Split (3)

train · 25k rows

text stringlengths 1.55k 332k	label int64 0 8
the reagents of the subject invention are useful in oligonucleotide synthesis ( both oligodeoxyribonucleotide and oligonucleotide ) to chemically modify a synthetic oligonucleotide at any position with any chemical functional group . in a preferred embodiment , the reagents and methods of the subject invention enable the biotinylation of oligonucleotides at multiple sites and at any position including internal sites and the 5 &# 39 ; terminus . these reagents , which couple exactly like normal ce - phosphoramidites , are designed for use with any automated dna synthesizer . advantageously , the reagents are soluble in acetonitrile and are stable to ammonium hydroxide deprotection . a further advantage of the methods and reagents of the subject invention is that it is possible to maintain the natural distance and structure between internucleotide phosphate groups . furthermore , the reagents of the subject invention may comprise a dimethyoxyltrityl ( dmt ) group for easy determination of coupling efficiency . with the use of reagents wherein r 2 is cpg , or a modification thereof , modifications at the 3 &# 39 ; terminus can be achieved . therefore , the reagents of the subject invention are specifically constructed for chain elongation and internal insertions . when used for internal insertion , the reagents have been engineered to retain the natural internucleotide phosphate distance . as a result of these reagents &# 39 ; unique construction , they can be incorporated at any position in an oligonucleotide , and they can be incorporated multiple times . we have also constructed a dmt protected hydroxyl group to quantify coupling efficiencies for multiple internal incorporation . typical coupling efficiencies are greater than 95 % as determined by uv measurement of the dimethoxytrityl group . conventional ammonia hydroxide cleavage and deprotection did not result in any decomposition of the incorporated biotin entity . these differences make the novel reagents both unique in molecular structure and in use . the subject invention can also incorporate controlled pore glass ( cpg ) in place of the phosphoramidite group for solid phase nucleotide elongation or 3 &# 39 ; modification procedures . preferably , the cpg comprises a unique multifunctional linking arm to give a multifunctional cpg , mf - cpg ®, which transfers a primary amine to the 3 &# 39 ; terminus of a synthesized oligonucleotide without changing any chemistry or adding extra steps . another important aspect of one embodiment of this invention is a 12 - atom spacer arm that connects the biotin moiety to the 2 - position of the 1 , 3 - propanediol backbone . we have observed the longer spacer arm to result in better streptavidin binding on magnetic particles . this is an important aspect in direct solid phase sequencing . following are examples which illustrate procedures , including the best mode , for practicing the invention . these examples should not be construed as limiting . all percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted . dissolve 311 . 9 g ( 96 %, 4 . 4 mol ) naoet ( mw 68 . 06 ) in 1600 ml anhydrous etoh . cool flask in ice bath . add 704 g ( 4 . 4 mol ) diethylmalonate ( mw 160 . 19 ) dropwise with thorough stirring . add 592 g ( 4 . 0 mol ) 4 - bromobutyronitrile ( mw 148 . 01 ) dropwise with stirring . bring slowly to reflux , and reflux for 2 . 5 hours . partition between water and etoac . wash the organic with 2 × 1 . 5 l brine , and dry over anhydrous na 2 so 4 . concentrate by rotary evaporation . distill under vacuum at 0 . 5 torr ; collect 154 - 156 ° c . fractions . yield : 555 . 4g ( 61 . 1 %). dissolve 220 . 9 g ( 0 . 97 mol ) 2 - butyronitrile diethylmalonate ( 1 ) in 1200 ml anhydrous toluene with stirring . heat solution to gentle reflux . add 1600 ml ( 3 . 2 mol , 3 . 3 × equiv .) bh 3 . me 2 s ( 2 m solution in toluene ) very slowly using a cannula and ar pressure . gently reflux for 45 hours , with thorough stirring . cool in an ice bath . add 300 ml meoh slowly with mechanical stirring , to quench reaction , then 5 ml concentrated hcl , and then another 300 ml meoh in one portion . check the ph of the solution at this point : ph should be about 7 . 5 . add 45 ml concentrated hcl , and stir at ambient temperature for 15 minutes . check the ph again : ph should be about 2 . 0 . set up for distillation and distill off toluene and dissolve residue in 750 ml dmf and 450 ml ( 2 . 58 mol ) anhydrous diisopropylethylamine with thorough stirring . cool the reaction mixture to 10 ° c . in an ice bath . add 243 . 0 g ( 0 . 94 mol , mw 258 . 70 ) fmoc - cl portionwise with thorough stirring and allow to react for 30 minutes . evaporate in vacuo to dryness using hard vacuum at 35 ° c . partition between 200 ml etoac and 100 ml h 2 o . wash 2 × 100 ml h 2 o and 1 × 100 ml brine . dry over na 2 so 4 . concentrate by rotary evaporation to about 20 % of original volume , then filter through a dry 0 . 5 &# 34 ; celite pad . purify on a silica gel column ( 10 cm diameter ), using ch 2 cl 2 as elution solvent . elute with 5 l of ch 2 cl 2 , 12 l of 2 . 5 % meoh in ch 2 cl 2 , 2 . 5 l of 5 % meoh in ch 2 cl 2 , and then 4 l of 10 % meoh in ch 2 cl 2 . monitor fractions by tlc , using 9 : 1 ch 2 cl 2 : meoh to develop and h 2 so 4 followed by heating to scorch and visualize . pool appropriate fractions and remove solvent in vacuo to get a white solid . yield : 192 g . weigh 170 g ( 0 . 461 mol ) 2 -( n - fmoc - 4 - aminobutyryl )- 1 , 3 - propanediol ( 2 ). dissolve in 900 ml anhydrous pyridine with magnetic stirring . stir until dissolved . add portionwise 171 . 0 g ( 0 . 504 mol ) dmt - cl . stir clear yellow solution 18 hours at room temperature . concentrate in vacuo . co - evaporate 2 × 250 ml toluene . partition residue between 800 ml etoac and 200 ml h 2 o . wash 2 × 400 ml brine . dry over na 2 so 4 . concentrate in vacuo , co - evaporate using 2 × 250 ml anhydrous toluene to completely remove pyridine . load onto a silica gel column ( 10 cm diameter ), using 2 . 5 % etoac in ch 2 cl 2 . elute product with 2 . 5 % etoac in ch 2 cl 2 ( 8 l ) then 15 % etoac in ch2cl 2 ( 9 l ). pool appropriate fractions containing product and strip solvent off on rotovap . yield : 101 . 0 g ( 40 . 8 %). dissolve 101 g ( 0 . 150 mol , mw 671 . 89 ) of 1 - o - dmt - 2 - n - fmoc - 4 - aminobutyryl )- 1 , 3 - propanediol ( 3 ) in 100 ml hot isopropyl alcohol with swirling until the bulk of the material has dissolved . transfer the solution , using the remaining 300 ml of hot isopropyl alcohol . slowly and carefully add 102 g ( 2 . 77 mol , mw 37 . 83 ) sodium borohydride in small portions with thorough stirring . stir at 70 ° c . for 40 minutes . check reaction progress by tlc using meoh : ch 2 cl 2 : nh4oh ( 10 : 10 : 1 ) to develop and h 2 so 4 to visualize . product r f 0 . 35 ; starting material at rf 0 . 8 . cool reaction mixture in an ice bath to approximately 5 ° c . and quench by dropwise addition of 800 ml 10 % naoh . allow mixture to warm to room temperature with stirring . add to etoac and partition the reaction mixture between phases . wash the organic phase 2 × 500 ml brine . dry over na 2 so 4 for 15 minutes and concentrate in vacuo . dissolve the crude product ( 98 . 5 g ) in 575 ml dry dmf , and add 52 . 2 g biotin - nhs ester and 35 ml anhydrous diisopropylethylamine . warm slightly to get a complete solution once all of the components are added . allow to react overnight at room temperature under argon . remove solvent by rotary evaporation at 50 ° c . under high vacuum . partition between 2 l etoac and 600 ml water . wash organic layer with 1 × 650 ml 10 % na2co 3 and 1 × 650 ml brine . dry over na 2 so 4 and concentrate in vacuo . take residue up in 300 ml ch 2 cl 2 ; add 200 g silica gel . mix thoroughly on rotovap . remove solvent using aspirator then high vacuum until dry ( flows freely ). dry pack column ( 6 . 5 cm diameter ) to 49 cm height with silica gel . load sample / silica gel mixture onto top of column . elute product from column with ch 2 cl 2 ( 3 l ), then 95 : 5 ch 2 cl 2 : meoh ( 4 l ) and then 9 : 1 ch 2 cl 2 : meoh ( 8 l ). pool appropriate fractions and concentrate in vacuo . yield : 89 . 7 g ( 86 . 3 %). dissolve 33 . 9 g ( 50 . 45 mmol ) of 1 - o - dmt - 2 -( n - fmoc - 4 - aminobutyryl )- 1 , 3 - propanediol ( 3 ) in 250 ml hot isopropanol with magnetic stirring . slowly and carefully add 34 . 2 g ( 305 mmol , mw 37 . 83 ) sodium borohydride in small portions with thorough stirring . stir at approximately 70 ° c . for 45 minutes . cool reaction mixture in an ice bath and carefully add 270 ml 10 % naoh dropwise . remove ice bath and stir for 15 minutes allowing mixture to warm to room temperature . add 340 ml ethyl acetate and partition phases . separate the phases , and wash the organic phase 2 × 170 ml brine . dry over na 2 so 4 for 15 minutes and concentrate in vacuo . dissolve the crude product in 200 ml dry dmf , add 24 . 1 g biotin - x - nhs ester and 12 ml anhydrous diisopropylethylamine . allow to react overnight at room temperature . check reaction progress with tlc , using ch 2 cl 2 : meoh ( 9 : 1 ) to develop tlc plate , and sulfuric acid to visualize . r f product = 0 . 4 . concentrate by rotary evaporation at 50 ° c . under high vacuum . partition between 670 ml etoac and 200 ml water . wash organic layer with 1 × 220 ml 10 % na 2 co 3 and 1 × 220 ml brine . dry over na 2 so 4 for 15 minutes and concentrate in vacuo . take residue up in 100 ml ch 2 cl 2 ; add 67 g silica gel . mix thoroughly and evaporate to dryness . dry pack column with silica gel and load sample / silica gel mixture onto top of column . elute product from column , starting with ch 2 cl 2 ( 3 ), 95 : 5 ch 2 cl 2 : meoh ( 4 l ), and then 9 : 1 ch 2 cl 2 : meoh ( 6 l ). pool appropriate fractions and concentrate in vacuo . yield : 24 . 8 g ( 62 . 3 %) of off - white solid . dissolve 18 . 0 g ( 0 . 079 mol ) 2 - butyronitrile diethylmalonate ( 1 ) in 80 ml anhydrous toluene with stirring . heat solution to gentle reflux . add 131 ml ( 0 . 261 mol , 3 . 3 × equiv .) bh 3 . me 2 s ( 2 m solution in toluene ) very slowly using a cannula and ar pressure . gently reflux for 46 hours , with thorough stirring . cool in an ice bath . add 50 ml meoh slowly with mechanical stirring , to quench reaction . add hcl to litmus ph of 2 . 0 . evaporate to a gummy residue in vacuo . dissolve in 65 mm of dmf and add 39 . 5 g ( 0 . 079 ) rhodamine isothiocyanate . react for 4 hours at room temperature and concentrate in vacuo . partition between 150 ml etoac and 50 ml water . wash 2 × 50 ml water , 1 × 50 ml brine , and dry over na 2 so 4 . concentrate in vacuo and load on silica gel column ( 5 cm diameter ). elute with stepwise gradient of ch 2 cl 2 , 2 . 5 % meoh in ch 2 cl 2 , 5 % meoh in ch 2 cl 2 , and 10 % meoh in ch 2 cl 2 . pool appropriate fraction and concentrate in vacuo to dryness . yield : approximately 35 g . dissolve 18 . 0 g ( 0 . 079 mol ) 2 - butyronitrile diethylmalonate ( 1 ) in 80 ml anhydrous toluene with stirring . heat solution to gentle reflux . add 131 ml ( 0 . 261 mol , 3 . 3 × equiv .) bh 3 . me 2 s ( 2 m solution in toluene ) very slowly using a cannula and ar pressure . gently reflux for 46 hours , with thorough stirring . cool in an ice bath . add 50 ml meoh slowly with mechanical stirring , to quench reaction . add hcl to litmus ph of 2 . 0 . evaporate to a gummy residue in vacuo . dissolve in 65 mm warm phenol and 29 ml ( 0 . 166 mol ) diisopropylethylamine . add 22 g ( 0 . 073 mol ) of 6 , 9 - dichloro - 2 - methoxyacridine . react at 110 ° c . for 1 hour . cool reaction mixture and add 35 ml methanol . pour mixture into 475 ml of cold 10 % sodium hydroxide . the resulting yellow precipitate was collected by filtration and washed with 1 n sodium hydroxide ( 4 × 100 ml ). the precipitate was taken up in 300 ml refluxing methanol . the undissolved solid was removed by filtration and the filtrate was evaporated in vacuo to a yellow orange solid ( 16 . 7 g ). dissolve 33 . 9 g ( 0 . 050 mol ) 1 - o - dmt - 2 -( n - fmoc - 4 - aminobutyryl )- 1 , 3 - propanediol ( 3 ) in 17 ml ( 0 . 089 mol ) diisopropylethylamine and 225 ml anhydrous ch 2 cl 2 with stirring under ar . add 11 . 2 g ( 0 . 048 mol ) chloro - n , n - diisopropyl - betacyanoethylphosphoramidite slowly , and stir at room temperature for 30 minutes . add 1 . 8 ml meoh through the septum to quench the phosphitylating reagent and stir an additional 10 minutes . take sample up in 800 ml base - washed etoac . wash the organic layer with 800 ml 10 % na 2 co 3 , then with 800 ml brine . dry over na 2 so 4 . take tlc of sample , using 60 : 30 : 10 hexanes : etoac : et 3 n to develop sample ; visualize with h 2 so 4 scorch . the product is at r f = 0 . 47 . remove solvent using rotary evaporation in vacuo . load sample onto a silica gel column . elute with a step gradient of hexanes : ch 2 cl 2 : et 3 n , 55 : 35 : 3 hexanes : ch 2 cl 2 : et 3 n ( 2 l ), and 55 : 45 : 3 hexanes : ch 2 cl 2 : et 3 n ( 4 l ). pool appropriate fractions and strip off solvents on rotovap . co - evaporate with 200 ml benzene to remove et 3 n . immediately dry sample under high vacuum at room temperature overnight . yield : 30 . 5 g ( 70 %). weight 10 . 0 g ( 0 . 0148 mol , mw 675 . 96 ) 1 - o - dmt - 2 -(( n - biotin )- 4 - aminobutyryl )- 1 , 3 - propanediol ( 4 ) into a clean dry 250 ml rb flask . dissolve starting material in 55 ml of anhydrous dichloromethane with magnetic stirring . add 1 . 1 g tetrazole ( 15 . 7 mmol ) with thorough stirring for 15 minutes . add 5 . 7 ml ( 1 mmol , mw 301 . 5 , 1 . 2 × excess ) phosphitylating reagent dropwise into the reaction mixture with thorough stirring and allow to react for 15 minutes . load directly onto a silica gel column packed in 8 : 2 : 1 ch 2 cl 2 : ch 3 cn : et 3 n . elute product isocratically with same solvent . pool appropriate fractions and immediately concentrate by rotary evaporation . place under high vacuum at room temperature overnight . yield : 6 . 5 g ( 51 %). dissolve 11 . 68 g ( 0 . 0148 mol , mw 789 . 16 ) 1 - o - dmt - 2 -( n - biotin - lc - 4 - aminobutyryl )- 1 , 3 - propanediol ( 5 ) in 150 ml of anhydrous dichloromethane with magnetic stirring . add 1 . 1 g tetrazole ( 15 . 7 mmol ) and stir for exactly 15 minutes . draw 5 . 5 ml ( 17 . 3 mmol , d 0 . 95 , 1 . 2 × excess ) of 2 - cyanoethyl - n , n , nq - nq - tetraisopropyl phosphoramidite into a graduated pipet and add dropwise into the reaction mixture with thorough stirring . react for 15 minutes at room temperature . load directly onto silica gel column . elute product isocratically with 7 : 2 : 1 ch 2 cl 2 : ch 3 cn : et 3 n . product should appear after about 1 . 5 liters of eluent . pool appropriate fractions and remove solvent in vacuo . place under high vacuum at room temperature overnight . yield : 6 . 5 g ( 51 %). dissolve 14 . 1 g ( 0 . 0148 mol ) 1 - o - dmt - 2 -( n - rhodamine - 4 - aminobutyryl )- 1 , 3 - propanediol ( 6 ) in 150 ml of anhydrous dichloromethane with magnetic stirring . add 1 . 1 g tetrazole ( 15 . 7 mmol ) and stir for exactly 15 minutes . draw 5 . 5 ml ( 17 . 3 mmol , d 0 . 95 , 1 . 2 × excess ) of 2 - cyanoethyl - n , n , nq - nq - tetraisopropyl phosphoramidite into a graduated pipet and add dropwise into the reaction mixture with thorough stirring . react for 15 minutes at room temperature . load directly onto silica gel column . elute product isocratically with 7 : 2 : 1 ch 2 cl 2 : ch 3 cn : et 3 n . product should appear after about 1 . 5 liters of eluent . pool appropriate fractions and remove solvent in vacuo . place under high vacuum at room temperature overnight . yield : 8 . 0 g . dissolve 10 . 0 g ( 0 . 0149 mol ) 1 - o - dmt - 2 -( n - acridine - 4 - aminobutyryl )- 1 , 3 - propanediol ( 7 ) in 150 ml of anhydrous dichloromethane with magnetic stirring . add 1 . 1 g tetrazole ( 15 . 7 mmol ) and stir for exactly 15 minutes . draw 5 . 5 ml ( 17 . 3 mmol , d 0 . 95 , 1 . 2 × excess ) of 2 - cyanoethyl - n , n , nq - nq - tetraisopropyl phosphoramidite into a graduated pipet and - add dropwise into the reaction mixture with thorough stirring . react for 15 minutes at room temperature . load directly onto silica gel column . elute product isocratically with 7 : 2 : 1 ch 2 cl 2 : ch 3 cn : et 3 n . product should appear after about 1 . 5 liters of eluent . pool appropriate fractions and remove solvent in vacuo . place under high vacuum at room temperature overnight . yield : 6 . 0 g . dissolve 38 . 3 g ( 0 . 057 mol ) 1 - o - dmt - 2 -(( n - fmoc )- 4 - aminobutyryl )- 1 , 3 - propanediol ( 3 ) in 160 ml anhydrous pyridine with stirring . add 3 . 2 g ( 0 . 026 mol ) p - dimethylaminopyridine ( dmap , mw 122 , 19 ) and 4 . 75 g ( 0 . 048 mol ) succinic anhydride ( mw 100 ). stir reaction mixture at room temperature for 24 hours . take a tlc to check whether reaction is completed . develop with 9 : 1 ch 2 cl 2 : meoh , with 2 drops of nh 4 oh in the tlc development chamber . scorch with h 2 so 4 to visualize . the product spot will be at r f = 0 . 32 ; unreacted starting material will be at the solvent front . strip solvent off on rotovap , using high vacuum . transfer oil into a 2 l separatory funnel containing 1400 ml etoac . wash 3 × 700 ml brine and dry over anhydrous na 2 so 4 . remove solvent by rotary evaporation in vacuo . co - evaporate 2 × 150 ml anhydrous pyridine . immediately add 225 ml anhydrous dioxane , 7 . 5 ml anhydrous pyridine , and 11 . 8 g ( 0 . 085 mol ) p - nitrophenol to flask with magnetic stirring . cool reaction flask to 25 ° c . and add 16 . 0 g ( 0 . 078 mol ) dicyclohexylcarbodiimide with stirring , and stir at room temperature for 4 hours . add 8 ml et 3 n to the reaction mixture and swirl to mix . filter reaction mixture through a sintered glass funnel directly into a flask of 100 g long chain alkylamine cpg . add more anhydrous dioxane , if necessary , in order to get a proper consistency . shake 48 hours . collect the derivatized cpg by filtration in a clean 2 l sintered glass funnel . wash with 3 × 1000 ml dmf , 3 × 100 ml meoh , and 3 × 1000 ml ether . transfer the cpg to a clean , dry 2 l rb flask and dry by rotary evaporation , using aspirator , then pump at hard vacuum for an hour to remove all solvents . cap unreacted amines by treating cpg with 70 ml acetic anhydride , 280 ml anhydrous pyridine , and 1 . 3 g dmap . swirl on orbital shaker for 2 hours . collect the capped cpg by filtration in a 2 l sintered glass funnel . wash with 1 × 1500 ml pyridine , 3 × 1000 ml dmf , 2 × 1000 ml water , 3 × 1000 ml meoh , and 3 × 1000 ml ether . dry in vacuo . yield : 100 g . dissolve 1 - o - dmt - 2 -(( n - biotin )- 4 - aminobutyryl )- 1 , 3 - propanediol ( 7 . 0 g , 10 . 4 mmol ) ( 4 ) in 30 ml anhydrous pyridine with stirring . stir at room temperature . add p - dimethylamino - pyridine ( 0 . 584 g , 4 . 8 mmol ) and succinic anhydride ( 0 . 863 g , 8 . 63 mmol ). stir reaction mixture at room temperature for 24 hours . analyze by tlc to check whether reaction is completed , using 1 : 1 meoh : ch 2 cl 2 with 4 drops of nh 4 oh added to develop ; visualize with h 2 so 4 ( r f product = 0 . 5 ). remove solvent by rotary evaporation using high vacuum . partition between 250 ml etoac and 100 ml h 2 o . wash 3 × 130 ml brine . combine aqueous layers and extract with 300 ml etoac . dry the organics over anhydrous na 2 so 4 . remove solvent by rotary evaporation in vacuo . co - evaporate 2 × 50 ml anhydrous pyridine . immediately add 41 ml anhydrous dioxane . swirl flask to achieve complete solution . add 7 . 5 ml anhydrous pyridine and p - nitrophenol ( 2 . 15 g , 15 . 5 mmol ) to flask with magnetic stirring . cool reaction flask to 25 ° c . add dicyclohexylcarbodiimide ( 2 . 92 g , 14 . 3 mmol , mw 204 . 35 ) with stirring , and stir at room temperature for 4 hours . add 1 . 6 ml triethylamine and stir 10 minutes . filter reaction mixture through a sintered glass funnel directly into 18 g long chain alkylamine cpg . agitate the cpg mixture for 24 hours . collect the derivatized cpg by filtration into a clean 600 ml sintered glass funnel . wash with 3 × 500 ml dmf , 3 × 500 ml meoh , and 3 × 500 ml ether . transfer the cpg to a clean , dry 500 ml rb flask and dry on the rotovap , using aspirator , then pump at hard vacuum for an hour to remove all solvents . mix together 12 . 7 ml acetic anhydride , 51 ml anhydrous pyridine , and 236 mg dmap . cap the cpg by adding this solution to the dry cpg and swirl on orbital shaker for 2 hours . collect the capped cpg by filtration in a clean 500 ml sintered glass funnel . wash with 1 × 1000 ml pyridine , 3 × 500 ml dmf , 2 × 500 ml water , 3 × 500 ml meoh , and 3 × 500 ml ether . dry in vacuo . dissolve 1 - o - dmt - 2 -( n - biotin - lc - 4 - aminobutyryl )- 1 , 3 - propanediol ( 8 . 2 g , 10 . 4 mmol ) ( 5 ) in 30 ml anhydrous pyridine with stirring . stir at room temperature . add p - dimethylamino - pyridine ( 0 . 584 g , 4 . 8 mmol ) and succinic anhydride ( 0 . 863 g , 8 . 63 mmol ). stir reaction mixture at room temperature for 24 hours . analyze by tlc to check whether reaction is completed , using 1 : 1 meoh : ch 2 cl 2 with 4 drops of nh 4 oh added to develop ; visualize with h 2 so 4 ( r f product = 0 . 5 ). remove solvent by rotary evaporation using high vacuum . partition between 250 ml etoac and 100 ml h 2 o . wash 3 × 130 ml brine . combine aqueous layers and extract with 300 ml etoac . dry the organics over anhydrous na 2 so 4 . remove solvent by rotary evaporation in vacuo . co - evaporate 2 × 50 ml anhydrous pyridine . immediately add 41 ml anhydrous dioxane . swirl flask to achieve complete solution . add 7 . 5 ml anhydrous pyridine and p - nitrophenol ( 2 . 15 g , 15 . 5 mmol ) to flask with magnetic stirring . cool reaction flask to 25 ° c . add dicyclohexylcarbodiimide ( 2 . 92 g , 14 . 3 mmol , mw 204 . 35 ) with stirring , and stir at room temperature for 4 hours . add 1 . 6 ml triethylamine and stir 10 minutes . filter reaction mixture through a sintered glass funnel directly into 18 g long chain alkylamine cpg . agitate the cpg mixture for 24 hours . collect the derivatized cpg by filtration into a clean 600 ml sintered glass funnel . wash with 3 × 500 ml dmf , 3 × 500 ml meoh , and 3 × 500 ml ether . transfer the cpg to a clean , dry 500 ml rb flask and dry on the rotovap , using aspirator , then pump at hard vacuum for an hour to remove all solvents . mix together 12 . 7 ml acetic anhydride , 51 ml anhydrous pyridine , and 236 mg dmap . cap the cpg by adding this solution to the dry cpg and swirl on orbital shaker for 2 hours . collect the capped cpg by filtration in a clean 500 ml sintered glass funnel . wash with 1 × 1000 ml pyridine , 3 × 500 ml dmf , 2 × 500 ml water , 3 × 500 ml meoh , and 3 × 500 ml ether . dry in vacuo . yield : 18 g . dissolve 1 - o - dmt - 2 -( n - rhodamine - 4 - aminobutyryl )- 1 , 3 - propanediol ( 9 . 9 g , 10 . 4 mmol ) ( 6 ) in 30 ml anhydrous pyridine with stirring . stir at room temperature . add p - dimethylamino - pyridine ( 0 . 584 g , 4 . 8 mmol ) and succinic anhydride ( 0 . 863 g , 8 . 63 mmol ). stir reaction mixture at room temperature for 24 hours . analyze by tlc to check whether reaction is completed , using 1 : 1 meoh : ch 2 cl 2 with 4 drops of nh 4 oh added to develop ; visualize with h 2 so 4 ( r f product = 0 . 5 ). remove solvent by rotary evaporation using high vacuum . partition between 250 ml etoac and 100 ml h 2 o . wash 3 × 130 ml brine . combine aqueous layers and extract with 300 ml etoac . dry the organics over anhydrous na 2 so 4 . remove solvent by rotary evaporation in vacuo . co - evaporate 2 × 50 ml anhydrous pyridine . immediately add 41 ml anhydrous dioxane . swirl flask to achieve complete solution . add 7 . 5 ml anhydrous pyridine and p - nitrophenol ( 2 . 15 g , 15 . 5 mmol ) to flask with magnetic stirring . cool reaction flask to 25 ° c . add dicyclohexylcarbodiimide ( 2 . 92 g , 14 . 3 mmol , mw 204 . 35 ) with stirring , and stir at room temperature for 4 hours . add 1 . 6 ml triethylamine and stir 10 minutes . filter reaction mixture through a sintered glass funnel directly into 18 g long chain alkylamine cpg . agitate the cpg mixture for 24 hours . collect the derivatized cpg by filtration into a clean 600 ml sintered glass funnel . wash with 3 × 500 ml dmf , 3 × 500 ml meoh , and 3 × 500 ml ether . transfer the cpg to a clean , dry 500 ml rb flask and dry on the rotovap , using aspirator , then pump at hard vacuum for an hour to remove all solvents . mix together 12 . 7 ml acetic anhydride , 51 ml anhydrous pyridine , and 236 mg dmap . cap the cpg by adding this solution to the dry cpg and swirl on orbital shaker for 2 hours . collect the capped cpg by filtration in a clean 500 ml sintered glass funnel . wash with 1 × 1000 ml pyridine , 3 × 500 ml dmf , 2 × 500 ml water , 3 × 500 ml meoh , and 3 × 500 ml ether . dry in vacuo . yield : 18 g . dissolve 1 - o - dmt - 2 -( n - acridine - 4 - aminobutyryl )- 1 , 3 - propanediol ( 7 . 2 g , 10 . 4 mmol ) ( 7 ) in 30 ml anhydrous pyridine with stirring . stir at room temperature . add p - dimethylamino - pyridine ( 0 . 584 g , 4 . 8 mmol ) and succinic anhydride ( 0 . 863 g , 8 . 63 mmol ). stir reaction mixture at room temperature for 24 hours . analyze by tlc to check whether reaction is completed , using 1 : 1 meoh : ch 2 cl 2 with 4 drops of nh 4 oh added to develop ; visualize with h 2 so 4 ( r f product = 0 . 5 ). remove solvent by rotary evaporation using high vacuum . partition between 250 ml etoac and 100 ml h 2 o . wash 3 × 130 ml brine . combine aqueous layers and extract with 300 ml etoac . dry the organics over anhydrous na 2 so 4 . remove solvent by rotary evaporation in vacuo . co - evaporate 2 × 50 ml anhydrous pyridine . immediately add 41 ml anhydrous dioxane . swirl flask to achieve complete solution . add 7 . 5 ml anhydrous pyridine and p - nitrophenol ( 2 . 15 g , 15 . 5 mmol ) to flask with magnetic stirring . cool reaction flask to 25 ° c . add dicyclohexylcarbodiimide ( 2 . 92 g , 14 . 3 mmol , mw 204 . 35 ) with stirring , and stir at room temperature for 4 hours . add 1 . 6 ml triethylamine and stir 10 minutes . filter reaction mixture through a sintered glass funnel directly into 18 g long chain alkylamine cpg . agitate the cpg mixture for 24 hours . collect the derivatized cpg by filtration into a clean 600 ml sintered glass funnel . wash with 3 × 500 ml dmf , 3 × 500 ml meoh , and 3 × 500 ml ether . transfer the cpg to a clean , dry 500 ml rb flask and dry on the rotovap , using aspirator , then pump at hard vacuum for an hour to remove all solvents . mix together 12 . 7 ml acetic anhydride , 51 ml anhydrous pyridine , and 236 mg dmap . cap the cpg by adding this solution to the dry cpg and swirl on orbital shaker for 2 hours . collect the capped cpg by filtration in a clean 500 ml sintered glass funnel . wash with 1 × 1000 ml pyridine , 3 × 500 ml dmf , 2 × 500 ml water , 3 × 500 ml meoh , and 3 × 500 ml ether . dry in vacuo . yield : 18 g . general procedure : preparation of modified oligonucleotides using phosphoramidite reagents , compounds 8 - 12 modified oligonucleotides were synthesized on a 1 . 0 μmol scale using a milligen / biosearch 8750 dna synthesizer with standard manufacturer procedures for cyanoethyl phosphoramidite chemistry . the modified reagents ( 8 - 12 ) were used in a concentration of 0 . 1 m without any increased coupling times . after synthesis of modified oligonucleotides , cleavage from cpg support and deprotection were performed by treatment with concentrated ammonium hydroxide at 55 ° c . for 6 hours . in the case of oligonucleotides modified with acridine - on ™ phosphoramidite ( 13 ), cleavage and deprotection were performed by treatment with 0 . 4 m naoh in methanol : water ( 4 : 1 ) for 16 hours at room temperature , followed by ph neutralization to ph 9 . 0 with 2 m teab , and desalting on a sephadex g - 25 column . hplc purification was performed employing an analtech rp - c18 column ( 1 × 25 cm ); solvent a = 0 . 1 m teaa , ph 7 ; solvent b = 50 % acetonitrile in solvent a , 30 - 75 % b , 60 minutes , 0 . 75 ml / minute , 260 nm . modified oligonucleotides were analyzed by both polyacrylamide electrophoresis ( 20 % denaturing ) and analytical hplc ( rp - c18 , 0 . 46 × 15 cm , 15 %- 70 % b , 30 minutes , 0 . 75 ml / minute , 260 nm ). general procedure : preparation of 3q modified oligonucleotides using cpg reagents . compounds 13 - 17 3 &# 39 ; modified oligonucleotides were synthesized on a 1 . 0 μmol scale using a milligen / biosearch 8750 dna synthesizer with standard manufacturer procedures for cyanoethyl phosphoramidite chemistry . the modified reagents ( 13 - 17 ) were packed in standard columns and installed in the dna synthesizer in the same fashion as normal cpg columns are used . after synthesis of modified oligonucleotides , cleavage from cpg support and deprotection were performed by treatment with concentrated ammonium hydroxide at 55 ° c . for 6 hours . in the case of oligonucleotides modified with acridine - on ™ cpg ( 18 ), cleavage and deprotection were performed by treatment with 0 . 4 m naoh in methanol : water ( 4 : 1 ) for 16 hours at room temperature , followed by ph neutralization to ph 9 . 0 with 2 m teab , and desalting on a sephadex g - 25 column . hplc purification was performed employing an analtech rp - c18 column ( 1 × 25 cm ); solvent a = 0 . 1 m teaa , ph 7 ; solvent b = 50 % acetonitrile in solvent a , 30 - 75 % b , 60 minutes , 0 . 75 ml / minute , 260 nm . modified oligonucleotides were analyzed by both polyacrylamide electrophoresis ( 20 % denaturing ) and analytical hplc ( rp - c18 , 0 . 46 × 15 cm , 15 %- 70 % b , 30 minutes , 0 . 75 ml / minute , 260 nm ). protocol for use of 3 &# 39 ; biotin - on ™ cpg with automated dna synthesizer attach a 3 &# 39 ; biotin - on ™ cpg to the automated dna synthesizer . enter the desired oligonucleotide sequence for synthesis . make sure the 3 &# 39 ; terminal base of the entered sequence is entered as the second base from the 3 &# 39 ; end . note that 3 &# 39 ; biotin - on ™ cpg has a multifunctional linking arm attached to it instead of a 3 &# 39 ; terminal nucleotide . hence , the 3 &# 39 ; base is not on the cpg as with normal oligonucleotide synthesis . this must be accounted for when the sequence is entered . because automated synthesizers assume that the 3 &# 39 ; nucleotide is pre - attached to the cpg , a nonsense base must be entered at the 3 &# 39 ; terminus when using 3 &# 39 ; biotin - on ™ cpg . initiate the synthesis using the trityl - on mode . it is recommended that the trityl group be left on when using clontech &# 39 ; s oligonucleotide purification / elution cartridge ( opec ) columns ( cat . # k1077 - 1 , clontech , palo alto , calif .) for easy purification . however , if other purification methods are employed , the trityl - off mode may be more desirable . the extent of 3 &# 39 ; biotin incorporation should be determined by measuring the deprotected dmt cation concentration of the first coupling step at 497 nm . protocol for use of biotin - on ™ phosphoramidite and lc - biotin - on ™ phosphoramidite with automated dna synthesizers dissolve the reagent in anhydrous acetonitrile according to the following table to give a concentration of 0 . 1 m . table 1______________________________________biotin - on ™ phosphoramidite lc - biotin - on ™ phosphoramiditeamount dilution volume amount dilution volume______________________________________ 50 mg 0 . 6 ml 50 mg 0 . 5 ml100 mg 1 . 15 ml 100 mg 1 . 0 ml250 mg 2 . 9 ml 250 mg 2 . 5 ml______________________________________ transfer the solution to the extra phosphoramidite port on the dna synthesizer ( the reagents are supplied in an abi industrial standard vial ). it is recommended to make all transfers of anhydrous acetonitrile with a syringe for ease of handling and for minimum exposure to air . the reagents should be used immediately after dissolving . enter in the oligonucleotide sequence to be synthesized . the reagents can be programmed to couple at any nucleotide position in the oligonucleotide sequence . multiple reagent units can be added by programming multiple coupling cycles . separation of reagent sites by at least one normal nucleotide is beneficial for subsequent streptavidin binding . carefully prime the reagent line on the dna synthesizer . the line must be well primed to obtain optimum coupling efficiency . initiate the synthesis using the trityl - on mode . it is recommended that the trityl group be left on when using clontech &# 39 ; s opec columns for easy purification . however , if other purification methods are employed , the trityl - off mode may be more desirable . note : if the dna synthesizer used has programming capabilities , it is recommended that a longer coupling time be programmed for these reagents ( up to 5 - 10 minutes ). this will ensure high coupling efficiency . to monitor the incorporation of the reagents , measure the dimethoxytrityl cation concentration at 497 nm . if the reagent is being incorporated at the 5 &# 39 ; terminus of the oligonucleotide , the trityl - off mode must be used . if the reagent is to incorporated at the 5 &# 39 ; terminus and opec columns are used for purification , then the trityl - on mode must be used , and therefore coupling efficiency cannot be measured . a convenient manual procedure can be employed to conserve the reagents . this procedure uses only 50 mg of reagent . synthesize the oligonucleotide on the dna synthesizer according to standard procedures . program the dna synthesizer to pause just before the reagent coupling step . pause the dna synthesizer immediately after the deblocking step . this can be manually performed if necessary . make sure the deblocking solution has been thoroughly rinsed out of the column before pausing the synthesis . dissolve 50 mg of reagent in 0 . 5 ml anhydrous acetonitrile and 0 . 5 ml activator ( saturated tetrazole in anhydrous acetonitrile ). this should be performed with a 1 . 0 ml syringe and needle . remove the cpg column from the synthesizer and react with reagent / activator solution using two 1 . 0 ml luer tip syringes . periodically swish the solution back and forth with plungers for 5 minutes . install the cpg column back into the dna synthesizer and restart the synthesis . make sure to restart the coupling step and restart at the oxidation step . alternatively , the reagent coupling cycle can be completed manually on the dna synthesizer with the following steps : the final deblocking step is optional depending on how the biotinylated oligonucleotide is purified . if using the opec columns , the trityl group must be left on . cleave the biotinylated oligonucleotide from the solid support by treating it with 1 ml of ammonium hydroxide at room temperature for 1 . 5 - 2 . 0 hours . it is convenient to use luer tip syringes for this step . care should be taken not to let the ammonia evaporate . complete the deprotection by transferring the ammonium hydroxide to a 1 . 5 ml screw cap microcentrifuge tube and heat at 55 ° c . for 6 hours ( the incorporated biotin moiety is stable to ammonium hydroxide at 55 ° c .). caution : ammonia gas builds up pressure at 55 ° c . in a closed reaction vessel ; cool to 4 ° c . before opening screw cap microcentrifuge tube . if opec columns are to be used for purification , do not evaporate off the ammonium hydroxide solution , but proceed directly to the procedure outlined in example 24 , below . if open columns are not to be used for purification , evaporate to dryness by vacuum centrifugation or rotary evaporation . the biotinylated oligonucleotide is now ready for purification using conventional methods such as reverse phase hplc , anion exchange hplc , and polyacrylamide gel electrophoresis . in many applications , further purification may not be necessary . however , to achieve optimum results , purification of biotinylated oligonucleotides with opec columns is recommended . purified oligonucleotides can be obtained in less than 30 minutes . when using opec columns , it is necessary to leave the trityl group on the oligonucleotide , i . e ., a trityl - on synthesis must be performed . the procedure is as follows : connect a syringe to the female luer end of the opec column . direct the male end of the column to a waste vessel . fill the syringe with 2 ml of hplc grade acetonitrile and gently push it through the column at a rate of approximately 1 - 2 drops per second . all subsequent steps should also be carried out a flow rate of 1 - 2 drops per second . wash the opec column with 2 ml of 2 . 0 m teaa . add 0 . 5 ml deionized water to the cleaved , deprotected oligonucleotide in the ammonium hydroxide solution . slowly load this solution onto the column . collect the eluent into a clean tube . recycle the eluent collected through the opec column , again collecting the eluent into a fresh tube . the final eluent may be retained and purified further on other columns until all trityl oligonucleotide is exhausted . when used according to this protocol , up to 25 od units of oligonucleotide can be purified . wash the column with 3 ml of ammonium hydroxide / water ( 1 : 10 , w / v ). wash the column with 2 ml deionized water . detritylate the support - bound oligonucleotide by treating the column with 2 ml of 2 % tfa at a rate of 1 - 2 drops per second . proceed immediately to the next step , as prolonged exposure to tfa will result in decomposition of the oligonucleotide . wash the opec column with 5 ml deionized water . elute the purified , detritylated oligonucleotide with 20 % acetonitrile . collect eluted fractions of 4 drops each . the first 4 drops of eluent can be discarded . the product is normally in the following 4 - 10 drops . to determine the od units at 260 nm , evaporate an aliquot of the elute and redissolve it in water . store unused oligonucleotide at - 20 ° c . the presence of biotin can be determined by a p - dimethylaminocinnamaldehyde colorimetric test . spot 0 . 2 od of biotinylated oligonucleotide on a silica gel tlc plate . dry plate thoroughly . spray with a solution of 2 % p - dimethylaminocinnamaldehyde , 2 % sulfuric acid in ethanol . heat plate with gentle warming . the presence of biotin is indicated by a pink - red spot . it is recommended to run a negative control as reference . it should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims .	2
the following detailed description is exemplary in nature and is not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the following description provides practical illustrations for implementing exemplary embodiments of the present invention . fig5 is a perspective view of a hanging organizer 100 according to a preferred embodiment of the present invention . the organizer 100 has a body that includes a top 102 , a bottom 104 , a first side panel 106 , a second side panel ( 108 , see fig6 ) and a back panel ( 110 , see fig7 ). the first side panel 106 couples the top 102 and bottom 104 and the second side panel 108 , opposite the first side panel , also couples the top 102 and bottom 104 . the back panel 110 couples the top 102 and bottom 104 and the first 106 and second 108 side panels . located at the top 102 of the body is a hanging mechanism 112 that allows the body to be coupled to a closet rod , for example . the hanging mechanism 112 , which will be described in further detail below , allows the body to be rotated 360 degrees about its longitudinal axis as shown by the arrow in fig5 . the body also includes cross panels 114 that are substantially parallel with the top 102 and bottom 104 that are coupled to the first 106 and second 108 side panels and back panel 110 . in a preferred embodiment , there are six cross - panels 114 although the number of cross - panels can certainly vary according to the size and configuration of the organizer 100 . the cross - panels create sectioned areas which may hold items such as sweaters or shoes , for example . in a preferred embodiment , the body and cross - panels are made of a heavy durable fabric such as any type of natural cloth , such as cotton , or synthetic material such as polyester , plastic , twill or any blended natural and synthetic material . in an embodiment , the body of the hanging organizer 100 is about 7 inches wide , 9 inches deep and 57 inches long , although the dimensions can certainly vary and the embodiments of the invention are not limited to these dimensions . located on an exterior surface of the first 106 and second 108 side panels as seen in fig5 and 9 are a plurality of belt loops 116 . in a preferred embodiment , the belt loop has a hook and loop fastening mechanism so that it may be unfastened to couple a belt and refastened thus securing the belt in the loop 116 . this allows the user to easily undo the loop 116 , thread a belt through the loop 116 and resecure the ends of the loop 116 . of course other embodiments may be used such as rings with open end or straps secured by a snap end . also , hooks may be used as shown in the prior art design of fig3 . both exterior surfaces of the first 106 and second 108 side panels may be provided with belt loops 116 . alternatively , only one side panel may be provided with the loops or no side panels may be provided with the loops . in the embodiment shown in fig5 a plurality of drawers 126 are located on the shelves or cross panels 114 . these drawers 126 may be collapsible drawers as shown in fig4 or they may be non - collapsible drawers . the drawers may be made out of plastic , cardboard or wood for example . preferably they are provided with a pull 128 to allow a user to easily pull out the drawer to gain access to its interior . while only four drawers are shown , more or less of the shelves may have a drawer located thereon if so desired by the user . fig7 is a rear elevational view of the organizer 100 shown in fig5 according to a preferred embodiment . in this embodiment , the exterior of the back panel 110 is provided with a plurality of pouches 130 . these pouches 130 may be securely fastened to the exterior of the back panel 110 . the pouches 130 may be like those shown in fig1 to hold purses . alternatively , as will be described with reference to fig1 - 16 , discrete organizers may be removably fastened to the exterior of the back panel 110 . as will be described hereinafter , preferably each discrete organizer has an opening in a top section which can be closed by a closing mechanism such as a zipper , complementary hook and loop strips or snaps . the pouches shown in fig8 and 9 may be clear or opaque . fig1 is a cross - sectional view of a section of a section of a hanging organizer according to any of the embodiments of the present invention showing a hanging mechanism according to a preferred embodiment of the present invention . the hanging mechanism includes a hanger 200 , washers 202 and 204 , nut 206 , bearing 208 , and bearing coupler 210 . the hanger 200 includes a hook portion 212 and a rod portion 214 . the top 102 of the organizer has a bracket 216 located underneath that has an aperture through which a portion of the hanging mechanism extends . in particular , the bearing 208 and bearing coupler 210 surround a portion of the rod portion 214 of the hanger 200 . the bearing coupler 210 extends partially in the aperture to surround the bearing 208 . a washer 202 and lock washer 204 surrounds the rod portion 214 of the hanger 200 exposed to the interior of the organizer and the nut 206 secures the hanging mechanism to the organizer . in another embodiment , the bearing 208 and bearing coupler 210 may be omitted . the hanging mechanism allows the organizer to be rotated 360 ° while it is mounted to a closet rod so that a user has access to all sides of the organizer . fig1 is a perspective view of another preferred embodiment of a hanging organizer . in this preferred embodiment , only a few cross - panels 314 are present and a top region is reserved for hanging articles of clothing inside the organizer via a clothes rod 310 . alternatively , to hang very long articles of clothing there may not be any cross - panels present . the clothes rod 310 is located on an interior surface of the top to allow articles of clothing to be hung therefrom . fig1 is a perspective view of a hanging organizer 400 according to another embodiment of the present invention . like the organizer shown in fig1 , only a few cross - panels are present . in a top region of the organizer is located a rotating tie tree 402 . the tie tree may be located on a track 404 located on an interior surface of the top so that the tie tree 402 can be pulled out from the interior of the organizer to allow a user a better view of ties located on the tie tree 402 and better access to rotate the tie tree 402 . fig1 a shows the tie tree 402 in its unextended position . fig1 b shows the tie tree 402 in its extended position . fig1 is a perspective view of a hanging organizer 500 according to another preferred embodiment of the present invention . like the organizers shown in fig1 and 12 , the top region is left devoid of cross - panels . coupled to an interior surface of the top is a plurality of racks 502 ( only one of which is illustrated ) that can be mounted in tracks on the interior surface of the top and slid out of the interior region of the organizer . the racks can be configured to hold slacks as shown . the racks may also be provided with clips to hold skirts as well . fig1 is a perspective view of a rear of an organizer 600 according to another preferred embodiment of the present invention . the exterior of the back panel 110 is provided with fastening mechanisms 602 , 604 that allow a discrete or a plurality of discrete organizers 606 to be coupled thereto . the discrete organizers 606 may have many different configurations to accommodate the storage of many types of items . for example , a discrete organizer 606 may be in the shape of a single pouch to hold a handbag or a pair of shoes . another discrete organizer 606 may have multiple compartments to hold items such as lingerie , scarves , hair accessories and / or toiletries and cosmetics . fig1 is a rear perspective view of a discrete organizer 606 according to a preferred embodiment of the present invention that may be used with the organizer shown in fig1 . in this embodiment , hook and loop strips 612 are used as the coupling mechanism ( see also fig1 ). of course the other types of coupling mechanisms may be used and the embodiments of the invention are not limited to those illustrated . the discrete organizer may be optionally provided with a loop 608 so that when it is removed from the organizer it can be hung on a hook , for example . fig1 is a rear perspective view of a discrete organizer 606 according to a preferred embodiment of the present invention that may be used with the organizer shown in fig1 . it can be seen that the discrete organizer has a flat back , panel on which are located stud posts 614 of snap fasteners that line up with sockets 616 on the 610 surface of the back - panel ( see fig1 ). the discrete organizer 606 is secured to the exterior surface of the back - panel 10 by lining up the stud posts with the sockets and applying enough pressure so that they snap together as is well known . in one embodiment , a support 700 ( see fig5 ) is provided in the top of the body in a frame formed by two pieces of material , preferably wood or metal , perpendicularly arranged with respect to each other . alternatively , a uniform piece of material such as wood or metal of the same dimension as the top piece may be used . an aperture is formed in the center of the top and through the support . fig1 is a perspective view of an organizer 700 according to another preferred embodiment of the present invention . fig1 is a perspective view of the organizer shown in fig1 turned counterclockwise 90 °. fig1 is a perspective view of the organizer shown in fig1 turned clockwise 90 °. in the preferred embodiments shown in fig1 - 19 , a plurality of exterior surfaces of the organizer 700 are provided with features . for example , in the embodiment illustrated , two exterior surfaces , the back panel 110 and side panel 108 are provided with shoe pockets 702 and side panel 106 , is provided with belt loops 716 . the arrangement of these features may be changed without departing from the scope of the invention as defined by the claims . in addition , instead of providing shoe pockets , removably attached discrete organizers may be provided on one or all exterior surfaces . the features described with respect to the various embodiments may be mixed and are not limited to the particular arrangements illustrated . thus , for example , all three sides may be provided with shoe pockets and / or belt loops and / or discrete organizers . furthermore , a third side panel may be included that couples the top and bottom and first and second side panels along an edge opposite of that coupled by the back panel so that there is no interior region of the closet organizer . shoe pockets , belt loops , pooches and / or discrete organizers may be located on the exterior surface of the first , second , third and back panels in any configuration . the organizers described with respect to the various embodiments may also be configured without a bottom 104 so that the organizer is open at the bottom .	0
fig1 illustrates a first component in the form of a wafer 1 to be bonded for example , a semiconductor , ceramic , glass , or other materials , whereas fig4 illustrates a second component in the form of a glass wafer 4 . a suitable type of glass material is borosilicate glass or other types of glass material having alkaline ions may be used . in this embodiment , pyrex 7740 glass is used as the glass wafer 4 for the bonding operation . in this embodiment , silicon will be used as an example for the first wafer 1 . the conditioning of the silicon wafer 1 may take the form of polishing the surface for the bonding operation so that the surface is a “ mirror - polished surface ”, which has a surface roughness of typically in the nanometer range . in addition , prior to introduction of the silicon wafer 1 into a deposition chamber , the surface is ultrasonically cleaned by means of a cleansing solvent , for example nitric acid , ammonium hydrogen peroxide , rca cleansing solution ( which can be sulfuric or hydrogen peroxide based ) or acetone . next , in the deposition chamber , an amorphous intermediate layer 2 is deposited on the “ mirror polished ” surface of the silicon wafer 1 , as shown in fig2 . the deposition of the amorphous intermediate layer 2 on the wafer surface creates a high surface energy on the wafer 1 and a “ non - closely ” stacked atom structure . high surface energy reduces the necessary bonding temperature and a “ non - closely ” stacked structure permits charge diffusion into a deeper depth so as to improve the bonding strength . examples of a suitable amorphous intermediate layer 2 are silicon , silicon oxide and silicon nitride . it is essential that the amorphous intermediate layer 2 is non - hydrogenated , meaning that the intermediate layer is deposited without deliberately using hydrogen or hydrogen radicals during the deposition process . in this way , the intermediate layer formed would be substantially hydrogen free . this is important because hydrogen has a higher affinity with oxygen than most of other elements and thus oxygen ( from the glass wafer 4 ) which is transported to the glass - silicon interface between the two wafers 1 , 4 will bond readily with hydrogen . therefore , if there is hydrogen present in the amorphous intermediate layer 2 , the chemical bonding strength between oxygen and silicon is reduced resulting in a low bonding quality . to ovecome this problem , the amorphous intermediate layer 2 is deposited using physical vapour deposition ( pvd ) which reduces or eliminates the hydrogen content in the amorphous layer 2 . examples of pvd methods include laser ablation , ion beam deposition and sputtering . in this embodiment , sputtering is used to grow an amorphous and non - hydrogenated silicon intermediate layer 2 on the silicon wafer 1 at room temperature in the depostion chamber . it should be apparent that there are no hydrogen gas or gases with hydrogen content being used in the deposition chamber . the silicon intermediate layer 2 is deposited using a dc magnetron sputtering system with a base pressure of 5 × 10 − 7 mbar . a 99 . 99 % high purity silicon planar target was mounted on the sputtering system and argon ( ar ) gas was used as a sputtering gas . during sputtering , energised plasma ions strike the silicon planar target and cause atoms from the silicon target to be ejected with enough energy to be deposited onto the silicon wafer 1 , as illustrated by arrows - 3 in fig2 . the total flow rate of the sputtering was 100 sccm ( standard cubic centimeter per minute ) and the actual pressure was approximately 2 × 10 3 mbar . the target current was in the range of 0 . 4 to 1 . 4 amperes . by controlling the depostion time , a typical intermediate layer thickness ranging from nanometers to micrometers can be achieved . after the deposition of the amorphous intermediate layer 2 on the silicon wafer 1 , the silicon wafer 1 is further treated by immersing the silicon wafer 1 with the amorphous layer 2 in a hydrophilic solution bath , such as sulfuric -, or hydrogen - peroxide - based rca solution . this treatement process is carried out at a temperature between 50 ° c . and 80 ° c . for about 5 to 10 minutes , so that the silicon wafer 1 becomes hydrophilic . this is depicted in fig3 . similarly , the glass wafer 4 is conditioned first by polishing the bonding surface and then treated in a same hydrophilic solution bath so that the wafer 4 becomes hydrophilic , as shown in fig4 . next , both wafers 1 , 4 ( and the amorphous intermediate layer 2 deposited on the silicon wafer 1 ) are flushed with deionised water to remove the hydrophilic solution from the wafer &# 39 ; s surface . this is followed by “ spin - drying ” the two wafers 1 , 4 or blowing inert gases on the wafers 1 , 4 to speed up the drying process . when the wafers 1 , 4 are dried , the glass wafer 4 is stacked or arranged in spaced relationship with the intermediate layer 2 and the silicon wafer 1 , as shown in fig5 . the alignment is of a high accuracy , typically better than 1 micron . in order to avoid wafer contact during vacuumizing , the two wafers 1 , 4 are separated by spacers 5 , having thickness of typically 20 - 50 microns , which are introduced at the wafer &# 39 ; s edges . after the alignment , the stacked wafers 1 , 4 are placed in a vacuum chamber . during vacuumizing , one or both of the wafers 1 , 4 are heated to a temperature between 300 ° c . and 200 ° c . or less . when the temperature reaches the predetermined setting , the two wafers 1 , 4 are first brought into point contact under pressure in the central area , as shown by arrow 6 in fig6 . next , the spacers 5 are pulled out to allow the rest of the surface between the glass wafer 4 to be in contact with the amorphous intermediate layer 2 . next , anodic bonding of both wafers 1 , 4 is carried out by applying a voltage ranging between 100 to 1000 volts on the two wafers 1 , 4 such that the voltage applied on the silicon wafer 1 is positive with respect to the voltage of the glass wafer 4 . fig7 illustrates the successful bonding of the two wafers 1 , 4 at a temperature between 300 ° c . and 200 ° c . or less and a voltage of 100 volts to 1000 volts . after bonding , the bonded assembly of wafers 1 , 4 are checked with a scanning acoustic microscope ( sam ) using a resolution of approximately 2 . 5 microns . fig8 shows a c - sam image of the whole bonded surface of a typical bonded wafer 1 , 4 assembly . as shown , a bubble free glass - silicon interface could be achieved . in some test samples , occasionally , small bubbles were found in the interface , but the unbonded area due to these bubbles was limited to less than 1 % of the whole wafer . a laser profilometer was also used to check the warpage and residual stress but there was no warpage and residual stress detected . the bond created in this manner is distinguished both by a high mechanical strength and long mechanical and chemical durability . the measurements in “ pull ” tests have shown that the bonding strength can be higher than the fracture strength of glass . the results from the pull tests revealed that bonding strength higher than 20 mpa can be achieved for the bonding temperatures between 200 ° c . and 300 ° c . used in the preferred embodiment . it is also found that fracture , if any , would occur inside the glass , or in some cases the silicon , rather than in the glass - silicon interface , as shown in fig9 a and 9 b . fig9 a shows a fractured surface of a bonded wafer 1 , 4 after dicing to 10 × 10 mm and fig9 b is a mirror image of fig9 a illustrating the corresponding fractured surface in the other portion of the bonded wafer 1 , 4 . both optical images show that the fracture happens in the glass or in the silicon , and not in the glass - silicon interface . this high bonding strength thus permits further trouble - free processing of the wafer plates for the fabrication of , for example highly complex microstructures or devices , or the like . it also permits trouble - free post processing of the wafers , such as grinding , polishing , dicing etc . the reliable bonding at such low temperature in this invention can minimise degradation or damage of pre - fabricated devices and integrated circuitry . it can minimize or eliminate bonding - induced residual stress or warpage after cooling which may cause reliability issues . it can also be used for hermetic and vacuum sealing at a low temperature . the embodiment described is not to be construed as limitative . for example , although the embodiment describes the bonding between a silicon wafer 1 and a glass wafer 4 , other types of wafer or substrate , such as metal , ceramic or semiconductor material , can be used . the described method is also applicable for bonding between a substrate and a wafer and not just between two wafers . the method may also be used for bonding two substrates or for bonding between a plurality of substrates and / or wafers . for example , after a bonded assembly is formed by using the described method , the bonded assembly can be further bonded using the described method with another component which can be a wafer or a substrate and subsequently , the bonded assembly can again be bonded with a further component . in this way , a multilayer wafer or substrate assembly is formed . the preferred bonding temperature is between 300 ° c . and 200 ° c . to alleviate any residual stress to the glass and silicon wafer 1 , 4 . however , it should be apparent that a bonding temperature higher than 300 ° c . may be applied to the wafers 1 , 4 to achieve a better bond if both wafers can withstand the thermal mismatch , when both wafers 1 , 4 are subsequently cooled to room temperature , or other degradations . the described embodiment uses sputtering as the pvd process for the deposition of the intermediate layer 2 . however , other pvd processes such as ion beam deposition and laser ablation can also be used . in the alternative , other suitable deposition methods , such as chemical vapour deposition ( cvd ) can also be used as long as the amorphous intermediate layer 2 formed is non - hydrogenated . the sputtering process described uses a silicon planar target to deposit the silicon intermediate layer 2 . in the alternative , other suitable planar targets can be used as long as the substance forming the target does not have hydrogen as a constituent element . having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the scope of the invention as claimed .	7
referring to fig1 , a preferred embodiment of an anode plug device 10 is shown with an anode 100 held therein . the anode plug device 10 is shown according to a preferred embodiment having a connector 11 that has a channel therethrough . according to a preferred embodiment , the connector 11 is illustrated having a lower body portion 11 a , an upper body portion 11 b , and a connecting portion lie . the connector 11 preferably has a threaded portion 13 that is matingly threaded for connection to a threaded bore 201 of an engine cooling system component , such as the pipe 200 ( or other structure to which the device 10 is mounted ). the connector 11 preferably has sealing means comprising a sealing mechanism for sealing the passage of seawater from escaping through the connector 10 when the anode 100 is removed . the sealing mechanism preferably comprises a sealing component . according to some embodiments , the sealing component may comprise a spring - loaded wafer valve . according to other embodiments , the sealing component may comprise an elastomeric seal . a preferred embodiment is illustrated , where a sealing mechanism is provided that includes at least one sealing member . according to some embodiments , a connector 11 has a chamber 14 in which a first sealing member 15 is disposed , the first sealing member 15 , according to a preferred embodiment , comprises a cross - slit valve , having an opening 15 a . as shown in fig2 , in the exploded view , the sealing means is shown , and , according to a preferred embodiment , a first sealing member is illustrated being configured as cross - slit valve 15 . according to a preferred embodiment , the cross - slit valve 15 preferably is elastomeric . preferably , the sealing means may include a second sealing member 16 , which may be provided as an additional sealing point to further facilitate the sealing properties of the device 10 . alternately , although not shown , according to an alternate embodiment , the sealing members 15 , 16 may be provided as a single member . the second sealing member 16 has an opening 16 a therein , as shown in fig2 . according to a preferred embodiment , the second sealing member 16 seals against an annular flange 18 of the connecting portion lie . the connecting portion 11 c is shown in fig2 and 3 having an aperture 20 therein and bores 21 that align with bores 22 of the lower body portion 11 a . the lower body portion bores 22 preferably are threaded to receive matingly threaded fasteners , such as bolts ( not shown ) that connect the connecting portion 11 e with the lower body portion 11 b . the connecting body portion 11 e ( fig3 ) also has bores 21 a , 21 b that preferably may be threaded and align with bores 34 a , 34 b , respectively , of the upper body portion 11 b . bolts ( not shown ) may be installed in the bores 21 a , 21 b and 34 a , 34 b to connect the upper body portion 11 b with the connecting body portion 11 c . according to a preferred embodiment , a biasing mechanism is provided to bias the valve 15 to a sealing position against the body of the anode 100 , and , according to some embodiments , to bias the valve 15 to seal the valve opening 15 a closed when the anode 100 is not present in the valve opening 15 a . according to a preferred embodiment , the biasing mechanism includes a garter spring 24 , which , for example , preferably may be a coil spring tied or secured end - to - end to provide an even force around the valve 15 . the garter spring 24 preferably maintains the valve 15 in sealing engagement against the anode 100 by keeping the valve 15 against the anode 100 ( or , when the anode is not present within the valve opening 15 a , closes the valve opening 15 a by exerting a biasing force on the valve 15 ). an annular groove 25 preferably is disposed in the lower body portion 11 a in which the spring 24 is disposed , and , as shown in fig1 , in the assembled view , the spring 24 engages the valve 15 . fig5 shows the device 10 with the anode 100 removed therefrom , and illustrates the biasing of the spring 24 against the valve 15 to close the valve opening 15 a . according to a preferred embodiment , as shown in fig2 , the cap member 12 is provided having a bore 26 therein which preferably is threaded with mating threads that engage the threaded end 101 of the anode 100 to hold the anode 100 in engagement with the cap member 12 . alternately , an anode that is not threaded may be turned into the threads of the cap member 12 to be releasably secured therein . alternately , the anode may be provided without a cap member , and according to some embodiments , the anode may have a handle or gripping means to facilitate rotating the anode ( see fig8 and 9 ). the connector 11 preferably has connecting means for providing a removable connection between the connector 11 and the anode 100 . the connecting means provides a connection to secure the anode 100 on the connector 11 , and permits removal of the anode 100 from the connector 11 as needed or desired to replace , install , maintain or inspect the anode 100 , or to maintain the structure to which the device 10 is installed , such as , for example , a pipe 200 of an engine system . according to a preferred embodiment , connecting means is shown comprising a connection mechanism . as shown in the exploded view of fig2 , according to a preferred embodiment , the anode 100 is provided having pins 102 that connect to the connector 11 . the connector upper body portion 11 b preferably has an engaging mechanism that engages the anode pins 102 to connect the anode 100 the device 10 . according to a preferred embodiment , the engaging mechanism may capture the anode 100 by capturing pins 102 provided on the anode 100 . according to a preferred embodiment , alternately , the anode 100 may be provided with an integral cap . the upper body portion 11 b preferably has a bore 33 therethrough in which the anode 100 ( or cap member sleeve 151 in the embodiment shown in fig8 ) may pass through . the pins 102 engage the outer slots 27 ( see fig1 , 2 , 5 and 6 ) provided in the upper body portion lib . as shown in fig6 and 7 , the upper body portion 11 b has outer slots 27 and inner slots 28 provided therein for receiving the pins 102 of the anode 100 . the slots 27 and 28 are connected by a channel 29 , and according to a preferred embodiment , a pair of slots 27 , 28 is provided on opposite sides of the upper body portion 11 b . for example , according to the exemplary embodiment , in fig1 , an anode 100 is connected to a cap member 12 , and the anode 100 is connected to the upper body portion 11 b by way of the pin engagement with the slots 27 , 28 and channel 29 . according to one embodiment , the slots 27 , 28 and channel 29 are provided at diametrically opposite sides of the upper body portion 11 b . preferably , the connection is made by aligning the pins 102 with the outer slots 27 . the pins 102 are received in the outer slots 27 , and the anode 102 is rotated to move the pins 102 along the channel 29 . preferably , the anode 102 rotation may be facilitated with downward pressure ( in the direction toward the lower body portion 11 a end ) to move against resistance of a biasing mechanism that urges the pins 102 upward . when the pins 102 reach the inner slots 28 , the pins 102 are cammed upwardly into the slots 28 by the action of a biasing mechanism . the biasing mechanism , according to a preferred embodiment , includes a wafer spring or wave washer 31 that preferably has an opening ( see fig1 ) to permit passage of the anode 100 therethrough . preferably , a camming washer , such as , for example , a stainless steel washer 30 with an opening 30 a ( see fig2 ), is disposed above the wave washer 31 and provides a camming surface for the pins 102 to travel along when the pins 102 are being rotated for installation or removal from the device 10 . a handle preferably may be provided on the anode 100 or cap 12 to provide a means for gripping the anode 100 or cap member 12 to facilitate rotation and removal of the anode 100 ( and any cap thereon ) from the connector 11 . referring to fig2 a , according to a preferred embodiment , an alternate anode embodiment 100 ′ is shown having a handle that may comprise a pin , or pins , 56 , 57 . the pins 56 , 57 may comprise a single pin that is passed through the upper portion of the anode 100 ′ ( or a cap ). similar pin handles 156 , 157 are shown in fig8 , and pins 156 ′, 157 ′ are shown in fig9 . referring to fig2 a , the pins 56 , 57 are shown in the exemplary anode 100 ′ and may be integrally provided with the anode 100 ′, or , alternately , may be separately provided , and attached , for example , through a horizontal bore ( not shown ) of the anode 100 ′. the anode pins 102 ′ also connect with the device 10 through the connection to the upper body portion 11 b , as shown and described herein in connection with the pins 102 . preferably , the anode pins 102 also make contact with the upper body portion 11 b when the anode 100 is installed on the device 10 , so as to maintain the anodic contact between the anode 100 and the system structure 200 , which , according to ta preferred embodiment , is done by having electrical conductivity maintained between the anode 100 and upper body portion 11 b , through the connector 11 , and according to the preferred connector embodiment , by maintaining electrical conductivity between the upper , connecting and lower body portions , respectively 11 b , 11 c , and 11 a . according to a preferred embodiment , the connection mechanism comprises a washer 30 , such as for example a stainless steel washer , and a wave washer 31 , which are disposed in a recess 32 of the of the upper body portion 11 b of the connector 11 . according to a preferred embodiment , the anode 100 is releasably installed on the connector 11 b . one preferred method of installing the anode 100 on the connector 11 is to position the anode pins 102 within the outer slots 27 , and apply a downward pressure against the force of the wave washer 31 to lower the pins 102 . the anode 100 is then rotated to move the pins 102 along the channel 29 to locate the pins 102 in the inner slots 28 , whereupon release of the downward pressure releases the force applied on the wave washer 31 , and the pins 102 are biased upwardly into a locking position where the pins 102 are seated within the inner slots 28 . referring to fig1 , a pin 102 is shown in the outer slot 27 . to secure the anode 100 on the device 10 , the downward pressure lowers the pin 102 , whereupon it may be rotated ( in the embodiment illustrated , in a clockwise direction ) until it reaches the locking or inner slot 28 . the other pin 102 also is lowered and rotated to the oppositely disposed slots 28 . according to a preferred embodiment , the inner slots 28 are disposed higher than the channels 29 that connect each outer slot 27 with an inner slot 28 . alternately , a single channel 29 may be provided to connect the outer slots 27 and inner slots 28 , or alternately , two channels 29 may be provided , each connecting an outer slot 27 with an inner slot 28 . likewise , removal of the anode 100 from the device 10 is accomplished in a similar manner , in reverse , by depressing the top of the anode 100 or cap member 12 to lower the pins 102 from the inner slots 28 , and rotating the anode 100 ( or cap member 12 that carries the anode 100 ) counterclockwise ( according to the embodiment illustrated ) so as to bring the pins 102 into alignment with the outer slots 27 . the anode 100 ( or cap member carrying the anode 100 ) is then lifted to remove it from the upper body portion 11 b . fig6 shows a top view of the upper body portion 11 b and slots 27 , 28 . the device 10 preferably is used with a zinc anode 100 . according to a preferred method , the device 10 may be supplied in one or more components , and may be supplied with an anode 100 , such as a zinc anode , or may be supplied separately from the anodes . although a zinc anode is described according to preferred embodiments , the anode 100 may be composed of other suitable materials , such as , for example , zinc alloys or other metals , metal compositions and alloys . according to a preferred embodiment , the anode 100 is secured to the cap member 12 . preferably , this is accomplished by threading the anode 100 onto the cap member 12 by engaging the anode threads 101 with the cap member threads 26 . ( see fig2 ) if the installation involves a replacement anode , then a degraded anode which is carried on the cap member 12 is removed from the cap member 12 ( preferably , by unscrewing it from the cap ), and a new anode 100 installed . alternately , although not shown , an anode may be configured having an integral cap , or alternately , in place of the cap 12 , the anode may be provided with handles or pins ( see , e . g ., fig2 a ). according to another alternate embodiment , the cap member may be configured with arms or pins that are received in slots , such as , for example , those outer slots 27 and inner slots 28 of the upper body portion 11 b , and an anode may be secured to the cap member by screwing the threaded end of the anode to the cap member . in this alternate embodiment , the spacing and location of the slots in the alternate embodiment ( like those slots 27 , 28 ) is provided to accommodate pins of the cap . the anode 100 , whether through its contacts between the pins 102 and upper body portion 11 b or through the anode contact with the cap member 12 and the cap member contact with the upper body portion 11 b , is in a conductive relationship with the structure to which the device 10 is attached ( such as the pipe 200 ). preferably , the upper body portion 11 b , lower body portion 11 a , and connecting portion 11 e are conductively connected to permit electrical conductivity between the anode 100 and a structure to which the device 10 is attached . preferably , the device 10 is used by installing the connector 11 on the cooling system structure , such as , for example a pipe 200 . according to a preferred embodiment , the connector threaded portion 13 is connected to a matingly threaded bore 201 of the structure or pipe 200 . according to one option , for an initial installation , the device 10 may be installed as a unit , with the connector 11 , cap member 12 and anode 100 pre - connected together . according to a preferred option , for an initial installation or for subsequent installations , the connector 11 is installed on a structure before the cap member 12 and anode 100 are installed on the connector 11 . the connector 11 carries the sealing member or cross - slit valve 15 therein . the connector 11 is installed by connecting it to the threaded bore 201 of the structure 200 . this may be done by rotating the connector 11 and tightening the connector mating threads 13 against the threaded bore 201 . the connector 11 may remain installed on the structure 200 when subsequent replacements of the anode 100 are to be made . according to a preferred embodiment of the method , the connector 11 remains attached to the structure 200 , and the cap member 12 with the anode 100 ( e . g ., the remaining portion of the anode 100 ) is removed from the device 10 by depressing the cap member 12 to lower the pins 102 in the inner slots 28 , and rotating the cap member to rotate to pins 102 along the channel 29 into alignment with the outer slots 27 of the upper body portion 11 b . the cap member 12 and any portion of the anode 100 attached thereto is then withdrawn from the connector 11 by lifting the cap member 12 and remaining anode portion ( in the case where the spent anode is being removed ) from the connector 11 b . according to the embodiments where the anode 100 ′ includes pins 56 , 57 ( fig2 a ), the pin handles 56 , 57 may be used to rotate the anode 100 ′ to install and remove the anode from the device 10 . according to a preferred embodiment , the connector 11 remains installed on the structure ( such as the pipe 200 ), and the cap member 12 is removed from the device 10 along with any remaining the portion of the anode 100 . in many instances , when about 70 % of the anode has been used , the anode should be replaced . the replacement of a worn anode before it is entirely consumed preferably is done to prevent potential corrosion of the components of the cooling system , engine or other structure to which the device 10 is attached and for which the anode 100 is used as a sacrificial anode . the device 10 prevents or minimizes water ( or other fluid ) from escaping from the system , such as the pipe 200 that contains a fluid ( e . g ., seawater for cooling marine engines ), since , as the removable components , such as , for example , the cap member 12 and anode 100 , are disconnected from the connector 11 , the sealing means , in particular , the first sealing member 15 covers the opening through which the anode 100 previously occupied ( see fig5 ) to block the passage of water from the structure or pipe 200 . in this manner , according to a preferred embodiment , the anode 100 and cap member 12 may be removed from the connector 11 . the withdrawal of the anode 100 withdrawals the anode 100 from the opening 15 a of the cross - slit valve 15 , and the cross - slit valve 15 closes to seal the opening 15 a that the anode 100 once occupied . the first sealing member 15 preferably , the cross - slit valve also facilitates sealing , such as when the anode 100 is consumed ( by galvanic corrosion ) and when the anode 100 recedes to a point above the valve 15 ( relative to the direction of the cap member 12 ). the valve opening 15 a will close to block passage of water . the closing of the cross - slit valve 15 is aided by the garter spring 24 , which constricts the valve 15 to close the valve opening when the anode 100 is no longer present . according to a preferred embodiment , preferably , the sealing member 15 is constructed from a resilient and suitably corrosion resistant material , such as a substantially non - reactive component , like silicone , or other elastomer , so that the material may be moved aside to provide the opening for passage of the anode 100 when the anode is present . according to a preferred embodiment , a second sealing member 16 is shown above the first sealing member 15 , relative to the cap member 12 of the device 10 , and provides a further blockage to potential water that may escape from the cooling system ( or other structure , such as the pipe 200 ) when the cap member 12 and anode 100 are removed for replacement of the anode 100 ( or when the cap member 12 is removed to check the anode 100 wear condition ). the second sealing member 16 preferably may be an elastomeric component , and more preferably may be made from a substantially non - reactive component , such as silicone . according to one embodiment , the second sealing member 16 preferably has at least one opening 16 a ( see fig2 ) to permit the anode 100 to pass through . alternately , the second sealing member 16 may be flexible so as to recede to close or substantially close the opening when the anode 100 is not present . for example , according to one embodiment , when the anode 100 is withdrawn from the connector 11 , the second sealing member 16 constricts against the anode 100 as the anode 100 is being withdrawn . this provides a secondary sealing ( when used in an embodiment with the first sealing member 15 ). according to some embodiments , the second sealing member 16 may constrict to close the opening 16 a , when the anode 100 is withdrawn from opening 16 a . the cap member 12 may be removed from the connector 11 , and a new anode 100 installed to replace the spent anode . preferably , the worn remainder of the anode 100 is removed from the cap member 12 , and a new anode 100 installed ( by screwing the threads 101 of a new anode to the threads 26 of the cap member 12 ). where a cap member is integral with an anode , or is not provided , the anode may be replaced with an anode having an integral cap or no cap ( see fig2 a ). the cap member 12 and anode 100 preferably are installed on the connector 11 by inserting the leading end of the anode 100 through the sealing means or sealing component , such as the second sealing member 16 and first sealing member 15 . preferably , the first sealing member 15 seals around the anode 100 to block water from passing through the device 10 ( e . g ., from the structure out through the device 10 ). according to a preferred embodiment , the device 10 is constructed having means for connecting the device 10 to a structure , such as , for example , a structure that may be an engine or a cooling system component of an engine . the means for connecting the device to a structure is illustrated , according to a preferred embodiment , comprising a connector 11 . the device 10 preferably includes means for removably coupling an anode with the means for connecting the device to a structure . the means for removably coupling an anode with the means for connecting the device to a structure is shown , according to a preferred embodiment , comprising a connecting mechanism that removably connects the anode 100 with the connector 11 . the means for removably coupling the anode with the means for connecting the device to a structure preferably comprises pins 102 that are received in outer slots 27 on the connector 11 , which are rotated through a channel 29 to inner grooves 28 , where the pins 102 are retained by the biasing force of a retaining member . the retaining member , according to preferred embodiments , may be a wave washer , and may include a camming surface such as a washer disposed on the wave washer . means for holding an anode 100 , according to a preferred embodiment , preferably is provided to hold the anode 100 to the cap member 12 , and , in a preferred embodiment , is shown comprising threads 26 provided on the cap member 12 into which matingly associated threads 101 of an anode 100 may engage . optionally , an alternate configuration may be used where pins are provided on the cap member . the device 10 preferably includes sealing means for sealing the structure environment so as to minimize or prevent escape of fluid from the structure to which the device 10 is attached . preferably , the sealing means seals against the anode 100 so as to prevent escape or leakage of fluid from the engine or structure compartment that contains the fluid into the area where the anode 100 is connected to or held by the device 10 . according to a preferred embodiment , the sealing means is shown comprising a seal , and , according to one preferred embodiment , the sealing means comprises , a cross - slit valve or seal 15 . in a preferred arrangement , the anode 100 passes through the cross - slit valve 15 when the anode 100 is installed . according to one preferred embodiment , a constricting member constricts the valve 15 against the anode 100 , or , when the anode 100 is not present , to a closed position to close the valve opening 15 a . according to a preferred embodiment , the connecting member may comprise a garter spring 24 . preferably , the cap member 12 holds the anode 100 . although the device 10 and method have been described , the cap member 12 ( when used ) preferably is connected to the connector 11 with the anode 100 already installed in place on the cap member 12 . the anode 100 and cap member 12 may be connected together and then installed on the connector 11 which already has been installed on the pipe 200 . according to an alternate method , when no fluid is present in the structure , as in an initial installation or dry installation , the cap member 12 and anode 100 may be installed on the connector 11 , and the device 10 , with the cap member 12 , anode 100 and connector 11 connected together ( with the cap member 12 and anode 100 ), may be installed on the structure , such as , for example the pipe 200 , by securing the threads 13 of the connector 11 to the threaded bore 201 of the structure 200 . although a single bore 201 is shown in the structure , there may be a plurality of bores on the cooling system components , and a device 10 may be installed in each bore . although the structure to which the device 10 is installed is illustrated as a pipe 200 , it is understood that the structure to which the device 10 may be attached may comprise components other than a pipe 200 , such as , for example , cooling system manifolds or other structures . in addition , the devices shown and described herein may be constructed in different sizes , and with different sized components , in order to accommodate different size bores and openings in structures to which the devices are attached . the device 10 , and in particular , the connector 11 , may be comprised of a conductive material that has resistance to corrosion . one example of a material from which the connector may be constructed is brass . other examples of material from which the connector may be constructed is metal and metal alloys , including stainless steel , or other materials coated to provide suitable conductivity between the anode and structure . the device 10 may be constructed with different size components in order to be used with different sized anodes . referring to fig8 , an alternate embodiment of an anode plug device 110 is shown having a connector 111 with a channel therethrough , the connector 111 , according to a preferred embodiment , having a lower body portion 111 a , an upper body portion 111 b , and a connecting portion 111 e . the connector 111 preferably has a threaded portion 113 that is matingly threaded for connection to a threaded bore , such as the bore 201 of an engine cooling system component or pipe 200 ( shown in fig1 ). the connector 111 has a chamber 114 in which a first sealing member 115 is disposed , the first sealing member 115 , as shown and discussed herein in connection with the embodiment shown in fig1 - 7 , may comprise a cross - slit valve , having an opening 115 a . a second sealing member 116 is provided above the first sealing member 115 . preferably , the cap member 112 has a sleeve 151 with a threaded bore 152 for connecting with a threaded shaft 301 of a matingly threaded anode 300 . a cap member 112 ( which is an optional member ) is shown according to a preferred configuration constructed as a post 155 with arms 156 , 157 extending outwardly from the post 155 to provide a handle for gripping and facilitating rotating of the cap member 112 and anode 300 attached thereto . the installation , maintenance and removal and replacement of the anode 300 may be done as shown and described herein in connection with the device 10 , except that the cap member 112 is released and removed from the connector 111 , and the anode 300 ( or portion of it that remains ) is unscrewed from the cap member sleeve 151 , and a new anode 300 is installed on the sleeve 151 . the withdrawal of the sleeve 151 from the channel 114 ( when the cap member 112 is released from the device 110 and withdrawn ), releases the pressure on the valve 115 and spring 124 , and the spring 124 bias facilitates closing of the valve opening 115 a . according to a preferred embodiment , the cap member 112 is secured on the connector 111 with suitable connecting means , such as , for example , the pin and slot arrangement shown and described in connection with the device 10 of fig1 - 7 . preferably , the cap member 112 has pins 160 that are disposed on the upper end of the sleeve 151 , preferably , on opposite sides thereof ; for receipt into slots and channels , such as the slots 27 , 28 and channels 29 shown and described herein in connection with the device 10 of fig1 - 7 . preferably , the upper body portion 111 b includes the slots 27 , 28 , and channels 29 , as shown and described herein in connection with the embodiment of fig1 - 7 . the pins 160 facilitate securing of the cap member 112 ( when used ) and anode 300 attached thereto onto the connector 111 , and releasing of the cap member 112 and anode 300 from the connector 111 . installation of the device 110 to a structure may be carried out as shown and described in connection with the device 10 ( which is shown installed on a structure 200 ). fig9 illustrates an alternate embodiment of a cap member 112 ′ having a sleeve 151 ′ and being constructed for use with an anode 300 ′, which has pins 160 ′ for facilitating a connection with a connector , such as , for example , the connector 11 or 111 . the cap member 112 ′ preferably has a handle formed from two upper pins 156 ′, 157 ′. the cap member sleeve 151 ′ preferably has a mechanism for connecting an anode 300 ′, which according to a preferred embodiment , the mechanism is shown including a threaded bore 152 ′ which may receive the threads 301 ′ of the anode 300 ′. referring to fig1 - 12 , an alternate embodiment of an anode plug device 210 is shown ( with an anode 400 shown in fig1 ). the anode plug device 210 has a connector 211 and a cap member 212 . the connector 211 is illustrated having a lower body portion 211 a and an upper body portion 211 b . the connector 211 preferably has a threaded portion 213 that is matingly threaded for connection to a threaded bore 201 of an engine cooling system component , such as the pipe 200 ( or other structure to which the device 10 is mounted as shown in fig1 ). the connector 211 has a chamber 214 in which sealing means comprising a first sealing member 215 is disposed , the first sealing member 215 , according to a preferred embodiment , comprising a cross - slit valve , having an opening 215 a . as shown in fig1 and 12 , in the exploded views , the first sealing member is illustrated being configured as a cross - slit valve 215 , and preferably , the sealing means may further include a second sealing member 216 . as discussed herein , alternately , the sealing members 215 , 216 may be provided as a single member . the second sealing member 216 has an opening 216 a therein . according to a preferred embodiment , the second sealing member 216 seals against the flange of the removable cap member 212 . according to the preferred embodiment , the upper body portion 211 b has threads 250 that connect with threads 251 of the lower body portion 211 a to secure the upper body portion 211 b to the lower body portion 211 a . the upper body portion retaining flange 252 holds the sealing members 215 , 216 against the upper ridge 253 of the lower body portion 211 a . the cap member 212 preferably has a bore 226 therein which preferably is threaded with mating threads 227 that engage the threaded end 401 of the anode 400 ( fig1 ) to hold the anode 400 in engagement with the cap member 212 . the anode 400 may be pre - threaded , or alternately , the anode threads 401 may be provided by turning an unthreaded anode into the threaded bore 226 of the cap member 212 . alternate embodiments may be provided where the cap member 212 is not used . the connector 211 preferably has a connecting means for providing a removable connection between the connector 211 and the cap member 212 . the connecting means provides a connection to secure the cap member 212 on the connector 211 and permits removal of the cap member 212 from the connector 211 as needed or desired to replace , install , maintain or inspect the anode 400 , or maintain the structure to which the device 210 is installed , such as , for example , a pipe 200 of the engine system ( fig1 ). according to the embodiment illustrated in fig1 - 12 , the connecting means is shown comprising a press - fit connection mechanism . a preferred embodiment of the press - fit connection mechanism comprises a plurality of bearings 233 which are disposed in the side wall 211 c of the upper body portion 211 b of the connector 211 . the bearings 233 are shown disposed in a location adjacent the side wall 231 of the cap member 212 , and preferably , the bearings 233 are located so that the annular groove 232 , which , in the preferred embodiment has camming edges 232 a , 232 b , engages the bearings 233 to move the bearings 233 into engagement with the collar 235 . the bearings 233 are provided to capture the cap member 212 to make a releasable connection between the cap member 212 and the connector 211 , so that the cap member 212 is held on the connector 211 . according to a preferred embodiment , the side wall 211 e of the connector upper body portion 211 b preferably has a plurality of bores 234 disposed therein . the bores 234 preferably are disposed in a circumferential arrangement , and preferably are spaced apart . the bores 234 are sized to accommodate the bearings 233 . as shown in fig1 , the bearings 233 occupy the bores 234 , and a bearing 233 moves within a bore 234 to provide the releasing and securing of the cap member 212 and connector 211 . the annular collar 235 provided on the connector upper body portion 211 b preferably includes an annular ridge 236 disposed for engagement with the bearings 233 when the cap member 212 is removed or installed on the connector 211 . a spring 237 is provided to bias the collar in an upward direction . the spring 237 according to a preferred embodiment , is disposed on an annular ridge 240 of the first connector 211 upper body portion 211 b , and located between the lower wall 241 of the collar annular ridge 236 . the spring 237 preferably is annularly disposed about the upper body portion 211 b . according to a preferred configuration , the collar 235 is biased by the spring 237 in a direction toward the head 230 of the cap member 212 . retaining means , such as , for example , the ring 242 shown disposed in an outer annular groove 239 of the collar 235 , is provided to retain the collar 235 on the connector 211 when the cap member 212 is removed from the connector 211 . the ring 242 provides a stop for the collar annular flange 236 , and prevents further upward movement of the collar 235 beyond the connector upper body portion 211 b . the device 210 preferably is used with a zinc anode 400 . according to a preferred method , the device 210 may be supplied in one or more components , and may be supplied with an anode , such as a zinc anode , or may be supplied separately from the anodes . according to a preferred embodiment , the anode 400 is secured to the cap member 212 . preferably , this is accomplished by threading the anode 400 onto the cap member 212 by engaging the anode threads 401 with the cap member threads 227 . if the installation involves a replacement , then a degraded anode which is carried in the cap member 212 is removed from the cap member 212 ( preferably , by unscrewing it ), and a new anode installed . the connector 211 may be installed on a structure , such as , for example a pipe 200 , as is shown and described herein in connection with the embodiments illustrated in fig1 - 9 . referring to fig1 - 14 , an alternate embodiment of a connection mechanism 510 for connecting the anode on the device is illustrated with an upper body portion 511 b having a connector comprising clips 530 , 531 . the clips 530 , 531 preferably are constructed from a resilient material . according to one preferred embodiment , the clips are constructed from spring steel or other suitable wire . the wire clips 530 , 531 are shown attached to the upper body portion 511 b at their ends 530 a , 530 b , and 531 a , 531 b . one preferred attachment mechanism is shown comprising bores 534 , 535 , 536 , 537 , into which the ends of the wire clips 530 a , 530 b , and 531 a , 531 b , respectively , are inserted and held . although not shown , the ends of the wire clips 530 a , 530 b , and 531 a , 531 b may be secured to the upper body portion by pins , welds , screws or other suitable means . according to some embodiments , the wire clip ends 530 a , 530 b , and 531 a , 531 b are secured by a friction fit in the respective bores 534 , 535 , 536 , 537 . the upper body portion 511 b or the depth of the bores 534 , 535 , 536 , 537 may be sufficient to secure the wire ends 530 a , 530 b , and 531 a , 531 b , and alternately , the depth of the bores may be sufficient to hold screws to connect the upper body portion 511 b with another element of the connector , such as , for example the middle body portion ( see 11 c of fig1 - 5 ). according to one embodiment , bores 538 , 539 may be provided in the upper body portion 511 so that screws may be used to connect the upper body portion 511 b to another component of the connector , such as , for example , the connecting portion 11 c . the upper body portion 511 b may be used in place of the upper body portion 11 b , and may be connected with the connecting portion 11 e , and connected together with the lower body portion 11 a . the bores 538 , 539 , and the bores , 534 , 535 , 536 , 537 may receive fasteners , such as , for example screws , to connect with the connecting portion 11 c . alternate arrangements of the bores , or additional bores , may be provided in the components as required for alignment or connection . as shown in fig1 and 14 , the anode 500 has a groove 501 around its circumference , and when the anode 500 engages the clips 530 , 531 , the clips 530 , 531 separate relative to one another and spring outward , and , as the anode 500 is lowered in the device , when the groove 501 is aligned with the wire clips 530 , 531 , the clips 530 , 531 spring inwardly to engage the anode groove 501 . the anode 500 thereby is held on the connector ( such as for example , the connector 10 shown and described herein , but fitted with the upper body portion 511 b ). removal of the anode 500 is accomplished by raising the anode 500 from the connector and disengaging the groove 501 from the wire clips 530 , 531 . the wire clips 530 , 531 are moved outwardly from the groove 501 by lifting the anode 500 , and the anode 500 is removed by lifting it out of the device . according to a preferred embodiment , the groove 501 preferably is an annular groove . as illustrated in fig1 and 14 , according to one preferred embodiment , the groove 501 may have a first wall that is substantially vertical , such as , for example , wall 501 a in the embodiment illustrated in fig1 and 14 , and one or more walls that are angular in relation to the vertical wall 501 a , such as , for example , the two angular walls 501 b and 501 c . according to an alternate embodiment ( not shown ) the anode groove may be non - continuous , and , according to another alternate embodiment , anode embodiments may be provided with a camming surface leading to the groove . the anode 500 ( as with other anodes shown and described herein ) may have a feature to facilitate grasping and pulling , such as , for example , a pull or d - ring , a head , pins or the cap 512 , illustrated in fig1 - 14 , including any of those features as shown and described herein , or any other suitable handle or gripping member . alternately , the anode 500 may be cylindrical ( or provided without a pull ) and a tool ( such as , pliers , etc .) may be to remove the anode . the wire clips 530 , 531 , although shown and described in connection with the embodiment illustrated in fig1 - 14 , may be utilized in conjunction with the other connectors disclosed and shown herein to removably retain the anode on a connector . an alternate embodiment of an anode 600 is shown in fig1 having a body 601 with a bore 602 provided therein . the bore 602 , as shown according to a preferred embodiment , is disposed within the body 601 , and the body 601 has a lower portion 601 a provided below the bore 602 . the anode bore includes a cover 603 provided at the top of the anode 600 . the cover 603 may be constructed from any suitable material , and , according to a preferred embodiment , may be made from , glass , crystal or plastic , such as an acrylic . according to one preferred embodiment , the cover 603 is composed of a mineral crystal . preferably , the cover is clear to permit viewing , and an indicator means for indicating a condition is provided so that when water reaches an indicator , the indicator provides a detectible response . according to a preferred embodiment the detectible response involves the indicator exhibiting a visual change . according to a preferred embodiment , the indicator means for indicating a condition is shown comprising a water detection pad 604 is provided at the top of the bore 602 and preferably within the bore 602 . the indicator detection pad 604 may be attached to the preferred clear cover 603 and preferably is visible and can be viewed through the cover 603 . the lower body portion 601 a may be eroded or consumed during use of the anode 600 in customary operating conditions within the environments in which the anode 600 may be used , such as , for example , marine engine cooling systems and other applications where anode plugs and / or anodes are employed . the anode 600 preferably is utilized as a sacrificial anode , and when the lower portion 601 a is consumed , the lower end of the bore 602 is exposed and the bore 602 communicates with liquid or fluid of the cooling system environment . the liquid or fluid travels through the bore 602 and reaches the indicator detection pad 604 . the detection pad 604 , which is a commercially available component , changes color when water reaches it , and therefore , the color change may be observable through the window or cover 603 . accordingly , when the color change is observed , then the anode 600 may be replaced with another anode 600 . the anode 600 may be used with the connectors shown and described herein . the cover 603 may be attached to the anode body 601 with the use of any suitable connecting mechanism , and , for example , preferably , is sealed . an adhesive may be used to secure the cover 603 to the anode body 601 . alternately , while not shown , according to some preferred embodiments , the cover 603 may be secured in a groove or channel , and / or a sealant , o - ring or gasket may be used to prevent or minimize water from passing from the bore 602 or cover 603 outside of the anode 600 . referring to fig1 , another alternate embodiment of an anode 700 is constructed like the anode 600 , with an indicator means including an indicator 704 ( which may be the detection pad 604 ). the anode 700 is shown having a lower channel or annular groove 750 , an o - ring 751 disposed in the lower groove 750 , a cover 703 disposed to seal against the o - ring 751 , and a retainer clip or ring 760 . the o - ring preferably is made from any suitable material , including an elastomeric material . the cover 703 , according to a preferred embodiment , may be any suitable cover , including a watch crystal , and the indicator 704 , which may be a detection pad ( like the pad 604 ), is adhered on the inside of the crystal cover 703 . preferably , the retainer clip or ring 760 is seated in an upper groove 770 and holds the crystal cover 703 in place against the o - ring 751 to prevent water from leaking out from the opening 709 covered with the crystal cover 703 . preferably , the covers or portions of the covers are clear to provide viewing of the indicator . the opening 709 communicates with the anode body channel or bore of the anode body ( like the bore 602 described above in connection with the anode 600 ). the bore of the anode 700 is shown enclosed and is bordered by at least a portion of the anode body ( like the lower body portion 601 a of anode 600 ). the body bore or body channel has the top opening 709 covered with the cover 703 to provide a window through which the indicator is viewable . the cover 703 seals the first opening 709 of the channel or bore and the lower body portion of the anode that borders the body channel or bore encloses the lower or second opening of the body bore or channel , to close the lower opening of the bore when the anode lower body portion is present , and to provide an opening into the body channel or bore when the lower portion is not present so as to permit fluid communication into the body bore or channel . when at least a portion of the anode body that borders the body bore or channel is eroded ( e . g ., by galvanic corrosion ), then the body bore or channel is provided with an opening for communicating with the cooling fluid in the structure on which the anode plug and anode are installed . these and other advantages may be obtained through the use of the inventive apparatus and methods disclosed herein . while the invention has been described with reference to specific embodiments , the description is illustrative and is not to be construed as limiting the scope of the invention . for example , although the anode plug devices 10 , 110 , 210 , 510 are described in connection with a marine engine , the anode plug devices may be used for applications requiring anodic contact where an anode must be maintained or replaced , such as , for example , pipelines , storage tanks , and other applications . in addition , although not shown in fig1 , 2 and 10 , the cap member 12 may be provided with a post and a handle or arms , such as , for example , as shown in connection with the embodiments of fig2 a , 8 and 9 . in addition , the cap member 12 ( and 212 , 512 ) and anode 100 may be integrally provided so that the anode 100 has a cap member 12 ( or 212 , 512 ). optionally , the cap member 12 , 212 or 512 may be separately provided , and the anode 100 may secure to the cap member 12 or 212 , 512 , such as , for example , with mating threads provided on the anode and cap member . according to the invention , the anode may be provided with pins or other element or elements that may be used to facilitate rotating the anode relative to the connector . although a cap 12 , 212 , 512 is shown , the cap member may be excluded , and the anode used without the cap , or with elements provided on the anode for facilitating rotation of the anode . alternately , the means for removably coupling the anode with the means for connecting the device to a structure may comprise a connection mechanism that secures the anode with the connector without the drawbacks associated with threads . according to alternate embodiments , the connector may be constructed with a connecting mechanism that permits ease of connection and disconnection of the anode from the device , and embodiments may be constructed without the spring 24 that closes the valve 15 . for example , one preferred alternate embodiment may be provided with a sealing element ( e . g ., the first sealing element or valve 15 , the second sealing element 16 , or both ) to seal against the anode when the anode is present in the device . according to another embodiment the sealing element is a valve that expands to seal against the anode , and to contract to close the opening when the anode is not present ( e . g ., is removed or degrades ). alternate embodiments provide a device for rapid disconnect of an anode from a system using the connectors shown and described herein . for example , according to some embodiments , the device may provide for rapid disconnect of the anode , including embodiments where the cross - slit valve is not provided , but where a sealing element is provided ( such as , for example , a sealing element like the second sealing element 16 ) to provide a seal against the anode body when the anode , or anode portion is present to engage the seal . embodiments of the invention also may provide a rapid disconnect feature for connecting and disconnecting an anode from an anode plug , as illustrated and described herein , but without the sealing elements . a device part may be installed on the system , and another device part may hold the anode and connect to the installed device part . in addition although reference is made to zinc and zinc alloys , the anode may be constructed from other types of metals in alloys with or as a substitute for zinc . exemplary embodiments are shown and described herein . in addition to the aforementioned , various modifications and changes may occur to those skilled in the art without departing from the spirit and scope of the invention described herein and as defined by the appended claims .	2
fig1 shows an overview of the major building blocks comprising the preferred implementation of the present invention . each block will be described in detail below . a preferred embodiment is a 64 - bit incrementer . however , reduction of the present scheme to less bits or extension to more bits is straight forward . the present invention can be implemented in any dynamic logic family . the embodiment shown here is in srcmos logic , as described in commonly assigned and copending u . s . application ser . no . 08 / 463 , 146 , filed jun . 5 , 1995 , now u . s . pat . no . 5 , 633 , 820 , by chappell et al ., and complies with the srcmos test modes described in commonly assigned and copending u . s . patent application ser . no . to 08 / 583 , 300 , filed dec . 6 , 1995 , now u . s . pat . no . 5 , 748 , 012 , by chappell et al . (“ chappell ”). the core of the present invention is the carry look - ahead circuit . first , the familiar logic functions for the sum signals s i and carry signals c i are given for an n - bit adder ( see weste and eshragian , “ principles of cmos vlsi design : a systems perspective ”, addison wesley , reading mass ., 1988 ): c i + 1 = a i b i +( a i + b i ) c i i = 0 . . . n − 1 ( 1 ) for an incrementer , since b i = 0 ( i = 0 . . . n − 1 ), this simplifies to : the last equation implies an n - high and tree for the most significant carry bit c n − 1 . in dynamic logic , however , an or function can be implemented faster and using less area than an equivalently wide and function , and thus it is advantageous to calculate the complemented carry signals : { overscore ( s i + l )}={ overscore ( a i + l ⊕ c i + l )}= a i c i +{ overscore ( a i + l c i + l )} ( 3 ) { overscore ( c i + 1 + l )}={ overscore ( a i + l )}+{ overscore ( c i + l )} i = 0 . . . n − 1 in fig2 the or tree circuit that implements the last equations for { overscore ( c i + l )} ( i = 0 . . . n ) is schematically shown for a 64 - bit incrementer . at the bottom , the input signals { overscore ( a i + l )}( i = 0 . . . 63 ) are indicated by their index i . the { overscore ( c 0 + l )} input is shown tied to ground . at the top of the figure , the output signals { overscore ( c i + l )}( i = 0 . . . 63 ) and { overscore ( c out + l )}={ overscore ( c 64 + l )} are indicated by their index i . the circuit of fig2 implements a 4 - bit merge carry look - ahead scheme . except for a single 5 - wide or gate , the or gates are maximally 4 wide , and they are arranged in a balanced tree . buffers have been inserted into the tree to balance delay and to provide for the necessary drive of the signals with larger fan - out . using the configuration of fig2 no carry signal takes more than 3 gate delays to be calculated . a 4 - wide or element is shown in fig3 as implemented in srcmos logic . in equation 3 above , the logic functions for a dual rail sum circuit , generating signals s i and { overscore ( s i + l )} were expanded , showing that the sum circuit requires the presence of both the true signals c i and a i and the complement signals { overscore ( c i + l )} and { overscore ( a i + l )}. in srcmos logic , signals are represented by voltage pulses on a net . to evaluate the sum logic correctly , the pulses representing the above signals have to overlap in time . this is accomplished in the following manner . the true and complement input pulses a i and { overscore ( a i + l )} are captured in input latches , as given in fig4 which act as pulse to static converters . in a given machine cycle , an ( active high ) pulse only appears on one of the two inputs , which then sets the latch , comprised of back to back inverters i 1 and i 2 , to have either output node { overscore ( as i + l )} following a pulse on input node a i , or to have { overscore ( as i + l )} high , following a pulse on input node { overscore ( a i + l )}. the output { overscore ( as i + l )} is therefore a static representation of the dual rail pulsed input signals . the static { overscore ( as i + l )} signal from fig4 is now fed into the sum xor circuit of fig5 ., and inverted to yield static signal as i . both as i and { overscore ( as i + l )} are then combined ( and - ed ) with a strobe pulse , to generate either a true or a complement pulse , at i or { overscore ( as i + l )}, respectively . by use of the strobe , these last pulses are timed to coincide with ( or be slightly delayed with respect to ) the pulsed { overscore ( c i + l )} signal resulting from the or tree of fig2 . the and - ing of at i or { overscore ( at i + l )} with c i and { overscore ( c i + l )} constitutes the appropriate xor or xnor function to calculate the output sum signals s i and { overscore ( s i + l )}. waveforms are given in fig6 for each possible combination of a i , { overscore ( a i + l )}, c i and { overscore ( c i + l )}, as depicted in 4 successive cycles separated by the vertical dividing lines , and annotated with the sum logic term activated during each cycle . in the 1st cycle , annotated with s i = a i { overscore ( c i + l )}, an input pulse on net a i results in as i going high , so that the strobe triggers a pulse on at i . if the or tree resulted in { overscore ( c i + l )} firing , coincident with the strobe , then c i is low during the pulse at i , which therefore triggers , through transistor q 14 in fig5 a pulse on output net s i . in the next cycle , annotated with s i ={ overscore ( a i + l )} c i , a similar sequence of events is depicted for an input pulse on net { overscore ( a i + l )}. this results in a pulse { overscore ( at i + l )} at the time of the strobe . since { overscore ( c i + l )} did not fire ( i . e ., stays low ), the { overscore ( at i + l )} pulse activates a pulldown conduction path through transistor q 13 , resulting again in an output pulse s i . the rest of the cycles of fig6 are analogous to those described above . in fig5 it is noticed that ground interrupt device q 1 allows reset signal r 7 to start the reset ( trailing edge ) of at i or { overscore ( at i + l )} before the trailing edge of the strobe . this feature allows pulse width control of the sum circuit independent of the pulse width in the carry tree . the calculation of the sum in two stages in fig5 allows the final nfet and stacks in the xor and xnor sub - circuits to be only two high , rather than 4 high ( as i , c i , strobe and ground interrupt ). this optimizes the speed of the critical path . for correct operation of the described circuit , the timing of the strobe signal is critical . as shown in fig1 and fig7 the strobe signal is generated by an or function from the true and complement input of the least significant bit ( lsb ): strobe = a 0 +{ overscore ( a 0 + l )}. the strobe is then propagated to track the critical path in terms of time delay of each stage . to ensure that the tracking has minimal dependence on process variations , the strobe propagation circuit mimics the carry tree by employing a series of 4 - wide or gates with unused inputs tied to ground , as shown in fig7 . according to the srcmos circuit methodology , the unipolar switching circuits described above in fig3 and 5 are reset using a locally derived reset signal , as opposed to a reset ( precharge ) by a global clock , as in domino logic . for better margins control as well as low circuit cycle time two reset chains are used , as shown in fig1 and as detailed in fig8 . the first reset chain , generating reset pulses r 1 , r 2 , r 3 , r 4 , r 5 and r 6 services the or gate tree and is triggered by the rising edge of the strobe signal . since this chain resets the or tree , it will also reset the strobe signal to standby low . the second reset chain applies to the sum circuits of fig5 generating reset pulses r 7 , r 8 , r 9 and r 10 . this chain is triggered by a very wide or of all the sum circuit outputs s i and { overscore ( s i + l )} ( i = 0 . . . n − 1 ) of fig5 . whereas each of the nfets q 0 a through q 63 b in fig8 may not be strong enough to pull down the “ titrating or ” node s_or , during the course of the evaluation of the sum circuits , eventually half of the nfets will switch on , pulling down the s_or node in the process , and triggering the reset chain . the pulse width of nodes r 7 through r 10 is governed by the feedback loop starting from node r 9 a . the s_or node itself is reset using the feedback loop starting from node r 9 . the polarities of the various pulsed signals ( active high or low ) is schematically indicated in fig8 . odd numbered reset pulses are active low ( applied to pfets ), whereas even numbered reset pulses are active high and applied to nfets . breaking the reset chain into two parts allows for easy output pulse width control , as indicated above . the reset chains can easily be altered by changing device sizes as well as adding additional links . this way , margins between reset pulses can be tailored and pulse widths can be controlled . the reset chains comprise the necessary logic to force or to inhibit the reset signals , as required by the test modes for srcmos described in copending chappell . the state of the global signals reset , evaluate and static_evaluate in the functional operation modes and various test modes is given in the following table ( where l = low voltage ( ground ) and h = high voltage ( vdd )): in particular , the forced reset mode ( reset ) or inhibited reset mode ( evaluate ) are indicated by global signals reset and evaluate , respectively , and their locally buffered ( and possibly inverted ) versions rs , rs_ and ev_ , as shown in fig8 . furthermore , all unipolar switching nodes in the srcmos circuits described in fig3 and 5 have been equipped with small leakage pfets , activated in static evaluate test mode by an active low signal { overscore ( se )}, which is a locally inverted and buffered representation of global signal static_evaluate , again as described in copending chappell . thus the present circuit fully complies with the srcmos test modes described therein .	6
hereinafter , the present invention will be described in detail with reference to drawings illustrating exemplary embodiments of the present invention . fig2 a is a partial perspective view of a structure of a condenser microphone having a flexure hinge diaphragm according to the present invention , and fig2 b is a cross - sectional view of the structure of the condenser microphone having the flexure hinge diaphragm according to the present invention . for convenience of description , sectional lines for some elements such as a sound hole and an air hole will be omitted . referring to fig2 a and 2b , a condenser microphone 20 according to the present invention includes a silicon on insulator ( soi ) wafer 21 including a lower silicon layer 21 a , a first insulating layer 21 b and an upper silicon layer 22 used as a back plate ( hereinafter , referred to as “ a back plate 22 ”), a second insulating layer 23 formed along an edge of the back plate 22 , and a diaphragm 25 formed over the back plate 22 . the diaphragm 25 includes a contact region 25 b in contact with the second insulating layer 23 and a vibration region 25 a upwardly projecting from the contact region 25 b . an air gap 24 is formed between the vibration region 25 a of the diaphragm 25 and the back plate 22 , and a plurality of air holes 25 c in communication with the air gap 24 and passing through the diaphragm 25 are formed in the vibration region 25 a of the diaphragm 25 . a plurality of sound holes 22 a passing through the back plate 22 and in communication with the air gap 24 are formed in the back plate 22 . condenser microphones having various frequency characteristics can be manufactured depending on the size and number of the air holes 25 c and the number , size and distribution of the sound holes 22 a . a method of manufacturing the condenser microphone having the above - described structure will now be described in detail with reference to fig3 a to 3h . fig3 a to 3h sequentially illustrate a manufacturing process of the condenser microphone of fig2 b . referring to fig3 a , to manufacture the condenser microphone according to the present invention , an soi wafer 21 is first prepared . the soi wafer 21 is composed of a lower silicon layer 21 a , a first insulating layer 21 and an upper silicon layer 22 used as a back plate ( hereinafter , referred to as “ a back plate 22 ”). referring to fig3 b , the back plate 22 is patterned to form sound holes 22 a in the back plate 22 . here , deep reactive ion etching ( drie ) equipment is used . then , an insulating layer 23 is formed on the patterned back plate 22 . the insulating layer 23 is deposited by chemical vapor deposition ( cvd ). referring to fig3 c , after forming the insulating layer 23 , the insulating layer 23 is patterned to remain only on an outer region of the back plate 22 in which the sound holes 22 a are not formed . here , the insulating layer 23 is patterned by photolithography . after that , referring to fig3 d , a conductive layer 31 is formed on the patterned insulating layer 23 and back plate 22 . in this embodiment , the conductive layer 31 may be formed of a metal such as al , au or tiw by implanting charges into its surface . the conductive layer 31 is used as a lower electrode layer for applying an electrode of the back plate 22 to the condenser microphone . a passivation layer 32 protecting the conductive layer 31 is formed on the conductive layer 31 . after that , referring to fig3 e , a sacrificial layer 33 is formed on the passivation layer 32 . the sacrificial layer 33 formed on the passivation layer 32 is formed to cover the region having the sound holes 22 a , and to expose edges of the passivation layer 32 . the sacrificial layer 33 is formed of a material having an excellent etch selectivity with respect to the passivation layer 32 since it will be etched in the final step . the sacrificial layer 33 may be formed of one of various polymers such as silicon oxide , photoresist and polyimide , or metal materials such as al . also , in order to planarize the uneven sacrificial layer 33 formed in the sound hole region 22 a , silicon on glass ( sog ) may be employed . however , when the sacrificial layer 33 is formed of , for example , photoresist which cannot be processed at a high temperature , dry film - resist ( dfr ) may be employed . the planarization material for the sacrificial layer 33 may be coated several times by spin coating . a thickness of the sacrificial layer 33 may depend on the number of spin - coatings of the planarization material , thereby controlling the height of the air gap 24 formed between a diaphragm 25 and the back plate 22 during the vibration of the diaphragm 25 . a sufficient space in which the diaphragm 25 and the back plate 22 are not in contact with each other may be created by controlling the height of the air gap 24 ( refer to fig3 h ). referring to fig3 f , the diaphragm 25 surrounding the sacrificial layer 33 is formed over the sacrificial layer 33 . the diaphragm 25 has a contact region 25 b in contact with the passivation layer 32 and a vibration region 25 a formed along the sacrificial layer 33 . the diaphragm 25 is formed of metal and silicon nitride . in the present invention , the diaphragm 25 is formed of two layers of metal and silicon nitride . meanwhile , the diaphragm 25 may include various materials such as silicon nitride , polyimide , polysilicon , etc ., and metals such as al , ag , tiw and cu . after the diaphragm 25 is formed on the sacrificial layer 33 , a plurality of air holes 25 c passing through the vibration region 25 a of the diaphragm 25 are formed . the diaphragm 25 has an elastic deformable hinge structure having flexibility . the air holes 25 c may have a hole shape and a slotted shape which is radially formed from centers of the vibration region 25 a . referring to fig3 g , electrode pads 34 a and 34 b including positive and negative electrodes are formed . the electrode pad 34 a is formed on the passivation layer 32 to be electrically connected with the conductive layer 31 , and the electrode pad 34 b is formed to be electrically connected with the diaphragm 25 . to form the electrode pads 34 a and 34 b , a part of the contact region 25 b between the passivation layer 32 and the diaphragm 25 is etched , and then a conductive material having a small surface resistance such as au or ag is deposited thereon and patterned . referring to fig3 h , after forming the electrode pads 34 a and 34 b , the lower silicon layer 21 a , the first insulating layer 21 b , the conductive layer 31 , the passivation layer 32 and the sacrificial layer 33 are etched . the lower silicon layer 21 a , the first insulating layer 21 b , the conductive layer 31 and the passivation layer 32 are etched by a drie process , and the sacrificial layer 33 is removed by a wet etching process . as the lower silicon layer 21 a , the first insulating layer 21 b and the conductive layer 31 are removed , a plurality of sound holes 22 a are formed in the upper silicon layer used as the back plate 22 , and as the sacrificial layer 33 is removed , an air gap 24 in communication with the air holes 25 c and the sound holes 22 a is formed . forming the air gap 24 further includes applying photoresist on the diaphragm 25 to prevent deformation of the diaphragm 25 that can occur in the removal of the sacrificial layer 33 , and removing the photoresist applied on the diaphragm 25 using a dry etching process after the removal of the sacrificial layer 33 . the condenser microphone 20 manufactured by the above - described process may variously change frequency characteristics and sensitivity by controlling the thickness of the diaphragm 25 or the diameter , width and thickness of the vibration region 25 a , the length and number of the air holes 25 c , or the number , size and distribution of the sound holes 22 a formed in the back plate 22 . when the flexure hinge diaphragm 25 manufactured in the above - described process is used , the condenser microphone is more flexible than that using the conventional disk - shaped or pleated diaphragm , so it may be more sensitively vibrated due to external sound pressure which is input to the microphone , and increase its output voltage . fig4 a illustrates flexibility of a conventional disk - shaped diaphragm , and fig4 b illustrates flexibility of a flexure hinge diaphragm according to the present invention . referring to fig4 a , when the conventional disk - shaped diaphragm is used , a displacement ( d max ) is 0 . 7314e - 4 μm / pa , and referring to fig4 b , when the diaphragm in the present invention is used , a displacement ( d max ) is 0 . 01826 μm / pa . these are results obtained under the same conditions , e . g ., the thickness and material of the diaphragm , the number of the sound holes , applied voltage , etc ., which show that the diaphragm of the present invention has a vibration range ( d ) 250 times larger than the conventional diaphragm . when the conventional condenser microphone is reduced to a certain size or less ( i . e ., 1 mm or less ), its sensitivity is decreased and its performance is poor in a low frequency range . however , even when the condenser microphone including the flexure hinge diaphragm according to the present invention is manufactured to a size of 1 mm or less , it has very high sensitivity so that it may cover all audio frequency ranges . according to the above - described structure , the present invention may include a flexure hinge diaphragm having a plurality of air holes , thereby being more sensitively vibrated by external sound pressure which is input to the microphone and increasing output voltage . also , even when the diaphragm formed by the above - described manufacturing process has a small size , it may have very high sensitivity , and thus may cover all audio frequency ranges . a condenser microphone of the present invention employs a silicon wafer , so it may be integrated with a driving circuit of a cmos transistor and also applied to mobile devices such as mobile phones , pdas and pmps . while the invention has been shown and described with reference to certain exemplary embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .	7
in fig1 a pumping system is shown mounted on a sheet metal base plate 10 for installation in a cabinet ( not shown ). the pumping system includes a fitting 12 for connecting a catalystsupply ( not shown ) by means of a tube connected to the shipping container . these are usually one or two - gallon plastic bottles . catalyst is thus delivered through connector 12 and tubing 14 to a tee 16 for connecting to single - acting pumps 18 and 20 by means of tubing 22 and 24 . the single - acting pumps 18 and 20 are operated by means of a double - acting , double - ended air motor 26 driving piston rods 28 and 30 to alternately operate the pumps 18 and 20 . the output of the pumps is commonly connected by tubes 32 and 34 to a second tee 36 which delivers the catalyst under pressure to a metering valve 38 , which controls the flow of the catalyst to a flow gauge 40 . the catalyst is then delivered to the spray gun through outlet 42 . the air motor 26 is a double - acting motor whose operation is controlled by a pneumatic control valve 46 which is a reversible air - operated air return spool valve which reverses the flow of regulated air supplied through tube 48 to fittings 52 and 54 respectively at opposite ends of air motor 26 . air pilot valves 56 and 58 are operated mechanically by means of rollers 61 and 63 on plungers 60 and 62 , which engage cam surfaces 65 , 67 on couplings 64 , 66 . when activated they deliver unregulated air from a source ( not shown ) connected through fitting 68 to operate the spool of pneumatic control valve 46 . the unregulated air is simultaneously delivered through tee 70 to the air pilot valves 56 and 58 . the air motor 26 has its piston rods 28 and 30 connected by means of self - aligning couplings 64 and 66 to pump piston rods 19 and 21 . the u - shape interlocking fittings of the couplings 64 and 66 automatically compensate for any slight misalignment which might occur from the respective piston rods . self - alignment of the pumps is also assisted by securing the pumps with floating mounts . that is , the pumps are not bolted tightly to base plate 10 but are loosely secured to allow them to &# 34 ; float &# 34 ; to compensate for any misalignment of the air motor and pump piston rods . each coupling has a cam surface 65 and 67 respectively which engages a roller 61 and 63 respectively on the air pilot valve plungers 60 and 62 for reversing the spool in pneumatic control valve 46 to reverse the operation of the air motor 26 . thus , when the air motor 26 reaches the end of its stroke , the respective cam surface engages the pilot valve roller 63 , opening the pilot valve and shifting the spool valve 46 to reverse the flow of regulated air to the air motor and thus reversing its operation . as shown in fig1 the system is about to reverse to start pumping from pump 18 , while fluid is being taken into pump 20 . thus , the pumps 18 and 20 are alternately operating in a discharge / intake sequence . while pump 18 is discharging ( i . e . pumping ), pump 20 is intaking ( i . e . filling ). when air motor 26 reverses its operation , pump 20 will then be pumping while pump 18 is filling . the air pilot valves 56 and 58 are extremely fast - acting roller plunger pilot valves which operate pneumatic spool valve 46 on movement of the plunger a small amount , and are readily available in the art . the pneumatic control valve 46 is an air - operated , air - return , two - position , three - port valve . operator ports 72 and 74 receive unregulated air from pilot valves 56 , 58 to shift the spool for changing regulated air from inlet port 76 to one or the other of outlet ports 78 . thus , when cam 67 engages plunger roller 63 of plunger 62 , air pilot valve 58 opens , shifting the spool of pneumatic control valve 46 , reversing the regulated air from connector 48 to air motor 26 , thus reversing the action of the pumps 18 and 20 . each of the pumps 18 and 20 is provided with a head 80 controlling the flow into and out of the pump and a base 82 . each base 82 includes drainpipes 83 and 84 connected to a sump 85 for draining any catalyst which collects behind the pistons of the pumps . the pump details are shown more clearly in the sectional views of fig2 and 3 . in fig2 each pump head 80 has two check valves 86 and 87 for controlling the direction of flow of catalyst to and from the pumps . catalyst flows into the pump through port 88 from tube 24 connected to check valve retainer 89 . catalyst flows out of the pump through tube 34 through check valve retainer 90 . thus , when pump 20 is taking in fluid , fluid flows through tube 24 , check valve 86 , through port 88 into the pump cylinder while check valve 87 is closed . when pump 20 is pumping fluid , the fluid flows out of port 88 and is blocked by check valve 86 , causing the catalyst to flow through check valve 87 to tube 34 . the pump construction is shown in greater detail in fig3 . each pump is identical and is comprised of a cylinder 92 mounted between head 80 and base 82 , being secured by four retaining rods 94 . pump cylinders 92 typically have a maximum capacity of less than one ounce to maintain the volume of catalyst under pressure at any time at a very low level . inside the cylinder 92 is a piston 96 operated by a piston rod 21 connected to the air motor by means of coupling 66 joined to air motor rod 30 . drain 84 connected to drain port 98 provides a bleed system for any catalyst collecting behind the piston . catalyst delivered by the alternately single - acting pumps 18 and 20 is delivered to a flow metering system comprised of metering valve 38 , which is shown in greater detail in fig4 and 5 . a tube 100 of flow gauge 40 seats a socket in metering valve block 102 . because of the unique properties of catalyst , flow metering valve 38 was specially designed to assure constant flow during operation and is illustrated in detail in fig5 . the valve 38 is provided with a threaded adjustable core 104 having a straight stem 106 engaging a helical channel 108 . the channel 108 is a bore having helical grooves . in its present position , the regulator or metering valve 38 is shown closed . to increase flow , the knob 110 is rotated counterclockwise , withdrawing straight stem 106 from helical channel 108 . the further needle stem 106 is withdrawn from the helical channel 108 , the greater the flow of catalyst to the flow metering gauge 40 . the maximum outer diameter of the straight stem 106 is a close fit to the maximum inner diameter of the helical channel 108 , thus forcing the flow through the helical channel 108 only to the outer port 112 for delivery to flow gauge 40 . maximum flow would occur when stem 106 is completely withdrawn from the helical channel 108 . the flow metering valve 38 is adjusted to the predetermined flow desired as indicated by the level of the flow indicator ball 41 in the flow gauge 40 . when the catalyst pumping system is shut down for a period of time , such as overnight , air pressure in the form of trapped air bubbles may build up in the pumps or lines which deliver the catalyst to a check valve in the outlet 42 . for this reason the outlet of the flow gauge 40 is connected to a bypass valve 44 , shown in greater detail in fig6 and 7 . flow gauge tube 100 seats in block 114 of the bypass valve and flow simulator 44 . bypass valve 44 is normally closed with ball 116 seated against a seal 118 . ball 116 may be momentarily displaced from the seal 118 by operation of plunger 120 to release trapped air bubbles or act as a flow simulator . this is accomplished by pushing on knob 122 , bypassing air or pressure in the system to fitting 124 , connected by means of tube 126 back to the catalyst supply . thus , the bypass valve 44 primes the system by removing any air bubbles collected or excess pressure readying the system for an instantaneous supply of catalyst to the hose connector or outlet 42 . thus , the bypass valve also acts as a flow simulator to preset the metered flow . the operation of the system is illustrated in the schematic diagram of fig8 . the catalyst supply 128 is connected to pumps 18 and 20 by means of delivery tubes 22 and 24 . once connected , air is supplied to air pilot valves 56 and 58 and pneumatic control valve 46 . the schematic shows air pilot valve 58 being operated by means of coupling 66 engaging plunger 62 . at this point , valve 58 will open , supplying air to shift pneumatic control valve 46 . the flow of air to air motor 26 will be reversed , causing the double - acting motor to start pump 18 into its discharge or pumping mode , while pump 20 will begin its intake mode . at this time fluid is being pumped from pump 18 to metering valve 38 . simultaneously , catalyst from catalyst supply 128 is flowing through tube 24 to fill the cylinder of pump 20 . at the end of the air motor stroke , the cam 65 on coupling 64 will engage the roller 61 on plunger 60 of pilot valve 56 , which shifts the pneumatic control valve 46 , thus reversing the supply of regulated air to double - acting motor 26 . pump 20 will now begin its discharge or pumping mode while pump 18 will begin its intake mode . catalyst will now be pumped from pump 20 to metering valve 38 , while catalyst from catalyst supply 128 will flow through tube 22 to the cylinder of pump 18 . the rate of flow to outlet check valve in outlet 42 will be controlled by adjustment of metering valve 38 as indicated by the flow ball 41 of flow gauge 40 . as can be seen by the schematic diagram bypass valve 44 permits purging of air bubbles or pressure in the system by bypassing catalyst back to the catalyst supply 128 . the rapid operation of the pneumatic control system comprised of the control valve 46 and pilot valves 56 and 58 along with the damping provided by metering valve 38 , eliminates any surges and assures constant flow . reversal of operation of the air motor 26 is accomplished quickly and smoothly without hesitation . the smooth operation is enhanced by the use of self - aligning couplings 64 and 66 in conjunction with the floating mounts for the pumps 18 and 20 . the pumping system operates on a demand basis . that is , when outlet check valve in outlet 42 is connected to a spray gun or other device , it is turned on and catalyst flows through the flow gauge , allowing the double - acting air motor which is under constant pressure from the regulated air , to begin operating whichever pump is in the pumping mode , causing catalyst to flow instantaneously to the spray gun . when the trigger of the spray gun is released , a static pressure head is created against the piston in either of the pumps , causing the pumps to stop . operation of the trigger of the spray gun releases the static pressure head , allowing the constant regulated air pressure on the double - acting air motor to begin the alternating pumping cycle again . as was stated previously , less than one ounce of unstable catalyst is being delivered by the pumps at any one time , thus considerably reducing the danger of any major or serious fire or explosions . thus , there has been described a novel pumping and delivery system for unstable fluids in which constant pressure , constant volume supply of catalyst may be provided with minimum danger of accidents , contamination or fire . the catalyst is supplied at a predetermined metered flow rate necessary for correct mixture with other components with a mimimum volume under pressure at any time to minimize the danger of explosion or fire . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that the full scope of the invention is not limited to the above description but may be practiced other than in the mode contemplated above .	1
fig1 and 2 illustrate one embodiment of a binding system 1 as proposed by the invention , between a sports device 2 in the form of a sliding or rolling member 3 , such as a ski 4 or a roller - skate for example , and a tread surface 5 for a user &# 39 ; s foot . the tread surface 5 for the user &# 39 ; s foot is preferably a shoe sole 6 of a sport shoe 7 . alternatively , the tread surface 5 for the user &# 39 ; s foot may also be a separate , contoured , largely non - deformable bearing element , designed to support or releasably receive the sport shoe 7 . the binding system i can be used with a whole variety of sports devices 2 . in particular , the binding system i is suitable for joining appropriate sport shoes 7 to skis for cross - country skiing or touring sports . similarly , the binding system 1 may be used with ice skating boots and / or with single or multi - track roller - skates . this being the case , the term sports device 2 should be read as meaning a skating blade or single - or multi - track rollers or a retaining frame for rollers . sports devices of this type are also known as folding ice skates or folding roller skates . the binding system has at least one binding element 11 in the form of lever 67 between the tread surface 5 for the user &# 39 ; s foot and the sports device 2 , which is the only element binding sport shoe to the sports device . the lever 67 is hinge - mounted on an end 18 of a body 22 affixed to sports device 2 , on which a forward end of sports shoe 7 rolls . in the end 17 spaced at a distance therefrom in the longitudinal region — double arrow 9 — the lever 67 is joined to a rolling element 69 in shoe sole 6 via hinge mechanism 45 , i . e . it is hinge - mounted on the shoe sole 6 . the rolling element 69 forming one link 70 of the hinge mechanism 45 can be releasably or non - releasably secured to the underside of the shoe sole 6 or alternatively may be integrated in the shoe sole 6 , i . e . embedded therein . the hinge mechanism 45 forms the pivot axis 46 extending perpendicular to the vertical plane 8 between the front end region 17 of the lever 67 and the rolling element 69 or shoe sole 6 . the hinge mechanism 68 in the other end region 18 of the lever 67 between the latter and the body 22 forms a pivot axis 71 extending perpendicular to the vertical plane 8 . the lever 67 is mounted in a recess 72 of the body 22 . the recess 72 is provided in the front end 36 of the body 22 relative to the direction of travel — arrow 19 — and houses the major part of the lever 67 . the recess 72 forms a guide for the lever 67 . the recess 72 also has a stop element 73 , which restricts the pivoting movement of the lever 67 about the pivot axis 71 . in particular , the stop element 73 prevents the shoe sole 6 and rolling element 69 from . lifting off the body 22 by restricting the pivoting range of the lever 67 about the pivot axis 71 in the direction away from the sports device 2 . in order to restrict the pivoting movement of the lever 67 about the pivot axis 71 in : the direction towards the sports device 2 , the recess 72 may be designed to provide another stop element 74 . clearly , the other stop element 74 could be configured in such a way that the lever 67 moves into abutment directly on the top face of the sports device 2 . the lever 67 is designed so that the pivot axis 46 between the lever 67 and the shoe sole 6 is disposed at a higher lever than the stationary pivot axis between the lever 67 and the body 22 when in the rest or initial position illustrated in full lines in fig1 and 2 . as a result , when the sport shoe 7 pivots relative to the sports device 2 about the pivot axis 71 , the shoe sole 6 is displaced in the direction in which the sports device 2 is moving or travelling — arrow 9 ( see phantom lines in fig1 ). this causes a lengthening of the stride . this effect is produced due to the fact that the pivot axis 46 moves on a circular course 75 about the stationary pivot axis 71 and because the pivot axis 46 between the sport shoe 7 and the lever 67 is disposed at a higher level than the pivot axis 71 . in particular , in the initial or rest position illustrated in full lines in fig1 and 2 , the pivot axis 46 islocated in the top half of the circular course 75 around the pivot axis 71 and , when the heel of the sport shoe 7 is , lifted off the sports device 2 , moves on the circular course 75 in the direction towards the top face 15 and simultaneously in the longitudinal direction of direction of forward movement arrow 9 . plane 8 , the lever 67 has curvature whose center lies above the top face 15 of the sports device 2 . moreover , the lever 67 extends between the body 22 and the shoe sole 6 substantially parallel with the tread surface 5 . specifically , when the binding system 1 is in the initial or rest position , as illustrated , a line joining the pivot axes 71 and 46 subtends an acute angle with a . horizontally extending plane , in particular an angle of approximately 2 ° and 30 °. at least one of the hinge mechanisms 45 , 68 , but preferably both include an energy storage device 76 , 77 , i . e . coil springs 78 , 79 . these energy storage devices 76 , 77 force the tread surface 5 of shoe sole 6 into the initial or rest position in which they extend parallel with the top face 15 of the sports device 2 and apply a defined resistance , which can be overcome , against an upward pivoting movement of the heel of sport shoe 7 relative to the sports device 2 . when the sportshoe 7 is pivoted relative to the sports device 2 , the rolling element 69 of the shoe sole 6 slides along the rolling track 27 of the body 22 in the direction towards the sports device 2 in circular course 75 , and moves the former back away from the sports device 2 when the heel of the sport shoe 7 is placed on the guide member 43 or the top face 15 of the sports device 2 . the guide member 43 and the body 22 are preferably made as a single component , a gap 80 to the shoe sole 6 being left free between the aforementioned components . by preference , the rolling element 69 also has side plates 58 , 59 to form a lateral guide device 30 between the rolling element 69 and the body 22 . the shoe sole 6 of the sport shoe 7 may be of a more bend - resistant design than conventional cross - country sport shoes 7 since the rolling movement can be produced by the binding system 1 proposed by the invention . by making the shoe sole 6 or the entire sport shoe 7 more bend - resistant , a more effective repulsive force from the ground underneath the sports device 2 can be achieved . in addition , the sport shoe 7 is better guided relative to the sports device 2 and the forces applied by the user more efficiently converted into energy to generate forward propulsion with the sports device 2 . due to the combined rotary and translatory coupling between the sport shoe 7 and the sports device 7 afforded by the binding system 1 , performance can be enhanced without detriment to comfort . reference numbers	0
as is shown in fig1 and fig2 , the automatically cooling iron comprises a housing 1 , an electric heating plate 2 , fan 3 and a circuit board 4 . a housing handle 11 with shell structure is disposed on the top of the housing 1 , the circuit board 4 is disposed in the concave in the upper portion of the handle 11 ; the handle cover 12 is mounted on the top of the handle 11 to cover the inside of the handle . the rear portion of the housing 1 is disposed with a rear cover 13 which is provided with an air inlet 131 . the housing 1 , handle cover 12 and the rear cover 13 are all made by plastic and have good appearance and well heating insulation . the electric heating plate 2 is made by aluminum alloy and is provided with a pre - embedded electric heating tube 24 . the top of the electric heating plate 2 is riveted with a electric heating plate cover 20 to close the electric heating plate 2 . a metal shell 21 for decoration is disposed on the upper of the electric heating plate cover 20 . the metal shell 21 is a box with a downward opening , the rear portion of the top surface of the metal shell 21 is provided with a window 211 , an interstice 25 for air flow is disposed between the side of the metal 21 and the electric heating plate 2 . an insulation board 22 made by heat insulation material is disposed on the upper of the metal shell 21 . the rear portion of the insulation board is provided with a window 221 . the upper surface of the insulation board 22 is disposed with a supporting board 23 , and the rear portion of the supporting board 23 is provided with an inclined tube 231 . the fan 3 is mounted inside the housing 1 and is located in the opening of the tube 231 in the rear portion of the supporting board 23 and is towards to the air inlet 131 of the rear cover 13 . the circuit board 4 is provided with an automatic circuit 41 and a ball switch 42 . referring to fig3 : the automatic switch circuit 41 comprises a microprocessor 411 , an alternating current power 412 , a heating switch 413 and a fan switch 414 . the control input terminals of the microprocessor 411 are respectively connected to the first detecting output terminal 421 and a common terminal 424 . the first control output terminal of the microprocessor 411 is connected to the control input terminal of the heating switch 413 and the second control output terminal of the microprocessor 411 is connected to the control input terminal of the fan switch 414 . the alternating power 412 provides alternating power to the heating switch 413 and the fan switch 414 . the output terminal of the heating switch 413 is connected to the heating tube 24 of the electric heating plate 2 . the output terminal of the fan switch 414 is connected to fan 3 . referring to fig4 , the opening end of the front shell 4201 is clamp to the opening end of the rear shell 4202 of the ball switch 42 , thus an arc guiding chamber 426 is formed between them . a concave contacting piece is embedded in the concaved portion of the front shell 4201 ( i . e . the front surface of the guiding chamber 426 ), correspondingly , a concave contacting piece 424 ′ with same size is embedded in the concaved portion of the rear shell 4202 ( i . e . the rear surface of the guiding chamber 426 ). referring to fig5 , the contacting piece of the front shell 4201 is separated into two portions along an direction oblique to the vertical axis by a separating groove 422 , the first portion 421 ′ is connected to a first detecting output terminal 421 which is extending outwardly ; the second portion 423 ′ is connected to a second detecting output terminal 423 which is extending outwardly ; an electric ball 425 is disposed in the guiding chamber 426 . the distance between the concave portions 4211 / 4231 of the contacting piece of the front shell 4201 of the guiding chamber 426 and the bottom of the concave portion 4241 of the contacting piece 424 ′ of the rear shell 4202 is bigger than the diameter of the electric ball 425 . when the ball switch 42 is in statically and vertically standing status , the electric ball 425 is connected to the first portion 421 ′ of the contacting piece of the front shell 4201 and the contacting piece 424 ′ of the rear shell 4202 , thus the first detecting output terminal 421 is connected to the common terminal 424 . while when the ball switch 42 is in moving vertical standing status , the electric ball 425 is jumped slightly between the first portion 421 of the contacting piece of the front shell 4201 and the contacting piece 424 ′ of the rear shell 4202 , so that the first detecting output terminal 421 is connected and unconnected alternatingly to the common terminal 424 . referring to fig6 , when ball switch 42 is in statically horizontally - placing status , the electric ball 425 is depart from the first portion 421 ′ of the contacting piece of the front shell 4201 but remains contacting with the contacting piece 424 ′ of the rear shell 4202 , thus the first detecting output terminal 421 is un - connected to the common terminal 424 . while when the ball switch 42 is in moving horizontally - placing status , the electric ball 425 is jumped slightly between the first portion 421 of the contacting piece of the front shell 4201 and the contacting piece 424 ′ of the rear shell 4202 , thus the first detecting output terminal 421 is connected and unconnected alternatingly to the common terminal 424 . so the ball switch 42 can provide three status information : statically and horizontally placing , statically and vertical standing , and moving . in normal ironing , when the iron is horizontally placed and statically . i . e . the ball switch 42 is in statically and horizontally placing status , the first detecting output terminal 421 and the common terminal 424 of the ball switch 42 are in connected status . the microprocessor 411 will startup the horizontally placing time when receive the statically and horizontally placing information from the ball switch . in this period , if the ball switch 411 receive the alternatingly connected and unconnected motion status information from the ball switch 42 , then the calculation of the horizontally placing time is stopped . if the horizontally placing time is calculated to 30 seconds , then the microprocessor 411 controls the heating switch 413 to cut off the power of the electric heating plate 2 and controls the fan switch 414 to connect to the power of the fan 3 . when the fan begin to work , the cooling air of the outside is input into the housing 1 through the air inlet 131 of the rear cover 13 , then the air passes though the tube 231 of the rear portion of the supporting board 23 , the window 221 of the rear portion and the window 211 of the rear portion of the shell 21 , then the cooling air blows to the electric heating plate cover 20 of the electric heating plate 2 , and bring out the heat of the electric heating plate 2 , the hot air is then blow out from the interstice 25 between the side of the shell 21 so that the electric heating plate 2 is to be cooled . the microprocessor 411 then startup the calculation of the working time of the fan , when the working time is calculated to 15 minutes , the electric heating plate 2 is fully cooled ; then the microprocessor 411 controls the fan switch 414 to cut off the power of the fan 3 , and the fan 3 will be automatically stopped . then the power cord can be removed from the power and the iron can be stored . when the iron is in statically and vertically standing status . i . e . the ball switch 42 is in statically and vertically standing status , the first detecting output terminal 421 and the common terminal 424 of the ball switch 42 are in unconnected status . after the microprocessor 411 received the vertical standing information from the ball switch 42 , then the vertical standing time calculation is startup ; in this period , if the microprocessor 411 receive the alternatingly connected and unconnected motion status information from the ball switch 42 , then stop the calculation of the vertical standing time . when the vertical standing time is calculated to 3 minutes , then the microprocessor 411 controls the heating switch 413 to cut off the power of the electric heating tube 24 of the electric heating plate 2 and control the fan switch 414 to be connected to the power of the fan 3 . after the fan 3 being working , the cooling air of the outside is input into the shell 1 through the air inlet 131 of the rear cover 13 , and then pass through the tube 231 of the rear portion of the supporting board 23 , the window 221 of the rear portion of the insulation board 22 and the window 211 of the rear portion of the shell 1 , blows to the electric heating plate cover 20 of the electric heating plate 2 so as to bring out the heat of the electric heating plate 2 , and the hot air is then blow out from the interstice 25 between the side of the shell 21 and the electric heating plate 1 , thus the electric heating plate 2 is rapidly cooled . the microprocessor 411 then startup the calculation of the working time of the fan , when the working time is calculated to 15 minutes , the electric heating plate 2 is fully cooled ; the microprocessor 411 will control the fan switch 414 to cut off the power of the fan 3 , thus the fan 3 will be automatically stopped . then the power cord can be removed from the power and the iron can be stored . certainly , in the automatic switch circuit 41 , the control input terminals of the microprocessor can also respectively connected to the second detecting output terminal 4231 and the common terminal 424 , this also can achieve the control as described aforementioned , but this needs to change the mounting location of the ball switch 42 . if the ball switch 42 is not used as a motion status detector , it also can use motion detector , horizontally placing detector , vertical standing detector to respectively provide the detecting information to the control input terminal of the microprocessor 411 , but this will make the hardware system to be complex . it will be apparent to those skilled in the art that various modifications and variations can be made in a water saving mechanism for a shower device of the present invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	3
fig1 schematically illustrates a lsi logic circuit such as a gate array to which the present invention may be applied . circuits which are surrounded with the two - dot chain line 10 are implemented in a single semiconductor chip such as a single crystal silicon substrate , although not necessarily limited thereto . the diagnosis of a lsi logic circuit is efficiently carried out by dividing it into a plurality of relatively small - sized combinational circuits and diagnosing each combinational circuit . in this embodiment , therefore , flip - flops 1 , 2 are connected to the data input side of a combinational circuit 7 , and flip - flops 3 , 4 are connected to the data output side thereof . the flip - flops 3 , 4 are connected to the data input side of a combinational circuit 8 , and flip - flops 5 , 6 are connected to the data output side thereof . the term &# 34 ; combinational circuit &# 34 ; is used in the conventional manner to refer to any logic circuit in which the output signal is determined by the input signal . examples of such logic circuits include an and circuit , or circuit , not circuit , nand circuit , nor circuit , xor circuit and circuits obtained by combining these logic circuits ( e . g ., a half - adder , full adder , sign converter , encoder , decoder , etc . ), together with wirings ( on which input and output signals are the same ). the above - described flip - flops ( denoted by the reference numerals 1 to 6 ) are , for example , configured as shown in fig2 . referring to fig2 each of the flip - flops illustrated in fig1 is a master - slave flip - flop consisting of a master latch 11 and a slave latch 12 . in the master latch 11 , when an operation control signal scan is at a low level ( the normal mode ), switches s1 , s2 are operated in such a manner that normal mode data d and a normal mode clock signal ck are validated , respectively . although not necessarily limited thereto , in this normal mode , the normal mode data d is supplied and , when the normal mode clock signal ck is raised to a high level , the data is latched by the master latch circuit 11 . when a test mode clock signals sck 2 is at a low level , the data latched by the master latch 11 is held therein , whereas , when the test mode clock signals sck 2 is raised to a high level , the latched data is outputted to the corresponding combinational circuit through an output terminal q 2 of the slave latch 12 . when the operation control signal scan is at a high level ( the test mode ), the switches s1 and s2 are operated in such a manner that test mode data sd and a test mode clock signal sck 1 are validated , respectively . although not necessarily limited thereto , in this test mode , when the test mode data sd is supplied and the test mode clock signal sck 1 is raised to a high level , test data used to test the combinational circuit is latched by the master latch 11 . when , the test mode clock signal sck 2 is at the low level , the data latched by the master latch 11 is held therein , whereas , when the test mode clock signal sck 2 is raised to the high level , the latched test data is outputted through the output terminal q 2 of the slave latch 12 in a manner similar to that in the case of the above - described normal mode . in the test mode , the test mode clock signals sck 1 and sck 2 are alternately raised to the high level , and desired testing data is thereby input to all the master - slave flip - flops each of which is provided at the data input side of the corresponding combinational circuit block and which consists of series - connected master and slave latches . a method of diagnosing a lsi logic circuit is described as follows . referring to fig1 test data for testing the combinational circuit 7 is set in the flip - flops 1 and 2 . more specifically , the operation control signal scan supplied to the flip - flops 1 and 2 is raised to the high level , and the switches sw1 to sw6 are controlled so that the test mode data sd is input to each flip - flop . then , the test mode clock signals sck 1 and sck 2 are alternately raised to the high level , and the test data sd for testing the combination circuit 7 and 8 are thus successively set in the flip - flops 1 , 2 , 3 and 4 . the test pattern set in each of the flip - flops 1 , 2 , 3 and 4 is supplied to the combinational circuit 7 or 8 through the associated slave latch . then , the operation control signal scan is shifted to the low level to control the switches sw1 and sw6 so that the normal mode data d is input to each flip - flop . thereafter , the test mode clock signals sck 1 and sck 2 are shifted to the low level , and the operation mode is thus changed to the normal mode . in the normal mode , the normal mode data clock signals ck ( not shown ) supplied to the flip - flops 3 and 4 is raised to the high level , and data which is delivered from the combinational circuits 7 and 8 is thereby latched by the flip - flops 3 , 4 and 5 , 6 , respectively . then , the operation control low level signal scan is raised to the high level again and the test mode clock signals sck 1 and sck 2 are alternately raised to the high level , and the data latched by the flip - flops 3 , 4 and 5 , 6 is thus read out . in this way , diagnosis of the combinational circuit blocks 7 and 8 is accomplished . it should be noted that it is also possible to diagnose the combinational circuits 7 and 8 separately from each other . in the above - described embodiment , a lsi logic circuit is divided into a plurality of combinational circuits , and a master - slave flip - flop which consists of series - connected master and slave latches is connected to each of the data input and output sides of each combinational circuit . further , the master latch which constitutes each of the master - slave flip - flops is provided with an operation control signal ( scan ) input terminal for setting either the normal operation mode or the test mode for testing the combinational circuit in accordance with the level of the signal supplied thereto . accordingly , once the test mode is set , the normal mode clock signal is invalidated , and there is therefor no chance of any undesirable data being input to the flip - flops . thus , it is possible to eliminate the restriction on the logic design that it is necessary to hold the normal mode clock signal at the low level at all times during the test mode in order to prevent any undesirable data from being input to the flip - flops . further , in the above - described embodiment , data which is output from each flip - flop to the corresponding combinational circuit is delivered from the slave latch which constitutes the flip - flop , and the latches which are respectively provided at the data input and output sides of one combinational circuit are controlled by means of clocks having different timings . accordingly , there is no chance of in - phase transfer occurring during a diagnosis , advantageously . although the invention has been described in terms of the foregoing embodiment , it should be clearly understood that the invention is not limited to the above - described embodiment and various changes and modifications may , of course , be made without departing from the gist of the invention . for example , although in the above - described embodiment a lsi logic circuit is divided into two combinational circuits and a diagnosis is carried out for each of the combinational circuits , a lsi logic circuit may be divided into any appropriate number of combinational circuits according to the size of the lsi circuit . fig3 shows one implementation of the switch means s1 , s2 and master - slave flip - flop shown in fig2 . master latch ml comprises an inverter n1 supplied with the normal mode data d , an inverter n6 supplied with the test mode data sd , an nand gate a 1 supplied with the operation control signal scan and the normal mode clock signal ck , inverters n2 and n3 series - connected so as to constitute a latch , and p - channel type mosfets q1 , q3 , q5 , q7 and n - channel type mosfets q2 , q4 , q6 , q8 , etc . mosfet pairs ( q3 , q4 ) and ( q7 , q8 ) are connected in series between the input side of the inverter n2 and the output side of the inverter n3 . the output signal from the inverter n1 is supplied to the inverter n2 through a mosfet pair ( q1 , q2 ). the output signal from the inverter n6 is supplied to the inverter n2 through a series connection of the mosfet pair ( q5 , q6 ) and the mosfet pair ( q3 , q4 ). the switching operations of the mosfet pairs ( q1 , q2 ) and ( q3 , q4 ) are controlled by means of the nand gate a1 and an inverter n4 which inverts the output signal from the and gate a1 . the switching operations of the mosfet pairs ( q5 , q6 ) and ( q7 , q8 ) are controlled by means of the test mode clock signal sck 1 and the output signal from an inverter n5 which inverts the signal sck 1 . the slave latch sl comprises inverters n8 and n9 which are series connected so as to constitute a latch , mosfet pairs ( q11 , q12 ), ( q9 , q10 ). the output signal from the inverter n9 is fed back to the input side of the inverter n8 through the mosfet pair ( q11 , q12 ). the output signal q m form the master latch is supplied to the inverter n8 through the mosfet pair ( q9 , q10 ). the switching operations of the mosfet pairs ( q9 , q10 ) and ( q11 , q12 ) are controlled by means of the test mode clock signal sck 2 and the output signal from an inverter n7 which inverts the signal sck 2 . the function tables of the master latch ml and the slave latch sl are respectively shown in tables 1 and 2 below . table 1__________________________________________________________________________function table of the master latch ( ml ) inputs output__________________________________________________________________________ ck d scan sck . sub . 1 sd q . sub . m l x h l x q . sub . monormal h h h l x hmode h l h l x l x x l l x q . sub . moscan x x l h h hmode x x l h l l__________________________________________________________________________ table 2______________________________________function table of the slave latch ( sl ) input output______________________________________ sck . sub . 2 q l q . sub . o h q . sub . m______________________________________ in these tables , &# 34 ; h &# 34 ; represents a high level , &# 34 ; l &# 34 ; a low level , and &# 34 ; x &# 34 ; a state wherein the output is not affected by the level (&# 34 ; don &# 39 ; t care &# 34 ;). &# 34 ; q mo &# 34 ; represents the output signal from the master latch in its previous state , while &# 34 ; q o &# 34 ; represents the output signal from the slave latch in its previous state . as will be clear from table 1 , in scan mode , the normal mode clock signal ck and the normal mode data d are in the &# 34 ; don &# 39 ; t care &# 34 ; state . accordingly , in test mode such as scan mode , the normal mode clock signal and the like can be invalidated . as a result , it is possible to prevent any undesirable data from being input to the flip - flop in test mode . further , the test mode data sd can be invalidated in the normal mode . as a result , it is possible to prevent any undesirable data from being input to the flip - flop in the normal mode . fig4 shows an example of an arrangement in which test mode data is scanned in and out by using a plurality of flip - flops shown in fig3 . a plurality of flip - flops ff1 , ff2 , . . . , ffn are fabricated on a single semiconductor chip together with combinational circuits ( not shown ). this semiconductor chip is provided with external terminals including an input terminal t 1 for the test input data sid , an input terminal t 2 for a mode select signal m , an input terminal t 3 for the clock signal sc 1 , an input terminal t 4 for the slave latch clock signal sck 2 , and an output terminal t 5 for test output data sod . a built - in logic circuit lc produces the operation control signal scan and the test mode clock signal sck 1 on the basis of the mode select signal m and the clock signal sc 1 . these signals are supplied to the master latches ml1 to mln in the flip - flops ff1 to ffn . the slave latch clock signal sck 2 is supplied to the slave latches sl1 to sln . fig5 is a waveform chart showing the operation of each of the circuit blocks shown in fig4 . the operation control signal scan is raised to the high level only when both the mode select signal m and the clock signal sc 1 are at the high level ( scan = m · sc1 ). the test mode clock signal sck 1 is raised to the high level only when the mode select signal m is at the low level and the clock signal sc 1 is at the high level ( sck 1 = m · sc 1 ). in the scan - in state , the test input data sid is serially inputted to the flip - flop ff1 and transferred by being successively shifted to the subsequent flip - flops . in the normal state , the mode select signal m is raised to the high level , and reception of any test input data is thereby inhibited . further , in the normal state , the test input data held in each flip - flop is supplied to the corresponding combinational circuit ( not shown ). the resultant output signal from the combinational circuit is supplied to the associated flip - flop as normal mode data d and latched by the flip - flop in synchronism with the normal mode clock signal ck . in the scan - out state , the output signals from the combinational circuits which are held in the associated flip - flops are successively shifted to the subsequent flip - flops and thereby transferred . as a result , test output data sod is serially delivered from the final flip - flop . although the invention has been described as an embodiment in which the present invention is applied to a circuit gate array , it should be clearly understood that the present invention is not limited thereto and may generally be applied to lsi logic circuits .	6
infant warmers are typically located in a neonatal unit of a hospital , and the neonatal unit typically has ceiling lights . further , an infant warmer may have a light that is used when medical personnel examine a baby . lights such as these shine into the eyes of the baby in the infant warmer and is believed to be an undesirable stimulus for the baby . with reference to fig1 an infant heater 10 is illustrated according to the present invention . infant heater 10 has a bed assembly a , a bed support b that holds and supports bed assembly a , and a support structure c , which holds a heat source h . a light shield 20 rests on bed assembly a , and light shield 20 can be adapted to reduce the amount of light that enters the eyes of a baby positioned below the light shield , thus protecting the baby from an undesirable stimulation . bed assembly a includes a bed 22 , which has a head end 22 a and a foot end 22 b . light shield 20 rests on or in bed 22 at head end 22 a . bed 22 has an upper surface 22 c , and a newborn infant , such as a baby born prematurely and having a low birth weight , would be placed on upper surface 22 a . the infant &# 39 ; s head would be placed towards head end 22 a , and the infant &# 39 ; s feet would be placed towards foot end 22 b . bed assembly a includes side panels 24 a , 24 b , 24 c and 24 d . side panels 24 ( suffixes omitted for simplicity ) help to hold heat within bed assembly a so that an infant resting on bed 22 will stay warmer . the infant is typically approximately centered between side panels 24 a and 24 c . light shield 20 is adapted to cover the head of the infant . in one embodiment , light shield 20 is made of a transparent plastic material such as an acrylic material . in this embodiment , an opaque blanket can be placed over light shield 20 to block a substantial portion of light from entering directly into the infant &# 39 ; s eyes . infant heater 10 has a light 28 held by support structure c . light 28 is generally left off , but turned on by a medical person using a switch 30 a in a control panel 30 . the medical person may activate light 28 by moving switch 30 a when examining the infant . the light from light 28 is believed to be an uncomfortable stimulation for the infant , so light shield 20 is preferably used when light 28 is on . light shield 20 may be used at any time , such as when ceiling lights are on , which light would travel into the eyes of the infant in infant heater 10 , except when light shield 20 is used to block the light . light shield 20 can have various configurations and can be made of various materials . light shield 20 is illustrated in fig1 as having opposing vertical sides 20 a and 20 b , each of which has a lower surface for contacting bed assembly a and holding light shield 20 in a stable position . extending from vertical members 20 a and 20 b , light shield 20 has angled members 20 c and 20 d that angle inwardly towards each other and above vertical members 20 a and 20 b . light shield 20 has an upper planar member 20 e , which is typically in an approximately horizontal plane while in use . angled members 20 c and 20 d join with and support planar member 20 e , holding planar member 20 e above upper surface 22 c of bed 22 . planar member 20 e has an inside upper surface 20 f that is sufficiently spaced from upper surface 22 c of bed 22 to accommodate the infant &# 39 ; s head . for example , vertical members 20 a and 20 b may extend upwardly a distance equivalent to the diameter of the infant &# 39 ; s head , or up to about two or three times that diameter , and angled members 20 c and 20 d may extend upwardly and inwardly so as to hold planar member 20 e at a distance spaced from the infant &# 39 ; s eyes . light shield 20 may be opaque and may be made of a metal or opaque plastic material , or it may be made of wood . in one embodiment , light shield 20 is made of a substantially transparent material , such as an acrylic material , and light shield 20 is covered by an opaque material , such as a baby blanket . any suitable opaque material can be used to cover light shield 20 so as to make it substantially impervious to light rays . light shield 20 can also be made of a thermally insulating material so as to help keep the infant warm by partially preventing heat loss from the infant &# 39 ; s head . in another embodiment , the light shield can be a frame for holding an opaque material , such as a blanket , and the frame may have no solid planar members . such a frame can be made of wire . bed 22 has a length between head end 22 a and foot end 22 b . light shield 20 is located toward head end 22 a and extends toward foot end 22 b . light shield 20 preferably covers enough of bed 22 so as to substantially block light from directly entering the infant &# 39 ; s eyes . at the same time , it is believed that a portion of upper surface 22 c should not be covered so as to provide access to the infant by medical personnel and / or to allow heat from heat source h to pass directly to the infant or upper surface 22 c of bed 22 . in one embodiment light shield 20 covers up to about 60 percent of the length of bed 22 . in other embodiments , light shield 20 covers between 10 and 50 percent of the length of bed 22 , 20 to 40 percent of the length of bed 22 , 15 to 35 percent of the length of bed assembly 22 , or about 25 percent of the length of bed 22 . with continued reference to fig1 bed support b of infant heater 10 includes a frame 40 , which has rails 40 a and 40 b connected together by a cross member 40 c . wheels or casters 42 are attached to frame 40 , which allow infant heater 10 to be rolled easily on a floor . a support column 44 extends upwardly from cross member 40 c of frame 40 . support structure c is secured to support column 44 . in the embodiment illustrated in fig1 support structure c extends upwardly from support column 44 , and bed assembly a is secured to support structure c , but other arrangements can be used . a cabinet 48 , which has drawers 50 a , 50 b and 50 c , is attached to support column 44 . bed assembly a has bed support arms 22 d and 22 e , which are secured to and extend from support structure c . temperature is regulated in bed assembly a for the infant using a temperature sensor ( not shown ) and a thermostatic control 30 b in control panel 30 . further details for making and using an infant heater are provided in the prior art , such as by u . s . pat . no . 5 , 474 , 517 , issued to falk et al ., and u . s . pat . no . 5 , 980 , 449 , issued to benson et al ., both of which are hereby incorporated by reference in their entirety for all purposes . turning to fig2 a light shield 60 is illustrated according to the present invention . light shield 60 is illustrative of one of many embodiments of a light shield according to the present invention . light shield 60 has vertical support members 62 and 64 and a semi - circular structure 66 joined with vertical support members 62 and 64 . a semi - circular member can be used without straight or vertical members . semi - circular structure 66 has an inside surface 66 a , which should be adequately spaced from an infant &# 39 ; s head that is covered by the light shield . for example , the light shield should be adequately spaced to allow the infant to breathe properly . a light shield according to the present invention can be made by heating and bending a sheet of plastic of a desired size to provide a lower surface that can rest on or in a bed assembly of an infant warmer or can be attached to the bed assembly of an infant warmer . the sheet of material is preferably substantially ductile and malleable . one can start with a rectangular sheet of material , possibly having a thickness ranging between about one - eighth of an inch to about one - half of an inch . the sheet of material can be bent and / or rolled so that it has an upper inside surface when placed in an orientation illustrated in fig1 or 2 . with the sheet bent or rolled so as to have at least two lower contact surfaces capable of resting on a planar surface , an inside upper surface of the light shield should be between about five and about thirty inches above the planar surface , preferably between about ten and about twenty inches above the planar surface . the size and shape of the light shield should be adapted to accomplish the purposes outlined herein . a light shield according to the present invention can be placed on or off of a bed assembly , depending on whether its use is desired at a particular time . alternatively , the light shield can be secured to the bed assembly or to a different portion of the infant heater so as to block light from entering an infant s eyes or to support an opaque material that substantially blocks light from entering an infant &# 39 ; s eyes . the infant heater and the light shield of the present invention operate to reduce undesired light stimulation to the eyes of an infant , particularly a premature baby having a very low birth weight and susceptible to distress caused by light entering the eyes . it is believed that the present invention provides a healthier and more soothing environment for a newborn baby that requires hospital care . while the present invention has been shown and described in its preferred embodiment and in certain specific alternative embodiments , those skilled in the art will recognize from the foregoing discussion that various changes , modifications and variations may be made thereto without departing from the spirit and scope of the invention as set forth in the claims . hence , the specific embodiments and any specific components and the like are merely illustrative and do not limit the scope of the invention or the claims herein .	0
a method of manufacturing a rigid - flexible printed circuit board according to an embodiment will now be described in detail below with reference to the drawings . ( 1 ) providing a flexible substrate , the flexible substrate including a main portion and a peripheral margin portion , the main portion including a first laminating section and an exposed section ; ( 2 ) defining at least one slit in the flexible substrate along at least one first imaginary boundary line between the exposed section and the peripheral margin portion ; ( 3 ) providing a rigid substrate , the rigid substrate comprising a main portion and a peripheral margin portion , the main portion including a second laminating section having a similar shape to the first laminating section and an unwanted section having a similar shape to the exposed section ; ( 4 ) laminating the flexible substrate to the rigid substrate to obtain a laminated substrate in such a matter that the first and second laminating sections are coincide with each other , and the exposed section is coincide with the unwanted section ; ( 5 ) removing the unwanted section ; and ( 6 ) cutting the laminated substrate along an imaginary boundary line between the second laminating section and the peripheral margin portion to remove the peripheral margin portions of the flexible substrate and the rigid substrate . referring to fig1 , in step ( 1 ), a flexible substrate 10 is provided . the flexible substrate 10 is a double - sided flexible copper clad laminate ( double - sided fccl ), and includes a first electrically conductive layer 101 , a second electrically conductive layer 102 , and an insulating layer 103 positioned between the first and second electrically conductive layers 101 , 102 . the flexible substrate 10 defines a main portion 11 and a peripheral margin portion 12 . in the present embodiment , the main portion 11 includes two first laminating sections 111 and an exposed section 112 connected between the two first laminating sections 111 . the first laminating sections 111 and the exposed section 112 are all rectangular shaped . in the illustrated embodiment , a width b 2 of the exposed section 112 is less than a width b 1 of each of the first laminating sections 111 . the first laminating sections 111 and the exposed section 112 each have electrically conductive patterns ( not shown ) formed therein , which are formed in the first and second electrically conductive layers 101 , 102 . the first laminating sections 111 and the exposed section 112 cooperatively constitute a printed circuit board . the peripheral margin portion 12 around the main portion 11 is configured for supporting the main portion 11 and will be removed in a later step , so no electrically conductive pattern formed in the peripheral margin portion 12 is needed . it is noted that the flexible substrate 10 also can be a single - sided board or a multilayer board . it is also noted that the number of the first laminating sections 111 of the flexible substrate 10 is not limit to be two , less or more may be defined therein according to practical need . referring to fig1 and fig2 , in step ( 2 ), at least one slit 13 is defined in the flexible substrate 10 along at least one first imaginary boundary line 14 between the exposed section 112 and the peripheral margin portion 12 . in the present embodiment , the flexible substrate 10 has two parallel straight first imaginary boundary lines 14 between the exposed section 112 and the peripheral margin portion 12 , thus , the flexible substrate 10 has two parallel straight slits 13 along the two first imaginary boundary lines 14 . the slits 13 can be formed using a laser beam , a blanking die or other means having high cutting accuracy . each of the slits 13 penetrates through the first electrically conductive layer 101 , the second electrically conductive layer 102 and the first insulating layer 103 . additionally , if the flexible substrate 10 has only one first laminating section 111 and one exposed section 112 , the first imaginary boundary line 14 defined between the exposed section 122 and the peripheral margin portion 12 would be a continuous polygonal line , and the slit 13 formed in the flexible substrate 10 would be a continuous polygonal shaped groove . referring to fig3 , in step ( 3 ), two rigid substrates 20 each have a structure ( e . g ., appearance , electrically conductive patterns or other elements ) corresponding to the flexible substrate 10 . in the present embodiment , each of the rigid substrates 20 is a single - sided copper clad laminate ( single - sided ccl ), and includes a third electrically conductive layer 201 and a second insulating layer 203 . correspondingly , the rigid substrates 20 each include a main portion 21 and a peripheral margin portion 22 . the main portion 21 includes two second laminating sections 211 having a similar shape to the first laminating sections 111 , and an unwanted section 212 having a similar shape to the exposed section 112 . electrically conductive patterns can be formed in each of the second laminating sections 211 using the third electrically conductive layer 201 . no electrically conductive patterns formed in the unwanted section 212 and the peripheral margin portion 22 are needed . it is noted that the number of the rigid substrate 20 is not limited to be two , less or more may be provided according to practical need . referring to fig4 , in step ( 4 ), the flexible substrate 10 is aligned with and laminated onto / sandwiched therebetween the rigid substrates 20 to obtain a laminated substrate 3 in such a matter that the first laminating sections 111 coincide with and are combined with the corresponding second laminating sections 211 to form first sections 311 , the exposed section 112 coincides with and is combined with the unwanted sections 212 to form a second section 312 , and the peripheral margin portions 12 , 22 coincide with and are combined with each other to form a third section 32 . in the present embodiment , the flexible substrate 10 is disposed and laminated between the two rigid substrates 20 . the first electrically conductive layer 101 is in contact with the second insulating layer 203 of one rigid substrate 20 , the second electrically conductive layer 102 is in contact with the second insulating layer 203 of another rigid substrate 20 . in order to ensure the laminated substrate 3 can be formed into a rigid - flexible printed circuit board , it is noted that if the laminated substrate 3 includes a number of flexible substrates 10 and a number of rigid flexible substrates 20 , the rigid substrates 20 should be arranged at the outermost sides of the laminated substrate 3 . referring to fig5 , in step ( 5 ), the unwanted sections 212 of the rigid substrates 20 are removed , and the exposed section 112 of the flexible substrate 10 is exposed . thus , the exposed section 112 can be regarded as a flexible section of the laminated substrate 3 . referring to fig5 to fig6 , in step ( 6 ), the laminated substrate 3 is cut along imaginary boundary lines 35 between the first sections 311 and the third section 32 to remove the third section 32 , i . e ., peripheral margin portions 12 , 22 of the flexible substrate 10 and the rigid substrate 20 . the imaginary boundary lines 35 between the first sections 311 and the third section 32 coincide with the borderlines between the second laminating sections 211 and the peripheral margin portion 22 of the rigid substrate 20 , whilst coincide with the borderlines between the first laminating sections 111 and the peripheral margin portion 112 of the flexible substrate 10 . in the present embodiment , the first sections 311 each have an imaginary boundary line 35 between the first section 311 and the third section 32 which is a continuous polygonal line . after the third section 32 of the laminated substrate 3 is removed , a rigid - flexible printed circuit board 4 is obtained . the rigid - flexible printed circuit board 4 has two rigid regions 41 formed from the first sections 311 and one flexible region 42 formed from the exposed section 212 . furthermore , a plurality of plated through holes ( not shown ) can be formed in the rigid - flexible printed circuit board 4 to electrically interconnect the first , second and third electrically conductive layers 101 , 102 and 201 . a coverlayer ( not shown ) can be formed on the rigid - flexible printed circuit board 4 to protect the conductive patterns formed by the third electrically conductive layers 201 . in the present embodiment , because slits 13 are formed in the flexible substrate 10 before laminating the flexible substrate 10 and the rigid substrates 20 , no burrs are occurred in the flexible region 42 . the appearance of the rigid - flexible printed circuit board 4 can be more precisely controlled than prior art manufacturing methods . thus , the quality of the rigid - flexible printed circuit board 4 is improved . while certain embodiments have been described and exemplified above , various other embodiments will be apparent to those skilled in the art from the foregoing disclosure . the present invention is not limited to the particular embodiments described and exemplified but is capable of considerable variation and modification without departure from the scope of the appended claims .	8
fig1 represents a block - diagram of an illustrative apparatus for controlling asynchronous machine , which is taught in this invention . the output voltage of the converter 1 is fed into block 2 , which contains a three - phase asynchronous machine ( block 3 ), and blocks for obtaining information on torque m ( block 4 ), rotor &# 39 ; s angular position θ ( block 5 ), velocity n ( block 6 ), acceleration ε ( block 7 ), magnitude of rotor &# 39 ; s magnetic flux ( the square of flux vector &# 39 ; s moduls ) φ ( block 8 ) and its time derivative e ( block 9 ), vector components of magnetic flux in a stationary orthogonal coordinate system φ 60 and φ . sub . β ( block 10 ). the blocks for obtaining information 4 , 5 , 6 , 7 , 8 , 9 , 10 , can contain transducers of corresponding quantities , for instance tensometric , torque transducer , angular velocity transducer , hall &# 39 ; s generator , some other known device for calculating corresponding quantities , or one of the later described blocks for calculating corresponding quantities . the converter 1 contains switching elements and can be a transistor power switch , a thyristor invereter , a mechanical , or some other converter transforming voltage + uo , - uo into a three - phase alternating u r , u s , u t , so that in any moment of time , any of the output phases of the converter 1 is connected to any of terminals + uo , or - uo of converter &# 39 ; s input voltage , depending on the sign of on - off control signals u r , u s , u t * respectively . on - off signals are formed in block 12 in dependence on the position of rotor flux vector ( components φ . sub . α and φ . sub . β ), and switchover functions of the structure s 1 and s 2 , which are formed in block 11 as linear combinations of the differences between the measured and set value of the torque m and m , angular position of the rotor 9 and 9 , angular velocity of the rotor n and n * angular acceleration of the rotor e and e , rotor flux quantities φ and φ , and it &# 39 ; s time derivatives e and e . fig2 represents a block - diagram of an alternate apparatus for the control of asynchronous machines taught in this invention . other than the mentioned blocks 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , the device for control represented in fig2 contains : a block for obtaining information on the components of the measured stator current of the asynchronous machine i . sub . α and i . sub . β in a stationary coordinate system ( block 13 ); block 14 which forms the components of the set stator current &# 39 ; s vector i . sub . α and i . sub . β * in a stationary system ; block 15 which forms relay signals u r , u s , u t , from the difference between the set and measured values of the components of asynchronous machine stator current for controlling converter 1 . block 13 can contain the transducer of phase currents r , s , t , of asynchronous machine &# 39 ; s stator 3 , for instance one with resistors , or hall &# 39 ; s generator , and the known devices for forming the components of the two - dimensional vector of asynchronous machine stator current in a stationary coordinate system . blocks 15 , 1 , 3 and 13 form a closed loop for following set point values i . sub . α and i . sub . β * of the components of asynchronous machine stator current &# 39 ; s vector . fig3 represents a moe detailed scheme of block 11 which forms the switchover functions of the structure . block 11 contains : block 16 forming the switchover function of the structure s 1 which is the sum of the differences between the measured and set value of rotor magnetic flux φ and φ , and their time derivatives e and e ; block 17 which forms the linear combination of differences between the measured and set value of angular position of the rotor θ and θ , angular velocity n and n , and angular acceleration e and e , block 18 , which forms the difference between the measured and set value of the torque m and m ; switch k , which forms the function of switchover of the structure s 2 which is equal to the output signal of blocks 17 , or 18 , depending on which quantity is controlled - torque , or angular parametars of asynchronous machine rotor . in that way structure switchover functions s 1 and s 2 are formed in block 11 as follows : ## equ1 ## fig4 represents the vectors of the speed change of structure switchover function ds / dt =( ds 1 / dt , ds 2 / dt ) in the space ( s 1 , s 2 ). it is assumed that in the space ( s 1 , s 2 ) surrounding an area , which is given by inequalities \| s 1 \|& lt ; δ 2 , or \| s 2 \|& lt ; δ 2 , and which is determined e . g . by the values of hysteresis δ 1 and δ 2 of the elements which switch over the structures , the vector of the speed ds / dt being directed towards the origin of coordinates , that is : ## equ2 ## condition ( 2 ) is the condition of the sliding mode existence in control systems represented in fig1 and 2 . if condition ( 2 ) is satisfied in the whole range of values s 1 and s 2 , which are realised in the process of control system functioning , then that condition is sufficient for phase point to fall in the neighborhood of coordinate system &# 39 ; s origin ( δ 1 , δ 2 ), that is in the range of &# 34 ; real &# 34 ; sliding motion at the intersection of planes s 1 = 0 and s 2 = 0 . fulfilment of condition ( 2 ) must be secured by changing the structure of control system , that is by the adequate switchover of the elements of the converter 1 . in the sliding mode the point with coordinates ( s 1 , s 2 ) obviously cannot leave the neighborhood or coordinate origin ( s 1 , s 2 ), so the quantities s 1 and s 2 equal zero with a precision up to quantities δ 1 and δ 2 . the law of controlled quantities change is given by differential equations with regard to the differences between the measured and set values of rotor flux , rotor &# 39 ; s angular position , or the torque : ## equ3 ## equations ( 3 ) are obtained by equalizing to zero the expression for switchover functions of the structure ( 1 ), and by an obvious substitution e = dφ / dt , m = dθ / dt , s = d 2 θ / dt 2 . it should be noticed that the equations of motion of the control system in the sliding mode do not depend on parameters of asynchronous machine and power converter but they are determined by coefficients c 1 , c 2 , c 3 , which can be selected according to the desired character of the process in control system , and the quantity of the problems being solved . for instance , when controlling rotor &# 39 ; s angular parameters , if c 2 = c 3 = 0 is chosen , one has a system for controlling rotor &# 39 ; s angular acceleration , with c 2 = 0 , c 3 = 0 , a system for controlling rotor &# 39 ; s angular velocity , and with c 2 , c 3 = 0 , a system for the control of rotor &# 39 ; s angular position . using the known differential equations for an asynchronous machine , and differentiating ( 1 ) in time one can obtain . ## equ4 ## where f 1 1 , f 2 1 are some continuous functions of the coordinates of the system : currents of asynchronous machine stator and rotor , angular velocity of the rotor , the corresponding set values and parameters of asynchronous machine rs , rr , lr , ls , lr , lh -- of reduced stator and rotor resistances , stator and rotor inductivity , and mutual inductivity , reduced inertial torque of the rotor and load j , reduced dissipation coefficient . ## equ5 ## ud , uq -- projections of asynchronous machine &# 39 ; s voltage vector on the direction of rotor flux vector , and on orthogonal direction : k 1 1 , k 2 1 -- some constant positive coefficients which are determined by the parameters of the employed asynchronous machine . obviously , for fulfilling the condition of existence of the sliding mode ( 2 ), it is sufficient to select the state of switching elements of the power converter supplying the asynchronous machine in such a way , that the signs of time derivatives of structure switchover functions ds 1 / dt and ds 2 / dt do not depend on the magnitude and signs of functions f 1 1 , and f 2 1 , which are included in equations ( 4 ), but only on the signs of components of asynchronous machine supply voltage vector ud and uq , while signs of the components ud and uq agree with signs of structure switchover functions s 1 and s 2 that is : ## equ6 ## in that way it is sufficient , for fulfilling the codition of existence of the sliding mode ( 2 ) in the control system of an asynchronous machine , to choose the state of switching elements of the converter supplying the asynchronous machine in such a way that corresponding projections ud , uq of supply voltage vector agree in sign with structure switchover functions s 1 , s 2 -- condition ( 5 ); the values of the projections of supply voltage vector must satisfy the inequalities ( 6 ). fig5 a represents a more elaborate block - scheme of the converter supplying asynchronous machine . switches k 1 , k 2 , k 3 connect the output terminals of phases r , s , t , to the input terminals + u o , or - u o , depending on the sign of control signals u r , u s and u t * respectively , so the output signals u r , u s , u t of the converter can be considered proportional to control signals . fig5 b represents possible positions of supply voltage vectors u 1 , u 2 , u 3 , u 4 , u 5 , u 6 in a stationary coordinate system ( α , β ), which correspond to possible positions of the switch k 1 , k 2 , k 3 and phase direction vectors e r , e s , e t , of the machine ; it represents also the momentary position of rotor flux vector φ , and the vector orthogonal to it jφ , which are tied to the revolving coordinate system ( d , q ). the last two vectors break the planes ( α , β ) and ( d , q ) ito 4 quadrants which correspond to the possible sign combinations of structure switchover functions s 1 and s 2 . to satisfy the condition of existence of the sliding mode ( 5 ), it is necessary to select such a combination of relay control signals u r , u s , u t , that the vector of supply voltage lies in the quadrant which is determined by the signs of structure switchover functions s 1 and s 2 , namely for s 1 & gt ; 0 , s 2 & gt ; 0 select control signals u r , u s , u t , which correspond to supply voltage vector u 2 ; for s 1 & lt ; 0 , s 2 & gt ; 0 - u 3 or u 4 ; with s 1 & lt ; 0 , s 2 & lt ; 0 - u 5 ; with s 1 & gt ; 0 , s 2 & lt ; 0 - u 6 or u 1 . fig6 a represents a more detailed block - diagram of block 12 of the asynchronous machine control system represented in fig1 . block 12 contains relay elements &# 39 ; block 19 , to whose inputs are fed the output signals of block 11 , which forms the structure switchover functions s 1 and s 2 ; switch elements &# 39 ; block 20 , where to the non - inverting and inverting inputs of switching elements k 1 , k 2 , k 3 , k 4 are fed the rotor flux vector components φ . sub . α and φ . sub . β respectively , and switches are controlled through relay signals from block 19 output ; output signals of b . 20 are fed to block 21 which computes the projections of two input signals , as components of two - dimensional vector in a stationary coordinate system , on the unit vectors of phases e r , e s , e t , of machine ; three output signals of block 21 are fed to the input of relay elements &# 39 ; b . 22 , whose output signals are at the same time the output signals of block 12 , so they serve as control signals u r , u s , u t * for controlling converter 1 which supplies asynchronous machine . hereinafter , for simplicity of exposition , the term asynchronous machine may be shortened to machine -- asynchronous being understood . fig6 b represents a diagram of possible instantaneous voltage values at the outputs 5 and 6 of b . 20 , denoted by u . sub . α * and u . sub . β , and considered as vector components u 1 , u 2 , u 3 , u 4 * which correspond to the four possible sign combinations of output signals of the relay elements &# 39 ; block 19 for controlling switches k1 , k2 , k3 , k4 of the b . 20 ; on the orts e r , e s , e t , of phases r , s , t of asynchronous machine , which are computed in coefficients block 21 . coefficient k of the output signals of switches k 3 and k 4 should satisfy the conditions 1 /√ 3 & lt ; k & lt ;√ 13 . if this condition is fulfilled in any moment of time , one of the relay output signals of b . 12 changes its sign , when the sign of switchover function s 1 is changed ( accounting hysteresis of relay elements of block 19 ), and the other two output relay signals of block 12 change their signs with sign change of switchover function s 2 ( also taking into account hysteresis of the relay elements of block 19 ), or vice versa , so , depending on the instantaneous position of rotor flux vector , the switch of one phase of the converter 1 is controlled by the sign of structure switchover function s 1 ( or s 2 ), and the switch of the other two phases by the sign of structure switchover function s 2 ( or s 1 ). fig7 represents a block - diagram of the alternate organization of block 12 which is proposed by this invention for asynchronous machine control system represented in fig1 . block 12 consists of : two blocks 21 for computing the projections of input signals vectors on the unit vectors of the machine phases e r , e s , e t , the components of rotor flux vector φ . sub . α and φ . sub . β being fed to the corresponding inputs of one of blocks 21 , and signals φ . sub . β and - φ . sub . α to the corresponding inputs of the other block 21 ; block 25 of multipliers 1 , 2 , 3 , 4 , 5 , 6 to whose inputs are fed the output signals from two blocks for computing the projections on phase orts e r , e s , e t , and output signals of block 11 which forms the functions s 1 and s 2 ; output signals of multipliers 1 , 2 , 3 , 4 , 5 , 6 are summed with input signal of b . 24 , which contains an integrator block ; block 23 made of three relay elements with hysteresis , to whose input are fed the output signals of multipliers &# 39 ; block 25 ; output signals of relay elements &# 39 ; b . 23 , are at the same time output signals of block 12 , and signals u r , u s , u t * for controlling the converter 1 which supplies asychronous machine ; to the input of block 24 , which contains an integrator , is fed the sum of ralay signals u r , u s , and u t . blocks 21 for computing the input projections of vector on the unit vectors e r , e s , e t , together with multipliers &# 39 ; block 25 , and block 24 , whose output signal will be written in the form s 3 , realize the continuous , non - singular transformation of functions s r , s s , s t -- the output signals of block 25 . if coefficients of transformation are as in fig7 block 25 output signals satisfy the following differential equations : ## equ7 ## where f 1 2 , f 2 2 , f 3 2 are continuous functions , k 2 2 is a coefficient depending on the parameters of asynchronous machine employed . voltages u r , u s , u t should satisfy the condition of sliding mode existence , that is : ## equ8 ## coincidence of signs of the voltages u r , u s , u t with the signs of relevant functions s r , s s , s t is secured by the relay elements &# 39 ; block 23 , which forms the signals for controlling the converter . in that way , block 12 , which is proposed in this invention and represented in fig7 secures the sliding mode at the intersection of three structure switchcover areas s r = 0 , s s = 0 , s t = 0 . the quantities s r , s s , s t in sliding mode are equal to zero , with a precision up to the structure switchover of the control system ( switchover of the output phase voltages of the converter supplying asynchronous machine ). because of the nonsingular character of transformation carried out in blocks 21 and 25 , the functions s 1 , s 2 , s 3 are also equal to zero with a precision up to the value of hysteresis . in the sliding mode desired character of the process of controlling asynchronous machine is achieved , as earlier , by selecting coefficients of linear combinations ( 3 ). equalizing to zero the quantity s 3 -- output signal of block 24 , which contains an integrator ( of a precision up to hysteresis value ), means equalizing to zero the mean ( with a precision up to the high frequency component ) sum of three signals for controlling the converter u r , u s , u t , or the signals proportional to them -- the output signals of phases u r , u s , u t of the converter supplying the asynchronous machine . in that way block 12 , represented in fig7 provides for the desired character of the change of asynchronous machine &# 39 ; s rotor flux , torque , or angular position , angular velocity and angular acceleration of the rotor in the system for the control of asynchronous machine represented in fig1 and secures that output voltage of the converter supplying asynchronous machine are three - phase &# 34 ; in the mean .&# 34 ; fig8 represents a diagram of possible effective voltages supplyng machine in the control system represented in fig1 . if block 12 , for forming the signals which control converter 1 , represented in fig6 is applied , the vector of machine effective supply voltage can be any of the vectors in the hexagonal area u 1 , u 2 , u 3 , u 4 , u 5 , u 6 . when applying block 12 for forming the signals which control the converter 1 ( represented in fig7 ), the vector of machine effective supply voltage can be any of the vectors in the circle of the radius u o ( the hatched circle in fig8 ), which lies entirely inside the hexagonal area u 1 , u 2 , u 3 , u 4 , u 5 , u 6 . the decrease of the range of possible values of the vector of machine effective supply voltage is explained by the fact that the condition of three phase output voltages of the converter supplying as machine is fulfilled &# 34 ; in the mean &# 34 ;. it is worth noticeing that in the steady state with rotor &# 39 ; s angular velocity m , and load torque m l of machine , constant , the functions f 1 1 and f 2 1 , included in the equations ( 4 ), are constant . accordingly in the sliding mode the components ud and uq of voltage vector are also constant &# 34 ; in the mean &# 34 ; ( with a precision up to the value of high frequency component ) while the components of vectors of voltage u . sub . α and u . sub . β , currents i . sub . α and i . sub . β , and flux φ . sub . α and φ . sub . β of machine in a steady coordinate system , are sine functions . however , &# 34 ; the mean values &# 34 ; of output phase voltages of the converter supplying machine when applying b . 12 for forming signals that control the converter represented in fig6 a does not have to be harmonic functions . at the same time , in the same conditions of the steady state , as are the above stated conditions , functions f 1 2 , f 2 2 , f 3 2 , included in equations ( 7 ), are harmonic functions . so , when applying block 12 , for forming signals which control the converter , represented in fig7 in the sliding mode &# 34 ; the mean &# 34 ; ( with precision up to the value of high frequency component ) value of output phase voltages of the converter u r , u s , u t is also a harmonic function . if a regulated power suply is used for supplying machine , or a voltage supply with an inner loop for the control of machine &# 39 ; s stator current , the sliding mode of control system can be secured by selecting the derivative of corresponding machine stator current &# 39 ; s component from the set of two possible values . using the known differential equations of machine and differentiating ( 1 ), we get : ## equ9 ## where f 1 3 and f 2 3 are some continuous functions of machine &# 39 ; s condition , and the system disturbances , k 1 3 , k 2 3 -- constant positive coefficients which are determined by the as machine &# 39 ; s parameters ; di d / dt and di q / dt -- derivatives of components of as machine stator current in an orthogonal coordinate system oriented in the direction of rotor flux vector . it follows from the equations ( 9 ) that the condition for sliding mode existence in as machine control system ( 2 ) can be fulfilled depending on the sign of structure switchover functions s 1 and s 2 , when components di d / dt and di q / satisfy these conditions : ## equ10 ## to explain the operation of the device for the control of machine , which is represented in fig2 fig9 represents a diagram of possible positions of vectors ( di d / dt , di q / dt ), which consists of time derivatives of machine stator current &# 39 ; s components in a coordinate system tied to the rotor flux vector φ , which correspond to the possible sign combinations of structure switchover functions s 1 and s 2 . fig1 represents a more elaborate block - diagram of block 14 of the device for machine control , with an inner loop for the stator current , represented in fig2 . block 14 , for forming the set point value of machine stator current , contains : block 19 , or relay elements with hysteresis , to whose input the output signal from b . 11 is fed , which forms structure switchover functions s 1 and s 2 ; two blocks of integrator elements 26 and 27 , to whose inputs are fed the output signals of relay elements &# 39 ; block 19 ; multipliers block 28 , to whose inputs are fed the output signals of integrator elements blocks 26 and 27 , and rotor flux vector &# 39 ; s components φ . sub . α and φ . sub . β in a stationary coordinate system ; the output signals of multipliers &# 39 ; block 28 are the components i . sub . α * and i . sub . β * of the set current of machine stator in a stationary coordinate system , and are fed into block 15 , which is included in the contour for machine stator current . the output signals of integrator elements &# 39 ; blocks 26 and 27 are components i d * and i q , respectively , of the set stator current in a coordinate system which rotates together with machine rotor flux vector . multipliers block realises the transformation of components i d and i q * into the stationary coordinate system ( α , β ), with a precision up to the multiplicator of the modulus of machine rotor flux vector . as machine rotor flux is in many cases in practice kept at the set level φ = const , this multiplication is not essential , and can be taken into account by selecting the coefficient of amplification for corresponding quantities . fig1 represents a detailed block of block 15 which forms signals u r , u s , u t for controlling the converter in the control system represented in fig2 . block 15 consists of : block 21 for calculating the projections v . sub . α and v . sub . β of the vector , composed of the difference between the components of the measured and set value of asynchronous machine stator current in a stationary coordinate system , on the unit vectors e b , e s , e t , of as machine ; block 23 of relay elements with hysteresis , to whose input are fed the differences between the corresponding output signals of block 21 for computation of the vector projections , and the output signal of block 24 ; block 24 consists of an integrator element to whose input is fed the sum of the output signals u r , u s , u t ; the output signals of block 15 -- signals which control the converter supplying the machine , are the output signals of relay elements block 23 . the input signals of relay elements block 23 , which are denoted by s r , s s , s t , when the values of coefficients are as in fig1 , are governed by the following differential equations : ## equ11 ## where f 1 4 , f 2 4 and f 3 4 are continuous functions , k 2 4 -- a constant positive coefficient which is defined by machine &# 39 ; s parameters . under a discrete variation of u r , u s , u t , the sliding mode is established in the system ( 12 ) at the intersection of the areas s r = 0 , s s = 0 , s t = 0 , if the conditions of its existence are fulfilled : ## equ12 ## in the steady state , with the rotor &# 39 ; s angular velocity of rotation , and the load torque of machine constant , the functions f 1 4 , f 2 4 , f 3 4 which are included in the equation ( 12 ), are sinusoidal functions . thus , in the sliding mode , the output phase voltages of the converter supplying machine ( if block 15 , represented in fig1 , is used for forming the signals for controlling the converter change &# 34 ; in the mean &# 34 ; ( with a precision up to the high frequency component ) according to the sinusoidal law , too . if sinusoidality of &# 34 ; mean &# 34 ; values of converter phase voltages is not obligatory , ( e . g . when machine &# 39 ; s windings are connected without the zero lead ), then , putting aside the integral condition of converter &# 39 ; s output voltages forming a three - phase system , the power indices of controlled electric drive can be improved by reducing the number of commutations of converter &# 39 ; s switch . the other functional characteristics of the control system will , nevertheless , be preserved . fig1 represents a block - diagram of the alternate block 15 which forms signals u r , u s , u t for converter control system , represented in fig2 ; this block realises the control algorithm with a minimal number of converter commutations . block 15 consists of : block 29 which forms control signals u r , u s , u t , to whose input are fed the signals of difference between the components of measured and set value of asynchronous machine stator current in a stationary coordinate system , and relay signals a , b , c , d , e , f ( formed in block 30 ) which determine the phase of the converter when the switch is in the fixed position ; block 30 , which forms the signals for selecting that converter phase , in which there is no switchover at the given moment , to whose input are fed the signals from block 31 , block 31 , which computes the components u . sub . α and u . sub . β * of effective machine supply voltage in a stationary coordinate system , to whose input are fed the signals u r , u s , u t * for the control of the converter represented in fig1 , which supplies machine can be used in an open control loop : in that case , output signals u . sub . α * and u . sub . β * of block 30 must be the components of the desired as machine supply voltage , which are obtained from the device for setting the voltage ; input signals of block 32 , which calculate the integral error of the set and measured value of machine supply voltage , and which is represented in fig1 via dotted lines . fig1 a represents a more detailed block - diagram of block 30 , which forms the signals for selecting the non - commutating phase of the converter supplying machine , which is included in block 15 represented in fig1 . block 30 consists of : block 21 which computes the projections of vector u * of the machine effective supply voltage , whose components u . sub . α * and u . sub . β * are , in a stationary coordinate system , the input signals of b . 21 , on the block machine &# 39 ; s phase unit vectors ε r , ε s , ε t ; relay elements block 22 to whose input are fed the output signals of block 21 , a block of logic elements e 1 , e 2 , e 3 to whose inputs are fed the output signals from the ralay elements block ; output signals a , c , e and b , d , f from block 30 , are at the same time output signals of relay elements &# 39 ; block 22 , and block of logic elements 33 , respectively . logic of elements e 1 , e 2 , e 3 is given by the following relation : where x and y are the input signals of logic elements , z is the output signal . fig1 b represents a vector diagram of possible values of output signals of the logic block 33 ( for all posible positions of vector u ), which explains the function of block 30 . as it is seen in fig1 b , the plane ( α , β ) is divided into six parts , so that , if vector u makes a minimal angle with part orts ε r , ε s , ε t , of as machine , the signals f , d or b equal + 1 ; in the opposite case , signals f , d or b equal - 1 . fig1 represents a more detaliled block - diagram of block 29 which is included in block 16 represented in fig1 . block 29 , which forms signals u r , u s , u t * for the control of converter which supplies as machine , consists of : block 21 , which computes projections of vector , whose components are differences between components v . sub . α and v . sub . β of measured and set value of machine stationary current , in a stationary coordinate system , on unit vectors of phase e r , e s , e t , of asynchronous machine ; block 34 containing switches k 1 , k 2 , k 3 and k 4 , k 5 , k 6 where the output signals of block 21 are fed to the inputs of switches k 1 , k 2 , k 3 ; the differences between the corresponding output signals of block 21 and the sum of output signals of switches k 1 , k 2 , k 3 are fed to the upper inputs of switches k 4 , k 5 , k 6 , while the output relay signals a , c , e , of block 30 , which is included in block 15 represented in fig1 are fed to the lower imputs of switches k 4 , k 5 , k 6 , and the output relay signals f , d , b , of the mentioned b . 30 are fed to the control imputs of switches k 1 and k 4 , k 2 and k 5 , k 3 and k 6 , block 23 of relay elements with hysteresis , to whose input the output signals of block 34 are fed ; output signals of block 29 -- signals for the control of the converter which supplied as machine -- are the output relay signals of block 23 . in accordance with the logic of block 30 functioning , only one of output signals b , d , f of block 30 equals + 1 at any instant . therefore , at any instant , only one of switches k 1 , k 2 , k 3 of block 34 ( which is included in block 29 ) is on , and only one of switches k 4 , k 5 , k 6 lets through the relay signals e , c , or a , fed from the output of block 30 , while the switches k 1 , k 2 , k 3 , k 4 , k 5 , k 6 remain in the fixed position in the time interval during which the vector of effective voltage is in one of six hatched areas in fig1 b . in such a way , during this time interval one of the signals u r , u s , u t , which controls the converter , does not change the sign . the output voltage corresponding to the relevant phase of the converter supplying asynchronous machine does not change either . the input signals of block 23 , which is included in block 29 , denoted by s r , s s , s t respectively , with the coefficients values as shown in fig1 , satisfy the following differential equation : ## equ13 ## where f 1 5 and f 2 6 are some functions , continuous in the given interval . in such a way , provided the conditions of existence ( 15 ) are fulfilled , sliding mode for which s i = 0 , s j = 0 is established in the system , with a precision up to hysteresis of relay elements included in block 23 . accordingly , signals v . sub . α and v . sub . β of block 29 equal zero with a precision up to hysteresis . fig1 a represents a vector diagram which explains the operation of block 15 represented in fig1 , which is included in machine control system represented in fig2 . if the effective voltage vector u * lies in the hatched range in fig1 a , the output voltage of converter &# 39 ; s phase r does not vary , and is equal to + u o . in the sliding mode the voltage of converter &# 39 ; s phases s and t varies in such a way that the set machine &# 39 ; s effective supply voltage is provided ; then four vectors of supply voltage are possible : 0 , u 1 , u 2 , u 3 , and they correspond to possible states of converter &# 39 ; s switch . fig1 b represents output voltages of the converter vs . time , with a condition that effective supply voltage of machine varies sinusoidally . the intervals in which the output voltage of phase r of the converter supplying machine does not change sign , are marked in fig1 b . as it follows from fig1 b , independently of the amplitude of machine effective supply voltage which varies sinusidaly , the output voltage of each of phases u r , u s , u t of the converter supplying machine does not change sign during one third of the period of harmonic effective voltage . the change of &# 34 ; mean &# 34 ; ( with a precision up to the high frequency component ) output phase voltage of the converter differs in this case from sinusoidal form , even in the steady state asynchronous machine &# 39 ; s operation . fig1 represents a more detailed block - diagram of block 31 ( which is included in block 15 represented in fig1 ) which computes the effective machine supply voltage . block 31 consists of : two blocks 21 for computing vector projections on unit vectors of phases e r , e s , e t , of machine , components φ . sub . α and φ . sub . β of machine rotor flux vector being fed to the inputs of one block 21 , while the components φ . sub . β and φ . sub . α of vector jφ , orthogonal on asynchronous machine rotor flux vector are fed to the inputs of the other block 21 ; two blocks 35 , each consisting of three switching elements , where the output signals from two blocks 21 respectively are fed to the non - inverting and inverting input of switches k 1 , k 2 , k 3 of each block 35 ; the relay signals u r , u s , u t , which control the switch supplying machine are fed to control inputs of switches k 1 , k 2 , k 3 of both of blocks 35 while the outputs of switches k 1 , k 2 , k 3 of each block 35 are summed up ; two blocks 24 , which consist of one inertial block each , whose input signals are output signals of blocks 35 ; block 28 which realizes the transformation of vector ( whose components are output signals of blocks 24 ) from coordinate system ( d , q ), rotating together with rotor flux , into stationary coordinate system ( α , β ). block 28 inputs are outputs of inertial blocks 24 , and of components φ . sub . α and φ . sub . β of as machine rotor flux vector . output signals of block 28 are components u . sub . α * and u . sub . β * of as machine supply voltage ( with a precision determined by the multiplicator ). in its nature block 31 is a vector filter , which enables computing effective value of machine supply voltage without phase shift , accounting for the particularity of switching character of output voltage of the converter supplying asynchronous machine . fig1 represents a more elaborate block - diagram of block 32 , which computes the integral error of measured and set point value of machine supply voltage , included in blocks represented in fig1 . block 32 consists of : block 36 which computes two - dimensional vector of voltage from the signals u r , u s , u t * for the control of converter which calculate the difference between measured and set values of components of machine supply voltage vector ; two integrator blocks 26 , whose input signals are the differences between the components of measured and set value of machine supply voltage , and their outputs are the integral error of machine supply voltage . this text by now has described the basic methods of synthesizing the asynchronous machine control system on theoretical grounds of control system with varibale structure , and especially , on the basis of introducing the sliding mode of control system &# 39 ; s operation . the frequency of sign change of switchover functions and the operational frequency of the switch of the converter supplying asynchronous machine , can be in a real system 100 hz - 2 khz , and is determined by the minimum allowed time interval between two switchovers of each converter &# 39 ; s power switch . in order to choose the desired switchover frequency , one should choose the corresponding frequency of switching over the hysteresis of relay elements which determine the signs of structure switchover functions , and the signals for converter control , or , apply block 37 for automatical setting of the operational frequency of switching elements , represented in fig1 a . block 37 contains three identical devices , each of which is connected to the corresponding output of any of devices for forming the signals u r , u s , u t * described above , or to the inputs of devices which form the input signals of relay elements of devices for forming signals u r , u s , u t , and the output relay signals of block 37 are signals for the control of the switches of the converter supplying asynchronous machine . each of three device of block 37 consists of two amplifier 1 and 2 in positive feedback : a passive inertial network consisting of resistors r and ( 1 +( 2 / k ) r , and a capacitor c , the resistors being connected to the output terminals of corresponding amplifiers ; the voltage of capacitor c is fed to the inverting input of amplifier 2 , while the output voltage ± u o 1 of amplifier 2 is fed , via a resistor k 1 r 1 , to the non - inverting input of amplifier 1 ; the input signal of block 37 is fed to the inverting input of amplifier 1 , output voltage u out =± u o 1 of amplifier 1 is the output signal of block 37 . block 37 operation is determined by hysteresis magnitude in relation to the input signal , and by the time interval τ between two successive sign changes of output signal : ## equ14 ## fig1 b represents a diagram of voltage change at some points of block 37 , which explains its function . after the sign of output signal of converter 1 changes , voltage u 1 of capacitor c varies exponentially , with time constant ## equ15 ## with the initial condition ± u o 1 /( 1 + k ), whose value is equal to the hysteresis of amplifier 2 . exponential voltage change on capacitor c has duration τ until reaching the value ± u o 1 /( 1 + k ) in that interval the output voltage of amplifier 1 does not change sign with no regard to the possible changes of sign and value of input voltage of block 37 . that interval over , the output voltage of amplifier 2 changes its sign ; the sign of output voltage of amplifier 1 will be determined after that by the sign of input signal of block 37 , accounting the hysteresis value δ . when realizing systems for the control of machine , which are taught in the present invention and represented in fig1 and 2 , it may be necessary to apply a device for limiting machine &# 39 ; s stator current , which is explained e . g . by maximum allowed values of switch currents in the converter supplying mchine , maximum allowed power dissipated in stator windings , etc . block - scheme of the device for limitting the current in control systems represented in fig1 and 2 , is represented in fig1 . the device for limitting the current consists of : block 38 , located between blocks 11 and 12 of the control system represented in fig1 or between blocks 11 and 14 of control system represented in fig2 and it consists of switches k 1 and k 2 which form the structure switchover functions s 1 and s 2 , which equal functions s 1 and v &# 39 ;, and s 2 or m &# 39 ;, respectively ; block 39 which consists of previously described block 23 , which forms quantities v &# 39 ; and m &# 39 ; equal respectively to i . sub . α φ . sub . α + i . sub . β φ . sub . β and i . sub . α φ . sub . α - i . sub . β φ . sub . α ; block 40 , forming relay signals o 1 and o 2 for controlling switches k 2 and k 1 of block 38 by input signals -- components of machine stator current i . sub . α and i . sub . β . quantity m &# 39 ; is proportional to the machine torque , and quantity v &# 39 ; is equal to the scalar product of stator current vector , and machine &# 39 ; s rotor flux , and it characterizes current component i d which forms magnetic flux . relay signals o 1 and o 2 for the control switches k 1 and k 2 are formed by the following law : ## equ16 ## where i inst = max {\| i r \|, \| i s \|, \| i t \|}- maximum value of phase currents of the converter supplying as machine ; p 1 and p 2 -- the permitted set values of converter &# 39 ; s phase currents . values of p 1 and p 2 must be smaller than the maximum permitted value of converter &# 39 ; s phase currents , and p 1 & lt ; p 2 . if o 1 = o 2 =- 1 , that is , if asynchronous machine &# 39 ; s stator current does not exced p 1 and p 2 levels the switches k 1 and k 2 of block 38 , represented in fig1 , are in upper position i . e . s 2 = s 2 , and s 1 = s 1 . fig2 a represents a vector diagram which explains the choice of allowed values of phase currents p 1 and p 2 . introduction of two comparative levels of p 1 and p 2 , and two signals o 1 and o 2 for switch control , enables adding the following functional qualities to a control system : if phase point s =( s 1 , s 2 ) is outside the sliding mode zone \| s 1 \|& gt ; δ 1 and \| s 2 \|& gt ; δ 2 , the magnetic circuit is magnetized by the maximum possible current i d = i inst = p 2 , machine rotor flux will tend to reach the set value φ at the maximal possible speed ; if the sliding mode is established in the area s 1 = 0 ( namely machine &# 39 ; s rotor is sufficiently magnetized ), but \| s 1 \|& gt ; δ 2 , then i inst = p 1 , stator current component i d , which magnetizes as machine &# 39 ; s rotor , being kept in accord with the demanded change of rotor flux φ and stator current component i q , which forms torque m , is kept maximal possible , accounting for the limitation conditions of converter &# 39 ; s phase currents i inst = p 1 . in other cases the device for limitting current does not affect the function of above described systems for the control of machines . fig2 b represents the diagrams of starting a non - magnetized machine and reversing it using the system for the control of angular velocity of rotor &# 39 ; s rotation , which explain the function of the device for limitting phase current of the converter supplying machine . it is supposed that the set value of machine rotor flux is constant φ = const , load torque is not applied m l = 0 , and the set value velocity of rotation n undergoes a step change at the moment t = t 3 . during the starting time interval o ÷ t 1 converter &# 39 ; s phase current is limited at the level of p 2 , machine &# 39 ; s rotor flux rising at the maximum possible speed with the set current limit . at the moment t = t 1 sliding mode is established on the structure sliding surface s 1 = 0 , starting then , rotor flux varies exponentially , in accordance with the sliding mode equation ( 3 ). in the interval t 1 ÷ t 2 converter &# 39 ; s phase current is limited at the level of p 1 , rotor &# 39 ; s angular velocity of rotation n changing at the maximum possible speed . at the moment t = t 2 sliding mode is established on the sliding surface of the structure s 2 = 0 ; starting then , rotor &# 39 ; s angular velocity varies exponentially in accordance with the sliding motion equations ( 3 ). when the set value of rotor &# 39 ; s angular velocity n * undergoes a step change ( reverse command ), at the moment t = t 3 , further processes are analogous to the processes of rising and stabilization of angular velocity in intervals t 1 ÷ t 2 , t 2 ÷ t 3 . fig2 represents a more detailed block - diagram of block 40 , which is proposed by this invention , and which is represented in fig1 . block 40 consists of : block 21 which forms projections of machine &# 39 ; s vector current ( set and measured values ) on the unit vectors e r , e s , e t , of machine &# 39 ; s phases -- the current of phases i r , i s , i t of the converter ; two equal electronic schemes which consist of the amplifiers 1 ÷ 7 , and diodes d1 ÷ d6 , each of which forms relay signals o 1 and o 2 for controlling switches k 2 and k 1 of block 33 of the device for limiting current , represented in fig1 . amplifiers 1 ÷ 6 are comparators which compare the quantities i r , i s , i t of the converter &# 39 ; s phase currents , with levels of ± p 1 or ± p 2 , which are set by potentiometers , and the inverting amplifier 7 ; diodes d1 ÷ d6 are connected by the scheme for selecting maximum signal at the output of amplifiers - comparators 1 ÷ 6 . it was noticed earlier , that , for establishing sliding mode on the structure sliding surfaces s 1 = 0 , s 2 = 0 in a control system with an inner contour by machine &# 39 ; s stator current ( represented in fig2 ), it is enough to select components di d / dt , and di q / dt from the set of two possible values , both components fulfilling conditions ( 10 ), ( 11 ). functions f 1 3 and f 2 3 , which are included in equations ( 9 ) and inequalities ( 11 ), become equal to zero in the steady state of machine &# 39 ; s operation , with angular velocity of rotor n , and load torque m l , constant . this follows especially from the fact that components of stator current i d * and i q * are constant in the steady state . thus , to secure the conditions of sliding mode existence ( 11 ), it is sufficient , in this case , to select components di d / dt and di q / dt from a set of arbitrary , small values . on the other side , in transient dynamical regimes of operation , functions f 1 3 and f 2 3 rise , and , to satisfy the conditions of sliding mode existence , it is necessary to select components di d / dt to be sufficiently large in absolute value . so appears a possibility of varying the values of components of derivatives of asynchronous machine &# 39 ; s stator current , in dependance on the regime of operation of machine &# 39 ; s control system . the desirability of such variation is obvious from the fact that with a definite , and in a general case , fixed effective frequency of switching over the elements which determine the selection of control system &# 39 ; s structure , the amplitude of deviation of machine &# 39 ; s stator currents components i d and i q * is proportional to the values of interruptions of corresponding components of current derivatives di d / dt and di q / dt . shortening the amplitude of deviation of currents components to the minimal possible values , enables enlarging the operative precision of control system , because the conditions of operation of the inner contour by stator current of asynchronous machine , are made easier . fig2 represents a block - scheme of block 19 for automatic setting the values of discontinuities of derivatives of machine &# 39 ; s stator current &# 39 ; s components , according to the invention . block 19 for automatic setting the values , consists of : relay element 1 with hysteresis , which forms the sign of structure switchover function s 1 or s 2 ; two integrator elements 2 and 3 , both with two - side limitation , the lower level of limitation of integrator 2 , and the upper level of integrator 3 equaling zero , while the upper level of integrator 2 , and the lower level of integrator 3 equal to the maximum value of derivatives of stator current components with which the operation of the inner contour by stator current is possible ; to the inputs of integrators 2 and 3 is fed the sum of output signals of relay element 1 , and constant signals + and - respectively . the difference between the output signals of integrators 2 and 3 is fed to the inverting and non - inverting input of the switch controlled by the output signal of relay element 1 ; the output signal of switch k is also the output signal of b . 19 . in that way the output signal of block 19 is asgn s i i = 1 , 2 where a is the difference between the output signals of integrators 2 and 3 , which determines the value of discontinuities of derivatives of machine &# 39 ; s stator current components . in sliding mode quantity , a is set automatically so ( in the range of set limitations of integrators 2 and 3 ), that the mean time value of output signal of relay element 1 is constant and equal + α , or - α . time constant t of integrators 2 and 3 determine the speed of automatical setting the quantities a , and are to be selected in relation to the realized frequency f of sign change of output element 1 , namely t 1 / r . fig2 represents a more detailed block - scheme of the device 41 for automatical setting the values of discontinuities of derivatives of stator current components , represented in fig2 , and the device for limitting stator current represented in fig1 . the device 41 consists of : two integrator elements with limitation , realized on amplifiers 1 and 2 , for polarity limitation of output signals of the amplifier being used diodes d 1 and d 2 , which are connected in a feedback circuit of amplifier ; the limit of value of output signal is reached because of natural limits of amplifier &# 39 ; s voltage ; to the inputs of amplifier 1 and 2 s fed the sum of relay signals sgn s 1 , or sgn s 2 , and the quantities α and - α ; two summators of output signals of integrators 2 and 3 , realized on amplifiers 3 and 4 , the output signal of the summator 3 being positive , and its value being equal to negative output signal of summator 4 ; a switch , realized on transistors t 1 and t 2 , which connects the input of integrator 5 to the outputs of summator 3 or 4 , and which is controlled by the output signal sgn s 1 , or sgn s 2 from device 41 ; integrator 5 , which is closed in a feedback circuit via relay elements 6 , and which forms the sign of output signal of integrator 5 ; and a switch realized via fet transistor t 3 , and controlled by a signal of current limit o 1 and o 2 . the output signal of integrator 5 is component i d , or i q of the set machine &# 39 ; s stator current , and is fed to the device for transforming the coordinates 28 of block 14 which forms the set stator current i . sub . α * and i . sub . β * in a stationary coordinate system . it should be noticed that in many cases of asynchronous machine control , it is sufficient to keep rotor flux constant , or slowly varying during the time of control system &# 39 ; s functioning , and flux regulating contour will not have to fulfil any strict conditions for the quality of following the given value of rotor flux φ . in machine in control system represented in fig2 can be simplified . simplification of the scheme means forming stator current component i d , which determines rotor flux , this way : ## equ17 ## where φ d is as machine &# 39 ; s rotor flux modulus ( in coordinate system ( d , q ) which is connected to rotor flux , φ =( φ d , 0 ); k is a constant coefficient . with ( 18 ) in , differential equations of as machine rotor flux becomes ## equ18 ## if the difference φ - φ * is small , or , more precisely , if ( φ - φ )/ φ & lt ;& lt ; 1 , the coefficient before the difference between the measured and set rotor flux value on the right of equation ( 19 ) changes insignificantly , and can be considered constant . the law of variation of the measured rotor flux value , will be near the exponential one with time constant l r / 2φ r r l n k . it is worth noticing that , with the difference between the measured and set flux value large enough , the as machine &# 39 ; s stator current &# 39 ; s component i * d will be limitted through the function of the device for current limitting ; thus , the law for forming component i d * will be ( 18 ) applicable just for small values of the difference between the measured and set flux value . a block - scheme of a simplified device for rotor flux control , which is realised in the above described control system , is represented in fig2 . that simplified device consists of : block 42 , which forms a signal proportional to difference φ - φ *, or signal which is sufficient for fulfilling the condition for current limitting i inst = p 2 ; output signal of block 42 is fed to the inputs of multipliers 1 and 2 , which are included in block 23 of device 14 for forming the set current value , represented in fig1 ; machine &# 39 ; s stator current &# 39 ; s component which is proportional to rotor flux ( second term on the right of ( 18 ), is formed by summing up the components φ . sub . α and φ . sub . β , with output signals of multipliers 1 and 2 of block 28 . block 42 consists of : multipliers 1 and 2 forming a signal proportional to the difference between the measured and set rotor flux value , amplifier 2 being included in dynamic circuit with feedback , which consists of comparator 3 , a switch realized via fet transistor t , and regulated by the relay output signal o 2 of the device for current limitting , represented in fig2 , and an inertial block realized on amplifier 4 . the time constant t of inertial block 4 is selected by the effective working frequency of f 1 which switch over the structure of control system t 1 / r . it was assumed earlier that systems for controlling machine , which are taught in this invention , and represented in fig1 and 2 , contain blocks 4 , 5 , 6 , 7 , 8 , 9 , 10 for obtaining information on torque h , angular position of rotor θ angular velocity of rotor n , angular acceleration ε , magnetic flux of rotor φ , time derivative of rotor flux value e , and rotor flux components φ . sub . α and φ . sub . β . consider now , in more detail , blocks of information 4 ÷ 10 in the cases when they are , in fact , blocks for computing corresponding quantities . the problem of computing the quantities necessary for synthesis of machine control system was already mentioned when the device for limitting machine stator current was explained . for instance the device for stator current limitting , represented in fig1 , contained block 39 which forms the quantity m &# 39 ;= i . sub . α φ . sub . β - i . sub . β φ . sub . α proportional ( with proportionality coefficient ( lh / lr ) to the torque m of machine , and quantity v &# 39 ; which equals the scaler product of rotor flux vector φ , and stator current i of machine v &# 39 ;= i . sub . α φ . sub . β + i . sub . β φ . sub . α . fig2 represents a block - scheme of block 43 which forms the square of rotor flux modulus φ , and the quantity of its time derivative e . block 43 consists of two multipliers 1 and 2 which form the squares of components φ . sub . α 2 and φ . sub . β 2 of rotor flux vector , and two summators . the sum of output signals of multipliers 1 and 2 of block 43 is the square of rotor flux modulus φ ; the sum of quantity φ and quantity v &# 39 ; which is calculated in block 39 of the device for current limiting represented in fig1 , is time derivative e of the quantity φ . sub .. in thise cases the sumation coefficients equal -( r r / l r ) and rr ( l h / l r ) respectively , and are determined by the parameters of asynchronous machine employed . the operation of block 43 is based on the differential equation of machine rotor circuit : ## equ19 ## components φ . sub . α and φ . sub . β of rotor flux can be calculated using the model of machine rotor circuit . differential equations of rotor circuit , written down in relation to the rotor flux components φ . sub . α and φ . sub . β in a stationary coordinate system have the form ## equ20 ## in that way , on the basis of the known ( e . g . measured ): angular velocity of rotor n , and stator current components i . sub . α and i . sub . β , one can calculate components φ . sub . α and φ . sub . β of machine rotor flux . a block - scheme of device 44 for calculating components φ . sub . α and φ . sub . β of rotor flux , is represented in fig2 . the device 44 consists of : two multipliers 1 and 2 , which form quantities p and q : block 45 , which realises the dynamic connections of equations ( 21 ). fig2 represents a more elaborate scheme of block 45 which is included in block 44 for calculating machine rotor flux components φ . sub . α and φ . sub . β . block 45 consists of : amplifiers 1 ÷ 6 , which realize the first ( amplifiers 1 ÷ 3 ), and second ( amplifiers 4 ÷ 6 ) differential equation of the system ( 21 ). for the realization of the device for calculating rotor flux components φ . sub . α and φ . sub . β , which is represented in fig2 , the information on angular velocity n is needed . if the application of a transducer measuring rotor &# 39 ; s angular velocity is not wanted , there can be used the device for calculating components φ . sub . α and φ . sub . β of rotor flux , and the velocity of rotation of rotor n , on the grounds of known ( measured ) components i . sub . α and i . sub . β of stator current , and components u . sub . α and u . sub . β of machine supply voltage , which is represented in fig2 . the function of device 46 for calculating the components φ . sub . α and φ . sub . β of rotor flux and the velocity of rotor &# 39 ; s rotation n , is grounded on bringing sliding mode into the system consisting of an asynchronous machine , and the models of rotor and stator circuits of machien . the stator circuit is described by differential equations ## equ21 ## differential equations of machine rotor circuit ( 21 ) were stated before . the device 46 consists of block 5 modelling machine rotor circuit , reprsented in fig2 ; block 47 modelling machine &# 39 ; s stator circuit , to whose inputs are fed components u . sub . α and u . sub . β of machine voltage vector ; block 48 consisting of multipliers 1 and 2 , whose inputs are the differences between model ( outputs of block 47 ), and measured values of stator current components , and components of machine &# 39 ; s rotor flux ( output signals of block 45 ); a relay element whose input is quantity s -- the difference between output signals of multipliers 1 and 2 ; switches k 1 and k 2 , to whose inverting inputs are fed output signals of the model of rotor circuit 45 , that is components φ . sub . α and φ . sub . β of machine rotor flux ; output signals p and q of switches k 1 and k 2 are fed to the inputs of rotor circuit model 45 ; output signal of device 46 are components φ . sub . α and φ . sub . β of as machine rotor flux which is calculated in block 45 , and output signal of the relay element n &# 39 ;, which contains the informationon on the velocity of rotation of machine . a more detailed scheme of block 47 , which models the machine stator circuit is represented in fig2 . the structure of block 47 is in accordance with differential equations of stator circuit ( 23 ), and is identical to the structure of block 45 , of the model of machine rotor circuit . quantity s is formed in block 46 for computing components φ . sub . α and φ . sub . β of the flux and velocity of rotation of rotor n . represented in fig2 , in the form where δi . sub . α and δi . sub . β is the difference between the calculated ( in block 47 ) and measured components of machine stator current in a stationary coordinate system ; φ . sub . α and φ . sub . β are output signals of block 45 . differentiating by time equation ( 24 ), and using the known differential equations of the models of rotor ( 21 ) and stator ( 22 ) circuit of machine , one can obtain ## equ22 ## where f 1 6 is a continuous function , k 1 6 -- a constant coefficient determined by the parameters of machine applied . to obtain equation ( 25 ) there were used the connections between the input signals p and q of the block , and output signal sign s of relay element and switches k 1 and k 2 of block 48 , included in block 46 . satisfied , sliding mode is possible in the structure switchover area s = 0 . sliding mode established , components of stator current and rotor flux , which are calculated in blocks 47 and 45 included in blck 46 , tend torwards measured values , function f 1 6 tends towards zero , output signal n &# 39 ;= sgn s of relay element equals measured value of velocity of rotor &# 39 ; s rotation ( with a precision determined by high frequency component ). information on velocity of rotor &# 39 ; s rotation n can be obtained using a filter which selects the mean component of output signal n &# 39 ;. analog filter can be used for getting the information on the velocity of rotor &# 39 ; s rotation n , when pulse generator of velocity , or a technogenerator is used . when adequate differentiating filter is used , the information on angular acceleration of machine &# 39 ; s rotor can be obtained . nevertheless , real filter application significantly deforms the information on angular velocity , and angular acceleration of rotor in the range of high frequency components of the spectrum . this fact makes the synthesis of very fast systems for machines control more difficult , by resulting in , for instance , the loss of stability of the control system by the high values of gain of corresponding regulators . at the same time , for the synthesis of the above - described machine &# 39 ; s control systems , represented in fig1 and 2 , the pieces of information on angular velocity and angular acceleration of rotor must be of a quality high enough , as the dynamic non - idealness of different kinds , which are not accounted in the employed mathematical model of system &# 39 ; s process , before all filter slowness , can result in unpermissible drop of working frequency of relay and switching elements which determine the structure of control system . applying a method of parallel correction is suggested for the compensation of dynamical non - idealness of devices for filtering and differentiating . to illustrate this method , fig3 a represents a part of structural scheme of machine , which correspond to the mechanical time constant of the rotor -- the reduced inertial torque j of machine rotor load -- and the desired ( from the point of synthesis of control system ) &# 34 ; ideal &# 34 ; transfer function of filter w o ( which , maybe , cannot be realized ). the output coordinate y of the filter can be for instance velocity of rotation , then w o = 1 , or angular acceleration of rotor , then w o = p . fig3 represents the same part of structural scheme with a filter which can be realized and whose transfer function is denoted by w1 . besides the demand on the physical realizability , filter transfer function w1 can be put on additional conditions , as a result of particularity of the elements applied in control system . for instance , if the velocity of rotation of machine &# 39 ; s rotor n is measured by a pulse generator of velocity , or if it is contained in the information on the mean value of output signal of relay element , which is obtained by the device 46 for calculating components of rotor flux , and velocity of machine &# 39 ; s rotation , represented in fig2 , then filter w1 should filter the pulse of output signal separating the mean component of output signal ; thus the difference between the powers of denomination and numerator polynomial of transfer function w1 should be at least 1 . to compensate the existing dynamical non - idealness , application of the filter with transfer function w2 , which physically can be realized , is suggested , and to its input is fed the difference between the electrical torque m , and load torque m l of as machine . if conditions of componsating dynamical non - idealness are fulfilled ## equ23 ## the total transfer function of the circuit , the function represented in fig3 b , coincides with the ideal transfer function of the circuit , the function represented in fig3 a . the output signals of the above mentioned circuits will coincide , with a precision up to , maybe , damping component of the transient , which can appear because of the different initial conditions of output signals of the filters . if load torque m l of the machine is not being measured , the input of filter w2 can be a signal proportional to the machine &# 39 ; s torque m , measured by a transducer , or by the devices for torque calculation described earlier . in that case transfer function w2 should comply with the additional condition ## equ24 ## satisfying the condition ( 28 ) is reached through the adequate selection of transfer function w1 , accounting for the condition of the possibility of its physical realization , and the condition of compensating dynamic non - idealness ( 27 ). as transfer function w2 , defined by the expression ( 28 ), complies with the condition of compensating non - idealness ( 27 ), and when m = 1 , filter gain , with transfer function w2 as a constant component of input signal , equals zero , then , obviously both discussed cases of filter w2 use are equivalent , if load torque m 1 of the machine is constant , or changes slowly enough . fig3 represents a circuit for device 49 for calculating rotor &# 39 ; s angular velocity n , and angular acceleration ε , which employes ( 49 ) the method of parallel correction . the input of device ( 49 ) is the output signal of velocity filter generator , which has time constant t , and which describes generator &# 39 ; s inertness , or the inertial block for filtering high frequency signal of angular velocity transducer ( of interferences or high frequency impulses ), and the signal proportional to the machine &# 39 ; s torque m . the device 49 consists of active filters , realized via amplifiers 1 , 2 , 4 , and summators realized via amplifiers 3 , 4 , which realize filtering and correction of transfer functions of filters . time constants of the filters of the device 49 realized via amplifiers 1 and 4 , must equal one another , and time constant of the filter realized via amplifier 2 must be equal to the time constant of t filter , which characterizes the inertness of the transducer , or of the convertor of angular velocity transducer &# 39 ; s pulses . the condition of equality of corresponding time constants follows from the condition ( 27 ). when realizing the device 49 , there can appear the technical difficulties of selecting equal time constants of corresponding filters , and measuring them precisely , which is explained by e . g . significant differences between the values of parameters of capacitors employed . fig3 represents a block - scheme of a device 50 for calculating rotor &# 39 ; s angular velocity n , and angular acceleration ε , which uses the method of parallel correction , which does not require an exact selection of values of filter time constants . the device 50 , represented in fig3 , consists of : two inertial blocks with time constants t 1 and t 2 , and a summator , while damping , differentiating , and correcting the signals are effectuated by the same filters t 1 , t 2 , which explains the freedom in selecting their time constants . the input signals of the device 50 , are the direct signals from the transducer of rotor &# 39 ; s angular velocity ( when pulse generator is applied , the input of device 50 is , for instance , pulse output signal of the device for forming standard length pulses ), or output signal of relay element n &# 39 ;= sgn s of the device 46 for calculating the components of rotor flux , and angular velocity of the rotor , represented in fig2 , and signal m &# 39 ;, proportional to the torque of machine , which is computed , for instance using block 39 represented in fig1 . output signals of the device 50 are rotor &# 39 ; s angular velocity n , and angular acceleration of the machine &# 39 ; s rotor . although the description in the sugested patent was done through the concrete examples , and according to the concrete realization , it does not exclude amendments and other apparent modifications , which do not change the essence , and which stay within the limits of the given invention .	7
other objects , features and advantages of the invention will become apparent from a consideration of the following detailed description and the accompanying drawings . referring to fig1 and 2 , it can be understood that the present invention is embodied in a sealed filtration system 10 which comprises a sealed housing 12 that is portable and which can be used in large and / or small bodies of water . the submersible / nonsubmersible nature of the housing 12 makes it inconspicuous in use . housing 12 includes a first end wall 14 having an inner surface 16 and an outer surface 18 , a bottom rim 20 and a top rim 22 . a second end wall 24 has an inner surface 26 and an outer surface 28 , a bottom rim 30 and a top rim 32 . end walls 14 and 24 are parallel with each other and co - extensive . a longitudinal axis 36 extends between the first end wall 14 and the second end wall 24 and defines a length dimension for the housing 12 . housing 12 further includes a first side wall 38 having an inner surface 40 and an outer surface 42 , a bottom rim 44 and a top rim 46 . housing 12 further includes a second side wall 50 having an inner surface 52 and an outer surface 54 , a bottom rim 56 and a top rim 58 . the side walls 38 , 50 are also parallel with each other and are coextensive with each other . a transverse axis 60 extends between the first side wall 38 and the second side wall 50 and a width dimension for housing 12 is defined along the transverse axis 60 . the top rims 22 , 32 , 46 , 58 of the first end wall 14 , the second end wall 24 , the first side wall 38 and the second side wall 50 are all coplanar with each other and together define a housing top rim 62 . the bottom rims 20 , 30 , 44 , 56 of the first end wall 14 , the second end wall 24 , the first side wall 38 and the second side wall 50 are all coplanar with each other and together define a housing bottom rim 64 . a height dimension h extends between the housing top rim 62 and the housing bottom rim 64 . a housing top 66 has an inner surface 68 and an outer surface 70 and is supported on the housing top rim 62 when covering the housing 12 . housing top 66 is removable to provide access to the interior volume of the housing 12 as will be understood from the following disclosure . when in place , top 66 seals the housing 12 so fluid cannot bypass the fluid filter circuit of the system by entering the housing 12 between the top 66 and the rest of the housing 12 . a lock system 72 is located on the outside surface 42 of the first side wall 38 and on the housing top 66 and locks the housing top 66 to the first side wall 38 when the housing top 66 is in position on the housing 12 . the lock 72 attaches the housing top 66 to the side and end walls 14 , 24 , 38 , 50 in a watertight manner . an inlet port 78 is defined through the first end wall 14 adjacent to the top rim 22 of the first end wall 14 . a fluid conduit 80 is fluidically connected to the inlet port 78 and a quick disconnect joint 82 is fluidically connected to the inlet port 78 via fluid conduit 80 . a further fluid conduit 84 is also connected to the quick disconnect joint 82 for a purpose that will be understood from the following discussion . an outlet port 86 is defined through the second end wall 24 adjacent to the bottom rim 30 of the second end wall 24 . a fluid conduit 88 is fluidically connected to the interior of the housing 12 via the outlet port 86 and a quick disconnect joint 90 is fluidically connected to the outlet port 86 via fluid conduit 88 . a further fluid conduit 92 is fluidically connected to quick disconnect joint 90 . as will be understood from the teaching of the present disclosure , fluid flows into the interior of the housing 12 via the inlet port 78 and the associated fluid conduits and then flows out of the interior of the housing 12 via the outlet port 86 and the fluid conduits associated with the outlet port 86 . a plurality of drain ports 100 are defined through the first side wall 38 adjacent to the bottom rim 44 of the first side wall 38 . the drain ports 100 are spaced apart from each other along the longitudinal axis 36 of the housing 12 . a grate 102 is located adjacent to the inner surface of the bottom wall and is spaced apart from the inner surface of the bottom wall along the height dimension h of the housing 12 . the grate 102 has a multiplicity of liquid drain holes 104 defined there - through and is attached to the inner surface 16 of the first end wall 14 , to the inner surface 26 of the second end wall 24 , to the inner surface 40 of the first side wall 38 and to the inner surface 52 of the second side wall 50 to be supported in position on the housing 12 . a collection chamber 106 is defined between the grate 102 and the inner surface of the bottom of the housing 12 . the collection chamber 106 is fluidically connected to each of the drain ports 100 of the housing 12 . a first dividing wall 110 is located between the first end wall 14 and the second end wall 24 and is attached to the inner surface 40 of the first side wall 38 and to the inner surface 52 of the second side wall 50 and extends across the entire width of the housing 12 to divide the housing 12 as will be understood from the following discussion . the first dividing wall 110 has a top end 112 which is coplanar with the housing top rim and a bottom end 114 which located closely adjacent to the grate 102 and is superadjacent to the collection chamber 106 . a second dividing wall 116 is located between the second end wall 24 and the first dividing wall 110 and is spaced apart from the first dividing wall 110 along the longitudinal axis 36 of the housing 12 . second dividing wall 116 is attached to the inner surface 40 of the first side wall 38 and to the inner surface 52 of the second side wall 50 to extend completely across the width of the housing 12 . the second dividing wall 116 has a bottom end 120 fixed to the inner surface of the bottom wall of the housing 12 and a top end 122 spaced apart from the top rim 62 of the housing 12 . top end 122 of second dividing wall 116 is located between the top rim 62 of the housing 12 and the bottom rim 64 of the housing 12 and extends through the grate 102 and forms a wall 124 in the collection chamber 106 . wall 124 is impervious to fluid and drain ports 100 are located on both sides of wall 124 so chamber 106 can be fully drained . a flow chamber 130 is located between the first dividing wall 110 and the second dividing wall 116 and extends from the grate 102 adjacent to the bottom end 114 of the first dividing wall 110 to the top 122 of the second dividing wall 116 . a first filter chamber 132 is located between the inside surface 16 of the first end wall 14 and the first dividing wall 110 and between the grate 102 and the housing top rim 62 . first filter chamber 132 includes a first liquid permeable filter - supporting shelf 134 fixed to the first dividing wall 110 and to the inside surface 16 of the first end wall 14 and to the inside surface 40 of the first side wall 38 and to the inside surface 52 of the second side wall 50 . first filter - supporting shelf 134 is spaced apart from the grate 102 along the height dimension h of the housing 12 and extends in a direction which is parallel to the grate 102 . a first filter media - containing chamber 138 is defined between the first filter supporting shelf 134 and the grate 102 and between the first end wall 14 and the first dividing wall 110 and between the first side wall 38 and the second side wall 50 . a second liquid permeable filter - supporting shelf 140 is fixed to the first dividing wall 110 and to the inside surface 16 of the first end wall 14 and to the inside surface 40 of the first side wall 38 and to the inside surface 52 of the second side wall 50 . second filter - supporting shelf 140 is spaced apart from the first filter - supporting shelf 134 toward the top rim 62 of the housing 12 along the height dimension h of the housing 12 and extends in a direction which is parallel to the first filter - supporting supporting shelf 134 . the second filter - supporting shelf 140 is located immediately subadjacent to the inlet port 78 of the housing 12 . a second filter media - containing chamber 142 is defined between the first filter - supporting shelf 134 and the second filter - supporting shelf 140 and between the first end wall 14 and the first dividing wall 110 and between the first side wall 38 and the second side wall 50 . a fluid inlet chamber 144 is defined between the second filter - supporting shelf 140 and the top rim 62 of the housing 12 and is fluidically connected to the inlet port 78 of the housing 12 to receive fluid therefrom . a second filter chamber 150 is located between the inside surface 26 of the second end wall 24 and the second dividing wall 116 and between the grate 102 and the housing top rim 62 . first dividing wall 110 is spaced apart from second dividing wall 116 and defines therebetween a flow chamber 154 fluidically connecting the first filter chamber 132 to the second filter chamber 150 via drain holes 104 through the grate 102 . a drain plug 160 is removably mounted in each drain port 100 . first mechanical filter medium 170 is located in the first filter media - containing chamber 138 and a first biological filter medium 172 is located in the second filter media - containing chamber 142 . other forms of filter media can be used and both chambers can contain mechanical filter media , or both chambers can contain biological filter media , or the like without departing from the scope of the present disclosure as will be understood by those skilled in the art . a submersible liquid pump 180 is located in the second filter chamber 150 and is supported on the grate 102 . pump 180 is powered from a power source via a cord p . liquid pump 180 includes an inlet 182 which is fluidically connected to the second filter chamber 150 and an outlet 184 which is fluidically connected to the outlet port 86 of the housing 12 . an inlet pump system 190 is also included in the system 10 and includes an inlet 192 fluidically connected to a body of liquid to be filtered , an outlet 194 fluidically connected to the inlet port 78 of the housing 12 , a filter chamber 196 fluidically interposed between inlet 192 of the inlet pump system 190 and outlet 194 of the inlet pump system 190 . power for pump system 190 is supplied via a cord p 1 from a suitable power source . a base element 197 supports housing 198 of the inlet pump system 190 . ports 200 control flow through pump system 190 and ports 202 are also included to further control flow through pump system 190 . a filter medium 206 is located in the filter chamber 196 of inlet pump housing 198 . a fluid connection element 210 connects outlet 194 of inlet pump system 190 to conduit 84 and hence to quick disconnect joint 82 and to the inlet port 78 of the housing 12 . as indicated by flow arrows f in fig2 flow enters housing 12 via inlet port 78 from pump system 190 , flows through the various filter media where both physical and chemical impurities are removed , with the various filter media removing specific portions of the impurities , then into chamber 106 where sludge or the like is deposited to be removed via drain holes 100 during cleaning and / or servicing of the system 10 , then via holes 104 in grate 102 to flow chamber 154 and over wall 116 into chamber 150 and then to pump 180 and via pump 180 to outlet port 86 . further sludge or large particles can settle through grate 102 via the holes 104 in the grate 102 into chamber 106 for later removal via drain ports 100 . pump 180 works in conjunction with pump system 190 to move liquid into and through housing 12 in the manner just described whereby impurities are removed from that liquid before it is discharged via housing outlet port 86 and conduit 92 . whereas most filter systems use high pressure to pump fluid through a media , the system of the present invention pulls the fluid across a media substantially similar to the manner in which a natural aquafer system uses the earth to purify water . in other words , the system of the present invention uses fluid flow rate over media , not pressure through media , to remove contaminants . it is understood that while certain forms of the present invention have been illustrated and described herein , it is not to be limited to the specific forms or arrangements of parts described and shown .	1
as shown in fig1 and 2 , the apparatus of my invention mounts to a standard professional thirty - five millimeter motion - picture camera 10 , which has a left side wall or bulkhead 11 . in this side 11 there is formed a cutout 12 , whose inner edge 13 is shown in dashed lines . the camera 10 typically is fitted with a lens 14 , tripod 15 , and film magazine 16 . in the absence of my invention , the cutout 12 is typically occupied by a door ( not shown ) which hinges at the front of the cutout and carries a fixed viewfinder . the standard , fixed viewfinder conducts an image from a ground glass , just inside the door near the front of the camera , through a port in the door to a reflector just outside the door -- and thence through a viewfinder tube ( mounted to the outside of the door ) to an ocular mounting port toward the rear of the camera . in some motion - picture cameras the ground glass is at the top , rather than the side , of the camera -- but still very near the front . a deflecting prism or mirror above the ground glass directs light rays from the image on the glass to the side of the camera . from that point on , the finder geometry is generally as described above for cameras with the ground glass located at the side . to either of such standard configurations a conventional &# 34 ; video door &# 34 ; simply adds a beam splitter , partway along the door , for deflecting some of the light upward to a video camera . my accessory invention is shown generally at 20 . attached to the accessory 20 as illustrated in fig2 are a small video camera 17 and an ocular 18 with its eyecup 19 . my invention includes a mounting plate 21 ( fig1 ) that serves in place of the standard door or &# 34 ; video door .&# 34 ; as best shown in fig4 and 5 , the plate 21 carries half - hinges 41 that engage mating half - hinges ( not illustrated ) just inside the cutout 12 near the front of the camera . attached to the mounting plate 21 , and thus effectively to the side of the motion - picture camera 10 , is a case 22 ( fig1 ). through a port ( not shown here ) in the plate 21 , the case 22 receives light from the ground glass of the motion - picture camera . at the rear of the case 22 is a video attachment port 23 , including a neutral - density filter and control 24 as well as a suitable lens - and - iris combination 25 . the lens and iris 25 are adapted to form on the light - sensitive surface of the video camera an image of proper focal properties and intensity for operation of the video camera . a viewfinder tube 26 is pivoted at one end , by a generally light - tight swivel joint 46 , to the case . within the finder tube 26 , as will be detailed shortly , light is received from the case 22 and redirected to the far end of the tube -- and into the ocular 18 , when present . along the way , the light passes through a filter - wheel housing 27 and a reducing - lens housing 28 , which in effect form the remote end of the viewfinder tube 26 ( fig3 ). a knurled lock ring 29 ( fig1 ) is provided at the remote end of the reducing - lens housing 28 for attachment of the user &# 39 ; s own ocular 18 . operationally mounted at the bottom of the filter - wheel housing 27 is a control wheel 131 &# 34 ; or other suitable control device , for operating a filter wheel within the housing . through manipulation of the control wheel 131 &# 34 ; the operator may position either of two optical filters in the optical path of the viewfinder -- or may select a &# 34 ; clear filter &# 34 ; ( that is to say , a clear piece of glass ) that is also mounted in the wheel , if no filtering is desired ; or an opaque section of the wheel 131 when it is desired to prevent light from entering the finder . mounted for good visibility at the user &# 39 ; s side of the filter - wheel housing 27 is an indicator device 35 , with suitable indicia 36 , for displaying what condition of the filter wheel has been selected . a control rod 33 extends upward through a slot 34 formed in the top of the reducing - lens housing 28 . with this control the operator can slide a reducing - lens mounting block 33 &# 39 ;, which is within the housing 28 , into or out of the light path -- as preferred for viewing all or only part of the scene being photographed . some further details of external construction appear in fig4 and 5 . as shown there the construction of the case 22 includes several plates , particularly the outermost panel 62 from which the tube 26 is pivoted , and top panels 42 and 43 . the latter are readily removable -- after loosening respective groups of mounting screws 44 and 45 -- for cleaning , adjustment or maintenance of the optics within . optical elements within the case 22 include the amici prism 109 , the beam splitter 113 , and the upward deflecting prism 116 . conventional optical mounts and retaining elements ( not shown ) are used within the case . at this point it will be helpful to consider the overall optical system as shown in fig1 . on the ground glass 101 , which is within the motion - picture camera , there appears an image 102 of the scene being photographed with the camera . light from the image 102 enters the amici prism 109 , which turns the light through a right angle and directs it rearward to the beam - splitting prism 113 . within this two - piece prism 113 is a half - silvered diagonal facet 114 that passes approximately half of the light on rearward to the ninety - degree / forty - five - degree prism 116 . this prism 116 simply deflects the light upward through the neutral - density filter 117 and the lens 118 ( and iris , not shown ) to the video camera 17 . the half - silvered facet 114 in the beam - splitter prism 113 reflects most of the remaining half of the light from the amici prism outward -- roughly parallel to the original light path from the ground glass 101 , but offset rearward . if it is desired to divide the light energy unequally , between the viewfinder and video camera , the facet 114 may be silvered at some other fraction than half . further , as is known to those skilled in the art of optical systems , the beam splitter 113 need not necessarily be a prism such as here illustrated and discussed , but may instead be some other type of splitter such as , for example , a partially metallized pellicle plate . well - known performance or maintenance disadvantages , however , usually accrue from such a substitution . the outward - directed light from the splitter 113 next reaches another ninety - degree / forty - five - degree prism 124 . this prism 124 is fixed within the pivoting viewfinder tube 26 ( fig1 and fig3 through 5 ), and so rotates with that tube . the prism 124 deflects the light from the beam splitter 113 through another ninety - degree angle and along the axis of the finder tube . there the light passes through a relay lens 125 , pechan prism 126 , either of two color filters 133 or a &# 34 ; clear filter &# 34 ; 134 , reducing lens 135 if present , and ocular 137 to the user &# 39 ; s eye . the clear filter 134 ( rather than simply an empty , open port ) should be provided in the wheel for unfiltered viewing , to avoid displacement of the focal plane upon movement of the color filters 133 into or out of the optical path . an opaque section 131 &# 39 ; of the wheel 131 is needed so that the operator can set the wheel to prevent light from entering the camera through the viewfinder , when the operator &# 39 ; s face is not present to block the ocular . although it is perhaps instinctive to think of the viewfinder tube and its components as pivoting while the case and its components are stationary , in fact the purpose of the accessory is to facilitate exactly the opposite usage . that is to say , in use the operator wishes to hold the finder tube at an approximately constant height while the camera and the attached accessory case pivot . ( in certain portions of this disclosure and the appended claims it is more logical and communicative to describe the tube and its contained components as pivoting while the case remains stationary . in other portions of the disclosure and claims it is more appropriate to reverse the convention . it is to be understood that these modes of description are equivalent .) thus all of the optical elements 109 through 118 that are within the case will pivot , with the motion - picture camera , relative to all the optical elements 124 through 137 that are within the viewfinder tube . in fig1 this motion is symbolized by a curved , broad double - headed arrow 121 at the point of relative rotation -- that is , between the beam splitter and the ninety - degree / forty - five - degree prism 124 . selective operation of the filter wheel 131 is similarly indicated in the drawing by another like arrow 132 . selective movement of the reducing lens 135 out of or into the optical path is represented by a linear double - headed arrow 136 . as suggested in fig1 , the image 102 on the ground glass of the motion - picture camera is upside - down , but as in a conventional nontilting finder an inversion is necessarily performed by the relay lens 125 . consequently if there were no other inversions anywhere in the system the image would be right - side - up at the ocular 137 -- and , as the latter does not invert , the user would see the scene right - side - up . it is therefore important that the number of inversions occurring in all other elements of the system be an even number -- so that the image at the ocular will be right - side - up . at least one other inversion does necessarily occur , for the following reason . as mentioned earlier , the prism 124 in the finder tube must rotate with that tube . if the light entering the prism 124 contains , for example , a thin vertical image , and the prism 124 is turned to deflect the light rearward , the light leaving the prism 124 contains an image that is likewise vertical . this image can be seen by a person standing behind the apparatus and looking into the prism 124 from the rear along a horizontal path -- with suitable focusing , such as relay lens 125 -- and it will be seen as vertical . this can be understood by studying respective parallel light rays 104f , 103f from the top and bottom tips of the vertical image : these rays will strike the forty - five - degree reflecting facet of the prism 124 at two points 122 , 123 that are along a vertical line in that facet , and they will both be reflected through horizontal ninety - degree angles as illustrated and leave the prism 124 as rays 104g and 103g -- with 104g still at the very top and 103g still at the very bottom , just as shown in fig1 . on the other hand , suppose that the camera , accessory case , and optical elements 101 through 118 are rotated through a full ninety degrees to point the camera lens straight downward toward the ground . it is further assumed that the camera is pointed at a thin object which is on the ground but aligned &# 34 ; vertically &# 34 ; in the sense that the image on the film will appear vertical . now a person standing behind the apparatus and still looking into the prism 124 from the rear along a horizontal path -- and still with necessary focusing -- will see the thin image as horizontal . this can be understood by again following the two parallel rays 104f and 103f from the &# 34 ; top &# 34 ; and &# 34 ; bottom &# 34 ; tips of the image . under the circumstances just described , the beam splitter 113 is turned -- with the camera -- so that the &# 34 ; vertical &# 34 ; image is actually horizontal as it enters the ninety - degree / forty - five - degree prism 124 . the &# 34 ; bottom &# 34 ; ray 103f will be to the right ( as drawn in fig1 ) of the &# 34 ; top &# 34 ; ray 104f , and will have to travel farther than the &# 34 ; top &# 34 ; ray 104f to reach the reflective forty - five - degree facet of the prism . the rays will therefore be offset from one another horizontally as viewed by the user . since they are now assumed to enter the prism 124 aligned horizontally , however , after a horizontal reflection in the prism 124 they will not be offset from one another vertically as seen by the user . from considering these two extreme cases it will be understood that tilting the camera , the accessory case 124 and the components within the case through a ninety - degree angle -- while holding the finder tube at constant height -- has the effect of twisting , so to speak , the observed image through the same angle . smaller tilt angles produce a proportionate twist angle . it would be extremely awkward to use a tilt viewfinder that was subject to such rotation of the image about the optical path whenever the camera was tilted . it is for this reason that the pechan prism 126 is included in the system . this prism has the property of twisting the image about the optical path in proportion to rotation of the prism about the optical path . consequently provision must be made for rotating the prism by just the right amount to counterrotate the image back through the twist angle introduced by relative rotation between the beam splitter 113 and the ninety - degree / forty - five - degree prism 124 . this mechanical arrangement will be detailed shortly , but for present purposes the point to note is that the pechan prism happens to have an additional property that is important : it introduces an inversion of the image . this inversion is suggested in the enlarged view of the pechan prism in fig1 : ray 103h entering the prism near the top exits as lower ray 103i , while ray 104h entering the prism near the bottom leaves as upper ray 104i . these same relationships appear in fig1 . as already noted , the total number of inversions permitted in the system -- other than the inversion at the relay lens 125 -- must be even . the pechan prism introduces just one inversion , so another inversion is required . the amici prism supplies this added inversion . fig8 through 10 , considered in conjunction with fig1 , may be helpful to an understanding of the operation of the amici prism 109 . the amici prism 109 has a rather complicated shape , which is further confused by the fact that in my invention two of its corners 213 , 214 are advantageously cut off to help fit the prism 109 into the case 22 . removal of these two corners 213 , 214 leaves plane facets 213 &# 39 ;, 214 &# 39 ; that are not optically functional and need not be of optical quality . likewise the top , rear , and bottom surfaces 212 , 217 , 218 need not be finished . the amici prism 109 has two large planar facets 212 , 212 &# 39 ;, one above and one below its vertical midplane , which are used for internal reflection of light rays . these facets , each angled at forty - five degrees to the vertical , meet each other at a ninety - degree angle along a horizontal line -- which may be helpfully regarded as a &# 34 ; folding &# 34 ; line , since in a sense that will be appreciated shortly the image is &# 34 ; folded &# 34 ; vertically at this line . in my invention light enters the prism through the vertical end face 209 and strikes either the upper or lower forty - five - degree facet 212 or 212 &# 39 ;-- depending , simply , upon the height and angle of each particular ray . it is easiest to conceptualize what happens to rays that are &# 34 ; horizontal &# 34 ;-- that is , parallel to the top and bottom facets 211 and 218 of the prism . such a ray that strikes the upper forty - five - degree facet 212 will be deflected downward to the lower forty - five - degree facet 212 &# 39 ;, and vice versa . both rays are then again reflected by the second facet encountered , back into horizontal paths . rays near the centerline ( the folding line ) 215 of the prism remain near that line , and rays near the vertical extremes of the prism remain near the vertical extremes , but in both cases the upper and lower rays exchange heights . though it may not be intuitively as clear , rays that are not horizontal are similarly returned by two reflections at the forty - five - degree facets 212 , 212 &# 39 ;, preserving their angles to the horizontal ( with an inversion ), and preserving the relative relationships between all the rays ( within the accuracy of the ninety - degree angle at the folding line 215 between those two facets ). in overall net effect , consequently , the amici prism introduces an image inversion . at the same time , however , if both rays impinge on the forty - five degree facets of the prism at a forty - five degree angle in the horizontal plane , they are turned through a horizontal angle too . thus , in addition to providing the needed inversion , as previously stated the amici prism deflects the outward - directed light from the ground glass rearward , with respect to the camera . this double action is illustrated in fig1 , which traces the progress through the entire system of horizontal rays 103 from the top and 104 from the bottom of the ground glass 101 . upper ray 103 strikes the upper forty - five - degree facet 212 of the amici prism 109 at point 105 , where it is deflected as ray 103a downward and laterally within the prism to strike the lower forty - five - degree facet 212 &# 39 ; at point 107 . from this second internal reflection the ray leaves the prism as lower ray 103b . conversely the lower ray 104 strikes the lower forty - five - degree facet 212 &# 39 ; of the amici prism 109 at point 106 , where it is deflected as ray 104a upward and laterally within the prism to strike the upper forty - five - degree facet 212 at point 108 . from this second internal reflection the ray leaves the prism as upper ray 104b . these two rays next enter the beam - splitter prism , which divides their energy between video - camera path and the viewfinder path without altering their relative orientation . more specifically , the upper ray 104b entering the beam splitter becomes both the upper ray 104c entering the video - tap deflector prism 116 and the upper ray 104f entering the viewfinder deflector prism 124 ; and similarly for the splitting of the lower ray 103b into lower rays 103c and 103f . a difference in orientation does , however , arise in the video - tap deflector prism 116 . here the upper ray 104c travels further to the deflector &# 39 ; s forty - five - degree facet , which it strikes at a point 115 near the rear of the prism , than does the lower ray 103c , which strikes at point 114 near the front of the prism . thus the image may be considered to undergo a twist through ninety degrees at this prism ; however , since the orientation of the video camera 17 about the optical axis is controllable arbitrarily , this twisting is inconsequential . now considering the viewfinder part of the system , upper and lower rays 104f and 103f entering the deflector prism 124 strike the reflecting forty - five - degree facet at points 122 and 123 respectively , and -- subject to relative rotation 121 as already explained -- proceed as upper and lower rays 104g and 103g to the relay lens 125 . this lens 125 reimages with an inversion , so that the entering upper ray 104g leaves the lens 125 as the lower ray 104h ; while conversely the entering lower ray 103g leaves as the upper ray 103h . the pechan prism 126 too introduces an inversion -- plus - or - minus a twist of as much as ninety degrees , or even more . the size of the twist varies with the relative rotation 121 of the two halves of the optical system as already explained . thus the upper ray 103h entering the pechan prism 126 exits as the lower ray 103i , while the lower ray 104h entering exits as the upper ray 104i . since none of the other elements in the system affects the image orientation as such , the upper ray 104i leaving the pechan prism 126 passes onward as the upper ray 104j into the reducing lens 135 ( if it is moved into the beam ) and the ocular 137 , and as the upper ray 104k between the ocular and the user &# 39 ; s eye . similarly the lower ray 103j from the pechan prism continues as the upper ray 104j , 104k into and out of the ocular . with this understanding of the optical system in mind , it remains to discuss certain mechanical details of my invention . those that are essentially external appear in fig4 and 5 . an adjustable knurled ring 46 controls the amount of frictional drag in the pivoting of the finder tube 26 relative to the case 22 . a desired setting of the friction control ring 46 , once found , can be maintained by tightening a locking lever 47 against a locking tab 48 . the finder tube 26 is made up of sections 51 , 52 , 54 , that are held together and to the filter - wheel housing 27 by screws 53 and 55 . similarly , the filter - wheel housing 27 is made up of two sections that are held together by screws 56 , and the reducing - lens housing 28 has a cover that is held to the body of the housing by screws 57 . as suggested in fig3 and 7 , the reducing lens 135 is out of the optical path when the control rod 33 is positioned at the outboard side of the lens housing 28 . when the user slides the rod 33 to the other end of its slot 34 , in line with the ocular mounting port 32 , the attached lens 135 correspondingly moves into place to reduce the image as seen at the ocular . fig6 illustrates the mounting and inner mechanics of the finder tube . in this drawing the cover surfaces are cut away at 202 and 203 . first it may be noted that the outermost plate 62 of the case 22 is apertured at 65 , for passage of light from the beam splitter 113 ( fig4 and 13 ) into the finder tube . fixed to the outside of the plate 62 , by screws 68 that are threaded into the plate 62 , is a mounting ring 67 . this mounting ring is aligned with the aperture 65 , and provides a ledge for attachment of a ring gear 84 : the gear is formed as a cylinder 81 with a flange 82 , and a mounting screw 83 passes through the flange 82 into the ledge of the mounting ring 67 . the internal cylindrical surface 81 &# 39 ; of the ring gear 84 serves as a continuation of the aperture 65 for the purpose of passing light from the beam splitter to the deflecting prism 124 in the viewfinder tube 26 . adjacent to the mounting ring 67 that is fixed to the plate 62 is a corresponding mounting ring 73 that is fixed to and is part of the viewfinder tube . the tube mounting ring 73 carries an outwardly projecting peripheral flange 73f . this external flange 73f is captured behind an internal flange 71 of a friction ring 69 , which is threaded at 72 to the periphery of the plate mounting ring 67 . as illustrated , the flange 73f is preferably protected from the plate mounting ring 67 -- and particularly from the edges of the counterbores for the mounting screws 68 in that ring -- by a washer 66 . tightening the friction ring 69 , by threading it further onto the plate mounting ring 67 , increases the friction or drag between the tube mounting ring 73 and the flange 71 of the friction ring 69 . the operator can use this variable drag to stabilize the relative angular position of the tube and case when desired , while permitting movement when desired . within the tube 26 , a conventional retainer plate 201 is provided to hold the prism 124 in place . the ring gear 84 has forty - seven - degree teeth . engaged with these teeth is a spur 75 , that is rotatably pinned to a forty - seven - degree pedestal formed at the interior edge of the plate mounting ring 73 . the spur teeth ( or equivalent ) are also engaged with forty - seven - degree teeth of another ring gear 85 , which is mounted for rotation within a ring bushing 88 . the reason for departure of the teeth and pedestal from the more natural forty - five - degree angle is that the viewfinder tube 26 actually is not parallel to the outboard plate 62 of the case 22 but angled outward slightly -- four degrees , to be exact -- so that it is further from the case at the rear than at the front . this small angle , together with an additional angle of about six degrees between the mounting plate 21 and the outboard plate 62 of the case , causes the viewfinder tube 26 to swing outward from the camera whenever the camera is tilted downward or upward . this outward swinging action is desirable to provide additional clearance between the operator &# 39 ; s head and the film magazine and video camera mounted to the top of the motion - picture camera , and other bulky attachments that may be mounted to the underside of the motion - picture camera . since there is a four - degree angle between the case and tube , the &# 34 ; corner &# 34 ; around which the motion must be transmitted contains an &# 34 ; extra &# 34 ; four degrees -- that is to say , it is a ninety four - degree corner . the extra four degrees is simply shared , at the two sides of the spur 75 , with both of its meshing ring gears 84 and 85 . hence each of the three meshing elements has forty - seven - degree teeth or equivalent . here again , the ring gear 85 is formed at one end of a cylinder 86 , whose inner surface 86 &# 39 ; serves as an aperture for passage of the light between the deflector prism 124 and the relay lens 125 . at the other end of the cylinder 86 is a third ring gear 87 . when the finder tube 26 is pivoted relative to the plate 62 , the spur 75 is forced to roll around the outside of the first - mentioned ring gear 84 , which is stationary relative to the plate 62 . in rolling around the stationary ring gear 84 while in mesh with both of the first two ring gears 84 and 85 , the spur 75 forces the second ring gear 85 to rotate about its own axis . thus the spur accurately transfers the pivoting of the tube into rotation of the second ring gear 85 . this rotation of the second ring gear 85 is transmitted through the body of the cylinder 86 to the third ring gear 87 , at the remote end of the cylinder 86 . engaged with and turned by the third ring ring 87 is a planetary element 97 , which in the illustrated embodiment is a planetary gear . the planetary 97 is pinned at 92 to the periphery of a stepped barrel 91 , 94s , 94 . this barrel has two sections of different diameters -- one section 91 that is nearer the third ring gear 87 and that is of relatively small diameter , and another section 94 that is nearer the filter - wheel housing 27 and that is of relatively large diameter . these two sections 91 and 94 are interconnected by an annular step or ledge 94s , and the barrel is mounted for rotation within a ring bushing 96 . the bush 96 is held fixed within the tube by a setscrew 97 . fixed to or integral with the bushing 96 is a fourth ring gear 95 , which is thus also fixed with respect to the viewfinder tube 26 . engaged with this fourth ring gear 95 is the planetary 97 mentioned earlier . in forcing the spur 97 to rotate , the third ring gear 87 also forces the spur 97 to roll around the fixed fourth ring gear 95 . this motion of course requires that the axis of rotation of the spur -- that is , the pin 92 -- revolve bodily about the optical path . the pin 92 , being embedded in the smaller - diameter section 91 of the barrel 91 - 94s - 94 , forces the barrel to revolve about its own axis . as previously mentioned , such a drive causes the barrel 91 - 94s - 94 to rotate through just half the angle of rotation of the third ring gear 87 . thus the barrel rotates through exactly half the angle of pivoting of the finder tube 26 relative to the case 22 . mounted within the larger - diameter section 94 of this barrel is the pechan prism 126 , which is thus forced into rotation through an angle equal to half the angle of pivoting of the tube 26 relative to the case 22 . the relay lens 125 too is mounted within the barrel 91 - 94s - 94 , but only for convenience since the lens 125 need not be rotated . on the other hand , as the lens 125 is cylindrically symmetrical its rotation does not interfere with performance of the system . at the remote end of the viewfinder tube proper 26 is the filter - wheel housing peripheral wall 27 . this peripheral wall 27 overlaps the finder tube proper 26 -- and is secured to it and to the bulkhead 27a of the filter - wheel housing by screws 98 . formed in the bulkhead 27a is an aperture 27b for passage of the light beam . also desirable are a suitable detent mechanism ( not shown ) to hold the filter wheel 131 in any selected position , a control wheel 131 &# 34 ; or other control device for the operator &# 39 ; s use in rotating the wheel 131 , and an indicator 35 of any suitable kind with an operational linkage ( not shown ) to the filter wheel as necessary . the detent , control device , and indicator linkage if required may all be conventional . secured to or integral with the bottom of the reducing - lens housing 28a is a dovetail track 28c or other suitable guideway for the reducing - lens holder 33 &# 39 ;. if preferred the reducing - lens holder 33 &# 39 ; may be movably mounted in any other suitable fashion -- e . g ., pivoted to swing in and out of the optical path . the reducing lens 135 is mounted within this holder 33 &# 39 ;, and the reducing - lens control rod 33 is mounted to the top of this same holder 33 &# 39 ; and as previously described projects upward through the slot 34 ( fig3 ) in the housing cover 28 . at the remote end of the reducing - lens housing 28a is an extended cylindrical port 28b , which terminates in an external flange 28c . loosely surrounding this port and flange 28b , 28c is an internally threaded mounting ring 29 for direct attachment to the user &# 39 ; s ocular . the mounting ring 29 has at its nearer edge an internal flange 29a ; and a washer 99 is captured between this internal flange 29a and the external flange 28c of the port 28b . the optical system of my invention is , as mentioned earlier , extremely sensitive to backlash in the mechanical system described above for rotation of the pechan prism 126 . this sensitivity can be adequately controlled by using extremely high - precision machining for all of the ring gears 84 , 85 , 87 and 95 , and the spur 75 and planetary 93 as well . it now appears that equivalent operational quality can be achieved at substantially lower cost by using a friction wheel rather than a gear for the planetary element 93 -- and perhaps also for the spur 75 . as shown in fig1 , a suitable friction wheel can be provided in the form of a pulley - like wheel 93a with a circumferential o - ring groove , and an o - ring 93b fitted in the groove . the o - ring 93b may be frictionally engaged with the teeth of the ring gears 87 and 95 or other suitable annular friction surfaces . substitution of friction wheels -- whether of the o - ring type described here or of any other type -- for gears would not be practical in motional transmission systems considered generally . slippage , wear and erratic behavior of friction wheels would be expected in almost all such systems , and it seems fair to say that the teaching of the prior art would be counter to such a substitution . accordingly a part of the present invention consists in the recognition that the operating conditions for the mechanism here are qualitatively different from operating conditions for the great majority of all transmission systems -- and that this difference can be turned to advantage in use of friction wheels for present purposes . the dispositive difference is in the speed and speed of operation . most mechanical linkages are expected to rotate through many revolutions and at angular velocities measured in hundreds to thousands of revolutions per minute . by contrast , the linkage of the present invention will probably never be rotated through more than a quarter of a revolution -- and that at probably no more than ten revolutions per minute . it is therefore believed that a friction wheel such as described will perform very adequately in terms of slippage , reliability and wear . even if wear is found significant over a period of weeks or months , the economics of the friction - wheel approach may yet be superior : a worn o - ring can be readily thrown away and replaced at a cost of pennies , on occasion of regular maintenance sessions . the following rough parameters will be helpful to persons skilled in the art . the plate 21 is 4 7 / 16 &# 34 ; maximum height , 5 7 / 16 &# 34 ; long , and 5 / 8 &# 34 ; thick . the case 22 is 5 7 / 16 &# 34 ; maximum length , 2 9 / 16 &# 34 ; tall , and 2 9 / 16 &# 34 ; maximum width excluding the plate 21 . the locking ring 46 is 3 / 4 &# 34 ; wide and 3 &# 34 ; in diameter . the finder tube 20 is 7 &# 34 ; long excluding the ocular . the narrow part of the finder tube is 2 &# 34 ; wide , and the larger end 35 / 8 &# 34 ; in diameter . the lens focal lengths are 60 mm for the reducer 135 , 120 mm for the relay 125 , and 45 mm for the video link 118 . the beam - splitter 113 and forty - five / ninety - degree prisms 116 , 124 are 1 &# 34 ; tall and have square entry and exit faces . the pechan prism , 1 &# 34 ; long ( along the optical path ), is obtained in a square cross - section oversize , cut to 1 &# 34 ; width , and its top and bottom rounded to 11 / 4 &# 34 ; diameter . the amici prism is of bk7 glass , 1 9 / 16 &# 34 ; tall ( to capture the entire image at the immediately adjacent ground glass ); before its corners are removed the entry and exit faces are 21 / 8 &# 34 ; maximum width , the fold line 215 about 4 9 / 16 &# 34 ; long . the foregoing disclosure is meant as merely exemplary , and not to limit the scope of the invention -- which is to be determined by reference to the appended claims .	7
referring to fig1 , there is shown a cross sectional view of an unassembled device 100 in accordance with the principles of the invention . fig1 , illustrates a camera / light combination device 100 comprising a camera housing 110 ( including a camera 111 , therein ), and a light assembly 120 . also shown is a pivot mechanism 130 attached to a substantially distal end of each of the light assembly 120 and the camera housing 110 . pivot mechanism 130 allows for a change in angle between the camera housing 110 and the light 120 . further illustrated is an alignment mechanism 140 that controls and retains a set angle between camera housing 110 and light 120 , such that the illumination provided by light 120 is maintained at a desired point ( e . g ., a focal point of camera 111 ). alignment mechanism 140 includes a housing 142 and an adjustment mechanism 144 . housing 142 engages pivot mechanism 130 attached to camera housing 110 . housing 142 rotates about pivot mechanism 130 in order to vary or change the angle of light 120 relative to a reference line ( e . g ., an optical axis of camera 111 ). thus , alignment means 140 controls the orientation of light 120 with respect to camera 110 . adjustment mechanism 144 is pivotedly attached to housing 142 . adjustment mechanism 144 controls and maintains the orientation of housing 142 , and consequently , the orientation of light 120 with respect to camera housing 110 . adjustment mechanism 144 includes a lead screw 150 , a vertical follower 152 , a vertical follower cover 170 and spring 154 , wherein vertical flower 152 and vertical follower cover 170 includes a passage ( not shown ) to allow insertion of lead screw 150 . lead screw 150 enables linear actuation of the threaded vertical follower 152 in a vertical direction . vertical follower 152 is threaded such that vertical follower 152 moves vertically along the lead screw 150 and , consequently , vary an angle of the light 120 with respect to the orientation of the camera housing 110 . spring 154 retains rigidity of the adjustment mechanism 144 by providing vertical pressure on a bottom face of vertical follower 152 ( see fig4 ). also shown are washer 160 and nut 162 . washer 160 minimizes surface wear between nut 162 and camera housing 110 . nut 162 captures lead screw 150 and allows for the turning of lead screw 150 , which causes vertical movement of vertical follower 152 ( and cover 172 ). also shown is attachment ( dowel ) pin 164 that attaches the adjustment mechanism 144 to housing 142 through recess 168 in housing 142 and recess 166 in vertical follower 152 . vertical follower cover 170 is attached to vertical follower 152 ) through set screw 172 . vertical follower cover 170 , thus , moves vertically as vertical follower 152 moves along lead screw 150 . dowel pin 164 enables vertical follower 152 to pivot in order to retain a substantially vertical position relative to housing 142 as lead screw 150 is adjusted ( i . e ., turned ) and orientation of light fixture 120 with camera housing 110 changes . fig2 illustrates a prospective view of the camera / light assembly 100 in accordance with the principles of the invention . also shown is an exploded view of the attachment of pivot point 130 with housing 142 and an exploded view of alignment mechanism 140 . also shown is a passage 210 in vertical follower cover 170 and vertical follower 152 through which lead screw 150 passes . also shown is spring 154 and nut 162 through which lead screw 150 passes . spring 154 engages a bottom surface of vertical follower 152 . also shown is cavity 220 in camera housing 110 . cavity 220 captures and retains nut 162 within camera housing 110 . fig3 a and 3b illustrate angular orientation of the light 120 with regard to the optical axis of camera 110 at two different distances ( e . g ., the focal points 320 ); 9 inches and 28 inches . in this illustrative embodiment , the angular orientation of light 120 with respect to the optical axis of camera 110 varies from 6 . 9 degrees at 9 inches to 2 . 15 degrees at 28 inches . the vertical and substantially liner motion of lead screw 150 causes an angular ( and non - linear ) motion of light 120 with respect to optical axis 310 of camera 111 . as would be appreciated , the angular orientation of light 120 with respect to the optical axis of camera 111 , at one or more distances from the camera housing 110 , is also based on a distance between a center point of the optical axis 310 of the camera 111 and a center point of light projection of light 120 . hence , the range ( i . e ., 9 - 28 inches ) discussed herein is solely to illustrate a range ( distance ) and present the subject matter claimed as the invention . thus , changes in the height of the vertical follower 152 , which rides on the lead screw 150 , adjusts the angle of the light 120 relative to the optical axis 310 of the camera 111 , such that a substantially maximum illumination is presented at the focal point of camera 111 . thus , in accordance with the principles of the invention , the angular orientation between light 120 and camera 111 may be set , and retained , at a specific angle that is based on a specific distance from the camera lens . fig4 illustrates an detailed cross - sectional view of the alignment mechanism 140 showing lead screw 150 engaging nut 162 and being retained by compression spring 154 between a bottom surface 420 of vertical follower 152 and camera housing 110 . also shown is housing 142 , which pivots about pivot point 130 , as lead screw 150 engages nut 162 and vertical follower 152 travels vertically along lead screw 150 . further illustrated is cavity 220 in camera housing 110 retaining nut 162 , which retains lead screw in a desired position . cavity 220 allows lead screw 150 to turn but not advance in its position with regard to nut 162 . also shown is a second cavity 430 in camera housing 110 . second cavity 430 , which is substantially perpendicular to the first cavity 220 , captures spring 154 to retain spring 154 in tension between a surface of camera housing 110 ( e . g ., surface 440 of second cavity 430 ) and bottom surface 420 of vertical follower 152 . also shown is passage 460 through camera housing 110 that connects second cavity 430 with first cavity 220 . passage 460 allows lead screw 150 to connect to nut 162 in first cavity 220 . passage 460 may in one aspect of the invention be threaded , with a thread comparable to that of lead screw 150 . in another aspect of the invention , passage 460 may be smooth to allow lead screw 150 to pass through to engage retaining nut 162 . also shown is screw head 450 , which is used to adjust the adjustment mechanism by turning lead screw 150 . screw head 450 may be one of a slotted , phillips , hex , knurled , etc ., which allows turning of lead screw 150 . as would be appreciated the incremental change in orientation of housing 142 about pivot point 130 is determined based at least on a tread sizing ( i . e ., treads per inch ) and the length of lead screw 150 . for example , using a treading size of 80 treads per inch , a quarter - turn of the lead screw 150 may result in an incremental distance change in the order of one - half ( ½ ) inch . note , that the incremental distance change is a non - linear function of the rotation of the lead screw 150 . thus , at a close range or distance ( e . g ., 9 inches ) a one - quarter turn rotation of lead screw 150 results in change of distance that is different than a similar one - quarter turn rotation of lead screw 150 at a further distance . ( e . g ., 28 inches ). hence , the pitch of lead screw 150 is determined based on a desired rate of angular change of the light 120 with regard to a rotational change of the lead screw 150 . the sizing of lead screw 150 at 80 threads per inch is merely one of an example , and it would be recognized that other thread sizing may be incorporated without altering the scope of the invention . returning to fig2 , there is also shown a second attachment means 260 . in this illustrated case , the second attachment means 260 includes a slotted or “ t ” attachment 262 that may be used to attach or mate with an external “ t ” ( not shown ). attachment means 260 may be used to attach the completed device 100 to a second device ( not shown ). for example , device 100 may be attached to the bridge of eyeglasses using second attachment means 260 . or device 100 may be attached to a head set ( or head band ) using second attachment means 260 . in addition , second attachment means 260 may be fixedly attached to a proximate end of the housing 110 . alternatively , the second attachment means 260 may be pivotedly attached to housing 110 ( as shown in fig2 ) to housing 110 . in an alternative embodiment , the second attachment means 260 may represent a screw type mechanism that may include a screw and fixed surface . the screw retains device 100 in place by the screw applying pressure to a bridge of an eyeglass captured between the screw and the fixed surface . as discussed , assembly 100 may be attached to the bridge of eyeglasses using second attachment means 260 , such that a focal point 320 ( fig3 a ) of the device 100 shown in fig1 may be coincident to a focal point of telescopic lens , for example . fig1 illustrates an exemplary configuration 1000 of the incorporation of device 100 onto eye glass wear in accordance with the principles of the invention . in this illustrated configuration eyewear 1010 includes telescopic lens 1020 incorporated into lens 1025 . device 100 , composed of light assembly 120 and camera 111 ( contained within housing 110 ), which has been previously described , is attached to the bridge 1030 between the lens 1025 . as discussed with regard to fig3 a , 3 b , device 100 includes adjustment means to fix the light generated by light 120 to be coincident with the viewing point of camera 111 . fig1 illustrates an exemplary configuration 1100 illustrating the convergence of the light generated by light assembly 120 , the viewing field of camera 111 with the focal point 1120 of telescopic lens 1020 , in accordance with the principles of the invention . in this illustrative embodiment , attachment means 260 is shown engaging a connector 1110 on bridge 1030 . hence , after light assembly 120 is adjusted to be coincident with the viewing field of camera 111 , the device 100 ( i . e ., combined camera 111 , light assembly 120 ) may be aligned with the focal point 1120 of telescopic lens 1020 . fig5 illustrates an exemplary embodiment of attachment means 260 that allows adjusting and locking device 100 to be adjusted such that a focal point of device 100 is coincident with a focal point 1120 of telescopic lens 1020 . telescopic lens 1020 , which may be used for medical and dental surgery , may , for example , be similar to those manufactured by the assignee of the instant application wherein telescopic lens are incorporated into eyewear that allow the surgeon or dentist to focus on , and magnify , a desired point in space . in this illustrated example , attachment means 260 includes the t - slot attachment 262 , as previously discussed . attachment means 260 may be composed of two interleaved elements , 510 and 520 . element 510 , referred to hereinafter as a body attachment , includes at a fixed section 512 extending from element 510 . fixed section 512 includes a connection or throughhole 513 . body attachment 510 may be permanently attached to housing 110 . for example , body attachment 510 may be held by a screw attachment ( not shown ) in which the body attachment 510 is attached by screws that may extend from an inner surface of housing 110 into body attachment 510 . alternately , body element 510 may be an integral part of housing 110 . ( see fig6 ). element 520 , referred to hereinafter as bridge attachment , includes at least one interleaving element ( not shown ) that engages , by being interleaved with , fixed section 512 . body attachment 510 and bridge attachment 520 may be interconnected about a pivot axis through their corresponding interleaving elements . for example , insertion of pin 530 into the throughhole 513 enables body element 510 and bridge element 520 to be rotatable with respect to each other . as shown , pin 530 may be inserted into through - hole 522 of bridge element 520 to engage throughhole 513 of body element 510 to connect body element 510 with bridge element 520 . pin 530 , as shown , is a substantially straight pin that incorporates a slot 532 at a first end and larger area 534 at a second end . slot 532 is used to capture lock washer 540 , such that pin 530 is retained in place when body element 510 and bridge element 520 are joined . in one aspect of the invention , pin 530 includes a flat surface 536 , which may be used to provide addition surface area to lock bridge element 520 to housing 110 , as will be described . fig6 illustrates a cross sectional view , through section a - a of fig5 , of the adjustment and locking mechanism according to an aspect of the invention . in this illustrated embodiment , the interleaving elements 615 and 620 on bridge element 520 are shown . in this exemplary configuration , body element 510 is connected to bridge element 520 though the mating of interleaving element 512 between interleaving elements 615 and 620 . when pin 530 is inserted into through - holes 522 and 513 , bridge element 520 and body element 510 are rotable about pin 530 . also shown is through - hole 612 in housing 110 . through - hole 612 includes a screw thread 614 into which a screw ( not shown ) may be threaded . the screw ( not shown ) may be used to engage pin 530 through the through - hole 612 . the screw ( not shown ), which in a preferred embodiment may be a set screw , retains ( or fixes ) the orientation of body element 510 to the bridge element 520 by the application of pressure on pin 530 . in a preferred embodiment , the pressure applied by the screw ( not shown ) in through hole 612 on pin 530 is applied to flat surface 536 on pin 530 to provide a maximum surface to which the pressure is applied . fig7 illustrates a cross - sectional view , through section b - b , fig5 , of the adjustment and locking mechanism in accordance with the principles of the invention . in this illustrative exemplary embodiment , bridge attachment 520 includes a threaded screw hole 710 into which screw 712 may be placed . screw 712 , when inserted into screw hole 710 , engages pin 530 inserted in through - hole 522 . screw 712 applies a pressure on pin 530 to lock the position of bridge element 520 with respect to body attachment 510 . once screwed in place , the angular orientation of body attachment 510 with respect bridge element 520 is retained ( or fixed ). in one aspect of the invention , screw 712 may be a set screw that engages pin 530 . in the illustrated embodiment , pin 530 includes an enlarged end 534 ( i . e ., a thumbscrew ), which may be inserted into through - hole 522 ( see fig6 ). screw 712 may , when screwed in position , engage the larger area of the enlarged end 534 . the use of a larger area of enlarged end 534 is advantageous in order to provide a larger area upon which pressure may be applied screw 712 . although an enlarged end 534 of pin 530 is shown , it would be recognized that end 534 may be similar in size to pin 530 and screw 712 would equally engage the end 534 without altering the scope of the invention . also shown is a lock screw 714 that may be used to retain ( or lock ) screw 712 in place . use of a lock screw 714 is advantageous to prevent screw 712 from becoming loose or backing out . although fig7 illustrates screw 712 engaging enlarged area 534 , it would be recognized that screw 712 may engage any portion of pin 530 and enlarged area 534 is merely used to provide a larger surface to which screw 712 engages pin 530 . fig8 illustrates a cross sectional view of pin 530 inserted in through - holes 522 and 512 and retained in place by washer 540 . also shown is threaded screw hole 710 containing screw 712 , which engages section 534 . locking screw 714 is also shown . as discussed locking screw 714 prevents screw 712 from loosening and changing the orientation of the body element 510 with the bridge element 520 . fig9 illustrates a cross sectional view of through hole 612 including screw 910 ( which was not shown previously ) engaging pin 530 . in a preferred embodiment , screw 910 engages a flat area 536 of pin 530 , as previously discussed . also shown is a locking screw 912 . locking screw 912 prevents screw 910 from loosening and / or backing out . also shown is lead screw 150 inserted through spring 154 and engaging nut 162 , as discussed with regard to fig4 . in one aspect of the invention , the housing 110 of device 100 and body element 510 may be integrated together , such that body element 510 and housing 110 are a single piece . fig1 illustrates a prospective view of an exemplary connection of the device 100 onto an eyewear in accordance with the principles of the invention . eyewear 1010 includes two lens 1025 , each of which includes telescopic lens 1020 ( of which only one is shown ). bridge 1030 joins lens 1025 together . attached to bridge 1030 is connector element 1110 . connector element 1110 may be locked onto bridge 1030 by a screw mechanism attachment , for example . alternatively , connector element 1110 may also be glued , welded or integrally formed onto bridge 1030 . also shown is connector 260 attached to connector element 1110 . connector 260 may be permanently attached to connector element 1110 . preferably , connector 260 may be removable from connector element 1110 . in a preferred embodiment , removal of connector 260 from connector element 1110 is advantageous as it enables a user to incorporate device 100 ( i . e ., camera 111 and light 120 ) when desired . fig1 illustrates a prospective view of the attachment of connector 260 with connector element 1110 . in this illustrative embodiment , a “ t - slot ” connector is utilized . as discussed previously , connector 260 includes an internal “ t - slot ” element 262 . connector element 1110 , in this illustrated example , includes an external “ t - slot ” element 1310 . engagement of element 262 with element 1110 locks device 100 in a same origination or configuration such that the viewing field of camera 111 is locked to the focal point of the telescopic lens 1020 ( as shown in fig1 ). although the present invention has been described with regard to an internal t - slot connection 262 , it would be recognized that element 262 may also be an external t - slot connection and element 1110 be an internal t - slot connection without altering the scope of the invention . although not shown it would be appreciated that the connection element 262 may also be a slot connector with a different cross - section , either internal or external , without altering the scope of the invention . although present invention has been described with regard to eyewear , it would also be appreciated that the assembly shown in fig1 may be attached to a headband , without altering the scope of the invention . the invention has been described with reference to specific embodiments . one of ordinary skill in the art , however , appreciates that various modifications and changes can be made without departing from the scope of the invention as set forth in the claims . accordingly , the specification is to be regarded in an illustrative manner , rather than with a restrictive view , and all such modifications are intended to be included within the scope of the invention . benefits , other advantages , and solutions to problems have been described above with regard to specific embodiments . the benefits , advantages , and solutions to problems , and any element ( s ) that may cause any benefits , advantages , or solutions to occur or become more pronounced , are not to be construed as a critical , required , or an essential feature or element of any or all of the claims . as used herein , the terms “ comprises ”, “ comprising ”, “ includes ”, “ including ”, “ has ”, “ having ”, or any other variation thereof , are intended to cover non - exclusive inclusions . for example , a process , method , article or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process , method , article , or apparatus . in addition , unless expressly stated to the contrary , the term “ of ’ refers to an inclusive “ or ” and not to an exclusive “ or ”. for example , a condition a or b is satisfied by any one of the following : a is true ( or present ) and b is false ( or not present ); a is false ( or not present ) and b is true ( or present ); and both a and b are true ( or present ). the terms “ a ” or “ an ” as used herein are to describe elements and components of the invention . this is done for convenience to the reader and to provide a general sense of the invention . the use of these terms in the description herein should be read and understood to include one or at least one . in addition , the singular also includes the plural unless indicated to the contrary . for example , reference to a composition containing “ a compound ” includes one or more compounds . as used in this specification and the appended claims , the term “ or ” is generally employed in its sense including “ and / or ” unless the content clearly dictates otherwise . all numeric values are herein assumed to be modified by the term “ about ,” whether or not explicitly indicated . the term “ about ” generally refers to a range of numbers that one of skill in the art would consider equivalent to the recited value ( i . e ., having the same function or result ). in any instances , the terms “ about ” may include numbers that are rounded ( or lowered ) to the nearest significant figure . it is expressly intended that all combinations of those elements that perform substantially the same function in substantially the same way to achieve the same results are within the scope of the invention . substitutions of elements from one described embodiment to another are also fully intended and contemplated .	7
the preferred embodiment of the invention is illustrated in perspective view in the fully assembled condition in fig1 . generally , caster assembly 2 includes bushing 4 rotationally disposed in a longitudinal bore 5 of body 6 . in the preferred embodiment , body 6 includes axle sleeve 8 configured to retain an axle 7 for a support wheel 9 or tandem wheel assembly . sleeve 8 is preferably constructed to provide lateral support for hub 11 on wheel 9 . the longitudinal bore of body 6 is defined by a pair of axially spaced sockets 10 , 12 . alternatively , bore 5 can be defined by a single socket or more than two sockets . sockets 10 , 12 are generally tubular - shaped and made integral with body 6 . body 6 couples sockets 10 , 12 to axle sleeve 8 extending transverse to and offset from the longitudinal axis of sockets 10 , 12 . bracket 14 is preferably hollow to reduce weight and is substantially &# 34 ; c &# 34 ;- shaped defining a cavity 16 between sockets 10 , 12 . bracket 14 and sockets 10 , 12 are preferably integral . ring - shaped sleeve 18 is disposed between sockets 10 , 12 in cavity 16 and limited in longitudinal movement thereby . bushing 4 is rotationally disposed in the longitudinal bore of body 6 defined by sockets 10 , 12 . bushing 4 includes at least one grooved recess 20 more fully described below . bushing 4 also includes inner receptacle 22 configured to receive leg 24 of a baby stroller , baby furniture or the like . as best seen in fig2 bushing 4 is generally tubular in shape and includes perimeter wall 26 , top end 28 and bottom end 30 . top end 28 includes an outwardly extending flange 32 preferably configured to form a perimeter collar or rim at top end 28 . at least one grooved recess 20 is provided on perimeter wall 26 . in the preferred embodiment , two opposing grooved recesses 20 are provided 180 degrees apart on perimeter wall 26 as best seen in fig3 . bushing 4 includes hollow 34 sized to receive leg 24 . bushing 4 is rotatably disposed in the bore created by sockets 10 , 12 and sized to minimize play therein while allowing full rotational movement along the longitudinal axis of the bore in body 6 . ring - shaped sleeve 36 is disposed about bushing 4 in cavity 16 and is preferably sized having an inner diameter and outer diameter substantially equivalent to that of sockets 10 , 12 . leg 24 includes opposed holes 38 providing a transverse bore thereto . likewise , bushing 4 also includes holes 40 and ring - shaped sleeve 36 has similarly shaped and sized holes 42 . in assembly , holes 38 , 40 and 42 are aligned to provide a transverse through - bore adapted to receive a fastener such as a rivet 36 , bolt or suitable alternative to rotationally secure leg 24 to bushing 4 and ring - shaped sleeve 36 . thus , when assembled , leg 24 , bushing 4 and ring - shaped sleeve 36 rotate in unison relative to body 6 . it is preferred that caster assembly 2 be fabricated from suitable plastic material . alternatively , however , metals , ceramics or other materials could be used . one of the primary features of the invention is the provision of grooved recess 20 on perimeter wall 26 of bushing 4 . in conventional bushing and sleeve constructions , dirt , moisture and particulate matter can foul and inhibit the rotational movement between the bushing and related sleeve . in extreme cases , accumulated dirt or other particulate matter can cause the device to bind or seize altogether restricting or preventing rotational movement . grooved recess 20 on bushing 4 provides a self - cleaning function in caster assembly 2 . this function is best explained in conjunction with fig3 and 4 . referring to fig3 and 4 , grooved recess 20 is provided on perimeter wall 26 of bushing 4 facing towards the inner surface of sockets 10 , 12 and ring - shaped sleeve 18 . preferably , two opposed grooved recesses 20 are provided as illustrated in the drawing . however , as few as one or more than two could be employed . in the embodiment illustrated , grooved recess 20 is fabricated having a generally semi - circular cross - section with a depth approximately equal to one - half of the thickness of perimeter wall 26 . grooved recess 20 extends from bottom end 30 to top end 28 of bushing 4 and across the bottom edge of flange 32 . as bushing 4 and sockets 10 , 12 rotate relative to each other , grooved recess 20 passes across the inner wall of the bore formed by sockets 10 , 12 . in the preferred embodiment , the edges 44 of grooved recess 20 are relatively sharp to help scrape away and dislodge particulate matter from the inner wall of sockets 10 , 12 . the entire inner surface of the sockets 10 , 12 can therefore be scraped upon 180 degree relative revolution between bushing 4 and body 6 . when more than two grooved recesses 20 are used , this rotational angle is decreased . grooved recesses 20 are preferably linear and vertical parallel to the longitudinal axis of the bore . as such , particulate matter dislodged during revolution falls by gravity and is channeled downwardly through grooved recess 20 to the bottom of bushing 4 . although linear vertical grooved recesses are preferred , non - linear grooved recesses could be used providing they extend to bottom end 30 . as shown in fig4 in the preferred embodiment of the invention bushing 4 extends into the bore of body 6 formed by sockets 10 , 12 and includes bottom 46 at bottom end 30 having central aperture 48 therein . socket 12 preferably includes end wall 50 with one or more debris outlets 52 positioned below grooved recesses 20 . as particulate matter and dirt is dislodged and channeled downwardly through grooved recess 20 , it falls away from caster assembly 2 through debris outlets 52 . additionally , debris outlets 52 and grooved recesses 20 provide enhanced ventilation to reduce trapped moisture . end wall 50 preferably includes an upwardly extending protrusion 52 which extends through central aperture 48 of bushing 4 . protrusion 52 and central aperture 48 help further to align and retain bushing 4 along the longitudinal axis of the bore in body 6 thus adding structural integrity . alternatively , end wall 50 can be made flat , if desired , or eliminated all together . in such a case , bottom 46 can be eliminated from bushing 4 . the foregoing description of the preferred embodiment of the invention has been presented for purposes of illustration and description . it is not intended to be exhaustive with respect to possible alternative embodiments or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching without deviation from the spirit and scope of the invention . for example , grooved recess 20 can be other than linear as discussed . likewise , cross - sections other than semi - circular can be used for grooved recess 20 such as rectangular , v - shaped , etc . further , socket 12 provides a substantially closed end in the bore of body 6 by providing end wall 50 at the bottom of socket 12 as illustrated . this construction provides enhanced protection from contaminates and in aesthetically pleasing . as previously described , socket 12 can be made completely open - ended on both ends thus removing completely end wall 50 and protrusion 52 . axial movement of bushing 4 would still be limited by the travel available to ring - shaped sleeve 18 within cavity 16 since ring - shaped sleeve 18 is secured to bushing 4 . likewise , vertical loads placed on bushing 4 by leg 24 is dissipated by flange 32 and the connection with ring - shaped sleeve in most circumstances . end wall 50 could also be made spoked or cross - hatched as desired . axial sleeve 8 can be positioned other than as illustrated in the drawing if suitable to the particular use contemplated . additionally , bushing 4 could be retained in the bore of body 6 using means other than those shown and described . the embodiments described in this description were selected to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as suited to the particular purpose contemplated . it is intended that the scope of the invention be defined by the claims appended hereto .	8
a preferred embodiment of the invention is shown in fig1 . support rail 10 is made of electrically non - conductive or insulative material such as poly - carbonate materials , carbon fibers , ceramics , or combinations thereof . any insulative material that has sufficient structural strength to support a vehicle on the rail may be used . the top of the support rail 10 contains a notch 12 that runs the length of rail 10 . in the preferred embodiment , notch 12 is a dovetail groove . this dovetail groove is designed to receive the dovetail bead 14 of a minimum - joint conductive rail 16 on top of support rail 10 . support rails 10 are abutted end - to - end to form any desired length of rail in a track system . in fig1 support rail 10 is joined to abutting support rail 18 at joint 22 by fish plate 20 and a matching counterpart fish plate ( not shown ) on the other side of rails 10 and 18 . in a model railroad implementation , the fish plates are preferably plastic with simulated bolts and nuts molded as a part of each fish plate . each molded bolt ( see fig2 c ) is a nub 38 molded on the fish plate and snapfits through holes 58 in a matching fish plate on the other side of the rail . in fig1 nubs ( not shown ) from the opposite - side fish plate pass through holes in rails 10 and 18 and snapfit through holes 26 in fish plate 20 . false nuts 24 are molded into fish plate 20 to simulate real nuts . of course , in a conventional rail system , the fish plates would have holes at the locations of false nuts 24 for normal nut / bolt fastening of two abutting rails . the continuous conductive member or rail 16 is attached to both rails 10 and 18 by inserting the dovetail bead 14 into matching dovetail groove 12 in the rails . the flat portion of conductive rail 16 rests on the top surface of support rails 10 and 18 . the bead 14 of rail 16 riding in groove 12 holds the conductive rail in place . thus conductive rail 16 spans the support rail abutment joint 22 so that relative to a vehicle of electro - motive device riding on the rail there is no physical discontinuity or electrical discontinuity of the composite minimum - joint conductive rail at joint 22 . the minimum - joint conductive rail 16 terminates at some point along the track where it is desireable to end an electrical control zone . in fig1 rail 16 terminates where it abuts against floating insulator 28 . insulator 28 thus defines the end of one electric control zone or control block defined by conductive rail 16 and the beginning of the next control block defined by conductive rail 30 . floating insulator 28 has a dovetail bead 32 to engage groove 12 in the support rail in the same manner as conductive rail 16 . insulator 28 floats on support rail 18 in that it may slid along the top of rail 18 . this allows for expansion and contraction of the conductive rails due to changes in temperature . fig2 a and 2b show an alternative design for the plastic fish plates . fish plates 34 and 35 are concave relative to the support rail 44 so that a cavity 36 is formed between plates 34 and 35 and the non - conductive support rails . as illustrated in end view in fig2 b , nub 39 of shaft 38 is pressed through a hole in the fish plate by deforming the fish plates 34 and 35 inward as depicted by arrows 33 . fish plates 34 and 35 are identical ; when installed , plate 35 is reversed in direction relative to plate 34 . thus , shafts 38 of one plate extend through holes 58 ( fig2 c ) of the other plate . after nub 39 on shaft 38 of fish plate 34 has snapped through the hole in fish plate 35 , plates 34 and 35 are held deformed toward the support rail 44 . as a result , plates 34 and 35 want to extend in an upward and downward direction , as depicted by arrows 42 , against the foot 46 and head 48 of rail 44 . the upward pressure on head 48 of the support rail causes the walls of groove 50 to pinch or grip the dovetail 52 of the conductive rail 54 mounted on the support rail . fig2 c shows details of the fish plate or bracket 34 . shafts 38 and nuts 40 are molded as a part of plate 34 . the position of the innermost edge of the concave inner surface of plate 34 is illustrated by dashed line 56 . holes 58 in the plate are tapered to receive the nubs 39 of shafts 38 that snapfit into holes 58 . the molded shape of nuts 40 is a matter of choice since they are provided for aesthetics in simulating the appearance of conventional track installation . fig3 a illustrates a clip 64 for holding the support rail to a support member or railroad tie 62 . alternatively , the clip could hold the support rail directly to the roadbed . clip 64 has spring tension arms 60 . a support rail may be snapped into the clip between the arms 64 as shown in fig3 b and be held by the clip on tie 62 or a roadbed ( not shown ). fig3 b shows a non - conductive support rail 65 and minimum - joint conductive member 67 similar to rail 16 in fig1 . in addition fig3 b shows a second conductive strip 69 ( shown in end view at the end of the rail ) positioned at the bottom of support rail 65 . one or more conductive strips 69 might be used to conduct control signals , such as a radio frequency control signals , down the length of the track . conductive strip 69 would be a continuous or minimum - joint strip in the same manner as conductive strip 67 . a end view of support rail 65 with conductors 67 and 69 is shown in fig4 a . in addition in fig4 a , the support rail 65 is made of a conductive metal such as steel , brass , aluminum or tin . in this embodiment with a conductive support rail , there must be an insulating layer 67a and 69a between the support rail 65 and conductors 67 and 69 respectively . insulating layers 67a and 69a are preferrably coatings of polycarbonate materials . plastics such as vinyl or teflon might be used . also shown in the end view in fig4 a is a space between the bottom of conductor 67 and the bottom of the dovetail groove . this space is provided so that a electrical wire might be trapped in the space after passing through a hole ( not shown ) in the support rail . thus the conductor 67 can receive electrical power from a power source . a preferred embodiment of the rail clip 64 is shown in fig4 a , 4b and 4c . clip 64 is precast or molded out of flexible polycarbonate materials and has posts 68 with ears 63 that snap fit over the base 46 of support rail 44 . in the detail of fig4 b , the clip 64 has upstanding posts 68 molded as a single piece with base 65 . upstanding posts 68 have arcuate , vertical - fluted surfaces 66 and ears 63 to hold a rail firmly in place after it is snapped into clip 64 . fluted surfaces 66 would be shaped out of a harder material than the plastic clip and for example might be a metal insert such as steel , brass , or aluminum , molded into the clip . further the rail base is held in a recessed area 67 . in fig4 c , there is a top view of clip 64 in fig4 b . four poses 68 are shown . arcuate fluted surfaces 66 are shown by dashed lines . the edges 67a of recess 67 are indicated . also holes 61 in base plate 65 are provided so that the clip 64 can be fastened to railroad ties or roadbed with nails , spikes or bolts through the holes . when a rail is pushed down into clip 64 , base 65 and posts 68 flex to allow posts 68 to open sufficiently for the base of the rail to slip past ears 63 . after ears 63 snap over the base of the rail , the rail is kept from moving vertically and is held in recess 67 by ears 63 applying retentive forces in direction of arrows 63a . in addition the rail is kept from slipping transverse to the direction of the rail by the edges of recess 67 and by retentive forces ( in the direction of arrows 66a ) from the inner arcuate surfaces 66 of posts 68 . the rail is kept from slipping along the length of the rail by the vertical fluted surfaces 66 . fig5 through 7 illustrate various alternative embodiments for attaching the minimum - joint conductive strip on top of the nonconductive sectional support rail . in fig5 the conductive strip 71 has two rounded beads 70 and 72 for engaging rounded grooves 74 and 76 respectively in non - conductive support rail 69 . in fig6 the support rail 79 has a top surface containing a cylindrical groove 80 with ears 82 and 83 . the minimum - joint conductor 84 has a cylindrical cross - sectional shape . when the conductor 84 is pressed into groove 80 , ears 82 and 83 of the groove snap over the conductor . conductor 84 has a diameter somewhat greater than the depth of groove 80 so that upto 20 % of the diameter of the conductor protrudes above the surface of the support rail . this will insure good electrical contact between the conductive strip and wheels electro - motive device drawing power from the rail . in fig7 the support rail 87 has two dovetail grooves 88 and 90 to engage two conductive strips 92 and 94 respectively . strips 92 and 94 each have a dovetail bead 96 and 98 for engaging dovetail grooves 88 and 90 . strips 92 and 94 are insulated from each other by a ridge 100 on top of the non - conductive support rail 87 . in fig8 an alternative embodiment of the minimum - joint conductive rail is shown . in this embodiment , the dovetail bead 102 is discontinuous . the bead need not extend the length of the conductive strip . there only needs to be a bead at spaced intervals . two beads 102 and 104 are shown . the interval between beads should be short enough so that good engagement with the support rail is maintained when the conductive rail is snapped into the matching groove in the non - conductive support rail . fig9 and 10 illustrate attachment of minimum - joint conductive strips to sectional non - conductive mono - rails . as in fig1 the non - conductive mono - rail would be built of strong relatively stiff material to support the weight of the vehicle travelling on the rail . accordingly , the mono - rail would be in sections which would be assembled to form a track . the conductive strips would be flexible and of any length and would span any number of mono - rail sections thereby providing electrical continuity for a predetermined length of track . in the mono - rail illustrated as an end view in fig9 the rail is supported at the base 108 by pylons or a roadbed in cross - section . the electro - motive vehicle rides on the top surface 110 of the rail and carries two electrical conductive wipers or wheels which make contact with conductive strips 112 and 114 . the continuous conductive strips have a dovetail bead 116 and snap into a matching dovetail groove 118 . in the mono - rail illustrated as an end view in fig1 , the rail is supported at the top 120 of the i - beam by hanging support 122 in cross - section . the electro - motive vehicle rides on wheels running on the top surfaces 124 and 126 of the base 128 of the i - beam . the vehicle also carries two electrical conductive wipers or wheels which make contact with conductive strips 130 and 132 . the continuous conductive strips have a dovetail shape and snap into a matching dovetail grooves 131 and 133 respectively . while a number of preferred embodiments of the invention have been shown and described , it will be appreciated by one skilled in the art , that a number of further variations or modifications may be made without departing from the spirit and scope of my invention .	4
with reference now to the drawings , the preferred embodiment and alternate embodiments of the revolver are herein described . it should be noted that the articles “ a ”, “ an ”, and “ the ”, as used in this specification , include plural referents unless the content clearly dictates otherwise . reference numerals indicated in the specification are consistent through all drawing sheets and indicate the following items : with reference to fig1 - 2 , a typical revolver 100 has the main components expected of a revolver , that is to say it has a frame 110 , barrel 120 , cylinder 112 , center pin 114 , and the ability to house at least one cartridge 116 . fig3 shows a cross - section of a typical revolver 100 , taken along the line a - a of fig2 , showing the components listed above , as well as , a chamber 118 of which there is often between five and ten of within a cylinder 112 . the detailed cross - section of a cylinder 112 , taken along the line a - a of fig2 , of a typical revolver 100 as shown in fig4 reveals how a cartridge 116 is dimensionally constrained . the cartridge 116 is located within the chamber 118 which is part of the cylinder 112 . the rearward position of the cartridge 116 is constrained by the ratchet pad 126 of the cylinder 112 bearing on the frame 110 . the forward position of the cartridge 116 is constrained by the cylinder 112 bearing on the bushing 124 which then bears on the frame 110 . the axial clearance in this assembly is typically only 0 . 001 - 0 . 002 inches to prevent damage to the components during firing . the radial position of the cartridge 116 is constrained by the chamber 118 which , as part of cylinder 112 , and is constrained by the center pin 114 which bears on the frame 110 , in both the front and rear . also shown in fig4 is how the chamber 118 aligns with the barrel 120 and specifically the throat 122 , which is the tapered region of the barrel 120 that helps align the projectile component of the cartridge 116 during firing of the typical revolver 100 . to guarantee proper operation of the typical revolver 100 during adverse conditions there must be a gap between the barrel 120 and cylinder 112 , which is commonly referred to as the barrel - cylinder gap 128 . hot propulsion gases expand spherically unless constrained by an external feature . as a result , they leak from the barrel - cylinder gap 128 during firing of the typical revolver 100 in a radially symmetric pattern due to the constraints provided by the frame 110 , cylinder , 112 , and barrel 120 . the purpose of disclosed invention is to redirect the gases leaking from the barrel - cylinder gap 128 away from the frame - cylinder gap 130 , and consequently away from the user and in a safe direction , which may be upward , as defined by the top of the firearm , away from the grip . shown in fig5 is the cross - section of a typical revolver 100 , taken along the line b - b of fig2 , which reveals that the cylinder 112 contains more than one chamber 118 , and that one chamber 118 aligns with the barrel 120 . shown in fig6 is the detailed cross - section of a typical revolver 100 , taken along the line b - b of fig2 , showing the details of the assembly just in front of the cylinder 112 , including the throat 122 region of the barrel 120 , and its proximity to the bushing 124 . shown in fig7 is the cross - section of a typical revolver 100 , taken along the line b - b of fig2 , as in fig6 , but the bushing 124 has been replaced with a revolver louver 210 in the frame - cylinder gap 130 ( fig8 ). since the bushing 124 is a structural part of the cylinder 112 assembly and the louver 210 replaces said bushing 124 , the material chosen for this embodiment of the revolver louver 210 must be rigid . although the revolver louver 210 could be any shape which results in the gases leaking from the barrel - cylinder gap 128 to be redirected from their typical radially symmetric pattern , the preferred configuration is a y - shape , as shown in fig7 and 21 , with two upwards branches 212 and a downward trunk 214 , at least partially surrounding the barrel throat 122 . the partial surrounding of the barrel creates a damming structure and leaves a passage whereby gases are redirected from their normal radial expansion . any shape may be utilized so long as a passage is left for gases to escape . in addition to the y - shape disclosed in the drawings , a u - shape may also be used , as may a partial ring , utilizing one branch partially surrounding the barrel throat 122 . the design merely needs to block gases from the frame - cylinder gap and direct them in a safe direction from the user . fig8 depicts the cross - section of the revolver louver 210 of fig7 , taken along the line a - a of fig2 . the barrel - cylinder gap 128 can be seen relative to the revolver louver 210 . while the shown geometry will deflect the majority of the propulsion gases leaking from the barrel - cylinder gap 128 , there is some axial tolerance between the revolver louver 210 , cylinder 112 , and ratchet pad 126 as mentioned above , along the major axis of the center pin 114 , within the constraints of the frame 110 , such that it may be possible for gases to leak downward between the revolver louver 210 and either the frame 110 or cylinder 112 towards the user . however , due to the axial clearance of the cylinder 112 along the axis of the center pin 114 being much less than the barrel - cylinder gap 128 , and that the hot gases escaping from the barrel - cylinder gap 128 attempt to expand as a sphere of increasing radius , very little of the hot gases are likely to leak around the cylinder louver 210 . as a result of the possible gas leakage around the cylinder louver 210 described above , an alternate embodiment of the revolver louver 310 is shown in fig9 . a tangential expansion groove 312 within the alternate revolver louver 310 is thin - walled to expand axially , similar to how a cartridge case expands during firing , against the frame 110 and cylinder 112 , preventing propulsion gases from leaking around the alternate cylinder louver 310 and towards the user . after the pressure has dropped in the system from the projectile exiting the barrel 120 , the thin walls of the expansion groove 312 of the alternate revolver louver 310 return to their original positions and the cylinder 112 is free to rotate again . although there are likely many acceptable materials to construct the alternate revolver louver 310 out of , spring tempered steel and high strength and high temperature resistant plastics , such as nylon and acetal , are potentially good choices . as shown , the cross - sectional shape , or trough 314 , of the expansion groove 312 may be rectangular . shown in fig1 is another alternate revolver louver 410 , which is similar to the one shown in fig9 except that in addition to it having an expansion groove 412 , it is constructed of laminated layers 416 to allow easier fabrication and / or varying material properties . leaving the cross - sectional shape 414 of the expansion groove rectangular is a relatively easy and effective strategy with this construction . shown in fig1 is another alternate revolver louver 510 , which is similar to the one shown in fig9 except that in addition to it being expandable , the expansion groove 512 is u - shaped , with a curved cross - sectional shape 514 . shown in fig1 is another alternate revolver louver 610 , which is similar to the one shown in fig9 except that in addition to it being expandable , the expansion groove 612 is v - shaped , with an angled cross - sectional shape 614 . shown in fig1 is another alternate revolver louver 710 , which is similar to the one shown in fig9 except that in addition to it being expandable , it is constructed from sheet metal . since the sheet metal alternate revolver louver 710 cannot support an axial load , an alternate bushing 224 is required , which is possibly smaller in diameter than the original bushing 124 . this alternate louver 710 blocks the frame - cylinder gap 130 after firing and gasses fill the louver 710 , expanding both of its leaves outward to seal the frame - cylinder gap 130 . shown in fig1 is another alternate revolver louver 810 , which is similar to the one shown in fig9 except that instead of it expanding axially due to pressure on the thin walls of an expansion groove , it expands axially due to being constructed of a compressible material . radial pressure from the propulsion gases forces the louver to compress downward which in turn causes it to expand along the major axis of the center pin 114 . like with alternate revolver louver 710 , this embodiment cannot support an axial load , and an alternate bushing 224 is required . fig1 shows the alternate revolver louver 810 in its compressed position , having axially expanded and contacting the frame 110 and cylinder 112 , thereby filling frame - cylinder gap 130 . like with the other expanding designs , alternate revolver louver 810 , will return to its initial position once pressure has dropped in the system . a high temperature elastomer would be ideal in this embodiment as the material must withstand the heat of the propulsion gases without degrading . in the event that additional pressure is needed to expand the alternate revolver louver 310 , or any other expanding embodiment , a ported alternate barrel 220 can be used to direct gases into the expansion groove 312 to aid in the thin walls expanding against the frame 110 and cylinder 112 , as shown in fig1 . the port 850 , or ports , can be circular , elongated , or any other shape , and in any direction . additionally , there may be one port present , or multiple ports present , in the alternate barrel 220 . the port or ports of the alternate barrel 220 can intersect the barrel - cylinder gap 128 , or not . shown in fig1 and 18 is another alternate revolver louver 910 featuring a stepped construction . this alternate revolver louver features an alternate bushing feature which projects toward the cylinder from a planar surface of the louver . the louver relief step 912 is non - planer with the alternate bushing feature 924 , faces towards the cylinder 112 and is located along an edge of the louver along the passage defined for gas redirection . this stepped construction aids in the cylinder 112 rotating smoothly , even if debris accumulates on cylinder 112 . additionally , the louver relief step may or may not be planer with the body of the alternate revolver louver 910 . fig1 and 20 depict a further embodiment where the frame 950 is extended to reduce the frame - cylinder gap to the clearance normally required of the support bushing 124 ( fig4 ), which is to say on the order of 0 . 001 inches . two arms 960 extend upward to surround the barrel 120 of the firearm and maintain the 0 . 001 inch clearance , thereby serving as a louver insert as described above . in essence , this embodiment is as if the initially described louver embodiment 210 ( fig7 and 8 ) were brazed or otherwise attached to the frame 110 directly . although the present invention has been described with reference to preferred embodiments , numerous modifications and variations can be made and still the result will come within the scope of the invention . the shape of the louver has been described as being preferably y - or u - shaped with a passage extending upwards as this is the typically safest direction in which to direct the gases resultant from firing the weapon . however , any shape may be utilized and such gases may be directed in any direction , including utilizing a singular arm which acts as a unilateral dam or a partial ring , so long as it is sufficient to re - direct gases away from the user . no limitation with respect to the specific embodiments disclosed herein is intended or should be inferred .	5
this application is directed towards a novel application of nanosuspensions for delivery of biological agents , either singly or in various combinations , e . g . multi - vitamin / mineral supplements . as an illustrative , albeit non - limiting example , we have demonstrated that a common vitamin , biotin , when administered as a buccal spray achieves higher blood levels as a nanosuspension when compared to the same vitamin administered after preparation in normal solution without microfluidization and administered in the same fashion . by extension , this application applies to all biologically active agents . while not wishing to be bound to any particular theory of operation , there are several hypothetical mechanisms that may account for the increased absorption of biotin , or alternative biologically active agents , when formulated as a nanosuspension and administered via the buccal mucosal route . 1 . there is a greater concentration of drug at the active mucosal surface ( there are two possible explanations for this phenomenon ): the reduced size of the microdroplets in the nanosuspension ( which concentrates more molecules in a smaller unit volume of fluid ) allows a greater number of molecules to come into contact with the mucosal membrane , over a shorter period of time . this increases the adhesiveness of the drug to the surface of the buccal membrane and enhances the probability that more molecules will be absorbed than from non - microfluidized preparations ; as a result of the increased local concentration of drug , there may be greater passive diffusion gradient across the mucosal membrane , ultimately resulting in greater plasma levels . 2 . nanosuspensions stimulate active transport of the molecules across the mucosal membrane : in adopting this explanation , it is theorized that the nanodroplets could stimulate greater “ active transport ” of compounds across the mucosal membrane by bringing a greater concentration of biotin into contact with specific receptor sites . the present invention provides a method for the delivery of a biologically active agent enhanced by the formation of a stable uniform submicron emulsion , termed a nanosuspension . while illustrative examples are limited to human subjects , the technology is in no way limited by said examples . the nanosuspensions which are the subject of the instant invention are contemplated for use in either a medical or veterinary setting , and may be administered in any reasonable fashion as is known in the art . the preferred embodiment , as thoroughly illustrated herein , is preferably formulated to be sprayed into the mouth of a human subject or an animal , whereby absorption via the buccal mucosa is accomplished . a “ biologically active agent ”, “ biological agent ”, or “ agent ”, as used herein , refers to any synthetic or natural element or compound , protein , cell , or tissue including a pharmaceutical , drug , therapeutic , nutritional supplement , herb , hormone , or the like , or any combinations thereof , which when introduced into the body causes a desired biological response , such as altering body function or altering cosmetic appearance . to convert the microfluidizable mixture to the stable uniform submicron emulsion of the present invention , the mixture is subjected to an ultra - high energy mixing device . this is preferably achieved through the process of microfluidization . the microfluidizer processor is a device that provides high shear rates , maximizing the energy - per - unit fluid volume to produce uniform submicron particle and droplet sizes of chemical or particulate substances . process pressures are highly variable , ranging from a low of 1 , 500 to 23 , 000 psi , enabling the processing of a wide variety of fluids ranging from simple oil - in - water emulsions to high - weight - percent solids - in - liquid suspensions . the microfluidizer contains an air - powered intensifier pump designed to supply the desired pressure at a constant rate to the product stream . as the pump travels through its pressure stroke , it drives the product at a constant pressure through precisely defined fixed - geometry microchannels within the interaction chamber . as a result , the product stream accelerates to high velocities , creating shear rates within the product stream that are orders of magnitude greater than any other conventional means . all of the product experiences identical processing conditions , producing the desired results , including : uniform particle and droplet size reduction ( often submicron ). as a result of the high shear rate there is produced a mixture containing uniform submicron particles and the creation of stable emulsions and dispersions is achieved . this processing overcomes limitations of conventional processing technologies by utilizing high pressure streams that collide at ultra - high velocities in precisely defined microchannels . the final product is a stable uniform submicron emulsion , a “ nanosuspension ” composed of nanodroplets . the stability and rate of absorption may be further enhanced by one or more components within the initial emulsion . in addition , the rate of absorption of the final product may be enhanced by the uniformity or size of the particles . permeation enhancers utilized in the present invention include the conventional physiologically acceptable compounds generally recognized as safe ( gras ) for human consumption . any surfactant which assists in decreasing particle size is contemplated by the instant invention . in order to examine the increased efficiency of absorption this formulation provides , initial experimentation was performed . a microfluidizable mixture including biotin as an agent was prepared . biotin is a water - soluble , b - complex vitamin that is necessary for the synthesis of fatty acids and nucleic acids . if biotin is absent in the body , the production of fat is impaired . the synthesis of niacin is dependent upon biotin . biotin has a rather unique structure with three asymmetric carbons and therefore eight different isomers are possible . only one isomer has vitamin activity , d - biotin . it exists in natural foodstuffs in both bound and free forms and is also taken as a supplement . biotin is absorbed as the intact molecule in the first half of the small intestine . it is transported as a free water - soluble component of plasma , is taken up by cells via active transport , and is attached to its apoenzymes . all animal cells contain some biotin , with larger quantities in liver and kidneys . metabolically , biotin is an essential coenzyme in carbohydrate , fat , and protein metabolism is important in the conversion of carbohydrate to protein and vice versa , functions as maintaining normal blood glucose levels when carbohydrate intake is low , transports carboxyl units and fixes carbon dioxide ( as bicarbonate ) in tissue . bacteria synthesize biotin in the intestinal tract . a small amount of this water soluble vitamin is absorbed : however , the quantity that is not used is excreted through the urine . raw eggs contain a compound called avidin . avidin has the same chemical structure as biotin . because of this structural similarity , avidin binds to biotin &# 39 ; s receptor sites ; therefore , biotin is unable to bind and is unable to be used . the skin and hair mainly affected by a biotin deficiency causing baldness , dermatitis , and rashes around the mouth and nose . the locations that are commonly deficient in biotin are the male genitalia , bone marrow , liver , and the kidneys . other symptoms of the deficiency are sleeplessness , poor appetite , and dry skin . an aqueous solution comprising purified water ( 64 %) and glycerin ( 30 %), acting as a solvent and taste enhancer , was stirred and heated to a temperature of about 60 ° c . once complete dissolution was reached , the mixture was cooled to about 50 ° c . biotin , ( about 2 %) potassium hydroxide ( about 0 . 75 %) and citric acid ( as an acidulent / buffering agent ) ( about 0 . 1 %) were added and the mixture was adjusted to a ph of about 8 - 9 . the mixture was further cooled to about 40 ° c . and while stirring , polysorbate - 80 ( about 0 . 5 %) was added , which acted as an emulsifier and surface activator . natural cranberry flavor ( about 2 . 39 %) and potassium sorbate ( about 0 . 26 %), a preservative , were then added . upon reaching complete dissolution , the compound mixture appeared homogeneous , brown , and slightly transparent . the crude emulsion was then passed through a model m - 110y microfluidizer ( microfluidics corporation , newton , mass .) under 18 , 000 psi . after a single pass , the mean particle size , according to a horiba la - 910 particle size analyzer , was 151 nm . the resulting stable uniform submicron emulsion was then placed into a spray vial with a fine mist nozzle . the particular nozzle provided thorough coverage of the oral cavity . absorption of microprocessed biotin and non - processed biotin via the buccal mucosa versus oral administration in a normal human subject objective : to compare the absorption rate and the total amount of absorption across the buccal mucosa of biotin prepared in microdroplets with the absorption rate and total absorption of a megadose of biotin contained in regular solution , in a normal healthy subject , when given by a spray applicator . utilizing a process , as outlined above , for producing microdroplets of aqueous and oil based solutions for use in drug delivery systems , formulations for testing were produced . the process allows molecules to be embedded into microdroplets of between about 87 nm and 10 μm in size , which are used to create stable and uniform emulsions and dispersions . theoretically , such dispersions should allow molecules to be delivered across tissue barriers at a more even rate than non - microfluidized or “ normal ” solutions . this should allow the accumulation of higher concentrations of a molecule in the blood stream over a longer period of time than with molecules prepared by standard pharmacological methods and delivered either by buccal mucosal or intestinal absorption . by using the “ microfluidization ” process to prepare mixtures of biologically active agents , e . g . vitamins and other nutritional supplements , products may be designed , manufactured and standardized for use in spray applicators which deliver single dose sprays to the buccal mucosa . the purpose of this type of delivery is to introduce such biologically active agents , e . g . vitamins and minerals , into the body in a manner which allows , over time , more rapid , uniform and complete absorption than that which has been heretofore achieved via administration of non - microfluidized components in the form of pills , tablets , capsules or liquids which are absorbed through the gastrointestinal tract . in addition , the microfluidization process appears to offer increases in shelf - life , with testing showing a shelf - life of about 3 years . in its physiologically active form biotin is attached at the active site of four important enzymes , known as carboxylases . each carboxylase catalyzes an essential metabolic reaction . acetyl - coa carboxylase catalyzes the binding of bicarbonate to acetyl - coa to form malonyl - coa . malonyl - coa is required for the synthesis of fatty acids . pyruvate carboxylase is a critical enzyme in gluconeogenesis , the formation of glucose from sources other than carbohydrates , for example , amino acids and fats . methylcrotonyl - coa carboxylase catalyzes an essential step in the metabolism of leucine , an indispensable ( essential ) amino acid . propionyl - coa carboxylase catalyzes essential steps in the metabolism of amino acids , cholesterol , and odd chain fatty acids ( fatty acids with an odd number of carbon molecules ). histones are proteins that bind to dna and package it into compact structures to form chromosomes . the compact packaging of dna must be relaxed somewhat for dna replication and transcription to occur . modification of histones through the attachment of acetyl or methyl groups ( acetylation or methylation ) has been shown to affect the structure of histones , thereby affecting replication and transcription of dna . the attachment of biotin to another molecule , such as a protein , is known as “ biotinylation ”. the enzyme biotinidase has recently been shown to catalyze the biotinylation of histones , suggesting that biotin may play a role in dna replication and transcription . a normal human subject who had not taken supplements containing biotin for at least 48 hours before testing used a spray applicator to administer a single megadose of biotin ( 15 mg ) by carefully spraying the inside of each cheek ( buccal mucosa ). a prebleed of 5 ml of blood , taken by routine venipuncture from an antecubital vein , was obtained before the biotin was administered and serial blood draws were obtained at 5 , 10 , 15 , 30 , 60 and 120 minutes after administration . preparations of microprocessed biotin , nonprocessed biotin , and commercially available non - processed biotin in pill form were administered at different times in the same individual , subsequent to a period of time to enable washout , e . g . 1 week , thereby allowing an intrasubject comparison . the pill form of biotin was administered ( 18 . 75 pills at 800 mcg . each - increasing the surface area for better absorption ) by swallowing , as instructed , and allowing absorption via the gastro - intestinal tract . furthermore , blood was drawn at 180 minutes ( an additional hour past that which was utilized for comparison of the microfluidized and non - microfluidized formulations ) thereby yielding an additional datapoint . biotin was assayed from the whole blood in a commercial laboratory using a sensitive biological assay . in this assay , the flagellate ochromonas danica , which has a sensitive biotin requirement for growth in culture , was mixed with dilutions of the subjects whole blood , incubated for 3 - 5 days and assayed for growth . biotin was measured in picograms / ml . this test being more accurate than the common chemical hplc assay . data was recorded showing both the rate and amount of biotin adsorption in subject rv after administration of microprocessed biotin or non - processed biotin via the buccal mucosa and in pill form via the gastro - intestinal tract . normal blood levels of biotin in individuals who have not taken supplements or who have not recently eaten foods high in biotin concentration within 24 - 48 hours are between 200 - 500 picograms / ml . fig1 represents a graphic analysis of the data . based on this anecdotal trial in a human subject , microprocessed biotin , when given in megadose amounts , was absorbed in significantly higher amounts than non - processed biotin , achieving between 5 - 9 fold greater levels , at pre - maximum and maximum absorption times of 30 minutes and 1 hour , respectively . orally administered pills containing biotin reached a level of only about 40 , 000 picograms / ml at the 1 hour level , an amount only ⅓ that of the microfluidized biotin when administered via the buccal mucosa . it is thus seen that administration of biotin via the buccal mucosa subsequent to formation of a microfluidized nanosuspension results in substantially higher absorption at a substantially higher rate than that which has heretofore been known in the prior art . all patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . all patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and drawings / figures . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the embodiments , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims .	8
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims . fig1 is an illustration of a posterior view of a deformed spine 104 whereby the preferred embodiment of the device 200 is attached to an ilium 102 and a vertebra 100 . device 200 includes a tether 204 having a free end 206 and that is configured to be attached to the ilium and a portion of the vertebra . specifically , in one embodiment , two attachment mechanisms such as pedicle screws 300 are anchored to the vertebra of the spine by insertion into opposing pedicles , and a transverse rod 311 is attached to the pedicle screws 300 . it should be noted that although pedicle screws are provided in this particular embodiment , any other type of anchoring mechanism such as hooks may also be used . a tether clamp 310 is attached to rod 311 and the tether 204 is passed though tether clamp 310 and then passed down to the ilium 102 thereby securing a connection between the attached vertebra and the ilium . to attach the tether 204 to the ilium 102 , an ilium anchor 210 is provided . the ilium anchor 210 includes a bore 211 and is configured to be attached to the ilium by inserting the anchor 210 ( threading ) into a hole which has been drilled or punched through the ilium 102 . it should be noted that any other similar mechanism to attach anchor 210 to the ilium 102 may also be utilized . tether 204 is passed through hole or bore 211 in the ilium anchor 210 and then brought back to the vertebra 100 and passed again through the tether clamp 310 . in other embodiments , the tether 204 may only be passed once through the tether clamp and ilium anchor 210 . fig2 illustrates the correction of the spine of fig1 using device 200 . as illustrated in fig2 , the free end 206 of tether 204 is pulled and the spine is manually manipulated during the surgery to achieve a correction of the deformity . when a satisfactory curve magnitude is achieved , tether 204 is tightened within the tether clamp , effectively locking the distance between vertebra 100 and the ilium 102 . it should be noted that various levels of manipulation of the vertebral column can be coordinated using the device . for instance , different curvatures of the spine can be achieved by changing the position of the anchor and the clamp on the tether with respect to the vertebral column and the ilium . the locations along the tether where the clamp and anchor are attached determine an effective length of the tether , which in turn maximizes the distance that the attached vertebra may move relative to the position where the tether is attached at in the ilium . the scoliotic curve is corrected ( or maintained ) by adjusting the clamping and anchoring locations along the tether . fig3 shows a detailed view of pedicle screws 300 , transverse rod 311 , tether clamp 310 and tether 204 . in a preferred embodiment tether clamp 310 includes locking screw 312 which clamps tether clamp 310 onto rod 311 as well as locking the tether 204 within the clamp 310 . fig4 shows a detailed view of the tether clamp 310 coupled to the transverse rod . the tether clamp 310 is configured with a slot 501 which is provided through the tether clamp 310 and tether 204 is passed through slot 501 . it should be noted that the tether may be passed through the slot multiple times , if necessary . locking screw 312 is used to secure the transverse rod 311 onto the tether clamp 310 and applies a compressive force upon the rod 311 onto the tether 204 , thereby clamping the tether 204 securely in place . it should be noted that although a threaded set screw is utilized in the present embodiment , any type of locking element know in the art for securing the tether within tether clamp may be used . fig5 shows a detailed view of an ilium anchor 210 . ilium anchor 210 includes threads 212 for engagement with ilium 102 ( not shown ). tether 204 is passed through bore 211 and then passed back to the vertebral column . a collar 215 is shown which keeps tether 204 adjacent to itself . fig6 shows an extra - long pair of forceps 900 . fig7 shows the preferred method of passing the tether through an incision 845 and underneath skin and other soft tissues . the forceps 900 are used to pass the tether though the openings in the tether clamp and used to tension the tether to correct the deformity of the curvature in the spine . fig8 illustrates another embodiment of a tether clamp 320 according to the present invention . in this embodiment , the tether clamp 320 is configured with a through hole 322 that is configured to correspond to a through hole 324 in an elongate rod 326 that is fixated to a portion of the spinal column . a fastening element 328 such as a set screw is provided to couple the tether clamp 320 and the elongate rod 326 together . the tether clamp 320 also includes openings 330 , 332 which are dimensioned to receive and securely couple a tether 334 to the clamp 320 . the tether 334 is pulled through each of the openings 330 , 332 to securely attach the tether 334 to the clamp 320 and the elongate rod 326 . fig9 and 10 illustrate an alternative embodiment of a clamp and / or anchor 250 that can be used to secure a tether 252 to either the vertebral column or a portion of the ilium . more specifically , the anchor 250 of fig9 and 10 may be configured and dimensioned to be attached to a portion of the vertebral column or may be configured be secure the tether to the ilium . the anchor 250 is configured as a plate 251 having at least two openings 254 , 256 to receive fasteners 258 , 260 capable of fixating the plate to bone . the plate 251 includes a middle portion 262 having an opening 264 that is capable of receiving the tether 252 . the middle portion 262 of the plate 251 is further provided with a fastening element 266 to secure the tether 252 to the plate 251 . as more clearly illustrated in fig1 , the fastening element 266 may be a set screw which directly contacts the tether 252 when tightened to secure the tether 252 to the plate 251 . it should be noted that any other type of fastening element which is capable of securing the tether to the anchor may be used , such as a pin . fig1 illustrates yet another embodiment of a clamp or anchor 400 according the present invention . in this embodiment , the clamp and / or anchor 400 includes a first plate 402 and second plate 404 that are secured to one another via a fastening element 406 . the first and second plates 402 , 404 are may also include spikes 408 or similar type of features that bite into bone . either the first or second plate 402 , 404 or both also includes an opening 410 for receiving a tether . the first and second plates 402 , 404 are positioned so that bone is in between , such as the ilium or a portion of the vertebral column . as the first and second plates 402 , 404 are compressed into bone , the tether which is positioned through the opening 410 and in between the first and second plates 402 , 404 , is also securely locked between the plates and the bone thereby securing the tether to the plates 402 , 404 . in an alternative embodiment , the tether is passed through the opening and secured to the anchor 400 by a clamp device such a belt clamp or secured by knotting the tether around the edge of the anchor 400 . it should be noted that any type of mechanical mechanism to attach the tether to the anchor may be used . fig1 - 15 illustrate yet another embodiment of a clamp according to the present invention . the closed head clamp 420 as illustrated in fig1 and 13 , includes a first opening 422 extending through the clamp 420 in a first direction and a second opening 424 extending in a second direction . the first and second direction are generally perpendicular to one another . the first opening 422 is configured to receive an elongate rod 426 and the second opening 424 is configured to receive a tether 428 . the clamp 420 is further provided with a fastening element 430 that is used to secure both the rod 426 and the tether 428 . in this embodiment , fig1 and 13 also illustrates that the second opening 424 is positioned at a bottom portion of the clamp 420 , thus , as the fastening element 430 is tightened , the fastening element 430 contacts the rod 426 which is pushed against the tether 428 thereby securing the tether 428 and rod 426 within the clamp . in an alternative embodiment of the closed head clamp as illustrated in fig1 and 15 , the closed head clamp 432 includes a first opening 434 and a second opening 436 . the first opening 434 and the second opening 436 are configured to be generally transverse to one another . the first opening 434 is dimensioned to receive an elongate rod 438 and the second opening 436 is dimensioned to receive a tether 440 . the clamp 432 also includes a fastening element 442 , such as a set screw , which when tightened secures and locks the tether 440 and the elongate rod 438 within the clamp 432 . in this particular embodiment , the second opening 436 is positioned between the fastening element 442 and the elongate rod 438 . when the fastening element 442 is tightened , the fastening element 442 directly contacts the tether 440 which contacts the elongate rod 438 thereby securely locking the tether 440 and the elongate rod 438 within the closed head clamp 432 . fig1 - 18 illustrate alternative embodiments of the inventive device . specifically , fig1 illustrates the use of clamp to attach the tether to the lamina of a vertebra . as illustrated , the tether may encircle the lamina and may be tightened using a belt clamp . the other end of the tether is as shown in the earlier embodiments coupled to a portion of the ilium . using this mechanism , the deformity of the spine may be corrected by manipulating the tether as well as the positioning of the clamp , as needed . fig1 shows a tether that includes a loop which is used to for coupling the tether to the transverse rod to fixate the tether to the transverse rod . fig1 illustrates the coupling of the tether directly to the ilium using another type of tether clamp . it should be noted that in the examples provided of both anchor and clamps , these mechanical devices may be interchangeable . it should also be noted that the tether of the present invention may be composed of fabric , polymer , such as pet , or any other biocompatible materials . the tether can be a cable and can be dimensioned to be a wide elastic band which advantageously reduce the risk of damage to tissue lacerations or injury . in some embodiments , the tether can be is between 2 and 900 mm . also , to ensure that proper correction of deformities , a tensioner can be included as part of the system to make sure that the tether are in proper tension and tightness . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention . moreover , the improved bone screw assemblies and related methods of use need not feature all of the objects , advantages , features and aspects discussed above . thus , for example , those skilled in the art will recognize that the invention can be embodied or carried out in a manner that achieves or optimizes one advantage or a group of advantages as taught herein without necessarily achieving other objects or advantages as may be taught or suggested herein . in addition , while a number of variations of the invention have been shown and described in detail , other modifications and methods of use , which are within the scope of this invention , will be readily apparent to those of skill in the art based upon this disclosure . it is contemplated that various combinations or subcombinations of these specific features and aspects of embodiments may be made and still fall within the scope of the invention . accordingly , it should be understood that various features and aspects of the disclosed embodiments can be combined with or substituted for one another in order to form varying modes of the discussed bone screw assemblies . thus , it is intended that the present invention cover the modifications and variations of this invention provided that they come within the scope of the appended claims or their equivalents .	0
fig1 shows a cross - sectional view of an electrical cable 11 , comprising , in this example , four electrical leads 13 encased in cladding 12 . the electrical leads 13 themselves comprise an electrical conductor 14 , preferably of copper , and an outer insulation 15 , typically of polyethylene . interspersed between the electrical leads 13 and the outer cladding 12 , is a filler gel composition 16 . in this embodiment , the filler composition can comprise an oily base , a thermoplastic rubber as polymeric gelling agent and micro spheres disperse therein and optionally an anti - oxidant . the electrical cable , typically comprising a copper core , can be used for the purposes of telecommunications or distribution of electricity . although fig1 shows a cross - sectional view of an electrical cable comprising four conductors in a star quad configuration , it will be appreciated that cables having a variety of different configurations can be used as alternatives to the configuration shown . fig2 shows an optical cable 21 comprising three optical fibre buffer tubes 23 encased in cladding 22 . the optical fibre buffer tubes 23 themselves consist of an optical fibre 24 provided with a protective coating 26 and a protective sheath 25 . the filler composition 27 is disposed between the coated optical fibre and the protective sheath . additionally , it fills the interstices formed between individual buffer tubes and between the buffer tubes and the internal surface of the cable cladding . examples of specific gels suitable for use in cables , such as the cables illustrated in fig1 and 2 are as follows : component concentration (% wt .) white mineral oil 89 . 0 sn 500 ( mobil ) thermoplastic elastomer 5 . 5 kraton 1701 or1702 ( shell ) micro spheres ( pre - expanded ) 5 . 0 expancel 091 de ( triones chems . int .) anti - oxidant 0 . 5 irganox l 135 ( ciba - geigy ) the gel filler of this example is suitable for filling the interstices between the tubes and conductors ( flooding ) and is not in direct contact with the fibre guides . the oily base was introduced into a stirred heating - blending tank and heated to 110 - 120 ° c . before transferring to a high shear blending - cooling tank , whereupon the thermoplastic elastomer ( kraton ) ( in the form of granules ) was added . the mixture was blended under high shear conditions using a multi - purpose immersion type mixer emulsifier ( silverson machines limited , model gdd 25 ) for no more than 60 minutes . during the blending process , the temperature of the mixture was allowed to rise to 120 - 130 ° c . the mixture was cooled by means of a cold water chiller system , and the chilled mixture was transferred to a stirred main reactor where the anti - oxidant was added . a vacuum was then created inside the reactor in order to suck in the micro spheres which were mixed into the blend over a period of at least two minutes . the vacuum was maintained for at least a further ten minutes in order to effect removal of any air bubbles . the vacuum was then released , the stirrer switched off and samples taken prior to release of the finished gel from the main reactor . the product was characterised by a number of tests , the results of which are summarised in table 1 below . the thermal conductivities referred to in the table were determined as follows : specimen discs were created by scooping the gels into a pair of nylon rings of mean internal diameter 70 . 1 mm and mean thickness 10 . 03 mm and placing cling film above and below . a small correction was made to allow for the extra interface introduced by the cling film . the thermal conductivity of the specimens was measured using a 76 mm guarded hotplate . a pair of specimen discs were mounted , under the pressure of two cooled plates , on either side of a guarded heater plate . the cooled plates were maintained at a constant temperature to better than ± 0 . 05 ° c . the surfaces of the plates had emittances of better than 0 . 9 . the temperature of the annular guard on the heater plate was matched to that of the central part to better than ± 0 . 01 ° c . in order to minimise lateral heat flow in the specimens . the heater plate and the specimens were insulated with a glass fibre blanket to further reduce edge heat losses . the temperature drop through the specimens was fixed at 14 ° c . and about 5 hours was allowed for thermal equilibrium to be established before final readings were taken . the aging test was derived from yd / t839 . 4 - 1996 ( prc method ) except that the temperature and duration of the test was altered . property value test method density ( 20 ° c .) g / ml 0 . 356 astm d 1475 viscosity ( 100 s . 1 , 25 ° c .) pa · s 23 . 63 haake vt500 tube drainage ( 7 mm id / 80 ° c ./ 24 hrs .) pass eia / tia - 455 - 81a cone penetration ( 23 ° c .) dmm 335 astm d937 cone penetration (− 30 ° c .) dmm 167 astm d937 cone penetration (− 40 ° c .) dmm 120 astm d937 oil separation ( 80 ° c ./ 24 hrs .) % wt . 0 ftm791 ( 321 ) volatile loss ( 80 ° c ./ 24 hrs .) % w / w 0 . 17 ftm791 ( 321 ) oit ( 190 ° c .) min . 34 . 75 astm d3895 thermal conductivity ( 23 ° c .) w / m · k 0 . 077 see above thermal conductivity ( 80 ° c .) w / m · k 0 . 078 see above hydrogen generation ( 80 ° c ./ 24 hrs .) μl / g 0 . 010 acid value mgkoh / g 0 . 036 bs2000 aging ( 100 ° c ./ 240 hrs .) pass see above uv exposure ( 25 ° c ./ 14 days ) pass temperature exposure ( 240 ° c ./ 5 mins .) pass oit ≡ oxidative induction time table 1 shows that the density of the gel is low which contributed to good anti - drip properties ( measured at 80 ° c .). low temperature performance was assessed by cone penetration at − 40 ° c . whilst high temperature performance was tested by a combination of the drip test , oil separation and volatile loss tests all carried out at 80 ° c . and the oxidative induction time test carried out at 190 ° c . an oxidative induction time in excess of 20 minutes is desirable . the results indicate that the gel has a working temperature range of − 40 to + 80 ° c . furthermore the rheological behaviour of the gel , shown in fig3 , is thixotropic ( shear thinning ) allowing for cold pumping and processing , and thus cable filling in the absence of voids created by gel shrinkage . thermal conductivity was determined at 23 ° c . and 80 ° c . the values for the conductivity were low reflecting the low density of the gel , and varied little with temperature suggesting a material possessing a disordered structure . the good insulating properties indicated a material possessing good resistance to thermal decomposition that can occur at the elevated temperatures reached during cable manufacture . in addition , the gel would be less sensitive to the thermal expansion and contraction that can take place during cable manufacture leading to the formation of voids in the cable filling . for purposes of comparison , the thermal conductivities of a range of materials are given in table 2 . a similar gel filler was prepared in a similar manner to that described in example 1 but with a different grade of mineral oil . the gel was suitable for use in small pair telephone copper cable filling and flooding applications . the gel was subject to a number of physical tests . the results of the physical tests were similar to those of the composition of example 1 and therefore only the electrical properties are quoted in table 3 . the gel is characterised by a low relative permitivity ( 1 . 62 ) and a high volume resistivity ( 2 . 8 × 10 15 ohm . cm ). for purposes of comparison , the relative permitivities of a number of materials are given in table 4 . a gel suitable for use in filling loose tubes and interstitial filling between ribbons and open slotted cores , was prepared in a similar manner to that described in example 1 . the formula for this gel is set out below : component concentration (% wt .) poly α - olefin oil a 66 . 37 durasyn 166 ( amoco ) white mineral oil 22 . 13 whiterex 250 ( bp / mobil thermoplastic elastomer 7 . 5 kraton 1701 or1702 ( shell ) micro spheres ( pre - expanded ) 3 . 5 expancel 091 de ( triones chems . int .) anti - oxidant 0 . 5 irganox l 135 ( ciba - geigy ) a the poly α - olefin oil is also supplied by bp / mobil as shf 61 the gel was subject to a number of physical tests . the results of the physical tests , which were similar to the results of the composition of example 1 , are shown in table 5 . in addition , the tensile strength and coating strip force of optical fibres were tested according to the standards fotp - 28 and fotp - 178 respectively . the optical fibre was cpc6 fired by siecor . the tests were carried out after aging of the fibres in forced air chambers for 30 days at 85 ± 1 ° c . whilst immersed in the gel . measurements were carried out at 20 ° c . and 70 % relative humidity . the tensile strength was measured on thirty 0 . 5 mm samples from four different groups at a rate of elongation of 500 ± 50 mm / min . 50 mm samples were used for the coating strip force tests using a stripping tool at a speed of 500 ± 50 mm / min . average tensile strength and coating strip force values for a control sample were 68 . 89 n and 3 . 61 n respectively . the shear sensitive behaviour of the viscosity is illustrated in fig4 and shows that the gel is thixotropic or shear thinning . this gel , although of lower viscosity than the gel of example 1 , still passed the drainage test . the low temperature performance , characterised by the cone penetration at − 40 ° c ., was exceptional . this is particularly important as this gel is used in direct contact with optical fibres and must maintain flexibility at low temperatures to avoid applying stresses to the aforementioned fibres or micro bending caused by contraction which can lead to an increase in attenuation . the tensile strength and coating strip force results suggested that there was no deterioration in the mechanical strength of the fibres or degradation in the fibre coating after exposure to the gel . this gel , formulated for filling loose tubes and interstitial filling between ribbons and open slotted cores particularly for use with polypropylene cable polymers , was prepared in a similar manner to that described in example 1 . the formula for this gel is set out below : component concentration (% wt .) silicone oil 94 . 7 f111 / 5000 ( ambersil ) fumed silica 1 . 8 m5 ( cabot ) micro spheres ( pre - expanded ) 3 . 0 expancel 091 de ( triones chems . int .) cross - linking additive 0 . 5 the resulting gel was subject to a number of physical and chemical tests , the results of which are summarised in table 6 below . the gel was tested for compatibility with polypropylene using the following method : six 50 mm long samples of buffer loose tubes were weighed to 0 . 00001 g . five of the samples were subsequently immersed in the gel and all six aged in an air - circulated oven at 80 ° c . for two weeks . the samples were then re - weighed . the results from the low temperature cone penetration , and the oil separation , volatile loss and oxidative induction time experiments suggest that the operating range of this gel is − 40 to + 80 ° c . the tensile strength and coating strip force results suggested that there was no deterioration in the mechanical strength of the fibres or degradation in the fibre coating after exposure to the gel . the gel was found to be compatible with polypropylene as there was no weight gain in the immersed tube samples after aging . this gel , formulated for cable flooding and interstitial filling applications and is a swellable water blocking gel , was prepared in a similar manner to that described in example 1 . the formula for this gel is set out below : component concentration (% wt .) white mineral oil 89 . 5 sn 500 ( mobil ) thermoplastic elastomer 4 . 0 kraton 1701 or 1702 ( shell fumed silica 3 . 0 m5 ( cabot ) micro spheres ( unexpanded ) 2 . 5 expancel 551 du ( triones chems . int .) anti - oxidant 0 . 5 irganox l135 ( ciba - geigy ) monopropylene glycol 0 . 5 pgusp - 1s ( arco chemical ) the gel was subject to a number of physical tests , the results of which are summarised in table 7 below . the presence of unexpanded hollow micro spheres in the gel meant that the filler increased in volume by 1 - 10 % on heating in the temperature range 95 - 140 ° c . such heat can originate from the extrusion head during manufacture of , for example , fibre optic cables . the swellable nature of the gel can help eliminate voids in the cable created on shrinkage of the cable filler and ensure a watertight seal around the core . the elimination of voids also reduces the likelihood of problems of attenuation associated with fibre optic cables . the gel can also be used for filling beneath the metallic amine where over - flooding with petroleum jelly type material can prevent sealing of the overlap whilst under - flooding may create a water path within the cable and lead to the problems of attention described above . it will readily be apparent that numerous modifications and alterations can readily be made to the compositions exemplified in the examples without departing from the principles underlying the invention and all such modifications and alterations are intended to be embraced by this application .	2
the present invention is based on the hypothesis that oral bioavailability can be dramatically improved for any compound which possesses extensive first pass elimination and that can be formulated as a nanoparticulate in a digestible oil or fatty acid . the present invention can be practiced with a wide variety of crystalline materials that are water insoluble or poorly soluble in water . as used herein , poorly soluble means that the material has a solubility in aqueous medium of less than about 10 mg / ml , and preferably of less than about 1 mg / ml . examples of the preferred crystalline material are as follows . the therapeutic candidates include [ 6 - methoxy - 4 -( 1 - methylethyl )- 3 - oxo - 1 , 2 - benzisothiazol - 2 ( 3h )- yl ] methyl 2 , 6 - dichlorobenzoate , s , s - dioxide , described in u . s . pat . no . 5 , 128 , 339 ( win 63394 ), cyclosporin , propanolol , antifungals , antivirals , chemotherapeutics , oligonucleotides , peptides or peptidomimetics and proteins . in addition it is believed that vaccines can also be delivered to the lymphatic system by use of the present invention . the present invention also allows imaging of the intestinal lymphatic system with x - ray or mri agents formulated as nanoparticles in digestible oils or fatty acids . potential imaging agents include any x - ray or mri nanoparticulate core . suitable surface modifiers can preferably be selected from known organic and inorganic pharmaceutical excipeints . such excipients include various polymers , low molecular weight oligomers , natural products and surfactants . preferred surface modifiers include nonionic and ionic surfactants . representative examples of surface modifiers include gelatin , casein , lecithin ( phosphatides ), gum acacia , cholesterol , tragacanth , stearic acid , benzalkonium chloride , calcium stearate , glycerol monostearate , cetostearyl alcohol , cetomacrogol emulsifying wax , sorbitan esters , polyoxyethylene alkyl ethers , e . g ., macrogol ethers such as cetomacrogol 1000 , polyoxyethylene castor oil derivatives , polyoxyethylene sorbitan fatty acid esters , e . g ., the commercially available tweens , polyethylene glycols , polyoxyethylene stearates , colloidal silicon dioxide , phosphates , sodium dodecylsulfate , carboxymethylcellulose calcium , carboxymethylcellulose sodium , methylcellulose , hydroxyethylcellulose , hydroxypropylcellulose , hydroxypropylmethylcellulose phthlate , microcrystalline cellulose , magnesium aluminum silicate , triethanolamine , polyvinyl alcohol , and polyvinylpyrrolidcne ( pvp ). most of these surface modifiers are known pharmaceutical excipients and are described in detail in the handbook of pharmaceutical excipients , published jointly by the american pharmaceutical association and the pharmaceutical society of great britain , the pharmaceutical press , 1986 . particularly preferred surface modifiers include polyvinylpyrrolidone , tyloxapol , poloxamers such as pluronic f68 and f108 , which are block copolymers of ethylene oxide and propylene oxide , and polyxamines such as tetronic 908 ( also known as poloxamine 908 ), which is a tetrafunctional block copolymer derived from sequential addition of propylene oxide and ethylene oxide to ethylenediamine , available from basf , dextran , lecithin , dialkylesters of sodium sulfosuccinic acid , such as aerosol ot , which is a dioctyl ester of sodium sulfosuccinic acid , available from american cyanimid , duponol p , which is a sodium lauryl sulfate , available from dupont , triton x - 200 , which is an alkyl aryl polyether sulfonate , available from rohm and haas , tween 20 and tween 80 , which are polyoxyethylene sorbitan fatty acid esters , available from ici specialty chemicals ; carbowax 3550 and 934 , which are polyethylene glycols available from union carbide ; crodesta f - 110 , which is a mixture of sucrose stearate and sucrose distearate , available from croda inc ., crodesta sl - 40 , which is available from croda , inc ., and sa90hco , which is c 18 h 37 - ch 2 ( con ( ch 3 ) ch 2 ( choh ) 4 ch 2 oh ) 2 . surface modifiers which have been found to be particularly useful include tetronic 908 , the tweens , pluronic f - 68 and polyvinylpyrrolidone . other useful surface modifiers include : another useful surface modifier is tyloxapol ( a nonionic liquid polymer of the alkyl aryl polyether alcohol type ; also known as superinone or triton ). this surface modifier is commercially available and / or can be prepared by techniques known in the art . another preferred surface modifier is p - isononylphenoxypoly ( glycidol ) also known as olin - 10g or surfactant 10 - g , is commercially available as 10g from olin chemicals , stamford , conn . one preferred surface modifier is a block copolymers linked to at least one anionic group . the polymers contain at least one , and preferably two , three , four or more anionic groups per molecule . preferred anionic groups include sulfate , sulfonate , phosphonate , phosphate and carboxylate groups . the anionic groups are covalently attached to the nonionic block copolymer . the nonionic sulfated polymeric surfactant has a molecular weight of 1 , 000 - 50 , 000 , preferably 2 , 000 - 40 , 000 and more preferably 3 , 000 - 30 , 000 . in preferred embodiments , the polymer comprises at least about 50 %, and more preferably , at least about 60 % by weight of hydrophilic units , e . g ., alkylene oxide units . the reason for this is that the presence of a major weight proportion of hydrophilic units confers aqueous solubility to the polymer . a preferred class of block copolymers useful as surface modifiers herein includes sulfated block copolymers of ethylene oxide and propylene oxide . these block copolymers in an unsulfated form are commercially available as pluronics . specific examples of the unsulfated block copolymers include f68 , f108 and f127 . another preferred class of block copolymers useful herein include tetrafunctional block copolymers derived from sequential addition of ethylene oxide and propylene oxide to ethylene diamine . these polymers , in an unsulfated form , are commercially available as tetronics . the following investigation of preparing nanoparticle dispersions in non - aqueous media was completed for the elastase inhibitor win 63394 . oleic acid and three pharmaceutically acceptable oils , soybean oil , corn oil , and safflower seed oil were screened , with and without the addition of secondary stabilizers . each combination was qualitatively characterized using light microscopy . favorable particle size reduction and particle dispersion stability were observed for win 63394 nanosuspensions milled with a pluronic f127 to water ratio of 1 : 9 in oleic acid . analysis of dispersions was limited by the their highly viscous nature . dilution of soybean , corn , and safflower seed oil dispersions stabilized with pluronic f127 to improve contrast between milled particles and the aqueous and non - aqueous was not effective . a description of the methods and procedures used for media conditioning , product recovery and qualitative microscopic analysis are discussed below . all experiments requiring milling were completed in a dispersion mill . a 25 ml volume of dispersion was milled using 42 . 0 g of 0 . 5 mm acid washed glass beads . at the conclusion of the milling period , vacuum filtration was used to recover the product dispersion . a leitz diaplan microscope with a pl fluotar 100 / 1 . 32 oil object was used to make qualitative observations of the nanoparticle suspension character and estimate particle size of the product dispersions . particle size distributions could not be quantitatively determined for dispersions in complex media such as oleic acid or oil ,, using traditional light scattering measurement methods , such as the microtrac upa , due to the viscosity and the refractive characteristics of the samples . a sony color video camera printer was fitted to the microscope and allowed a hard copy micrograph of each sample to be generated for future reference . the resolution of sample was limited due to the microscope power and the sample character . dilution of each dispersion was completed using the respective oleic acid or oil medium to improve the contrast between particles and emulsion droplets . dispersions milled in oleic acid / oil were diluted 1 : 2 in oleic acid / oil , respectively . this technique increased the resolution of the drug particles for dispersions milled in oleic acid . however , those suspensions milled in oils were unable to be diluted . eight stabilizer systems were screened to identify a potential stabilizer for milling win 63394 in oleic acid and was milled four hours . each nanoparticulate dispersion contained 222 . 5 mg of win 63394 ( 1 %) in a measured amount of stabilizer in 22 . 25 g oleic acid with 42 . 0 g of 0 . 5 mm acid washed glass beads . table i outlines materials and stabilizers used to mill win 63394 in oleic acid . table i______________________________________material grade source______________________________________win 63394 -- sterling - winthropoleic acid nf spectrumstabilizertween 80 reagent sigmaspan 80 reagent icityloxapol reagent sigmapluronic f68 nf basfpluronic nf basff127pluronic nf basfl122propylene reagent aldrichglycol______________________________________ table ii______________________________________description of win 63394 dispersion milledin oleic acidtrial stabilizer amount (% total ) ______________________________________1 tween 80 0 . 25 ml tween 80 ( 1 . 0 %) 2 span 80 0 . 25 ml span 80 ( 1 . 0 %) 3 tyloxapol 0 . 25 ml tyloxapol ( 1 . 0 %) 4 h . sub . 2 o 1 . 25 ml h . sub . 2 o ( 5 . 0 %) pluronic f68 250 mg f68 ( 1 . 0 %) 5 h . sub . 2 o 1 . 25 ml h . sub . 2 o ( 5 . 0 %) pluronic l122 250 mg l122 ( 1 . 0 %) 6 h . sub . 2 o 1 . 25 ml h . sub . 2 o ( 5 . 0 %) pluronic f127 250 mg f127 ( 1 . 0 %) 7 propylene glycol 6 . 25 ml ( 25 %) 8 50 % naoh solution 12 . 5 ul ( 0 . 2 %) 9 h . sub . 2 o 1 . 25 ml h . sub . 2 o ( 5 . 0 %) pluronic f127 250 mg f127 ( 1 . 0 %) ______________________________________ * trial 9 was milled without win 63394 as a control for trial 6 . in table ii , trials 1 - 8 , win 63394 was milled in oleic acid at low solids concentrations . trial 9 was used as a control for trial 6 , which showed favorable particle size reduction of less than 1000 nanometers and good particle dispersion . in trial 8 win 63394 was milled without stabilizer for 3 hours and 12 . 5 μl 50 % naoh solution was added at 3 hours and milled for the final hour . good particle size reduction and stability observed in trial 6 . that is , 5 % h 2 o , 1 % pluronic f127 in oleic acid . in all other trials , 1 - 5 , 7 and 8 , agglomeration of drug substance was observed . the stabilizer system of pluronic f127 in water and oleic acid and increased win 63394 concentrations was investigated in example 2 . trials 10 - 12 were completed using solid stock pluronic f127 . a 10 % pluronic f127 solution was added to trial 13 . trials 14 and 15 were milled in oleic acid as controls for trial 13 , trial 14 was milled without win 63394 and trial 15 was milled without the addition of pluronic f127 - h2o stabilizer . a description of the trials completed are found in table iii . table iii______________________________________description of win 63394 dispersions milledin oleic acid at increased solids concentration % win stabilizer oleictrial 63394 ( f127 : h . sub . 2 o ratio ) water acid______________________________________0 10 . 0 % 0 . 75 g f127 ( dry ) 15 . 0 % 18 . 6 ml ( 1 : 5 ) 1 15 . 0 % 0 . 75 g f127 ( dry ) 15 . 0 % 17 . 5 ml ( 1 : 5 ) 2 20 . 0 % 1 . 0 g f127 ( dry ) 20 . 0 % 15 . 0 ml ( 1 : 5 ) 3 10 . 0 % 7 . 5 ml - 10 % f127 -- 15 . 0 ml soln ( 1 : 9 ) 4 -- 7 . 5 ml - 10 % f127 -- 17 . 5 ml soln ( 1 : 9 ) 5 10 . 0 % -- -- 22 . 5 ml______________________________________ the results of experiments described in example 2 revealed that at increased solid concentrations , i . e . 20 %, dispersion viscosity is increased . as a result , milling efficiency was significantly reduced and the temperature of the suspension during milling increased dramatically . trial 12 was discontinued after 30 minutes for these reasons . comparison of trials 13 and 14 is difficult due to the resolution of the samples . however , minimal agglomeration is observed in trial 13 when diluted in 2 parts oleic acid . trial 15 shows significant hard agglomeration in both diluted and undiluted samples . in addition to the dispersions milled in oleic acid , an investigation of soybean , corn , and safflower seed oil was conducted . again , dispersions were milled using 42g of 0 . 5 mm acid washed glass beads as the milling agent . table iv lists the materials used for these oil milling trials . table iv______________________________________materials used for screening of milling oilmediummaterials grade source______________________________________win 63394 -- -- soybean oil reagent sigmacorn oil reagent sigmasafflower seed reagent sigmaoil______________________________________ based on the favorable results in trial 6 , 5 % h 2 o - 1 % pluronic f127 in oleic acid , 7 . 5 ml - 10 % pluronic f127 solution was added to each oil medium . controlled dispersions without stabilizer , trials 16 - 18 , and dispersions with stabilizer and without win 63394 , trials 20 , 22 and 24 , were completed to distinguish between drug particles and other components of the emulsion suspension . a description of win 63394 dispersions milled in oil mediums with pluronic f127 is table v______________________________________description of win 63394 dispersions milled inoil mediums medium / amounttrial stabilizer % win 63394 [ ml ] ______________________________________16 -- 3 . 0 % soybean oil / 24 . 25 ml17 -- 3 . 0 % corn oil / 24 . 25 ml18 -- 3 . 0 % safflower seed oil / 24 . 25 ml19 7 . 5 ml - 10 % 3 . 0 % soybean oil / f127 16 . 75 ml20 7 . 5 ml - 10 % -- soybean oil / f127 16 . 75 ml21 7 . 5 ml - 10 % 3 . 0 % corn oil / f127 16 . 75 ml22 7 . 5 ml - 10 % -- corn oil / f127 16 . 75 ml23 7 . 5 ml - 10 % 3 . 0 % safflower seed f127 oil / 16 . 75 ml24 7 . 5 ml - 10 % -- safflower seed f127 oil / 16 . 75 ml______________________________________ micrographs of the diluted samples from trials 16 - 18 showed minimal particle agglomeration . however , as was observed in micrographs of the samples in oleic acid , resolution between the components in the dispersion was limited . samples from the trials milled at low solids concentrations , trials 19 , 21 and 23 were observed to have the particles residing within large water droplets . control trials 20 and 22 formed stable emulsions while interconnected water droplets were observed in trial 24 . all attempts to dilute the samples in their respective oil medium were unsuccessful . an attempt was made to optimize the pluronic f127 to water ratio which provides a stable emulsion in oleic acid . the results of this evaluation are described below . pluronic f127 and water were combined with 10 ml of oleic acid in 20 ml borosilicate glass vials . the vials were placed on a shaker for one hour at 400 rpm at 37 c . qualitative analysis was completed using photomicroscopy to assess physical stability of each emulsion suspension immediately after shaking and after setting on a bench top for 3 days at 25 ° c . the conditions of the trials are listed in table iv . table vi______________________________________description of pluronic f127 / h . sub . 2 o optimizationtrials stabilizer ( f127 : h . sub . 2 o oleictrial ratio ) water acid______________________________________1 1 ml - 1 . 0 % f127 soln -- 10 ml ( 1 : 200 ) 2 1 ml - 1 . 0 % f127 soln -- 10 ml ( 1 : 100 ) 3 1 ml - 5 . 0 % f127 soln -- 10 ml ( 1 : 20 ) 4 1 ml - 10 % f127 soln ( 1 : 10 ) -- 10 ml5 10 mg f127 ( dry ) ( 1 : 100 ) 1 ml 10 ml6 50 mg f127 ( dry ) ( 1 : 20 ) 1 ml 10 ml7 100 mg f127 ( dry ) ( 1 : 10 ) 1 ml 10 ml8 1 ml - 0 . 5 % f68 soln -- 10 ml ( 1 : 200 ) 9 1 ml - 0 . 5 % f68 soln -- 10 ml______________________________________ trials 1 - 4 of example 4 resulted in milky emulsions after shaking . trials 5 - 7 , which introduced the pluronic f127 as a dry material also appeared to be well dispersed upon shaking , however the micrographs revealed undissolved f127 material dispersed in the oleic acid . trials 1 - 7 separated into 3 phases after 3 days , but were easily returned to a milky emulsion with gentle agitation . large water droplets were observed in the samples from trials 8 and 9 after shaking . after 3 days , the emulsion separated into two phases and was difficult to return to an emulsion . the results of example 4 demonstrate that it is possible to produce a nanoparticulate aqueous dispersion emulsified in a continuous oil or fatty acid phase . oleic acid as the fatty acid showed the best results ; however , it is anticipated that other fatty acids would also produce stable nanoparticle aqueous dispersion emulsions . the invention has been described in detail with particular reference to the preferred embodiments thereof , but it will be understood that variations and modifications can be affected within the spirit and scope of the invention .	8
the present invention relates to a new method of coat - finishing polyester fabrics , specifically , to a new method of coat - finishing polyester fabrics to produce anti - migration properties . ( 1 ) a uniform resin composition is formed by adding a cyclic compound of a non - reductive , maltooligosaccharine , a cyclodextrin in which 6 - 8 units of glucose exists in α - 1 , 4 glucoside - bonded form , to the coating resin composition . ( 2 ) this uniform resin composition is coated on the fabric surface by known methods . in the present invention , polyester fabric means fabrics in which polyester is one component , such as polyester - nylon , polyester - cotton , polyester - rayon and polyester - acrylic blends , as well as 100 % polyester fabrics . the coating effect is especially high in the case of 100 % polyester fabrics dyed with disperse dyes . among the cyclic compounds of non - reductive maltooligosaccharide , cyclodextrin , in which the glucose unit is composed of 6 - 8 , α - 1 , 4 glucoside bonds , has good solubility in polar and nonpolary solvents and is not changed chemically on heat - setting due to its high stability above 180 ° c . moreover , since the above cyclodextrin has good compatibility with the coating resin , it does not limit the choice of the resin and it is possible to obtain a coating material having various properties . and it is possible to obtain a sufficient anti - migration property with even a small amount , since the cyclodextrin is uniformly dispersed into the coating layer , due to the uniform resin composition . since the cyclodextrin in the coating layer has good affinity towards disperse dyes , which migrate in the course of coating processes or sewing , handling and using , the cyclodextrin fixes the disperse dyes , which prevents migration ; thus staining of white or light color fibers which come into contact with the coating layer does not occur . the amount of cyclodextrin to be used depends , in particular , on the content of the disperse dye existing in the polyester fabrics ; generally a suitable amount is 1 . 0 - 15 weight % based on the weight of the fabrics , preferably 2 . 0 - 10 weight %. when the amount of cyclodextrin is less than 1 . 0 weight %, the effect is not sufficient and if the amount of cyclodextrin is more than 15 weight %, it is not economical , since no further improvement in the anti - migration property is obtained . furthermore , cyclodextrin having repeating units of glucose of less than 5 or more than 9 is very expensive , and not economical in comparison to the preferred cyclodextrin . resins for coat - finishing are not particularly limited , but one or more resins selected from acrylic , urethane , silicone , fluorinated vinyl chloride , amide , cellulose , peptide and rubber resin can be used for clothes , generally urethane and acrylic resins are used . as a process of coat - finishing , dry processes , wet processes , melt cooling processes and laminating processes can be used without limitation . a suitable process should be selected , depending on the resin used and the appearance characteristics of the coating layer . the polyester coated fabrics according to the present invention have excellent mechanical properties , chemical resistance , feel , aesthetic properties and economical efficiency as compared to nylon and cotton fabrics . the coating compositions can be applied as coatings for clothes , such as moisture - permeable water proof and water - repellent and water proof materials and can be widely applied to industrial use . the following examples will be given by way of illustration of the present invention but are not construed as limiting thereof . the polyester fabrics which are used in examples and comparative examples are plain fabrics constituted of polyester 100d / 192f as warp and polyester 75d / 72f as weft , and having a warp of 216 ply / inch and a weft of 94 ply / inch . polyester fabrics were dyed with a disperse dye at 130 ° c . for 45 min ., and washed by known methods , heat - set at 170 ° c . and coated . blue fabric was dyed with dispersol blue b - r ( ici , c . i . disperse blue 56 ) 5 % o . w . f ., red fabric was dyed with dispersol red b - 2b ( ici , c . i . disperse red 60 ) 5 % o . w . f ., yellow fabric was dyed with miketon polyester yellow f3g ( mitsui doatsu dyestuff co ., c . i . disperse yellow 54 ) % 5 o . w . f ., and black fabric was dyed with miketon polyester black pbsf ( mitsui doatsu dyestuff co .) 10 % o . w . f ., respectively . migration of the coated fabrics was measured by japanese industrial standard , jis l 0854 , wherein a white polyester fabric , coated with a conventional , non - cyclodextrin containing resin , was contacted with the dyed fabrics of the examples . the fabrics were inserted between two pieces of glass and pressed together with a 4 . 5 kg weight . the samples were kept in a constant temperature and moisture apparatus of 120 ° c .± 2 ° c . for 80 min ., and cooled to room temperature . the migration state from sample to the appended white fabrics was graded with a grey scale for staining . the coating resin which was used in examples and comparative examples is as follows . ______________________________________1 . polyester system polyurethane resin crisvon 8006hv : dainippon ink and chemical manufacture pararesin u - 11 : ohara paragium co . manufacture2 . acrylic resin criscoat p - 1018a : dainippon ink and chemical manufacture3 . amino acid resin luckskin ua - 3295a , b : seiko chemical co . manufacture______________________________________ and the result of examples and comparative examples were shown in table 1 . a uniform coating resin composition composed of crisvon 8006hv urethane resin , 90 parts , dmf ( demethylformamide ), 50 parts , cyclodextrin having 7 repeating units of glucose , 10 parts and a crosslinking agent , 5 parts , was coated on test fabrics by gravure coating machine . the coated fabrics were coagulated in water , dried and heat - set , so that the adhesion amount of cyclodextrin in the fabrics was 5 % o . w . f . a uniform coating resin composed of crisvon 8006hv urethane resin , 90 parts , dmf 50 parts , cyclodextrin having 5 repeating units of glucose , 15 parts and a crosslinking agent , 5 parts , was coated on test fabrics as in example 1 , so that the amount of cyclodextrin was 2 . 5 % o . w . f . a uniform coating resin composed of crisvon 8006hv urethane resin 90 parts , dmf 50 parts , cyclodextrin having 8 repeating units of glucose , 15 parts and a crosslinking agent 5 parts was coated on test fabrics as in example 1 , so that the amount of cyclodextrin was 7 . 5 % o . w . f . a resin prepared by dissolving crisvon 8006hv urethane resin , 100 parts , in dmf 30 parts was coated on test fabrics as in example 1 . a uniform coating resin composed of crisvon 8006 hv urethane resin , 90 parts , dmf 50 parts , cyclodextrin mixture having 6 - 8 repeating units of glucose , 20 parts and a crosslinking agent , 5 parts , was coated as in example 1 , so that the amount of cyclodextrin mixture was 7 % o . w . f . when crisvon 8006 hv urethane resin was used in the above examples , crisvon nx ( dainippon ink and chemical co .) was used as crosslinking agent . a uniform resin composition composed of cyclodextrin having 7 repeating units of glucose , 10 parts , dmf 30 parts , parkresin u - 11 , 100 parts , cat . u , which is the mixture of crosslinking agent and catalyst , 10 parts and ammonia water , as viscosity increasing agent , was knife coated on test fabrics . coated fabrics were dried and heat - set , so that the amount of cyclodextrin was 3 % o . w . f . a uniform resin composition composed of pararesin u - 11 , 100 parts , cat . u , 10 parts and ammonia water was coated on test fabrics as in example 5 . a resin composition composed of criscoat p - 1018 a acrylic resin , 100 parts , crisvon cl - 3 ( dainippon ink and chemical co .) as isocyanate system crosslinking agent , 3 parts , toluene , 2 parts and cyclodextrin having 7 repeating units of glucose , 10 parts , was knife coated on test fabrics . the coated fabrics were dried and heat - set , so that the amount of cyclodextrin was 8 % o . w . f . a resin composition composed of criscoat p - 1018 a acrylic resin , 100 parts , isocyanate system crosslinking agent , 3 parts , and toluene , 2 parts , was coated as in example 6 . a uniform resin composition composed of luckskin 3295 a amino acid resin , 50 parts , luckskin 3295 b amino acid resin , 50 parts , luckskin cl - 100 as crosslinking agent ( seiko chemical co . ), 2 parts , dmf , 20 parts , cyclodextrin having 7 repeating units of glucose , 10 parts , was coated on test fabrics by gravure coating machine . the coated fabric was coagulated , washed , dried and heat - set , so that the amount of cyclodextrin was 4 % o . w . f . a resin composition composed of luckskin 3295 a amino acid resin , 50 parts , luckskin 3295 b amino acid resin , 50 parts , luckskin cl - 100 , 2 parts , dmf , 20 parts , was coated as in example 7 . table 1______________________________________ fastness to sublimation ( staining , grey scale ) section blue red yellow black______________________________________example 1 4 - 5 4 - 5 5 4example 2 4 4 4 - 5 3 - 4example 3 4 - 5 4 - 5 4 - 5 4example 4 5 5 5 4 - 5example 5 5 4 - 5 5 4example 6 5 5 5 4 - 5example 7 4 4 4 4comparative 2 1 - 2 2 1example 1comparative 2 2 2 1 - 2example 2comparative 2 2 2 1 - 2example 3comparative 2 2 2 1 - 2example 4______________________________________	3
in order to implement legacy ieee 802 . 11 coding and interleaving schemes and systems , coding schemes are implemented to move bit padding in the physical or phy layer from before coding ( encoder ) to after coding ( encoder ). exemplary implementations include an encoder module in devices to provide for such schemes and processes . fig1 is an illustrative system 100 that implements coded bit padding . the system 100 can include multiple devices 102 in communication with one another . in this example , the system includes a device 102 ( 1 ) with an encoding module 104 ( 1 ). device 102 ( 1 ) is coupled via a wired connection 106 to a device 102 ( 2 ). device 102 ( 2 ) includes an encoding module 104 ( 2 ). system 100 further includes a device 102 ( 2 ) in wireless communication 108 with device 102 ( n ). device 102 ( 3 ) includes an encoder module 104 ( 3 ), and device 102 ( n ) includes an encoder module 104 ( n ). encoder modules 104 are implemented to provide coded bit padding for ofdm symbols transmitted by devices 102 . in certain implementations , the devices 102 may include ofdm modules ( not shown ) to generate an ofdm signal . each device 102 can include a transmitter , receiver , or transceiver to convey output ( i . e ., ofdm symbols ). these transmitters , receivers , or transceivers may be configured to convey the output via an electrical conductor , electromagnetic radiation , or both . each device 102 includes one or more processors ( described below ) and a memory ( described below ) coupled to the processor ( s ). devices 102 can include wireless access points , radio frequency transceivers , software defined radios , modems , interface cards , cellular telephones , portable media players , desktop computers , laptops , tablet computers , net books , personal digital assistants , servers , standalone transceiver interfaces , and so forth . in exemplary operations , communication in system 100 can implement an 80 mhz channel , or higher such as 120 mhz or 160 mhz and 256 qam ( quadrature amplitude modulation ). in legacy ieee 802 . 11 , such features can be problematic for data tone selection . the encoding schemes and processes ( i . e ., encoding module 104 ) described herein , are directed to such issues . the number of data tones implemented by system 100 may be even tone counts of 216 , 220 , 222 , 224 , 228 , 230 , 232 and 234 for a 80 mhz system . these numbers are based on the reuse of the ieee 802 . 11n interleaver structure , and data bit flow . this is in addition to having a minimum tone count of at least two times the 40 mhz ( i . e . 80 mhz ) ieee 802 . 11n system . the described encoding schemes consider the addition of 256 qam , with code rates such as 2 / 3 and 5 / 6 , where the number of data tone count options drops by a half . this is due the numerology and flow used in the ieee 802 . 11a / n standard . a code rate of 2 / 3 is attractive when coupled with 256 qam . the 2 / 3 code rate is more effective from a transmitter power amplifier perspective , than rates such as 3 / 4 or 7 / 8 , and can allow a decrease in power consumption or a less expensive device 102 to be utilized when implementing the same transmit range as legacy ieee 802 . 11 systems . furthermore , if legacy 20 mhz ieee 802 . 11 systems use 256 qam , coding rates of 2 / 3 or 5 / 6 may not be used . this can be the case , because providing new tone allocation ( configurations ) may not fit exactly in an integer number of ofdm symbols , unlike legacy ieee 802 . 11 systems that have data tone counts and modulation and coding that create payloads that fit exactly in an integer number of ofdm symbols . for legacy ieee 802 . 11 encoding schemes , consideration can be made for two constraints , which depend on the ofdm symbol size and the encoder ( encoding module 104 ). the first constraint is that the number of coded bits per ofdm symbol or ncbps should be an integer . the second constraint is that the number of data bits per ofdm symbol or ndbps should also be an integer . an integer for ndbps can assure that all data lengths work with no additional padding using the current ieee 801 . 11 a / n equations . if ndbps is not an integer , then many payload sizes can result in a non - integer number of padding bits , or the number of encoded bits exceeding the number of ofdm symbols . in either case , this leads to a minimum of one additional ofdm symbol that is not needed , which includes only padding bits . current ieee 802 . 11a / n equations require that ncbps and ndbps be integers . in certain cases , the ieee 802 . 11a / n equations the padding bits to be added can be a non integer , which results in the inability to fill out the packet . the schemes processes described herein are not limited to by the having ncbps and ndbps to be integers . the schemes and processes that are described provide that for data tone counts to be used with various modulation or coding scenarios , to move the bit padding operation from the input of the encoder ( coding ), to the output of the encoder ( coding ), after the bits have been encoded . the following equation ( 1 ) can be used to compute the number of padding bits to fill out the least number of ofdm symbols to transmit the media access control or mac payload . where n pad is the number of padded symbols to be added ; n sym is the number of ofdm symbols based on the equation in ieee 802 . 11a / n standard ; n sym is the number of data tones ; n macbytes is the number of mac layer bytes that are being passed to the phy layer ; 16 is the length of the service field ; and 6 is the length of the tail bits . this bit padding approach can remove an ieee 802 . 11 requirement on the ndbps and ncbps for data tone allocation , with a number of modulation and coding combinations . the bit padding approach is also intended to be backwards compatibility with ieee 802 . 11 systems / standards incorporated into current and legacy ieee 802 . 11 processing chains . furthermore , such a bit padding approach can allow for various combinations of data tones , modulation , and coding without restricting one of the aforementioned variables . in particular , restricting the number of data tones can lower system data rate , as would disallowing 256 qam . restricting the coding can , as discussed above , potentially increase cost or power consumption . in prior or legacy ieee 802 . 11 systems , the numerology can only allow for integer data bits per ofdm symbol and integer number of coded bits per ofdm symbol . a new signal field can be required for next generation ieee 802 . 11 systems , where knowledge of the padding method and number may have to be known . the bit padding approach can provide modulation and coding rates used in bandwidths of 60 to 160 mhz , and in particular 80 mhz . fig2 illustrates an exemplary device 104 that implements coded bit padding . the device 104 includes devices 104 ( 1 ), 104 ( 2 ), 104 ( 3 ) and 104 ( n ). device 104 describes certain components and it is to be understood that described components can be replaced with other components , and combined with one another . additional components and devices may also be included in device 104 . a host microprocessor or processor 200 , which can include multiple processors , is provided . the processor 200 can be connected or coupled to a memory 202 . memory 202 can include multiple memory components and devices . the memory component 202 can be coupled to the processor 200 to support and / or implement the execution of programs , such as key generation and delivery protocol . the memory component 202 includes removable / non - removable and volatile / non - volatile device storage media with computer - readable instructions , which are not limited to magnetic tape cassettes , flash memory cards , digital versatile disks , and the like . the memory 202 can store processes that perform the methods that are described herein . in an implementation , the ieee 802 . 11 standard is extended and implemented by device 104 . therefore , in such an implementation , device 104 includes particular hardware / firmware / software configurations to support the ieee 802 . 11 standard . device 104 implements a common medium access control or mac layer , which provides a variety of functions that support the operation of ieee 802 . 11 based wireless communications . as known by those skilled in the art , the mac layer manages and maintains communications between ieee 802 . 11 wireless communication devices by coordinating access to a shared radio channel and utilizing protocols that enhance communications over a wireless medium . the mac layer uses an 802 . 11 physical or phy layer , to perform the tasks of carrier sensing , transmission , and receiving of ofdm symbols . the device 104 further includes encoder module 104 . the encoder module 104 , which is further described below , is used to perform receiving data bits , encoding ( coding ), modulating , and outputting ofdm symbols . furthermore , one or more antennae 206 ( 1 ) to 206 ( n ) can be included with or connected to the device 104 . antennae 206 can include multiple antennae for multiple input , multiple output ( mimo ) operation . antenna 210 can be configured to receive and send transmission . fig3 illustrates an exemplary encoder module 104 for bit padding . the particular operating parameters described are illustrative and are not intended to be limiting . it is to be understood that other operating parameters may be implemented . in this example , encoder module 104 can operate using an 80 mhz transmission bandwidth with 224 data tones , implementing 256 qam with a code rate of 2 / 3 . the data bits 300 , include 200 bytes ( 200 * 8 ) or 1600 data bits , which are passed from the mac layer . the data bits 300 are passed onto a payload represented by a service field 302 having 16 bits , the data bits 304 ( 1600 data bits ), and tail bits 306 . the tail bits 306 are used to flush the encoder module 104 . the payload is sent to a scrambling process 308 and encoded 310 at a 2 / 3 rate . the scramble 308 and encode 310 can be presented as a coding or encoding module 312 . addition of padding bits represented by module 314 , is performed . in this example , 1151 symbols or bits are added . interleaving and modulation mapping can be performed as shown in module 316 . an output buffer 318 receives the interleaved and modulated symbols which included 3584 coded symbols or 450 modulation signals . a minimal number of ofdm symbols represented by ofdm symbol 1 320 and ofdm symbol 2 322 is shown . the ofdm symbol 1 320 and ofdm symbol 2 are output of the output buffer 318 . in contrast to schemes that implement the use of padding bits prior to coding or encoding ( i . e ., encoding 312 ), no extra padding bits are needed , and no extra ofdm symbol is generated . fig4 is a flow chart for an example process 400 for coded bit padding . as an example , the code bit padding may be performed using the encoder module 104 of the device 102 . the order in which the method is described is not intended to be construed as a limitation , and any number of the described method blocks can be combined to implement the method , or alternate method . additionally , individual blocks can be deleted from the method without departing from the spirit and scope of the subject matter described herein . furthermore , the method can be implemented in any suitable hardware , software , firmware , or a combination thereof , without departing from the scope of the invention . at block 402 , receiving a data payload for ofdm transmission is performed . as discussed above , the data payload can be passed from the mac layer to the phy layer . the received payload can include data bits along with service data bits and tail bits . the data payload may be determined by a number of data tones , which as discussed above , can be an even number tone count . at block 404 , coding or encoding is performed on the data payload . as discussed above , 256 qam may be implemented , and code rates such 2 / 3 or 5 / 6 . furthermore , bandwidth operation can include 60 to 160 mhz , and particularly 80 mhz . at block 406 , adding padding bits is performed . the number of padding bits may be derived by the following equation as discussed above , to fill out the least number of ofdm symbols to transmit the media access control or mac payload . where n pad is the number of padded symbols to be added ; n sym is the number of ofdm symbols based on the equation in ieee 802 . 11a / n standard ; n sym is the number of data tones ; n macbytes is the number of mac layer bytes that are being passed to the phy layer ; 16 is the length of the service field ; and 6 is the length of the tail bits . in addition , interleaving and modulation may occur after padding bits are added . at block 408 , outputting a minimal number of ofdm symbols is performed . the number of coded bits per ofdm signal or ncbps can be an integer . also , the number of data bits per ofdm signal or ndbps can also be an integer . although specific details of illustrative methods are described with regard to the figures and other flow diagrams presented herein , it should be understood that certain acts shown in the figures need not be performed in the order described , and may be modified , and / or may be omitted entirely , depending on the circumstances . as described in this application , modules and engines may be implemented using software , hardware , firmware , or a combination of these . moreover , the acts and methods described may be implemented by a computer , processor or other computing device based on instructions stored on memory , the memory comprising one or more computer - readable storage media ( crsm ). the crsm may be any available physical media accessible by a computing device to implement the instructions stored thereon . crsm may include , but is not limited to , random access memory ( ram ), read - only memory ( rom ), electrically erasable programmable read - only memory ( eeprom ), flash memory or other solid - state memory technology , compact disk read - only memory ( cd - rom ), digital versatile disks ( dvd ) or other optical disk storage , magnetic disk storage or other magnetic storage devices , or any other medium which can be used to store the desired information and which can be accessed by a computing device .	7
reference will now be made in detail to the preferred embodiments , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . there have been discussions in connection with 3gpp frequency division duplex ( fdd ) enhanced dedicated channel , or enhanced uplink ( e - dch ) relating to how radio resource management ( rrm ) for uplink ( ul ) resources and the corresponding scheduling of e - dch resources in the network can be improved . the proposals consider measurements by a radio network controller ( rnc ). e - dch is a packet oriented uplink channel especially suited for high data rates and bursty transmission . the received power used by user equipments ( ues ) in the uplink is managed by a base station ( bs ) in order to improve utilization of uplink noise rise . however since the network is responsible for overall rrm , including legacy channels , noise rise in the bs receiver needs to be carefully controlled by the network . radio resource management is a method whereby the network controls how many ues come into a node b . noise contributed by each ue is measured , so that the network can determine if the number of ues in a cell is at its maximum , or whether it can be increased , or whether the data rate of existing ues in the cell can be increased . fig1 shows a typical arrangement of cells 1 , 2 , 3 in a network 4 controlled by an rnc 5 . the rnc sends instructions via radio network links 6 to each node b nb 1 , nb 2 , nb 3 setting limits of maximum noise rise . each node b then subdivides the available noise rise in a known manner and signals to each ue 7 , 8 , 9 ( and 10 , 11 , 12 ) the maximum which is available to it . fig2 illustrates how one ue 12 can have an impact on the noise at more than one node b nb 2 , nb 3 . e - dch transmissions 13 from the ue are received at both nb 2 , its serving node b and a non - serving node nb 3 . the serving node b can send absolute grants 14 and relative grants and the non - serving node b sends relative grants 15 . the rnc communicates the maximum noise rise to each node b . although , ue 12 is not served by nb 3 , its position is such that it can interfere with ues served by nb 2 , so the rnc needs to be able to control this effect . fig3 illustrates how different types of noise make up the noise rise at a node b . for all node bs there is a certain amount of noise whose source is unknown and which cannot be compensated for . this unknown noise 16 is the minimum . added to this is an amount of noise caused by the receiver itself , e . g . due to the components 17 . noise produced due to communication can be broken down into noise from other cells 18 , noise 19 from other channels communicating via the node b which are not operating enhanced uplink ; and noise 20 at the node b caused by its served ues operating e - dch . as described in more detail below , the method allows a received total wideband power value to be determined for each of the operating noise types , 18 , 19 , 20 . an additional variable is that at different ambient temperatures the component noise 17 will vary . it will be least at the daily minimum and usually greatest at the daily maximum . the increase in this noise 17 is indicated by the dotted line 21 . the maximum permitted noise rise in the cell is indicted by the level 22 . to optimize efficiency , it is desirable to get as close to this level without exceeding it . in order to effectively manage overall rrm , it is necessary for the rnc to be able to set targets for the bs for the uplink resources that it manages and monitor the usage of these resources ( noise rise ) by the bs . currently the only suitable measurement in this area is received total wideband power ( rtwp ) at the bs receiver . rtwp measures uplink interference and so can be used to determine the overall noise rise if the noise level at the bs is known . rtwp measured at an antenna is analog and takes into account the receiver behavior . rtwp is measured in a quiet period with no 3g transmissions , so only hardware or random other noise outside the control of the node b is measured . the measured quiet rtwp is either stored at the node b or returned to the rnc to give a basic level of noise from which to calculate the e - dch generated noise . examples of determination of the optimum quiet period t 0 based on statistical cell traffic analysis are described below . the phase of low traffic activity within one day can be determined by analyzing the cell traffic of an example cell , cell x and other cells close to cell x for a number of days . this can be analyzed in the rnc . this analysis provides a time dependent probability for low traffic activity on a cell basis in terms of a time window where the probability for low traffic activity is the lowest for cell x and the surrounding cells . the optimal time t 0 within this time window is either when there is no traffic in cell x , by setting a threshold , or at a time when the traffic is predicted to be lowest based on the statistics . the time t 0 can be signalled from the rnc to the node b , alternatively the rnc signals only the time window and the node b decides t 0 within this time window autonomously . to determine the noise rise share of e - dch users , a sum of received signal code power ( rscp ) of all ues using e - dch is determined . rscp in the node b is not defined as a measurement in the standard , but such a determination of the code power can be easily done in the digital domain node b , since the signal to interference ratio ( sir ) measurement also requires this functionality . knowledge of corresponding scrambling and spreading codes that are used is required . rscp is a digital measurement , from which after decoding channels , the node b knows all transmission power levels and where they are from . the ue from which these come may or may not be served by that node b . in order to compensate errors when referencing such an rscp value to the antenna connector , e . g . due to rf gain variations , this is a relative measurement . e ⁢ - ⁢ d ⁢ ⁢ c ⁢ ⁢ h ⁢ ⁢ noise total ⁢ ⁢ uplink ⁢ ⁢ noise = sum ⁢ ⁢ of ⁢ ⁢ all ⁢ ⁢ e ⁢ - ⁢ d ⁢ ⁢ c ⁢ ⁢ h ⁢ ⁢ r ⁢ ⁢ s ⁢ ⁢ c ⁢ ⁢ p ⁢ ⁢ in ⁢ ⁢ cell ⁢ ⁢ x r ⁢ ⁢ t ⁢ ⁢ w ⁢ ⁢ p ⁢ ⁢ in ⁢ ⁢ cell ⁢ ⁢ x ( note : this is a linear description , in db it would be a difference ) such a measurement reported from a node b to an rnc allows determination of the share of the sum of all enhanced ul ( e - dch ) channels from other cells ( for which cell x is called non - serving cell ); and other intra cell interference in cell x ( e . g . rach or hs - dpcch in cell x ) to the total ul noise . as the sum of all enhanced ul ( e - dch ) channels for which cell x is the serving cell and the sum of all enhanced ul ( e - dch ) channels from other cells ( for which cell x is called non - serving cell ) are controlled by cell x in a different way , the former , serving cell is controlled by absolute grant ( ag ) or relative grant ( rg ) up / hold / down commands , and the latter , non - serving cell is controlled only by rg down / hold command , then these noise types can also be further distinguished into : this allows an even more detailed control of the ul interference caused by e - dch and such information can be used in the node b scheduler as well as in the admission control by the rnc . it is also possible to calculate and report to the rnc for a finer admission control the ratio of : measurement of rscp applies more overall accuracy to control the noise rise by taking into account the type of use of each ue . in an active cell , an increase in noise occurs when physical receiver characteristics change due to variation in ambient temperature , e . g . at a different time of day . in some places temperatures may vary significantly between night and day , such as from 2 ° c . to 40 ° c . a further feature provides a method of dealing with these temperature induced changes , by measuring the temperature at the node b when the later measurement is made and using a lut to determine how characteristics change due to temperature , a correction is applied to improve the accuracy of the total noise measurement . this method can be used in conjunction with the rscp measurements , or separately . it is necessary to know how much e - dch alone contributes to the measured differential , rather than from other cells in the vicinity . conventionally , it has not been possible to determine an indication of the share of interference or noise rise resulting from e - dch transmissions compared to that used for other transmissions such as legacy dedicated channel ( dch ), forward access channel ( fach ) etc ., although , this can be done using rscp as described above . a scheduler in the node b determines the available noise rise for all ues and allocates a local maximum for each . transmission at a higher data rate means more noise , so fewer ues can transmit . the node b allocates to the ue a maximum data rate that it can used and from this it is possible to determine the noise that this data rate will create at the node b ), so the node b must measure the actual noise correctly to keep within the allocated maximum . in a known system , the rnc can command that a certain portion of the noise rise ( target noise rise ) be used by the scheduler for e - dch noise rise at the bs , or node b receiver , but the node b has no way of informing the rnc about the actual status , i . e . the noise rise in the bs receiver caused by e - dch users which it serves , or e - dch users in other cells . in this case , the expression “ users in other cells ” includes users sending their data to a different node b , but receiving relative grants from the same node b . therefore the rrm control mechanism available to the rnc is at best open loop , which is unlikely to be sufficient in a real network . the node b needs to measure all noise contributions and the rnc signals an upper limit which is the maximum uplink noise permitted . if the node b exceeds this maximum , the performance and throughput will deteriorate and at worst the whole cell will cease to operate . the rnc must tell each node b the maximum noise rise it can use and send a limit and then the node b must measure the actual noise rise against this limit and tell the rnc . in all cells there is background noise and the node b needs to know what the background noise is , so it can determine the amount by which it changes in busy times . an absolute value for this purpose ( e . g . absolute interference at the bs receiver ) is not suitable , as e - dch caused rtwp does not exist as such and such an absolute value would be of no use . an absolute value would not indicate noise rise to the rnc and the value would be determined in the base band and needs to be referenced to the antenna connector , thus containing inaccuracy due to the receiver gain in the receive chain . current total rtwp power measurement has an error of +/− 4 db absolute accuracy which cannot be significantly improved . an error of 0 . 5 db in the ul noise rise estimation will cause an e - dch throughput loss of about 10 % and a 3 db error leads to a loss in the order of 50 %. similar figures could be expected for any rrm based on absolute interference measurements , so a better solution is required . there is also a relative accuracy defined for rtwp : +/− 0 . 5 db . “ relative accuracy ” refers to the allowed difference between two measurements of rtwp made at different points in time arising from measurement inaccuracy ; however the time between these two rtwp measurements is not explicitly specified in 3gpp release 6 . one way to obtain a noise rise measurement , including a component which takes into account the interference from other cells , with a relative accuracy of 0 . 5 db , rather than the absolute accuracy of 4 db would be to measure the node b noise power by taking an rtwp measurement at a point in time when the entire network is quiet , i . e . when there are no uplink transmissions in any cell , and then during active e - dch operation to report measured rtwp relative to the quiet period value . however , taking an rtwp in ‘ low cell traffic density hours ’, to get an estimation of the receiver noise and the other parts of interference which can not directly be influenced , as a reference could be a problem in that temperature drift can produce fluctuations in receiver noise of 0 . 5 db , for the example of a temperature difference between day and night of 20 - 30 ° c . with remote radio heads . another problem is to determine the time of lowest cell traffic activity as this depends of the deployment , time and other influences . the node b can only measure the total noise , which includes unknown background noise , temperature induced noise and noise from legacy channels which are not operating e - dch . in a known system , the rnc controlled how much power each ue could use , which is quite slow and inefficient because of the need to transmit information over a long run . enhanced uplink passes some of the management function to the node b , thereby reducing signalling delays . however , the node b is not able to control ues in adjacent cells which might cause interference although it can adjust the maximum power that they use by the relative grant , so the rnc still has a role and a need to determine the noise actually generated at each node b to ensure that one cell does not interfere with another . if the node b scheduler is not doing too well , the rnc will tell the node b to reduce its noise . the node b does not know what other node bs are doing so rnc controls to make sure other node bs are not interfered with . the method enables a practical bs measurement that is useful for rrm , has reasonable accuracy and reflects the proportion of uplink resources used for e - dch rtwp received from cell x can be considered as a sum of : ( a ) receiver noise caused by a receiver in node b for cell x ; ( b ) inter - cell interference from other cells close to cell x ( as long as not covered below ); ( c ) the sum of all ul dedicated channels ( ul dpch ) of cell x ; ( d ) the sum of all enhanced ul ( e - dch ) channels for which cell x is the serving cell ; ( e ) the sum of all enhanced ul ( e - dch ) channels from other cells ( for which cell x is called non - serving cell ); and ( f ) other intra cell interference in cell x ( e . g . rach or hs - dpcch in cell x ) a measurement rtwp_ 1 at time instant t 1 relative to rtwp_ 0 at t 0 where t 1 is the time instant at which the ul noise should be controlled in an active network and t 0 is a phase of low traffic activity in the network , means that it is possible to get an impression of how the parts c , d , e and f contribute to the ul noise rise ( rtwp_ 1 / rtwp_ 0 ). in such a case rtwp_ 0 could either be stored in the node b or provided by the rnc via lub signalling , indicating that this is to be used as a basis for the control of the total noise rise . the relative rtwp measurement has the advantage of higher accuracy as systematic errors ( e . g . for rf gain variations when referring to the antenna connector ) for both rtwp parts cancel each other for the quotient . drawbacks of the “ quiet period ” measurement must be overcome . considering a reference rtwp_ 0 which is taken in the low activity hours , during which only ( a ) and ( b ) are relevant , the temperature drift of the receiver noise ( a ) can be improved by having a stored reference for receiver noise , i . e . a table dependent on temperature which may be provided for example in the node b , in the rnc , or provided by omc . such a look up table can be e . g . noise figure as a function of temperature at the receiver and this can be either stored in the node b or stored in the rnc or provided to node b or rnc via operation & amp ; maintenance ( o & amp ; m ). assuming rtwp_ 0 ( t 0 , t 0 ) is measured where t 0 is the temperature at the receiver at the time instant t 0 and at a later time t 1 where the temperature at the receiver is t 1 but it is not possible to measure rtwp_ 0 at t 1 as there is already a higher activity in the cell : in this case the receiver noise for t 0 could be subtracted from the rtwp_ 0 value at t 0 ( based on the table ) and a corresponding correction for t 1 could be added ( also dependent on the table ) as soon as t 0 and t 1 are known . although this does not deal with the problem that the inter cell interference ( b ) at t 0 and t 1 might not be identical , it improves the temperature drift of the receiver noise ( a ). the look up table can be made dependent on further parameters which influence the receiver noise . the more parameters that are included , the more desirable it is to keep the table in the node b , as otherwise these parameters need to be signalled to the rnc too , removing some of the benefits of operating e - dch . the optimal time t 0 can be determined by statistical analysis of the cell traffic in cell x and the other cells close to cell x , as described above . taken alone , such an improved measurement gives a more accurate idea of the noise rise level and in combination with measuring the share of the noise rise occupied by e - dch users , significantly improves efficiency . the control of ul noise rise is based on the assumption that the rnc provides a target value and the node b measures corresponding quantities and the node b reports them back to the rnc ( in a filtered way ) and / or uses them for its own scheduler . with the measurement improvements described above , a finer control of the ul noise rise is possible which improves the cell capacity , the interference control and the performance at the cell edge . the overall noise rise report using rtwp is improved by a temperature dependent lookup table and an indication of noise rise share is provided using relative rscp measurements . the system also includes permanent or removable storage , such as magnetic and optical discs , ram , rom , etc . on which the process and data structures of the method can be stored and distributed . the processes can also be distributed via , for example , downloading over a network such as the internet . the system can output the results to a display device , printer , readily accessible memory or another computer on a network . a description has been provided with particular reference to preferred embodiments thereof and examples , but it will be understood that variations and modifications can be effected within the spirit and scope of the claims which may include the phrase “ at least one of a , b and c ” as an alternative expression that means one or more of a , b and c may be used , contrary to the holding in superguide v . directv , 358 f3d 870 , 69 uspq2d 1865 ( fed . cir . 2004 ).	7
[ 0034 ] fig1 is a partial isometric view of a boat fitted with the apparatus . in this figure the apparatus shown is integrated with a steering rudder . this assembly includes the vessel hull ( 11 ), the structural connection between the vessel hull and the rudder ( 15 ), the rudder of the vessel ( 13 ), and the transverse hydrofoil . [ 0035 ] fig2 is a profile view of a complete sailboat fitted with the invention . in addition to the items noted in fig1 this figure illustrates a representative static waterplane ( 14 ). it is anticipated that the preferred configuration will be to structurally support the hydrofoil by attaching it to the steering rudder of the vessel which in turn will be located aft of the stern of the vessel . however , in some vessels this will be impractical for structural and / or aesthetic reasons . in these cases the hydrofoil may be held in the preferred position using a streamlined strut or struts that are not designed as the primary mechanism to steer the vessel . also , in ballasted sailing vessels that often sail with significant heel , it is anticipated that more than one of these foil assemblies may be fitted such that the span of the hydrofoil is approximately parallel with the waterplane of the vessel in its heeled position . [ 0036 ] fig3 shows the preferred embodiment of the invention with adjustable hydrofoil angle of attack . in this case the foil is mounted in a steering rudder . the hydrofoil ( 12 ) is mounted on a pivot axle ( 22 ) and is actuated by a pushrod ( 20 ). this pushrod is recessed in the middle of the rudder section and is actuated by a device comprised of a sheave ( 19 ) attached to the pushrod . this sheave is actuated by a rope ( 21 ) that is led into the boat from where it can be adjusted by the crew . a cleat is provided to allow this rope to be fixed so that a hydrofoil angle of attack may be maintained . in the preferred embodiment , the pushrod is spring loaded so that it maintains pressure on the rope . there are many other possible methods of hydrofoil actuation — the assembly shown represents one possible method . a representative range of hydrofoil angles of attack is shown by note ( 18 ). note ( 16 ) shows a representative stem wave contour without the invention fitted . note ( 17 ) shows a representative stem wave contour with the invention fitted and adjusted to a positive angle of attack . [ 0037 ] fig4 shows a detail of the assembly shown in fig3 . in this figure the hydrofoil section ( 33 ) is shown as symmetrical about the plane which contains the edges of the hydrofoil . it is important to note that for many applications , the preferred hydrofoil section will not be symmetrical about this plane . in addition to the features noted in fig3 fig4 shows the transverse pin ( 32 ) attached to the end of the pushrod . it is anticipated that the hydrofoil will be built in two halves , one on each side of the rudder ( or support strut ). these halves will slide onto the hydrofoil axle ( 22 ) and the transverse pin ( 32 ) and will be held in place with set screws . [ 0038 ] fig5 shows an alternate embodiment of the invention with adjustable hydrofoil angle of attack . the hydrofoil is again shown connected to a steering rudder . in this embodiment of the invention , the hydrofoil is rigidly attached to the rudder which in turn is inserted into a steering case ( 34 ). fig6 shows a representative section through the case and rudder near the top of the steering case . the complete rudder / hydrofoil assembly can be rotated relative to the steering case with the intent of adjusting the hydrofoil angle of attack . note ( 23 ) points to the rudder in the positive angle of attack ( lifting ) position . note ( 24 ) points to the rudder in the negative or neutral angle of attack position . in this embodiment of the invention the forward upper section of the rudder is cut back ( 29 ) to allow clearance for the rudder to rotate between positions ( 23 ) and ( 24 ). a sheave ( 35 ) is attached to the top of the rudder . a rope ( 30 ) running through this sheave transmits force to the top of the rudder to accomplish rotation . this rope leads into the vessel to allow it to be adjusted by the crew . some fixing method shall be fitted to allow a hydrofoil angle of attack to be maintained . a spring device ( 25 ) is fitted to maintain pressure against the adjustment rope . in order to transmit vertical forces from the rudder / hydrofoil assembly into the case , the top of the rudder is fitted with a transverse rod ( 27 ). a rope ( 26 ) loops over this pin and restrains it from large vertical movements without restraining it forward and aft within the desired range of motion . [ 0039 ] fig6 shows a section through the steering case . the pivot point ( 36 ) for rotating the steering case and rudder / hydrofoil assembly with the intention of steering the vessel is shown . a cross section of the top of the rudder ( 37 ) is also shown .	1
the invention relates to an interfacing system and method for a diesel particulate filter regeneration system in a truck or other vehicle . fig1 is a schematic diagram of how the invention may be integrated in an exemplary simplified diesel engine - equipped vehicle . a diesel engine 10 has an exhaust conduit 14 connected to receive exhaust gas from the engine cylinders 12 . the engine 10 in fig1 illustrates six cylinders , however , the details of engine and the number of cylinders is not part of the invention and it is to be understood that the invention may be adapted for an engine of any design . the exhaust conduit 14 conveys exhaust gas to one or more aftertreatment devices as may be installed on the vehicle . in fig1 , a diesel particulate filter ( dpf ) 16 is illustrated . as is known , a dpf removes particulate matter from the exhaust stream before the exhaust is released to the environment through the stack outlet 18 . pressure sensors are disposed at the inlet 20 and outlet 22 of the dpf to measure the exhaust gas pressure going into and exiting the dpf . the pressure values may be used as an indication of the amount of particulate matter collected in the filter . a processing unit 24 is connected to receive pressure data from the inlet 20 and outlet 22 pressure sensors , and apply an algorithm to determine a particulate load in the dpf . the processing unit 24 communicates the particulate load calculation , or alternatively , the raw pressure data , to a control unit 26 , which may be the vehicle &# 39 ; s engine control unit ( ecu ). the control unit 26 will include a control sequence to determine , based on the particulate load calculation , when a regeneration of the dpf is needed to remove collected particulate matter . when initiated by an operator , the control unit 26 will receive and monitor vehicle data 28 to determine whether conditions are appropriate for running a regeneration of the dpf . the other vehicle data may be related to requisites for the system to allow a regeneration to be done . for example , and for the example described here , the system may be configured for a vocational truck and programmed so that a regeneration may occur only when the truck is parked with various vehicle systems in a neutral or non - active state . these may include one or more of : the parking brake engaged , the service brake not engaged , the clutch pedal not depressed , the transmission in neutral , the accelerator at idle speed , the vehicle speed at zero or below a selected threshold value , no power take - off devices active , the engine oil and / or coolant temperature at a sufficient value , and the exhaust temperature at a sufficient value . the skilled person implementing the system and method in accordance with the invention may of course choose alternative or additional requisites . the control unit 26 receives the particulate load data from the processing unit 24 and receives information on other vehicle systems from other sensors and devices ( not illustrated ). responsive to at least one piece of received information , the control unit 26 causes a message to display on the display unit 30 . as described in greater detail below , the message may inform the operator of the particulate load status of the dpf unit , request an action by the operator , or display additional selected information responsive to operator input . an input device 32 is operatively connected to the display to allow the operator to request information and select a particular action to be carried out the control unit 26 . the control unit 26 responds to the operator input to cause the selected action to be performed . if a regeneration of the dpf is the selected action , the control unit 26 will cause the vehicle &# 39 ; s regeneration sequence to function . in the illustrated embodiment , a regeneration is performed by an injector 34 injecting hydrocarbon into the exhaust upstream of the dpf . if , for example , the dpf includes a catalyzed filter , the hydrocarbon will oxidize when it comes into contact with the catalyst , raising the exhaust gas temperature and burning the collected particulate matter . other methods of handling an injected hydrocarbon , and other methods of performing a regeneration , as are known or become known could be used in connection with the invention . the invention may be configured to advantageously operate through existing vehicle devices , that is , the existing instrument panel screen display and existing levers and buttons . fig2 illustrates an input device 32 as may be used with the invention . the input device 32 is integrated in a lever 36 mounted on a vehicle steering column , as , for example , a windshield wiper control lever or turn signal . the input device 32 is positioned for and includes devices conveniently controlled by the fingers , including a rocker switch 40 mounted on the axial end 38 of the lever 36 , a first pushbutton switch 42 , and a second pushbutton switch 44 . these switches are used to scroll through and select various information displays and actions that are displayed on the display unit 30 . the rocker switch 40 may be configured so that a movement depressing one side 40 a causes a cursor ( or highlighting or the like ) to move in one direction , for example , advancing through a list or series , and depressing the other side 40 b causes the cursor to move in the opposite direction . the first pushbutton switch 42 may be configured to input an “ enter ” command to cause the selected choice ( highlighted or cursor indicated ) to be performed . the second pushbutton switch 44 may be configured as an “ escape ” selection to cause the display to return to the previous display or screen . turning to fig3 , a default or general information screen display is shown . the general display includes a first portion 50 including a series 52 of selections an operator may make to obtain information from the control unit 26 on the status of vehicle components . the illustrated series 50 includes “ gauges ”, which will display certain vehicle gauges such as speed , engine revolutions , coolant temperature , etc ., “ fuel data ” which will show fuel volume and the like , “ time / distance ” which shows trip time and distance traveled , and “ aftertreatment ”, which shows information and presents action selections related to the aftertreatment system . the first part also includes a day and month display 54 . the default display may include displays of other information , for example , a second portion 60 showing oil temperature , a third portion 62 showing a clock , and a fourth portion 64 including an odometer display 66 and a status indicator 68 for the aftertreatment system . the status indicator 68 is shown as “ ats ” crossed out . according to the invention , and as illustrated in fig4 , the control unit 26 will cause a pop - up message box 56 to be displayed to alert the operator of a status change of the dpf system requiring attention , usually that the control unit 26 has determined that regeneration of the dpf is needed . an icon may be included in the message display . the pop - up message may be tailored to the urgency of the need for regeneration . for example , when the control unit 26 first determines that a regeneration is needed , the message “ parked regen needed ”, may be displayed in the pop - up box 56 . as explained below , the operator may then navigate through screen displays to choose more information on vehicle systems or initiate the regeneration as requested . the operator may , however , be forced to ignore the message because it is inconvenient or inappropriate to initiate a regeneration at the time the message is displayed . for example , the vehicle may be at a fuel pump or unloading or picking up a load . the control unit 26 continues to monitor the dpf particulate load , and if a regeneration is not performed when initially indicated , the particulate load will increase , prompting a second , higher urgency , message to be displayed , for example , “ parked regen required .” this message may be displayed as blinking to underscore the urgency . if the operator does not initiate a regeneration as requested by the message the control unit 26 will continue to monitor the particulate load on the dpf , and when the particulate load reaches a level that could cause engine or exhaust system damage will display a message “ ats service required engine derate active ”, which may also be displayed as blinking or flashing . this indicates to the operator that the aftertreatment service by a technician is required and an operator - initiated regeneration is no longer allowed . in addition , the operator is notified that the engine power is being derated , and the operator should prepare for an engine shutdown , for example , by pulling off the road . the control unit 26 may determine or estimate the particulate load in the dpf by calculation using the pressure sensor data , by engine running time and load , or any convenient method . after receiving the message in the pop up box 56 shown in fig4 that a regeneration is needed or required , the operator can remove the pop - up message and return to the default screen by pressing the escape button 44 on the input device 32 shown in fig2 . using the rocker switch 40 the operator may highlight “ aftertreatment ” ( as shown in fig3 ), and press the “ enter ” button 42 to have displayed information and action selections related to the aftertreatment system , which is shown in fig5 . the display will indicate that the “ aftertreatment ” menu is open , and operator will be presented with a selection box 58 displaying choices of requesting a parked regeneration , checking the ats ( aftertreatment system ) status , and canceling or inhibiting regeneration , as will be explained . as an optional feature of the invention , the operator may select “ ats status ” to inquire on the particulate load specifics , for example , if near the end of a trip to avoid an additional stop . the selection “ ats status ” will display a series shown in fig6 , including “ dpf load ”. the operator may then highlight this selection using the rocker switch 40 and select it using the enter button 42 . the system will then display a pop up message box , overlaying the selection box 58 , communicating particulate load data , for example , “ soot level moderately high ”, indicating the operator may be able to operate the vehicle for an additional period of time , or , “ soot level critically high ”, indicating that the operator must request a regeneration without undue delay to avoid an engine derate condition . returning to fig5 , the operator may elect to request a regeneration by highlighting and selecting the option “ request parked regen ” from the selection box 58 . a display screen as shown in fig7 will be shown on the screen showing that “ request parked regen ” has been selected and displaying a message box 56 . the operator will typically be trained to first park the truck and establish the conditions for a regeneration . the truck may optionally include the instructions in a readily accessible location , for example , on a sun visor card . in response , the system will check whether the requisite conditions are established , and while doing so , display a message indicating “ data transfer in progress , please wait .” an exemplary list of requisite conditions was described in connection with fig1 , above . if the system determines that the vehicle requisite conditions are not appropriate for initiating a regeneration , a message is displayed in the message box 56 indicating “ regen failed ” and instructing the operator to “ check status menu ”, to investigate which of the requisite conditions is not met . pressing the enter button 42 will bring the operator directly to the screen display shown in fig6 , or alternatively , to the screen display shown in fig5 from which the operator can navigate to the display of fig6 by selecting “ ats status ”. the screen display of fig6 will include a message box 56 including a listing of vehicle systems : dpf load , clutch , service brake , and pto status are shown as examples . using the rocker switch 42 , the operator may scroll through the list to discover which system is not in compliance for regeneration . if the condition is one the operator can correct , such as the parking brake not being engaged or a pto device being engaged , the operator can make the correction , press escape to return to the screen display of fig5 , and re - enter the request for regeneration . the message that initiation of a regeneration failed may be due to the engine temperature being too low to support the regeneration , which the operator will discover by scrolling through the selections of the screen display shown in fig6 . this may happen when the system determines immediately after engine start that a regeneration is needed . in this case , the operator will simply wait for the engine to warm to the appropriate temperature and re - enter the request for regeneration . another condition that prevents a regeneration from initiating is that the operator had previously selected to inhibit regeneration under the “ cancel regen ” selection shown in fig5 . by selecting “ cancel regen ”, the display shows the screen display shown in fig8 . the operator may highlight either “ disable regen ” or “ enable regen ” as needed and press the enter button to make that selection . of course , to allow regeneration to be initiated , the “ enable regen ” selection must be selected . as described above , the operator can then return to the display of fig5 using the escape button 44 and re - enter the request for a regeneration . the “ disable regen ” selection may be appropriate to prevent inadvertently initiating a regeneration . the “ disable regen ” selection will also work to cancel an ongoing regeneration , which may be necessary if conditions merit . returning to fig7 , if a regeneration has been requested , and the requisite vehicle conditions are met , the system will initiate a regeneration of the dpf , which will be indicated by a message “ regen requested ” as the system prepares for the regeneration . this message will be followed by a pop - up message when the regeneration is actually being performed , “ regen in progress .” the “ regen in progress ” message will continue to be displayed while the regeneration is being done , which may take on the order of twenty minutes to thirty minutes . as mentioned , an activated regeneration can be canceled by the operator navigating to the “ cancel regen ” selection in the aftertreatment screen of fig5 to the screen display of fig8 , and selecting “ disable regen ”. in addition , the system can be configured to cancel an activated regeneration if one or more of the requisite vehicle conditions is changed during the regeneration . for example , if the operator puts the vehicle in gear , releases the parking brake , and presses the accelerator to begin moving the vehicle , three requisite conditions will be changed , and in response to any of them the system may stop the regeneration if configured to do so and display the “ regen failed ” message in the pop up box 58 . the invention has been described in terms of exemplary embodiments , structure , and components and those skilled in the art will understand that the scope of the invention is defined by the appended claims and equivalents and substitutions may be made without departing from the scope of the claims .	5
fig1 through 3 , discussed below , and the various embodiments used to describe the principles of the present invention in this patent document are by way of illustration only and should not be construed in any way to limit the scope of the invention . those skilled in the art will understand that the principles of the present invention may be implemented in any suitably arranged microprocessor , microcontroller , or similar data processor . fig1 illustrates exemplary microcontroller 100 , which contains an encryption - decryption circuit according to a first embodiment of the present invention . microcontroller 100 comprises processor core logic and flash memory circuit 110 and encryption and decryption circuit 120 . processor core logic and flash memory circuit 110 executes the primary functions of microcontroller 100 . encryption and decryption circuit 120 is used to encrypt and decrypt data . according to an advantageous embodiment of the present invention , microcontroller 100 is able to receive encrypted data , such as object code , from an external source , such as the internet or an external processing system to which microcontroller 100 is connected . advantageously , microcontroller 100 may also send encrypted data to the external source . processor core logic and flash memory circuit 110 controls encryption and decryption circuit 120 using the control lines load , shift , encrypt / decrypt ( e / d ), and the data buses data in and data out . when the encrypt / decrypt is set to encrypt mode , processor core logic and flash memory circuit 110 is operable to transfer unencrypted data to encryption and decryption circuit 120 on the k - bit data in bus and to receive encrypted data from encryption and decryption circuit 120 on the k - bit data out bus . when the encrypt / decrypt is set to decrypt mode , processor core logic and flash memory circuit 110 is operable to transfer encrypted data to encryption and decryption circuit 120 on the k - bit data in bus and to receive unencrypted data from encryption and decryption circuit 120 on the k - bit data out bus . encryption and decryption circuit 120 comprises n - bit shift register 122 , n - bit keyword buffer 124 , exclusive - or ( xor ) gate array 126 , and exclusive - or ( xor ) +/− y gate array 127 . n - bit keyword buffer 124 contains an n - bit binary data key that is unique to microcontroller 100 . the key may be broken into two n / 2 - bit keys , one of which is held within microcontroller 100 , such as a serial number . this is used to limit the distribution of the software to only one target machine ( such as a license upgrade ). processor core logic and flash memory circuit 110 loads the key into n - bit shift register 122 by enabling the load signal . xor gate array 126 receives m arbitrary bits from n - bit shift register 122 and determines a single bit exclusive - or result of all m bits . thus , the single bit xor result , f ( b ), is given by : where ba , bb , bc , . . . , and bg are the m arbitrarily selected ones of bits b 1 , b 2 , b 3 , . . . , bn from n - bit shift register 122 . the xor result , f ( b ), is then input to n - bit shift register 122 . processor core logic and flash memory circuit 110 shifts the n binary bits in n - bit shift register 122 using the shift control signal . for each shift of n - bit shift register 122 , k arbitrary bits from n - bit shift register 122 are also applied to xor +/− y gate array 127 . xor +/− y gate array 127 comprises k exclusive - or gates , each of which has two inputs and one output . each of the k arbitrary bits from n - bit shift register 122 is xored with one of the k bits on the data in bits to produce one of the k bits on the data out bus . since exclusive or is a reversible operation if the output ( i . e ., result ) and one input are known , the present invention has the advantage of being symmetrical between encryption and decryption . thus , unencrypted data may be encrypted by exclusive - oring with the k bits from n - bit shift register 122 . the encrypted data may then be decrypted by exclusive - oring with the k bits from n - bit shift register 122 . the data pattern in n - bit shift register is completely deterministic given a known key and the number of shifts . according to an advantageous embodiment , the k bit binary value y may be added after the xor operation during encryption mode and k bit binary value y may be subtracted prior to the xor operation during decryption mode . in an exemplary embodiment of the present invention , y = 0 , so that only the xor function is implemented by xor +/− y gate array 127 . according to an advantageous embodiment of the present invention , the value of k is the same as the data width of processor core logic and flash memory circuit 110 . thus , if microcontroller 100 is an 8 - bit processing device , k = 8 , if microcontroller 110 is a 16 - bit processing device , k = 16 , and so forth . by way of example , in a representative microcontroller , n - bit shift register 122 may be a 128 shift register , m may be 25 , and k may be 16 . thus , the 128 bits from 128 bit keyword buffer 124 may be loaded into shift register 122 and shifted s times to an arbitrary starting point . on each shift , 25 arbitrary bits from shift register 122 are exclusive - ored ( xored ) together to produce a one bit result that is shifted into shift register 122 . once the starting point is reached , 16 arbirtrary bits from shift register 122 are xored with the 16 bits from the data in bus to produce 16 encrypted bits on the data out bus . each subsequent shift of shift register 122 produces a new 16 bit pattern that is xored with the next 16 bit data word on the data in bus , until all data words are encrypted . a similar operation occurs during decryption . the 128 bits from 128 bit keyword buffer 124 are loaded into shift register 122 and shifted s times to the arbitrary starting point , just as during encryption . on each shift , 25 arbitrary bits from shift register 122 are exclusive - ored ( xored ) together to produce a one bit result that is shifted into shift register 122 . once the starting point is reached , 16 arbitrary bits from shift register 122 are xored with the 16 encrypted data bits from the data in bus to produce 16 unencrypted bits on the data out bus . each subsequent shift of shift register 122 produces a new 16 bit pattern that is xored with the next 16 bit encrypted data word on the data in bus , until all encrypted data words are unencrypted ( decrypted ). fig2 illustrates exemplary microcontroller 200 containing an encryption - decryption circuit according to a second embodiment of the present invention . microcontroller 200 is similar to microcontroller 100 in fig1 in most respects . microcontroller 200 comprises processor core logic and flash memory circuit 210 and encryption - decryption circuit 220 . processor core logic and flash memory circuit 210 executes the primary functions of microcontroller 200 . encryption and decryption circuit 220 is used to encrypt and decrypt data . processor core logic and flash memory circuit 210 controls encryption and decryption circuit 220 using the control lines load , shift , and encrypt / decrypt ( e / d ), the switch select control lines , switch select , and the data buses data in and data out . when the encrypt / decrypt is set to encrypt mode , processor core logic and flash memory circuit 210 is operable to transfer unencrypted data to encryption - decryption circuit 220 on the k - bit data in bus and to receive encrypted data from encryption and decryption circuit 220 on the k - bit data out bus . when the encrypt / decrypt is set to decrypt mode , processor core logic and flash memory circuit 210 is operable to transfer encrypted data to encryption and decryption circuit 220 on the k - bit data in bus and to receive unencrypted data from encryption and decryption circuit 220 on the k - bit data out bus . encryption and decryption circuit 220 comprises n - bit shift register 222 , n - bit keyword buffer 224 , n × m switch 225 , exclusive - or ( xor ) gate array 226 , n × k switch 227 , and exclusive - or ( xor ) +/− y gate array 228 . n - bit keyword buffer 224 contains an n - bit binary data key that is unique to microcontroller 200 . the primary difference between microcontroller 200 and microcontroller 100 in fig1 is that the m bits applied to xor gate array 226 are not fixed , but rather are selectable by the switch select control signals using n × m switch 225 . similarly , the k bits applied to xor gate array 228 are not fixed , but rather are selectable by the switch select control signals using n × k switch 225 . switch 225 and switch 227 are optional and may be implemented to provide additional levels of security . fig3 depicts flow diagram 300 , which illustrates the operation of the exemplary encryption - decryption circuit according to the principles of the present invention . initially , microcontroller 200 loads the n bit keyword into shift register 222 ( process step 305 ). optionally , microcontroller 200 sets switch select signals for one or both of n × m switch 225 and n × k switch 227 if the switches are implemented ( process step 310 ). next , microcontroller 200 shifts the bits in shift register 222 s times to establish a starting point ( process step 310 ). then , microcontroller 200 applies the first k bit data word to xor +/− y gate array 228 via the data in bus and reads the result from the data out bus ( process step 320 ). finally , microcontroller 200 shifts the data in shift register 222 and applies the next k bit data word to xor +/− y gate array 228 via the data in bus and reads the result from the data out bus ( process step 325 ). microcontroller 200 repeats step 325 until all data is encrypted or decrypted ( process step 330 ). although the present invention has been described in detail , those skilled in the art should understand that they can make various changes , substitutions and alterations herein without departing from the spirit and scope of the invention in its broadest form .	7
referring now more particularly to the drawings , fig1 shows a cast bar 10 advancing from a casting machine ( not shown ) toward a rolling mill 14 . a cast bar 10 advances toward mill 14 it passes through sooter 16 which burns acetylene to form a uniform layer of soot which deposits on the surface of cast bar 10 . after soot is uniformly applied to its surface , cast bar 10 continues to advance toward mill 14 and passes infrared radiation sensor 18 where infrared radiation which is emitted from bar 10 is detected . the detected infrared radiation is converted into an electrical signal in sensor 18 , simplified by amplifier 20 and transmitted to recorder 21 , digital display 23 or other remote instruments not shown where it is displayed in a useful fashion or used as control input data . cast bar 10 continues to advance and passes atomizer 22 where the soot coating is removed by means of a fine water spray or water oil emulsion spray directed against bar 10 by atomizer 22 which causes the carbon to fall from the cast bar 10 . automatic sooter 16 is illustrated in more detail in fig2 . the acetylene supply means 19 which supplies acetylene to sooting tips 17 is adapted to provide a constant flow of acetylene regardless of the pressure of the acetylene source . this is accomplished by first flowing the acetylene through acetylene filter 24 where gas borne solid impurities are removed . after exiting the filter 24 the acetylene passes through a solenoid valve 25 which is adapted to receive remote signals capable of interrupting or starting the flow of acetylene through the system . from solenoid valve 25 the acetylene passes to flow control valve 26 where the flow rate of the acetylene is adjusted to a constant rate which is thereafter independant of the upstream pressure of the general source of acetylene supply . the acetylene then flows from the flow control valve 26 to flow meter 27 and thence to mixer 28 where it is mixed with air before being conveyed to manifold 20 to which sooting tips 17 are attached . the air which is mixed with the acetylene in mixer 28 follows a similar and parallel path from the general air supply to mixer 28 . air flows through air supply means 19 to filter 24a which removes any air borne particulate contaminants . after passing through air filter 24a the air then passes through solenoid valve 25a which is adapted to receive remote source signals capable of interrupting or starting the flow of air through the system . from solenoid valve 25a the air then passes to flow control valve 26a where the flow rate is adjusted to a constant rate which is independant of the pressure of the general source of air supply . air then flows from flow control valve 26a through flow meter 27a to mixer 28 where it is mixed with the acetylene and the air acetylene mixture is then transported to manifold 29 for subsequent soot production at sooting tips 17 . ignition of the air acetylene mixture flowing from sooting tips 17 is accomplished by positioning an electric igniter 30 in the stream of air fuel mixture flowing from tips 17 . the electric igniter ignites the acetylene - air mixture and the mixture of acetylene and air is regulated to burn in such a way to promote soot formation so that a layer of soot will be deposited by convection and system pressure on cast bar 10 as it advances past and through the burning air - acetylene mixture . an electric igniter of the glow - plug type has been used with best results but both a spark plug type igniter or pilot flame could also be used successfully . carbon could also be applied as a spray or by electrostatic deposition methods but such methods are temperature dependent and must be closely controlled . soot applied using the automatic sooter 16 can be applied in varied thicknesses and with proper acetylene and air flow rates ( for example 12 cubic feet per minute acetylene and 20 cubic feet per minute air ) essentially no free atmospheric soot is experienced when tips 17 are of the horns h - 1 type and are positioned approximately three to four inches from the cast bar . at such use levels , approximately 7 to 8 pounds of soot would be deposited on the substrate in a five day , 24 hour per day work week if the equipment were operating at eighty percent efficiency . in the operation of the automatic sooter 16 an air supply of from 20 to 200 psi ( 2 to 5 scfh ) is required and an acetylene supply of a maximum 15 psi at 5 to 20 scfh per hour is required . cast bar 10 which has been blackened with soot produced by automatic sooter 16 advances past infrared sensor 18 . because the cast bar 10 has been blackened , the emissivity of the bar passing sensor 18 becomes the emissivity of the carbon coating ( from about 0 . 78 to about 0 . 80 in the temperature range of from room temperature to 1000 ° f .) instead of the highly variable emissivity of an uncoated aluminum cast bar . therefore , accurate bar temperature measurements can be made with very little variation ( k 3 ° f . within the separational temperature range ). when the cast bar 10 is coated with soot the radiative surface properties of the bar are made substantially constant and because the black surface will absorb and not reflect radiative energy from other sources , the radiation detected relates to the absolute temperature of the emitting object ( cast bar 10 ) and therefore such detected radiation can be used to monitor the temperature of the emitting object . because the ambient temperature in the vicinity of a continuous casting and rolling line can reach temperatures in excess of 100 ° f . cooler 32 is used to cool sensor 18 . this cooling is accomplished by using a water system the used water from which is routed to atomizer 22 via water delivery means 33 for spraying thereof onto the cast bar 10 . cooling water is supplied to cooler 32 via water supply means 33a with the motive force necessary to move the water being supplied by the flow of air through atomizer 22 which is of the venturi type . lens 34 of sensor 18 is kept free of dust and other particulate matter which might interfere with reception of infrared radiation from cast bar 10 by continuously purging the lens 34 and lens area with either air , nitrogen , helium or mixtures thereof which is delivered to the lens through purging gas purge line 35 . purging gas entering purge line 25 from the source of purging gas ( not shown ) passes through filter 36 which houses a filter element fine enough to remove any harmful particulate contaminants which might be in the unfiltered purging gas . after passing through filter 36 the purging gas passes through flow control unit 37 so that a constant flow of purging gas to lens 34 is assured without regard to intermittent increases or decreases in the pressure of the purging gas . a flow meter 38 is also provided downstream of flow control unit 37 so that the operator may select the desired flow rate of the purging gas being supplied to lens 34 through purging line 35 . this introduction of a purging gas into lens 34 creates a positive pressure within the lens body thereby preventing carbon particles or other particulate contaminants from entering the lens and interfering with the accurate sensing of radiant energy from cast bar 20 . while it is necessary to apply the soot to the surface of cast bar 10 to accurately measure the radiant energy being emitted by the bar , it is equally as necessary to completely remove all of the soot from bar 10 before the bar enters rolling mill 14 . if the soot is not removed , the carbon particles will be removed from the surface of rod by the rolling lubricant and will soon so alter the lubricating properties of the rolling lubricant that production will have to be curtailed or stopped altogether while contaminated rolling lubricant is replaced with fresh lubricant . in order to avoid such an occurance , the apparatus of the present invention has had included in it a device designed to completely remove the soot from the surface of bar 10 before the bar enters rolling mill 14 . referring to fig4 for a more detailed view of this device , it can be seen that cooler 32 which maintains the temperature of sensor 18 within the optional operating range for infrared radiation sensors is adapted to allow the cooling water which enters from coolant supply line 32a to drain from the sensor area through drain line 32b . cooling water thus removed from sensor 18 is accumulated in reservoir 40 and as needed withdrawn from reservoir 40 through atomizer supply line 41 by the flow of air through venturi type atomizer 43 . water being withdrawn from reservoir 40 is filtered through submerged filter 42 as it enters supply line 41 . this filtered water is then conveyed to atomizer 43 where it is applied to the soot bearing surface of cast bar 10 in quantities sufficient to remove all residual soot from the surface of bar 10 . usually no more than about one - half to one liter of water per hour is required to completely remove all residual soot from the bar surface depending on production rate and size of bar . a soluble oil and water emulsion may be used to remove the soot from bar 10 with equal success . atomizer 43 requires air to draw water from reservoir 40 and propel the water droplets onto the cast bar 10 , this air is supplied to atomizer 43 through air line 44 . air entering atomizer 43 through line 44 is filtered through filter 45 before entering the atomizer 43 to prevent blockages caused by particulate contaminants borne by the unfiltered air . soot may also be removed from bar 10 by using a torch ( not shown ) and a very lean oxidizing flame which completes combustion of the soot . in any event , it is necessary to carefully remove the soot from bar 10 to prevent the harmful effects described above and to avoid significantly altering the temperature of bar 10 before it enters the rolling mill 14 because , an increase or decrease from optimum rolling temperature can significantly harm the physical and electrical properties of the rod being rolled from cast bar 10 . to demonstrate the effect of reflected radiant energy upon the temperature of a cast aluminum alloy bar , soot was applied to a cast bar which had implanted in it a type &# 34 ; k &# 34 ; thermocouple . the temperature of the soot covered area of the cast bar was determined to be approximately 800 ° f . when the temperature of the bar was measured by the infrared radiation technique of the present invention and the temperature of the cast bar as measured by the type &# 34 ; k &# 34 ; thermocouple was also measured as approximately 800 ° f . while the temperature measured by an infrared sensor focused on an area of the bar having no soot covering was lower than 500 ° f . additionally experiments also demonstrated that within reasonable limits , the thickness of the soot layer covering the bar has no appreciable effect on the accuracy of the measurements made by the method and apparatus of the present invention so long as the bar surface is completely covered . this invention has hereinbefore been described in terms of one preferred embodiment but it is understood that variations and modifications can be effected within the spirit and scope of the invention as described and as defined in the appended claims .	8
as illustrated in fig1 a tube extractor / slitter constructed in accordance with the present invention is illustrated in a disposition abutting a tubesheet 12 for extracting tubes 14 which have been partially pulled through the face of the tubesheet , the extractor / slitter acting not only to grasp and extract the tube but also to slit it into a pair of tube halves 16 , 18 . the extractor / slitter is structurally similar to the extractor disclosed in the aforesaid harris u . s . pat . nos . 4 , 044 , 444 and 4 , 815 , 201 except for various changes for the slitting function as hereinafter described . the tube 14 is illustrated after it has been loosened from the tight fit with the tubesheet 12 and other tubesheets ( not illustrated ) and has been pulled by a tube puller a distance of approximately 21 / 2 inches . although the apparatus may comprise a single housing , it preferably in the preferred embodiment includes a pair of housings 20 , 22 positioned for movement relative to each other by a plurality of parallel rods 24 , best illustrated in fig2 extending through both housings and having stop nuts 26 threaded on the ends thereof for limiting the separation between the housings . mounted within each housing 20 , 22 is a respective driving and deforming roll 28 , 30 mounted on respective shafts 32 , 34 journally supported by bearings 36 , 38 mounted in the respective housing 20 , 22 . the periphery of each of the driving and deforming rolls 28 , 30 project out of a face of the respective housing 20 , 22 toward the opposite housing and define a passageway 40 therebetween through which a tube 14 may be driven or pulled , the width of the passageway being determined by the positions of the stop nuts 26 . if implementation of the invention was by a single housing , the passageway would be formed therethrough and the rolls could be mounted within a cartridge or the like positioned within the passageway . at least one of the rollers 28 , 30 , and preferably both , are driven by motor means . to achieve this , the upper end of the shaft 32 is coupled to a hydraulic motor 42 while the upper end of the shaft 34 may be coupled to a similar hydraulic motor 44 , the motor 42 being bolted to the housing 20 and the motor 44 being bolted to the housing 22 . ideally , the motors 42 , 44 are series connected , positive displacement hydraulic motors wherein the motor 44 receives hydraulic fluid under pressure through a line 46 and exhausts the fluid through a line 48 from the outlet of the motor 44 to the inlet of the motor 42 . the hydraulic fluid is exhausted from the motor 42 through a line 50 and recirculated to the source of pressurized fluid . as pointed out in the aforesaid harris u . s . pat . no . 4 , 815 , 201 with this arrangement the flow rate and the pressure drop for each motor is substantially the same and the motors are continuously driven at the same speed and power in a synchronous manner . although such synchronous drive of the rollers 20 , 22 is desirable and provides significant advantages , other connections between the hydraulic motors may also effect a positive traveling of the tubes from the tubesheet . although , in these latter situations some slippage may occur , slippage may not be a major disadvantage in this case since the tubes are slit . if one of the motors fails to keep up with the other motor it may be dragged along by the tube itself . should one drive begin to slip , the other will tend to take over and if the tube becomes stuck , both may slip to prevent damage to the equipment . additionally , although somewhat inefficient , a single motor may be utilized to drive one of the shafts 34 , 36 with the other shaft driven by gearing means or the like . whatever drive means is utilized , however , it must be understood that the shafts 34 , 36 rotate in opposite directions relative to the other so as to pull a tube 14 into the passageway 40 defined by the nip between the rolls . a handle 52 secured to a bracket 54 rigidly secured to the housing of one of the motors , e . g . motor 42 , permits the apparatus to be positioned relative to the tubesheet 12 . as illustrated in the drawings , and in particular fig5 each roll 28 , 30 is a serrated roll so as to grasp and pull a tube entering the passageway 40 therebetween . as illustrated in fig2 through 4 and 6 of the drawings , as best shown in fig6 each roll has its greatest diameter in the central portion 56 , and has axially remote cylindrical portions 58 , 60 of a smaller diameter connected to the central portion 56 by respective substantially truncated conical surfaces 62 , 64 tapering from the diameter of the central section 56 to the respective smaller sections 58 , 60 . thus , as illustrated in fig6 a tube being drawn into the passageway 40 is deformed by the rolls 28 , 30 from its normal cylindrical cross section to one which has a flattened central portion 66 with a pair of bulbous shaped edges 68 , 70 . thus , the tube is effectively changed in cross sectional configuration to one which has a figure - eight shape with a flattened midsection . such configuration is substantially different from the deformation created by the prior art on tubes being withdrawn from the tubesheet . this configuration permits the deformed tube to be slit axially along the respective edges 68 , 70 by a rotary blade without an anvil or supplemental backing . the material itself acts as an anvil since the flattened figure - eight configuration has been found to permit one - sided slitting . journalled for rotation on a respective pin 72 , 74 carried in the housings 20 , 22 on mounting plates or the like 76 , 78 are a pair of slitter blades 80 , 82 . the pins 72 , 74 extend intermediate the housings 20 , 22 and , as best illustrated in fig4 and 6 , the axes of the pins are disposed downstream of the axes of the shafts 32 , 34 and thus the axes of the rollers 28 , 30 . thus , the axis of each slitter blade 80 , 82 lies in a plane that is normal or perpendicular to the axes of both rollers 28 , 30 and closer to the exit of the passageway 40 . each slitter blade 80 , 82 is a circular wheel having a sharp hardened steel wedge shaped cutting edge 84 , 86 and the disposition of the slitter blade intermediate the housings 20 , 22 is such that the blades are centrally located relative to the bulbous edges 68 , 70 of the deformed tubes . additionally , as illustrated in fig3 the diameters of the blades 80 , 82 and the disposition of the pins 72 and 74 is such that the blades 80 and 82 are disposed intermediate the smaller diameter portions 58 and 60 respectively of both rollers 28 , 30 and the cutting edges 84 and 86 are disposed intermediate a portion of the conical surfaces 62 and 64 respectively of the rollers . additionally , by positioning the axes of the slitter blades 80 , 82 downstream of the axes of the rollers 28 , 30 , such that cutting takes place at the intersection of the peripheries of the blades and the plane of the axes of both rollers , i . e ., at points 88 , 90 , the tubes are deformed into the flattened midsection figure - eight configuration as aforesaid as they are being contacted by the slitter blades . thus , the bulbous edges 68 , 70 of the tubes may be slit by the slitter blades engaging the leading edges of the tubes and entering from outside the deformed tubes to cleanly sever the walls of the tubes along the bulbous edge , the blades being rotated by the movement of the tubes being fed by the rollers 28 , 30 . during the cutting action of the slitter blades the driving deforming rollers 28 , 30 at the conical surfaces thereof support the sloped portion of the surfaces of the bulbous edges so that the slitter blades may sever the edges of the tubing rather than merely displacing the material inwardly . the configuration of the flattened mid - section figure - eight deformed tubes is such that the full beam strength of both walls of the tube offer sufficient resistance to the inward deformation that would otherwise result due to the pressure of the edge of the rotary slitting blades . the tube walls are therefore severed rather than merely displaced inwardly . no internal supporting device is thus necessary to prevent the displacement since the material of the tube itself acts as an anvil . by using a rotary blade to slit the tube , minimal force is required and thus not only is a sharp edge maintained over a long period of time , but also the cutting does not rob excessive force from the application to the rollers 28 , 30 necessary for extracting and traveling the tubes out of the tubesheet . the traveling and forming action of the combination rollers 28 , 30 impart internal stresses on the tube so that when the walls are slit , the two flattened half sections curl outwardly in the respective directions of the rotating rolls . this results in two substantially neat coils formed from the severed tube halves and the entire operation may take place within five feet of the tubesheet . numerous alterations of the structure herein disclosed will suggest themselves to those skilled in the art . however , it is to be understood that the present disclosure relates to the preferred embodiment of the invention which is for purposes of illustration only and not to be construed as a limitation of the invention . all such modifications which do not depart from the spirit of the invention are intended to be included within the scope of the appended claims .	1
referring now to fig1 the circuit illustrated includes a simplified generic representation of a conventional ground fault interrupter housed in enclosure 1 wherein electrical power from a . c . source 100 is supplied to the gfci circuitry through male plug contacts as follows : hot side contact 10 to lead 7 and grounded neutral contact 9 to lead 6 . grounding contact 11 is connected to a feed through lead 8 which by - passes the gfci circuitry , and is connected directly to third wire contact 51 of receptacle 30 . leads 6 and 7 are passed through the core of the toroidal differential current transformer 3 which is also called a core balance and zero sequence current transformer . such a transformer is designed to sense differences in current carried by the said conductors 6 and 7 . a difference which can be attributed to a fault current path carrying a portion of the current to ground which should be carried to the source by the return wire or grounded neutral 6 . the leads 4 and 5 from the coil of transformer 3 are connected to the ground fault circuit interrupter module 2 for amplification of generated current and subsequent control of current to relay coil 25 . leads 6 and 7 after passage through the core of toroidal transformer 3 feed through the module as respective leads 12 and 13 , and emerge , respectively , as leads 19 and 20 which connect , respectively , with relay armature contacts 21 and 22 . feed - through lead 13 also carries current from the hot side of the line from source 100 through lead 16 to reset switch terminal 17 . feed - through lead 12 is connected to the module at 14 to furnish a grounded neutral return path for its circuitry . current from the hot side is supplied from 17 through contact 18 to the module when the contacts are connected by a reset switch and the module then acts to supply energizing current to coil 25 through its leads 26 and 27 , except when a differentially generated signal from transformer 3 indicates a fault , at which time the current to coil 25 is interrupted and it is de - energized . when coil 25 is energized , hot side contact pair 22 and 24 and grounded neutral side and contact pair 21 and 23 close to supply electrical power from source 100 to respective receptacle contacts 50 and 49 through respective leads 29 and 28 . when plugged into the receptacle , ground fault protected power from source 100 is supplied to a load circuit which includes leads 35 and 34 carried in plug housing 37 and cable sheath 38 which are connected to hot and neutral contacts 32 and 31 of plug 37 which engage hot and neutral receptacle contacts 50 and 49 , respectively . the third wire grounding contact 51 of receptacle 30 engages the grounding prong 33 of plug 37 which is connected to lead 36 carried by cable sheath 38 to supply a grounding means in the load circuit . the test switch terminals 46 and 47 are connected momentarily for testing purposes by normally open switch 48 . in many instances of gfci design the test switch connects a resistance between an ungrounded conductor on the load side such as 29 with a grounded neutral conductor such as 6 before its passage through transformer 3 , or with a grounding conductor such as 8 . no specifics are depicted in the generalized representation . it should be noted here that the above described portion of fig1 comprising the elements listed as 100 and as 1 through 14 , 16 through 44 , and 46 through 51 , are substantially the same in fig1 through 5 . in the block diagram of fig1 instead of a normally closed reset switch 15 , such as that shown only in fig5 a controlled reset switch 41 is shown connected to reset switch terminals 17 and 18 by leads 53 and 52 , respectively . the controlled reset switch 41 is shown linked for control to a current limited ground fault sensor 43 by a control coupling 42 . the ground fault sensor 43 is shown connected to hot lead 29 by a coupling lead 44 which passes a brief probe or test current into the load circuit when otherwise disconnected from the power source 100 by the de - energizing of relay coil 25 and opening of contacts 22 and 24 , and contacts 21 and 23 . if a path to ground in the load circuit exists for the test current from the sensor 43 , and is above a conduction level predetermined to constitute a hazard , the sensor 43 through control coupling 42 causes the controlled reset switch 41 to open , or to remain open after initial opening caused by momentary ground fault simulator 45 . in accomplishing a reset of the gfci , the current path across reset switch terminals 17 and 18 must first be broken , and then restored . if a fault causing the gfci to trip is very brief , the path across the terminals 17 and 18 may be substantially uninterrupted , or interrupted insufficiently for reset purposes , and the continuing current path would cause the gfci to remain in the off or tripped state in the absence of hazard . to assure the initial open state after tripping , prerequisite to resetting of the gfci , the momentary ground fault simulator device 45 is provided . a momentary path to ground of sufficient extent supplied by the ground fault simulator 45 , also serves to test the function of current limited ground fault sensor 43 , control coupling 42 , and controlled reset switch 41 , and is preferred to a more direct means of causing an initial open state in the reset switch current path . in the event that any of the elements fail to the extent that there is no response to the simulated ground fault , and the said current path remains conductive , the ground fault circuit interrupter will not be reset . if the defect causes the said current path to remain open , the gfci will also not be reset . in either instance , a unit with defective automatic reset circuitry would be kept out of service . if the automatic reset circuit is connected in series with a manually operated reset switch rather than in its place , and the failure is such that the controlled reset switch remains conductive , the manual reset switch may be used to override the automatic device . in the more specific embodiment of fig2 the controlled reset switch is shown to comprise an scr 57 connected between reset switch terminals 17 and 18 , by respective leads 53 and 52 . variable resistance 58 and fixed resistance 59 are connected in series between the gate and anode of scr 57 with photo conductive cell 60 connected between the gate and cathode . a probe or test current supplied from source 100 through terminal 17 and lead 53 is limited by resistance 62 , and is passed through neon discharge lamp 61 and rectifier diode 63 before passing into the coupling lead 44 which connects the sensor 43 to lead 29 and thus passes it on to load circuit . the resistance 62 may be 22k to 220k ohms with readily available ne2h or ne2 lamps , respectively , and while the sensitivity of the automatic reset is shown as being made adjustable only by the variable gate to anode resistance 58 of scr 57 in the controlled reset switch element 41 , it should be understood that resistance 62 may also be made variable to further affect sensitivity to fault by adjustment in the sensor element 43 . if a fault path to ground exists in the load circuit after disconnection by the tripped gfci , current will flow through the lamp 61 of sensor element 43 , and the emission path will serve as control coupling 42 wherein the light emitted by fault current flow in the neon of 61 will reach the photo conductor 60 of controlled reset switching element 41 and when sufficient to sufficiently lower the resistance of 60 , will cause scr 57 to interrupt the current path between reset terminals 17 and 18 , or to reduce said current flow below a critical level required for gfci operation . the sensitivity of the reset circuit , determined by selection of components as well as adjustment of variable resistances , should be such as to provide a greater sensitivity to a given fault resistance in sensor 43 after tripping of the gfci than that exhibited by the gfci in its tripping , in order to avoid rapid resetting and retripping in the presence of a fault of marginal hazard level . the sensitivity of sensor 43 should not be made overly great , however , or the continuing presence of minor faults below established hazard levels may prevent reset after the fault that caused the tripping has been cleared . the specifics of this adjustment are a matter related to the nature of the appliance and scenario of the application , however , and special circumstances such as those to be found in medical situations may benefit from special levels of &# 34 ; holding &# 34 ; sensitivity after tripping , not only in adjustment of the sensor to delay reset until faults of any appreciable level are cleared , but in increasing the trip sensitivity of the gfci itself for the greater protection of shock susceptible patients since unwarranted and unnecessary downtime would not be increased due to the automatic reset feature , and power would not be appreciably interrupted , except in the presence of true fault conditions . the more specific embodiment of fig2 also shows the momentary ground fault simulator 45 to comprise a capacitor 54 charged in one direction through rectifier diode 55 during the time relay coil 25 is energized and contacts 22 and 24 are closed , and contacts 21 and 39 are open . when the gfci is tripped , and coil 25 is de - energized , contacts 22 and 24 are open , and contacts 21 and 39 close to short out rectifier diode 55 through lead 56 , so that the capacitor 54 is free to charge in the opposite direction through rectifier diode 63 included in the ground fault sensor 43 and to thus supply to the sensor circuitry a brief pathway to ground as a ground fault simulation . fig2 a depicts an alternate means of connecting capacitor 54 and rectifier diode 55 of the momentary ground fault simulator in fig2 so as to utilize the hot side contacts 22 and 40 to short out or shunt rectifier diode 55 rather than the grounded neutral contacts 21 and 39 . the combined resistance of 58 and 59 would be typically adjusted between 400k and 1 megohm and the scr should be a sensitive gate type rated as having a 200 microampere igt , 1 to 4 ampere it ( rms ), and 200 volt or greater vdrm . the value of the capacitor 54 should be 0 . 033 mfd to 0 . 2 mfd , and should be rated in excess of 250 wvdc . the photo conductor 60 is typically a 170 volt 0 . 2 watt cadmium sulphide type , and the minimum resistance is preferably low , in the 100 ohm range , with dark resistance in the 500k ohm range , resistances 58 , 59 , and 62 , should be 1 / 4 to 1 / 2 watt and rectifier diodes 55 and 63 are general purpose silicon types rated at 1000 volt prv and 1 to 2 . 5 amperes ( rms ). turning now to fig3 it should be noted that components referenced as 100 , 1 through 14 , and 16 through 57 have substantially the same location connection , and function as in fig2 . an additional component , rectifier 64 is included in controlled reset switch 41 to protect the gate of scr 57 , to block reverse gate voltage on the negative half cycle of anode supply voltage . the current limited ground fault sensor in this instance comprises the gate connected control circuit of scr 57 and includes a rectifier 65 having its anode connected to the anode of gate protective rectifier 64 , and its cathode connected to the anode of scr 57 or directly to reset terminal 17 , or other similar supplier of current from source 100 . the fault sensor 43 also includes a capacitor 68 connected in parallel with a series connected variable resistance 66 and fixed resistance 67 and the combination also connecting the anode of rectifier 64 with a supplier of current from source 100 which is in this instance contact 40 connected to lead 20 by gfci relay armature contact 22 . this connection through the relay contacts , rather than an optional direct connection to a source of anode voltage , disconnects the path of triggering current to the gate until tripping of the gfci and assists in the necessary interruption of the current path across reset terminals 17 and 18 . this arrangement also causes a reduction in the difference between the lessor initial sensitivity to fault and the greater sensitivity to fault that results once the scr has reacted to substantially reduce current flow across reset terminals 17 and 18 . if the difference were extreme , the far greater &# 34 ; holding &# 34 ; sensitivity could have the undesirable effect of maintaining the tripped state in the presence of much less than hazardous fault conditions as previously discussed in regard to fig2 . the first element or current limited ground fault sensor 43 also includes a capacitor 69 and rectifier 70 . the capacitor 69 is connected on one side to the anode of rectifier 64 and on the other to the cathode of rectifier 70 , and to the cathode of scr 57 in the second element 41 through rectifier 89 , which is shown as a part of the second element 41 , but which could just as well be included as a part of the first element 43 , as could rectifier 64 . in this instance , the coupling of the first element 43 with the second element 41 made through the control coupling element 42 is of an electrically conductive nature . the coupling of the first element 43 with the load circuit is accomplished by connection of the anode of rectifier 70 to lead 29 by means of coupling lead 44 , and may be made through an optional current limiting resistance 71 . such a current limiting resistance 71 , is of value only in the event of a bi - directionally conducting failure of scr 57 , a conductive failure of capacitor 69 , a failure of both of the rectifiers 70 and 89 , or any other conductive failure that would deliver a hazardous level of current from the source to the load circuit after it is disconnected from the source by the gfci . it should be noted that the current limited sensor circuit can be employed without connecting the capacitor 69 to the cathode of scr 57 through rectifier 89 or by any other means , but if this is done , rectifier 70 must also be eliminated , and capacitor 69 connected directly to optional current limiting resistance 71 or to lead 44 . in fig3 the scr is as for fig2 resistances are 1 / 4 to 1 / 2 watt with 67 having a value of 470k ohm , 66 having a value of approximately 500k ohms , and the optional resistance 71 , having a value of approximately 33k ohms . the capacitor 69 should be approximately 0 . 033 to 0 . 047 mfd . the capacitor 68 should be approximately 0 . 02 mfd , and tends to be a more critical value . both capacitors should have a minimum rating of 250 wvdc . in operation , the scr is triggered into conduction by voltage supplied through resistances 67 and 68 , and capacitor 68 when connected to the source 100 through lead 72 contacts 22 and 40 , leads 20 , 13 , etc ., and triggering level will be normally reached at the gate when capacitor 69 is sufficiently charged in the forward direction of scr 57 . a subsequent discharge of capacitor 69 or charge in the opposite direction is accomplished through rectifier 65 which is continuously connected to source 100 through reset terminal 17 . after tripping of the gfci , opening of the load circuit , including leads 34 and 35 , and closure of contacts 21 and 39 , and 22 and 40 , a brief pathway to ground exists through capacitor 54 in the momentary ground fault simulator element 45 to discharge capacitor 69 and provide for an initial non - conductive state in scr 57 . if another pathway to ground of sufficiently low impedance exists in the load circuit , capacitor 69 will continue to be discharged or to be charged in the opposite direction at a rate greater than it can be charged in the forward direction , and scr 57 will remain non - conductive , and the gfci will not be reset . when no such pathway to ground exists , capacitor 69 can be charged in the forward direction , scr 57 can be triggered into conduction , and the gfci reset . in fig4 components referenced as 100 , 1 through 14 , 16 through 44 , and 46 through 53 , have substantially the same location and function as in fig3 . in this instance , lead 72 from gfci relay contact 40 is connected to one side of the coil 74 of a small d . p . s . t ., normally closed relay with contact pairs 75 and 77 , and 76 and 78 , and the other side of the coil is connected through small relay contacts 75 and 77 , and lead 73 to gfci relay contact 39 . the series connected resistances 66 and 67 which were connected in parallel with capacitor 68 contacts 75 and 77 , and lead 73 to gfci relay contact 39 . the series connected resistances 66 and 67 which were connected in parallel with capacitor 68 to source 100 through lead 72 and contact 40 in fig3 are now connected to said source 100 through lead 78 , small relay contacts 78 and 76 , lead 79 and 53 , etc . when the gfci relay coil 25 is de - energized and the load disconnected from source 100 by the opening relay contacts , the closing contact pairs 21 and 39 and 22 and 40 supply power from source 100 to small relay coil 74 through its own normally closed contacts 75 and 77 which causes the relay to open and close rapidly in buzzer fashion and open and close its contacts 76 and 78 carried on the same armature . this effect provides an audible indication of tripping , greatly facilitates the initial current path interruption across reset terminals 17 and 18 , and causes a more controllable difference between the lesser initial sensitivity to fault and the greater sensitivity to fault that exists after scr 57 has been rendered substantially non - conductive ( holding sensitivity ). in this instance , the momentary ground fault simulator is not employed , but resistance 81 connecting lead 44 with a source of ground potential through contacts 39 and 21 assists in achieving an initial break in the current path between reset terminals 17 and 18 when tripping is not due to a true fault or the tripping fault is very brief . since the rate of contact opening and closure is dependent upon the physical characteristics of the small relay , care should be taken in the selection to maximize the effect and some means of providing adjustability such as a variability in spring tension could be of value . turning finally to fig5 it will be noted that components 1 through 14 , and 16 through 40 , and 46 through 51 are shown in fig1 through 4 , having substantially the same location , and with the addition of normally closed pushbutton switch 15 across the reset terminals 17 and 18 , represent an unmodified conventional ground fault circuit interrupter connected to a load circuit plug and cable and to an a . c . power source . in this instance the automatic reset circuit resides in its own enclosure 150 , but still functions to interrupt and restore the current pathway to the ground fault circuit interrupter module through reset terminals 17 and 18 , and switch 15 , by interrupting current to the entire gfci unit after tripping of the gfci has disconnected the load from source 100 . gfci plug terminals 9 , 10 , and 11 , engage automatic reset receptacle terminals 90 , 91 , and 92 , respectively , with grounded and grounding terminals 90 and 92 feeding directly through leads 93 and 95 to grounded and grounding terminals 97 and 99 , respectively . the hot side current pathway to plug contact 10 of the gfci comprising the reset circuit plug contact 98 , leads 121 and 94 , and receptacle contact 91 is interrupted by normally open contacts 102 and 103 . lead 121 supplies current from the hot side of source 100 to the anode of scr 107 and through 107 , when made conductive , to relay coil 118 equipped with &# 34 ; free wheeling &# 34 ; diode 119 . in accord with this invention , and in order to provide an assurance of correct or non - hazardous wiring in a receptacle into which plug contacts 97 , 98 , and 99 will be inserted , return current through coil 118 to the ground side of source 100 is given two pathways . initially , when coil 118 is not energized , contacts 104 and 106 provide the pathway to lead 95 , and thus to grounding plug contact 99 . if no third wire grounding is available , the coil cannot be energized . if grounding pathway is intact , the coil can be energized and immediately upon energizing will close contacts 105 and 106 , and transfer the ground side pathway to lead 93 , and thus to grounded neutral plug contact 97 . if hot and neutral are reversed in the receptacle , no energizing will take place . if hot and grounding are reversed , the coil will be energized only when contacts 104 and 106 are closed . no continuous current pathway will be provided , and the resulting buzzer action of the relay will give audible indication of the receptacle error . if grounded and grounding connections are reversed , energizing will occur , but while this latter receptacle wiring error is of some importance , it does not constitute an immediate hazard with reference to operation of the invention . in this arrangement , the relay comprising coil 118 and contacts 101 through 106 should be selected to offer a rapid transfer from grounding to grounded neutral connection to avoid de - energizing during transfer . it will be noted that resistances 111 and 112 , rectifier diodes 108 , 109 , 113 , and 120 , and capacitor 110 perform substantially the same function as resistances 66 and 67 , rectifier diodes 64 , 65 , 70 , and 89 , and capacitor 69 in fig3 and 4 , in comprising an scr gate control circuit capable of reacting to a fault in the load circuit which includes leads 34 , 35 , and 36 in plug 37 and cable sheath 38 . in this instance , the controlled scr 107 with its gate protective rectifier diode 108 does not directly perform the reset switching function as in fig3 and 4 , but becomes part of the first element or current limited ground fault sensor . the relay coil 118 with its free wheeling diode 119 also becomes part of the first element with the relay contacts 102 and 103 comprising the controlled reset switching function of the second element in interrupting and restoring power to the gfci module . a magnetic field of influence indicated by dotted line 42 &# 39 ; generated by the coil 118 with its core becomes the control coupling or third element of the automatic reset circuit . while current limiting resistance 114 , approximately 22k ohms resembles that of 71 in fig3 and 4 , it is not optional . resistance 117 , approximately 100k ohms , connects the sensor element to the grounded neutral load lead 34 through contact 31 of plug 37 , contact 83 of receptacle - plug combination 82 , and lead 115 , and serves to assist in assuring initial reset interruption in the event of very brief tripping and in place of the fault simulator . resistance 114 is connected by lead 116 to contact 84 in receptacle - plug combination 82 and thus to contact 32 and load lead 35 in load plug 37 and cable sheath 38 . load plug contacts 31 , 32 , and 33 feed through contacts 83 - 86 , 84 - 87 , and 85 - 88 of receptacle - plug . combination 82 to the gfci receptacle contacts 49 , 50 , and 51 , respectively . relay contacts 101 , 104 , 105 , and 106 , carry only the current demanded by the automatic reset circuit , and may be small . while the 102 and 103 contacts enjoy dry switching conditions and are designed to close before the relay of the gfci closes to connect the load and to open after the relay of the gfci opens to disconnect the load , to avoid arcing problems , they must be large enough to carry the current for which the gfci is rated . while the sensor element in this instance includes the gate control circuit comprising capacitor 110 , resistances 111 and 112 , and rectifier 109 , it should be understood that scr 107 could be controlled by other means such as a photoconductive cell as outlined in fig2 wherein a light source is employed in the sensor circuit . while this invention has been described with respect to certain specific embodiments , it will be appreciated that many modifications and changes may be made by those skilled in the art without departing from the inventive concepts or spirit of this invention . it is intended , therefore , by the appended claims to cover all such modifications and changes as fall within the true spirit and scope of the invention .	7
the following description of the preferred embodiment ( s ) is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term module refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that executes one or more software or firmware programs , a combinational logic circuit , and / or other suitable components that provide the described functionality . referring now to fig1 , a vehicle is shown generally at 10 . the vehicle includes an engine 12 that drives a transmission 14 through a torque converter 16 . air is drawn into the engine 12 through a throttle 18 . the air is mixed with fuel and combusted within cylinders ( not shown ) of the engine 12 to produce drive torque . the torque converter 16 supplies the engine torque to the transmission via an input shaft 20 . the transmission 14 in the exemplary embodiment is a multi - speed , automatic , clutch - to - clutch transmission that drives an output shaft 22 based on engine torque . the output shaft 22 drives a driveline 24 of the vehicle 10 . a range selection device 26 enables an operator to set the transmission 14 at a desired operating range including , but not limited to , park , reverse , neutral , and one or more forward drive positions . the speed and torque relationships between the engine 12 and the driveline 24 are controlled by hydraulically operated clutches c 1 , c 2 , c 3 , c 4 , and c 5 of the transmission 14 . pressurized fluid is provided to the clutches from a regulated hydraulic pressure source 28 . the clutches c 1 , c 2 , c 3 , c 4 , and c 5 are coupled to the hydraulic pressure source via control valves 30 , which regulate clutch pressure by supplying or discharging fluid to / from the clutches c 1 , c 2 , c 3 , c 4 , and c 5 . referring now to fig2 , in the exemplary transmission , the five clutches c 1 , c 2 , c 3 , c 4 and c 5 are selectively engaged to provide neutral , six forward drive ratios , and one reverse drive ratio . although the exemplary automatic transmission 14 includes six forward drive ratios and one reverse drive ratio , it is appreciated that the air purge method and system for a rotating clutch according to the present invention can be implemented in automatic transmissions having more or fewer drive ratios . the table of fig2 illustrates an exemplary combination of engaged clutches to establish the various drive ratios . each drive ratio relates to an automatic gear of the transmission where the gears for a six speed automatic transmission are first , second , third , fourth , fifth and sixth . the first forward drive ratio is established by engaging the first clutch c 1 and the fifth clutch c 5 . the second forward drive ratio is established by disengaging the fifth clutch c 5 and substantially simultaneously engaging the fourth clutch c 4 . to establish the third forward drive ratio , the fourth clutch c 4 is disengaged as the third clutch c 3 is engaged . the fourth forward drive ratio is established by disengaging the third clutch c 3 while engaging the second clutch c 2 . to establish the fifth forward drive ratio , the first clutch c 1 is disengaged as the third clutch c 3 is substantially simultaneously engaged . the sixth forward drive ratio is established by disengaging the third clutch c 3 and simultaneously engaging the fourth clutch c 4 . the reverse drive ratio is established by engaging the third clutch c 3 and the fifth clutch c 5 . the transmission 14 is in neutral when only the fifth clutch c 5 is engaged . referring back to fig1 , a speed sensor 32 senses a rotational speed of the engine 12 and generates an engine speed signal . a temperature sensor 36 senses a temperature of the transmission fluid and generates a transmission temperature signal . the range selection device 26 generates a range signal . a control module 40 receives the above mentioned signals . the control module 40 controls the operation of the control valves 30 in order to pulse on and off clutches of the transmission 14 . the control module 40 pulses a clutch based on the received signals and the air purge method of the present invention . in an exemplary embodiment , the control module 40 pulses c 3 a determined number of times while the transmission 14 is operating in first and second gear , before the transmission 14 reaches third gear . referring to fig3 , fig3 is a data flow diagram illustrating sub - modules and data - flows of the control module 40 of the present invention . the control module 40 includes an enable module 42 , a gear enable module 44 , a pulse determination module 46 , a clutch pressure module 48 , and a shift delay module 50 . the enable module 42 receives the range signal 52 from the range selection device 26 ( fig1 ). the enable module 42 determines whether the air purge method has already run this key cycle . if the air purge method has not run , the enable module enables the air purge method by setting an enable flag 54 to true . if the air purge method has already run once this key cycle but the transmission range 52 indicates park or neutral for a selectable period of time during the key cycle , the enable module 42 re - enables the air purge method by setting the enable flag 54 to true . gear enable module 44 receives a transmission gear 56 determined from the ratio of the transmission 14 ( fig1 ) and the enable flag 54 from enable module 42 . gear enable module 44 evaluates the transmission gear 56 . if the enable flag 54 is true and the transmission 14 ( fig1 ) is operating in a proper gear to enable pulsing of a clutch , gear enable module 44 enables the pulse determination module 46 by setting a pulse enable flag 58 to true . pulse determination module 46 receives the transmission temperature 60 , a current calculated line pressure 62 , and the enable flag 58 . pulse determination module 46 calculates a pulse on time 66 from a learned volume of the clutch and a state of convergence to the volume . the learned volume of the clutch and the state of convergence of the volume are calculated based on the transmission temperature 60 and the current line pressure 62 . pulse determination module 46 also calculates a pulse off time 68 and an adequate pulse number 70 based on the transmission temperature 60 . clutch pressure module 48 receives the pulse on time 66 , the pulse off time 68 , and the pulse number 70 . clutch pressure module 48 commands line pressure 72 at a maximum value according to the pulse on and off times 66 , 68 and the number of pulses 70 . clutch pressure module keeps a pulse count 74 of the number of pulses completed . shift delay module 50 receives engine speed sensed from the engine 12 ( fig1 ), the transmission gear 56 , and the pulse count 74 . if the pulse count 74 is not equal to a desired number of pulses for the current gear 56 , shift delay module 50 delays the transmission 14 ( fig1 ) from shifting to the next higher gear ( upshifting ) by sending a commanded gear signal 78 to maintain the current gear . shift delay module 50 delays the shift as long as the engine speed 76 does not indicate an overspeed condition . shift delay module 50 further delays subsequent upshifts after the pulse count 74 indicates the pulses have completed to ensure adequate shift spacing . referring now to fig4 , a flowchart illustrating steps of the air purge method according to the present invention is shown . the air purge method is continually performed throughout a key cycle . in step 100 , control determines whether enable conditions are met . if a new key cycle has occurred or the range indicates park or neutral for a selected period of time , enable conditions are met and control continues with step 110 . otherwise control loops back and continues to monitor the enable conditions . in step 110 , control determines whether the transmission is operating in the proper gear to pulse the clutch on and off . in the example of pulsing c 3 on and off , the proper gears would be first gear and second gear . if the transmission is in the proper gear , control continues with step 120 . in step 120 , control calculates a pulse on and off time and pulse number based on a learned clutch volume , an adaptive convergence state , and the transmission temperature . in step 130 , control commands maximum pressure . if the pulse on time has expired in step 140 , control continues with step 150 . if the pulse on time has not expired in step 140 , control continues commanding maximum pressure in step 130 . once the pulse on time has expired , control commands pressure off in step 150 . in step 160 , control determines whether a desired number of pulses has completed for that gear . if the desired number of pulses has not completed , control delays an upshift from occurring in step 170 by commanding the current gear to be maintained . control then evaluates the pulse off time in step 180 . if the pulse off time has not expired control continues to command pressure off in step 150 . if the pulse off time has expired , control increments a pulse counter in step 186 and loops back to step 120 where a new pulse on and off time and pulse number is calculated . control then continues to pulse the clutch on and off until a desired number of pulses has completed . in step 160 , if the pulse counter equals the desired number of pulses , the upshift is allowed in step 190 and the pulse values are reset to zero in step 200 . control then loops back to step 110 where the transmission gear is evaluated . if the transmission is still operating in the proper gear for pulsing , control continues to pulse the clutch as stated in the steps above . otherwise , the transmission 14 ( fig1 ) has shifted to a gear in which pulsing of the clutch is not desired . in the exemplary embodiment , this is third gear because c 3 is required to be fully applied for the operation of third gear . once the transmission 14 ( fig1 ) is not operating in the desired gear , control delays any subsequent upshifts based on the time delay created by the pulsing in step 210 . this delay time can be selectable . the delay prevents undesireable shifts occurring one right after another . control then loops back to step 100 where the enable conditions are evaluated . those skilled in the art can now appreciate from the foregoing description that the broad teachings of the present invention can be implemented in a variety of forms . therefore , while this invention has been described in connection with particular examples thereof , the true scope of the invention should not be so limited since other modifications will become apparent to the skilled practitioner upon a study of the drawings , specification , and the following claims .	5
in addition to the description provided below , all of the materials contained in co - pending patent application , ser . no . 08 / 136 , 161 filed on oct . 15 , 1993 , are incorporated herein by this reference . with reference to fig1 there is shown a portion of a memory wherein the present invention is implemented , the memory 10 preferably comprising a plurality of multi - bit memory cells uc00 - uc22 arranged in rows and columns . each of the memory cells is preferably capable of storing a plurality of bits of data . for each column of cells , there is a pair of corresponding complementary bit lines ( bl0 and bl0 , bl1 and bl1 , bl2 and bl2 ) coupled to each of the cells in that column . in addition to being coupled to each of the cells in a particular column , each pair of complementary bit lines is also coupled to a corresponding bit driver line ( bl0 , bl1 , bl2 ). as will be explained , the bit driver lines and the complementary bit lines are used to store a voltage found on the input voltage line vr into the memory cells uc00 - uc22 . preferably , the complementary bit lines ( bl0 and bl0 , bl1 and bl1 , bl2 and bl2 ) are further coupled to corresponding sense amps ( sa0 , sa1 , sa2 ). as will be explained , the sense amps and the bit lines are used to read data out of the memory cells . coupled to each row of the memory cells are complementary word lines ( wl0 and wl0 , wl1 and wl1 , wl2 and wl2 ). these word lines are used to control the activation ( i . e . the conduction ) of the memory cells . together , the word lines and the bit lines control which memory cell is accessed , both for reading and writing purposes . with reference to fig2 the structure of each of the memory cells will now be described in detail . for the sake of convenience , only memory cell uc00 is shown in fig2 but it should be understood that each of the memory cells uc00 - uc22 preferably has the same construction . as shown , memory cell uc00 preferably comprises a switching element 20 , a storage capacitor 22 , and an isolating element 24 . the switching element 20 preferably has a first terminal coupled to bit line bl0 , a second terminal coupled to the storage capacitor 22 , and a plurality of control terminals coupled to complementary word lines wl0 and wl0 . the switching element 20 preferably comprises at least two complementary switching components , with one switching component 26 having a threshold voltage which is positive , and one switching component having a threshold voltage which is negative . by positive threshold voltage , it is meant that switching component 26 will conduct ( i . e . turn on ) when a positive voltage having a sufficient magnitude exists between the control terminal of the switching component 26 and the capacitor 22 . likewise , by negative threshold voltage , it is meant that switching component 28 will conduct when a negative voltage having a sufficient magnitude exists between the control terminal of the switching component 28 and the capacitor 22 . the positive threshold switching component 26 preferably has a first terminal coupled to the bit line bl0 , a second terminal coupled to the capacitor 22 , and a control terminal coupled to word line wl0 . likewise , the negative threshold switching component 28 preferably has a first terminal coupled to the bit line bl0 , a second terminal coupled to the capacitor 22 , and a control terminal coupled to word line wl0 . the general function of switching element 20 is to selectively couple the capacitor 22 to the bit line bl0 in response to control signals received on the word lines wl0 , wl0 . this allows data to be selectively read from and written to cell uc00 . the construction of switching element 20 is advantageous in at least two respects . first , the positive and negative threshold components 26 , 28 are complementary devices . this means that when they both conduct , they generate complementary noise signals which cancel each other out . this serves to significantly reduce the amount of switching noise that is passed on to the capacitor 22 , which in turn , reduces the impact of noise on the data stored in the capacitor 22 . second , because one of the switching components 26 has a positive threshold , and the other 28 has a negative threshold , switching element 20 does not suffer from the cut - off effect described above . as long as a sufficient voltage is applied to the word lines wl0 , wl0 , at least one of the components 26 , 28 will be able to conduct to couple the capacitor 22 to the bit line bl0 , regardless of the voltage stored in the capacitor . this means that memory cell uc00 can store voltages within the entire dynamic operating voltage range , free of any cut - off effects . since memory cell uc00 is able to store voltages in a wider voltage range than the prior art cells , memory cell uc00 is capable of storing more data than the prior art memory cells . the isolating element 24 preferably has substantially the same construction as switching element 20 . element 24 preferably comprises a positive threshold switching component 30 and a negative threshold switching component 32 . component 30 preferably has a first terminal coupled to the capacitor 22 , a second terminal coupled to the bit line bl0 , and a control terminal coupled to word line wl0 , while component 32 preferably has a first terminal coupled to the capacitor 22 , a second terminal coupled to the bit line bl0 , and a control terminal coupled to word line wl0 . the general function of element 24 is to electrically isolate memory cell uc00 from other neighboring circuit components . when it is non - conducting ( i . e . off ), element 24 prevents signals on bit line bl0 from affecting the data stored in capacitor 22 . when conducting , element 24 couples the capacitor 22 to the bit line bl0 . in implementing the memory cell of the present invention , a number of different switching devices can be used as the positive and negative threshold switching components 26 , 28 , 30 , 32 . examples of positive threshold switching devices include n - channel enhancement metal oxide semiconductor field effect transistors ( mosfet ), npn bipolar junction transistors ( bjt ), n - type junction field effect transistors ( jfet ). n - channel enhancement metal electrode semiconductor field effect transistors ( mesfet ), and n - channel metal insulator semiconductor field effect transistor ( misfet ). examples of negative threshold switching devices include p - channel enhancement mosfet &# 39 ; s , pnp bjt &# 39 ; s , p - type jfet &# 39 ; s , p - channel enhancement mesfet &# 39 ; s , and p - channel misfet &# 39 ; s . which devices are used is a matter of design choice . with reference to fig3 there is shown a preferred embodiment of the present invention wherein the memory cell uc00 is implemented using mosfet &# 39 ; s . as shown in fig3 the memory cell 40 preferably comprises a storage capacitor 42 , two n - channel enhancement mosfet &# 39 ; s n1 , n2 , and two p - channel enhancement mosfet &# 39 ; s p1 , p2 . together , transistors n1 and p1 form the switching element 20 of fig1 and together , transistors n2 and p2 form the isolating element 24 of fig1 . transistor n1 preferably has a drain terminal coupled to bit line bl0 , a source terminal coupled to a first terminal of the capacitor 42 , and a gate terminal coupled to write line wl0 . transistor p1 preferably has a drain terminal coupled to bit line bl0 , a source terminal coupled to the first terminal of the capacitor 42 , and a gate terminal coupled to write line wl0 . transistor n2 preferably has a drain terminal coupled to a second terminal of the capacitor 42 , a source terminal coupled to bit line bl0 , and a gate terminal coupled to write line wl0 . transistor p2 preferably has a drain terminal coupled to the second terminal of the capacitor 42 , a source terminal coupled to bit line bl0 , and a gate terminal coupled to write line wl0 . other types of field effect transistors ( fet &# 39 ; s ), such as the ones noted above , may be substituted for mosfet &# 39 ; s n1 , n2 , p1 , and p2 . the configuration just described may be used for all implementations where fet &# 39 ; s are used . in the case where bipolar junction transistors are employed , n1 and n2 are preferably implemented using npn bjt &# 39 ; s , and p1 and p2 are preferably implemented using pnp bjt &# 39 ; s . in such an implementation , transistor n1 preferably has a collector terminal coupled to bit line bl0 , an emitter terminal coupled to a first terminal of the capacitor 42 , and a base terminal coupled to write line wl0 . transistor p1 preferably has a collector terminal coupled to bit line bl0 , an emitter terminal coupled to the first terminal of the capacitor 42 , and a base terminal coupled to write line wl0 . transistor n2 preferably has a collector terminal coupled to a second terminal of the capacitor 42 , an emitter terminal coupled to bit line bl0 , and a base terminal coupled to write line wl0 . further , transistor p2 preferably has a collector terminal coupled to the second terminal of the capacitor 42 , an emitter terminal coupled to bit line bl0 , and a base terminal coupled to write line wl0 . connected in this manner , the bjt implementation would function in substantially the same manner as the mosfet implementation shown in fig3 . thus far , only the basic memory cell 40 has been described . optionally , other elements may be added to the cell 40 to further enhance performance . fig4 shows a memory cell of the present invention wherein a discharge element 50 is added to the cell . discharge element 50 preferably has a first terminal coupled to the first terminal of the capacitor 42 , a second terminal coupled to the second terminal of the capacitor 42 , and two control terminals coupled to the complementary discharge control lines ( discharge and discharge ). the primary function of discharge element 50 is to remove charge from the capacitor 42 before new data is stored in the capacitor 42 . this prevents any leftover charge from affecting or altering the new data being stored in the capacitor 42 . the discharge element 50 preferably has substantially the same construction as the switching 20 and isolating elements 24 . more specifically , element 50 preferably comprises a pair of complementary switching components , with one component having a positive threshold voltage and the other having a negative threshold voltage . in the preferred embodiment shown in fig4 element 50 comprises an n - channel enhancement mosfet n3 ( acting as the positive threshold component ) and a p - channel enhancement mosfet p3 ( acting as the negative threshold component ). transistor n3 preferably has a drain terminal coupled to the first terminal of the capacitor 42 , a source terminal coupled to the second terminal of the capacitor 42 , and a gate terminal coupled to the discharge line ( discharge ). likewise , transistor p3 preferably has a drain terminal coupled to the first terminal of the capacitor 42 , a source terminal coupled to the second terminal of the capacitor 42 , and a gate terminal coupled to the discharge line ( discharge ). of course , other similar devices , such as bjt &# 39 ; s and other types of fet &# 39 ; s may be used instead of the mosfet &# 39 ; s shown in fig4 . as a further enhancement to the memory circuit , yet another discharge element 60 may be included . note that this discharge element 60 is preferably not a part of the memory cell 40 . discharge element 60 preferably has a first terminal coupled to bit line bl0 , a second terminal coupled to bit line bl0 , and two control terminals coupled to the complementary reset control lines ( reset and reset ). the primary function of element 60 is to remove leftover charge from the complementary bit lines before reading and writing operations so that the leftover charge does not affect the data being read or written . the discharge element 60 preferably has substantially the same construction as the discharge element 50 . more specifically , discharge element 60 preferably comprises a pair of complementary switching components , with one component having a positive threshold voltage and the other having a negative threshold voltage . in the preferred embodiment shown in fig4 element 60 comprises an n - channel enhancement mosfet n4 ( acting as the positive threshold component ) and a p - channel enhancement mosfet p4 ( acting as the negative threshold component ). transistor n4 preferably has a drain terminal coupled to the bit line bl0 , a source terminal coupled to the bit line bl0 , and a gate terminal coupled to the reset line ( reset ). likewise , transistor p4 preferably has a drain terminal coupled to the bit line bl0 , a source terminal coupled to the bit line bl0 , and a gate terminal coupled to the reset line ( reset ). if so desired , other devices such as bjt &# 39 ; s and other types of fet &# 39 ; s may be used in place of the mosfet &# 39 ; s shown in fig4 . with reference to fig1 and 4 , the operation of memory 10 will now be described . the writing cycle will be described first . for the sake of illustration , it will be assumed that memory cell uc00 is the cell to which data will be written . the write cycle begins with reset signals being sent on the reset lines ( reset and reset ). these signals cause transistors n4 and p4 to become conductive , which in turn , causes bit lines bl0 and bl0 to be discharged . this process serves to cleanse the bit lines to get them ready for the write operation . also , discharge signals are sent onto the discharge lines ( discharge and discharge ) to activate transistors n3 and p3 . this causes capacitor 42 to be discharged , thereby making it ready to receive the new data . once that is done , bit driver line bd0 is activated , to allow the voltage appearing on the input voltage line vr to reach bit line bl0 . the voltage on line vr will increment with each clock cycle , as is known in the art . when the voltage on line vr reaches the desired voltage ( representing the desired data bits ), then activation signals are sent onto word lines wl0 and wl0 to turn on transistors n1 , n2 , p1 , and p2 . this in effect allows the voltage appearing on bit line bl0 to be loaded into the storage capacitor 42 . thereafter , the activation signals are removed from the word lines wl0 , wl0 to once again render the transistors n1 , n2 , p1 , p2 non - conductive , thereby storing the desired voltage within the capacitor 42 . the write cycle is thus complete . for the read cycle , a similar process is carried out . to read data from memory cell uc00 , reset signals are first sent onto the reset lines ( reset and reset ) to cause transistors n4 and p4 to remove any leftover charge from the bit lines bl0 , bl0 . then , activation signals are sent onto word lines wl0 and wl0 to activate transistors n1 , n2 , p1 , and p2 . this allows the voltage stored in the capacitor 42 to be transferred onto bit line bl0 . thereafter , the sense amp sa0 receives the voltage from memory cell uc00 and compares it with a reference voltage appearing on line vref . like the voltages appearing on input line vr , the voltages on line vref are preferably incremented each clock cycle . eventually , the voltage from cell uc00 will match one of the voltages appearing on line vref . the voltage , and hence the data , stored in the memory cell uc00 is thus ascertained . in the reading method just described , the output voltage from the memory cell uc00 is compared directly with the voltage on line vref . it should be noted that cell uc00 may also be read using a comparison method involving a dummy cell . this method will be described with reference to the memory portion 70 shown in fig5 . as shown , memory portion 70 preferably comprises a plurality of bit lines bl0 , bl1 with each bit line bl0 , bl1 having a plurality of memory cells uc00 , uc10 , uc20 , uc01 , uc11 , uc21 coupled thereto . in addition to the memory cells , a pair of dummy cells 72 , 74 are also coupled to the bit lines bl0 , bl1 . preferably , all of the cells in fig5 including both the memory cells uc00 , uc10 , uc20 , uc01 , uc11 , uc21 and the dummy cells 72 , take the form of the memory cell of the present invention . the bit lines bl0 , bl1 are attached at one end to the inputs of a comparator 76 , and at the other end to switches 78 and 80 . switches 78 , 80 selectively couple the bit lines bl0 , bl1 to the reference voltage line vref , the input voltage line vr , or to neither . also preferably included in memory portion 70 is a discharge element 82 coupled to both of the bit lines bl0 , bl1 . discharge element 82 serves substantially the same function as discharge element 60 of fig4 and preferably has the same construction . to read data from one of the memory cells , memory cell uc00 for example , the bit lines bl0 , bl1 are first discharged by activating discharge element 82 . once the bit lines are cleansed , switch 80 is activated ( i . e . turned on ) to couple line vref to bit line bl1 , thereby passing a reference voltage appearing on line vref onto bit line bl1 . thereafter , the dummy cell 74 is rendered conductive to receive the voltage appearing on bit line bl1 . once that is done , dummy cell 74 is rendered non - conductive to store the received voltage , and switch 80 is deactivated to decouple bit line bl1 from line vref . thereafter , both the memory cell uc00 and the dummy cell 74 are rendered conductive to transfer the voltages stored within the cells onto bit lines bl0 and bl1 to allow the comparator 76 to compare the voltages from the two cells uc00 , 74 . the above process is preferably repeated for each increment of the voltage on line vref . eventually , the voltage in cell uc00 will match a voltage in the dummy cell 74 . the voltage , and hence , the data in cell uc00 is thus ascertained . a similar process may be used to read data from the other memory cells . a point to note is that to read data from one of the memory cells attached to bit line bl0 , dummy cell 74 is used as a reference cell , and to read data from one of the memory cells attached to bit line bl1 , dummy cell 72 is used as a reference cell . an advantage of this reading method is that it allows for stray capacitance canceling . more specifically , since the memory cell uc00 and the dummy cell 74 have substantially the same construction , and since bit lines bl0 and bl1 are substantially symmetrical , the effects of stray capacitance will be substantially the same for both cells . these effects will cancel each other out when the comparator 76 compares the voltages on the two bit lines bl0 , bl1 . thus , a true comparison of the memory cell voltage and the reference voltage is obtained . this contributes to a more accurate determination of the data stored within the memory cell .	6
preferred embodiments of the present invention are illustrated in the figures , like numerals being used to refer to like and corresponding parts of the various drawings . the various embodiments of the method and system for enhancing the useful lifetime of an ophthalmic illumination system of this invention provide for an enhanced fiber optic illuminator that has an optimized throughput after a preset number of operating hours ( e . g ., 200 hrs ) that meets the throughput requirements desired for the illumination system . in some embodiments , the throughput during the initial operating period ( e . g ., up to 200 hrs ) can be at least as high as the throughput at a desired end of the initial operating period ( e . g ., at 200 hrs ). embodiments of the present invention can further provide a fiber throughput that is relatively constant during the initial operating period . by initially misaligning the xenon lamp arc in a direction towards the lamp anode , an optimum throughput during the initial operating period can be achieved , as well as equal or better throughput during the illuminator lifetime after the initial operating period . embodiments of the present invention can include a fiber optic illumination system comprising a xenon light source in which the xenon arc lamp bulb has been offset ( e . g ., positioned in a vertically offset position ) from an axis corresponding to the optical path axis of an optical fiber ( e . g ., from the initial position of prior art systems as known to those having skill in the art ) to move the arc off - axis at the beginning of life of the xenon light source . the xenon light source can be any xenon lamp having the characteristics required to provide high intensity light for an illuminator , such as an ophthalmic illuminator , as will be known to those having skill in the art . for example , the xenon light source can be an osram 75 w xenon bulb . by initially positioning the xenon lamp arc off - axis at the zero operating hour time ( the initial position ), as the xenon lamp arc location moves away from the anode due to cathode degradation as the lamp ages , the arc will move increasingly on - axis and the coupling efficiency into the optical fiber will increase . this effect will tend to cancel out the effect of decreasing arc peak luminance as operation time increases so that the overall light throughput through the optical fiber ( e . g ., a handheld illuminator probe fiber ) will tend to remain about constant as the lamp ages . the initial position of the xenon lamp is determined by first positioning the xenon lamp bulb to achieve a maximum light flux through an output optical fiber . the bulb ( or bulb \ mirror assembly ) is then vertically misaligned by a prescribed amount and set in place . the desired initial position of the bulb is determined as described below . fig1 is a diagrammatic representation of one embodiment of an enhanced high brightness ophthalmic illuminator system of the present invention . illuminator system 10 comprises power supply 12 and illumination source 14 , cold mirror 16 , a hot mirror 18 , a beam splitter 20 , mirror 21 , optical fiber ports 24 and attenuators 22 . illuminator system 10 also can comprise one or more optical fiber probes 26 for receiving and transmitting light from illumination source 14 to a surgical site . optical fiber probes 26 comprise the handheld portion of the illuminator system 10 , including optical fiber 34 , which is optically coupled to the illumination source 14 within enclosure 11 . high brightness illuminator system 10 is exemplary only and is not intended to limit the scope of the present invention in any way . the embodiments of the present invention can be used to enhance any such ophthalmic illuminator , medical laser , or any other system or machine in which it is desirable to extend the useful lifetime of an illumination source . optical source 14 of illuminator system 10 in this example comprises a xenon lamp , but it can comprise any suitable light source as known to those having skill in the art in which the cathode degrades with age affecting the arc position and intensity . xenon lamp 14 emits light beam 28 , which is directed along the optical path comprising cold mirror 16 , hot mirror 18 , beam splitter 20 , mirror 21 , attenuators 22 , and optical fiber ports 24 . in this example , beam splitter 20 splits light beam 28 into two optical paths to provide for two optical probes 26 if desired . cold mirror 16 and hot mirror 18 combine to remove the infrared and uv components of light beam 28 ( heat ) and provide a cool visible light beam 28 to the downstream optical components , as will be familiar to those skilled in the art . attenuators 22 attenuate optical beam 28 . attenuators 22 can each be custom designed for its respective optical path and need not be identical , though they can be . further , each attenuator 22 can be independently controlled via , for example , pcb 30 . although high brightness illuminator system 10 is shown comprising two optical fiber ports 24 ( with aspheric lenses or other focusing elements ), it will be known to those having skill in the art that a single optical port 24 or multiple optical ports 24 can be implemented within illuminator system 10 . illuminator system 10 further comprises a printed circuit board (“ pcb ”) 30 , or its electronic equivalent , to provide signal processing and control functions . pcb 30 can be implemented in any manner and configuration capable of performing the desired processing and control functions described herein , as will be apparent to those having skill in the art . optical ports 24 comprise a receptacle to receive the proximal end of an optical fiber 34 corresponding to a fiber probe 26 , which is inserted into the high brightness illuminator enclosure 11 and optically coupled to illumination source 14 to direct light onto a desired site . fig2 is a more detailed diagrammatic representation of a portion of illuminator system 10 of fig1 . light emitted from the illumination source 14 arc region ( e . g ., a xenon arc lamp ) is collimated by the collimating lens 13 , and filtered by the cold mirror 16 , hot mirror 18 and attenuator 22 . the light is then focused by the condensing lens 23 ( which can be part of an optical fiber port 24 ) into optical fiber 34 . coupling the light from illumination source 14 into optical fiber 34 is efficient if the arc region is very small , the magnification provided by the illuminator system optics is small enough that the area of the arc image on the optical fiber 34 fits the core area of the optical fiber 34 and the illumination source 14 bulb is aligned so that the arc image size is kept small and the arc image fits within the core area of the optical fiber . fig3 illustrates one example of the optical coupling to a fiber of the light from an illumination source 14 comprising an osram 75 w xenon bulb . as shown in fig3 , the light source 14 arc is tear - drop shaped in this example with the long axis vertical and having an approximate width of about 0 . 18 mm . the optical fiber 34 , in this example , has a 1 . 14 mm diameter proximal end and the optical components of illuminator system 10 provide a magnification of about 1 . 41 . in this example , the arc image 52 fits within the optical fiber 34 core area , and due to the tear - drop shape of the arc , an optimum fiber throughput occurs when the hot - spot 50 is vertically decentered relative to the optical fiber 34 longitudinal axis . fig4 is a close - up view of the arc region of an illumination source 14 comprising a xenon lamp . arc 55 is created between anode 60 and cathode 65 . as can be seen from fig4 , arc 55 is closer to the cathode 65 . arc 55 emits the light provided by illuminator system 10 . as the illumination source 14 bulb ages , the tip of the cathode 65 erodes away , causing the tip of cathode 65 to move in a downward direction ( for a typical installation ) away from the anode 60 and to become blunter . as the cathode 65 erodes , the arc 55 grows in size , decreases in peak luminance , and also moves in the same direction as the cathode 65 away from anode 60 , causing a monotonic and rapid decrease in the illuminator system light throughput . the resultant change in measured arc luminance versus operating time for the example of an osram 75 w bulb is show in the graph of fig5 . it is worth noting that although the examples provided herein involve an osram 75 w xenon bulb , the analysis and results are expected to be comparable for other such illumination sources . the arc 55 position can shift by about 250 microns during the first 200 hours of bulb operation due to such cathode degradation . therefore , if the illumination source 14 is aligned for maximum fiber throughput at zero hours of system operation , the arc 55 movement combined with the decrease in arc 55 peak luminance can cause significant degradation in fiber throughput . the embodiments of the present invention comprise an illumination source 14 bulb offset ( e . g ., vertically misaligned ) relative to the longitudinal axis of an optical fiber 34 , so that the illumination source 14 performance at the end of a desired initial high - performance period of operation ( e . g ., about 200 hours ) is at a desired optimal level . at zero hours , the arc 55 can be positioned to have a desired optimum peak luminance , but will be vertically misaligned . at the end of the initial period of operation , the arc 55 will have a degraded peak luminance ( see fig5 ), but will achieve a position of approximate vertical alignment . these two effects can tend to cancel each other out so that the fiber throughput at zero hours , at the end of the initial period of operation ( e . g ., 200 hours ) and at times in between will be about the same ( approximately constant ). the effects described herein have been demonstrated theoretically by analyzing an illuminator system 10 having an osram 75 w xenon illumination source 14 using zemax optical ray tracing software . the results of one such analysis are illustrated in fig6 . as shown in fig6 , if the vertical portion of the illumination source 14 bulb is positioned to achieve a desired optimum throughput at 5 . 5 hours of operation , the bulb throughput will decrease by about 35 % after about 219 hours . however , if the vertical position of the bulb is adjusted to achieve a desired optimum throughput at 219 hours , the 5 . 5 hour to 219 hour throughput decrease is less than about 7 %. the throughput in such a case degrades much more slowly and monotonically between about 5 . 5 and about 219 hours . in some embodiments , an illuminator system 10 can comprise a retro - reflecting mirror ( or other reflector ) 70 behind the illumination source 14 arc , as shown in fig7 . the retro - reflecting mirror 70 can be positioned such that it is slightly misaligned ( offset ) vertically relative to the illumination source 14 bulb in order to keep the majority of reflected arc 55 image power off the cathode 65 , and thus decrease the rate of cathode 65 erosion . fig8 a and 8b illustrate the results of a comparison between a theoretical zemax software simulation and experimental data ( on a different osram 75 w xenon bulb than the theoretical simulation ). the results for about zero hours and about 200 hours operation time ( with the peak throughput value at about zero hours operation time normalized to 1 ) show excellent agreement between theory and experiment . various embodiments of the present invention thus provide for improved optical coupling to and light transmission through a small gauge optical fiber . further , the embodiments of this invention provide the ability to significantly reduce the decay in coupling efficiency with time as a xenon light source ages . the embodiments of the present invention can be incorporated into any xenon lamp based optical device , such as an ophthalmic illuminator , where optical coupling of a light beam into a small gauge optical fiber is desired . the present invention has been described by reference to certain preferred embodiments ; however , it should be understood that it may be embodied in other specific forms or variations thereof without departing from its spirit or essential characteristics . the embodiments described above are therefore considered to be illustrative in all respects and not restrictive , the scope of the invention being indicated by the appended claims .	0
the brushless homopolar axial - field motor represented in fig1 to 3 is triphasic , has eight poles , and exhibits six about 8 mm wide airgaps . it comprises a rotor 1 and a stator 2 , the stator 2 being connected to a source of electrical energy by suitable lead wires l , l &# 39 ;, and l &# 34 ; as shown in fig1 . the rotor 1 replaces the brake drum or brake disk , and the stator 2 replaces the brake shoe assembly or brake pads together with the brake back plate or brake splash shield , without changes in the wheel - axle 3 . the rotor 1 contains an axially magnetized , or non - magnetic , support tube 5 . in the case of motor - driven wheels , the rotor 1 is solid with the ( rotating ) axle of the wheel , and the bearings 4 are missing . a tubular permanent magnet 6 of highest energy density and with predominantly axial magnetization is set on the support tube 5 . the permanent magnet 6 may be composed of annular disks or annular sectors . it is suitably composed of a samarium - cobalt ( or similar ) material with energy density of 2 . 10 5 j / m 3 or higher . forged iron annular - stellar disks 7 , for example , 1 . 9 cm thick , adjoin the permanent magnet 6 frontally . the forged iron disk facing the external side of the wheel carries the screws 8 holding the wheel , as indicated on fig1 and 2 . the predominantly axially magnetized permanent magnet 6 can exhibit , towards its ends adjoining the forged iron disks , a gradually increased radial component of the magnetization , pointing outward . five pole rings 9 shaped in the form of stars of support arms with axially magnetized pole - pieces 11 of high energy density attached to the free ends of the support arms 10 , are set on the permanent magnet 6 . the pole pieces 11 can also be made of samarium - cobalt material , or , e . g ., of an iron - aluminum - nickel - cobalt alloy ( 5 . 10 4 j / m 3 ). between the pole - rings 9 , light metal plastic or poured resin rings can be applied as additional fasteners . the support arms 10 themselves are made of non - magnetic material and are slightly slanted to provide ventilation . the stator 2 of the axial - field motor is composed of a pot - shaped casing 13 fastened on the wheel - axle and steering knuckle . some openings are present on the bottom of the pot - shaped casing for ventilation and cooling . in the case of motor wheels the casing rests on the bearings which support the ( rotating ) axle . six ring - shaped support elements 14 , each of them carrying a flat ring - shaped coil 15 protruding into the airgap between the pole - pieces 11 , are fixed in the case , extending inwards . on the inner side of the ring - shaped coils there are support rings 16 . the support elements 14 and the support rings 16 are fastened to the corresponding flat ring - shaped coil 15 e . g ., by pouring a hardening agent . the ring - shaped bobbin - wound armature coil 15 can be made suitably of lamellar windings 17 as shown in fig4 with the use of ribbon conductor . each of the six ring - shaped coils 15 contains three phases spatially displaced by 15 ° from each other and connected for all six ring - shaped coils in series such that only three power leads are leaving the motor . the winding is connected preferably in star . the axial - field motor is homopolar , since the lines of force are passing through the pole - pieces 11 everywhere in the same direction . the magnetic flux density in the airgap is about 0 . 8 tests . for a current of 250a the motor develops a torque of about 330 nm . a power of about 20 kw is thereby obtained at a frequency of 600 rotations / m which corresponds to an applied voltage of 100 v . usually there would be two axial - field motors installed in any car at the otherwise not propelled wheels , yielding 40 kw together . for a small car weighing 1000 kg ( including the batteries ), with a diameter of the wheels of 0 . 5 m the speed developed is then about 100 km / h or 62 . 5 m . p . h . due to the limited available torque , the highest slope accessible to the car without use of the internal combustion engine is about 15 %. the acceleration time from rest to 50 km / h ( 31 m . p . h .) is about 8 s . a control system and a battery are needed for the operation of the axial - field motor . the control system is constructed with solid - state components and performs two main functions . ( a ) switching the current for the three phases in the right sequence , such that all radially oriented conductors in the three - phase winding contribute positively to the torque while they are in the airgap . this switching process is triggered by three hall - effect switches h1 , h2 , h3 ( fig2 ) placed on the stator 2 in spatial intervals of α = 15 ° in order to sense the position of the rotor . the switching cycle of the hall switches is represented in fig5 . ( b ) control of the current absorbed by the motor and of the torque generated in the motor . the torque is proportional to the current . the battery contains , e . g ., 18 lead or iron - nickel batteries of 6 v , or the same number of 12 v - batteries , the first choice being particularly favorable for the case of 120 v power outlets being used with a transformerless charger for overnight recharging , or used without charger , by simply switching from the motor m in fig6 to the power outlet ( not shown ). during driving or regenerative braking the batteries can be switched automatically , depending on the frequency of the signals given by the hall switches h 1 - h 3 to the prom , i . e ., depending both on motor speed and on whether the gas pedal or the brake pedal is depressed , in six parallel groups of three batteries in series ( 18 / 36 v ), in three parallel groups of six batteries in series ( 36 / 72 v ), in two parallel groups of nine batteries in series , or all in series ( 108 / 215 v ). the batteries , located for instance in the trunk of the car , are weighing at this time about 300 kg and provide the car with an action radius of about 80 km without the use of the internal combustion engine . the engine is to be used for longer trips . with the battery taken out , only the resistive braking mode of operation can be used . removal of the battery is recommended for extended , or trans - continental trips . fig6 shows a circuit in the power control , which allows for driving , regenerative braking , and resistive braking operation of the axial - field motor . the circuit is connected through an ammeter i and a main switch h to the battery . the capacitor c is parallel to the entrance and reduces the ripple . then a second switch a follows . parallel to the capacitor c is the series connection of a transistor - diode chopper combination tm , dm , a braking resistor and a transistor - diode chopper combination tb , db . the transistor - diode chopper combination tm , dm is for current limitation and control in the driving mode , and the chopper tb , db is for current limitation and control in the resistive braking mode . parallel to the chopper tm , dm there is an inductor l and a safety - diode d which eliminates possible high voltage transients . after the circuit mentioned above , in fig6 there follows a bridge of six transistor - diode combinations t1d1 , t2d2 , t3d3 , t4d4 , t5d5 and t6d6 which are connected with the motor m . these six transistor - diode combinations are switched by the hall - effect switches ( through the prom ) and generate triphasic current . during regenerative braking the six diodes d1 , d2 , d3 , d4 , d5 and d6 work as a rectifier bridge and charge the battery b . the transistors tm , tb , and t1 - t6 are preferably silicon controlled rectifiers ( scr ). if n motors are present , this ( bridge ) part of the controller will be duplicated n times in parallel . a suitable choice of the currents j r j s and j t sent to the motor in the three phases in fig5 is shown in fig7 . the steering of the control shown in fig6 by the hall switches h1 , h2 and h3 , by the gas and brake pedals of the car , and by the respective level of the motor current is performed advantageously through a prom . the connections of such a prom are presented in fig8 . the prom receives signals from the hall - switches h1 , h2 and h3 , a signal v / r corresponding to the choice of forward or reverse driving , a signal ap / bp from a gas pedal ( accelerator ) potentiometer or a brake pedal potentiometer , a signal tj indicating possible thermal overloads of the motor m and the transistor tm , as well as a current level signal jv . from the output of the prom leave the control signals for the transistors t1 to t6 . two other signals from the prom control two oscillant circuits which determine the width and frequency of the rectangular opening - pulses for the transistor - diode chopper combinations tm and tb , respectively . in addition , the prom emits several battery - switching signals . due to the most likely presence of two motors ( with independent phases ) the upper part of the prom in fig8 and the connections h1 - h3 , t1 - t6 , and tj will be duplicated in practice . this duplication is trivial and has been omitted in this text for the sake of simplicity . in the electric operation mode the driver controls the vehicle with the help of the gas pedal , of the brake pedal , and of the three - position switch for forward driving , exclusively ( resistive , i . e ., dynamical ) braking , and reverse driving . from the three - position switch the signal v / r originates , depending on which position the switch is in . braking is possible in all three positions , resistive ( i . e ., dynamical ) braking even when the main switch h is open . the other parts of the control system are set in operation by closing the main switch h . this is suitably done in the &# 34 ; garage &# 34 ; position of the ignition lock ( which does not lock the steering wheel , but has the ignition off ). in addition to their normal function , the gas and brake pedals are each connected mechanically with a potentiometer which also has a contact at the beginning of its way in the case of the gas pedal and a contact at the middle of its way in the case of the brake pedal . with the main switch h closed , if the gas pedal is depressed the switch a ( fig6 ) and the gas pedal contact arm ( which switches the ap / bp signal ) will close themselves after a short way of the pedal . in this position the gas potentiometer has the largest value of its resistance , and consequently the prom opens the transistor tm only about 5 % of the time ( creep speed , to be adjusted at the oscillant circuit next to the prom ). if the gas pedal is further depressed , the width and repetition frequency of the rectangular &# 34 ; on &# 34 ;- signals finally increase , e . g . up to 3 . 10 - 3 s and 300 hz , respectively and the transistor tm will be open for about 90 % of the time . at this point the transistor tm may be short - circuited by a direct switch ( not shown on fig6 ). the control can also be performed by making the gas potentiometer ( or variable inductance ), part of an oscillant circuit whose frequency it determines , and which in turn determines the repetition frequency and width of the &# 34 ; on &# 34 ;- signals for the transistor tm . the &# 34 ; on &# 34 ;- signals are further limited in width and frequency by thermal overload signals t1 which act on the oscillant circuit and are coming from the stator - windings of the axial - field motors and from the support of the transistor tm . if the gas pedal is left free , the car moves freely by virtue of its inertia . if the brake pedal is depressed , after a very short way a contact is closed switching the battery ( through the prom ) to the series - parallel combination corresponding to the respective motor speed , similar to what happens if the gas pedal is depressed , but with a slightly different adjustment . simultaneously , the switch a closes itself . thereby the battery will be charged through the six diodes d1 to d6 in regenerative braking . at very low speeds , at which the battery can no longer be switched down , the regenerative braking action vanishes gradually . if the brake pedal is further depressed , both the hydraulic brakes ( at the non - electric wheels ) and resistive ( dynamical ) braking are initiated beyond a certain position s of the pedal . resistive braking occurs , similar to the electric action of the gas pedal , by the closing of the brake potentiometer contact in the position s . at this initial position , somewhat before the middle of the pedal way , the brake potentiometer ( or variable inductance ) has its largest value , and therefore the prom opens the transistor tb only for about 5 % of the time . resistive braking occurs with heat being generated mainly in the resistor r b , but also in the motors m , the transistor tb and in the wiring in parallel , i . e ., additionally to the hydraulic brakes . the energy appearing in the case of stronger braking action is therefore distributed among battery , brake pads , and the resistor r b connected in series with the chopper combination tb , db in fig6 . the control of the resistive braking is again accomplished , e . g ., by making the brake potentiometer ( or variable inductance ) part of an oscillant circuit connected to the prom , thereby controlling the frequency of the circuit , and indirectly the frequency and width of the &# 34 ; on &# 34 ; signals for tb . however , these signals are not limited additionally by thermal overload signals from the motors m and the support of the transistor tb , but these thermal overload signals activate only a red brake overload warning light in view of the driver on the dashboard . the ammeter i , with red maximal current marks on both sides , indicates the battery discharge current by deflection to the right and the charging current by deflection to the left in regenerative braking . the series - parallel battery - switching is controlled by the prom both in driving and regenerative braking on the basis of the motor speed information derived from the hall switches h1 , h2 and h3 , also taking into account the signal ap / bp . a different shaping of the axial - field motor , e . g . as disk motor , is considered as a poorer execution of the invention . all other modifications of mechanical or electrical nature within the framework of the claims are included in the protected domain of the invention . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is , therefore , to be understood that within the scope of the appended claims , the invention may be practiced otherwise than specifically described herein .	8
the present methods described herein are primarily referenced to forming a single electrode device , and in particular a neural electrode device . however , it should be understood that the present methods can be configured to form a plurality of electrode devices that are suitable for medical sensing or stimulation applications . in a preferred embodiment , the present methods can be adapted to manufacture an electrode that is suitable for any electrical stimulation technology and any recording or sensing technology having conductive electrodes , such as electrodes that are useful in physiological solutions . in that light , the methods described herein are readily adaptable to scaling to batch processes for forming a plurality of electrode devices with reduced impedance at relatively low cost and high uniformity from one electrode to the next . turning now to the drawings , fig1 illustrates a neural interface system 10 according to the present invention . the neural interface system 10 comprises an electrode array 12 having a plurality of electrode sites 14 a and 14 b . the electrodes may be adapted to optimally sample ( record ) 14 a or selectively activate ( stimulate ) 14 b neural populations and may be individually or simultaneously activatable to create an activation pattern . the neural interface system 10 may further include a pre - molded component 15 onto which the neural interface array is attached or assembled that supports the electrode array 12 . the electrode array 12 is coupled to the pre - molded component 15 such that the electrodes 14 a , 14 b are arranged both circumferentially around and axially there along . alternatively the electrode array 12 may be kept in its original planar form and attached to another planar component for mechanical support . the neural interface system 10 of the present invention is preferably designed for deep brain stimulation and , more specifically , for deep brain stimulation with fine electrode site positioning , selectivity , tunability , and precise activation patterning . the neural interface system 10 , however , may be alternatively used in any suitable environment ( such as the spinal cord , peripheral nerve , muscle , or any other suitable anatomical location ) and for any suitable reason . methods for building the electrode array 12 comprising the electrodes 14 a , 14 b formed from shaped metallizations with reduced impedance will now be described . fig2 shows the dielectric substrate 16 contacting a release layer 18 that is directly supported on a carrier 20 . the dielectric layer 16 can be of a flexible thin material , preferably parylene , polyimide , silicone , or even a thin - film of silicon , or some combination of organic and inorganic dielectrics , but may alternatively be of any suitable material . the carrier 20 is preferably made of glass or silicon , but may alternatively be made from any other suitable material . the carrier 20 is may be flexible , rigid , or semi rigid depending on the microfabrication tooling ( organic electronics equipment can increasingly use flexible substrates without a carrier layer such as in roll - to - roll manufacturing , whereas ic and mems microfabrication equipment use a rigid silicon carrier ). a rigid carrier layer 20 has a thickness ranging from about 200 microns to about 925 microns , preferably greater than 500 microns . a metallization layer 22 in fig2 is deposited on the upper or outer surface 16 a of the dielectric substrate 16 . the metallization 22 is shown as a continuous layer and can be patterned using any suitable wet etch or dry etch wherein the mask is a photodefined resist or any other masking material patterned directly or indirectly using standard photolithography techniques having a perimeter extending from a lower metallization surface supported on the upper substrate surface 16 a to an upper metallization surface spaced from the lower metallization surface by a thickness of the perimeter . the metallizations 22 can be deposited using any suitable thin film , semiconductor , microelectromechanical systems ( mems ) manufacturing technique or other microfabrication process , such as physical vapor deposition . exemplary techniques and processes include evaporation and sputtering deposition . the metallizations layer 22 preferably includes a conductive material such as of gold ( au ), platinum ( pt ) or platinum - iridium , iridium oxide , titanium nitride , or any other metal , metal oxide , or conductive polymer having suitable electrically conductive properties . fig3 shows where the continuous metallization 22 has been patterned into a plurality of discrete metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . the metallization layer 22 can be patterned through etching , liftoff deposition ( not shown ), or any other suitable thin film , semiconductor manufacturing , mems manufacturing , or other microfabrication process . depending on the particular application for the finished neural interface system 10 , the dielectric substrate 16 , the release layer 18 and the carrier 20 can be flexible , semi - flexible , or rigid . the present method can further include patterning the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . to include conductive traces , bond pads , and other suitable conductive elements . in fig4 , a layer of nanospheres 26 has been deposited onto the dielectric substrate 16 to cover both the shaped metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . and the substrate surface 16 a between adjacent metallizations . the nanospheres 26 form a high - density , high - resolution spatial pattern serving as a substantially uniform mask or template over the surface of the individual metallizations . that is because the nanospheres 26 are substantially identical in size and shape . when they are deposited in a monolayer onto the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc ., the nanospheres 26 self - assemble into a tightly packed , uniform pattern . for example , the present method can include depositing a monolayer of nanospheres 26 onto the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . by drop wetting ( direct application of the nanospheres in solution ) and then allowing them to self - assemble into hexagonally packed patterns ( fig8 ) upon de - wetting . this embodiment includes depositing a nanosphere solution including nanospheres and a solvent onto the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . the solvent is then evaporated . the solvent is preferably selected based on its viscosity , evaporation rate , and wettability on the metallizations patterned on the dielectric substrate 16 . in one illustrative example , the solution includes polystyrene spheres mixed in a solvent of ethanol and de - ionized water . the ratio of ethanol to de - ionized water is approximately 4 : 1 . however , the solution can include nanospheres 26 other than those of polystyrene , such as glass , and a suitable solvent other than a mixture of ethanol and de - ionized water . the solution is preferably dropped onto the dielectric substrate 16 such that a monolayer of nanospheres 26 is distributed substantially uniformly on the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . depositing the nanosphere solution may be performed by using the langmuir - blodgett technique to transfer a pre - fabricated monolayer of nanospheres 26 onto the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . patterned on the dielectric substrate 16 . in an example , nanospheres 26 having a surface tension of γ - ns are in a solvent having a surface tension of γ - solvent . it is given that γ - ns is less than γ - solvent . then , a monolayer of nanospheres 26 forms at the exposed surface of metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . patterned on the dielectric substrate 16 . the substrate 16 supported on the carrier 20 can be moved through the solution to transfer the monolayer of the nanospheres 26 thereto . illustratively , one can use the drop wetting method by mixing a nanosphere solution ( e . g ., 5 % w / v solution ) into a 4 : 1 volume mixture of ethanol to de - ionized water . when applied to a patterned dielectric substrate 16 at room temperature on a horizontal surface , the nanospheres 26 will self - assemble along a contact line during the evaporation or de - wetting process . evaporation of the solvent can occur unassisted or be accelerated with environmental changes , such as in temperature and pressure from that of an ambient atmosphere . a second preferred embodiment is where the nanospheres 26 are deposited onto the metallization structures 22 a , 22 b , 22 c , 22 d , 22 e , etc . via spin - coating the above described nanosphere solution . if desired , the nanosphere solution can have a different viscosity , wettability , or other mixture ratio than that used with the drop - wetting or langmuir - elodgett technique . furthermore , depending on the nature of the nanosphere solution , spin - coating can include a particular rate of spinning and / or acceleration . according to the present invention , a series of recessed undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . or upstanding undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . are formed on the surface of the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . the recessed or upstanding undulations can be approximately pyramidal wave undulations , square wave undulations , approximately triangular wave undulations , or an undulation of any other suitable shape . fig5 , 5 a and 5 a ′ show recessed undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . that have been formed by etching 28 recesses 30 into the thickness of the respective metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . etching 28 the recesses 30 into the metallizations takes place beneath the interstitial spaces of the layer of assembled nanospheres 26 . the result is undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . comprising recesses extending into the original thickness or height ( h ) of the metallization layers supported on the substrate 16 . for etching , it is preferred that the nanospheres 26 a diameter ranging from about 20 nanometer ( nm ) to about 1 , 000 nm . etching can be performed with any suitable etching process . one advantage of etching is that it does not require any adhesion between the existing metallization layer and newly deposited conductive material . platinum , for example , is a commonly used biocompatible metal that can be dry etched using techniques described in u . s . pat . no . 6 , 323 , 132 with a reactive ion etcher . the contents of this patent are incorporated herein by reference . in that manner , etching forms the recesses 30 having a depth extending part - way through the thickness of the metallization 22 b from that portion of its upper surface of the metallization not contacted or otherwise covered by a nanosphere 26 . the recesses 30 can extend from about 1 % to about 99 % into the thickness of the metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . more preferably , the recesses are from about 50 % to about 90 % into the original metallization thickness . the metallizations shown in fig5 a have a thickness measured from the upper surface 16 a of the dielectric 18 to the upper surface of the as - deposited metallization of from about 0 . 25 micron to about 20 microns , more preferably from about 10 microns to about 20 microns . fig6 , 6 a and 6 a ′ relate to an alternative method where the upstanding undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . are formed by depositing 30 additional metallization material ( e . g ., in a lift - off deposition ) onto the metallizations 22 a , 225 , 22 c , 22 d , 22 e , etc . through the interstitial spaces between the nanospheres 26 . deposition 30 continues until the desired height of the added metallization material 32 measured from its base 32 a supported on the upper surface of the original metallization 22 b is achieved . for this technique , it is preferred that that the nanospheres have a diameter ranging from about 500 nm to about 5 , 000 nm . one advantage of this variation is that depositing material preferably results in metal - metal bonds and predictable surface properties . fig7 a illustrates a representative one of the undulations where the additional metallization material 32 forms a base on the upper surface of the metallization 22 b and build - up in a pyramidal manner . that is without contacting the adjacent nanospheres 26 , but while following their generally circular contour . in that respect , the height of the upstanding undulations is preferably about 90 % of the radius of the nanosphere . it has been discovered that this ratio provides maximum . added surface area for the added metallization . that means the upstanding additional or secondary metallization material has a height ranging from about 225 nm to about 2 , 250 nm above the upper surface of the primary metallization 22 . moreover , the added metallization does not grow so high as to prevent the subsequent removal of the nanospheres . in order for nanosphere removal , it is important that the added metallization not extend past the imaginary equator and over the upper half of the hemisphere . with this rule , it has been determined that approximately a . four - fold increase in the geometric surface area ( gsa ) is achievable . fig7 b is a photograph showing how the deposited metallization material builds up from the upper surface of a metallization without contacting the nanospheres 26 . the nanospheres 26 have been removed in the photograph , but the generally circular shape of one of them is delineated by the circle bordered by the deposited metallization material , which is seen as the off - white pyramidal bodies having somewhat triangular bases . in both embodiments , the recessed undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc and extending 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc on the respective metallizations are preferably bounded by the interstitial spaces of the nanospheres 26 . since the nanospheres 26 are substantially uniform in shape and arranged in a substantially uniform distribution in the layers of fig5 and 6 supported on the upper surface of the metallization 22 a , 22 b , 22 c , 22 d , 22 e , etc ., there is a substantially uniform distribution of interstitial spaces between the nanospheres 26 . consequently , the undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . and 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ”, etc . are substantially uniformly distributed throughout the surface area of the shaped metallization . if desired , the nanospheres 26 are removed from the dielectric substrate 18 after forming recessed or extending the undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . and 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc . on the respective metallizations 22 a , 22 b , 22 c , 22 d , 22 e , etc . or , the nanospheres 26 can be left on the metallizations . the undulations 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc and 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″, etc significantly increase the electrochemical surface area ( esa ) of the electrode , particularly relative to the geometric surface area ( gsa ) of an electrode formed from one of the metallization according to the present invention . the interstitial spaces of the nanospheres ( or “ pores ” of the layers of the nanospheres ) are preferably arranged in a . substantially uniform distribution , thereby enabling substantially uniform arrangement of the undulations . the particular form of the undulation , whether they be of the recessed or the extending form ( etching or deposition ) of the metallizations depends on the functional application of the electrode that will be manufactured from the metallization device , desired dimensions of the electrode , extensions , and / or recesses , materials within the metallization , and / or any suitable factor . in any event , the undulating surface provides an increased esa predicated on the diameter and packing arrangement of the nanospheres 26 , and the depth of recess 30 for the recessed undulation 22 a ′, 22 b ′, 22 c ′, 22 d ′, 22 e ′, etc . or the increased thickness of the deposited metallization material 32 for the extending undulations 22 a ″, 22 b ″, 22 c ″, 22 d ″, 22 e ″ etc . as shown in fig8 , the amount that the esa increases as is inversely proportional to the diameter of the sphere : where a inc = additional area additional area created inside the fundamental unit of the equilateral triangle formed by 3 adjacent spheres when hexagonally packed , d s = diameter of a sphere , d m = height of deposition or the depth of etch , and a e = geometric area of electrode ( derived from the metallizations 22 ). estimated area change in various illustrative examples of etched metallization electrode sites ( fig5 , 5 a and 5 a ′) are shown in table 1 of fig9 . in some preferred embodiments , the present invention methods additionally or alternatively include one or more of several variations described below . as shown in fig1 a and 10b , a further surface area increase can be achieved according to the present invention by undercutting one or more alternating layers of patterned metal . in one version of this embodiment , the method includes : depositing a planar metallization layer stack ( e . g ., au / pt , au / ir , or other au stack ) onto the dielectric substrate 16 , and then selectively wet etching the au metal . an example of this is to deposit a layer of platinum 40 onto the dielectric layer ( not shown in fig1 b ) using one of the methods previously described with respect to fig3 and 4 . without removing the nanospheres 26 , a layer of gold 42 is deposited on top of the platinum 40 followed by a second layer of platinum . the nanospheres 26 and the underlying photoresist pattern 24 are then removed and the gold 42 is wet etched . etching serves to expose additional surface area of the platinum 40 that was previously positioned both above and below the gold . this is shown by the exposed surface 42 a of the platinum layers 42 in fig1 b . it is important to not etch too much of the gold 42 so that it can no longer act as a structural support for the platinum . 40 . in fig1 b , the depth of etch is depicted as d au , which is less than the original thickness of the gold layer measured parallel to the plane of the dielectric substrate 16 . in addition to platinum , iridium , iridium oxide , and titanium nitride are suitable metallization materials for use with this gold etching process . in that manner , gold etching serves to expose more of the non - au metal surface area . fig1 a and 11b relate to another embodiment of the method according to the present invention . this embodiment additionally or alternatively includes depositing an alternating combination of layers on the dielectric substrate ( not shown in fig1 b ). in one specific embodiment alternating layer of platinum 40 and gold 42 are deposited one on top of the other until a stack of a desired height is achieved . in a similar manner as described above with respect to fig1 a and 10b , the gold layers are wet etched to undercut and expose addition platinum surface area . as described above , it is important not to etch too much of the gold 42 . in fig1 b , the depth of etch is depicted as d au , which is less than the original thickness of the gold layer measured parallel to the plane of the dielectric substrate 16 . enough gold must be left to serve as a structural pillar supporting the above platinum and gold layers . an example of this embodiment is alternating layers of au / pt / au / pt / au / pt stacked one on top of the other . gold . etching preferably forms more esa . although omitted for clarity , the preferred embodiments of the present methods include every combination and permutation of the various processes described above . furthermore , the preferred embodiments of the present method can be executed by a computer program or other system including computer program code for controlling hardware ( e . g ., machines for deposition , sputtering ) in an automated fashion . as previously discussed with respect to fig1 , a neural interface device 10 with reduced impedance according to the present invention includes the dielectric substrate 16 supporting the electrode array 12 comprising the plurality of electrodes 14 a , 14 b . after the metallization material 22 has been provided with an undulating surface characteristic , whether the undulations are recessed or upstanding the neural array is further completed with the addition of top dielectric , bond pads if necessary , vias , and other desired features ( none of these are shown here ). finally the neural array including the dielectric substrate 16 is removed from the carrier 20 . the release layer 18 facilitates this separation in some cases but not always required especially if the dielectric substrate 16 only has weak bonding to the carrier 18 . the dielectric substrates ( top and bottom ) and the electrode array 12 are then formed into a desired shape of the neural interface system 10 , which can be either planar or three - dimensional such as the cylindrical shape shown . the neural interface device 10 can be a planar probe with the electrode array 12 , a cylindrical probe with the electrode array , a substantially planar or curved substrate with the electrode array , or any suitable electrode device . at least a portion of each electrode 14 a , 14 b has a substantially uniform undulating surface described above . at least a portion . of the substantially uniform undulating surfaces of the electrodes 14 a , 14 b includes peaks and / or crevices ( e . g ., recesses ) that are preferably distributed in a regular arrangement and , more preferably , in an approximately hexagonal arrangement as shown in fig5 a , 5 a ′, 6 a and 6 a ′. the undulating surfaces increases the electrochemical surface area of the electrodes 14 a , 14 b , thereby reducing their impedance and improving their functionality for stimulation and sensing purposes . while this invention has been described in conjunction with preferred embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , the present invention is intended to embrace all such alternatives , modifications and variations that fall within the broad scope of the appended claims .	0
in one embodiment , the present invention is a digitally controlled threshold adjustment circuit which does not impose any significant bandwidth reduction due to loading of the signal path . since the circuit is digitally controlled , it can easily be incorporated into an adaptive algorithm that can automatically find the optimal point for sampling , without user intervention . fig4 is an exemplary circuit diagram of a threshold adjuster , according to one embodiment of the present invention . as depicted in fig4 , a threshold adjustment circuit 42 is connected to current summing nodes 43 and 44 , which generate outp and outn , respectively . as an example , threshold adjustment circuit 42 can be connected to outp and outn at the output of a gain stage which includes a trans - conductance ( gm ) 41 sinking current from load impedances ( r load ) 47 a and 47 b . threshold adjustment circuit 42 includes a current dac 45 , which generates a threshold current 46 ( i threshold ). in one embodiment , a thermometer coded current steering dac is utilized to implement the dac 45 , as depicted in fig5 . fig5 is an exemplary circuit diagram of a current steering dac , according to one embodiment of the present invention . as shown , transistor m b biased by a current i unit supplies a bias voltage v bias . each of the transistors m 0 to m k is turned on by respective switches s 0 to s k that are driven by cont & lt ; 0 & gt ; to cont & lt ; k & gt ;, respectively . depending on the digital code cont & lt ; k : 0 & gt ;, current i out ( i threshold ) varies from 0 to its maximum required value in linear and monotonic steps . the maximum i threshold value can be calculated as ( k + 1 ) i unit . in addition , the linear step size is i unit . the dac is called a thermometer dac in this case , because the current sources switch one - at - a - time only . referring back to fig4 , nmos transistors mp and mn are used in their saturation regions to sink all of i threshold to either outp or outn . in other words , nmos transistors mp and mn are used for polarity selection of threshold adjustment . if mp is turned on ( saturation region ), then mn is turned off sending i threshold to outn . likewise , if mn is turned on ( saturation region ), then mp is turned off sending i threshold to outp . if i threshold is sunk into outn , the dc voltage component of outn decreases by the amount that corresponds to the voltage drop generated by i threshold on r load 47 a . that is , the selected current from the dac induces a voltage drop across the loads , which in turn reduces the dc voltage component of outn . in the above embodiment , nmos transistors mp and mn , as well as transistors in the dac are all low voltage transistors . furthermore , the power supply vdd is used above the reliability voltage limit of the low voltage transistors . using low voltage transistors is preferred to obtain the maximum trans - conductance with minimum area and loading . using a vdd above the reliability voltage limit is also preferred to achieve higher speed for circuit components such as drivers , flip - flops , etc . if the low voltage transistors are used with a vdd above their reliability voltage limit , a careful biasing and proper operation of the low voltage transistors should be taken into account in the design of the circuit . in other words , the design should ensure that the voltage drops across the terminals of every low voltage transistor be within their reliability voltage limit . in operation , when mp is turned on , input voltage vbp ( on ) is pulled to a predetermined voltage level above the threshold voltage v th of mp , but lower than power supply vdd , to keep mp in saturation region , even if i threshold goes to its maximum level . a saturation region of a nmos transition occurs when vd & gt ; vg − v th of the transistor . when operating in the saturation region , a transistor has a high impedance between its source and drain . this high impedance decouples the output capacitance of the dac from the r load . if vbp ( on ) was selected as high as vdd , then mp would go into triode region where not only its drain capacitance increases , but also , the dac output capacitance would be added to the outn node . increased drain capacitance due to mp entering into triode region would decrease the bandwidth at node outn . in one embodiment , the input voltages vbp and vbn are digitally controlled . likewise , when mn is turned on , input voltage vbn ( on ) is pulled to a predetermined voltage level , lower than power supply vdd to keep mn in saturation region , even if i threshold goes to its maximum level . similar to vbp ( on ), if vbn ( on ) was selected as high as vdd , then mn would go into triode region where its drain capacitance increases significantly . again , increased drain capacitance due to mn entering into triode region would decrease the bandwidth at node outp . in one embodiment , the predetermined voltage level of the input voltage vbp ( on )/ vbn ( on ) is generated using a resistor voltage divider ( not shown ) to limit the vbp ( on )/ vbn ( on ) voltage to a voltage lower than vdd , so that mp / mn operate in their saturation regions and stay within their reliability limits . similarly , the predetermined voltage level of the input voltages vbp ( off )/ vbn ( off ) is generated using a resistor divider ( not shown ) to limit the vbp ( off )/ vbn ( off ) to a voltage higher than gnd , so that mp / mn operate in their off regions and stay within their reliability limits . further , bulk nodes of mp and mn are tied to a common source node v source to prevent drain - to - bulk voltage ( vdb ) from going above the reliability voltage limit . likewise , when the bulk node is tied to source node the bulk - to - source voltage ( vbs ) becomes zero . thus , the body effect on threshold voltage v th of the transistor , which is a function of vbs , is also eliminated . this decreases the gate - to - source voltage ( vgs ) of the respective transistor for a given current density . since vgs is reduced , this results in relaxing the headroom requirement of dac transistors . when mp is turned off , vbp ( off ) is pulled to a predetermined voltage level below the threshold voltage v th of mp , but higher than ground voltage ( gnd ) to keep drain - to - gate voltage ( vdg ) of mp below the reliability voltage limit . similarly , when mn is turned off , vbn ( off ) is pulled to a predetermined voltage level below the threshold voltage v th of mn , but higher than gnd to keep vdg voltage of mn below the reliability voltage limit . however , if vbn ( off ) is selected too low , such as gnd , vdg of mp and mn would increase above its limit , which could cause reliability issues for mp and mn . when the threshold adjustment circuit is disabled , the dc component voltage levels of outp and outn do not need to be adjusted . in one embodiment , both mp and mn are turned on resulting in sinking a small amount of current such as , but not limited to , i unit into mp and mn . however , keeping mp and mn both on will have some disadvantages . due to mismatch between mp and mn , i threshold will not be evenly sunk into outp and outn , which can cause a leaky and undesired threshold adjustment . depending on the amount of current left sinking , dc component voltage levels of both outp and outn will go down and thus decrease the headroom for gm ( dac ) stage . moreover , if both mp and mn are left on ( in their saturation regions ), then rds ( mp )+ rds ( mn ) decrease the output impedance r load resulting in a decrease in the gain . in one embodiment , when the threshold adjustment circuit is disabled , both mp and mn are turned off and another current passage path is created by switching on the transistor m shut . the reason for creating another current passage path is to keep the common source node voltage v source of mp and mn above a certain level so that the drain - to - source voltage ( vds ) of mp and mn can be kept within the reliability voltage limit . thus , a small amount of current such as , i unit is left sinking into m shut to keep v source above a certain level . since m shut is not in the critical signal path , a high voltage transistor for m shut is used such that it does not require any special biasing for m shut , since vdd is within the reliability voltage limit of the high voltage transistor m shut . if high voltage transistors are not available in the process and / or m shut should also be protected against over the limit terminal voltages , an alternative implementation of disabling scheme is illustrated in fig6 . resistor r is used to limit the vds voltage of m shut . in addition , the gate voltages of m shut , disable and enable voltages , have predetermined values to avoid any over the limit terminal voltages for m shut and m ena whether they are turned on or off . one or more nmos or pmos transistors can be utilized to implement resistor r . transistor mi that is biased by v bias operates as a current source . although the threshold adjustment circuit is described using nmos transistors only , those skilled in the art understand that the threshold adjustment circuit can be implemented using only pmos transistors or using both nmos and pmos transistors . the threshold adjustment circuit of fig4 is utilized to decrease the dc voltage components of outn or outp . fig7 is an exemplary circuit diagram of a threshold adjustment circuit that decreases the dc voltage components of outn and outp and increases the dc voltage components of outn and outp , resulting in a more uniform signal , as shown in fig1 b . as illustrated in fig7 , a first threshold adjustment circuit 73 operates similar to the threshold adjustment circuit described in fig4 to decrease and / or increase the dc voltage components of gm 72 outputs , outn and outp . a second threshold adjustment circuit 74 operates in a complementary way to the threshold adjustment circuit 73 to increase and / or decrease the dc voltage components of outn and outp also . a signal nv shut which may be the inverted signal v shut is used to shut the second threshold adjustment circuit 74 . each of the threshold adjustment circuits 73 and 74 include a dac that is controlled by control signals cont & lt ; k : 0 & gt ;. the control signals cont & lt ; k : 0 & gt ; to each of the threshold adjustment circuits 73 and 74 may be the same or different , depending on the amount of current requirements to reduce the asymmetric eye opening , shown in fig1 a . in one embodiment there is only one dac that is supplying / sinking current to each of the threshold adjustment circuits 73 and 74 . load resistors 75 a and 75 b are similar to those load resistors of fig4 . an exemplary embodiment of the threshold adjustment circuit 74 is shown in fig8 . fig8 is an exemplary circuit diagram of a threshold adjustment circuit for increasing dc voltage components , according to one embodiment of the present invention . the circuit is similar to the threshold adjustment circuit of fig4 in operation , however , it uses pmos transistors , instead of nmos transistors and supplies a current i threshold , rather than sinking the current , to the loads . the threshold adjustment circuit is coupled to outp and outn at the output of a gm 82 sourcing current from load impedances ( r load ) 85 a and 85 b . dac 84 generates a threshold current 86 ( i threshold ). again , depending on the digital code cont & lt ; k : 0 & gt ;, current i threshold varies from 0 to its maximum required value in linear and monotonic steps . pmos transistors mpp and mpn driven by inputs vbn and vbp are used in their saturation regions to send all of i threshold to either outp or outn . if mpp is turned on ( saturation region ), then mpn is turned off sending i threshold to outp . likewise , if mpn is turned on ( saturation region ), then mpp is turned off sending i threshold to outn . if i threshold is supplied into outn , dc voltage components of outn increases by the amount that corresponds to the voltage drop generated by i threshold on r load 85 b . in the above embodiment , pmos transistors mpp and mpn , as well as transistors in the dac are all low voltage transistors . however , m pshut transistor may be a thick oxide transistor . if high voltage transistors are not available in the process and / or m pshut should also be protected against over the limit terminal voltages , the alternative implementation of disabling scheme of fig6 , that is , using a resistor r to limit the vds voltage of mpshut may be used . control signal nv shut is used to disable the threshold adjustment circuit by turning the pmos transistor m pshut on while both mpn and mpp are off . also , the bulks of mpp and mpn are connected to the common source node v psource and vbp and vbn voltages are set properly for turning mpp and mpn on / off to avoid any voltage drop across the terminals of mpp and mpn rising below the reliability limit . it will be recognized by those skilled in the art that various modifications may be made to the illustrated and other embodiments of the invention described above , without departing from the broad inventive scope thereof . it will be understood therefore that the invention is not limited to the particular embodiments or arrangements disclosed .	7
as shown in fig1 a of the drawings , there is represented a substrate 10 having a semiconductor chip 12 of an electronic package located thereon . the semiconductor chip 12 in this structure , as presently employed in the technology , utilizes essentially round ball - shaped solder balls 14 ( of which one is illustrated ) on an enlarged scale in fig1 c , from the encircled part a in fig1 b , which produces a c4 connection . all of the electronic package components , including the printed circuit board 18 , are known in the state - of - the - art , as mentioned hereinabove . referring in further detail to the drawings , as illustrated herein , fig2 a shows a deformed state of the c4 connection 14 due to the relative motion of the upper and lower c4 pads 20 , 22 . the arrow shown on top of the substrate 10 represents the vector of relative motion . fig2 b shows a generalized displacement pattern of the c4 connection in a three - dimensional representation . hereby , ab and cd represent the displacement vectors of the top and bottom pads 20 , 22 . the in - plane relative motion of the circular pads 20 , 22 is given by the vector be . thus , the vector be is the in - plane projection of the relative pad motion ( referred to as relative motion vector ). in this representation , the pads 20 , 22 are assumed to be arranged in parallel relative to each other . fig3 a and 3 b show an array of c4s 14 on a substrate 10 as currently employed in prior art , together with the typical direction of motion thereof during a thermal cycle . in this diagrammatic representation , the relative motion or displacement vector is assumed to be directed along the radial direction in an in - plane projection . a detailed analysis of a specified electronic package may indicate that the direction of motion can be closely projected before an electronic package is actually prototyped or manufactured . referring to fig4 a of the drawings , this elucidates the concept of the present invention . the previously disclosed circular pads 20 , 22 are now modified into elliptical pads 26 and the minor axis 28 of each pad 26 is set parallel to the relative motion or displacement vector , as shown in fig4 b . an identical grid structure is deployed , as in fig3 a and 3 b , indicative that the pitch of the elliptic - c4 is the same as that of the circular - c4 . the mode of implementation as shown in fig4 a consists of depositing only a limited number of elliptical - shape c4s 30 near the corner of a substrate 10 , while maintaining the spherical shape of c4s 14 for all the remaining ones . the c4s 30 carry signals and voltages to transistors ( not shown ) embedded in the semiconductor chip 12 , whereby it can be shown that an elliptical c4 30 may enhance resistance to electromigration . therefore , currently carrying c4s that are prone to electromigration can be made of elliptical c4 30 , while others can be left as circular c4s 14 in the event that fatigue is not a concern , this can then be a second mode of implementation of the invention . a combination of first and second mode in these configurations of the c4 connects is optimal for a semiconductor chip that is prone to fatigue as well as to electromigration problems . fig5 shows an example of an elliptical c4 30 , which is subjected to shear strain along the minor axis thereof . the aspect ratio of the c4 elliptical cross - section ( major axis / minor axis ) is 2 . 25 , obtained from a circular shape by stretching the radius by 50 % along one direction and reducing the radius in the perpendicular direction by 33 %— so that the overall surface area is maintained . the computed von mises stresses are maximum near the edge of the pads . fig6 shows the effect of the relative increase of the major axis on strain energy and von mises stress . both quantities have been obtained by averaging the fe results on a slice of the c4 close to a pad ( thickness of the slice = 7 μm ). it is noted that an elliptical c4 with a 125 μm major axis , when loaded along its minor axis , reduces the strain energy by 10 % with respect to its spherical c4 counterpart of equal cross sectional area . it is emphasized that these estimates are based on linear elastic analyses , whereas the c4s are well - known to undergo plastic deformations upon thermal cycling conditions ( both in the field and under dtc ). however , reductions in the elastic stresses ( and strain energy ) prior to yielding translate to benefits in the plastic strains and energies , and consequently impart enhancements in the fatigue life of the electronic components . unlike their spherical counterparts , c4s based on elliptical cross - sections are not isotropic , meaning that any miscalculation or uncertainty in the gradient vector will inevitably raise stresses and energies above the predicted level . in order for the proposed approach to be convenient , it needs to be robust , signifying that realistically possible miscalculations must not transform the benefit into a disadvantage . fig7 illustrates the effect of misorientation of an elliptic - c4 from its ideal position . the location and magnitude of the peak value changes , whereas fig8 depicts the effect of misorientation on stresses and energy . hereby , it is notable that for the same aspect ratio as in fig6 , a miscalculation of 20 % ( quite severe ) in the gradient vector only causes stresses and energy increases of less than 4 %. in other words , the benefit gained in choosing c4s 30 of elliptical cross section is reduced , but is not eliminated , or even worse turned into a potential disadvantage . surviving industry standard dtc cycle is many times more challenging than surviving a customer “ use condition .” the dtc cycle subjects a whole electronic package to same temperature condition in which the differential displacement vector ( ddv ) has a cohesive directions response . fig9 represents a depiction of a current density distribution through a c4 connection in three elevational locations , whereby there can be observed that the electrical current density peaks along the pad edges . fig1 a and 10 b show a schematic representation of the dimensions used for , respectively , a circular and an elliptical c4 . fig1 a and 11 b show the current density distribution when a 200 ma current is driven through the circular and elliptical c4s wherein the elliptical c4s provide a longer edge for the electrical current to be distributed , and to thereby reduce the peak magnitude commensurately . finally , fig1 discloses a normalized comparative plot of current density . there is obtained a 10 % decrease in peak electrical current density for an aspect ratio of 1 . 65 , as used in this example . the foregoing clearly indicates the advantages obtained over standard spherical c4s through the use of c4s with elliptical pads . in conclusion , c4s with elliptical pads , when oriented along an optimal path , possess the following advantages over the industry standard spherical c4s : ( i ) an increased fatigue life , which is achieved due to a reduced stressed level under the same thermal cycle conditions ; and ( ii ) a reduced sensitivity to electromigration damage , due to an obtained reduction in the peak current density . an implementation of the invention consists of using elliptical c4s in the semiconductor chip areas subjected to a maximum strain ( i . e ., normally near the corner region of the chip ), with the minor axis of the c4 pad aligned with the relative displacement vector ( i . e ., roughly along the radial direction from the center of the chip ); similarly , the c4s that receive the highest currents should be elliptical , with the minor axis aligned with the horizontal lines feeding power to a c4 . it is important to emphasize that the above - mentioned approach does not require any new manufacturing process ; only needed is the depositing of elliptical pads on both the semiconductor chip and the substrate , and the c4s will assume the desired shape during the reflow process to which they are subjected . the advantage of the elliptical geometry can be applied to all electrical or non - electrical components that require attachment , using fatigue prone material . while the present invention has been particularly shown and described with respect to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in forms and details may be made without departing from the spirit and scope of the present invention . it is therefore intended that the present invention not be limited to the exact forms and details described and illustrated , but to fall within the spirit and scope of the appended claims .	8
as fig1 and 2 show , the frame of the bogie comprises two lateral sole - bars 1 whose general longitudinal direction m is , at rest , parallel to the rails 2 and to a median vertical plane pp of the bogie . in the following , everything which is parallel to the plane defined by the two rails 2 , which are assumed to be horizontal and parallel , will be described as horizontal and everything which is perpendicular to this plane as vertical . the two sole - bars 1 are supported by two axles 3 whose axis 4 is perpendicular to the plane pp . the axles 3 are symmetrically disposed on either side of a median vertical transverse plane tt of the bogie . between the sole - bars 1 , each axle 3 carries two wheels 6 . beyond each wheel 6 , the axles 3 have an axial extension 7 supported by a bearing 8 mounted in an axle - box 9 which is located beneath the sole - bar . the base of each axle - box 9 is extended forwards and backwards by a lug 11 extending in an approximately horizontal plane . an elastic system 12 , comprising , in the example , two helical springs with a common vertical axis , bears in compression on the upper face of each lug 11 . at each axle end , one of the elastic systems 12 bears directly beneath the sole - bar 1 . the other elastic system 12 bears in a cap 13 which is pulled downwards by the sole - bar 1 by means of an oblique swing - link 14 . because of the obliqueness of the swing - link 14 , the cap 13 undergoes a force directed obliquely downwards , the vertical component of which compresses the elastic system 12 and the horizontal component of which is transmitted to the axle - box 9 by means of a pushing device 16 which is slidably mounted in the sole - bar . the pushing device 16 bears on a lateral face of the axle - box 9 and pushes the axle - box 9 so as to bear by its opposite lateral face against a corresponding wall 17 of the sole - bar . thus , in a known manner , during the oscillations of the suspension , the axle - box 9 rubs against the pushing device 16 and against the face 17 through a bearing force which is proportional to the state of compression of the elastic systems 12 , and therefore proportional to the load supported by the axle . this produces a damping effect of the oscillations which is proportional to the load supported by the axle . the sole - bars 1 are joined together , in the plane tt , by a bolster 18 . the central region of the upper face of the bolster is constructed in the form of a cylindrical pivot - bearing 19 for the articulation of the bolster 18 with the body ( not shown ) of the wagon . as fig4 shows , the pivot - bearing 19 is intended to receive a complementary cylindrical pivot 21 fixed to the lower face of the body of the wagon and connected axially to the bolster , with the possibility for rotation about the central vertical axis of the bogie , by means of a retention bolt 22 . the pivot 21 bears on the bottom of the pivot - bearing 19 by means of a side friction block 23 . the use of a cylindrical pivot is rendered possible as , with the bogie according to the invention , it is sufficient that the bolster 18 can pivot about a single axis in relation to the body of the wagon . it is therefore pointless having recourse to a more complicated and bulkier articulation of the spherical type . as fig3 shows , the bolster 18 also carries on its upper face , in the vicinity of the inner face of each sole - bar , two lateral bearing members 37 for the body of the wagon . these lateral bearing members are elastically compressible and comprise , on their upper faces , a friction lining 38 intended to bear frictionally against the lower face of the body of the wagon in order to hold up the body of the wagon at some distance away from the pivot - bearing 19 and , consequently , to eliminate the major portion of the swinging loads to which the pivot - bearing could be subjected and , at the same time , to dampen , by friction , the possible sideways movements of the bogie in relation to the body of the wagon . each end of the bolster 18 is engaged in a window 24 of one of the sole - bars 1 . an elastic articulation is produced between the bolster 18 and the sole - bar 1 in this opening . this linkage prepositions each sole - bar in relation to the bolster 18 . in order to achieve this , each sole - bar 1 carries on its inner face , that is to say facing the other sole - bar 1 , two friction linings 26 located on each side of the window 24 , which define two lateral reference faces of the sole - bar which are coplanar and parallel to the plane pp . in addition , the bolster 18 carries in the vicinity of each of its ends and on each of its lateral faces a bracket 27 to which is fixed , facing respectively one of the linings 26 , a friction lining 28 . the friction linings 28 define on the bolster 18 two reference faces which are conjugate with those defined by the linings 26 on the sole - bar 1 and which are coplanar and perpendicular to the longitudinal direction l of the bolster 18 . thus , when the linings 26 and 28 bear on each other , the corresponding sole - bar 1 is in an orthogonal configuration in relation to the bolster 18 . in addition , if the two sole - bars 1 are in this configuration in relation to the bolster 18 , neither of the sole - bars 1 is ahead of the other in relation to the direction of advance of the bogie along the rails , provided that the distribution of the clearances x and x &# 39 ; ( fig1 and 2 ), which are allowed on each side of the bolster in the window 24 along the longitudinal direction m , is the same at the two ends of the bolster . it will be noticed that each sole - bar 1 can pivot in an equalising movement about an axis parallel to the longitudinal direction l of the bolster 18 without this leading to lift - off between the friction linings 26 and 28 . such a movement requires simply sliding with friction between these linings , which plays a beneficial damping role . such an equalising movement is permitted by the clearances x and x &# 39 ; initially provided between the bolster and the front and rear walls of the window 24 . this clearance then assumes a wedge shape on each side of the bolster , as fig5 shows . furthermore , each end of the bolster 18 bears by its base against the base of the window 24 , by means of two elastic blocks 32 each comprising a mass 33 of rubber or another elastomer interposed between two end plates 34 and 36 . more particularly , the base of the window comprises two faces 31 in the form of a concave dihedron , which is symmetrical in relation to the transverse plane tt , and the base of the bolster end has a complementary convex dihedral shape whose two faces 29 are , when the bogie is at rest , substantially parallel to the faces 31 of the bolster . the two elastic blocks 32 are each mounted between one of the faces 31 of the window 24 and the parallel face 29 of the bolster . each elastic block 32 is relatively incompressible , but very flexible in terms of shear deformation such that the block 32 barely transmits forces parallel to its bearing faces . thus the compressive forces exerted by the block 32 on each of these faces are substantially perpendicular to the latter . each face 31 and each face 29 is inclined at an angle a ( fig3 ) in relation to the longitudinal direction l of the bolster 18 . the angle a , approximately 30 °, is oriented such that the compressive force f of the elastic block 32 ( fig3 ) on the corresponding face 31 of the window 24 has a horizontal component f ht parallel to the direction l which pushes the sole - bar 1 towards the median longitudinal plane pp and , consequently , tends to press the sole - bar by its two friction linings 26 against the two friction linings 28 which are firmly attached to the bolster 18 . the face 31 is therefore directed obliquely upwards and towards the plane pp . it will be noted that the elastic block 32 exerts on the face 29 of the bolster 18 a force having a component directed horizontally towards the outside of the bogie , but this force is balanced by an equal and opposite force exerted by the elastic blocks on which the other end of the bolster 18 bears . thus , the transverse horizontal component f ht produced by each elastic block 32 on the associated sole - bar 1 tends permanently to produce , between the linings 26 and 28 the bearing together by virtue of which the sole - bar 1 preserves its preferred configuration in relation to the bolster 18 . furthermore , as fig1 shows , the two faces 31 and the two faces 29 form an angle b of approximately 30 ° with the longitudinal direction m of the sole - bar 1 . taking into account the symmetry in relation to the plane tt , this inclination results in the compressive force f exerted by each elastic block 32 on the corresponding face 31 of the window 24 having a horizontal component f hl parallel to the longitudinal direction m of the sole - bar 1 . when the clearances x and x &# 39 ; are equal , the two components f hl are equal and opposite : this is the position of stability . if the clearances x and x &# 39 ; are not equal , one of the elastic blocks 32 is more compressed than the other and this results in the two components f hl being unequal and their resultant is non zero and tends to move the sole - bar in relation to the bolster in the direction for re - establishing the equality between the clearances x and x &# 39 ;. as the faces 29 and 31 , between which the elastic blocks 32 are interposed , are substantially parallel to each other , the elastic blocks 32 have , a priori , no strong tendency to slide parallel to these faces under the effect of the load : such a sliding would produce no work of spring - back of the blocks 32 . however , in order to preposition the blocks and to prevent parasitic movements , a stop shoulder 39 in the vicinity of the upper end of the face 29 and a stop shoulder 41 in the vicinity of the lower end of each face 31 are provided for each block 32 ( fig3 ). in the example shown , the angle a ( fig3 ) is chosen to be 25 ° and the angle b ( fig1 ) is chosen to be 30 °. the rubber of the blocks 32 can have a shore hardness equal to 50 . the dimensions ( length and width ) of the rubber blocks 32 are chosen to be sufficient for the blocks not to undergo an excessive compression from the bolster and the sole - bars . in service , through the action of the load from the wagon , which load is transmitted to the pivot - bearing 19 of the central bolster 18 via the pivot 21 , the bolster bears on the sole - bars 1 by means of the elastic blocks 32 . the latter , under compression and shear stresses , allow a relative sliding between the bolster and each sole - bar and produce on the sole - bars , in relation to the bolster , a force whose component f ht ( fig4 ) applies the reference faces of both sole - bars , which faces are defined by the linings 26 , against the corresponding references faces , which faces are defined by the linings 28 , of the bolster 18 . under the lateral thrusts transmitted to the sole - bar by the axles , the sole - bar tends , when travelling , to have parasitic movements which would correspond to a lift - off of one of the lining pairs 26 , 28 , the other lining pair 26 , 28 , located on the other side of the bolster playing the role of a hinge . but this tendency for parasitic movement is combatted by the elastic blocks loaded by the bolster 18 and , more particularly by the component f ht of their compressive force f . this force is proportional to the load supported by the bolster 5 , such that the stability increases with the load supported by the bogie , since this is desirable , given that the parasitic forces are themselves proportional to the load . on the other hand , as fig5 shows , the elastic blocks 32 oppose only a small return moment countering the pivoting movements of each sole - bar 1 about an axis parallel to the longitudinal direction of the bolster . during such a movement , it is generally observed that one of the elastic blocks 32 undergoes an overload , but that the other , on the contrary , helps the movement as this movement corresponds for it to a spring back . under these conditions , the bogie according to the invention enables the two sole - bars to assume different orientations about an axis parallel to the longitudinal direction of the bolster , which enables the load to be distributed over the four wheels 6 of the bogie even when the railway track is highly deformed . all this is possible without the bolster 18 having to be inclined in relation to the body of the wagon . this is why the invention permits the use of a flat cylindrical pivot - bearing , as explained hereinabove . during violent buffing between wagons , one of the clearances x or x &# 39 ; may momentarily be cancelled out and a lateral face of the bolster may come into contact with the lateral face of the window 24 located opposite . this is not a drawback , these two faces being sized in a sufficiently extensive manner in order to undergo such a shock without damage . the invention is not limited to the example described and shown . the bolster could have in place of the surfaces 29 a single surface in the form of a cylinder sector whose generatrices would be parallel to the edge separating the surfaces 29 . this cylindrical surface would bear directly , by two of its generatrices , on the surfaces 31 of the sole - bar . it is also possible to produce the linkage between the bolster and each sole - bar by a traction connection rod or a pair of traction connection rods extending upwards and towards the outside of the bogie from the bolster to the sole - bar . this connection rod or these connection rods would transmit an oblique force whose horizontal component would push the sole - bar against the bearing linings 28 of the bolster .	1
with reference to fig1 the preferred embodiment of a folding ladder assembly 20 according to the presenting invention is depicted connected to a vehicle , preferably beneath the platform 22 , or bed , of a flatbed truck . the ladder assembly 20 includes a support frame 26 ( see also fig3 ) which is secured to the underside of the platform 22 , and a ladder portion 28 which is pivotably attached to the support frame 26 by a pair of pivots 30 , 32 . the ladder portion is pivotable about an axis extending through the pivots 30 , 32 between an upright , operable position ( fig1 ) and a horizontal , collapsed position ( see fig2 ). with reference to fig1 the support frame 26 includes a pair of side members 34 , 36 which are arranged parallel to one another and extend in a manner transverse to a longitudinal axis of the truck . an outer end of each of the side members 34 , 36 is situated beneath and immediately adjacent an edge 18 of the platform 22 of the truck . the side members 34 , 36 extend beneath the platform of the truck and are joined together at the inner ends of the members 34 , 36 by an end member 38 . projecting downwardly at the outer end of each of the side members 34 , 36 is a flange member 40 , 42 which pivotably carries the ladder portion 28 by the pivots 30 , 32 . a pair of guide members 44 , 46 , are located on the support frame between the end member 38 and the flange members 40 , 42 . the guide members project downwardly from the side members 34 , 36 ( see fig5 ) and are each formed of a pair of flat members 52 , 54 , 56 , 58 secured on either edge of one of the side members 34 , 36 . extending between the lower ends of the flat members of each guide member is a pin 48 , 50 which functions to guide and orient the ladder portion 28 as will be more fully explained below . preferably , all of the members of the support frame are formed of flat steel and may be welded together at suitable joints . the side members 34 , 36 and the end member 38 form a rigid frame unit which may be readily secured to the underside of a platform of a truck as by welding or bolting , for example by bolts 24 . the ladder portion 28 includes a generally u - shaped peripheral frame having side members 62 , 64 and parallel crosspieces 66 , 68 , 70 . the crosspieces interconnect the side members to provide a rigid frame suitable for use as a ladder when the ladder portion is in the operative position . in this way , crosspiece 66 provides a bottom step , crosspiece 68 provides an intermediate step and crosspiece 70 provides a top step . the side members and crosspieces may be formed out of flat steel suitably welded together , with the top crosspiece 70 formed of right angle steel in order to impart substantial strength to the frame . a pair of spacing members 72 , 74 are each attached at one end to one of the side members 62 , 64 at the top of the u - shaped frame . the spacing members each extend at right angles to the frame formed by the side members 62 , 64 and crosspieces 66 , 68 , 70 and are pivotably attached to the flange members 40 , 42 at the pivots 30 , 32 . the pivots 30 , 32 are aligned with one another along an axis which is parallel to a fore - to - aft longitudinal axis of the truck . the ladder portion further includes a pair of stabilizer arms 80 , 82 which are pivotably connected at their outer ends to the side members 62 , 64 by a pair of aligned pivots 88 , 90 . the stabilizer arms are located on the insides of the side members 62 , 64 . the pair of pivots 88 , 90 are aligned on an axis which is parallel to the axis of pivots 30 , 32 and parallel to the fore - to - aft longitudinal axis of the truck . the stabilizer arms 80 , 82 each have a generally elongate , curved shape with an outer end thereof being pivotably attached to the side members 62 , 64 , see fig1 and 3 . the stabilizer arms are situated generally beneath and coplanar relative to the side members 34 , 36 of the support frame . the stabilizer arms are received by the guide members 44 , 46 of the support frame with a bottom edge of each of the stabilizer arms 80 , 82 traveling on the pins 48 , 50 when the ladder portion is moving between the operable and collapsed positions . a stop member 92 , 94 including a length of steel that is longer than the spacing between the pairs of flat members 52 , 54 and 56 , 58 is provided at the inner end of each of the stabilizer arms 80 , 82 to engage the flat members and thereby retain the arm within its respective guide member , see fig5 . each stabilizer arm 80 , 82 is provided with an inner notch 100 , 102 and an outer notch 104 , 106 on lower edges of the stabilizer arms . the inner notches 100 , 102 are located in proximity to the inner ends of the stabilizer arms and receive the pins 48 , 50 when the ladder portion is in the operable position . the outer notches 104 , 106 are located in proximity to the outer ends of the stabilizer arms and receive the pins 48 , 50 when the ladder portion is in the collapsed position , see fig2 . the inner notches 100 , 102 have a generally u - shaped configuration , with the closed ends thereof being inclined outwardly , i . e ., toward the edge of the platform edge 38 so that the force resulting from the weight of the ladder , or a person climbing the ladder , urges the pins 48 , 50 toward the closed ends of the notches 100 , 102 . the outer notches 104 , 106 have a generally u - shaped configuration and are oriented so as to be essentially upright when the ladder assembly is collapsed . thus , the force resulting from the weight of the ladder portion in the collapsed position tends to urge the pins 48 , 50 toward the closed ends of the notches 104 , 106 . it will be appreciated that the inner and outer notches cooperate with the pins 48 , 50 to provide releasable connections between the guide members 44 , 46 of the support frame and the stabilizer arms 80 , 82 when the ladder portion is in the operable and collapsed positions . the stabilizer arms travel in the guide members while the ladder portion is moving between the operable and collapsed positions and are maintained within the guide members by the stop members 92 , 94 . the spacing between the pins 48 , 50 and the cross members 34 , 36 of the support frame is sufficient to enable the stabilizer arms to freely travel within the guide members without obstruction and to move up and down in a vertical manner to a limited extent . a pair of release levers 84 , 86 are provided for facilitating release of the stabilizer arms from the guide members when unfolding the ladder to an upright position . the release levers are pivotably connected intermediate their ends to the pivots 88 , 90 so as to be situated to the outside of the side members 62 , 64 , see fig1 and 3 . the unlatching levers 84 , 86 each include a generally u - shaped bar portion 110 , 112 secured at a midsection thereof to a respective flange portion 114 , 116 . the flange portions are pivotably connected to the side members 62 , 64 of the ladder portion at the pivots 88 , 90 . the u - shaped bar portions 110 , 112 each have an upper leg end 118 which is located above the stabilizer arms 80 , 82 and a lower leg 120 which is located beneath the stabilizer arms , see fig1 and 4 . when the ladder portion is in the collapsed position ( fig2 ), the stabilizer arms may be unlatched from the guide members by exerting an upward , lifting force on the frame of the ladder portion about the pivots 30 , 32 and pivoting the upper legs 118 of the unlatching levers toward the side members 62 , 64 . in this fashion , the lower legs 120 of the unlatching levers are swung into contact with the stabilizer arms 80 , 82 and raise these arms about the pivots 88 , 90 to disengage the outer notches 104 , 106 from the pins 48 , 50 , see also fig3 . thereafter , the ladder portion is allowed to swing downwardly about pivots 30 , 32 under its own weight , enabling the stabilizer arms to slide upon the pins 48 , 50 , until the pins 48 , 50 enter the inner notches 100 , 102 , see fig4 . in this regard , it should be noted that the ladder portion may be permitted to swing downwardly so that the inner notches 100 , 102 ride past the pins 48 , 50 and the stop members 92 , 94 contact the guide members 44 , 46 . in such a position the ladder portion will have traveled outwardly of its equilibrium position ( i . e ., the rest position in which it would have from the pivots 30 , 32 in the absence of the stabilizer arms ) and can then be allowed to swing slowly inwardly under its own weight until the inner notches 100 , 102 receive the pins 48 , 50 ( fig4 ). even when the pins are received in the inner notches 100 , 102 , the ladder is disposed forwardly of its equilibrium position . thus , the weight of the ladder portion will tend to maintain the pins against the closed ends of the inner notches . the ladder portion is maintained in the collapsed and operable positions by the forces resulting from the weight of the ladder portion acting about the pivots 30 , 32 . the forces act in directions which tend to urge the pins 48 , 50 into the notches of the stabilizer arms . the move the ladder portion into the collapsed position , the stabilizer arms are moved in an upward direction about the pivots 88 , 90 by lifting the stabilizer arms . the lifting disconnects the stabilizer arms from the guide members by disengaging the notches 100 , 102 from the pins 48 , 50 . while the stabilizer arms are lifted above the pins , the ladder portion is swung towards the guide members . as soon as the pins 48 , 50 become relocated between the notches 100 , 102 and the pivots 88 , 90 , the stabilizer arms may be permitted to travel on the pins 48 , 50 . as soon as the ladder has been moved sufficiently beyond the collapsed position , the ladder portion may be permitted to move downwardly , in the opposite direction to automatically engage the notches 104 , 106 in the pins 48 , 50 . the ladder portion will now be maintained in the collapsed position by reason of the force resulting from the weight of the ladder portion about the pivots 30 , 32 . it should be apparent that there has been provided in accordance with the present invention a folding ladder for attachment to the underside of a flatbed truck which is readily movable between a first useful position and a second storage position . moreover , it will be apparent to those skilled in the art that numerous modifications , variations , substitutions and equivalents may be made for the features of the invention without departing from the spirit and scope of the invention . accordingly , it is expressly intended that all such modifications , variations , substitutions and equivalents which fall within the spirit and scope of the invention are defined in the appended claims being embraced thereby .	1
the present invention shall be further explained by the following , on the basis of the examples , which make reference to the accompanying figures , the invention not being limited by the examples or the figures . in the figures : fig1 shows the relationship between the plasma concentrations of sflt - 1 and plgf . fig2 shows sflt - 1 - concentrations relating to the plgf initial status , and plgf concentrations relating to the initial concentration of sflt - 1 . fig3 shows event - rates , calculated according to kaplan - meier , wherein the cumulative incidence of death , non - fatal myocardial infarction , stroke , and resuscitation is related to the initial concentration of plgf in plasma ( n = 230 ). the patients were divided into groups according to the median plgf concentrations of plgf ( 17 . 7 ng / l ). fig4 shows event - rates , calculated according to kaplan - meier , wherein the cumulative incidence of death , non - fatal myocardial infarction , stroke , and resuscitation is related to the initial concentrations of sflt - 1 in plasma ( n = 230 ). the patients were divided into groups according to the median sflt - 1 concentrations ( 56 . 5 ng / l ). fig5 shows the prognostic relevance of plgf for the incidence of death , non - fatal myocardial infarction , stroke , and resuscitation related to the sflt - 1 - concentrations . the patients were divided into tertiles according to the plgf - concentrations (& lt ; 15 . 6 ; 15 . 6 - 23 . 3 ; & gt ; 23 . 3 ng / l ) and to the sflt - 1 concentrations (& lt ; 37 . 4 ; 37 . 4 - 91 . 4 ; & gt ; 91 . 4 ng / l ) ( n = 230 ), respectively . fig6 shows event - rates , calculated according to kaplan - meier , wherein the cumulative incidence of death , non - fatal myocardial infarction , stroke , and resuscitation is related to the initial concentrations of flt - 1 and plgf ( n = 230 ), respectively . the patients were divided into groups according to the median concentrations of sflt - 1 and plgf . fig7 shows changes in the concentrations of plgf and sflt - 1 , respectively , related to a randomised treatment during the further observation . the samples were collected at the beginning ( initial value ), after 30 days , and after 12 months ( n ≧ 80 ). the patients who were examined were those who were already involved in the optimaal study ( optimal trial in myocardial infarction with angiotensin ii antagonist losartan ) and who had experienced a myocardial infarction . the design and the most important results of the optimaal study were already described earlier ( 11 ). the study comprised a group of 230 patients diagnosed with myocardial infarction and a dysfunction of the left ventricle and / or a heart failure during the acute phase of the myocardial infarction . the patients were randomly divided into groups and adjusted to a dosage of losartan ( 1 × 50 mg / day ) or captopril ( 3 × 50 mg / day ), in accordance with compatibility . there were no substantial differences between both groups as treated regarding the initial characteristics . blood was drawn from the patients in the morning in a fasted state , wherein the blood samples were collected in pyrogen - free vacuum tubes with edta . the tubes were immediately immersed in ice - water , centrifuged within 15 minutes ( 1 , 000 g , 4 ° c ., 15 minutes ), and the plasma was stored as a multitude of aliquots at − 80 ° c . until analysis . the determination of the markers were performed blinded , i . e ., without knowledge of the patients &# 39 ; histories and treatment as assigned , in the central laboratory of the university of frankfurt . plgf , vegf , sflt - 1 , and scd40 ligand ( scd40l ) were measured using the elisa technique ( all reagents from r & amp ; d systems , wiesbaden ) ( 7 , 12 , 13 ). highly sensitive c - reactive protein ( hscrp ) was measured using the behring bn ii nephelometer ( dade - behring , deerfield , ill .) ( 14 ). in connection with the study , an end point was determined which was composed of several parameters . the end point included overall mortality independent from the cause of death , resuscitation after cardiac arrest , re - occurring of non - fatal myocardial infarction , and stroke . a detailed description of the design and organization of the optimaal study has already been published earlier ( 11 , 15 ). a logistic regression model was used in order to determine the relative risk for vascular events ( 16 ). the separation into groups took place on the basis of the median concentration of each biomarker . a logistic regression model was used in order to determine the relative risk of death , non - fatal myocardial infarction , stroke and the need for resuscitation ( 16 ). the effects of the initial characteristics and biochemical markers on each of the relationships between plgf concentrations and sflt - 1 concentrations , respectively , and vascular events , as examined , were analyzed through the stepwise functioning logistic regression model . all results that were obtained for continuous variables are given as mean value ± standard deviation . comparisons between the groups were analyzed by the t - test ( two - sided ). a comparison of the categorical variables was made by the pearson χ 2 - test . values of p & lt ; 0 . 05 were regarded as statistically significant . all analyses were performed using the software spss 11 . 5 ( spss inc ., chicago , ill .). statistical parameters are : n = 230 , lacking 10 ; median ( plgf ) = 17 . 7250 , median ( sflt - 1 ) = 56 . 5000 ; percentile = 33 . 33333333 , 15 . 5700 , 37 . 4300 , 66 . 66666667 , 23 . 2700 , 91 . 4100 . the analysis according to kaplan - meyer represents a statistic standard method for the calculation of differences in the rate of death or the rate of an event - free survival . the initial concentrations of sflt - 1 in plasma showed a mean value of 183 . 2 ± 465 . 6 ng / l ( range of 5 . 0 to 2503 . 4 ), and the initial concentrations of plgf in plasma were 24 . 0 ± 20 . 0 ng / l ( range of 5 . 0 to 144 . 9 ). when the sflt - 1 - plasma concentrations were correlated to traditional biomarkers , no correlation with hscrp concentrations ( rank correlation coefficient according to spearman r = 0 . 12 ; p = 0 . 08 ) was found , whereas the bi - variable correlation analysis showed a significant inverse correlation between sflt - 1 and scd40l , although the correlation coefficients of r = 0 . 17 ( p = 0 . 018 ) were low . in addition , no significant correlation between vegf ( r = 0 . 03 ; p = 0 . 66 ) or plgf ( r = 0 . 05 ; p = 0 . 44 ) and sflt - 1 plasma concentrations ( fig1 ), respectively , was found , although the sflt - 1 - concentrations were significantly higher in patients with elevated plgf - concentrations ( fig2 ). relationship between vascular events and the plasma concentrations of plgf and sflt - 1 the patients were divided according to their median concentrations of biomarkers . the initial characteristics differed in patients with high plgf concentrations and patients with low plgf concentrations only with respect to the sflt - 1 - concentrations ( table 1 ). in patients with elevated plgf concentrations , the event - rates for the combined end points of mortality , non - fatal . myocardial infarction , stroke , and reuscitation resuscitation were significantly higher ( 38 . 8 % vs . 18 . 3 %; p = 0 . 001 ) ( fig3 ) compared to those with low plgf concentrations . with reference to the most important vascular events ( death and non - fatal myocardial infarction ), the differences persisted with an event rate of 30 . 4 % in patients with elevated plgf concentrations , compared to 15 . 7 % in patients with low plgf - concentrations ( odds ratio 2 . 36 [ 95 % ci 1 . 24 - 4 . 48 ]; p = 0 . 012 ). the initial characteristics differed in patients with high sflt - 1 concentrations and patients with low sflt - 1 - concentrations in view of the concentrations of bnp , scd40l , and plgf , and the incidence of new q - waves in the ecg and the duration of hospitalization ( table 1 ). in patients with elevated sflt - 1 concentrations the event - rates for the combined end points of mortality , non - fatal myocardial infarction , stroke , and resuscitation tended to be lower than in patients with low sflt - 1 concentrations ( 22 . 6 % vs . 33 . 9 %; p = 0 . 08 ) ( fig4 ). a non - significant difference was observed for the most important vascular events ( death and non - fatal myocardial infarction ) in 19 . 1 % of the patients with elevated sflt - 1 - concentrations compared to 27 . 0 % in patients with low sflt - 1 - concentrations ( odds ratio 0 . 64 [ 95 % ci 0 . 34 - 1 . 19 ]; p = 0 . 21 ). patients with elevated plgf concentrations also showed elevated concentrations of sflt - 1 ( fig2 ). nevertheless , the sflt - 1 concentrations of both groups overlapped in a substantial range indicating that , surprisingly , the compensatory increase of the sflt - 1 concentrations in patients with elevated plgf concentrations is inconsistent and can not be observed in all patients . patients with plgf concentrations in the two upper tertiles who , nevertheless , did not show an increase in the sflt - 1 concentrations ( lower tertile ), showed adverse after - effects compared to patients who exhibited sflt concentrations in the uppermost tertile , but similarly elevated plgf concentrations ( fig5 ). when the plgf concentrations were only slightly elevated ( second tertile ), even a moderate increase in the sflt - 1 concentrations appeared to protect the patients from adverse after - effects . in contrast , in patients with strongly elevated concentrations of plgf ( third tertile ), only those patients with sflt - 1 concentrations in the uppermost tertile showed a significantly lower event - rate . when the patients were divided into two groups on the basis of their plgf and sflt - 1 concentrations , respectively , the prognosis of the patients with high sflt - 1 concentrations did not differ significantly from those patients with either high or low plgf concentrations ( fig6 ). accordingly , the ratio of plgf and sflt - 1 is a powerful independent parameter for a prediction of vascular events ( odds ratio 4 . 00 [ 95 % ci 2 . 14 - 7 . 23 ]; p & lt ; 0 . 001 ), which is significantly superior to the exclusive determination of one of the parameters . the event - rates in patients with low plgf - concentrations were 14 . 0 % and were independent from the sflt - 1 - concentrations ( p = 0 . 95 ). in contrast , the event - rates in patients with high plgf - concentrations were 55 . 8 %, if the sflt - 1 - concentrations were low , but 24 . 3 %, if the sflt - 1 - concentrations were elevated ( p = 0 . 002 ). ( a ) a ratio of [ plgf = high : sflt - 1 = low ] indicates a high risk for the patient for an adverse event such as death , non - fatal myocardial infarction , and stroke . ( b ) in contrast , if the plgf value is low , the risk for an adverse event is markedly lowered , regardless of whether or not the sflt - 1 - value is high or low . ( c ) at a ratio of [ plgf = low : sflt - 1 = low ], the risk for an adverse event is particularly low . ( d ) if the sflt - 1 - value is high , the risk for an adverse event is markedly lowered , regardless of whether or not the plgf - value is high or low . in order to further examine the potential prognostic independence of individual biomarkers , a stepwise multivariable logistic regression analysis was performed , comprising plgf and sflt - 1 , as well as further biochemical markers , such as bnp , a marker of neurohumoral activation , hscrp , a classical acute phase protein , and scd40l , a marker of thromboinflammatory activation . in addition , basic characteristics were taken into account that showed a significant prognostic meaning in an univariable model . for the combined end points after a four - year observation period , only two established risk factors , namely advanced age and diabetes , were found as independent prognostic parameters , after the biochemical markers were included in the model ( table 2 ). the markers bnp ( p = 0 . 043 ), scd40l ( p = 0 . 007 ), plgf ( p = 0 . 001 ), and sflt - 1 ( p = 0 . 006 ) remained important and independent prognostic parameters for the further disease progression , whereas hscrp lost somewhat of importance after plgf was introduced into the model ( p = 0 . 77 after introduction of plgf ). in agreement with the results of the study , which were derived from the overall group of the patients , no difference in clinical progression was found between the captopril and the losartan treatment groups . in addition , neither in patients with high nor in patients with low plgf concentrations was a reduction of the events observed ( plgf low : 19 % event - rate in the captopril group vs . 17 . 5 % in the losartan group ; p = 1 . 00 ; plgf high : 41 . 1 % vs . 35 . 6 %; p = 0 . 57 ). similar results were obtained for the sflt - 1 - concentrations : sflt - 1 high : 22 . 2 % in the captopril group vs . 23 . 9 % in the losartan group ( p = 1 . 00 ); sflt - 1 low : 36 . 7 % in the captopril - group vs . 30 . 9 % in the group vs . 30 . 9 % in the losartan - group ( p = 0 . 56 ). it was furthermore found that in patients of whom serial samples were available ( day 0 , 30 days , and 1 year ; n ≧ 80 for each group and each time point ) both the plgf and the sflt - 1 concentrations continuously decreased during the observation period , no differences occurring between the treatment groups ( fig7 ). the results of the study show that elevated blood levels of plgf are connected to vascular events in patients after a myocardial infarction . in agreement with a new study on patients with acute coronary heart diseases ( 7 ), the prognostic importance of the concentrations of plgf in plasma was independent from other biomarkers representing distinct pathophysiological processes . elevated plgf concentrations provided a prognostic value which had more significance than information derived from hscrp plasma concentrations . through multivariate regression analysis , several other biochemical markers , including b - type natriuretic peptide , a marker of neurohumoral activation , scd40l , a marker of thrombo - inflammatory activation , and plgf , a marker of vascular inflammation , were identified as independent prognostic parameters for the further progression of the disease during the following four years . nevertheless , the new and most important finding of the study is that the prognostic importance of plgf is modulated by sflt - 1 . these findings show that the balance between plgf and its soluble receptor sflt - 1 as the only known endogenous regulator is an essential determinant in view of the further disease progression in patients with acute myocardial infarction . both the reason of the elevated concentrations of sflt - 1 as well as the signals which up - regulate the flt - 1 expression in patients which have experienced an acute myocardial infarction currently are not known . hypoxia is a potent stimulus for the up - regulation of the flt - 1 - expression ( 6 , 19 ). it is possible that a large portion of sflt - 1 is released from the inflammatory cells by so - called shedding ( 3 , 9 , 20 ). independent of the mechanisms that are involved in the increase of the concentrations of sflt - 1 in plasma , the results of the present study emphasize the key role of the balance between pro - and anti - inflammatory mediators for the risk stratification in the context of an acute coronary heart disease ( 21 ). in particular , these studies give rise to the hope that new anti - inflammatory strategies can be developed in order to counteract the progression of a manifested atherosclerosis . the infusion of sflt - 1 with the purpose to reduce the concentrations of circulating active plgf in patients with unstable or rapidly progressing coronary heart disease could be particularly effective in those patients who have elevated plgf concentrations and low concentrations of its inhibitor sflt - 1 . the results of the present study show that elevated plasma concentrations of plgf , a marker of vascular inflammation , in patients after a myocardial infarction is correlated with an elevated risk for subsequent vascular events . nevertheless , the informational value with regard to prognosis depends on the concentration of sflt - 1 , which supports the hypothesis that sflt - 1 regulates the activity of plgf through binding and inactivation . these findings could provide the basis of a new anti - inflammatory therapeutic approach using sflt - 1 in order to reduce circulating plgf in patients who have an elevated risk for an adverse vascular event . braunwald e . unstable angina : an etiologic approach to management . circulation . 1998 ; 98 : 2219 - 22 . libby p , ridker p m , maseri a . inflammation and atherosclerosis . circulation . 2002 ; 105 : 1135 - 43 . luttun a , tjwa m , moons l , wu y , angelillo - scherrer a , liao f , nagy j a , hooper a , priller j , de klerck b , compernolle v , daci e , bohlen p , dewerchin m , herbert j m , fava r , matthys p , carmeliet g , collen d , dvorak h f , hicklin d j , carmeliet p . revascularization of ischemic tissues by plgf treatment , and inhibition of tumor angiogenesis , arthritis and atherosclerosis by anti - flt1 . nat med . 2002 ; 8 : 831 - 40 . maglione d , guerriero v , viglietto g , delli - bovi p , persico m g . isolation of a human placenta cdna coding for a protein related to the vascular permeability factor . proc natl acad sci usa . 1991 ; 88 : 9267 - 71 . autiero m , luttun a , tjwa m , carmeliet p . placental growth factor and its receptor , vascular endothelial growth factor receptor - 1 : novel targets for stimulation of ischemic tissue revascularization and inhibition of angiogenic and inflammatory disorders . j thromb haemost . 2003 ; 1 : 1356 - 70 . luttun a , tjwa m , carmeliet p . placental growth factor ( plgf ) and its receptor flt - 1 ( vegfr - 1 ): novel therapeutic targets for angiogenic disorders . ann n y acad sci . 2002 ; 979 : 80 - 93 . heeschen c , dimmeler s , fichtlscherer s , hamm c w , berger j , simoons m l , zeiher a m . prognostic value of placental growth factor in patients with acute chest pain . jama . 2004 ; 291 : 435 - 41 . khaliq a , dunk c , jiang j , shams m , li x f , acevedo c , weich h , whittle m , ahmed a . hypoxia down - regulates placenta growth factor , whereas fetal growth restriction up - regulates placenta growth factor expression : molecular evidence for “ placental hyperoxia ” in intrauterine growth restriction . lab invest . 1999 ; 79 : 151 - 70 . rafii s , avecilla s , shmelkov s , shido k , tejada r , moore m a , heissig b , hattori k . angiogenic factors reconstitute hematopoiesis by recruiting stem cells from bone marrow microenvironment . ann n y acad sci . 2003 ; 996 : 49 - 60 . chung n a , makin a j , lip g y . measurement of the soluble angiopoietin receptor tie - 2 in patients with coronary artery disease : development and application of an immunoassay . eur j clin invest . 2003 ; 33 : 529 - 35 . dickstein k , kjekshus j . effects of losartan and captopril on mortality and morbidity in high - risk patients after acute myocardial infarction : the optimaal randomised randomized trial . optimal trial in myocardial infarction with angiotensin ii antagonist losartan . lancet . 2002 ; 360 : 752 - 760 . heeschen c , dimmeler s , hamm c w , van den brand m j , boersma e , zeiher a m , simoons m l . soluble cd40 ligand in acute coronary syndromes . n engl j med . 2003 ; 348 : 1104 - 11 . heeschen c , dimmeler s , hamm c w , boersma e , zeiher a m , simoons m l . prognostic significance of angiogenic growth factor serum levels in patients with acute coronary syndromes . circulation . 2003 ; 107 : 524 - 530 . heeschen c , hamm c w , bruemmer j , simoons m l . predictive value of c - reactive protein and troponin t in patients with unstable angina : a comparative analysis . capture investigators . chimeric c7e3 antiplatelet therapy in unstable angina refractory to standard treatment trial . j am coll cardiol . 2000 ; 35 : 1535 - 42 . dickstein k , kjekshus j . comparison of the effects of losartan and captopril on mortality in patients after acute myocardial infarction : the optimaal trial design . optimal therapy in myocardial infarction with the angiotensin ii antagonist losartan . am j cardiol . 1999 ; 83 : 477 - 81 . cox d r . regression models and life - tables . j r stat soc [ b ]. 1972 ; 34 : 187 - 220 . maynard s e , jiang - yong min j - y , merchan j , lim k h , li j , mondal s , libermann t a , morgan j p , sellke f w , stillman i e , epstein f h , sukhatme v p , karumanchi s a . excess placental soluble fms - like tyrosine kinase 1 ( sflt1 ) may contribute to endothelial dysfunction , hypertension , and proteinuria in preeclampsia . j . clin . invest . 2003 ; 1 11 : 649 - 658 . levine r j , maynard s e , qian c , lim k h , england l j , lu k f , schisterman e f , thadhani r , sachs b p , epstein f h , sibai b m , sukhatme v p , karumanchi s a . circulating angiogenic factors and the risk of peeelampsioa preeclampsioa . n engl j med . 2004 ; 350 : 672 - 683 . takeda n , maemura k , imai y , harada t , kawanami d , nojiri t , manabe i , nagai r . endothelial pas domain protein 1 gene promotes angiogenesis through the transactivation of both vascular endothelial growth factor and its receptor , flt - 1 . circ res . 2004 ; 95 : 146 - 53 . selvaraj s k , giri r k , perelman n , johnson c , malik p , kalra v k . mechanism of monocyte activation and expression of proinflammatory cytochemokines by placenta growth factor . blood . 2003 ; 102 : 1515 - 24 . heeschen c , dimmeler s , hamm c w , fichtlscherer s , boersma e , simoons m l , zeiher a m . serum level of the antiinflammatory cytokine interleukin - 10 is an important prognostic determinant in patients with acute coronary syndromes . circulation . 2003 ; 107 : 2109 - 14 . ridker p m . clinical application of c - reactive protein for cardiovascular disease detection and prevention . circulation 2003 ; 107 : 363 - 369 . koenig w , lowel h , baumert j , meisinger c . c - reactive protein modulates risk prediction based on the framingham score : implications for future risk assessment : results from a large cohort study in southern germany . circulation 2004 ; 109 : 1349 - 53 . danesh j , wheeler j g , hirschfield g m , et al . c - reactive protein and other circulating markers of inflammation in the prediction of coronary heart disease . n engl j med 2004 ; 350 : 1387 - 97 . morrow d a , rifai n , antman e m , et al . c - reactive protein is a potent predictor of mortality independently of and in combination with troponin t in acute coronary syndromes : a timi 11a substudy . thrombolysis in myocardial infarction . j am coll cardiol 1998 ; 31 : 1460 - 5 . lindahl b , toss h , siegbahn a , venge p , wallentin l . markers of myocardial damage and inflammation in relation to long - term mortality in unstable coronary artery disease . frisc study group . fragmin during instability in coronary artery disease . n engl j med 2000 ; 343 : 1139 - 47 . james s k , lindahl b , siegbahn a , et al . n - terminal pro - brain natriuretic peptide and other risk markers for the separate prediction of mortality and subsequent myocardial infarction in patients with unstable coronary artery disease : a global utilization of strategies to open occluded arteries ( gusto )- iv substudy . circulation 2003 ; 108 : 275 - 81 .	6
the novel compounds of this invention are the levorotatory and dextrorotatory enantiomers of the compound having the following structural formula : ## str1 ## or pharmaceutically acceptable salts thereof , wherein x . sub . α represents bromo or chloro ; r represents hydrogen , lower alkyl , especially c 1 - 3 alkyl , or fluoro ; r 1 represents methyl or cyclopropylmethyl , when x . sub . α is bromo ; and r 1 represents cyclopropylmethyl when x . sub . α is chloro . a preferred embodiment of the novel compounds is that wherein r is hydrogen . an even more preferred embodiment of the novel compounds is that wherein r is hydrogen , and x . sub . α is bromo . the pharmaceutically acceptable salts of the novel compounds of this invention are acid addition salts formed from a novel compound and an organic or inorganic acid recognized by the art as providing a pharmaceutically acceptable acid addition salt , such as hydrochloride , hydrobromide , dihydrogen phosphate , sulfate , pamoate , citrate , napsylate , pyruvate , isethionate , maleate , fumarate , or the like . the salts are prepared by dissolving approximately equimolecular amounts of the free base compound and the desired acid in a solvent followed by crystallization of the salt product . the novel process for the preparation of the compounds of this invention comprises dehydration of an r - substituted 1 - r 1 - 4 -( 3 - x . sub . α - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine with a dehydrating agent such as trifluoroacetic acid / trifluoroacetic anhydride at reflux temperature , as described in j . med . chem ., 8 , 829 ( 1965 ), to form a racemic mixture of the novel compounds of this invention . the racemic mixture is then resolved by formation of diastereomeric salts with it and an optically active acid such as di - p - toluoyl - d - tartaric acid in a solvent such as ethanol followed by separation of the diastereomeric pair of salts such as by fractional crystallization followed by separate treatment of each salt with an alkali such as an alkali metal hydroxide , bicarbonate or carbonate , especially sodium bicarbonate or carbonate to liberate the free (+)- and (-)- enantiomers . the levorotatory isomer is further resolved via recrystallization from a solvent such as acetonitrile . the optically enriched dextrorotatory compound obtained as described above can be racemized by heating a solution of it in an inert solvent until a sample fails to show optical activity . it is convenient to reflux a toluene solution for about 10 - 50 hours . in this manner , additional quantities of the racemic compound can be obtained from which additional levorotatory material can be isolated by the above described resolution . the compounds useful in the novel method of treatment and novel pharmaceutical formulations of this invention have structural formula : ## str2 ## or a pharmaceutically acceptable salt thereof , wherein r is as previously defined ; r 1 is methyl or cyclopropylmethyl ; and x is halo , such as chloro , bromo , or iodo . it is preferred that r be hydrogen and x be bromo or iodo . the pharmaceutically acceptable salts contemplated for this purpose are the same salts discussed herein in connection with the group of novel compounds . as pointed out by ebnother et al ., helv . chim . acta , 48 , 1237 - 1249 ( 1965 ) these compounds exist as levorotatory and dextrorotatory optical enantiomers . all of the antipsychotic activity resides in the levorotatory enantiomers , but the racemic mixtures of the levo - and dextrorotatory enantiomers , the mixture from which the levorotatory enantiomers are obtained are still potent antipsychotic agents and are useful in the novel method of treatment and novel pharmaceutical formulations of this invention . thus there is contemplated for use in the novel method of treatment and pharmaceutical formulations : ( 1 ) racemic mixtures of levo - and dextrorotatory enantiomers , herein after referred to as &# 34 ; racemic compounds &# 34 ;; and ( 2 ) any mixtures optically enriched in the levoratory sense or pure levoratotary enantiomers , hereinafter referred to as &# 34 ; levorotatory compounds &# 34 ;. the novel method of treatment of this invention comprises the administration of an antipsychotically effective amount of one of the racemic or levorotatory compounds or a pharmaceutically acceptable salt thereof to a psychotic patient . the route of administration can be oral , rectal , intravenous , intramuscular , or subcutaneous . doses of 0 . 1 to 20 mg ./ kg ./ day and preferably of 0 . 5 to 10 mg ./ kg ./ day of active ingredient are adequate , and if preferred , it can be administered in divided doses given two to four times daily . it is to be noted that the precise unit dosage form and dosage level depend upon the case history of the individual being treated and , consequently , are left to the discretion of the therapist . pharmaceutical compositions comprising a compound useful in the novel method of treatment as active ingredient may be in any art recognized form suitable for oral use , such as tablets , troches , lozenges , aqueous or oil suspensions , dispersible powders , or granules , emulsions , hard or soft capsules , syrups , or elixirs . for intravenous and intramuscular and subcutaneous use the pharmaceutical compositions may be in any art recognized form of a sterile injectable preparation such as a sterile aqueous or oleaginous solution or suspension . the amount of active ingredient incorporated in a unit dosage of the above described pharmaceutical compositions may be from 1 to 400 mg ., and preferably from 5 to 250 mg . to an ice cooled solution of 2 . 10 g . ( 0 . 0074 mol ) of 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - one in 35 ml . of dry tetrahydrofuran is added dropwise 36 ml . of 0 . 41 m 1 - methyl - 4 - piperidylmagnesium chloride . the solution is stirred for one hour and then the tetrahydrofuran is removed by evaporation on a rotary evaporator . the red , oily residue that remains is dissolved in benzene and water is added dropwise until a clear benzene supernatant and a gelatinous aqueous phase is obtained . the benzene phase is decanted and the gelatinous aqueous phase is extracted with four 50 ml . portions of hot benzene . the combined benzene phases are washed with water , dried over magnesium sulfate , filtered , and benzene is removed on a rotary evaporator . the residue is triturated with cold acetonitrile and collected by filtration to give 0 . 86 g . ( 40 %) of 1 - methyl - 4 -( 3 - bromo - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine . a solution of 0 . 86 g . ( 0 . 003 mol ) of 1 - methyl - 4 -( 3 - bromo - 5 - hydroxy - 5h - dibenzo [ a , d ] cyclohepten - 5 - yl ) piperidine in 30 ml . of trifluoroacetic acid and 15 ml . of trifluoroacetic anhydride is stirred and refluxed for 16 hours . the solvents are removed by evaporation on a rotary evaporator . the residue is dissolved in chloroform , and this chloroform solution is washed with sodium hydroxide solution , water , dried over magnesium sulfate , and filtered . evaporation of the chloroform from the filtrate gives 0 . 88 g . of a yellow oil . this oil is dissolved in a minimum amount of absolute ethanol , treated with ethanolic hcl , and is cooled . the white crystalline material that precipitates is collected by filtration and is recrystallized from acetonitrile to give 0 . 67 g . of (±)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine hydrochloride . to a solution of 12 . 42 g . ( 0 . 0339 mol ) of (±)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene piperidine in 250 ml of hot ethanol is added 13 . 11 g . ( 0 . 0339 mol ) of di - p - toluoyl - d - tartaric acid dissolved in 50 ml of warm ethanol . the solution is stirred and allowed to cool to room temperature . the salt that crystallizes is removed by filtration and is recrystallized from ethanol six times to afford 2 . 62 g . of material having a constant rotation : [ α ] 589 25 - 111 °, [ α ] 578 25 - 116 °, [ α ] 546 25 - 137 °, [ α ] 436 25 - 306 ° ( c , 0 . 531 , pyridine ). this salt is converted to the free base with saturated sodium bicarbonate solution and extracting it into ether . the ether phase is washed with water , dried over magnesium sulfate , filtered , and the ether is removed . recrystallization from acetonitrile gives (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine as tlc homogeneous ( fl . alumina / chcl 3 ), sparkling white prisms , m . p . 189 °- 190 °; [ α ] 589 25 - 100 °, [ α ] 578 25 - 106 °, [ α ] 546 25 - 127 °, [ α ] 436 25 - 304 ° ( c , 0 . 731 , chcl 3 ). anal . calcd . for c 21 h 20 brn : c , 68 . 86 ; h , 5 . 50 ; br , 21 , 82 ; n , 3 . 82 . found : c , 68 . 97 ; h , 5 . 58 ; br , 21 . 62 ; n , 3 . 39 . starting with 5 . 76 g ( 0 . 0157 mol ) of (±)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine toluoyl - 1 - tartaric acid monohydrate in 25 ml . of ethanol and using the procedure as described above , 1 . 60 g of crystalline salt is obtained [ α ] 589 25 + 110 °; [ α ] 578 25 + 116 °; [ α ] 546 25 + 137 °; [ α ] 436 25 + 302 ° ( c , 0 . 403 , pyridine ). conversion to the free base and crystallization from acetonitrile gives (+)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine , m . p . 189 °- 191 ° c . ; [ α ] 589 25 + 100 °, [ α ] 578 25 + 107 , [ α ] 546 25 + 127 , [ α ] 436 25 + 307 ° ( c , 0 . 651 , chcl 3 ). employing the procedures substantially as described in examples 1 and 2 but substituting for the 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - one and / or the 1 - methyl - 4 - piperidylmagnesium chloride used in example 1 , step a similar relative amounts of the 3 - x . sub . α - 7 - r - 5h - dibenzo [ a , d ]- cyclohepten - 5 - ones , and 1 - r 1 - 4 - piperidylmagnesium chloride , described in table i , there are produced the (-)- and (+)- enantiomers of 1 - r 1 - 4 -( 3 - x . sub . α - 7 - r - 5h - dibenzo [ a , d ]- cyclohepten - 5 - ylidene ) piperidine , also described in table i in accordance with the following reaction scheme : table i__________________________________________________________________________ ## str3 ## r r . sup . 1 x . sub . α__________________________________________________________________________ f ch . sub . 3 br ch . sub . 3 ch . sub . 3 br h ## str4 ## br f ## str5 ## br ch . sub . 3 ## str6 ## br h ## str7 ## cl f ch . sub . 3 cl ch . sub . 3 ch . sub . 3 cl f ## str8 ## cl ch . sub . 3 ## str9 ## cl__________________________________________________________________________ a typical tablet containing 100 mg . of (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine per tablet is prepared by mixing together with the active ingredient calcium phosphate , lactose and starch in the amounts shown in the table below . after these ingredients are thoroughly mixed , the appropriate amount of magnesium stearate is added and the dry mixture is then compressed into tablets . ______________________________________tablet formulaingredient mg . per tablet______________________________________ (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ]- cyclohepten - 5 - ylidene ) piperidine 100 mg . calcium phosphate 52 mg . lactose 60 mg . starch 10 mg . magnesium stearate 1 mg . ______________________________________ similarly tablets containing the other racemic or levorotatory compounds active in the novel method of treatment of this invention are prepared by substituting for the 100 mg ( 2 . 7 × 10 - 4 mole ) of (-)- 1 - methyl - 4 -( 3 - bromo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine a comparable molecular amount of any of the racemic or levorotatory compounds with structural formula : ## str10 ## or a pharmaceutically acceptable salt thereof wherein x , r and r 1 are as previously defined . mice ( cf 1 females weighing about 20 g .) were injected i . p . with the test compounds two hours and five minutes prior to a subcutaneous administration of (+)- amphetamine , 10 mg ./ kg . forty - five minutes after giving (+)- amphetamine , the mice were observed for the presence or absence of excitement and locomotor stimulation elicited by (+)- amphetamine . at a dose of 30 mg ./ kg . of (-)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - yldiene )- piperidine ( l - 634 , 340 ) or (-)- 1 - methyl - 4 -( 3 - bromo - 5 - h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine ( l - 636 , 524 ), 80 % of the mice failed to exhibit the typical signs normally elicited by (+)- amphetamine . a reference neuroleptic , chlorpromazine , also antagonized the action of (+)- amphetamine ( table 1 ). squirrel monkeys ( saimiri sciureus ) of both sexes were trained to press a lever in order to avoid an electric shock . the animals were trained and tested while restrained in a chair in an isolation chamber . the electric shock ( 600 v a . c ., 2 ma , 1 second ) was given via leads placed on the seat of the chair and a ring around the animal &# 39 ; s neck . background noise was supplied with a grason stadler noise generator . a modified sidman avoidance schedule ( rs - 36 , ss - 36 ) was used , programming 36 seconds of shock - free time after each lever press ( avoidance response ). a lever press made during a shock ( escape response ) immediately terminated the shock , resetting the shock - shock interval timer to 36 seconds . the avoidance schedule also contained an &# 34 ; alarm &# 34 ; system to shut off the schedule for 30 minutes , if an animal received 10 consecutive shocks without a lever press . this prevented the animals from receiving an excessive number of shocks . following the 30 - minute alarm period , the schedule resumed again . an animal was assigned the maximum number of shocks ( 50 / 30 minutes ), if the alarm system was activated during a trial . the test compounds were administered by gavage at cumulative doses of 0 . 33 , 1 and 3 mg ./ kg . given at 0 , 90 and 180 minutes of the test session . (-)- 1 - methyl - 4 -( 3 - iodo - 5h - dibenzo [ a , d ] cyclohepten - 5 - ylidene ) piperidine ( l - 634 , 340 ) caused the monkeys to take a large number of shocks , i . e . avoidance responding was markedly depressed ( table 2 ). chlorpromazine , a reference standard , also exhibits a similar action in this test procedure . table 1______________________________________antagonism of (+)- amphetamine - inducedexcitement and hyperactivity . treatment . sup . a # protected . sup . b ( mg ./ kg . i . p .) # tested______________________________________l - 634 , 340 - oop - 02 ( 6 ) 2 / 5 &# 34 ; ( 30 ) 4 / 5 &# 34 ; ( 150 ) 5 / 5l - 636 , 524 - ooy - 01 ( 6 ) 0 / 5 &# 34 ; ( 30 ) 4 / 5 &# 34 ; ( 150 ) 5 / 5chlorpromazine ( 6 ) 5 / 5 &# 34 ; ( 30 ) 5 / 5 &# 34 ; ( 150 ) ______________________________________ . sup . a two hours and five minutes before (+) amphetamine ( 10 mg ./ kg . s . c .) . sup . b mice were observed 45 minutes after (+) amphetamine . table 2__________________________________________________________________________antiavoidance activity in squirrel monkey . shocks received / 30 minutes time ( minutes ) treatment 0 - 30 30 - 60 60 - 90 90 - 120 120 - 150 150 - 180 180 - 210 210 - 240 240 - 270__________________________________________________________________________mg ./ kg . p . o . : 0 . 33 1 . 0 3 . 0control . sup . a 0 0 0 1 0 0 0 0 0l - 634 , 340 . sup . b 0 1 10 20 38 50 50 50 50control . sup . a 0 1 3 3 3 1 1 2 3chlorpromazine . sup . b 0 0 0 0 2 2 5 50 50__________________________________________________________________________ . sup . a average of two control sessions ( one before and one after drug testing ) for three monkeys . . sup . b average for the same three monkeys for one session .	2
turning to the drawings , wherein like reference numerals refer to like elements , the invention is illustrated as being implemented in a suitable environment . the following description is based on embodiments of the invention and should not be taken as limiting the invention with regard to alternative embodiments that are not explicitly described herein . embodiments of the invention provide techniques for identifying and enhancing ( e . g ., visually enhancing ) one or more multimedia feeds ( e . g ., video feeds ) from a plurality of such feeds that are simultaneously being presented ( e . g ., displayed ) to the user . this identification and enhancement may be based on media analysis performed on the plurality of feeds , e . g ., in a runtime or in a pre - processed fashion . this media analysis may be customized for or by the user . apparatus for implementing any of the below described arrangements , and for performing any of the below described method steps , may be provided by configuring or adapting any suitable apparatus , for example one or more computers or other processing apparatus or processors or by providing additional modules . the apparatus may comprise a computer , a network of computers , or one or more processors for implementing instructions and using data , including instructions and data in the form of a computer program or a plurality of computer programs stored in or on a machine - readable storage medium such as computer memory , a computer disk , rom , prom , etc ., or any combination of these or other storage media . it should be noted that certain of the process steps depicted in the below described process flowcharts may be omitted or such process steps may be performed in an order differing from that presented below and shown in those process flowcharts . furthermore , although all the process steps have , for convenience and ease of understanding , been depicted as discrete temporally - sequential steps , nevertheless some of the process steps may in fact be performed simultaneously or at least overlapping to some extent temporally . referring now to the figures , fig1 is a schematic illustration ( not to scale ) showing an example system 1 in which embodiments of a method of video - feed enhancement can be implemented . an embodiment of the method of video - feed enhancement is described in more detail below with reference to fig3 . in other embodiments , the method of video - feed enhancement may be implemented in a different way that may , for example , comprise one or more different entities instead of or in addition to those shown in fig1 . the system 1 comprises a service provider 2 , a network 4 , a television ( tv ) 6 , and a user 8 . in other embodiments , a different type of audiovisual - reception client ( e . g ., a tablet computer , a smartphone , etc .) may be used instead of or in addition to the tv 6 . the service provider 2 may be a provider of cable - television or satellite - television services . the service provider 2 is a provider of a plurality of tv feeds . each of the tv feeds may be for a different tv program . for example , each tv feed may be a tv feed for a different sporting event . also , one or more of the tv feeds may relate to the same event ( e . g ., a sporting event , a political rally , etc .) but may be from different camera angles , broadcasters , etc . the service provider 2 is connected ( e . g ., via the network 4 ) to the tv 6 . this connection is such that the tv feeds provided by the service provider 2 may be sent from the service provider 2 to the tv 6 via the network 4 . in other embodiments , the service provider 2 may be an internet site or service that provides multimedia feeds or clips ( e . g ., hulu ™, youtube ™, etc .). in other embodiments , there may be a plurality of service providers 2 each of which may provide multimedia content . the network 4 may be any appropriate network , for example , a cable - television network , a satellite - television network , the internet , or a combination of those networks . in embodiments in which a plurality of service providers 2 ( e . g ., different types of service provider 2 ) provide multimedia content to a client device 6 , the multimedia content may be provided over a plurality of networks 4 ( e . g ., different types of network 4 ). for example , each service provider 2 may provide multimedia content to a client device 6 via a different network 4 . the client device 6 ( e . g ., a tv ) may be capable of receiving multimedia content over each of the networks 4 used . furthermore , the client device 6 may be capable of receiving multimedia content simultaneously over the plurality of networks 4 . the tv 6 is described in more detail below with reference to fig2 . the tv 6 is configured to receive the tv feeds sent to it from the service provider 2 . the tv 6 is configured to process the received tv feeds as described in more detail below with reference to fig3 . the tv 6 is configured to display one or more of the tv feeds to the user 8 as described in more detail below with reference to fig3 . the user 8 is a user of the tv 6 . fig2 is a schematic illustration ( not to scale ) of the tv 6 . the tv 6 may comprise a media - analysis module 10 , a selection module 12 , an enhancement module 14 , a display 16 , and a user input 18 . in other embodiments , one or more of the modules 10 through 18 may be located remotely from the tv 6 . in other words , the functionality of the tv 6 in this embodiment may be provided , in other embodiments , by one or more differently arranged modules . for example , in other embodiments one or more of the modules 10 through 14 may be located remotely from the tv 6 ( which may comprise the display 16 and the user input 18 ) and may be connected to the tv 6 via the network 4 . for example , the modules 10 through 14 may be located in the “ cloud ” rather than in the tv 6 . also for example , in other embodiments one or more of the modules 10 through 14 may be located in one or more separate computing devices ( devices that are different from to the tv 6 ) that may communicate with the tv 6 ( e . g ., via a wired or wireless communications link ) such that information may be transferred among the tv 6 and one or more of the separate computing devices . in this embodiment , the media - analysis module 10 may be connected to the service provider 2 via the network 4 such that the media - analysis module 10 may receive the plurality of tv feeds sent to the tv 6 from the service provider 2 . the media - analysis module 10 may be configured to process the received tv feeds as described in more detail below with reference to fig3 . this processing may be performed to determine , for each of the received tv feeds , values of one or more metrics . the media - analysis module 10 may be connected to the selection module 12 and to the enhancement module 14 such that information ( e . g ., the metric values determined by the media - analysis module 10 ) may be sent from the media - analysis module 10 to each of the selection module 12 and the enhancement module 14 . the media - analysis module 10 may also be connected to the user input 18 such that information input ( e . g ., by the user 8 ) at the user input 18 may be sent from the user input 18 to the media - analysis module 10 . the information input at the user input 18 may be used by the media - analysis module 10 during the processing of the tv feeds . the selection module 12 may be connected to the service provider 2 via the network 4 such that the selection module 12 may receive the plurality of tv feeds sent to the tv 6 from the service provider 2 . the selection module 12 may be configured to process the received tv feeds as described in more detail below with reference to fig3 . this processing may comprise using the information sent to the selection module 12 from the media - analysis module 10 ( e . g ., the determined metric values ). also , this processing may be performed to select one or more of the tv feeds . the selection module 12 may be connected to the enhancement module 14 such that information ( e . g ., information specifying which tv feeds have been selected by the selection module 12 ) may be sent from the selection module 12 to the enhancement module 14 . the selection module 12 may also be connected to the user input 18 such that information input ( e . g ., by the user 8 ) at the user input 18 may be sent from the user input 18 to the selection module 12 . the information input at the user input 18 may be used by the selection module 12 during the processing of the tv feeds . the enhancement module 14 may be connected to the service provider 2 via the network 4 such that the enhancement module 14 may receive the plurality of tv feeds sent to the tv 6 from the service provider 2 . the enhancement module 14 may be configured to process the received tv feeds as described in more detail below with reference to fig3 . this processing may comprise using the information sent to the enhancement module 14 from the media - analysis module 10 ( e . g ., the determined metric values ). also , this processing may comprise using the information sent to the enhancement module 14 from the selection module 12 ( e . g ., information specifying which tv feeds have been selected by the selection module 12 ). also , this processing may be performed to enhance one or more of the tv feeds . the terminology “ enhancing a tv feed ” is used herein to refer to processing performed on a tv feed such that , when displayed , that tv feed is displayed differently from how an unenhanced tv feed would be displayed . for example , an enhanced tv feed may be displayed in a display window on a display screen larger than that in which an unenhanced tv feed would be displayed , an enhanced tv feed may be displayed at a resolution higher than that with which an unenhanced tv feed would be displayed , an enhanced tv feed may be displayed with an aspect ratio different from that with which an unenhanced tv feed would be displayed , an enhanced tv feed may have its audio played , whilst unenhanced tv feeds may not have their audio played , etc . the enhancement module 14 may be connected to the display 16 such that information ( e . g ., enhanced or unenhanced tv feeds ) may be sent from the enhancement module 14 to the display 16 . the enhancement module 14 may also be connected to the user input 18 such that information input ( e . g ., by the user 8 ) at the user input 18 may be sent from the user input 18 to the enhancement module 14 . the information input at the user input 18 may be used by the enhancement module 14 during the processing of the tv feeds . the display 16 may be configured to display the tv feeds sent to it from the enhancement module 14 as described in more detail below with reference to fig3 . the user input 18 may be any appropriate device , means , or interface using which the user 8 may input information into the tv 6 ( e . g ., for use by the media - analysis module 10 , by the selection module 12 , or by the enhancement module 14 ). fig3 is a process flow - chart showing certain steps of an embodiment of the method of video - feed enhancement as may be performed by elements of the system 1 . at step s 2 , the service provider 2 sends , via the network 4 , the plurality of tv feeds to the tv 6 . in particular , the plurality of tv feeds may be sent to the media - analysis module 10 , to the selection module 12 , and to the enhancement module 14 . at step s 4 , the media - analysis module 10 processes the received plurality of tv feeds . the media - analysis module 10 may , for each of the plurality of tv feeds , determine a value of one or more metrics . a metric determined at step s 4 may be any appropriate metric . for example , one or more of the metrics may be measures of how exciting a tv feed is . in other words , a metric value determined for a tv feed may be indicative of how exciting events occurring in that tv feed are deemed to be . such metrics may be thought of as “ excitement metrics .” an example excitement metric is that determined by thuuz ™. a metric determined at step s 4 may be a function or combination of any number of other metric values . for example , a metric value determined at step s 4 may be a weighted combination of a plurality of other metric values . a metric determined at step s 4 may be dependent upon any parameters that are related to the tv feeds . such parameters related to a tv feed may include , but are not limited to : a number of current “ likes ” for that tv feed from members of a social network of the user 8 , a source - generated rating for that tv feed , a detected presence of a specific actor or object ( e . g ., as specified by the user 8 ) in that tv feed , and a detected discussion of or reference to a specific topic ( e . g ., a subject , event , person , or story , as specified by the user 8 ) in that tv feed . the media - analysis module 10 may comprise one or more detectors for determining the metric values . for example , the media - analysis module 10 may comprise an “ excitement detector ” ( for detecting a level of excitement in a tv feed ), a “ social activity detector ” ( for detecting activity in one or more of the user &# 39 ; s social networks related to a tv feed ), an “ object detector ” ( for detecting the presence of a specific object in a tv feed ), etc . one or more of the detectors may monitor or analyze only some of the content of a tv feed , such as the audio track , the video track , individual frames from the video track , or the closed - captioning text associated with the tv feed . for example , an object detector that is monitoring for the presence of a car may analyze frames from the video track for the presence of car - shaped objects , or analyze the audio track for car - engine sounds , or analyze the closed - caption text for words associated with cars or driving . a detector may combine two or more types of analysis . this tends to improve robustness . in this embodiment , the metric values may be determined automatically by one or more processors ( i . e ., by the media - analysis module 10 ). however , in other embodiments , one or more of the metric values may be determined in a different way , e . g ., by a human . the user 8 may select which metrics are determined at step s 4 or how those metrics are determined . the user 8 may specify which parameters or data sources are used to determine the metric values . the user 8 may specify such information , for example , by inputting his preferences in to the media - analysis module 10 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify such information and may be accessed by the media - analysis module 10 . the user profile could be entered , stored , and accessed in any appropriate way . for example , the user 8 may input profile information into a web - site designed to capture and store such information . also for example , one or more processors may analyze the user behaviour ( e . g ., the user &# 39 ; s viewing habits or social networking behaviour ) to learn the user preferences or to derive profile information . at step s 6 , the one or more metric values that have been determined for each of the tv feeds are sent from the media - analysis module 10 to the selection module 12 and to the enhancement module 14 . at step s 8 , using the received metric values , the selection module 12 may select one or more of the plurality of tv feeds received by the tv 6 . the selection module 12 may select one or more of the plurality of tv feeds for display to the user 8 as described in more detail below at step s 16 . the selection of a tv feed by the selection module 12 may depend on the metric values corresponding to that tv feed relative to the metric values corresponding to other tv feeds . the selection of one or more tv feeds from the plurality of tv feeds may be in accordance with any appropriate criteria . for example , if the metric values determined for each the tv feeds are indicative of the level of excitement of that tv feed , then the selection module 12 may select the subset of the plurality of tv feeds that correspond to the highest metric values ( i . e ., the highest excitement levels ). in other words , the selection module 12 may select the most exciting tv feeds from the plurality of received tv feeds . for example , if twenty tv feeds are sent from the service provider 2 to the tv 6 , then the selection module 12 may select from those twenty tv feeds the six tv feeds that correspond to the highest excitement levels ( i . e ., the tv feeds that correspond to the six highest metric values ). the one or more tv feeds selected by the selection module 12 are hereinafter referred to as the “ selected tv feeds .” the user 8 may specify one or more of the criteria that are used , by the selection module 12 , to select one or more tv feeds from the plurality of tv feeds . the user 8 may specify these criteria , for example , by inputting the criteria in to the selection module 12 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify such criteria and may be accessed by the selection module 12 . at step s 10 , information specifying the selected tv feeds is sent from the selection module 12 to the enhancement module 14 . at step s 12 , using the information received from the media - analysis module 10 ( i . e ., the metric values determined for each of the tv feeds ) and the information received from the selection module 12 ( i . e ., the information specifying the selected tv feeds ), the enhancement module 14 may identify one or more of the of the selected tv feeds for enhancement . any appropriate criteria may be used to identify which of the selected tv feeds are to be enhanced . for example , the tv feed corresponding to the highest excitement metric value ( i . e ., the most exciting tv feed ) may be identified as the only tv feed to be enhanced . the user 8 may specify one or more of the criteria that are used , by the enhancement module 14 , to identify one or more tv feeds from the selected tv feeds . the user 8 may specify these criteria , for example , by inputting the criteria in to the enhancement module 14 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify such criteria and may be accessed by the enhancement module 14 . at step s 14 , the one or more tv feeds identified at step s 12 may be processed by the enhancement module 14 so that , when displayed ( at step s 16 ) those tv feeds are enhanced . in other words , the one or more tv feeds identified at step s 12 may be processed by the enhancement module 14 so that , when displayed , they are displayed differently from the other tv feeds ( i . e ., from the unenhanced tv feeds ). for example , the one or more tv feeds identified at step s 12 may be processed by the enhancement module 14 so that , when displayed , they are displayed in a larger display window on the display 16 than are the tv feeds that were not identified at step s 12 . the enhancements applied to one or more of the selected tv feeds may be any appropriate enhancements . for example , enhancements may be such that an enhanced tv feed is displayed in a different size display window , in a different shape display window , at a different resolution , with a different aspect ratio , at a different location on a display , etc ., when compared with an unenhanced tv feed . also , the type or level of enhancement applied to a tv feed may be dependent upon the metric values corresponding to that tv feed . for example , the selected tv feeds may be processed so that , when those tv feeds are displayed , the relative sizes of display windows that those tv feeds are displayed in reflect the relative magnitudes of the metric values corresponding to those tv feeds ( e . g ., a tv feed corresponding to a relatively large metric value would be displayed in a relatively large display window , whilst a tv feed corresponding to a relatively small metric value would be displayed in a relatively small display window ). the user 8 may specify one or more of the enhancements that may be applied to one or more of the selected tv feeds by the enhancement module 14 . the user 8 may specify these enhancements , for example , by inputting enhancement selections in to the enhancement module 14 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify desired enhancements and may be accessed by the enhancement module 14 . at step s 16 , the enhancement module 14 may display , on the display 16 , the selected tv feeds . one or more of these selected tv feeds may have been enhanced at step s 14 such that those enhanced tv feeds are displayed differently from the unenhanced tv feeds . for example , enhanced tv feeds may be displayed , on the display 16 , in a different size display window , in a different shape display window , at a different resolution , with a different aspect ratio , at a different location on a display , etc ., when compared with unenhanced tv feeds . the selected tv feeds may be displayed in any appropriate way , configuration , or format . for example , the tv feeds may be displayed in a circular configuration . alternatively , the tv feeds may be displayed such that the one or more enhanced tv feeds are displayed in one portion of the display 16 , whilst the other , unenhanced , tv feeds are displayed in a different portion of the display 16 . the user 8 may specify a way , configuration , or format in which the selected tv feeds may be displayed on the display 16 . the user 8 may specify these , for example , by inputting display specifications in to the enhancement module 14 using the user input 18 . alternatively , the user 8 may specify a “ user profile ” which may specify display specifications and may be accessed by the enhancement module 14 . fig4 is a schematic illustration ( not to scale ) showing an example of how the selected tv feeds may be displayed on the display 16 at step s 16 . in this example , a single tv feed has been enhanced so that it is displayed in a larger display window than the ones used for the other unenhanced tv feeds . in fig4 the enhanced tv feed and the display window in which it is displayed are indicated by the reference numeral 20 , whereas unenhanced tv feeds and the display windows in which they are displayed are indicated by the reference numeral 22 . in this example , there are a total of six tv feeds ( i . e ., six tv feeds have been selected at step s 8 for display ). in particular , there is a single enhanced tv feed 20 and five unenhanced tv feeds 22 . also , in this example , the selected tv feeds 20 , 22 are displayed on the display 16 in a circular formation . the audio track of the enhanced tv feed 20 may be played , whilst the audio tracks of the unenhanced tv feeds 22 may be muted . an advantage provided by the above described system and method is that a number of tv feeds may be monitored , and only those that are determined to be the most exciting or interesting , etc ., ( as measured using some metric ) are displayed to the user 8 . if exciting or interesting , etc ., events occur in a tv feed that is not currently being displayed to a user 8 ( such that that hidden tv feed becomes more exciting or interesting than one or more of the tv feeds currently being displayed ), then that hidden feed may replace a less exciting or interesting tv feed that is currently being displayed . this replacement may be based on any appropriate replacement policy . this replacement of one tv feed with another may be performed automatically ( e . g ., without requiring the user &# 39 ; s permission to perform ), or the user 8 may be asked for permission to perform the replacement . a further advantage provided by the above described system and method is that , of the tv feeds that are displayed to the user 8 , one or more of the most exciting or interesting , etc ., ( as measured using some metric ) tv feeds may be highlighted to the user 8 , i . e ., one or more of the most exciting or interesting , etc ., tv feeds may be enhanced . this tends to draw the user &# 39 ; s attention to events that the user 8 may regard as the most exciting or interesting , etc . if exciting or interesting , etc ., events occur in an unenhanced tv feed ( such that the unenhanced tv feed becomes more exciting or interesting than an enhanced tv feed ), then that unenhanced tv feed may be enhanced . also , the currently enhanced tv feed may be unenhanced . this enhancement change may be performed automatically ( e . g ., without requiring the user &# 39 ; s permission to perform ), or the user 8 may be asked for permission to perform the replacement . a display size of a de - emphasized tv feed may , for example , correspond to its relative excitement level with respect to other tv feeds . any interactive prompts that ask for user permission to change which feeds are being displayed to the user 8 or how those feeds are displayed may be disabled , e . g ., by the user 8 . thus , a user 8 can choose to not be disturbed by interactive prompts if he so wishes . for example , if the user 8 wishes to watch a currently enhanced tv feed and has no interest in watching another feed , then the user 8 may disable the updating of the tv feeds or may select that currently enhanced tv feed as the only feed for display . the above described system and method advantageously tend to improve the ability of a user 8 to find content that is of interest to that user 8 . the above described method may be implemented as a web - based service that is capable of enhancing a content search experience of a user 8 . alternatively , the above described method may be implemented as an application ( or suite of applications ) running on a user device 6 . the above described method may be implemented in a “ smart remote ” ( i . e ., in a tv remote control ) that assists the selection of content from a secondary device based on the configured metric for display on a primary device . the above described system and method advantageously tend to help the user 8 in navigating through large amounts of multimedia content . an example of an optional additional feature is a feature that tends to prevent the user 8 from missing an interesting or exciting event . such features may include , for example , a feature that “ rewinds ” ( by an appropriate amount of time ) a tv feed before it is displayed to the user 8 or before it is enhanced . for example , at least a portion of a multimedia feed may be stored . using the metric value corresponding to that multimedia feed , a start time ( within that multimedia feed ) of an exciting or interesting event may be determined . when that feed is displayed to the user 8 , that feed may be replayed from a point in that feed prior to the determined start time of the event ( by replaying some or all of the stored portion of the feed ). in some embodiments , a rewind feature may track the start times of events that the user 8 may regard as the most exciting or interesting and time - shift playback of tv feeds containing those events such that those feeds are displayed to the user 8 from a point prior to the exciting or interesting events occurring . time shifting may involve recording ( e . g ., temporarily ) some or all of a tv feed and then playing back some or all of the stored portion . for example , the tv feeds received by the tv and displayed to the user 8 may be stored beginning at tv - program boundaries . alternatively the tv feeds may be stored beginning at the start of exciting or interesting events . the display 16 showing the user 8 the tv feed may continue showing the time - shifted tv feed until a catch - up event occurs . examples of catch - up events include the end of a tv program , the end of an exciting or interesting event , or a request by the user 8 to begin watching the tv feed live . a further example of an optional additional feature is a feature that enables a user , whilst watching a plurality of tv feeds , to choose a subset of those feeds ( e . g ., a single tv feed ) to view on its own rather than continuing to watch the plurality of tv feeds . upon changing from viewing a plurality of tv feeds to viewing a subset ( e . g ., one ) of those feeds , the above described “ rewind feature ” may be implemented . this would tend to ensure that the user does not miss any important or interesting events that occur in the tv feeds that he has elected to view . in other embodiments , the feeds could be provided with a delay to permit the analysis ( by the media - analysis module 10 ) to be ahead of the presented video . thus , the display or enhancement of a feed may be at a point in the feed prior to the exciting or notable event . alternatively , scene - detection processes may be implemented to allow a tv feed to be displayed or enhanced from the start of a scene . in the above embodiments , metric values ( e . g ., excitement metric values ) for the tv feeds are determined by the tv 6 . however , in other embodiments excitement information for a feed may be determined or received in a different way . for example , metric values may be provided by the content source ( e . g ., the service provider 2 or the provider of the multimedia content ). the metric values for a feed may then be embedded in the transport stream of that feed . also for example , metric values may be provided by a head end , e . g ., as a web service front end to a service analyzing incoming feeds . also for example , metric values may be determined by an application running on the tv 6 . also for example , if a feed is being received from an “ over - the - top source ,” e . g ., the internet , metric values may be provided by the content source and may be embedded in the metadata of the source ( e . g ., in the html header ). also for example , metric values may be provided by a third party ( e . g ., a separate on - line provider of metric values ), for example as a web service front end to the service analyzing web feeds . in the above embodiments , the process of fig3 may be performed by the apparatus described above with reference to fig1 and 2 . however , in other embodiments the method of fig3 may be implemented by a different appropriate apparatus configured or arranged in a different way . for example , in other embodiments , some or all of the modules that perform some or all of the process steps of fig3 may be in a network - centric arrangement . also , in other embodiments , some or all of the modules that perform some or all of the process steps of fig3 may be located “ in the cloud .” in the above embodiment , the invention is implemented using tv feeds . however , in other embodiments , one or more of these feeds may be a different type of multimedia feed , e . g ., movies , youtube ™ videos , videos from web sites , “ apps ,” etc . in view of the many possible embodiments to which the principles of the present invention may be applied , it should be recognized that the embodiments described herein with respect to the drawing figures are meant to be illustrative only and should not be taken as limiting the scope of the invention . therefore , the invention as described herein contemplates all such embodiments as may come within the scope of the following claims and equivalents thereof .	7
any of the embodiments may be driven by a high inertia fluid stream . the fluid stream may be a liquid stream moving at a moderate velocity or a gas or vapor stream moving at higher velocity . in one application , the gas stream may be the exhaust of a gas turbine , such as of the type used to drive large electrical generators . one of the advantages of this invention is that energy is taken from the inertia of the fluid stream , such as by reducing the velocity of a gas stream , without substantially changing the temperature of the gas stream significantly . in this manner , this invention may be used in conjunction with a thermal energy recovery system , as by using the hot exhaust gases exiting from this device in a steam cycle . referring to fig1 - 3 , there is illustrated a simplified wobble plate motor 10 illustrating its principles of operation . the motor 10 comprises a plate or disc 12 journalled or rotatably mounted by a bearing assembly 14 on a bent end 16 of a shaft 18 rotatably mounted by a bearing assembly 20 in a planar base 22 perpendicular to the shaft 18 . if necessary or desirable , the bearing assemblies 14 , 20 may include thrust elements to counteract any tendency of the shaft 18 to move axially . the concept is that a force applied to only one segment of the disc 12 , as in the direction of the arrow 24 , causes the disc 12 to roll on the planar base 22 and thereby rotate the shaft 18 in the direction shown by the arrow 26 thereby driving an input to a work consumer such as an electrical generator , pump , compressor or the like . thus , the plate 12 rotates about an axis 28 of the shaft 18 in a manner analogous to a spinning coin as it begins to decay , i . e . as the spin rate slows to a value where the coin is inclined to its axis of rotation . in other words , the plate 12 nutates as it rolls on a track provided by the base 22 . the force applied to the plate 12 is generated by a differential pressure applied directly to the plate 12 as contrasted to a pressure generated force applied through a cylinder , piston or other mechanical device . although the differential pressure may be the difference between atmospheric pressure and a partial vacuum , it may be preferred to provide a positive pressure to only one segment of the disc 12 because much greater positive pressures are more readily available and produce much greater torque on the output shaft 18 . although the power fluid may be a liquid , it may be preferred to use a gas , such as steam which is readily available in some industrial environments of which one example is the exhaust from steam turbines . as shown in fig1 , an imaginary plane 30 is defined by the shaft 18 and its bent end 16 to divide a front 32 of the disc 12 into two segments 34 , 36 to divide the back of the disc 12 into two segments 38 , 40 . it will be seen that a force applied in the direction of the arrow 24 to the segment 34 causes the disc 12 to rotate in the direction shown by the arrow 26 , as does a force applied to segment 40 in the direction shown by the arrow 42 . in other words , forces represented by the arrows 24 , 42 cause rotation of the disc 12 in the same direction , i . e . as shown by the arrow 26 . similarly , forces applied to the segments 36 , 38 cause rotation of the disc 12 in the direction opposite to the arrow 26 . thus , the segments 34 , 40 may be considered complementary or additive and the segments 36 , 38 may be considered opposite or subtractive relative to the segments 34 , 40 . the various segments 34 , 36 , 38 , 40 suggest a myriad of ways in which pressures , or partial vacuums , may be applied to the disc 12 to induce rotation of the shaft 18 in a desired direction . as used herein , saying that pressure is applied to only one segment of the disc 12 may mean that the disc is subject to greater pressures inducing rotation in one direction rather than in the other direction , such as will occur when high pressure is applied to one segment of the disc 12 and atmospheric pressure is applied to an opposite or subtractive segment . there are a variety of ways to apply pressure to only one segment of the plate 12 and not to its opposite . as shown in fig1 - 3 , one or more horizontal arrays of nozzles 44 may be supported in any suitable manner , such as on a ring header 46 , about the disc 12 so that one or more nozzles 44 is always aimed at or near a given point on the disc 12 such as the imaginary marking 270 °. the nozzles 44 are actuated sequentially so that one or more of them discharge power fluid onto the plate 12 toward one or more of the selected plate segments inducing rotation in the desired direction . this may be accomplished in any suitable manner , a simple version of which may be that each nozzle includes a valve 46 having a sensor , such as a feeler , positioned to be tripped by an edge or a detectable marker on the plate 12 as it approaches the nozzle 44 to deliver high pressure fluid from a source 49 . each of the nozzles 44 is connected by a valve 48 to a pressure source 49 so by judiciously operating selected ones of the valves 48 , a high pressure fluid is delivered through the nozzle 44 aimed at the 270 ° mark , the disc 12 will rotate or nutate about the axis 18 in the direction of the arrow 26 . the nozzles 44 may extend completely around the disc 12 as shown in fig3 so one or more of the nozzles 44 aimed at the back 38 of the disc 12 may simultaneously be actuated to deliver power fluid to the back of the imaginary marking 90 °, i . e . at the complementary segment 40 . this effectively doubles the force applied to the disc 12 and thus doubles the usable output of the shaft 18 . operation of the motor 10 will now be described . when motive fluid is delivered by the nozzles 44 to the segment 34 and / or to the segment 40 , the disc 12 rolls on the base 22 because the pressure and thus the force applied to the complementary disc segments 34 , 40 is greater than atmospheric pressure acting on the subtractive segments 36 , 38 . this rotates the shaft 18 and provides torque and horsepower to operate a work consuming device . referring to fig4 - 5 , there is illustrated another embodiment comprising a motor 50 having a member 52 such as a plate , disc , tube or the like journalled or rotatably mounted by a bearing assembly 54 on a bent end 56 of a shaft 58 rotatably mounted about an axis 60 by a bearing assembly 62 in a planar base 64 . if necessary or desirable , the bearing assemblies 54 , 62 may include thrust elements to counteract any tendency of the shaft 58 to move axially . from one point of view , the concept is that a force applied to the disc 52 , as in the direction of the arrow 66 , causes the plate 52 to roll on the planar base 64 and thereby rotate the shaft 58 in the direction shown by the arrow 68 thereby driving an input to a work consumer such as an electrical generator , pump , compressor or the like drivably connected to the shaft end 70 . from another point of view , the concept is that a force applied to the disc 52 , as in the direction of the arrow 66 , causes the shaft 58 to rotate in the direction of the arrow 68 while the plate 52 cooperates with the base 64 to constrain movement of the shaft end 70 into simple rotary movement about the axis 60 . the member 52 may preferably include a ring or rim 72 and a plurality of radiating struts 74 providing a receptacle for the bearing 54 . this allows the motive fluid to flow through the member 52 for purposes more fully apparent hereinafter . the base 64 may be of similar construction providing a ring 76 and a series of radiating struts 78 . to make the plate 52 roll on the base 64 without slipping , a gear or gear teeth 80 on the plate 52 may mesh with a gear or gear teeth 82 on the base 64 . it will be seen that the gear teeth 80 , 82 provide complementary bevel gears . it will also be seen that the rings 72 , 76 may be of equal diameter or may be of different diameter , meaning that the gears 80 , 82 may be of different or the same diameter . the motor 50 may be positioned in a housing 84 of any suitable type and is illustrated as a simple tubular housing having a passage 86 , an inlet end 88 and an outlet end 90 . the struts 78 may extend to connect to the housing 84 thereby positioning the motor 50 at a desired location . the plate 52 and base 64 may accordingly comprise latticework arrangements in the sense that a fluid flowing through the housing passage 86 is only minimally obstructed . driving the shaft 58 or the plate 52 , depending on ones view , is a blade assembly 92 mounted on the bent end 56 of the shaft 58 . the blade assembly 92 may include the bevel gear provided by the teeth 80 . the blade assembly 92 may include a hub 94 and a series of blades 96 radiating away from the hub 94 . the blade assembly 92 is fixed to the gear 80 and the blades 96 are inclined so that , on one side of the blade assembly 92 , the blades 96 present a more - or - less solid appearance ( such as on the left in fig4 ) and a more - or - less open appearance ( such as on the right of fig4 ). as the plate 52 nutates on its circular edge around and in cooperation with the ring 76 , the plate 52 and shaft rotates relative to each other as allowed by the bearing 54 . manifestly , the inclination of the blades 96 can be reversed to cause rotation of the blade assembly 92 in the opposite direction . as an alternative , the blades 96 may be of airfoil shape and suitably positioned to produce torque to drive the plate 52 and the shaft 58 . high inertia fluid flowing through the passage 86 in the direction shown by the arrow 100 impacts the blades 96 on the left in fig4 and tends to flow freely through the blades 96 on the right in fig4 . this pushes the blade assembly 92 to the left in fig4 causing nutation of the blade assembly 92 as it tracks along the stationary bevel gear 82 . the axial shaft 70 is accordingly rotated and may be connected to a work producing device such as an electrical generator , pump or the like thereby producing work . it will accordingly be seen that the blade assembly 92 nutates during operation of the motor 50 thereby rotating the output shaft 70 . there is a tendency of air flowing through the passage 86 to bypass the blade assembly 92 reducing the efficiency of the motor 50 . it may be preferred to provide a shroud 110 to divert air through the blade assembly 92 as shown in the embodiments of fig6 and 7 . the shroud 110 may act as a flow director , directing flow only toward the blades 96 which are transverse to , or side - on to , the direction of flow through the housing 84 . the shroud 110 may also act as a flow accelerator as will be more fully apparent hereinafter . the shroud 110 may take a number of suitable forms and may include a plate 112 having an opening 114 aligned with those fan blades 96 that are side - on to the direction of flow as suggested in fig6 . an important advantage of the embodiment of fig6 - 7 is that rotation of the plate 112 and the opening 114 remains synchronized with nutation of the fan assembly 92 so the opening 114 always aligns with the side - on blades . to this end , the plate 112 may rotate at the same rate , or synchronously , with nutation of the fan assembly 92 . this is much easier to accomplish when the gears provided by the teeth 80 , 82 are the same size because this means that the member 52 nutates and the plate 112 rotates at the same rate . the plate 112 may be fixed on a shaft end 115 by a coupling 117 coaxial with the axis 60 . the shaft end 115 is part of a bent shaft 116 having an inclined end 118 rotatably mounted on the inclined shaft end 56 by a coupling 120 . it will be seen that rotation of the fan assembly 92 causes the inclined shaft end 56 to rotate in a circle 122 . this causes the inclined end 118 of the shaft 116 to rotate thereby rotating the plate 112 and maintaining the opening 114 aligned with that segment of the blades 96 that act to rotate the fan assembly . the shroud 110 accordingly increases the efficiency of the motor 50 by reducing fluid bypass around the blade assembly 92 . it will also be apparent that the opening 114 restricts the area of flow immediately upstream of the blade assembly 92 thereby increasing the velocity of the fluid stream impacting the side - on blades . the motors 10 , 50 are effective in producing work from moving fluid streams of different density , such as air and water , and from fluid streams moving at much different velocities . the exhaust stream from gas turbine engines is quite high , perhaps too high for efficient use in some of the embodiments disclosed herein . in this event , the exhaust stream may be split and run through motors which are essentially parallel , the size of the passage through which it flows may be increased to decrease the velocity or in some other arrangement . in addition , the exhaust stream may be of sufficient velocity that substantial energy remains after passing through one of the motors disclosed herein . in this event , motors may be placed in series , depending on the tradeoff between efficient use of available energy , capital costs , operating costs and the like . it will be apparent that suitable seals may be provided at desired locations to minimize leaking of the driving fluid , suitable bearings may be provided to increase reliability and performance and other engineering solutions may be provided to overcome problems which may become apparent . it will be seen that the discs 12 , 52 may be circular or of other smooth arcuate periphery so long as the base 22 , 64 is either planar in the case of a circular disc or of complementary shape in the case of a smoothly arcuate periphery , such as an ellipse . it will also be seen that the discs 12 , 52 are at an acute angle relative to the bases 22 , 64 . although this invention has been disclosed and described in its preferred forms with a certain degree of particularity , it is understood that the present disclosure of the preferred forms is only by way of example and that numerous changes in the details of operation and in the combination and arrangement of parts may be resorted to without departing from the spirit and scope of the invention as hereinafter claimed .	5
as shown in fig1 , the fuel - saving accelerator 1 for internal combustion engine of the present invention comprises a water tank 2 , a water processing unit 4 and a water amount control unit 6 . the water tank 2 stores water which is used as auxiliary fuel for the internal combustion engine . when the amount of the water stored the water tank reduces to a preset lower threshold , fresh water will be supplied to the water tank , to maintain the amount of water to a level sufficient for the normal operation of the internal combustion engine . the water tank 2 supplies water to the water processing unit 4 through the inlet 3 of the latter , and then the water will be processed by the water processing unit . the processed water is output from the outlet 3 ′ of the water processing unit 4 , and then is supplied to the water amount control unit 6 through the inlet 7 of the water amount control unit via a tube 5 . the water amount control unit 6 will control the amount of water output therefrom , and supplies a controlled amount of water to the combustion chamber 10 of the internal combustion engine 11 via the outlet 7 ′ thereof , a connection tube 8 and an intake port 9 of the internal combustion engine . in the combustion chamber , the water will be mixed with the fuel oil , and then the mixture of water and fuel oil will be burnt together , thus , the combustion rate of the fuel oil could be improved . in an example shown in fig2 , the water processing unit 4 includes an inner cavity to contain the materials for processing the water , an inlet 3 and an outlet 3 ′ provided at opposite ends of the water processing unit 4 , in which the water to be processed is supplied to the inner cavity through the inlet 3 and then the processed water is output through the outlet 3 ′. the inner cavity of the water processing unit 4 may be divided into three sections which are provided with organic absorption cotton 12 , absorbent charcoal 13 , and ion - exchange resin 14 respectively , in which the organic absorption cotton 12 is used to absorb particles and impurities in the water , the absorbent charcoal 13 is used to absorb the harmful metals and other heavy metals in the water , and the ion - exchange resin 14 is used to lower the concentration of calcium and magnesium ion in the water . the water processing unit 4 could remove the impurities in the water and adjust the ph value of the water . preferably , the water processing unit 4 may adjust the ph value of the water to ph 6 ˜ 8 . the water processing unit 4 may be of column shape , as shown in fig2 , or be in any other suitable forms . alternatively , the inner cavity of the water processing unit 4 could be filled with other suitable materials for processing the water . fig3 shows an example of the water amount control unit 6 of the fuel - saving accelerator 1 according to the present invention . the water amount control unit 6 is provided with a through hole 15 , and an inlet 7 and an outlet 7 ′ of the water amount control unit 6 are formed on the opposite ends of the through hole 15 . the water amount control unit 6 may be made of stainless steel , copper or other suitable materials . the diameter d of the through hole 15 is determined according to the following equation . where apui is a constant value of 8000 whose unit of ( cc * km / l )* mm , fc is the fuel consumption of the internal combustion engine whose unit is l / km , while cc is the cylinder capacity of the internal combustion engine whose unit is cc ( cubic centimeter ). the water processed by the water processing unit 4 is supplied to the water amount control unit 6 through the transmission tube 5 and the inlet 7 , and the water amount control unit 6 controls the amount of water output therefrom by virtue of the through hole 15 , and then the controlled amount of water is supplied to the combustion chamber of the internal combustion engine through the outlet 7 ′ and the connection tube 8 . through determining the diameter of the through hole 15 within the water amount control unit 6 according to the above - mentioned equation , the amount of water suctioned into the combustion chamber via intake port 9 during the induction stroke of the internal combustion engine could be controlled . thus , the water and the fuel oil could be mixed in an appropriate rate with the combustion chamber , therefore , the combustion efficiency of the fuel oil could be improved , and the fuel consumption and environmental pollution could be reduced . as shown in fig1 , the water processing unit 4 and the water amount control unit 6 may be mounted within the water tank 2 , to minimize the size of the fuel - saving accelerator 1 and integrate the components thereof . alternatively , the water processing unit 4 and the water amount control unit 6 may also be mounted outside of the water tank 2 , to increase the capacity of the water tank 2 . the operation of the fuel - saving accelerator of the present invention is as follows . firstly , the water tank 2 supplies water to the water processing unit 4 , and then the water processing unit 4 supplies the water processed therein to the water amount control unit 6 . next , during the induction stroke of the internal combustion engine 11 , the controlled amount of water is suctioned into the combustion chamber 10 through the intake port 9 from the water amount control unit 6 . the suctioned water will mix with the fuel oil in the combustion chamber . during the compression stroke of the internal combustion engine , the suctioned water would release hydrogen under the condition of high temperature and high pressure within the combustion chamber . the hydrogen may assist in improving the combustion efficiency of the fuel oil , thus , the dynamic performance of the internal combustion engine could be enhanced , and the fuel consumption and environmental pollution could be reduced . to verify the fuel - saving performance of the fuel - saving accelerator of the present invention , the present applicant entrusted the china national quality control & amp ; inspection center for automobiles ( xiang fan ) to have comparison tests on the performance of the samples with or without the fuel - saving accelerator of the present invention . the samples are based on the vehicles honda odyssey ( manufactured by guangzhou honda automobile co ., ltd . in china ) and landwind ( manufactured by jiangling motors corporation , ltd . in china ). the standards adopted in the comparison tests are “ passenger car — fuel consumption test method ” ( gb / t 12545 . 1 - 2001 ), “ motor vehicles — acceleration performance — test method ” ( gb / t 12543 - 1990 ), “ motor vehicles — maximum speed — test method ” ( gb / t 12544 - 1990 ), “ motor vehicles — minimum stable speed — test method ” ( gb / t 12547 - 1990 ), and “ motor vehicles — steep hill climbing — test method ” ( gb / t 12539 - 1990 ). honda odyssey is used as the basis of the samples 1 and 2 of the test 1 , in which the sample 1 is a sample without a fuel - saving accelerator of the present invention , while the sample 2 is a sample provided with the present fuel - saving accelerator . the cylinder capacity of honda odyssey is 2400 cc and the fuel consumption is 7 . 46 l / 100 km = 0 . 0746 l / km , thus , the diameter d of the through hole 15 of the water amount control unit 6 is d =( 0 . 0746 / 2400 )* 8000 = 0 . 24867 mm . the test results of the test 1 are listed in the following table 1 . as shown in table 1 , after provided with the present fuel - saving accelerator , the dynamic performance of the prototype honda odyssey is improved obviously , and the fuel consumption of its internal combustion engine is decreased at the same time . fig4 shows the v - t curve graph of the samples 1 and 2 during the acceleration from standing start , and fig5 shows the v - s curve graph of the samples 1 and 2 during the acceleration from standing start . also shown in the fig4 and 5 , after provided with the present fuel - saving accelerator , the dynamic performance , especially the acceleration capability of the prototype is enhanced significantly . landwind is used as basis of the sample 3 and 4 of the test 2 , in which the sample 3 is a sample without a fuel - saving accelerator of the present invention , while the sample 4 is a sample provided with the present fuel - saving accelerator . the cylinder capacity of landwind is 2000 cc and the fuel consumption is 12 . 17 l / 100 km = 0 . 01217l / km , thus , the diameter d of the through hole 15 of the water amount control unit 6 is d =( 0 . 01217 / 2000 )* 8000 = 0 . 4868 mm . the test results of the test 2 are listed in the following table 2 . as shown in table 2 , after provided with the present fuel - saving accelerator , the dynamic performance of the prototype landwind is improved obviously , and the fuel consumption of its internal combustion engine is decreased at the same time . fig6 shows the v - s curve graph of the samples 3 and 4 during the acceleration from standing start , fig7 shows the v - t curve graph of the samples 3 and 4 during the acceleration from standing start , fig8 shows the v - s curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with direct drive transmission , fig9 shows the v - t curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with direct drive transmission , fig1 shows the v - s curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with maximum drive transmission , and fig1 shows the v - t curve graph of the samples 3 and 4 during the acceleration from 30 km / h to 110 km / h with maximum drive transmission . also shown in the fig6 - 11 , after provided with the present fuel - saving accelerator , the dynamic performance , especially the acceleration capability of the prototype is enhanced significantly . although the description of the present invention is made with reference to the preferred embodiments , the present invention is not limited to these embodiments . various modifications and changes can be made to the invention by those skilled in the art without departing from the spirit and scopes of the present invention .	8
[ 0027 ] fig1 is an exemplary block diagram of an audio transmission system 100 of the invention . an encoding terminal 110 that downsamples and encodes audio signals is connected to a multimedia communications network 140 through modem 120 and local exchange carrier 130 . a decoding terminal 170 that receives , decodes and upsamples the audio signals is also connected to the multimedia communications network 140 through modem 160 and local exchange carrier 150 . the encoding terminal 110 and decoding terminal 170 include memory units 180 and 190 , respectively , for intermediate storage of the compressed audio signal either prior to transmission or after reception of the audio signals , for example . the multimedia communications network 140 represents any combination of existing communications networks , such as a telephone network , internet , intranet , etc . the modem devices 120 , 160 may be ethernet interfaces , cable modems , isdn modems , adsl modems , or any other interface circuit intended to connect two networks or a network and a digital computing apparatus . the modem devices 120 , 160 may contain a conventional rj - 11 outlet for connection to computer modem , facsimiles , printers or other equipment . the modem devices 120 and 160 may also be equipped with universal serial bus ( usb ), integrated system digital network ( isdn ) or other standard data interfaces , as will be appreciated by the person skilled in the art . however , other similar devices may be used to permit sharing of large bandwidths over media already installed . encoding terminal 110 and decoding terminal 170 may be any pair of devices that receive and send audio signals according to the invention through the multimedia communications network 140 via modems 120 and 160 . the encoding terminal 110 and decoding terminal 170 may represent such devices as a personal computer ( pc ), telephone , television , facsimile , or any other device capable of sending and receiving audio signals . it may be appreciated that the encoding terminal 110 and decoding terminal 170 may include software and / or hardware for performing the encoding and decoding functions , and further that the encoding and decoding terminals may be different types of devices . it may further be appreciated that while the encoding terminal 110 and the decoding terminal 170 include memory units 180 and 190 , respectively , for intermediate storage of the compressed audio signal , the compressed audio signal may be intermediately stored in one or more other intermediate storage devices located throughout the audio transmission system 100 , such as between the modem 120 , 160 and the local exchange carrier 130 , 150 , or in the multi - media communications network 140 . in providing a more detailed discussion of the encoding and decoding of audio signals , a discussion of conventional systems is set forth in fig2 - 6 to better to explain the features and advantages of the present invention . [ 0033 ] fig2 shows a generic audio encoding / decoding system 200 operating at a bit rate which is sufficient to encode all of the frequencies in the input signal . an encoder 210 located within a computing unit , for example a pc , receives an audio input signal with frequency range fin ( typically spanning the range of 20 hz - 20 khz ) and encodes the signal for transmission across a communications channel . the input signal may either be analog or digital . if the input signal is analog , the encoder 210 will include an analog - to - digital conversion apparatus . however , the input signal may already be digitized , such as stored signals retrieved from an audio compact disc , for example . a decoder 220 , located within another pc for example , receives and decodes the transmitted audio signal to produce an audio output f out which is less than fin and less than f s / 2 . the encoder / decoder system 200 in this example has no other specified bandwidth limit and the distortion level is unspecified . if the bit rate b ch and the sample rate f s are high enough ( for the encoding algorithm ) then the reproduced audio will be indistinguishable from the original . if either is too low , then the audio will be perceived as degraded . [ 0036 ] fig3 shows a generic frame - based audio encoding / decoding system 300 operating at a high sampling rate , such as 44100 sps . the audio encoder / decoder system of fig3 is similar to that of fig2 but the sampling rate of 44100 sps used for encoding is too high to permit transparent audio reproduction of the full human - audible frequency range ( 20 hz - 20 khz ) at the specified bit rate of 96 kbps , so a degradation in audio signal quality is perceived . in this example , as well as in the examples in fig4 - 6 , the encoder is operating at 96 kbps and 44100 sps , although the same principles apply at other sampling rates and other bit rates . one way to improve reproduced audio signal quality when the bit rate is too low to support the full frequency range of the input is to encode less than the full frequency range . by way of reference , for a production quality aac codec , best reproduced signal quality at 96 kbps and 44100 sps occurs for a signal bandwidth of about 13 khz . fig4 - 6 show various ways to decrease the audio frequency range . [ 0038 ] fig4 shows a generic frame - based audio encoding / decoding system 400 operating at a high sampling rate that uses a low pass filter 410 to limit the frequency range that is encoded . in many cases , a lower sampling rate would allow a wider frequency range or alternatively a higher quality audio signal ( because of frame overhead and music statistics ). consequently , the system in fig4 is sub - optimal . [ 0039 ] fig5 shows a generic frame - based audio encoding / decoding system 500 that operates at a high sampling rate ( 44100 sps ) that discards spectral coefficients in the input signal to limit the frequency range that is encoded and transmitted . this operation is similar but not identical to that of the low pass filter 410 discussed above . the audio input signal is input to the modified discrete cosine transform ( mdct ) 510 ( or other time - to - frequency domain transform ) and the spectral coefficients are discarded by the spectral coefficient discard unit 520 . the signal is then input to a noise allocation unit 530 ( which computes the masking thresholds for the audio frame and quantizes the spectral coefficients according to the thresholds ) which emits the compressed signal . the compressed signal is then transmitted to the decoder 220 of another computing unit ( for example , another pc , or a portable audio device similar to the diamond rio mp3 player ) for decoding and output . [ 0041 ] fig6 shows a generic frame - based audio encoding / decoding system 600 that downsamples the audio input signal to limit the frequency range that is encoded and transmitted . ( resamplers typically incorporate frequency - limiting filters .) the audio input signal is downsampled by the downsampler 610 at a 2 : 1 ratio and is then input into encoder 210 for encoding . the signal is then transmitted across a communication channel to the decoder 220 at the receiving pc that plays out the audio signal at the downsampled rate . this will generally be suboptimal because the decoder 220 must operate at a submultiple of 44100 sps . in this example , the suboptimal would be 2 : 1 to 22050 , which is not the rate that provides optimal frequency response . [ 0042 ] fig7 shows the encoding / decoding system 700 of the invention . the audio encoding / decoding system 700 includes an optimal triplet of sample rate f s0 ( in this case 32 ksps ), bit rate 96 kbps , and the maximum supportable frequency range f 0 which at 96 kbps / 32 ksps is about 13 khz . the optimal triplet could be determined in a number of ways , e . g . algorithmically or by searching a table . the analog signal ( or a digitized version of the analog signal ) is input to the encoding unit 710 of a pc , for example , where the signal is downsampled by downsampler 730 from 44100 to 32000 and encoded by the audio encoder 740 . the encoded audio signal is then transmitted across a communications channel , through a modem , for example , at a given bit rate of 96 kbps to another pc for output . at the receiving pc , the received signal is input to a decoding unit 720 , where a bit stream decoder 750 decodes the downsampled signal . the decoded signal is then input to the upsampler 760 which upsamples the signal to the original or other suitable sample rate . an audio output is then produced with a frequency range f out of about 13 khz . note that in the example of fig7 sps and 32000 sps are standard aac rates . as discussed above in reference to fig1 the encoding unit 710 and the decoding unit 720 may include memory units for intermediate storage of the compressed audio signal either prior to transmission or after reception of the audio signals , for example . it may be the case that the codec ( for example , aac ) is specified at a set of standard rates ; and that f s0 does not match one of these standard rates . however many codecs ( such as aac ) can be modified to run at an arbitrary sample rate , and although the resulting encoding unit 710 will generate aac bit streams that will not reproduce audio accurately unless the decoding unit 720 incorporates this invention , the perceived quality of the reproduced audio signal will be better for the bit stream that uses the non - standard rate than for a bit stream that uses any standard rate . for example , as shown in fig8 the downsampling process used in fig7 may be more computationally efficient when the downsampling factor is the ratio of two small numbers . consider the case where it is desired to downsample from the standard rate of 44100 sps to the standard rate of 32000 sps . neither 441 nor 320 ( the smallest integers which preserve the 44100 : 32000 ratio ) qualify as a small integer in this context . if a ratio of 11 : 8 is used , which is equivalent to the ratio of 44000 : 32000 , we can downsample to a comparable intermediate sample rate ( 32073 sps ) in a computationally efficient way , without degrading significantly either frequency response or distortion levels from the optimal sample rate of 32000 sps . accordingly , as shown in fig8 the process is the same as that in fig7 but 32073 sps is used as the intermediate sampling frequency . 32073 sps is sufficiently close to an aac standard rate that audio signals can be encoded using the parameters for a standard aac rate . when the intermediate sampling rate is close to a codec standard rate , the bit stream header , which generally carries information about the sampling rate at which the audio was encoded , can indicate the nearby standard rate . this is generally advantageous because it allows a conventional decoder ( i . e . one which does not incorporate the current invention ) to decode the bit stream and reproduce the audio , even though the audio reproduction strictly speaking is not accurate . in this case ( 32073 sps sampling rate rather than the 32000 sps indicated in the bit stream header ), there will be a pitch shift in the audio reproduced by the conventional decoder . this may be acceptable for some applications but not for others . however , the invention is still useful when the resulting sampling rate is not close to a standard rate , as long as it is possible to modify the audio encoding unit 710 so that it supports the non - standard rate . for example , with a downsample ratio of 9 : 8 one obtains a sampling rate of 39200 sps , which with a production aac codec would support a frequency range as high as 15 - 17 khz at a bit rate of 112 kbps at an acceptable level of distortion . since the downsample factor is again the ratio of two small numbers , the resampling process would again be computationally efficient . it may be advantageous to indicate to the decoding unit 720 what resampling ratio has been used to encode the audio , since otherwise the codec system ( fig7 & amp ; 8 ) must operate at a fixed resampling ratio . as a particular embodiment of the method and apparatus of this invention , the resampling ratio is incorporated into the bit stream within a reserved bit field of the standard header . as an alternative embodiment , the resampling ratio can be incorporated as side channel information . in a specific example , aac permits “ data packets ” to be incorporated in the bit stream . these data packets are ignored by a standard aac codec . the resampling ratio can be specified in a data packet , possibly along with other information . while the invention above has been discussed from the point of view of supporting the maximum frequency range for a given bit rate and level of distortion , there are two alternative ways of looking at this problem . rather than support maximum frequency at a given bit rate , a frequency range and a given distortion level at a minimum bit rate may be supported . alternatively , a given frequency range at a given bit rate may be supported to achieve the lowest distortion levels . that is , there are three interrelated variables : bit rate , distortion level , and frequency support . one can fix any two variables and use the above embodiment to achieve the best possible results for the remaining variable . [ 0052 ] fig9 is a flowchart of the encoding process according to the invention . process begins at step 1000 and proceeds to step 1010 where the sample rate f s0 and maximum frequency range f 0 are determined as an optimal pair either algorithmically or by searching a table , for example . in step 1020 , an input signal is received by the encoding unit 710 and is downsampled by downsampler 730 to f s0 . the process proceeds to step 1030 where the signal is encoded by the audio encoder 740 . the process then proceeds to step 1040 where the signal ( along with a header , data packet , etc . that includes the downsampling information ), is transmitted at a given bit rate from a modem across a communication channel . the encoding process then goes to step 1050 and ends . [ 0053 ] fig1 is a flowchart of the decoding process . process begins at step 1100 and proceeds to step 1110 where the downsampled signal ( along with a header , data packet , etc . that includes the downsampling information ) is received by another pc &# 39 ; s ( for example ) decoding unit 720 . the process proceeds to step 1120 where the downsampled signal is decoded by the bit stream decoder 750 and then upsampled at step 1130 by the upsampler 760 at a ratio corresponding to the downsampling ratio included with the received downsampled signal , for example . the upsampled signal is then output in step 1140 . the process then goes to step 1150 and ends . while this invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art . accordingly , preferred embodiments of the invention is set forth herein are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the invention .	6
in a cdma - system mobile terminals receive and combine branches from many base stations at the same time . this is possible since different base stations use the same frequency for their branches to one and the same mobile terminal . in the following description each base station corresponds to one cell . [ 0032 ] fig1 shows schematically a mobile terminal 1 , which has established radio links to a first , a second and a third base station 3 , 5 and 7 , respectively . there is also shown a fourth , a fifth and a sixth base station 9 , 11 and 13 , respectively . they have not established radio links to the mobile terminal 1 . the mobile terminal 1 has an active set 15 of base stations 3 , 5 , 7 from which the mobile terminal 1 receives radio signals and a monitored set 17 of base stations 9 , 11 , 13 from which the mobile terminal 1 should be ready to receive radio signals . the mobile terminal 1 receives a pilot signal from all base stations in a region around the mobile terminal , this region comprising both the active set 15 and the monitored set 17 . pilot signals are used in the cdma system to estimate the quality of the downlinks from the base stations . a pilot signal is a data - unmodulated spreading - coded signal , which is continuously transmitted by each base station to its coverage area . a rake receiver ( not shown ) in a mobile terminal indicates when it has received power on a specific code corresponding to a pilot signal from a specific base station . the mobile terminal receives these pilot signals from the base stations and reports measurement values to a node , rnc , in the network connected to the base stations . the node uses the pilot signal measurements to instruct the mobile terminal to receive or not receive downlinks from the different base stations . the pilot signals giving the strongest measurement values form the active set 15 of the base stations 3 , 5 , 7 in the mobile terminal . from the base stations 9 , 11 , 13 comprised in the monitored set 17 the mobile terminal 1 receives nothing but these pilot signals . the rake receiver in each mobile terminal continuously measures pilot signals . each rake receiver maintains a measurement list of the base stations and the corresponding spreading codes of the pilot signals that are situated near the mobile terminal and that are possible candidates for handover or connection establishment . the base stations on the measurement list form a group of candidates , which may become members of the active set . when a mobile terminal moves , the measurement list is updated . the rake receiver receives radio signals from a new base station when the rnc instructs the mobile terminal to do so . the instructions from the rnc are based on the strengths of the , in the mobile terminal , received pilot signals . the mobile terminal repeatedly sends information to the base stations about for example , how strong the different received pilot signals are . this information could be sent periodically or only when a change in the signal has been recorded . the information is forwarded from the base stations to the rnc ( radio network controller ). the rnc knows also the sending effect of the pilot signals and thus it knows the attenuation between the base station and the mobile terminal for each downlink ( radio links from the base stations to the mobile terminals ). it can thus from this information derive which downlinks that are most important in the different connections . accordingly , in fig1 the base stations 3 , 5 , 7 in the active set 15 are located “ close ” to the mobile terminal 1 and the base stations 9 , 11 , 13 in the monitored set 17 are located “ next ” to the active set base stations . this “ close ” and “ next ” corresponds rather to the needed power for a good connection than to a geographical distance . when the mobile terminal moves some of the monitored set base stations 9 , 11 , 13 are moved from the monitored set 17 to the active set 15 and vice versa . both sets 15 , 17 are thus currently updated as the mobile 1 moves between the cells of the base stations . [ 0039 ] fig2 shows schematically the mobile terminal 1 in fig1 . the mobile terminal 1 comprises a rake receiver 20 . a similar device is placed in all mobile terminals and also in each base station . the rake receiver 20 receives radio signals 22 , 24 and 26 , respectively , from the base stations 3 , 5 and 7 , respectively , ( see fig1 ) that are comprised in the above - mentioned active set 15 . these signals 22 , 24 , 26 have each different codes . the rake receiver 20 decodes the signals 22 , 24 , 26 and combines them into one signal 28 . the fact that the end signal 28 is combined from many signals 22 , 24 , 26 gives an increased signal quality thanks to diversity . the signal from one base station is also divided into many radio paths during the transmission between the base station and the rake receiver due to reflections . the different radio paths will propagate along different paths and thus they will arrive at the rake receiver 20 in different times . the rake receiver 20 combines also these radio paths and quality in the connection is once again gained because of diversity . [ 0040 ] fig3 shows a node , rnc ( radio network controller ) 30 , in the telephone network and how it is connected to the first , second , third , fourth , fifth and sixth base stations 3 , 5 , 7 , 9 , 11 , 13 in fig1 . the mobile terminal 1 shown in fig3 emits a signal , which is received in the three “ closest ” base stations 3 , 5 , 7 . the signal has travelled along different radio paths to the different base stations 3 , 5 , 7 and thus the signal quality could differ . the rnc 30 combines then the different uplinks of the signal received in the first , second and third base stations 3 , 5 , 7 . quality of the resulting signal is gained thanks to diversity . a lack of resources can arise in a base station . it could be a lack of power or a lack of codes . a lack of codes means that there are so many connections that the number of orthogonal codes is not sufficient . however , if there are many connections using a high data rate a lack of codes can occur even if there are not so many branches since high data rate codes are few . in the case of a lack of resources in a base station one or more downlinks from this base station to different mobile terminals has to be given less power or be removed . if there is a lack of codes the code for the removed downlink should be reallocated for a new connection . this decision about how to free resources has to be quick and according to the invention the decision should be taken locally in the base station and it should rely on information sent to the base station from the rnc . there are different possibilities for the transmission of data , such as voice , text and information from the rnc 30 to the base stations 3 , 5 , 7 , 9 , 11 , 13 and vice versa . one example is that a packet with data is sent whenever there is data to be sent . another example is that packets with data are sent continuously between the base stations and the rnc , for example every 20 ms , no matter if there is data to be sent . according to the invention the rnc informs the base stations about the importance of different branches . one way of informing is to send some information in a header together with the data in the packet from the rnc to the base stations . this information could for example be information about how important this particular base station , to which the packet is going , is for the receiving of the signal from the mobile terminal concerned . the information sent from the rnc to the base stations could , beside the mentioned information about how important each branch in the uplink ( from the mobile terminals to the base stations ) is for a resulting signal combined in the rnc , contain information about how important each branch in the downlink ( from the base stations to the mobile terminals ) is for the resulting signal in the mobile terminal . this is possible since the mobile terminals send information about for example measurements of the pilot signals to the rnc through the base stations in measurement report messages . information about the uplinks known in the base stations , for example interference of the uplinks , can be sent to the rnc from the base stations , in either a packet header or as a separate message . the rnc has also knowledge about codes used for the connections . this code information and uplink and downlink information is , according to one embodiment of the invention , forwarded in any suitable combination from the rnc to the base stations in a header of a packet . either the rnc forwards just the plain information or a mean value of the importance according to this information over a certain time period . if packets are sent continuously it is possible that the rnc sends information of the importance back to a base station for every received data packet from the base station . this implies that the base station has to combine and evaluate all pieces of information to get a correct judgement of what to do to save resources . the information is then used in the base stations to decide locally for example which downlinks that should be given less power or how the signal processing resources for the receiving of different uplinks should be distributed in case of a shortage of resources . another method for informing the base stations of the importance of different branches is to provide each data packet that is sent to the base stations with a value telling how important it is that this data is forwarded to the mobile terminal . the value is thus based on the information of the uplinks , downlinks and codes that is available in the rnc . the base station may then calculate from these values the importance of each branch . still another method is to not send data at all from the rnc to branches that are unnecessary for the total signal . the rnc still uses the information about uplinks , downlinks and codes or one or two of them to decide which branches that are not so important . the base station may then from the amount of received data estimate the importance of each branch and in the case of a shortage of power use this estimation when choosing which branch that should be given less power . however , if a base station receives nothing from the rnc it is important that the base station does not transmit anything to the mobile terminal since this “ nonsense signal ” if sent would disturb the real signal . this is described in a copending u . s . patent application ser . no . 09 / 042359 filed mar . 13 , 1998 . still another method is to let the base station count the number of faulty signal blocks it has received from a mobile terminal and to let the rnc inform the base station if there are more than one base station connected to the mobile terminal and perhaps about downlink conditions . if there are more than one base station connected and the base station receives many faulty blocks the base station can decide by itself to decrease the power to a downlink . with this information about both uplink and downlink conditions and also about codes , that in some way is sent to the base stations from the rnc in different combinations , the base stations can make a correct decision about how to save resources . for example a branch with little importance to the signal quality could be given less power or maybe be removed . and if there is a lack of codes the code used for the branch that has been removed should be reallocated to a new connection . if the condition of a branch is changed and no data is going to be sent from the rnc to the base station concerned , i . e . no packet is going to be sent , there is a possibility to send packets without data , just containing the needed information in a header . there are as already mentioned different possibilities for the rnc to inform the base stations of the conditions of the different branches . one is that the rnc sends information to the base stations every time a packet is sent . in this case the base station needs to combine and evaluate these pieces of information by itself . another possibility is that the rnc collects information about the different branches from the base stations and the mobile terminals for a certain time period and combines it to a judgement of the importance of the different branches to be sent to the base stations . in a first embodiment of the invention , shown in fig3 the rnc 30 comprises receiving means 40 adapted to receive uplinks from the base stations and measurement reports on the pilot signal measurements from the mobile terminals . the receiving means 40 is connected to a deriving means 41 adapted to derive a resulting signal from the incoming uplinks from the base stations . in this embodiment the deriving means 41 combines the uplinks to acquire a signal of good quality . the rnc comprises also determination means 42 connected to the deriving means 41 . the determination means 42 is adapted to determine the importance of each received uplink to the resulting signals . the rnc also comprises informing means 44 connected to the determination means 42 adapted to inform each base station concerned about for example this determination . the information comprises in this embodiment information about the quality of the uplink in relation to the other received uplinks from the same signal and also information about the quality of the different downlinks from the base stations . the downlink information is obtained from the measurement reports received from the mobile terminals . in this embodiment this information is sent to the base stations whenever there is a change in the importance of the branches . this could be done in a packet switched interface where information could be sent in a header of a packet even if there is no payload to be sent . in this first embodiment each base station comprises , as shown in fig3 in the first base station 3 , a resource device 31 adapted to either decrease the transmission power for a specific branch or remove this specific branch and if necessary reallocate the code of the branch to a new connection when the base station experiences a decrease or a lack of resources . the resource device 31 comprises a receiving means 32 , a deciding means 34 connected to the receiving means 32 and a power controlling means 36 connected to the deciding means 34 . the receiving means 32 receives the information sent by the informing means 44 in the rnc 30 . the deciding means 34 decides according to the information received in the receiving means 32 which downlinks that should be removed or be given less power if there is or is about to be a shortage of resources in the base station . the power controlling means 36 turns off or decreases the power according to the decision in case of a shortage of resources . the power controlling means 36 could also reallocate the code for the branch that has been removed to a new connection if there is or is about to be a lack of codes . in fig4 a base station 50 connected to a node 52 in the network according to a second embodiment of the invention is shown . the node 52 is of the same kind as illustrated in fig3 . it comprises a receiving means 40 ′, a deriving means 41 ′ connected to the receiving means , a determination means 42 ′ connected to the deriving means 41 ′ and an informing means 44 ′ connected to the determination means 42 ′. the functions of the means 40 ′, 41 ′, 42 ′, 44 ′ are the same as the functions of the means 40 , 41 , 42 , 44 in the first embodiment besides that in this embodiment the information about the quality of the uplinks and downlinks and information about the codes is sent from the node 52 to the base station as an answer every time data , such as voice or text , has been delivered from the base station 50 to the node 52 . this implies that the base station 50 has to combine and evaluate the pieces of information by itself . for this purpose a resource device 54 is provided in the base station 50 . it comprises a receiving means 56 , a decision means 58 and a power controlling means 59 of the same kind as in the embodiment of fig3 . the power controlling means 59 is in this embodiment connected to a receiving resources controlling means 60 adapted for controlling the receiving resources in the base station . the resource device 54 comprises also a combining means 61 connected to the receiving means 56 and an evaluating means 62 connected to the combining means 61 and to the decision means 58 . in the combining means 61 the information from the node 52 is combined and in the evaluating means 62 the information is evaluated before the decision means 58 decides what to do to save resources . in this second embodiment the power controlling means 59 controls the power and the allocated codes as described in the first embodiment but it can also decrease the data rate for certain connections to save power . these two embodiments are just two examples of embodiments . by combining the different possibilities described above in different ways a number of new embodiments is achieved .	7
[ 0044 ] fig1 illustrates one version of the hydrolysis process and the arrangement of its component parts by which a urea - free ammonia gas stream is produced from solid urea . in this version , the gaseous ammonia - containing product formed is separated from the liquid phase aqueous reaction media remaining within the hydrolysis reactor , the contents of which are mainly comprised of unreacted urea , ammonium carbamate , water , and a lesser amount of biuret . as shown , the urea feed , line 3 , is supplied as a dry solid from bin 1 . the urea from this is fed into a dissolver 2 to which makeup water is supplied from line 4 in an amount to solubilize the urea . the urea solution formed is further adjusted to the desired concentration for feeding to the hydrolysis reaction by the addition of additional water introduced through line 5 . the solution is then pressurized by pump 6 for injection through line 7 into the hydrolysis reactor 10 , in which the urea is converted to ammonium carbamate , ammonia and carbon dioxide upon heating under pressure . the heating may be provided by various means known to those familiar with the art , such as by internal or external heat exchange , as shown by heater 14 . a particularly useful way is with an internal pipe coil using steam or a hot heat transfer fluid . the heat input is adjusted to maintain the desired operating temperature and pressure to supply ammonia at the rate required . the contents are held at a constant volume by a liquid level controller which controls the urea feed pump and maintains a space above the aqueous liquid reaction media for the gaseous ammonia and carbon dioxide products to separate from the liquid . an expanded section 11 of the hydrolysis reactor 10 can be used to aid in the separation of the product gases from the liquid solution and prevent carryover of unreacted urea by entrainment and / or foaming . unreacted urea and / or biuret and intermediate ammonium carbamate remain in the reactor in the liquid reaction media for eventual conversion . a back pressure valve 12 is used to maintain pressure in the reactor and control the flow of the gaseous products being removed . the gaseous ammonia and carbon dioxide are discharged at a controlled rate to match the needs of the nitrogen oxides removal , flue gas “ conditioning ”, or other applications . the ammonia - carbon dioxide stream is customarily diluted with a carrier gas , such as compressed air , steam or flue gas , or mixtures thereof introduced through line 13 , before discharge into the flue gas flowing in duct 20 , in order to aid in obtaining a better distribution of the ammonia into the flue gas stream , such as for reaction with nitrogen oxides . the gas leaving the reactor is not allowed to cool below 60 ° c . in order to prevent solids deposition from ammonium carbonate / bicarbonate formation , or until it is diluted enough to prevent such happening . [ 0046 ] fig2 illustrates another version of the process equipment arrangement designed to provide good separation of the gaseous ammonia and carbon dioxide hydrolysis products formed from the liquid reaction media in the hydrolysis reactor by use of an overflow takeoff line to maintain a constant level of the reaction media , through which a portion of the liquid reaction media is removed and recycled back through line 16 to the urea feed dissolver 2 , or into the feed to pump 6 through line 16 - b . control valve 15 prevents the discharge of product gas through the liquid recycle line and controls the rate of flow through line 16 . the process is operated in a manner similar to that described for fig1 . the recycled reaction media leaving through line 16 is comprised mainly of the unreacted urea , ammonium carbamate , dissolved ammonia and water . [ 0047 ] fig3 shows an equipment arrangement which reduces the amount of water carried away in the product gas stream . in this arrangement , a condenser 17 is located in the vapor line leaving the hydrolysis reactor 10 which condenses and removes a substantial portion of the water that is carried along with the product gaseous ammonia and carbon dioxide stream in line 21 leaving the hydrolysis reactor 10 . the condensed water is separated and removed in line 16 . this not only removes a substantial portion of the water from the gaseous ammonia and carbon dioxide product stream , but reduces the water requirements of the system . the condensate in line 16 may be returned to the system at various optional points . it may be recycled to the bottom of the hydrolysis reactor 10 through line 16 - a , to replace dilution water normally introduced through line 5 at line 16 - b , or to the urea dissolver 2 to replace a portion of the solution water normally introduced in line 4 . control valve 15 prevents the discharge of gas and allows only liquid to pass . the condenser 17 , control valve 12 and off - gas product line 21 are not allowed to cool below 60 ° c . in order to avoid deposition of ammonium carbonate solids . the heat requirements for the hydrolysis reaction system may also be reduced by using the urea feed stream from pump 6 , prior to its entrance into the reactor 10 , as the coolant to the condenser 17 , following which the heated feed stream in line 7 is delivered to the reactor 10 . [ 0048 ] fig4 shows another arrangement and method of operation in which the hydrolyzed reaction products are discharged from heated reactor 30 as a mixed liquid - gas stream and there is no separation of the gaseous reaction products within the reactor body . the liquid reaction media and gaseous product stream pass from reactor 30 and are discharged into a separator 31 also under pressure . the gaseous product stream is removed at a controlled rate through control valve 32 in line 33 , and the separated liquid phase reaction media recycled through line 34 . control valve 35 allows only liquid phase to pass . the discharged liquid media can optionally be recycled back to reactor 30 through line 34 - a by gravity , or fed to the suction side of reactor feed pump 6 through line 34 - b . in another option , the liquid media in line 35 can be recycled back to urea dissolver 2 . via line 34 . the gaseous ammonia , carbon dioxide and water vapor leave via line 33 and are fed at a controlled rate through control valve 32 into the process gas stream gas in duct 20 . the control valve and off - gas piping are heated to a temperature above 60 ° c . [ 0050 ] fig5 shows an equipment arrangement by which the product ammonia and carbon dioxide stream is diluted , that is particularly useful for the removal of nitrogen oxides by the scr and sncr methods , or the “ conditioning ” of flue gas to give improved particulates removal . in this , the product gas stream from the hydrolysis reactor , controlled by valve 12 or 32 discharges into mixer 22 into which a stream of compressed air , steam or combustion gas , or mixtures thereof , is introduced simultaneously . the increased gas volume and lower concentration of the diluted ammonia treating gas makes for a better distribution and commingling of the ammonia and the intimate mixing and contact needed for contacting and reaction with all of the nitrogen oxides molecules or fine particulates in the combustion gas stream . typically , the ammonia gas feed stream is distributed into the combustion gas stream by means of an injection grid with multiple feed points extending over the cross - sectional flow area of the duct or by multiple high pressure injection nozzles . with this arrangement , the dilution gas is air which is introduced through line 23 , is compressed by compressor 24 and then heated in heat exchanger 25 located in hot gas duct 20 prior to its introduction into contactor 22 . [ 0051 ] fig6 shows an arrangement by which the hot combustion gas stream may be utilized to supply the heat requirements of the endothermic hydrolysis reaction and thereby eliminate the requirement for an outside or separate source of heat , such as steam or hot oil . a sidestream of the hot flue gas in duct 20 is delivered through line 40 to blower 41 from which it passes through heat exchanger 42 in which it heats a circulating heat transfer fluid and exits back into the flue gas stream in line 43 . the heated heat transfer fluid leaves through line 44 and re - enters exchanger 42 in line 48 . the hot heat transfer fluid in line 44 is circulated by pump 45 through buffer tank 46 from which a portion is delivered to reactor 10 through control valve 49 at a rate as required by the hydrolysis reaction taking place in reactor 10 , in which heat is transferred through internal heat transfer coil 50 to the urea hydrolysis reaction media . the cooled heat transfer fluid leaves heat transfer coil 50 in reactor 10 through line 51 . the cooled fluid then joins the overflow from surge tank 46 exiting through pressure control valve 47 and returns to heat exchanger 42 for reheating . the heating of reactor 10 may also be provided by an exchanger located externally to the hydrolysis reactor . such a means may be used for heating the hydrolysis reactor as shown in the systems of fig1 , 3 and 4 , and / or dilution gas of fig5 and 6 . various of the individual equipment features , configurations and modes of operation described in the foregoing may be utilized in other arrangements . a test reactor for determining the rate of the hydrolysis reaction versus temperature for the thermal hydrolysis method for converting urea to ammonia was constructed of ¾ - inch diameter by 12 - inch long pipe with an expanded upper section similar to that shown in fig1 . the lower section is heated externally and a pressure gauge is located at the top of the expanded upper disengaging section . tests were conducted at a number of different concentrations of urea in water to determine the effect of urea concentration on the rate of the hydrolysis reaction . solutions were introduced into the lower section of the hydrolysis reactor and heated progressively to higher temperature levels in a batch mode of operation . the ammonia and carbon dioxide generated build up the gas pressure as the temperature is increased above 125 ° c . below 125 ° c . the rate of reaction is very slow . table 1 shows the effect of temperature on the rate at which the hydrolysis reaction proceeds for several urea concentrations ( as ammonia generated ) and the effect of an additive reaction rate enhancing material — vanadium pentaoxice ( v 2 o 5 )— on the reaction rate , when operated in a batch mode . a graphical comparison of the data presented in example 1 shows the rates of hydrolysis for urea with water alone , with vanadium oxide ( v 2 o 5 ) and molybdic oxide ( moo 3 ), is shown in fig7 . the addition of vanadium oxide to the reaction media enhances the rate of the hydrolysis reaction , as shown by the data of example 1 . vanadium pentaoxide , or its salts , shows the greatest effect in increasing the rate of reaction , both as to the kindling temperature for the reaction and over the entire temperature range . the enhancement , however , can be equaled by a modest increase in temperature for the water system alone . the rate of the urea hydrolysis reaction is also enhanced to varying degrees by the addition of other elements selected from groups ii i - b , iv , v and vi - a of the periodic chart of the elements to the reaction media . in their elemental metallic form , there is no significant increase over that of water alone . materials showing enhancing activity include the oxides and ammonium and alkali metal salts of molybdenum , chromium , tin , bismuth , boron , and certain active surface solid materials , such as activated carbon , activated silica and activated alumina , and ion - exchange resins in their acid and basic forms . the solids not dissolved among these may be used in either suspended or fixed positions . reaction rates are further increased by operation at elevated ph levels ( above ph = 10 ), as obtained by the addition of alkali metal hydroxides , carbonates , or bicarbonate salts to the reaction media with both water based reaction systems alone , or when added to an enhancer - containing system . at a ratio of 0 . 5 k 2 co 3 : 1 . 0 urea in a 40 % urea solution , rates similar to that of vanadium oxide are obtained . the hydrolysis reaction was operated in a continuous mode in which a solution of 40 percent urea in water was pumped at a controlled rate into the hydrolysis reactor described in example 1 , in which it was heated to temperatures up to 155 ° c . with the heat “ input ” controlled to maintain a pressure of 75 psig . the ammonia - containing product gas stream formed discharged through a needle valve at a controlled flow rate equivalent to 0 . 2 g / min . the ammonia - containing product gas generated was absorbed in a measured amount of water and analyzed at regular intervals for buildup of ammonia . a constant level of the urea solution was maintained in the reactor by injection of urea feed solution into the bottom of the hydrolysis reactor at a rate of 0 . 9 ml / min ., which essentially matches the ammonia generation rate of 0 . 2 g / min . and the amount of urea injected . the urea hydrolysis reactor and system described in example 3 was operated in a continuous manner in conjunction with a pilot plant combustion gas generator to demonstrate the effectiveness of ammonia derived from the hydrolysis of urea for the actual removal of nitrogen oxides from a typical combustion gas stream when using a regular commercial scr catalyst . the temperature of the nitrogen oxides containing combustion gas was adjusted to approximately 750 ° f . at the catalyst inlet . at a concentration of 200 ppm nox in the inlet feed gas to the catalyst section the concentration of nitrogen oxides in the leaving combustion gas was reduced to the 18 ppm level , to give a removal efficiency of better than 90 %. the urea hydrolysis section generated ammonia smoothly at a constant rate as evidenced by the constancy of the nitrogen oxides concentration over an extended period of operation . when the system was operated with an aqueous ammonia solution as the source of ammonia and the same flue gas stream and catalyst , the removal of nitrogen oxides was the same . plant operating data developed for an industrial scale 110 mw gas fired turbine combined cycle power plant are shown in table 2 . the plant currently uses hazardous anhydrous ammonia that is stored in a 25 ton storage vessel , which provides a 30 day supply . employment of the subject invention eliminates the need for storage of anhydrous ammonia . urea is available commercially in solid form or as a 50 % solution that can be delivered to the plant site by tank car or truck . for the 50 percent urea solution , a 11 , 000 gallon storage tank provides 30 days capacity . the 50 % urea solution from the storage tank is then diluted to 40 % by feeding in deionized water at a matching rate as the urea is fed to the hydrolysis reactor . the hydrolysis reactor is heated with steam ( 200 psig ) and is operated at an approximate temperature of 150 ° c . and an operating pressure of 75 psig . the reactor pressure is controlled by the heat input to the reactor and the gas takeoff rate is controlled by an adjustable control valve , which adjusts to match the required amount for control of the nitrogen oxides in the combustion gas stream . the control valve and discharge piping are heated to above 80 ° c . the product gas stream is diluted with hot compressed air prior to introduction into a distribution grid in the flue gas duct . it is to be understood that the examples shown are given by way of illustration and are not to be construed as limiting the invention . a similar process may be used for other processes requiring ammonia . the above descriptions are for teaching the person of ordinary skill in the art how to practice the present invention and it is not intended to detail all of those modifications and variations of it which will become apparent to the skilled worker upon reading the description . it is intended , however that all such obvious modifications and variations be included within the scope of the present invention which is defined by the following claims .	2
turning more specifically to the drawings , in fig1 the transmission housing 10 supports within its interior the engine pulley 12 and the drive shaft pulley 14 . each of the pulleys has one sidewall fixed in the horizontal direction and the other movable in the horizontal direction , so that the spacing of the groove between the two sidewalls of each pulley is variable . the mechanism for controlling the spacing will be discussed in more detail below in conjunction with fig2 but basically this mechanism is included in a hydraulic actuator unit 16 . this actuator unit located between the two pulleys controls the position of the horizontally movable sidewall of each pulley . since the movable sidewall is opposite for the two pulleys , one , for example being the right wall 12a in pulley 12 and the left wall 14a in pulley 14 , movement of the horizontally movable wall 12a of pulley 12 to the left ( as viewed in fig1 ) decreases its spacing from the horizontally fixed wall 12b , whereas movement of the horizontally movable wall 14a of pulley 14 to the left increases its spacing from the horizontally fixed wall 14b . the opposite results are achieved when both walls 12a and 14a are moved to the right . the engine pulley 12 is coupled to the shaft 18 which is linked to the engine ( not shown ) and the driven shaft pulley 14 is coupled to the driven shaft 20 . the coupling will be described in more detail below . bearings 22 are included to support rotation of the pulleys and shafts with respect to the housing in the usual fashion . as is seen , the sidewalls of each of the pulleys 12 and 14 are slanted in the working parts of their widths so that the grooves 24 and 26 , respectively , between the sidewalls are tapered , and their widths increase with distance from the pulley axes , which lie along the associated shafts 18 and 20 , respectively . the drive belt 28 rides between the two sidewalls of each of the two pulleys . as is described more fully hereinafter in connection with fig4 and 5 , the belt 28 is provided with transverse metal bands or pins 30 whose end portions 32 are bent and ground at their tips to match the taper of the sidewalls so that a tight slipless contact is made between the tips and the sidewalls of the pulley . the bent ends provide a predesigned spring tension adequate to keep the tips pressed against the sidewalls . when the sidewalls of pulley 12 are far apart as shown in fig1 the belt 28 will be located close to the shaft 18 , so that pulley 12 has a small effective radius and will make several rotations for each rotation of pulley 14 in which the belt 28 rides higher in the groove so that it has a larger effective radius . when the sidewalls of pulley 12 are moved closer together , thereby also moving the sidewalls of pulley 14 farther apart , the belt 28 will rise in pulley 12 and drop in pulley 14 and the ratio of the radii of the two pulleys will thereby change . as will be understood , fig1 depicts the pulleys 12 and 14 in a very low ratio configuration , and any change would normally be in the direction of a higher ratio , i . e ., so that the belt would rise in pulley 12 and drop in pulley 14 . returning to the hydraulic actuator unit 16 , shown in more detail in fig2 and used to control the horizontal movement of the horizontally movable sidewalls 12a and 14a , it comprises a cylinder 36 defining a chamber 38 within which is a compression spring 40 which bears against and biases an axial plunger member 42 to the right . the plunger member 42 includes an axial shaft 44 extending axially through the chamber 38 and carrying at its opposite ends brackets 46 and 48 for engagement with the horizontal movable walls 12a and 14a , respectively , of the two pulleys 12 and 14 ( see fig1 ). an annular stop member 50 surrounds the shaft 44 and is axially captured within the chamber 38 by split rings 52 . o - rings 54 and 56 carried by the plunger 42 and the stop member 50 seal the chamber 38 relative to the shaft 44 and the cylinder 36 . a further o - ring 58 establishes a seal between the shaft 44 and the end wall 60 of the cylinder 36 . to effect a ratio change , fluid is introduced into and withdrawn from the chamber 38 by way of a fluid coupling 62 to urge the plunger 42 to the left against the bias of the spring 40 . as illustrated in fig2 the spring 40 normally biases the plunger to the low ratio configuration of fig1 and 2 . the pressure provided by the fluid in cavity 38 is controlled by the factors which are normally used to determine the optimum effective gear ratio of an automatic transmission system and will not be discussed in detail herein . other arrangements are known for controlling the movement and may be substituted . for example , a second fluid coupling 64 may be provided in place of or as a supplement to the spring 40 depending on the control system used . with reference to fig1 and 3 , the manner in which shafts 18 and 20 are coupled to the sidewall members of the pulleys 12 and 14 , respectively , will now be described . for illustrative purposes , the description will be made with reference to the connection for pulley sidewall 14a , but it will be understood to apply to the other pulley sidewalls as well . as shown in fig1 the sidewall member 14a contains an annular hub portion 66 that is rotatably mounted on the surface of shaft 20 . there is no direct driving connection between the sidewall member 14a and the shaft 20 . rather , the driving connection is made through an intermediate resilient ring member 68 and an annular collar member 70 . the collar member includes a first cylindrical portion 72 that is splined or otherwise rigidly connected to shaft 20 for rotation therewith . at its axially inner end the collar 70 includes an enlarged diameter portion 74 which forms a seat for the bearing 22 ( see fig1 ). inwardly of the bearing seal portion 74 , the collar is formed with an upstanding flange 76 which engages , in a manner more fully described hereinafter , the intermediate flex ring member 68 . the outer bearing seat for the bearing 22 is carried by a non - rotating cap member 78 ( fig1 ) that fits over the collar member 70 . to stabilize the unit a sealed bearing unit 80 is provided between the cap member 78 and the collar 70 . as shown in fig1 the bracket 48 of the actuator unit 16 engages the axially outer end of the cap member 78 for purposes of control of the width of groove 26 in pulley 14 . the other end bracket 46 of the actuator unit 16 engages the axially inner end of a like cap member 81 associated with the movable sidewall member 12a of the pulley 12 . an access cover 82 fits over the axially outer ends of the drive shaft 20 and the actuator 16 . as illustrated in fig3 the facing surfaces 76a and 68a of the flange 76 and the ring member 68 , respectively , are formed with matching wedge serrations to provide a secure driving engagement therebetween . the other surface 68b of ring member 68 and the facing surface 66a of the hub portion 66 of the sidewall member 14a ( shown in phantom ) are also formed with matching serrations for the like purpose . as mentioned , the ring member 68 is made of a resilient material , such as a suitable elastomer and is so proportioned as to wedge members 66 and 70 apart when one element is rotatably displaced with respect to the other . because brackets 46 and 48 are rigid , the displacement can only be an inward clamping force on the belt . firstly , and most importantly , since the driving member 76 is clamped by way of the serrations to the resilient member 68 , the force clamping the two together will be dependent on the torque being applied to the clamping member 68 and this clamping force will be further transmitted as an inward clamping force between the pulley sidewall to which member 76 is bound and the belt . this force is proportional to the torque being applied . additionally , this resilient member helps provide isolation against shocks which might affect the system deleteriously , although most of the vibration isolation is provided by the rotational flex or displacement between members 66 and 70 . advantageously , a driving connection utilizing a resilient element 68 , as described , is used between both the horizontally fixed and horizontally moveable sidewalls of each pulley with its associated shaft . in some instances , it may be sufficient if the resilient coupling is provided between only one of the sidewalls and its shaft . in other instances , it may prove sufficient to provide such resilient coupling between only one shaft and one or both of the pulley sidewalls associated with it . it is to be recognized , that this aspect of the invention can be independent of the belt aspect of the invention and can find utility with other forms of belts . alternatively , the novel form of belt can be used independently of this novel driving arrangement . in particular in some instances , it may prove advantageous to use instead , the known &# 34 ; roller wedge &# 34 ; mechanism for coupling the shaft to the pulley wall . this mechanism can also be used to provide a strong clamping force between the belt and the pulley walls which is proportional to the torque applied . in this technique , a roller is enclosed between inwardly tapered portions of the shaft and that pulley wall , such that rotation , for example , of the shaft , coupled with resistance of the wall will cause the roller to try to climb the incline in its enclosure . however , because the shaft cannot move axially because of bearings in the housing , the shaft causes the wall to rotate as well as exert an inward or clamping force on the belt . fig4 and 6 illustrate the structure of one embodiment of a drive belt in accordance with this feature of the invention . the belt comprises a matrix or base 84 , typically of a rubber compound of the type useful in pulley belts . a plurality of transversely extending pins or bands 30 of generally rectangular cross section are imbedded in the base over most of their lengths , only the end portions 32 being free . the end portions 32 are bent and their tips 88 ground so that the belt will sit tightly between the sidewalls . typically the edges will be ground to an angle of about 25 degrees from the vertical , and the sidewalls forming the grooves in the pulleys are tapered similarly . other bevels may of course be used . also imbedded in the base 84 is a plurality of cables or cords 90 , suitably fiberglass or the like , which extend longitudinally along the length of the belt to increase its resistance to stretching during operation . importantly the pins are spaced apart from one another in the longitudinal direction of the belt as seen best in fig6 . fig5 and 7 show an alternative form of the belt which differs in several respects . in this form , the pins or bands 130 are circular in cross section . additionally , the base 184 is divided transversely into two sections and each pin includes a central section 130a which is an inverted u to increase the flexibility of the belt particularly in the transverse direction . as previously mentioned , an important characteristic of this belt is that it is designed to make essentially a metal - to - metal contact with the sidewalls of the groove during operation . a metal - to - metal contact is therefore established and maintained so long as the drive is active . such a contact because of its high frictional characteristics , has many times the holding ability of to the contact in a drive in which torque is transmitted through an oil film . moreover , though ordinarily it is preferred to run the belt completely dry , in some instances it may be useful to have an oil film initially present at the beginning of energizing the drive . in such a case the tips of the pin should be so shaped that any such film is rapidly squeezed out between the two working surfaces so that a metal - to - metal contact is quickly established and thereafter maintained as long as the drive is active . it is important to avoid overheating of the belt which might destabilize the rubber base . spacing the pins apart longitudinally and the use of exposed end portions for the metal pins acts to keep the belt from overheating by circulation . moreover , having the pins only partially imbedded in the matrix also helps avoid overheating . a spacing apart longitudinally comparable to the width of the pin has been found particularly advantageous . in the two embodiments shown , each of the pins comprises a slightly curved intermediate portion between a pair of end portions which are bent to provide spring action on the tapered tips to keep the tips pressed to the sidewalls . in some instances , it may prove advantageous to provide a more curved intermediate portion , the radius of curvature being chosen to provide an increase in the flexibility of the pins to improve the gripping action between the pin tips and the pulley sidewalls . especially in such instances , it may be advantageous to imbed the central portions of the pins more deeply in the rubber base . the cables provide longitudinal strength and stability of the belt while permitting considerable flexibility in the transverse direction . it should be apparent that there should be considerable latitude in the choice of materials forming the belt . for example , the rubber - like compound used for the base can take a variety of forms consistent with its desired characteristics of stability despite heating , strong support of the pins and enough flexibility to permit a tight fit even though the pin tips must be permitted to flex in and out as the spacing of the walls is varied . the effective dimension of the pin will change to allow speed change . tangential initial contact later will be either lengthened or shortened . the pin tips must never lose contact with the pulleys so the pins must have the capacity to make this adjustment . as previously mentioned , the pins are advantageously essentially of hardened steel but protective coatings may be useful . although the invention has been described with reference to specific embodiments thereof , it will be understood that such embodiments are illustrative only and that the invention is susceptible of variation and modification without departing from the inventive concepts disclosed . all such variations and modifications , therefore , are intended to be encompassed within the spirit and scope of the appended claims .	5
when referred to hereafter , the terminology “ wireless transmit / receive unit ( wtru )” includes but is not limited to a user equipment ( ue ), a mobile station , a fixed or mobile subscriber unit , a pager , a cellular telephone , a personal digital assistant ( pda ), a computer , or any other type of user device capable of operating in a wireless environment . when referred to hereafter , the terminology “ base station ” includes but is not limited to a node - b , a site controller , an access point ( ap ), or any other type of interfacing device capable of operating in a wireless environment . although the present disclosure is described in the context of hspa , it should not be construed as being limited to this context , which is used as an example . a plurality of power grant tables are stored in the wtru . in a first embodiment an index offset value and extended power grant table are disclosed . the plurality of power grant tables is derived from the extended table . as an example , one table of the plurality may contain power values which can be used for bpsk modulation while another contains power values which can be used for 16qam modulation . the offset value is used as a pointer for the starting index and is established as part of initial call setup between two transceivers . an example of two such transceivers is a wtru and a node b initiating a call setup by layer 3 signaling . once the offset value is known to the wtru , the portion of the extended grant table that will be used is known to the wtru . this method provides flexibility since the extended table could be any size and only the applicable portion of the table is used . referring to fig1 , by way of example , an absolute grant value table , formerly with 32 indices , is extended to 64 indices by the addition of 32 new entries . an existing table is shown as feature 15 in fig1 , containing indices 0 through 31 and corresponding power ratio values in the column headed “ absolute grant value .” the power ratio values are shown as squares of ratios of e - dpdch amplitude to dpcch amplitude . ( e - dpdch is enhanced dedicated physical data channel and dpcch is dedicated physical control channel .) the notation x4 , x6 etc . in entries for index 24 - 31 indicates the number of e - dpdch channels for each of these entries . index 24 is associated with four e - dpdch channels , index 25 with two , etc . the table designated as feature 15 is defined in the third generation partnership project ( 3gpp ) specification 25 . 212 , version 7 . 5 . 0 , section 4 . 10 . 1a . 1 . the 32 newly defined entries , defining a second table , are indicated as feature 10 , with indices 32 through 63 . the two tables of fig1 can accommodate both 16qam modulation power ratios and bpsk modulation power ratios . for bpsk modulation , the index offset value is zero . this indicates that the table containing index values from 0 - 31 shall be used for bpsk . for 16qam modulation , the index offset value is 32 . this indicates that the table for 16qam contains the entries having index values from 32 - 63 . if the modulation scheme is on the borderline between bpsk and 16qam , an index offset value of 16 may be used . this would indicate the use of the upper range of bpsk ( index 16 - 31 ) and the lower range of 16qam ( index 32 - 47 ), resulting in a range of values from index number 16 to 47 . to reduce the number of bits used to indicate the index offset value , a large table , for example a table with the number of indices much greater than 64 , may be split into segments corresponding to the offset value . if , for example , only bpsk and 16qam are used , then only 1 - bit is required to indicate the offset value to determine whether the upper half 10 or lower half 15 of table 1 is used . the index offset value may be used to specify a custom power grant table depending on the number of bits that are available for use in the initial setup . this method provides flexibility with minimal changes in initial setup . the offset value in the table may be transmitted to the wtru in multiple ways . a first alternative is direct transmission of value during setup . direct transmission of the offset value may be set up to accommodate any desired offset value . a second alternative is to make the offset dependent on the slot offset of the agch relative to a top sub - frame boundary . for a currently configured agch , this allows for three possible values , namely 0 , 1 or 2 . a third alternative is to make the offset a function of the hybrid radio network temporary identifier ( h - rnti ). the h - rnti offset value could be pre - assigned for different offset values . a fourth alternative is to make the offset dependent on the agch code or channel number that is being used for the agch . the agch coding or channel number could be set up for different offset values . only one code currently exits for the agch . other convolutional codes with same rate and puncturing could be used to signify different offsets . this may require that the wtru perform several decoding cycles of agch data until the right code is selected . as a fifth alternative , the offset could be signaled by the radio access network ( ran ) through radio resource control ( rrc ) signaling . the value of the offset , and thereby the grant table being used , can either be static ( i . e . same offset throughout the duration of the connection ), semi - static ( i . e . reconfigurable through l3 or l2 signaling ) or dynamic ( i . e . dynamically signaled to the node b for every new transport block ). a second embodiment uses a separate power grant table for different modulation types , such as bpsk and 16qam modulation . in this case , no setup is required since the modulation type determines the tables to use . the applicable table is designated based on the modulation type . by way of example , for bpsk modulation , a current absolute grant value mapping may be used , while for 16qam modulation , a new grant table could be devised and either preconfigured in the wtru or signaled to the wtru . a current table which could be used for bpsk is defined in the third generation partnership project ( 3gpp ) specification 25 . 212 , version 7 . 5 . 0 , section 4 . 10 . 1a . 1 . this method has no impact on current systems other than adding a new table for 16qam modulation . a third embodiment uses an existing power grant table , but with one or more larger intervals for the power ratio values so that the power values cover both bpsk and 16qam modulation or other modulation types . this may be done by updating existing grant tables with new values . in particular , two power grant tables used in the wtru may be tables 16b and 16b . 12 in third generation partnership project ( 3gpp ) specification 25 . 212 , version 7 . 5 . 0 , section 4 . 10 . 1a . 1 . the 3gpp specification 25 . 331 , version 7 . 5 . 0 , section 10 . 3 . 6 . 86a may also be used to define the tables . grant tables , intervals , or both may be pre - configured in a wtru . alternatively , tables , intervals or both may be signaled to the wtru through rrc signaling upon establishment of the radio communication . in the latter case , either a table or an interval between power values can also be dynamically reconfigurable throughout the life of a connection through rrc signaling . the updated grant table may be signaled by the ran to the wtru in one of the following ways : signaling the entire table ; signaling the first and last power grant values ; or signaling an interval between power values . fig2 shows a wireless transmit receive unit ( wtru ) 100 configured to operate according to the method disclosed above . wtru 100 contains a transceiver 105 operating as a transmitter and a receiver , a memory 110 , and a processor 115 . memory 110 stores a plurality of power grant tables . transceiver 105 is configured for receiving a signal designating which table is to be used to grant power levels during a communication . the signal may contain an offset or an interval for defining and designating grant tables , as described above . transceiver 105 may receive grant tables which may be stored in memory 110 . processor 115 processes the information in the signal , designates the grant table to be used , and controls transmitted power based on the designated table . although the features and elements of the present disclosure are described in particular combinations , each feature or element can be used alone without the other features and elements or in various combinations with or without other features and elements . the methods or flow charts provided in the present disclosure may be implemented in a computer program , software , or firmware tangibly embodied in a computer - readable storage medium for execution by a general purpose computer or a processor . examples of computer - readable storage mediums include a read only memory ( rom ), a random access memory ( ram ), a register , cache memory , semiconductor memory devices , magnetic media such as internal hard disks and removable disks , magneto - optical media , and optical media such as cd - rom disks , and digital versatile disks ( dvds ). suitable processors include , by way of example , a general purpose processor , a special purpose processor , a conventional processor , a digital signal processor ( dsp ), a plurality of microprocessors , one or more microprocessors in association with a dsp core , a controller , a microcontroller , application specific integrated circuits ( asics ), field programmable gate arrays ( fpgas ) circuits , any other type of integrated circuit ( ic ), and / or a state machine . a processor in association with software may be used to implement a radio frequency transceiver for use in a wireless transmit receive unit ( wtru ), user equipment ( ue ), terminal , base station , radio network controller ( rnc ), or any host computer . the wtru may be used in conjunction with modules , implemented in hardware and / or software , such as a camera , a video camera module , a videophone , a speakerphone , a vibration device , a speaker , a microphone , a television transceiver , a hands free headset , a keyboard , a bluetooth ® module , a frequency modulated ( fm ) radio unit , a liquid crystal display ( lcd ) display unit , an organic light - emitting diode ( oled ) display unit , a digital music player , a media player , a video game player module , an internet browser , and / or any wireless local area network ( wlan ) module .	7
referring to fig1 a first presently preferred embodiment of a security cover 10 for a display case 12 is shown . the display case 12 , commonly used in retail establishments for merchandising jewelry or other valuable items , includes a typically wooden base 14 supporting a glass enclosed display area containing the jewelry or similar items . the display area is enclosed by transparent glass for viewing of the items and includes a glass front face 16 , a glass rear face 18 , a glass top face 20 and glass end faces 22 . commonly , the rear face 18 of the display case 12 may be glass or another material and include sliding and lockable doors ( not shown ) for convenient access to the contents of the display case 12 by a salesperson . it should be readily understood by those skilled in the art that the display case shown and described herein is for exemplary purposes only and should not be considered a limitation upon the scope of this invention as defined by the appended claims . for example , the present invention is readily useful for a variety of display case sizes , configurations , geometries and designs . the security cover 10 , according to a first presently preferred embodiment of this invention , as shown in fig1 and 6 , includes a pair of generally l - shaped mating panels 24 which are secured together by an elongate lock bar 26 and a lock 28 . the panels 24 are releasably mounted to the base 14 of the display case 12 by an anchor in the form of a front rail 30 and a rear rail 32 . the front and rear rails 30 , 32 are positioned immediately below the front and rear glass faces 16 , 18 , respectively , of the display case 12 and are mounted to the base 14 as will be described later herein . each panel 24 of the security cover 10 is generally l - shaped and , when installed on the display case 12 , includes a generally vertical pane 34 juxtaposed to and covering the glass front face 16 or glass rear face 18 and a generally horizontal pane 36 juxtaposed to and covering at least a portion of the glass top face 20 of the display case 12 in the presently preferred embodiment . panes of the panels 24 may be included for covering the end faces 22 of the display case 12 as required within the scope of this invention . each panel 24 is preferably molded or otherwise formed of an opaque plexiglass , lexan ®, abs plastic or similar material . preferably , the panels 24 are a frangible - resistant rigid material which is resistant to breaking , mutilation , fracture or the like . additionally , the panels 24 are preferably opaque to inhibit visual access to the contents of the display case 12 when installed thereon . the horizontal and vertical panes 36 , 34 are rigidly connected to conform to the geometry of the display case 12 to which they are installed . depending upon the forming technique used in manufacturing the panels 24 , a generally vertical lip 38 may be included at the juncture between the vertical and horizontal panes 34 , 36 or , as shown in a second presently preferred embodiment of the panels in fig6 a smoothly continuous corner 40 may be formed at the juncture between the panes 34 , 36 . the vertical lip 38 also serves as a structural member to provide added strength to the display cover 10 in this area to distribute the stresses from hammer or other blows and prevents such forces from being transmitted to the attachment points of the rails 30 , 32 . a hook 42 extends the length of each panel 24 along a lower proximal edge of the vertical pane 34 for releasably coupling the panel 24 to the anchor rail 30 , 32 . depending upon the mounting mechanism for the anchor rail 30 , 32 , a notch 44 may be provided in the hook 42 to accommodate the mounting mechanism . preferably , a sloped sill 46 is also included along the lower portion of the vertical pane 34 of each panel 24 . the sloped sill 46 protrudes from the vertical pane 34 and overhangs the anchor rail 30 , 32 as shown in fig6 so that a downwardly directed blow by a hammer or other blunt instrument is deflected from impacting and damaging the anchor rail 30 , 32 . an upstanding flange 48 extends the length of each panel 24 along a distal edge thereof on the horizontal pane 36 of the panel . the flange 48 of each panel 24 is juxtaposed to the flange 24 of the complimentary panel 24 generally along the longitudinal center line of the top glass face 20 of the display case 12 in the embodiments shown in fig1 and 6 . the flanges 48 each include a plurality of spaced inverted t - slots 50 which correspond in size , location and configuration with the t - slots 50 in the flange 48 of the mating panel 24 . the t - slot 50 includes a generally vertical opening or mouth 52 connected to oppositely directed stems 54 . additionally , at least one and preferably two lock apertures 56 a , 56 b are provided in the flanges 48 . the lock bar 26 , as shown in fig1 - 3 , has a generally inverted u - shaped configuration with a pair of spaced sidewalls 58 . the lock bar 26 is also preferably made out of 0 . 060 inch thick stainless steel . a plurality of pins 60 extend between the sidewalls 58 of the lock bar 26 at spaced locations corresponding to the locations of the t - slots 50 in the flanges 48 . similarly , at least one lock bar aperture 62 is provided through each of the sidewalls 58 of the lock bar 26 . for installation of the lock bar 26 , the pins 60 are aligned with the mouth 52 of the t - slots 50 and the lock bar 26 is pushed downwardly with the flanges 48 positioned between the spaced sidewalls 58 thereof until the pins 60 bottom out in the t - slots 50 . the lock bar 26 is then slid or translated longitudinally relative to the panels 24 in either direction so that each pin 60 is seated within one of the stems 54 of the respective t - slot 50 . once the pins 60 are inserted into the stems 54 of the t - slot 50 , the lock bar apertures 62 register with one of the lock apertures 56 a , 56 b in the flanges 48 so that the pad lock or other locking mechanism 28 can be inserted through the lock apertures 56 a , 56 b and the lock bar apertures 62 to securely enclose the faces of the display case 12 . in addition to joining the panels 24 together , the lock bar 26 provides a structural member at the center of the display case 12 to withstand the stresses of an attack . referring to fig4 and 5 , a mounting mechanism for each anchor rail 30 , 32 is shown . the anchor rail 30 , 32 is preferably a circular metal rail with a tubular opening 64 on each end thereof . a post 66 projecting from an end cap 68 is received into the tubular opening 64 . the end cap 68 also includes a bore hole 70 through a body portion 72 thereof . the end cap 68 is mounted to the base 14 of the display case 12 by a preferably three inch long screw 74 inserted through the bore hole 70 and screwed into a wooden , particleboard , plywood or other similar material portion of the base 14 . preferably , a metal , generally square plate 76 having a central hole 78 therethrough is positioned between the end cap 68 and the base 14 of the display case 12 for more secure mounting of the rail 30 , 32 . the opposite end of the rail 30 , 32 is likewise mounted to the base 14 with an end cap 68 , screw 74 and plate 76 . spaced along the length of the rail 30 , 32 between the end caps 68 are a plurality of spacers 80 positioned between the rail 30 , 32 and the base 14 of the display case 12 . the spacers 80 include a central bore hole 82 through which a screw 84 is inserted through a hole 86 in the bottom 88 of a notch 90 on the rail 30 , 32 to firmly anchor the rail 30 , 32 approximately three - eighths of an inch from the base 14 . preferably , the screws 74 , 84 are inserted into a typically three - quarter inch thick particleboard , plywood or other wooden portion of the base 14 underlying the display area of the display case 12 , as shown in fig5 . as such , the rail 30 , 32 is securely mounted to the display case 12 for anchoring the panels 24 of the security cover 10 to resist removal , mutilation , dislodgment or the like . it should be readily understood that the installation of the anchor rails 30 , 32 and other components of the security cover 10 according to a presently preferred embodiment of this invention are shown and described for exemplary purposes only . after the front and rear anchor rails 30 , 32 are mounted to the base 14 of the display case 12 , the respective panels 24 are installed by initially hooking the proximal hook - shaped edge 42 of each panel 24 onto the anchor rail 30 , 32 with the vertical pane 34 spaced from the front or rear face 16 , 18 of the display case 12 as shown in fig6 . with the hook 42 engaged on the rail 30 , 32 , the panel 24 is pivoted upwardly toward the display case 12 until the vertical pane 34 is juxtaposed to the front or rear face 16 , 18 of the display case 12 and the horizontal pane 36 is juxtaposed to the top face 20 of the display case 12 . after the complementary panel 24 is likewise installed , the lock bar 26 is installed onto the juxtaposed flanges 48 with the pins 60 inserted into the mouth 52 of the respective t - slots 50 . the lock bar 26 is then slid longitudinally to seat the pins 60 within one of the stems 54 of the t - slots 50 and thereby register the lock bar apertures 62 with the lock apertures 56 a or 56 b on the flanges 48 . the padlock or other locking device 28 is then inserted through the registered lock apertures 56 a or 56 b and lock bar apertures 62 and the installation of the security cover 10 according to a presently preferred embodiment of this invention is complete . removal of the security cover 10 is likewise easily accomplished by a salesperson by removal of the lock 28 , translation of the lock bar 26 to align the pins 60 with the mouth 52 of the respective t - slots 50 , removal of the lock bar 26 and pivotal removal of each of the panels 24 for storage and subsequent reuse . as such , the security cover 10 according to the presently preferred embodiment of this invention provides a frangible - resistant protective cover for the glass faces of the display case 12 . moreover , the security cover 10 is completely removable from the display case 12 when not in use and securely anchored thereto when in use . furthermore , the use of the security cover 10 does not detrimentally impact the viewing of the contents of the display case 12 during normal business hours nor hinder the access to those contents by salespersons . it should be readily understood that the presently preferred embodiments of the security cover 10 include two complimentary or mating generally l - shaped panels 24 with flanges 48 that are juxtaposed directly together on the top face 20 of the display case 12 . however , other arrangements are readily within the scope of this invention . for example , panels which are not l - shaped , complementary panels one of which is l - shaped having a horizontal pane that covers the entirety of the top face and security covers which include intermediate panel sections which cover a portion or all of one of the faces of the display case are within the scope of this invention . moreover , any arrangement of panels which , in combination , are juxtaposed to and / or cover the various faces of the display case are also within the scope of this invention . from the above disclosure of the general principles of the present invention and the preceding detailed description of at least one preferred embodiment , those skilled in the art will readily comprehend the various modifications to which this invention is susceptible . therefore , we desire to be limited only by the scope of the following claims and equivalents thereof .	0
the entire disclosures of u . s . application ser . no . 12 / 518 , 460 filed jun . 10 , 2009 , entitled distributed emitter voice lift system , and u . s . provisional patent application no . 60 / 874 , 818 filed dec . 14 , 2006 , entitled distributed emitter voice lift system with optional sound masking , are incorporated herein by reference . an improved system and method is disclosed for providing sound reinforcement in a classroom , an office , a conference room , an auditorium , or any other suitable venue . the presently disclosed system and method can provide voice reinforcement (“ voice lift ”) functionality via a plurality of spatially distributed emitters (“ loudspeakers ”), providing a more uniform sound field coverage and allowing a talker &# 39 ; s voice to sound equally natural and equally intelligible at all listener locations . the disclosed system and method can also provide sound masking functionality via the same plurality of spatially distributed loudspeakers used for the voice lift function , generating more uniform levels of acoustic sound masking signals throughout the venue in which the system is deployed . fig1 depicts an illustrative embodiment of a sound reinforcement system 100 , in accordance with the present invention . in the illustrated embodiment , the sound reinforcement system 100 includes a plurality of microphones 102 a , 102 b , at least one receiver 104 , at least one sound masking signal generator 106 , at least one system controller 108 , and a plurality of emitters (“ loudspeakers ”) 112 a , 112 b , 112 c , 112 d , 112 e , 112 f spatially distributed within a venue 110 . each of the microphones 102 a , 102 b is operative to detect the speech of a human operator ( the “ talker ”), to generate at least one voice signal corresponding to the detected speech , and to provide the voice signals to the receiver 104 . as shown in fig1 , the voice signals generated by the microphones 102 a , 102 b correspond to wireless ( e . g ., infrared ( ir ) or radio frequency ( rf )) voice signals 103 , and therefore the receiver 104 is configured as a wireless ( e . g ., ir or rf ) receiver . it should be appreciated , however , that the voice signals generated by the microphones 102 a , 102 b may alternatively be provided to the receiver 104 via wired connections . for example , the voice signals 103 may be provided to the receiver 104 using institute of electrical and electronics engineers ( ieee ) 802 . 11 , bluetooth , or any other suitable wireless or wired communications protocol . in one embodiment , the receiver 104 is configured to be ceiling mountable to assure that the ir or rf signals 103 generated by the microphones 102 a , 102 b are received with minimal obstruction and / or interference . the receiver 104 provides electrical voice signals 105 corresponding to the wireless voice signals 103 generated by the microphones 102 a , 102 b to the system controller 108 . as shown in fig1 , the sound masking signal generator 106 is configured to generate at least one electrical sound masking signal 107 having a specified sound masking spectrum , and to provide the sound masking signal 107 to the system controller 108 , which receives the voice signals 105 and the sound masking signal 107 from the receiver 104 and the sound masking signal generator 106 , respectively . in one embodiment , the system controller 108 provides the voice signals 105 and the sound masking signal 107 to the six spatially distributed loudspeakers 112 a - 112 f over multiple channels 109 . for example , the system controller 108 may provide the voice signals on at least one first channel and the sound masking signal on at least one second channel , and then provide the voice and sound masking signals to the loudspeakers 112 a - 112 f over the respective channels 109 . like the receiver 104 , each of the spatially distributed loudspeakers 112 a - 112 f is configured to be ceiling mountable . in one embodiment , each of the loudspeakers 112 a - 112 f has a low directivity index , and is arranged to face downwardly from the ceiling , thereby allowing the respective loudspeaker to emit acoustic voice and sound masking signals simultaneously in one or more direct paths to the ears of individuals ( the “ listeners ”) located in the venue 110 in which the system 100 is deployed . as a result , a more uniform sound field coverage for the acoustic voice signals , and more uniform levels of the acoustic sound masking signals , can be obtained throughout the venue 110 . in an alternative embodiment , the plurality of loudspeakers can include two or more sets of loudspeakers , in which at least one set of loudspeakers is used to emit the acoustic voice signals and at least one other set of loudspeakers is used to emit the acoustic sound masking signals . in one embodiment , the sound masking signal generator 106 is configured to store at least one set of information specifying at least one sound masking spectrum , and to generate at least one electrical sound masking signal having the sound masking spectrum specified by the stored set of information . the sound masking signal generator 106 is therefore like the sound masking signal generator described in u . s . pat . no . 7 , 194 , 094 ( the &# 39 ; 094 patent ) issued mar . 20 , 2007 entitled sound masking system and assigned to the same assignee of the present invention , the entire disclosure of which is incorporated herein by reference . specifically , the sound masking signal generator 106 operates to provide two or more channels of mutually incoherent electrical sound masking signals having temporally random signals with frequency characteristics within the specified sound masking spectrum . in one embodiment , the predetermined sound masking spectrum is designed with less “ roll off ” in sound intensity in high frequency components , e . g ., frequency components above approximately 1250 hz , to provide superior sound masking in an open plan venue such as an open plan classroom or office . as described above , each of the spatially distributed loudspeakers 112 a - 112 f is configured to be ceiling mountable , to have a low directivity index , and to be arranged to face downwardly from the ceiling to allow the respective loudspeaker to emit the acoustic voice and sound masking signals simultaneously in one or more direct paths to the ears of the listeners located in the venue 110 . in the illustrated embodiment , each of the loudspeakers 112 a - 112 f is like the loudspeaker assembly described in the above - referenced &# 39 ; 094 patent , having the low directivity index and being disposable within an aperture in the ceiling . as shown in fig1 , the six loudspeakers 112 a - 112 f are disposed in a 3 - by - 2 arrangement spaced apart from one another by distances d 1 , d 2 to provide sufficient overlap in the acoustic voice and sound masking signals emitted by adjacent loudspeakers , thereby producing a uniform sound field coverage and uniform levels of acoustic sound masking signals throughout the venue 110 . it should be appreciated , however , that any other suitable number of loudspeakers in any other suitable arrangement may alternatively be employed . for example , the loudspeakers 112 a - 112 f can be wired directly to the system controller 108 , or daisy chained from one loudspeaker to the next via wired connections . as shown in fig1 , the sound reinforcement system 100 further includes a remote control unit 114 , an external audio source 116 , a network 118 , a server 120 , and a database 122 . in the illustrated embodiment , the remote control unit 114 is configured to use ir , rf , or any other suitable wireless signals 115 to transmit data and / or commands to the system controller 108 for controlling the levels of one or both of the acoustic voice signals and the acoustic sound masking signals emitted by the loudspeakers 112 a - 112 f in the venue 110 . the external audio source 116 is configured to provide additional audio input signals 117 to the system controller 108 for subsequent transmission in the venue 110 by the loudspeakers 112 a - 112 f . for example , the external audio source 116 may be a compact disk ( cd ) player , a digital video disk ( dvd ) player , a personal computer ( pc ), a source of paging signals , or any other suitable audio source . the system controller 108 is configured to be communicably connectable to the network 118 via a network connection 119 . for example , the network 118 may include one or more of a local area network ( lan ), a wide area network ( wan ), the internet , or any other suitable network . the system controller 108 is operative to communicate over the network 118 with the server 120 , which can include or be externally connectable to the database 122 . in one embodiment , the server 120 operates in conjunction with the database 122 as a database server to provide a structured collection of data files in the mp3 format or any other suitable file format for storing digital audio data . in an illustrative mode of operation , the sound reinforcement system 100 is configured to provide a voice reinforcement (“ voice lift ”) function in a classroom environment . to that end , one of the microphones 102 a , 102 b may be designed to be worn by a classroom instructor either on a lanyard , clipped as a lavaliere , or as a headset , and another one of the microphones 102 a , 102 b may be designed as a hand - held type suitable for being passed from one student to another during periods of student participation . the system controller 108 receives the voice signals 105 corresponding to the speech detected by the respective instructor and student microphones , and optionally any additional audio input signals 117 that the instructor may provide via a cd player , a dvd player , a pc , etc . in one embodiment , the voice signals 105 and the additional audio input signals 117 are provided to the system controller 108 simultaneously . the system controller 108 amplifies and processes the voice and other audio input signals 105 , 117 , as appropriate , for subsequent distribution in the venue 110 , i . e ., the classroom , via the loudspeakers 112 a - 112 f . the sound reinforcement system 100 provides features that address the communication needs of individuals who gather to meet in small or large venues such as instructors and students in a classroom environment . according to one such feature , the system controller 108 provides microphone localization processing to locate the microphone of the instructor , and to apply suitable delays to the voice and other audio signals provided to the spatially distributed loudspeakers 112 a - 112 f based on the location of the instructor &# 39 ; s microphone . as a result , the instructor &# 39 ; s voice can be made to have a more natural sound at all student locations no matter where the instructor is currently located in the classroom . such microphone localization processing is particularly useful in a large , open plan classroom environment . fig2 depicts a representative layout of the spatially distributed loudspeakers 112 a - 112 f for use in describing the microphone localization processing of the system controller 108 ( see fig1 ). as shown in fig2 , the representative layout of the loudspeakers 112 a - 112 f is like that depicted in fig1 , i . e ., the six loudspeakers 112 a - 112 f are disposed in a 3 - by - 2 arrangement spaced apart from one another by distances sufficient to provide a degree of overlap in the acoustic signals emitted by adjacent loudspeakers . the microphone localization processing can be employed to mitigate delay - related phenomena caused by the haas effect ( also called the “ precedence effect ”) when the system is deployed in a large venue such as a large , open plan classroom . specifically , the system controller 108 performs microphone localization processing by calculating time delays to be applied to voice signals generated by the talker &# 39 ; s microphone based upon the relative distances between the microphone and the respective loudspeakers spatially distributed throughout the venue . the system controller 108 typically calculates and applies such time delays when the venue is large enough to have listener locations where the observed difference between the arrival time of speech via the amplified signal path through the loudspeakers , and the arrival time of the same speech via the direct propagation signal path from the talker , exceeds approximately 20 msec . by tracking the talker &# 39 ; s microphone location and applying the calculated time delays to the amplified signals , the speech emanating from the loudspeakers can be made to sound more natural at all listener locations . applying the calculated time delays to the amplified signals also allows the listeners to locate the talker more easily . for example , in a classroom environment , students located at the rear of the classroom will be able to locate an instructor lecturing at the front of the classroom more easily because the sound of the instructor &# 39 ; s voice emanating from the loudspeakers will be delayed , thereby causing the amplified sound from the loudspeakers to reach the students at substantially the same time as the sound of the instructor &# 39 ; s unamplified voice . to calculate the appropriate amount of time delay to be applied to the amplified signals , the location of the talker &# 39 ; s microphone , e . g ., the instructor &# 39 ; s microphone 102 a , is estimated relative to the locations of the loudspeakers 112 a - 112 f spatially distributed in the venue 110 , e . g ., the classroom . as shown in fig2 , the exemplary venue 110 is partitioned into a plurality of zones 1 , 2 , 3 such that the loudspeakers 112 e - 112 f are disposed in zone 1 , the loudspeakers 112 a , 112 d are disposed in zone 2 , and the loudspeakers 112 b - 112 c are disposed in zone 3 . further , in this example , the instructor &# 39 ; s microphone 102 a is approximately centrally located in the classroom within zone 2 . next , the time delays to be applied to the amplified sound emanating from the loudspeakers 112 a - 112 f are calculated based on the time required for sound to travel from the location of the instructor &# 39 ; s microphone 102 a to the locations of the loudspeakers 112 a - 112 f in the respective zones 1 , 2 , 3 . in one embodiment , the system controller 108 can apply the calculated time delays to the amplified signals by digitizing the voice signals 105 provided by the receiver 104 , buffering the digitized voice signals , and sampling the buffered signals at the calculated time delays . for example , a first time delay may be applied to the sound emanating from the loudspeakers 112 e - 112 f in zone 1 and a second time delay may be applied to the sound emanating from the loudspeakers 112 b - 112 c in zone 3 , while no time delay is applied to the sound emanating from the loudspeakers 112 a , 112 d in zone 2 where the instructor &# 39 ; s microphone 102 a is located . in one embodiment , the location of the instructor &# 39 ; s microphone 102 a in the venue 110 , e . g ., the classroom , is estimated by using a wavefront curvature technique . to employ the wavefront curvature technique , both the microphone 102 a and the receiver 104 may be implemented as ir devices . for example , the ir receiver 104 may be configured as a two dimensional array of ir point sensors . by measuring the time delay of the ir signals generated by the microphone 102 a between the ir point sensors of the two dimensional array , such as by cross - correlation of the ir sensor outputs , the curvature of the arriving ir wavefront , the direction of the microphone 102 a relative to the receiver 104 , and the distance between the microphone 102 a and the receiver 104 can be estimated . using the estimated direction and distance of the microphone 102 a relative to the receiver 104 and the known locations of the loudspeakers 112 a - 112 f in the venue 110 , the distances between the microphone 102 a and the respective loudspeakers 112 a - 112 f can be determined . the appropriate time delays to be applied to the sound emanating from the loudspeakers 112 a - 112 f can then be calculated based on the distances between the microphone 102 a and the respective loudspeakers 112 a - 112 f . according to another feature , the sound reinforcement system 100 of fig1 can be incorporated for use in a voip emergency or other event notification system , as illustrated in fig3 . as shown in fig3 , a sound reinforcement system 300 deployed in a classroom environment can be communicably connected to a school or campus emergency response center via a network 318 . the sound reinforcement system 300 includes at least one microphone 302 , a system controller 308 , at least one loudspeaker 312 , at least one optional ear - bud device 326 , and an emergency on / off switch 324 for enabling the emergency or other event notification functionality . the microphone 302 is communicably connected to a voip encoder / decoder 308 . 1 and a voice lift processor 308 . 2 contained in the system controller 308 . the emergency on / off switch 324 is also communicably connected to the voip encoder / decoder 308 . 1 , which in turn is communicably connectable to the ear - bud device 326 via a bluetooth transmitter 308 . 3 contained in the system controller 308 . as further shown in fig3 , the school or campus emergency response center includes an emergency processor 328 containing an alert processor 330 , a voip encoder / decoder 332 , and a server 320 , an alert display 334 , at least one microphone 336 , and at least one audio output 338 . the system controller 308 within the sound reinforcement system 300 can communicate with the emergency processor 328 over the network 318 . in addition , the alert processor 330 can provide alert outputs for display on the alert display 334 , and the voip encoder / decoder 332 can receive input signals and provide output signals from / to the microphone 336 and the audio output 338 , respectively . accordingly , if an emergency occurs in the classroom , then the network 318 connecting the sound reinforcement system 300 to the school / campus emergency response center can be used as a communications path to inform school officials and / or emergency responders of both the occurrence and the characteristics of the emergency . in one embodiment , the network 318 corresponds to a school / campus data network generally accessible from every classroom in the school or on the campus . the two - way voip capability provided over the network 318 allows both emergency signaling and voice communications between the sound reinforcement system 300 and the school / campus emergency response center . in one embodiment , such emergency communication is implemented at the classroom in three steps , specifically , ( 1 ) notifying the school / campus emergency response center of the emergency , ( 2 ) describing the emergency in detail to the emergency response center , and ( 3 ) responding to instructions from the emergency response center for mitigation of the emergency . for example , such emergency notification may be accomplished by activating a pushbutton or a series of pushbuttons on the emergency on / off switch 324 , which may be located on the lavaliere microphone , on one of the hand - held microphones , or on the voice lift unit itself , or by providing speech recognition in the system controller 108 . upon activating the emergency notifying signal , the time and location of the emergency is determined and recorded at the server 320 and subsequently routed to the emergency responders . subsequent speech further describing the nature of the emergency , provided via the microphone 302 , can also be recorded at the server 320 and routed to the emergency responders . upon receipt of the time , location , and description of the emergency , the emergency responders can , should the situation require it , provide information to an instructor alone through the ear - bud device 326 . the emergency responders can also activate emergency paging in the classroom and / or on a wider basis ( e . g ., building - wide or campus - wide ), and initiate a two - way dialog with the individuals in the classroom over the network 318 for implementing possible emergency mitigation scenarios . according to still another feature , the sound reinforcement system 100 of fig1 can be incorporated for use in a voip point - to - point communication system , as illustrated in fig4 . as shown in fig4 , a plurality of sound reinforcement systems 400 a , 400 b , 400 c , 400 d can be deployed in multiple classrooms , respectively , either in a school or on a campus . further , each of the sound reinforcement systems 400 a - 400 d is communicably connected to a server 420 via a local network 418 . 1 , which in turn is communicably connected to an external network 418 . 2 such as the internet . each of the systems 400 a - 400 d includes at least one microphone 402 , a system controller 408 , a plurality of loudspeakers 412 a , 412 b , and a network connection on / off switch 324 for enabling the voip point - to - point communication functionality . the microphone 402 is communicably connected to a voip encoder / decoder 408 . 1 and a voice lift processor 408 . 2 contained in the system controller 408 . the pod - cast on / off switch 424 is also communicably connected to the voip encoder / decoder 408 . 1 . moreover , the system controller 408 within each sound reinforcement system 400 a - 400 d can communicate with the server 420 over the local network 418 . 1 , and with a system 400 e deployed in a remote classroom over the internet 418 . 2 . in the illustrated embodiment , the system 400 e is like the sound reinforcement systems 400 a - 400 d , and is deployed in the remote classroom for enabling voip point - to - point communication , e . g ., for remote learning , with the systems 400 a - 400 d over the networks 418 . 1 - 418 . 2 . according to yet another feature , the sound reinforcement system 100 of fig1 can be employed in a voip pod - casting application , as illustrated in fig5 . as shown in fig5 , a sound reinforcement system 500 deployed in a classroom environment can be communicably connected to a local computer 540 and a server 520 via a local network 518 . 1 , and to a remote computer 542 via the local network 518 . 1 and an external network 518 . 2 such as the internet . the sound reinforcement system 500 includes at least one microphone 502 , a system controller 508 , and an on / off switch 524 for enabling the voip pod - casting functionality . the microphone 502 is communicably connected to a voip encoder 508 . 1 contained in the system controller 508 . the pod - cast on / off switch 524 is also communicably connected to the voip encoder 508 . 1 , which in turn is connectable to the network 518 . 1 . in the voip pod - casting application , the capability of the system 500 to convert sounds into data packets allows archiving , storing , recovering , and replaying of those sounds concurrently or at some later time . for example , a lecture presented by an instructor , inclusive or exclusive of commentary from the student audience , may be recorded and archived , allowing others who may have missed the lecture , or may wish to revisit the lecture in the course of studying , to download and replay ( e . g ., pod - cast ) the lecture at anytime in the future . in one embodiment , the system 500 can record digital audio , convert it to any suitable audio format , e . g ., compressed ( mp3 , mp4 , etc .) or uncompressed ( wav , etc . ), and allow the instructor or others to catalog the recording appropriately . such recording capability allows instructors and their supervisors to listen to the instructors ’ lectures at some later time for the purpose of oversight and / or evaluation . in addition , the system 500 can be combined with a video recording / broadcasting system to create integrated audio / video broadcasts for use in remote learning . according to still yet another feature , the sound reinforcement system 100 of fig1 can be employed in a voip paging application , as illustrated in fig6 . as shown in fig6 , a sound reinforcement system 600 deployed in a classroom environment can be communicably connected to an administration center 616 via a local network 617 . the administration center 616 includes at least one microphone 616 . 1 and a voip paging interface 616 . 2 . the sound reinforcement system 600 includes a system controller 608 , a plurality of loudspeakers 612 a , 612 b , and an optional ear - bud device 626 . the system controller 608 includes a voip decoder 608 . 1 , which is connected to the loudspeakers 612 a , 612 b . in this example , the voip decoder 608 . 1 is also communicably connectable to the optional ear - bud device 626 via , e . g ., a bluetooth transmitter 608 . 2 contained in the system controller 608 . in the voip paging application , the system controller 608 converts voice signals generated by the microphone 616 . 1 into data packets , which may be received by any compatible voip device ( e . g ., a telephone , a pc , etc .) or by another installation of the sound reinforcement system ( not shown ). the sound corresponding to the data packets may subsequently be played through the spatially distributed loudspeakers 612 a , 612 b disposed in one or more of the respective systems . having described the above illustrative embodiments , other alternative embodiments or variations may be made . for example , the sound reinforcement system may be configured to distribute a voice lift function and a sound masking function via separate loudspeaker assembly systems ; e . g ., the sound masking signal may be distributed via upwardly facing loudspeakers in the ceiling plenum . the sound reinforcement system may be configured to include one or more personal receiver / amplifier / loudspeaker units for use by audibly challenged individuals in the venue in which the system is deployed . in addition , the sound reinforcement system may be configured to provide for the distribution of two or more channels of sound generated by one or more music sources . for example , the system can be configured to associate adjacent loudspeakers with different channels for appropriately distributing , e . g ., the “ right ” and “ left ” channels of stereophonic sound . because the subjective improvement of musical sound from stereophonic music sources is mostly due to the incoherence among the channels , the spatially distributed loudspeakers need not be arranged in the right - left configuration of traditional stereo sound systems . the system can also be provided with one or more “ woofer ” loudspeakers , cross - over filters , and / or power amplifiers to raise the output level and / or improve the quality of the musical sound . in addition , it was described above that the system controller can receive voice signals and a sound masking signal , and provide the voice signals and the sound masking signal to a plurality of spatially distributed loudspeakers over multiple channels . in alternative embodiments , the system controller can be configured to incorporate any suitable digital signal processing capability to allow a user to select any desired functionality or any desired combination of functionalities , including but not limited to voice lift , sound masking , paging , pod - casting , emergency broadcasting , and / or remote learning . it will be appreciated by those of ordinary skill in the art that modifications to and variations of the above - described distributed emitter voice lift system may be made without departing from the inventive concepts disclosed herein . accordingly , the invention should not be viewed as limited except as by the scope and spirit of the appended claims .	7
the cable lock / bracket combination 10 of the present invention is shown in fig1 as attaching a cable - type bicycle lock 14 to a strut 8 of a bicycle . the cable lock 14 has a lock head 16 and a cable 18 . the cable 18 is permanently attached to the lock head 16 at an anchor end 20 and is releasably attached to the lock head 16 at a free end 22 . the lock head 16 includes a keyway 24 that accepts a key for accessing an internal locking mechanism . when closed , the locking mechanism retains the cable free end 22 through an aperture 26 in the side of the lock head 16 . when opened by the key , the locking mechanism releases the free end 22 , allowing it to be removed from the aperture 26 so the cable 18 may be snaked through the bicycle and a stationary fixture . alternatively , a set of combination dials , rather than a key , operates the locking mechanism . the cable 18 is typically composed of braided steel encased in vinyl , but the present invention contemplates that any form of cable may be used . the bracket 12 attaches to a frame strut 8 and has two sections , an attachment 30 and a seat 32 . the attachment 30 is adapted to mount the bracket 12 to the frame strut 8 . the present invention contemplates using any form of mounting that is adequate for the task , two of which are briefly described below . a unitary embodiment 36 of the attachment 30 is shown in fig3 . the unitary embodiment 36 consists of a flap 38 that extends from one side of the bracket 12 and wraps around the frame strut 8 . the end 40 of the flap 38 has a hole 42 through which a screw 44 extends . the screw 44 is tightened via a nut 46 to secure the bracket 12 to the frame strut 8 . the clamp embodiment 50 of the attachment 30 is shown in fig3 . the face 52 of the bracket 12 includes a semi - cylindrical surface . a hose clamp 54 or other similar device extends around the frame strut 8 and through a slot 56 behind the face 52 . the clamp 54 is tightened to secure the bracket 12 to the frame strut 8 . at the opposite end of the bracket 12 from the attachment 30 is the seat 32 . the seat 32 has a cavity 60 , the inner surface of which is shaped somewhat like a funnel . the lock head 16 fits into the cavity 60 , where the cable 18 extending from the lock head 16 fits through an opening 62 at the bottom of the cavity 60 . typically , gravity holds the lock head 16 in the cavity 60 . the purpose of the funnel shape is to act as a stop limiting the distance that the lock head 16 can go into the cavity 60 , thereby preventing the lock head 16 from falling through the cable opening 62 . the exact shape of the cavity 60 is not particularly important . the only restrictions are that the lock head 16 can fit into the cavity 60 and that the cable opening 62 is too small for the entire lock head 16 to fit through . preferably , the shape of the lock head 16 and cavity 60 are matched so that the lock head 16 fits snuggly within the cavity 60 . a snug fit minimizes movement of the lock head 16 within the cavity 60 . an improvement over the prior art is a gap 64 in the side of the cavity 60 that allows for insertion of the cable 18 into the cavity 60 . without the gap 64 , as in the prior art , the cable 18 would have to be released from the lock head 16 and the free end 22 snaked completely through the cavity 60 . the gap 64 provides a much more convenient way to insert the lock head 16 into the cavity 60 . the gap 64 should only be wide enough to allow the cable 18 to fit through . it should not be so wide as to compromise the integrity of the bracket 12 or to allow the lock head 16 to fit through . in the typical cable lock , the aperture 26 into which the free end 22 of the cable 18 is inserted is located on the side of the lock head 16 . if the cavity 60 is sized so that the aperture 26 would fall within the cavity 60 , a means must be provided to accommodate the cable 18 when the free end 22 is in locked into the aperture 26 . a notch 68 in the upper edge 66 of the cavity 60 provides a location for the cable 18 . the notch 68 can also provide a secondary function , which is to prevent the lock head 16 from rotating within the cavity 60 . normally , however , this function is unnecessary if the cavity 60 and lock head are shaped to prevent rotation . for example , in the embodiment of fig1 the lock head has an approximately oval horizontal cross - section , so that it cannot rotate within the cavity 60 . optionally , the seat 32 has a latch for securing the lock head 16 into the cavity 60 , as shown in fig5 and 6 . the latch precludes the need for gravity to hold the lock head 16 in the cavity 60 , so that various orientations of the bracket 12 are possible . the latch includes an arm 72 in four sections . the lower end of the spring section 74 is anchored to the bracket 12 , as at 76 . extending at about 90 ° from the upper end of the spring section 74 is an offset section 78 , which offsets the knob section 80 from the spring section 74 . extending in the opposite direction from the offset section 78 is a tongue 82 . the arm 72 is positioned so that it can flex between a latched position and an unlatched position . in the latched position , the tongue 82 extends into the cavity 60 . in the unlatched position , the tongue 82 does not extend into the cavity 60 . the spring section 74 biases the arm 72 to the latched position , so that manual force is needed to move the arm 72 to the unlatched position . when the manual force is removed , the arm 72 returns to the latched position . when the lock head 16 is within the cavity 60 , the tongue 82 fits into a groove 88 in the lock head 16 . the upper surface of the tongue 82 is curved downwardly , as at 84 , so that the arm 72 is pushed out of the way when the lock head 16 is being inserted into the cavity 60 . when the lock head 16 is fully inserted into the cavity 60 and the tongue 82 is aligned with the groove 88 , the arm 72 snaps back so that the tongue 82 is in the groove 88 . the lower surface of the tongue 82 and the lower surface of the groove 88 are flat so that the lock head 16 cannot be pulled from the cavity 60 . the lock head 16 is removed from the cavity 60 by manually pulling back on the knob 80 so that the tongue 82 comes out of the groove 88 , and then pulling the lock head 16 from the cavity 60 . the arm 72 can be located anywhere around the circumference of the seat 32 . most preferably , however , it is located in the section of the seat nearest the attachment 30 . this gives the most support and protection to the arm 72 . because the arm 72 has a protruding knob 80 and is somewhat flexible , it would be vulnerable to having an external object catch on it and snap it off if not protected . preferably , the bracket 12 is composed of a rigid plastic , such as abs , nylon 6 / 6 , or glass - filled nylon 6 / 6 . thus it has been shown and described a cable lock and bracket which satisfies the objects set forth above . since certain changes may be made in the present disclosure without departing from the scope of the present invention , it is intended that all matter described in the foregoing specification and shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense .	8
following is a description of one exemplary data center environment in which a heat removal system may be implemented according to some embodiments . fig1 depicts a diagram schematically illustrating a layout of a data center heat removal system according to some embodiments . in the example of fig1 , a data center heat removal system for a data center 100 includes a chilling unit 102 . as will be described in greater detail below , the chilling unit 102 may include a housing , one or more fans or similar devices configured for drawing in air from outside the data center , one or more misters for cooling the air , and one or more chiller units for further reducing the air temperature . the data center 100 may include one or more server pods 106 a and 106 b . the server pods 106 a and 106 b may be embodied as self - contained rooms or enclosures that have walls 107 , doors 116 a , 116 b , 116 c , 116 d , and ceilings ( not shown ). the server pods 106 a and 106 b are configured to house one or more banks of servers 108 a , 108 b and 108 c , and 108 d , respectively . the server banks 108 a , 108 b and 108 c , and 108 d may comprise racks of servers mounted on above each other . it is noted that while two server pods are illustrated , in practice , a data center may employ many more . thus , the figures are by way of example only . the server pods 106 a and 106 b include openings 112 for drawing in cool air from the chilling unit 102 via one or more “ cold aisles ” 115 . additional cold aisles may be formed between other server pods , in the example where the data center includes numerous server pods . the server pods 106 a and 106 b may further be configured such that banks of servers 108 a and 108 b ( and similarly , server banks 108 c and 108 d ) are separated by a “ hot aisle ” 110 a and 110 b , respectively . in operation , cold air is drawn in from the cold aisle ( s ) 115 and flows across the server banks 108 a and 108 b ( and similarly , server banks 108 c and 108 d ), where the air is heated by the servers . the heated air , isolated in the hot aisles 110 a and 110 b , is then drawn up and out through vents 117 a and 117 b in the ceiling of the respective pods 106 a and 106 b . the heated air escaping from the hot aisles 110 a and 110 b will yield lower pressure in the hot aisles 110 a and 110 b , causing cool air to be drawn from the cold aisle ( s ) 115 . the air circulation can be controlled by varying the volume of air allowed through the supply side or through the exhaust side or both ( described in detail below ). accordingly , air heated by the server banks 108 a , 108 b and 108 c , and 108 d will rise to the top of the pods 106 a and 106 b via natural convection and be vented through vents 117 a and 117 b . some embodiments provide a sealed hood for the hot air flows ( see e . g ., the hood 211 shown in fig2 ). in some embodiments , additional fans may be provided in or in conjunction with the vents 117 a and 117 b to assist in drawing out the heated air and / or to maintain a desired pressure differential . as illustrated by the exemplary flow lines in fig1 ( represented by lines 114 a and 114 b ), air flows from the chilling unit 102 into one or more cold aisles 115 , from which they are drawn into the server pods 106 a and 106 b via openings 112 . inside the server pods 106 a and 106 b , internal fans of the servers ( not shown ) may draw the air across the servers and out into the hot aisles 110 a and 110 b . from the hot aisles 110 a and 110 b , the heated air is vented through the vents 117 a and 117 b . in some embodiments , the vents 117 a and 117 b may be provided with or associated with fans that draw air up into them . in some embodiments , the fans are coupled to or controlled by one or more pressure sensors , which can be utilized to ensure that the pressure in the hot aisles 110 a and 110 b is lower than the pressure in the cold aisles 115 . for example , if the pressure in the hot aisle 110 a or 110 b is detected as being the same or higher than the pressure in the cold aisle 115 , the respective fans may be operated at a higher speed to draw more air in the hot aisles 110 a and 110 b up for venting through the vents 117 a and 117 b . this ensures that a desired pressure differential , and / or a desired air flow rate , can be maintained or otherwise controlled . fig2 is a perspective view illustrating an exemplary server pod of a data center that houses a plurality of server banks ( now shown ). for clarity , only one server pod is shown . the data center of fig2 may be an embodiment of the data center 100 shown in fig1 . in this example , a server pod 206 a and an adjacent server pod ( not shown ) are separated by cold aisle 215 . the sides of the server pod 206 a include screened openings 212 for admitting cool air into the server pods 206 a . as illustrated , the server pod 206 a includes an access door 216 a defining an opening to the hot aisle ( not shown ) inside the server pod 206 a . in the example illustrated , the server pod hot aisle ( inside the server pod 206 a ) extends from the ceiling of the server pod 206 a to the ceiling of the data center via an enclosure or hood 211 . the cold aisle 215 is pressurized with cool air which is then drawn through the racks of the server pod 206 a , as illustrated by arrows 214 . the air is then drawn out the top of the server pod 206 a via the enclosed or sealed hood 211 . as described above with respect to fig1 , a data center heat removal system may include one or more chilling units , such as the chilling unit 102 . fig3 is a block diagram of one exemplary arrangement of a chilling unit 300 , which may be used in a data center according to some embodiments . the chilling unit 300 may include a structure or housing for housing the various components of the chilling unit , described below . in one example , a housing may comprise a shipping container housing , being approximately 20 feet long , 7 ′ 10 ″ tall , and 7 ′ 8 ″ wide according to one non - limiting example . other types and sizes are may also be used . in the exemplary chilling unit 300 shown in fig3 , the direction of air flow through the chilling unit 300 is shown by the arrows at each end of the chilling unit 300 . ambient air enters the chilling unit 300 at a first end 301 ( as shown by the arrow 303 ) and exits at a second end 305 into the data center ( as shown by the arrow 307 ). in the example illustrated in fig3 , the chilling unit 300 includes a first fan unit 314 , a first filter 312 , a second fan unit 310 , a mister 308 , a chiller unit 306 , a third fan unit 304 , and a second mister 302 . in some embodiments , each of the components may be configured to extend across a cross section of the container . further , in some embodiments , one or more of the components may not be necessary . for example , in some embodiments , the chiller unit 306 may not be required by a data center heat removal system disclosed herein ( e . g ., the data center 100 shown in fig1 ) where the air outside a data center configured with the data center heat removal system is usually at a sufficiently cool temperature ( e . g ., depending upon the climate , location , and / or altitude at which the data center is located ) that artificial cooling may not be necessary . furthermore , in some embodiments , the humidity of the air may be such that only one mister is needed . in some embodiments , the number and configuration of fan units in the chilling unit 300 may be chosen based on air flow requirements , as desired . in some embodiments , the fan units 314 , 310 , and 304 may each include four 44 ″ drum fans capable of moving approximately 72 , 000 cfm of air . the control of the fan units is described in detail below . the filter units 312 may be implemented as four - stage hepa filters in some embodiments . in some embodiments , the chiller unit 306 may be configured to include chillers on both sides of the chilling unit 300 , with coils that extend to meet each other at 45 degrees from the sides . in some embodiments , the coil units may be hinged such that , when not in use , they can swing to the sides of the chilling unit using motors . in some embodiments of a data center heat removal system , various types of sensors can be placed in a data center to sense various conditions in the data center . in some embodiments , the sensed conditions are stored in a database and are used by a control system to control the operation of the components of the chilling unit and associated fans , vents , etc . ( described below ). the control system may be associated with the chilling unit 300 or the data center itself , or both . the sensors may include temperature sensors , humidity sensors , air flow sensors , pressure sensors , and / or other types of environmental sensors . in some embodiments , each chilling unit 300 may provide up to 60 , 000 cfm of air to the data center at or under 78 degrees . in other embodiments , each chill unit 300 may provide more or less capacity , as desired . while the chilling unit 300 is pressurizing the data center , the variable speed ceiling fans ( e . g ., for the vents 117 a and 117 b of fig1 or the hood 211 of fig2 ) of the data center may be adjusted to keep the pressure in the hot aisles at lower than the cool side of the system . when the temperature is below a threshold value ( e . g ., 65 degrees ), one of the fans may be slowed or shut off to decrease the pressure and the ceiling fan will slow to reduce amount of air that is being released . fig4 - 7 are views of an exemplary chilling unit according to some embodiments . other configurations and layouts are also possible . in fig4 - 7 , the housing walls are hidden to show the chilling unit components inside the housing . fig4 is an isometric view of a chilling unit . fig5 is a top view of the chilling unit shown in fig4 . fig6 is a side view of the chilling unit shown in fig4 . fig7 is an end view of the chilling unit shown in fig4 . as mentioned above , in some embodiments , a chilling unit can be housed using a standard shipping container . a typical shipping container is comprised of a steel box having doors at one end . although a standard shipping container works well as a chilling unit housing , a customized housing can also be used . in one example , a standard 20 foot freezer shipping container is used . in this example , an intake area ( described below ) is formed at one end of the container . as shown in fig4 - 7 , a chilling unit 400 includes a housing 410 having doors 412 at one end . during use of the chilling unit 400 , the doors 412 are opened , or completely removed . in fig4 - 6 , the direction of air flow through the chilling unit 400 is from right to left . at the right end of the chilling unit 400 are a plurality of vents 414 that form openings in the housing 410 to allow air to be drawn into the chilling unit 400 from outside . in the example shown in fig4 , the vents 414 are formed on the end , and on 3 sides of the housing 410 . downstream from the vents 414 are one or more fans 416 . in the example shown in fig4 - 7 , four fans are arranged to substantially cover the cross - sectional area of the housing 410 . more or fewer fans could be used . as described in more detail below , the fans 416 may be single or variable speed , and may be controlled together or independently . the fans 416 draw air into the chilling unit 400 via the vents 414 , and force the air through filter ( s ) 418 . in one example , the fans 416 are 42 inch drum fans , each capable of moving 18 , 200 cubic feet per minute ( cfm ) of air . in the example of fig4 - 7 , four fans are placed in the intake side . in other examples ( e . g ., fig3 ), four more fans are placed on the exhaust end of the housing 410 . in one example , the filters are 3 - stage heap filters angled at 45 degrees from both sides to provide more surface area . downstream from the filters 418 is a mister 420 . in the example shown , the mister 420 comprises a series of mister nozzles near the top of the housing 410 pointing downward . when the mister 420 is activated , a fine mist 422 of water is sprayed downward as the air flows through the chilling unit 400 . depending on the temperature and relative humidity , the mister 420 can lower the temperature of the air by approximately 10 degrees . downstream from the mister 420 are mister cooling elements 424 . for clarity , the mister cooling elements 424 are not shown in fig4 , but are shown in fig5 - 6 . the mister cooling elements 424 are made of a metal material and help to cool the air even further by providing a surface for mist condensation . as the air flows through the mister cooling elements 424 , the air is not only cooled by evaporating mist , but also by passing through the mister cooling elements 424 . the mister cooling elements 424 can be any configuration that allows air to flow through , while providing a metal surface for mist condensation . examples of the mister cooling elements 424 can include coils , a metal grate or mesh , etc ., as one skilled in the art would understand . downstream from the mister 420 and the mister cooling elements 424 are a pair of chillers 426 mounted on opposite walls of the housing 410 . the chillers 426 can be conventional off - the - shelf air - conditioning or freezer units configured to chill the air . if the air needs to be further cooled , one or more of the chillers 426 can be turned on . fig5 - 6 also show freezer elements such as freezer coils 428 disposed within the housing 410 between the chillers 426 . the freezer elements 428 are extensions of piping from the chillers 426 extending into the chiller unit 400 to improve heat transfer with the air . in one example , the freezer elements 428 are configured to extend out at a 45 degree angle from the sides of the housing 410 . in one example , the freezer elements 428 are movable to automatically swing back against the interior wall of the housing 410 when not in use . note that the configuration of a chilling unit can take on many configurations , as desired . for example , the chilling unit 300 shown in fig3 has three sets of fans and two sets of misters . depending on various factors , such as local climate , data center size , cost limitations , etc ., a chilling unit can be configured in such a way as to balance desired performance and cost . as mentioned above , the temperature of a data center can be controlled and maintained by sensing various conditions in the data center and controlling various components of a system accordingly . fig8 is a block diagram illustrating a system 800 that is configured to maintain a desired data center temperature in the most energy efficient manner possible . the system 800 has a controller 810 capable of interfacing and controlling the various components of the system 800 . the controller 810 may be comprised of a single device that interfaces with the components of the system 800 , or may include multiple devices working together . for example , a data center may have separate fan controllers , chiller controllers , etc . in one example , a web - based application runs on a server 812 and controls the operation of the controller 810 . one or more client devices 814 can be used by a technician to configure and monitor the controller via the web - based application . the system 800 uses a plurality of sensors 816 to sense various conditions in the data center . the sensors may include temperature sensors , humidity sensors , air flow sensors , and / or pressure sensors , and any other desired sensors . the temperature sensors may sense the temperature in the hot isles , cold isles , server pods , chilling units , exhaust vents , individual servers , etc . the ambient temperature can also be sensed outdoors or at the intake portion of the chilling unit . similarly , humidity sensors can also sense the humidity anywhere in the data center , as desired . pressure sensors sense air pressure at various places in the data center . by monitoring the air pressure throughout the data center , a desired air flow through the system can be maintained . in one example , the air pressure is sensed in the cold isles , hot isles , and exhaust vents . the system 800 may also use any other type of sensor desired . the system 800 controls the operation of the fans 818 of the system to maintain a desired air flow throughout the system . for example , a data center may have fans in the chilling units ( e . g ., fans 416 in fig4 ) and in the exhaust vents ( e . g ., vents 117 a and 117 b in fig1 ). the controller 810 controls whether the fans are on or off , as well as controlling their speed , when variable speed fans are used . the controller 810 is capable of determining how to most efficiently use the fans to maintain a desired air flow , and thus temperature . for example , if a given amount of air flow is needed to maintain a target temperature , the controller can selectively activate individual fans , and control them at desired speed ( s ) to achieve a desired airflow using the least amount of electricity possible . the system 800 can also control the opening and closing of vents 820 in the system , if the system is equipped with closable vents . for example , the intake vents of the chilling units may include louvers that can be opened and closed by the controller 810 . similarly , the exhaust vents can be opened and closed by the controller 810 . the vents 820 can not only be opened and closed , but can be opened a desired amount , to further control the amount of air flow through the vents 820 . the system 800 also controls the operation of the misters 822 ( e . g ., misters 420 in fig4 ) of the system to lower the air temperature in the system . as described above , activating the misters 822 can , under the right conditions , lower the air temperature by approximately 10 degrees . the misters 822 have the most effect in low - humidity conditions . by knowing the humidity of the air , the controller 810 can determine when activating the misters 822 will have a beneficial effect . the system 800 also controls the operation of the chiller units 824 ( e . g ., chillers 426 in fig4 ) of the system to lower the air temperature . by activating the chiller units 824 , the air temperature can be significantly lowered to help achieve a desired air temperature . the controller 810 may also control various other components , as desired . in addition , the controller 810 and web - based application can monitor , log , and report various aspects of the operation of the system 800 . the system 800 may include monitors , visual indicators , alarms , etc ., either via client devices or standalone indicators and devices , to allow users or technicians to monitor the operation of the system 800 . the system 800 is controlled to achieve a desired target temperature in the server pods in the most efficient manner possible . the dominate factor that determines the cost of cooling a data center of electricity usage . the various components of the system 800 that contribute to lowering air temperatures each use different amounts of electricity . therefore , the controller 810 is configured to achieve and maintain a target temperature by controlling the system components in such a way that electricity usage is minimized . a goal of the controller is to maintain a desired target temperature , using the least possible amount of electricity . when the chiller units may use significantly more power than the fans and misters , the controller will try to maintain the desired target temperature without using the chiller units , or at least minimizing the use of the chiller units . similarly , the controller will selectively activate and control the speed of the fans to achieve a desired airflow using the least amount of power . in one example , the controller 810 uses an algorithm to control the system . the algorithm may , when possible , maintain a desired target temperature without using the chiller units 824 . for example , under the right conditions , the desired target temperature can be maintained by controlling the activation and speed of the fans 818 alone . under the right conditions ( e . g ., a relatively low humidity level ), the misters 822 may be used with the fans . use of the misters 822 may allow fans usage to be reduced , further lowering power usage . the control algorithm , via the sensors , knows the conditions ( e . g ., temperature , humidity , air pressure differentials ) in the system , and can control the system accordingly . for example , assume that an x degree temperature drop is needed . knowing the outside ambient air temperature , the various temperatures in the system , and the relative air pressures in the system , the controller can determine that y cubic feet of air flow is needed to reach the desired target temperature . the controller then selectively activates and controls the speed of the fans in the system to achieve the determined air flow rate . the controller also takes into account how activation of the misters will affect the air temperature , and thus the desired air flow rate . when the sensed conditions indicate that use of the misters would be beneficial , the misters will be activated . as a result , the controller can maintain the desired target temperature using a combination of fans and the misters in the most efficient way possible , preferably without relying on the chiller units . if the outside ambient temperature is high enough ( perhaps 78 degrees , in one example ), the desired target temperature may not be achievable with fans and mister alone . when that is the case , the controller will turn on one or more of the chiller units to bring the air temperature down to the desired target level . fig9 is a logical control diagram illustrating an example of the control of the fans ( e . g ., fans 416 in fig4 ) in a chilling unit based on a sensed condition . in the example illustrated in fig9 , the controller controls the amount of air flow through the system based on the temperature of the air at the intake of the chilling unit . in general , cooler air requires less air flow to cool the data center , while warmer air requires more air flow to cool the data center . as shown in fig9 , the controller obtains a temperature reading from one or more temperature sensors . the temperature sensor ( s ) may be located at the intake of the chilling unit , outside of the chilling unit , or at any other suitable location . in this example , if the sensor reports an air temperature of approximately 50 degrees fahrenheit , the controller sends a digital signal to the chilling unit fans to run at 50 cfm / kw . as indicated by the air flow rate values in fig9 , the desired flow rate also depends on the amount of power being consumed in the data center , in this example , 50 cfm / kw . in other words , when more power is being consumed by the data center , more heat is generated , and therefore , more air flow is needed . the desired flow rate can be achieved by selectively activating fans , as well as setting the speed of the activated fans . in some examples , the air flow rate may be fine - tuned by also controlling exhaust fans . if the sensor reports an air temperature of approximately 70 degrees fahrenheit , the controller sends a digital signal to the chilling unit fans to run at 126 cfm / kw . if the sensor reports an air temperature of approximately 90 degrees fahrenheit , the controller sends a digital signal to the chilling unit fans to run at 225 cfm / kw . other components of the system ( e . g ., misters , coolers , etc .) can be controlled in a similar manner based on any desired sensed conditions , as one skilled in the art would understand . also note that the activation of different components of the system may affect each other . for example , if the misters are activated , a lower air flow rate may be desired , compared to a desired air flow rate without the misters . note that it is important to not only lower the temperature of a data center to a desired level , but to not let the temperature drop too far below the desired level . the reliability of some server equipment relies on a relatively constant temperature . therefore , in some conditions ( e . g ., winter months ), the outside ambient air will be cool enough that the controller will restrict air flow to keep the air temperature up to the desired target value . the systems described above can be built into a new data center or retrofitted into an existing data center . in an example where a system is retrofitted into an existing data center , one or more chilling units can each be installed in an opening formed in a data center wall , as illustrated in fig1 . in each hot isle , an exhaust vent / hood ( e . g ., vents 117 a and 117 b in fig1 ) is created to draw hot air out of the data center . a controller and various sensors ( e . g ., temperature , humidity , and / or pressure , etc .) can also be installed to monitor and control the operation of the system . these , and other , aspects of the disclosure and various features and advantageous details thereof are explained more fully with reference to the exemplary , and therefore non - limiting , embodiments illustrated herein . it should be understood , however , that the detailed description and the specific examples , while indicating the preferred embodiments , are given by way of illustration only and not by way of limitation . descriptions of known programming techniques , computer software , hardware , operating platforms and protocols may be omitted so as not to unnecessarily obscure the disclosure in detail . various substitutions , modifications , additions and / or rearrangements within the spirit and / or scope of the underlying inventive concept will become apparent to those skilled in the art from this disclosure . some embodiments described herein can be implemented in the form of control logic in software or hardware or a combination of both . the control logic may be stored in an information storage medium , such as a computer - readable medium , as a plurality of instructions adapted to direct an information processing device to perform a set of steps disclosed in the various embodiments . based on the disclosure and teachings provided herein , a person of ordinary skill in the art will appreciate other ways and / or methods to implement the invention . it is also within the spirit and scope of the invention to implement in software programming or code the steps , operations , methods , routines or portions thereof described herein , where such software programming or code can be stored in a computer - readable medium and can be operated on by a processor to permit a computer to perform any of the steps , operations , methods , routines or portions thereof described herein . the invention may be implemented by using software programming or code in one or more control systems , by using application specific integrated circuits , programmable logic devices , field programmable gate arrays , optical , chemical , biological , quantum or nanoengineered systems , components and mechanisms , various types of sensors including temperature , humidity , and / or pressure sensors may be used . the functions of the invention can be achieved by various means including distributed , or networked systems , hardware components , and / or circuits . in another example , communication or transfer ( or otherwise moving from one place to another ) of data may be wired , wireless , or by any other means . a “ computer - readable medium ” may be any medium that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , system or device . the computer readable medium can be , by way of example only but not by limitation , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , system , device , propagation medium , or computer memory . such computer - readable medium shall be machine readable and include software programming or code that can be human readable ( e . g ., source code ) or machine readable ( e . g ., object code ). examples of non - transitory computer - readable media can include random access memories , read - only memories , hard drives , data cartridges , magnetic tapes , floppy diskettes , flash memory drives , optical data storage devices , compact - disc read - only memories , and other appropriate computer memories and data storage devices . in an illustrative embodiment , some or all of the software components may reside on a single server computer or on any combination of separate server computers . as one skilled in the art can appreciate , a computer program product implementing an embodiment disclosed herein may comprise one or more non - transitory computer readable media storing computer instructions translatable by one or more processors in a computing environment . a “ processor ” includes any , hardware system , mechanism or component that processes data , signals or other information . a processor can include a system with a central processing unit , multiple processing units , dedicated circuitry for achieving functionality , or other systems . processing need not be limited to a geographic location , or have temporal limitations . for example , a processor can perform its functions in “ real - time ,” “ offline ,” in a “ batch mode ,” etc . portions of processing can be performed at different times and at different locations , by different ( or the same ) processing systems . those skilled in the art will appreciate that a suitable control system can include a central processing unit (“ cpu ”), at least one read - only memory (“ rom ”), at least one random access memory (“ ram ”), at least one hard drive (“ hd ”), and one or more input / output (“ i / o ”) device ( s ). the i / o devices can include a keyboard , monitor , printer , electronic pointing device ( for example , mouse , trackball , stylus , touch pad , etc . ), or the like . in embodiments of the invention , the control system can have access to at least one database over a network connection . rom , ram , and hd are computer memories for storing computer - executable instructions executable by the cpu or capable of being compiled or interpreted to be executable by the cpu . suitable computer - executable instructions may reside on a computer readable medium ( e . g ., rom , ram , and / or hd ), hardware circuitry or the like , or any combination thereof . within this disclosure , the term “ computer readable medium ” is not limited to rom , ram , and hd and can include any type of data storage medium that can be read by a processor . examples of computer - readable storage media can include , but are not limited to , volatile and non - volatile computer memories and storage devices such as random access memories , read - only memories , hard drives , data cartridges , direct access storage device arrays , magnetic tapes , floppy diskettes , flash memory drives , optical data storage devices , compact - disc read - only memories , and other appropriate computer memories and data storage devices . thus , a computer - readable medium may refer to a data cartridge , a data backup magnetic tape , a floppy diskette , a flash memory drive , an optical data storage drive , a cd - rom , rom , ram , hd , or the like . as used herein , the terms “ comprises ,” “ comprising ,” “ includes ,” “ including ,” “ has ,” “ having ,” or any other variation thereof , are intended to cover a non - exclusive inclusion . for example , a process , product , article , or apparatus that comprises a list of elements is not necessarily limited only those elements but may include other elements not expressly listed or inherent to such process , product , article , or apparatus . furthermore , the term “ or ” as used herein is generally intended to mean “ and / or ” unless otherwise indicated . for example , a condition a or b is satisfied by any one of the following : a is true ( or present ) and b is false ( or not present ), a is false ( or not present ) and b is true ( or present ), and both a and b are true ( or present ). as used herein , including the accompanying appendices , a term preceded by “ a ” or “ an ” ( and “ the ” when antecedent basis is “ a ” or “ an ”) includes both singular and plural of such term , unless clearly indicated otherwise ( i . e ., that the reference “ a ” or “ an ” clearly indicates only the singular or only the plural ). also , as used in the description herein and in the accompanying appendices , the meaning of “ in ” includes “ in ” and “ on ” unless the context clearly dictates otherwise . additionally , any examples or illustrations given herein are not to be regarded in any way as restrictions on , limits to , or express definitions of , any term or terms with which they are utilized . instead these examples or illustrations are to be regarded as being described with respect to one particular embodiment and as illustrative only . those of ordinary skill in the art will appreciate that any term or terms with which these examples or illustrations are utilized encompass other embodiments as well as implementations and adaptations thereof which may or may not be given therewith or elsewhere in the specification and all such embodiments are intended to be included within the scope of that term or terms . language designating such non - limiting examples and illustrations includes , but is not limited to : “ for example ,” “ for instance ,” “ e . g .,” “ in one embodiment ,” and the like . those skilled in the art of the invention will recognize that the disclosed embodiments have relevance to a wide variety of areas in addition to the specific examples described above . for example , although the examples above are described in the context of data centers , some embodiments disclosed herein can be adapted or otherwise implemented to work in other types of environments , circumstances , etc . in this context , the specification and figures are to be regarded in an illustrative rather than a restrictive sense , and all such modifications are intended to be included within the scope of this disclosure . accordingly , the scope of the present disclosure should be determined by the following claims and their legal equivalents .	7
fig1 shows schematically an inverter 5 according to an embodiment of the present invention that is configured to provide a boosted output voltage vgb in response to an input signal changing . inverter 5 has a power supply input 6 for receiving vddg which is the voltage level of the high power rail of the circuit , a power supply input 7 which receives the voltage from a boosted voltage source vgb which is a higher voltage level than that of the high voltage rail and a power supply input 8 which receives the low voltage level vss . inverter 5 has an input 10 and an output 12 and in response to the input signal being high the inverter outputs a low output signal . when the input signal falls low then the inverter output level rises . initially it rises to the level of vddg and then it rises higher to the boosted vgb level . as can be seen schematically in this figure the rise from the low level to vddg occurs at one rate while the rise from vddg to vgb occurs more slowly . the rate at which these levels rise depends on the sizing of the devices within inverter 5 . the rise to the level of vddg affects the timing of the circuit and thus , should be fast , while the rise to the additional biased voltage simply reduces leakage currents and thus , this level not being attained very quickly is not so important . thus , it may be advantageous to allow the rise in voltage level from vddg to vgb to occur more slowly and use smaller components thereby saving area . fig2 shows a circuit diagram illustrating the inverter 5 of an embodiment of the present invention . in this embodiment the input signal is shown as changing from a 1 to 0 and the various states of the transistors are shown as changing in response to this . the input signal is designated as a sleep signal as this inverter is to be used to control the power transistors of a circuit such that in this case as they are pmos transistors when the sleep signal goes low and the output rises it turns them off and the circuit enters low power mode . a boost to the output voltage makes sure that these power transistors are in the super cut off state during this low power mode and their leakage current is therefore reduced . in this embodiment we have various transistors 20 , 30 , 40 , 50 , 60 , 70 , 80 and 90 , which act to control the connection of the high voltage line vddg and the boosted high voltage vgb to the output . operation of this circuit occurs as follows . when the input signal is high transistor 20 is on and a low signal is output at the output . this low signal turns transistor 30 on and a high signal is transmitted to node n 2 such that a 1 appears at this node . this turns transistor 60 off and isolates the output from the power supply vddg . the 1 at the input and the 0 at the output mean that transistor 90 is on and the 1 from the input is transmitted to node n 4 and turns transistor 80 off . this isolates the bias gate voltage 1 ′ from the output . the 0 at the output also turns gate 70 on but as gate 90 is off the 1 ′ does not get transmitted any further . when the input signal falls to a 0 then this turns transistor 20 off and isolates the output from vss . initially the 0 that was previously output means that gate 30 is still on and thus , the 0 at the input is transmitted to node n 2 and this falls to 0 . this turns transistor 60 on and current from the power supply vddg is sent through transistor 60 and raises the output level to 1 . transistor 60 is a large transistor with a low impedance and can thus , transmit a high current and the transition at the output from 0 to 1 is fast . as the output reaches 1 , transistor 90 is turned on and the 0 at the input is transmitted through transistor 90 to the gate of transistor 80 and this turns this on . this means that the output voltage rises from 1 to p . this rise in voltage level being supplied by the boosted voltage source vgb . when the output is at 1 before the boost there is a 1 at the input to transistor 70 but a 1 ′ at its source meaning that it is only partially off . the 1 that is transmitted through transistor 90 goes to transistor 50 and turns this off and turns transistor 40 on . this means that the 0 that was at n 2 rises to 1 ′ through transistor 40 and this turns transistor 60 off . the 1 ′ at the output is also transmitted to the gate of transistor 70 and turns this off completely . thus , as can be seen once the output level reaches the level of the power supply source vddg the arrangement of the transistors means that the transistor 80 is turned on and the boosted power supply can be supplied to the output but at the same time the power supply vddg is isolated from this output preventing any route for current from the boosted power supply vbg to the power supply vddg . fig3 shows a timing diagram showing how the voltage at nodes n 2 and n 4 of the circuit of fig2 vary with the input signal . thus , when the input signal is high the voltage at node 2 is also high at one volt , the voltage of the supply line while the voltage at n 4 is at the boosted 1 . 25 volts . this is because transistor 70 is on while transistor 80 is off . when the input voltage falls low then the voltage at node n 2 falls too . this is in response to transistor 40 turning off . the voltage at node n 2 being low causes transistor 60 to turn on . this is a large transistor designed to connect to the high power line vddg and thus , it can carry a lot of current and the voltage level at the output signal therefore rises quickly to a 1 . when it reaches a 1 then this acts to turn the nmos transistor 90 on which transmits the 0 through to the gate of transistor 80 and turns it on , this then supplies the boosted voltage level to the output . this high level at the input to transistor 70 turns it off which in turn turns transistor 40 on making the voltage at n 2 rise to the boosted voltage level of 1 . 25 volts and turns transistor 60 off thereby isolating the supply voltage vddg from the supply voltage vgb via the output line . when the input voltage signal goes high again then the voltage at n 2 drops to 1 volt from the 1 ′ volt while the voltage at n 4 rises to 1 ′ as transistor 70 turns on . thus , the various transistors act to connect firstly the high voltage source vddg to the output and then to connect the boosted high voltage source to the output while isolating the output from the high voltage source vddg . fig4 shows a use of an inverter according to an embodiment of the present invention . in this embodiment , inverter 5 is used to control the header transistors 100 that act to gate processing circuitry 110 . thus , the high voltage rail 120 supplying vddg is connected to the virtual power rail 130 via transistors 100 which are aligned in parallel in response to a signal output by the inverter 5 . thus , when a 0 is output these header transistors 100 are on and the virtual power rail 130 is at approximately vddg . when a sleep signal indicating that the circuitry is to enter low power mode is received at inverter 5 then a high output signal is output which turns header transistors 100 off . inverter 5 is a two - stage inverter as is described with respect to fig1 and 2 . thus , initially the voltage level rises to vddg which is sufficient to turn the header transistors 100 off . it then rises further to the gate bias voltage of 1 . 25 volts which means that transistors 100 enter their super cut off state which reduces any leakage currents across these header transistors 100 . in this embodiment , a number of driver circuits 140 are shown connected to the three stage inverter 5 . these circuits are there to introduce a delay to the switching on of the transistors . this is because many circuits have a large number of header transistors which are arranged in groups . if all the header transistors are turned on at the same time then there will be a large current peak and this will cause the supply voltage to fall and might cause some failure of the circuit if it falls beneath a critical value . thus , the switching on of the circuits is arranged such that they do not all turn on together but are turned on with a slight delay between each . these driver circuits 140 are used to introduce the delay . there is no need to provide a delay when the circuit is switching off . fig5 shows an alternative use of the voltage level shifting device according to an embodiment of the present invention . in this embodiment inverter 5 is used to boost the voltage on the word lines for accessing a memory cell 7 . one problem with memory cells is that if they are to be robust with regard to data retention then they can be quite difficult to overwrite . writing requires the state of the cells to flip . the cells are generally cross - coupled inverters and if they are stable to voltage fluctuations they do become difficult to overwrite . this problem has been addressed by providing a boost to the word line voltage during write which enables the cells to be flipped . inverter 5 according to embodiments of the present invention is a convenient way of providing this boost to the word line in an area efficient manner . fig6 shows a tristate two - stage inverter according to an embodiment of the present invention . inverter 5 of fig1 to 4 has an output state of a 0 or of 1 ′ vbg . it may be convenient for the inverter to also have a tristate high impedance output in which the input signal is isolated from the output signal . this tristate three - stage inverter has additional transistors to the two - stage inverter of fig2 . these additional inverters comprise a transistor 210 for controlling the tristate output and transistors 220 , 230 , 240 and 250 . these transistors help generate the high impedance state when the retention signal indicates that this sleep state is to be entered . thus , this tristate two - stage inverter has three possible outputs , the tristate high impedance output , a 0 output and the , boosted voltage output . this can be used in a circuit shown in fig7 for controlling header transistors 100 . in this case , there is an additional diode connected transistor 140 that is arranged between the header transistors and that is used to generate the retention state . thus , in this case transistors 100 and 140 can be used to generate three possible states , an on state when the circuitry 110 is powered , an off state when transistors 100 are turned off and no power is supplied to circuitry 110 and a retention state when a reduced voltage level is applied to virtual power rail 130 such that there is sufficient voltage to retain the state within circuitry 110 but there is a reduced voltage drop across this circuitry and thus , power leakage levels are lower . when diode connected transistor 140 is on it provides a connection between the output of the header transistors 100 and their gates such that there is a voltage drop across them which is dependent on the threshold voltage of the header transistors 100 . thus , the output voltage on the virtual voltage rail is no longer vddg but is vddg minus the threshold voltage of these header transistors . this is the tristate state where the input signal input to tristate inverter 55 is isolated from its output which stops this output from competing with the voltage level at the source of the diode connected transistor 140 . as in the embodiment of fig4 , the inverter 55 has the ability to output a boosted voltage level vgb and thus , produce the super cut off state for header transistors 100 . there is an additional instate inverter 5 which is used to generate this boosted signal for the input to the diode connected transistor 140 and stop any leakage route through this transistor 140 . fig8 shows some example of current flows of two - stage voltage level shifters according to embodiments of the present invention compared to a single stage voltage level shifter according to the prior art that simply uses the boosted voltage source for the complete transition . row 300 relates to a circuit having a voltage level shifter of the prior art , 310 relates to the two - state inverter with a fast slew rate , 320 a two - stage inverter with a slow slate rate , 330 the tristate two - stage inverter with the slow slew rate and 340 the slow slew rate tristate arrangement shown in fig7 . as was noted previously , the rate of change of voltage level from vddg to the boosted level vgb can be slow as at this point the circuit is already turned off but is not in the super cut off state . delaying entry into the super cut off state merely increases leakage currents without affecting operational performance and thus , in many cases is acceptable . thus , it may be advantageous in some embodiments to select small transistors for the transistors that feed the boosted voltage level , i . e . transistors 70 , 80 and 90 in fig2 . this will result in a slow slew rate rise from vddg to vgb as is shown in the diagram at the bottom of fig8 . in other embodiments , it may be acceptable to have larger transistors at these points and thus , a fast slew rate can be obtained for this later portion of the transition . in the prior art the peak current taken from the boosted voltage source is 2 . 23 milliamps , whilst the highest current taken from the boosted voltage source in any of the embodiments of the present invention is 927 micro amps . this is significantly lower . this is because the current for generating this change in voltage level is generated from the vddg source . as this is required to power the rest of the circuitry it needs to be a large source and the grid connecting it to the circuitry is similarly large . thus , in the prior art a grid and boosted power supply sufficient to supply a peak current of 2 . 23 milliamps is required , while embodiments of the current invention only require a peak current of 927 microamps , or if a slow slew rate is acceptable 174 microamps . the diagram also shows the difference in transition times and peak currents between the fast and the slow slew rates . these are quite significant and thus , in some embodiments where it is very important to have a small source the slow slew rates may prove to be advantageous . fig9 shows a flow diagram illustrating steps in a method according to an embodiment of the present invention . in this method a high input signal is initially received and in response to this the low voltage source is connected to the output and a low output signal is output . it is then determined if the input signal has transitioned to a low value . if it has the power supply vddg is connected to the output and a high output signal is output . it is then determined if the output voltage has obtained this vddg value . when it has the boosted output voltage is connected to the output and the vddg output is isolated from the output and thus , a boosted value is output . it is then determined if the input signal has transitioned to a higher value . if it has then the sequence is started again . it should be noted that although embodiments of the invention have been described with respect to providing a voltage level shift from a low level to a high level and then a boosted high level , it will be clear to a skilled person that the techniques of embodiments of the present invention could equally well be applied to shifting from a high level to a low level and then a boosted extra low level , for example from vdd to vss to vss ′. thus , in an embodiment corresponding to those of fig4 and 7 a voltage booster could be used where the power control transistors are footer nmos transistors and they could be used to produce a voltage level that is boosted with respect to the low voltage level such that perhaps a negative voltage is applied to the gates of these footer transistors . although illustrative embodiments of the invention have been described in detail herein with reference to the accompanying drawings , it is to be understood that the invention is not limited to those precise embodiments , and that various changes and modifications can be effected therein by one skilled in the art without departing from the scope and spirit of the invention as defined by the appended claims . for example , various combinations of the features of the following dependent claims could be made with the features of the independent claims without departing from the scope of the present invention .	7
the invention provides a semiconductor device having low - voltage / high - voltage transistors and a method for forming low - voltage / high - voltage transistors of semiconductor devices for use in large scale integrated circuits ( lsi ), for example . in the method , and preferably on an lsi where at least one low - voltage transistor is intermingled with a high - voltage transistor , a low - density doping ( ldd ) implantation of the high - voltage transistor is conducted . then , a protective oxide film for the ldd implantation of the low - voltage transistor is formed using a suitable oxidation process such as thermal oxidation or thermal chemical vapor deposition ( cvd ). thereafter , ldd implantation of the low - voltage transistor is conducted . with the method of the invention , a deep junction is obtained in the ldd region of the high - voltage transistor because , after ldd implantation , the oxidation process ( thermal oxidation / thermal cvd ) is applied , causing any impurities to diffuse . moreover , any generation of hot carriers near the drain region is suppressed because the ldd junction is smooth and deep . a smooth ldd junction relaxes the electrical field density near the drain . also , a deep ldd junction prevents the concentration of current pass at interface channel and gate oxide . what results is a structure that is substantially impervious to deterioration in transistor characteristics . moreover , since an oxidation or thermal process is not applied in the ldd region of the low - voltage transistor , the low - voltage transistor has a shallow ldd region , making it difficult for any short channel effects to occur . with this method , characteristics for both the low - voltage and high - voltage transistors may be optimized . that is , high - voltage transistors have deep and smooth ldd junctions , resulting in good hot carrier immunity . low - voltage transistors have shallow and high dosed ldd junctions to thereby ensure good short channel immunity with high performance . fig2 is a cross - sectional view illustrating a semiconductor device 10 having at least one high voltage transistor and one low - voltage transistor provided on a single chip . this semiconductor device 10 is an exemplary device formed according to a preferred embodiment of the invention . the semiconductor device 10 comprises n - channel mos ( nmos ) transistors 12 and 14 and p - channel mos ( pmos ) transistors 16 and 18 . the nmos transistor 12 and the pmos transistor 16 are low voltage transistors that are driven at a given low voltage , e . g ., an operation voltage of about 1 . 8 volts . in contrast , the nmos transistor 14 and the pmos transistor 18 are high voltage transistors that are driven at a high voltage , e . g ., an operation voltage of about 3 . 3 volts . the nmos transistor 12 and the pmos transistor 16 driven at the low operating voltage are used for a portion of circuitry that exchanges signals within the semiconductor device 10 , such as a logic circuit . the low voltage mos transistors 12 and 14 have thin - film gate oxide films 20 and 22 respectively . in contrast , high - voltage nmos transistor 14 and pmos transistor 18 are typically used for a portion of the interface between the semiconductor device 10 and an external circuit . the high voltage mos transistors 14 and 18 have thick - film gate oxide films 24 and 26 respectively . a p - type channel region 28 is formed below the nmos transistor 12 , and a p - type channel region 30 is formed below the nmos transistor 14 . n - type lightly doped drain regions ( ldd ) 32 and n - type source / drain ( s / d ) regions 36 are formed on each side of the channel region 28 , and n - type ldd regions 34 and n - type source / drain regions 38 are formed on each side of the channel region 30 . the ldd regions 32 and 34 are formed so as to be lower in impurity concentration than the source / drain regions 36 and 38 . an n - type channel region 40 is formed below the pmos transistor 16 , and an n - type channel region 42 is formed below the pmos transistor 18 . p - type ldd regions 44 and p - type source / drain regions 48 are formed on each side of the channel region 40 , and p - type ldd regions 46 and p - type source / drain regions 50 are formed on each side of the channel region 42 . the ldd regions 44 and 46 are formed so as to be lower in impurity concentration than the source / drain regions 48 and 50 . in fig2 , reference symbol pa represents a junction depth profile of ldd region 32 ; pb represents a junction depth profile of ldd region 34 ; pc represents a junction depth profile of ldd region 44 ; and pd represents a junction depth profile of ldd region 46 . as shown in fig2 , in the semiconductor device 10 in accordance with the invention , the high - voltage transistors 14 and 18 have deeper junction depth profiles in the ldd regions than the low - voltage transistors 12 and 16 ( i . e ., pa & lt ; pb , and pc & lt ; pd ). fig3 is a flow diagram illustrating the method of the invention . referring to fig3 , in step s 30 element separations are formed on a semiconductor substrate using sti ( shallow trench isolation ) or the like . in step s 30 , a well is formed and the threshold voltage value of the transistor ( s ) is adjusted by using a mask made of photo - resist , for example , to implant p - type impurities into the nmos region of nmos transistors 12 and 14 , and n - type impurities into the pmos region of pmos transistors 16 and 18 . these form the p - type channel regions 28 and 30 and the n - type channel regions 40 and 42 of fig2 . since the threshold voltage value of the low - voltage transistors 12 and 16 and the high - voltage transistors 14 and 18 are each respectively adjusted , it is also acceptable to use a mask to further implant separately . next , a gate insulation film is formed in step s 31 , and the gate oxide film of only the high - voltage transistor is applied , so as to be thicker than the gate oxide film of the low - voltage transistor . this application also may be done using a known masking technique or the like . then , in step s 32 poly - si is deposited as a gate electrode for each transistor and the gate electrode for each transistor is processed into the desired shape . thereafter , a dopant of n - type impurities , such as phosphorous at an energy of about 20 kev and a dose of about 6 × 10 13 / cm 2 for example , are implanted in a step s 33 into the ldd region 34 of only the high - voltage nmos transistor 14 , and a dopant of p - type impurities ( e . g ., bf 2 at energy of about 20 kev and dose of about 6 × 10 13 / cm 2 ) are implanted into the ldd region 46 of only the high - voltage pmos transistor 18 . in step s 34 the oxidation process is performed . an oxide film approximately 3 to 7 nm in thickness is formed on the poly - si surface over each of the transistors 12 , 14 , 16 and 18 as well as the silicon substrate surface 11 , using an oxidation process at approximately 800 to 1100 ° c . the oxidation step advantageously dopes the high - voltage transistors , because the thermal diffusing of the dopant by oxidation ( implanted in the previous step ) causes a deeper ldd region junction to be formed , as illustrated in fig2 . moreover , the thermal diffusing of the dopant in the oxidation step ensures that there is a smooth transition between n - type and p - type regions within each transistor , which enhances transistor reliability . the resulting smooth junction relaxes electrical field density near drain , which suppress generation of hot carrier . thereafter , in step s 35 , a dopant of n - type impurities ( e . g ., arsenic at energy of about 5 kev and dose of about 1 × 10 15 / cm 2 ) are implanted into the ldd region 32 and a dopant of p - type impurities ( e . g ., boron at energy of about 15 kev and a dose of about 3 × 10 13 / cm 2 with 20 degrees tilt ) are implanted into the pocket region 33 of only the low - voltage nmos transistor 12 and a dopant of p - type impurities ( e . g ., boron at an energy of about 2 kev and a dose of about 3 × 10 14 / cm 2 ) are implanted into the ldd region 44 , and a dopant of n - type impurities ( e . g ., phosphorus at an energy of about 45 kev and a dose of about 5 × 10 13 / cm 2 with 25 degrees tilt ) are implanted into the pocket region 45 of low - voltage pmos transistor 16 . after forming a gate spacer ( not shown ), source and drain implantations for the source and drain regions 36 , 38 , 48 and 50 of the nmos and pmos transistors are conducted ( step s 36 ), followed by the application of a silicide interlayer film ( step s 37 ). finally , wiring formation processes ( step s 38 ) are conducted to form wire pairs for connection to the surface of the semiconductor device 10 for each transistor . as described above , the method of the present invention provides a semiconductor device having both high - voltage and low - voltage transistors with increased reliability , where both may be manufactured without reducing the reliability of the high - voltage transistor or performance of the low - voltage transistor . moreover , oxidation after ldd doping of the high - voltage transistor enables diffusion to create a deeper ldd region junction , while the protective oxide film allows the low - voltage transistor to maintain a relatively shallow ldd junction depth to optimize performance and reliability . therefore , the present invention inserts a thermal process such as oxidation between the ldd step for the high - voltage transistor and the ldd step for the low - voltage transistor . as a result , the impurities in the ldd region of the high - voltage transistor undergo thermal diffusion , thus causing the junction at the ldd / source region of ldd / channel or ldd / drain region to be smooth and the electric field in the vicinity of the drain region to be eased . as for the low - voltage transistor , since no thermal process is conducted , the ldd region structure is of a shallow depth so that transistor performance can be maintained . the invention being thus described , it will be obvious that the same may be varied in many ways . the above - described method has been described as comprised of several components , flowcharts or blocks , it should be understood that the method or manufacturing the semiconductor device may be implemented by application specific integrated circuits , software - driven processor circuitry , or other arrangements of discrete components . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	7
certain terminology may be employed in the description to follow for convenience rather than for any limiting purpose . for example , the terms “ top ”, “ bottom ”, “ forward ”, “ rearward ”, “ right ”, “ left ”, “ rightmost ”, “ leftmost ”, “ upper ”, and “ lower ” designate directions in the drawings to which reference is made . terminology of similar import other than the words specifically mentioned above is likewise to be considered as being used for purposes of convenience rather than in any limiting sense . in the description and figures to follow , corresponding characters are used to designate corresponding elements throughout the several views , with equivalent elements being referenced with prime or sequential alphanumeric designations where appropriate to assist understanding . modern electronic circuit assemblies are progressively moving towards denser and denser concentrations of heat generating components within given package sizes . increased density brings a need for enhanced means to remove heat , and as well , means to contain electromagnetic radiation generated by the circuitry during its operation . one approach known in the art is to completely enclose the electronic circuit board and attendant circuitry with a thermally conductive and electromagnetic radiation containing enclosure . a common term for such an enclosure which conforms relatively closely to the dimensions of a circuit card is that of a “ clamshell ”. the clamshell enclosure has additional advantages in assisting in preventing penetration of exterior interfering radiation , such as that from adjacent circuit assemblies , from interfering with circuitry within the enclosure . a relative disadvantage of a clamshell enclosure is the difficulty in replacing components . within telecommunications systems , there are electronic assemblies with subassemblies which may have an operational life significantly less than the life of the remainder of the assembly . one example is the laser transceivers used in modern optical networking equipment . with a clamshell enclosure which contains multiple such laser transceiver assemblies , the failure of one assembly would require the removal of the entire clamshell if the failed assembly were to be replaced . clearly , it would be desirable to have a clamshell enclosure which would admit removable subassemblies . however , in the case of laser transceiver assemblies , for example , there is a strong need for effective heatsinking of the transceiver assembly . in an assembly with permanently mounted transceivers , it is common in the art to use the wall of the clamshell enclosure as a heatsink , and appropriate means for securing the transceiver in good thermal contact with the wall are used . in the case of removable assemblies , it is necessary to be able to remove the subassembly , yet when the subassembly is mounted in operational position , to also ensure adequate thermal contact . referring to fig1 a there may be seen an exploded view of a circuit board 180 having mounted thereon a frame 182 , a heatsink 184 , and a clip assembly 186 . the frame 182 serves as a mounting enclosure for a removable component or assembly , while heatsink 184 is mechanically attached to frame 182 via clip assembly 186 . not shown is a connector mounted on circuit board 180 , to which the removable component connects upon insertion into frame 182 . referring to fig1 b , there may seen a perspective view of the heatsink 184 , secured to frame 182 with clip 186 , while removable component 110 is shown prior to mounting within frame 182 . in fig1 c , removable component 110 is shown mounted within frame 182 . in the mounted position , heatsink 184 , in mechanical contact with removable component 110 , acts to reduce thermal resistance from removable component 110 to the ambient environment , thereby dissipating heat generated within removable component 110 . the resulting reduction in temperature rises within removable component 110 act to keep temperatures within operational limits and enhance long term reliability of removable component 110 , as is well known in the art . one possible problem with the approach diagrammed in fig1 is the sliding friction occurring between heatsink 184 and the removable component 110 . close mechanical contact between removable component 110 and heatsink 184 is necessary for good thermal flow , however manufacturing tolerances work against achieving the necessary fit . intermediate resilient thermally conductive materials may be used to mediate the gap resulting from manufacturing tolerances , however the high coefficient of friction that results from use of such materials results in unacceptably high forces being generated upon insertion and removal of removable component 110 . referring to fig2 , there may be seen a perspective view from the bottom , of one side 200 of a clamshell enclosure . on the enclosure side 200 may be seen mounting holes 202 , for securing the enclosure side 200 to the circuit board and opposite side of the enclosure . also visible is aperture 204 , an opening in enclosure side 200 , for the receiving of a floating heatsink which will be described below . mounting tabs 206 , at the front of enclosure side 200 , are for the installation of card ejectors ( not shown ), mechanical latches which assist in insertion and removal of the clamshell assembly upon installation . the clamshell enclosure is conveniently made from a castable , extruded or machined aluminum alloy , providing both thermal conductivity and electromagnetic interference shielding . reference is now made to fig3 a , which shows a floating heatsink 330 having a resilient bias member 332 disposed on the top surface of floating heatsink 330 around its periphery . in this embodiment , the resilient bias member 332 is an electromagnetic gasket formed from an elastomeric compound having electrically conductive media disbursed therethrough . the electromagnetic gasket acts so as to contain electromagnetic energy within the clamshell enclosure . resilient bias member 332 also operates to urge floating heatsink 330 downwards against a removable component . in particular , the floating heatsink 330 is dimensioned larger than the aperture 204 ( fig2 ) within the clamshell enclosure . accordingly , the floating heatsink 330 is dimensioned such that its periphery overlaps with the enclosure side 200 ( fig2 ) of the clamshell enclosure surrounding the aperture 204 . thus , the resilient bias member 332 is disposed between the enclosure side 200 of the clamshell enclosure and the peripheral overlap portion of the floating heatsink 330 . resilient bias member 332 acts against the underside of the clamshell enclosure so as to urge the floating heatsink 330 downwards against a removable component . although in this embodiment , resilient bias member 332 is formed of an elastomeric compound , in general any resilient gasketing material known to those skilled in the art having a compression - set over its operating life sufficient to provide an appropriate biasing force to provide good thermal contact against a removable component while providing adequate electromagnetic interference gasketing could be employed . under certain applications , the amount of bias provided by the resilient gasketing material may be insufficient to provide the amount of bias desired . in these circumstances an additional bias element 340 , for example a separate spring element , may be used to augment the bias provided by the resilient gasketing material that makes up the resilient bias member 332 . such an additional bias element 340 may comprise a spring element running parallel to the resilient gasketing material , or a plurality of spaced smaller springs , for example . the additional bias element 340 may be disposed in a channel 334 formed between the resilient bias member 332 and an upper portion of the floating heatsink 330 . it is also clear that certain applications , for example circuitry having low frequency signals , may not require a continuous gasket around the periphery of the overlap . in this case , the resilient gasketing material may be disposed only over a portion of the overlap , or at a plurality of discontinuous portions , insofar as the emissions or susceptibility requirements regarding electromagnetic leakage through any gaps meet the requirements of the particular apparatus . reference is now made to fig3 b , which shows another embodiment of a floating heatsink 330 with resilient bias member 332 . in this embodiment , resilient bias member 332 includes a multi - fingered metallic gasketing strip surrounding the periphery of floating heatsink 330 . the metallic gasketing strip is formed from a plurality of fingers or ridges 338 ( individually indicated as 338 a , 338 b , . . . , 338 n ). the succession of fingers or ridges 338 within the ridged metallic gasketing strip provides resilience as well as effective electromagnetic shielding . the fingers or ridges 338 bias the floating heatsink 330 in a downward direction relative to the surrounding clamshell enclosure by bearing against the enclosure side 200 surrounding the aperture 204 within the clamshell enclosure . referring to fig4 , there may be seen an exploded perspective view of a clamshell enclosure using a floating heatsink according to an embodiment of the invention . a top side clamshell enclosure portion 420 is securable to a bottom side clamshell enclosure portion 421 . circuit board 400 , located within the clamshell enclosure when top side 420 is secured to bottom side 421 , has component frame 402 mounted thereon . component frame 402 , for receiving a removable component , is mounted adjacent aperture 423 which is located on a front face of bottom side enclosure portion 421 . upon assembly of the clamshell enclosure , floating heatsink 430 mounts within aperture 424 in top side clamshell enclosure portion 420 , immediately adjacent component frame 402 . in operation , resilient bias member 432 urges floating heatsink 430 against a component housed within frame 402 . resilient bias member 432 also provides an electromagnetic interference gasket function within the gap between floating heatsink 430 and top side clamshell enclosure portion 420 . referring to fig5 , there may be seen an assembled clamshell enclosure 525 , having a removable component 510 in position for insertion into aperture 523 . upon insertion into aperture 523 , removable component 510 passes into the component frame ( not seen in this diagram ) and bears against floating heatsink 532 . the resilient bias member mounted between the top surface 520 and floating heatsink 532 urges heatsink 532 against removable component 510 , providing good thermal contact . also , as described previously , the resilient bias member also serves as a gasket , blocking or attenuating electromagnetic radiation that might enter or exit the clamshell enclosure around the periphery of floating heatsink 532 . referring to fig6 a , there may be seen a cross - sectional view of fig5 taken at section 2 and a corresponding cross - sectional view with the removable component 610 inserted at fig6 b . more specifically , clamshell enclosure 625 has top side enclosure member 620 having aperture 624 therein . floating heatsink 630 resides within aperture 624 , having resilient bias member 632 between heatsink 630 and top side enclosure member 620 . removable component 610 , illustrated in the removed position in fig6 a , upon insertion , bears against heatsink 630 . in the inserted position , illustrated in fig6 b , resilient bias member 632 urges the heatsink 630 against removable component 610 , providing good thermal contact . as may be seen , the assemblies described above provide one skilled in the art a method and apparatus for providing thermal contact for removable components and maintenance of the integrity of an electromagnetic screening enclosure so as to prevent either emissions or admission of electromagnetic radiation . as well , the aforedescribed assemblies provide allowance for mechanical tolerances incurred in manufacturing and over the operational life of the assembly , as well as control of contact forces via the resilient bias member for proper thermal and interconnection performance . further , the described design provides for a reduction in size over approaches which do not integrate the bias member functionality with electromagnetic gasketing . this reduction in size allows for greater utilization of the interior space of the clamshell enclosure . while the invention has been described in conjunction with specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art in light of the foregoing description . for example , the floating heatsink assembly within a clamshell enclosure could be adapted to non - removable components fixed to the circuit board , eliminating the usual need for a compliant thermal compound to fill the space between the fixed component and the heatsink . in this type of application , the elimination of the thermal compound would both simplify initial manufacturing processes and any subsequent repair processes . as well , the clamshell type of enclosure exemplifies but one kind of containment enclosure . it is contemplated that electronic assemblies having portions of the assembly enclosed , albeit not wholly as in the clamshell embodiment , could also make use of the floating heatsink for removable components requiring heatsinking within the enclosed portion . therefore , what has been described are embodiments providing means for mounting a removable component to a circuit pack where the circuit pack is enclosed in a fixed heatsink . by utilizing a floating heatsink mounted within an aperture of the fixed heatsink , in coordination with a resilient bias member that also acts as an electromagnetic containment gasket , component removability is obtained while still effecting electromagnetic shielding and thermal contact between the heatsink and component . numerous modifications , variations and adaptations may be made to the particular embodiments of the invention described above without departing from the scope of the invention , which is defined in the claims . accordingly , it is intended to embrace all such alternatives , modifications , and variations as fall within the spirit and broad scope of the appended claims .	6
the following detailed description is for the best currently contemplated methods for carrying out the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention . in order to fully appreciate this invention , it is best to describe the details of the component parts in connection with the operational modes of the gas turbine engine &# 39 ; s fuel control system . in this light the descriptions that follow address both engine operation and shutdown modes for two embodiments of the inventive rapid shutdown and ecology system . in fig1 an illustrative gas turbine engine fuel control system 10 of a mostly conventional configuration known to those skilled in the art includes fuel supply 11 originating from fuel tanks ( not shown ) entering a low pressure fuel pump 12 , which increases the pressure in line 13 to level po . fuel then proceeds to high pressure pump 14 , which further increases fuel pressure to level p 1 in line 15 , at which point it enters metering valve 16 for modulating the rate of flow from the fuel supply to the combustor atomizers ( not shown ). fuel pressure in line 15 a downstream of metering valve 16 decreases to level p 2 ( by the setting of bypass valve 18 ) and thereafter further decreases to level p 3 in line 22 after passing through pressurizing valve 21 , which controls and establishes a minimum pressure of fuel delivered to the combustor atomizers downstream of flow arrow 23 . the bypass valve 18 returns , via lines 19 and 20 , pump flow in excess of metered flow and also controls fuel pressure such that p 1 is always higher than p 3 , usually about 25 psi or greater . additionally , at low fuel flow rates , p 1 will be additionally higher than p 3 by the setting of pressure rising valve 21 . orifice 19 a is provided on line 19 to create a damping pressure drop to stabilize bypass valve 18 . all functions of the gas turbine engine fuel control system 10 are commanded by the engine electronic control unit ( ecu ), which is not shown on the drawings , by repositioning the metering valve 16 . the inventive rapid shutdown and ecology system 24 communicates with line 22 by means of line 25 , and is positioned to be downstream of pressure rising valve 21 and upstream of the combustor atomizers . it is comprised of a metallic cylindrically shaped valve body 26 internally bored to define valve chamber 27 having an upper end 28 and an a lower end 29 at the longitudinal extremities . a large piston member “ b ” 30 is movable along the longitudinal axis of the valve chamber 27 between upper end 28 and lower end 29 . the flat surface of large piston member “ b ” 30 at the upper end 28 is bored to form fuel cavity “ b ” 31 . the depth and diameter of said fuel cavity “ b ” 31 are sized to provide a scavenge volume sufficient to accommodate all fuel in the fuel control system 10 downstream of pressure rising valve 21 , when the large piston member “ b ” 30 has moved to the extreme of its stroke in the direction of lower end 29 . a spirally wound spring 32 is positioned along the axial periphery of fuel cavity “ b ” 31 , such that when compressed , one end bears on upper end 28 and the other end bears on the base of fuel cavity “ b ” 31 . spring 32 is designed to remain fully compressed when fuel pressure px in fuel cavity “ a ” 34 is sufficiently greater than p 3 , the pressure immediately downstream of pressure rising valve 21 . in other words , the difference between px and p 3 times the area of piston b must be greater than the load in spring 32 . o - ring seals 44 are provided at three circumferential levels to prevent fuel flow between the inner surface of valve chamber 27 and the exterior surface of large piston member “ b ” 30 when the latter strokes along the longitudinal axis of valve chamber 27 . small piston member “ a ” 33 is placed internal to a close tolerance cylindrically bored cavity 36 located along the longitudinal centerline of large piston member “ b ” 30 at lower end 29 . small piston member “ a ” 33 may be equipped with an o - ring seat 45 to prevent any leakage of metered fuel during normal engine operation . face plate 35 , secured to large piston member “ b ” 30 , interlocks small piston member “ a ” 33 within bored cavity 36 . two fuel passages extending from bored cavity upper end 36 a provide communication with elements of the fuel control system 10 manifold as follows : passageway 37 leads to annular cavity 37 a on valve body 26 , and then to line 38 , thus permitting free flow of fuel from downstream of metering valve 16 to small piston member “ a ” 33 at the bored cavity upper end 36 a . fuel passageway 39 leads to annular cavity 39 a on valve body 26 , and then via line 40 to line 13 downstream of the low pressure fuel pump 12 . electro - magnetic solenoid valve 41 , which is commanded by the ecu , connects line 40 with fuel cavity “ a ” at lower end 29 . on the opposite side of valve body 26 , line 42 connects fuel cavity “ a ” 34 with line 15 , immediately downstream of high pressure pump 14 . a small orifice 43 is provided on line 42 to establish a pressure drop from p 1 to px when solenoid valve 41 is open . for one embodiment , diameter 46 of large piston member “ b ” 30 is about 2 . 5 inches and stroke 47 is about 1 . 5 inches . those dimensions will vary as a function of the specific gas turbine engine &# 39 ; s fuel control system configuration . still referring to fig1 the fuel control system is shown in its first position during engine operation . solenoid valve 41 is closed and pressure in fuel cavity “ a ” 34 , px , is equal to p 1 , which is always higher than p 3 ( by at least about 25 psi ). accordingly , large piston member “ b ” 30 is fully stroked toward upper end 28 , and spring 32 is fully compressed . simultaneously , since px is higher than p 2 , small piston member “ a ” 33 is fully stroked toward bored cavity upper end 36 a , thus preventing fuel flow from line 38 to line 40 . therefore , during engine operation , the inventive rapid shutdown and ecology system remains inoperative . referring now to fig2 there is shown the same gas turbine engine fuel control system schematic as in fig1 with the exception that the embodiment of the inventive rapid shutdown and ecology system 10 is now shown in its second position at engine shut down . it is at this phase that it accomplishes its intended dual function of rapid shutoff ( or turn on ) of fuel flow as well as ecology fuel management . when the gas turbine engine is shut down either by manual command from the control system ( for instance , by the pilot for aircraft applications ) or automatically through an overspeed , overtemperature or other fault detection system , the ecu opens solenoid valve 41 and shortly thereafter , when p 2 falls below a predetermined level , pressure rising valve 21 closes . closure of pressure rising valve 21 terminates fuel delivery to the combustor atomizers and opening of solenoid valve 41 immediately establishes a communication path between the upstream and downstream sides of high pressure pump 14 ( via line 42 , fuel cavity “ a ” 34 , solenoid valve 41 , and line 40 ). due to the pressure drop of orifice 43 , fuel pressure in fuel cavity “ a ” 34 , px , thus drops to po , causing spring 32 to shift large piston member “ b ” 30 to the extreme of its stroke in the direction of lower end 29 . this action increases the volume of fuel cavity “ b ” 31 thereby collecting all the fuel in the fuel control system 10 downstream of pressure rising valve 21 , and preventing it from draining into the engine creating atmospheric pollution and / or puddling , causing hot starts upon subsequent engine operation . simultaneously with the reduction of px to po , small piston member “ a ” 33 moves toward lower end 29 , thus establishing an open communication path between passageways 37 and 39 , annular cavity 39 a , and line 40 . in addition , as the pressure in lines 37 , 38 and 19 fall to the po level the bypass valve 18 moves toward orifice 19 a . these actions cause all of the fuel being delivered to the chamber atomizers to be immediately bypassed back to the high pressure pump 14 inlet , either through the bypass valve itself or through piston “ a ” cavity upper end 36 a . the rapid shutoff of fuel flow to the engine has therefore been achieved . when solenoid valve 41 is again closed by ecu command , the reverse process takes place . fuel cavity “ a ” pressure px increases to p 1 forcing small piston member “ a ” 33 to move toward bored cavity upper end 36 a , closing passageway 39 and terminating the fuel bypass condition . large piston “ b ” 30 also moves toward upper end 28 , compressing spring 32 , and forcing the fuel previously collected in fuel cavity “ b ” 31 to return to the fuel control system manifold downstream of pressure rising valve 21 . rapid turn on of fuel flow to the engine has therefore been achieved and atmospheric pollution has been prevented . on some gas turbine engine fuel control systems , the setting of bypass valve 18 is quite low and pressure rising valve 21 is referenced to po rather than p 2 . under those conditions , the difference between p 1 and p 3 is insufficient to compress spring 32 and hold large piston member “ b ” 30 fully stroked toward upper end 28 , as shown in fig1 . to accommodate those conditions and still provide the intended dual function of rapid shut down ( or turn on ) of fuel flow as well as ecology fuel management , another embodiment of the inventive rapid shut down and ecology system has been devised and is shown on fig3 and 4 . in fig3 another embodiment of the inventive rapid shutdown and ecology system is shown in its first position during engine operation . the gas turbine engine fuel control system 10 is the same as that shown of fig1 and 2 , and is comprised of the same conventional components , including low pressure fuel pump 12 , high pressure pump 14 , metering valve 16 , bypass valve 18 , pressurizing valve 21 , and various inter - communicating fuel lines , and all functions are commanded by the engine electronic control unit ( ecu ). the other embodiment is comprised of two separately functioning subsystems , one for the ecology management function 48 a and another for the rapid shutdown function 48 b . the ecology management subsystem is shown to the right of view line a - a , and may be remotely located from the remaining fuel control system . it is comprised of a cylindrically shaped valve body 49 internally bored to define valve chamber 50 having an upper end 52 and an a lower end 53 at the longitudinal extremities . a large piston member “ b ” 51 is movable along the longitudinal axis of valve chamber 50 between upper end 52 and lower end 53 . the flat surface of large piston member “ b ” 51 at the upper end 52 is bored to form fuel cavity “ b ” 54 . the depth and diameter of said fuel cavity “ b ” 54 are sized to provide a scavenge volume sufficient to accommodate all fuel in the fuel control system 10 downstream of pressure rising valve 21 , when the large piston member “ b ” 51 has moved to the extreme of its stroke in the direction of lower end 53 . a spirally wound spring 55 is positioned along the axial periphery of fuel cavity “ b ” 54 , such that when compressed , one end bears on upper end 52 and the other end bears on the base of fuel cavity “ b ” 54 . spring 55 is designed to remain fully compressed when fuel pressure px , in fuel cavity “ a ” 57 , acting on piston diameter “ a ” 59 produces a force which is greater that the force produced by pressure p 3 acting on the smaller piston diameter “ b ” 58 . when large piston member “ b ” 51 is in contact with upper end 52 during engine operation , fuel leakage from p 3 to px is prevented by circumferential o - ring seal 56 and annular o - ring seal 60 . under this condition , the small amount of fuel displaced into large piston annular cavity 66 is routed via fuel port 61 into a small , spring loaded , accumulator valve 62 where it is temporarily stored until engine shut down , at which time the spring load forces its return to fuel cavity “ b ” 54 . a “ witness ” drain 63 is provided to collect any inadvertent fuel leakage past accumulator valve 62 . an alternate embodiment involves use of a spring loaded check valve 64 in lieu of accumulator valve 62 . in such a case , the displaced fuel is released via line 65 to any fuel line , such as line 40 , having pressure po . for another embodiment of the ecology management subsystem 48 a , piston diameter “ a ” 59 is about 2 . 5 inches and piston diameter “ b ” 58 is about 2 . 0 inches , while stroke 51 a is about 1 . 5 inches . those dimensions will vary as a function of the specific gas turbine engine &# 39 ; s fuel control system configuration . still referring to fig3 the rapid shutdown subsystem 48 b is comprised of a metallic cylindrically shaped valve body 67 internally bored to define valve chamber 68 and having an upper end 69 and a lower end 70 . a closely fitting cylindrically shaped small piston 71 placed internal to valve body 67 and is movable along the longitudinal axis of valve chamber 68 between the upper end 69 and the lower end 70 . an o - ring seal 72 is fitted along the periphery of small piston 70 to prevent fuel passage between upper 69 and lower 70 ends of valve chamber 68 . the rapid shutdown subsystem 48 b communicates with the ecology subsystem 48 a and other elements of the fuel control system 10 by means of the following fuel lines : line 73 is connected to line 15 downstream of high pressure pump 14 and leads to solenoid valve 74 ( which is commanded by the ecu ) and then to fuel cavity “ a ” 57 of the ecology subsystem 48 a . an orifice 75 is provided to create a pressure drop from p 1 to px when the solenoid valve 74 is open . line 76 connects line 73 to valve body 67 , thus exposing the lower end 70 of small piston 71 to pressure p 1 . line 77 connects to line 15 a and exposes the upper end 69 of small piston 71 to pressure p 2 , which is lower than p 1 . finally , line 79 communicates between the upper end 69 of valve body 67 and line 13 , immediately downstream of low pressure pump 12 , which is at pressure po , and line 78 connects line 79 to solenoid valve 74 . the fuel control system as shown in fig3 is in its first position during engine operation . solenoid valve 74 is closed and pressure in fuel cavity “ a ” 57 , px , is equal to p 1 by virtue of fuel flow through line 73 . accordingly , large piston member “ b ” 51 is fully stroked toward upper end 52 , and spring 55 is fully compressed . simultaneously , since px is higher than p 2 , small piston 71 is fully stroked toward the upper end 69 , thus preventing fuel flow from line 77 ( pressure p 2 ) to line 79 ( pressure po ). therefore , during engine operation , the other embodiment of the inventive rapid shutdown and ecology system remains inoperative . referring now to fig4 there is shown the same gas turbine engine fuel control system schematic as in fig3 with the exception that the other embodiment of the inventive rapid shutdown and ecology system 10 is now shown in its second position at engine shut down . it is at this phase that it accomplishes its intended dual function of rapid shutoff ( or turn on ) of fuel flow as well as ecology fuel management . when the gas turbine engine is shut down either by manual command from the control system ( for instance , by the pilot for aircraft applications ) or automatically through an overspeed , overtemperature or other fault detection system , the ecu opens solenoid valve 74 and shortly thereafter , when p 2 falls below a predetermined level , pressure rising valve 21 closes . closure of pressure rising valve 21 terminates fuel delivery to the combustor atomizers and opening of solenoid valve 74 immediately establishes a communication path between the upstream and downstream sides of high pressure pump 14 ( via line 73 , solenoid valve 74 , and lines 78 and 79 ). fuel pressure in fuel cavity “ a ” 57 , px , thus drops to po , causing spring 55 to shift large piston member “ b ” 51 to the extreme of its stroke in the direction of lower end 53 . this action increases the volume of fuel cavity “ b ” 54 thereby collecting all the fuel in the fuel control system 10 downstream of pressure rising valve 21 , and preventing it from draining into the engine creating atmospheric pollution and / or puddling , causing hot starts upon subsequent engine operation . simultaneously , at rapid shutdown subsystem 48 b , with the reduction of px to po , small piston 71 moves toward lower end 70 , thus establishing an open communication path between line 77 and line 79 . in addition , as the pressure in lines 77 and 19 fall to the p 0 level the bypass valve 18 moves toward orifice 19 a . these actions causes all of the fuel being delivered to the chamber atomizers to be immediately bypassed back to the high pressure pump 14 inlet , either through the bypass valve itself or through piston “ a ” cavity upper end 69 . the rapid shutoff of fuel flow to the engine has therefore been achieved . when solenoid valve 74 is again closed by ecu command , the reverse process takes place . fuel cavity “ a ” 57 pressure px increases to p 1 forcing small piston 71 to move toward upper end 69 , stopping flow through line 77 thus terminating the fuel bypass condition . on the ecology management subsystem , 48 a , large piston member “ b ” 51 also moves toward upper end 52 , compressing spring 55 , and forcing the fuel previously collected in fuel cavity “ b ” 54 to return to the fuel control system manifold downstream of pressure rising valve 21 . rapid turn on of fuel flow to the engine has therefore been achieved and atmospheric pollution has been prevented . the other embodiment also has the advantage that the ecology and rapid shutdown features can be separated , along line a - a of fig3 and 4 , in the event the ecology function is not required , such as on military engines . although the present invention has been described in considerable detail with reference to certain preferred versions thereof , other versions are possible . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred versions contained therein .	5
fig1 shows a flowchart which illustrates an embodiment of the method in accordance with the invention especially suitable for detection of low - frequency faults ; step s 10 of the flowchart determines the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 . this is preferably done by determining the amount of the difference between a first value s 1 w 1 of the first signal s 1 and an earlier second value s 1 w 2 of the first signal s 1 . the rate of change for the second signal s 2 is preferably determined by determining the amount of the difference between a first value s 2 w 1 of the second signal s 2 and an earlier second value s 2 w 2 of the second signal s 2 . in step s 11 the first threshold value sw 1 is adapted . for this purpose there is preferably provision for the adaptation of the first threshold value sw 1 to be undertaken depending on the rate of change roc 1 of the first signal s 1 and depending on the rate of change roc 2 of the second signal s 2 , by determining at the sum of the maximum rates of change max 1 , max 2 , max 3 and max 4 determined at the various points in time and of a constant k . step s 12 determines the amount b 1 of the difference between the value of the first signal s 1 and the value of the second signal s 2 . step s 13 compares the amount b 1 determined in step s 12 with the first threshold value sw 1 adapted in a step s 11 . where the amount b 1 exceeds the current first threshold value sw 1 the conclusion is that a fault has occurred . the flowchart then branches back to step s 10 . fig2 shows a flowchart which illustrates an embodiment of the method in accordance with the invention especially suitable for detection of high - frequency faults ; step s 20 determined the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 in the way already explained on the basis of fig1 . step s 21 determines the first rate of change sum roc 1 s and the second rate of change sum roc 2 s . in this case the first rate of change sum roc 1 s is determined from a rate of change roc 1 w 1 of the first signal s 1 determined at a first point in time and a number of rates of change roc 1 w 2 , roc 1 w 3 , roc 1 w 4 , roc 1 w 5 , roc 1 w 6 , roc 1 w 7 and roc 1 w 8 of the first signal s 1 determined before the first point in time while the second of rate of change sum roc 2 s is determined from a rate of change roc 2 w 1 of the second signal s 2 determined at a second point in time and a number of rates of change r 0 c 2 w 2 , roc 2 w 3 , roc 2 w 4 , r 0 c 2 w 5 , roc 2 w 6 , roc 2 w 7 and roc 2 w 8 of the second signal s 2 determined before the second point in time . the first point in time and the second point in time can coincide in this case . step s 23 executes low pass filtering of the difference between the first rate of change sum roc 1 s and the second rate of change sum roc 2 s in order to remove undesired high frequency components from this difference . in step s 24 the amount of the low pass filtered difference between first rate of change sum roc 1 s and the second rate of change sum roc 2 s is formed in order to determine a filtered value fw . subsequently the filtered value fw is compared in step s 25 with a first prespecified second threshold value sw 2 in which case a high frequency fault is concluded if the filtered value fw exceeds the second threshold value fw 2 . then the flowchart branches back to step s 20 . fig3 shows an embodiment of the first means for determining rates of change preferably provided in the device in accordance of invention . in this diagram subtraction means 34 form the difference between a first value s 1 w 1 of the first signal s 1 and an earlier second value s 1 w 2 of the first signal s 1 provided by delay means 32 . means for forming the amount 36 generate the amount of this difference and make it available as rate of change roc 1 of the first signal s 1 . fig4 shows an embodiment of the second means for determining rates of change preferably provided in the device in accordance of invention . in a similar way to the case shown in fig3 , subtraction means 40 form the difference between a first value s 2 w 1 of the second signal s 2 and an earlier second value sws 2 of the second signal s 2 provided by delay means 38 . means of forming the amount 42 make available the difference as a rate - of - change signal roc 2 of the second signal s 2 . fig5 shows part of an embodiment of the device in accordance with the invention especially for detection of low - frequency faults . in this diagram the means of adapting the threshold values designated 16 overall feature means for determining maxima 44 to which the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 are directed . the means of determining maxima 44 directs the current maximum of the rate of change roc 1 of the first signal s 1 and the rate of change roc 2 of the second signal s 2 to summation means 46 . furthermore the maxima of the rates of change max 1 , max 2 , max 3 and max 4 determined at various points in time and provided by the relevant delay means 48 to 52 are directed to the summation means 46 . from these and from a constant k fed in from memory means 54 the summation means 46 determines the current first threshold value sw 1 which will be directed to first comparison means 14 . the first comparison means 14 compare the first threshold value sw 1 with an amount b 1 which is determined by the means for forming the amount 58 from a difference between a value of the first signal s 1 and value of the second signal s 2 provided by a subtraction means 56 . where the first comparison means 14 determines that the amount b 1 is larger than the first threshold value sw 1 it concludes that there is a fault . fig6 shows a part of an embodiment of the device in accordance with the invention especially suitable for detection of high - frequency faults . in this diagram a first rate of change sum roc 1 s and a second rate of change sum roc 2 s is fed to a means of subtraction 26 to form the difference between these two rates of change . the first rate of change sum roc 1 s and the second rate of change sum roc 2 s are determined in this case using the means described below on the basis of fig7 and 8 . the difference determined by the means of subtraction 26 is fed to a low pass filter 28 which filters out undesired high - frequency signal components . the low pass filtered difference between the first rate of change sum roc 1 s and the second rate of change sum roc 2 s is subsequently fed to amount formation means 30 which delivers a corresponding amount as filtered value fw . the filtered value fw is fed to second comparison means 18 which compares the filtered value fw with a second threshold value sw 2 which is fed from threshold value storage means 20 . where the filtered value fw is larger than the second threshold value sw 2 the conclusion is that there is a high - frequency fault . fig7 shows an embodiment of the first means of summation preferably provided for the device in accordance with the invention . in this diagram a current rate of change roc 1 determined by the means for determining rates of change shown in fig3 is fed to first means of summation 22 . furthermore earlier rates of change roc 1 w 2 , roc 1 w 3 , roc 1 w 4 , roc 1 w 5 , roc 1 w 6 , roc 1 w 7 and r 0 c 1 w 8 provided by the relevant delay means 60 to 72 are fed to the first means of summation 22 . the first means of summation 22 delivers the first rate of change sum roc 1 s , which corresponds to a sliding average . fig8 shows an embodiment of the second means of summation preferably provided for the device in accordance with the invention . in this diagram a current rate of change roc 2 of second signal s 2 determined by the means for determining rates of change shown in fig4 is fed to second means of summation 24 . furthermore earlier rates of change roc 2 w 2 , roc 2 w 3 , roc 2 w 4 , roc 2 w 5 , roc 2 w 6 , roc 2 w 7 and roc 2 w 8 of the second signal s 2 provided by the relevant delay means 74 to 86 are fed to the second means of summation 24 . the second means of summation 24 delivers the second rate of change sum roc 2 s which can also be designated as a sliding average value . fig9 shows a graph which for example illustrates a typical curve of the first signal and of the second signal , in which case the curve s 1 designates the curve of the first signal and the curve s 2 reproduces the curve of the second signal . it can be seen from the illustration in fig9 that the second signal s 2 is delayed by four sampling steps compared to the first signal s 1 . furthermore the second signal s 2 exhibits a sine - wave additive fault with rising frequency . fig1 shows a graph which , for the curve of the first signal and the second signal in accordance with fig9 , illustrates the adaptation of the first threshold value , the amount of the difference between the value of the first signal and the value of the second signal and an error signal which shows when the signal difference lies above the relevant diagnosis threshold , with the curve sw 1 reproducing the curve of the first threshold value while the curve b 1 reproduces the amount of the difference of the first signal s 1 and the second signal s 2 . the curve fe shows when the amount b 1 lies above the diagnosis threshold determined in each case by the first threshold value sw 1 . it can be seen from the illustration in fig1 that the first threshold value sw 1 becomes ever greater as the frequency of the fault increases , which is also caused by the fact that the rate of change of the first signal and of the second signal increases . the curve shown in fig1 for example can be produced by the form of embodiment of the method in accordance with the invention explained on the basis of fig1 . it can be seen that faults are less easily able to be detected as the signal frequency increases . fig1 shows a graph which , for the curves of the first signal and the second signal in accordance with fig9 , illustrates the output signal of the first summation means and the second summation means . in this diagram the curve roc 1 s indicates the first rate of change sum while the curve roc 2 s indicates the second rate of change sum . the illustration in fig1 corresponds to a sliding average formed over 8 sampling steps of the first signal s 1 of the second signal s 2 respectively . the first rate of change sum roc 1 s returns to 0 after 50 sampling steps , while the second rate of change sum roc 2 s becomes ever larger as the signal frequency rises . fig1 shows a graph , which for the curves of the first signal and the second signal in accordance with fig9 , illustrates the amount of the low pass filtered difference between the first rate of change sum and second rate of change sum . it can be seen from the illustration in fig1 that the filtered value fw continues to increase as the frequency of the input signals rises . error detection , particularly of high frequency faults , is possible by a subsequent comparison with the second threshold value . the features of the invention disclosed in this description , in the drawings and in the claims can be of importance both individually and in any combination for implementing the invention .	6
fig1 - 5 show generally a first embodiment of the apparatus of the present designated generally by the numeral 10 . medullary nail inserter and remover 10 includes a frame or body in the form of an elongated handle 11 having a proximal end 12 and a distal end 13 . the proximal end 12 of the handle provides an anvil 14 that can be hammered or otherwise impacted by a user in order to insert or to remove the handle and an attached intramedullary rod 56 . placement of intramedullary rods per se in a patient &# 39 ; s femur is discussed in u . s . pat . no . 5 , 167 , 663 incorporated herein by reference . a trigger 15 and pushrod 16 are preferably integral and moveable relative to the handle body 11 . the trigger 15 moves between &# 34 ; releasing &# 34 ; and &# 34 ; locking &# 34 ; positions . when the surgeon pulls the trigger 15 towards anvil 14 and overcomes the spring 17 pressure , this defines the &# 34 ; releasing &# 34 ; position . when the surgeon releases the trigger , spring 17 urges trigger 15 and its pushrod 16 towards the distal end 13 of the handle body 11 to define the &# 34 ; locking &# 34 ; position . trigger 15 and pushrod 16 can be an integral part . handle body 11 has a longitudinal slot 18 that is occupied by pushrod 16 . trigger 15 tracks slot 18 and a longitudinal groove 20 in handle 11 . post 19 extends from rear of trigger 15 and is surrounded by coil spring 17 . spring 17 is held in position by virtue of its placement on post 19 . the coil spring 17 presses at one end portion against trigger 15 . the opposing end portion coil spring 17 fits against handle 11 at opening 19a . the distal end 13 portion of handle body 11 provides a cylindrical sleeve 21 having an outer surface 22 and an inner surface 23 . sleeve 21 surrounds cylindrically shaped member 24 . cylindrical member 24 provides an open socket that includes a hexagonal ( see fig6 ) or circular ( see fig1 ) portion 25 . socket portion 25 carries a plurality of locking balls 26 . each locking ball 26 is carried in an opening 27 . the openings 27 are sized and shaped to allow each ball 26 to extend well into socket 25 . however , the balls 26 do not fall into the socket 25 . each opening 27 is sized to allow almost one - half of a particular ball 26 to enter socket 26 ( see fig6 - 8 ). a majority of each locking ball 26 is retained within opening 27 at all times . cylindrical member 24 includes an annular end portion 29 that has a beveled annular surface portion 28 . beveled annular surface 28 allows each of the locking balls 26 to retreat fully into opening 27 so that nail puller element 48 can be removed when the trigger 15 is pulled to the &# 34 ; releasing &# 34 ; position ( see fig8 ). cylindrically shaped member 24 attaches to handle body 11 at narrowed portion 30 . a pair of opposed slots 31 , 33 are placed on opposite sides of longitudinally extending slot 18 . the slots 31 , 33 allow post 32 to extend through pushrod 16 and into each slot 31 , 33 . the post 32 forms a connection with link 34 at one end portion of link 34 . the opposing end portion of link 34 attaches to transverse post 35 ( see fig1 ). post 35 is attached to cylindrical sleeve 21 at slot opening 36 . an angle 37 is formed between the central axis of socket 25 and the longitudinal axis of handle body 11 which is generally parallel to pushrod 16 . cylindrical bore 39 is separated from the socket portion 25 by annular shoulder 38 . cylindrical bore 39 communicates with a smaller diameter passageways or channels 40 , 41 each having a common central axis 42 . the channels 40 , 41 allow a wire to be placed through each channel 40 , 41 and into cylindrical bore 39 and then into socket 25 . the wire can also be inserted into the intramedullary rod via the central bore 55 of nail puller 48 . axis 42 in fig4 shows the central axis of channels 40 , 41 . angle 37 defines the angle between axis 42 and the central longitudinal axis of handle body 11 designated as 43 in fig4 . a pair of opposed longitudinally extending slots 44 , 45 are positioned on opposite sides of cylindrical member 24 . pins 46 , 47 are provided on cylindrical sleeve 21 , each of the pins 46 , 47 extending respectively into a slot 44 , 45 . the pins 46 , 47 communicate with the end portions of the respective slots 44 , 45 to define limits of movement of cylindrical sleeve 21 relative to cylindrical member 24 . because of the connection between cylindrical sleeve 21 and pushrod 16 via link 34 , this also defines the limits of travel of pushrod 16 and trigger 15 . nail puller 48 includes an elongated shank 49 that includes a cylindrical head 50 and a hexagonal section 53 . an annular groove 52 is positioned at one end portion of shank 49 adjacent hexagonal section 53 . the opposite end of shank 49 provides a threaded end portion 54 . nail puller element 48 includes a longitudinal cylindrical bore 55 that extends the full length of shank 49 . nail puller element 48 can threadably attach at threads 54 to intramedullary rod 56 . the proximal end 57 of intramedullary rod 56 is provided with internal threads 58 that can engage the distal end 58 of nail puller element 48 at threaded portion 54 . intramedullary rod 56 is a commercially available surgical prosthetic device . such a rod can be seen in the prior brumfield patent 5 , 167 , 633 incorporated herein by reference . intramedullary rods 56 typically include a longitudinal bore 59 , a pair of diagonal openings 60 , 61 , a pair of transverse openings 62 , 63 . a plurality of bone screws ( not shown ) can be affixed through one of the openings 60 - 63 for affixing the intramedullary rod 56 to a patient &# 39 ; s bone tissue . bore 59 can extend the full length of rod 56 . the distal end 58 can be a closed end . in order to remove an intramedullary rod 56 from a patient &# 39 ; s intramedullary canal ( such as a femur ) 68 the surgeon first threads nail puller 48 into the proximal end 57 of intramedullary rod 56 . the surgeon can apply torque to the nail puller element 48 at hexagonal head 53 portion or to hexagonal section 51 using a wrench or like instrument . the surgeon then pulls trigger 15 which retracts pushrod 68 and pulls link 34 and sleeve 21 . this places the plurality of locking balls 26 adjacent beveled annular section 28 of sleeve 21 . in the position , each of the locking balls 26 is free to travel toward the beveled annular surface 28 and away from hexagonal socket 25 . this allows the nail puller element 48 to be withdrawn socket 25 as the locking balls 26 are released from the annular groove 52 of nail puller element 48 . to insert a rod 56 , the surgeon attaches nail puller element 48 to intramedullary rod 56 at proximal end 57 by threading the threaded end portion 54 into corresponding internal threads with bore 59 . the surgeon then attaches handle 11 to the nail puller element 48 at head 51a , 53 . the locking balls 26 register in annular groove 52 . the surgeon releases the trigger to lock the balls 26 in locking position ( fig7 ). the surgeon can them impact the handle 11 to transmit force necessary to implant rod 56 into the patient &# 39 ; s intramedullary canal . in fig1 - 13 , a second embodiment of the apparatus of the present invention is shown illustrating a second construction of the linkage that includes the handle 11 , pushrod 16 , cylindrical member 24 , and cylindrical sleeve 21 . in fig1 - 13 , the pushrod 16 provides a pair of tab 65 that extend transversely with respect to the central longitudinal axis of the pushrod 16 . the tab 65 register with an elongated longitudinal slot 66 . the pushrod moves between locking and releasing positions as with the first embodiment , but in the second embodiment , the locking tabs register with opposite end portions of the slot 66 depending upon whether the pushrod is in locking or releasing position . when a surgeon pulls the trigger 15 the locking tabs 65 register with end portion 67 of slot 66 . when the surgeon releases the trigger 15 , coil spring 17 urges the pushrod toward distal end 13 of handle body 11 and the tab 65 engage end portion 68 of longitudinal recess 66 . a link 70 is pinned at pinned connection 69 to pushrod 16 . link 70 attaches to cylindrical sleeve 21 at pinned connection 71 . transverse pin 71 extends through transverse 72 and sleeve 21 . one end portion of link 70 register in slot 73 of cylindrical sleeve 21 as shown in fig1 . the cylindrical portion 24 is integrally formed with handle body 11 as shown in fig1 . socket 25 is generally cylindrically shaped and carries the plurality of locking balls 26 at openings 27 . a single diagonally extending channel 74 extends between socket 25 and the upper surface 75 of handle 11 at opening 76 . the following table lists the part numbers and part descriptions as used herein and in the drawings attached hereto . ______________________________________parts listpart number description______________________________________10 medullary nail remover11 handle body12 proximal end13 distal end14 anvil15 trigger16 pushrod17 spring18 longitudinal slot19 post20 groove21 cylindrical sleeve22 outer surface23 inner surface24 cylindrical member25 socket26 locking ball27 opening28 beveled annular surface29 annular end portion30 narrowed portion31 slot32 post33 slot34 link35 post36 transverse opening37 angle38 annular shoulder39 cylindrical bore40 channel41 channel42 axis43 angle44 slot45 slot46 pin47 pin48 nail puller element49 shank50 cylindrical section51 hexagonal head section 51a cylindrical section52 annular groove53 hexagonal head section54 threaded portion55 cylindrical bore56 intramedullary rod57 proximal end58 distal end59 longitudinal bore60 diagonal opening61 diagonal opening62 transverse opening63 transverse opening64 distal end65 tab66 slot67 end of slot68 end of slot69 pinned connection70 link71 pin72 transverse opening73 slot74 channel75 upper surface76 opening______________________________________ because many varying and different embodiments may be made with in the scope of the inventive concept herein taught , and because many modifications may be made in the embodiments herein detailed in accordance with the descriptive requirement of the law , it is to be understood that the details herein are to be interpreted as illustrative and not in a limiting sense .	0
the principles of the present invention are particularly useful when utilized in a device generally illustrated at 20 in fig1 . the device 20 includes a pulse laser 6 which is a laser diode and transmits a light pulse 21 through a first focusing means such as a lens 1 to strike a beam divider 2 which is for example a 50 % mirror . the pulse 21 from the laser is divided in two portions 22 , 23 by the beam divider 2 with the unused portion 22 being fed or directed to a light absorbing surface 16 so that no disruptive reflections come about . if desired , the unused portion 22 may be directed to a light sensing means 15 ( fig2 ) to create a reference signal . the other portion 23 is directed towards an end of an optical fiber 11 and is preferably focused at the end by a second focusing means comprising a lens 3 . in order to avoid reflections as the pulse 23 strikes the end of the fiber 11 , a coated quartz plate 8 is disposed adjacent the end of the fiber 11 and the gap between the plate 8 is filled with an immersion fluid 9 . as illustrated , the fiber 11 is releasably held in a prism - shaped guideway 10 so that the fiber being measured may be easily interchanged . the pulse as it travels through the glass fiber 11 will be reflected when it reaches the opposite end or strikes a discontinuity in the fiber . when reflected , it will return and exit through the one end and strike the beam divider 2 which will reflect it preferably through focusing means such as a lens 4 onto a light sensing means receiver 7 which is a light sensitive receiver . since short fibers will require pulses having less magnitude than the longer fibers , it is desirable that the output of the laser 6 can be changed as the length of the fibers being tested is changed . however , it is undesirable to decrease the output of the laser by decreasing the current applied thereto because the necessary decreases in the current may fall in the vicinity of the laser threshold and cause alteration in the shape of the pulse as well as cause a timewise shifting . thus , the apparatus includes one or more interchangeable dampening filters 5 which are disposed in the path of the output pulse 21 of the laser to vary the output power of the pulse . it is especially favorable if all the optical surfaces for a utilized wavelength of the pulse laser 6 are coated to minimize reflection losses . it is also desirable for the laser 6 , the guideway 10 as well as the receiver 7 to be adjustable in three dimensions relative to the coupling device 2 . in fig2 a block circuit diagram of the inventive device is illustrated . the block 6 is the pulse laser which preferably is a laser diode of the type ld22 which is sold by laser diode company and which produces light of a wavelength of 905 m ( 9050 angstroms ). if a wavelength of 850 nm ( 8500 angstroms ) is desired , a laser diode la63 which is sold by the above manufacturer can be utilized . the laser 6 is triggered by a laser drive or control system 12 which can contain either a thyristor , a transistor or an avalanche transistor as an amplification element . the laser drive system 12 is controlled by a control device having a pulse generator 13 which produces pulses of a pulse width of 1 microsecond and at a pulse repetition frequency of 1 khz and at an amplitude of approximately 5 volts . an example of a suitable pulse generator is a pulse generator 101 which is manufactured and sold by the data pulse company . as mentioned above , light pulses which are reflected by a discontinuity or by a fiber end are directed to the light sensing means such as an optical receiver 7 which generates an electrical pulse from the sensed reflected light pulse . an example of suitable optical receivers are of a type such as rca &# 39 ; s type c 30815 or texas instrument type tixl74 . electrical pulses from the receiver 7 are fed to a stop input on a counter 14 which receives a triggering or starting pulse from the pulse generator 13 . an example of a typical counter which may be utilized is for example a tektronix type dc 505 or a hewlett packard type 5245 l . as mentioned above , the drive 12 may contain either a thyristor , transistor or an avalanche transistor as an amplifying element . as illustrated in fig3 the pulse laser 6 is connected to a power supply by an avalanche transistor 24 which receives an input pulse via line 25 from the pulse generator 13 . a strip line 26 is connected across the avalanche transistor 23 and may be for example approximately 1ω ≈ 5ns of electrical length and may comprise a teflon foil of 3 × 15 cm which foil is coated with copper . as mentioned above , the pulse which is coupled into one end of the glass fiber will be reflected by either the opposite end or a discontinuity contained in the fiber . thus , the term &# 34 ; discontinuity &# 34 ; should be interpreted in the present invention as including the discontinuity that occurs at the opposite end of the glass fiber . since the speed of propagation of the light in the glass fiber is easily determined and known , the geometric distance of the discontinuity from the one end of the glass fiber can be easily calculated from the measured time interval between coupling of the pulse into the one end and receiving or sensing the reflected pulse . due to the multiplicity of the losses which occur only a high output pulse laser and sensitive receivers can be utilized in the above apparatus . since the reflected output at the fiber end which is in contact with the area amounts to a so - called fresnel reflection in quartz of 3 . 5 %, the return signal is weaker by 15 db . based on this assumption , the following measurements of reflection were made with the other end of the glass fiber in contact with different materials . ______________________________________fiber end in contact with : reflection factors______________________________________air ( calibration value ) 0 . 035aluminum mirror 0 . 77mercury drops 0 . 35glycerin drops 0 . 0015non - coated photodiode ( bpx 65 ) 0 . 23non - coated photodiode immersed 0 . 11coated diode ( bpx special ) outside the coating 0 . 23inside the coating 0 . 038immersed and inside the coating not measuredplug , not immersed 0 . 052plug , immersed 0 . 0035water ( n . sub . 20 . sup . d = 1 , 333 ) 0 . 0039glycerin + water ( n . sub . 20 . sup . d = 1 . 46 ) 0 . 00035bromonaphthaline ( n . sub . 20 . sup . d = 1 . 66 ) 0 . 0049methylene iodine ( n . sub . 20 . sup . d = 1 . 74 ) 0 . 011______________________________________ if a simple gaas heterostructure laser diode with a pulse width of 100 ns and a 1 watt coupled - in output is used , a 95 db of dampening can still be permitted . a disadvantage of the broad pulses ( 100 ns ) consists in the fact that the resolution between two neighboring reflections comes at approximately 10 meters . thus , the point of reflection can be determined with only an accuracy of ± 3 . 5 meters . however , if one works with a repetition frequency of a few khz for the pulse laser , then one can employ a regulated amplifier and the accuracy improves to 1 meter . this relatively high accuracy comes from the fact that the pulse must pass through the glass fiber twice and the speed of light in glass is substantially less than that of air . thus , a doped quartz glass fiber for a light pulse of a wavelength of 0 . 9 μm has an index of refraction of 1 . 46 and the speed of the light pulse in the glass fiber is 0 . 1027 m / ns . while the apparatus of fig2 suggests starting the counter 14 with a triggering pulse from the pulse generator 13 which pulse is applied to the laser drive 12 , it is possible to use a second light sensing device 15 similar to the receiver 7 . this second light receiver is positioned to receive the portion 22 and will create a starting signal or pulse which is applied to the counter . although various minor modifications may be suggested by those versed in the art , it should be understood that i wish to employ within the scope of the patent granted hereon , all such modifications as reasonably and properly come within the scope of my contribution to the art .	6
fig1 represents a cube - shaped implant 1 of enlarged size reflecting the state of the art . the open configuration , especially of the faces 2 and vertex areas 4 , but also of edges 3 , is to be seen as a weak point of such implants 1 because the aneurysm wall in contact with them is particularly prone to rupture . in addition , the insufficient packing density of the implant 1 in the vicinity of said areas 2 , 3 and 4 only prevents to a minor extent implants subsequently placed for the purpose of filling the inner hollow space 5 from being expelled again . fig2 shows two views 2 a and 2 b of a tetrahedron - shaped implant 1 ′ according to the invention , said implant having assumed its three - dimensional tetrahedral tertiary structure . the faces 2 ′ of tetrahedron 6 are built up by two uniformly sized large loops 7 , two of which in each case being adjacently positioned , with the projections of the large loops 7 extending into the space constituted by the sectional areas of two neighboring large loops 7 each forming the imaginary edges 3 ′ of tetrahedron 6 . in each of faces 2 ′ a loop 8 of smaller size is arranged . by this arrangement the packing density of the tetrahedron 6 in the area of faces 2 ′ is increased , which significantly improves the safety against rupturing dangers to which the adjoining aneurysm wall is exposed when implant segments or further implants are subsequently inserted or placed . the high packing density thus achieved in faces 2 ′ moreover prevents in particular subsequently inserted implant segments or subsequently inserted additional implants meant to fill the inner hollow space 5 ′ from being forced out again through the neck of the aneurysm . for that reason the implant 1 ′ according to the invention is particularly suited as well to the therapeutic occlusion of wide - neck aneurysms the treatment of which , as is known , is especially difficult as a rule . besides , the arrangement of the smaller loops 8 slightly raised above the projection plane of the tetrahedron faces 2 ′ formed by the large loops 7 enables the implant 1 ′ to be particularly well secured in the aneurysm , with special reference in this context being made to fig2 a . filament 9 forming the tetrahedron 6 is a micro - helix having a diameter of 0 . 26 mm and consisting of a platinum - iridium wire which has a diameter of 60 . mu . m . a nitinol wire extends through the inner hollow space of the micro - helix , said wire being non - detachably connected at the proximal and distal end to filament 9 and due to its elastic biasing force imprinting on the helix 9 the tetrahedral tertiary structure after said helix has been released from the catheter . fig3 represents the secondary structure of the tetrahedron shown in fig2 in the form of a development of a ball making use of 4 radial sections 10 to 10 ″′. the loops 7 / 8 themselves are of roughly circular shape and having assumed their predetermined spatial configuration form a regular tetrahedron . along the longitudinal axis of helix 9 the large 7 and the small loops 8 are arranged alternately , with the small loops 8 being placed inside the large loops 7 in the secondary structure . the proximal and the distal ends of filament 9 are identified by reference number 11 and , respectively , 12 . fig4 shows two views 4 a and 4 b of a tetrahedron - shaped implant 1 ′ according to the invention , said implant having assumed its three - dimensional tertiary structure . the faces 2 ′ of tetrahedron 6 are built up by uniformly sized large loops 7 of which two each are positioned adjacent to each other and thus form by way of their projections the imaginary edges 3 ′ of tetrahedron 6 . at the location where the projection of three adjoining large loops 7 each intersects there are the vertices 4 ′ of the tetrahedron , with one smaller sized loop 8 each being arranged at said vertices . since the smaller loops 8 are arranged below the imaginary points of intersection the tetrahedron 6 in this case has a more rounded shape deviating from an ideal geometric tetrahedron shape . by this arrangement the packing density of the tetrahedron 6 in the area of vertices 4 ′ is increased , which significantly improves the safety against rupturing dangers to which the adjacent aneurysm wall is exposed when implant segments or further implants are subsequently inserted or placed . aside from this , the rounded tetrahedral shape thus formed will more favorably adapt to the organic structure of aneurysm lumens to be filled than could be accomplished with an ideal geometric tetrahedron . the high packing density thus achieved at vertices 4 ′ moreover prevents in particular implant segments or additional implants subsequently inserted or placed for the purpose of filling the inner hollow space 5 ′ from being forced out again through the neck of the aneurysm . the helix 9 forming the tetrahedron 6 is a micro - helix having a diameter of 0 . 26 mm and consisting of a platinum - iridium wire which has a diameter of 60 . mu . m . a polymer thread or a thread made of a nickel - titanium alloy extends through the inner hollow space of the micro - helix , with said thread being fixed at the proximal and distal end of the helix 9 and prevents the helix 9 from being torn off during the placement or repositioning . on the platinum - iridium wire an elastic biasing force has been imprinted which forces it into its preformed tetrahedral configuration as soon as the mechanical constraint caused by the catheter has been omitted . although the platinum - iridium alloy used has no shape - memory properties it greatly improves the slidability of the helix during placement on account of its excellent supporting characteristics . fig5 by way of 4 radial sections 10 to 10 ′″ represents the secondary structure of the tetrahedron shown in fig4 in the form of the development of a ball . the loops 7 / 8 themselves are of roughly circular shape and having assumed their predetermined spatial configuration form a regular tetrahedron . along the longitudinal axis of helix 9 the large 7 and the small loops 8 are arranged alternately , with the small loops 8 being placed between the large loops 7 . the proximal and the distal ends of helix 9 are identified by reference number 11 and , respectively , 12 . in fig6 an implant 1 ′ according to the invention is illustrated that is placed into an aciniform aneurysm 13 , said implant forming into a tetrahedron 6 as tertiary structure . by arranging the smaller loops 8 in the area of the faces 2 ′ of the tetrahedron 6 built up by the large loops 7 a higher packing density of the tetrahedron faces 2 ′ is achieved . this not only reduces the danger of a wall rupture but also and in particular prevents additionally inserted implants ( not shown here ) from exiting through the neck of the aneurysm 14 . this configuration even enables aneurysms exhibiting medium - sized necks 14 as illustrated here to be occluded without having to employ stents . it is particularly expedient here if the implant 1 ′ as shown is positioned in such a way that one of the tightly packed face areas 2 ′ of the tetrahedron 6 is situated at or above the aneurysm neck 14 . the tetrahedral tertiary structure is excellently suited for the occlusion of large aneurysms , for example of an aneurysm 13 as shown here having a therapeutic dimension of 10 min in diameter . since the tetrahedron 6 has a diameter of 12 mm it secures itself firmly inside the aneurysm 13 during placement when forming into its tertiary structure such that the tension thus built up prevents it from slipping out of the aneurysm 13 . such an “ oversizing ” offers advantages particularly for the treatment of wide - neck aneurysms because customary implants are not sufficiently secured inside of them to make sure they cannot exit or be expelled . with the help of a micro - catheter the implant 1 ′ with the distal portion 12 of the helix 9 in front was moved through the blood vessel 15 into the aneurysm 13 where , when discharged from the catheter , it assumed the illustrated three - dimensional tertiary structure on account of a mixed stress - and temperature - induced martensitic transformation of the nitinol wire accommodated in the micro - helix 9 consisting of a platinum - iridium alloy . after checking the correct positioning under radiographic control by employing customary state - of - the - art methods the implant was detached electrolytically from the insertion aid designed in the form of a guide wire . for this purpose and with the aid of a source of electrical power a voltage was applied for a period of 0 . 1 to 20 minutes to the cathode positioned on the body surface and to the implant 1 ′ acting as anode and being placed in the aneurysm 13 to be occluded . applying this voltage resulted in the implant 1 ′ becoming electrolytically detached due to electrolytic corrosion taking place at the electrolytically corrodible location in the severance module arranged between the guide wire and the filament 9 . said severance module is of particularly robust design and has a relatively large diameter of 100 . mu . m to yield a high margin of safety preventing kinking or buckling when the implant 1 is positioned . finally , the guide wire was retracted into the catheter and then removed from the system together with the catheter . fig7 is a schematic view of the development of a pentagonal dodecahedron and the extension of a micro - helix 9 designed to form into a pentagonal dodecahedron . the individual faces f1 to f12 of the polyhedron are defined by the loops of the micro - helix . in this case the distal end of the micro - helix 9 is located on a face f12 whereas the proximal end enters the body at a vertex or corner point between f1 / f2 / f3 . fig8 eventually shows as schematic representation the tapered portion of the distal end 17 of a filamentous shaping element 16 reducing to approx . 50 % of the diameter .	0
referring now to the drawings , wherein like components are designated by like reference numerals , fig1 schematically illustrates one preferred embodiment 10 of laser apparatus in accordance with the present invention . apparatus 10 includes a mode - locked resonator 12 having a resonator ( cavity ) length l . it is emphasized that the length l , as defined here , is the round - trip length of the resonator , i . e ., in a linear resonator having first and second end - mirrors , l is twice the distance from the first end - mirror to the second end - mirror . length l is an optical round - trip length of the resonator and includes the effect of refractive index of a gain - medium ( also not shown ) and any other refractive optical elements therein . mode - locked resonator 12 delivers optical pulses having a fundamental wavelength at a pulse - repetition period τ . the pulse - repetition period is dependent on the optical length of the resonator and is equal to the round - trip time τ for fundamental radiation in the resonator , i . e ., the round - trip length l divided by the speed of light . the pulse repetition frequency ( prf ) of pulses delivered is , of course , 1 / τ . the present invention is particularly useful when the prf of the fundamental wavelength pulses is greater than about 10 mhz and the pulse - duration of the fundamental wavelength optical pulses is less than about 100 picoseconds . in one example of the above - discussed paladin ™ laser , the prf of the resonator is about 80 mhz , i . e ., τ is about 12 . 5 nanoseconds ( ns ). the pulse - duration ( fwhm ) is about 15 picoseconds , i . e ., τ is about 830 times the pulse - duration . as noted above , this laser generates pulses of third - harmonic ( 3h ) radiation having a wavelength of about 355 nm from fundamental - wavelength pulses having a wavelength of about 1064 nm . for convenience of description , reference is made to this laser further in this description , but this should not be construed as limiting the invention to the particular structure or parameters of this mode - locked laser . in apparatus 10 , pulses of fundamental - wavelength radiation from resonator 12 are delivered to a harmonic generator 14 along path a . the harmonic generator converts the fundamental - wavelength pulses delivered by the laser - resonator to harmonic - wavelength pulses . harmonic generator 14 may include only one optically nonlinear crystal arranged to generate pulses of second - harmonic radiation , or two or more optically nonlinear crystals arranged to generate pulses of third or higher harmonic - wavelength radiation as is known in the art . harmonic - radiation pulses from harmonic generator 10 are delivered along path b to a pulse stretching delay loop ( pulse - stretcher ) 16 in accordance with the present invention . an inventive aspect of this pulse - stretcher is that the delay loop thereof has as round - trip of l ± δl , where δl is a relatively small fraction , for example , less than about one - hundredth of round - trip length l . in other words , the delay loop of stretcher 16 preferably has a round - trip delay time of τ ± δτ , where δτ is on the order of a few pulse - durations , i . e ., the round - trip delay time is fractionally greater than or less than a pulse - repetition period . a pulse - repetition period of 12 . 5 ns corresponds to a delay loop round - trip length of about 3 . 75 meters and a resonator length of about 1 . 875 meters . prior - art pulse - stretchers of the type described in above referenced u . s . pat . no . 7 , 035 , 012 have a delay time per round - trip that is only between one - half and a few pulse - durations . fig2 schematically illustrates one example of an optical delay loop 16 a suitable for use in the apparatus of fig1 . delay loop 16 a includes a beamsplitter 18 that is partially reflective and partially transmissive for the wavelength of harmonic - wavelength pulses generated by the harmonic generator of apparatus 10 . each of the harmonic - wavelength pulses is incident on beamsplitter 18 , which reflects a portion ( the first or prompt replica ) of the pulse along path c and transmits the remainder of the pulse into the delay loop . in the delay loop , the remainder of the pulse is incident sequentially on concave mirrors 20 , 22 , and 24 , which are preferably configured to image the remainder of the pulse 1 : 1 , and preferably in the same orientation , back onto the beamsplitter at the original point of incidence . a portion of the remainder of the pulse is transmitted through the beamsplitter along path c as a second replica of the pulse and the remainder of that remainder goes around the delay loop again to provide third fourth , fifth etc . replicas until the pulse - replicas become vanishingly small and there is essentially nothing remaining of the pulse in the delay loop . relay imaging in delay loop 16 a is at unit magnification ( 1 : 1 ) when mirrors 20 and 24 have the same focal length . mirrors 20 , 22 , 24 , and beamsplitter 18 are preferably separated by a distance approximately equal to f 1 + 2f 2 . where f 1 is the focal length of mirrors 20 and 24 , and f 2 is the focal length of mirror 22 . this ensures that a source in the plane of beamsplitter 18 is relay imaged onto the same plane after a complete roundtrip in delay loop 16 a . preferably f 1 is about equal to 2f 2 . this provides that the size of a circulating pulse ( pulse - beam ) is the same on all three mirrors and beamsplitter 18 , and that focal points ( waists ) of the beam are located about mid - way between mirrors 20 and 22 , and between mirrors 24 and 22 . the first replica of the pulse will have a relative ( to the original pulse ) peak - intensity ( relative peak - power ) r , where r is the reflectivity of the beamsplitter at the harmonic wavelength . the remaining ( transmitted ) replicas will have a relative power p ( n ) that can be approximated by an equation : p ( n )=( 1 − a ) n − 1 ( 1 − r ) 2 r n − 2 ( 1 ) where a is the round - trip loss from scatter , absorption and the like , and n is the replica - number 2 , 3 , 4 , and so forth . it can be determined from equation ( 1 ) that , in this loop configuration , the lowest peak relative power in a set ( burst ) of replicas of any one pulse will be obtained when the first and second replicas thereof have equal peak - power . the value of r required to establish this condition can be approximated by an equation : r = 2 ⁢ a - 3 + 5 - 4 ⁢ ⁢ a 2 ⁢ ( a - 1 ) ( 2 ) by way of example , for a round - trip loss a of 0 . 02 r will be about 37 . 85 %. it can also be determined that whatever the peak - power of the first and second replicas , the third replica will have a peak - power less than either the first and second replicas . it can further be determined that the fourth and higher replicas will have a lower peak - power than the forgoing replica ; and more than 99 % of the maximum pulse energy obtainable , i . e ., after round - trip losses , is contained in the first six replicas of any pulse . all pulse - replicas of any one pulse that are delivered by a delay loop are temporally spaced apart by τ ± δτ . fig3 schematically illustrates another preferred embodiment 11 of laser apparatus in accordance with the present invention similar to apparatus 10 of fig1 but wherein the delay loop 16 of apparatus 10 is replaced by a delay loop 17 that delivers a predetermined number ( here four ) of replicas of each pulse , with each replica delivered along a different path . the four paths are designated p 1 , p 2 , p 3 , and p 4 . beam - combining optics 26 combine the replicas along a common path c as illustrated . alternatively , beam - combining optics can be provided that focus the different replica paths at a common point on a target to which the replicas are being delivered . various forms of beam - combining optics are known in the art to which the present invention pertains . as a detailed description of any such beam - combining optics is not necessary for understanding principles of the present invention , no such detailed description is presented herein . fig4 depicts one example 17 a of delay - loop 17 . delay loop 17 a is similar to delay loop 16 a of fig2 with an exception that the beamsplitter and mirrors of the loop are misaligned from the alignment of fig2 such that , after a first round trip in the loop , the remainder of the pulse is incident on the beamsplitter at a point thereon spaced apart from the point of entry . after a second and third round trips in the loop the remainder of the remainder of the pulse , and the remainder of the remainder of the remainder of the pulse , are incident on the beamsplitter at other spaced - apart points . another exception is that beamsplitter 18 of loop 16 a is replaced in loop 17 a by a beamsplitter 18 s , the reflectivity ( and transmission ) of which is graded or stepped over the beamsplitter such that reflectivity thereof is dependent on the location thereon of incident radiation . fig4 a schematically illustrates one example of reflective zones r 1 , r 2 , r 3 , and r 4 on a beamsplitter 18 s corresponding to the location thereon of paths p 1 , p 2 , p 3 , and p 4 , respectively . the paths are spaced apart and about parallel to each other . the reflectivity r 4 at the point of incidence on beamsplitter 18 s after the third round trip is made as close to zero as possible . alternatively , the beamsplitter can be configured such that after the third round trip the remaining pulse energy bypasses the beamsplitter altogether . an advantage of this type of loop is that the reflectivity - grading or reflectivity - stepping of the beamsplitter can be selected such that each replica of any one pulse has about the same peak - power . a disadvantage is that beam quality on target will usually be less than optimum due to the separation of the replica paths . delay loop 17 a is only one example of a loop that can provide a predetermined number of replicas along a corresponding number of separate paths . others are described in above - referenced u . s . pat . no . 7 , 035 , 012 , the complete disclosure of which is hereby incorporated by reference . any of these loops can be operated in an aligned form as an “ infinite ” loop , such as loop 16 a , with all replicas leaving the loop on a common path . fig5 is a timing diagram schematically illustrating division of harmonic - wavelength pulses into replicas thereof and recombination of replicas of different pulses into bursts thereof in a delay loop such as the delay loop of fig2 . the vertical axis in each line of the timing diagram is relative peak - power . the timing diagram is meant to represent operation of apparatus 10 immediately after the resonator begins to deliver pulses . the temporal development of replicas of the first through sixth pulses is depicted . replicas d 1 , d 2 , d 3 , d 4 , and d 5 are depicted for each of the six pulses . replicas d 1 and d 2 are assumed to have the same peak - power . in a delay loop 16 a having a loss of 2 % per round trip , this will occur when the reflectivity of beamsplitter 18 is about 37 . 9 % and there is no second - surface reflection . replicas d 3 , d 4 and d 5 have progressively diminishing peak - power , and it is assumed that higher numbered replicas have a sufficiently low peak - power as to be negligible . by way of example for an input pulse of unit peak - power d 1 , d 2 , d 3 , d 4 , and d 5 will have relative peak values of about 0 . 379 , 0 . 379 , 0 . 140 , 0 . 052 , 0 . 019 . the next replica would have a peak - power less than 1 % of the input pulse . it is assumed that the round - trip delay in the resonator is τ ± δτ . successive replicas of any one pulse are temporally spaced apart by this round - trip delay time . the first replica of any one pulse is temporally spaced apart from the first replica of an immediately previous pulse by the pulse - repetition period τ . it can be seen that there is a transient period of about 4 round - trip times until a burst b 1 of 5 replicas is output . the burst comprises , in time sequence , the first replica of the fifth pulse , the second replica of the fourth pulse , the third replica of the third pulse , the fourth replica of the second pulse , and the fifth replica of the first pulse , with the replicas spaced apart by δτ . similar bursts will follow at intervals of τ , i . e ., the pulse - repetition period of pulses from the mode - locked resonator , with each burst comprising , in general , the sum of replicas p n ( d 1 ), p n − 1 ( d 2 ), p n − 2 ( d 3 ), p n − 3 ( d 4 ), p n − 4 ( d 5 ) where pn is the n th pulse , pn − 1 is the ( n − 1 ) th pulse and so forth . it should be noted here that pulses from a mode - locked resonator are typically highly coherent , and replicas thereof will also be highly coherent . accordingly , it is advisable to select a delay loop length such that δτ is at least about one pulse - duration , and preferably at least two or three pulse - durations , to avoid optical interference between the pulse - replicas . with a replica separation of three pulse - durations , the effective burst - duration will be only about twelve pulse - durations , i . e ., about 1 . 5 % of a pulse - repetition period for 15 - picosecond pulses at a prf of 80 mhz . the term “ effective ”, as used here , implies that the sixth and higher replicas of individual pulses have negligible contribution . the bursts of replicas will have an effect on a target of single , stretched pulses delivered at the prf of the laser - resonator . it should also be noted that if the length of the delay loop is selected such that the round - trip time therein is τ - δτ , pulse - replicas in a burst will be in a temporal sequence that is the reverse of the sequence discussed above , i . e ., p n − 4 ( d 5 ), p n − 3 ( d 4 ), p n − 2 ( d 3 ), p n − 1 ( d 2 ), and p n ( d 1 ). this is not possible in a prior - art closed - loop pulse - stretcher wherein the round - trip time is on the order of a pulse - duration . such a sequence can be used to “ tailor ” the energy - deposition temporal profile in pulse - bursts when two stretchers are “ cascaded ”. examples of this are presented further hereinbelow . fig6 is a timing diagram schematically illustrating division of harmonic - wavelength pulses into replicas thereof and recombination of replicas of different pulses into bursts thereof in a delay loop such as the delay loop of fig4 . in this example graded beamsplitter 18 s of delay loop 17 a ( see fig4 ) has been arranged such that only four replicas per pulse are created , all having the same peak - power . in this case , the temporal sequence of replicas in a burst is un - important . whatever the temporal sequence , the energy deposition profile in a burst of replicas can be tailored by appropriate selection of stepped or graded reflectivity in the beamsplitter of the delay loop . it is emphasized here that although the round - trip length of a delay loop in accordance with the present invention is only longer or shorter than that length required to provide a delay time equal to τ by a relatively small fraction , the fraction , in length units , is a few millimeters more or less than the round - trip length . this is very much greater than common manufacturing tolerances anticipated in constructing the loop or in variations in the loop length that might occur through environmental effects such as temperature variations or the like . in other words , the fractional difference is highly unlikely to occur by accident , and , in a properly constructed loop the length of the loop can be stabilized such that the fractional delay time δτ does not vary significantly in normal use . fig7 schematically illustrates yet another preferred embodiment 15 of laser apparatus in accordance with the present invention similar to the apparatus of fig1 , but wherein bursts of pulses from pulse - stretcher 16 are delivered along common path c to a second pulse - stretcher 19 having a round - trip length fractionally different from the round - trip resonator length and different from the round - trip length in pulse - stretcher 16 . pulse - stretcher 19 is arranged to divide bursts of replica pulses from pulse - stretcher into a plurality of temporally spaced - apart replicas of the pulse - bursts following a common path in the delay loop and to recombine different ones of the first pulse - burst - replicas along a common path e . pulse - stretcher 19 outputs burst of replicas with each of the bursts having more replicas per burst than the input bursts and a longer burst - duration than the input bursts . fig8 is a timing diagram schematically illustrating division of bursts of harmonic - wavelength pulses into replicas thereof by an example of pulse - stretcher 19 including a delay loop similar to the delay loop of fig2 . in this example , the beamsplitter reflectivity of both pulse - stretchers is assumed to be that which will provide that the first two replicas of a pulse ( in the case of first pulse - stretcher 16 ) or a burst thereof ( in the case of first pulse - stretcher 19 ) have equal peak - power . accordingly , the first two replica pulses in portions 1 and 2 of a first burst of pulse - replicas have a relative peak - power of about 0 . 143 with the first two replicas in subsequent portions scaling accordingly as depicted in the first line of fig8 . the burst - portions are spaced apart by a time period τ + aδτ , where a is selected ( cooperative with the temporal spacing δτ of replicas in a burst ) according to a desired degree of temporal overlap of burst - portions at the output of pulse - stretcher 19 , while still maintaining a preferred temporal spacing of at least two pulse - durations between any two replicas in the overlapping burst - portions . here , after 4 pulse - bursts have been delivered into pulse - stretcher 19 from pulse - stretcher 16 ( the first 4 lines of the timing diagram of fig8 ) the output of pulse - stretcher 19 ( the bottom line of the timing diagram of fig8 ) will comprise , portion 1 of burst 4 , portion 2 of burst three , portion 3 of burst two , and portion 4 of burst 1 . the burst - portions are combined and temporally overlapped to form , in effect , a single burst of pulse - replicas . similar combined burst - portions will be output from pulse - stretcher 19 at time intervals of τ , i . e ., at the prf of the mode - locked laser . the relative temporal position of replicas in a combined burst can be determined by tabling values of an expression : for integer values 1 through m and 1 through n , where a and b are specified in pulse - durations , a is the separation of replicas in a burst and b is the separation of burst - portions in a combination thereof , n is the number of significant replicas in a burst and m is the number of significant burst - portions in a combination . values of x in the table can be searched to make sure that there are no replicas too closely spaced according to whatever criterion is selected . fig8 a is a graph schematically illustrating computed relative intensity as a function of time in a burst of replicas at the output of pulse - stretcher 19 with the following assumptions . the replicas are assumed to be “ sech squared ” pulses . the first pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus seven - times the pulse - duration of the harmonic - wavelength pulses , and the second pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus twelve - times the pulse - duration of the harmonic - wavelength pulses . the beamsplitter reflectivity in each pulse - stretcher is assumed to be 37 . 85 % with round - trip losses of 2 % in each pulse - stretcher . the sixth and higher replicas in a burst are neglected and the fifth and higher burst - portions are neglected . a pulse - duration is about 1 . 7 on the arbitrary time scale . no two pulse - replicas are spaced apart by less than about two pulse - durations . fig8 b is a graph schematically illustrating computed relative intensity as a function of time in a burst of replicas at the output of pulse - stretcher 19 . here assumptions are the same as for the graph of fig8 with an exception that the first pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus three - times the pulse - duration of the harmonic - wavelength pulses , and the second pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus sixteen - times the pulse - duration of the harmonic - wavelength pulses . fig9 is a timing diagram schematically illustrating division of bursts of harmonic - wavelength pulses into replicas thereof by an example of pulse - stretcher 19 of fig7 including a delay loop similar to the delay loop of fig2 . replicas of different pulse - replica - bursts are combined into longer bursts as described above with reference to fig8 . in the timing diagram of fig9 , however , the delay loops of pulse - stretchers 16 and 19 are assumed to have round - trip lengths respectively fractionally greater and fractionally less than the round - trip resonator - length l of the mode - locked laser . a result of this is that , in combined burst - portions at the output of pulse - stretcher 19 , pulse - replicas having the highest peak - power are located in the center of the combination of bursts with replicas having lower power ahead of and behind these highest - peak - power replicas , as indicated in the bottom line of the timing diagram of fig9 . in the discussion presented above , the importance of avoiding temporal overlap of pulse - replicas is discussed in the context of avoiding interference . in cases where polarization of radiation delivered to a target is not important , it is possible to cause some replicas in a burst thereof to be plane - polarized in a first orientation , and others to be plane - polarized in a second orientation perpendicular to the first orientation . if a pulse - replica plane - polarized in the first orientation temporally overlaps a pulse - replica plane - polarized in the second orientation the replicas will not interfere . one means of effecting alternate polarization of replicas is depicted in fig7 a . here a second pulse - stretcher 19 a is configured such that the polarization of radiation circulating therein is rotated by 90 degrees on successive round - trips of the delay loop . fig7 b schematically illustrates one example 19 b of a delay loop for effecting this polarization rotation . delay loop 19 a is similar to the delay loop of fig2 with an exception that a half - wave ( at the wavelength of the harmonic - wavelength pulses ) plate 30 is included in the path of radiation in the loop . if radiation circulating in the resonator is vertically polarized on a nth round trip as indicated in fig7 b by arrow pn , the radiation will be horizontally polarized on an ( n + 1 ) th round trip as indicated by arrowhead pn + 1 . in this arrangement , it is recommended that the delay loop be configured such that the angle of incidence on beamsplitter 18 be as near normal as is practical . this will minimize the reflectivity difference on the beamsplitter for the different polarization - orientations . however , at an angle sufficiently different from normal , for example about 45 °, a beamsplitter can be designed that has a predetermined polarization - dependence of reflectivity , with this dependence used as an additional variable for tailoring the relative intensity of replicas output by the delay loop . by way of example , if the beamsplitter in a lossless loop has a reflectivity for the input polarization - orientation of about 29 . 289 % and a reflectivity of about 58 . 578 % for a polarization - orientation perpendicular to the input polarization - orientation , then the first three replicas will have a relative intensity of 0 . 29289 and the fourth replica and fifth replicas will have a relative intensity of only 0 . 0502 . the sixth replicas will have a relative intensity of about 0 . 008 . there will be about 88 % of the input pulse energy in the first three replicas . the peak - intensity in a burst of replicas will be about 25 % less than would be the case for an optimized loop without polarization dependence . for real ( lossy ) conditions the two reflectivity values ( r p and r s ) can be approximated by equations : r p = 1 + 1 t + 2 ⁢ ⁢ t - 1 + 2 ⁢ ⁢ t + 5 ⁢ ⁢ t 2 t 2 ⁢ ( 1 + t ) ( 4 ) r s = 1 + 3 ⁢ ⁢ t - 1 + 2 ⁢ ⁢ t + 5 ⁢ ⁢ t 2 2 ⁢ ⁢ t ( 5 ) where t is 1 . 0 minus the round trip loss , and r p has the lower of the two values . fig9 a is a timing diagram schematically illustrating division of bursts of harmonic - wavelength pulses into replicas thereof by an example of the second pulse - stretcher including a delay loop similar to the delay loop of fig7 b and recombination of horizontally and vertically polarized replicas of different pulse - replica - bursts into longer bursts . in fig9 a , vertically polarized pulse - replicas are designated by bold lines and horizontally - polarized pulse - replicas are designated by fine lines . odd - numbered portions of pulse - bursts created by the second pulse - stretcher from a burst of pulses received from the first stretcher are assumed to be vertically polarized . even - numbered burst - portions are assumed to be horizontally polarized . in a burst of replicas at the output of the second - pulse - stretcher the most closely temporally spaced replicas are plane - polarized perpendicular to each other . those skilled in the art will recognize without further detailed description or illustration that a half - wave plate could be incorporated in the first pulse - stretcher such that odd and even numbered pulse - replicas were plane - polarized perpendicular to each other . fig9 b - d are graphs schematically illustrating computed relative intensity as a function of time in a burst of replicas of hypothetical sech - squared pulses from the second pulse - stretcher of the apparatus of fig7 a wherein the first pulse - stretcher has a delay loop similar to the delay loop of fig2 and the second pulse - stretcher has a delay loop similar to the delay loop of fig7 b . the first pulse - stretcher is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses plus six - times the pulse - duration of the harmonic - wavelength pulses . the second pulse - stretcher ( the polarization alternating stretcher ) is assumed to have a round - trip time equal to a pulse - repetition period of the harmonic - wavelength pulses minus five - times the pulse - duration of the harmonic - wavelength pulses . odd and even numbered burst - portions generated by delay loop 19 b are assumed to be respectively vertically and horizontally polarized . the beamsplitter in the polarization alternating stretcher is assumed to have the same reflectivity for each polarization state . other assumptions are the same as those of the computation of fig8 a . fig9 b and 9c graphically depict respectively the sum of vertically - polarized pulse - replicas and the sum of horizontally polarized replicas ( curves v and h respectively ) at the output of the second pulse - stretcher . in each case , the temporally closest - spaced pulse - replicas are separated by at least about two pulse - durations and also have very different peak - power , such that the difference between any constructive and destructive interference will be negligible . fig9 d graphically depicts the sum of the horizontally and vertically polarized sums . here , there are three central peak components formed by temporally overlapping vertical and horizontally polarized components . there will , accordingly , not be any interference in these peaks it is evident from the above described examples that arranging two of the inventive pulse - stretchers “ cascaded ” in optical series , and using available variables such as positive and “ negative ” delay , different delay values , and overlapping pulse - replicas perpendicular to each other affords significant flexibility in tailoring the temporal energy deposition profile of a replica pulse - burst delivered by the second pulse - stretcher . additional flexibility is possible by varying the reflectivity of the beamsplitters in the two pulse - stretchers . in above - described embodiments of the invention , each pulse - stretcher has a round - trip delay that is fractionally different from the round - trip time of radiation in the mode - locked resonator , i . e ., fractionally different from a pulse - repetition period τ of the mode - locked resonator . the fractional difference referred to here is less than a few percent of τ . variables discussed above can also be used to advantage in embodiments of the present invention wherein the inventive pulse - stretching delay loops have a round - trip delay - time that is fractionally different from a submultiple of the resonator round - trip time τ ( τ / n ± δτ , where n is an integer equal to or greater than 2 ) of the resonator . this is achieved by making the length of a delay loop about equal to l / n ± δl , where l as noted above , is the round - trip optical length of the resonator . in such embodiments the prf of stretched harmonic - wavelength pulses is n times the prf of the fundamental - wavelength pulses . fig1 schematically illustrates yet another preferred embodiment 21 of laser apparatus in accordance with the present invention that provides stretched harmonic - wavelength pulses at a prf higher than that of the fundamental wavelength pulses . apparatus 21 is similar to apparatus 10 of fig1 with an exception that pulse - stretcher 16 of apparatus 10 is replaced in apparatus 21 by a pulse - stretcher 23 that includes a delay loop having a round - trip delay time of τ / 2 ± δτ , i . e ., fractionally different from one - half of the round - trip time τ of mode - locked resonator 12 . the round - trip time of mode - locked resonator 12 is , of course , equal to the pulse - repetition period of the resonator . fig1 is a timing diagram schematically illustrating generation of pulse - bursts in an example of the apparatus of fig1 . pulse - stretcher 23 divides each input pulse into replicas d 1 , d 2 , d 3 , d 4 , and so forth as discussed above . here fifth and six replicas have too low a peak - power to be depicted and , accordingly , are neglected . the replicas of any pulse each have a different peak - power . in fig1 , the second replica of each pulse has a higher peak - power than the first replica for reasons that are discussed further hereinbelow . the third replica has a lower peak - power than the first replica , and the fourth replica has a lower peak - power than the third replica , as discussed above . the delay loop is assumed to have a round - trip delay time of τ / 2 + δτ , and the replicas of each pulse are temporally spaced by this time - interval . the first replicas of successive pulses are temporally spaced by the pulse - repetition period τ . the steady state output of pulse - stretcher 23 , depicted on the bottom line of the timing diagram of fig1 will comprise bursts of pulse - replicas b 1 , b 2 , b 3 , b 4 , b 5 , and so forth , at a burst - repetition frequency that is twice the prf of mode - locked resonator 12 . the bursts of pulse - replicas can be considered as “ stretched ” pulses repeated at twice the prf of mode - locked resonator 12 . the burst - repetition frequency can be considered as a stretched - pulse - repetition frequency . in fig1 , as the fifth and higher replicas of each pulse are neglected , burst b 1 comprises the first replica of the third pulse and the third replica of the second pulse . burst b 2 comprises the second replica of the third pulse and the fourth replica of the second pulse . burst b 3 comprises the first replica of the fourth pulse and the third replica of the third pulse , and burst b 4 comprises the second replica of the third pulse and the fourth replica of the second pulse . burst b 3 will actually also comprise the fifth replica ( not shown ) of the second pulse . burst b 4 will actually also comprise the sixth replica ( not shown ) of the second pulse . generally , in the steady state , an n th burst of replicas will comprise only even numbered pulse - replicas and an ( n + 1 ) th burst of replicas will comprise only odd numbered replicas , although any replica higher than the sixth will have vanishingly small peak - power , and can be neglected in most cases . now , in certain applications , it may be desirable that each burst of pulse - replicas ( stretched pulse ) have the same energy . this can be achieved by selecting a suitable value for beamsplitter 18 in the delay loop . recognizing that equation ( 1 ) discussed above for computing the intensity of a particular transmitted replica defines a geometric progression having a common ration r ( 1 − a ) and a scale factor ( 1 − a ) ( 1 − r ) 2 , and defining t =( 1 − a ) the total intensity i odd of odd - numbered replicas will be given by an equation : i odd = r + ( 1 - r ) 2 ⁢ rt 2 1 - r 2 ⁢ t 2 ( 6 ) and the total intensity i even of even - numbered replicas will be given by an equation : i even = ( 1 - r ) 2 ⁢ t 1 - r 2 ⁢ t 2 ( 7 ) from which it can be determined that i odd and i even will be equal when : r will be ⅓ ( 33 . 333 . . . %) when the round - trip loss is zero ( t = 1 ). for a round - trip loss of 2 % ( t = 0 . 98 ), r is about 33 . 108 %. by way of example , this provides that the first , second , third , fourth , fifth , and sixth replicas of a pulse have relative peak - power ( or peak - intensity ) of , about , 0 . 331 , 0 . 439 , 0 . 142 , 0 . 046 , 0 . 015 , and 0 . 005 . similarly it can be determined that total loss l total is given by an equation : l total = ( 1 - r ) ⁢ ( 1 - t ) 1 - rt ( 9 ) and that the intensity i in each of the equal - energy bursts is given by an equation : where in each case r has been determined from equation ( 8 ). when t = 1 ( r = 333 . 3333 %) each of the equal energy bursts produced from an input pulse will have 50 % of the energy of the input pulse . in practice it is difficult to obtain , at least from commercial suppliers , beamsplitters having a reflectivity with one or two tenths of a percent of a specified value between about 30 % and 40 %. in cases where equal burst - energy is of critical importance , it may be found useful to configure beamsplitter 18 such that it has a selectively variable reflectivity . this can be done , for example , by providing a coating having a continuously graded reflectivity ( from a value high than a desired value to a value lower than the desired value ) over the surface of the beamsplitter , with either an angular or linear gradient , and correspondingly rotating or translating the beamsplitter in the input beam path until equal burst - energy is obtained . a method of producing graded reflectivity coatings is described in u . s . pat . no . 5 , 993 , 904 , assigned to the assignee of the present invention , and the complete disclosure of which is hereby incorporated by reference . fig1 a is graph schematically illustrating computed relative power as a function of time of a sequence of equal - energy bursts of pulse - replicas from pulse - stretcher 23 in which δτ is adjusted to provide a spacing of four pulse - durations between replicas . the time axis is greatly foreshortened to allow detail of the pulse - replicas to be depicted . of note , here , is that while there are two bursts per repetition - period , the bursts are not temporally , exactly equally spaced . the temporal spacing of the bursts alternates between τ / 2 + δτ and τ / 2 − δτ . as already noted , however , δτ will usually be less than about 1 % of τ . fig1 a schematically illustrates still another preferred embodiment 21 a of laser apparatus in accordance with the present invention similar to the apparatus of fig1 but wherein the output of pulse - stretcher 23 is directed along a path c 1 into a second pulse - stretcher 25 having a round - trip length l / 4 + aδl corresponding to a round - trip delay - time τ / 4 + aδτ . the action of pulse - stretcher 25 is depicted , in timing diagram form , in fig1 b . each burst from pulse - stretcher 23 is divided into portions in pulse - stretcher 25 . in fig1 b , odd - numbered burst - portions are designated o 1 , o 2 , o 3 , and o 4 , with higher numbered portions o 5 , o 6 , and so forth , not visible on the scale of the diagram . even - numbered burst - portions are designated e 1 , e 2 , e 3 , and e 4 , again , with higher numbered portions e 5 , e 6 , and so forth , also not visible on the scale of the diagram . in the output channel c of pulse - stretcher 25 , the bottom line of fig1 b , there is a repeated series of four sequences or bursts of pulse - replicas . each series includes sequences s 1 , s 2 , s 3 , and s 4 . these are delivered in a time period τ , such that the sequence repetition rate is four - times the pulse repetition rate of the mode - locked resonator . in the steady state , in general terms , s 1 comprises the 1 st portion of the ( n + 1 ) th burst from pulse - stretcher 23 , the 3 rd portion of the nth burst , the 5 th portion of the ( n − 1 ) th burst , and so forth . s 2 comprises the 2 nd portion of the ( n + 1 ) th burst , the 4 th portion of the n th burst , the 6 th portion of the ( n − 1 ) th burst , and so forth . s 3 comprises the 1 st portion of the ( n + 2 ) th burst , the 3 rd portion of the ( n + 1 ) th burst , the 5 th portion of the n th burst , and so forth . s 4 comprises the 2 nd portion of the ( n + 2 ) th burst , the 4 th portion of the ( n + 1 ) th burst , the 6 th portion of the n th burst , and so forth . fig1 c is a graph schematically illustrating detail of computed relative power as a function of time for five pulse - sequences in the timing diagram of fig1 b . as in fig1 a , the time - axis is greatly foreshortened to allow detail of the pulse - replicas to be depicted . it is assumed in this computation that pulse - replicas in the input bursts are spaced apart by δτ equal to four pulse - durations and that the value aδτ is sixteen pulse - durations . it is also assumed that the input to pulse - stretcher 25 is replica - bursts of equal energy as discussed above . it is further assumed that the round - trip loss in each of the pulse - stretchers is 0 . 02 , and that the reflectivity of the beamsplitter in each of the pulse - stretchers is about 33 . 1 %, i . e ., that value which provides the equal - energy bursts from pulse - stretcher 23 . those having sufficient patience to compute the energy in each of the four sequences s 1 - s 4 will find that each sequence has about the same energy , even though each comprises a different set of replicas from those comprised by any other . as in the case of pulse - stretcher 23 , the sequences are not temporally , exactly equally spaced , but can be described as being about equally spaced . the present invention is described above in terms of particular embodiments . certain embodiments are arranged to deliver bursts of harmonic - wavelength pulse - replicas with temporal separation of pulses in the burst being only a relatively small fraction of the temporal separation of the pulses bursts . although the invention is described in terms of generating the harmonic - wavelength pulse - replicas by extra - cavity frequency - conversion of fundamental - wavelength optical pulses , principles of the invention are also applicable to generating bursts of pulse - replicas of harmonic - wavelength pulses from an intra - cavity frequency - converted laser - resonator and even to generating bursts of fundamental wavelength pulses or frequency - converted pulses of a non - harmonic wavelength such are generated in the resonator of an optical parametric oscillator . those skilled in the art may devise other embodiments of the present invention combining features from the above - described embodiments with out departing from the spirit and scope of the present invention . accordingly it is emphasized that the present invention is not limited to the embodiments described and depicted herein . rather , the invention is limited only by the claims appended hereto .	7
the present invention may be best understood by reference to fig1 which is a flow chart setting forth the steps of the process of the invention that are described in greater detail hereinbelow . a color photograph or picture having the desired image is chosen . the photograph or picture is then used as the basis for preparing an illustration which will then serve as the basis for the four - color separation . when creating the illustration , the coloring of the illustration is based on the premise that the background color of the substrate upon which the image is printed will be allowed to show through in a large portion of the final decorative object . additionally , the illustration must also be made with sufficient detailing so as to present the design . for example , if the design is of a person , the details of the face and other distinguishing characteristics must be present . however , a large portion of the area of the object , in the range of about 20 - 80 % of the area of the substrate , will be left blank in the illustration so that after printing , the substrate will be seen in the final object . hence , smaller details of the design object are deleted in the illustration . as a first step in the printing process , once the illustration has been prepared , the illustration is scanned by a precision four color processor used in the print art . while the processor may be a standard scanner known in the art , the software controlling the processor must be adjusted in such a way that colors closely related to the color of the substrate that will be used are deleted . this is accomplished by reading the color that is to be deleted with the color densimeter , obtaining a value for that color and picking a suitable range of color values around the value of the deleted color , that will also be deleted . one skilled in the art may accomplish this with minimal experimentation by compressing the tonal range to eliminate the colors close in appearance to the color to be deleted . these deletions will leave blanks in the four stencils produced by the separator , where the color is close to the background color , in addition to those areas left blank by the illustrator . the blanks should result in 20 - 80 % of the surface area of the substrate , that is not printed on . more preferably , the blank area of the substrate ranges from about 40 - 60 % of the surface area . once the color separation has been completed , the image is then screen printed onto a suitable substrate . while any screen printing device may be used in the process , a preferred screen printer is one known as a four - color in - line uv screen press , such as was disclosed in u . s . pat . no . 4 , 903 , 592 . this type of screen press allows for the printing of all four colors on the substrate with a constant vacuum on the substrate . moreover , the use of such a screen printer prevents the substrate from excessive movement or vibration during the printing process , such that greater accuracy and clarity of the image may be accomplished . the substrate used in the process of this invention may be any substrate to which the uv inks used in the process will adhere . it is preferred that the substrate be one that is soft and glossy , so as to impart a good effect , i . e ., that of appearing three dimensional , to the final product . a preferred substrate is polyvinylchloride with plasticizers added up to 45 weight percent . for printing , the stencils are first inserted in the press , after which the substrate is fed into the press . the ink is then laid down on the substrate through the stencils so as to produce the image on the substrate . after application of each of the inks , the ink is allowed to set and dry before the next color ink is laid down . each ink application , followed by drying , is repeated until all four color inks have been applied . after a final drying , the substrate , with the design printed thereon , may then be cut as desired so as to produce the decorative design article of the present invention , e . g ., a human shape for a silhouette or a triangular shape for a pennant , etc . the present invention is further illustrated by the following specific example which is not intended in any way to limit the scope of the invention . dan marino silhouette -- an illustration was prepared from a photograph of a sports figure , dan marino of the miami dolphins football team . the drawing illustration of dan marino was created with the intent to put it on a white background , in order to simulate the white background of a miami dolphins uniform . various details of the design &# 39 ; s subject body were deleted in the illustration so as to maximize the blank area . however , sufficient definition remained , so that the figure in the illustration was recognizable as dan marino . the illustration so prepared was then scanned by a customized 70 line scan to produce the four - color preparation , which produced a high percentage of open print area . when scanning the illustration , the scanner was programmed to ignore colors near white , which was the color of the substrate background upon which the design was to be printed . four ulano 469 direct emulsion screw stencils were produced after the preparation of the four color separation by the scanner . for the screen printing , a precision processor model hpp3545 four - color in - line uv screen press was used . the process was initiated by placing the stencils into the press . the plain weave mesh used in the printing had a 390 line count and was made of low elongation monofilament polyester . the squeegee used in the printing was a special dual durometer 90 print side with 60 support side . the screen frame used was a newman adjustable roller model m6a . the inks used in the printing were ultra violet cured colonial ink corporation d40 process colors . two gallons of ink were used in total for a run of 2 , 500 35 &# 39 ;× 45 &# 39 ; substrate sheets . this was a very light amount , because such a large percentage ( about 50 %) of the substrate was not printed upon . the substrate used for preparing the dan marino silhouette was a 22 gauge polyvinyl chloride ( pvc ) film with plasticizers added at 45 weight percent . this is a relatively thick , soft and glossy plastic . the pvc had been dyed white . the pvc was fed into the press and the image was printed in four stages with four different colors being printed through their respective stencils that had been previously produced by the scanner . after each printing , the ink was allowed to dry before applying another layer of ink . once the printing was accomplished , the pvc was die - cut so as to produce a silhouette in the shape of dan marino , as he had posed for the original photograph .	1
as a preliminary matter , it readily will be understood by those persons skilled in the alt that the present invention is susceptible of broad utility and application . many methods , embodiments and adaptations of the present invention other than those herein described , as well as many variations , modifications , and equivalent arrangements , will be apparent from or reasonably suggested by the present invention and the following description thereof , without departing from the substance or scope of the present invention . accordingly , while the present invention has been described herein in detail in relation to preferred embodiments , it is to be understood that this disclosure is only illustrative and exemplary of the present invention and is made merely for the purposes of providing a full and enabling disclosure of the invention . the foregoing disclosure is not intended nor is to be construed to limit the present invention or otherwise to exclude any such other embodiments , adaptations , variations , modifications and equivalent arrangements , the present invention being limited only by the claims appended hereto and the equivalents thereof . turning now to the figures , fig1 illustrates a communication system 2 for altering communication segments at an intermediate communication device . a client device 4 communicates over a communication network 6 , such as a hybrid fiber coaxial cable (“ hfc ”) network , with a server device 8 . communications between client 4 and server 8 typically are processed by a centrally located intermediate network element , or device , 10 , such as a router , a cmts , a switch , or other device that processes and directs network traffic . for purposes of example , client 4 may refer to a consumer &# 39 ; s home personal computer (“ pc ”) and server 8 may refer to a web site operator &# 39 ; s web server . it will be appreciated that either client 4 or server 8 can be coupled to element 10 via network 6 as shown , or may be coupled to the intermediate network element from another network connection , such as an ethernet connection to the internet or a connection to a public switched telephony network . server 8 and client 4 communication may communication using internet protocol (“ ip ”) and related protocols , such as transmission control protocol (“ tcp ”), which is a core protocol of the internet protocol suite , as known in the alt . communication information and data is typically carried in packets , or segments , from one user device to another user device . a user device requesting information is typically referred to as a client and the device that the information is requested of is typically referred to as a server . as an example , client device 4 initiates a tcp session and sends a synchronization segment 12 a , or syn segment , toward server 8 . syn segment 12 a may include a syn bit 14 , that is set ( set is represented in the figure as a value of ‘ 1 ’) to indicate to another network device that it is indeed a syn segment . syn segment 12 a may also include a receive window scaling option field 16 . the receive window scale option field 16 is typically a three - byte field in segment 12 a and not only provides a window scale value , but also indicates that the tcp sending device , in this case client 4 , is prepared and ready to perform receive window scaling in both the send and receive directions . as syn segment 12 a propagates through network 6 after being sent from client 4 , the syn segment is intercepted by intermediate network device 10 ( a cmts is shown , but item 10 may also refers to other types of centrally located network devices that couple the client and server ). when syn segment 12 a is intercepted , cmts 10 evaluates the segment to determine whether it is a syn segment and if so , whether it indicates that receive window scaling is enabled at client 4 . if the result of both evaluations is true , then the cmts inserts a value retrieved from a memory 18 at the cmts that stores a scaling value . the value retrieved from memory 18 and inserted into the syn segment replaces the receive window size value stored in portion 16 of segment 12 a . the result of the replacement is that the altered syn segment , now shown as segment 12 b , includes the original syn bit set in portion 14 , but field 16 now contains a ‘ 4 ’ rather than ‘ 1 ’ as was in syn segment 12 a sent from client 4 . it will be appreciated that the syn segment structure is depicted in the figure for clarity and simplicity of illustration , and may not be representative of the structure of an actual segment . indeed , a typical tcp segment , including a syn segment , would have syn bit portion 14 , and receive window size value portion 16 at the beginning bytes that precede a segment &# 39 ; s payload . when server 8 receives the depicted syn segment 12 b , the receive window size scale value from portion 14 is stored to memory 20 . the value stored as value 22 is then used to scale all receive window size values in tcp segments received subsequent to receiving syn segment 12 b . another aspect shown in fig1 depicts cmts 18 altering a tcp segment sent from client 4 when the cmts intercepts the segment before forwarding it to the destination server 8 . a typical non - syn tcp packet 22 a contains a receive window value in a predetermined sixteen - bit receive window value portion 24 . this receive window value is typically based on the current capacity of a receive buffer at client 4 when the client sends tcp packet 22 a , or segment . in the example shown in the figure , the current capacity of the buffer at server 4 can support receiving 30k bytes of data . however , since the round trip time of segment 22 a propagating to cmts 10 , which intercepts it and forwards it on to server 8 and any return segments sent from server 8 to client 4 via the cmts takes a finite amount of time , and during that time the receive buffer at the client will have increased capacity as its contents are processed , the receive window size value can be artificially increased at the cmts . this provides the advantage that server 8 will send more segments back to client 4 that the receive window value in portion 24 indicates , thus making efficient use of the buffer &# 39 ; s increased capacity that will be available when the return segments are received at the client . it will be appreciated that typically after network element 10 alters a segment , or packet , it connects checksums associated with the altered segment . accordingly , the figure depicts tcp segment 22 a as sent from client 4 with a receive window size value of 30k , but after being intercepted at cmts 10 , the cmts replaces the value in portion 24 with a value determined according to a predetermined formula if the value in segment 22 a is less than a predetermined amount . in the example , assuming that the predetermined value is 64 kbytes ( the maximum that can be represented by the sixteen - bit portion 24 ), cmts 10 replaces the value in portion 24 of segment 22 a with a binary value representing 64k , and altered segment 22 b is the result , having a value of 64k in its portion 24 . this aspect ensures that server 8 will always send a minimum number of segments at each transmission during the session . it will be appreciated that the predetermined value and predetermined formula may be stored on memory 18 along with the receive window scale factor value discussed above . furthermore , it will be appreciated that the receive window scales factor value aspect and the replacing of the receive window size value aspect may both be used to increase the number and size of tcp segments sent from server 8 to client 4 . for example , if the scale factor is 4 , as discussed above and the receive window value is changed from 30k to 64k bytes , then server 8 would receive segment 22 b and scale it by the scale factor stored at memory 20 . the result of scaling 64k bytes by the scale factor of 4 is 2 4 × 64k = 16 × 64k = 1 , 024 , 000 bytes , or 1 . megabyte . thus , although client 4 sent out a syn segment 12 a with a scale factor of 1 and a subsequent tcp segment 22 a with a receive window size value of 30k , cmts 10 altered the syn segment and subsequent tcp segment so that server 8 will send segments totaling 1 megabyte to client 4 after receiving altered segment 22 b . combining the second aspect of altering the value in the portion 24 of a tcp segment with the scaling aspect prevents a no - send situation which would occur if the value in the receive window size value was zero in the tcp segment ( scaling zero results in zero ). it will , be appreciated that typically after network element 10 alters a segment , or packet , it corrects checksums associated with the altered segment . turning now to fig2 , the figure illustrates a flow diagram of a method 200 for adjusting a scalable receive window size value for regulating transmission of tcp segments . method 210 starts at step 205 . at step 210 , a tcp client begins setting up a tcp session with a tcp server . the tcp client may be , for example , a personal computer coupled to a network device , such as a cable modem , dsl modem , dial up modem , network interfaced card , etc . the tcp server may be , for example , a web server hosting a web site , a video program server , a media gateway , or other communication device . the client generates a syn message that is sent to the server as know in the art related to tcp networking , as detailed in rfc - 1323 , for example , which is incorporated herein by reference in its entirety . the syn message , or segment , as referred to in rfc - 1323 ( segments may also be commonly referred to as packets ) is sent from the tcp client to the tcp server . as discussed above , the tcp client may be coupled to a communication device that interfaces with a communication network , such as , for example , a cable network , a dsl network , a telephony network or a local area network , in the case of the network device being a cable modem , a dsl modem , a dial up modem or a network interface card , respectively . in the communication networks , the network devices typically couple to a central device , such as , for example , a cable modem termination system (“ cmts ”) in a cable network , which is sometimes referred to as a hybrid fiber coaxial (“ hfc ”) network . the cmts , or other similar device in other networks , is referred to as an intermediate network device herein and in the claims section . at step 215 , the cmts receives , or intercepts , the syn segment . a determination is made at step 217 whether the intercepted segment is a syn segment by evaluating whether a syn bit position / syn flag within the syn segment is set . if the determination at step 217 is that the segment is not a syn segment , then method 210 ends at step 240 . if the determination at step 217 is that the intercepted segment is a syn segment , then a determination is made at step 218 whether the tcp client device supports an optional receive window scaling feature . this determination may be made by evaluating the segment for , for example , a 3 - byte window scaling option field . if the scaling option field is not detected , method 200 ends . if a scaling option field is detected at step 218 , a scale factor value is inserted into the scaling option field at the cmts , or other intermediate network device , and the segment is forwarded on to the tcp server at step 220 . at step 225 , the tcp server receives the syn segment , extracts the scale factor value from the syn segment and stores the scale factor value to a memory at the server . the memory could be any memory known to those skilled in the alt , including ram , hard drive , flash memory , etc . as other packets / segments are received at the tcp server in the future , which will probably not be tcp syn segments and will likely be segments carrying data or other content information , a receive window value , as known in the art and as described in rfc 1323 , is evaluated . although described in rfc - 1323 , briefly , a receive window size value is used to inform a server how much memory capacity a client has to receive segments . according to the tcp protocol , the largest value that the sixteen - bit receive window value corresponds to is 64k bytes . to compensate for round trip delay time , as discussed above , the scale factor is applied to the receive window size value at step 230 . essentially , the sixteen - bit receive window value size is scaled by the scale amount ( defined to be 2 **( scaling option field value )) and the server then transmits a number of bytes to the requesting client up to the number of the scaled receive window value size at step 235 . for example , if the scale value is 00000100 2 = 4 10 then the receive window size value would be multiplied by 2 4 = 16 10 . if the receive window size value received in a given tcp packet corresponded to 10k bytes , and the scale factor stored at the server were 00000100 2 , then the server would send up to 160k bytes to the requesting tcp client at step 235 . method 200 ends at step 240 . turning now to fig3 , a flow diagram illustrates a method 300 for adjusting the size of the receive window value at an intermediate network device . method 300 starts at step 305 . following initial start up of a tcp session as discussed above and in rfc 1323 , an intermediate network element / device intercepts a tcp segment at step 310 from a tcp client . the segment is evaluated at step 320 and a determination is made whether the receive window size value — referred to in rfc - 1323 as receive window size ( seg . wnd ) value — in the tcp segment is less than a predetermined number . the predetermined number is preferably 64k bytes , but can be another value as chosen by the operator of the intermediate network device . if the value of the receive window size is not less that the predetermined number , then method 300 forwards the segment to the tcp server at step 340 . if the receive window value is determined by the intermediate network device at step 320 to be less than the predetermined value , for example 64k bytes , the intermediate network device adjusts the receive window size value in the tcp packet according to a predetermined formula . the formula may be , for example , ‘ x = 64k ’, thus always forcing the receive window size value to be 64k , or whatever other constant value that the operator of the intermediate network device chooses . after the receive window size value has been adjusted , or altered , at step 330 , the altered segment for which the receive window value has been altered , is forwarded to the tcp server at step 340 . method 300 ends at step 350 .	7
the description given here is to allow someone of ordinary skill in the art to build and use the present invention in related applications . a variety of modifications on the embodiments described , may be apparent to one skilled in the art and the general principles of the invention described here may be applicable to other embodiments . these other embodiments may be constructed using n - channel transistors instead of p - channel transistors , or vice versa ; bipolar transistors instead of mos ; different amplifier types instead of what is illustrated here ; different digital circuits with similar functionality instead of what is suggested here ; different construction topologies which functions similar to what is described here . therefore , the scope of present invention should not be taken as limited to the particular embodiments illustrated and described herein , but given the widest scope consistent with the principal and novel features disclosed here . in regards to fig1 , a typical switched capacitor step - down voltage regulator that is also known as “ buck ” regulator , operates based on storing and releasing electrical energy on an inductor ( 108 ). the input voltage v in is applied to node ( 106 ). during a period of time when a high side switch ( 103 ) is on but a low side switch ( 104 ) is off , a certain amount of energy is stored on the inductor . this “ stored ” energy and also the energy dissipated by the resistive load ( 110 ), are coming from the source supply . when the high side switch ( 103 ) is off and the low side switch ( 104 ) is on , although no energy is transferred from input source , the inductor continues to keep the amount of the current it was flowing through . by omitting the parasitics of the high side and low side switches ( 103 , 104 ), the inductor ( 108 ) and the capacitor ( 109 ); the voltage across the load ( 110 ) would be equivalent to in order to make the load voltage accurately constant , it is compared with a precise voltage reference connected to node ( 101 ) and duty cycle ( 105 ) is adjusted by a pulse width modulating ( pwm ) system ( 102 ). the details of such operation are is explained in many textbooks , articles , and other education materials . the important fact from this invention &# 39 ; s point of view is that , even if the duty cycle is not controlled by such a feedback loop system but stays constant , the voltage across the inductor ( 108 ) and the switch ( 107 ) must remain approximately constant . in other words , looking at equation ( 1 ), it is apparent that the output voltage can adjusted by varying d . if d is dynamically adjusted , any disturbance in the input voltage can be compensated for . this is a traditional way of how a switching regulator is made . however , if d is kept constant and the input voltage is dynamically adjusted , similar control can be exerted over the output voltage . since controlling the duty cycle without loosing stability of the loop is complicated and involved with special signals , such as a sawtooth waveform , therefore analysis and design and the number of components to be used becomes undesired , and regulation from the input voltage would have advantages . adjusting the input voltage can be done by using a linear regulator illustrated in fig2 . although variants of this type of regulator exist , the basic principle is more or less the same . a high gain operational amplifier ( 204 ) drives a pass transistor ( 203 ). in simple terms , the pass transistor &# 39 ; s resistance is adjusted in such a way that with the voltage division , a desired voltage across the load ( 205 ) can be achieved from input ( 202 ). to do this , the operational amplifier compares the output voltage and a precision reference voltage ( 201 ) and tries to make them the same . for simplification purposes , neither stability compensation nor other circuit techniques that make this circuit work properly are illustrated in this figure . when the ratio of the voltage at the output and input gets smaller , the efficiency of a linear regulator becomes poor . this is simply because the dissipated power on the pass transistor is not useful . other than efficiency , linear regulators are far better than their switching counterparts , in terms of electrical properties and design ease . it would be obvious to the one skilled in art that if the voltage across the pass transistor is kept small , then the downside of this type of regulator may be eliminated . referring to fig4 , an embodiment of such a system is illustrated . by using a high efficiency voltage shifter ( 407 ) the voltage across the pass transistor is minimized . this system is exactly same as the linear regulator drawn in fig2 with the addition of voltage shifter 407 . in this embodiment , the voltage across the voltage shifter is set to an appropriate value . this value can also be dynamically adjusted by looking at efficiency behavior of the entire system . the input to voltage shifter is indicated in fig4 by reference number ( 406 ). in essence , since the voltage across the pass transistor is a good measure of the efficiency , some embodiments can simply check this voltage and set the voltage across the voltage shifter . the linear loop still compares the output voltage with a reference voltage ( 401 ) using operational amplifier ( 405 ) and controls the resistance of pass transistor ( 403 ). this is done in such a way that the difference between input voltage ( 402 ) and output voltage ( 404 ) is essentially minimized . making the assumption that the voltage difference between node ( 404 ) and voltage across load ( 408 ) remains constant , the output voltage can be regulated without sacrificing efficiency . in fig5 is a simplified image of the buck regulator shown in fig1 configured for use as high efficiency voltage shifter for the linear regulator shown in fig2 . the difference here is that the switching regulator is not in a dynamic loop . the duty cycle ( 508 ) is set and not changed unless some efficiency drop or mode of operation ( continuous - discontinuous ) change occurs . fig6 illustrates one of many possible implementations of an efficiency monitor according to embodiments of the present invention . the linear regulator &# 39 ; s pass transistor ( 603 ) and its driving amplifier ( 605 ) are added for clarity . as mentioned earlier , the voltage across transistor ( 603 ) must be kept substantially to a minimum . the amplifier ( 615 ) measures this differential voltage and converts it to a signal referenced to the ground . gain of this amplifier is set to a known and invariant value . the output is fed to two comparators ( 610 ) and ( 611 ), compared with respect to two known values vupper ( 608 ) and vlower ( 609 ). the output of these comparators generates logic signals ( 612 ) and ( 613 ), named inc and dec , attributing either increment and decrement , or increase and decrease , depending on the embodiment that follows . for example , if this efficiency monitor drives the pwm ( 507 ) system shown on fig5 , these signals will increase or decrease the duty cycle . in other words , if the voltage across the pass transistor is larger than the upper reference voltage , the duty cycle will be increased to compensate , or vice versa . this embodiment can be used for current limiting feature of the entire regulator with an additional comparator . in fig7 , an electronic circuit block shown to generate signals ( 704 ) for controlling switches in the high efficiency voltage shifter . since various embodiments can be used for voltage shifter , this block ( 703 ) can convert inc ( 701 ) and dec ( 702 ) signals into either a duty cycle based or frequency based signals . an example duty cycle control logic which may be replaced with the block shown in fig7 , is illustrated in fig8 . when a clock is provided to input ( 803 ) or input ( 806 ), two counters starts counting . if a count value ( 813 ) in the period counter ( 805 ) reaches the value ( 812 ) in the pulse counter ( 804 ), a digital comparator ( 807 ) sends a signal ( 811 ) to a set - reset latch ( 808 ) to toggle . when the entire period is reached , period counter output ( 809 ) toggles the latch back . the period counter can be made programmable to set a desired period , however , maximum count of both counters should be the same to ensure a 100 % duty cycle . since the period counter holds the previous value if there is no change on the inc and dec signals , such a system acts as an integrator and helps the stability and also helps soft start operation naturally . fig9 illustrates the embodiment combining a linear regulator , a switching ( buck type ) step - down regulator , an efficiency monitor , and a duty cycle generator . due to the fact that signals and power are switched , a sample and hold ( sih ) block built out of a switch ( 909 ) and a capacitor ( 910 ) are added to efficiency monitor . the sih ensures that the efficiency is measured only when high side switch ( 921 ) is on . in this embodiment , a feedback filter ( 914 ) is placed to eliminate instability issues . the embodiment shown in fig1 brings further improvement over what is in fig9 . the pass transistor and the high side switch are incorporated in the same transistor ( 1017 ). the gate of transistor ( 1017 ) is driven by transistors ( 1015 ) and ( 1016 ). if transistor ( 1017 ) is off , then transistor ( 1015 ) is on and transistor ( 1016 ) is off . if transistor ( 1017 ) is on , transistor ( 1015 ) is off , then transistor ( 1016 ) is on and passes the analog signal , which the linear regulator amplifier generates , to the gate of transistor ( 1017 ). in this embodiment the feedback stability filter is replaced with a compensation network ( 1014 ) with a sih across the output transistor . in fig1 , the topology is modified slightly to reduce the need of two sih circuit ( 1107 ) to one . one of the advantages of this invention is to be able to switch the switching regulator switches faster . this is because they are not part of the main loop so that there is no unwanted latency . the higher switching frequency leads to smaller inductors . even then , this may not help to build fully integrated regulators unless switching frequency is at gigahz levels . an alternative might be a switched capacitor ( or charge redistribution ) type of step - down converters . a simplified switched capacitor step - down converter is illustrated in fig3 . in such embodiments , switches ( 303 , 304 , 305 , 306 ) are driven by non - overlapping but alternating signals to transfer charge from input voltage supply ( 315 ) to the load ( 313 ). every charge transfer causes a charge distribution between shorted capacitors which may be ( 309 , 310 , 311 , 312 ). this process reduces the voltage 307 to a desired level . as the voltage reduction amount can be adjusted by using predetermined capacitance values , it can also be determined by using variable switching frequency ( please refer to isik and james &# 39 ; u . s . patent application ser . no . 12 / 981 , 377 for a better explanation ). this is true 44 ′ only if there is always a load current . therefore , a feedback from the output is compared with a precision voltage reference ( 301 ) and a frequency modulator circuitry ( 302 ) generates a signal ( 314 ) to control the switches . advantages of such an embodiment over a buck converter is that it is inductor free and frequency can be increased to much higher levels . these two advantages can lead to fully integrated implementation . fig1 illustrates an embodiment which is very similar to the embodiment shown in fig1 . the difference is that the high efficiency voltage shifter is replaced with a switched capacitor regulator . it should also be obvious to one skilled in art that the duty cycle control block is replaced by a frequency control block ( 1206 ). fig1 . is a simplified schematic of an embodiment with enhancements similar to those enhancements shown in fig1 .	8
fig3 shows a first embodiment of the present invention . a ferrule 1 includes guide - pin guide holes 2 formed so as to penetrate a side edge of the ferrule from the front end surface of the side edge , an adhesive filling hole 3 formed in an upper surface of the ferrule 1 , multiple insertion holes 4 being communicated with this adhesive filling hole 3 and allowing insertion of front ends of optical fibers , and an obliquely polished surface 5 as well as a non - obliquely polished surface 6 both of which are formed on the front end surface of the ferrule 1 . specifically , near an entrance of each guide - pin guide hole 2 , a recess 7 communicated with this entrance is formed . the recess 7 is formed into a groove shape along the obliquely polished surface 5 , and this groove - shaped recess 7 is formed to reach an upper surface 8 of the ferrule 1 . to be more specific , the groove - shaped recess 7 is formed so as to extend toward the non - obliquely polished surface 6 and reach the upper surface 8 of the ferrule 1 . comparing with a case where the groove - shaped recess is formed toward an obliquely polished surface side ( a side opposite to the side where non - obliquely polished surface 6 is formed ), this structure prevents a depth of the recess 7 from being shallow because of the inclination . moreover , the groove - shaped recess 7 preferably has a width equal to or greater than a diameter of each of the guide - pin guide holes 2 . operations and effects of this invention will now be described with reference to fig5 . a pair of ferrules 1 and 1 are held by pressurization toward each other by use of pressurizing means ( not shown ) such as a clamp spring or the like . when the ferrules 1 and 1 are held by pressurization , the obliquely polished surfaces 5 slide relatively to each other along the oblique surfaces . as a result , a shear stress occurs in the vicinity of an edge of the guide - pin guide hole 2 , which is in contact with a guide pin p . if this stress occurs repeatedly , a bump q may be formed due to plastic deformation . in this case , the recess 7 formed at the edge of the guide - pin guide hole 2 on the obliquely polished surface 5 on the opponent side will house this bump q . therefore , the bump q will not pressurize the obliquely polished surface 5 on the opponent side and change a position thereof . in other words , since the recess 7 houses the bump q , a minute clearance will not be formed between the ferrules 1 and 1 by pressurizing the obliquely polished surface 5 of the opponent ferrule . therefore , pc contact will not be obstructed . in the first embodiment , an end of each of the recesses 7 itself is simply extended to the upper surface 8 of the ferrule 1 . alternatively , in a second embodiment , a taper portion 9 is first formed around each of the guide - pin guide holes 2 as shown in fig4 , and another groove can be formed continuously to this taper portion 9 . by forming the recess into a taper , it is possible to prevent a cracked resin formed at the time of connecting or disconnecting a joint pin from protruding toward a contact edge surface and thereby adversely affecting optical connection . each of the groove - shaped recesses 7 illustrated in fig3 and fig4 is extended until reaching the upper surface 8 of the ferrule . instead , the recess may be extended halfway before reaching the upper surface 8 of the ferrule . the present invention is applicable to a ferrule for an mt connector and to a ferrule for a mpo connector . moreover , an array of the insertion holes 4 for optical fibers formed on the front end surface is not limited only to a single row . the invention is also applicable to a structure including multiple rows of the insertion holes .	6
reference will now be made in detail to the embodiments of the invention , examples of which are illustrated in the accompanying drawings . the proper identification of a party in a proposed transaction of goods , information or services may be ascertained by the use of a two - dimensional bar code . the need to encode more information in a smaller space has driven the development , standardization , and growing use of two - dimensional bar codes . where traditional one - dimensional bar codes act as a pointer to reference information stored in a database , two - dimensional codes can function as the database itself , and therefore assure complete portability for two - dimensional labeled items . for example , pdf417 , or portable data file 417 , is a two - dimensional stacked bar code symbology capable of encoding over a kilobyte of data per label . the “ portable data file ” approach is well suited to applications where it is impractical to store item information in a database or where the database is not accessible when and where the item &# 39 ; s bar code is read in addition , pdf417 is an error - correcting symbology designed for real - world applications where portions of labels can get destroyed in handling . it performs error correction by making calculations , if necessary , to reconstruct undecoded or corrupted portions of the symbol . a user may define one of 9 error correction levels labelled levels 0 to 8 . all error correction levels , except level 0 , not only detect errors but also can correct erroneously decoded or missing information . pdf 417 also has the feature of macro pdf417 . this mechanism allows files of data to be represented logically and consecutively in a number of ‘ pdf417 ’ symbols . up to 99 , 999 different pdf417 symbols can be so linked or concatenated and be scanned in any sequence to enable the original data file to be correctly reconstructed . in particular , pdf417 has been demonstrated to be effective in communicating large data files and to be easily scannable with existing proven hand - held technologies . successful installations and broad supplier support further supported its selection . detailed decision factors included : demonstrated to be readable with a wide range of scanner technologies including laser , linear ccd and imagers best backward compatibility with the scanning of one - dimensional bar codes in existing applications . based on the versatility of the two - dimensional bar code , it is possible to use the code as a key to access information . for example , a consumer desiring certain information or goods from a provider presents a bar code previously obtained from the provider which encodes information about the consumer that only the consumer himself or herself can verify . if the provider matches the information from the bar code with the information presently provided characteristics of the user , the provider can allow access to the desired information or goods without fear that a fraud or mistake has taken place . for example , as illustrated in fig1 a computer program is used to generate a request to print a check . the user inputs the requisite information including his or her signature using , for example , a pen tablet . the computer program then prints a check similar to the form in fig2 which includes information about the user &# 39 ; s signature and other pertinent data encoded in the pdf 417 bar code on the check . the user then may sign the check in the normal fashion in the lower right hand corner . upon receipt , the bank may verify the authenticity of the signature by scanning both the pdf 417 bar code and the signature and comparing them . if they are substantially identical , the authenticity is verified . this concept can be expanded to include any type of biometric data such as facial appearance , signatures , thumbprints , handprints , voice prints and retinal scans and any type of transaction where a secure and inexpensive method of authentication is desired by each party . in an embodiment of the present invention , a mail item retrieval system ( mirs ) may be utilized . there are 38 , 000 retail postal locations and an unlimited number of non - usps commercial sites where mirs can be located . the mirs provides customers with the freedom to pick up their package 24 hours a day , seven days a week . in a further embodiment , the mirs may be located at a user &# 39 ; s home or place of business . the mirs is based on the concept that each user need only provide select biometric data to the mirs provider once in a secure fashion . at this time , the user also provides his or her location information which may include the user &# 39 ; s address , phone numbers and e - mail contacts . the user may also provide financial information to the mirs , such as a credit card number . this biometric data is then stored into the mirs to be encoded into future two - dimensional bar codes provided to the user in electronic format and thereafter printed by the user on his or her personal printer . the mirs may also provide security guarantees that creates a firewall between the biometric information . once an account is established with the mirs , the user may directs that providers of goods send merchandise purchased over the phone or the internet be sent to his or her mailbox account with the mirs . providers and other providers of goods and services may also interact with the mirs provider . turning now to fig3 shown is a flowchart of using the mirs , which is an embodiment of the present invention . in step 10 , a user receives notification of a package &# 39 ; s arrival at the mirs facility . such a notification could occur via voicemail , electronic mail , a cell phone , a pager or a pda . the notification will include an attachment for printing an appropriate receipt . in step 20 , the user at his or her convenience retrieves the information about the package received and in particular obtain a printed copy of a receipt including such information . the receipt will include a two - dimensional bar code , such as pdf which will incorporate information provided by the user to identify himself or herself previously to the system the bar code on the receipt may contain biometric data that is a unique to the user and that has been previously provided in a secure manner to the entity providing the notification service . such biometric data may include , for example , voice - print fingerprint , hand - print , retinal scan information , signature information , facial features or any other unique identifying features about the user . as shown in fig4 the printed receipt obtained may also include information necessary for the user to obtain the package . such information may include the nature of the package , the dimensions of the package and the location where the package currently resides . the security of the mirs is guaranteed by the fact that the receipt cannot be used to retrieve the package from the mirs unless and until it is countersigned by the correct user . if anyone other than the correct user attempts to sign the receipt and retrieve the package , the mirs will not release the package because the biometric signature information contained in the two - dimensional bar code and the signature will not match . this security technique may also be used for other biometric data . returning to fig3 in step 30 , the user brings the printed receipt to of the location of the package , at this location the user then it provides the required biometric data to the package provider . for example , the user may affix his or her signature on the printed receipt just prior to arriving at the package retrieval facility . as shown in step 40 , at the package retrieval facility which may be at a post office or other central location or even an the user &# 39 ; s home , the user has the mirs scan the two - dimensional bar code and also provides the necessary biometric data to the retrieval system . the act of providing such data may be accomplished by signing the receipt in the space indicated and having the mirs scan the signature or by providing a retinal scan handprint , fingerprint or voice print to the mirs . alternatively , the mirs could use a camera to scan the facial features of the user and compare the biometric data retrieved from that scan with the biometric data retrieved from scanning the two - dimensional bar code . in step 50 , the mirs compares the previously obtained biometric data encoded in and the two - dimensional bar code with the currently obtained data biometric data provided by the user . if the two sets of data match , the retrieval system than provides the package to the user . as shown in step 60 , the retrieval system may present the user with the package in order for the user to confirm that that is the actual package that is desired . in a further embodiment , the mirs can arrange that the provider of the goods only charge the user &# 39 ; s credit card once the user has actually retrieved the package . this can be accomplished without having the mirs reveal the user &# 39 ; s financial information to the provider . in a further embodiment , the mirs may employ the signature - capture system using electro - optical scanning as disclosed in u . s . pat . no . 5 , 138 , 140 , which is hereby incorporated by reference in its entirety . two - dimensional information such as a written signature can be captured and subsequently reconstructed by using an electro - optical scanner . a multi - row preamble code and a multi - row postamble code flank the signature , and each code has a row identifier for identifying which row is being scanned by a scan line emitted by the scanner , as well as start / stop data for identifying when each scan line traverses the boundaries of a space containing the signature . the occupied zones , i . e . those having parts of the signature , present a different light reflectivity to the scanner than the non - occupied zones , i . e . those having no parts of the signature . the occupied zones are akin to bars , while the non - occupied zones are akin to spaces of a upc symbol . the occupied zones represent binary ones , and the non - occupied zones represent binary zeros . when a scan line of the scanner traverses a row of zones in the space , the occupied zones reflect less light than the non - occupied zones , and this light - variable information can be processed into data representative of the signature in a manner completely analogous to that are known in the art for processing a upc symbol . however , unlike a upc symbol , which is one - dimensional and can be scanned and read by a scan line anywhere along its height ( i . e . the transverse “ y ” axis ), a signature is two - dimensional since it contains different information in both the longitudinal (“ x ” axis ) and the transverse (“ y ” axis ) directions . to decode a two - dimensional signature , it is further necessary to know which row of zones is being scanned by a particular scan line and also when each scan line enters and exits the space containing the signature . the signature scanner uses a multi - row preamble code means , and a multi - row postamble code means , respectively located forwardly and rearwardly of the space as considered along the longitudinal direction . each code means is a multi - tiered symbol structure having electro - optically scannable and readable encoded data arranged along the longitudinal and transverse directions . each symbol structure can be a unique two - dimensional marking symbol structure , a tiered bar code , or a new symbol structure compatible with prevailing standard bar code symbology . as shown in fig4 a , each code means arranges its encoded data in a plurality of longitudinally - extending rows 1 , 2 , 3 , 4 . . . n , where n is a substantially large enough number to provide adequate resolution of the signature . in theory , an infinite number of rows would provide the sharpest resolution , but , in practice , 25 rows are sufficient to provide an adequately resolved signature . the rows are tiered , i . e . stacked one above another , in the transverse direction . each row of encoded data also includes synchronizing means , i . e . start / stop data , for identifying when each scan line traverses the anterior and posterior boundary lines of the signature space . in a further embodiment , the scanning described above may be accomplished by the user using a device independent from the mirs , such as , for example , a stand - alone portable scanning device or a scanner integrated into a cell phone , pda , or pager . the returns process is a large and looming problem for retailers , e - tailers , catalog companies and the usps . the mirs may be used in a similar manner for the return of packages to a provider . after notifying the provider of the goods that a return is desired , the provider can take the opportunity to ascertain why the user wishes to return the item . such notification may be done by phone or over the internet . once the provider is notified , the provider can use the mirs to electronically deliver a return receipt to the user . the user may then print the receipt , which will include a two - dimensional bar code including encoded biometric information of the user . the receipt may also include information about addressing the package for a return including the location of the mirs , the address to which the package should be sent and postage return information . such information may also be printed out as a separate mailing label , which may be affixed to the return package . similar to the acquisition process , the user brings the printed receipt to the mirs . at this location the user then it provides the required biometric data to the mirs . for example , the user may affix his or her signature on the printed receipt just prior to arriving at the package retrieval facility . at the package deposit facility which may be at a post office or other central location or even an the user &# 39 ; s home , the user scans the two dimensional bar code and also provides the necessary biometric data to the retrieval system . the act of providing such data may be accomplished by signing the receipt in the space indicated and scanning the signature or by providing a retinal scan or handprint , fingerprint , voice print to the mirs . alternatively , the mirs could use a camera to scan the facial features of the user and compare the biometric data retrieved from that scan with the biometric data retrieved from scanning the two - dimensional bar code . the user may then deposit the package in the mirs in a secure manner . in a further embodiment , the mirs could analyze the returned package physical characteristics such as its size and weight to make a determination whether the goods to be returned are actually in the package . the mirs would compare the measured physical characteristics of the package with those previously provided by the provider . if the analysis reveals that the actual package characteristics differ from the expected characteristics , the user at the mirs could be given the opportunity to verify that the package actually contains the goods that are to be returned . if the analysis reveals that the actual package characteristics match the expected characteristics , the mirs could arrange for the provider to immediately refund the purchase price by crediting the credit card of the user if the user has chosen to provide this information to the mirs . such a credit could be reversed by the mirs if the provider later receives the package to find that the goods returned do not , in fact , match the goods expected . other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims .	6
fig1 depicts a surface acoustic wave filter 10 which is in some respects of conventional construction . for example , it is formed upon one surface of a piezoelectric substrate 12 by the deposition of conductive metallic elements designed to form a sending interdigital transducer 14 , a multi - strip coupler 16 , and a receiving interdigital transducer 18 . the sending and receiving transducers are located on different tracks , i . e . opposite halves of the substrate surface , so as to avoid bulk mode reflection coupling between them . the multi - strip coupler serves to translate acoustic signals laterally from the track of the sending transducer to that of the receiving transducer , so as to maintain coupling between the transducers with respect to surface acoustic signals , although they remain decoupled with respect to bulk mode reflections . unfortunately , the multi - strip coupler also transfers unwanted surface mode reflections from track to track , in either direction , just as efficiently as it does the desired surface acoustic signal . it is effective in discriminating against bulk mode reflections , but it cannot tell the difference between a surface mode signal and a surface mode reflection . in the usual manner , each of the interdigital transducers comprises a pair of electrically opposed bus bars 20 and 21 which are connected to respective opposite electrical terminals 24 and 25 . interior fingers 28 and 29 extend in mutually parallel relationship from the opposed bus bars 20 and 21 respectively , and are interdigitated ( i . e . their lengths overlap ) so as to produce the electro - acoustic interaction for which such devices are known . the spacing between the fingers is one quarter wavelength ( at the operating frequency of the filter ). most of the interior fingers 28 and 29 are of the usual split configuration , actually consisting in effect of two adjacent but separate half - fingers a quarter wavelength apart ( at the center frequency of the filter ), extending from a common bus bar 20 or 21 , and also connected together at the ends remote from their common bus bar . another conventional aspect of this filter is the fact that the receiving transducer 18 is apodized , or finger - length - weighted , to tailor its frequency response characteristics to the particular filter application . thus the lengths of the interior fingers 28 and 29 of the latter transducer vary along the length of the longitudinal transducer axis ab so that the active , interdigitated area of the transducer is divided roughly into a central major lobe 18c and a number of minor lobes such as 18a and 18b on either side of the major lobe . in accordance with this invention , however , a novel structural feature is introduced into each of the transducers 14 and 18 : at one end of each of these transducers is an electrically connected , unsplit end finger 32 extending from bus bar 20 in a direction parallel to interior fingers 28 and 29 to a point halfway across the aperture of the transducer ; while at the other end is another electrically connected unsplit end finger 33 extending from bus bar 21 also in a direction parallel to interior fingers 28 and 29 to a point halfway across the aperture of the transducer . no other finger is colinear with any of the end fingers 32 or 33 ; that is , the locations 36 and 37 which are colinear with the end fingers 32 and 33 respectively are empty substrate areas devoid of any metallic fingers . the end fingers 32 and 33 are , like the interior fingers , spaced one quarter wavelength ( at the operating frequency of the filter ) from their respective nearest neighbors . as the term is used herein , an &# 34 ; end finger &# 34 ; is one which which is located at either the entrance or exit end of its transducer , and has no neighboring fingers on one side thereof . the &# 34 ; aperture &# 34 ; of a transducer is defined as the distance , in a direction transverse to the transducer &# 39 ; s longitudinal axis ab , over which the electrically opposed interior fingers 28 and 29 thereof are interdigitated , i . e . the active breadth of the transducer . in the case of an apodized device such as transducer 18 , the &# 34 ; aperture &# 34 ; is considered to be the maximum interdigitated distance , i . e . the peak breadth of the major active lobe 18c . in this invention the end fingers 32 and 33 extend halfway across the apertures of their respective transducers . it should also be noted that the end fingers are electrically tied to the instantaneous voltages of their respective bus bars 20 and 21 . in the above - cited prior art patent a similarly located finger is employed for echo compensation . but in that case a portion of that finger is electrically isolated , rather than having a definite voltage , and another portion thereof which has a definite voltage is colinear with the isolated finger portion , and these two portions toghether extend across nearly the entire transducer aperture . these structural divergences result in important differences in the mechanism of echo suppression and the degree of success achieved . an understanding of the difference in mode of operation requires an explanation of the respective theories of operation of these two devices . as explained in the cited prior art patent , the operation of that device depends upon the assumption that a surface acoustic wave reflection bouncing off an electrically isolated finger portion will be 180 &# 39 ; out of phase with a surface acoustic wave reflection bouncing off another finger portion which is electrically connected to a bus bar , when the two finger portions are colinear so that they are in the same phase relationship to the incident wave . these two out - of - phase reflections tend to cancel each other . notice that colinearity and electrical isolation are fundamentally important aspects of the operation of the prior art device . notice also that the echo cancellation effect depends upon the electrical disparity ( connected vs . isolated ) between the two finger elements , rather than upon a acoustic path length differential ; since they are colinear , the acoustic paths are equal . in contrast , the echo cancellation effect of the present structure depends upon a differential between acoustic path lengths . with reference to fig1 suppose an incident surface acoustic wave , represented by arrows 39 and 40 , impinges upon one end ( the entrance end ) of receiving transducer 18 . arrow 39 represents that portion of the incident wave which impinges upon the end finger 33 at the entrance end of transducer 18 , while arrow 40 represents that portion of the incident wave which impinges upon the first interior finger 28 at that same end of the transducer . since the end finger 33 extends across half of the aperture of the transducer , the incident wave is divided equally between arrows 39 and 40 . arrow 41 represents the reflection which results from finger 33 , while arrow 42 represents the reflection from finger 28 at the entrance end of the receiving transducer . since the signals represented by arrows 39 and 40 are equal in amplitude , and since the structures they encounter have the same topography except for a quarter wavelength difference in location , the reflections represented by arrows 41 and 42 are also equal in amplitude . since the fingers 33 and 28 are separated by a distance of one quarter wavelength along the transducer axis ab , there is a half wavelength difference between the total incident and reflected path length traveled by wave 39 , 41 and the total incident and reflected path length traveled by wave 40 , 42 . therefore the reflections 41 and 42 are equal in amplitude and 180 degrees out of phase with each other , which is the relationship required for cancellation . note that in this device the fingers 28 and 33 at the entrance end of the transducer must not be colinear , as in the prior art , because the principle of operation requires these fingers to be a quarter wavelength apart . note also that , in order for the phase difference between the reflections 41 and 42 to be entirely a function of the acoustic path length differential , and not affected by electrical polarity or isolation , both fingers 28 and 33 at the entrance end of the transducer are electrically tied to their respective bus bars , and neither one of them is electrically floating , as in the prior art . the reason for also providing a similar end finger 32 at the exit end of transducer 18 , and similar end fingers 32 and 33 at the opposite ends of transducer 14 , may be understood by probing deeper into the theory of operation of this device . in actuality , each finger ( and each half of each split finger ) of each transducer produces its own reflection . but since the two halves of each split finger are a quarter wavelength apart , their reflections tend to cancel each other , for path - length - differential reasons . therefore , relatively little reflection occurs as a result of a wave front &# 39 ; s passage through the interior of a transducer . instead , most of the reflection results from uncompensated boundary effects occurring at the entrance and exit ends of the transducers . for the first transit wave , the signal from sending transducer 14 enters receiving transducer 18 at the entrance end ( where end finger 33 is located ) and is partly reflected back from that end . as the unreflected portion of the signal proceeds through the receiving transducer to the exit end ( where end finger 32 is located ), it is partly reflected back from that end also . the first reflections from both ends of transducer 18 travel back to transducer 14 , entering it at the end where end finger 32 is located , and exiting from it at the end where end finger 33 is located . these first reflections are then re - reflected , once from each end of the transducer 14 , forward toward transducer 18 again . accordingly , the present invention employs an end finger for reflection compensation at each end of each transducer . the mechanism by which reflection compensation occurs at each location is the same as that explained above for the entrance end of receiving transducer 18 . the means by which the present invention produces echo compensation has been shown to be fundamentally different from that exploited by the prior art &# 34 ; floating finger &# 34 ; patent . in addition , measurements made on both structures suggest that almost an order of magnitude improvement can be obtained by means of the present invention . the explanation for such a surprising improvement may lie in an analysis of the fundamental mechanisms responsible for surface acoustic reflections which are described above . the first mechanism , mass loading , is not eliminated by the prior art technique of floating half a finger , because substantially all the mass of the floating half finger remains . the second mechanism , local short circuiting , is likewise not affected by floating half a finger , because the finger material is still there to provide a conductive path between different voltage points on the substrate . in other words , the assumption of the prior art patent , that the reflection from a floating finger will be 180 degrees out of phase with the reflection from a connected finger , is not borne out with respect to these two mechanisms . only the circulating current effect is affected by the floating finger technique , because disconnecting the floating finger from a bus bar does interrupt the circulating current path . the approach of the present invention , however , compensates for the reflections produced by all three of these mechanisms , because the assumption that reflections from the two opposite halves of the transducer aperture will have 180 &# 39 ; different path lengths is always true , regardless of the fundamental mechanism by which the reflection is produced . the result , according to empirical observations , is a surprising degree of improvement in echo suppression . because of this invention , therefore , superior filters producing a more ghost - free television image are possible . in the foregoing discussion , the theory of operation was described in connection with transducer 18 , considered as a receiver , while transducer 14 was viewed as the transmitter . but it is demonstrable that the same theoretical mechanisms of echo suppression operate when the improvement of this invention is incorporated into the transmitting transducer 14 . fig2 through 4 illustrate some of the structural variations of the invention , which however operate in the same manner as the embodiment of fig1 explained above . fig2 illustrates a transducer 110 comprising a piezoelectric substrate 112 on a surface of which are formed a sending transducer 114 , a multistrip coupler 116 , and an apodized receiving transducer 118 . in this embodiment , however , the axis of apodization cd is not coincident with the longitudinal transducer axis ab , but is at an angle to it . in order to point out that the placement of the end fingers is not important , the end finger 132 of the sending transducer 114 is not confined to one side of the transducer aperture , i . e . it is not adjacent to bus bar 120 nor to bus bar 121 thereof . although it is necessary for effective echo cancellation that the length w / 2 of the end finger be equal to one half the transducer aperture w , its location need not be confined to one half of the transducer . since the end finger 132 is not within connecting distance of either of the bus bars 120 or 121 , however , it is necessary to find another way to connect it to a definite potential reference . in the embodiment of fig2 this is accomplished by connecting the end finger 132 to the nearest interior finger 128 at both ends as illustrated , or only at one end if preferred . another type of end finger is illustrated by finger 133 at the other end of transducer 114 . this one is divided into two segments 133a and 133b , in order to demonstrate that the end finger need not be continuous , so long as the combined lengths of all the segments equals half the transducer aperture ; i . e . in this case w1 + w2 = w / 2 . still another type of end finger , exemplified by fingers 232 and 233 of transducer 118 , is required to accommodate the asymmetric apodization pattern thereof . these , however , are best seen in the enlarged detailed views of fig3 and 4 respectively . in fig3 it is seen more clearly that , because of the asymmetry of the apodization pattern , the division between the opposite polarity fingers ( short finger 128 and long finger 129 ) is much closer to one side of the transducer than the other , i . e . closer to bus bar 120 than to bus bar 121 . therefore the end finger 232 , since it extends from bus bar 120 halfway across the transducer aperture , overlaps all of the neighboring short finger 128 extending from bus bar 120 plus a portion of the neighboring long finger 129 which extends from the opposite bus bar 121 . in order to avoid disrupting the apodization pattern , this necessitates that the end finger 232 be divided into two segments 232a and 232b which are electrically connected to opposite sides of the transducer . segment 232a is connected to bus bar 120 , while segment 232b is connected to finger 129 which in turn is connected to bus bar 121 . similarly in fig4 the end finger 233 is divided into a longer segment 233a which is electrically connected to finger 128 and through the latter to bus bar 120 , and a shorter segment 233b which is connected directly to bus bar 121 . thus it will be realized that , while it is necessary for the end fingers 232 and 233 of transducer 118 to be connected to some definite potential , it is not necessary that all segments thereof be at the same potential . it should also be observed that the half aperture length requirement for end fingers is met when the total length of segment 232a plus segment 232b is equal to w / 2 , and similarly for the total length of segment 233a plus segment 233b . in any of these embodiments , the invention not only accomplishes echo suppression in a way which is different from the approaches taken by the prior art , but also achieves a significant and surprising degree of improvement thereover . the foregoing detailed description specifies an embodiment which is presently preferred , and which serves to illustrate this invention . but other embodiments may be imagined now or in the future which may incorporate one or more aspects of the invention . therefore the scope of protection accorded should not be limited to the particulars of this description , but instead should be determined by the following claims . these claims , moreover , should be interpreted consistently with the general principles and novel teachings expressed herein .	7
the current subject matter utilizes acoustophoresis , a low - power , no - pressure - drop , no - clog , solid - state approach to particle removal from fluid dispersions : i . e ., it is used to achieve separations that are more typically performed with porous filters and centrifuges , but it has none of the disadvantages of these systems . for example , the diagram 100 of fig1 shows the acoustic radiation forces acting on a suspended particle for an applied acoustic frequency of 1 mhz ( typical for an ultrasonic transducer ) and an acoustic pressure of 0 . 5 mpa maximum at the antinodes ( readily achieved in water ). achievement of higher applied acoustic frequencies and higher acoustic pressures is possible with modern electronic drives , transducers , and intermediate matching layers . examples of acoustic filters utilizing acoustophoresis can be found in commonly owned u . s . patent application ser . nos . 12 / 947 , 757 , 61 / 261 , 686 , 13 / 085 , 299 and 61 / 342 , 307 , the contents of all of these applications are hereby fully incorporated by reference . the acoustic radiation force ( f ac ) acts on the secondary - phase particles ( or fluid droplets ), pushing them to the nodes ( or antinodes ) of the acoustic standing wave . the magnitude of the force depends on the particle density and compressibility relative to the fluid medium , and increases with the particle volume . the diagram 100 of fig1 illustrates the acoustic force that operates on four different secondary phases in water as a function of the particle ( or droplet ) radius . the four secondary phases are hexanes ( a mixture of hydrocarbons , a model for oils ), red blood cells ( a model for biological cells ), bacterial spores ( a model for “ large ” protein clusters and polystyrene beads such as are used for flow cytometry ), and paramagnetic polystyrene beads ( used for various biological capture and separation protocols ). parameters used in the calculation of the acoustic force are given below in table 1 . the current subject matter is advantageous in that it uses acoustophoresis for separations in extremely high volumes and in flowing systems with very high flow rates . separations have been done for micron - size particles , for which the acoustophoretic force is quite small . for example , b . lipkens , j . dionne , a . trask , b . szczur , a . stevens , e . rietman , “ separation of micron - sized particles in macro - scale cavities by ultrasonic standing waves ,” presented at the international congress on ultrasonics , santiago , jan . 11 - 17 , 2009 ; and b . lipkens , j . dionne , m . costolo , a . stevens , and e . rietman , “ separation of bacterial spores from flowing water in macro - scale cavities by ultrasonic standing waves ”, ( arxiv ) june 2010 , the contents of both papers are hereby fully incorporated by reference ) show that bacillus cereus bacterial spores ( a model for anthrax ) have been trapped at 15 % efficiency in an acoustophoretic cavity embedded in a flow system that can process drinking water at rates up to 120 ml / minute ( 1 cm / second linear flow ). the concentration ratio has been as high as 1000 in a single - pass , small - scale prototype acoustocollector . the techniques described in this paper will scale up to higher flow rates or larger flow channel , which has been proven in a 6 ″× 6 ″ system and processing to 12 ″ in dimension . the current subject matter allows for the simultaneous agglomeration of suspended solids such as microorganisms and dirt ( metal oxides ) and oil droplets . the ability to translate and concentrate these secondary phases is known as acoustophoresis . described herein is an improved flow chamber with two different ultrasonic transducer arrangements . diagrams 200 , 300 respectively of fig2 - 3 , show two different transducer arrangements for two variations of an overall - view of the current systems which utilize a series of solid cylindrical and hollow cylindrical transducers with the flowing water for particle agglomeration . a small experimental system put together by the inventors that demonstrate the concept is described below . with reference to fig2 and 3 , a flow chamber 210 is illustrated having a multi - phase water inlet 220 , a low density outlet 230 , a water outlet 240 , and a solids outlet 250 . it will be appreciated that there may be two or more of each inlet and outlet depending on the desired configuration and volumes being processed . multi - phase water ( i . e ., water having suspended particulate , etc .) enters from the multi - phase water inlet 220 and exits as filtered water from water outlet 240 . particles and fluids having a low density , i . e ., lower than the host fluid , such , as oils and other low - density fluids , exit from the low density outlet 230 and solids and other higher density particles exit from the solids outlet 250 . an acoustic standing wave is generated in the middle of the flow chamber 210 , either by a set of tube - shaped transducers 260 arranged in a parallel spacing within a center portion of the flow chamber or by an array of flat transducers 310 , causes the particles ( oil droplets ) to agglomerate at the nodes ( antinodes ) in the acoustic wave . the agglomeration for high density particles will eventually result in their growing so as to overcome the acoustic pinning force and gravity settling causes them to fall into solids outlet 250 . in the case of oil droplets the agglomeration at the antinodes will result in droplet coalescence and they will be able to overcome the acoustic pinning force and buoyancy force causes the larger droplets to drift to the low density outlet 230 . several examples are shown in the photographs in fig4 a - d . the first photo 410 shows the acoustophoretic collection of iron oxide particles , the second photograph 420 shows the collection of algae , the third photograph 430 shows the collection of bacterial spores , and the fourth photograph 440 shows the collection of oil droplets , all in a flowing water stream . a flat , circular transducer can , for example , be used in an acoustocollector to generate the collected matter in fig4 a - d . the radial component of the pressure field of such a transducer is described by a bessel function t whereas the axial component is described by a cosine function such as in the case of a one dimensional standing wave . the radial component acts to hold the captured algae in the column against the fluid flow drag force . the trapped algae are then further concentrated by inter - particles forces . the particles are then further separated from the flow by gravitational settling or by being driven to a collector pocket through a slow frequency sweeping method similar to that given in ( i ) b . lipkens , m . costolo , and e . rietman , “ the effect of frequency sweeping and fluid flow on particle trajectories in ultrasonic standing waves ”, ieee sensors journal , vol . 8 , no . 6 , pp . 667 - 677 , 2008 ; ( ii ) lipkens , j . dionne , m . costolo , and e . rietman , “ frequency sweeping and fluid flow effects on particle trajectories in ultrasonic standing waves ,” acoustics 08 , paris , jun . 29 - jul . 4 , 2008 ; and ( iii ) b . lipkens , j . dionne , a . trask , b . szczur , and e . rietman , “ prediction and measurement of particle velocities in ultrasonic standing waves ,” j . acoust . soc . am . 124 , no . 4 , pp . 2492 ( a ). the contents of each of the aforementioned papers are hereby fully incorporated by reference . physics of acoustophoresis . acoustophoresis is the separation of a second phase ( or phases ) from a host fluid using sound pressure to create the driving force . an ultrasonic transducer operating at a fixed frequency f ( hz ) is used to set up an acoustic standing wave in a fluid - filled cavity . a one dimensional standing wave is characterized by a local pressure p that is a function of position ( x ) and time ( t ), p ( x , t )= p cos ( kx ) cos ( ω t ), ( 1 ) where p is the amplitude of the acoustic pressure ; k is the wavenumber (= 2π / λ , where λ is the wavelength ), and ω = 2πf , where ω is the angular frequency . the pressure of the acoustic wave produces an acoustic radiation force f ac on secondary - phase elements according to where r p is the particle radius , ρ f is the density of the fluid medium , c f is the speed of sound in the fluid , and x is the acoustic contrast factor , defined by where λ is the ratio of the particle density to fluid density and σ is the ratio of the speed of sound in the particle to the sound speed in the fluid . the acoustic radiation force acts in the direction of the acoustic field . the acoustic radiation force is proportional to the product of acoustic pressure and acoustic pressure gradient . an inspection of the acoustic radiation force shows that it is proportional to the particle volume , frequency ( or wavenumber ), the acoustic energy density ( or the square of the acoustic pressure amplitude ), and the acoustic contrast factor . note also that the spatial dependency has twice the periodicity of the acoustic field . the acoustic radiation force is thus a function of two mechanical properties , namely density and compressibility . for three dimensional acoustic fields , a more general approach for calculating the acoustic radiation force is needed . gor &# 39 ; kov &# 39 ; s ( 1962 ) formulation can be used for this ( see l . p . gor &# 39 ; kov , “ on the forces acting on a small particle in an acoustical field in an ideal fluid ,” sov . phys . dokl ., vol . 6 , pp . 773 - 775 , 1962 ). gor &# 39 ; kov developed an expression for the acoustic radiation force f ac applicable to any sound field . the primary acoustic radiation force is defined as the gradient of a field potential u , given by and f 1 and f 2 are the monopole and dipole contributions defined by where p ( x , y , z , t ) is the acoustic pressure , v ( x , y , z , t ) is the fluid particle velocity , and & lt ;& gt ; denote time averages . v o is the volume of the particle . the diagram 100 of fig1 shows the force required to separate small particles of various material properties . each material has its own x parameter given in equation [ 3 ]. in diagram 100 , material properties ( e . g . speed of sound , density ) are used for the indicated material . the graph for bacteria spore is also valid for other materials of similar bulk modulus . meaning smaller bacteria spore , very large protein clusters , and polystyrene microspheres would all be in this category . the blood cell curve is for any cells of similar bulk modulus . finally the hexane curve would be valid for any tiny drops of oil - like material with the radius indicated on the curve . these curves are for , as an example , 1 mhz applied acoustic frequency and an acoustic pressure of 0 . 5 mpa . these are easily achieved control variables . higher frequency and higher pressure will afford better separation of smaller particles — down to 10 s of nm . simulations regarding the current subject matter were run by plotting the following equation : where n is the number density of the suspended particulate , f is the frequency , c is the speed of sound , e ac is the energy density of the acoustic wave , r is the particle radius , x is the contrast factor , t is time , m is the dynamic viscosity of the fluid , and x is position in the standing wave . the equation describes the kinetics of the particles in the standing wave as a result of the action of the drag force and acoustic radiation force . this equation is derived in the paper by feke et al . the diagrams of fig5 - 10 plot the relative concentration , capture efficiency for different size particles of different densities and different frequencies . along the x - axis is direction the particles travel from 0 to λ / 2 . the y - axis is the concentration relative to the initial of 1 . diagram 500 of fig5 shows the separation at 250 khz for oil and an acoustic pressure amplitude of 250 khz . three particles sizes are shown ; in black a 1 mm radius particle , in green a 10 mm radius particle , and in red a 100 mm radius particle . we see that the large droplets are heavily concentrated at the pressure anti - nodal planes of the standing wave , whereas the intermediate and small particle have not undergone any appreciable concentration . this situation can be used to selectively concentrate and separate large particles , and exhibits size - exclusion behavior . diagram 600 of fig6 shows separation at 1 mhz for oil . here one can see a concentration efficiency of much greater than 20 : 1 for the intermediate and large droplets , and only minor changes for the small droplets . finally , diagram 700 of fig7 shows separation at 10 mhz , where the intermediate and small particles are heavily concentrated , but not the large ones . this is caused by the fact that the large particles are of the same order as the wavelength , and the acoustic radiation force is no longer effective . this is significant , because it shows a size - exclusion behavior that can be further exploited for preparation of very fine emulsions of biologically significant agents . fig8 - 10 show analogous conditions for iron oxide ( feo 2 , a metal oxide simulant ). diagram 800 of fig8 shows concentration at 250 khz and 250 kpa for large , intermediate , and small particles of 100 , 10 , and 1 micron . we observe that particles with positive contrast move to the pressure nodes . it also shows that the large particles are concentrated significantly at the pressure nodes , and intermediate and smaller particles are not concentrated . therefore , size - exclusion can work here as well . diagram 900 of fig9 shows the concentration at 1 mhz and 1 mpa , and shows that large and intermediate particles are concentrated but not small ones . finally , diagram 1000 of fig1 shows concentration at 10 mhz , where intermediate and small particles are concentrated . the large particles are of similar magnitude as the wavelength and do not experience significant concentration . analogous behavior is observed for micro - algae , bacteria , and blood cells . like the oil case above , this is also significant because it demonstrates that the current subject matter can be applied for biotechnology applications for separating species of various sizes , essentially a high - flow , large - volume , size - exclusion separation technology . it also shows promise for lipid and platelet separation of blood . as described above , two approaches to concentrating the particles through acoustic standing wave agglomeration ( or coalescence ). ( 1 ) the first approach as illustrated in fig2 involves a series involves a parallel array of tube - shaped transducers . ( 2 ) the second approach as illustrated in fig3 uses a series of flat acoustic transducers operating at 1 mhz and 10 mhz . notwithstanding , it will be appreciated that other arrangements of acoustic transducers can be utilized . the first implementation is shown in fig2 with further details in the diagram 1100 of fig1 . with this arrangement , a multiphase - water mixture is pumped into the flow chamber 210 via the multi - phase water inlet 220 device from the where it encounters a parallel array of tube - shaped transducers 260 each operating at 1 - 10 mhz frequency . when the solution encounters the array of tube transducers 260 the agglomeration occurs and due to gravity the large clumps fall into the solids outlet 250 ( e . g ., a collection port , etc .). any coalesced oil , or oil - like substances , will overcome buoyancy and self - transport to the respective low density outlet 230 on the top of the flow chamber 210 . diagram 1100 of fig1 shows pressure nodes in the tube - shaped transducer array 260 . with the second approach , as shown in fig3 , a multiphase - water mixture is pumped into the flow chamber 210 via the multi - phase water inlet 220 where it encounters a serial array of flat 1 cm transducers 310 operating at a frequency range between 1 and 10 mhz . like the first approach , when the solution encounters the array of tube transducers 310 the agglomeration occurs and due to gravity the large clumps fall into the solids outlet 250 ( e . g ., a collection port , etc .). any coalesced oil , or oil - like substances , will overcome buoyancy and self - transport to the low density outlet 230 on the top of the flow chamber 210 . as used herein , unless otherwise stated , the term outlet can comprise a piped exit from the flow chamber 210 or it can comprise a collection port requiring periodic removal of separated particulate . while this specification contains many specifics , these should not be construed as limitations on the scope of what is claimed or of what may be claimed , but rather as descriptions of features specific to particular variations . certain features that are described in this specification in the context of separate variations can also be implemented in combination in a single variation . conversely , various features that are described in the context of a single variation can also be implemented in multiple variations separately or in any suitable sub - combination . moreover , although features may be described above as acting in certain combinations and even initially claimed as such , one or more features from a claimed combination can in some cases be excised from the combination , and the claimed combination may be directed to a sub - combination or a variation of a sub - combination . similarly , while operations are depicted in the drawings in a particular order , this should not be understood as requiring that such operations be performed in the particular order shown or in sequential order , or that all illustrated operations be performed , to achieve desirable results . only a few examples and implementations are disclosed . variations , modifications and enhancements to the described examples and implementations and other implementations may be made based on what is disclosed .	2
a new formulation on of zta that is lighter in weight than standard zta ( 10 - 25 percent by weight zro 2 ), but that is stronger than non - toughened alumina has been formulated . yittria tetragonal zirconia polycrystals ( ytzp ) has a theoretical density of around 6 . 1 g / cc and is much denser than pure α - al 2 o 3 that has a theoretical density of around 3 . 98 g / cc , so incorporating less ytzp will make the material lighter . standard zta of 25 - percent by weight of ytzp has a theoretical density of 4 . 35 g / cc . the new material with about 1 - to - 2 percent by weight ytzp has an actual density of only 3 . 92 - 3 . 95 g / cc . less than 2 . 5 weight percent ytzp keeps density of the final ceramic under 4 . 0 g / cc , while more than 0 . 5 weight percent ytzp helps add some strength to the ceramic . by itself the small amount of ytzp added to the α - al 2 o 3 , however , does not dramatically increase the strength of the alumina as the grain size of the alumina still grows during processing to grain sizes of 6 - to - 20 microns during high temperature processing of 1637 ° c .- 1660 ° c . the large grain size equates to lower strength . mgo is known to be a grain growth inhibitor , however standard amounts of mgo ( 0 . 06 - percent by weight ) provided alone in vendor materials such as by pechiney ® lsb 172 do not provide enough inhibition to limit grain growth to less than 6 - microns . it was found that by adding small amounts ( range of 0 . 03 to 0 . 05 weight percent ) of mgo as mg ( oh ) 2 particles , and further combining with low percentages of nano - ytzp the average . al 2 o 3 grain size can be kept less than 6 - microns ( specifically a d50 diameter of between 4 . 8 and 6 . 0 - microns for the ceramic produced in examples 1 - 3 ) during high - temperature processing and improve the material &# 39 ; s strength . this new sintered composition of zta comprises 0 . 5 to 2 . 5 weight percent zro 2 in the form of crystalline grains that are stabilized in a substantially tetragonal crystal structure , 0 . 03 to 0 . 10 weight percent mgo in the form of crystalline grains , and the remainder of the ceramic being substantially α - al 2 o 3 . the ceramic has an actual density of less than 4 . 0 g / cc . the ceramic has an average α - al 2 o 3 grain size less than 6 - microns and strength greater than 50 kpsi . α - al 2 o 3 crystalline particles used in the preparation of the examples described below were pechiney ® powders , specifically , pechiney ® p172 sb03 that has no mgo and a d50 particle size of 0 . 5 - microns and pechiney ® p172 lsb that has 0 . 06 weight percent mgo and a d50 particle size of 0 . 50 - microns . ytzp with a particle size of less than 0 . 1 - microns ( nanoparticle size ) were used . these ytzp powders were purchased from absco ® and mel ® of england . the mgo added to control the grain growth was in the fully hydrated form as mg ( oh ) 2 . the fully hydrated mgo was prepared by milling mgo in dionized water at a concentration of 60 - percent solids . the yield from the solids becomes 69 - percent mgo on sintering . the slurry particle size was 0 . 5 - 1 . 0 microns , which upon calcination becomes less than 0 . 1 - microns . having the mgo fully hydrated provides for better composition control with yields of mgo that are more accurate . one or more organic binders in combination with water and a dispersant ( ammonium polyacrylate by rt vanderbuilt ®) were mixed with all particles to form a slurry . the organic binders act as a binding agent that holds the mixture of particles together . during sintering , the organic binders burn off , leaving the shape of the body intact . some examples of organic binders that may be used to form green compact include polyvinyl alcohol ( pva ) and polyethylene glycol ( peg ). other binders include , but are not limited to , acrylic binders , gum and waxes . general preparation of the new lightweight zta formulation is as follows . measured amounts of α - al 2 o 3 powder , ytzp powder , mg ( oh ) 2 as a slurry , organic binders , dispersants and water are mixed together in a premix tank and then passed through a bead mill . after bead milling , the d50 of all particles in the slurry is milled to less than 1 - micron . the resulting slurry is spray dried into granulated powder and then pressed into a green compact of a given shape . the green compact is heated to 350 ° c . to 600 ° c . as part of a binder burn out cycle . the green compact is then further heated to a sintering temperature of 1637 ° c . to 1660 ° c . for 4 - hours . shrinkage of approximately 18 - 22 percent is obtained after sintering . the composition ranges of the final lightweight , high - strength zta materials are listed in table 1 . modulus of rupture was tested using an instron ® three point bend fixture . a mixture of alumina powder with no vendor added mgo , 0 . 05 - weight percent added mgo ( added as 0 . 12 % mg ( oh ) 2 slurry ), and 2 . 0 - weight percent nano - ytzp was prepared according to the formulation in table 2 . p172 sb03 and mg ( oh ) 2 were added first followed by nanoparticle ytzp to the water , binder and a dispersant . the slurry was premixed for 30 - minutes and then passed through the bead mill once . the slurry was spray dried with the binder at 550 - 600 psi . the parts were pressed and sintered at 1637 ° c . to 1660 ° c . with a binder burnout cycle between 350 ° c .- 600 ° c . a 3 - point bend test showed strength of 55 kpsi . actual density of the sintered ceramic was 3 . 94 g / cc . grain size was d50 4 . 8 - microns . sample preparation was the same as example 2 above ; however , 0 . 03 - weight percent mgo was added as mg ( oh ) 2 slurry . a 3 - point bend test showed strength of 53 kpsi . grain size was d50 5 . 4 - microns . sample preparation was the same as example 2 above ; however , 1 . 0 - weight percent nano - ytzp was added . a 3 - point bend test showed strength of 48 kpsi . grain size was d50 5 . 8 - microns . sample preparation was the same as example 2 above ; however , no mgo was added . a 3 - point bend test showed strength of 43 kpsi . grain size was d50 6 . 1 - microns . sample preparation was the same as example 2 above ; however , no nano - ytzp was added . a 3 - point bend test showed strength of 44 kpsi . grain size was d50 12 . 0 - microns . a mixture of alumina powder with only the mgo added by the vendor and 2 . 0 - weight percent nano - ytzp , but with no additional mg ( oh ) 2 , was prepared according to the formulation in table 3 . p172 lsb was added first followed by nano - ytzp to the water , binder and a dispersant . the slurry was premix for 30 - minutes and then passed through the bead mill once . the slurry vas spray dried with the binder at 550 - 600 psi . the pans were pressed and sintered at 1637 ° c . to 1660 ° c . with a binder burnout cycle between 350 ° c .- 600 ° c . a 3 - point bend test showed strength of 44 kpsi . actual density of the sintered ceramic was 3 . 94 g / cc . average grain size was 7 . 7 - microns . sample preparation was the same as example 6 above ; however , no nano - ytzp was added . a 3 - point bend test showed strength of 44 kpsi . actual density of the sintered ceramic was 3 . 90 g / cc . grain size was 15 - microns . while several embodiments of the invention , together with modifications thereof , have been described in detail herein and illustrated by the accompanying examples , it will be evident that various compositions and further modifications are possible without departing from the scope of the invention . nothing in the above specification is intended to limit the invention more narrowly than the appended claims . the examples given are intended only to be illustrative rather than exclusive .	2
clearly , a method and apparatus for electronically determining the true internal temperature of a cell / battery would be of great value . the present invention addresses this need . a very important application of the method taught herein is in the detection of “ thermal runaway ”— a phenomenon in which the internal temperature of a battery undergoing charging rises catastrophically ( see , e . g ., mcshane et al ., u . s . pat . no . 5 , 574 , 355 ). using the technique disclosed below , a runaway condition can be quickly detected by a precipitous internal temperature rise , which , in turn could be used to shut off the charger or reduce its charging voltage . fig1 discloses a block diagram of apparatus for evaluating a battery &# 39 ; s internal temperature according to the present invention . apparatus of this type is fully disclosed in pending u . s . patent application ser . no . 09 / 152 , 219 , filed sep . 11 , 1998 and entitled “ method and apparatus for measuring complex impedance of cells and batteries ” and pending u . s . patent application ser . no . 09 / 151 , 324 , filed sep . 11 , 1998 , entitled “ method and apparatus for determining battery properties from complex impedance admittance ” which are incorporated herein by reference . measuring circuitry 10 electrically couples to cell / battery 20 by means of current - carrying contacts a and b and voltage - sensing contacts c and d . measuring circuitry 10 passes a periodic time - varying current i ( t ) through contacts a and b and senses a periodic time - varying voltage v ( t ) across contacts c and d . by appropriately processing and combining i ( t ) and v ( t ), measuring circuitry 10 determines real and imaginary parts of a complex parameter , either impedance z or admittance y , at a measuring frequency f k ; where f k is a discrete frequency contained in the periodic waveforms of both i ( t ) and v ( t ). control circuitry 30 couples to measuring circuitry 10 via command path 40 and commands measuring circuitry 10 to determine the complex parameter of cell / battery 20 at , each one of n discrete measuring frequencies , where n is an integer number . this action defines 3 n experimental quantities : the values of the n measuring frequencies and the values of the n imaginary parts and n real parts of the complex parameter at the n measuring frequencies . computation circuitry 50 couples to measuring circuitry 10 and to control circuitry 30 via data paths 60 and 70 , respectively , and accepts the 2 n experimental values from measuring circuitry 10 and the values of the n measuring frequencies from control circuitry 30 . upon a “ begin computation ” command from control circuitry 30 via command path 80 , computation circuitry 50 uses algorithms disclosed in u . s . patent application ser . no . 09 / 151 , 324 to combine these 3 n quantities numerically to evaluate 2 n elements of an equivalent circuit representation of the cell / battery . computation circuitry 50 then calculates the internal temperature of the cell / battery from values of particular elements of this circuit representation . finally , computation circuitry 50 outputs the computed result to the user on display 90 and / or uses the result to activate an alarm 100 or to control a process 110 such as a battery charger . in practice , a microprocessor or microcontroller running an appropriate software program can perform the functions of both control circuitry 30 and computation circuitry 50 . fig2 discloses a six - element equivalent circuit representation of a typical automotive storage battery . this circuit representation was evaluated using apparatus of the type disclosed in fig1 with n = 3 by employing algorithms disclosed in u . s . patent application ser . no . 09 / 151 , 324 . the three measurement frequencies were 5 hz , 70 hz , and 1000 hz . one notes that the n = 3 equivalent circuit comprises three subcircuits : one notes further that the three subcircuits are characterized by having very different time constants . the shortest time constant , τ 1 = l 1 · g 1 = 93 . 5 μs , belongs to the series g 1 - l 1 subcircuit . the next longest time constant , τ 2 = c 2 / g 2 = 2 . 22 ms , belongs to the parallel g 2 - c 2 subcircuit ; and the longest time - constant , τ 3 = c 3 / g 3 = 41 . 6 ms , belongs to the parallel g 3 - c 3 subcircuit . accordingly , the three subcircuits represent quite different physical processes and can be differentiated from one another by their time constants . fig3 is a logarithmic plot of the three time constants defined above as functions of charge ( ampere - hours ) removed from the battery . one notes that the three time constants remain widely separated as charge is removed , and that the longest of the three , τ 3 , is nearly independent of state - of - charge . this result is important to the present invention . fig4 discloses the observed variation of time constant τ 3 = c 3 / g 3 with internal battery temperature . one sees that τ 3 varies inversely with temperature . this variation is consistent with a theoretical model that associates the g 3 - c 3 subcircuit with a linearized , small - signal , representation of the nonlinear electrochemical reaction occurring at the negative plates . for such a model , the rc product τ 3 = c 3 / g 3 represents the reaction time for the process and therefore varies inversely with temperature . by empirically establishing this relationship between τ 3 and t , one can actually utilize measurements of τ 3 to determine the battery &# 39 ; s internal temperature , t . fig4 shows experimental points compared with a theoretical τ 3 ( t c ) relationship . note that the steepest slope , and hence the most accurate temperature determination , occurs in the most interesting region between − 20 ° c . and + 20 ° c . the theoretical curve disclosed in fig4 is a plot of the following equation : τ 3  ( t c ) = k 3 + 1 1 k 2 + 1 k 1  exp   { qv 0 / k  ( t c + 273  ° ) } ( 1 ) where τ 3 is the time constant measured in milliseconds and t c is the internal temperature measured in degrees celsius . physical parameters introduced in this equation are : the three constants k 1 , k 2 , and k 3 were empirically determined to be one notes excellent agreement between theory and experiment . measurements show that τ 3 is virtually independent of battery size and state - of - charge ( see fig3 ). thus , this empirical τ 3 ( t c ) relationship plotted in fig4 appears to be quite universal . in order to determine internal temperature from time constant measurements , one must mathematically invert the above τ 3 ( t c ) relationship to obtain a t c ( τ 3 ) relationship . the result is : t c  ( τ 3 ) = ( qv 0 / k ) ln   { ( k 2 / k 1 )  ( τ 3 - k 3 ) ( k 2 + k 3 - τ 3 ) } - 273  ° ( 2 ) where the parameters and constants , q , v 0 , k , k 1 , k 2 , k 3 , are the same as those introduced in the τ 3 ( t c ) relationship . the inverse theoretical t c ( τ 3 ) curve is plotted in fig5 . by employing this relationship , one can readily determine the battery &# 39 ; s true internal temperature from measurements of τ 3 . this important temperature information can then be used to apply accurate temperature corrections to other measured quantities , such as cca , state - of - charge , and amp - hour capacity . it can also be used to detect a thermal runaway condition , and to control an external process such as a battery charger . this completes the disclosure of my invention . fig6 however , will place the true nature of the invention in greater perspective . fig6 illustrates the g 3 - c 3 subcircuit and shows that the complex admittance of this parallel subcircuit , y 3 = g 3 + jωc 3 , explicitly contains the two quantities , g 3 and c 3 , necessary to determine the battery &# 39 ; s internal temperature . thus , my discussion above actually discloses a relationship existing between the real and imaginary parts of y 3 and the internal temperature of the battery . although it is true that complex z and complex y are reciprocals of one another , no simple relationship exists between the real and imaginary parts of impedance z 3 and time constant τ 3 . accordingly , the results of any ac measurement must be expressed in complex admittance form — not complex impedance form — in order to observe the important relationship that i have disclosed herein . how this complex admittance is obtained , however , is relatively unimportant . although my disclosure has relied upon particular apparatus and algorithms previously disclosed in u . s . patent applications ser . no . 09 / 152 , 219 and ser . no . 09 / 151 , 324 , other methods will be apparent to one skilled in the arts . for example , one can employ bridges or other types of apparatus to measure complex admittance ( or its reciprocal , complex impedance ). furthermore , if accuracy is not a strict requirement , one can take advantage of the fact that the various time constants are widely separated from one another and simply assume that the subcircuits are not coupled . within this approximation , c 2 and c 3 are treated as short circuits at frequencies near f 01 = ½ πτ 2 , l 1 and c 3 are treated as short circuits at frequencies near f 02 = ½ πτ 1 , and at frequencies near f 03 = ½ πτ 3 , l 1 is treated as a short circuit while c 2 is treated as an open circuit . thus , with some batteries , it is possible to obtain satisfactory results from a very simple analysis of measurements at two or three frequencies . with certain batteries , it is even possible to obtain useful approximations to y 3 from measurements of complex y or z = 1 / y obtained at a single , appropriately chosen , frequency . workers skilled in the art will recognize that these and other variations may be made in form , and detail without departing from the true spirit and scope of my invention .	6
pastes ready for use based on organopolysiloxanes have already been widely used for sealing joints . such masses and the elastomer bodies obtained from them by cross - linking with atmospheric moisture constitute an ideal sealing substance for many different purposes . the classical examples of such so - called one - component systems are described , for example , in french pat . no . 1 , 188 , 495 , german pat . no . 1 , 247 , 646 , and w . noll , &# 34 ; chemie und technologie der silicone &# 34 ;, 1966 , verlag chemie , weinheim , chapter 8 . 1 , in particular pages 341 and 342 . it has surprisingly been found that such masses have very little power of adherence to ice compared with other materials . due to the excellent hydrophobic action of these substances , formation of compact ice is to a large extent prevented and any coarse crystalline ice adhering to the substances can be removed by a fairly strong wind or rapidly drops off due to its loose structure and weak adherence . in addition , these masses have the advantage that they can be diluted with a wide variety of solvents ( anhydrous ) and can be applied to the surface relatively rapidly and inexpensively , e . g . by spraying . the important advantage of the masses used according to the invention , however , compared with the known materials which are relatively rigid and hard , is that when cured they constitute a highly elastic substance which is capable of absorbing quite large movements ( from about ± 20 % to ± 50 %, depending on their composition ) without any loss in functional efficiency . this elasticity is particularly advantageous in facilitating the removal of parts of ice from the underlying surface . the vulcanizates are insensitive to a wide variety of environmental influences such as uv radiation , moisture , sea water and high and low temperatures . their mechanical characteristics therefore remain unchanged over very long periods of time which is , of course , a great advantage when the substances are used , for example , on an offshore drilling platform . the above mentioned application of the masses according to the invention provides a considerable lowering in cost ( saving of energy ) since the formation of ice in critical areas , e . g . on a drilling platform , had hitherto to be prevented by electric heating . the cold - setting one - component silicone systems used according to the invention normally contain the following components : 1 . an α , ω - dihydroxy - diorganosiloxane in which the organo group would normally be a methyl or phenyl group . a halogen alkyl group such as chloromethyl , an alkenyl group such as vinyl or a cycloalkyl group such as a cyclohexyl group may also be present in minor proportions . the viscosity of these dihydroxy - polydiorganosiloxanes is in the region of about 500 to 2 , 000 , 000 cp ( 20 ° c . ), depending on the requirements of the end product . such homo -, hetero - or copolymers generally constitute about 10 to 90 % by weight of the total quantity of paste . 2 . plasticizers as additives , e . g . α , ω - trialkyl - siloxypolydiorganic siloxane having a viscosity of 10 to 1 , 000 , 000 cp ( 20 ° c .). 3 . the cross - linking substances are polyfunctional organosilicon compounds containing more than two functional groups . when the one - component silicone pastes used according to the invention are prepared by mixing the various substances listed under ( a )-( g ), the substances used as cross - linking agents may be bound to the polymer either during the mixing process or during storage or in a form of premix by splitting off one of the reactive groups . these organosilicon compounds may be of the following kind : in this formula , r may be an alkyl , alkenyl , aryl or halogenated alkyl , alkenyl or aryl group , and x is a reactive group capable of reacting with a silanol group of component ( 1 ). the reactive group may be , for example , an alkoxy , acyloxy , amino , acid amide or oxime group . alkyltriacetoxysilanes are preferred . ( b ) di -, tri - and polysiloxanes formed by partial hydrolysis from the silanes mentioned under ( a ) as indicated by the formula for the disiloxane : 4 . fillers ( charged or uncharged ) of a general kind used singly or in most cases as mixtures , e . g . reinforcing fillers ( highly disperse silica produced by flame hydrolysis , titanium dioxide , carbon black , etc .) or fillers such as powdered quartz , chalk ( natural and precipitated ), synthetic resin powder and pigments of all kinds , e . g . iron oxide pigments . 5 . various kinds of auxiliary substances , e . g . the silanes described under paragraph 2 ., above , containing aminoalkyl , epoxyalkyl or other reactive alkyl groups . ( a ) additives , acting , for example , as drying agents , e . g . complex titanic acid esters ( see e . g . german pat . no . 1 , 258 , 087 ) ( b ) additives acting , for example , as adhesifying agents , e . g . hexamethyldisiloxane ( see u . s . pat . no . 4 , 419 , 484 or european no . 57 , 878 b1 ) or di - tert .- butoxydiacetoxysilane . primers may also be used to improve adherence . ( c ) catalysts to accelerate the reaction , e . g . organic tin compounds or , for example , amino compounds . ( d ) suitable solvent additives are mainly those which do not react with the cross - linking substance , e . g . xylene , petroleum hydrocarbon fractions or , for example , isododecane or different mixtures of the various solvents to enable the substance used according to the invention to be adjusted , for example so that it can be sprayed on a wide variety of different surfaces . the polysiloxane masses may be prepared in known manner in planet mixers , dissolvers or other suitable mixing apparatus . the quantity of solvent used generally amounts to about 5 to 85 % by weight , based on the total quantity of coating compound , preferably 35 to 55 % by weight . under certain accurately specified conditions , however , the process may also be carried out solvent - free . the coating may be applied , for example , by spraying , spread coating , immersion or casting . the coating is preferably applied by a so - called airless spraying process . preparation of the substances to be used according to the invention and their application are described in more detail in the following examples ( percentages are percentages by weight unless otherwise indicated ). a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp . was introduced into the reaction vessel . 5 parts by weight of ethyltriacetoxysilane and 0 . 9 parts by weight of di - tert .- butoxy - diacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) was then added and the mixture stirred under vacuum until homogeneous . 60 parts by weight of xylene were finally added and the mixture again stirred until homogeneous . a vacuum was briefly applied at the end . the mass was then filled into containers and if kept free from moisture could be stored for half a year without any deterioration in the capacity for vulcanization or in the adherence when the mass was subsequently used as anti - icing mass . this mass can be applied by spraying , for example by the airless spraying technique . the following examples illustrate the same properties as regards storage and application . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., were introduced into the reaction vessel . 5 parts by weight of methyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 01 part by weight of a catalyst ( dibutyl tin diacetate ) was then added and the mixture stirred under vacuum until homogeneous . 60 parts by weight of isooctane were finally added and stirred in until homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp . and 2 parts by weight of hexamethyldisiloxane were introduced into the reaction vessel . 15 parts by weight of vinyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 01 part by weight of a catalyst ( dibutyl tin diacetate ) was then added and the mixture stirred under vacuum until homogeneous . 60 parts by weight of isododecane were finally added and the mixture stirred until homogeneous . finally , a vacuum was briefly applied . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 5 parts by weight of ethyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) was then added and stirred in under vacuum until the mixture was homogeneous . 60 parts by weight of xylene were finally added and the mixture was stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane was introduced into the reaction vessel . 5 parts by weight of ethyltriacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 1 . 0 part by weight of a complex titanic acid ester ( di - butoxy - di - acetoacetic ester titanate ) was then added and the mixture was briefly stirred . 0 . 03 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and the mixture was stirred under vacuum until homogeneous . 60 parts by weight of xylene were finally added and the mixture stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 35 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 8 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 4 . 5 parts by weight of a complex titanic acid ester ( dibutoxy - diacetoacetic - ester titanate ) were added at room temperature and the mixture was stirred . 4 . 5 parts by weight of a finely disperse silica and 40 parts by weight of a chalk were incorporated ( finally under vacuum ). 1 . 2 parts by weight of an iron oxide pigment and 1 . 4 parts by weight of a catalyst ( dibutyl tin dilaurate ) were then stirred in . 4 parts by weight of bis -( n - methylbenzamido )- ethoxy - methylsilane were then added . 50 parts by weight of isododecane were finally added and the mixture stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 34 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 34 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 4 parts by weight of complex titanic acid ester ( dibutoxy - diacetoacetic ester titanate ), 2 parts by weight of methyltrimethoxy silane and 0 . 5 parts by weight of γ - glycidyloxy - propyltrimethoxysilane were added and stirred in . 30 parts by weight of a chalk and 1 . 2 parts by weight of an iron oxide pigment were then added and the mixture was stirred . 4 . 5 parts by weight of a finely disperse silica were then stirred in ( a vacuum was finally applied ). 0 . 06 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and incorporated under vacuum . 50 % by weight of a petroleum hydrocarbon fraction ( isopar h of esso ) were finally added and the mixture stirred until homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane was introduced into the reaction vessel . 5 parts by weight of methyl - tris ( 2 - butanoneoxime )- silane were added at room temperature and the mixture was briefly stirred . 8 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 5 parts by weight of γ - aminopropyl - triethoxysilane and 0 . 6 parts by weight of a catalyst ( dibutyl tin dilaurate ) were then added and the mixture was stirred under vacuum until homogeneous . 60 parts by weight of xylene were finally added and stirred in until the mixture was homogeneous , a vacuum being briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane were introduced into the reaction vessel . 6 parts by weight of methyltributylaminosilane were added at room temperature and the mixture was briefly stirred . 13 parts by weight of a finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred until homogeneous . 20 parts by weight of xylene and 40 parts by weight of isododecane were finally added and the mixture stirred until homogeneous with brief application of a vacuum towards the end of the mixing process . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy )- polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., and 2 parts by weight of hexamethyldisiloxane were introduced into the reaction vessel . 5 parts by weight of ethyl triacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and the mixture was stirred under vacuum until homogeneous . 65 parts by weight of methylene chloride , based on the starting quantity , were finally added and stirred in until the mixture was homogeneous . a vacuum was briefly applied at the end . a mixture of 60 parts by weight of α , ω - dihydroxypolydimethylsiloxane , viscosity at 20 ° c . of 50 , 000 cp ., and 20 parts by weight of α , ω - bis -( trimethylsiloxy ) polydimethylsiloxane , viscosity at 20 ° c . of 1400 cp ., was introduced into the reaction vessel . 5 parts by weight of ethyltriacetoxysilane and 0 . 9 parts by weight of di - tert .- butoxydiacetoxysilane were added at room temperature and the mixture was briefly stirred . 9 parts by weight of finely disperse silica and 0 . 4 parts by weight of iron oxide pigment were then added and the mixture was stirred under vacuum until homogeneous . 0 . 02 parts by weight of a catalyst ( dibutyl tin diacetate ) were then added and the mixture was stirred under vacuum until homogeneous . 65 parts by weight of 1 , 1 , 1 - trichloroethane were then added , based on the starting quantity , and stirred in until the mixture was homogeneous . a vacuum was briefly applied at the end . the following anti - icing experiments were carried out with the masses described above : a layer of ice about 25 mm in thickness ( from sea water ) was produced at a temperature of - 21 ° c . on a steel plate measuring 8 × 1000 × 1000 mm coated with the material according to example 4 . the plate was placed vertically . the thickness of the coating was 1 . 5 mm . the temperature was maintained at - 21 ° c . for a further 12 hours after the ice had formed so that all the ice could assume this temperature . the temperature in the chamber was then slowly raised ( 2 ° c ./ h ). at - 10 ° c ., the forces of adherence of the ice to the silicone rubber diminished to such an extent that the ice became detached and fell off , i . e . at - 10 ° c . adherence between ice and the mass according to the invention was already eliminated . the ice adhered very firmly to a vinyl coating used in practice and could only be removed at temperatures above 0 ° c . ( 2 ) test in a climatic chamber with simulation of natural environment ( wind , temperature , water ) several plates ( 1 × 500 × 500 mm ) were again coated with the mass according to example 1 ( thickness of coating 1 . 5 mm ) and tested in the climatic chamber ( see table 1 ) table 1______________________________________test no . 1 2 3 4 5 6______________________________________wind velocity ( m / s ) 1 12 1 12 1 12air temperature (° c .) - 6 - 6 - 14 - 14 - 20 - 20sea water temperature + 4 . 5 + 4 . 5 + 4 . 5 + 4 . 5 + 4 . 5 + 4 . 5 (° c . ) diameter of drops of 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1 0 . 1sea water ( mm ) spray frequency ( s / s ) 2 / 5 2 / 5 2 / 5 2 / 5 2 / 5water content / liquid 1 1 1 1 1 ( g / m . sup . 3 ) ______________________________________ the plates were set up at an angle of 15 ° which is close to the position occurring under practical conditions and promotes the formation of ice . the test plates were inspected every hour so that the formation of ice on the surface could be recorded . table 2__________________________________________________________________________wind air temp . duration ice thicknesstest no . ( m / s ) ° c . of test hrs ( mm ) remarks__________________________________________________________________________1 1 - 6 4 0 no ice , water sprayed from the plate2 12 - 6 9 0 - 4 loose ice sludge in the water layer3 1 - 14 5 1 - 4 hard ice easily removed by hand4 12 - 14 12 10 - 50 hard , needle - shaped ice which was blown away by the wind after some time . the thin layer left behind could easily be removed by hand5 1 - 20 4 1 - 4 hard ice , easily removed by hand6 12 - 20 2 . 5 2 - 4 hard ice , easily removed by hand7 12 - 14 3 5 - 10 hard ice , breaks cohesive in one piece when attempts are made at removal__________________________________________________________________________ simulated climate , a coating according to example 1 was tested in test nos . 1 to 6 and a standard vinyl coating was tested in test no . 7 . this test clearly shows the advantage of a plate treated with the silicone mass compared with a surface treated with the vinyl coating conventionally used . the ice was very readily removed from the plates treated with silicone rubber and was blown away by the wind when it reached a certain size . on the vinyl coating used in practice ( test no . 7 ), by contrast , the forces of adherence were more powerful than the forces of cohesion so that a permanent layer of ice could form . in test no . 6 , the plate was stored for a further 48 hours ( without wind or sea water ) after the test described above . at the end of that time , the ice was in equilibrium with its surroundings . even after this treatment , no special change in the properties was observed and the ice could still be easily removed by hand .	2
plasmid pfs14nsd hpv16 - l1 was constructed by exchanging in the plasmid pfs14 nsd ( 54 ) the hepatitis b nucleocapsid gene ( hbcag , ncoi - hindiii fragment ) for a ncoi - hindiii fragment encoding the hpv16 - l1 open reading frame . the hpv 16 - l1 ncoi - hindiii fragment was generated by polymerase chain reaction ( pcr ) using the baculovirus expression plasmid psynwtvi − hpv16 114 / b - l1 + l2 ( 23 ) as a template with a 28mer containing a ncoi site : 5 ′- gggccatggctctttggctgccttagtga - 3 ′ ( seq id no : 1 and a 27 mer containing a hindiii site 5 ′- gggaagcttcaatacttaagcttacg - 3 ′( seq id no : 2 . the final construct containing the tac promoter places the hpv16 - l1 atg at position + 8 relative to the shine - dalgarno sequence and introduces a change in the second amino acid which becomes an alanine instead of the serine encoded by the original sequence . sequencing of the entire l1 open reading frame was carried out ( mycrosynthag ) and no further nucleotide change was observed . plasmid pfs14nsd hpv16 - l1 was amplified in e . coli jm105 and then electroporated as described previously ( 50 ) into bacterial strain cs022 . this strain is derived from the atcc 14028 strain , into which the pho - 24 mutation was introduced by p22 transduction , resulting in attenuation in both virulence and survival within macrophages in vitro ( phop c , ( 35 )). the resultant recombinant strain is called phop c / hpv hereafter . after overnight growth at 37 ° c . the recombinant bacteria were lysed by boiling in laemmli buffer containing 5 % sds . the lysates were separated on 10 % sds / page gels and expression of l1 was analyzed by western blot using hpv16 - l1 mab camvir - 1 ( 33 ) as primary antibody , an alkaline - phosphatase conjugated goat anti - mouse igg ( sigma ) as secondary antibody and bcip / nbt ( boehringer ) as substrate . to prepare vlps , bacteria were lysed by sonication and the lysate fractionnated on a 10 %- 40 % sucrose gradient in phosphate buffer saline ( pbs ) containing 1m nacl for 1 hour at 40 krpm using a tst41 . 14 rotor . fractions of the gradient were then analysed for the presence of the l1 protein by western blot . the fractions of high sedimentation containing the l1 protein were pooled , dialyzed against pbs / 0 . 5m nacl . vlps were pelleted for 1h at 50 krpm using a tst65 . 1 rotor , adsorbed to carbon - coated grids , negatively stained with phosphotungstic acid and examined with a philips electron microscope . purification of hpv16 vlps expressed in insect cells from a recombinant baculovirus . the transfer vector psynwtvi − hpv16 114 / b - l1 + l2 ( 23 ) was cotransfected with the linearized genome of baculovirus ( baculo - gold , pharmingen ) using the calcium - phosphate method into sf9 cells . the recombinant baculoviruses were plaque - purified and propagated by standard methods ( 39 ). baculo - derived hpv16 vlps were purified as described previously ( 23 ). six - week - old female balb / c mice were immunized at day 0 and at week 14 by the nasal route with 5 × 10 7 cfu of inoculum . blood , saliva and genital samples were taken as described previously ( 18 ). all samples were stored at − 70 ° c . the amount of total iga , anti - lps iga and igg antibodies in samples were determined by enzyme - linked immunosorbent assay ( elisa ) as described previously ( 18 ). for the anti - hpv16 vlp , elisa plates were coated with 10 ng of a preparation of baculo - derived hpv16 vlps in pbs ( total protein content was determined with a biorad protein assay with bsa as standard ). this amount of vlp was saturating in our elisa test . endpoint dilutions of samples were carried out . the specific iga or igg amounts are expressed as reciprocal of the highest dilution that yielded an od 492 four times that of preimmune samples . these reciprocal dilutions were normalized to the amount of total iga or igg in saliva and genital washes . elisa plates were also coated with 10 ng of baculo - derived hpv16 vlps in 0 . 2m carbonate buffer ph9 . 5 to determine the titer of antibodies recognizing unfolded vlps ( 14 ). infectious pseudovirions consisting of hpv capsid made of l1 and l2 surrounding the bovine papillomavirus type 1 ( bpv1 ) genome , designated hpv16 ( bpv1 ) , were generated as recently described ( 43 ). briefly , bphe - 1 hamster cells harbouring autonomously replicating bpv1 genomes were co - infected with defective recombinant semliki forest viruses that expressed l1 and l2 virion capsid genes of hpv16 . infectious pseudotype hpv16 virus in cell extracts was quantitated by the induction of transformed foci in monolayers of mouse c127 cells . neutralizing activity was measured after preincubation of the cell extracts with mouse sera diluted 1 : 50 ( 1 . 0 ml final volume ) in culture medium . mouse monoclonal antibodies h16 . e70 and r1a1 were generated against recombinant baculovirus expressed hpv16 l1 vlps and bpv16 vlps respectively , and used at a 1 : 100 dilution . h16 . e70 and b1 . a1 served as positive and negative controls for hpv16 ( bpv1 ) neutralization , respectively . the open reading frame of the major protein l1 of hpv16 was cloned in the plasmid pfs14 nsd ( 53 ). l1 is constitutively expressed under the control of the tac promoter in s . typhimurium . a unique 57 kda protein detected in the lysate of phop c / hpv overnight cultures ( fig1 a ), was identified as hpv16 l1 by western immunoblot using an anti - hpv16 - l1 monoclonal antibody ( camvir , ( 33 ), fig1 b ). to determine whether the l1 protein expressed by phop c / hpv assembled into vlp , the bacterial lysate was fractionated through a 10 - 400 sucrose gradient and the heavier fractions containing the l1 protein ( fig1 b ) were analyzed by electron microscopy . spherical particles typical of pv capsids were recovered from the bacterial preparation ( fig2 a ) but the bacterial vlps appeared more polymorphic in size with diameters ranging from 40 to 55 nm ( fig2 a ) when compared to ˜ 55 nm vlps expressed in insect cells ( fig2 b ). nasal immunization with the phop c / hpv strain induces systemic and mucosal antibody responses . since nasal immunization using recombinant salmonella was shown to elicit strong vaginal siga responses against an expressed foreign antigen ( 18 ), we immunized mice nasally with the phop c / hpv strain ( 5 × 10 7 cfu ). samples of blood , saliva and vaginal washes were taken 0 , 2 , 4 , and 6 weeks after immunization . the immune responses against both the carrier , i . e . anti - lps and the carried antigen , i . e . anti - hpv16 vlp , were determined . serum hpv16 vlp specific igg ( fig3 ) were detected after 2 weeks in one mouse and after 4 weeks in all mice . the response peaked after 6 weeks at relatively low titers and persisted at least until week 14 . at that time , no hpv16 vlp specific antibodies were detected in vaginal secretions , while one mouse had low titers of iga in the saliva . the systemic and the mucosal immune responses against lps were relatively low ( fig3 ), but similar to those elicited by the phop c / hbc strain ( 18 ) suggesting a normal take of phop c / hpv salmonella by the mice . the low anti - lps response observed after nasal immunization incited us to perform a booster immunization . thus , a second nasal immunization was performed at week 14 and samples were taken 5 and 10 weeks later ( week 19 and 24 respectively ). the second immunization induced , 5 weeks later ( week 19 ), a 15 fold increase of anti - hpv16 vlp igg in serum , as well as anti - hpv16 vlp iga in the vaginal washes ( fig3 ) from the three mice . anti - hpv16 vlp igg were also found in vaginal washes but only in two mice at week 19 and titers were again almost undetectable at week 24 ( fig3 ). anti - hpv16 vlp iga and igg were also found in the saliva of the three mice in amounts comparable or slightly higher to those found in vaginal washes . in order to examine whether the immune responses induced by the phop c / hpv strain generated conformational antibodies directed against native but not unfolded vlps , we measured by elisa ( table 1 ) the binding of antibodies , in the samples from the immunized mice , to baculo - derived vlps in pbs ( native form ) or in carbonate buffer ( ph 9 . 5 , unfolded vlp , ( 14 )). the specific igg or iga elicited by the phop c / hpv strain very poorly recognizes unfolded vlps suggesting that the majority of l1 were folded into highly ordered structures when expressed in phop c / hpv ( table 1 ) in previous studies of baculo - derived vlps , neutralizing activity and protection from experimental infection generally correlated with elisa reactivity to native vlps . we therefore wished to determine if the conformationally dependent anti - vlp antibodies elicited by the live salmonella vaccine were also neutralizing . although no infectivity assay or source of the virus currently exists for authentic hpv16 , it has recently been demonstrated that hpv16 capsid proteins can encapsidate autonomously replicating bpv1 genomes resulting in hpv16 ( bpv1 ) pseudotype virions whose infectivity can be monitored by focal transformation of cultured mouse fibroblasts ( 43 ). we therefore used the hpv16 ( bpv1 ) infectivity assay to examine the neutralizing activity of the mouse sera generated above . each of the three immune sera displayed strong neutralizing activity against hpv16 ( bpv1 ) ( fig5 ), but did not neutralize bpv1 virions ( data not shown ). the preimmune sera had no neutralizing activity . the neutralizing activities of the immmune sera appeared to correlate with the titers in the native vlp elisa , although the sera were only tested at a single dilution . it has been recently shown that the growth syngeneic tumour cells ( c3 ) injected into the flank of c57bl / 6 mice was inhibited by a subcutaneous immunization with purified hpv16 cell ( 84 ). we have tested whether nasal immunization with purified vlps and recombinant salmonella / hpv strains was able to induce the same effect . specifically , we have tested the following strains : phoc / hpv16 l1 ( 86 ) and the x4550 ( 56 ) expressing either high levels ( x4550 / pya34l1 ) or low levels ( x4550 / pya32l1 ) hpv16 l1 . tumour growth in the different groups of mice is shown in fig6 . our preliminary results demonstrate that nasal immunization with purified vlps is effective and that all the salmonella / hpv strain tested induced partial tumour protection . of interest , is the strain x4550 / pya34l1 that prevented complete tumour growth in 4 / 10 mice . the l2 or17 was cloned downstream of the l1 orf by pcr into the plasmid ppsnsdhpv16 l1 ( 86 ). the pcr reaction included a 5 ′ specific oligonucleotide that contained a synthetic shine - dalgarno sequence in order to allow translation of 12 from a polycistronic l1 − l2 rna . the resultant phopc / hpv16 l1 + l2 recombinant strain expressed both l1 and l2 and vlps assembled in amount similar to the parent phopc / hpv16 l1 strain as assessed by a sandwich elisa . this suggests that by fusing the e7 orf to the l2 orf , in the phop c / hpv16 l1 + l2 strain , a chimeric vlps would also assemble and such recombinant salmonella strain used to induce hpv16 e7 - ctls . high level expression of l1 in the inducible e . coli pet expression system . the l1 orf was cloned in the plasmid pet3 ( novagen ). l1 - expression driven by a t7 promoter was assessed in the strain pl21aplyss ( expressing t7 polymerase upon iptg induction ). after iptg induction , a 10 fold higher level of l1 expression / bacteria was achieved in comparison to the salmonella phop c strain ( see fig8 ). the lysate of this recombinant e . coli formed a band at a density of vlps in a cscl density gradient , suggesting that the vlps self - assembled in this bacteria . in this study , we demonstrate that an attenuated salmonella strain expressing the major capsid protein of hpv16 is a promising vaccine candidate against hpv16 infection , as the vlps that are assembled by this recombinant bacteria can induce serum as well as genital vlp - specific conformational antibodies . the results above also show that the antibodies are able to neutralize hpv16 viruses . these results could be readily extrapolated by the skilled person to other types of hpv or other papillomaviruses , or other prokaryotic microorganisms . the life cycle of papillomavirus is intimately associated with the differentiation of the epithelial cells in skin or the oral and genital mucosa ( 5 , 19 , 40 , 62 ). it is believed that viruses gain access to the basal epithelial cells through mucosal abrasions ( 21 ). upon infection of the cervical epithelium for instance , the viral dna released in the cytoplasm of the basal cells migrates into the nucleus where it remains episomic and early genes are transcribed leading to a low rate of cell proliferation and the thickening of the basal layer ( cervical intraepithelial neoplasia type i , cin i ). as the infected epithelial cells migrate through the suprabasal layer and undergo differentiation , the episomal viral genome replicates reaching ˜ 1000 copies per cell ( 29 ). concomitant to viral dna amplification , late genes become expressed and capsids assemble in terminally differentiated keratinocytes ( fig4 ), thus facilitating a new round of infection . in high grade lesions ( cin iii and carcinoma ) the entire epithelium consists of undifferentiated basal cells in which the viral dna has been integrated into cellular dna . in these cells , the e6 / e7 gene products constitute the major hpv proteins expressed and viruses are no longer produced . based on our knowledge of hpv pathogenesis , it appears that two arms of immunity ( humoral and cellular ) have to be effective to prevent viral infection , to decrease the local viral load , or to cure tumors ( fig4 see also ( 59 )) . a local or systemic humoral immune response with neutralizing antibodies is likely to block early infection , while a cellular response may contribute to the elimination of untransformed or transformed infected cells . an ideal vaccine should trigger the two types of response , although the immunological correlate of protection and of cure have not been identified so far . prophylactic vaccines inducing type - specific neutralizing conformational ( anti - vlp ) antibodies have been shown to prevent crpv or copv infections in cottontail rabbit ( 4 ) or dog ( 57 ), respectively . in both cases serum neutralizing antibodies where generated by vaccination with self - assembled pv capsids . by analogy , neutralizing antibodies to hpv16 capsid in cervical secretions are expected to prevent infection . since the precise mucosal site where early hpv infection takes place is not known , it is difficult to predict whether siga antibodies acting from the lumenal site or circulating igg antibodies reaching the basal layers will be most efficient . the elimination of hpv - infected cells or tumor cells requires a cellular immune response with cytotoxic t lymphocytes ( ctl ) recognizing viral antigens presented by mhc class i molecules on the infected cells . therapeutic vaccines aimed at eliminating hpv - induced tumors have been generated using either peptides corresponding to t cell epitopes from the e6 / e7 oncogenes or e6 / e7 expressing vaccinia viruses . both were shown to elicit ctls and in some cases tumor regression was observed ( 3 , 6 , 7 , 12 , 13 , 34 ). one of the major problems , however , is that mhc class i molecules are down - regulated in the differentiated keratinocytes that produce viruses or in tumour cells ( 9 ). since both humoral and cellular immunity are believed to control hpv infection and since local and systemic responses are desirable , an efficient vaccine should reach inductive sites associated with mucosal surface and / or peripheral lymph nodes . live bacterial vaccines are known to cross mucosal surfaces and elicit humoral or cellular responses ( 41 ). recombinant and attenuated enteropathogenic bacteria , such as salmonella , represent ideal antigen delivery systems , because they efficiently cross all mucosal surfaces to gain access to both mucosal organized lymphoid tissue ( malt ) or draining lymph nodes . they exploit the two basic sampling systems mediating uptake of mucosally administered antigens including m cells in simple epithelial and dendritic cells both in simple and stratified epithelial ( 38 ). we have selected a salmonella typhimurium strain attenuated for macrophage survival , because long lasting antibody responses were elicited by a single nasal , oral , rectal or vaginal administration of recombinant bacteria expressing a foreign antigen ( 18 ). in that study , the best genital responses were obtained after nasal immunization . in the airways , antigen uptake occurs through m cells found in nalt , the nasal associated lymphoid tissue ( 25 ) and balt , the bronchial associated lymphoid tissue ( 55 ). the primed iga - expressing lymphocytes then migrate into cervical and uterine tissues where they produce polymeric iga antibodies , which are transported across the epithelium by the polymeric ig receptor ( 26 - 28 ). intraepithelial dendritic cells in the bronchial epithelium also play a major role in antigen presentation by taking up the antigens in the respiratory epithelium and carrying them to distant draining lymph nodes where priming occurs ( 17 ). this probably explains why nasal immunization is so efficient in triggering both local and systemic antibody responses . antigens expressed in salmonella strains can also elicit cellular responses with specific ctls ( 1 , 16 , 58 ). depending on which viral antigen is expressed , specific ctls recognizing infected cells at different stages of differentiation could be generated ( fig4 ). for instance , e7 - specific ctls were generated by immunizing mice with recombinant salmonella expressing hpv16 e7 epitopes ( 31 ). to trigger neutralizing antibodies using recombinant salmonella , it is essential that the antigen retains its native conformation . for hpv , this requires that the l1 proteins form vlps . papilloma vlps have been shown to assemble in eukaryotic cells ( 15 , 22 , 45 , 48 , 61 ), but not in prokaryotes . in bacteria mainly l1 - fusion proteins were expressed ( 2 , 20 , 24 ) and when bona fide l1 proteins were expressed , vlp assembly was not examined ( 11 ). as shown in this paper , hpv16 vlp assemble in salmonella probably because the level of expression achieved in our experiments was high and capsid assembly does not require glycosylation ( 60 ). capsid production in bacteria has also been reported for other viruses such as the nucleocapsid of hepatitis b virus ( 52 ) and the capsid of polyomavirus ( 30 , 46 ). polyomavirus vp1 major capsid protein , analogous to hpv l1 , forms capsomers when expressed in e . coli which subsequently self - assembled into vlps in vitro ( 46 ). the fact that only capsomers but no vlps were recovered is probably due to the reducing agents present during purification , which are known to disrupt capsids ( 47 ). nasal immunization with the phop c / hpv strain induced systemic and mucosal antibodies against native but not denatured hpv16 vlps . in contrast , recombinant vaccinia expressing hpv1 capsid protein triggered serum antibodies recognizing both folded and unfolded vlp , probably reflecting different mode of viral protein expression , and low hpv - specific genital iga antibody titers ( 14 ), as expected with a non - mucosal route of immunization . antibody titers against the foreign antigen induced by phop c / hpv compared to phop / hbc salmonella were about 10 times lower ( 18 ). this could reflect differences in immunogenicity between the two viral antigens ( 51 ) or , more likely , differences in plasmid stability . in contrast to the hbc dna , the plasmid carrying the hpv16 - l1 dna was unstable in salmonella in vivo in the absence of selective pressure , since less than 1 % of the salmonella recovered from different tissues two weeks after immunization still harboured the l1 - containing plasmid ( data not shown ). to increase the stability of the plasmid we are currently recloning the l1 gene in β - aspartate semialdehyde dehydrogenase ( asd )- based vectors which maintain selective pressure in vivo ( 36 , 56 ). ( a ) that purified vlps and salmonella / hpv strains are capable of providing tumour protection in a hpv16 mouse tumour model . ( b ) that chimeras of a hpv protein and a fusion partner assemble in prokaryotes to form vlps . ( c ) that high levels of expression of hpv proteins that assemble to form vlps can be obtained in e . coli , demonstrating that the invention is applicable in prokaryotes other than salmonella . in conclusion , we have constructed a recombinant salmonella strain expressing hpv 16 - l1 capsid proteins and assembling vlps that induce conformational serum igg and vaginal siga antibodies recognizing vlps . neutralizing activities of these antibodies were tested and shown to display strong neutralizing activity in an hpv16 ( bpv1 ) infectivity assay . b titers are expressed as the reciprocal of the highest sample dilution that yielded an od 492 four times that of preimmune sample c anti - hpv16 l1 monoclonal igg ( 35 μg / ml ), 30 ) used as positive control 7 . chen et al , 1991 . proc . nat . acad . sci . usa . 88 ( 1 ) : 110 - 4 . 10 . curtiss , 1990 . attenuated salmonella strains as live vectors for the expression of foreign antigens . marcel dekker , inc ., new york . 16 . hess et al , 1996 . proc . nat . acad . sci . usa . 93 ( 4 ): 1458 - 1463 . 19 . howley , 1990 . papillomaviridae and their replication . fields virology . raven press , new york . 21 . jenson et al , 1987 . obst . gynec . clin . north am . 14 ( 2 ): 397 - 406 . 22 . kirnbauer et al , 1992 . proc . nat . acad . sci . usa . 89 : 12180 - 12184 . 37 . nardelli - haefliger et al , 1996 . oral and rectal immunization of adult female volunteers with a recombinant attenuated salmonella typhi vaccine strain . submitted . 39 . o &# 39 ; reilly et al , 1992 . baculovirus expression vectors . a laboratory manual . freman w . h . and company , new york . 41 . roberts et al , 1994 . salmonella as carriers of heterologous antigens , p . 27 - 58 . crc press inc . 49 . schiffman et al , 1993 . j . nat . cancer inst ,. 85 ( 12 ) : 958 - 64 . 51 . schödel et al , 1990 . collogue inserm ed , vol . 194 . john libbey eurotext , montrouge . 53 . schödel et al , 1993 . hybrid hepatitis b virus core / pre - s particles : position effects on immunogenicity of heterologous epitopes and expression in avirulent salmonellae for oral vaccination . plenum press , new york . 57 . suzich et al , 1995 . proc . nat . acad . sci . usa . 92 ( 25 ): 11553 - 11557 . 59 . tindle et al , 1994 . curr . top . in micr . immunol . 186 ( 217 ): 217 - 53 . 62 . zur hausen and schneider , 1987 . the role of papillomaviruses in human anogenital cancer , in the papovaviridae : the papillomaviruses , vol . 2 . salzman , n . p . and howley , p . m . eds , plenum , new york . 64 . bartholomeusz et al , 1986 . journal of gastroenterology and hepatology . 1 : 61 - 67 . 66 . curtiss et al , 1994 . nonrecombinant and recombinant avirulent salmonella vacines . in g . p . e . a . talwar ( ed . ), recombinant and synthetic vaccines . narosa publishing house , new delhi , india . 68 . curtiss et al , 1994 . recombinant salmonella vectors in vaccine development , p . 23 - 33 . in f . brown ( ed . ), recombinant vectors in vaccine development , vol . 82 . karger , basel . 73 . hone et al , 1992 . journal of clinical investigation . 90 ( 2 ) : 412 - 20 . 75 . roberts et al , 1994 . salmonella as carriers of heterologous antigens , p . 27 - 58 . crc press inc . 77 . schödel et al , 1996 . hybrid hepatitis b virus core antigen as a vaccine carrier moiety : ii expression in avirulent salmonella spp . for mucosal immunization , p . 15 - 21 . in s . cohen and a . shaf ferman ( ed . ), novel strategies in design and production of vaccines . plenum press , ny . 84 . greestone et al , 1997 . hpv16 l1 / l2 - e7 chimeric papillomavirus - like particles induce both neutralizing antibodies and e7 specific anti - tumour immunity . 16th international papillomavirus conferencce , siena , italy , abstract : 177 .	8
an example of known display apparatus is shown in u . s . pat . no . 4 , 019 , 773 -- vehling , f . w .-- issued apr . 26 , 1977 fai 5 and directed to a mobile carpet display center . although the display apparatus is suitable for the use specified , in the patent , it could not readily be maneuvered into a trade show space since there is no provision for close quarter maneuvering . other examples of equally unsuitable display apparatus are shown in u . s . pat . nos . 3 , 692 , 350 -- radtke , c . w .-- issued sep . 19 , 1972 , for a mobile outdoor display unit and 4 , 480 , 866 -- komatsu , s .-- issued nov . 6 , 1984 and 2 , 069 , 852 -- ruthenburg , l .-- issued feb . 9 , 1937 for a vehicle for displaying goods . the apparatus shown in these patents also do not meet the requirement for maneuvering . in addition , none of the known vehicles are specially adapted for maximizing the usage of alloted space . it is a prime object of the present invention to provide mobile article display vehicles which are maneuverable into closely defined spaces while maintaining an excellent economy 4 :) f space use . a further object is to provide a self contained mobile display vehicle which can be substantially completely set up off the show location and readily moved and set up for article display with a minimum of time and labor cost . a still further object of the invention is to provide a vehicle especially adapted to utilize the alloted space at an exhibition site . in accordance with the present invention the mobile display apparatus comprises a trailer type structure with normal undercarriage and trailer hitch facilities . the display part of the apparatus can be in the form of a flat bed trailer for articles which can be transported covered with a tarpaulin or in the form of a box - like main body , preferably utilizing the flat bed as the floor thereof , provided with , at least , one box - like cover on , at least , one side . the cover being hinge connected to one vertical edge of the end of the fixed structure to allow opening outward to approximately 180 degrees . it may be desirable to divide the cover into , for instance , two equal parts , one part hinged at each end of the main structure . furthermore , covers may be provided on both sides of the main body resulting in increased display area with a walk through possibility and maximum usage of space . the fixed structure and the cover can each be provided with counters and shelves , as required to display the articles , with the necessary accessory piping and wiring incorporated . in order to improve the usefulness and facilitate fast and efficient set - up of a display slotted structural elements are secured in the inside corners and on the inside peripheries of the box - like structure and the covers . these slotted elements are available commercially and are eminently suited for this purpose and come in cross - sectional configurations suitable for corner and flat surface mounting with the slotted side facing outward so that hangers , shelf brackets and the like can be inserted in and locked in the slots at the appropriate locations for hangers and shelf supports . the vehicle then requires only one or two connections to be made on the site for power , water etc ., the articles to be displayed being previously placed in position , off site , so that they are immediately on display when the covers are opened . in order to facilitate maneuvering the apparatus in tight spaces casters are provided , preferably , at each of the corners of the trailer part . the casters are vertically adjustable to raise the undercarriage free of a floor or road surface whereafter the casters carry the weight of the complete apparatus and allow movement of the vehicle , in any direction , on the casters . when the vehicle is properly positioned the casters may be adjusted to allow part or all of the weight of the vehicle to rest on the undercarriage . alternately the casters may be fixed in position and the undercarriage raised to leave the fixed casters to support the weight of the vehicle . it is , however , desirable to provide casters which are , individually , vertically adjustable in order that on site levelling may be achieved . fig1 shows a perspective view of the vehicle in partly open condition illustrating the versatility of article display configuration , fig2 shows a plan view of the mobile article display vehicle in the configuration shown in fig1 fig3 shows a side view of the vehicle of fig1 in a closed configuration , fig5 shows a end view of the of fig1 in a parked position , with the vehicle weight resting on the casters . fig6 and 7 illustrate cross - sectional configurations of slotted elements adapted to hold hangers , shelf brackets and the like . referring to the drawings , fig1 and 2 show the article display vehicle , according to the invention , as comprising a flat bed 1 having an undercarriage 2 provided with wheels 3 and a trailer hitch 4 , preferably removable , for attaching the apparatus to a motor vehicle for movement between locations . the vehicle is shown as being provided with casters 11 supported by telescopic pipe or hydraulic cylinder means 10 , 12 which provide , additional to the normal caster support , means to adjust the caster downward to lift the undercarriage wheels 3 clear of a road or floor surface , see fig1 so that the vehicle , as a whole , can be minutely maneuvered , on its caster supports , into a confined space , i . e . an exhibition space . means , not shown , are provided to lock the caster wheels and their supports in fixed positions vertically and against rolling or swiveling . the casters may be retracted slightly to allow part of the weight of the unit to rest on the undercarriage . furthermore , the casters may be used to level the flat bed area of the vehicle if this is desirable and / or necessary . mounted on the flat bed is a box - like main body 8 having side covers 5 which are preferably box - like in structure although it is conceivable and perhaps useful , in some instances , to omit either the top or bottom side , or both , of the cover for easier access to the inner side of the main vertical panel of the cover . the covers are hinged to the vertical end corners of the main body part 8 by hinges 9 as best shown in fig4 and 5 . preferably two equally dimensioned covers 5 are provided on each side of the main body 8 as shown in fig3 . as best shown in fig1 and 5 , the body is provided with a roof or top side 7 . running lengthwise , on each top side of the main body part and under the outer sides of the roof are auxiliary closure flaps 6 each having a turned down outer flange 6a which overlaps the top edge of the cover . these flaps serve two purposes , they act as rain shields for the covers and the structure as a whole and , furthermore , when the structure is closed the flaps prevent inadvertent opening of the covers . referring now to fig1 and 5 , caster supports 12 , preferably in the form of hydraulic cylinders , are shown located at the corners of the vehicle . the supports 12 are provided with telescoped parts 10 , for instance secured to a piston movable in a cylinder 12 , which parts are provided , at their lower extremities with caster wheels 11 which are shown in fig1 and 5 as supporting the weight of the vehicle , the undercarriage wheels 3 being raised clear of the floor or road surface 13 thus allowing for the maneuvering of the vehicle on the caster wheels 11 . individual adjustment of the casters can be used for levelling of the trailer as required for the display . in order to facilitate easy set - up of a display and provide a wide choice of arrangements , the box 8 and the covers 5 are provided with slotted structural elements 14 , shown in heavy line in fig1 on the inside perimeter edges of the box - like structure and the covers as well as in the inside corners of the box - like structure and the covers . the slotted elements have cross - sectional configurations suitable for corner ( quarter round ), fig6 and flat surface ( partial sphere ), fig7 mounting where the slots 15 face inward to provide a longitudinal lock - in slots for hangers and shelf brackets arrangeable in a great variety of configurations . with this facility provided integral with the box - like structure an exhibiter is free to exhibit in an individualistic manner . the box - like structure , complete with structural elements may in itself constitute a separate unit conveniently removable from the trailer part to constitute a portable display container and be transported separately to an exhibition site . the vehicle , according to the invention , is the basic display vehicle . shelving , lighting , power and water supplies etc . can be incorporated in the box - like structure as needed to facilitate the display of particular articles of merchandise and in a manner which requires only one connection for each particular supply . the apparatus can be completely outfitted , for instance , at the products - to - be - displayed source so that it is only necessary to connect supply sources after the apparatus is maneuvered into the allotted space at the exhibition site , thus saving time and labor . in addition , problems that may arise in the setting up of the display can be solved at the source location . since exhibition spaces are standardized the vehicle can be dimensioned to make the most efficient use of the space available . although a simple embodiment of the invention is disclosed it will be obvious that variations of the embodiment described may be made which do not depart from the spirit and scope of the invention as defined in the appended claims . for instance , there may be one or more covers per side of the box - like structure , one side of the box may be closed and fill panels and the like may be used to enhance the display . adjustment of the caster supports may be manually or electrical powered . in addition , there may be three or more casters provided for maneuvering and the hitch and supporting tongue made retractable into the bed of the vehicle .	6
according to the method of at least one of the preferred embodiments of the present invention , a printing plate precursor having a support with a surface including titanium is converted from a hydrophobic state into a hydrophilic state by first anodizing and than annealing the surface under reduced pressure . alternatively , a printing plate precursor having a support with a surface including titanium is converted from a hydrophobic state into a hydrophilic state by first etching the support followed by an anodizing step . by irradiation of the hydrophilized surface with heat and / or infrared light , a switch from a hydrophilic state into a hydrophobic state is obtained . the support of the printing plate precursor having a surface including titanium is preferably a titanium metal sheet . alternatively , the support is a base onto which a thin layer of titanium metal is applied . the titanium metal sheet may be a commercially available titanium metal sheet having preferably about 99 . 5 % wt to about 99 . 9 % wt purity . also suitable is an alloy of titanium containing about 4 % wt to about 5 % wt of for example aluminum , vanadium , manganese , iron , chromium and molybdenum . the thickness of the titanium metal sheet is not critical : it may be between about 0 . 05 mm to about 0 . 6 mm , preferably from about 0 . 05 mm to about 0 . 4 mm , and more preferably from about 0 . 1 mm to about 0 . 3 mm . the base onto which a thin layer of titanium is applied may be a metal sheet including , for example , aluminum , stainless steel , nickel , and copper . also suitable as a base is a flexible plastic support such as polyester or cellulose ester , waterproof paper , polyethylene - laminated paper , or polyethylene - impregnated paper . the support can also be a laminate including an aluminum foil and a plastic layer , e . g ., polyester film . when a metal sheet is used as a base for the titanium layer , the surface of the metal base may have been roughened by any of the known methods . the surface roughening may be mechanical , electrochemical , or chemical etching , or by combinations of these methods . a particularly preferred lithographic support is an electrochemically grained and anodized aluminum support . the grained and anodized aluminum support is preferably grained by electrochemical graining , and anodized via anodizing techniques employing phosphoric acid or a sulphuric acid / phosphoric acid mixture . methods of both graining and anodization of aluminum are very well known in the art . by varying the type and / or concentration of the electrolyte and the applied voltage in the graining step , different types of grains can be obtained . by anodizing the aluminum support , its abrasion resistance and hydrophilic nature are improved . the microstructure as well as the thickness of the al 2 o 3 layer are determined by the anodizing step , the anodic weight ( g / m 2 al 2 o 3 formed on the aluminum surface ) varies between about 1 g / m 2 and about 8 g / m 2 . the thin layer of titanium present on the base may be applied by known methods such as for example vapor deposition , spray pyrolysis , sputtering , or electrodeposition . the thickness of the deposited titanium metal layer is preferably from about 0 . 01 μm to about 10 μm , more preferably from about 0 . 05 μm to about 1 . 0 μm , and most preferably the thickness varies between about 0 . 10 μm and about 0 . 30 μm . the titanium sheet or the base provided with a titanium layer may be subjected to a surface roughening step treatment prior to the anodization step . preceding the surface - roughening step , a degreasing step may be conducted with for example a surfactant , an organic solvent or an aqueous alkali solution . the surface roughening treatment of the titanium sheet or the base provided with a titanium layer can be conducted by various methods ; examples thereof include mechanically roughening ( e . g ., grinding with balls , brushing , blasting , or buffing ), electrochemical dissolution ( e . g ., surface roughening in an electrolytic solution with application of an ac or dc current ) or chemical dissolution ( e . g ., immersing the metal in an aqueous solution of one or more alkaline salts selected from sodium hydroxide , sodium carbonate , sodium silicate or sodium pyrophosphate ). these methods may be used alone or in combination . according to a preferred method of the present invention , the anodization of titanium is performed by treatment of the surface including titanium with an aqueous electrolyte solution at a concentration of about 0 . 001 mol / l to about 5 mol / l , preferably from about 0 . 005 mol / l to about 3 mol / l , a liquid temperature of about 5 ° c . to about 70 ° c ., preferably from about 15 ° c . to about 30 ° c ., a dc voltage of about 1 v to about 100 v , preferably about 5 v to about 50 v , more preferably about 10 v to about 30 v , and an electrolysis period of about 10 seconds to about 10 minutes , preferably about 1 minute to about 8 minutes . more preferably , the surface of the support is anodized in an aqueous electrolyte solution containing at least one of the following chemicals : an inorganic acid selected from sulfuric acid , phosphoric acid , nitric acid or boric acid ; hydrogen peroxide in addition to one or more of the above inorganic acids ; an alkali metal salt and / or an alkaline earth metal salt of the above inorganic acids ; an organic acid selected from oxalic acid , tartaric acid , citric acid , acetic acid , lactic acid , succinic acid , glutamic acid , sulfosalicyclic acid or naphthalenedisulfonic acid ; an alkali metal salt and / or an alkaline earth metal salt of the above organic acids ; hydroxides and / or water - soluble carbonates of sodium , potassium , calcium , lithium , and magnesium and / or aqueous alkali solutions such as ammonium hydroxide solution ; glycerophosphoric acid and the alkali metal salt and / or the alkaline earth metal salt thereof and / or acetic acid and the alkali metal salt and / or the alkaline earth metal salt thereof . these aqueous electrolyte solutions may be used alone or in combination . the concentration of the solutions depends on the kind of the electrolyte used for the anodization process . in an example of a preferred embodiment of the present invention , the electrolyte solution preferably includes oxalic acid at a concentration of about 0 . 6 mol / l , and the anodizing reaction is carried out at room temperature using about 20 v dc for a period of about 5 minutes . doping the anodized surface with a metal such as platinum , palladium , gold , silver , copper , nickel , iron , or cobalt or a mixture thereof may be advantageous . according to the method of the first preferred embodiment of the present invention , the anodized support is annealed at a reduced atmospheric pressure . other gasses such as h 2 or n 2 gas may be used during the annealing step . preferably , the annealing temperature varies between about 350 ° c . and about 550 ° c ., more preferably between about 400 ° c . and about 500 ° c ., and the annealing time varies between about 60 minutes and about 240 minutes , more preferably between about 80 and about 200 minutes . the pressure applied during the annealing step varies between about 0 . 1 kpa ( 1 mbar ) and about 1 kpa ( 10 mbar ), and more preferably between about 0 . 2 kpa ( 2 mbar ) and about 0 . 6 kpa ( 6 mbar ). according to the method of the second preferred embodiment of the present invention , prior to the anodization step , the support is etched . etching of metal surfaces can be done in many ways . for example , aqueous solutions including one or more alkaline salts can be used . in an example of the present preferred embodiment , a mixture including h 2 o 2 and naoh is used wherein the concentration of h 2 o 2 varies between about 0 . 05 mol / l and about 1 mol / l , more preferably between about 0 . 1 mol / l and about 0 . 8 mol / l and the concentration of naoh varies between about 0 . 1 mol / l and about 5 mol / l , more preferably between about 0 . 5 mol / l and about 3 . 5 mol / l . the etching temperature varies preferably between about 50 ° c . and about 100 ° c ., more preferably between about 60 ° c . and about 80 ° c . and the reaction time varies preferably between about 0 . 5 minute and about 10 minutes , more preferably between about 0 . 5 minute and about 5 minutes . alternatively , the etching and anodizing steps may be carried out in one step . the etched and anodized printing plate precursor may optionally undergo further post - treatments such as chemical reducing treatments , e . g ., annealing at reduced pressure as defined in the first method , or photolytic reduction , e . g ., uv - treatment . the lithographic printing plate precursor including an anodized and annealed support or including an etched and anodized support thus obtained , may be rinsed with water , with a liquid containing a surfactant or with a desensitizing liquid ( so called gum solution ) containing gum arabic or a starch derivative , or with combinations thereof . the surface of the printing plate precursor is hydrophilic and upon image - wise exposure to heat and / or light , the exposed areas become ink accepting . this conversion from a hydrophilic to a hydrophobic state can , for example , be characterized by an increase of the contact angle for water measured on the surface : the contact angle for water increases after the treatment of the support indicating a hydrophilic / hydrophobic conversion . the contact angle is defined as the angle between the tangent of the edge of the water droplet at the contact zone between the support and the droplet . a layer which includes a compound capable of absorbing light and converting the absorbed energy into heat may optionally be coated onto the anodized and annealed support or onto the etched and anodized support . the compound capable of absorbing light and converting it into heat is preferably an infrared absorbing agent . preferred ir absorbing compounds are dyes such as cyanine , merocyanine , indoaniline , oxonol , pyrilium and squarilium dyes or pigments such as carbon black . examples of suitable ir absorbers are described in , e . g ., ep 823 327 , ep 978 376 , ep 1 029 667 , ep 1 053 868 , ep 1 093 934 , wo 97 / 39894 and wo 00 / 29214 . a preferred compound is the following cyanine dye ir - a : wherein x − is a suitable counter ion such as tosylate . the coating may in addition to the layer including the infrared absorbing agent also contain one or more additional layer ( s ) such as , i . e ., a protective layer or an adhesion - improving layer between the layer including the infrared absorbing agent and the support . optionally , the layer including a compound capable of absorbing light or an optional other layer may further contain additional ingredients . for example , binders , surfactants such as perfluoro surfactants , silicon or titanium dioxide particles or colorants may be present . according to the present preferred embodiment , the heat - sensitive printing plate precursor thus obtained is then image - wise exposed directly with heat or indirectly with infrared light , preferably near infrared light . the infrared light is preferably converted into heat by an ir light absorbing compound as discussed above . the printing plate precursor is not sensitive to ambient light so that it can be handled without the need for a safe light environment . the printing plate precursor can be exposed to infrared light via , e . g ., leds or an infrared laser . preferably , the light used for the exposure is a laser emitting near infrared light having a wavelength in the range from about 700 nm to about 1500 nm , e . g ., a semiconductor laser diode , a nd : yag or a nd : ylf laser . the exposure step may optionally be followed by a rinsing step and / or a gumming step . the gumming step involves post - treatment of the heat - sensitive printing plate with a gum solution . a gum solution is typically an aqueous liquid which includes one or more surface protective compounds that are capable of protecting the lithographic image of a heat - sensitive material or printing plate against contamination or damaging . suitable examples of such compounds are film - forming hydrophilic polymers or surfactants . according to the present preferred embodiment , the heat - sensitive printing plate is then ready for printing without an additional development step . the exposed plate can be mounted on a conventional , so - called wet offset printing press in which ink and an aqueous dampening liquid are supplied to the material . the non - image areas hold the dampening water and the image areas hold the ink . another suitable printing method uses so - called single - fluid ink without a dampening liquid . suitable single - fluid inks have been described in u . s . pat . no . 4 , 045 , 232 , u . s . pat . no . 4 , 981 , 517 and u . s . pat . no . 6 , 140 , 392 . in an example of the present preferred embodiment , the single - fluid ink includes an ink phase , also called the hydrophobic or oleophilic phase , and a polyol phase as described in wo 00 / 32705 . alternatively , the printing plate is first mounted on the printing cylinder of the printing press and then image - wise exposed directly on the press via an integrated image - recording device . subsequent to exposure , the plate is ready for printing . the printing plate can be regenerated after printing . after printing , the printing plate is subjected to a flood exposure with uv light whereby hydrophobic areas are converted to a hydrophilic state and recover sensitivity to infrared light and / or heat irradiation . optionally , before the flood exposure step , a cleaning step may be performed to remove the adherent ink . suitable solvents that can be used for cleaning include hydrophobic petroleum solvents such as aromatic hydrocarbons commercially available as printing ink solvents : kerosine , benzol , toluol , xylol , acetone , methyl ethyl ketone , and mixtures thereof . the regenerated printing plate precursor thus obtained can be used for a next printing operation involving image - wise exposure and printing . a titanium foil ( goodfellow ti000380 99 . 6 %, 125 μm foil ) was cleaned by ultrasound treatment in isopropanol and was subsequently rinsed with water . samples with a size of 19 cm × 5 . 5 cm were cut out of the cleaned titanium support and anodized using a counter electrode of titanium and a distance between the two electrodes of 2 . 4 cm . table 1 lists the different anodizing conditions . printing plate precursors 1 and 3 were anodized in one single step whereas printing plate precursor 2 was anodized in three subsequent steps . every anodizing step was followed by a rinsing step with water . the thus obtained printing plate precursors 1 , 2 and 3 were subsequently irradiated with a single beam ir - laser diode at 830 nm with a pitch of 7 μm at 280 mw at 4 m / s ( corresponding to an energy density of 1000 mj / cm 2 ) and with a single beam ir - laser diode at 830 nm with a pitch of 7 μm at 280 mw at 8 m / s ( corresponding to an energy density of 500 mj / cm 2 ). after irradiation , the contact angles of the printing plates 1 , 2 and 3 were measured with a water droplet utilizing a fibro dat1100 equipment ( trademark of fibro system ab ). the contact angles were measured 2 ms after the deposition of the water droplet and are summarized in table 2 . the results of table 2 indicate that the annealing step under reduced pressure of the printing plate precursors results in a lowering of the contact angle value . upon laser irradiation of printing plate precursor 3 ( non annealed sample and annealed sample ), printing plate 3 is obtained of which the contact angle remains the same for the non - annealed plate and increases for the annealed plates indicating a hydrophilic / hydrophobic switch ( table 3 ). after the etching step , the different printing plate precursors were anodized at room temperature utilizing a dc voltage of 20 v ( table 4 ). a titanium counter electrode was used and the distance between the two electrodes was 2 . 4 cm . the printing plate precursors 4 - 10 were subsequently exposed with a single beam ir laser diode at 830 nm with a pitch of 7 μm at different powers and drum speeds . the resulting energy densities are given in table 5 . after the laser exposure , the plates were immediately mounted on a abdick 360 wet offset printing press . van son 167 ink ( trademark of van son ) was used together with a fountain solution of 5 % g671 ( trademark of agfa - gevaert ) in water . a non - compressible rubber blanket was used and 250 copies were printed on 80 g offset paper . the ink density on the prints were measured using a gretag macbeth d19c densitometer ( available from gretag macbeth ag ) and are summarized in table 6 ( ink density after 50 prints ) and table 7 ( ink density after 250 prints ). tables 6 and 7 show that an etching step followed by an anodization step results in a support having a surface with hydrophilic properties . upon exposure to infrared light , the ink density values increase . the best results are obtained by the “ strongest ” etching condition , i . e ., longest reaction time and highest concentration of h 2 o 2 and naoh ( see inventive printing plate 8 ). when no etching step is carried out ( only an anodization step ), the support has a surface with hydrophobic properties ( ink density value ≧ 1 ; see comparative printing plates 4 and 5 ). after the printjob , printing plate 8 was cleaned by removing the ink from the plate ; the plate cleaner howson normakleen rc910 ( trademark of howson normakleen ) was used . subsequently , the plate was irradiated for 24 hours with a mercury lamp emitting at 254 nm at 0 . 5 mw / cm 2 . after the uv - treatment , half of the plate was irradiated with the ir - laser according to table 5 . after the laser exposure , the plates were immediately mounted on a abdick 360 wet offset printing press . van son 167 ink was used together with a fountain solution of 5 % g671 ( trademark of agfa - gevaert ) in water . a non - compressible rubber blanket was used and the copies were printed on 80 g offset paper . the portion of the plate which was not irradiated with the ir - laser showed at print 50 ink density values varying between 0 . 05 and 0 . 15 . the portion of the plate which was irradiated with the ir - laser showed ink density values of 1 . 0 . the ink density values were measured using a gretag macbeth d19c densitometer ( available from gretag macbeth ). this example shows that flood exposure of the printing plate with uv - light results in a precursor which can be re - used in a next cycle of imaging and printing . while preferred embodiments of the present invention have been described above , it is to be understood that variations and modifications will be apparent to those skilled in the art without departing the scope and spirit of the present invention . the scope of the present invention , therefore , is to be determined solely by the following claims .	2
referring initially to fig1 a wellbore system 10 is illustrated as generally comprising a borehole 12 extending downward into a subterranean formation 14 , implanted radioactive marker bullets ( rmbs ) 16 , stray side rmbs 18 , stray bottom rmbs 20 , stray floating rmb 21 , and a downhole tool assembly 22 . downhole tool assembly 22 is received in borehole 12 and is supported by a cable 24 which extends into borehole 12 and is coupled to surface equipment 26 . cable 24 and surface equipment 26 cooperate to raise and lower tool assembly 22 in borehole 12 . preferably , cable 24 is a wireline which not only physically supports tool assembly 22 , but also includes electrical conductors for carrying power and / or electrical control signals from surface equipment 26 to tool assembly 22 . downhole tool assembly 22 comprises a radioactive marker bullet gun 28 and a magnetic fishing tool 30 . gun 28 is operable to propel radioactive marker bullets ( rmbs ) outward and into subterranean formation 14 . properly implanted rmbs 16 are snugly received in subterranean formation 14 so that any local shifting of subterranean formation 14 causes corresponding shifting of implanted rmbs 16 in that location . although gun 28 is designed to fire radioactive marker bullets into subterranean formation 14 , several factors , such as improper operation of gun 28 and / or extremely high density of subterranean formation 14 , may cause inadequate lodging of the radioactive marker bullets in subterranean formation 14 . such stray rmbs 18 , 20 , 21 may partially lodge in formation 14 ( e . g ., stray side rmb 18 b ), may fall ( e . g ., stray floating rmb 21 ) in borehole 12 and come to rest on a ledge of the sidewall of borehole 12 ( e . g ., stray side rmb 18 a ), or may simply fall to the bottom of borehole 12 ( e . g ., stray bottom rmbs 20 ). magnetic fishing tool 30 is operable to attract and hold stray rmbs 18 , 20 which are relatively loosely positioned in borehole 12 . magnetic fishing tool 30 comprises a first group of side magnets 32 , a second group of side magnets 34 axially spaced from the first group of side magnets 32 , and a group of end magnets 36 . side magnets 32 , 34 face generally outward toward the side walls of borehole 12 so that stray rmbs 18 , 21 can be pulled into contact with and held against the outwardly facing surface of side magnets 32 , 34 by magnetic force . end magnets 36 face generally downward toward the bottom of borehole 12 so that stray bottom rmbs 20 can be pulled into contact with and held against the downwardly facing surface of end magnets 36 by magnetic force . rmbs 16 , 18 , 20 , 21 can be any conventional bullet capable of being coupled to magnets 32 , 24 , 36 of fishing tool 30 by magnetic force . preferably , rmbs 16 , 18 , 20 , 21 include a quantity of a radioactive substance , for example , a pellet of cesium 137 of about 100 - 150 micro - curies . the radioactive substance is preferably encased in a durable , metallic casing ( shaped as a conventional bullet ) which can be attracted to and held in contact with magnets 32 , 24 , 36 of fishing tool 30 . radioactive marker bullet gun 28 can be any conventional radioactive marker bullet gun capable of propelling radioactive marker bullets into subterranean formation 14 . an example of a suitable radioactive marker bullet gun is the “ e - gun ( bullet ) perforating system ” available from baker atlas , houston , tex . another radioactive marker bullet gun which can be modified for use with fishing tool 30 is described in u . s . pat . no . 4 , 916 , 312 ( assigned to schlumberger technology ), the entire disclosure of which is incorporated herein by reference . other suitable radioactive marker bullet gun configurations are well known in the art . referring now to fig2 - 4 , magnetic fishing tool 30 generally comprises an elongated main body 38 extending along a longitudinal axis 39 and three groups of magnets 32 , 34 , 36 coupled to body 38 at specific axial locations . body 38 includes a proximal end 40 adapted to be coupled to a radioactive marker bullet gun and a distal end 42 which normally faces downward when fishing tool 30 is inserted into a borehole . proximal end 40 preferably includes a male threaded member 44 for coupling fishing tool 30 to a normally lower end of a radioactive marker bullet gun . the outer surface of main body 38 includes first , second , and third axially spaced wide outer surfaces 46 , 48 , 50 , first and second axially spaced narrow outer surfaces 52 , 54 , a plurality of tapered axially spaced transition surfaces 56 , a terminal end surface 58 , and a terminal tapered surface 60 . first wide outer surface 46 is located proximate distal end 42 . third wide outer surface 50 is located proximate proximal end 40 . second wide outer surface 48 is axially spaced from and positioned between first and third wide outer surfaces 46 , 50 . first narrow outer surface 52 is axially positioned between first and second wide outer surfaces 46 , 48 . second narrow outer surface 54 is axially positioned between second and third wide outer surfaces 48 , 50 . each transition surface 56 provides a tapered transition between one of narrow outer surfaces 52 , 54 and an adjacent one of wide outer surfaces 46 , 48 , 50 . terminal tapered surface 60 provides a tapered transition between first wide outer surface 46 and terminal end surface 58 . preferably , wide outer surfaces 46 , 48 , 50 and narrow outer surfaces 52 , 54 are substantially cylindrical in shape , transition surfaces 56 and terminal tapered surface 60 are substantially frustoconical in shape , and terminal end surface 58 is substantially flat . first and second groups of side magnets 32 , 34 are coupled to main body 38 proximate first and second narrow outer surfaces 52 , 54 , respectively . end magnets 36 are coupled to main body 38 proximate terminal end surface 58 . preferably magnets 32 , 34 , 36 are embedded in main body 38 by inserting each individual magnet into a respective bore in main body 38 . preferably , magnets 32 , 34 , 36 are generally cylindrical in shape . magnets 32 , 34 , 36 can be fixed to main body 38 by any means known in the art such as , for example , glueing , soldering , or welding . magnets 32 , 34 , 36 can be any magnet ( permanent or electromagnet ) of suitable strength for attracting and holding radioactive marker bullets thereto . magnets 32 , 34 , 36 are preferably permanent magnets , more preferably rare earth permanent magnets , and most preferably samarium cobalt magnets . first and second groups of side magnets 32 , 34 each comprise a plurality of individual magnets which are circumferentially spaced around a respective narrow outer surface 52 , 54 of main body 38 . preferably , each of first and second groups of side magnets 32 , 34 comprises from 3 to 12 individual magnets , more preferably from 4 to 8 individual magnets . the individual magnets in each of first and second groups of side magnets 32 , 34 are preferably substantially symmetrically spaced around longitudinal axis 39 . each magnet in first and second groups of side magnets 32 , 34 presents a substantially flat outwardly - facing side surface 62 . side surfaces 62 preferably face generally radially away from longitudinal axis 39 of main body 38 . preferably , each side surface 62 of each individual magnet in the groups of side magnets 32 , 34 faces in a direction which is within 30 degrees of perpendicular to the direction of extension of longitudinal axis 39 , more preferably within 15 degrees of perpendicular to the direction of extension of longitudinal axis 39 , and most preferably substantially perpendicular to the direction of extension of longitudinal axis 39 . wide outer surfaces 46 , 48 , 50 are preferably substantially cylindrical and have substantially the same width . wide outer surfaces 46 , 48 , 50 are radially spaced from longitudinal axis 39 by a maximum radial distance which is greater than the maximum distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 . it is important for wide outer surfaces 46 , 48 , 50 to extend a greater radial distance from longitudinal axis 39 than side surfaces 62 of side magnets 32 , 34 in order to protect a captured side rmb 64 from being disengaged from ( i . e ., “ scraped off ”) side surface 62 by the sidewall of the borehole when fishing tool 30 is shifted up and down in the borehole . preferably , the maximum radial distance between longitudinal axis 39 and wide outer surfaces 46 , 48 , 50 is at least 10 percent greater than the maximum radial distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 , more preferably at least 20 percent greater , and most preferably at least 40 percent greater . as used herein , the term “ maximum radial distance ” means the maximum distance from a central axis ( e . g ., longitudinal axis 39 ) to any point on a particular surface or group of surfaces , measured perpendicular to the direction of extension of the central axis . the maximum radial distance between longitudinal axis 39 and wide outer surfaces 46 , 48 , 50 is preferably in the range of from about 1 inch to about 6 inches , more preferably in the range of from about 1 . 5 inches to about 4 inches , and most preferably in the range of from 2 inches to 3 inches . narrow outer surfaces 52 , 54 are preferably substantially cylindrical and have substantially the same width . the maximum radial distance between longitudinal axis 39 and narrow outer surfaces 52 , 54 is less than the maximum radial distance between longitudinal axis 39 and wide outer surfaces 46 , 48 , 50 . the maximum radial distance between longitudinal axis 39 and narrow outer surfaces 52 , 54 can be less than the maximum radial distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 ( i . e ., when side surfaces 62 of side magnets 32 , 34 are slightly raised from narrow outer surfaces 52 , 54 ). alternatively , the maximum radial distance between longitudinal axis 39 and narrow outer surfaces 52 , 54 and the maximum radial distance between longitudinal axis 39 and side surfaces 62 of side magnets 32 , 34 is substantially the same ( i . e ., when side surfaces 62 of side magnets 32 , 34 are substantially flush with narrow outer surfaces 52 , 54 ). group of end magnets 36 comprises a plurality of spaced - apart individual magnets . preferably , group of end magnets 36 comprises from 1 to 8 individual magnets , more preferably from 2 to 6 individual magnets , and most preferably 3 individual magnets . each end magnet 36 presents a substantially flat downwardly - facing bottom surface 66 . bottom surfaces 66 preferably face generally axially away from main body 38 in a direction which is within 30 degrees of parallel to the direction of extension of longitudinal axis 39 , more preferably within 15 degrees of parallel to the direction of extension of longitudinal axis 39 , and most preferably substantially parallel to the direction of extension of longitudinal axis 39 . the direction in which bottom surfaces 66 of end magnets 36 face and the direction in which each side surface 62 of side magnets 32 , 34 face are preferably within 30 degrees of perpendicular to one another , more preferably within 15 degrees to perpendicular to one another , and most preferably substantially perpendicular to one another . side surfaces 62 of side magnets 32 , 34 and bottom surfaces 66 of end magnets 36 are preferably exposed ( i . e ., uncovered ) so that radioactive marker bullets located away from side and bottom surfaces 62 , 66 can be pulled directly into contact with and held against side and bottom surfaces 62 , 66 by magnetic force . referring again to fig1 in operation , downhole tool assembly 22 can be assembled by coupling magnetic fishing tool 30 to a normally lower end of radioactive marker bullet gun 28 . a normally upper end of radioactive marker bullet gun 28 can then be coupled to cable 24 . downhole tool assembly 22 can then be lowered into borehole 12 . once in borehole 12 , radioactive marker bullets ( rmbs ) can be propelled outwardly from gun 28 into subterranean formation 14 . stray rmbs 18 , 20 , 21 fired from gun 28 but not properly lodged in subterranean formation 14 may fall downward from gun 28 and towards magnetic fishing tool 30 . as these stray rmbs ( e . g ., stray floating rmb 21 ) fall past fishing tool 30 , they may become attracted by and coupled to side magnets 32 , 34 of fishing tool 30 . some of the stray rmbs ( e . g ., stray side rmb 18 a ) may fall past magnetic fishing tool 30 and come to rest on ledges of the sidewall of borehole 12 . other of the stray rmbs ( e . g ., stray bottom rmbs 20 ) may fall to the bottom of borehole 12 . stray rmbs 18 , 21 can be pulled into contact with and coupled to side magnets 32 , 34 of fishing tool 30 when fishing tool 30 is passed by and / or contacted with stray side rmbs 18 . stray bottom rmbs 20 can be pulled into contact with and coupled to end magnets 36 when fishing tool 30 is lowered to the bottom of borehole 12 . when downhole tool assembly 22 is removed from borehole 12 , the stray rmbs coupled to magnets 32 , 34 , 36 of magnetic fishing tool 30 are removed therewith . thus , downhole tool 22 allows implanted rmbs 16 to be fired into subterranean formation 14 and stray rmbs 18 , 20 , 21 to be retrieved from borehole 12 during a single run of downhole tool assembly 22 in borehole 12 . the preferred forms of the invention described above are to be used as illustration only , and should not be utilized in a limiting sense to interpret the scope of the present invention . obvious modifications to the exemplary embodiments , set forth above could be readily made by those skilled in the art without departing from the spirit of the present invention . the inventor hereby states his intent to rely on the doctrine of equivalence to determine and assess the reasonably fair scope of the present invention as pertains to any apparatus not materially departing from , but outside the literal scope of the invention as set forth in the following claims .	4
throughout the drawings , the same reference numerals are used to denote the same features . fig1 is an schematic , top plan view of the present invention . in this view , the plane of the door to which the invention is mounted is in the plane of the paper . in this version of the invention , the housing 12 of the device is a slipcover , which is placed over the latch handle of an existing deadbolt door lock . the slipcover is preferably constructed of metal or metalized plastic and is dimensioned and configured to be slightly larger than the existing latch . alternatively , the slip cover may be constructed from a flexible or elastic material so that the slipcover will fit snugly over the handle without any loose edges . the slipcover has an outside surface and an inside surface ; see fig4 . the inside surface of the slipcover is next to the door and has an opening to receive the existing deadbolt latch handle . fig1 and 2 illustrate that the outside surface has a visible signal 14 incorporated into the slip cover . as noted earlier , the signal 14 may be any type of signal , without limitation , that is dimensioned and configured to toggle between an “ on ” position and an “ off ” position . a light - emitting diode ( led ) is preferred , but a small light bulb or lcd may also be used . the signal is preferably positioned distally from the rotational axis of the deadbolt latch handle . this is simply the preferred embodiment . the signal 14 may be disposed at any point on the surface of housing 12 . the signal is attached to circuitry 16 securely contained within the slipcover . the circuitry operationally connects the signal 14 to a switch 18 for turning the signal on and off , at least one battery 20 to power the signal , and an optional timer 22 . in the preferred version of the invention , the circuitry is configured so that the battery supplies power through the optional timer 22 to the signal 14 when the deadbolt is in the locked position . a switch 18 responsive to the rotation of the latch handle controls the power supply from the battery 20 to the timer 22 . when the deadbolt is locked , the switch is closed , and power flows from the battery , through the timer , and into the signal , thus turning it on . when the deadbolt is unlocked , the switch is opened , and the signal is turned off . thus , the switch is activated when the latch handle is thrown to engage the deadbolt , which locks the door . in the preferred embodiment , the switch 18 is a simple , pressure activated switch that responds to the rotational movement of the latch handle . simple rotary switches are well known . any other type of switch that is responsive to the rotation of the deadbolt latch handle may also be used , for example a magnetic switch , a mercury - type gravity switch , a gyroscopically - activated switch , a reed switch , etc . as noted earlier , the invention may be configured in the form of a slip cover that fits over the latch of an existing deadbolt lockset . another version of the invention is a replacement latch handle which attaches to an existing deadbolt lockset . the latch handle contains the signal and circuitry noted earlier . in this version of the invention , the conventional latch handle on an existing deadbolt lockset is removed , and a latch handle according to the present invention is inserted in its place . alternatively , an original equipment manufacturer deadbolt latch set may be manufactured that includes the present invention directly incorporated into the latch . fig4 is a perspective , exploded rendering of a preferred version of the present invention . the back side of the housing is visible , as is frame 40 on which is anchored the batteries 20 , circuitry 16 ( in the form of an integrated chip ) and signal 15 ( depicted as an led ). fig5 a is a top plan view of the invention depicted in fig4 , and fig5 b is a vertical cross - section along line c - c of fig5 a . as can be best in fig5 b , the frame 40 and its associated components , fits snugly within the housing 12 . the led 14 is then visible through an aperture 14 ′ ( see fig6 c ) in the housing 12 . the frame 40 can be adhered within the frame by any mechanism known in the art , including friction , glue , solder , fasteners of any sort , etc . detailed views of the housing in isolation are provided in fig6 a , 6 b , 6 c , 6 d , 6 e . fig6 c is the top plan view of the housing ; fig6 a is a cross - section through line a - a ; fig6 b is a cross - section through line b - b ; fig6 d is a left - side , vertical cross - section of fig6 c ; fig6 e is a rear elevation view of fig6 c . preferred dimensions ( in inches ) are provided . these dimensions are provided solely for purposes of illustration and are not limiting in any fashion . fig7 is a perspective rendering of the circuitry , batteries , and led that are carried on frame 40 , which is ultimately contained within the housing . the frame 40 can be fabricated from any suitably stiff or semi - flexible material , typically plastic . the frame may also be a printed circuit board , in which case the required circuitry would be incorporated directly into frame 40 itself . a micro - chip 16 is provided to activate and deactivate signal 14 in response to the position of the housing . the position of the housing is sensed by reed switch 18 , which activates and deactivate the signal 14 in response to the position of the housing in which the frame is disposed . batteries 20 are depicted within corresponding brackets 41 to hold them in place . fig8 is a circuit diagram illustrating how the led 14 is energized by batteries 20 in response to motion of the handle body . the circuit is opened or closed via switches sw 1 ( right side ) and sw 2 ( left side ) in response to the position of the housing . the two arms of the reed valve 18 serve to open and close the circuit in response to the left or right orientation of the deadbolt lock to which the housing is attached . a microchip 16 ′, such as a pic10f206 , may be used to control the status of the led . the pic10f206 is a low - cost , high - performance , 8 - bit , fully static , flash - based cmos microcontroller . it employs a risc architecture with only 33 single - word / single - cycle instructions . all instructions are single cycle ( 1 μs ) except for program branches , which take two cycles . it is a preferred chip because of its easy - to - use and easy to remember instruction set reduces development time significantly . a host of other functionally equivalent microcontrollers may also be used . they can be obtained from a very large number of international suppliers , such as microchip technology inc ., chandler , ariz . it is understood that the invention is not confined to the particular construction and arrangement of parts herein illustrated and described , but embraces such modified forms thereof as come within the scope of the following claims .	4
the catalystic cracking processes of this invention are those employing zeolitic - containing catalysts wherein the concentration of the zeolite is in the range of 6 to 40 weight percent of the catalyst composite and which have a tendency to be deactivated by the deposition thereon of metal contaminants as previously described , to the extent that optimum gasoline product yields are no longer obtained . the inventive process is effective in processes employing cracking catalyst compositions which contain at least 1 , 500 ppm nickel equivalent metal contaminants and is generally applicable to processes wherein the cracking catalyst can contain up to 5 , 000 ppm nickel equivalent metal contaminants . the cracking catalyst compositions of the process of this invention include those which comprise a crystalline aluminosilicate dispersed in a refractory metal oxide matrix such as disclosed in u . s . pat . nos . 3 , 140 , 249 and 3 , 140 , 253 to c . j . plank and e . j . rosinski . suitable matrix materials comprise inorganic oxides such as amorphous and semi - crystalline silica - aluminas , silica - magnesias , silica - alumina - magnesia , alumina , titania , zirconia , and mixtures thereof . zeolites or molecular sieves having cracking activity and suitable in the preparation of the catalysts of this invention are crystalline , three - dimensional , stable structures containing a large number of uniform openings or cavities interconnected by smaller , relatively uniform holes or channels . the formula for the zeolites can be represented as follows : where m is a metal cation and n its valence ; x varies from 0 to 1 ; and y is a function of the degree of dehydration and varies from 0 to 9 . m is preferably a rare earth metal cation such as lanthanum , cerium , praseodymium , neodymium or mixtures thereof . zeolites which can be employed in the practice of this invention include both natural and synthetic zeolites . these natural occurring zeolites include gmelinite , chabazite , dachiardite , clinoptilolite , faujasite , heulandite , analcite , levynite , erionite , sodalite , cancrinite , nepheline lazurite , scolecite , natrolite , offretite , mesolite , mordenite , brewsterite , ferrierite , and the like . suitable synthetic zeolites which can be employed in the inventive process include zeolites x , y , a , l , zk - 4 b , e , f , h , j , m , q , t , w , z , alpha and beta , zsm - types and omega . the effective pore size of synthetic zeolites are suitable between 6 and 15 a in diameter . the term &# 34 ; zeolites &# 34 ; as used herein contemplates not only aluminosilicates but substances in which the aluminum are replaced by gallium and substances in which the silicon is replaced by germanium . the preferred zeolites are the synthetic faujasites of the types y and x or mixtures thereof . it is also well known in the art that to obtain good cracking activity the zeolites must be in good cracking form . in most cases this involves reducing the alkali metal content of the zeolite to as low a level as possible as a high alkali metal content reduces the thermal structural stability , and the effective lifetime of the catalyst is impaired . procedures for removing alkali metals and putting the zeolite in the proper form are well known in the art and are as described in u . s . pat . no . 3 , 547 , 816 . conventional methods can be employed to form the catalyst composite . for example , finely divided zeolite can be admixed with the finely divided matrix material , and the mixture spray dried to form the catalyst composite . other suitable methods of dispersing the zeolite materials in the matrix materials are described in u . s . pat . nos . 3 , 271 , 418 ; 3 , 717 , 587 ; 3 , 657 , 154 ; and 3 , 676 , 330 whose descriptions are incorporated herein by reference thereto . in addition to the zeolitic - containing cracking catalyst compositions heretofore described , other materials useful in preparing the tin - containing catalysts of this invention also include the laminer 2 : 1 layer - lattice aluminosilicate materials described in u . s . pat . no . 3 , 852 , 405 . the preparation of such materials is described in the said patent and the disclosure therein is incorporated in this application by reference thereto . when employed in the preparation of the catalysts of this invention , such laminar 2 : 1 layer - lattice aluminosilicate materials are combined with a zeolitic composition . the cracking catalyst compositions of this invention also contain a concentration of tin of at least 2 , 000 ppm . the concentration of tin in the catalyst composite will normally range from 0 . 2 to 2 . 5 weight percent of the catalyst composite . the tin can be added to the fresh cracking catalyst by impregnation , employing a tin compound which is either the oxide or which is convertible to the oxide upon subjecting the catalyst composite to a calcination step . for example , a compound selected from the group consisting of tetraphenyl tin , hexabutyl tin , and tetraethyl tin can be added to a hydrocarbon solvent such as benzene and the catalyst composition contacted with the hydrocarbon solvent containing the selected tin compound so as to prepare , after drying and calcination , a final catalyst composition containing a concentration of tin as defined above . when the tin compound employed in preparing the catalyst composite is selected from the group consisting of tin chloride , tin bromide , and tin sulfate , the compound can be dissolved in water and the catalyst composition contacted with the water solution so as to prepare , after drying and calcination , a final catalyst composition containing the desired concentration of tin . another method of adding the tin to the catalyst composite is by the addition of tin to an inorganic oxide gel . the preparation of plural gels is well known in the art and generally involves either separate precipitation or coprecipitation in which a suitable salt of the tin oxide is added to an alkali metal silicate and an acid or base , as required , is added to precipitate the corresponding oxide . the inorganic oxide gel as prepared and containing the tin can then be combined with the aluminosilicate by methods well known in the art . another suitable method of adding the tin to the zeolite - containing catalyst composite is by a conventional ion exchange method . an alternative method of compositing the tin with the zeolite - containing cracking catalyst is to introduce a tin compound , such as previously descried , into the hydrocarbon feed to the catalytic cracking zone until the concentration of the tin on the catalyst is at least 2 , 000 ppm . generally , the rate of introduction of the tin compound in the hydrocarbon feed to the cracking zone will be such that the concentration of the tin compound will range from about 3 ppm to 3 , 000 ppm , preferably from 100 to 500 ppm in the hydrocarbon feed . contacting the catalyst containing contaminating metals with the tin compound can conveniently comprise dispersing the tin compound into the hydrocarbon feed employing a suitable liquid solvent or dispersing agent . following the compositing of the tin with the zeolite - containing catalyst , the catalyst can be further treated according to conventional methods such as heating the catalyst to elevated temperatures , generally in the range of about 800 ° to about 1 , 600 ° f . ( 427 ° to 870 ° c .) for a period of time ranging from 3 to 30 minutes in the presence of a free oxygen - containing gas . this further treatment which is effected in the catalyst regeneration step when the tin compound is introduced into the cracking zone hydrocarbon feed , results in the treating agent , if not presently in the form of the oxide , being converted to the oxide . the catalyst compositions of this invention are employed in the cracking of charge stocks , in the absence of added hydrogen , to produce gasoline and light distillate fractions from heavier hydrocarbon feed stocks . the charge stocks generally are those having an average boiling temperature above 600 ° f . ( 316 ° c .) and include materials such as gas oils , cycle oils , residuums and the like . as previously described , conventional catalytic cracking charge stocks contain less than 1 . 5 ppm nickel equivalents as metal contaminants . the charge stocks employed in the process of this invention can contain significantly higher concentrations of metal contaminants as the tin - containing catalysts are effective in catalytic cracking processes operated at metal contaminant levers exceeding 1 , 500 ppm nickel equivalents . the process employing the tin - containing catalysts is also effective at metal contaminant levels exceeding 2 , 500 ppm nickel equivalents and even exceeding 5 , 000 ppm nickel equivalents . thus , the charge stocks to the catalytic cracking process of this invention can contain metal contaminants in the range up to 3 . 5 ppm and higher nickel equivalents . although not to be limited thereto , a preferred method of employing the catalysts of this invention is by fluid catalytic cracking using riser outlet temperatures between about 900 ° to 1 , 100 ° f . ( 482 ° to 593 ° c ). the invention will hereafter be described as it relates to a fluid catalytic cracking process although those skilled in the art will readily recognize that the invention is equally applicable to those catalytic cracking processes employing a fixed catalyst bed and conventional operating conditions of temperature , pressure , and space velocity . under fluid catalytic cracking conditions the cracking occurs in the presence of a fluidized composited catalyst in an elongated reactor tube commonly referred to as a riser . generally , the riser has a length to diameter ratio of about 20 . the charge stock is passed through a preheater which heats the feed to a temperature of about 600 ° f . ( 316 ° c .) and the heated feed is then charged into the bottom of the riser . in operation , a contact time ( based on feed ) of up to 15 seconds and catalyst to oil weight ratios of about 4 : 1 to about 15 : 1 are employed . steam can be introduced into the oil inlet line to the riser and / or introduced independently to the bottom of the riser so as to assist in carrying regenerated catalyst upwardly through the riser . regenerated catalyst at temperatures generally between about 1 , 100 ° and 1 , 350 ° f . ( 593 ° to 732 ° c .) is introduced into the bottom of the riser . the riser system at a pressure in the range of about 5 to about 50 psig (. 35 to 3 . 50 kg / cm 2 ) is normally operated with catalyst and hydrocarbon feed flowing concurrently into and upwardly into the riser at about the same flow velocity , thereby avoiding any significant slippage of catalyst relative to hydrocarbon in the riser and avoiding formation of a catalyst bed in the reaction flow stream . in this manner the catalyst to oil ratio thus increases significantly from the riser inlet along the reaction flow stream . the riser temperature drops along the riser length due to heating and vaporization of the feed by the slightly endothermic nature of the cracking reaction and heat loss to the atmosphere . as nearly all the cracking occurs within one or two seconds , it is necessary that feed vaporization occurs nearly instantaneously upon contact of feed and regenerated catalyst at the bottom of the riser . therefore , at the riser inlet , the hot , regenerated catalyst and preheated feed , generally together with a mixing agent such as steam , ( as hereto described ) nitrogen , methane , ethane or other light gas , are intimately admixed to achieve an equilibrium temperature nearly instantaneously . the catalyst containing metal contaminants and carbon is separated from the hydrocarbon product effluent withdrawn from the reactor and passed to a regenerator . in the regenerator the catalyst is heated to a temperature in the range of about 800 ° to about 1600 ° f . ( 427 ° to 871 ° c . ), preferably 1160 ° to 1260 ° f . ( 627 ° to 682 ° c . ), for a period of time ranging from three to thirty minutes in the presence of a free - oxygen containing gas . this burning step is conducted so as to reduce the concentration of the carbon on the catalyst to less than 0 . 3 weight percent by conversion of the carbon to carbon monoxide and carbon dioxide . conventional processes can operate with catalysts containing contaminated metals concentrations greater than 1000 ppm nickel equivalents but at a substantial loss of product distribution and conversion . further , under such conditions undesirably high concentrations of coke , hydrogen and light gas are produced . by employing the defined catalyst in the manner of this invention , the contaminant metals level on the catalyst can exceed 2500 ppm nickel equivalents while obtaining a conversion and gasoline yield normally effected by conventional catalysts containing only 500 ppm nickel equivalent metal contaminants . gasoline yield is not significantly reduced as metals contaminant levels increase up to 5 , 000 ppm nickel equivalents . although hydrogen yields increase with increasing metal contamination above 1500 ppm , the rate of increase is substantially less than that normally obtained in conventional hydrocarbon cracking processes . thus , by this invention the cracking process can be operated efficiently with a metal contaminant concentration level on the catalyst up to at least 5000 ppm nickel equivalents . as previously indicated , the process of this invention has a significant advantage over conventional catalytic cracking processes by providing an economically attractive method to include higher metals - containing gas oils as a feed to the catalytic cracking process . because of the loss of selectivity to high value products ( loss of conversion and yield of gasoline , and gain in coke and light gases ) with the increase in metals contamination on conventional cracking catalysts , most refiners attempt to maintain a low metals level on the cracking catalyst -- less than 1000 ppm . an unsatisfactory method of controlling metals contamination in addition to those previously discussed is to increase the catalyst makeup rate to a level higher than that required to maintain activity or to satisfy unit losses . the following examples are presented to illustrate objects and advantages of the invention . however , it is not intended that the invention should be limited to the specific embodiments presented therein . in the catalytic cracking run , conducted in the absence of added hydrogen , of this example , a kuwait gas oil feed stock having a boiling range of 500 ° f . ( 260 ° c .) to 800 ° f . ( 427 ° c .) was employed . the catalyst employed was a crystalline aluminosilicate dispersed in a refractory oxide matrix wherein the concentration of the zeolite was in the range of 30 - 40 weight percent . the physical characteristics and chemical composition of the catalyst containing 0 . 25 weight percent nickel and 0 . 035 weight percent vanadium for a total of 2 , 570 ppm nickel equivalents as metal contaminants was as follows : ______________________________________ after heating in the presence of oxygen forphysical characteristics : 3 hours at 552 ° c . ______________________________________ surface area : m . sup . 2 / g 193 pore volume : cc / g 0 . 222 apparent bulk density : kg / dm . sup . 3 0 . 716 volatile content : 2 hrs . at 1500 ° f . 12 . 3 % particle size distribution 0 - 20 microns 3 . 0 20 - 40 microns 12 . 8 40 - 80 microns 52 . 7 & gt ; 80 microns 31 . 5chemical composition : wt . % iron ( fe . sub . 2 o . sub . 3 ) 0 . 543 nickel ( ni ) 0 . 25 vanadium ( v ) 0 . 035 sodium ( na ) 0 . 62 alumina ( al . sub . 2 o . sub . 3 ) 42 . 15 cerium ( ce ) 0 . 19______________________________________ the catalytic cracking run of this example was conducted employing a fixed catalyst bed , a temperature of 900 ° f . ( 482 ° c . ), a weight hourly space velocity of 15 , and a contact time of 80 . 5 seconds . the results obtained in this run ( run no . 1 ) were a conversion of 56 . 2 volume percent of the feed , a c 5 + gasoline production of 36 . 0 volume percent of the feed , a production of 5 . 47 weight percent carbon on the catalyst and a hydrogen yield of 0 . 44 weight percent of the feed . in this example the effectiveness of employing a cracking catalyst when processing the kuwait gas oil of example i is demonstrated . in run no . 2 the catalyst composition of example i containing 2 , 570 ppm nickel equivalents as metal contaminants was impregnated with hexabutyl tin to obtain a catalyst composite containing 0 . 61 weight percent tin . in run no . 3 the fresh catalyst composition of example i was impregnated with tin chloride to obtain a catalyst composite containing 0 . 61 weight percent tin and the catalyst thereafter contaminated with 2 , 570 ppm nickel equivalents as metal contaminants . the cracking conditions employed in each of runs 2 and 3 were the same as those employed in run no . 1 of example i . the results obtained in each of the runs , together with the results otained in run no . 1 , are shown below in table i . table i______________________________________ c . sub . 5 . sup .+ conversion gasoline carbon hydrogenrun vol % vol % wt % wt % no . of feed of feed of feed of feed______________________________________1 56 . 2 36 . 0 5 . 47 . 442 60 . 3 40 . 1 5 . 06 . 283 63 . 9 42 . 6 4 . 58 . 28______________________________________ a comparison of the results obtained demonstrates the effectiveness of the catalyst composition containing tin to obtain significant improvement in the conversion and in c 5 + gasoline produced when operating with metal contaminants on the catalyst equal to 2 , 570 ppm nickel equivalents . also , the effectiveness of a tin - containing catalyst to significantly reduce the production of carbon and hydrogen is demonstrated . although the invention has been described with references to specific embodiments , references , and details , various modifications and changes will be apparent to one skilled in the art and are contemplated to be embraced in this invention .	2
the present disclosure provides an online shopping system and method which increases the conversion rate of an e - commerce website by reducing the incidence of shopping cart abandonment , which is now described in detail with reference to the figures . it is to be understood and appreciated the herein description is meant to illustrate , and not limit , the scope of the present disclosure . as used throughout this disclosure , the term “ product ” is to be construed to mean a deliverable product ( i . e ., physical product , downloadable media , and the like ) except when used in an arithmetical context whereupon “ product ” is to be construed to have its ordinary meaning ( i . e ., the result of an arithmetic multiplication ). as used throughout this disclosure , the term “ item ” is to be construed to mean a symbolic representation of product ( i . e ., a database entry of corresponding to a product or a representation of the product in a shopping cart ). fig1 illustrates an exemplary e - commerce server 10 embodying aspects of the present disclosure . the e - commerce server 10 includes at least one processor 25 that is operatively coupled , by system bus or other suitable means , to storage device 15 , memory 20 , and communications interface 30 . communications interface 30 is operatively coupled to consumer access devices , which may include without limitation a personal computer 65 and / or wireless device 70 , via a data network 60 , such as the internet , as is well - known in the art . in an embodiment , communications interface 30 may be a wired network interface such as a 100base - t fast ethernet interface , or a wireless network interface such as a wireless network interface compliant with the ieee 802 . 11 (“ wifi ”) standard . e - commerce server 10 may include a merchant item database ( not shown ) for storing data related to the items the merchant may offer for sale , a consumer favorite products list ( not shown ), and / or a record of a consumer &# 39 ; s purchase history . e - commerce server 10 may also provide an online shopping cart for enabling a consumer to select items for purchase , as is well - known . e - commerce server 10 further includes a filler item processing module 50 having at least one of software , firmware and hardware for evaluating the value of items in a shopping cart and suggesting filler items in accordance with the present disclosure . in one embodiment , the filler item processing module 50 includes a shopping cart filler item module 100 , a checkout filler item module 200 , and a filler item identification module 300 . shopping cart filler item module 100 includes a software program having a set of programmable instructions configured for execution by the at least one processor 25 of the e - commerce server 100 for presenting filler items to a consumer when the shopping cart is modified , i . e ., at least one item is added , changed , or deleted from the shopping cart . checkout filler item module 200 includes a software program having a set of programmable instructions configured for execution by the at least one processor 25 of the e - commerce server 100 for presenting filler items and / or alternative offers to a consumer during the checkout process . filler item identification module 300 includes a software program having a set of programmable instructions configured for execution by the at least one processor 25 of the e - commerce server 100 for identifying filler items that may be offered to a consumer . in an envisioned embodiment of present disclosure , the filler item processing module 50 implementing the algorithms disclosed herein is contained within a software extension component , such as a script , macro , dynamic link library ( dll ), plug - in or snap - in , that extends the capabilities of a website e - commerce module 140 , such as without limitation , microsoft commerce server ™, adobe coldfusion ™, or apache or other web server in an e - commerce configuration . in another embodiment contemplated by the present disclosure , filler item processing module 50 implementing the algorithms disclosed herein is incorporated within the website e - commerce module 140 . with reference to fig2 , an embodiment of the shopping cart filler item module 100 is presented in accordance with the present disclosure . it is to be understood that the labels and symbols used throughout this disclosure are illustrative in nature , and are not to be construed as limiting the scope of the present disclosure . in the step 110 the consumer browses , or “ shops ” the merchant site , to select item ( s ) for purchase . upon selection the items may be added to the shopping cart in the step 115 . alternatively , in the step 115 an existing item in the shopping cart may be modified , i . e ., the desired quantity may be changed , or an existing item in the shopping cart may be deleted . the product of the unit price and corresponding quantity of each item is summed in the step 120 to cumulatively compute the order subtotal . in the step 125 the order subtotal is compared to the promotional threshold amount . if the promotional threshold has been reached , i . e ., the order total is equal to or greater than the promotional threshold , the shopping cart filler item module 100 processing is concluded and the consumer is returned to the browsing state 110 . however , if the promotional threshold has not been reached , the step 130 is performed wherein filler items are identified by the filler item identification module 300 , as will be described in detail hereinbelow . if no filler items are identified , the shopping cart filler item module 100 processing is concluded and the consumer is returned to the browsing state 10 . however , if filler items have been found , the step 140 is performed wherein the filler items are presented to the consumer for purchase . in the step 145 it is determined whether the consumer has chosen a filler items . if no item was selected , the consumer is returned to the browsing state 110 . if an item was selected , the item is added to the shopping cart in the step 150 and the consumer is returned to the browsing state 10 . turning now to fig3 , an embodiment of the checkout filler item module 200 is presented in accordance with the present disclosure . in the step 210 the consumer may browse or “ shop ” the merchant and ultimately in the step 215 proceed to checkout . the product of the unit price and corresponding quantity of each item is summed in the step 220 to cumulatively compute the order subtotal . in the step 225 the order subtotal is compared to the promotional threshold amount . if the promotional threshold has been reached , i . e ., the order total is equal to or greater than the promotional threshold , the checkout filler item module 200 processing is concluded and the checkout process continues , i . e ., the consumer may supply to the merchant site shipping , billing and other necessary information to complete the transaction . however , if the promotional threshold has not been reached , the step 228 is performed wherein filler items are identified by the filler item identification module 300 , as will be described in detail hereinbelow . if no filler items are identified , the step 250 is performed wherein an alternative offer is presented to the consumer , for example , reduced cost shipping . in the step 255 it is determined whether the consumer has accepted the order . if the consumer rejected the alternative offer , the checkout filler item module 200 processing is concluded and the checkout process continues . conversely , if the consumer accepted the alternative offer , the alternative offer is applied to the shopping cart in the step 260 , and thereafter checkout filler item module 200 concludes and checkout continues . if , however , filler items are identified , the step 235 is performed wherein the filler items are presented to the consumer for purchase . in the step 240 it is determined whether the consumer has chosen a filler items . if no item was chosen , checkout filler item module 200 processing concludes and checkout continues . if an item was chosen , the item is added to the shopping cart in the step 245 , and checkout filler item module 200 processing concludes and checkout continues . in another envisioned embodiment , only certain items corresponding to a predetermined criteria , i . e ., only items from a particular manufacturer or of a particular type , are considered in an order subtotal calculation . in this manner , a promotion such as “ buy one hundred dollars worth of xerox toner and receive free shipping ” could be achieved . referring now to fig4 , the filler item identification module 300 is described . in the step 305 , a qualification amount needed to qualify the consumer &# 39 ; s order is computed by subtracting the order subtotal ( previously described ) from the promotional threshold amount . in the step 310 , the consumer &# 39 ; s favorite product list may be examined to identify which , if any , of the consumer &# 39 ; s favorite products have a price that equals or exceeds the qualification amount . the list may be examined any suitable means , including without limitation a database query , an indexed lookup , or a sequential search . in the step 315 it is determined whether any filler items were identified in the consumer &# 39 ; s favorite product list and if so , the filler items are processed for presentation to the consumer . in an embodiment , the identified filler items are caused to be conveyed to a calling module ( i . e ., the module which requested identification of filler items ) such as a shopping cart filler item module 100 or checkout filler item module 200 . having successfully identified filler items in the consumer &# 39 ; s favorite product list , the filler item identification module 300 concludes ( step 350 ). if no filler items were identified in the consumer &# 39 ; s favorite product list , the step 320 is performed wherein a consumer &# 39 ; s purchase history may be examined to correlate types of items the consumer has purchased in the past with items in a merchant item database ( i . e . items which are offered for sale by the merchant ). in an embodiment , the consumer &# 39 ; s purchase history may include the items currently in the consumer &# 39 ; s shopping cart . those items in the merchant item database which are similar to items in the customer &# 39 ; s purchase history are identified as potential filler items . as an example only , purchase history items may be correlated to merchant database items on any of merchandise class , department , color , style , size , technology , artist , brand , and / or manufacturer . any potential filler items thus identified are then further examined to determine which , if any , potential filler items having a price that equals or exceeds the qualification amount . those items which have a price equaling or exceeding the qualification amount are identified as filler items . in the step 325 it is determined whether any filler items were identified and if so , the filler items are processed for presentation to the consumer as previously described herein , and the filler item identification module 300 concludes ( step 350 ). if no filler items were identified which correlate to the consumer &# 39 ; s purchasing history , the step 330 is performed wherein a merchant database may be examined to identify which , if any , of the items which are offered for sale by the merchant have a price that equals or exceeds the qualification amount . in an embodiment , the identified merchant database items may be ranked in accordance with a predetermined priority , such as items currently “ on sale ” ( i . e ., currently offered at a reduced price ), overstock items , slow moving inventory , and / or clearance items . higher - ranked items may then be presented to the consumer before lower - ranked items . the ranking order may be determined by the merchant to , for example , help achieve the merchant &# 39 ; s business objectives ( i . e ., reduce inventory on slow moving or overstock items , promotes particular brands , and the like ). in the step 335 it is determined whether any filler items were identified and if so , the filler items are processed for presentation to the consumer as previously described herein , and the filler item identification module 300 concludes ( step 350 ). otherwise , no filler items could be identified by the filler item identification module 300 . in an embodiment , the fact that no filler items were identified is caused to be conveyed to a calling module ( i . e ., the module which requested identification of filler items ) such as a shopping cart filler item module 100 or checkout filler item module 200 . filler item identification module 300 then concludes ( step 350 ). other methods of identifying filler items are contemplated with the scope of the present disclosure , for example , choosing a filler item from a list of at least one predetermined filler item . in fig5 and 6 there is shown exemplary web pages illustrating a shopping cart presentation of filler items to the consumer , and the shopping cart after the consumer has selected a filler item , respectively . in fig4 the consumer has previously added the items 410 to the cart , having a subtotal 420 . filler items 450 a - d are presented to the consumer in accordance with the method disclosed herein . the consumer may select a filler item 450 a - d by causing to be activated a corresponding “ add to cart ” button 455 a - d . alternatively , the consumer may choose to view additional or alternative filler items by causing to be activated a “ suggest more items ” button 440 . alternatively , the consumer may choose to keep shopping the merchant site by causing to be activated a “ keep shopping ” button 430 , or , continue to checkout by causing to be activated a “ continue checkout ” button 435 . in fig6 , the consumer has selected filler item 450 a which has been added to the cart 510 having a subtotal 520 . the consumer may choose to keep shopping the merchant site by causing to be activated a “ keep shopping ” button 530 , or , continue to checkout by causing to be activated a “ continue checkout ” button 535 . it will be appreciated that various of the above - disclosed and other features and functions , or alternatives thereof , may be desirably combined into many other different systems or applications . various presently unforeseen or unanticipated alternatives , modifications , variations or improvements therein may be subsequently made by those skilled in the art which are also intended to be encompassed by the following claims . the claims can encompass embodiments in hardware , software , or a combination thereof .	6
the present disclosure is directed to lens - to - camera mount adapters that permit both tilting and shifting , and more specifically is directed to such adapters suitable for use with short flange distance mirrorless cameras coupled with conventional long - working distance lenses designed for slr type cameras . the lens - to camera mount adapter disclosed herein is referred to as a “ tilt shift adapter ” or just “ adapter ” for short . the combination of a tilt shift adapter and at least one of a lens and a camera is called an “ assembly ” and is identified by reference number 4 . with reference to fig1 , 7 , 10 and 13 , an exemplary adapter 10 is shown as part of an assembly 4 . adapter 10 includes a first body portion 11 with a first side 11 a configured to operably engage a camera 300 and a second body portion 12 with a second side 12 a configured to operably engage a lens 200 . an aperture 16 in body portions 11 and 12 allows the passage of light from lens 200 attached to the second side 12 a to camera 300 attached to the first side 11 a . an example adapter 10 has a rounded top 13 with generally parallel edges 22 when viewed face on . first and second body portions are engaged so that they can move relatively to one another to create a tilt and a shift relative to first side 11 a and second side 12 ( i . e ., between the first and second sides ). as described below , the amount of tilting and the amount of shifting can be precisely controlled by tilt adjustment screws 109 and shift adjustment screws 108 . example first and second sides 11 a and 12 a are respectively configured with standard camera - engaging and lens - engaging devices 124 and 115 respectively , as is used in the art . an exemplary engagement device is a bayonet mount . threads can also be used . the exact size and shape of the aperture 16 depends on the requirements and specifications of the engagement devices 124 and 115 , respectively . the first and second sides 11 a and 12 a include respective first and second flanges 124 and 115 that respectively engage camera and lens flanges of camera 300 and lens 200 being operably coupled to the adapter . the first and second flanges 124 and 115 are also called the camera flange and the lens flange , respectively . the first and second flanges 124 and 115 can be tilted and shifted with respect to one another by tilting and shifting the first and second body portions 11 and 12 , respectively . the tilting and shifting motions are constrained by cylindrical and planar dovetail bearings 117 and 110 . in both cases , play in the dovetail bearings 117 and 110 is eliminated by tilt movement adjustment screws 109 and shift movement adjustment screws 108 , respectively . adjustment screws 108 and 109 are tipped with slide adjustment bearing material 145 to provide a smooth sliding friction . the tilt and shift dovetail bearings 117 and 110 are independent from each other , meaning that the tilting and shifting motions can be carried out either separately or in combination . both the tilt and shift motions are precisely controlled by the aforementioned precision tilting and shifting mechanisms that include in an example corresponding leadscrews 131 and 126 , respectively , tipped with ergonomic knobs 105 and 106 , respectively . the precision tilting and shifting mechanisms can be used to precisely set select amounts of tilt and shift . the adapter 10 includes an extended body portion 14 . the extended body portion 14 includes a side 14 a that accommodates a spring - tensioned lock lever 118 ( fig6 ), whose function is explained below . the extended body portion 14 includes a bottom edge 15 to which is attached a mount 101 , e . g ., a mounting plate , that allows the adapter 10 to be mounted to an adapter body support 400 , i . e ., a support structure , such as a tripod ( see fig1 ). while mount 101 is sometimes referred to below as a “ tripod mount ,” it is not limited to mounting to tripods . mount 101 is shown attached to the bottom edge 15 of the extended body portion 14 using screws 149 , by way of example . in addition to tilt and shift motions , the adapter 10 features a rotation function so that the tilting and shifting can take place in different directions . this is accomplished by a precision rotation bearing 150 that lies between the first body portion 11 and the first flange 124 . as mentioned above , the first flange 124 is configured to couple the adapter 10 to the camera 300 , and so it remains fixed relative to the camera . by rotating the first flange 124 relative to the remainder of the adapter 10 , the adapter is able to rotate relative to the camera 300 . this allows the shifting and tilting motions to take place along either the landscape or portrait direction of the camera 300 , or along at least one and preferably several intermediate angular positions . in an example , the rotation is controlled by the aforementioned spring - tensioned lock lever 118 shown in fig6 . rotation is locked by engaging the hooked end 119 of lock lever 118 with any of several corresponding holes 151 located along the outer edge of the first flange 124 . in an example , the spacing of holes 151 permits angular rotation from zero to 90 degrees in angular increments , such as 30 - degree increments . in an embodiment , the adapter 10 has a maximum shift of +/− 8 mm , a maximum tilt of +/− 8 degrees , and a maximum rotation of 90 degrees to permit both portrait and landscape camera orientations . the adapter 10 includes bayonet rings 115 and 124 for attaching a lens 200 and a camera body 300 , respectively . the tripod mount 101 is interchangeable to permit use with an arbitrary variety of tripod heads . fig2 a through 2c shows three elevation views ( front , side and rear , respectively ) of assembly 4 with camera and lens attached to tilt shift adapter 10 in the portrait orientation . fig3 shows a tilt drive knob 105 and a shift drive knob 106 that control the tilt and shift motions respectively . the aperture setting indicator 107 and shift scale 104 provide a visual indicator for the aperture value and degree of shift , respectively . the lens unlock button 107 is pressed to release the lens 200 to allow its removal . the camera - mounted lens unlock button 301 is normally used to release lenses attached to the camera 300 , but in the present case it is used to release adapter 10 . in fig4 , adjustment screws 108 are used to eliminate play in the shifting mechanism . the aperture set knob 112 is moved in a short arc to manually adjust the aperture of suitable lenses 200 . this is particularly useful for nikkor g type lenses ( manufactured by nikon corporation ), which have a mechanical iris control tab but lack an aperture control ring . in fig5 , the adapter 10 is shown in a maximum tilt configuration . the adjustment screws 109 are used to eliminate play in the tilting mechanism . the center of rotation of the tilt motion approximately coincides with the image plane . this ensures that there is little or no focus shift in the center of the image when the lens is tilted . fig6 illustrates features related to adapter rotation . this rotation is used to rotate the adapter 10 relative to the camera flange 124 of camera 300 so that the camera orientation can be switched from landscape to portrait orientation or vice versa . the spring - tensioned lock lever 118 allows controlled adapter rotation by engaging the camera flange 124 at holes 151 spaced at fixed angular increments my means of a hook 119 . fig6 also illustrates the screws 149 that are used to attach mount 101 to extended body portion 14 . fig7 illustrates additional features related to adapter rotation . in fig7 , the camera &# 39 ; s lens locking pin 302 , which is analgous to the lens locking pin 116 on the adapter , engages with the hole 125 in the camera flange 124 to allow precise adapter rotation while keeping the bayonet ring rigidly fixed to the camera . the oblong slot 122 in the spring - tensioned lock lever 118 allows the lever to rotate about the bearing 121 while the bearing screw 123 prevents the lever from lifting up out of its plane of rotation . the spring - tensioned lock lever 118 is actuated by grasping the lock lever knob 120 and moving it to - and - fro . fig8 is a cross - sectional view of the adapter that illustrates several mechanisms and features of an embodiment of the present invention including the aperture drive ring 111 , the aperture drive knob 112 , the shift drive knob 106 , the shift movment lead screw 126 , the shift movement drive nut 127 , and dovetail tilt 117 and shift 110 guides . fig9 is an elevation view of side 12 a shown when the lens flange 115 is shifted to its maximum vertical position . several mechanisms and features are illustrated , including an aperture indicator 113 , a lens locking pin 116 , a lens locking pin retractor button 107 , the shift drive knob 106 , the tilt drive knob 105 , a portion of the dovetail shift gude 110 , the aperture drive ring 111 , the aperture drive knob 112 , and the lens engagement hook of the aperture drive , 114 . fig1 is a side view showing the shift indicator line 128 , the shift index scale 104 , the first body portion 11 , the first side 11 a , the second body portion 12 , the second side 12 a , the first flange 124 , the second flange 115 , the lens locking pin 116 , the tilt drive knob 105 , the shift drive knob 106 , the extended body portion 14 , the side 14 a that accommodates a spring - tensioned lock lever 118 with lock lever knob 120 , and the bottom edge 15 of the extended body portion to which mount 101 is attached . fig1 is a cross - sectional view of the adapter 10 that illustrates several mechanisms , including the tilt drive lead screw 131 , the self - aligning tilt drive lead screw bearing 132 , the self - aligning tilt drive nut 133 , the rotation bearing for the self aligning tilt drive nut 134 , the lens lock pin sleeve 135 , the bottom of the spring - loaded lens locking pin 136 , the lens locking pin 116 , the lens locking pin lever 130 , the shift drive lead screw 126 , the shift drive nut , 127 , the cylindrical dovetail tilt guide 117 , the linear dovetail shift guide 110 , the first side flange ( i . e ., camera flange ) 124 , and the second side flange ( i . e . lens flange ) 115 . fig1 is a detail view of the second side showing details related to the neutral setting of the tilt mechanism . this mechanism is important because it provides a precise and repeatable means for making the second flange 115 parallel to the first flange 124 . this setting will be used very often in photography when no tilt adjustment is desired . the tilt scale 137 reads an angle ( e . g ., one degree ) for each tic mark . the vernier index line 138 for the tilt scale permits tilt readings to within a finer angle , such as 0 . 5 degrees . a tilt lead screw bearing cover 140 also serves as a zero position stop for a zero tilt lever 139 . an eccentric sleeve bearing 149 is shown for the zero tilt lever 139 . a countersunk sleeve bearing lock 142 is also shown . a zero tilt lever engagement stop 143 is used to position the zero tilt lever 139 in the proper position in order to engage the zero tilt lever stop 140 . fig1 is a view of the second side of the adapter 10 when set in a neutral position for both tilt and shift ( i . e ., zero tilt and zero shift ). fig1 shows the rounded top 13 , parallel edges 22 , extended body portion 14 , bottom edge 15 of the extended body portion , along with mount 101 . fig1 illustrates the aperture open indicator 103 and closed indicator 102 . the small central dot symbol 102 indicates the minimum aperture position , and the large central dot symbol 103 indicates the maximum aperture position . indicator lines 153 show intermediate aperture values . fig1 illustrates a variety of additional mechanisms and features , including the lens locking pin 116 , one of several lens bayonet springs 144 that provide a snug fit of the lens onto the second side flange 115 , the slide adjustment bearing material 145 which provides a smooth sliding friction , one of the tilt movement adjustment screws 109 , the compression spring 146 for adapter rotation , one of several set screws 147 to lock the inner ring of the adapter to the camera flange 124 , the portion of the adapter body 148 that rotates relative to the camera flange when the adapter is rotated from landscape to portrait orientation ( or vice versa ), and the rotation bearing surface 150 . fig1 illustrates an adapter 10 according to the present invention attached to an adapter body support 400 . in this figure the body support 400 is shown as a tripod , but in practice other types of supports may be used , such as a rigid pier , a clamp mounted to a pole , a beanbag support , or any other camera supporting means known in the art . fig1 is a schematic drawing of a camera 300 , including the camera body 305 , lens flange 303 , lens mounting pin 302 , and image plane 304 . thus , embodiments include a lens - to - camera mount adapter , referred to herein as a tilt shift adapter ( or just “ adapter ”), with both tilting and shifting functions . in addition , the adapter has tilt and shift functions that are precisely controlled , e . g ., by means of lead screws or the like . in addition , example adapters include means for direct attachment to a tripod or similar support . example adapters also have means for manually controlling the aperture for certain attached lenses which lack a manual aperture control means , such as an aperture ring . the example embodiments described above is suitable to adapt nikon f - mount lenses onto panasonic or olympus micro four thirds camera bodies . since the flange distance df ( i . e ., the distance from the lens mounting flange 303 on the camera body 305 to the camera image plane 304 ; see fig1 ) of micro four thirds cameras is 19 . 25 mm and the flange distance for nikon f - mount lenses is 46 . 5 mm , the distance between the flange surfaces 115 and 124 of an embodiment is 27 . 25 mm . in addition , the example embodiment can provide manual aperture adjustment for nikon “ g ” type lenses having an f - mount . many other embodiments fall within the scope of this disclosure . for example , in order to be compatible with sony nex series cameras having a flange distance ( see fig1 ) of 18 mm , the distance between the flange surfaces 115 and 124 would have to be increased by 1 . 25 mm relative to an adapter designed for micro four thirds cameras . the adapter 10 may also be made compatible with lenses mounts other than the nikon f - mount standard . such lens mounts include but are not limited to canon eos , sony alpha , pentax k , olympus om , minolta maxxum , m42 , yashica / contax , and leica r . exemplary embodiments incorporating various different tripod adapters to fit different tripod heads are also fall within the scope of this disclosure . such tripod heads include but are not limited to those manufactured by arca - swiss , manfrotto , and gitzo . it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit and scope of the invention . thus it is intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .	6
typically , a compound of the invention is administered in an amount effective to treat a condition as described herein . the compounds of the invention are administered by any suitable route in the form of a pharmaceutical composition adapted to such a route , and in a dose effective for the treatment intended . therapeutically effective doses of the compounds required to treat the progress of the medical condition are readily ascertained by one of ordinary skill in the art using preclinical and clinical approaches familiar to the medicinal arts . the term “ treating ”, as used herein , unless otherwise indicated , means reversing , alleviating , inhibiting the progress of , or preventing the disorder or condition to which such term applies , or one or more symptoms of such disorder or condition . the term “ treatment ”, as used herein , unless otherwise indicated , refers to the act of treating as “ treating ” is defined immediately above . the term “ treating ” also includes adjuvant and neo - adjuvant treatment of a subject . the compounds of the invention may be administered orally . oral administration may involve swallowing , so that the compound enters the gastrointestinal tract , or buccal or sublingual administration may be employed , by which the compound enters the blood stream directly from the mouth . in another embodiment , the compounds of the invention may also be administered directly into the blood stream , into muscle , or into an internal organ . suitable means for parenteral administration include intravenous , intraarterial , intraperitoneal , intrathecal , intraventricular , intraurethral , intrasternal , intracranial , intramuscular and subcutaneous . suitable devices for parenteral administration include needle ( including microneedle ) injectors , needle - free injectors and infusion techniques . in another embodiment , the compounds of the invention may also be administered topically to the skin or mucosa , that is , dermally or transdermally . in another embodiment , the compounds of the invention can also be administered intranasally or by inhalation . in another embodiment , the compounds of the invention may be administered rectally or vaginally . in another embodiment , the compounds of the invention may also be administered directly to the eye or ear . the dosage regimen for the compounds and / or compositions containing the compounds is based on a variety of factors , including the type , age , weight , sex and medical condition of the patient ; the severity of the condition ; the route of administration ; and the activity of the particular compound employed . thus the dosage regimen may vary widely . dosage levels of the order from about 0 . 01 mg to about 100 mg per kilogram of body weight per day are useful in the treatment of the above - indicated conditions . in one embodiment , the total daily dose of a compound of the invention ( administered in single or divided doses ) is typically from about 0 . 01 to about 100 mg / kg . in another embodiment , the total daily dose of the compound of the invention is from about 0 . 1 to about 50 mg / kg , and in another embodiment , from about 0 . 5 to about 30 mg / kg ( i . e ., mg compound of the invention per kg body weight ). in one embodiment , dosing is from 0 . 01 to 10 mg / kg / day . in another embodiment , dosing is from 0 . 1 to 1 . 0 mg / kg / day . dosage unit compositions may contain such amounts or submultiples thereof to make up the daily dose . in many instances , the administration of the compound will be repeated a plurality of times in a day ( typically no greater than 4 times ). multiple doses per day typically may be used to increase the total daily dose , if desired . for oral administration , the compositions may be provided in the form of tablets containing from about 0 . 01 mg to about 500 mg of the active ingredient , or in another embodiment , from about 1 mg to about 100 mg of active ingredient . intravenously , doses may range from about 0 . 1 to about 10 mg / kg / minute during a constant rate infusion . suitable subjects according to the present invention include mammalian subjects . mammals according to the present invention include , but are not limited to , canine , feline , bovine , caprine , equine , ovine , porcine , rodents , lagomorphs , primates , and the like , and encompass mammals in utero . in one embodiment , humans are suitable subjects . human subjects may be of either gender and at any stage of development . in another embodiment , the invention comprises the use of one or more compounds of the invention for the preparation of a medicament for the treatment of the conditions recited herein . for the treatment of the conditions referred to above , the compound of the invention can be administered as compound per se . alternatively , pharmaceutically acceptable salts are suitable for medical applications because of their greater aqueous solubility relative to the parent compound . in another embodiment , the present invention comprises pharmaceutical compositions . such pharmaceutical compositions comprise a compound of the invention presented with a pharmaceutically acceptable carrier . the carrier can be a solid , a liquid , or both , and may be formulated with the compound as a unit - dose composition , for example , a tablet , which can contain from 0 . 05 % to 95 % by weight of the active compounds . a compound of the invention may be coupled with suitable polymers as targetable drug carriers . other pharmacologically active substances can also be present . the compounds of the present invention may be administered by any suitable route , preferably in the form of a pharmaceutical composition adapted to such a route , and in a dose effective for the treatment intended . the active compounds and compositions , for example , may be administered orally , rectally , parenterally , or topically . oral administration of a solid dose form may be , for example , presented in discrete units , such as hard or soft capsules , pills , cachets , lozenges , or tablets , each containing a predetermined amount of at least one compound of the present invention . in another embodiment , the oral administration may be in a powder or granule form . in another embodiment , the oral dose form is sub - lingual , such as , for example , a lozenge . in such solid dosage forms , the compounds of formula i are ordinarily combined with one or more adjuvants . such capsules or tablets may contain a controlled - release formulation . in the case of capsules , tablets , and pills , the dosage forms also may comprise buffering agents or may be prepared with enteric coatings . in another embodiment , oral administration may be in a liquid dose form . liquid dosage forms for oral administration include , for example , pharmaceutically acceptable emulsions , solutions , suspensions , syrups , and elixirs containing inert diluents commonly used in the art ( e . g ., water ). such compositions also may comprise adjuvants , such as wetting , emulsifying , suspending , flavoring ( e . g ., sweetening ), and / or perfuming agents . in another embodiment , the present invention comprises a parenteral dose form . “ parenteral administration ” includes , for example , subcutaneous injections , intravenous injections , intraperitoneal injections , intramuscular injections , intrasternal injections , and infusion . injectable preparations ( e . g ., sterile injectable aqueous or oleaginous suspensions ) may be formulated according to the known art using suitable dispersing , wetting agents , and / or suspending agents . in another embodiment , the present invention comprises a topical dose form . “ topical administration ” includes , for example , transdermal administration , such as via transdermal patches or iontophoresis devices , intraocular administration , or intranasal or inhalation administration . compositions for topical administration also include , for example , topical gels , sprays , ointments , and creams . a topical formulation may include a compound which enhances absorption or penetration of the active ingredient through the skin or other affected areas . when the compounds of this invention are administered by a transdermal device , administration will be accomplished using a patch either of the reservoir and porous membrane type or of a solid matrix variety . typical formulations for this purpose include gels , hydrogels , lotions , solutions , creams , ointments , dusting powders , dressings , foams , films , skin patches , wafers , implants , sponges , fibers , bandages and microemulsions . liposomes may also be used . typical carriers include alcohol , water , mineral oil , liquid petrolatum , white petrolatum , glycerin , polyethylene glycol and propylene glycol . penetration enhancers may be incorporated ; see , for example , j . pharm . sci ., 88 ( 10 ), 955 - 958 , by finnin and morgan ( october 1999 ). formulations suitable for topical administration to the eye include , for example , eye drops wherein the compound of this invention is dissolved or suspended in a suitable carrier . a typical formulation suitable for ocular or aural administration may be in the form of drops of a micronized suspension or solution in isotonic , ph - adjusted , sterile saline . other formulations suitable for ocular and aural administration include ointments , biodegradable ( e . g ., absorbable gel sponges , collagen ) and non - biodegradable ( e . g ., silicone ) implants , wafers , lenses and particulate or vesicular systems , such as niosomes or liposomes . a polymer such as cross - linked polyacrylic acid , polyvinyl alcohol , hyaluronic acid , a cellulosic polymer , for example , ( hydroxypropyl ) methyl cellulose , hydroxyethyl cellulose , or methyl cellulose , or a heteropolysaccharide polymer , for example , gelan gum , may be incorporated together with a preservative , such as benzalkonium chloride . such formulations may also be delivered by iontophoresis . for intranasal administration or administration by inhalation , the active compounds of the invention are conveniently delivered in the form of a solution or suspension from a pump spray container that is squeezed or pumped by the patient or as an aerosol spray presentation from a pressurized container or a nebulizer , with the use of a suitable propellant . formulations suitable for intranasal administration are typically administered in the form of a dry powder ( either alone , as a mixture , for example , in a dry blend with lactose , or as a mixed component particle , for example , mixed with phospholipids , such as phosphatidylcholine ) from a dry powder inhaler or as an aerosol spray from a pressurized container , pump , spray , atomizer ( preferably an atomizer using electrohydrodynamics to produce a fine mist ), or nebulizer , with or without the use of a suitable propellant , such as 1 , 1 , 1 , 2 - tetrafluoroethane or 1 , 1 , 1 , 2 , 3 , 3 , 3 - heptafluoropropane . for intranasal use , the powder may comprise a bioadhesive agent , for example , chitosan or cyclodextrin . in another embodiment , the present invention comprises a rectal dose form . such rectal dose form may be in the form of , for example , a suppository . cocoa butter is a traditional suppository base , but various alternatives may be used as appropriate . other carrier materials and modes of administration known in the pharmaceutical art may also be used . pharmaceutical compositions of the invention may be prepared by any of the well - known techniques of pharmacy , such as effective formulation and administration procedures . the above considerations in regard to effective formulations and administration procedures are well known in the art and are described in standard textbooks . formulation of drugs is discussed in , for example , hoover , john e ., remington &# 39 ; s pharmaceutical sciences , mack publishing co ., easton , pa ., 1975 ; liberman et al ., eds ., pharmaceutical dosage forms , marcel decker , new york , n . y ., 1980 ; and kibbe et al ., eds ., handbook of pharmaceutical excipients ( 3 rd ed . ), american pharmaceutical association , washington , 1999 . the compounds of the present invention can be used , alone or in combination with other therapeutic agents , in the treatment of various conditions or disease states . the compound ( s ) of the present invention and other therapeutic agent ( s ) may be may be administered simultaneously ( either in the same dosage form or in separate dosage forms ) or sequentially . two or more compounds may be administered simultaneously , concurrently or sequentially . additionally , simultaneous administration may be carried out by mixing the compounds prior to administration or by administering the compounds at the same point in time but at different anatomic sites or using different routes of administration . the phrases “ concurrent administration ,” “ co - administration ,” “ simultaneous administration ,” and “ administered simultaneously ” mean that the compounds are administered in combination . the present invention includes the use of a combination of a lrrk2 inhibitor compound as provided in formula ( i ) and one or more additional pharmaceutically active agent ( s ). if a combination of active agents is administered , then they may be administered sequentially or simultaneously , in separate dosage forms or combined in a single dosage form . accordingly , the present invention also includes pharmaceutical compositions comprising an amount of : ( a ) a first agent comprising a compound of formula ( i ) or a pharmaceutically acceptable salt of the compound ; ( b ) a second pharmaceutically active agent ; and ( c ) a pharmaceutically acceptable carrier , vehicle or diluent . various pharmaceutically active agents may be selected for use in conjunction with the compounds of formula ( i ), depending on the disease , disorder , or condition to be treated . for example , a pharmaceutical composition for use in treating parkinson &# 39 ; s disease may comprise a compound of formula ( i ) or a pharmaceutically acceptable salt thereof together with another agent such as a dopamine ( levodopa , either alone or with a dopa decarboxylase inhibitor ), a monoamine oxidase ( mao ) inhibitor , a catechol o - methyltransferase ( comt ) inhibitor or an anticholinergic agent , or any combination thereof . particularly preferred agents to combine with the compounds of formula ( i ) for use in treating parkinson &# 39 ; s disease include levodopa , carbidopa , tolcapone , entacapone , selegiline , benztropine and trihexyphenidyl , or any combination thereof . pharmaceutically active agents that may be used in combination with the compounds of formula ( i ) and compositions thereof include , without limitation : ( i ) levodopa ( or its methyl or ethyl ester ), alone or in combination with a dopa decarboxylase inhibitor ( e . g ., carbidopa ( sinemet , carbilev , parcopa ), benserazide ( madopar ), α - methyldopa , monofluoromethyldopa , difluoromethyldopa , brocresine , or m - hydroxybenzylhydrazine ); ( ii ) anticholinergics , such as amitriptyline ( elavil , endep ), butriptyline , benztropine mesylate ( cogentin ), trihexyphenidyl ( artane ), diphenhydramine ( benadryl ), orphenadrine ( norflex ), hyoscyamine , atropine ( atropen ), scopolamine ( transderm - scop ), scopolamine methylbromide ( parmine ), dicycloverine ( bentyl , byclomine , dibent , dilomine ), tolterodine ( detrol ), oxybutynin ( ditropan , lyrinel xl , oxytrol ), penthienate bromide , propantheline ( pro - banthine ), cyclizine , imipramine hydrochloride ( tofranil ), imipramine maleate ( surmontil ), lofepramine , desipramine ( norpramin ), doxepin ( sinequan , zonalon ), trimipramine ( surmontil ), and glycopyrrolate ( robinul ); ( iii ) catechol o - methyltransferase ( comt ) inhibitors , such as nitecapone , tolcapone ( tasmar ), entacapone ( comtan ), and tropolone ; ( iv ) monoamine oxidase ( mao ) inhibitors , such as selegiline ( emsam ), selegiline hydrochloride ( 1 - deprenyl , eldepryl , zelapar ), dimethylselegiline , brofaromine , phenelzine ( nardil ), tranylcypromine ( parnate ), moclobemide ( aurorix , manerix ), befloxatone , safinamide , isocarboxazid ( marplan ), nialamide ( niamid ), rasagiline ( azilect ), iproniazide ( marsilid , iprozid , ipronid ), iproclozide , toloxatone ( humoryl , perenum ), bifemelane , desoxypeganine , harmine ( also known as telepathine or banasterine ), harmaline , linezolid ( zyvox , zyvoxid ), and pargyline ( eudatin , supirdyl ); ( v ) acetylcholinesterase inhibitors , such as donepezil hydrochloride ( aricept ®, memac ), physostigmine salicylate ( antilirium ®), physostigmine sulfate ( eserine ), ganstigmine , rivastigmine ( exelon ®), ladostigil , np - 0361 , galantamine hydrobromide ( razadyne ®, reminyl ®, nivalin ®), tacrine ( cognex ®), tolserine , memoquin , huperzine a ( hup - a ; neuro - hitech ), phenserine , bisnorcymserine ( also known as bnc ), and inm - 176 ; ( vi ) amyloid - β ( or fragments thereof ), such as aβ 1 - 15 conjugated to pan hla dr - binding epitope ( padre ®), acc - 001 ( elan / wyeth ), and affitope ; ( vii ) antibodies to amyloid - β ( or fragments thereof ), such as ponezumab , solanezumab , bapineuzumab ( also known as aab - 001 ), aab - 002 ( wyeth / elan ), gantenerumab , intravenous ig ( gammagard ®), ly2062430 ( humanized m266 ; lilly ), and those disclosed in international patent publication nos wo04 / 032868 , wo05 / 025616 , wo006 / 036291 , wo006 / 069081 , wo06 / 118959 , in us patent publication nos us2003 / 0073655 , us2004 / 0192898 , us2005 / 0048049 , us2005 / 0019328 , in european patent publication nos ep0994728 and 1257584 , and in u . s . pat . no . 5 , 750 , 349 ; ( viii ) amyloid - lowering or - inhibiting agents ( including those that reduce amyloid production , accumulation and fibrillization ) such as eprodisate , celecoxib , lovastatin , anapsos , colostrinin , pioglitazone , clioquinol ( also known as pbt1 ), pbt2 ( prana biotechnology ), flurbiprofen ( ansaid ®, froben ®) and its r - enantiomer tarenflurbil ( flurizan ®), nitroflurbiprofen , fenoprofen ( fenopron , nalfon ®), ibuprofen ( advil ®, motrin ®, nurofen ®), ibuprofen lysinate , meclofenamic acid , meclofenamate sodium ( meclomen ®), indomethacin ( indocin ®), diclofenac sodium ( voltaren ®), diclofenac potassium , sulindac ( clinoril ®), sulindac sulfide , diflunisal ( dolobid ®), naproxen ( naprosyn ®), naproxen sodium ( anaprox ®, aleve ®), insulin - degrading enzyme ( also known as insulysin ), the gingko biloba extract egb - 761 ( rokan ®, tebonin ®), tramiprosate ( cerebril ®, alzhemed ®), kiacta ®), neprilysin ( also known as neutral endopeptidase ( nep )), scyllo - inositol ( also known as scyllitol ), atorvastatin ( lipitor ®), simvastatin ( zocor ®), ibutamoren mesylate , bace inhibitors such as ly450139 ( lilly ), bms - 782450 , gsk - 188909 ; gamma secretase modulators and inhibitors such as elnd - 007 , bms - 708163 ( avagacestat ), and dsp8658 ( dainippon ); and rage ( receptor for advanced glycation end - products ) inhibitors , such as ttp488 ( transtech ) and ttp4000 ( transtech ), and those disclosed in u . s . pat . no . 7 , 285 , 293 , including pti - 777 ; ( ix ) alpha - adrenergic receptor agonists , and beta - adrenergic receptor blocking agents ( beta blockers ); anticholinergics ; anticonvulsants ; antipsychotics ; calcium channel blockers ; catechol o - methyltransferase ( comt ) inhibitors ; central nervous system stimulants ; corticosteroids ; dopamine receptor agonists and antagonists ; dopamine reuptake inhibitors ; gamma - aminobutyric acid ( gaba ) receptor agonists ; immunosuppressants ; interferons ; muscarinic receptor agonists ; neuroprotective drugs ; nicotinic receptor agonists ; norepinephrine ( noradrenaline ) reuptake inhibitors ; quinolines ; and trophic factors ; ( x ) histamine 3 ( h3 ) antagonists , such as pf - 3654746 and those disclosed in us patent publication nos us2005 - 0043354 , us2005 - 0267095 , us2005 - 0256135 , us2008 - 0096955 , us2007 - 1079175 , and us2008 - 0176925 ; international patent publication nos wo2006 / 136924 , wo2007 / 063385 , wo2007 / 069053 , wo2007 / 088450 , wo2007 / 099423 , wo2007 / 105053 , wo2007 / 138431 , and wo2007 / 088462 ; and u . s . pat . no . 7 , 115 , 600 ); ( xi ) n - methyl - d - aspartate ( nmda ) receptor antagonists , such as memantine ( namenda , axura , eb ixa ), amantadine ( symmetrel ), acamprosate ( campral ), besonprodil , ketamine ( ketalar ), delucemine , dexanabinol , dexefaroxan , dextromethorphan , dextrorphan , traxoprodil , cp - 283097 , himantane , idantadol , ipenoxazone , l - 701252 ( merck ), lancicemine , levorphanol ( dromoran ), methadone , ( dolophine ), neramexane , perzinfotel , phencyclidine , tianeptine ( stablon ), dizocilpine ( also known as mk - 801 ), ibogaine , voacangine , tiletamine , riluzole ( rilutek ), aptiganel ( cerestat ), gavestinel , and remacimide ; ( xii ) phosphodiesterase ( pde ) inhibitors , including ( a ) pde1 inhibitors ; ( b ) pde2 inhibitors ; ( c ) pde3 inhibitors ; ( d ) pde4 inhibitors ; ( e ) pde5 inhibitors ; ( f ) pde9 inhibitors ( e . g ., pf - 04447943 , bay 73 - 6691 ( bayer ag ) and those disclosed in us patent publication nos us2003 / 0195205 , us2004 / 0220186 , us2006 / 0111372 , us2006 / 0106035 , and u . s . ser . no . 12 / 118 , 062 ( filed may 9 , 2008 )); and ( g ) pde10 inhibitors such as 2 -({ 4 -[ 1 - methyl - 4 -( pyridin - 4 - yl )- 1h - pyrazol - 3 - yl ] phenoxy } methyl ) quinoline ( pf - 2545920 ); ( xiii ) serotonin ( 5 - hydroxytryptamine ) 1a ( 5 - ht 1a ) receptor antagonists , such as spiperone , levo - pindolol , lecozotan ; ( xiv ) serotonin ( 5 - hydroxytryptamine ) 2c ( 5 - ht 2c ) receptor agonists , such as vabicaserin , and zicronapine ; serotonin ( 5 - hydroxytryptamine ) 4 ( 5 - ht 4 ) receptor agonists / antagonists , such as prx - 03140 ( epix ) and pf - 04995274 ; ( xv ) serotonin ( 5 - hydroxytryptamine ) 3c ( 5 - ht 3c ) receptor antagonists , such as ondansetron ( zofran ); ( xvi ) serotonin ( 5 - hydroxytryptamine ) 6 ( 5 - ht 6 ) receptor antagonists , such as mianserin ( tolvon , bolvidon , norval ), methiothepin ( also known as metitepine ), ritanserin , sb - 271046 , sb - 742457 ( glaxosmithkline ), lu ae58054 ( lundbeck a / s ), sam - 760 , and prx - 07034 ( epix ); ( xvii ) serotonin ( 5 - ht ) reuptake inhibitors such as alaproclate , citalopram ( celexa , cipramil ), escitalopram ( lexapro , cipralex ), clomipramine ( anafranil ), duloxetine ( cymbalta ), femoxetine ( malexil ), fenfluramine ( pondimin ), norfenfluramine , fluoxetine ( prozac ), fluvoxamine ( luvox ), indalpine , milnacipran ( ixel ), paroxetine ( paxil , seroxat ), sertraline ( zoloft , lustral ), trazodone ( desyrel , molipaxin ), venlafaxine ( effexor ), zimelidine ( normud , zelmid ), bicifadine , desvenlafaxine ( pristiq ), brasofensine , vilazodone , cariprazine and tesofensine ; ( xviii ) glycine transporter - 1 inhibitors such as paliflutine , org - 25935 , and org - 26041 ; and mglur modulators such as afq - 059 and amantidine ; ( xix ) ampa - type glutamate receptor modulators such as perampanel , mibampator , selurampanel , gsk - 729327 , and n -{( 3s , 4s )- 4 -[ 4 -( 5 - cyanothiophen - 2 - yl ) phenoxy ] tetrahydrofuran - 3 - yl } propane - 2 - sulfonamide ; ( xx ) p450 inhibitors , such as ritonavir ; ( xxi ) tau therapy targets , such as davunetide ; the present invention further comprises kits that are suitable for use in performing the methods of treatment described above . in one embodiment , the kit contains a first dosage form comprising one or more of the compounds of the present invention and a container for the dosage , in quantities sufficient to carry out the methods of the present invention . in another embodiment , the kit of the present invention comprises one or more compounds of the invention . the compounds of formula ( i ) may be prepared by the methods described below , together with synthetic methods known in the art of organic chemistry , or modifications and transformations that are familiar to those of ordinary skill in the art . the starting materials used herein are commercially available or may be prepared by routine methods known in the art [ such as those methods disclosed in standard reference books such as the compendium of organic synthetic methods , vol . i - xii ( published by wiley - interscience )]. preferred methods include , but are not limited to , those described below . during any of the following synthetic sequences it may be necessary and / or desirable to protect sensitive or reactive groups on any of the molecules concerned . this can be achieved by means of conventional protecting groups , such as those described in t . w . greene , protective groups in organic chemistry , john wiley & amp ; sons , 1981 ; t . w . greene and p . g . m . wuts , protective groups in organic chemistry , john wiley & amp ; sons , 1991 ; and t . w . greene and p . g . m . wuts , protective groups in organic chemistry , john wiley & amp ; sons , 1999 , which are hereby incorporated by reference . compounds of formula ( i ), or their pharmaceutically acceptable salts , can be prepared according to the reaction schemes discussed herein below . unless otherwise indicated , the substituents in the schemes are defined as above . isolation and purification of the products is accomplished by standard procedures , which are known to a chemist of ordinary skill . one skilled in the art will recognize that in many cases , the compounds in reaction schemes 1 through 4 may be generated as a mixture of diastereomers and / or enantiomers ; these may be separated at various stages of the synthetic schemes using conventional techniques or a combination of such techniques , such as , but not limited to , crystallization , normal - phase chromatography , reversed phase chromatography and chiral chromatography , to afford the single enantiomers of the invention . it will be understood by one skilled in the art that the various symbols , superscripts and subscripts used in the schemes , methods and examples are used for convenience of representation and / or to reflect the order in which they are introduced in the schemes , and are not intended to necessarily correspond to the symbols , superscripts or subscripts in the appended claims . the schemes are representative of methods useful in synthesizing the compounds of the present invention . they are not to constrain the scope of the invention in any way . the reactions for preparing compounds of the invention can be carried out in suitable solvents , which can be readily selected by one of skill in the art of organic synthesis . suitable solvents can be substantially non - reactive with the starting materials ( reactants ), the intermediates , or products at the temperatures at which the reactions are carried out , e . g ., temperatures which can range from the solvent &# 39 ; s freezing temperature to the solvent &# 39 ; s boiling temperature . a given reaction can be carried out in one solvent or a mixture of more than one solvent . depending on the particular reaction step , suitable solvents for a particular reaction step can be selected by the skilled artisan . reactions can be monitored according to any suitable method known in the art . for example , product formation can be monitored by spectroscopic means , such as nuclear magnetic resonance spectroscopy ( e . g ., 1 h or 13 c ), infrared spectroscopy , spectrophotometry ( e . g ., uv - visible ), mass spectrometry , or by chromatographic methods such as high performance liquid chromatography ( hplc ) or thin layer chromatography ( tlc ). compounds of formula ( i ) and intermediates thereof may be prepared according to the following reaction schemes and accompanying discussion . unless otherwise indicated , r 1 , r 1a , r 1b , r 2 , r 3 , r 4 , r 5 , r 6 , x and z in the reaction schemes and discussions that follow are as defined as the same as hereinabove . in general the compounds of this invention may be made by processes which include processes analogous to those known in the chemical arts , particularly in light of the description contained herein . certain processes for the manufacture of the compounds of this invention and intermediates thereof are provided as further features of the invention and are illustrated by the following reaction schemes . other processes may be described in the experimental section . the schemes and examples provided herein ( including the corresponding description ) are for illustration only , and not intended to limit the scope of the present invention . reaction scheme 1 depicts the preparation of compounds of formula ( i ). referring to scheme 1 , compounds 1 . 1 and 1 . 2 are either commercially available or can be made by methods described herein or other methods well known to those skilled in the art . in the compound of formula 1 . 1 the group designated lg represents an appropriate leaving group such as a halide ( eg chloro or bromo ) or triflate which is suitable to undergoe nucleophilic displacement when reacted with the amine of formula 1 . 2 . in the amine compound of formula 1 . 2 the group designated pg represents an appropriate amine protecting group such as an acid labile protecting group selected from 2 , 4 - dimethoxybenzyl ( dmb ), 4 - methoxybenzyl ( pmb ) and t - butoxycarbonyl ( boc ). the compounds of formulae 1 . 1 and 1 . 2 can be reacted , for example , in the presence of an appropriate base such as n , n - diisopropylethylamine ( hunig &# 39 ; s base ) or triethylamine in a suitable solvent such as acetonitrile or n , n - dimethylformamide ( dmf ) to afford the compound of formula 1 . 3 . the reaction is typically carried out at an elevated temperature , such as 50 to 100 ° c . for a period of 1 to 48 hours . removal of the protecting group , such as an acid labile protecting group ( pg ) from the compound of formula 1 . 3 can typically be accomplished by treatment of 1 . 3 with an appropriate acid such as acetic acid , trifluoroacetic acid or hydrochloric acid to provide the compound of formula 1 . 4 . also , it is to be understood that in certain instances the compound of formula 1 . 1 can be reacted with an unprotected amine of formula r 2 — nh 2 to arrive directly to a compound of formula 1 . 4 . reduction of the nitro group in the compound of formula 1 . 4 using conditions congruent with the functionality present affords the compound of formula 1 . 5 . for example , the nitro group in the compound of formula 1 . 4 can be reduced to the corresponding amine of formula 1 . 5 by treatment of 1 . 4 with zinc dust and ammonium hydroxide in methanol or alternatively by hydrogenation of 1 . 4 using an appropriate catalyst such as platinum ( iv ) oxide in an appropriate solvent such as methanol , acetonitrile or a mixture thereof . coupling the diamine compound 1 . 5 with the carboxylic acid of formula 1 . 6 then provides the desired compound of formula ( i ), also denoted as 1 . 7 . the coupling reaction with the diamine of formula 1 . 5 and the carboxylic acid of formula 1 . 6 can be carried out in an appropriate solvent such as n , n - dimethylformamide in the presence of an appropriate base such as diisopropylethylamine and a coupling reagent such as 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphirane 2 , 4 , 6 - trioxide . reaction scheme 2 depicts to the preparation of compounds of formula 1 . 7 ′ which is a compound of formula ( i ) in which r 2 is the chiral 2 - methyltetrahydropyran - 4 - yl moiety as shown . using a published procedure , prins reaction of the compound 2 . 1 with the compound 2 . 2 generated the pyran 2 . 3 . chiral resolution to produce the separated enantiomers , using an enzyme - based method , afforded the compound of formula 2 . 5 after hydrolysis of the resolved ester 2 . 4 . oxidation of 2 . 5 gave ketone 2 . 6 which was reacted with the compound of formula 2 . 7 using reductive amination chemistry to provide the protected amine of formula 2 . 8 . the protected amine of formula 2 . 8 can be reacted with the compound of formula 1 . 1 in a manner analogous to that previously described in scheme 1 to provide the compound of formula 1 . 3 ′. the compounds of formulae 1 . 4 ′, 1 . 5 ′ and 1 . 7 ′ can then be prepared in a manner analogous to the methods described in scheme 1 for the compounds of formulae 1 . 4 , 1 . 5 and 1 . 7 , respectively . reaction scheme 3 depicts how the functional group at position r 3 of a compound of formula ( i ) ( i . e . when z is cr 3 ) can be modified early in the synthesis . modification , early in the synthesis of a compound such as commercially available 3 . 1 ( wherein lg is bromo ) allows one skilled in the art to introduce groups such as methoxy which are robust enough to be carried throughout the entire synthesis in a manner analogous to that described for scheme 1 . the compound of formula 3 . 1 can be reacted with sodium methoxide in the presence of copper iodide to provide the methoxy compound of formula 3 . 2 . the compound of formula 3 . 2 can then be treated with phosphorous oxychloride in order to convert the hydroxy group present in the compound of formula 3 . 1 into the corresponding chloride of formula 1 . 1 ″. the compound of formula 1 . 1 ″ can then be reacted with the amine of formula 1 . 2 to provide the compound of 1 . 3 ″ in a manner as previously described for scheme 1 . the compound of formula 1 . 3 ″ can then be further elaborated to the compounds of formulae 1 . 4 ″, 1 . 5 ″ and 1 . 7 ″ in a manner analogous to the corresponding steps described previously for scheme 1 . reaction scheme 4 shows a late stage transformation of the compound of formula 4 . 1 to 1 . 7 ′″, a method which can be employed to prepare certain compounds within formula ( i ) where z is cr 3 and in which the r 3 functional group present is not compatible with the entire synthetic route as set forth in scheme 1 . for example , the nitrile group (— cn ) present at the r 3 position in the compound of formula 1 . 7 ′″ would not survive the reduction step necessary for the transformation of 1 . 4 to 1 . 5 as described in scheme 1 ( the reduction of the nitro group to the corresponding amine ). in scheme 4 the compound of formula 4 . 1 is one in which lg represents a suitable leaving group such as a halide ( eg bromo ). the compound of formula 4 . 1 can be reacted with zinc cyanide in the presence of an appropriate catalyst such as tetrakis ( triphenylphosphine ) palladium in an appropriate solvent such as n , n - dimethylformamide . the reaction is typically carried out at a temperature range of approximately ambient temperature to 100 ° c . for a period of 1 to 48 hours to provide the compound of formula 1 . 7 ′″. the methods generically described in schemes 1 - 4 are not to be construed in a limiting manner . it is to be understood by one skilled in the art that variation in the order of certain reaction steps and conditions may be employed to provide compounds of formula ( i ). the selection of which approach is best to utilize can be made by one skilled in the art of organic synthesis . more specific examples of the methods used to prepare compounds of formula ( i ) are provided below in the examples , and likewise these methods are also not to be construed by one skilled in the art in a limiting manner . the following illustrate the synthesis of various compounds of the present invention . additional compounds within the scope of this invention may be prepared using the methods illustrated in these examples , either alone or in combination with techniques generally known in the art . experiments were generally carried out under inert atmosphere ( nitrogen or argon ), particularly in cases where oxygen - or moisture - sensitive reagents or intermediates were employed . commercial solvents and reagents were generally used without further purification . anhydrous solvents were employed where appropriate , generally acroseal ® products from acros organics or drisolv ® products from emd chemicals . in other cases , commercial solvents were passed through columns packed with 4 å molecular sieves , until the following qc standards for water were attained : a ) & lt ; 100 ppm for dichloromethane , toluene , n , n - dimethylformamide and tetrahydrofuran ; b ) & lt ; 180 ppm for methanol , ethanol , 1 , 4 - dioxane and diisopropylamine . for very sensitive reactions , solvents were further treated with metallic sodium , calcium hydride or molecular sieves , and distilled just prior to use . products were generally dried under vacuum before being carried on to further reactions or submitted for biological testing . mass spectrometry data is reported from either liquid chromatography - mass spectrometry ( lcms ), atmospheric pressure chemical ionization ( apci ) or gas chromatography - mass spectrometry ( gcms ) instrumentation . chemical shifts for nuclear magnetic resonance ( nmr ) data are expressed in parts per million ( ppm , 6 ) referenced to residual peaks from the deuterated solvents employed . in some examples , chiral separations were carried out to separate enantiomers of certain compounds of the invention ( in some examples , the separated enantiomers are designated as ent - 1 and ent - 2 , according to their order of elution ). in some examples , the optical rotation of an enantiomer was measured using a polarimeter . according to its observed rotation data ( or its specific rotation data ), an enantiomer with a clockwise rotation was designated as the (+)- enantiomer and an enantiomer with a counter - clockwise rotation was designated as the (−)- enantiomer . racemic compounds are indicated by the presence of (+/−) adjacent to the structure ; in these cases , indicated stereochemistry represents the relative ( rather than absolute ) configuration of the compound &# 39 ; s substituents . reactions proceeding through detectable intermediates were generally followed by lcms , and allowed to proceed to full conversion prior to addition of subsequent reagents . for syntheses referencing procedures in other examples or methods , reaction conditions ( reaction time and temperature ) may vary . in general , reactions were followed by thin - layer chromatography or mass spectrometry , and subjected to work - up when appropriate . purifications may vary between experiments : in general , solvents and the solvent ratios used for eluents / gradients were chosen to provide appropriate r f s or retention times . 1 -( 2 , 4 - dimethoxyphenyl ) methanamine ( 1 . 97 ml , 13 . 1 mmol ) was added to a solution of 2 - methyltetrahydro - 4h - pyran - 4 - one ( 500 mg , 4 . 4 mmol ) in methanol ( 10 ml ). after stirring for 1 hour at room temperature , the reaction mixture was cooled to − 78 ° c . and a solution of lithium borohydride ( 98 %, 85 mg , 3 . 8 mmol ) in tetrahydrofuran ( 1 . 5 ml ) was added drop - wise . the reaction mixture was allowed to slowly warm to room temperature overnight , whereupon it was cooled to − 20 ° c . and quenched via careful addition of saturated aqueous sodium bicarbonate solution . ethyl acetate ( 25 ml ) and sufficient water to solubilize the precipitate were added , and the aqueous layer was extracted with ethyl acetate . the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel [ gradient : 0 % to 15 % ( 10 : 1 methanol / concentrated ammonium hydroxide ) in ethyl acetate ] provided the product as a colorless oil . yield : 936 mg , 3 . 53 mmol , 80 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 13 ( d , j = 8 . 0 hz , 1h ), 6 . 46 ( d , half of ab quartet , j = 2 . 2 hz , 1h ), 6 . 44 ( dd , half of abx pattern , j = 8 . 1 , 2 . 3 hz , 1h ), 4 . 00 ( ddd , j = 11 . 6 , 4 . 6 , 1 . 6 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 81 ( s , 3h ), 3 . 76 ( s , 2h ), 3 . 37 - 3 . 46 ( m , 2h ), 2 . 63 - 2 . 72 ( m , 1h ), 1 . 85 - 1 . 92 ( m , 1h ), 1 . 78 - 1 . 85 ( m , 1h ), 1 . 37 ( dddd , j = 13 , 12 , 11 , 4 . 6 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 10 ( ddd , j = 12 , 11 , 11 hz , 1h ). using a syringe pump , 2 - methyltetrahydro - 4h - pyran - 4 - one ( 7 . 00 g , 61 . 3 mmol ) was added over 3 . 5 hours ( 2 ml / hour ) to a solution of 1 -( 2 , 4 - dimethoxyphenyl ) methanamine ( 9 . 21 ml , 61 . 3 mmol ) in methanol ( 137 ml ). after completion of the addition , the reaction mixture was allowed to stir at room temperature for 1 hour . this solution was then reacted with lithium borohydride ( 0 . 48 m solution in tetrahydrofuran , 153 . 2 ml , 73 . 5 mmol ) using a flow reactor [ 25 ml reactor made up of a 1 ml glass chip with two feeding channels and perfluoroalkoxy tubing ( 24 ml volume ); temperature : − 78 ° c . ; reaction concentration : 0 . 2 m ; residence time : 10 minutes ; flow rate : 1 . 25 ml / minute on both streams ]. the collected reaction mixture was diluted with saturated aqueous sodium bicarbonate solution and extracted with ethyl acetate . the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . 1 h nmr analysis at this point revealed a cis : trans ratio of 10 . 7 : 1 . silica gel chromatography ( gradient : 0 % to 20 % methanol in ethyl acetate ) afforded cis product p1 . yield : 11 . 59 g , 43 . 68 mmol , 71 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 16 ( d , j = 8 . 0 hz , 1h ), 6 . 41 - 6 . 48 ( m , 2h ), 4 . 00 ( ddd , j = 11 . 7 , 4 . 7 , 1 . 8 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 80 ( s , 3h ), 3 . 78 ( s , 2h ), 3 . 36 - 3 . 46 ( m , 2h ), 2 . 70 ( tt , j = 11 . 2 , 4 . 1 hz , 1h ), 1 . 87 - 1 . 94 ( m , 1h ), 1 . 79 - 1 . 87 ( m , 1h ), 1 . 35 - 1 . 47 ( m , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 08 - 1 . 19 ( m , 1h ). also isolated was the trans isomer c38 . yield : 1 . 24 g , 4 . 67 mmol , 7 . 6 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 14 ( d , j = 8 . 2 hz , 1h ), 6 . 42 - 6 . 48 ( m , 2h ), 3 . 84 - 3 . 94 ( m , 2h ), 3 . 82 ( s , 3h ), 3 . 81 ( s , 3h ), 3 . 69 - 3 . 77 ( m , 3h ), 2 . 97 - 3 . 02 ( m , 1h ), 1 . 72 - 1 . 82 ( m , 1h ), 1 . 44 - 1 . 66 ( m , 3h ), 1 . 14 ( d , j = 6 . 2 hz , 3h ). but - 3 - en - 1 - ol ( 39 . 0 ml , 453 mmol ) and acetaldehyde ( 25 . 5 ml , 454 mmol ) were combined in aqueous sulfuric acid ( 20 % w / w , 565 g ) and stirred at 80 ° c . for 5 days . the reaction mixture was cooled to room temperature and extracted with diethyl ether , and then with dichloromethane ; the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 25 % ethyl acetate in heptane ) afforded the product as a colorless oil . yield : 11 . 2 g , 96 . 4 mmol , 21 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 3 . 99 ( ddd , j = 11 . 8 , 4 . 9 , 1 . 7 hz , 1h ), 3 . 71 - 3 . 80 ( m , 1h ), 3 . 35 - 3 . 46 ( m , 2h ), 1 . 82 - 1 . 98 ( m , 3h ), 1 . 48 ( dddd , j = 12 . 5 , 12 . 4 , 11 . 1 , 4 . 9 hz , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ), 1 . 14 - 1 . 24 ( m , 1h ). ethenyl butanoate ( 78 . 6 ml , 620 mmol ) and novozyme 435 ( immobilized candida antarctica lipase b , 25 g ) were added to a solution of c1 ( 150 g , 1 . 29 mol ) in tetrahydrofuran ( 1 . 3 l ). the reaction mixture was stirred at room temperature for 2 hours , whereupon it was filtered through a pad of diatomaceous earth , which was then rinsed twice with dichloromethane . the combined filtrates were concentrated in vacuo and purified via silica gel chromatography ( gradient : 0 % to 10 % ethyl acetate in heptane ), providing the product as an oil . yield : 51 . 5 g , 276 mmol , 45 %. the absolute configurations of c2 and subsequent intermediates were confirmed via an x - ray structural determination carried out on c14 ( see example 2 ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 82 - 4 . 92 ( m , 1h ), 3 . 99 ( ddd , j = 11 . 9 , 4 . 9 , 1 . 7 hz , 1h ), 3 . 42 - 3 . 52 ( m , 2h ), 2 . 25 ( t , j = 7 . 4 hz , 2h ), 1 . 92 - 2 . 00 ( m , 1h ), 1 . 84 - 1 . 91 ( m , 1h ), 1 . 52 - 1 . 69 ( m , 3h ), 1 . 28 ( ddd , j = 12 , 11 , 11 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 0 . 94 ( t , j = 7 . 4 hz , 3h ). a solution of c2 ( 51 . 5 g , 276 mmol ) in methanol and tetrahydrofuran ( 1 : 1 , 700 ml ) was treated with a solution of lithium hydroxide ( 19 . 9 g , 831 mmol ) in water ( 120 ml ), and the reaction mixture was stirred overnight at room temperature . after removal of the organic solvents via concentration under reduced pressure , the aqueous residue was extracted 4 times with dichloromethane ; the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo to afford the product as a colorless oil . yield : 27 . 3 g , 235 mmol , 85 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 3 . 99 ( ddd , j = 11 . 8 , 4 . 8 , 1 . 7 hz , 1h ), 3 . 71 - 3 . 80 ( m , 1h ), 3 . 35 - 3 . 47 ( m , 2h ), 1 . 82 - 1 . 98 ( m , 3h ), 1 . 48 ( dddd , j = 12 . 5 , 12 . 4 , 11 . 1 , 4 . 8 hz , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ), 1 . 14 - 1 . 24 ( m , 1h ). a solution of c3 ( 27 . 3 g , 235 mmol ) in acetone ( 980 ml ) was cooled in an ice bath and treated drop - wise with jones reagent ( 2 . 5 m , 103 ml , 258 mmol ). the reaction mixture was stirred for 10 minutes at 0 ° c ., then warmed to room temperature , stirred for a further 30 minutes , and cooled to 0 ° c . 2 - propanol ( 18 ml , 240 mmol ) was added , and stirring was continued for 30 minutes . after the mixture had been concentrated in vacuo , the residue was partitioned between water and dichloromethane ; the aqueous layer was extracted 3 times with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated under reduced pressure to provide the product as a light yellow oil . yield : 23 g , 200 mmol , 85 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 25 ( ddd , j = 11 . 5 , 7 . 4 , 1 . 3 hz , 1h ), 3 . 70 ( dqd , j = 12 . 2 , 6 . 1 , 2 . 7 hz , 1h ), 3 . 64 ( ddd , j = 12 . 2 , 11 . 6 , 2 . 8 hz , 1h ), 2 . 55 ( dddd , j = 14 . 6 , 12 . 4 , 7 . 4 , 1 . 0 hz , 1h ), 2 . 37 ( ddd , j = 14 . 4 , 2 . 3 , 2 . 3 hz , 1h ), 2 . 21 - 2 . 31 ( m , 2h ), 1 . 29 ( d , j = 6 . 2 hz , 3h ). 1 -( 2 , 4 - dimethoxyphenyl ) methanamine ( 20 . 3 ml , 135 mmol ) was added to a solution of c4 ( 10 . 3 g , 90 . 2 mmol ) in methanol ( 200 ml ), and the reaction mixture was stirred for 1 hour at room temperature . it was then cooled to − 78 ° c . ; lithium borohydride solution ( 2 m in tetrahydrofuran , 45 . 1 ml , 90 . 2 mmol ) was added drop - wise , and stirring was continued at − 78 ° c . for 2 hours . after slowly warming to room temperature overnight , the reaction mixture was quenched via careful addition of saturated aqueous sodium bicarbonate solution . ethyl acetate ( 250 ml ) and sufficient water to solubilize the precipitate were added , and the aqueous layer was extracted with ethyl acetate ; the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) provided the product as a colorless oil ( 10 . 4 g ). similar purification of mixed fractions afforded additional product ( 3 . 7 g ). combined yield : 14 . 1 g , 53 . 1 mmol , 59 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 13 ( d , j = 8 . 0 hz , 1h ), 6 . 42 - 6 . 47 ( m , 2h ), 3 . 99 ( ddd , j = 11 . 6 , 4 . 6 , 1 . 5 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 80 ( s , 3h ), 3 . 76 ( s , 2h ), 3 . 36 - 3 . 45 ( m , 2h ), 2 . 63 - 2 . 73 ( m , 1h ), 1 . 85 - 1 . 92 ( m , 1h ), 1 . 78 - 1 . 85 ( m , 1h ), 1 . 38 ( dddd , j = 13 , 12 , 11 , 4 . 7 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 10 ( ddd , j = 11 , 11 , 11 hz , 1h ). a solution of p1 ( 200 mg , 0 . 754 mmol ) in acetonitrile ( 0 . 05 m ) was added to a slurry of (+)-( 2s )- 4 -( 1 , 3 - dioxo - 1 , 3 - dihydro - 2h - isoindol - 2 - yl )- 2 - hydroxybutanoic acid ( 93 . 9 mg , 0 . 377 mmol ) in acetonitrile ( 0 . 15 m ). the reaction mixture was heated to 75 ° c . to effect complete dissolution , and was then allowed to cool to room temperature and stir for an additional 18 hours . the resulting solid ( c39 ) was collected via filtration , washed with acetonitrile , and dissolved in dichloromethane . this solution was washed three times with 1 m aqueous sodium hydroxide solution and once with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo to afford the product as a colorless oil . the indicated absolute configuration was established via chiral hplc comparison with a known sample of p2 . the enantiomeric excess of this batch of p2 was determined to be 77 . 5 % by supercritical fluid chromatography ( column : chiral technologies chiralpak as , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 2 % ammonium hydroxide ; gradient : 5 % to 60 % b ). in this system , p2 was the second - eluting enantiomer . yield : 68 mg , 0 . 26 mmol , 69 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 13 ( d , j = 8 . 0 hz , 1h ), 6 . 46 ( d , half of ab quartet , j = 2 . 3 hz , 1h ), 6 . 44 ( dd , half of abx pattern , j = 8 . 1 , 2 . 4 hz , 1h ), 4 . 00 ( ddd , j = 11 . 7 , 4 . 7 , 1 . 8 hz , 1h ), 3 . 82 ( s , 3h ), 3 . 81 ( s , 3h ), 3 . 76 ( s , 2h ), 3 . 37 - 3 . 46 ( m , 2h ), 2 . 63 - 2 . 72 ( m , 1h ), 1 . 85 - 1 . 92 ( m , 1h ), 1 . 78 - 1 . 85 ( m , 1h ), 1 . 38 ( dddd , j = 12 . 7 , 12 . 5 , 11 . 3 , 4 . 7 hz , 1h ), 1 . 20 ( d , j = 6 . 2 hz , 3h ), 1 . 10 ( ddd , j = 12 . 3 , 11 . 3 , 11 . 1 hz , 1h ). trans - 3 - aminocyclopentanol , hydrochloride salt ( 9 . 7 g , 70 mmol ) was mixed with dichloromethane ( 120 ml ), whereupon triethylamine ( 21 . 6 ml , 155 mmol ) was added , followed by di - tert - butyl dicarbonate ( 16 . 9 g , 77 . 4 mmol ). after the reaction mixture had been stirred at room temperature overnight , water was added and the resulting mixture was extracted with dichloromethane . the organic layer was washed with water , dried over sodium sulfate , filtered , and concentrated in vacuo to afford a slightly yellow oil , which solidified upon addition of heptane . this material was collected via filtration , washed with heptane and crystallized from dichloromethane / heptane , providing the product as a white solid . yield : 11 . 86 g , 58 . 93 mmol , 84 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 36 - 4 . 54 ( m , 2h ), 4 . 10 - 4 . 25 ( br m , 1h ), 2 . 16 - 2 . 28 ( m , 1h ), 1 . 97 - 2 . 09 ( m , 2h ), 1 . 55 - 1 . 71 ( m , 2h ), 1 . 45 ( s , 9h ), 1 . 36 - 1 . 48 ( m , 2h ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 7 . 43 ml , 49 . 7 mmol ) was added to a mixture of c40 ( 5 . 00 g , 24 . 8 mmol ), toluene ( 25 ml ), and pyridine - 2 - sulfonyl fluoride ( pyfluor ; 4 . 40 g , 27 . 3 mmol ). after 16 hours at room temperature , the reaction mixture was diluted with saturated aqueous sodium bicarbonate solution ( 50 ml ) and extracted with heptane ( 3 × 100 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in heptane ) provided the product as a solid . yield : 3 . 78 g , 18 . 6 mmol , 75 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ [ 5 . 20 - 5 . 26 ( m ) and 5 . 07 - 5 . 13 ( m ), j hf = 54 hz , total 1h ], 4 . 75 - 4 . 89 ( br m , 1h ), 4 . 10 - 4 . 24 ( br m , 1h ), 1 . 99 - 2 . 21 ( m , 3h ), 1 . 66 - 1 . 95 ( m , 3h ), 1 . 45 ( s , 9h ). hydrogen chloride ( 4 m solution in 1 , 4 - dioxane , 46 . 2 ml , 185 mmol ) was added to a 0 ° c . solution of c41 ( 3 . 76 g , 18 . 5 mmol ) in tetrahydrofuran ( 54 ml ), and the reaction mixture was allowed to slowly warm to room temperature overnight . solvents were removed in vacuo , and the residue was recrystallized from 2 - propanol / heptane , affording the product as a white solid . yield : 2 . 45 g , 17 . 6 mmol , 95 %. 1 h nmr ( 400 mhz , d 2 o ) δ [ 5 . 31 - 5 . 35 ( m ) and 5 . 18 - 5 . 22 ( m ), j hf = 53 hz , total 1h ], 3 . 76 - 3 . 84 ( m , 1h ), 2 . 00 - 2 . 40 ( m , 4h ), 1 . 75 - 1 . 98 ( m , 2h ). using the method of s . specklin et al . ( tetrahedron lett . 2014 , 55 , 6987 - 6991 ), pancreatin ( sigma , from porcine pancreas , 4 × usp specifications ; 15 . 2 g ) was added to a stirring solution of cis - cyclopent - 4 - ene - 1 , 3 - diol ( 3 . 04 g , 30 . 4 mmol ), vinyl acetate ( 19 . 6 ml , 213 mmol ), and triethylamine ( 29 . 6 ml , 212 mmol ) in tetrahydrofuran ( 76 ml ). the resulting suspension was stirred for 22 hours at room temperature , whereupon it was filtered through a pad of diatomaceous earth . after the filter pad had been washed with ethyl acetate ( 50 ml ), the combined filtrates were concentrated in vacuo and purified via silica gel chromatography ( gradient : 20 % to 33 % ethyl acetate in cyclohexane ), affording the product as a yellow solid . yield : 2 . 28 g , 16 . 0 mmol , 53 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 6 . 12 ( ddd , j = 5 . 5 , 1 . 9 , 1 . 3 hz , 1h ), 5 . 99 ( ddd , j = 5 . 5 , 2 . 1 , 1 . 2 hz , 1h ), 5 . 48 - 5 . 53 ( m , 1h ), 4 . 70 - 4 . 75 ( m , 1h ), 2 . 76 - 2 . 86 ( m , 1h ), 2 . 06 ( s , 3h ), 1 . 66 ( ddd , j = 14 . 6 , 3 . 9 , 3 . 7 hz , 1h ). diisopropyl azodicarboxylate ( 94 %, 2 . 73 ml , 13 . 0 mmol ) was slowly added to a mixture of c42 ( 1 . 68 g , 11 . 8 mmol ), tetrahydrofuran ( 50 ml ), 1h - isoindole - 1 , 3 ( 2h )- dione ( 1 . 92 g , 13 . 0 mmol ), and triphenylphosphine ( 98 . 5 %, 3 . 47 g , 13 . 0 mmol ). after the reaction mixture had been stirred at room temperature for 18 hours , it was eluted through a short pad of silica gel ( 100 g ), which was then further eluted with ethyl acetate . fractions containing the product were combined , concentrated in vacuo , and subjected to chromatography on silica gel ( gradient : 0 % to 40 % ethyl acetate in heptane ), providing the product as a white solid ( 4 . 96 g ). by 1 h nmr , this material was contaminated with a substantial quantity of material derived from diisopropyl azodicarboxylate ; a portion was taken to the following step without additional purification . gcms m / z 211 . 0 [ m - acoh ] + . 1 h nmr ( 400 mhz , cdcl 3 ), product peaks only : δ 7 . 81 - 7 . 84 ( m , 2h ), 7 . 70 - 7 . 73 ( m , 2h ), 6 . 16 ( ddd , j = 5 . 7 , 2 . 3 , 2 . 2 hz , 1h ), 6 . 01 - 6 . 06 ( m , 1h ), 5 . 98 ( ddd , j = 5 . 7 , 2 . 2 , 1 . 0 hz , 1h ), 5 . 52 - 5 . 58 ( m , 1h ), 2 . 57 ( ddd , j = 14 . 4 , 7 . 2 , 4 . 7 hz , 1h ), 2 . 27 ( ddd , j = 14 . 5 , 8 . 5 , 2 . 9 hz , 1h ), 2 . 07 ( s , 3h ). 2 - aminoethanol ( 2 . 13 ml , 35 . 3 mmol ) was added to a solution of c43 ( from the previous step , 2 . 40 g , 56 . 29 mmol ) in ethyl acetate ( 20 ml ), and the reaction mixture was heated at reflux for 18 hours . more 2 - aminoethanol ( 1 . 0 ml , 17 mmol ) was added , and heating was continued for an additional 4 hours . after removal of solvent under reduced pressure , the residue was purified using silica gel chromatography [ gradient : 0 % to 10 % ( 2 m ammonia in methanol ) in dichloromethane ] to afford the product as a colorless oil ( 1 . 25 g ). this material was taken directly into the following step . to a solution of c44 ( from the previous step , 56 . 29 mmol ) in dichloromethane ( 30 ml ) was added sodium bicarbonate ( 3 . 72 g , 44 . 3 mmol ) and di - tert - butyl dicarbonate ( 3 . 86 g , 17 . 7 mmol ). the reaction mixture was stirred at room temperature overnight , whereupon it was concentrated in vacuo and used directly in the following step . potassium carbonate ( 2 . 44 g , 17 . 7 mmol ) was added to a solution of c45 ( from the previous step , 56 . 29 mmol ) in methanol ( 20 ml ). the reaction mixture was stirred at room temperature for 1 hour , whereupon it was diluted with water ( 50 ml ) and extracted with diethyl ether ( 3 × 30 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 60 % ethyl acetate in heptane ) provided the product as a white solid . yield : 783 mg , 3 . 93 mmol , 62 % over 4 steps . gcms m / z 143 . 0 [ m - 2 - methylprop - 1 - ene ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 5 . 96 - 6 . 00 ( m , 1h ), 5 . 92 - 5 . 96 ( m , 1h ), 4 . 85 - 5 . 01 ( m , 2h ), 2 . 19 ( ddd , j = 14 . 4 , 7 . 4 , 3 . 1 hz , 1h ), 1 . 95 ( ddd , j = 14 . 4 , 7 . 0 , 4 . 3 hz , 1h ), 1 . 45 ( s , 9h ). a mixture of c46 ( 315 mg , 1 . 58 mmol ) and 10 % palladium on carbon ( 150 mg ) in methanol ( 20 ml ) was hydrogenated at 60 psi for 4 hours . the catalyst was removed via filtration , and the filtrate was concentrated in vacuo and combined with the crude product from a similar reaction carried out using c46 ( 151 mg , 0 . 758 mmol ). chromatography on silica gel ( gradient : 0 % to 60 % ethyl acetate in heptane ) afforded the product as a white solid . combined yield : 286 mg , 1 . 42 mmol , 61 %. gcms m / z 145 . 0 [ m - 2 - methylprop - 1 - ene ]+. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 49 ( br s , 1h ), 4 . 36 - 4 . 42 ( m , 1h ), 4 . 09 - 4 . 24 ( br m , 1h ), 2 . 15 - 2 . 26 ( m , 1h ), 1 . 95 - 2 . 08 ( m , 2h ), 1 . 8 - 2 . 0 ( v br s , 1h ), 1 . 55 - 1 . 69 ( m , 2h ), 1 . 44 ( s , 9h ), 1 . 33 - 1 . 45 ( m , 1h ). pyridine - 2 - sulfonyl fluoride ( 252 mg , 1 . 56 mmol ) was added to a mixture of c47 ( 286 mg , 1 . 42 mmol ) in toluene ( 1 . 4 ml ). 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 0 . 425 ml , 2 . 84 mmol ) was then added , and the reaction mixture was stirred overnight at room temperature . saturated aqueous sodium bicarbonate solution ( 10 ml ) was added , and the resulting mixture was extracted with diethyl ether ( 3 × 10 ml ). the combined organic layers were dried over sodium sulfate , filtered , concentrated in vacuo , and purified via silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in heptane ), providing the product as a white solid . yield : 181 mg , 0 . 890 mmol , 63 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ [ 5 . 20 - 5 . 25 ( m ) and 5 . 07 - 5 . 12 ( m ), j hf = 54 hz , total 1h ], 4 . 76 - 4 . 88 ( br m , 1h ), 4 . 10 - 4 . 23 ( br m , 1h ), 1 . 99 - 2 . 20 ( m , 3h ), 1 . 66 - 1 . 94 ( m , 3h ), 1 . 45 ( s , 9h ). a solution of hydrogen chloride in 1 , 4 - dioxane ( 4 m , 2 . 2 ml , 8 . 8 mmol ) was added to c48 ( 181 mg , 0 . 890 mmol ), and the reaction mixture was stirred at room temperature for 3 hours . concentration in vacuo afforded the product as a white solid . yield : 121 mg , 0 . 867 mmol , 97 %. 1 h nmr ( 400 mhz , cd 3 od ) δ [ 5 . 25 - 5 . 29 ( m ) and 5 . 11 - 5 . 16 ( m ), j hf = 53 hz , total 1h ], 3 . 67 - 3 . 76 ( m , 1h ), 2 . 35 ( dddd , j = 36 . 0 , 15 . 6 , 8 . 6 , 4 . 7 hz , 1h ), 1 . 79 - 2 . 27 ( m , 5h ). triethylamine ( 2 . 6 mmol ) and benzyl chloroformate ( 0 . 136 ml , 0 . 953 mmol ) were added to a suspension of c49 ( 121 mg , 0 . 867 mmol ) in dichloromethane ( 5 ml ), and the reaction mixture was stirred at room temperature for 2 hours . it was then concentrated in vacuo and purified via chromatography on silica gel ( gradient : 0 % to 40 % ethyl acetate in heptane ), affording the product as a white solid . yield : 159 mg , 0 . 670 mmol , 77 %. specific rotation : [ α ]− 1 . 4 ° ( c 1 . 52 , dichloromethane ). gcms m / z 237 . 0 [ m + ]. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 40 ( m , 5h ), 5 . 10 ( s , 2h ), 5 . 00 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 00 - 2 . 20 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). a mixture of trans - 3 - aminocyclopentanol , hydrochloride salt ( 2 . 30 g , 16 . 7 mmol ) in water ( 15 ml ) was cooled to 0 ° c . aqueous sodium hydroxide solution ( 3 m , 12 . 3 ml , 36 . 9 mmol ) and benzyl chloroformate ( 2 . 62 ml , 18 . 4 mmol ) were added by turns . after completion of the additions , the reaction mixture was stirred at 0 ° c . for 3 hours , whereupon it was diluted with water and extracted with dichloromethane ( 3 × 30 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . the residue was recrystallized from dichloromethane / heptane to afford the product as a white solid ( 2 . 88 g ). the mother liquors were concentrated and recrystallized from dichloromethane / heptane to provide additional product ( 286 mg ). combined yield : 3 . 17 g , 13 . 5 mmol , 81 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 40 ( m , 5h ), 5 . 10 ( br s , 2h ), 4 . 60 - 4 . 77 ( br s , 1h ), 4 . 38 - 4 . 46 ( m , 1h ), 4 . 19 - 4 . 33 ( m , 1h ), 2 . 18 - 2 . 32 ( m , 1h ), 1 . 98 - 2 . 13 ( m , 2h ), 1 . 57 - 1 . 74 ( m , 2h ), 1 . 38 - 1 . 49 ( m , 1h ), 1 . 38 ( d , j = 3 . 5 hz , 1h ). pyridine - 2 - sulfonyl fluoride ( 2 . 17 g , 13 . 5 mmol ), followed by 1 , 8 - diazabicyclo [ 5 . 4 . 0 ] undec - 7 - ene ( 3 . 67 ml , 24 . 5 mmol ), was added to a solution of c50 ( 2 . 88 g , 12 . 2 mmol ) in toluene ( 20 ml ). the reaction mixture was stirred for 64 hours , whereupon saturated aqueous sodium bicarbonate solution ( 20 ml ) was added . the resulting mixture was extracted with ethyl acetate ( 3 × 20 ml ); the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 40 % ethyl acetate in heptane ) provided the product as a solid . yield : 2 . 23 g , 9 . 40 mmol , 77 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 41 ( m , 5h ), 5 . 10 ( br s , 2h ), 5 . 00 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 00 - 2 . 20 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). step 3 . isolation of benzyl [( 1r , 3s )- 3 - fluorocyclopentyl ] carbamate ( p4 ) and benzyl [( 1 s , 3r )- 3 - fluorocyclopentyl ] carbamate ( c52 ) the component enantiomers of c51 ( 1 . 60 g ) were separated using supercritical fluid chromatography [ column : phenomenex lux amylose - 2 , 5 μm ; mobile phase : 9 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was p4 , and the second - eluting enantiomer was c52 . the absolute configurations shown were assigned to the enantiomers through comparison of their rotations with the sample of p4 synthesized in preparation p4 . for p4 , yield : 612 mg , 38 % for the separation . specific rotation : [ α ]− 3 . 9 ° ( c 0 . 455 , dichloromethane ). lcms m / z 238 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 30 - 7 . 39 ( m , 5h ), 5 . 10 ( s , 2h ), 5 . 01 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 00 - 2 . 21 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). for c52 , yield : 647 mg , 40 % for the separation . specific rotation : [ α ]+ 5 . 5 ° ( c 0 . 445 , dichloromethane ). lcms m / z 238 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 29 - 7 . 39 ( m , 5h ), 5 . 10 ( s , 2h ), 5 . 01 - 5 . 27 ( m , 2h ), 4 . 20 - 4 . 31 ( br m , 1h ), 2 . 01 - 2 . 20 ( m , 3h ), 1 . 69 - 1 . 98 ( m , 3h ). a mixture of c5 ( which may be prepared according to j . gainer et al ., j . chem . soc ., perkin trans . 1 ( 1972 - 1999 ) 1976 , 9 , 994 - 997 ; 400 mg , 2 . 36 mmol ) and concentrated hydrochloric acid ( 5 ml ) was heated at 50 ° c . overnight . the reaction mixture was concentrated to provide the product . yield : 300 mg , 2 . 1 mmol , 89 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 6 . 18 ( br s , 1h ), 3 . 62 ( s , 2h ), 2 . 37 ( d , j = 0 . 6 hz , 3h ). a mixture of sodium metal ( 1 . 3 g , 56 mmol ) in methanol ( 50 ml ) was stirred at room temperature for 30 minutes , whereupon n , n - dimethylformamide ( 50 ml ) was introduced . copper ( i ) iodide ( 4 . 25 g , 22 . 3 mmol ) and 6 - bromo - 3 - nitroquinolin - 4 - ol ( 5 . 00 g , 18 . 6 mmol ) were added , and the reaction mixture was heated at 100 ° c . for 3 days . it was then cooled and filtered ; the filtrate was concentrated in vacuo and the residue was diluted with water ( 200 ml ). after adjustment of the ph to 5 - 6 via addition of concentrated hydrochloric acid , the mixture was filtered again , and the filter cake was washed with water ( 40 ml ), affording the product as a brown solid . yield : 2 . 8 g , 13 mmol , 70 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 12 ( br s , 1h ), 7 . 68 ( br d , j = 8 . 5 hz , 1h ), 7 . 65 ( d , j = 2 . 3 hz , 1h ), 7 . 42 ( dd , j = 8 . 8 , 2 . 8 hz , 1h ), 3 . 87 ( s , 3h ). phosphorus oxychloride ( 11 . 7 g , 76 . 3 mmol ) was added drop - wise to a solution of c7 ( 5 . 8 g , 26 mmol ) in n , n - dimethylformamide ( 50 ml ), and the reaction mixture was stirred at room temperature for 2 hours , whereupon it was poured into ice water ( 100 ml ). the resulting mixture was filtered and the filter cake was washed with water ( 300 ml ) to provide the product as a brown solid . yield : 4 . 5 g , 19 mmol , 73 %. this experiment was carried out in three batches . to a mixture of c8 ( 1 . 5 g , 6 . 3 mmol ) and p1 ( 2 . 18 g , 8 . 22 mmol ) in n , n - dimethylformamide ( 15 ml ) was added triethylamine ( 1 . 3 g , 13 mmol ), and the mixture was heated at 80 ° c . overnight . the three reaction mixtures were combined , diluted with water ( 300 ml ), and extracted with dichloromethane ( 3 × 150 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 3 × 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo ; purification via silica gel chromatography ( eluent : 5 : 1 petroleum ether / ethyl acetate ) afforded the product as a yellow oil . yield : 4 . 8 g , 10 mmol , 53 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 94 ( s , 1h ), 7 . 97 ( d , j = 9 . 2 hz , 1h ), 7 . 51 ( d , j = 2 . 9 hz , 1h ), 7 . 42 ( dd , j = 9 . 1 , 2 . 8 hz , 1h ), 6 . 91 ( d , j = 8 . 3 hz , 1h ), 6 . 24 ( dd , half of abx pattern , j = 8 . 3 , 2 . 4 hz , 1h ), 6 . 21 ( d , half of ab quartet , j = 2 . 3 hz , 1h ), 4 . 32 ( ab quartet , j ab = 14 . 8 hz , δν ab = 8 . 0 hz , 2h ), 3 . 98 - 4 . 05 ( m , 1h ), 3 . 88 ( s , 3h ), 3 . 73 - 3 . 84 ( m , 1h ), 3 . 70 ( s , 3h ), 3 . 48 ( s , 3h ), 3 . 38 - 3 . 47 ( m , 2h ), 1 . 82 - 2 . 00 ( m , 3h ), 1 . 51 - 1 . 62 ( m , 1h ), 1 . 18 ( d , j = 6 . 2 hz , 3h ). a solution of c9 ( 4 . 8 g , 10 mmol ) in trifluoroacetic acid ( 30 ml ) was stirred at room temperature for 30 minutes , whereupon it was diluted with dichloromethane ( 200 ml ). saturated aqueous sodium bicarbonate solution ( 200 ml ) was added , and the aqueous layer was extracted with dichloromethane ( 3 × 100 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 3 × 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure . the residue was washed with ethyl acetate ( 30 ml ) to afford the product as a yellow solid . yield : 2 . 5 g , 7 . 9 mmol , 79 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 26 ( s , 1h ), 8 . 87 ( br d , j = 8 . 9 hz , 1h ), 7 . 97 ( d , j = 10 . 0 hz , 1h ), 7 . 42 - 7 . 48 ( m , 2h ), 4 . 23 - 4 . 35 ( m , 1h ), 4 . 11 ( br dd , j = 12 , 5 hz , 1h ), 3 . 93 ( s , 3h ), 3 . 45 - 3 . 55 ( m , 2h ), 2 . 09 - 2 . 19 ( m , 2h ), 1 . 7 - 1 . 84 ( m , 1h ), 1 . 48 ( ddd , j = 12 , 12 , 11 hz , 1h ), 1 . 26 ( d , j = 6 . 3 hz , 3h ). to a solution of c10 ( 2 . 5 g , 7 . 9 mmol ) in a mixture of methanol ( 25 ml ) and acetonitrile ( 100 ml ) was added platinum ( iv ) oxide ( 500 mg , 2 . 2 mmol ). the reaction mixture was degassed and purged with hydrogen three times , then stirred at room temperature for 3 hours under a balloon containing hydrogen . the reaction mixture was filtered and the filtrate was concentrated , providing the product as a black solid , which was used without further purification . yield : 2 . 0 g , 7 . 0 mmol , 89 %. lcms m / z 287 . 9 [ m + h ] + . to a solution of c11 ( 350 mg , 1 . 22 mmol ) and c6 ( 200 mg , 1 . 4 mmol ) in n , n - dimethylformamide ( 15 ml ) was added n , n - diisopropylethylamine ( 346 mg , 2 . 68 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 3 g , 3 . 6 mmol ), and the reaction mixture was heated at 120 ° c . for 5 hours . it was then diluted with water ( 80 ml ) and extracted with ethyl acetate ( 3 × 50 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . purification via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient 18 % to 38 % b ) provided the racemic product as a white solid , which was then separated into its component enantiomers using supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the first - eluting compound was 1 , isolated as a white solid . yield : 9 . 2 mg , 23 μmol , 2 %. lcms m / z 393 . 0 [ m + h ] + . retention time : 5 . 51 minutes ( analytical column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ; flow rate : 1 . 5 ml / minute ). 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 01 ( s , 1h ), 8 . 07 ( d , j = 9 . 2 hz , 1h ), 7 . 85 - 7 . 94 ( br m , 1h ), 7 . 35 ( br d , j = 9 hz , 1h ), 6 . 24 ( s , 1h ), 5 . 04 - 5 . 20 ( br m , 1h ), 4 . 60 ( br s , 2h ), 4 . 12 - 4 . 23 ( br m , 1h ), 3 . 97 ( s , 3h ), 3 . 54 - 3 . 72 ( br m , 2h ), 2 . 6 - 2 . 72 ( br m , 1h , assumed ; partially obscured by solvent peak ), 2 . 39 ( s , 3h ), 2 . 24 - 2 . 35 ( br m , 1h ), 1 . 93 - 2 . 05 ( br m , 1h ), 1 . 78 - 1 . 90 ( br m , 1h ), 1 . 21 ( d , j = 5 . 9 hz , 3h ). the second - eluting enantiomer was c12 , also obtained as a white solid . yield : 11 . 3 mg , 28 . 8 μmol , 2 . 4 %. lcms m / z 393 . 0 [ m + h ] + . retention time : 6 . 6 minutes ( analytical conditions identical to those used for 1 ) 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 01 ( s , 1h ), 8 . 07 ( d , j = 9 . 2 hz , 1h ), 7 . 85 - 7 . 94 ( br m , 1h ), 7 . 35 ( dd , j = 9 . 3 , 2 . 5 hz , 1h ), 6 . 24 ( s , 1h ), 5 . 05 - 5 . 19 ( br m , 1h ), 4 . 59 ( br s , 2h ), 4 . 12 - 4 . 23 ( br m , 1h ), 3 . 97 ( s , 3h ), 3 . 55 - 3 . 72 ( br m , 2h ), 2 . 57 - 2 . 72 ( br m , 1h ), 2 . 39 ( s , 3h ), 2 . 22 - 2 . 36 ( br m , 1h ), 1 . 93 - 2 . 06 ( br m , 1h ), 1 . 78 - 1 . 91 ( br m , 1h ), 1 . 21 ( d , j = 6 . 0 hz , 3h ). the absolute configurations of 1 and c12 were assigned based on their relative biological activity ( see table 3 , the x - ray crystal structure determination of c14 below , and the discussion in example 5 , step 3 ). n , n - dimethylformamide ( 3 . 1 ml , 40 mmol ) and thionyl chloride ( 97 %, 6 . 9 ml , 93 mmol ) were added to a suspension of 6 - chloro - 3 - nitroquinolin - 4 - ol ( 15 . 38 g , 68 . 48 mmol ) in dichloromethane ( 140 ml ), and the reaction mixture was heated at reflux . after 5 hours , it was cooled to room temperature , diluted with additional dichloromethane ( 25 ml ), and poured into saturated aqueous sodium bicarbonate solution ( 250 ml ). the aqueous layer was extracted with dichloromethane ( 100 ml ), then passed through a plug of diatomaceous earth , which was rinsed with dichloromethane ( 50 ml ). the combined organic layers and organic filtrate were dried over magnesium sulfate , filtered , and concentrated in vacuo to afford the product as a pale tan solid . yield : 16 . 8 g , quantitative . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 25 ( s , 1h ), 8 . 42 ( d , j = 2 . 2 hz , 1h ), 8 . 17 ( d , j = 8 . 9 hz , 1h ), 7 . 89 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ). compound c13 ( 12 . 2 g , 50 . 2 mmol ) was added to a solution of p2 ( 13 . 3 g , 50 . 1 mmol ) and n , n - diisopropylethylamine ( 13 . 1 ml , 75 . 2 mmol ) in acetonitrile ( 250 ml ), and the reaction mixture was heated to 55 ° c . overnight . after concentration in vacuo , the residue was partitioned between aqueous sodium bicarbonate solution ( 100 ml ) and dichloromethane ( 150 ml ). the aqueous layer was extracted with dichloromethane ( 2 × 50 ml ) and the combined organic layers were treated with trifluoroacetic acid ( 25 ml ). { caution : exotherm !}. after 20 minutes , saturated aqueous sodium carbonate solution ( 150 ml ) was added portion - wise , and the mixture was allowed to stir for 10 minutes . the aqueous layer was extracted twice with dichloromethane , and the combined organic layers were concentrated in vacuo , providing a reddish solid ( 17 . 3 g ); this was triturated with diethyl ether ( 230 ml ) to afford a yellow solid ( 14 . 0 g ). a portion of this solid ( 10 g ) was subjected to purification via supercritical fluid chromatography ( column : lux amylose - 2 , 5 μm ; mobile phase : 65 : 35 carbon dioxide / methanol ), providing the product as a crystalline solid . the indicated absolute configuration was determined via single crystal x - ray structural determination on this material : see below . yield : 7 . 1 g , 22 mmol , 62 % ( yield corrected for material omitted from purification ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 36 ( s , 1h ), 9 . 11 ( br d , j = 9 hz , 1h ), 8 . 12 ( d , j = 2 . 0 hz , 1h ), 7 . 98 ( d , j = 8 . 9 hz , 1h ), 7 . 73 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), 4 . 21 - 4 . 33 ( m , 1h ), 4 . 08 - 4 . 15 ( m , 1h ), 3 . 50 - 3 . 60 ( m , 2h ), 2 . 11 - 2 . 22 ( m , 2h ), 1 . 77 ( dddd , j = 12 , 12 , 12 , 5 hz , 1h ), 1 . 49 ( ddd , j = 12 , 12 , 11 hz , 1h ), 1 . 28 ( d , j = 6 . 2 hz , 3h ). data collection was performed on a bruker apex diffractometer at room temperature . data collection consisted of omega and phi scans . the structure was solved by direct methods using shelx software suite in the space group p2 1 2 1 2 1 . the structure was subsequently refined by the full - matrix least squares method . all non - hydrogen atoms were found and refined using anisotropic displacement parameters . the hydrogen atom located on nitrogen was found from the fourier difference map and refined with distances restrained . the remaining hydrogen atoms were placed in calculated positions and were allowed to ride on their carrier atoms . the final refinement included isotropic displacement parameters for all hydrogen atoms . analysis of the absolute structure using likelihood methods ( hooft , 2008 ) was performed using platon ( spek , 2003 ). the results indicate that the absolute structure has been correctly assigned . the method calculates that the probability that the structure is correct is 100 . 0 . the hooft parameter is reported as 0 . 017 with an esd of 0 . 09 . the final r - index was 4 . 8 %. a final difference fourier revealed no missing or misplaced electron density . pertinent crystal , data collection and refinement information is summarized in table a . atomic coordinates , bond lengths , bond angles , torsion angles and displacement parameters are listed in tables b - e . platon , a . l . spek , j . appl . cryst . 2003 , 36 , 7 - 13 . mercury , c . f . macrae , p . r . edington , p . mccabe , e . pidcock , g . p . shields , r . taylor , m . towler , and j . van de streek , j . appl . cryst . 2006 , 39 , 453 - 457 . olex2 , o . v . dolomanov , l . j . bourhis , r . j . gildea , j . a . k . howard , and h . puschmann , j . appl . cryst . 2009 , 42 , 339 - 341 . r . w . w . hooft , l . h . straver , and a . l . spek , j . appl . cryst . 2008 , 41 , 96 - 103 . parameters ( å 2 × 10 3 ) for c14 . u ( eq ) is defined as one - third anisotropic displacement parameters ( å 2 × 10 3 ) for c14 . form : − 2π 2 [ h 2 a * 2 u 11 + . . . + 2 h k a * b * u 12 ]. zinc dust ( 97 . 5 %, 12 . 3 g , 183 mmol ) was added in one portion to a suspension of c14 ( 7 . 40 g , 23 . 0 mmol ) in methanol ( 100 ml ) and concentrated ammonium hydroxide ( 100 ml ). after 1 hour , the reaction mixture was filtered through diatomaceous earth ; the filter pad was rinsed with dichloromethane ( 70 ml ). the filtrate was diluted with water , and the aqueous layer was extracted with dichloromethane ( 2 × 60 ml ). the combined organic layers were dried over sodium sulfate , filtered , concentrated in vacuo , and purified via silica gel chromatography ( gradient : 40 % to 100 % ethyl acetate in heptane ) to provide the product . yield : 3 . 68 g , 12 . 6 mmol , 55 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 48 ( s , 1h ), 7 . 91 ( d , j = 8 . 9 hz , 1h ), 7 . 74 ( d , j = 2 . 2 hz , 1h ), 7 . 40 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), 4 . 02 ( br dd , j = 12 , 5 hz , 1h ), 3 . 88 ( br s , 2h ), 3 . 29 - 3 . 56 ( m , 4h ), 1 . 82 - 1 . 96 ( m , 2h ), 1 . 56 ( dddd , j = 12 , 12 , 12 , 5 hz , 1h ), 1 . 21 - 1 . 31 ( m , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ). to a mixture of c15 ( 400 mg , 1 . 37 mmol ) and ( 5 - methoxypyridin - 2 - yl ) acetic acid ( 229 mg , 1 . 37 mmol ) in n , n - dimethylformamide ( 3 ml ) was added n , n - diisopropylethylamine ( 532 mg , 4 . 12 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 1 . 31 g , 4 . 12 mmol , as a 50 % solution in ethyl acetate ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was cooled to room temperature , combined with two similar , small - scale , reactions carried out on c15 ( total of 40 mg , 0 . 14 mmol ) and diluted with water ( 100 ml ). the resulting mixture was extracted with dichloromethane ( 2 × 200 ml ), and the combined organic layers were concentrated in vacuo . silica gel chromatography ( eluent : 2 % methanol in ethyl acetate ), followed by reversed phase hplc ( column : dikma diamonsil ( 2 ) c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 22 % to 42 % b ), afforded the product as a yellow solid . yield : 147 mg , 0 . 348 mmol , 23 %. lcms m / z 423 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 9 . 16 ( s , 1h ), 8 . 70 - 8 . 82 ( br m , 1h ), 8 . 17 - 8 . 22 ( m , 2h ), 7 . 75 ( dd , j = 8 . 8 , 2 . 1 hz , 1h ), 7 . 35 - 7 . 43 ( m , 2h ), 5 . 23 - 5 . 42 ( br m , 1h ), 4 . 69 ( s , 2h ), 4 . 18 - 4 . 26 ( m , 1h ), 3 . 86 ( s , 3h ), 3 . 61 - 3 . 76 ( br m , 2h ), 2 . 56 - 2 . 69 ( br m , 1h ), 2 . 24 - 2 . 41 ( br m , 1h ), 1 . 75 - 1 . 91 ( br m , 1h ), 1 . 61 - 1 . 75 ( br m , 1h ), 1 . 28 ( d , j = 6 . 2 hz , 3h ). 6 - bromo - 4 - chloro - 3 - nitroquinoline ( 1 . 93 g , 6 . 71 mmol ) was added to a solution of p2 ( 2 . 35 g , 8 . 86 mmol ) and n , n - diisopropylethylamine ( 3 . 4 ml , 20 mmol ) in acetonitrile ( 39 ml ), and the reaction mixture was heated to 45 ° c . for 18 hours . acetic acid ( 1 . 8 ml , 24 mmol ) was then added , and stirring was continued for 5 hours at 100 ° c ., whereupon the reaction mixture was allowed to cool to room temperature and stir for 18 hours . after solvent had been removed in vacuo , the residue was taken up in dichloromethane and washed with saturated aqueous sodium bicarbonate solution . the organic layer was loaded onto a silica gel column and eluted ( gradient : 0 % to 5 % methanol in dichloromethane ), affording the product as a brown oil . yield : 1 . 40 g , 3 . 82 mmol , 57 %. lcms m / z 366 . 0 , 368 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 37 ( s , 1h ), 9 . 13 ( br d , j = 9 hz , 1h ), 8 . 30 ( br d , j = 2 . 0 hz , 1h ), 7 . 91 ( br d , half of ab quartet , j = 8 . 8 hz , 1h ), 7 . 86 ( dd , half of abx pattern , j = 8 . 9 , 2 . 0 hz , 1h ), 4 . 21 - 4 . 32 ( m , 1h ), 4 . 12 ( ddd , j = 12 . 1 , 4 . 7 , 1 . 7 hz , 1h ), 3 . 52 - 3 . 60 ( m , 2h ), 2 . 11 - 2 . 21 ( m , 2h ), 1 . 78 ( dddd , j = 12 , 12 , 11 , 5 hz , 1h ), 1 . 49 ( ddd , j = 13 , 11 , 11 hz , 1h ), 1 . 28 ( d , j = 6 . 2 hz , 3h ). zinc ( 97 . 5 %, 2 . 33 g , 34 . 7 mmol ) was added in one portion to a 0 ° c . suspension of c16 ( 1 . 40 g , 3 . 82 mmol ) in methanol ( 6 ml ) and concentrated ammonium hydroxide ( 6 ml ), and the reaction mixture was stirred at 0 ° c . for 30 minutes . it was then allowed to warm to room temperature and stir for 45 minutes , whereupon it was filtered through diatomaceous earth . the filter cake was rinsed with dichloromethane , and the combined filtrates were diluted with water . the aqueous layer was extracted with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 3 % methanol in dichloromethane ) provided the product as a tan foam . yield : 836 mg , 2 . 49 mmol , 65 %. lcms m / z 336 . 1 , 338 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 49 ( s , 1h ), 7 . 92 ( d , j = 2 . 1 hz , 1h ), 7 . 84 ( d , j = 8 . 8 hz , 1h ), 7 . 53 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 4 . 03 ( ddd , j = 11 . 8 , 4 . 7 , 1 . 7 hz , 1h ), 3 . 88 ( br s , 2h ), 3 . 33 - 3 . 56 ( m , 4h ), 1 . 82 - 1 . 96 ( m , 2h ), 1 . 50 - 1 . 62 ( m , 1h ), 1 . 26 ( ddd , j = 12 , 11 , 11 hz , 1h ), 1 . 21 ( d , j = 6 . 2 hz , 3h ). a mixture of c17 ( 836 mg , 2 . 49 mmol ), c6 ( 281 mg , 1 . 99 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 9 ml , 3 . 2 mmol ), and n , n - diisopropylethylamine ( 0 . 87 ml , 5 . 0 mmol ) in ethyl acetate ( 10 ml ) was stirred at 50 ° c . overnight . acetic acid ( 1 equivalent ) was added , and heating was continued at 115 ° c . for 5 hours , whereupon the reaction mixture was allowed to cool to room temperature and stir for 18 hours . after removal of volatiles in vacuo , the residue was taken up in dichloromethane and washed with saturated aqueous sodium bicarbonate solution . the organic layer was loaded onto a silica gel column and eluted ( gradient : 0 % to 5 % methanol in dichloromethane ) to provide the product as a tan solid . yield : 507 mg , 1 . 15 mmol , 58 %. lcms m / z 441 . 2 , 443 . 3 [ m + h ] + . tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 262 mg , 0 . 227 mmol ) was added to a mixture of c18 ( 500 mg , 1 . 13 mmol ) and zinc cyanide ( 99 %, 644 mg , 5 . 43 mmol ) in n , n - dimethylformamide ( 5 ml ), and the reaction flask was subjected to three cycles of evacuation followed by nitrogen fill . the reaction mixture was then heated at 100 ° c . for 20 hours , whereupon it was partitioned between water and ethyl acetate , and filtered through diatomaceous earth . the filter cake was rinsed with ethyl acetate , and the aqueous layer from the combined filtrates was extracted twice with ethyl acetate . the combined organic layers were washed 5 times with water , dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient , 0 % to 3 % methanol in methylene chloride ) provided a mixture of product and c18 ( 324 mg , ˜ 1 : 1 ), so this material was resubjected to the reaction conditions . tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 172 mg , 0 . 149 mmol ) was added to a mixture of zinc cyanide ( 99 %, 422 mg , 3 . 56 mmol ) and the material containing c18 and 3 ( 324 mg ) in n , n - dimethylformamide ( 2 ml ), and the reaction flask was subjected to three cycles of evacuation followed by nitrogen fill . the reaction mixture was then heated at 100 ° c . for 2 hours , partitioned between water and ethyl acetate , and filtered through diatomaceous earth . the filter cake was rinsed with ethyl acetate and with water , and the aqueous layer from the combined filtrates was extracted twice with ethyl acetate . the combined organic layers were washed 5 times with water , dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) yielded an oil , which was triturated with diethyl ether to afford a tan solid . this was recrystallized from ethyl acetate / heptane to provide the product as an off - white solid . yield : 97 mg , 0 . 25 mmol , 22 %. lcms m / z 388 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 41 ( s , 1h ), 8 . 9 - 9 . 1 ( br m , 1h ), 8 . 38 ( d , j = 8 . 7 hz , 1h ), 7 . 86 ( dd , j = 8 . 6 , 1 . 5 hz , 1h ), 6 . 02 ( br s , 1h ), 5 . 15 - 5 . 28 ( br m , 1h ), 4 . 53 ( s , 2h ), 4 . 32 ( br dd , j = 12 , 5 hz , 1h ), 3 . 66 - 3 . 79 ( br m , 2h ), 2 . 53 - 2 . 69 ( br m , 1h ), 2 . 41 ( s , 3h ), 2 . 23 - 2 . 4 ( br m , 1h ), 1 . 66 - 1 . 96 ( br m , 2h ), 1 . 36 ( d , j = 6 . 2 hz , 3h ). a mixture of c15 ( 400 mg , 1 . 4 mmol ), ( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) acetic acid ( 155 mg , 1 . 10 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 0 ml , 1 . 7 mmol ), and n , n - diisopropylethylamine ( 0 . 48 ml , 2 . 8 mmol ) in ethyl acetate ( 10 ml ) was stirred at 50 ° c . overnight . the reaction mixture was concentrated in vacuo to remove most of the ethyl acetate , then diluted with acetic acid and heated to 115 ° c . when the reaction was judged to be complete by lcms analysis , the reaction mixture was concentrated under reduced pressure , taken up in dichloromethane , and washed with saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted once with dichloromethane , and the combined organic layers were adsorbed onto silica gel and chromatographed ( eluent : ethyl acetate ). the product ( 405 mg ) was mixed with diethyl ether and allowed to stir for 2 days , whereupon the solid was collected by filtration and washed with a mixture of 3 : 1 heptane / diethyl ether , to afford the product ( 239 mg ) as a solid . this material was shown to be crystalline via powder x - ray diffraction . the combined filtrates were concentrated in vacuo , mixed with diethyl ether ( 4 ml ), and stirred for 2 hours , whereupon heptane ( 1 ml ) was added . after 2 hours , heptane ( 2 ml ) was again added , and stirring was continued overnight . additional heptane ( 1 ml ) was added , and after stirring overnight once more , the solid present was isolated via filtration and rinsed with heptane , to provide additional product ( 99 mg ). total yield : 338 mg , 0 . 852 mmol , 77 %. lcms m / z 397 . 3 , 399 . 3 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 29 ( s , 1h ), 8 . 58 - 8 . 73 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 64 ( dd , j = 8 . 8 , 2 . 0 hz , 1h ), 6 . 00 ( br s , 1h ), 5 . 09 - 5 . 25 ( br m , 1h ), 4 . 51 ( s , 2h ), 4 . 30 ( br dd , j = 12 , 5 hz , 1h ), 3 . 65 - 3 . 79 ( br m , 2h ), 2 . 59 - 2 . 77 ( br m , 1h ), 2 . 40 ( s , 3h ), 2 . 32 - 2 . 47 ( m , 1h ), 1 . 73 - 1 . 88 ( br m , 1h ), 1 . 35 ( d , j = 6 . 2 hz , 3h ). this experiment was carried out in two identical batches . to a 0 ° c . mixture of hydroxylamine hydrochloride ( 39 . 3 g , 566 mmol ) in ethanol ( 1 . 2 l ) was added triethylamine ( 86 g , 850 mmol ). after this mixture had stirred for 10 minutes , ethyl cyanoacetate ( 32 g , 280 mmol ) was added drop - wise , and the reaction mixture was allowed to warm to room temperature and stir overnight . additional triethylamine ( 86 g , 850 mmol ) was introduced , followed by acetic anhydride ( 89 . 5 g , 877 mmol ), and stirring was continued for 2 hours at room temperature . the reaction mixture was then stirred overnight at 90 ° c . at this point , the two batches were combined and concentrated in vacuo . the residue was partitioned between ethyl acetate ( 1 l ) and hydrochloric acid ( 1 m , 500 ml ), and the aqueous layer was extracted with ethyl acetate ( 2 × 100 ml ); the combined organic layers were washed with saturated aqueous sodium bicarbonate solution ( 1 l ) until the ph reached 7 , then dried over sodium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 0 % to 20 % ethyl acetate in petroleum ether ) afforded the product as a colorless oil . yield : 20 . 0 g , 118 mmol , 21 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 4 . 20 ( q , j = 7 . 1 hz , 2h ), 3 . 76 ( s , 2h ), 2 . 58 ( s , 3h ), 1 . 26 ( t , j = 7 . 2 hz , 3h ). a mixture of c19 ( 4 . 30 g , 25 . 3 mmol ) and hydrochloric acid ( 2 m , 50 ml , 100 mmol ) was stirred for 2 days at room temperature , then warmed to 50 ° c . for 2 days . concentrated hydrochloric acid ( 2 ml ) was added , and heating was continued at 50 ° c . for 66 hours , whereupon the reaction mixture was cooled to room temperature and concentrated in vacuo , to a volume of approximately 10 ml . this was extracted eight times with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated under reduced pressure to afford the product as a white solid . yield : 2 . 85 g , 20 . 1 mmol , 79 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( br s , 1h ), 3 . 86 ( s , 2h ), 2 . 62 ( s , 3h ). a mixture of c15 ( 770 mg , 2 . 64 mmol ), c20 ( 300 mg , 2 . 11 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 0 ml , 3 . 4 mmol ), and n , n - diisopropylethylamine ( 0 . 92 ml , 5 . 3 mmol ) in ethyl acetate ( 10 ml ) was heated at 60 ° c . for 2 hours , then at reflux for 2 hours . additional 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 0 ml , 3 . 4 mmol ) was introduced , and heating at reflux was continued overnight . the reaction mixture was concentrated in vacuo to remove the majority of the ethyl acetate , then diluted with acetic acid and heated to 100 ° c . overnight . after removal of solvents under reduced pressure , the residue was taken up in dichloromethane and washed with saturated aqueous sodium bicarbonate solution ; the aqueous layer was extracted with dichloromethane , and the combined organic layers were adsorbed onto diatomaceous earth and chromatographed using silica gel ( gradient : 0 % to 5 % methanol in dichloromethane ). the product ( 739 mg ) was mixed with diethyl ether ( 7 ml ) and stirred for 2 days . the resulting solid was collected via filtration and rinsed with 3 : 1 heptane / diethyl ether , affording the product as an off - white solid ( 329 mg ). the combined filtrates were concentrated in vacuo , dissolved in diethyl ether ( 3 ml ) and stirred for 2 days . filtration and washing of the filter cake with 3 : 1 heptane / diethyl ether provided additional product as an off - white solid . combined yield : 390 mg , 0 . 98 mmol , 46 %. lcms m / z 398 . 2 , 400 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 29 ( s , 1h ), 8 . 56 - 8 . 78 ( br m , 1h ), 8 . 24 ( d , j = 8 . 8 hz , 1h ), 7 . 65 ( dd , j = 8 . 9 , 1 . 9 hz , 1h ), 4 . 94 - 5 . 17 ( br m , 1h ), 4 . 60 ( s , 2h ), 4 . 28 - 4 . 39 ( m , 1h ), 3 . 63 - 3 . 81 ( br m , 2h ), 2 . 67 - 2 . 88 ( br m , 1h ), 2 . 60 ( s , 3h ), 2 . 38 - 2 . 6 ( br m , 1h ), 1 . 80 - 2 . 08 ( br m , 2h ), 1 . 38 ( d , j = 6 . 2 hz , 3h ). compared to example 5 , the enantiomer of example 5 ( example 51 ) proved to be significantly less potent ( see table 3 for biological activity data ). the absolute configurations of separated enantiomers described herein were assigned on the basis of their relative biological activity in accordance with these two compounds . triethylamine ( 364 mg , 3 . 60 mmol ) was added to a mixture of 6 - bromo - 4 - chloro - 3 - nitroquinoline ( 515 mg , 1 . 79 mmol ) and ( 1 s , 3r )- 3 - fluorocyclopentanamine ( 250 mg , 2 . 4 mmol ) in tetrahydrofuran ( 10 ml ), and the reaction mixture was heated at 45 ° c . for 2 hours . it was then diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 20 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo , providing the product as a yellow solid . yield : 439 mg , 1 . 24 mmol , 69 %. lcms m / z 355 . 6 [ m + h ] + . to a mixture of c21 ( 500 mg , 1 . 4 mmol ) in methanol ( 50 ml ) and acetonitrile ( 10 ml ) was added platinum ( iv ) oxide ( 50 mg , 0 . 22 mmol ). the suspension was degassed and purged with hydrogen three times , whereupon the reaction mixture was stirred at room temperature for 1 . 5 hours under a balloon of hydrogen . after filtration of the reaction mixture , the filter cake was washed with acetonitrile ( 3 × 10 ml ), and the combined filtrates were concentrated in vacuo to provide the product as a yellow oil . yield : 400 mg , 1 . 2 mmol , 86 %. lcms m / z 323 . 8 [ m + h ] + . a solution of c22 ( 90 mg , 0 . 28 mmol ) and acetic acid ( catalytic quantity ) in 1 , 1 , 1 - triethoxyethane ( 5 ml ) was stirred at 110 ° c . overnight , whereupon the reaction mixture was concentrated in vacuo . purification via reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 25 % to 45 % b ) provided the product as a yellow solid . yield : 30 . 2 mg , 86 . 7 μmol , 31 %. lcms m / z 350 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 22 ( s , 1h ), 8 . 69 - 8 . 73 ( m , 1h ), 8 . 11 ( d , j = 9 . 0 hz , 1h ), 7 . 86 ( dd , j = 8 . 9 , 1 . 9 hz , 1h ), 5 . 40 - 5 . 53 ( m , 1 . 5h ), 5 . 31 - 5 . 38 ( m , 0 . 5h ), 2 . 8 - 2 . 96 ( m , 1h ), 2 . 78 ( s , 3h ), 2 . 01 - 2 . 5 ( m , 5h ). concentrated nitric acid ( 1 . 5 ml ) was added to a solution of 1 , 5 - naphthyridin - 4 - ol ( 600 mg , 4 . 1 mmol ) in concentrated sulfuric acid ( 4 . 5 ml ), and the reaction mixture was stirred at 90 ° c . overnight . it was then poured into water , cooled in an ice bath , and adjusted to a ph of 6 - 7 by addition of aqueous ammonium hydroxide . the resulting mixture was stirred in the ice bath for 10 minutes , then filtered ; the collected solid was washed with water to afford the product as a yellow solid . yield : 0 . 60 g , 3 . 1 mmol , 76 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 8 . 96 ( s , 1h ), 8 . 55 - 8 . 60 ( m , 1h ), 7 . 98 ( br d , j = 8 . 2 hz , 1h ), 7 . 54 ( dd , j = 8 . 3 , 4 . 3 hz , 1h ). phosphorus oxychloride ( 624 mg , 4 . 08 mmol ) was added drop - wise to a solution of c23 ( 0 . 60 g , 3 . 1 mmol ) in n , n - dimethylformamide ( 10 ml ). the reaction mixture was stirred at room temperature for 2 hours , whereupon it was poured into ice water ( 80 ml ). the resulting mixture was filtered and the filter cake was washed with water ( 30 ml ), affording the product as a yellow solid . yield : 0 . 36 g , 1 . 7 mmol , 55 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 50 ( s , 1h ), 9 . 28 ( dd , j = 4 . 1 , 1 . 5 hz , 1h ), 8 . 65 ( dd , j = 8 . 5 , 1 . 5 hz , 1h ), 8 . 09 ( dd , j = 8 . 5 , 4 . 1 hz , 1h ). triethylamine ( 580 mg , 5 . 7 mmol ) was added to a mixture of c24 ( 600 mg , 2 . 9 mmol ) and p1 ( 761 mg , 2 . 87 mmol ) in n , n - dimethylformamide ( 10 ml ). the reaction mixture was heated at 50 ° c . for 1 hour , whereupon it was diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 30 ml ). after the combined organic layers had been washed with saturated aqueous sodium chloride solution ( 100 ml ), they were dried over sodium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel ( gradient : 0 % to 40 % ethyl acetate in petroleum ether ) provided the product as a yellow solid . yield : 1 . 0 g , 2 . 3 mmol , 80 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 96 ( s , 1h ), 8 . 90 ( dd , j = 4 . 1 , 1 . 7 hz , 1h ), 8 . 29 ( dd , j = 8 . 5 , 1 . 7 hz , 1h ), 7 . 65 ( dd , j = 8 . 5 , 4 . 1 hz , 1h ), 6 . 89 ( d , j = 9 . 0 hz , 1h ), 6 . 16 - 6 . 20 ( m , 2h ), 4 . 76 - 4 . 86 ( m , 1h ), 4 . 56 ( ab quartet , j ab = 16 . 1 hz , δν ab = 18 . 6 hz , 2h ), 4 . 07 - 4 . 14 ( m , 1h ), 3 . 69 ( s , 3h ), 3 . 47 - 3 . 55 ( m , 2h ), 3 . 46 ( s , 3h ), 2 . 25 - 2 . 34 ( m , 2h ), 2 . 04 - 2 . 16 ( m , 1h ), 1 . 76 - 1 . 88 ( m , 1h ), 1 . 27 ( d , j = 6 . 3 hz , 3h ). a mixture of c25 ( 1 . 0 g , 2 . 3 mmol ) and trifluoroacetic acid ( 20 ml ) was stirred at room temperature for 30 minutes , whereupon it was concentrated in vacuo . after the residue had been adjusted to a ph of 7 - 8 via addition of saturated aqueous sodium bicarbonate solution ( 100 ml ), it was extracted with ethyl acetate ( 3 × 30 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product as a yellow solid . yield : 0 . 60 g , 2 . 1 mmol , 91 %. 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 41 ( br s , 1h ), 8 . 83 ( dd , j = 4 . 1 , 1 . 6 hz , 1h ), 8 . 29 ( br dd , j = 8 . 4 , 1 . 6 hz , 1h ), 7 . 69 ( dd , j = 8 . 5 , 4 . 1 hz , 1h ), 4 . 11 ( br dd , j = 12 , 4 hz , 1h ), 3 . 59 - 3 . 69 ( m , 2h ), 2 . 15 - 2 . 30 ( m , 2h ), 1 . 61 - 1 . 74 ( m , 1h ), 1 . 35 - 1 . 45 ( m , 1h ), 1 . 28 ( d , j = 6 . 3 hz , 3h ). to a suspension of c26 ( 600 mg , 2 . 1 mmol ) in tetrahydrofuran ( 10 ml ) and water ( 5 ml ) was added zinc dust ( 677 mg , 10 . 4 mmol ) and ammonium chloride ( 551 mg , 10 . 3 mmol ). the reaction mixture was then stirred at 60 ° c . for 40 minutes , whereupon it was diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 50 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to afford the product as a yellow solid . yield : 0 . 40 g , 1 . 5 mmol , 71 %. lcms m / z 259 . 0 [ m + h ] + . 1 , 1 ′- carbonyldiimidazole ( cdi , 250 mg , 1 . 54 mmol ) was added to a mixture of c27 ( 200 mg , 0 . 77 mmol ) and 1 , 3 - thiazol - 4 - ylacetic acid ( 138 mg , 0 . 964 mmol ) in n , n - dimethylformamide ( 3 ml ). the reaction mixture was heated at 50 ° c . overnight , whereupon it was diluted with water ( 30 ml ) and extracted with ethyl acetate ( 3 × 30 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product , which was carried directly into the following step . lcms m / z 384 . 2 [ m + h ] + . compound c28 ( from the previous step , 295 mg , & lt ; 0 . 77 mmol ) and acetic acid ( 2 ml ) were combined in a sealed tube and heated in a microwave reactor at 155 ° c . for 20 minutes . the reaction mixture was concentrated in vacuo and purified by reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 23 % to 43 % b ) to afford a racemic mixture of the products as a yellow solid . yield : 25 mg , 68 μmol , 9 % over 2 steps . the component enantiomers were separated via supercritical fluid chromatography ( column : chiralcel od - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). example 7 , the second - eluting enantiomer , was isolated as a yellow solid . yield : 9 . 0 mg , 25 μmol , 3 % over two steps . retention time : 6 . 37 minutes ( analytical column : chiralcel od - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient as above ; flow rate : 1 . 5 ml / minute ). lcms m / z 366 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 26 ( s , 1h ), 9 . 05 ( d , j = 1 . 9 hz , 1h ), 9 . 02 ( dd , j = 4 . 3 , 1 . 6 hz , 1h ), 8 . 53 ( dd , j = 8 . 5 , 1 . 7 hz , 1h ), 7 . 74 ( dd , j = 8 . 5 , 4 . 3 hz , 1h ), 7 . 65 ( br s , 1h ), 4 . 86 - 5 . 05 ( br m , 1h ), 4 . 76 ( s , 2h ), 3 . 96 - 4 . 05 ( m , 1h ), 3 . 44 - 3 . 60 ( m , 2h ), 3 . 13 - 3 . 3 ( br m , 1h ), 2 . 85 - 3 . 07 ( br m , 1h ), 1 . 31 - 1 . 55 ( br m , 2h ), 1 . 13 ( d , j = 6 . 2 hz , 3h ). enantiomer c29 eluted first , and was also isolated as a yellow solid . yield : 6 . 5 mg , 18 μmol , 2 % over two steps . retention time : 6 . 16 minutes using an identical analytical hplc system . lcms m / z 366 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 26 ( s , 1h ), 9 . 05 ( d , j = 2 . 0 hz , 1h ), 9 . 02 ( dd , j = 4 . 1 , 1 . 6 hz , 1h ), 8 . 53 ( dd , j = 8 . 4 , 1 . 6 hz , 1h ), 7 . 74 ( dd , j = 8 . 4 , 4 . 3 hz , 1h ), 7 . 65 ( br s , 1h ), 4 . 86 - 5 . 05 ( br m , 1h ), 4 . 76 ( s , 2h ), 3 . 97 - 4 . 04 ( m , 1h ), 3 . 44 - 3 . 60 ( m , 2h ), 3 . 14 - 3 . 28 ( br m , 1h ), 2 . 86 - 3 . 08 ( br m , 1h ), 1 . 31 - 1 . 56 ( br m , 2h ), 1 . 13 ( d , j = 6 . 2 hz , 3h ). a solution of 1 , 3 , 4 - thiadiazol - 2 - amine ( 3 . 0 g , 30 mmol ) and ethyl 4 - chloro - 3 - oxobutanoate ( 7 . 4 g , 45 mmol ) in anhydrous ethanol ( 50 ml ) was heated at reflux for 24 hours , whereupon the reaction mixture was concentrated in vacuo . the residue was dissolved in 10 % hydrochloric acid , and washed with chloroform ( 3 × 50 ml ); the aqueous layer was then neutralized with sodium bicarbonate and extracted with chloroform ( 3 × 50 ml ). the combined organic extracts were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow oil . yield : 1 . 0 g , 4 . 7 mmol , 16 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 51 ( s , 1h ), 7 . 80 ( t , j = 0 . 7 hz , 1h ), 4 . 21 ( q , j = 7 . 2 hz , 2h ), 3 . 77 ( d , j = 0 . 6 hz , 2h ), 1 . 29 ( t , j = 7 . 2 hz , 3h ). a solution of c30 ( 1 . 0 g , 4 . 7 mmol ) in hydrochloric acid ( 5 ml ) was heated at reflux overnight . the reaction mixture was then concentrated in vacuo , and the residue was washed with dichloromethane ( 10 ml ) to afford the product as a brown solid . yield : 1 g , quantitative . lcms m / z 184 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 40 ( s , 1h ), 8 . 28 ( br s , 1h ), 3 . 79 ( br s , 2h ). to a mixture of c15 ( 850 mg , 2 . 91 mmol ) and c31 ( 640 mg , 3 . 5 mmol ) in n , n - dimethylformamide ( 20 ml ) was added n , n - diisopropylethylamine ( 828 mg , 6 . 41 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 5 . 5 g , 8 . 6 mmol ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was diluted with water ( 50 ml ) and extracted with dichloromethane ( 3 × 50 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 150 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : 10 : 1 dichloromethane / methanol ) provided the product as a yellow solid . yield : 372 mg , 0 . 848 mmol , 29 %. lcms m / z 438 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 29 ( s , 1h ), 8 . 60 - 8 . 75 ( br m , 1h ), 8 . 53 ( s , 1h ), 8 . 22 ( d , j = 8 . 8 hz , 1h ), 7 . 79 ( s , 1h ), 7 . 63 ( dd , j = 8 . 7 , 1 . 9 hz , 1h ), 5 . 29 - 5 . 42 ( m , 1h ), 4 . 58 ( br s , 2h ), 4 . 30 ( br dd , j = 12 , 5 hz , 1h ), 3 . 65 - 3 . 80 ( br m , 2h ), 2 . 61 - 2 . 82 ( br m , 1h ), 2 . 34 - 2 . 54 ( br m , 1h ), 1 . 71 - 1 . 97 ( br m , 2h ), 1 . 35 ( d , j = 6 . 2 hz , 3h ). a mixture of c15 ( 280 mg , 0 . 96 mmol ), cyanoacetic acid ( 65 . 3 mg , 0 . 768 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 635 mg , 2 . 00 mmol , as a 50 % solution in ethyl acetate ), and n , n - diisopropylethylamine ( 0 . 34 ml , 2 . 0 mmol ) in ethyl acetate ( 8 ml ) was stirred for 1 hour , then treated with additional 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 0 ml , 1 . 7 mmol ) and heated at reflux overnight . the reaction mixture was cooled to room temperature , diluted with additional ethyl acetate and washed with saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted with ethyl acetate , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel ( gradient : 50 % to 100 % ethyl acetate in heptane ) afforded the product as a white solid . yield : 159 mg , 0 . 466 mmol , 61 %. lcms m / z 341 . 2 , 343 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 30 ( s , 1h ), 8 . 5 - 8 . 8 ( v br m , 1h ), 8 . 26 ( d , j = 9 . 0 hz , 1h ), 7 . 69 ( dd , j = 8 . 8 , 2 . 0 hz , 1h ), 4 . 8 - 5 . 1 ( v br m , 1h ), 4 . 35 - 4 . 43 ( m , 1h ), 4 . 29 ( s , 2h ), 3 . 73 - 3 . 86 ( m , 2h ), 2 . 35 - 2 . 95 ( v br m , 2h ), 2 . 05 - 2 . 29 ( br m , 2h ), 1 . 41 ( d , j = 6 . 0 hz , 3h ). a mixture of c15 ( 889 mg , 3 . 05 mmol ), 1 , 3 - thiazol - 4 - ylacetic acid ( 438 mg , 2 . 44 mmol ), 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 2 . 3 ml , 3 . 9 mmol ), and n , n - diisopropylethylamine ( 1 . 1 ml , 6 . 3 mmol ) in ethyl acetate ( 14 ml ) was stirred for 1 hour and 45 minutes at room temperature , then heated at 50 ° c . for 1 hour . acetic acid ( 30 ml ) was added , and the reaction mixture was stirred at 115 ° c . for 66 hours . solvents were removed in vacuo ; the residue was diluted with saturated aqueous sodium bicarbonate solution and extracted three times with ethyl acetate . the combined organic layers were dried over magnesium sulfate , filtered , and concentrated under reduced pressure . after silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ), the material obtained from the clean fractions was dissolved in ethyl acetate , treated with activated charcoal , and filtered . the filtrate was concentrated in vacuo and purified via silica gel chromatography ( eluent : diethyl ether ) to afford the product as a white foam . yield : 584 mg , 1 . 46 mmol , 60 %. lcms m / z 399 . 2 , 401 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 29 ( s , 1h ), 8 . 80 - 8 . 83 ( m , 1h ), 8 . 58 - 8 . 71 ( br m , 1h ), 8 . 22 ( d , j = 8 . 9 hz , 1h ), 7 . 63 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 24 ( br s , 1h ), 5 . 20 - 5 . 34 ( m , 1h ), 4 . 72 ( s , 2h ), 4 . 29 ( br dd , j = 12 , 5 hz , 1h ), 3 . 60 - 3 . 76 ( br m , 2h ), 2 . 60 - 2 . 80 ( br m , 1h ), 2 . 33 - 2 . 51 ( br m , 1h ), 1 . 7 - 1 . 87 ( br m , 1h ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). 3 - chloroperoxybenzoic acid ( mcpba , 547 mg , 3 . 17 mmol ) was added to a solution of c32 ( 972 mg , 2 . 44 mmol ) in dichloromethane ( 12 ml ). after stirring at room temperature overnight , the reaction mixture was treated with saturated aqueous sodium bicarbonate solution ( 30 ml ) and stirred for an additional 20 minutes . the aqueous layer was extracted three times with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) provided the product as a yellow solid . yield : 1 . 0 g , 2 . 4 mmol , 98 %. lcms m / z 415 . 3 , 417 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 05 ( d , j = 9 . 4 hz , 1h ), 9 . 03 ( s , 1h ), 8 . 81 ( d , j = 1 . 8 hz , 1h ), 8 . 63 - 8 . 76 ( br m , 1h ), 7 . 70 ( dd , j = 9 . 4 , 1 . 8 hz , 1h ), 5 . 23 - 5 . 36 ( m , 1h ), 4 . 68 ( s , 2h ), 4 . 30 ( dd , j = 12 . 1 , 5 . 1 hz , 1h ), 3 . 61 - 3 . 80 ( m , 2h ), 2 . 53 - 2 . 71 ( br m , 1h ), 2 . 25 - 2 . 42 ( br m , 1h ), 1 . 78 - 1 . 93 ( br m , 1h ), 1 . 65 - 1 . 78 ( br m , 1h ), 1 . 34 ( d , j = 6 . 2 hz , 3h ). phosphorus oxychloride ( 98 %, 0 . 17 ml , 1 . 8 mmol ) was added to a solution of c33 ( 300 mg , 0 . 72 mmol ) in chloroform ( 4 ml ), and the reaction mixture was heated to 70 ° c . for 1 . 5 hours . after cooling to room temperature , it was poured into a stirring mixture of water and dichloromethane and allowed to stir for 20 minutes . the mixture was basified via addition of saturated aqueous sodium bicarbonate solution ; the aqueous layer was extracted once with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 50 % to 100 % ethyl acetate in heptane ) provided the product as a white foam . yield : 290 mg , 0 . 669 mmol , 93 %. lcms m / z 433 . 2 , 435 . 2 , 437 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 78 ( d , j = 1 . 8 hz , 1h ), 8 . 56 - 8 . 67 ( br m , 1h ), 8 . 07 ( d , j = 8 . 9 hz , 1h ), 7 . 59 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 23 - 7 . 29 ( br m , 1h ), 5 . 23 - 5 . 35 ( m , 1h ), 4 . 75 ( s , 2h ), 4 . 26 ( dd , j = 11 . 9 , 4 . 9 hz , 1h ), 3 . 57 - 3 . 72 ( m , 2h ), 2 . 53 - 2 . 74 ( br m , 1h ), 2 . 26 - 2 . 46 ( br m , 1h ), 1 . 69 - 1 . 83 ( br m , 1h ), 1 . 55 - 1 . 69 ( br m , 1h ), 1 . 31 ( d , j = 6 . 2 hz , 3h ). compound c34 ( 45 mg , 0 . 10 mmol ) was combined with zinc dust ( 98 %, 55 . 5 mg , 0 . 832 mmol ) in ( 2 h 4 ) acetic acid ( 0 . 5 ml ) and heated at 100 ° c . for 15 minutes . the reaction mixture was cooled to room temperature , treated with 1 m aqueous sodium hydroxide solution , and extracted with dichloromethane . the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . the residue was mixed with acetic acid ( 2 ml ) and heated to 100 ° c . for 10 minutes ; after removal of solvent under reduced pressure , the residue was dissolved in dichloromethane and washed with saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted once with dichloromethane , and the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : ethyl acetate , followed by a gradient of 0 % to 5 % methanol in dichloromethane ) afforded the product as a white solid . yield : 10 . 1 mg , 25 . 3 μmol , 25 %. this material exhibited − 85 % deuterium incorporation by 1 h nmr analysis . lcms m / z 400 . 3 , 402 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ), characteristic peaks : δ 9 . 29 ( residual protio peak ), 8 . 81 ( d , j = 1 . 8 hz , 1h ), 8 . 59 - 8 . 70 ( br m , 1h ), 8 . 22 ( d , j = 9 . 0 hz , 1h ), 7 . 63 ( dd , j = 9 . 0 , 2 . 1 hz , 1h ), 7 . 22 - 7 . 25 ( m , 1h ), 5 . 20 - 5 . 33 ( m , 1h ), 4 . 73 ( s , 2h ), 4 . 29 ( br dd , j = 12 , 5 hz , 1h ), 3 . 61 - 3 . 75 ( br m , 2h ), 2 . 61 - 2 . 79 ( br m , 1h ), 2 . 33 - 2 . 52 ( br m , 1h ), 1 . 70 - 1 . 85 ( br m , 1h ), 1 . 34 ( d , j = 6 . 2 hz , 3h ). n , n - diisopropylethylamine ( 828 mg , 6 . 41 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 5 . 5 g , 8 . 7 mmol ) were added to a mixture of c15 ( 850 mg , 2 . 91 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 493 mg , 3 . 49 mmol ) in n , n - dimethylformamide ( 20 ml ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was diluted with water ( 50 ml ) and extracted with dichloromethane ( 3 × 50 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 150 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . purification via reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : water containing 0 . 225 % formic acid ; mobile phase b : acetonitrile ; eluent : 42 % b ) afforded the product as a yellow solid . yield : 340 mg , 0 . 86 mmol , 30 %. lcms m / z 396 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 31 ( s , 1h ), 8 . 58 - 8 . 72 ( br m , 1h ), 8 . 23 ( d , j = 8 . 9 hz , 1h ), 7 . 67 ( dd , j = 8 . 9 , 2 . 0 hz , 1h ), 7 . 47 ( br s , 1h ), 5 . 99 ( s , 2h ), 5 . 30 - 5 . 42 ( m , 1h ), 4 . 29 ( br dd , j = 12 , 5 hz , 1h ), 3 . 68 - 3 . 81 ( m , 2h ), 2 . 56 - 2 . 74 ( br m , 1h ), 2 . 32 ( s , 3h ), 2 . 3 - 2 . 46 ( br m , 1h ), 1 . 43 - 1 . 90 ( 2 br m , 2h , assumed ; partially obscured by water peak ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). a mixture of c15 ( 500 mg , 1 . 71 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 247 mg , 1 . 75 mmol ) was purged three times with nitrogen and then mixed with toluene ( 5 . 7 ml ). n , n - diisopropylethylamine ( 0 . 30 ml , 1 . 72 mmol ) was added , followed by 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 48 ml , 2 . 49 mmol ). the reaction mixture was heated to 70 ° c . for 70 minutes , at which time lcms analysis indicated consumption of starting material and an approximately 2 : 1 ratio of intermediate amide : 11 . the reaction mixture was then heated at 110 ° c . for 3 hours , whereupon it was cooled , diluted with ethyl acetate , and washed with saturated aqueous sodium bicarbonate solution . the organic layer was dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 10 % methanol in dichloromethane ) afforded the product as a solid . yield : 585 mg , 1 . 47 mmol , 86 %. lcms m / z 397 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 30 ( s , 1h ), 8 . 55 - 8 . 73 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 66 ( dd , j = 8 . 8 , 2 . 2 hz , 1h ), 7 . 43 - 7 . 50 ( br m , 1h ), 5 . 99 ( s , 2h ), 5 . 29 - 5 . 42 ( m , 1h ), 4 . 29 ( br dd , j = 12 . 1 , 4 . 7 hz , 1h ), 3 . 65 - 3 . 81 ( m , 2h ), 2 . 54 - 2 . 75 ( br m , 1h ), 2 . 31 ( s , 3h ), 2 . 24 - 2 . 47 ( br m , 1h ), 1 . 43 - 1 . 75 ( br m , 2h ), 1 . 34 ( d , j = 6 . 1 hz , 3h ). n , n - diisopropylethylamine ( 8 . 33 ml , 47 . 8 mmol ) was added to a suspension of c13 ( 3 . 32 g , 13 . 7 mmol ) and p3 ( 2 . 00 g , 14 . 3 mmol ) in acetonitrile ( 80 ml ). the reaction mixture was stirred at room temperature for 5 minutes and then heated to 55 ° c . for 6 hours , whereupon it was cooled to room temperature . after addition of aqueous sodium bicarbonate solution , the mixture was extracted with dichloromethane , and the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 40 % ethyl acetate in heptane ) provided the product as a solid . yield : 3 . 78 g , 12 . 2 mmol , 89 %. lcms m / z 310 . 3 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 79 ( br d , 1h ), 9 . 35 ( s , 1h ), 8 . 23 ( d , j = 2 . 3 hz , 1h ), 7 . 95 ( d , j = 9 . 0 hz , 1h ), 7 . 71 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ), [ 5 . 38 - 5 . 43 ( m ) and 5 . 25 - 5 . 30 ( m ), total 1h ], 4 . 71 - 4 . 80 ( m , 1h ), 2 . 43 - 2 . 54 ( m , 1h ), 2 . 27 - 2 . 43 ( m , 3h ), 2 . 15 - 2 . 27 ( m , 1h ), 1 . 87 - 2 . 08 ( m , 1h ). zinc ( 8 . 66 g , 132 mmol ) was added in one portion to a mixture of c53 ( 4 . 00 g , 12 . 9 mmol ) in methanol ( 64 ml ) and concentrated ammonium hydroxide ( 64 ml ). after 2 hours at room temperature , the reaction mixture was filtered through diatomaceous earth , and the filter pad was washed with dichloromethane and methanol . the combined filtrates were concentrated in vacuo ; the residue was diluted with water and extracted with dichloromethane ( 3 × 100 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 0 % to 60 % ethyl acetate in heptane , followed by 100 % ethyl acetate ) and subsequent trituration with diethyl ether afforded the product as a solid . yield : 1 . 68 g , 6 . 01 mmol , 47 %. lcms m / z 280 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 47 ( s , 1h ), 7 . 89 ( d , j = 9 . 0 hz , 1h ), 7 . 85 ( d , j = 2 . 2 hz , 1h ), 7 . 39 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), [ 5 . 36 - 5 . 41 ( m ) and 5 . 23 - 5 . 28 ( m ), j hf = 54 hz , total 1h ], 4 . 16 - 4 . 26 ( m , 1h ), 3 . 81 - 3 . 92 ( m , 3h ), 1 . 78 - 2 . 34 ( m , 6h ). n , n - diisopropylethylamine ( 0 . 280 ml , 1 . 61 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 958 ml , 1 . 61 mmol ) were added to a mixture of c54 ( 150 mg , 0 . 536 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 75 . 7 mg , 0 . 536 mmol ) in ethyl acetate ( 3 . 2 ml ). the reaction mixture was heated at 80 ° c . overnight , whereupon it was diluted with ethyl acetate and washed with water . the aqueous layer was extracted once with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . chromatography on silica gel ( gradient : 0 % to 5 % methanol in dichloromethane ), followed by trituration with heptane containing a small amount of ethyl acetate , provided a mixture of 93 and c55 as an off - white solid . yield of racemic product : 148 mg , 0 . 384 mmol , 72 %. the component enantiomers were separated using supercritical fluid chromatography [ column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 7 : 3 carbon dioxide /( 1 : 1 acetonitrile / methanol )]. the first - eluting enantiomer was triturated with diethyl ether to afford 93 , obtained as a white solid . yield : 52 mg . 0 . 135 mmol , 35 % for the separation . lcms m / z 385 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 31 ( s , 1h ), 8 . 49 - 8 . 53 ( m , 1h ), 8 . 22 ( d , j = 9 . 0 hz , 1h ), 7 . 67 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ), 7 . 47 ( br s , 1h ), 5 . 99 ( ab quartet , j ab = 15 . 6 hz , δν ab = 11 . 0 hz , 2h ), [ 5 . 43 - 5 . 56 ( m ) and 5 . 32 - 5 . 38 ( m ), total 2h ], 2 . 42 - 2 . 78 ( m , 4h ), 2 . 33 ( d , j = 0 . 6 hz , 3h ), 1 . 98 - 2 . 18 ( m , 1h ), 1 . 88 - 1 . 98 ( m , 1h ). the second - eluting enantiomer was c55 , also isolated as a white solid after trituration with diethyl ether . yield : 58 mg , 0 . 151 mmol , 39 % for the separation . lcms m / z 385 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 31 ( s , 1h ), 8 . 49 - 8 . 53 ( m , 1h ), 8 . 22 ( d , j = 9 . 0 hz , 1h ), 7 . 67 ( dd , j = 9 . 0 , 2 . 2 hz , 1h ), 7 . 47 ( br s , 1h ), 5 . 99 ( ab quartet , j ab = 15 . 6 hz , δν ab = 11 . 0 hz , 2h ), [ 5 . 43 - 5 . 56 ( m ) and 5 . 32 - 5 . 38 ( m ), total 2h ], 2 . 42 - 2 . 77 ( m , 4h ), 2 . 33 ( d , j = 0 . 6 hz , 3h ), 1 . 98 - 2 . 18 ( m , 1h ), 1 . 88 - 1 . 98 ( m , 1h ). a reaction vessel containing a mixture of c53 ( 6 . 00 g , 19 . 4 mmol ), potassium ferrocyanide ( ii ) trihydrate ( 4 . 09 g , 9 . 68 mmol ), [( 2 - di - tert - butylphosphino - 2 ′, 4 ′, 6 ′- triisopropyl - 1 , 1 ′- biphenyl )- 2 -( 2 ′- amino - 1 , 1 ′- biphenyl )] palladium ( ii ) methanesulfonate ( tbuxphos pd g3 precatalyst ; 769 mg , 0 . 968 mmol ), and di - tert - butyl [ 2 ′, 4 ′, 6 ′- tri ( propan - 2 - yl ) biphenyl - 2 - yl ] phosphane ( 411 mg , 0 . 968 mmol ) was evacuated and charged with nitrogen . this evacuation cycle was repeated twice , and then 1 , 4 - dioxane ( previously degassed by bubbling nitrogen through it for 2 hours with vigorous stirring ; 39 ml ) and aqueous potassium acetate solution ( 0 . 0625 m , prepared using degassed deionized water ; 38 . 7 ml , 2 . 42 mmol ) were added . the reaction mixture was placed into a preheated 100 ° c . oil bath and stirred at 100 ° c . for 2 hours , whereupon it was removed from the oil bath , cooled to room temperature , and partitioned between ethyl acetate and saturated aqueous sodium bicarbonate solution . the aqueous layer was extracted with ethyl acetate ( 3 × 100 ml ) and dichloromethane ( 100 ml ), and the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . the residue was triturated with dichloromethane and heptane , and the resulting solid was recrystallized from dichloromethane / heptane to provide the product as a solid . yield : 4 . 70 g , 15 . 6 mmol , 80 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 98 - 10 . 09 ( br m , 1h ), 9 . 46 ( s , 1h ), 8 . 61 ( d , j = 1 . 8 hz , 1h ), 8 . 09 ( d , half of ab quartet , j = 8 . 6 hz , 1h ), 7 . 92 ( dd , half of abx pattern , j = 8 . 8 , 1 . 8 hz , 1h ), [ 5 . 42 - 5 . 46 ( m ) and 5 . 29 - 5 . 33 ( m ), total 1h ], 4 . 71 - 4 . 80 ( m , 1h ), 2 . 48 - 2 . 59 ( m , 1h ), 2 . 29 - 2 . 46 ( m , 3h ), 2 . 19 - 2 . 29 ( m , 1h ), 1 . 92 - 2 . 13 ( m , 1h ). zinc ( 4 . 46 g , 66 . 4 mmol ) was added in one portion to a mixture of c56 ( 2 . 00 g , 6 . 63 mmol ) in methanol ( 33 ml ) and concentrated ammonium hydroxide ( 33 ml ). after 1 hour , the reaction mixture was filtered through a pad of diatomaceous earth ; the filter pad was rinsed with dichloromethane and a small amount of methanol , and the combined filtrates were diluted with a 1 : 1 mixture of water and saturated aqueous sodium chloride solution . the aqueous layer was extracted with dichloromethane , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . trituration of the residue with diethyl ether for 30 minutes provided the product as a yellow solid . yield : 1 . 49 g , 5 . 51 mmol , 83 %. lcms m / z 271 . 4 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 58 ( s , 1h ), 8 . 28 ( d , j = 1 . 6 hz , 1h ), 8 . 02 ( d , j = 8 . 6 hz , 1h ), 7 . 60 ( dd , j = 8 . 7 , 1 . 7 hz , 1h ), [ 5 . 39 - 5 . 44 ( m ) and 5 . 26 - 5 . 30 ( m ), j hf = 53 hz , total 1h ], 4 . 23 - 4 . 33 ( m , 1h ), 3 . 98 - 4 . 07 ( m , 1h ), 3 . 91 ( br s , 2h ), 2 . 20 - 2 . 36 ( m , 1h ), 2 . 04 - 2 . 18 ( m , 2h ), 1 . 81 - 2 . 03 ( m , 3h ). n , n - diisopropylethylamine ( 0 . 374 ml , 2 . 15 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 28 ml , 2 . 15 mmol ) were added to a mixture of c57 ( 200 mg , 0 . 740 mmol ) and ( 4 - methyl - 1h - pyrazol - 1 - yl ) acetic acid ( 100 mg , 0 . 714 mmol ) in ethyl acetate ( 4 . 4 ml ), and the reaction mixture was heated at 80 ° c . overnight . it was then partitioned between ethyl acetate and water . the aqueous layer was extracted with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ), followed by trituration with diethyl ether , provided a mixture of 94 and c58 as an off - white solid . yield of racemic material : 203 mg , 0 . 542 mmol , 76 %. this was separated into its component enantiomers using supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 4 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was 94 , isolated as a white solid . yield : 78 mg , 0 . 21 mmol , 39 % for the separation . lcms m / z 375 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 94 - 9 . 00 ( m , 1h ), 8 . 36 ( d , j = 8 . 6 hz , 1h ), 7 . 86 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 7 . 37 ( s , 1h ), 7 . 28 ( s , 1h ), 5 . 75 ( s , 2h ), 5 . 53 - 5 . 65 ( m , 1h ), [ 5 . 47 - 5 . 53 ( m ) and 5 . 34 - 5 . 40 ( m ), j hf = 54 hz , total 1h ], 2 . 43 - 2 . 70 ( m , 4h ), 2 . 04 ( s , 3h ), 1 . 92 - 2 . 14 ( m , 1h ), 1 . 82 - 1 . 92 ( m , 1h ). the second - eluting compound , also obtained as a white solid , was c58 . yield : 91 mg , 0 . 24 mmol , 44 % for the separation . lcms m / z 375 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 95 - 9 . 00 ( m , 1h ), 8 . 36 ( d , j = 8 . 6 hz , 1h ), 7 . 86 ( dd , j = 8 . 7 , 1 . 7 hz , 1h ), 7 . 37 ( s , 1h ), 7 . 28 ( s , 1h ), 5 . 75 ( s , 2h ), 5 . 52 - 5 . 65 ( m , 1h ), [ 5 . 48 - 5 . 53 ( m ) and 5 . 34 - 5 . 40 ( m ), j hf = 54 hz , total 1h ], 2 . 43 - 2 . 70 ( m , 4h ), 2 . 04 ( s , 3h ), 1 . 92 - 2 . 14 ( m , 1h ), 1 . 82 - 1 . 92 ( m , 1h ). this experiment was run in two identical batches . { caution : this reaction should not be carried out on greater than a 1 gram scale , due to highly energetic reactants and intermediates . use of proper safety precautions and a blast shield is essential .} nitromethane ( 4 . 71 g , 77 . 2 mmol ) was added in a drop - wise manner to a solution of sodium hydroxide ( 3 . 95 g , 98 . 8 mmol ) in water ( 25 ml ), and the resulting solution was allowed to heat to 45 ° c . over 5 minutes , whereupon it was cooled in a water bath and treated with concentrated hydrochloric acid ( 12 m , 10 ml ) until the ph of the solution became acidic . this was then added to a suspension of 2 - amino - 5 - cyanobenzoic acid ( 5 . 0 g , 31 mmol ) in water ( 50 ml ), acetone ( 10 ml ) and concentrated hydrochloric acid ( 12 m , 50 ml ) at 25 ° c ., and the reaction mixture was allowed to stir at 25 ° c . for 15 hours . the two batches were combined at this point , and the resulting suspension was filtered ; the collected solid was washed with water to provide the product as a yellow solid . from analysis of the 1 h nmr , the product was presumed to exist as a mixture of rotamers . yield : 13 . 8 g , 59 . 2 mmol , 95 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ [ 13 . 15 ( s ) and 13 . 12 ( s ), total 1h ], 8 . 37 ( d , j = 2 . 0 hz , 1h ), 8 . 07 - 8 . 15 ( m , 2h ), 7 . 92 ( d , half of ab quartet , j = 9 . 0 hz , 1h ), 6 . 86 ( d , j = 6 . 0 hz , 1h ). potassium carbonate ( 39 . 1 g , 283 mmol ) was added to a suspension of c59 ( 22 . 0 g , 94 . 4 mmol ) in acetic anhydride ( 200 ml ). after the reaction mixture had been heated to 90 ° c . for 2 hours , it was filtered , and the collected material was washed with tert - butyl methyl ether ( 100 ml ) and with water ( 400 ml ), affording the product as a brown solid . yield : 17 . 0 g , 79 . 0 mmol , 84 %. lcms m / z 215 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 14 ( s , 1h ), 8 . 55 ( dd , j = 2 . 0 , 0 . 5 hz , 1h ), 7 . 98 ( dd , j = 8 . 5 , 2 . 0 hz , 1h ), 7 . 77 ( dd , j = 8 . 5 , 0 . 5 hz , 1h ). conversion of c60 to the product was carried out using the method described for synthesis of c8 from c7 in example 1 . the product was isolated as a brown solid . yield : 9 . 1 g , 39 mmol , 86 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 26 ( s , 1h ), 8 . 59 ( d , j = 1 . 8 hz , 1h ), 8 . 16 ( dd , j = 8 . 7 , 1 . 9 hz , 1h ), 7 . 93 ( d , j = 8 . 8 hz , 1h ). to a solution of c61 ( 8 . 81 g , 37 . 7 mmol ) in acetonitrile ( 80 ml ) was added p2 ( 11 . 0 g , 41 . 5 mmol ), followed by n , n - diisopropylethylamine ( 5 . 85 g , 45 . 3 mmol ). the reaction mixture was stirred for 2 hours at room temperature , whereupon it was concentrated in vacuo and purified via silica gel chromatography ( eluent : 4 : 1 petroleum ether / ethyl acetate ), affording the product as a viscous orange oil that slowly solidified . yield : 15 . 0 g , 32 . 4 mmol , 86 %. lcms m / z 313 . 0 [ m -( 2 , 4 - dimethoxybenzyl )+ h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 18 ( s , 1h ), 8 . 55 ( br dd , j = 1 . 3 , 1 hz , 1h ), 8 . 15 ( d , j = 1 . 0 hz , 2h ), 6 . 88 ( d , j = 8 . 0 hz , 1h ), 6 . 24 - 6 . 30 ( m , 2h ), 4 . 33 ( br ab quartet , j ab = 14 . 5 hz , δν ab = 12 hz , 2h ), 3 . 76 - 3 . 92 ( m , 2h ), 3 . 62 ( s , 3h ), 3 . 42 ( s , 3h ), 3 . 3 - 3 . 4 ( m , 2h , assumed ; largely obscured by water peak ), 1 . 83 - 2 . 00 ( m , 2h ), 1 . 70 - 1 . 83 ( m , 1h ), 1 . 42 - 1 . 54 ( m , 1h ), 1 . 09 ( d , j = 6 . 0 hz , 3h ). a mixture of c62 ( 15 . 0 g , 32 . 4 mmol ) and trifluoroacetic acid ( 18 . 5 g , 162 mmol ) in dichloromethane ( 150 ml ) was stirred at room temperature for 30 minutes , whereupon it was concentrated to a volume of 20 ml and treated with saturated aqueous sodium bicarbonate solution ( 200 ml ). the aqueous layer was extracted with dichloromethane ( 3 × 150 ml ), and the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow solid . yield : 5 . 68 g , 18 . 2 mmol , 56 %. lcms m / z 313 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 06 - 9 . 09 ( m , 2h ), 8 . 30 ( br d , j = 9 . 0 hz , 1h ), 8 . 14 ( dd , half of abx pattern , j = 8 . 7 , 1 . 6 hz , 1h ), 8 . 01 ( d , half of ab quartet , j = 8 . 8 hz , 1h ), 3 . 87 - 3 . 93 ( m , 1h ), 3 . 69 - 3 . 82 ( m , 1h ), 3 . 3 - 3 . 5 ( m , 2h , assumed ; largely obscured by water peak ), 1 . 87 - 2 . 03 ( m , 2h ), 1 . 60 - 1 . 72 ( m , 1h ), 1 . 36 - 1 . 47 ( m , 1h ), 1 . 11 ( d , j = 6 . 0 hz , 3h ). ethanol ( 60 ml ) and water ( 15 ml ) were added to a mixture of c63 ( 5 . 68 g , 18 . 2 mmol ), iron ( 10 . 2 g , 183 mmol ), and ammonium chloride ( 9 . 73 g , 182 mmol ). the reaction mixture was heated to 80 ° c . for 1 hour , whereupon it was diluted with ethanol ( 100 ml ) and filtered . the filtrate was concentrated in vacuo , and the resulting solid was partitioned between saturated aqueous sodium bicarbonate solution ( 100 ml ) and dichloromethane ( 300 ml ). the organic layer was dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product as a brown solid . yield : 4 . 73 g , 16 . 8 mmol , 92 %. lcms m / z 282 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 8 . 55 ( d , j = 1 . 2 hz , 1h ), 8 . 51 ( s , 1h ), 7 . 90 ( d , j = 8 . 8 hz , 1h ), 7 . 60 ( dd , j = 8 . 5 , 1 . 8 hz , 1h ), 3 . 92 - 4 . 00 ( m , 1h ), 3 . 58 - 3 . 69 ( m , 1h ), 3 . 39 - 3 . 50 ( m , 2h ), 1 . 78 - 1 . 94 ( m , 2h ), 1 . 56 - 1 . 69 ( m , 1h ), 1 . 29 - 1 . 40 ( m , 1h ), 1 . 17 ( d , j = 6 . 0 hz , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 8 g , 2 . 8 mmol ) and n , n - diisopropylethylamine ( 439 mg , 3 . 40 mmol ) were added to a mixture of c64 ( 320 mg , 1 . 13 mmol ) and ( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) acetic acid ( 192 mg , 1 . 36 mmol ) in ethyl acetate ( 5 ml ) at room temperature ( 18 ° c .). after the reaction mixture had been heated at 80 ° c . for 2 . 5 days , it was cooled to room temperature ( 18 ° c . ), and partitioned between saturated aqueous sodium chloride solution ( 40 ml ) and ethyl acetate ( 6 × 40 ml ). the combined organic layers were concentrated in vacuo and purified via silica gel chromatography ( gradient : 0 % to 8 % methanol in dichloromethane ) to give a brown gum , which was triturated with a mixture of petroleum ether and ethyl acetate ( 2 : 1 , 30 ml ). the resulting solid was washed with a mixture of petroleum ether and ethyl acetate ( 1 : 1 , 10 ml ) and then with petroleum ether ( 10 ml ), providing the product as a brownish solid . yield : 160 mg , 0 . 413 mmol , 37 %. lcms m / z 388 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 40 ( s , 1h ), 8 . 80 - 9 . 15 ( br m , 1h ), 8 . 39 ( d , j = 8 . 5 hz , 1h ), 7 . 88 ( br d , j = 8 . 5 hz , 1h ), 6 . 10 ( s , 1h ), 4 . 99 - 5 . 25 ( br m , 1h ), 4 . 63 ( s , 2h ), 4 . 35 ( br dd , j = 12 , 5 hz , 1h ), 3 . 65 - 3 . 83 ( m , 2h ), 2 . 51 - 2 . 78 ( br m , 1h ), 2 . 22 - 2 . 48 ( br m , 1h ), 2 . 29 ( s , 3h ), 1 . 75 - 2 . 19 ( br m , 2h ), 1 . 38 ( d , j = 6 . 0 hz , 3h ). a solution of c64 in n , n - dimethylacetamide ( 0 . 1 m , 1 . 0 ml , 100 μmol ) was added to ( 5 - methoxypyridin - 2 - yl ) acetic acid ( 25 mg , 150 μmol ). n , n - diisopropylethylamine ( 50 μl , 300 μmol ) was added , followed by bis ( 2 - oxo - 1 , 3 - oxazolidin - 3 - yl ) phosphinic chloride ( bop - cl , 38 . 1 mg , 150 μmol ), and the reaction vial was capped and shaken at 30 ° c . for 16 hours . after solvent had been removed using a speedvac ® concentrator , the residue was washed and extracted with ethyl acetate ( 3 × 1 . 5 ml ). the combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo , affording the product , which was taken directly to the next step acetic acid ( 1 ml ) was added to c65 ( from the previous step , 5100 μmol ), and the reaction vial was capped and shaken at 80 ° c . for 16 hours . purification via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 20 % to 50 % b ) provided the product . yield : 4 . 0 mg , 8 . 7 μmol , 9 % over 2 steps . lcms m / z 414 [ m + h ] + . retention time : 2 . 44 minutes via analytical hplc ( column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 1 % to 5 % b over 0 . 6 minutes ; 5 % to 100 % b over 3 . 4 minutes ; flow rate : 0 . 8 ml / minute ). n , n - diisopropylethylamine ( 0 . 387 ml , 2 . 22 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 32 ml , 2 . 22 mmol ) were added to a mixture of c57 ( 200 mg , 0 . 740 mmol ) and c6 ( 104 mg , 0 . 737 mmol ) in ethyl acetate ( 4 . 4 ml ), and the reaction mixture was heated at 80 ° c . overnight . it was then diluted with additional ethyl acetate and washed with water . the aqueous layer was extracted once with ethyl acetate , and the combined organic layers were washed with saturated aqueous sodium chloride solution , dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( eluent : ethyl acetate ), followed by trituration with diethyl ether , provided a mixture of 97 and c66 as an off - white solid . yield of racemic product : 141 mg , 0 . 376 mmol , 51 %. this material was separated into its component enantiomers via supercritical fluid chromatography ( column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 4 : 1 carbon dioxide / ethanol ). the first - eluting enantiomer was 97 , obtained as a white solid . yield : 63 . 4 mg , 0 . 169 mmol , 45 % for the separation . lcms m / z 376 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 40 ( s , 1h ), 8 . 92 - 8 . 97 ( m , 1h ), 8 . 35 ( d , j = 8 . 6 hz , 1h ), 7 . 85 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 6 . 00 ( s , 1h ), [ 5 . 48 - 5 . 54 ( m ) and 5 . 32 - 5 . 44 ( m ), total 2h ], 4 . 53 ( s , 2h ), 2 . 46 - 2 . 76 ( m , 4h ), 2 . 40 ( s , 3h ), 1 . 92 - 2 . 15 ( m , 2h ). a sample of 97 synthesized and isolated in the same way gave specific rotation [ α ]− 42 . 0 ° ( c 0 . 105 , dichloromethane ). an x - ray structural determination ( see below ) was carried out on a sample of 97 that had been crystallized from heptane / ethyl acetate ; this provided confirmation of the cis - configuration of the nitrogen and fluorine atoms on the cyclopentane ring . the indicated absolute stereochemistry of 97 is strongly inferred from the alternate synthesis of example 97 described below ; the absolute configuration of reagent c49 would be identical to that of its precursor p4 , which is predicted based on its enzymatic synthesis in preparation p4 . the second - eluting enantiomer , also isolated as a white solid , was c66 , 1 -[( 1 s , 3r )- 3 - fluorocyclopentyl ]- 2 -[( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile . yield : 65 . 3 mg , 0 . 174 mmol , 46 % for the separation . lcms m / z 376 . 2 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 40 ( s , 1h ), 8 . 92 - 8 . 97 ( m , 1h ), 8 . 35 ( d , j = 8 . 8 hz , 1h ), 7 . 85 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 6 . 00 ( s , 1h ), [ 5 . 48 - 5 . 54 ( m ) and 5 . 32 - 5 . 44 ( m ), total 2h ], 4 . 53 ( s , 2h ), 2 . 45 - 2 . 76 ( m , 4h ), 2 . 40 ( s , 3h ), 1 . 92 - 2 . 15 ( m , 2h ). a sample of c66 synthesized and isolated in the same way gave specific rotation [ α ]+ 21 . 4 ° ( c 0 . 180 , dichloromethane ). data collection was performed on a bruker apex diffractometer at − 150 ° c . data collection consisted of omega and phi scans . the structure was solved by direct methods using shelx software suite in the triclinic class space group p1 as two molecules per asymmetric unit . the structure was subsequently refined by the full - matrix least squares method . all non - hydrogen atoms were found and refined using anisotropic displacement parameters . the remaining hydrogen atoms were placed in calculated positions and were allowed to ride on their carrier atoms . the final refinement included isotropic displacement parameters for all hydrogen atoms . analysis of the absolute structure using likelihood methods ( hooft 2008 ) was performed using platon ( spek 2010 ). the analysis could not determine the absolute configuration in this case because of the weak intensity of the friedel pairs . the final r - index was 7 . 5 %. a final difference fourier revealed no missing or misplaced electron density . pertinent crystal , data collection , and refinement information is summarized in table f . atomic coordinates , bond lengths , bond angles , and displacement parameters are listed in tables g , h , and j . platon , a . l . spek , j . appl . cryst . 2003 , 36 , 7 - 13 . mercury , c . f . macrae , p . r . edington , p . mccabe , e . pidcock , g . p . shields , r . taylor , m . towler , and j . van de streek , j . appl . cryst . 2006 , 39 , 453 - 457 . olex2 , o . v . dolomanov , l . j . bourhis , r . j . gildea , j . a . k . howard , and h . puschmann , j . appl . cryst . 2009 , 42 , 339 - 341 . r . w . w . hooft , l . h . straver , and a . l . spek , j . appl . cryst . 2008 , 41 , 96 - 103 . parameters ( å 2 × 10 3 ) for 97 . u ( eq ) is defined as one - third anisotropic displacement parameters ( å 2 × 10 3 ) for 97 . form : − 2π 2 [ h 2 a * 2 u 11 + . . . + 2 h k a * b * u 12 ]. compound p4 ( from alternate preparation of p4 above , 250 mg , 1 . 05 mmol ) was dissolved in a solution of hydrogen chloride in methanol ( 1 . 25 m , 12 . 6 ml , 15 . 8 mmol ). palladium on carbon ( 10 %, 250 mg ) was added , and the reaction vessel was pressurized to 100 psi with nitrogen three times , followed by pressurization to 40 psi with hydrogen three times . the reaction mixture was then hydrogenated at room temperature and 40 psi overnight , whereupon it was purged three times with nitrogen and combined with a similar reaction carried out on p4 ( 270 mg , 1 . 14 mmol ). after the mixture had been filtered through a polyethylene filter , the filtrate was concentrated in vacuo , azeotroped once with toluene , and washed twice with heptane , affording the product as a white solid . yield : 315 mg , assumed quantitative . 1 h nmr ( 400 mhz , cd 3 od ) δ [ 5 . 24 - 5 . 29 ( m ) and 5 . 11 - 5 . 16 ( m ), j hf = 53 hz , total 1h ], 3 . 67 - 3 . 77 ( br m , 1h ), 2 . 35 ( dddd , j = 35 . 9 , 15 . 6 , 8 . 6 , 4 . 7 hz , 1h ), 1 . 79 - 2 . 27 ( m , 5h ). reaction of c13 with c49 was effected using the method described for synthesis of c53 from c13 in example 93 . in this case , the purified material from silica gel chromatography was crystallized from dichloromethane / heptane , affording the product as a solid . yield : 685 mg , 2 . 21 mmol , 89 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 80 ( br d , j = 7 hz , 1h ), 9 . 36 ( s , 1h ), 8 . 24 ( d , j = 2 . 3 hz , 1h ), 7 . 96 ( d , j = 9 . 0 hz , 1h ), 7 . 71 ( dd , j = 8 . 9 , 2 . 2 hz , 1h ), [ 5 . 38 - 5 . 43 ( m ) and 5 . 25 - 5 . 30 ( m ), j hf = 53 hz , total 1h ], 4 . 71 - 4 . 81 ( m , 1h ), 2 . 43 - 2 . 54 ( m , 1h ), 2 . 28 - 2 . 43 ( m , 3h ), 2 . 16 - 2 . 27 ( m , 1h ), 1 . 88 - 2 . 08 ( m , 1h ). conversion of c67 to the product was carried out using the method described for synthesis of c56 from c53 in example 94 . in this case , purification was effected using silica gel chromatography ( gradient : 0 % to 60 % ethyl acetate in heptane , followed by 100 % ethyl acetate ), providing the product as a solid . yield : 332 mg , 1 . 11 mmol , 50 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 04 ( br d , j = 7 hz , 1h ), 9 . 46 ( s , 1h ), 8 . 61 ( d , j = 1 . 8 hz , 1h ), 8 . 09 ( d , half of ab quartet , j = 8 . 8 hz , 1h ), 7 . 92 ( dd , half of abx pattern , j = 8 . 7 , 1 . 7 hz , 1h ), [ 5 . 42 - 5 . 46 ( m ) and 5 . 29 - 5 . 33 ( m ), total 1h ], 4 . 71 - 4 . 80 ( m , 1h ), 2 . 48 - 2 . 59 ( m , 1h ), 2 . 29 - 2 . 46 ( m , 3h ), 2 . 19 - 2 . 29 ( m , 1h ), 1 . 92 - 2 . 13 ( m , 1h ). zinc ( 97 . 5 %, 0 . 739 g , 11 . 0 mmol ) was added in one portion to a mixture of c68 ( 331 mg , 1 . 10 mmol ) in methanol ( 5 . 5 ml ) and concentrated ammonium hydroxide ( 5 . 5 ml ). after 1 hour at room temperature , the reaction mixture was filtered through diatomaceous earth , and the filter pad was washed with methanol . the combined filtrates were concentrated in vacuo , and the residue was purified via chromatography on silica gel ( gradient : 0 % to 10 % methanol in ethyl acetate ). the resulting material was triturated with diethyl ether and washed with heptane to afford the product . yield : 114 mg , 0 . 422 mmol , 38 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 57 ( s , 1h ), 8 . 28 ( d , j = 1 . 6 hz , 1h ), 8 . 02 ( d , j = 8 . 6 hz , 1h ), 7 . 60 ( dd , j = 8 . 6 , 1 . 8 hz , 1h ), [ 5 . 39 - 5 . 43 ( m ) and 5 . 26 - 5 . 30 ( m ), j hf = 53 . 5 hz , total 1h ], 4 . 23 - 4 . 33 ( m , 1h ), 3 . 99 - 4 . 07 ( m , 1h ), 3 . 91 ( br s , 2h ), 2 . 20 - 2 . 35 ( m , 1h ), 2 . 04 - 2 . 17 ( m , 2h ), 1 . 82 - 2 . 03 ( m , 3h ). n , n - diisopropylethylamine ( 39 . 1 μl , 0 . 224 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 191 ml , 0 . 321 mmol ) were added to a mixture of c69 ( 60 mg , 0 . 22 mmol ) and c6 ( 31 . 3 mg , 0 . 222 mmol ) in toluene ( 2 . 2 ml ). the reaction mixture was heated at 70 ° c . for 1 hour , and then at 110 ° c . for 3 hours , whereupon it was cooled to room temperature and directly subjected to two chromatographic purifications on silica gel ( gradient : 0 % to 20 % methanol in ethyl acetate ). the resulting material was triturated with ethyl acetate and diethyl ether to provide the product as an off - white to light yellow solid . yield : 41 . 2 mg , 0 . 110 mmol , 50 %. specific rotation : [ α ]− 39 . 4 ° ( c 0 . 120 , dichloromethane ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 41 ( s , 1h ), 8 . 92 - 8 . 97 ( m , 1h ), 8 . 36 ( d , j = 8 . 8 hz , 1h ), 7 . 85 ( dd , j = 8 . 7 , 1 . 7 hz , 1h ), 6 . 00 ( br s , 1h ), 5 . 32 - 5 . 54 ( m , 2h ), 4 . 53 ( s , 2h ), 2 . 46 - 2 . 76 ( m , 4h ), 2 . 41 ( br s , 3h ), 1 . 92 - 2 . 15 ( m , 2h ). compound c64 was reacted with pyrazin - 2 - ylacetic acid using the method described in example 96 for synthesis of c65 from c64 . the product was taken directly to the next step . conversion of c70 to the product was effected using the method described for synthesis of 96 from c65 in example 96 . purification via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : aqueous ammonia , ph 10 ; mobile phase b : acetonitrile ; gradient : 18 % to 48 % b ) provided the product . yield : 3 . 0 mg , 7 . 0 μmol , 7 %. lcms m / z 385 [ m + h ] + . retention time : 2 . 30 minutes via analytical hplc ( column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 5 % b for 0 . 5 minutes ; 5 % to 100 % b over 2 . 9 minutes ; 100 % b for 0 . 8 minutes ; flow rate : 0 . 8 ml / minute ). a mixture of c15 ( 29 mg , 100 μmol ), [ 4 -( trifluoromethyl )- 1h - 1 , 2 , 3 - triazol - 1 - yl ] acetic acid ( see m . d . andrews et al ., us 20150218172 a1 , aug . 6 , 2015 ) ( 23 mg , 120 μmol ), and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 0 ml , 1 . 7 mmol ) was prepared in a vial , which was then capped and shaken at 120 ° c . for 16 hours . after solvent had been removed using a speedvac ® concentrator , the residue was purified via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 17 % to 57 % b ) to provide the product . yield : 10 . 2 mg , 20 . 5 μmol , 20 %. lcms m / z 451 [ m + h ] + . retention time : 2 . 90 minutes via analytical hplc ( column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 1 % to 5 % b over 0 . 6 minutes ; 5 % to 100 % b over 3 . 4 minutes ; flow rate : 0 . 8 ml / minute ). formic acid ( 310 ml ) was added to a mixture of iron powder ( 34 . 7 g , 621 mmol ), ammonium chloride ( 33 . 2 g , 621 mmol ), and c14 ( 20 g , 62 . 2 mmol ) in 2 - propanol ( 310 ml ) at room temperature ( 14 ° c .). the reaction mixture was heated at 80 ° c . for 16 hours , whereupon it was diluted with ethanol ( 300 ml ), and filtered . the collected solids were washed with 2 - propanol ( 200 ml ) and dichloromethane ( 100 ml ), and the combined filtrates were concentrated in vacuo , then co - evaporated with ethanol ( 200 ml ). the residue was diluted with dichloromethane ( 300 ml ), basified via addition of saturated aqueous sodium bicarbonate solution ( 500 ml ), and then filtered through diatomaceous earth ; the filter pad was washed with dichloromethane ( 300 ml ). the aqueous layer of the combined filtrates was extracted with dichloromethane ( 4 × 100 ml ), and the combined organic layers were washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure . silica gel chromatography ( gradient : 0 % to 5 % methanol in dichloromethane ) afforded a solid , which was washed with a mixture of petroleum ether and ethyl acetate ( 3 : 1 , 100 ml ) and with petroleum ether ( 50 ml ) to provide the product as a beige solid . yield : 10 . 05 g , 33 . 3 mmol , 54 %. lcms m / z 301 . 8 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 35 ( s , 1h ), 8 . 25 ( d , j = 9 . 0 hz , 1h ), 8 . 19 ( s , 1h ), 8 . 09 ( d , j = 2 . 3 hz , 1h ), 7 . 66 ( dd , j = 8 . 8 , 2 . 3 hz , 1h ), 5 . 02 ( tt , j = 12 . 0 , 3 . 8 hz , 1h ), 4 . 30 ( ddd , j = 11 . 9 , 4 . 6 , 1 . 6 hz , 1h ), 3 . 77 - 3 . 89 ( m , 2h ), 2 . 33 - 2 . 46 ( m , 2h ), 2 . 09 - 2 . 22 ( m , 1h ), 1 . 83 - 1 . 95 ( m , 1h ), 1 . 38 ( d , j = 6 . 3 hz , 3h ). a solution of lithium diisopropylamide in heptane / tetrahydrofuran / ethylbenzene ( 2 m , 3 . 0 ml , 6 . 0 mmol ) was added to a − 78 ° c . solution of c71 ( 1 . 64 g , 5 . 43 mmol ) in tetrahydrofuran ( 28 ml ), and the reaction mixture was allowed to stir at − 78 ° c . for 15 minutes . a solution of 5 - methylpyridine - 2 - carbaldehyde ( 29 mg , 0 . 24 mmol ) in tetrahydrofuran ( 0 . 4 ml ) was cooled to − 78 ° c . and treated with a portion of the c71 - containing reaction mixture ( 0 . 9 ml , approximately 0 . 15 mmol ); stirring was continued at − 78 ° c . for 15 minutes , whereupon the cooling bath was removed , and the reaction mixture was allowed to warm to room temperature . it was then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid phase extraction cartridge ( 6 ml ) charged with sodium sulfate (˜ 1 g ); this extraction procedure was repeated twice , and the combined eluents were concentrated in vacuo and used directly in the following step . pyridine ( 45 μl , 0 . 56 mmol ) was added to c72 ( from the previous step , 50 . 15 mmol ), followed by a solution of 4 -( dimethylamino ) pyridine ( 2 . 5 mg , 20 μmol ) in 1 , 2 - dichloroethane ( 0 . 3 ml ). the reaction vessel was evacuated and charged with nitrogen ; this evacuation cycle was repeated twice , and then a solution of o - phenyl carbonochloridothioate ( 52 mg , 0 . 30 mmol ) in 1 , 2 - dichloroethane ( 0 . 3 ml ) was added . after the reaction mixture had been shaken at room temperature for 2 hours , it was partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid phase extraction cartridge ( 6 ml ) charged with sodium sulfate (˜ 1 g ); this extraction procedure was repeated twice , and the combined eluents were concentrated in vacuo . the resulting material was treated with a solution of 2 , 2 ′- azobisisobutyronitrile ( 2 mg , 10 μmol ) in toluene ( 0 . 6 ml ) and 1 , 1 , 1 , 3 , 3 , 3 - hexamethyl - 2 -( trimethylsilyl ) trisilane ( 40 ul , 0 . 13 mmol ) and the reaction mixture was shaken at 110 ° c . for 20 hours . it was then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing , and the organic layer was eluted through a solid phase extraction cartridge ( 6 ml ) charged with sodium sulfate (˜ 1 g ); this extraction procedure was repeated twice , and the combined eluents were concentrated in vacuo and purified using reversed phase hplc ( column : waters xbridge c18 , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : 0 . 05 % ammonium hydroxide in acetonitrile ; gradient : 5 % to 100 % b ). yield : 4 . 7 mg , 12 μmol , 8 % over 2 steps . lcms m / z 407 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . retention time : 1 . 89 minutes via analytical hplc ( column : waters atlantis dc18 , 4 . 6 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 20 % to 95 % b , linear over 4 . 0 minutes ; flow rate : 2 ml / minute ). reaction of c57 with ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid was effected using the method described for synthesis of 97 from c57 and c6 in example 97 , providing a racemic mixture of c73 and 101 as an off - white solid . yield of racemic material : 54 . 0 mg , 0 . 144 mmol , 40 %. lcms m / z 376 . 4 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 93 - 8 . 99 ( m , 1h ), 8 . 37 ( d , j = 8 . 6 hz , 1h ), 7 . 89 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 7 . 48 ( br s , 1h ), 6 . 01 ( ab quartet , j ab = 15 . 4 hz , δν ab = 11 . 7 hz , 2h ), [ 5 . 49 - 5 . 63 ( m ) and 5 . 36 - 5 . 42 ( m ), total 2h ], 2 . 46 - 2 . 75 ( m , 4h ), 2 . 33 ( br s , 3h ), 1 . 92 - 2 . 19 ( m , 2h ). the component enantiomers were separated using supercritical fluid chromatography [ column : phenomenex lux cellulose - 2 , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer , isolated as a white solid , was c73 , 1 -( cis - 3 - fluorocyclopentyl )- 2 -[( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 1 . yield : 8 . 4 mg , 22 μmol , 16 % for the separation . lcms m / z 376 . 1 [ m + h ] + . retention time : 8 . 32 minutes via analytical hplc [ column : phenomenex lux cellulose - 2 , 4 . 6 × 100 mm , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide ); flow rate : 1 . 5 ml / minute ]. the second - eluting enantiomer was 101 , also obtained as a white solid . yield : 6 . 6 mg , 18 μmol , 12 % for the separation . lcms m / z 376 . 0 [ m + h ] + . retention time : 9 . 93 minutes ( analytical hplc conditions identical to those described above for c73 ). n - butyllithium ( 2 . 5 m in hexanes ; 5 . 00 ml , 12 . 5 mmol ) was slowly added drop - wise to a − 78 ° c . solution of 4 , 6 - dimethylpyrimidine ( 1 . 08 g , 9 . 99 mmol ) in tetrahydrofuran ( 20 ml ). after the reaction mixture had been stirred for 20 minutes at − 78 ° c ., solid carbon dioxide ( dry ice , 5 . 0 g ) was added , and the reaction mixture was warmed to room temperature ( 15 ° c .) and stirred for 1 hour . water ( 3 . 0 ml ) was then added , and the resulting mixture was concentrated in vacuo to provide the product as a white solid . yield : 1 . 53 g , 9 . 68 mmol , 97 %. 1 h nmr ( 400 mhz , d 2 o ) δ 8 . 78 ( s , 1h ), 7 . 28 ( s , 1h ), [ 3 . 60 ( s ) and 3 . 59 ( br s ), total 2h ], 2 . 43 ( s , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 795 mg , 1 . 25 mmol ) and n , n - diisopropylethylamine ( 194 mg , 1 . 50 mmol ) were added to a mixture of c15 ( 146 mg , 0 . 500 mmol ) and c74 ( 87 . 5 mg , 0 . 553 mmol ) in ethyl acetate ( 2 ml ) at room temperature ( 15 ° c .). the reaction mixture was heated at 80 ° c . for 16 hours , whereupon it was combined with a reaction mixture from a similar reaction carried out using c15 ( 100 mg , 0 . 343 mmol ). the mixture was partitioned between water ( 40 ml ) and ethyl acetate ( 40 ml ), and the aqueous layer was extracted with ethyl acetate ( 6 × 40 ml ). the combined organic layers were concentrated in vacuo and purified via reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 26 % to 56 % b ) to afford the product as a yellow solid . yield : 195 mg , 0 . 478 mmol , 57 %. chromatography on silica gel ( gradient : 0 % to 10 % methanol in dichloromethane ), followed by trituration with diethyl ether , provided a further purified sample as a light yellow solid . this sample was crystalline via powder x - ray diffraction . lcms m / z 408 . 4 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : δ 9 . 19 ( s , 1h ), 8 . 94 ( s , 1h ), 8 . 56 - 8 . 75 ( br m , 1h ), 8 . 20 ( d , j = 9 . 0 hz , 1h ), 7 . 75 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 46 ( br s , 1h ), 5 . 10 - 5 . 34 ( br m , 1h ), 4 . 72 ( s , 2h ), 4 . 06 - 4 . 22 ( br m , 1h ), 3 . 48 - 3 . 77 ( br m , 2h ), 2 . 46 ( s , 3h ), 2 . 10 - 2 . 28 ( br m , 1h ), 1 . 93 - 2 . 09 ( br m , 1h ), 1 . 76 - 1 . 93 ( br m , 1h ), 1 . 21 ( d , j = 5 . 9 hz , 3h ). n - bromosuccinimide ( 5 . 89 g , 33 . 1 mmol ) was added to a solution of 4 - methyl - 1h - 1 , 2 , 3 - triazole ( 2 . 50 g , 30 . 1 mmol ) in chloroform ( 30 ml ), and the reaction mixture was stirred for 16 hours at room temperature ( 15 ° c .). it was then diluted with dichloromethane ( 100 ml ), washed with water ( 2 × 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a white solid ( 4 . 9 g ), which was used directly in the next step . tert - butyl bromoacetate ( 8 . 8 g , 45 mmol ) was added in one portion to a mixture of c75 ( from the previous step , 4 . 9 g , ≦ 30 . 1 mmol ) and cesium carbonate ( 17 . 6 g , 54 . 0 mmol ) in n , n - dimethylformamide ( 80 ml ). the reaction mixture was stirred at room temperature ( 20 ° c .) for 16 hours , whereupon it was diluted with water ( 100 ml ) and extracted with ethyl acetate ( 2 × 80 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 2 × 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 15 %, ethyl acetate in petroleum ether ) provided the product as a colorless oil . yield : 4 . 00 g , 14 . 5 mmol , 48 % over 2 steps . step 3 . synthesis of tert - butyl ( 4 - methyl - 2h - 1 , 2 , 3 - triazol - 2 - yl ) acetate ( c77 ), methyl ( 4 - methyl - 2h - 1 , 2 , 3 - triazol - 2 - yl ) acetate ( c78 ), and ( 4 - methyl - 2h - 1 , 2 , 3 - triazol - 2 - yl ) acetic acid ( c79 ) a mixture of c76 ( 3 . 50 g , 12 . 7 mmol ) and palladium on carbon ( 10 %, 500 mg ) in methanol ( 35 ml ) was stirred under hydrogen ( 40 psi ) for 4 hours at room temperature ( 17 ° c .). the reaction mixture was filtered , and the filtrate was concentrated in vacuo , providing a yellow oil ( 3 . 00 g ). on the basis of 1 h nmr , the product was assigned as a mixture of c77 ( tert - butyl ester ), c78 ( methyl ester ), and c79 ( carboxylic acid ); this material was taken directly to the following step for ester hydrolysis . 1 h nmr peaks ( 400 mhz , cd 3 od ) δ [ 7 . 50 ( s ) and 7 . 49 ( s ), total 1h ], [ 5 . 23 ( s ), 5 . 17 ( s ), and 5 . 10 ( s ), total 2h ], 3 . 75 ( s , from methyl ester ), 2 . 30 ( s , 3h ), 1 . 46 ( s , from tert - butyl ester ). a mixture of c77 , c78 , and c79 ( from the previous step , 3 . 00 g , 512 . 7 mmol ) in trifluoroacetic acid ( 3 ml ) was stirred for 2 hours at room temperature ( 17 ° c .). after removal of solvent in vacuo , the residue was dissolved in tetrahydrofuran ( 10 ml ) and treated with aqueous sodium hydroxide solution ( 2 m , 10 ml ). the reaction mixture was stirred for 1 hour at room temperature ( 17 ° c . ), concentrated in vacuo , and partitioned between water ( 50 ml ) and dichloromethane ( 20 ml ). the aqueous layer was extracted with dichloromethane ( 2 × 20 ml ), and then acidified with 1 m aqueous hydrochloric acid to a ph of 1 . this acidic aqueous layer was extracted with ethyl acetate ( 3 × 40 ml ), and the combined ethyl acetate layers were dried over sodium sulfate , filtered , and concentrated under reduced pressure to provide the product as a yellow solid . yield : 1 . 9 g , 13 mmol , 100 % over 2 steps . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 46 ( s , 1h ), 5 . 25 ( s , 2h ), 2 . 34 ( s , 3h ). reaction of c15 with c79 was carried out using the method described for synthesis of 95 from c64 and ( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) acetic acid in example 95 . purification was effected via reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 35 % to 55 % b ), affording the product as a pale yellow gum . yield : 95 mg , 0 . 24 mmol , 48 %. lcms m / z 397 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 33 ( s , 1h ), 8 . 54 - 8 . 70 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 65 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 7 . 44 ( br s , 1h ), 6 . 02 ( s , 2h ), 5 . 15 - 5 . 30 ( m , 1h ), 4 . 29 ( dd , j = 12 , 5 hz , 1h ), 3 . 58 - 3 . 78 ( m , 2h ), 2 . 55 - 2 . 81 ( br m , 1h ), 2 . 31 ( s , 3h ), 2 . 3 - 2 . 52 ( br m , 1h ), 1 . 62 - 1 . 78 ( br m , 1h ), 1 . 44 - 1 . 62 ( br m , 1h ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). to a solution of 2 - bromo - 5 - methylpyrazine ( 5 . 0 g , 28 . 9 mmol ) in 1 , 4 - dioxane ( 150 ml ) were added dimethyl propanedioate ( 11 . 5 g , 87 . 0 mmol ), pyridine - 2 - carboxylic acid ( 712 mg , 5 . 78 mmol ), copper ( i ) iodide ( 2 . 20 g , 11 . 6 mmol ), and cesium carbonate ( 28 . 2 g , 86 . 6 mmol ). the reaction mixture was stirred at 95 ° c . for 16 hours , whereupon it was cooled to ambient temperature and combined with a similar reaction carried out using 2 - bromo - 5 - methylpyrazine ( 100 mg , 0 . 578 mmol ). the combined material was diluted with ethyl acetate ( 150 ml ), washed with saturated aqueous sodium chloride solution ( 150 ml ), dried over sodium sulfate , filtered and concentrated in vacuo . silica gel chromatography ( gradient : 1 % to 67 % ethyl acetate in petroleum ether ) provided the product as a yellow solid . yield : 5 . 1 g , 23 mmol , 78 %. lcms m / z 224 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 62 ( d , j = 1 . 5 hz , 1h ), 8 . 42 - 8 . 44 ( m , 1h ), 4 . 94 ( s , 1h ), 3 . 80 ( s , 6h ), 2 . 58 ( s , 3h ). aqueous sodium hydroxide solution ( 2 m , 44 . 6 ml , 89 . 2 mmol ) was added to a 10 ° c . solution of c80 ( 5 . 00 g , 22 . 3 mmol ) in tetrahydrofuran ( 15 ml ). after the reaction mixture had been stirred for 16 hours , it was combined with a similar reaction carried out using c80 ( 100 mg , 0 . 45 mmol ) and washed with 4 - methylpentan - 2 - one . the aqueous layer was then adjusted to ph 3 via addition of 6 m aqueous hydrochloric acid , while the temperature of the mixture was maintained between 20 ° c . and 25 ° c . after the mixture had been concentrated to dryness , the residue was extracted with 4 - methylpentan - 2 - one ( 2 × 150 ml ), and the two combined organic layers were dried over magnesium sulfate , filtered , and concentrated in vacuo . recrystallization from dichloromethane / tert - butyl methyl ether ( 1 : 20 , 50 ml ) afforded the product as a yellow solid . yield : 1 . 80 g , 11 . 8 mmol , 52 %. lcms m / z 153 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 33 ( s , 1h ), 8 . 20 ( s , 1h ), 3 . 62 ( s , 2h ), 2 . 45 ( s , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 4 . 30 g , 6 . 76 mmol ) and n , n - diisopropylethylamine ( 1 . 05 g , 8 . 12 mmol ) were added to a mixture of c15 ( 788 mg , 2 . 70 mmol ) and c81 ( 452 mg , 2 . 97 mmol ) in ethyl acetate ( 11 ml ) at room temperature ( 15 ° c .). the reaction mixture was heated at 80 ° c . for 44 hours , whereupon it was cooled to room temperature and combined with a similar reaction carried out using c15 ( 87 . 5 mg , 0 . 300 mmol ). the mixture was partitioned between water ( 40 ml ) and dichloromethane ( 100 ml ), and the aqueous layer was extracted with dichloromethane ( 6 × 100 ml ). the combined organic layers were concentrated in vacuo and purified using silica gel chromatography ( gradient : 0 % to 10 % methanol in dichloromethane ), followed by reversed phase hplc ( column : agela durashell c18 , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 35 % to 65 % b ). the product was obtained as a pale yellow gum . yield : 490 mg , 1 . 20 mmol , 40 %. lcms m / z 408 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 26 ( s , 1h ), 8 . 6 - 8 . 70 ( br m , 1h ), 8 . 58 ( s , 1h ), 8 . 38 ( s , 1h ), 8 . 21 ( d , j = 8 . 8 hz , 1h ), 7 . 62 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 5 . 18 - 5 . 35 ( br m , 1h ), 4 . 65 ( s , 2h ), 4 . 30 ( br dd , j = 11 . 8 , 5 . 0 hz , 1h ), 3 . 58 - 3 . 80 ( br m , 2h ), 2 . 61 - 2 . 82 ( br m , 1h ), 2 . 55 ( s , 3h ), 2 . 34 - 2 . 54 ( br m , 1h ), 1 . 58 - 1 . 91 ( br m , 2h ), 1 . 34 ( d , j = 6 . 3 hz , 3h ). potential improvement to step 3 ( synthesis of 104 ), demonstrated using the racemate of c15 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 436 mg , 0 . 685 mmol ) was added to a solution of the racemate of c15 ( 100 mg , 0 . 343 mmol ), c81 ( 52 . 1 mg , 0 . 342 mmol ), and n , n - diisopropylethylamine ( 66 μl , 0 . 38 mmol ) in ethyl acetate ( 3 ml ). the reaction mixture was allowed to stir at room temperature for 1 . 5 hours , at which time lcms analysis indicated complete conversion to the uncyclized amide ( lcms m / z 426 . 4 [ m + h ]+). the reaction mixture was concentrated in vacuo to remove ethyl acetate , and the resulting oil was dissolved in toluene ( 5 ml ) and heated to 105 ° c . for 1 hour and 40 minutes . the reaction mixture was partitioned between ethyl acetate and saturated aqueous sodium bicarbonate solution , and the organic layer was washed with saturated aqueous sodium chloride solution , dried over magnesium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 10 % to 20 % methanol in ethyl acetate ) provided an oil , which was dissolved in minimal ethyl acetate and treated with heptane . concentration in vacuo provided the racemate of 104 as a nearly colorless solid . yield : 78 mg , 0 . 19 mmol , 55 %. lcms m / z 408 . 3 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 600 mhz , dmso - d 6 ), characteristic peaks : δ 9 . 16 ( br s , 1h ), 8 . 59 - 8 . 71 ( m , 2h ), 8 . 46 ( s , 1h ), 8 . 19 ( d , j = 8 . 8 hz , 1h ), 7 . 74 ( br d , j = 8 . 8 hz , 1h ), 5 . 20 - 5 . 35 ( br m , 1h ), 4 . 76 ( s , 2h ), 4 . 10 - 4 . 20 ( br m , 1h ), 3 . 54 - 3 . 76 ( br m , 2h ), 2 . 48 ( s , 3h ), 2 . 12 - 2 . 28 ( br m , 1h ), 1 . 92 - 2 . 07 ( br m , 1h ), 1 . 78 - 1 . 92 ( br m , 1h ), 1 . 22 ( d , j = 5 . 9 hz , 3h ). a mixture of 2 - chloro - 5 -( trifluoromethyl ) pyrazine ( 6 . 10 g , 33 . 4 mmol ), dimethyl propanedioate ( 4 . 64 g , 35 . 1 mmol ), and cesium carbonate ( 12 . 0 g , 36 . 8 mmol ) in n , n - dimethylformamide ( 40 ml ) was stirred at 15 ° c . for 16 hours . the reaction mixture was then partitioned between ethyl acetate ( 200 ml ) and saturated aqueous sodium chloride solution ( 150 ml ), and the organic layer was washed with saturated aqueous sodium chloride solution ( 100 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . purification via chromatography on silica gel ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) afforded the product as a yellow oil ( 6 . 1 g ). by 1 h nmr , it was determined that the product contained dimethyl propanedioate . yield , corrected for dimethyl propanedioate contaminant : 4 . 30 g , 15 . 5 mmol , 46 %. 1 h nmr ( 400 mhz , cdcl 3 ), product peaks only : δ 8 . 91 ( s , 2h ), 5 . 08 ( s , 1h ), 3 . 83 ( s , 6h ). to a solution of c82 ( 2 . 78 g from the previous step ; corrected for dimethyl propanedioate contaminant : 1 . 96 g , 7 . 05 mmol ) in tetrahydrofuran ( 15 ml ) was added aqueous sodium hydroxide solution ( 2 m , 20 ml , 40 mmol ) in one portion , and the reaction mixture was stirred at 45 ° c . for 16 hours . after it had been cooled to 20 ° c ., the reaction mixture was washed with tert - butyl methyl ether ( 2 × 30 ml ). the aqueous layer was then acidified to ph 3 via addition of 6 m aqueous hydrochloric acid , and extracted with ethyl acetate ( 2 × 40 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 2 × 20 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow oil . yield : 1 . 0 g , 4 . 9 mmol , 70 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 8 . 93 ( br s , 1h ), 8 . 75 ( br s , 1h ), 4 . 07 ( s , 2h ). n , n - diisopropylethylamine ( 111 mg , 0 . 859 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 545 mg , 0 . 856 mmol ) were added to a solution of c15 ( 100 mg , 0 . 343 mmol ) and c83 ( 70 . 6 mg , 0 . 343 mmol ) in ethyl acetate ( 2 ml ) at room temperature ( 19 ° c .). the reaction mixture was stirred at 80 ° c . for 40 hours , whereupon it was washed sequentially with water ( 3 × 50 ml ) and with saturated aqueous sodium chloride solution ( 100 ml ). the organic layer was dried over sodium sulfate , filtered , and concentrated in vacuo . reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 44 % to 74 % b ) afforded the product as a brown solid . yield : 125 mg , 0 . 271 mmol , 79 %. lcms m / z 462 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 9 . 09 ( br s , 1h ), 8 . 98 ( br s , 1h ), 8 . 96 ( br s , 1h ), 8 . 75 - 8 . 90 ( br m , 1h ), 8 . 19 ( d , j = 9 . 0 hz , 1h ), 7 . 74 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 5 . 25 - 5 . 45 ( br m , 1h ), 4 . 93 - 4 . 98 ( m , 2h ), 4 . 28 ( br dd , j = 12 . 0 , 5 . 3 hz , 1h ), 3 . 69 - 3 . 86 ( m , 2h ), 2 . 62 - 2 . 83 ( br m , 1h ), 2 . 32 - 2 . 52 ( br m , 1h ), 1 . 93 - 2 . 22 ( br m , 2h ), 1 . 34 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 169 mg , 1 . 31 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 1 . 2 g , 1 . 9 mmol ) were added to a mixture of c17 ( 200 mg , 0 . 595 mmol ) and ( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) acetic acid ( 101 mg , 0 . 716 mmol ) in n , n - dimethylformamide ( 10 ml ), and the reaction mixture was heated at 100 ° c . overnight . it was then diluted with water ( 30 ml ) and extracted with dichloromethane ( 3 × 20 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 50 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : water containing 0 . 225 % formic acid ; mobile phase b : acetonitrile ; gradient : 31 % to 51 % b ) provided the product as a yellow solid . yield : 18 . 9 mg , 42 . 8 μmol , 7 %. lcms m / z 442 . 8 ( bromine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : δ 9 . 24 ( s , 1h ), 8 . 70 - 8 . 89 ( m , 1h ), 8 . 13 ( d , j = 8 . 5 hz , 1h ), 7 . 97 ( s , 1h ), 7 . 88 ( br dd , j = 9 , 2 hz , 1h ), 6 . 22 ( s , 2h ), 5 . 21 - 5 . 40 ( br m , 1h ), 4 . 11 - 4 . 23 ( m , 1h ), 3 . 54 - 3 . 78 ( m , 2h ), 2 . 25 ( s , 3h ), 2 . 05 - 2 . 24 ( br m , 1h ), 1 . 69 - 2 . 04 ( br m , 2h ), 1 . 23 ( d , j = 6 . 0 hz , 3h ). tetrakis ( triphenylphosphine ) palladium ( 0 ) ( 52 . 4 mg , 45 . 3 μmol ) and zinc cyanide ( 426 mg , 3 . 63 mmol ) were added to a solution of c84 ( 200 mg , 0 . 453 mmol ) in n , n - dimethylformamide ( 15 ml ), and the reaction vessel was evacuated and charged with nitrogen . this evacuation cycle was repeated twice , and the reaction mixture was then heated at 140 ° c . overnight . after filtration of the reaction mixture , the filtrate was diluted with water ( 50 ml ) and extracted with ethyl acetate ( 3 × 50 ml ); the combined organic layers were washed with saturated aqueous sodium chloride solution ( 50 ml ), dried over sodium sulfate , and concentrated in vacuo . purification via reversed phase hplc ( column : phenomenex gemini c18 , 8 μm ; mobile phase a : aqueous ammonia , ph 10 ; mobile phase b : acetonitrile ; gradient : 21 % to 41 % b ) afforded the product as a white solid . yield : 43 . 6 mg , 0 . 113 mmol , 25 %. lcms m / z 387 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 43 ( s , 1h ), 8 . 91 - 9 . 10 ( br m , 1h ), 8 . 39 ( d , j = 8 . 8 hz , 1h ), 7 . 90 ( dd , j = 9 , 1 hz , 1h ), 7 . 45 - 7 . 51 ( br s , 1h ), 6 . 01 ( s , 2h ), 5 . 34 - 5 . 48 ( br m , 1h ), 4 . 31 ( br dd , j = 12 , 5 hz , 1h ), 3 . 68 - 3 . 83 ( m , 2h ), 2 . 50 - 2 . 67 ( br m , 1h ), 2 . 33 ( s , 3h ), 2 . 21 - 2 . 38 ( br m , 1h ), 1 . 48 - 1 . 82 ( br m , 2h , assumed ; partially obscured by water peak ), 1 . 35 ( d , j = 6 . 0 hz , 3h ). lithium aluminum hydride ( 685 mg , 18 . 0 mmol ) was added to a 0 ° c . suspension of ethyl 1 - methyl - 1h - 1 , 2 , 3 - triazole - 4 - carboxylate ( 1 . 40 g , 9 . 02 mmol ) in tetrahydrofuran ( 20 ml ) and the reaction mixture was stirred at 0 ° c . for 1 hour . water was then added drop - wise at 0 ° c . until no further gas evolution was observed , whereupon sodium sulfate was added , and the mixture was stirred for 10 minutes . the mixture was then filtered , and the filtrate was concentrated in vacuo , affording the product as a yellow oil . yield : 700 mg , 6 . 19 mmol , 69 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 90 ( s , 1h ), 5 . 15 ( t , j = 5 . 5 hz , 1h ), 4 . 49 ( d , j = 5 . 5 hz , 2h ), 4 . 01 ( s , 3h ). methanesulfonyl chloride ( 851 mg , 7 . 43 mmol ) was added to a 0 ° c . solution of c85 ( 700 mg , 6 . 19 mmol ) and triethylamine ( 1 . 00 g , 9 . 88 mmol ) in dichloromethane ( 20 ml ). the reaction mixture was stirred at 0 ° c . for 2 hours , whereupon water ( 100 ml ) was added , and the mixture was extracted with dichloromethane ( 2 × 100 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo to provide the product as a yellow oil , which was used directly in the next step . yield : 800 mg , 4 . 18 mmol , 68 %. to a solution of c86 ( 800 mg , 4 . 18 mmol ) in acetonitrile ( 20 ml ) was added potassium cyanide ( 1 . 50 g , 23 . 0 mmol ). the reaction mixture was stirred at 60 ° c . overnight , whereupon it was treated with water ( 150 ml ) and extracted with dichloromethane ( 3 × 100 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 80 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo to afford the product as a brown solid . yield : 200 mg , 1 . 64 mmol , 39 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 61 ( s , 1h ), 4 . 13 ( s , 3h ), 3 . 89 ( br s , 2h ). a solution of c87 ( 200 mg , 1 . 64 mmol ) in concentrated hydrochloric acid ( 4 ml ) was stirred at 60 ° c . for 2 hours . after the reaction mixture had cooled to room temperature , it was diluted with water ( 10 ml ) and washed with tert - butyl methyl ether ( 2 × 20 ml ). the aqueous layer was then concentrated to dryness , providing the product as a brown solid . yield : 200 mg , 1 . 42 mmol , 87 %. lcms m / z 142 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 7 . 94 ( s , 1h ), 4 . 01 ( s , 3h ), 3 . 66 ( s , 2h ). n , n - diisopropylethylamine ( 133 mg , 1 . 03 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 327 mg , 1 . 03 mmol ) were added to a mixture of c15 ( 100 g , 0 . 343 mmol ) and c88 ( 100 mg , 0 . 709 mmol ) in n , n - dimethylformamide ( 2 ml ). the reaction mixture was heated at 100 ° c . overnight , whereupon it was cooled to room temperature , diluted with saturated aqueous sodium chloride solution ( 30 ml ), and extracted with dichloromethane ( 2 × 30 ml ). the combined organic layers were concentrated in vacuo and purified using reversed phase hplc ( column : phenomenex gemini c18 , 8 μm ; mobile phase a : aqueous ammonia , ph 10 ; mobile phase b : acetonitrile ; gradient : 25 % to 45 % b ) to afford the product as a white solid . yield : 30 . 6 mg , 77 . 1 μmol , 22 %. lcms m / z 396 . 9 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 18 ( s , 1h ), 8 . 57 - 8 . 71 ( br m , 1h ), 8 . 19 ( d , j = 8 . 8 hz , 1h ), 8 . 03 ( br s , 1h ), 7 . 74 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 5 . 22 - 5 . 39 ( br m , 1h ), 4 . 62 ( s , 2h ), 4 . 11 - 4 . 21 ( br m , 1h ), 4 . 02 ( s , 3h ), 3 . 55 - 3 . 76 ( br m , 2h ), 2 . 36 - 2 . 5 ( br m , 1h , assumed ; partially obscured by solvent peak ), 2 . 09 - 2 . 25 ( br m , 1h ), 1 . 73 - 2 . 04 ( br m , 2h ), 1 . 22 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 150 mg , 1 . 16 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 493 ml , 0 . 828 mmol ) were added to a mixture of c64 ( 148 mg , 0 . 524 mmol ) and c81 ( 80 mg , 0 . 53 mmol ) in n , n - dimethylformamide ( 2 ml ), and the reaction mixture was stirred at 110 ° c . for 15 hours . it was then poured into water ( 10 ml ) and extracted with dichloromethane ( 3 × 20 ml ). the combined organic layers were washed with water ( 2 × 20 ml ), dried over sodium sulfate , filtered , concentrated under reduced pressure , and purified using reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 25 % to 55 % b ) to afford the product as a light yellow solid . yield : 41 . 1 mg , 0 . 103 mmol , 20 %. lcms m / z 399 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cd 3 od ) δ 9 . 23 ( s , 1h ), 9 . 07 - 9 . 20 ( br m , 1h ), 8 . 64 ( s , 1h ), 8 . 47 ( s , 1h ), 8 . 32 ( d , j = 9 . 0 hz , 1h ), 7 . 97 ( br d , j = 8 . 5 hz , 1h ), 5 . 35 - 5 . 54 ( br m , 1h ), 4 . 81 ( s , 2h ), 4 . 22 - 4 . 33 ( m , 1h ), 3 . 68 - 3 . 86 ( br m , 2h ), 2 . 57 - 2 . 75 ( br m , 1h ), 2 . 55 ( s , 3h ), 2 . 24 - 2 . 44 ( br m , 1h ), 1 . 84 - 2 . 21 ( br m , 2h ), 1 . 33 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 1 . 29 ml , 7 . 41 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 3 . 53 g , 5 . 55 mmol ) were added to a mixture of c57 ( 500 mg , 1 . 85 mmol ) and c81 ( 296 mg , 1 . 94 mmol ) in n , n - dimethylformamide ( 9 . 2 ml ). the reaction mixture was heated to 110 ° c . overnight , whereupon it was cooled to room temperature and partitioned between water and ethyl acetate . the aqueous layer was extracted three times with ethyl acetate , and the combined organic layers were washed with water ( 3 × 20 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 10 % methanol in ethyl acetate ) afforded a mixture of 109 and c89 as a solid . yield of racemic product : 444 mg , 1 . 15 mmol , 62 %. this was combined with the product of a similar reaction ( 14 mg ) and separated into its component enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak as - h , 5 μm ; mobile phase : 4 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was 109 , obtained as a solid . yield : 164 mg , 36 % for the separation . lcms m / z 387 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 39 ( s , 1h ), 8 . 90 - 8 . 95 ( m , 1h ), 8 . 61 ( s , 1h ), 8 . 38 ( s , 1h ), 8 . 35 ( d , j = 8 . 6 hz , 1h ), 7 . 85 ( br d , j = 8 . 6 hz , 1h ), 5 . 35 - 5 . 58 ( m , 2h ), 4 . 69 ( s , 2h ), 2 . 61 - 2 . 81 ( m , 3h ), 2 . 57 ( s , 3h ), 2 . 46 - 2 . 61 ( m , 1h ), 1 . 90 - 2 . 18 ( m , 2h ). the second - eluting enantiomer , also isolated as a solid , was c89 , 1 -( cis - 3 - fluorocyclopentyl )- 2 -[( 5 - methylpyrazin - 2 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 2 . yield : 179 mg , 39 % for the separation . lcms m / z 387 . 5 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 39 ( s , 1h ), 8 . 90 - 8 . 95 ( m , 1h ), 8 . 60 ( br s , 1h ), 8 . 38 ( br s , 1h ), 8 . 35 ( d , j = 9 . 0 hz , 1h ), 7 . 85 ( dd , j = 8 . 6 , 1 . 2 hz , 1h ), 5 . 35 - 5 . 58 ( m , 2h ), 4 . 68 ( s , 2h ), 2 . 61 - 2 . 80 ( m , 3h ), 2 . 57 ( s , 3h ), 2 . 46 - 2 . 61 ( m , 1h ), 1 . 90 - 2 . 17 ( m , 2h ). ethyl bromoacetate ( 2 . 59 g , 15 . 5 mmol ) was added in one portion to a mixture of 4 - methoxy - 1h - pyrazole , hydrochloride salt ( 1 . 90 g , 14 . 1 mmol ) and potassium carbonate ( 4 . 10 g , 29 . 7 mmol ) in n , n - dimethylformamide ( 20 ml ), and the reaction mixture was stirred at room temperature ( 20 ° c .) for 60 hours . it was then diluted with water ( 100 ml ) and extracted with ethyl acetate ( 3 × 80 ml ). the combined organic layers were washed with saturated aqueous sodium chloride solution ( 2 × 150 ml ), dried over sodium sulfate , filtered , and concentrated in vacuo . silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) provided the product as a colorless oil . yield : 1 . 90 g , 10 . 3 mmol , 73 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 30 ( s , 1h ), 7 . 15 ( s , 1h ), 4 . 80 ( s , 2h ), 4 . 24 ( q , j = 7 . 2 hz , 2h ), 3 . 76 ( s , 3h ), 1 . 29 ( t , j = 7 . 2 hz , 3h ). aqueous sodium hydroxide solution ( 2 m , 10 . 3 ml , 20 . 6 mmol ) was added in one portion to a room temperature ( 17 ° c .) solution of c90 ( 1 . 90 g , 10 . 3 mmol ) in tetrahydrofuran ( 10 ml ), and the reaction mixture was stirred at room temperature ( 17 ° c .) for 3 hours . after removal of tetrahydrofuran in vacuo , the residue was dissolved in water ( 20 ml ) and washed with dichloromethane ( 2 × 20 ml ). the aqueous phase was acidified to ph 1 with 1 m hydrochloric acid , and then extracted with ethyl acetate ( 3 × 30 ml ). the combined ethyl acetate layers were dried over sodium sulfate , filtered , and concentrated under reduced pressure to afford the product as a white solid . yield : 1 . 5 g , 9 . 6 mmol , 93 %. 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 35 ( s , 1h ), 7 . 15 ( s , 1h ), 4 . 87 ( s , 2h ), 3 . 77 ( s , 3h ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 436 mg , 0 . 685 mmol ) and n , n - diisopropylethylamine ( 106 mg , 0 . 820 mmol ) were added to a mixture of c15 ( 80 mg , 0 . 27 mmol ) and c91 ( 42 . 8 mg , 0 . 274 mmol ) in ethyl acetate ( 2 ml ). the reaction mixture was heated at 85 ° c . for 16 hours , whereupon it was partitioned between ethyl acetate ( 10 ml ) and water ( 30 ml ). the organic layer was washed sequentially with water ( 2 × 30 ml ) and with saturated aqueous sodium chloride solution ( 50 ml ), dried , filtered , and concentrated in vacuo . reversed phase hplc ( column : waters xbridge c18 obd , 5 μm ; mobile phase a : water containing 0 . 05 % ammonium hydroxide ; mobile phase b : acetonitrile ; gradient : 5 % to 95 % b ) provided the product as a white solid . yield : 64 . 6 mg , 0 . 157 mmol , 58 %. lcms m / z 412 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 32 ( s , 1h ), 8 . 57 - 8 . 70 ( br m , 1h ), 8 . 23 ( d , j = 8 . 5 hz , 1h ), 7 . 66 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 7 . 29 ( s , 1h ), 7 . 14 ( s , 1h ), 5 . 70 ( s , 2h ), 5 . 27 - 5 . 41 ( m , 1h ), 4 . 28 ( br dd , j = 12 . 0 , 5 . 0 hz , 1h ), 3 . 67 ( s , 3h ), 3 . 63 - 3 . 77 ( m , 2h ), 2 . 53 - 2 . 74 ( br m , 1h ), 2 . 26 - 2 . 47 ( br m , 1h ), 1 . 56 - 1 . 7 ( br m , 1h , assumed ; partially obscured by water peak ), 1 . 40 - 1 . 56 ( br m , 1h ), 1 . 33 ( d , j = 6 . 0 hz , 3h ). this reaction was run in two identical batches . 2 , 2 - difluorocyclohexanamine , hydrochloride salt ( 410 mg , 2 . 39 mmol ) and n , n - diisopropylethylamine ( 900 mg , 6 . 96 mmol ) were added to a mixture of c61 ( 620 mg , 2 . 6 mmol ) in acetonitrile ( 10 ml ), and the reaction mixture was stirred at room temperature for 15 hours . the two batches were combined , concentrated in vacuo , and purified using silica gel chromatography ( gradient : 0 % to 30 % ethyl acetate in petroleum ether ) to provide the product as a yellow solid . yield : 790 mg , 2 . 38 mmol , 50 %. lcms m / z 332 . 7 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 49 ( s , 1h ), 9 . 05 ( brd , j = 9 . 8 hz , 1h ), 8 . 43 ( brs , 1h ), 8 . 15 ( d , j = 8 . 5 hz , 1h ), 7 . 96 ( dd , j = 8 . 8 , 1 . 8 hz , 1h ), 4 . 10 - 4 . 24 ( m , 1h ), 2 . 22 - 2 . 42 ( m , 2h ), 1 . 43 - 2 . 01 ( m , 6h , assumed ; partially obscured by water peak ). platinum on carbon ( 5 %, 81 mg ) was added in one portion to a mixture of c92 ( 690 mg , 2 . 08 mmol ) in tetrahydrofuran ( 50 ml ). the reaction mixture was purged three times with nitrogen , and then purged three times with hydrogen , whereupon it was hydrogenated for 2 hours at room temperature (− 20 ° c .) under 40 psi of hydrogen . after the reaction mixture had remained at room temperature for 16 hours , it was filtered through diatomaceous earth ; the filter pad was washed sequentially with tetrahydrofuran ( 150 ml ) and ethyl acetate ( 50 ml ), and the combined filtrates were concentrated in vacuo to afford the product as an orange solid . yield : 650 mg , quantitative . lcms m / z 302 . 7 [ m + h ] + . n , n - diisopropylethylamine ( 80 mg , 0 . 62 mmol ) was added to a mixture of c93 ( 100 mg , 0 . 33 mmol ) and c6 ( 68 mg , 0 . 48 mmol ) in toluene ( 1 ml ). 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 411 mg , 0 . 646 mmol ) was then added , and the reaction mixture was heated at 70 ° c . for 45 minutes , and then at 105 ° c . for 2 . 5 days . after cooling to room temperature , it was combined with a similar reaction carried out using c93 ( 20 mg , 66 μmol ), and the resulting mixture was taken up in ethyl acetate ( 40 ml ) and washed with saturated aqueous sodium bicarbonate solution ( 20 ml ). the aqueous layer was extracted with ethyl acetate ( 2 × 30 ml ), and the combined organic layers were washed with saturated aqueous sodium chloride solution ( 30 ml ), dried over sodium sulfate , filtered , and concentrated under reduced pressure . purification using reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 35 % to 65 % b ) afforded a racemic mixture of 111 and c94 as a yellow solid . from analysis of the 1 h nmr spectrum , this material was assumed to exist as a mixture of rotamers . yield of racemic material : 40 mg , 98 μmol , 25 %. lcms m / z 407 . 8 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ [ 9 . 40 ( s ) and 9 . 40 ( s ), total 1h ], [ 8 . 94 ( br s ) and 8 . 51 ( br s ), total 1h ], [ 8 . 39 ( d , j = 8 . 8 hz ) and 8 . 33 ( d , j = 8 . 5 hz ), total 1h ], [ 7 . 87 ( dd , j = 8 . 7 , 1 . 6 hz ) and 7 . 82 ( dd , j = 8 . 7 , 1 . 6 hz ), total 1h ], [ 6 . 11 - 6 . 13 ( m ) and 6 . 04 - 6 . 06 ( m ), total 1h ], 5 . 18 - 5 . 42 ( m , 1h ), [ 4 . 62 ( ab quartet , j ab = 16 . 7 hz , δν ab = 21 . 8 hz ) and 4 . 51 ( ab quartet , j ab = 15 . 8 hz , δν ab = 10 . 7 hz ), total 2h ], 2 . 47 - 2 . 88 ( m , 2h ), [ 2 . 43 ( d , j = 1 . 0 hz ) and 2 . 40 ( d , j = 0 . 8 hz ), total 3h ], 2 . 03 - 2 . 25 ( m , 4h ), 1 . 78 - 1 . 98 ( m , 2h ). the racemic material ( 34 . 3 mg ) was separated into its component enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 95 : 5 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting enantiomer was 111 . yield : 5 . 6 mg , 16 % for the separation . lcms m / z 408 . 4 [ m + h ] + . retention time : 3 . 66 minutes via analytical hplc [ column : chiral technologies ad - h , 4 . 6 × 100 mm , 5 μm ; mobile phase : 90 : 10 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide ); flow rate : 1 . 5 ml / minute ]. the second - eluting enantiomer was c94 . yield : 4 . 3 mg , 12 % for the separation . lcms m / z 408 . 1 [ m + h ] + . retention time 4 . 63 minutes ( analytical hplc conditions identical to those used above for 111 ). n , n - diisopropylethylamine ( 251 mg , 1 . 94 mmol ) was added to a 20 ° c . solution of c61 ( 210 mg , 0 . 899 mmol ) and ( 3r )- 1 - methylpyrrolidin - 3 - amine ( 77 . 9 mg , 0 . 778 mmol ) in acetonitrile ( 3 ml ). the reaction mixture was stirred at 20 ° c . for 2 hours , whereupon it was concentrated in vacuo . purification of the residue via silica gel chromatography ( gradient : 0 % to 1 % methanol in dichloromethane ) afforded the product as a yellow solid . yield : 210 mg , 0 . 706 mmol , 91 %. lcms m / z 297 . 9 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 04 - 10 . 15 ( br m , 1h ), 9 . 45 ( s , 1h ), 8 . 55 ( d , j = 1 . 5 hz , 1h ), 8 . 07 ( d , half of ab quartet , j = 8 . 5 hz , 1h ), 7 . 92 ( dd , half of abx pattern , j = 8 . 5 , 1 . 8 hz , 1h ), 4 . 65 - 4 . 74 ( m , 1h ), 3 . 02 - 3 . 10 ( m , 1h ), 2 . 84 - 2 . 90 ( m , 1h ), 2 . 80 ( dd , half of abx pattern , j = 9 . 9 , 5 . 6 hz , 1h ), 2 . 61 - 2 . 71 ( m , 1h ) 2 . 46 ( s , 3h ), 2 . 41 - 2 . 50 ( m , 1h ), 2 . 06 - 2 . 16 ( m , 1h ). to a solution of c95 ( 100 mg , 0 . 336 mmol ) in a mixture of ethanol ( 1 ml ) and water ( 0 . 25 ml ) were added ammonium chloride ( 36 mg , 0 . 673 mmol ) and iron powder ( 75 . 1 mg , 1 . 34 mmol ), and the reaction mixture was stirred at 80 ° c . for 1 hour . it was then filtered , and the filter cake was washed with methanol ( 30 ml ). the organic layer from the combined filtrates was concentrated in vacuo and purified via silica gel chromatography ( gradient : 0 % to 15 % methanol in dichloromethane ), affording the product as a yellow solid . yield : 112 mg , assumed quantitative . 1 h nmr ( 400 mhz , dmso - d 6 ), characteristic peaks : δ 8 . 65 - 8 . 71 ( br s , 1h ), 8 . 58 ( s , 1h ), 7 . 89 ( d , j = 8 . 5 hz , 1h ), 7 . 62 ( dd , j = 8 . 5 , 2 . 0 hz , 1h ), 5 . 56 - 5 . 70 ( br s , 1h ), 5 . 43 ( d , j = 10 . 5 hz , 1h ), 4 . 32 - 4 . 46 ( br m , 1h ), 2 . 81 ( s , 3h ), 1 . 84 - 1 . 95 ( m , 1h ). n , n - diisopropylethylamine ( 25 . 4 mg , 0 . 196 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 238 mg , 0 . 374 mmol ) were added to a solution of c96 ( 50 mg , 0 . 19 mmol ) and c20 ( 27 . 1 mg , 0 . 191 mmol ) in toluene ( 1 ml ), and the reaction mixture was stirred at 70 ° c . for 1 hour . lcms at this point indicated conversion to the intermediate amide ( lcms m / z 392 . 2 [ m + h ]+), and the reaction mixture was then stirred at 105 ° c . for 16 hours , whereupon it was concentrated in vacuo and purified by reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 27 % to 47 % b ), affording the product as a yellow solid . yield : 13 . 0 mg , 34 . 8 μmol , 18 %. lcms m / z 374 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 00 - 10 . 26 ( br s , 1h ), 9 . 39 ( s , 1h ), 8 . 32 ( d , j = 8 . 6 hz , 1h ), 7 . 84 ( dd , j = 8 . 7 , 1 . 6 hz , 1h ), 5 . 50 - 5 . 62 ( m , 1h ), 4 . 72 ( br ab quartet , j ab = 16 . 3 hz , δν ab = 20 . 5 hz , 2h ), 3 . 38 - 3 . 48 ( m , 2h ), 2 . 86 ( dd , j = 11 . 0 , 10 . 8 hz , 1h ), 2 . 60 ( s , 3h ), 2 . 57 ( s , 3h ), 2 . 42 - 2 . 63 ( m , 2h ), 2 . 32 - 2 . 42 ( br m , 1h ). n , n - diisopropylethylamine ( 25 . 4 mg , 0 . 196 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 238 mg , 0 . 374 mmol ) were added to a solution of c96 ( 50 mg , 0 . 19 mmol ) and pyrazin - 2 - ylacetic acid ( 26 . 4 mg , 0 . 191 mmol ) in toluene ( 1 ml ). the reaction mixture was stirred at 70 ° c . for 1 hour , and then at 105 ° c . for 16 hours . removal of solvent in vacuo provided a residue , which was purified using reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 25 % to 55 % b ) to afford the product as a yellow solid . yield : 10 . 3 mg , 30 . 6 μmol , 16 %. lcms m / z 370 . 1 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 10 . 18 - 10 . 32 ( br s , 1h ), 9 . 38 ( s , 1h ), 8 . 72 ( d , j = 1 . 3 hz , 1h ), 8 . 52 - 8 . 54 ( m , 2h ), 8 . 32 ( d , j = 8 . 5 hz , 1h ), 7 . 83 ( dd , j = 8 . 6 , 1 . 6 hz , 1h ), 5 . 64 - 5 . 74 ( m , 1h ), 4 . 78 ( br s , 2h ), 3 . 40 - 3 . 46 ( m , 1h ), 3 . 38 ( dd , j = 11 . 0 , 4 . 3 hz , 1h ), 2 . 79 ( dd , j = 11 . 0 , 10 . 8 hz , 1h ), 2 . 56 ( s , 3h ), 2 . 53 - 2 . 61 ( m , 1h ), 2 . 41 - 2 . 52 ( m , 1h ), 2 . 15 - 2 . 27 ( br m , 1h ). a solution of 6 -( trifluoromethyl ) quinolin - 4 - ol ( 2 . 00 g , 9 . 38 mmol ) in concentrated nitric acid ( 10 ml ) was stirred for 14 hours at 50 ° c ., whereupon it was poured into water ( 50 ml ). the resulting solid was isolated via filtration , providing the product as a pale yellow solid . yield : 1 . 80 g , 6 . 97 mmol , 74 %. 1 h nmr ( 400 mhz , dmso - d 6 ) δ 9 . 29 ( s , 1h ), 8 . 46 ( s , 1h ), 8 . 11 ( d , j = 9 . 0 hz , 1h ), 7 . 92 ( d , j = 8 . 5 hz , 1h ). phosphorus oxychloride ( 3 . 25 ml , 34 . 9 mmol ) was added to a 15 ° c . solution of compound c97 ( 3 . 00 g , 11 . 6 mmol ) in n , n - dimethylformamide ( 10 ml ), and the reaction mixture was stirred for 2 hours at 15 ° c . it was then poured into water ( 80 ml ). collection of the precipitate via filtration provided the product as a solid ( 2 . 40 g ). this material was impure by 1 h nmr analysis , and was taken directly into the following step . 1 h nmr ( 400 mhz , dmso - d 6 ), product peaks only : δ 9 . 22 ( s , 1h ), 8 . 40 ( br s , 1h ), 8 . 03 ( br d , j = 8 . 5 hz , 1h ), 7 . 92 - 7 . 97 ( m , 1h ). n , n - diisopropylethylamine ( 3 . 36 g , 26 . 0 mmol ) and p2 ( 2 . 43 g , 9 . 16 mmol ) were slowly added to a 15 ° c . solution of c98 ( from the previous step , 2 . 40 g , 58 . 68 mmol ) in acetonitrile ( 30 ml ), and the reaction mixture was stirred for 30 minutes at 80 ° c . water ( 100 ml ) was added , and the resulting mixture was extracted with ethyl acetate ( 3 × 100 ml ). the combined organic layers were concentrated in vacuo , and the residue was purified via silica gel chromatography ( gradient : 9 % to 25 % ethyl acetate in petroleum ether ) to provide the product as a yellow solid . yield : 3 . 40 g , 6 . 73 mmol , 58 % over 2 steps . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 11 ( s , 1h ), 8 . 60 ( br s , 1h ), 8 . 15 ( d , j = 9 . 0 hz , 1h ), 7 . 92 ( dd , j = 8 . 8 , 1 . 8 hz , 1h ), 6 . 84 ( d , j = 8 . 0 hz , 1h ), 6 . 22 ( dd , j = 8 . 3 , 2 . 3 hz , 1h ), 6 . 16 ( d , j = 2 . 0 hz , 1h ), 4 . 33 - 4 . 44 ( m , 2h ), 4 . 02 - 4 . 10 ( m , 1h ), 3 . 77 - 3 . 87 ( m , 1h ), 3 . 68 ( s , 3h ), 3 . 50 ( s , 3h ), 3 . 36 - 3 . 46 ( m , 2h ), 1 . 95 - 2 . 10 ( m , 3h ), 1 . 67 - 1 . 78 ( m , 1h ), 1 . 23 ( d , j = 6 . 0 hz , 3h ). trifluoroacetic acid ( 7 . 67 g , 67 . 3 mmol ) was added to a 15 ° c . solution of compound c99 ( 3 . 40 g , 6 . 73 mmol ) in dichloromethane ( 30 ml ), and the reaction mixture was stirred for 30 minutes at 15 ° c . solvents were removed in vacuo , and the residue was diluted with water ( 100 ml ) and extracted with ethyl acetate ( 3 × 100 ml ). the combined organic layers were concentrated in vacuo to afford the product ( 2 . 50 g ) as a pale yellow solid , a portion of which was used directly in the following step . lcms m / z 355 . 8 [ m + h ] + . iron powder ( 314 mg , 5 . 62 mmol ) and ammonium chloride ( 301 mg , 5 . 63 mmol ) were added to a solution of c100 ( from the previous step , 200 mg , 50 . 54 mmol ) in ethanol ( 5 ml ) and water ( 1 ml ), and the reaction mixture was stirred for 1 hour at 80 ° c . it was then filtered through diatomaceous earth , and the filtrate was concentrated in vacuo . silica gel chromatography ( gradient : 9 % to 33 % ethyl acetate in petroleum ether ) afforded the product as a pale grey solid . yield : 140 mg , 0 . 430 mmol , 80 % over 2 steps . lcms m / z 325 . 9 [ m + h ] + . to a solution of c20 ( 60 . 0 mg , 0 . 422 mmol ) in n , n - dimethylformamide ( 2 ml ) were added c101 ( 137 mg , 0 . 421 mmol ), n , n - diisopropylethylamine ( 161 mg , 1 . 25 mmol ), and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 39 ml , 0 . 655 mmol ). the reaction mixture was stirred for 2 hours at 110 ° c ., whereupon it was diluted with water ( 80 ml ) and extracted with ethyl acetate ( 3 × 80 ml ). the combined organic layers were concentrated in vacuo and purified by reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 40 % to 70 % b ), providing the product as a pale grey solid . yield : 16 . 8 mg , 38 . 9 μmol , 9 %. lcms m / z 432 . 0 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 41 ( s , 1h ), 8 . 94 - 9 . 11 ( br m , 1h ), 8 . 41 ( d , j = 8 . 8 hz , 1h ), 7 . 90 ( dd , j = 8 . 8 , 1 . 8 hz , 1h ), 4 . 99 - 5 . 19 ( br m , 1h ), 4 . 62 ( s , 2h ), 4 . 33 ( br dd , j = 12 , 5 hz , 1h ), 3 . 64 - 3 . 79 ( m , 2h ), 2 . 67 - 2 . 87 ( br m , 1h ), 2 . 61 ( s , 3h ), 2 . 38 - 2 . 63 ( br m , 1h ), 1 . 80 - 2 . 09 ( br m , 2h ), 1 . 35 ( d , j = 6 . 0 hz , 3h ). n , n - diisopropylethylamine ( 71 . 6 μl , 0 . 411 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 0 . 245 ml , 0 . 412 mmol ) were added to a mixture of c15 ( 40 . 0 mg , 0 . 137 mmol ) and ( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) acetic acid ( 19 . 3 mg , 0 . 137 mmol ) in ethyl acetate ( 0 . 8 ml ), and the reaction mixture was heated at 80 ° c . overnight . it was then partitioned between saturated aqueous sodium bicarbonate solution and ethyl acetate , and the aqueous layer was extracted twice with ethyl acetate . the combined organic layers were dried over sodium sulfate , filtered , and concentrated under reduced pressure . chromatography on silica gel ( gradient : 0 % to 10 % methanol in dichloromethane ), followed by trituration with diethyl ether , provided the product as a yellow solid . yield : 33 . 2 mg , 83 . 6 μmol , 61 %. lcms m / z 397 . 3 [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 28 ( s , 1h ), 8 . 55 - 8 . 75 ( br m , 1h ), 8 . 24 ( d , j = 8 . 6 hz , 1h ), 7 . 66 ( dd , j = 9 . 0 , 2 . 0 hz , 1h ), 6 . 07 ( s , 1h ), 4 . 90 - 5 . 13 ( br m , 1h ), 4 . 61 ( s , 2h ), 4 . 34 ( br dd , j = 11 . 7 , 4 . 3 hz , 1h ), 3 . 64 - 3 . 82 ( m , 2h ), 2 . 62 - 2 . 88 ( br m , 1h ), 2 . 36 - 2 . 59 ( br m , 1h ), 2 . 28 ( s , 3h ), 1 . 71 - 2 . 02 ( br m , 2h ), 1 . 37 ( d , j = 5 . 9 hz , 3h ). n , n - diisopropylethylamine ( 52 mg , 0 . 40 mmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 480 mg , 0 . 75 mmol ) were added to a solution of c15 ( 102 mg , 0 . 350 mmol ) and ( 5 - methyl - 1 , 3 , 4 - thiadiazol - 2 - yl ) acetic acid ( 60 mg , 0 . 38 mmol ) in toluene ( 3 ml ). the reaction mixture was heated to 70 ° c . for 2 hours , and then at 105 ° c . for 18 hours . saturated aqueous sodium bicarbonate solution ( 10 ml ) was added , and the resulting mixture was extracted with ethyl acetate ( 6 × 10 ml ). the combined organic layers were dried over sodium sulfate , filtered , and concentrated in vacuo . purification via reversed phase hplc ( column : agela durashell , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 34 % to 54 % b ) afforded the product as a red solid . yield : 38 mg , 92 μmol , 26 %. lcms m / z 414 . 0 ( chlorine isotope pattern observed ) [ m + h ] + . 1 h nmr ( 400 mhz , cdcl 3 ) δ 9 . 28 ( s , 1h ), 8 . 56 - 8 . 76 ( br m , 1h ), 8 . 23 ( d , j = 9 . 0 hz , 1h ), 7 . 65 ( dd , j = 8 . 9 , 2 . 1 hz , 1h ), 5 . 23 - 5 . 37 ( m , 1h ), 4 . 94 ( s , 2h ), 4 . 31 ( br dd , j = 12 , 5 hz , 1h ), 3 . 68 - 3 . 82 ( m , 2h ), 2 . 76 ( s , 3h ), 2 . 57 - 2 . 80 ( br m , 1h ), 2 . 31 - 2 . 52 ( br m , 1h ), 1 . 58 - 1 . 9 ( br m , 2h , assumed ; partially obscured by water peak ), 1 . 36 ( d , j = 6 . 0 hz , 3h ). conversion of vicinal chloro - nitro bicyclic heteroaromatics to 1 , 2 - disubstituted - imidazo [ 4 , 5 - c ]- fused tricyclic compounds m1 the vicinal chloro - nitro bicyclic heteroaromatic starting material c35 ( 1 mmol ) was combined in a vial with amine r 2 — nh 2 ( 1 . 2 mmol ) and n , n - dimethylformamide ( 4 ml ). triethylamine ( 300 μl , 2 mmol ) was added , the vial was sealed , and the reaction mixture was shaken at 30 ° c . for 16 hours . solvent was removed using a speedvac ® concentrator to provide the product . compound c36 from the previous step was mixed with methanol ( 2 ml ) and aqueous ammonium hydroxide solution ( 2 ml ). activated zinc dust ( 650 mg , 10 mmol ) was added to the vial , which was then sealed and shaken at 30 ° c . for 1 hour . the reaction mixture was filtered , and the filtrate was concentrated using a speedvac ® concentrator . water ( 10 ml ) was added to the residue , and the mixture was extracted with ethyl acetate ( 3 × 10 ml ); the combined organic layers were dried over sodium sulfate , filtered , and concentrated to afford the product . a solution of c37 in 1 , 4 - dioxane ( 0 . 125 m , 800 μl , 100 μmol ) was added to the carboxylic acid ( r 1 )( r 10 ) chcooh ( 100 μmol ). triethylamine ( 45 μl , 320 μmol ) and 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide ( 50 % solution in ethyl acetate , 80 μl , 130 μmol ) were added , the vial was sealed , and the reaction mixture was shaken at 130 ° c . for 16 hours . after concentration using a speedvac ®, the product was purified using one of the following reversed phase hplc systems : 1 ) column : phenomenex gemini c18 , 8 μm ; gradient : acetonitrile in aqueous ammonium hydroxide ( ph 10 ); 2 ) column : dikma diamonsil ( 2 ) c18 , 5 μm ; gradient : acetonitrile in ( water containing 0 . 225 % formic acid ); 3 ) column : ymc - actus triart c18 , 5 μm ; gradient : acetonitrile in aqueous ammonium hydroxide ( ph 10 ). conversion of vicinal chloro - nitro bicyclic heteroaromatics to 1 , 2 - disubstituted - imidazo [ 4 , 5 - c ]- fused tricyclic compounds m1 compound c35 ( 0 . 15 mmol ) was combined with amine r 2 — nh 2 ( 0 . 18 mmol ) and n , n - diisopropylethylamine ( 0 . 10 ml , 0 . 6 mmol ) in acetonitrile ( 0 . 5 ml ), and the reaction vial was shaken at 45 ° c . for 2 hours . the reaction mixture was then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid - phase extraction cartridge ( 6 ml ) loaded with sodium sulfate (˜ 1 g ); this extraction process was repeated twice , and solvent was removed in vacuo to provide the product . compound c36 ( from the previous step , ˜ 0 . 15 mmol ) was treated with methanol ( 0 . 3 ml ) and aqueous ammonium hydroxide solution ( 0 . 3 ml ). zinc dust (˜ 100 mg , 1 . 5 mmol ) was added , and the reaction mixture was shaken at room temperature for 1 hour , then filtered through diatomaceous earth . the filter pad was washed with ethyl acetate ( 2 × 2 . 5 ml ), and the combined filtrates were concentrated in vacuo . the residue was partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid - phase extraction cartridge ( 6 ml ) loaded with sodium sulfate (˜ 1 g ); this extraction process was repeated twice , and solvent was removed under reduced pressure to provide the product . compound c37 ( from the previous step , ˜ 0 . 15 mmol ) was dissolved in 1 - methylpyrrolidin - 2 - one ( 0 . 4 ml ) and added to carboxylic acid ( r 1 )( r 10 ) chcooh ( 0 . 19 mmol ). triethylamine ( 23 μl , 0 . 16 mmol ) and a solution of o -( 7 - azabenzotriazol - 1 - yl )- n , n , n ′, n ′- tetramethyluronium hexafluorophosphate ( hatu , 71 mg , 0 . 19 mmol ) in 1 - methylpyrrolidin - 2 - one ( 0 . 3 ml ) were added . ( an extra equivalent of triethylamine was employed if the carboxylic acid was a hydrochloride salt .) the reaction mixture was shaken at 100 ° c . for 20 hours , then partitioned between water ( 1 . 5 ml ) and ethyl acetate ( 2 . 4 ml ) with vortexing . the organic layer was eluted through a solid - phase extraction cartridge ( 6 ml ) loaded with sodium sulfate (˜ 1 g ); this extraction process was repeated twice , and solvent was removed under reduced pressure to provide the product . purification was carried out via gradient elution , using one of the following reversed phase hplc systems : 1 ) column : waters sunfire c18 , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); or 2 ) column : waters xbridge c18 , 5 μm ; mobile phase a : 0 . 03 % ammonium hydroxide in water ( v / v ); mobile phase b : 0 . 03 % ammonium hydroxide in acetonitrile ( v / v ). table 1 , below , provides the method of preparation , structure , and physicochemical data for the compounds of examples 12 - 92 and 117 - 145 . 2 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : lux cellulose - 1 , 5 μm ; eluent : 4 : 1 carbon dioxide / methanol ). the second - eluting compound was example 12 . the enantiomer of example 12 , 8 - bromo - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , was the first - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 510 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 226 nm . 3 . example 9 was reacted with hydroxylamine and n , n - diisopropylethylamine in ethanol ; the resulting 2 -{ 8 - chloro - 1 -[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 1h - imidazo [ 4 , 5 - c ] quinolin - 2 - yl }- n ′- hydroxyethanimidamide was cyclized using trimethyl orthoformate and p - toluenesulfonic acid to afford example 13 . 4 . the requisite 8 - bromo - 2 - methyl - 1 -( tetrahydro - 2h - pyran - 4 - yl )- 1h - imidazo [ 4 , 5 - c ] quinoline was prepared using the general method of example 6 . 5 . reaction of tert - butyl [( 1r , 3r )- 3 - hydroxycyclopentyl ] carbamate with ( diethylamino ) sulfur trifluoride , followed by treatment with hydrogen chloride in ethyl acetate , afforded ( 1r , 3s )- 3 - fluorocyclopentanamine . 6 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 1 % to 5 % b over 0 . 6 minutes ; 5 % to 100 % b over 3 . 4 minutes ; flow rate : 0 . 8 ml / minute . 7 . the requisite 8 - bromo - 2 - methyl - 1 -( 2 - methyltetrahydro - 2h - pyran - 4 - yl )- 1h - imidazo [ 4 , 5 - c ] quinoline was prepared using the general method of example 6 . 8 . 8 - bromo - 1 -( 2 - methyltetrahydro - 2h - pyran - 4 - yl )- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline was synthesized using the method of example 7 . the final product was generated as a mixture of examples 21 and 23 , which was separated via reversed phase hplc ( column : ymc - actus triart c18 , 5 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 29 % to 49 % b ). 9 . the requisite 8 - bromo - 1 -( cis - 2 - methyltetrahydro - 2h - pyran - 4 - yl )- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline was prepared using the general method of example 1 . 10 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 50 mm , 3 μm ; same gradient system ), example 22 exhibited a retention time of 1 . 18 minutes . the enantiomer of example 22 , 1 -[( 2 s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 1 . 37 minutes under the same conditions . the enantiomer of example 22 , lcms m / z 374 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 534 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 258 nm . 11 . example 23 was separated into its component enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 50 mm , 3 μm ; same gradient system ), example 24 exhibited a retention time of 1 . 37 minutes . the enantiomer of example 24 , 1 -[( 2r , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 1 . 51 minutes under the same conditions . the enantiomer of example 24 , lcms m / z 374 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 267 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 134 nm . 12 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 0375 % trifluoroacetic acid in water ; mobile phase b : 0 . 01875 % trifluoroacetic acid in acetonitrile ; gradient : 10 % to 100 % b over 4 . 0 minutes ; flow rate : 0 . 8 ml / minute . 13 . conditions for analytical hplc . column : waters xbridge c18 , 2 . 1 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % ammonium hydroxide in water ; mobile phase b : acetonitrile ; gradient : 5 % b for 0 . 5 minutes ; 5 % to 100 % b over 2 . 9 minutes ; 100 % b for 0 . 8 minutes ; flow rate : 0 . 8 ml / minute . 14 . this example was prepared as a racemate ; the enantiomers were separated via supercritical fluid chromatography . example 51 was the second - eluting enantiomer ; retention time 6 . 21 minutes ( analytical column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ; flow rate : 1 . 5 ml / minute ). the enantiomer of example 51 ( example 5 ) exhibited a retention time of 5 . 65 minutes in this analytical system . 15 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 54 exhibited a retention time of 6 . 28 minutes . the enantiomer of example 54 , 8 - fluoro - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 6 . 66 minutes under the same conditions . the enantiomer of example 54 , lcms m / z 366 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 332 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 236 nm . 16 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralcel od - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc [ column : chiralpak as - h , 4 . 6 × 250 mm , 5 μm ; mobile phase : 10 % ethanol ( containing 0 . 05 % diethylamine ) in carbon dioxide ], example 55 exhibited a retention time of 5 . 85 minutes . the enantiomer of example 55 , 8 - fluoro - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 3 - thiazol - 4 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , lcms m / z 383 . 0 [ m + h ] + , had a retention time of 6 . 02 minutes under the same conditions . the enantiomer of example 55 , lcms m / z 366 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 725 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 380 nm . 17 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralcel od - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralcel od - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ; flow rate : 1 . 5 ml / minute ), example 57 exhibited a retention time of 8 . 22 minutes . the enantiomer of example 57 , 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 3 - thiazol - 4 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 7 . 29 minutes under the same conditions . the enantiomer of example 57 , lcms m / z 390 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 382 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 196 nm . 18 . hydrogenation of 2 , 6 - dimethyl - 4h - pyran - 4 - one over palladium on carbon afforded cis - 2 , 6 - dimethyltetrahydro - 4h - pyran - 4 - one , which was converted to the requisite ( 2r , 4r , 6s )- n -( 2 , 4 - dimethoxybenzyl )- 2 , 6 - dimethyltetrahydro - 2h - pyran - 4 - amine using the method described for synthesis of p1 in preparation p1 . 19 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ), example 62 exhibited a retention time of 4 . 19 minutes . the enantiomer of example 62 , 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 5 . 07 minutes under the same conditions . the enantiomer of example 62 , lcms m / z 379 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1713 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 508 nm . 20 . this example was prepared as a racemate ; the enantiomers were separated via supercritical fluid chromatography . example 64 was the second - eluting enantiomer ; retention time 8 . 87 minutes ( analytical column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the enantiomer of example 64 ( example 8 ) exhibited a retention time of 6 . 98 minutes in this analytical system . 21 . this example was prepared as a racemate ; the enantiomers were separated via supercritical fluid chromatography . example 65 was the second - eluting enantiomer ; retention time 8 . 73 minutes ( analytical column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the enantiomer of example 65 , 8 - chloro - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1h - 1 , 2 , 4 - triazol - 1 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 7 . 97 minutes under the same conditions . the enantiomer of example 65 , lcms m / z 382 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 687 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 241 nm . 22 . the requisite cis - n -( 2 , 4 - dimethoxybenzyl )- 2 - ethyltetrahydro - 2h - pyran - 4 - amine was prepared from propanal and but - 3 - en - 1 - ol in analogy with the syntheses of p1 and p2 , except that pyridinium chlorochromate was used in place of jones reagent . 23 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ), example 67 exhibited a retention time of 1 . 17 minutes . the enantiomer of example 67 , 1 -[( 2s , 4s )- 2 - ethyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , had a retention time of 1 . 38 minutes under the same conditions . the enantiomer of example 67 , lcms m / z 388 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 699 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 403 nm . 24 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - 3 , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; same gradient system ), example 68 exhibited a retention time of 5 . 76 minutes . the enantiomer of example 68 , 1 -[( 2 s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 2 - oxazol - 3 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ][ 1 , 5 ] naphthyridine , had a retention time of 6 . 14 minutes under the same conditions . the enantiomer of example 68 , lcms m / z 349 . 9 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 853 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 632 nm . 25 . conditions for analytical hplc . column : waters atlantis dc18 , 4 . 6 × 50 mm , 5 μm ; mobile phase a : 0 . 05 % trifluoroacetic acid in water ( v / v ); mobile phase b : 0 . 05 % trifluoroacetic acid in acetonitrile ( v / v ); gradient : 5 . 0 % to 95 % b , linear over 4 . 0 minutes ; flow rate : 2 ml / minute . 26 . compound c34 was combined with a solution of ammonia in methanol ( 7 m ) and heated in a microwave reactor at 160 ° c . to afford example 85 . 27 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 87 exhibited a retention time of 6 . 39 minutes . the enantiomer of example 87 , 8 - methoxy - 2 -[( 5 - methyl - 1 , 2 , 4 - oxadiazol - 3 - yl ) methyl ]- 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 7 . 57 minutes under the same conditions . the enantiomer of example 87 , lcms m / z 394 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 2853 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 929 nm . 28 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 88 exhibited a retention time of 6 . 96 minutes . the enantiomer of example 88 , 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -[( 4 - methyl - 1h - 1 , 2 , 3 - triazol - 1 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 7 . 78 minutes under the same conditions . the enantiomer of example 88 , lcms m / z 393 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1055 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 372 nm . 29 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 89 exhibited a retention time of 7 . 54 minutes . the enantiomer of example 89 , 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 2 -( 1 , 3 - thiazol - 4 - ylmethyl )- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 8 . 17 minutes under the same conditions . the enantiomer of example 89 , lcms m / z 395 . 0 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1218 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 743 nm . 30 . the racemic product was separated into its enantiomers via supercritical fluid chromatography ( column : chiralpak ad - h , 5 μm ; mobile phase a : carbon dioxide ; mobile phase b : ethanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). on analytical hplc ( column : chiralpak ad - h , 4 . 6 × 250 mm , 5 μm ; same gradient system ), example 90 exhibited a retention time of 8 . 60 minutes . the enantiomer of example 90 , 2 -( imidazo [ 2 , 1 - b ][ 1 , 3 , 4 ] thiadiazol - 6 - ylmethyl )- 8 - methoxy - 1 -[( 2s , 4s )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , had a retention time of 9 . 48 minutes under the same conditions . the enantiomer of example 90 , lcms m / z 435 . 1 [ m + h ] + , exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 623 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 245 nm . 31 . reagent cis - 2 -[( benzyloxy ) methyl ]- n -( 2 , 4 - dimethoxybenzyl ) tetrahydro - 2h - pyran - 4 - amine was prepared from ( benzyloxy ) acetaldehyde and but - 3 - en - 1 - ol in analogy with footnote 22 . 32 . intermediate 1 -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 2 - methyl - 1h - imidazo [ 4 , 5 - c ] quinoline was deprotected with boron trichloride , and the resulting alcohol was converted to the 4 - methylbenzenesulfonate derivative . displacement with tetraethylammonium cyanide afforded example 91 . 33 . the requisite ( 5 - methyl - 1 , 3 - oxazol - 2 - yl ) acetic acid was prepared using the method of a . s . k . hashmi et al ., org . lett . 2004 , 6 , 4391 - 4394 . 34 . in this case , the zinc cyanide reaction employed tris ( dibenzylideneacetone ) dipalladium ( 0 ) and dicyclohexyl ( 2 ′, 6 ′- dimethoxybiphenyl - 2 - yl ) phosphane rather than tetrakis ( triphenylphosphine ) palladium ( 0 ), and was carried out using microwave irradiation . 35 . the racemic product was separated into its enantiomers via supercritical fluid chromatography [ column : phenomenex lux cellulose - 1 , 5 μm ; eluent : 4 : 1 carbon dioxide /( ethanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting compound was example 118 . the enantiomer of example 118 , 1 -( cis - 3 - fluorocyclopentyl ]- 2 -[( 3 - methyl - 1 , 2 - oxazol - 5 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 2 wt ic 50 , 22 . 4 nm ; lrrk2 , format 2 g2019s mutant ic 50 , 26 . 1 nm . 36 . reaction of ethyl 5 -( trifluoromethyl )- 1 , 2 - oxazole - 3 - carboxylate with sodium borohydride , followed by conversion of the primary alcohol to the corresponding mesylate and displacement with potassium cyanide , provided [ 5 -( trifluoromethyl )- 1 , 2 - oxazol - 3 - yl ] acetonitrile . nitrile hydrolysis using concentrated hydrochloric acid then afforded the requisite [ 5 -( trifluoromethyl )- 1 , 2 - oxazol - 3 - yl ] acetic acid . 37 . the requisite ( 2 - cyclopropyl - 1 , 3 - oxazol - 4 - yl ) acetic acid can be prepared using the method described by m . d . andrews et al ., pct int . appl ., 2012137089 , oct . 11 , 2012 . 38 . reaction of 5 -( chloromethyl )- 1 , 3 - oxazole with sodium cyanide , followed by nitrile hydrolysis using aqueous sodium hydroxide , provided 1 , 3 - oxazol - 5 - ylacetic acid . 39 . the racemic product was separated into its enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. the first - eluting compound was example 132 . the enantiomer of example 132 , 1 -( cis - 3 - fluorocyclopentyl )- 2 -{[ 4 -( methoxymethyl )- 1h - 1 , 2 , 3 - triazol - 1 - yl ] methyl }- 1h - imidazo [ 4 , 5 - c ] quinoline - 8 - carbonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 2 wt ic 50 , 26 . 8 nm ; lrrk2 , format 2 g2019s mutant ic 50 , 34 . 5 nm . 40 . conditions for analytical hplc . column : chiral technologies chiralpak ad - h , 4 . 6 × 100 mm , 5 μm ; mobile phase : 1 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide ); flow rate : 3 . 0 ml / minute . 41 . reaction of but - 3 - en - 1 - ol and ( benzyloxy ) acetaldehyde in the presence of sulfuric acid provided 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - ol , which was oxidized with pyridinium chlorochromate to afford 2 -[( benzyloxy ) methyl ] tetrahydro - 4h - pyran - 4 - one . subsequent reductive amination with 1 -( 2 , 4 - dimethoxyphenyl ) methanamine and lithium borohydride gave cis - 2 -[( benzyloxy ) methyl ]- n -( 2 , 4 - dimethoxybenzyl ) tetrahydro - 2h - pyran - 4 - amine . this was reacted with c13 and triethylamine , and the product was deprotected using trifluoroacetic acid to yield n -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 6 - chloro - 3 - nitroquinolin - 4 - am ine ; hydrogenation of the nitro group over platinum ( iv ) oxide afforded n 4 -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 6 - chloroquinoline - 3 , 4 - diamine . 42 . 1 -{( 2r , 4s )- 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 8 - chloro - 2 -[( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline ( the product from reaction of c6 and n 4 -{ cis - 2 -[( benzyloxy ) methyl ] tetrahydro - 2h - pyran - 4 - yl }- 6 - chloroquinoline - 3 , 4 - diamine , described in footnote 41 ) was reacted with boron trichloride . the resulting primary alcohol was converted to the corresponding mesylate derivative and displaced using potassium cyanide with catalytic tetraethylammonium cyanide to afford the racemate of example 134 . 43 . the racemate of example 134 was separated into its component enantiomers via supercritical fluid chromatography ( column : chiral technologies chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the first - eluting compound was example 134 . the enantiomer of example 134 , [ cis - 4 -{ 8 - chloro - 2 -[( 5 - methyl - 1 , 2 - oxazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl } tetrahydro - 2h - pyran - 2 - yl ] acetonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 353 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 327 nm . 44 . the racemate of example 135 was separated into its component enantiomers via supercritical fluid chromatography ( column : chiral technologies chiralpak ad - 3 , 4 . 6 × 150 mm , 3 μm ; mobile phase a : carbon dioxide ; mobile phase b : methanol containing 0 . 05 % diethylamine ; gradient : 5 % to 40 % b ). the first - eluting compound was example 135 . the enantiomer of example 135 , [ cis - 4 -{ 8 - chloro - 2 -[( 5 - methyl - 1 , 2 , 4 - oxadiazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinolin - 1 - yl } tetrahydro - 2h - pyran - 2 - yl ] acetonitrile , ent - 2 , was the second - eluting enantiomer , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 1450 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 1220 nm . 45 . reaction of tert - butyl cyclopent - 3 - en - 1 - ylcarbamate with 3 - chloroperoxybenzoic acid , followed by epoxide opening with methylmagnesium bromide in the presence of copper ( i ) iodide , provided tert - butyl [ rel -( 3r , 4r )- 3 - hydroxy - 4 - methylcyclopentyl ] carbamate . conversion of the secondary alcohol to the corresponding fluoride was carried out with ( diethylamino ) sulfur trifluoride ; deprotection using hydrogen chloride afforded the requisite rel -( 3s , 4r )- 3 - fluoro - 4 - methylcyclopentanamine . this was reacted with c13 in the presence of triethylamine , and the nitro group of the product was hydrogenated over platinum ( iv ) oxide to provide 6 - chloro - n 4 -[ rel -( 3s , 4r )- 3 - fluoro - 4 - methylcyclopentyl ] quinoline - 3 , 4 - diamine . 46 . the mixture of diastereomeric products was separated into its component racemic isomers via reversed phase hplc ( column : kromasil eternity xt c18 , 10 μm ; mobile phase a : 0 . 225 % formic acid in water ; mobile phase b : acetonitrile ; gradient : 26 % to 46 % b ). the first - eluting compound was example 136 . the diastereomer of example 136 , 8 - chloro - 1 -[ rel -( 3s , 4r )- 3 - fluoro - 4 - methylcyclopentyl ]- 2 -[( 5 - methyl - 1 , 2 , 4 - oxadiazol - 3 - yl ) methyl ]- 1h - imidazo [ 4 , 5 - c ] quinoline , diast - 2 , was the second - eluting compound , and exhibited the following biological data : lrrk2 , format 1 wt ic 50 , 156 nm ; lrrk2 , format 1 g2019s mutant ic 50 , 105 nm , lrrk2 , format 2 wt ic 50 , 63 . 2 nm ; lrrk2 , format 2 g2019s mutant ic 50 , 69 . 2 nm 47 . mcyp - rxn buffer ( 545 . 0 mg , codex ®) was treated with deionized water ( 19 . 2 ml ) and charged with a solution of mcyp0016 ( 41 . 38 mg , codex ® microcyp ®) dissolved in potassium phosphate buffer ( 0 . 1 m , 4 . 0 ml ) at ph 8 . 0 . the mixture was treated with a solution of example 4 ( 5 . 72 mg ) dissolved in dimethyl sulfoxide ( 0 . 6 ml ) and potassium phosphate buffer ( 0 . 1 m , 0 . 6 ml ) at ph 8 . 0 . the reaction mixture was shaken at 30 ° c . for 12 hours . isolation via reversed phase hplc ( column : phenomenex gemini nx c18 , 5 μm ; mobile phase a : water containing 0 . 1 % formic acid ; mobile phase b : acetonitrile containing 0 . 1 % formic acid ; gradient : 5 % to 90 % b ) afforded example 137 . 48 . example 4 was subjected to incubation with codex ® microcyp ® mcyp0030 at 30 ° c ., using the general procedure described in footnote 47 . isolation via reversed phase hplc ( column : phenomenex gemini nx c18 , 5 μm ; mobile phase a : water containing 0 . 1 % formic acid ; mobile phase b : acetonitrile containing 0 . 1 % formic acid ; gradient : 5 % to 90 % b ) afforded example 138 . 49 . example 138 was reacted with ( diethylamino ) sulfur trifluoride to provide example 139 . 50 . the requisite 6 - fluoro - n 4 -[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ] quinoline - 3 , 4 - diamine was synthesized from 6 - fluoro - 3 - nitroquinolin - 4 - ol using the general method described in example 1 for synthesis of c11 from c7 , except that p2 was used in place of p1 , and hydrogenation was carried out over platinum on carbon , rather than platinum ( iv ) oxide . 51 . reaction of 1 , 2 , 3 - thiadiazol - 4 - ylmethanol with methanesulfonyl chloride , followed by displacement using potassium cyanide and hydrolysis in concentrated hydrochloric acid , provided the requisite 1 , 2 , 3 - thiadiazol - 4 - ylacetic acid . 52 . in this case , the final coupling and cyclization reaction was carried out in two steps : reaction of 6 - fluoro - n 4 -[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ] quinoline - 3 , 4 - diamine ( footnote 50 ) with 1 , 2 , 3 - thiadiazol - 4 - ylacetic acid ( footnote 51 ) was effected with 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide and triethylamine at 50 ° c ., and intermediate n -( 6 - fluoro - 4 -{[( 2r , 4r )- 2 - methyltetrahydro - 2h - pyran - 4 - yl ] amino } quinolin - 3 - yl )- 2 -( 1 , 2 , 3 - thiadiazol - 4 - yl ) acetamide was isolated . further reaction with 2 , 4 , 6 - tripropyl - 1 , 3 , 5 , 2 , 4 , 6 - trioxatriphosphinane 2 , 4 , 6 - trioxide and n , n - diisopropylethylamine at 110 ° c . afforded example 140 . 53 . the final coupling and cyclization reaction was carried out in two steps , as described for example 140 in footnote 52 . 55 . 3 - amino - 4 -[( 2 , 2 - difluorocyclopentyl ) amino ] quinoline - 6 - carbonitrile was synthesized from c61 using the method described for preparation of c54 from c13 in example 93 . 56 . the racemic product was separated into its enantiomers via supercritical fluid chromatography [ column : chiral technologies chiralpak as , 5 μm ; eluent : 4 : 1 carbon dioxide / 2 - propanol containing 0 . 1 % ammonium hydroxide )]. the first - eluting compound was example 143 , and example 144 was the second - eluting enantiomer . 57 . conversion of ( 5 - cyclopropyl - 1 , 2 - oxazol - 3 - yl ) methanol to the requisite ( 5 - cyclopropyl - 1 , 2 - oxazol - 3 - yl ) acetic acid was carried out using the method described in footnote 51 . table 2 , below , provides the structure and mass spectral data for the compounds of examples 146 - 250 . 1 . examples 146 and 147 were synthesized as the racemic mixture , and then separated into individual enantiomers using supercritical fluid chromatography ( column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 85 : 15 carbon dioxide / ethanol ). example 146 was the first - eluting enantiomer , followed by example 147 . 2 . examples 168 and 169 were synthesized as the racemic mixture , and then separated into individual enantiomers using supercritical fluid chromatography [ column : phenomenex chiralcel od - h , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( methanol containing 0 . 05 % ammonium hydroxide )]. example 168 was the first - eluting enantiomer , followed by example 169 . 3 . example 170 was isolated from the corresponding racemic mixture via supercritical fluid chromatography [ column : chiral technologies chiralpak ad - h , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. example 170 was the first - eluting enantiomer . 4 . examples 176 and 177 were synthesized as the racemic mixture , and then separated into individual enantiomers using supercritical fluid chromatography [ column : chiral technologies chiralpak as , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( 2 - propanol containing 0 . 1 % ammonium hydroxide )]. example 176 was the first - eluting enantiomer , followed by example 177 . 5 . examples 196 and 197 were synthesized as the racemic mixture . separation and purification required two chromatographic steps : supercritical fluid chromatography [ column : phenomenex lux cellulose - 2 , 10 μm ; mobile phase : 3 : 2 carbon dioxide /( methanol containing 0 . 1 % ammonium hydroxide )] provided example 196 as the first - eluting enantiomer and example 197 as the second - eluting enantiomer . further purification was effected using reversed phase hplc ( column : waters xbridge c18 obd , 5 μm ; mobile phase a : water containing 0 . 05 % ammonium hydroxide ; mobile phase b : acetonitrile ; gradient : 25 % to 55 % b ). 6 . example 207 was isolated from the corresponding racemic mixture via supercritical fluid chromatography [ column : chiral technologies chiralpak ad , 5 μm ; mobile phase : 3 : 1 carbon dioxide /( ethanol containing 0 . 1 % ammonium hydroxide )]. example 207 was the second - eluting enantiomer . 7 . reaction of c61 with 2 , 2 - difluoropropan - 1 - amine and n , n - diisopropylethylamine provided 4 -[( 2 , 2 - difluoropropyl ) amino ]- 3 - nitroquinoline - 6 - carbonitrile , which was reduced with iron in the presence of hydrochloric acid to afford the requisite intermediate 3 - amino - 4 -[( 2 , 2 - difluoropropyl ) amino ] quinoline - 6 - carbonitrile . 8 . example 211 was isolated from the corresponding racemic mixture via supercritical fluid chromatography [ column : phenomenex lux amylose - 1 , 5 μm ; mobile phase : 85 : 15 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. example 211 was the first - eluting enantiomer . 9 . example 215 was isolated from the corresponding racemic mixture via supercritical fluid chromatography . under analytical hplc [ column : phenomenex lux cellulose - 2 , 3 μm ; mobile phase : 3 : 2 carbon dioxide /( 2 - propanol containing 0 . 05 % diethylamine ); flow rate : 2 . 5 ml / minute ], example 215 was the first - eluting enantiomer . 10 . example 221 was synthesized from example 137 via fluorination with ( diethylamino ) sulfur trifluoride . 11 . examples 237 and 238 were synthesized as the diastereomeric mixture , and then separated into individual diastereomers using supercritical fluid chromatography [ column : phenomenex chiralcel oj - h , 5 μm ; mobile phase : 9 : 1 carbon dioxide /( methanol containing 0 . 2 % ammonium hydroxide )]. example 237 was the first - eluting diastereomer , followed by example 238 . lrrk2 kinase activity was measured using lantha screen technology from invitrogen . gst - tagged truncated lrrk2 from invitrogen ( cat # pv4874 ) was incubated with a fluorescein - labeled peptide substrate based upon ezrin / radixin / moesin ( erm ), also known as lrrktide ( invitrogen cat # pr8976a ), in the presence of a dose response of compound . upon completion , the assay was stopped and detected with a terbium labeled anti - phospho - erm antibody ( invitrogen , cat # pr8975a ). the assay was carried out under the following protocol : 3 μl of a working solution of substrate ( 233 nm lrrktide , 117 μm atp ) prepared in assay buffer ( 50 mm hepes , ph 7 . 5 , 3 mm mgcl 2 , with 2 mm dtt and 0 . 01 % brij35 added fresh ) was added to a low volume greiner 384 - well plate . the compound dose response was prepared by diluting compound to a top concentration of 3 . 16 mm in 100 % dmso and serial diluted by half - log in dmso 11 times . aliquots ( 3 . 5 μl ) of the 100 % dmso dose response were mixed with 46 . 5 μl water then 1 μl of this mixture was added to the 3 μl substrate mix in the 384 - well plate . the kinase reaction was started with 3 μl of a working solution of lrrk2 enzyme at a concentration of 4 μg / ml . the final reaction concentrations were 100 nm lrrktide , 50 μm atp , 1 . 7 μg / ml lrrk2 enzyme and a compound dose response with a top dose of 32 μm . the reaction was allowed to progress at room temperature for two hours and then stopped with the addition of 7 μl of detection buffer ( 20 mm tris ph 7 . 6 , 0 . 01 % np - 40 , 0 . 02 % nan 3 , 6 mm edta with 2 nm terbium labeled anti - phospho - erm ). after an incubation of 1 hour at room temperature , the plate was read on an envision with an excitation wavelength of 340 nm and a reading emission at both 520 nm and 495 nm . the ratio of the 520 nm and 495 nm emission was used to analyze the data . inhibition of mutant g2019s lrrk2 ( invitrogen cat # pv4881 ) was measured in the exact same method . all final concentrations of substrate atp and enzyme were the same . however , since the mutant enzyme is more active the reaction time was reduced to 90 minutes to ensure that inhibition was measured at steady state before any substrate depletion could occur . lrrk2 kinase activity was measured using lantha screen technology from invitrogen . gst - tagged truncated lrrk2 from invitrogen ( cat # pv4874 ) was incubated with a fluorescein - labeled peptide substrate based upon ezrin / radixin / moesin ( erm ), also known as lrrktide ( invitrogen cat # pr8976a ), in the presence of a dose response of compound . upon completion , the assay was stopped and detected with a terbium labeled anti - phospho - erm antibody ( invitrogen , cat # pr8975a ). the assay was carried out under the following protocol : the compound dose response was prepared by diluting compound to a top concentration of 0 . 3 mm in 100 % dmso and serial diluted by half - log in dmso to give an 11 point curve , 100 × final assay concentration . using echo acoustic dispensing , 60 nl of compound was transferred to a low volume corning 384 - well assay plate . 3 μl of a working solution of substrate ( 200 nm lrrktide , 2000 mm atp ) prepared in assay buffer ( 50 mm hepes , ph 7 . 5 , 3 mm mgcl 2 , with 2 mm dtt and 0 . 01 % brij35 added fresh ) was added to the 60 nl compound assay plate . the kinase reaction was started with 3 ml of a working solution of lrrk2 enzyme at a concentration of 4 mg / ml . the final reaction concentrations were 100 nm lrrktide , 1000 mm atp , 2 mg / ml lrrk2 enzyme and a compound dose response with a top dose of 3 mm . the reaction was allowed to progress at room temperature for 30 minutes and then stopped with the addition of 6 ml of detection buffer ( 20 mm tris ph 7 . 6 , 0 . 01 % np - 40 , 6 mm edta with 2 nm terbium labeled anti - phospho - erm ). after an incubation of 1 hour at room temperature , the plate was read on an envision with an excitation wavelength of 340 nm and a reading emission at both 520 nm and 495 nm . the ratio of the 520 nm and 495 nm emission was used to analyze the data . inhibition of mutant g2019s lrrk2 ( invitrogen cat # pv4881 ) was measured in the exact same method . all final concentrations of substrate atp and enzyme were the same . tables 3 and 4 , below , provide the lrrk2 ic 50 data for the compounds of the invention . the examples presented in table 4 may be prepared using the methods illustrated in the syntheses of examples 1 - 92 , either alone or in combination with techniques generally known in the art . table 5 below provides kinase selectivity data for the compounds of examples 3 , 4 , 5 and 22 . the compounds were run using a commercially available kinase selectivity assay which is available from carnabio usa , inc . 209 west central st ., suite 307 , natick , mass . 01760 usa . the compounds of examples 3 , 4 , 5 and 22 were run in the assay at a concentration of 1 μm using an atp concentration of 1 mm . table 5a below provides kinase selectivity from a further assay run for the compounds of examples 4 , 11 , 5 , 104 , 102 and 116 .	0
referring now in detail to the drawings for the purpose of illustrating the present invention , the improved dental drilling assembly as shown in fig1 comprises an adjustable extension member 10 containing a body 11 , a threaded end portion 12 disposed at end thereof , an inner threaded hole 13 disposed at the other end thereof and a slot 14 extending across the end of the extension member . the apparatus further includes a triple arm drilling assembly 15 having large wheels 16 , small wheels 17 and 18 , a hand piece 19 connected to the small wheels 18 , a hanger 20 , a motor 21 having both a large pulley 22 and a small pulley 23 , and a belt 24 providing rotational communication between small wheels 17 and 18 , large wheels 16 and either the large or small pulleys 22 and 23 , respectively . in operation , if it is desired to use the large pulley 22 on the motor 21 , then the distance between the wheels 16 must be increased in order to make the pulleys 22 and 16 compatible and the belt 24 conveyed thereon in substantial parallel relationship . thus , the space between the wheels 16 is enlarged by first removing the bolts 25 and the wheels 16 from the drilling assembly and using the threaded end portion 12 to screw the adjustable extension member into the location from which the bolt 25 was removed . the wheel 16 is then placed over the other end of the adjustable extension member and the bolt 25 is screwed into the threaded end portion 13 of the extension member . by the use of the adjustable extension member , the space between the pulley wheel 16 can be substantially increased . by utilizing the adjustable extension members at both sides of the pulley wheel 16 , the distance between the pulley wheels can be further increased . the slot 14 is provided on the end of the adjustable extension member to provide a location for a screwdriver or other device for facilitating the attachment of the adjustable extension member . if it is desired to use the small pulley 23 on the motor , then the adjustable extension members can be removed and the pulley wheel 16 replaced in the manner discussed hereinabove . thus , the device of the present invention makes it possible to utilize a single drilling assembly with a motor which is provided with multiple sized pulleys in order to achieve different operating conditions . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .	0
reference will now be made in detail to embodiments of the present invention , one or more examples of which are illustrated in the accompanying drawings . each example is provided by way of explanation of the invention , not as a limitation of the invention . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention . for instance , features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment . thus , it is intended that the present invention cover such modifications and variations that come within the scope of the appended claims and their equivalents . by way of explanation and not by way of limitation , the following description focuses on subsea pre - positioned capping device ( pcd ) used with a jack - up drilling unit . however , it is to be clearly understood that the principles of the present invention are not limited to environments as described herein . thus , the use of the pcd on a jack - up drilling unit is described herein as merely an example of the wide variety of uses for the principles of the present invention . the pcd can be used with a subsea bop or any surface bop with location being subsea , on a lower level below the bop , or positioned immediately below the bop . fig1 illustrates a jack - up drilling rig unit 10 depicted with a jack - up rig 100 resting on the sea - bed 20 . the jack - up rig 100 is a type of mobile platform including a buoyant hull 160 fitted with a number of movable legs 140 , capable of raising the hull 160 over the surface of the sea . the buoyant hull 160 enables transportation of the unit 10 and all attached machinery to a desired location . once on location , the hull 160 raises to the required elevation above the sea - bed 20 surface on its legs 140 supported by the sea - bed 20 . the legs 140 of such units may be designed to penetrate the sea - bed 20 , may be fitted with enlarged sections or footings , or may be attached to a bottom mat . footings or spudcans 180 spread the load so the rig 100 does not sink into the sea - bed 20 . the base of each leg 140 is fitted with a spudcan 180 , which may include a plate or dish designed to spread the load and prevent over penetration of the leg 140 into the sea - bed 20 . the spudcans 180 may be circular , square or polygonal . a high pressure riser 220 leads to the wellhead 200 in the sea - bed 20 . the high pressure riser 220 may be a thick walled , high strength riser and can contain full well pressure . a surface blowout preventer ( bop ) stack 240 is located on the jack - up rig 100 . the pcd 300 is pre - installed on the wellhead 200 . the pcd 300 functions as an independent safety and containment device for well leakage and / or blowout . the pcd 300 is installed on the well when the bop stack 240 is installed and is a safety device to be used if the drilling unit &# 39 ; s bop stack 240 fails to control a well blowout . when necessary , the pcd 300 is activated immediately to regain control of the well leak or blowout providing a secondary level of environmental and personnel protection . the pcd 300 can additionally function to secure the well by closure of the pcd 300 if the rig must be moved . fig2 shows the pcd 300 designed for attachment onto substantially any wellbore worldwide and for functioning in subsea and surface operations . the pcd 300 forms a capping stack , which may include a first blind shear ram 301 , a second blind shear ram 302 , a power source 307 for closing the rams 301 , 302 and that is independent from the rig 100 and an independent control system 303 . the power source 307 ( e . g ., pressurized tanks with hydraulic fluid ) of the pcd 300 provides stored power to the control system 303 and as otherwise necessary for actuation of the pcd 300 without relying on power from the rig 100 . since the power source 307 may form an integral component of the pcd 300 and be disposed remote from the rig 100 , collocation of the power source 307 with the blind shear rams 301 , 302 enables operability without relying on hydraulic pressure supplied from the rig 100 . the blind shear rams 301 , 302 ( also known as shear seal rams , or sealing shear rams ) seal the wellbore , even when the bore is occupied by a drill string , by cutting through the drill string as the rams 301 , 302 close off the well . the upper portion of the severed drill string is freed from the ram 301 , 302 , while the lower portion may be crimped and the “ fish tail ” captured to hang the drill string . for some embodiments , the independent control system 303 for the pcd 300 may not actuate the rams 301 , 302 during normal drilling or kick occurrences handled by the bop stack 240 but rather only upon the independent control system 303 being operated for loss of control for which the bop stack 240 does not or cannot regain control . the pcd 300 may further include at least one pressure and / or temperature transducer below each ram 301 , 302 capable of analogue local display . the pcd 300 may have a number of outlets 304 . each outlet may be provided with two hydraulically controlled gate valves . two of the outlets may be equipped with manually controlled chokes to perform soft shut - in of the second blind shear ram 302 . the capping stack may also include an inlet 305 to inject glycol or methanol to mitigate hydrate formation . as described in further detail with respect to fig3 , the independent control system 303 activates the pcd 300 independent from activation of the bop stack 240 and can be operated by the drilling rig unit 10 or from a vessel or other installation remote from the drilling rig unit 10 . for some embodiments , the control system 303 includes a self - contained electrical supply , such as a battery , for any functions of the control system 303 described herein and utilizing current independent of the drilling rig unit 10 . in some embodiments , the independent control system 303 may form part of a digital acoustic control system . the digital acoustic control system may utilize low frequency sound sent to , or received from , the control system 303 on the pcd 300 . fig3 depicts two digital acoustic control systems . the digital acoustic control system on the drilling rig unit 10 includes a rig transducer 315 disposed in the water and coupled to a rig user interface station 320 , which may be operated by the drilling crew or the operator supervisor on the drilling rig unit 10 . the digital acoustic control system on a vessel near the drilling location includes an auxiliary transducer 340 coupled to an auxiliary user interface station 345 , which may be operated by a well control representative . as used herein , an independent management system refers to the auxiliary user interface station 345 with the well control representative not being managed by the drilling crew operating the rig user interface station 320 . for some embodiments , the auxiliary user interface station 345 functions concurrent with the rig user interface station 320 for possible actuation of the pcd 300 if needed . the pcd 300 having this independent management system ensures that decisions are made in a timely manner to prevent a major blowout and harm to personnel . personnel directly involved in the well blowout on the installation , and which perhaps caused it , may not manage the pcd 300 . independent systems from the drilling rig unit 10 mean that in the event of a large fire / explosion on the drilling rig unit 10 the pcd 300 can still be activated to protect personnel and the environment . as previously mentioned , the pcd 300 may be implemented in numerous cases , including : ( 1 ) failure of the well control system on the drilling rig unit 10 ; ( 2 ) management system failure on the drilling rig unit 10 ; or ( 3 ) fire or explosion on the drilling rig unit 10 that prevents operation or continued operation , i . e ., loss of hydraulic pressure on some function , of other well control systems , such as the bop stack 240 . in operation , signals from the rig transducer 315 or the auxiliary transducer 340 to a pcd transducer 310 or a remote transducer 335 provide command signals to the control system 303 for functioning of the pcd 300 . both the pcd transducer 310 and the remote transducer 335 connect to the control system 303 . the remote transducer 335 may connect to the pcd 300 by a cable 325 of sufficient length ( e . g ., 150 meters ) to enable placement of the remote transducer 335 away from the pcd transducer 310 proximate the pcd 300 . the remote transducer 335 thus may facilitate communicating with pcd 300 should access to the drilling rig unit 10 be restricted . acoustic data transmission may also be sent from the pcd 300 to the surface via the transducers 310 , 315 , 335 , 340 to monitor the system status and wellbore conditions ( e . g ., pressure and / or temperature measured by the transducers of the pcd 300 ). while the digital acoustic control system functions as the primary pcd control system , a secondary interface may also be utilized . in an embodiment , a remotely operated vehicle ( rov ) may be utilized as a secondary pcd control system with the rov providing physical input direct to the pcd 300 through an rov control panel 306 . the rov control panel 306 may send a signal to the control system 303 of the pcd 300 that operates valves sending hydraulic pressure from the power source 307 to operate the blind shear rams 301 , 302 . pcd systems on the surface have independent controls also . examples of such independent controls include wireless controls or shielded fiber optics , cable , or piping . regardless of signal interface techniques employed , the independent controls enable operation of the pcd systems independent from bop control systems . in some embodiments , the pcd facilitates capping a well almost immediately . this quick response time reduces the chance of fire or explosion endangering personnel or even sinking the drilling unit or complete loss of a fixed platform . the blowout oil spill volume is greatly reduced as the flow duration is minutes instead of weeks reducing the potential for environmental damage . there are no issues with installing the system since the pcd is preinstalled . a conventional capping stack , which is installed after a blowout , could encounter a situation where debris prevents installation . the pcd also prevents the situation where the drilling unit or platform collapses on a well due to fire and / or explosion . in this case , the blowout could not be capped with a capping stack due to debris or damage to the bop and / or wellhead . the pcd with independent power can be operated even with significant damage to the drilling unit . the drilling unit &# 39 ; s bop might have failed due to loss of power but this would not impact the pcd . the pcd may include redundant blind shear rams in case one ram fails to shear the drill string and seal the well , but one ram may be sufficient if designed to shear and seal on tubulars used in the well . fig4 illustrates use of a capping and diverter assembly with a conduit 400 for flow diversion from the pcd 300 to a location away from the drilling rig unit 10 . ability of the pcd 300 to close the well depends on integrity of the well casing and extent of pressure in the well . if casing integrity is lost , formation hydrocarbons may flow outside the casing bypassing a fluid pathway through the wellhead 200 . the hydrocarbons coming from the seabed 20 create environmental problems and endanger personnel and the drilling rig unit 10 since the hydrocarbons leak under or in direct proximity of the drilling rig unit 10 . for some embodiments , the conduit 400 and some or all associated components shown in fig4 may be pre - positioned and coupled together during drilling such that in the event of an emergency no delay or installation issues are encountered with respect to operations described herein . use of the pcd 300 coupled to the conduit 400 to divert the hydrocarbons eliminates or at least limits flow of the hydrocarbons to the seabed 20 at the wellhead 200 . diverting the hydrocarbons from around the drilling rig unit 10 enables the drilling unit rig 10 to be boarded and problems corrected to secure the well using the drilling rig unit 10 . the capping and diverter assembly includes the conduit 400 coupled to the outlet 304 ( shown in fig2 ) of the pcd 300 and extending in a lateral direction away from the wellhead 200 , and hence the drilling rig unit 10 , a distance of at least 250 meters or at least 500 meters . part of the conduit 400 may form a riser section to take the hydrocarbons to above a sea surface for facilitating disposal / processing . in some embodiments , a portion of the conduit 400 lays on the seabed 20 between the pcd 300 and a weight 402 . the riser section of the conduit 400 extends upward from the weight 402 toward a buoy 404 . mooring lines 406 from the buoy 404 anchor to the seabed 20 and secure the buoy 404 in location above the weight 402 . in some embodiments , an end of the conduit 400 includes a flare 410 for burning the hydrocarbons above the sea surface . a containment boom 408 may secure to the buoy 410 and encircle the sea surface surrounding the flare 410 for limiting the hydrocarbons from floating away from an area of the flare 410 . for some embodiments , an end of the conduit 400 couples to a containment module 414 , such as a floating production storage and offloading ( fpso ) facility , for holding a quantity of the hydrocarbons flowing from the conduit 400 . the containment module 414 may couple to the conduit 400 via a moored and buoyed terminal 412 . the containment module 414 captures the hydrocarbons for limiting environmental impacts if the well cannot be repaired or secured for an extended period of time . in operation , the pcd 300 closes in event of a blowout where the bop stack 240 does not function to close the well . if the hydrocarbons come to the seabed 20 while the pcd 300 is closed , operating the chokes on the outlet 304 open the flow from the wellhead 200 through the conduit 400 . the opening of the chokes continues and may be done in increments until flow ceases coming up through the seabed 20 or at least is reduced and may enable safe work on the drilling rig unit 10 . once the hydrocarbons stop flowing around the drilling rig unit 10 , the rig personnel can board the drilling rig unit 10 for operation to correct problems . operating the chokes to adjust flow rates may utilize the acoustic control system described herein with respect to fig3 for the pcd 300 . in some embodiments , a rov may also manipulate the choke or be utilized as a secondary controller for backup to the acoustic control system . the chokes may utilize power of the pcd 300 and thus also be operable independent of the drilling rig unit 10 . the flare 410 ignites upon the hydrocarbons being diverted through the conduit 400 by the opening of the chokes . activation of the pcd 300 and subsequent burning of the hydrocarbons with the flare 410 may occur immediately following an event without delay of bringing in and connecting equipment after the event . even if not present when the event occurs , the containment module 414 also may require no subsea work , which could be impossible or difficult near the wellhead 200 , to couple with the conduit 400 and accept the hydrocarbons diverted due to the event . in closing , it should be noted that the discussion of any reference is not an admission that it is prior art to the present invention , especially any reference that may have a publication date after the priority date of this application . at the same time , each and every claim below is hereby incorporated into this detailed description or specification as an additional embodiment of the present invention . although the systems and processes described herein have been described in detail , it should be understood that various changes , substitutions , and alterations can be made without departing from the spirit and scope of the invention as defined by the following claims . those skilled in the art may be able to study the preferred embodiments and identify other ways to practice the invention that are not exactly as described herein . it is the intent of the inventors that variations and equivalents of the invention are within the scope of the claims while the description , abstract and drawings are not to be used to limit the scope of the invention . the invention is specifically intended to be as broad as the claims below and their equivalents .	4
turning first to fig1 through 6 of the drawings , there is depicted an apparatus 10 for surgical , or gastrointestinal decompression and irrigation of a patient . the apparatus includes a tube 12 with a distal end 14 which is inserted into the intestine through the nasal or oral orifice . if there is a need for large bowel decompression , it can be inserted through the anal canal or through enterotomy . a proximal end 18 is located outside the patient . having a generally circular cross - section , the tube 12 defines quadruple longitudinally extending lumens 20 , 22 , 24 , 26 ( fig3 ). accommodated within a guide wire lumen 20 is a spring wire 28 which prevents kinking of the tube 12 during insertion into the patient and for stiffening the tube , thereby facilitating emplacement in the gastrointestinal tract . a spring wire 28 may be of any kind which has a stiffening means . exemplary of such means include intermeshing coils which stiffen the spring wire 28 upon squeezing . suction means 30 , such as a vacuum pump ( fig1 ), are connected to the suction lumen 22 via a container 50 for receiving syphoned fluid . irrigation means , such as a fluid delivery device 32 , are connected to an irrigation lumen 24 . if desired , an electrical supply means ( not shown ) is in electrical communication with a lamp 74 ( fig2 ) along the electrical lumen 26 , so that signals are communicated from a pressure sensing device located at the distal end 14 of the tube 12 , and so that the lamp 74 may be illuminated if desired . one or more openings 38 extend through a septum 42 of the tube 12 ( fig4 ) from the suction lumen 22 to the irrigation lumen 24 for ducting irrigation fluid or gastrointestinal content from the irrigation lumen 24 to the suction lumen 22 and for venting the suction lumen in case the pores 44 are plugged by solid matter or by the stomach lining . to communicate negative pressure to gastrointestinal contents or other spaces which require decompression , the suction pores 44 extend laterally from the suction lumen 22 through an outside wall of the tube 10 . referring now to fig1 the apparatus of the invention comprises suction lumen 22 , a manometric device 46 with an inflow channel 48 and a container 50 for fluid collection . the manometric device 46 is located between a centralized suction system 30 and the sealed container 50 . the manometric system has an indicator 52 , which indicates pressure and first and second pre - set stops or electrodes 54 , 56 . if desired , the indicator 52 may have its oscillation damped by a suitable vibration dampening means . the system works in the following manner . when the negative pressure ( suction ) is applied to the suctioning lumen , negative pressure gradually builds in the organ , cavity or space ( closed system ). as negative pressure in the system builds , the indicator 52 moves towards the first electrode 56 . as pressure in the inflow channel 48 falls due to the negative pressure , the indicator 52 contacts the electrode 56 . at that moment , the suction control valve 64 will cut off the suction system 30 . other valves , 58 , 60 , 62 , will control the air vent and fluid flow of the irrigation solution . air and / or saline solution , or both , will gradually enter the system , and the negative pressure will become alleviated . at that time the indicator will move in the opposite direction ( towards second electrode 54 ) and finally will contact the electrode located thereat . then , the pressure in the decompressed organ or cavity will approximate the pre - set maximum level . contact with electrode 54 will close valves 58 , 60 , 62 so that no more air or fluid may enter the organ cavity . at that moment , the suction system becomes on - line via valve 64 , and the pressure begins to fall , moving the indicator again towards 56 . this movement of the indicator back and forth will continue intermittently . in practice , the manometric device 56 is in electrical communication with the valves 58 , 60 , 62 , 64 . further detail of the operating modes 1 - 9 are to be discussed later . the system also permits increasing or decreasing pressure in the system by moving the pre - set pressure levels 54 , 56 towards each other or apart . this is achieved by moving the electrodes clockwise or counterclockwise with a suitable means , such as two rotary rings inset into the manometric device ( fig1 ). referring again to fig1 to assist the surgeon in using the disclosed system , there are provided visual or aural phase indicators 80 , 82 . for example , indicator 80 may usually take the form of a red lamp , while 82 may be a violet - colored lamp , if desired . the chart below summarizes the indications during suction , transition from suction to irrigation , irrigation , and suction phases of the disclosed apparatus : ______________________________________phase indicatorphase violet ( 80 ) red ( 82 ) needle movement______________________________________suction on off clockwisesuction / off on staticirrigationirrigation off on counter - clockwisesuction on off static______________________________________ disclosure will now be made of the surgical procedures by which the apparatus 10 of the present invention may be used . 3 . inflate a balloon 76 via an inflation channel 78 which is located outside and extends along the length of the sheath 66 ; 4 . withdraw the sheath 66 , leaving the tube in place so that the balloon 76 blocks the gastroesophageal junction to prevent regurgitation of the gastrointestinal contents while carrying out the procedure ( fig5 ); 5 . advance the tube toward the pylorus and to the duodenum through the curvatures of the duodenum and the small bowel . during this step , the flexibility of the tube may be changed by altering the stiffness of the guidewire ; 6 . transillumination can be used in order to properly locate the distal end of the tube in the duodenum and to direct the tube to the small bowel . in this step , a source of illumination 74 located at the distal end 14 of the tube 12 is energized ; 7 . grasp or knead through the bowel the tube thereby advancing the tube further into the bowel to the desired extent ; 8 . connect the apparatus 10 to an external system ( fig1 ); 9 . decompress or syphon off the bowel contents and irrigate until the effluent is clear or reduced ; 10 . remove the tube slowly while continually decompressing the small bowel , duodenum , and stomach ; 11 . totally decompress the stomach so that no residual content can be regurgitated ; it should be noted that the above described decompressive and irrigation procedure can be performed with any environment requiring drainage and / or decompression , e . g . the sump drains placed in the cavity of a wound or abscess . for general surgical applications , less than all of the four lumens may be needed . for example , the spring wire lumen 28 may not be needed . nor may the electrical supply lumen 26 be required , so that only two lumens , irrigation and suction may be in operation . medical drainage system can broadly be classified as &# 34 ; closed suction &# 34 ; and sump drains . in closed suction drainage systems , there is one lumen , which drains a closed system . as a result , the system tends to collapse under the influence of the vacuum created thereby and tends to become sealed . in sump drainage systems , however , there are generally two lumens . one provides drainage , while another provides venting . in such systems , no appreciable vacuum is formed . the present system can be utilized with different drainage systems . if closed , a suction draining technique is used , e . g . in pleural space drains , only with one lumen chest tube . to define a suitable suctioning regime , the indicator would be placed in a pre - set negative pressure by regulating the suction vent 30 . if the pressure in the suction tube drops , the arrow will move towards preset minimum pressure considered to be critical . ultimately , the arrow will touch the contact ( 54 ) and the ( red ) lamp 80 will illuminate . simultaneously , a timer will turn on . if the negative pressure in the system does not start building up after the pre - set period of time , an emergency alarm may provide a cue to decrease pressure in the system . the 3 - way stopcock valve 62 allows fluid communication between the irrigation and suction lines . in one valve configuration there is flow between the suction line and ambient air . in another there is fluid communication between the irrigation line and ambient air . thus , by suitable orientation of the valve 62 , the irrigation fluid may flow alone , air may flow alone , or the irrigation fluid and air may flow together toward the closed system 72 . the different modes in which the disclosed apparatus can be used will be described . in this mode , all valves are closed . no drainage occurs , and there is no air or fluid inflow ; in this mode , the irrigation and suction lumens function , but passively under ambient atmospheric pressure . outflow of , for example , stomach contents , occurs solely under the influence of gravity ; in this mode , there is a slow inflow of irrigation solution into the stomach or cavity to be treated . in this mode , the disclosed apparatus is used to administer a medicament to the vessel to be treated ; in this mode , both the inflow of irrigation fluid and the outflow of , for example , stomach contents , occurs solely under the influence of gravity . there is no communication of negative pressure by the suctioning system ; in this mode , a positive pressure means , such as a roller pump , is in fluid communication with a source of irrigation fluid . inflow occurs under the positive pressure which is used in part to displace fluid in the vessel to be treated so that it emerges into a collecting container . again , no negative pressure is communicated to the vessel to be treated by a central suctioning system ; in this mode , there is negative pressure communicated by the central source thereof to the container and to the manometric device . simultaneously , active irrigation of the space which requires decompression and / or lavage of the organ or space is carrout out ; in step 1 of this mode , suction is applied , the irrigating fluid is turned off , and pressure in the system declines , as registered by a clockwise movement of the indicator in the manometric device ; in this configuration , pressure in the vessel to be decompressed diminishes and reaches a minimum level . at this point , the arrow of the manometric device moves and touches the contact 56 . suction is then arrested and the illuminated indicator 80 activates . irrigation then begins and pressure in the system begins accumulating . at that moment , irrigation occurs under the influence of existing negative pressure , gravitational forces , and the elastic forces exerted by a decompressed organ as it tends to revert to its original , compliant shape ; in this configuration , the indicator of the manometric device slowly moves counterclockwise as negative pressure in the system continues to be alleviated . in this configuration , suction predominates , and the vessel to be treated begins to be evacuated ; in this configuration , the device is being used as a sump , wherein an air vent and suction combine to promote free drainage or purging of the vessel to be treated ; in this mode , the supply of irrigation fluid is isolated , and the vessel to be treated becomes contracted ; and in this configuration , if the seal formed by the vessel to be treated breaks , e . g . there is an air leak from a lung , the arrow in the manometric device will inevitably turn counterclockwise and touch the contact 54 . an alarm will sound at this point , indicating a potentially dangerous condition . fig4 is an enlarged sectional view of the distal end 14 of the tube 12 . as will now be apparent , the manometric device 46 enables negative pressure to be applied in a pulsating manner . in one cycle , suction is applied , while in the subsequent cycle , suction is suppressed . under gravity , or under externally applied pressure , the irrigation fluid travels along the irrigation lumen 24 and emerges from the tube 12 at its distal end 14 through pores 38 . the stomach lining 72 envelopes the distal end 14 of the tube 12 , forming a closed system . when suction is applied , the gastrointestinal contents are syphoned through the pores 38 and through the gate 44 , before being transported along the suction lumen 22 . if solid matter or the stomach lining plugs or blocks any pore 38 , fluid communication is still enabled via other pores 38 and the gate 44 . continuing with reference to fig4 in the disclosed configuration , there is a solution to problems which were manifest in prior art approaches . under traditional approaches , plugging of a pore 38 often resulted in an absence of flow . it was not always clear to the surgeon as to why flow had stopped . a question may have lingered as to whether the absence was attributable to the absence of stomach content ( decompression complete ) or to obstruction by food particles , blood clots , or other materials ( decompression incomplete ). in contrast , the tube and associated apparatus of the present invention allow suction and flow to continue intermittently . the tube can be produced from silicon as well as other elastic natural or artificial ( synthetic ) materials . the manometric device 56 of the present invention can usefully be embodied in an intermittent suction unit , such as that sold by the boc health care company ( ohmeda model ), or the boehringer company &# 39 ; s intermitting suction regulator ( model 7702 ). noteworthy is that the present invention discloses a system which is driven in response to the pressure sensed by the manometric device 56 . this is an indicator of pressure existing within the closed system 72 ( fig4 ). so that such pressure is sensed directly , none of the pores 38 may lie outside the closed system 72 . continuing with reference to fig4 the distal end 14 may include a tip structure which includes a pressure transducer connected to an external pressure gauge independent of the manometric device 56 . such a pressure gauge is helpful in corroborating data indicated by the device 56 and may , in an emergency case or if desired , be used to override the pulsating influence of the device 56 . although not depicted , it will be apparent to those of ordinary skill that there is a means for communicating to each of the valves a suitable electrical signal for triggering their opening and closing in response to pressure sensed in the inlet channel 48 . having above indicated a preferred embodiment of the present invention , it will occur to those skilled in the art that modifications and alternatives can be practiced within the spirit of the invention . it is accordingly intended to define the scope of the invention only as indicated in the following claims .	0
hereinafter , the preferred embodiments of the present invention will be described in detail with reference to the accompanying drawings . it is to be understood , however , that the present invention may be embodied in various forms not to be interpreted as limiting . the embodiments of the present invention are provided for those skilled in the art to understand the present invention more completely . in the embodiments of the present invention , a sulfur compound including copper sulfide is used to provide an antibacterial filter that is relatively inexpensive , easy to process , non - toxic , and excellent in antibacterial and deodorizing activities . for this , a description will be given as to an antibacterial filter using a sulfur compound dispersed in or applied to a porous medium and , more specifically , to its antibacterial and deodorizing activities . on the other hand , the antibacterial filter of the present invention may be manufactured by applying a coating of the sulfur compound on the surface of a porous medium through deposition or dyeing or mixing particles of the sulfur compound with the porous medium . the antibacterial filter of the present invention not only does the antibacterial activity to eliminate toxic microorganisms through the holes in the porous medium , but also the deodorizing activity to remove a foul odor . the material for the porous medium may be a polymer , a ceramic , or a metal , preferably a polymer . specific examples of the polymer include polyurethane resin , nylon resin , etc . ; those of the ceramic may include zeolite , silica , alumina , zirconium phosphate , etc . ; and those of the metal include aluminum , etc . the porous medium contains minute pores , through which a fluid passes . the pore size or the porosity of the porous medium may vary depending on the environment in which the antibacterial filter of the present invention is used . in the embodiment of the present invention , a porous medium comprised of a polymer is given as a preferred example . but , the porous medium may be comprised of a ceramic or a metal within the scope of the present invention . a chemical foaming agent , liquid nitrogen , or a supercritical fluid may be incorporated into the porous medium to form pores . more specifically , while extruded at a temperature higher than the melting temperature by 30 to 40 ° c ., a polymer resin used as a matrix for the porous medium is mixed with a chemical foaming agent , liquid nitrogen , or supercritical carbon dioxide that is side - fed . as the polymer resin is extruded , the evaporated foaming agent , nitrogen or carbon dioxide is released into the air to form pores . the copper - based compound applied to the embodiment of the present invention is preferably copper sulfide ( cus ). copper sulfide is prepared by reacting copper sulfate ( cuso 4 ) with a salt selected from sulfides , fluorides , and chlorides in an aqueous phase at mole ratio of 1 : 1 at 10 to 80 ° c . in this regard , the synthesis is performed under the condition that the synthesized particle of copper sulfide has a chemical structure of cu x s y ( where x / y is 0 . 8 to 1 . 5 ). specific examples of the sulfides available in the present invention may include sodium sulfide , iron sulfide , potassium sulfide , zinc sulfide , etc . ; specific examples of the fluorides available in the present invention may include sodium fluoride , iron fluoride , potassium fluoride , zinc fluoride , etc . ; and specific examples of the chlorides available in the present invention may include sodium chloride , iron chloride , potassium chloride , zinc chloride , etc . in this case , the copper sulfide synthesized from sodium sulfide and copper sulfate is most excellent in the antibacterial activity . when the reaction temperature is less than 10 ° c . in the synthesis of copper - based particles , the reactivity of copper sulfate and the salt decreases to deteriorate the deodorizing activity despite the good antibacterial activity . when the reaction temperature exceeds 80 ° c ., the reaction rate is extremely high so as to increase the density of the crystals on the surface of copper sulfide and the concentration of copper , resulting in good deodorizing activity and poor antibacterial activity . further , the ratio x / y of the copper - based particles less than 0 . 8 leads to excessively high concentration of sulfur ( s ), consequently with good antibacterial activity and poor deodorizing activity . the ratio x / y of the copper - based particles greater than 1 . 5 contributes to an increase in the concentration of copper ( cu ), which improves the deodorizing activity and deteriorates the antibacterial activity . hereinafter , a description will be given as to the process for manufacturing an antibacterial filter in two methods : applying a coating of copper sulfide as a sulfur compound to a porous medium ; or dispersing copper sulfide particles in a porous medium . the method for applying a coating of copper sulfide to a porous medium according to an embodiment of the present invention involves stirring a predetermined amount of copper sulfide in a solvent such as isopropyl alcohol ( ipa ) at the room temperature for several hours to prepare a coating solution with good dispersability . then , the coating solution is applied to the porous medium by dip coating . the coated porous medium is dried for several hours to scores of hours and then subjected to an annealing process at t c to t m for scores of minutes . in order to obtain a filter with good antibacterial and deodorizing activities , the procedures are repeatedly performed in the same manner as described above to form a coating of copper sulfide at high concentration on the surface of the porous medium . a porous medium of copper sulfide may have pores made by using a foaming agent or adding liquid nitrogen or a supercritical fluid . more specifically , while extruded at a temperature higher than the melting temperature of the resin by about 30 to 40 ° c ., the polymer resin used as a matrix for the porous medium and copper sulfide are mixed sufficiently with a chemical foaming agent , liquid nitrogen , or supercritical carbon dioxide that is side - fed . as the polymer resin mixed with copper sulfide is extruded , a filter comprising a porous medium of copper sulfide with pores is completed . the porosity of the filter is suitably 10 to 40 %, more preferably 20 to 30 %. when the porosity is less than 10 %, the contact area is too small to display a good deodorizing activity . when the porosity is greater than 40 %, it is hard to get a filter form . the porosity may be controlled by the weight ratio of the resin to the foaming agent , the temperature , the rotating speed of the screw , the retention time , the l / d ratio ( where l is the length of the compounder screw ; and d is the diameter of the screw ), etc . when a chemical foaming agent is used , it has a lower evaporation temperature than the thermoplastic resin used as a matrix and thus kept in the gas state while moved by the screw . during the extrusion , the chemical foaming agent is released into the air to form pores . in the case of using liquid nitrogen or a supercritical fluid , which is supplied under high pressure , it is designed to maintain high pressure in the extrusion step . in other words , the liquid nitrogen or supercritical fluid supplied by side feeding is sufficiently mixed with the resin and then extruded . in the extrusion step , the evaporated nitrogen and carbon dioxide are released into the air to form pores . the chemical foaming agent is in wide use , because it is relatively inexpensive and requires a simple facility . but , the use of the chemical foaming agent possibly causes a pyrolysis of the resin and makes it hard to control the fine pores uniform . the liquid nitrogen or supercritical carbon dioxide costs high but advantageously enables it to make minute pores uniform . an exemplary method for manufacturing the antibacterial filter of the present invention is given as follows . cuso 4 and na 2 s in an amount of one mole each are added to distilled water and stirred to prepare an aqueous solution , which is then put into an isothermal reactor at 50 ° c . to synthesize copper sulfide ( cus ) as shown in fig1 . in this regard , the x / y ratio is 1 . 02 . the copper sulfide thus obtained has the crystalline structure peculiar to copper sulfide as shown in fig2 , and its particle image magnified by a factor of 30 , 000 is presented in fig3 . referring to fig3 , there appears no peak for the sulfur , which does not have a crystalline structure , whereas peaks for the copper appear at 55 , 65 , 99 , 125 , and 137 degrees . the copper sulfide thus prepared is mixed with the nylon resin to form an antibacterial filter as shown in fig4 . the activity evaluation of the antibacterial filter prepared in the embodiment of the present invention is performed in the manner as follows . the average particle diameter of the copper sulfide and metal particles is measured with a particle size analyzer ( els - z2 , otsuka electronics co ., japan ). ( 2 ) antibacterial activity a culture medium with escherichia coli ( atcc 25922 ) is put in contact with a specimen and incubated at 25 ° c . for 24 hours . after incubation , the bacterial growth is determined to evaluate the antibacterial effect of the specimen . 1 g of the copper - based particles is put into a reactor and then 10 , 000 ng / ml of gaseous formaldehyde is injected . after 5 minutes , the concentration of the formaldehyde eliminated is determined to evaluate the deodorizing effect of the copper - based particles . the concentration of the remaining gaseous formaldehyde is determined with a gas chromatograph ( agilent 6890 , aglient technologies inc ., u . s . a ). the copper - to - sulfur molar ratio of the copper sulfide particles is determined with an inductively coupled plasma mass spectrometer ( agilent 7500 , aglient technologies inc ., u . s . a .). the porosity (%) (=[( d i − d p )/ d i ]× 100 , where d i is the density of the filter without pores ; and d p is the density of the filter with pores ) of the porous filter is determined by measuring the density of the specimen . the density measurement is performed with an electronic scale ( xp204v , mettler - toledo co ., swiss ). the copper sulfide used in the antibacterial filter according to the embodiment of the present invention has the antibacterial activity of 1 × 10 4 counts / ml to 1 × 10 6 counts / ml , and the deodorizing activity of 90 to 98 %. further , the copper / sulfur ratio , i . e ., x / y ratio is 0 . 8 to 1 . 5 , and the porosity is suitably 10 to 40 %, more preferably 20 to 30 % accordingly , the antibacterial filter of the present invention makes the use of the properties of copper sulfide to secure the antibacterial and deodorizing effects required to antibacterial filters . furthermore , copper sulfide is relatively inexpensive , easy to process , and non - toxic , so the antibacterial filter using copper sulfide is considered to be more useful than the conventional antibacterial filters using silver . although the preferred embodiments of the present invention have been described in detail , it is understood that the present invention should not be limited to these exemplary embodiments but various alternatives can be made by those skilled in the art within the spirit and scope of the present invention as hereinafter claimed .	1
a connector system with a plug and socket is described . the connector system allows rotation of the plug and socket with respect to each other while the plug and socket are electrically coupled . embodiments of the connector system help to prevent component and connector damage during coupling and uncoupling of mating components . fig1 is a diagram of an embodiment of a connector system 100 . the connector system 100 includes a plug housing 102 and a receptacle housing 112 . portions of the plug housing 102 and the receptacle housing 112 are cut away to show contacts 108 and 110 . reference number 110 indicates a representative receptacle electrical contact . the receptacle electrical contact 110 is fixedly attached to the receptacle housing 112 . the receptacle electrical contact 110 is a single piece of conductive material in a blade shape with a ninety degree angle between its two ends . one end of the receptacle electrical contact 110 is a mating end that is accessible through an opening in the receptacle housing 112 . as shown in fig1 all of the mating ends of the receptacle electrical contacts 110 are accessible through a single opening in the receptacle housing 112 that faces the plug housing 102 . the ends of the receptacle electrical contacts 110 opposite the mating ends may be electrically connected to an electrical component either removably or permanently . the plug housing 102 includes two bosses 104 that allow the plug housing 102 to be connected to a component , for example by screws inserted through the holes in the bosses 104 . the plug housing 102 further includes two tapered ears 115 that fit into the opening in the receptacle housing 112 . between tapered ears 115 , multiple guide openings 113 in the plug housing 102 each accept one mating end of a receptacle electrical contact 110 . each plug electrical contact 108 includes a distal end accessible through the guide opening 113 and a proximal end that projects between the bosses 104 . each plug electrical contact 108 is fixedly attached to the plug housing 102 between its distal end and its proximal end . the proximal ends of the plug electrical contacts 108 may be electrically connected , removably or permanently , to an electrical component . the proximal ends of the plug electrical contacts 108 are blades in one plane . the distal ends of the plug electrical contacts 108 are the distal sections of the same blades bent to be substantially in a plane orthogonal to the plane of the proximal ends . when the plug housing 102 is inserted in the receptacle housing 112 , the mating end of a receptacle electrical contact 110 is placed in physical contact with a distal end of a respective plug electrical contact 108 . the plug housing 102 and the receptacle housing 112 are rotatable with respect to each other while the electrical connection between the plug electrical contacts 108 and the receptacle electrical contacts 110 is maintained . the limits of rotation are defined by the ears 115 making contact with sides of the opening in the receptacle housing 112 in which the ears 115 are inserted . in one embodiment , the plug housing 102 and the receptacle housing 112 may rotate through an angle of up to thirty degrees with respect to each other . in various embodiments , the number of plug electrical contacts 108 and the number of receptacle electrical contacts 110 varies according to need . for example , one embodiment has four plug electrical contacts 108 and the same number of receptacle electrical contacts 110 . another embodiment has twenty plug electrical contacts 108 and the same number of receptacle electrical contacts 110 . in general , according to the components that are to be electrically coupled through the connector system 100 , the number of plug and receptacle contact pairs may vary between one and twenty or more pairs of contacts . in one embodiment , the plug housing 102 and the receptacle housing 112 are made of glass reinforced thermoplastic . in various embodiments , the plug housing 102 and the receptacle housing 112 may be made of any relatively rigid insulating material with the appropriate wear characteristics . in one embodiment , the receptacle electrical contacts 110 and the plug electrical contacts 108 are made of a copper alloy plated with gold . the receptacle electrical contacts 110 and the plug electrical contacts 108 may be made of any conducting material with the appropriate electrical and mechanical characteristics for the required application . the material should be resilient such that the distal ends of the plug electrical contacts retain resilience after being preshaped as shown in fig2 a . fig2 a is a diagram of a plug electrical contact 108 , showing the distal end 111 and the proximal end 109 . in one embodiment , the plug electrical contact 108 is a single piece of a resilient , conductive material . the distal end 111 is preshaped so as to remain biased against the mating end of a respective receptacle electrical contact 110 . fig2 b is a right side view of the plug electrical contact 108 of fig2 a , and fig2 c is a left side view of the plug electrical contact 108 of fig2 a . fig3 is a diagram of a plug electrical contact 108 in a mated position with a receptacle electrical contact 110 . the area 220 is the area of electrical contact and the point about which the plug electrical contact 108 and the receptacle electrical contact 110 rotate with respect to each other . fig4 is a diagram of one embodiment in which the connector system 100 is used to couple a hand - held device 202 and a cradle 204 . the cradle 204 may be a source of power for recharging or may facilitate communication between the hand - held device 202 and , for example , a personal computer . the hand - held device may be any hand - held electrical component , such as a personal data assistant ( pda ), that must occasionally communicate with another electrical component . the hand - held device 202 rests in the cradle in a curved rest area 208 . the hand - held device includes a curved area 206 that fits into the curved rest area 208 and allows easy rotation of the hand - held device 202 with respect to the cradle 204 . when the hand - held device 202 is placed in the cradle 204 or removed from the cradle 204 , the natural path of motion is not straight into and out of the cradle 204 in line with the contacts 108 and 110 of the plug housing 102 and the receptacle housing 112 . rather , the natural path includes placing lateral stress on the connector 100 . for example , a user removing the hand - held device 202 from the cradle 204 naturally pulls the hand - held device out from the cradle 204 either before or at the same time the user pulls the hand - held device 202 up in line with the connector 100 . the connector 100 allows rotation of the plug housing 102 and its contacts 108 with respect to the receptacle housing 112 and its contacts 110 . connector system 100 thus alleviates the problem of inadvertent component and contact damage on insertion and removal of the hand - held device 202 . the plug housing 102 is shown connected to the cradle 204 by screws 210 through the bosses 104 . the proximal ends of the plug electrical contacts 108 are visible inside and outside the plug housing 102 in this case because the plug housing 102 is made of a transparent insulator material . in other embodiments , the plug housing 102 may not be transparent , in which case only the tips of the proximal ends of the plug electrical contacts 108 extending beyond the plug housing 102 would be visible . a connector ( not shown ) may be removably coupled to the proximal ends of the plug electrical contacts 108 to couple the connector 100 directly or indirectly to some device , such as a personal computer . in other embodiments , the plug electrical contacts 108 may be permanently coupled to another connector or to a device or component , for example by soldering the proximal ends . fig5 is a diagram of the hand - held device 202 coupled to the cradle 204 through the connector 100 . in this diagram , the hand - held device 202 is rotated through an angle 302 with respect to the cradle 204 . in one embodiment , the angle 302 represents one half of the total rotation possible . in various embodiments , the total angle of rotation available may be variously distributed between a direction to one side of the connector 100 and a direction to the opposite side of the connector 100 . for example , in some embodiments , the cradle 204 may hold the plug connector 102 in a vertical position and allow rotation out of the vertical in two directions . in one embodiment , the total angle of rotation is less than or equal to thirty degrees . fig6 is a diagram showing the side of the hand - held device 202 that faces the cradle 204 ( and is therefore not visible in fig4 and 5 ). the hand - held device 202 includes a circuit board 402 containing electrical components necessary to make it function . part of the circuit board 402 is visible because a region of the hand - held device 202 casing is cut away , as shown . the receptacle housing 112 is shown . the receptacle housing 112 appears as it would if it were made of a transparent insulating material so that all of the mating ends of the receptacle electrical connections are visible . the ends opposite the mating ends ( not shown ) are inserted into the circuit board 402 and are permanently coupled to electrical contacts on the side of the circuit board 402 that is not shown . for example , each of the receptacle electrical contacts 110 may be soldered , in which case , solder dots such as solder dots 406 would be visible on the circuit board 402 . in one embodiment of the connector system 100 suitable for a common pda device and cradle , the connector system has a current rating of one amp , a dielectric withstanding voltage of 400 volt alternating current , and an insulation resistance of 1000 megaohms . typical mechanical characteristics of such an embodiment include a 5000 cycle life , a contact normal force of 3 . 5 pounds , a withdrawal force of 0 . 7 pounds , minimum , and an operating temperature range of from − 10 ° c . to + 105 ° c . fig7 a is a diagram of one embodiment of a connector system having ten sets of plug electrical contacts 1087 and receptacle electrical contacts 1107 . a plug housing 1027 is shown with its dimensions , and a receptacle housing 1127 is shown with its dimensions . fig7 b is a diagram showing a side view of the plug housing 1027 with its dimensions , and a side view of the receptacle housing 1127 with its dimensions . the invention has been described with reference to specific embodiments . various modifications may be made by one of ordinary skill in the art without departing from the spirit and scope of the invention as defined in the following claims . for example , alternative materials , different dimensions , and different configurations are within the scope of the invention as claimed . in addition , the connector system described may used to electrically couple , directly or indirectly , any components other than the components specifically shown and described .	7
fig1 shows an embodiment of the anti - ram system of this invention installed in a shallow trench alongside a sidewalk . the top surface 10 of the base or pad of the anti - ram system is shown recessed below the desired grade level . as shown in fig2 , a landscaping surface , such as grass 12 is placed over the top surface 10 of the base or pad . as further shown in fig2 , ornamental or functional objects are placed over the bollards 14 shown in fig1 . such objects include lamp posts 16 , waste container 18 , ornaments 20 , and a seat and shelter 22 . the ornamental and functional items disguise the presence of the bollards of the anti - ram system . fig3 shows an embodiment of this invention with four bollards 14 , mounted on the steel framework 23 for the pad of the anti - ram system . the framework 23 includes transversely extending tubular members 24 , longitudinally extending tubular members 26 , and longitudinally extending angle members 28 . in a preferred embodiment of this invention , the tubular members 24 and 26 have a rectangular cross - section , such that they form a generally planar upper and lower surface for the pad . the longitudinally extending tubular members 26 are welded to the sides of the transversely extending tubular members 24 . depending on the strength requirements of a particular anti - ram system , the welds can be fillet welds or full penetration welds on all four sides of the tubular members 26 . similarly , the longitudinally extending angle members 28 are welded to the sides of the tubular members 24 by either full penetration or fillet welds . alternatively , angular notches can be cut in the transversely extending tubular members 24 for the longitudinally extending angle member to pass through , in which case the angle member may be formed as one continuous piece . holes are provided in the transversely extending tubular members 24 to receive the cylindrical bollards 14 . again , the cylindrical bollards are secured to the tubular members 24 by fillet or full penetrations welds at both the upper and lower surfaces of the tubular members 24 . apertures 31 are provided in both tubular members 24 and 26 , such that they may be filled with a material such as concrete , to add strength and weight to the base or pad . fig4 , which is similar to fig3 , shows a rebar cage , or grillage 30 placed around the steel framework 23 . the rebar cage includes an upper portion on top of the tubular members 24 and 26 and a lower portion under the tubular members 24 and 26 . the rebars forming the cage 30 , are welded to the tubular member 24 and 26 . fig5 shows a top plan view of a framework for a typical set of three bollards , and fig6 shows a side elevation of the same framework constructed in accordance with this invention . fig7 shows an elevation view of a rebar cage or grillage secured to the framework shown in fig5 . fig8 is a typical side section view of the rebar cage and framework shown in fig7 , and fig9 is a typical front end section view , while fig1 is a typical rear end section view . fig1 is a cross - sectional detailed view of an end plate secured in the tubular member 24 . a gap is provided in the end plate to provide for the filling of the tubular member with a material such as concrete . fig1 is a detailed cross - section of one of the cover strips 32 provided on the bollards 14 . fig5 - 12 are representative of a base or pad system in accordance with this invention which requires the provision of an excavation approximately 14 inches deep . the steel framework has a height of approximately 10 inches , the rebar cage adding approximately ½ inch to the height , and the encapsulating concrete adding another 1 and ½ inch , for a total of 12 inches . fig1 - 22 are similar to fig5 - 12 in showing details of a second preferred embodiment of this invention . in this embodiment the base or pad is considerable thinner than that shown in fig5 - 12 . in this embodiment the overall height of the pad could be only 6 and ½ inches , the steel frame having a height of 5 inches , with the rebar being located mid - height in the steel frame , rather that on the top and the bottom . the concrete adds 1 and ½ inches to the height of the pad . referring to fig2 - 28 , it can be seen that by forming triangles with the transversely and longitudinally extending tubular members , it is possible to form a curved line of bollards . referring to fig4 , two bollard pads 32 , are shown spaced apart by a gap . before the pads are filed with concrete , a pair of pipes are placed within the pads , such that post tensioning members can be passed through the pipes to secure the two bollard pads 32 to each other . of course , any number of pads could be placed in alignment and secured by the post tensioning members . referring to fig4 , the bollard system of this invention may be formed as a unit to be place on a surface for temporary bollard protection . the bottom surface is formed as a high friction surface , so as to resist sliding when an impact is received by the bollards . referring to fig4 a perspective view of a steel frame formed for the base of a bollard system of this invention is shown , which is intended for placement on a slope . the bollards are secured to the base at an angle , such that when the base is placed on a slope , the bollards will be vertical . fig4 shows an embodiment of this invention wherein an opening is left in the base of the bollard system to provide for an opening , such that when a grate is installed over the opening , an open space below the base is ventilated through the opening . while only one embodiment of the invention has been shown , it should be apparent to those skilled in the art that what has been described is considered at present to be a preferred embodiment of the anti - ram system and method of installation of this invention . in accordance with the patent statute , changes may be made in the anti - ram system and method of installation of this invention without actually departing from the true spirit and scope of this invention . the appended claims are intended to cover all such changes and modifications which fall in the true spirit and scope of this invention .	4
the expression , &# 34 ; insular form ,&# 34 ; means that isolated particles and / or agglomerates of particles of vanadium oxide are spaced from one another on the peripheral surface of the taper - nose portion . the particles of vanadium oxide do not provide a continuous line or coating on the peripheral surface of the taper - nose portion , but are in the form of islands thereon . according to the present invention , the spark plug has improved self - cleaning ability due to the presence of islands of vanadium oxide on a taper - nose portion of the insulator . vanadium oxide is provided in insular form or as islands on the peripheral surface of the taper - nose portion of a spark plug insulator so that required electrical insulation is not lowered . as particles of vanadium oxide ( in insular form ) are separated from the taper - nose portion during spark plug service over a long period of time , it is most fortunate that such separated vanadium oxide particles are readily discharged to the exterior of the engine along with exhaust gases discharged therefrom , thus having no likelihood of damaging the engine . furthermore , in a spark plug according to the present invention , since particles of vanadium oxide are merely islands on the taper - nose portion , the taper - nose portion of the insulator is free of an undesirable temperature rise during the running of the engine ; there is no risk of pre - ignition during high - speed , high - load running . in order to form particles of vanadium oxide in insular form on the peripheral surface of the taper - nose portion , all that is required is to apply a suspension , e . g . aqueous , of vanadium oxide to the taper - nose portion , followed by drying or by drying and baking . thus , the formation of vanadium oxide in insular form is simple and easy . the expression , &# 34 ; self - cleaning ability ,&# 34 ; means that , in the event that unburnt carbon adheres to the surface of the taper - nose portion as a result of running an engine at a low temperature for a short distance , the spark plug is heated by heat in the combustion chamber , the temperature of which is raised during a subsequent engine running cycle , thus resulting in the natural removal of carbon therefrom . the cleaning function is consequently achieved by the spark plug itself . in this connection , effecting self - cleaning at the lowest possible temperature is desired . for example , if a self - cleaning temperature of a spark plug having no specially - provided countermeasure for the self - cleaning is in the order of 550 ° c ., it is desired that the self - cleaning temperature is lowered to lower than 500 ° c ., more preferably lower than 450 ° c ., by suitable countermeasures for the self - cleaning , in view of the improvement of a self - cleaning . it is noteworthy that vanadium oxide , in insular form , sticks to the taper - nose surface of a spark plug insulator . by forming particles of vanadium oxide in insular form on the taper - nose portion , the self - cleaning ability of a spark plug is greatly improved . since particles of vanadium oxide are in insular form and are thus spaced from one another of from aggregates thereof on the taper - nose surface , such particles of vanadium oxide do not impair the electric - insulation properties of the surface of the spark plug insulator . were particles of vanadium oxide to form a continuum over the surface of the insulator , a breakdown in electric - insulating properties of the taper - nose surface of the insulator would be caused during spark plug service , reducing the effectiveness of the spark plug itself . particles of vanadium oxide may be of a primary particle consisting of a single particle of vanadium oxide or of a secondary agglomerated particle consisting of two or more particles agglomerated ( see fig2 b and 2c ). as the degree of adhesion of vanadium oxide to the taper - nose insulator surface increases , the spark plug provides increased durability . even when the sticking force is weak , the self - cleaning action is by no means impaired by the presence of vanadium oxide islands on the taper - nose portion . in the present invention , a material for forming particles in insular form 7 is vanadium oxide . this is a generic term which includes all oxides of vanadium , e . g . vanadium pentoxide ( v 2 o 5 ) and vanadium trioxide ( v 2 o 3 ), individually or in any combination . however , vanadium pentoxide is preferred . the particles ( in insular form ) formed on the taper - nose portion of the insulator are also unlimited in their vanadium oxide constitution , which is , e . g ., v 2 o 5 , v 2 o 3 or a mixture thereof . thus , whenever the formed particles are of an oxide of vanadium , the objects of the present invention are achieved irrespective of the type of vanadium oxide used . in order to form particles of vanadium oxide in insular form on the taper - nose portion , powdered vanadium oxide is suspended in a liquid , such as water or alcohol , e . g . ethyl alcohol . the suspension is then applied to the taper - nose surface 61 of an insulator 6 , followed by drying at a temperature in the range of from 40 ° to 100 ° c . the drying causes vanadium oxide to stick to the taper - nose portion of the insulator with a comparatively weak force . in this connection , baking at a temperature in a range of from 700 ° to 900 ° c . for five to thirty minutes , after drying , is recommended in order to ensure the adhesion of the vanadium oxide sticking to the taper - nose portion and to increase durability of the plug . the suspension is applied to the taper - nose portion , e . g ., by dipping the taper - nose portion in the suspension of vanadium oxide , by coating the suspension on the taper - nose portion with a brush or by spraying the same on the taper - nose portion . the concentration of vanadium oxide in the suspension is from 0 . 01 to 6 percent by weight ( the same throughout the specification ), and a vanadium oxide concentration of from 0 . 5 to 5 percent by weight is preferred to obtain an extended duration of the self - cleaning function . in forming particles of vanadium oxide in insular form on the taper - nose insulator surface , powdered vanadium oxide having a grain diameter of from 0 . 5 to 10μ is used . the particle density of vanadium oxide , in insular form , on the taper - nose portion is preferably in the range of from 3 × 10 - 5 g to 3 × 10 - 3 g per cm 2 of the taper - nose surface area . an average vanadium oxide particle thickness is preferably less than 10μ in view of the electrically insulating property of the insulator . however , the self - cleaning ability is reduced when particles of vanadium oxide are less than 0 . 1μ in thickness . the formation of particles of vanadium oxide in insular form on the taper - nose portion is accomplished , e . g ., by applying a liquid suspension of vanadium oxide to the taper - nose portion , drying and ( optionally ) heating . particles of vanadium oxide , during the several steps , pass through the stages or states depicted by fig2 a , 2b and 2c . as seen in these figures by application of the suspension to the taper - nose portion 61 , a layer of suspension 70 , wherein powdered vanadium oxide 71 in a suspended state , such as , of a primary particle or a secondary agglomerated particle , is formed on the taper - nose insulator surface 61 ( fig2 a ). by the succeeding drying step , the particles of vanadium oxide 72 , in insular form , scatter and stick to the surface of the taper - nose portion 61 of the insulator ( fig2 b ). by the heating ( for baking ), following the drying , particles of vanadium oxide 72 are fused to cling closely and to adhere more securely to the surface of the insulator . the fused particles , after cooling , stiffen and remain in insular form as they stick firmly to the surface of the insulator , whereby vanadium oxide , in insular form 73 , sticks on the surface of the taper - nose portion of the insulator ( fig2 c ). without further elaboration , one skilled in the art can , from the preceding description , appreciate and use the present invention to its fullest extent . the following specific embodiments are , therefore , merely illustrative and do not in any way limit the disclosure . as a material for forming particles , in insular form , a suspension of powdered vanadium pentoxide ( v 2 o 5 ) is applied to the surface of a taper - nose portion 61 of a ceramic insulator 6 of a commercially - available spark plug . the spark plug insulator dried at about 60 ° c . for 30 seconds , and then heated ( baked ) in an electric furnace at 750 ° c . for 20 minutes , followed by cooling to obtain a spark plug having particles of vanadium oxide , in insular form , on the surface of the taper - nose portion 61 . in this first embodiment , suspensions containing powdered vanadium pentoxide of 5 , 1 , 0 . 5 , 0 . 1 , and 0 . 01 % by weight , respectively , are used , as shown in table a , and the taper - nose portion 61 is dipped once in such suspension . the suspension is applied to an area of the taper - nose portion 61 covering from the lower tip to an upper portion thereof which is 10 mm distant from the lower tip thereof . powdered vanadium pentoxide having an average grain diameter of 0 . 5 to 6μ is used , and ethyl alcohol is the suspension medium . the particles and agglomerates of vanadium oxide form islands on the surface of the taper - nose portion 61 of insulator 6 and have average thicknesses , respectively , as shown in table a . the thus - obtained spark plug 1 is conventionally installed in an automobile engine . the engine is then run while the engine wall is being cooled in order to maintain nose portion 61 of the insulator 6 of the spark plug 1 at a temperature lower than 150 ° c . a large amount of unburnt carbon is thus made to adhere to the surface of the taper - nose portion 61 . the spark plug 1 is then removed from the engine and placed in an electric furnace . the temperature of the electric furnace is raised by degrees to measure the temperature ( carbon removal temperature ) at which the unburnt carbon ( adhering to the taper - nose portion ) is removed from the spark plug . the aforesaid engine was run for 8 minutes at 1000 rpm / min . with a mixture charge of an air - fuel ratio of 5 or 6 . table a also shows corresponding results for an untreated , commercially - available spark plug ( no . c 1 ) having no vanadium oxide . table a confirms that , in case of spark plugs ( nos . 1 through 5 ) according to the present invention , a temperature at which the unburnt carbon is removed from the plugs is lower by from 100 ° to 120 ° c . than that required for a commercially - available spark plug ( no . c 1 ) having no vanadium oxide thereon . in order to observe the distribution of vanadium oxide , in insular form , on spark plugs produced according to the present invention , the surface of the taper - nose portion of the insulator was electron - photomicrographed . fig3 a is an electron - photomicrograph ( 3000 magnifications ) of spark plug no . 3 in table a . in this photomicrograph , the minute granular form is a particle of vanadium oxide , in insular form , sticking to the surface of the taper - nose portion . for better presentation , a copy of the electron - photomicrograph was prepared by hand as fig3 b . in fig3 b the granular matters depicted by a thick line are the aforesaid particles of vanadium oxide in insular form , wherein a single particle ( represented by reference symbol a ) is the aforesaid primary particle , and groups of two or more particles ( represented by reference symbol b ) are the aforesaid secondary agglomerated particles . for reference , the black portions seen on the left of the photomicrograph of fig3 a ( namely : the portions represented by reference symbol c in fig3 b ) are portions from which particles of vanadium oxide have been separated at the production of a replica necessary for photomicrographing . for comparison purposes , fig4 is an electron - photomicrograph , similar to that of fig3 a , on the surface of the taper - nose portion of the insulator of a commercially - available spark plug prior to being subjected to treatment according to the present invention . table a______________________________________ mean thicknessconcentration of particles in carbon - removalno . of v . sub . 2 o . sub . 5 ( wt %) insular form ( μ ) temperature (° c . ) ______________________________________1 5 8 . 0 4302 1 1 . 6 4303 0 . 5 0 . 8 4304 0 . 1 0 . 16 4505 0 . 01 0 . 016 450c . sub . 1none -- 550______________________________________ the aforesaid carbon removal temperature means a temperature at which unburnt carbon adherent to the taper nose portion of the insulator is completely removed from at least tip portion of the taper nose portion , so that the surface of the insulator surrounding a tip portion of the center electrode is maintained to be in an electric insulation state . this carbon removal temperature corresponds to a self - cleaning temperature and to improve the self - cleaning , lowering of this self - cleaning temperature is required . by varying the concentration of vanadium oxide in a suspension , a variety of spark plugs is produced in a manner similar to that of example 1 , and the durability of the self - cleaning ability of each spark plug is measured . more in detail , carbon is similarly made to adhere to respective spark plugs , which are the same as those in example 1 . the temperature at which such carbon is removed from the spark plug is measured , and then carbon is again made to adhere to the same spark plug according to the same procedure . the temperature at which this carbon is removed is then measured . such procedures for adhesion and removal of carbon to and from the spark plug are repeated six times for each spark plug . prior to the commencement of a succeeding procedure for adhesion of carbon , each spark plug is carefully examined to determine whether carbon adherent to the spark plug in the preceding cycle had been completely removed . carbon - removal - temperatures at respective cycles for each spark plug are shown in table b . the measurement for the commercially - available untreated spark plug ( no . c 2 ) is also given in table b . table b______________________________________ carbon - removal temperature (° c . ) concentration sec - no . of v . sub . 2 o . sub . 5 ( wt %) first ond third fourth fifth sixth______________________________________6 5 430 430 430 440 440 4407 1 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 8 0 . 5 &# 34 ; &# 34 ; 440 &# 34 ; &# 34 ; 4509 0 . 1 450 450 450 460 460 46010 0 . 01 &# 34 ; &# 34 ; 460 &# 34 ; 480 480c . sub . 2none 550 550 550 550 550 550______________________________________ table b confirms that the removal temperature for adhering matter , such as carbon , is maintained low even after six cycles of carbon - adhesion and removal for spark plugs ( nos . 6 through 10 ) of the present invention and , particularly in the case of the spark plugs ( nos . 6 through 9 ) treated with a suspension having more than 0 . 1 % by weight of v 2 o 5 , the carbon removal temperatures are from 90 ° to 110 ° c . lower than that for the untreated spark plug ( no . c 2 ), thus reflecting an extended duration of self - cleaning ability resulting from the presence of vanadium oxide islands on the taper - nose portion of the insulator . by varying the v 2 o 5 concentration , spark plugs ( nos . 11 and 12 ) are produced in a manner similar to that of example 1 , and carbon is made to adhere thereto in like manner . the adhered carbon is then removed at 450 ° c . the electrically - insulating property of the surface of the taper - nose portion of the insulator of each plug is determined by measuring the electric resistance between the central electrode and the ground of each spark plug . for comparison purposes , a spark plug ( no . c 3 ) is prepared by applying a paste ( consisting of 70 % by weight of vanadium pentoxide and 30 % by weight of water ) to the surface of the taper - nose portion of the insulator of the spark plug , drying the spark plug , and baking the same at 750 ° c . in an electric furnace for 20 minutes . thus , there is obtained the spark plug ( no . c 3 ) having a layer of vanadium oxide formed uniformly over the entire surface of the taper - nose portion thereof . then , carbon is made to adhere to the spark plug , is removed at 450 ° c ., and the electrical insulation of the plug ( no . c 3 ) is measured in the same manner as in example 1 . the results are given in table c , together with a concentration of v 2 o 5 in the applied paste , a state of particles of vanadium oxide on the surface of the taper - nose portion of the insulator and the thickness of the layer . table c______________________________________ electricconcentration state of mean thickness resist - no . of v . sub . 2 o . sub . 5 ( wt %) particles of particles ( μ ) ance ( ω ) ______________________________________11 0 . 1 scattered in 0 . 16 infinite insular form12 1 . 0 scattered in 1 . 6 &# 34 ; insular form substantially over thec . sub . 370 entire surface 150 0 . 1 mω______________________________________ fig3 shows that spark plugs nos . 11 and 12 according to the present invention are unchangeably infinite in electric resistance even after service . in contrast thereto , the ignition plug ( no . c 3 ), having a uniform layer of 150μ in thickness , does not have any particles in insular form on the surface of the taper - nose portion , the electric insulation of the taper - nose portion is impaired by only one cycle of adhesion of carbon and removal thereof by heating , and the spark plug no . c 3 nearly lost its inherent function . with spark plugs nos . 11 and 12 in table c , there is no breakdown in electric insulation even after 6 cycles of a carbon - adhering and removing operation . no . c 3 spark plug turned light brown in an area of the taper - nose portion to which a large amount of v 2 o 5 had been applied , and turned black in the aforesaid area when heated for removal of the adhering matter , such as carbon . this change to a black color is considered to relate to a change in electric insulation of the leg portion . spark plugs are produced by the same procedures as in example 1 , with the exception that the drying subsequent to the application of the suspension is effected at 100 ° c . for 30 seconds , and heating after drying is omitted . the duration of the self - cleaning ability of these spark plugs is measured in the same manner as in example 2 . the results are given in table d . the results of the test for the untreated plug no . c 2 are also given in this table . table d______________________________________ carbon - removal temperature (° c . ) concentration sec - no . of v . sub . 2 o . sub . 5 ( wt %) first ond third fourth fifth sixth______________________________________13 5 430 430 430 450 450 46014 1 &# 34 ; &# 34 ; &# 34 ; &# 34 ; &# 34 ; 47015 0 . 5 &# 34 ; &# 34 ; 450 &# 34 ; 470 50016 0 . 1 450 450 470 500 550 55017 0 . 01 &# 34 ; &# 34 ; 500 530 &# 34 ; &# 34 ; c . sub . 2none 550 550 550 550 550 550______________________________________ as is obvious from table d , even the spark plugs which have not been heated after the drying present improved self - cleaning ability . a comparison of table d with table b shows that spark plugs subjected to heating after drying in table b have a more - extended duration of self - cleaning ability , as compared with those in table d , which are produced by a process excluding heating subsequent to drying or by a process including heating after drying are , respectively , mounted in an engine . the engine is run a short distance at a low speed , as in actual running . these spark plugs perform their function without causing smoldering . the invention and its advantages are readily understood from the foregoing description . various changes may be made in the process and in the products without departing from the spirit and scope of the invention or sacrificing its material advantages . the process , products and new use , hereinbefore described , are exemplary of preferred embodiments and are not intended to limit the claims which follow .	7
the biofilter 10 of the present invention is generally depicted in various embodiments in fig1 , 3 and 4 . the biofilter 10 is preferably provided with a container 12 having side walls 14 and a bottom wall 16 . a layer of particulate rubber 18 is at least partially disposed within the container 12 . in one preferred embodiment the rubber particulate is obtained from recycled rubber products , such as the automobile tire 20 depicted in fig2 a . although it is contemplated that substantially all portions of the recycled tire 20 and other rubber based products could be used , it is preferred that those portions having steel reinforcing wires or other such foreign matter be avoided or used sparingly due to the undesirable nature of long term exposure of such materials to wet environments , which may cause the foreign matter to oxidize . however , the sidewall 22 and tread 24 of most modern passenger vehicle tires will likely be sufficiently free of such foreign matter for many of the contemplated uses for the biofilter 10 . the chipped rubber 26 , depicted in fig2 b , and crumb rubber 28 , depicted in fig2 c , provide optimal shapes for use as the filter media in the biofilter 10 . both the chipped and the crumb shapes are fairly irregular in nature , providing a large surface area for each individual piece . this , combined with the porous nature of the rubber provides an optimal platform for the formation and maintenance of a microbial ecosystem , which naturally occurs in the treatment of organic waste material . moreover , the irregular shape of the chipped and crumb rubber allow the particulate layer 18 to settle into a loosely packed layer that permits a consistent flow of gas through the layer of particulate rubber 18 over extended periods of time . however , the irregular shape of the particulate function to “ interlock ” the pieces of particulate to one another to sufficiently reduce the incidence of erosion caused by wind and weather where the layer of rubber particulate 18 is directly exposed to the elements . after the organic material 30 passes through the layer of rubber particulate 18 , the layer of rubber particulate 18 will substantially recover any openings formed by the passing organic material 30 . one contemplated embodiment of the biofilter 10 of the present invention is depicted in fig3 , which closely resembles an open - air lagoon typically utilized for liquid and / or solid organic waste 30 . depending on the particular application and the specific organic waste 30 being treated , the side and bottom walls of the container 12 could be comprised of nearly any material , such as concrete , rubber , plastic , and various non - corrosive metals . it is further contemplated that the side walls 14 and bottom wall 12 could be comprised of earthen materials , as the container could be a lagoon formed directly in the ground adjacent an organic waste producing facility . the organic waste 30 may be dumped directly into the open upper end of the container 12 since the organic waste 30 , regardless of its composition , will substantially pass through the layer of rubber particulate 18 and settle at the bottom of the container 12 or become partially suspended within the layer of fluid 32 . in many applications , the fluid 32 will simply be comprised of water but may be comprised of sludge or other known organic slurry . it is further contemplated that a system of conduit 34 or the like could be used to deliver the organic waste 30 and / or fluid 32 to the container 12 from an adjacent or remote organic waste producing facility when top - loading of such materials is not practical or otherwise desirable . regardless of the manner in which the organic waste 30 is delivered to the container 12 , a naturally occurring microbial ecosystem will begin breaking down the organic waste 30 within and below the layer of fluid 32 . this microbial ecosystem will also inhabit the layer of rubber particulate 18 and feed on the contaminated gasses delivered upwardly through the layer of fluid 32 to the layer of rubber particulate 18 . a test facility was created to quantify the benefits of the biofilter 10 as the same could be used in the treatment of organic waste within a manure slurry pit that was set up similarly to that depicted in fig3 . a six week testing and sampling of the manure storage containers was completed and the results are presented in fig5 . the contents of the manure storage tanks were similar to those typically observed in under - barn pit storage . odor reduction was studied for one inch layer of rubber particulate ( sample 3 ) and three inch layer of rubber particulate with reference to a control tank ( sample 2 ). for the three inch layer , experiments were based on the mode of addition of manure to the storage structure simulating an under - barn pit ( sample 5 ) and an outdoor storage unit ( sample 4 ). a container filled with water and a three inch layer of rubber particulate ( sample 1 ) was used to obtain background readings for the rubber particulate . sludge , lagoon top water and manure for these experiments were produced from a swine facility . as the table in fig5 indicates , the one inch layer of rubber particulate resulted in more than eighty percent odor reduction during sampling weeks 2 , 3 , and 6 . odor reduction diminished in other weeks where high ambient temperatures were experienced or the manure additions were made by dropping the waste through the layer of rubber particulate , simulating under - barn tank conditions , thus temporarily disbursing portions of the layer of rubber particulate and exposing the waste being stored below . performance of the three inch layer of rubber particulate was superior compared to the one inch layer of rubber particulate , effecting an odor reduction to the extent of eighty to ninety five percent , irrespective of the manner in which the manure was added to the tanks or the ambient temperature . other important facts discovered in the testing of the layers of rubber particulate include a ninety nine percent reduction of hydrogen sulfide and a ninety eight percent reduction in ammonia . the biofilter 10 of the present invention is sufficiently simple in its structure and design that it is easily used as a much smaller biofilter than that depicted in fig1 or 3 . for example , it is contemplated that a plurality of biofilters such as the biofilter 10 ′ depicted in fig4 could be used throughout a waste treatment system , such as a municipal sewer system . in that particular application , the container 12 ′ will preferably be provided with a sidewall 14 ′ and a bottom wall 16 ′. the bottom wall 16 ′ will preferably have one or more apertures formed therethrough that are sized and shaped to substantially prevent the passage of the layer of rubber particulate 18 ′ therethrough . however , the apertures within the bottom wall 16 ′ will permit the contaminated gasses emanating from the organic waste 30 , which flows beneath the biofilter 10 ′ within the conduit 36 , to pass through to the layer of rubber particulate 18 ′. a slightly increased pressure of the air within the conduit 36 will tend to direct the contaminated gasses upwardly through the bottom wall 16 ′ and through the layer of rubber particulate 18 ′ which will host the naturally occurring microbial ecosystem . when a cover 38 is used , such as a manhole cover , it should be provided with a plurality of apertures similar to those formed within the bottom wall 16 ′ so that the treated air may freely pass therethrough . it is contemplated that the layer of rubber particulate 18 ′ could be divided into a plurality of layers using apertured dividing plates 39 that are coupled to the side walls 14 ′. additionally , a layer of activated carbon 40 may be provided to absorb a substantial portion of the small amount of contaminated gases that may pass beyond the layer of rubber particulate 18 ′. the biofilter 10 ′ is simply one example of the flexibility provided by the design of the biofilter of the present invention . the functionality of the biofilter 10 ′ will be nearly identical to that of the biofilter 10 and will be expected to have similar success in the treatment of the contaminated gases emanating from the organic waste 30 . any of the contemplated structural embodiments of the biofilter will be appropriate for use in the treatment of low and high volume contaminating air streams that are characterized by a low or high concentration of a plurality of different gases and compounds . the biofilter is particularly well suited for the treatment of hydrogen sulfide , ammonia , aldehydes , ketones , amines , aliphatic hydrocarbons and aromatic hydrocarbons . the use of recycled tires in particulate form makes the filter media easy to apply and nearly maintenance free over an indefinite lifetime . moreover , the use of recycled materials provides an added benefit to the environment . in the drawings and in the specification , there have been set forth preferred embodiments of the invention and although specific items are employed , these are used in a generic and descriptive sense only and not for purposes of limitation . changes in the form and proportion of parts , as well as a substitution of equivalents , are contemplated as circumstances may suggest or render expedient without departing from the spirit or scope of the invention as further defined in the following claims . thus it can be seen that the invention accomplishes at least all of its stated objectives .	1
the various features of the preferred embodiments will now be described with reference to the drawing figures , in which like parts are identified with the same reference characters . the following description of the presently contemplated best mode of practicing the invention is not to be taken in a limiting sense , but is provided merely for the purpose of describing the general principles of the invention . according to a preferred embodiment of the present invention , a pseudowire packet mtie and ppb estimator is provided that can be used to indicate that the derived t1 clock may be exceeding the wander specification for a t1 traffic interface , such as t1 . 403 (§ 6 . 3 . 1 . 2 ) either over one or multiple 15 minute intervals or a 24 hour interval . the packet mtie estimator according to a preferred embodiment of the present invention presumes a constant network propagation delay for the fastest packets during a static period of the network operation . the packet mtie estimator according to a preferred embodiment of the present invention selectively processes the time difference between the rtp packet timestamps , which are marked at the time the packet is generated by the t1 line timed node , and the marked timestamp that indicates when the packet is received by the respective pseudowire timed node . the clock used to generate the t1 signal timestamps the data packet when the data packet is generated . if one or other of the clocks runs faster ( conversely slower ) than the other , then the mtie will exhibit those errors . the goal is to lock the two clocks together so that timing differences between the two are substantially minimized , or preferably eliminated , according to an exemplary embodiment of the present invention . when the two nodes &# 39 ; clocks are synchronized , the timestamp difference is constant . if the clocks are not locked , then the time difference increases or decreases accordingly with the differential clock error . the t1 mtie is the peak value of the difference over a given period . the derivative of this mtie is used to estimate the t1 clock error . as discussed above , the embodiments of the present invention and discussion herein have been directed towards t1 pseudowire data signals ; however , those of ordinary skill in the art of the present invention can appreciate that the embodiments discussed herein can also be used for e1 pseudowire data signals , and / or bundled or unbundled t1 pseudowire data streams . fig2 illustrates the effect of an incorrectly configured switch that was inadvertently programmed to half duplex operation rather than full duplex . fig2 shows , as an example , the effects of an incorrectly configured cisco ® switch , which was inadvertently programmed to 100 mbps half duplex operation rather than full duplex . the vertical axis shows relative packet delays ( jitter ) through the cisco ® switch measured in uis , and the horizontal axis represents time ( in hundreds of microseconds ). each point indicates , the arrival of a pseudowire packet . fig2 represents approximately 10 minutes of traffic samples . fig2 illustrates anomalous link behaviour that resulted from programming the link speed from full to half duplex . part of this anomalous behaviour is the slow packets , listed as i , ii , iii , and iv , which although periodic in nature , can be filtered out by software that uses fastest packets for timing determination . also shown is the odd behaviour of bursts “ v ” and “ vi ” of fast packets which occurred as a result of the full to half duplex setting . these fast bursts of packets can affect timing recovery and result in a change that can only be seen through the mtie estimator according to an exemplary embodiment of the present invention . thus , in this example , a network change in which an interface is changed from full to half duplex , caused packet delay variations which resulted in an mtie alarm being raised . the mtie alarm is raised at the same time as the network change was implemented , allowing the network engineer to quickly flag the install crew that they changed a parameter which affected the clock recovery . accordingly , it is the ability to detect a clock fault condition as the condition where the control loop is not maintaining the t1 mtie requirements and alarm it that various exemplary embodiments of the present invention addresses . accordingly , a first aspect of the present invention provides for the selective use of the “ fastest packets ”, or more specifically , those packets with the lowest network transit delay . as is well known to those of ordinary skill in the art of the present invention , network delay changes with respect to network loading , such that higher network loading will cause greater packet latency . as is also well known to those of ordinary skill in the art of the present invention , average and maximum packet delays increase with network loading . as network loading approaches 100 %, average and maximum packet transit time delays increase exponentially . however , minimum packet transit times remain substantially constant over most network loading conditions , barring the exceptional case of near 100 % loading . fig3 illustrates theoretical timing packet network transit delays under light and heavily loaded networks . the minimum packet transit delay is shown as time t 0 in fig3 . this delay is achieved by the fastest packets and is a statistical data point . according to a preferred embodiment of the present invention , the static value of t 0 is used as an absolute reference point for zero packet delay maximum time interval error ( mtie ) for a given network topology . when the network topology changes , a new value of t 0 is calculated , and used as the reference point for a new zero packet mtie . zero packet mtie — t 0 — is a statistical parameter , calculated by processing as many packet delay samples as required to achieve an accurate estimate of minimum packet delay . once to is determined for a static network topology , control algorithms adjust the regenerated t1 clock to maintain to constant , representing a substantially zero mtie . thus , the system and method according to an exemplary embodiment of the present invention constantly re - estimate t 0 . the re - estimation of to is recorded as an ongoing measure of mtie and used to adjust the clock in the device ( e . g . a bts ) being controlled . as can be appreciated to those of ordinary skill in the art of the present invention , different algorithms can be used to estimate t 0 . an example of such an algorithm operates a proportional / integral / derivative ( pid ) control loop to optimize the clock . according to an exemplary embodiment of the present invention , the mtie estimator shows how far the pid or other control algorithm is swinging in t1 bit times based on the packet arrival time stamps . the different algorithms are designed to keep the relative time difference of the received packet stream small with respect to to , and bounded by allowed mtie of 28 ui per 24 hours . if there are any excursions beyond this limit implies then it can be ascertained , according to the present invention , that the data being fed to the pid or other control loop is misbehaving . as those of ordinary skill in the present art can appreciate , substantially all control algorithms employ models for both the system to be controlled as well as for the received data used to control the system . the models may be linear or non - linear . a linear control system would be a pid controller , where the feedback control signal is proportional to either the error of ( t n − t 0 ) multiplied by a constant k p , or the proportional to the derivative of ( t n − t 0 ) with respect to time multiplied by a different constant k d , or proportional to the integral of the error of ( t n − t 0 ) multiplies by a constant k i . a non - linear control system could be similar to a linear control system , but for example where the gain of the control loop is exponentially increased based on the error ( t n − t 0 ), so for example , the proportional gain is k p for error signal ( t n − t 0 )& lt ; 10 , but increases to 2 * k p for ( t n - t 0 )≧ 10 . the model for the crystal ( i . e ., to generate the receive clock ), for example , can define the allowed range of digital control values and corresponding relative frequency change in parts per billion . the non - linear model for the timing packet delay samples can assume network topology changes resulting in stepwise changes to the network delay . other non - linear aspects can address micro - beating of the timing packets with other similar timed packets . when the models are correct , the control system works as designed and maintains to within the specifications for a traffic t1 . this is shown in fig4 , which illustrates packet maximum time interval error rate when correct linear and non - linear models are used to replicate both the system and the data used within the system according to an embodiment of the present invention . fig4 , although theoretical , shows that the normal operation of the control loop is to work well within the defined mtie and ppb bounds required for t1 circuits . the control loop according to a preferred embodiment of the present invention is a phase locked loop control system , as shown in fig8 . fig5 illustrates a current packet maximum time interval error for a specific circuit for a first time period according to an exemplary embodiment of the present invention . the data for fig5 was extracted from an exemplary embodiment of the present invention , a live belair ® networks mesh network carrying pseudowire traffic . fig5 represents actual performance data of current packet maximum time interval error estimation over about a 24 hour ( 96 interval ) period . also shown on fig5 is an error estimation in ppb based on the recovered pseudowire streams and their relative position in the receive buffer . fig6 illustrates current packet maximum time interval error for a specific circuit for a second time period according to an exemplary embodiment of the present invention . fig6 illustrates the mtie and ppb error estimates based on the packet data streams over a shorter time period of about 3 hours , or twelve intervals of approximately 15 minutes each . according to a exemplary embodiment of the present invention , the ppb estimation , which is based on the differential of the packet mtie estimation , can be roughly approximated as : ppb error [ n ] =( mtie [ n ]− mtie [ n − 1 ])( 647000 ps )/( 15 minutes 60 seconds ), so that the scaling factor between ppb and differential mtie estimation is approximately 0 . 9 : 1 . if , however , the packet mtie exceeds a defined threshold , or the ppb estimate exceeds an alternate defined threshold , then most often , the packet timing samples are not behaving according to the model , indicating a problem with the network packet delay statistics . fig7 illustrates a current packet maximum time interval error with an alarm condition according to an exemplary embodiment of the present invention . in the case shown in fig7 , the high threshold alarm has been exceeded . an alarm would be raised if the condition persists for a specified period of time ( a process known as “ debouncing ”), or if the ppb estimate exceeded a defined allowed error threshold . for example , if the ppb estimate exceeded the 50 ppb specification for a single 15 minute interval , then the resulting t1 buffer error in the subtending equipment could be as high as 15 * 60 * 0 . 1 = 90 μs , or approximately 140 ui . this condition would need to be alarmed , as most t1 buffers in subtending equipment are rated only for ± 128 ui and the mtie estimate is not an absolute value . alarms raised as a result of mtie thresholds being exceeded , or ppb estimates being exceeded , do not inform the noc of the cause of the clock error , only that there is a clock error and that the recovered clock is not meeting required specifications . an alarm condition can be used by the noc to aid in the determination of the cause . as is often the case , the root cause is a direct result of noc intervention , either changing of circuits , and these changes can be retracted quickly if the alarm condition is presented . according to a further exemplary embodiment of the present invention , a system and method are provided to extrapolate the t1 timing error based on the packet mtie estimator . the system and method for extrapolation according to an exemplary embodiment of the present invention utilizes the transfer function of the control algorithm in conjunction with the calculated packet mtie estimate to estimate the t1 mtie value . the estimated t1 mtie values are then used to set the alarm thresholds . fig9 illustrates an exemplary control system wherein timing for recovery of a pseudowire data stream is derived from the pseudowire data stream according to an embodiment of the present invention . fig9 illustrates the control system wherein the pseudowire data stream is used as the timing source , and is timed from the pseudowire unit 4 which is locally timed from line interface unit ( liu ) 4 . as data enters liu 2 , a t1 data clock time - stamps each packet . the t1 data is then transmitted as packets wired or wirelessly via network 6 , and recovered at converter 8 , and liu 10 . liu 10 time - stamps the recovered data packet with its own t1 data clock which is free - running compared to the transmitting t1 data clock . the rate of change in the difference between the two clock &# 39 ; s time - stamps indicates whether one clock is faster than the other . a delta - t that is increasing means the receive clock is running faster ; and if delta - t is decreasing , then the local receive clock is running slower . fig9 further includes an exemplary proportional integral derivative ( pid ) controller which forms the pll control system 12 . part of control system 12 is a monitoring function , which includes two taps : a first limiter 14 for alarming excessive mtie events , and a derivative function block 16 followed by a second limiter 18 for alarming excessive clock error conditions . according to a preferred embodiment of the present invention , the clock error condition will alarm when clock errors exceeds a threshold of about 100 ppb . fig1 illustrates an exemplary control system wherein timing for recovery of a pseudowire data stream is derived from an ieee 1588 timed local clock 26 according to an embodiment of the present invention . fig1 is similar to fig6 ; however , the regenerated t1 timing is derived from an ieee 1588 local clock 26 and not from the pseudowire stream . the ieee 1588 local clock 26 relies on exchanging timing messages and control with an ieee 1588 timing source 24 located in the network . the ieee 1588 timing source 24 uses the same stratum traceable timing reference as liu 2 , so the end result is that the regenerated ieee 1588 clock in pseudowire box 20 should have the same timing as the network . accordingly , the exemplary embodiment of the present invention illustrated in fig1 illustrates a system to monitor and alarm the operation of the ieee 1588 using almost the same circuitry as shown in fig9 , with the addition of ieee 1588 timing source 24 . pseudowire alarm monitor 22 is also shown in fig1 , and includes two taps : a first limiter 14 for alarming excessive mtie events , and a derivative function block 16 followed by a second limiter 18 for alarming excessive clock error conditions . the output of the timestamp filtering is combined with an output from an ieee 1588 timed local clock to for the timestamp extraction used to receiver t1 data signals . according to a preferred embodiment of the present invention , the clock error condition will alarm when clock errors exceeds a threshold of about 100 ppb . exemplary embodiments of the present invention can be implemented as a computer program that can be embodied in any computer - readable medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . as used herein , a “ computer - readable medium ” can be any means that can contain , store , communicate , propagate , or transport the program for use by or in connection with the instruction execution system , apparatus , or device . the computer readable medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , infrared , or semiconductor system , apparatus , device , or propagation medium . more specific examples ( a non - exhaustive list ) of the computer - readable medium can include the following : an electrical connection having one or more wires , a portable computer diskette , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), an optical fiber , and a portable compact disc read - only memory ( cdrom ). the present invention has been described with reference to certain exemplary embodiments thereof . however , it will be readily apparent to those skilled in the art that it is possible to embody the invention in specific forms other than those of the exemplary embodiments described above . this may be done without departing from the spirit and scope of the invention . the exemplary embodiments are merely illustrative and should not be considered restrictive in any way . the scope of the invention is defined by the appended claims and their equivalents , rather than by the preceding description . all united states patents and applications , foreign patents , and publications discussed above are hereby incorporated herein by reference in their entireties .	7
fig1 and 2 show a phone system demonstration station 100 configured in accordance with an embodiment of the present invention . the phone system demonstration station 100 includes a demonstration unit support platform 102 , a plurality of phone system demonstration units 104 secured to a top surface 106 of the demonstration unit support platform 102 , and phone system operating components 108 secured to a bottom surface 110 of the demonstration unit support platform 102 . alternatively , the phone system operating components 108 can be engaged with the top surface 106 or to both the top and bottom surfaces 106 , 110 of the demonstration unit support platform 102 . the platform 102 can be made using any suitable materials / construction and can include a suitable support structure such as , for example , a plurality of legs 114 . it is disclosed herein that , in some embodiments , one or more of the phone system demonstration units 104 are secured to the demonstration unit support platform 102 in a manner such that they are selectively detachable from and attachable to the top surface 106 of the demonstration unit support platform 102 . for example , one or more of the phone system demonstration units 104 can be desktop units that are fixedly secured to the top surface 106 of the demonstration unit support platform 102 and one or more of the phone system demonstration units 104 can be handheld / mobile units that are selectively detachable from and attachable to the top surface 106 of the demonstration unit support platform 102 . voice over internet protocol ( voip ) phone units such as those offered by polycom are examples of the phone system demonstration units 104 . furthermore , the phone system demonstration units 104 are one example of telecommunications equipment . it is disclosed herein that embodiments of the present invention can be configured to demonstrate telecommunications equipment other than that of a phone system . the phone system demonstration units 104 are operably connected to the phone system operating components 108 . the phone system operating components 108 include service interfaces 112 that are configured for being connected to services such as , for example , line power , a pots ( i . e ., plain old telephone service ( i . e ., landline service )) line , the internet ( i . e ., a public computer network system ) and the like for enabling fully functional actual and / or simulated operation of the phone system demonstration units 104 . the phone system operating components 108 is configured for providing demonstration enabling functionality thereof to the phone system demonstration units 104 when the phone system operating components 108 are provided with electrical power and a communication connection . in the case of the phone system demonstration units 104 operating over a computer network ( e . g ., a voip phone system ), an internet connection is a suitable type of communication connection ( i . e ., a communication network connection ) for enabling demonstration enabling functionality of the phone system operating components 108 to be implemented . it is disclosed herein that the communication connection can be provided in a wired and / or wireless manner . in view of the disclosures made herein , a skilled person will appreciate that the phone system operating components 108 is collectively an example of demonstration enabling circuitry configured in accordance with an embodiment of the present invention . it is disclosed herein that the demonstration enabling functionality enables the at least one phone demonstration unit to perform end - use communication services thereof . for a voip phone system or other suitably configured type of telecommunications equipment , examples of such end - use communication services include , but are not limited to , the functionalities listed in table 1 below . in view of the disclosures made herein , a skilled person will contemplate other end - use communication services that can be implemented via demonstration enabling functionality and demonstration enabling circuitry suitably configured for providing such demonstration enabling functionality . referring now to fig3 , a demonstration apparatus 200 ( i . e ., a phone system demonstration kit ) configured in accordance with an embodiment of the present invention is shown . the demonstration apparatus 200 includes a carrying case 202 ( i . e ., a equipment enclosure ) and the phone system demonstration station 100 . the carrying case 202 includes a carrying case base 204 and a carrying case lid 206 moveably mounted on the carrying case base 204 for allowing the carrying case lid 206 to be moved to an orientation with respect to the carrying case base 204 for allowing access to a cavity 208 of the carrying case base 204 . preferably , but not necessarily , the carrying case lid 206 is pivotably attached to the carrying case base 204 such as though one or more hinges . alternatively , the carrying case lid 206 can be configured for being entirely detached from the carrying case base 204 . the phone system demonstration station 100 is located ( e . g ., fixedly or removably ) within the cavity 208 of the carrying case base 204 . in this respect , the cavity 208 is a demonstration unit support platform receiving cavity . the phone system demonstration units 104 of the phone system demonstration station 100 are exposed within an opening 210 of the carrying case base 204 . the opening 210 is defined by an open end portion the cavity 208 . in this respect , particularly when the phone system demonstration station 100 is fixedly located within the cavity 208 of the carrying case base 204 , the portion of the phone system operating components 108 that are attached to the bottom surface 110 of the demonstration unit support platform 102 are located within an interior space of the carrying case 202 ( i . e ., a space jointly defined by the demonstration unit support platform 102 and the cavity 208 of the carrying case base 204 . the demonstration apparatus 200 includes a phone demonstration unit protection insert 220 . in one embodiment , the phone demonstration unit protection insert 220 is a protective foam insert . the phone demonstration unit protection insert 220 is positioned within the cavity 208 of the carrying case base 204 above the phone system demonstration station 100 . each one of the phone demonstration units 104 of the phone system demonstration station 100 is located within a respective phone demonstration unit receiving space 222 of the phone demonstration unit protection insert 220 . in this respect , the phone demonstration unit protection insert 220 supports and protects the phone demonstration units 104 during transport of the demonstration apparatus 200 . turing now to a method of use of the demonstration apparatus 200 , a set of steps for demonstrating a phone system is presented . after moving the carrying case lid 206 from its closed position ( fig3 ) to its open position ( fig4 ), the phone demonstration unit protection insert 220 is removed from within the cavity 208 of the carrying case base 204 . after removing the phone demonstration unit protection insert 220 from the cavity 208 of the carrying case base 204 , the phone system demonstration station 100 is removed from within the cavity 208 of the carrying case base 204 . in a first embodiment of the method ( i . e ., table top use with the phone system demonstration station 100 is removed from within the cavity 208 of the carrying case base 204 ), electrical power and one or more suitable communication connections are provided to the phone system operating components 108 after removal of the phone system demonstration station 100 is removed from within the cavity 208 of the carrying case base 204 thereby allowing demonstration of the phone demonstration units 104 to be implemented . electrical power can be provided via a power supply cable of the phone system operating components 108 being plugged into a power source and one or more suitable communication connection can be provided via an active ethernet cable being plugged into a network connector of the phone system operating components 108 to provide network ( e . g ., internet ) connectivity . in a second embodiment of the method ( i . e ., the phone system demonstration station 100 used while in the cavity 208 of the carrying case base 204 ), the phone demonstration unit protection insert 220 is placed back into the cavity 208 of the carrying case base 204 after the phone demonstration unit protection insert 220 is removed from the cavity 208 of the carrying case base 204 . thereafter , the phone system demonstration station 100 is placed back into the cavity 208 of the carrying case base 204 on top of the phone demonstration unit protection insert 220 . in this respect , the phone demonstration unit protection insert 220 serves as a stand - off for the phone system demonstration station 100 to maintain it at an elevated position within the cavity 208 of the carrying case base 204 . electrical power and one or more suitable communication connection are provided to the phone system operating components 108 after the phone system demonstration station 100 is placed back into the cavity 208 of the carrying case base 204 thereby allowing demonstration of the phone demonstration units 104 to be implemented . electrical power can be provided via a power supply cable of the phone system operating components 108 being plugged into a power source and one or more suitable communication connection can be provided via an active ethernet cable being plugged into a network connector of the phone system operating components 108 to provide network ( e . g ., internet ) connectivity . although the invention has been described with reference to several exemplary embodiments , it is understood that the words that have been used are words of description and illustration , rather than words of limitation . changes may be made within the purview of the appended claims , as presently stated and as amended , without departing from the scope and spirit of the invention in all its aspects . although the invention has been described with reference to particular means , materials and embodiments , the invention is not intended to be limited to the particulars disclosed ; rather , the invention extends to all functionally equivalent technologies , structures , methods and uses such as are within the scope of the appended claims .	7
referring again to the drawings , fig3 shows a modified logic cell which primarily utilizes npn transistors and which is capable of reliable low voltage operation . it should be noted that the present invention can be implemented using transistor types other than bipolar transistors , including fets and hbts . the modified cell includes an input differential pair including npn transistors q 1 and q 2 and an output differential pair which includes npn transistors q 3 and q 4 . the two differential pairs share common load resistors r l1 and r l2 . the output of the output differential pair ( q 3 / q 4 ) is coupled to the output of the cell by way of a pair of emitter - follower configured transistors q 7 and q 8 . transistors q 7 and q 8 are connected to current sources i x1 and i x2 , respectively . these transistors also provide feedback for increasing switching speed . current is provided to the input differential pair by npn transistor q 5 and to the output differential pair by npn transistor q 6 . transistors q 5 and q 6 are controlled by a switching circuit which is responsive to the clock signal . the switching circuit includes a differential pair of pnp transistors q 9 and q 10 connected to a common current source i x1 . the clock signal is fed to the bases of transistors q 9 and q 10 . the switching circuit further includes a pair of npn transistors q 11 and q 12 which function as active loads for transistors q 9 and q 10 , respectively . transistors q 11 and q 12 are diode connected with the base and collector electrodes shorted together . the base / collector electrodes of transistors q 11 and q 12 are coupled to the base electrode of transistors q 5 and q 6 , respectively . transistor pair q 11 and q 5 and pair q 12 and q 6 each function as current mirrors so that the current in the diode half of the pair is reflected in the transistor half . operation of the fig3 cell will now be described . when the clock is in a first phase , transistor q 9 is conducting and transistor q 10 is off . through the operation of the current mirror , transistor q 5 will be turned on and transistor q 6 will be off . thus , the input differential pair comprising transistors q 1 and q 2 will be active and will respond to the data input . in the second phase of the clock , transistor q 9 will be switched off and transistor q 10 will be switched on . this will cause the input differential pair comprising transistors q 1 and q 2 to become inactive and the output differential pair comprising transistors q 3 and q 4 to become active . the data stored in the input pair will be transferred to the output pair comprising transistors q 3 and q 4 and to the output of the cell by way of the emitter - follower transistors q 7 and q 8 . since the input pair are inactive , the cell will not respond to any further changes in the data input . the minimum operating voltage for the modified cell of fig3 is less than the voltage required by the conventional cell of fig2 . the minimum voltage for the input circuit to operate is limited by the voltage required for the output differential pair to operate . that voltage is determined by inspection and is as follows : v min is the minimum operating voltage for the modified cell ; v zl is the minimum quiescent voltage across the load resistors r l1 / r l2 ; v be ( q7 / 8 ) is the minimum quiescent base - emitter voltage of transistors q 7 / q 8 ; v be ( q3 / 4 ) is the minimum quiescent base - emitter voltage for transistors q 3 / 4 ; and v ce ( q6 ) is the minimum quiescent collector / emitter voltage for transistor q 6 . assuming that the minimum voltage for the three base - emitter voltages is 0 . 75 volts and the minimum voltage for the load resistors is 0 . 25 volts , it can be seen that the minimum voltage for reliable operation of the modified cell of fig3 is 2 . 75 volts , a significant improvement over the conventional cell of fig2 which requires 3 . 25 volts . as is the case with all of the circuits disclosed herein , the loads may be implemented either as resistive loads ( r l1 / r l2 ) or as active loads . the active loads may include , for example , a pair of transistors configured as a current mirror . fig4 depicts the complement of the modified cell of fig3 where pnp transistors have been replaced with npn transistors and npn transistors have been replaced with pnp transistors . further , the polarity of the supply voltage is reversed . operation of the fig4 circuit is the same as that of fig3 and the minimum operating voltage is also improved to the same extent as that of fig3 . referring to fig5 a further modified logic cell is disclosed which primarily utilizes npn transistors . the cell includes an input differential pair which includes transistors q 1 and q 2 having their emitters coupled to a common current source i x4 . the output of the input differential pair is coupled to an output differential pair which includes transistors q 3 and q 4 by way of emitter - follower configured transistors q 7 and q 8 . the input differential pair and the output differential pair share common load resistors r l1 and r l2 . the output differential pair transistors q 3 and q 4 have their emitters coupled to a common current source i x5 . in addition , emitter follower transistors q 7 and q 8 are coupled to separate current sources i x2 and i x3 . again , the output of the cell is at the emitters of transistors q 7 and q 8 . the fig5 cell includes a switching circuit which is responsive to the clock signal and which includes a pair of pnp transistors q 9 and q 10 having their emitters coupled to a common current source i x1 . current source i x1 has an output magnitude which matches that of both sources i x4 and i x5 . the collector of transistor q 9 is connected to current source i x5 and the collector of transistor q 10 is connected to current source i x4 . in operation , during one phase of the input clock , transistor q 9 is on and transistor q 10 is off . that means that all of the current from source i x1 flows through transistor q 9 into source i x5 . since the magnitude of the two current sources are the same , all of the current required by source i x5 is provided by source i x1 . there is no remaining current available for the output stage differential pair made up of transistors q 3 and q 4 so the output stage is inactive . at the same time , transistor q 10 is off so that all of the current required by source i x4 is provided by transistors q 1 and q 2 . thus , the input differential pair is active and the data input appears at the output of the circuit . when the clock changes phase , transistor q 10 is turned on and q 9 is turned off . the input differential stage then becomes inactive since all current for source i x4 is provided by transistors q 10 and the output stage is active since all current required by the stage is provided by transistors q 3 and q 4 . thus , the data from the input stage is transferred to the output stage and to the output . any further changes in the input data will not affect the cell since the input stage is inactive . the voltage required for reliable operation of the fig5 cell is less than that of the conventional cell of fig2 . the portion of the cell which requires the largest operating voltage is that which includes the output differential pair and therefore determines the minimum operating voltage . the minimum operating voltage , which is determined by inspection , is as follows : v min is the minimum operating voltage for the modified cell ; v zl is the minimum quiescent voltage across the load resistors r l1 / r 2 ; v be ( q7 / 8 ) is the minimum quiescent base - emitter voltage of transistors q 7 / q 8 ; v be ( q3 / 4 ) is the minimum quiescent base - emitter voltage for transistors q 3 / 4 ; and assuming that the minimum voltage for v be ( q7 / 8 ) v be ( q3 / 4 ) and v ix5 is 0 . 75 volts and the minimum voltage for v zl is 0 . 25 volts , the minimum operating voltage is 2 . 5 volts , a substantial improvement over the conventional cell of fig2 which , as previously noted , requires 3 . 25 volts . fig6 is a modified cell which is the complement of the fig5 cell . the npn transistors are replaced with pnp transistors and the pnp transistors are replaced with npn transistors . in addition , the polarity of the supply voltage is reversed . the improvement in minimum operating voltage over the conventional fig2 circuit is the same as the fig5 circuit . as previously noted , fig7 is a conventional cell which does not include the emitter - follower configured output transistors q 7 and q 8 of the conventional fig2 circuit . instead , the output of the input differential stage is connected directly to the input of the output differential stage and directly to the output of the cell . although the drive capability of the fig7 cell is somewhat less than that of the fig2 and the speed is reduced , the operating voltage is lowered . as can be seen from inspection , the minimum operating voltage is as follows : assuming that the minimum voltage for v ce , v be and v ix is 0 . 75 volts and is 0 . 25 volts for v zl , the minimum operating voltage v min is 2 . 75 volts . that is substantially less than the 3 . 25 volts required by the conventional cell of fig2 but still further reduced operating voltages are desirable . fig8 is a still further modified cell which does not include the emitter - follower configured output transistors q 7 and q 8 of the improved cell of fig3 . instead , the output of the input differential stage is connected directly to the input of the output differential stage and directly to the output of the cell . although the drive capability of the fig8 cell is somewhat less than that of the fig4 cell and the speed is reduced , the operating voltage is further lowered . as can be seen from inspection , the minimum operating voltage is as follows : v min is the minimum operating voltage for the modified cell ; v ix is the minimum quiescent voltage across the current sources ; and v ce ( q9 / 10 ) is the minimum quiescent collector - emitter voltage for transistors q 9 / 10 ; and v be ( q11 / 12 ) is the minimum quiescent base - emitter voltage for transistors q 11 / 12 . assuming that the minimum voltage for v be , v ce and v ix is 0 . 75 volts , the minimum operating voltage v min is 2 . 25 volts . that is a further reduction of minimum required operating voltage of 2 . 75 volts for improved cell of fig3 . it should be noted that a similar reduction of minimum operating voltage can be achieved in the fig4 complementary cell by removing transistors q 7 and q 8 connecting the output of the input differential pair directly to the output of the cell and directly to the input of the output differential pair . fig9 is a still further modified cell which does not include the emitter - follower configured output transistors q 7 and q 8 of the improved cell of fig5 . instead , the output of the input differential stage is connected directly to the input of the output differential stage and directly to the output of the cell . although the drive capability of the fig9 cell is somewhat less than that of the fig5 and the speed is reduced , the operating voltage is further lowered . as can be seen from inspection , the minimum operating voltage is as follows : v min is the minimum operating voltage for the modified cell ; and v ix is the minimum quiescent voltage across the current sources ; and v ce ( q9 / 10 ) is the minimum quiescent collector - emitter voltage for transistors q 9 / 10 . assuming that v ix and v ce ( q9 / 10 ) are each 0 . 75 volts , the minimum operating voltage for the fig9 cell is 2 . 25 volts . that represents a significant further improvement over the minimum operating voltage of the fig5 cell of 2 . 5 volts . a similar improvement in minimum operating voltage can be achieved for the complementary circuit of fig6 by deleting transistors q 7 and q 8 and connecting the output of the input differential pair directly to the output of the cell and the input of the output differential pair . the minimum operating voltage of the fig1 multiplier can also be improved . referring to fig1 , a modified multiplier circuit is depicted . again , the multiplier is configured as a mixer or frequency converter where the output of a local oscillator v lo is combined with a radio frequency signal v rf to produce an intermediate frequency signal v if . the fig1 converter includes a first differential pair of npn transistors q 1 and q 2 and a second differential pair of npn transistors q 3 and q 4 which drive a common load z l . the base electrodes of transistors q 2 and q 3 form the positive input for the differential input signal v lo and the base electrodes transistors q 1 and q 4 form the negative input . the inputs for the radio frequency signal v rf are the base electrodes of a pair of differentially - connected pnp transistors q 8 and q 9 . a current source i x1 is coupled to the common emitter connection of transistors q 8 and q 9 . the collectors of transistors q 8 and q 9 are connected to the base / collector terminals of npn transistors q 10 and q 11 , respectively . transistors q 10 and q 11 are both connected as diodes . the fig1 circuit further includes an npn transistor q 5 having a collector connected to the common emitter junction of transistors q 1 and q 2 and a second npn transistor q 6 having a collector which is connected to the common emitter junction of transistors q 3 and q 4 . the emitters of transistors q 5 , q 6 , q 10 and q 11 are connected to the negative supply vee . transistors q 10 and q 5 function together as a current mirror as do transistors q 11 and q 6 . accordingly , as signal v rf varies the current in transistors q 10 and q 11 , the current is caused to vary in transistors q 10 and q 11 . due to the action of the current mirrors , current also changes in transistors q 5 and q 6 . this causes changes in the transconductance of the two differential pairs so that the gain of the two pair change in the same manner as the conventional converter of fig1 . the minimum operating voltage of the fig1 circuit can be determined by inspection and is as follows : assuming that v zl is 1 volt and v ce is 0 . 75 volts , the minimum operating voltage v min is 2 . 50 volts . the minimum operating voltage of the conventional fig1 circuit is 3 . 25 volts . fig1 is the complement of fig1 , with the npn transistors of fig1 being replaced by pnp transistors , the pnp transistors of fig1 being replaced by npn transistors . in addition , the polarity of the supplies is reversed . the improvement in minimum operating voltage over the conventional circuit of fig1 is the same as the circuit of fig1 . fig1 is a still further modified converter . the converter circuit includes two differential pairs having a common load z l . the first differential pair includes npn transistors q 1 and q 2 and the second pair includes npn transistors q 3 and q 4 . the positive v lo signal is connected to the bases of transistors q 1 and q 4 and the negative v . sub . signal is connected to the bases of transistors q 2 and q 3 . the q 1 / q 2 differential pair has a current source i x2 connected to the common emitter junction . the q 3 / q 4 . differential pair has a current source i x3 connected to the common emitter junction of transistors q 3 and q 4 . the v rf signal is coupled to the base electrodes of a differential pair of pnp transistors q 8 and q 9 . the common emitter connection of transistors q 8 s and q 9 is coupled to a current source i x1 having a magnitude set equal to that of sources i x2 and i x3 . the collectors of transistors q 8 and q 9 are connected to the output of current sources i x2 and i x3 , respectively . in operation , signal v rf causes transistors q 8 and q 9 to conduct varying amounts of current provided by source i x1 . this causes the current available to the input and output differential pair to vary in accordance with signal v rf . since the current required by sources i x2 and i x3 is fixed , any current provided to either current source by transistors q 8 and q 9 will be subtracted from that available to the associated input or output differential pair . for example , if signal v rf causes transistor q 8 to conduct more current and q 9 to conduct less current , the current provided to the q 1 / q 2 differential pair will decrease and that provided to the q 3 / q 4 pair will increase . this action causes the transconductance of the differential pair to change so that the circuit will function as a multiplier circuit . the minimum operating voltage for the circuit of fig1 can be determined by inspection and is as follows : v ix is the minimum quiescent voltage across the current sources . assuming that v zl is 1 volt and v ce and v ix are 0 . 75 volts , v min is 2 . 5 volts . as previously noted in connection with the conventional multiplier of fig1 the minimum operating voltage of that circuit is 3 . 25 volts . fig1 is the complement of the fig1 circuit . the pnp transistors are replaced with npn transistors and the npn transistors are replaced with voltages are reversed . the operation of the fig1 circuit is the same as that of the fig1 circuit and the improvement in minimum operating voltage is the same . thus , various embodiments of circuit employing differential transistor pairs having low voltage operating capabilities have been disclosed . although these embodiments have been described in some detail , it is to be understood that changes can be made without departing from the spirit and scope of the invention as defined by the appended claims . by way of example , the input signals have been depicted and described as differential signals , but such signals could also be single - ended signals . in that event , one of the inputs to a differential pair will receive the single - ended signal and the remaining input will be held at a . c . ground .	7
referring to fig2 a preferred embodiment of a semiconductor device ( soj package ) according to the present invention will be described in detail . in fig2 a plurality of land patterns ( not shown here ) including through holes ( not shown here ) and connection leads 23 are formed on the lower surface of a main substrate 21 . a plurality of solder ball pads 25 are formed on the upper surface of the main substrate 21 , and a plurality of solder balls 26 are formed on the sold ball pads 25 of the main substrate 21 . a semiconductor chip 22 is mounted on the center , for example , of the lower surface of the main substrate 21 with an adhesive 29 , and bonding pads ( not shown ) of the semiconductor chip 22 are bonded to the connection leads 23 via wires 24 and are molded with emc to form a package body 20 . here , the connection leads 23 electrically connect the through holes with the land patterns , and are electrically connected to the wires 24 . the above construction will be more clearly understood with reference to fig3 which is a partially cutaway plan view of fig2 . referring to fig3 the land pattern 27 and through hole 28 are formed in the lengthwise direction of the main substrate 21 to be commonly and electrically connected by the connection lead 23 . the package body 20 is provided at the end of the connection lead 23 in the lengthwise direction . fig4 is a vertical sectional view showing another embodiment of the semiconductor device according to the present invention . referring to fig4 the semiconductor device has at least one semiconductor chip 32 mounted on the lower surface of a printed circuit board ( hereinafter referred to as &# 34 ; pcb &# 34 ;) 31 by interposing an adhesive 39 . bonding pads ( not shown ) of the semiconductor chip 32 and electrode connection terminals 33 of the pcb 31 are bonded by means of wires 34 . a connection portion of the semiconductor chip 32 and wire 34 are encapsulated with a resin to form a package body 30 . in the above - described semiconductor device , the pcb 31 is mounted upside down during a final mounting process , and the terminals of the pcb 31 are connected to external terminals via through holes . also , at least one other semiconductor device is stacked on the upper surface of the pcb 31 . in this case , the respective semiconductor devices are connected to each other by interposed solder balls 36 , and mounted to other pcbs by means of leads 38 , which function as the external terminals , resulting in as stacked semiconductor device having a three - dimensional structure . when viewed from the reversed direction , a die pad portion of the semiconductor chip 32 on the upper surface of the pcb 31 , a wire bonding pad portion for connecting the semiconductor chip 32 to the terminals of the package , and a solder bump pad portion formed of the solder balls 36 are plated with nickel ( ni ) and gold ( au ) to a thickness of 5 μm and 0 . 5 μm , respectively , using copper foil as a base , so that the device reliability is improved during the wire bonding . the above - described construction will be more clearly understood with reference to fig5 which is a partially cutaway plan view of fig4 . referring to fig5 a land pattern 47 and a through hole 48 are formed in the lengthwise direction of the pcb 31 , and are commonly and electrically connected by connection lead 33 . the external terminal lead 38 is connected via the through hole 48 . the package body 30 is provided on the end of the connection lead 33 in the lengthwise direction . the lead 38 , which is the external terminal of the pcb 31 , is plated with copper ( cu ) or an alloy thereof . meanwhile , referring to fig6 ( which is an enlarged , partial sectional view of region a fig4 ), a solder ball pad 35 on which solder ball 36 is mounted is a metal - coated layer obtained by sequentially plating copper 42 , nickel 43 and gold 44 on the pcb 41 . a disc - shaped solder ball mounting portion 37 is provided on the upper portion of the thus metal - coated layer . the pcb 41 is made of a thermostable material , such as bismaleimidetriazine ( bt ) resin and thermostable epoxy . the surface of the nickel plating is coated with gold ( au ) 0 . 5 μm thick . fig7 and 8 are both plan views illustrating the upper and lower portions , respectively , of the semiconductor substrate used in the semiconductor device according to the present invention , prior to forming the land pattern . referring to fig7 a disc - shaped terminal portion 55 is provided on an upper portion of a pcb 51 to allow another like pcb to be connected thereto by means of a respective solder ball . referring to fig8 ring - shaped through holes 52 are formed to individually correspond to the disc - shaped terminal portions 55 . the broken - lined region 53 on the center of the pcb 51 in fig8 indicates a molding region where a molding body is generally formed . therefore , the upper / lower surfaces of the pcb 51 connected by the solder balls become conductive by means of the through holes or via holes , and an interlayer connection terminal ( not shown ) on the lower surface of the pcb 51 is electrically connected to the through hole 52 . also , a conductive portion and a through hole portion , except the portions which will be connected by means of the solder balls in succeeding processes , are coated with a solder - resist , respectively . the above - described soj package may be manufactured in the following process , described by way of example with reference to fig4 to 8 . as shown in fig7 and 8 , after a through hole 52 is formed in the center of both ends of the lower surface and upper surface of the main substrate 51 , in which the through hole 52 in the lower surface is shaped as a ring to allow the external connection leads to be connected thereto , and the upper surface connected to the through hole 52 is provided as a disc form . the land portion , including the through hole , is shaped as a ring by eliminating a conductive material portion from the center to facilitate alignment during stacking of the bga packages . the land portion of the opposite side is shaped as a disc to prevent melted solder from flowing toward the opposite side during reflow soldering performed after mounting the solder ball . then , as shown in fig6 copper ( cu ), nickel ( ni ) and gold ( au ) are sequentially plated , centering around the through hole 52 via the plating process to form the metal - coated layer . thereafter , as shown in fig4 the land pattern , connection lead and ball grid array are provided in a predetermined pattern configuration around the metal - coated layer formed on the lower and upper surfaces of the main substrate 31 via a patterning process , and the solder - resist is coated . using an adhesive 39 , the semiconductor chip 32 is mounted onto the center of the main substrate 31 and is bonded to the connection lead 33 by means of the wire 34 , and the package body 30 is thereafter formed . at this time , the semiconductor chip 32 is attached on the center of the main substrate 31 by using the conductive adhesive 39 on the die pad portion for attaching the semiconductor chip 32 . the adhesive is then hardened at a temperature of approximately 150 ° c . then , the bonding pads of the semiconductor chip 32 are connected to the external leads 38 of the main substrate 31 with a thin gold wire under a temperature of about 170 ° c . at a heater block . upon completing connection of the thin metal wire , the body molding is performed with the emc . the solder ball mounting , in which the interlayer connection via the solder ball is accomplished by the land pattern , is then performed . thus , the manufacturing of the bga package is completed by forming the solder ball 36 of a predetermined shape onto the solder ball pads 35 having through holes therein . fig9 is a vertical sectional view showing still another embodiment of the semiconductor device according to the present invention , which illustrates one preferred embodiment of the soj package mounted with the bga package in a three - dimensional structure . however , this bga package has some disadvantages because of the different configuration of the land patterns between the upper and lower surfaces of the pcb . the terminals on both sides of the main substrate are thus connected via the through holes as shown in fig5 . in addition , by making the lower surface of the main substrate turn up after the molding , flux is coated over the land portion , and the solder balls are mounted on the land portion . then , reflow soldering is carried out to form bumps , and respective packages , cut as a unit product , are employed . in the semiconductor device illustrated in fig9 a semiconductor chip is adhesively mounted onto the central surface of a main substrate 61 including through holes , connection leads and land patterns and the semiconductor chip is wire - bonded to the connection leads , so that a main package body 60 molded with the emc is mounted in the opposite direction . after this , a first semiconductor chip is adhesively mounted onto the center of the lower surface of a first substrate 71 including first through holes , first electrode connection terminals and first land patterns over the land pattern , and is wire - bonded to the first connection leads , so that a first package body 70 molded with emc is mounted in the opposite direction , using first solder balls 76 as a connecting medium . then , a second semiconductor chip is adhesively mounted onto the center of the lower surface of a second substrate 81 including external leads 88 , second through holes , second electrode connection terminals and second land patterns over the first land patterns and is then wire - bonded to the second connection leads , so that a second package body 80 molded with the emc is mounted in the opposite direction , using second solder balls 86 as a connecting medium . a third semiconductor chip is adhesively mounted onto the center of the lower surface of a third substrate 91 including third through holes , third electrode connection terminals and third land patterns over the second land pattern and is wire - bonded to the third electrode connection terminals , so that a third package body 90 molded with the emc is mounted in the opposite direction , using third solder balls 96 as a connecting medium . a stacked semiconductor device having a three - dimensional structure is therefore completed . the semiconductor device having the three - dimensional structure constructed as above has external terminal leads 88 which are bent to be shaped as either &# 34 ; j - lead &# 34 ; or &# 34 ; gull - wing &# 34 ; for surface mounting onto a main substrate ( not shown ). the external shape of the high - density , three - dimensional mounting package of the soj package . internally , the bga packages are stacked to realize the interlayer connection . in other words , a substrate with leads and a substrate without leads are separately assembled to allow the upper surface having been molded to face upward , and the land portions that will be connected to solder bumps are coated with flux . the substrates are stacked , with the substrate with external leads generally in the center , and subjected to reflow soldering to achieve the interlayer connection . at this time , when applied to a memory device , the manufacturing process thereof is performed by designing signal lines in such a manner that common terminals are commonly connected and separately constructed terminals are connected by means of separate signal terminals . consequently , after reflow soldering , the memory device is molded with an encapsulation resin centering the substrate with external leads , hardened at a temperature around 175 ° c . for about 5 hours , and subjected to cutting and bending procedures to have a suitable lead shape required for the subsequent mounting thereof , thereby completing all processes . the semiconductor device and manufacturing method thereof according to the present invention as described above can be usefully applied to the soj package capable of attaining the three - dimensional surface mounting , out of the scope of the conventional two - dimensional flat mounting of the bga package . furthermore , the present invention is compatible with the currently - available mounting process on a main substrate and also improves reliability of the semiconductor device . in addition , since the three - dimensional mounting structure for performing the interlayer connection using the bga package , the mounting efficiency is improved to thus manufacture a semiconductor device that lowers manufacturing cost and enables mass production . as a result , since the semiconductor device and manufacturing method therefor is achieved by the three - dimensional mounting structure which utilizes the bga package capable of being stacked on the inside of soj package , it will be understood by those skilled in the art that various changes in form and details may be effected therein without departing from the spirit and scope of the invention as defined by the appended claims .	7
the charge capacity of a battery cell is a value , usually expressed in ampere hours ( ah ) or milliampere hours ( mah ), that indicates the maximum electrical charge that the battery cell is capable of holding . new battery cells are manufactured with certain nominal charge capacities , but as the battery cells age , their charge capacities generally decrease . when charging a battery cell , care must be taken so that its voltage does not exceed some maximum design voltage . when discharging a battery cell , care must be taken so that its voltage does not go below some minimum design voltage . for many battery cell electrochemical compositions , an over - voltage condition is a potential safety issue , and can cause fire or explosion . an under - voltage condition , while not a safety concern , can cause the battery cell to develop permanent degradation in charge capacity . battery packs are often made by connecting individual battery cells in series to obtain higher total voltage and higher total energy storage capacity . one consequence of individual battery cells connected in series is that all battery cells so connected will experience the same electrical current and the number of ampere - hours added or subtracted from each individual battery cell charge level will be the same . however , since the battery cells will have different individual charge capacities , one or more battery cells may limit the battery pack total energy capacity . a battery cell having lower charge capacity than others in the battery pack is more quickly charged to the maximum design voltage , and is more quickly discharged to the minimum design voltage . therefore , to maintain battery pack safety , not all battery cells will be fully charged when the battery cell having lowest charge capacity is fully charged , or not all battery cells will be fully discharged when the battery cell having lowest charge capacity is fully discharged . not all of the possible energy capacity of the battery pack will be realized unless all charge capacities are identical and the pack is perfectly balanced . at some point , a battery pack may be capable of higher total energy capacity if one or more of the battery cells having low charge capacity are removed from the pack so that they no longer limit the range of charge of the other battery cells . in some applications , these battery cells might be replaced with new battery cells . in other applications , that might not be practical , so the battery controller could then allow those battery cells to be abandoned . abandoning a battery cell means that that particular battery cell is ignored for the purposes of computing which battery cells to equalize , when determining maximum discharge power or energy , and when controlling the battery pack charging process ( except inasmuch as safety issues are necessary to consider ). that is , the lower voltage of these battery cells would no longer be restricted by the minimum design voltage during a discharge , and the battery cells &# 39 ; charge capacities would be allowed to collapse to zero ( a short - circuit condition ). this is a safe operating condition , and can result in higher overall battery pack energy capacity . therefore , in some applications it may be desirable to determine battery pack configurations that optimize the battery pack total energy capacity , possibly abandoning battery cells having low charge capacity . however , while abandoning a battery cell in this manner can result in higher overall battery pack energy capacity , it will also place greater stresses on the remaining battery cells in the battery pack , since they must provide greater power levels per battery cell than they did before . therefore , in other applications it may be desirable to optimize a different battery pack total energy metric that takes into account the battery pack total energy capacity and stress factors on remaining battery cells when some battery cells are abandoned . accordingly , there is a need for a method for efficiently determining a battery pack configuration based on present battery cell charge capacities that maximizes a battery pack total energy metric . in some applications , this battery pack total energy metric may be equal to battery pack total energy ; in other applications it may be equal to a modified function involving battery pack total energy . in every application , the goal is to maximize battery pack performance . to describe how the present embodiments determine which battery cells are limiting battery pack performance , the battery cell state - of - charge ( soc ) is first defined , which is a value between 0 % and 100 % that indicates the relative level of charge held by the battery cell . a state - of - charge of 100 % corresponds to a “ full ” battery cell , while a state - of - charge of 0 % corresponds to an “ empty ” battery cell . knowing this , the total energy capacity ( in watt hours ) of an individual battery cell can be computed as where v ( t ) is the battery cell voltage at time t , i ( t ) is battery cell current at time t , c is the charge capacity of the battery cell ( in ampere hours ), z 1 is the lower design limit soc value of the battery cell , z 2 is the upper design limit soc of the battery cell , and ocv ( ) is the open - circuit - voltage of the battery cell ( in volts ) as a function of soc . ( the second line of this equation relies on the relationship dz / dt = i ( t )/ c .) to compute battery cell energy , the battery cell charge capacity must be known , and the battery cell open - circuit - voltage function must be known . the battery cell open - circuit - voltage function is determined by the battery cell electrochemistry and may be measured using standard laboratory tests . additionally , it may be stored in a table in pre - integrated form in order to quickly look - up the desired values . battery pack energy capacity can be computed in a similar way . equation ( 2 ) recognizes that the charge capacities of each battery cell will be different , so denotes individual charge capacity values as c k where k is the index of the battery cell , from 1 to the number of battery cells in series . at any point in time , the voltages and states - of - charge of each battery cell will also differ , so are individually denoted as v k ( t ) and z k ( t ), respectively . the upper and lower limits on soc will also differ , so are denoted as z 2 , k and z 1 , k , respectively . battery pack total energy capacity will be maximized when all z 2 , k values are identical , since the open - circuit - voltage is an increasing function of soc . therefore , it is assumed that z 2 , k = z 2 for all k . ( this is not a requirement for the present invention , but makes the discussion simpler .) as the battery pack is discharged , the minimum z 1 , k may not go lower than z 1 . if all battery cells begin at soc level z 2 , the first battery cell to reach the soc level z 1 will be the battery cell with lowest charge capacity . without loss of generality , assume that battery cells are sorted by index in terms of increasing charge capacity . that is , c 1 ≦ c 2 ≦ c 3 . therefore , it is concluded that z 1 , 1 = z 1 . the lower soc limit for all other battery cells can be calculated by recognizing that the number of ampere - hours discharged from the battery cell with lowest charge capacity must be identical to the number of ampere - hours discharged from all other battery cells . therefore , there is now the capability of calculating the total energy capacity of a series - connected battery pack : 1 ) receive battery cell charge capacity estimates c k for all cells ; 2 ) determine the battery cell with lowest charge capacity , and label it as cell 1 ; 3 ) compute all z 1 , k values using equation ( 3 ); and knowing how to compute battery pack total energy allows for the embodiment using a method for maximizing a battery pack total energy metric . an exemplary embodiment receives battery cell charge capacity estimates c k for all cells , computes a battery pack total energy metric for hypothetical battery packs comprising subsets of the full set of battery cells , and selects the configuration having the largest battery pack total energy metric . in one exemplary embodiment , the battery pack total energy metric is selected to equal the battery pack total energy . the following steps are performed : 2 ) sort battery cell charge capacities in ascending order , indexed from 1 to n , where n is the number of battery cells . that is , c 1 ≦ c 2 ≦ l ≦ c n . 3 ) define battery pack configuration p k to comprise battery cells k through n . that is , p 1 comprises all battery cells , p 2 comprises all battery cells except the one with lowest charge capacity , and so forth . 4 ) compute the battery pack total energy e k using battery pack configuration p k . 5 ) select battery pack configuration with maximum value of e k . battery cells not included in this configuration are abandoned . fig4 shows results for this exemplary embodiment for a battery pack comprising 50 battery cells ( a lithium - ion battery chemistry is assumed for the ocv function , but the method works for any battery chemistry ). forty - eight of these cells have a capacity of 10 ampere hours , and two of the cells have a capacity of 9 . 5 ampere hours . in this example , the battery pack total energy is maximized if the two low - capacity battery cells are abandoned , and the pack is assumed to operate using only the remaining forty - eight battery cells . battery pack total energy might not be the only metric that is desired to be optimized . for example , by abandoning certain battery cells , greater stress is put on the remaining battery cells in the pack , potentially decreasing their lifetimes . an alternate embodiment optimizes a different battery pack total energy metric . the method receives battery cell charge capacity estimates c k for all battery cells , computes a different battery pack total energy metric me k for a hypothetical battery pack comprising subsets of the full set of battery cells , and selects the configuration having the largest modified battery pack total energy metric . 2 ) sort battery cell charge capacities in ascending order , indexed from 1 to n , where n is the number of battery cells . that is , c 1 ≦ c 2 ≦ l ≦ c n . 3 ) define battery pack configuration p k to comprise battery cells k through n . that is , p 1 comprises all battery cells , p 2 comprises all battery cells except the one with lowest charge capacity , and so forth . 4 ) compute the battery pack total energy metric me k using battery pack configuration p k . 5 ) select battery pack configuration with maximum value of me k . battery cells not included in this configuration are abandoned . fig5 shows results for this exemplary embodiment for a battery pack comprising 50 battery cells ( a lithium - ion battery chemistry is assumed for the ocv function , but the method works for any battery chemistry ). forty - eight of these battery cells have a capacity of 10 ampere hours , and two of the battery cells have a capacity of 9 . 5 ampere hours . the battery pack total energy metric in this exemplary embodiment is me k = 0 . 99 k e k . this performance metric penalizes removing cells , such that they will be abandoned only if it significantly increases the battery pack total energy . in the figure , the unmodified energy function e k is plotted as triangles , and the modified energy function me k is plotted as circles . in this example , the modified battery pack total energy is maximized by retaining all of the fifty battery cells and abandoning none of the battery cells . the system and method for maximizing a battery pack total energy metric provides a substantial advantage over other systems and methods . in particular , the system and method provide a technical effect of accurately determining an optimal battery pack configuration that maximizes a battery pack total energy metric that is computationally efficient to compute , and can take into account battery cell lifetime stresses while maximizing battery pack total energy . the above - described methods can be embodied in the form of computer program code containing instructions embodied in tangible media , such as floppy diskettes , cd roms , hard drives , or any other computer - readable storage medium , wherein , when the computer program code is loaded into and executed by a computer , the computer becomes an apparatus for practicing the invention . the above - described methods can also be embodied in the form of computer program code , for example , whether stored in a storage medium , loaded into and / or executed by a computer , or transmitted over some transmission medium , loaded into and / or executed by a computer , or transmitted over some transmission medium , such as over electrical wiring or cabling , through fiber optics , or via electromagnetic radiation , wherein , when the computer program code is loaded into an executed by a computer , the computer becomes an apparatus for practicing the methods . when implemented on a general - purpose microprocessor , the computer program code segments configure the microprocessor to create specific logic circuits . while the invention is described with reference to exemplary embodiments , it will be understood by those skilled in the art that various changes may be made and equivalent elements may be substituted for elements thereof without departing from the scope of the invention . in addition , many modifications may be made to the teachings of the invention to adapt to a particular situation without departing from the scope thereof . therefore , it is intended that the invention not be limited to the embodiments disclosed herein , but that the invention include all embodiments falling with the scope of the appended claims .	6
in order to explain the game , the playing grid , the pieces and the strategic elements of game play , it will be helpful to define the terminology that will be used herein . these terms will help one understand the features shown in the drawings . point : refers to the intersection of four or eight lines on the game board ; upon which a piece may rest . four - point : refers to the intersection of four diagonal lines on the game board . eight - point : refers to the intersection of eight lines ( four horizontal / vertical and four diagonal ) on the game board . base : one of five special points on the game board that is marked with any special symbol such as a darkened or bold plus (+) sign formed by the intersecting lines . territory : a defined region on the game board , denoted by darkened or bold lines , shading , coloration , or some other means . border - point : any point on the board that is part of a line marking the border between two territories . move : refers to one legal movement of a piece on the game board . turn : refers to one player &# 39 ; s total number of moves allowed before another player is allowed to move . a player may at times during the game have multiple moves per turn . movement number : refers to the maximum number of points that a given piece may move ( without capturing another piece ) during a player &# 39 ; s turn . attack number : refers to the maximum number of points away that a given piece may attack and capture another piece during a player &# 39 ; s turn . block / blocking direction : refers to any one of the faces on a given piece from which direction that piece cannot be captured by another piece . markings upon the piece to denote the blocking faces could be made with any convenient symbol such as stylized armor , a stylized brick shape , a solid color , or any other designation intended to aid the memory while playing . not block - able : a special property of a specific piece that allows that piece to capture other pieces regardless of their blocking directions . turning now to the drawings and referring initially to fig1 , fig1 is a diagrammatic illustration of an exemplary embodiment of a playing grid for a 2 player game of the present disclosure . depending on the specific embodiment of the game , grid 100 may be depicted on a wood or cardboard playing surface , for example , or on plastic or cloth surfaces , which are particularly advantageous for travel versions of the game . alternatively , grid 100 may be depicted on an electronic screen , including touch screens , for electronic embodiments . the standard two - player game board is a nine - by - nine grid of lines 100 , with each of the 64 resultant squares bisected by forty - five degree diagonal lines . the resulting network consists of 145 intersections — called points — upon which the game pieces may rest . preferred embodiments for both the 2 player and 4 - player grids provide alphanumeric coordinates along x - axis 102 and the y - axis 104 of the grid 100 layout . each territory contains one base . pieces may rest on any of the 145 board points , including the darkened edges of the board and the darkened border - points between territories . grid 100 is subdivided by straight lines that intersect at right angles and at 45 ° degree angles to make points . types of points include four - points 130 with 4 lines radiating from them , eight - points 140 with 8 lines radiating from them , border - points 150 , 152 , edge points 160 and bases . five specific points on the game board are called bases and marked in this case with a darkened (+). five regions called territories are denoted on the board by darkened lines . during game play , the player whose turn it is declares which territory the piece he or she intends to move is moving from . a piece on a border - point 150 may be declared to be in either territory of the border . a base is considered to be controlled or owned by a player when that player has a game piece of his or her color resting directly on the base point ( in this case marked with a darkened +). each player begins the game with the ownership of one base . a player must own at least one base to remain in the game . any player that at the start of his or her turn does not own at least one base is eliminated from the game . five bases 110 , 112 , 114 , 116 , 118 , are disposed around the grid . each base is in one territory and each territory 120 , 122 , 124 , 126 , 128 has one base . fig2 is a diagrammatic illustration of an exemplary embodiment of a playing grid for a 4 player game of the present disclosure . the four - player grid 200 is identical in layout to the two - player grid 100 , but is larger in proportion . instead of based on a nine - by - nine line grid , the four - player board is based on an eleven - by - eleven grid . the four - player board contains a total of 221 points but has the same five bases 210 , 212 , 214 , 216 , 218 and territories 220 , 222 , 224 , 226 , 228 . fig3 a is a side view schematic illustration of an exemplary embodiment of a scout piece of a game of the present disclosure . typical of a specific embodiment of a game piece , scout piece 300 has a footer 310 , upon which is mounted a figurine 320 . to more easily distinguish the types of game pieces , each figurine has a particular distinctive design . fig3 b is top view schematic illustration of the scout piece of fig3 a . features and attributes of a scout piece are displayed on the footer 310 . footer 310 , like the footers of the other pieces , has an octagonal perimeter shape with 8 sides or “ faces .” stylized arrowhead pointer 312 is a directional indicator which indicates the direction in which the piece is facing . the face of piece 300 to which the pointer 312 points is sometimes referred to as the “ front ” of the piece or “ front - facing .” as described herein , in specific embodiments , the attributes of the types of pieces are manifest on each piece , usually by printed or electronic display on the footer . alternative embodiments for experienced players , for example , dispense with the explicit manifestation of the piece attributes because the attributes are implicit in the shape of the figurine . stylized blocking brick 314 indicates the face at which an attack by an opposing player &# 39 ; s piece is blocked . piece identifier 315 indicates that the piece is a scout and therefore has the attributes of a scout . among the attributes of a scout piece is the movement number 318 , which is the number of points it is allowed to move and the attack number 316 , which is the number of points it may move to attack an opponent &# 39 ; s piece . in the case of a scout piece , a scout may move a maximum of 4 points and may attack an opponent &# 39 ; s piece that is 1 point away . fig4 a is a side view schematic illustration of an exemplary embodiment of a fighter piece of a game of the present disclosure . footer 410 of fighter 400 has affixed on top of it figurine 420 , which has a distinctive shape so that a fighter piece can be visually distinguished from the other types of pieces . fig4 b is top view schematic illustration of the fighter piece of fig4 a . directional indicator 412 , piece type indicator 415 , and attributes movement number 418 and attack number 416 are displayed on footer 410 . among the other attributes of a fighter 400 are blocking faces 414 a , 414 b , and 414 c , also displayed . fig5 a is a side view schematic illustration of an exemplary embodiment of a defender piece of a game of the present disclosure . footer 510 of defender 500 has affixed on top of it figurine 420 , which has a distinctive shape so that a defender piece can be visually distinguished from the other types of pieces . fig5 b is top view schematic illustration of the defender piece of fig5 a . directional indicator 512 , piece type indicator 515 , and attributes movement number 518 and attack number 516 are displayed on footer 510 . among the other attributes of a fighter 400 are blocking faces 514 a , 514 b , 514 c , 514 d , and 514 d , also displayed . fig6 a is a side view schematic illustration of an exemplary embodiment of a juggernaut piece of a game of the present disclosure . footer 610 of juggernaut 600 has affixed on top of it figurine 620 , which has a distinctive shape so that a juggernaut piece can be visually distinguished from the other types of pieces . fig6 b is top view schematic illustration of the juggernaut piece of fig6 a . directional indicator 612 , piece type indicator 515 , and attributes movement number and attack number 517 are displayed on footer 510 . the juggernaut piece has unlimited movement and unlimited attack numbers , indicated by the x - x designation . among the other attributes of a juggernaut 600 are blocking faces 614 a , and 614 b , also displayed . fig7 is a diagrammatic illustration of an exemplary embodiment of a game set up for a 2 person game of the present disclosure . game play involves a set of pieces , referred to herein as an army , of one player against an army of pieces of one or more opposing player attempting to eliminate all the bases of the opposing player ( s ). accordingly , preliminary to beginning game play , the pieces of each army are arranged on their assigned starting positions on the grid 100 . each army occupies one territory and owns one base . player 1 &# 39 ; s army 710 is arranged in territory 120 and controls base 110 . player 2 &# 39 ; s army 720 is arranged in territory 124 and controls base 114 . the pieces of each army are distinguished from the pieces of other armies by some convenient indicia such as color . fig8 is a diagrammatic annotated illustration of an exemplary embodiment of a game set up for a 4 person game of the present disclosure . the armies for player 1 and player 2 are set out as described for the two player game ( see fig7 ). player 3 &# 39 ; s army is arranged in territory 222 and controls base 212 . player 4 &# 39 ; s army is arranged in territory 226 and controls base 216 . in preferred embodiments , territory 228 is left vacant and base 218 in territory 228 is left unoccupied in both the 2 player and 4 player games . fig9 is a diagrammatic annotated illustration of game piece attributes of an exemplary embodiment of a game of the present disclosure . a portion of an exemplary embodiment of a game board of the present disclosure is depicted , with center base 118 of territory 228 in the upper left and base 114 of territory 224 in the lower right . border 910 / 912 is represented by bold lines . scout game pieces 310 a , 310 b and 310 c are deployed about points on the board . fighter piece 410 of an opposing player &# 39 ; s army is located on a point in territory 224 facing 412 scout 310 a . a fighter piece has the movement number attribute of 3 and the attack number attribute of 3 as well , therefore it can move 3 up to three points and capture a piece that is up to 3 points away ( counting the point the captured piece is resting on ). scout 310 a is safe from attack by fighter 410 because it is more than 3 points away . scout 310 b , however , can be captured and removed from the board by fighter 410 , so that fighter 410 occupies the point presently occupied by scout 310 b , because scout 310 b is within 3 points of fighter 410 . although scout 310 c is within 3 points of fighter 410 , scout 310 c is safe because its face 312 in line with fighter 410 is a blocking face 314 . it will be understood that the movement and attack attributes of the types of game pieces are displayed on the footer of each piece to assist those who are learning the game and to serve as a convenient reminder to players of the movement and attack numbers of each type of piece . however , as players become familiar with the attributes of each type of piece , the display will become less important . over time , alternative embodiments or versions of the game in which the pieces do not display the attributes will appear because , like chess pieces , players will be so familiar with the attributes that the attributes become second nature . specific alternative embodiments provide a printed legend of the attributes to which a player can refer in cases where the pieces themselves do not display the attributes . for example , versions of the game provide a printed legend on the game board and other versions provide a legend in a printed instruction booklet of the rules of the game . all pieces move in straight lines from one point to another point on the grid . the front facing direction of a piece has no relation to the allowed directions that piece may move — all pieces may move in any direction that is not directly blocked by another piece . all pieces may move up to the allowed maximum movement number for that piece type , unless directly blocked by another piece . the moving of pieces changes their facing on the game board . the facing of a piece is determined by the last direction that the piece moved . the arrow ( e . g ., reference number 312 of fig3 ) on the game piece ( which is to say the front - facing of the game piece ) always faces away from the last point on which the piece was resting . 1 . pieces may move any number of points up to the maximum for that piece type . 2 . pieces must move in a straight line , with no changing direction mid - move . 3 . pieces may not move through , over , or around other pieces that occupy points on the line they are traversing . 4 . a piece may move between two other pieces , so long as there is a visible line on the board between the starting point and the ending point . 5 . pieces may not change facing ( rotate in place ) without moving . 6 . except for attack ( capturing ), pieces may not move to a point on the board that is already occupied by another piece . attack is a special type of movement that allows one player to take another player &# 39 ; s piece off the board , by placing one of his or her own pieces on the point that the eliminated piece previously occupied . attack moves follow all the same rules as movement moves , with the exception that one piece may occupy the point upon which a different player &# 39 ; s piece currently rests . the attack number for the various piece types is different and usually smaller than the movement number . this means that a piece may move a certain number of points without capturing a piece , but may only capture a piece by moving within a different maximum number . in addition , one piece may only capture another piece if the line on which the first piece will move is not protected by one of the second piece &# 39 ; s blocking directions . 1 . pieces may capture other pieces any number of points away , up to the maximum attack number for that piece type . 2 . pieces must attack in a straight line , with no change of direction mid - move . 3 . pieces may not attack through , over , or around other pieces that occupy points on the line they are traversing . 4 . a piece may attack between two other pieces , so long as there is a visible line on the board between the starting point and the ending piece . 5 . pieces may not attack other pieces which have a blocking face in the direction of the attacking piece — except juggernaut pieces , which ignore all blocking faces when attacking . 1 ) player counts his or her bases to determine how many moves are allowed this turn . 3 ) player declares which territory the piece is moving from , so that all other players may hear . 5 ) the player repeats the declaration and movement , without moving one piece more than once , and without moving more than one piece per territory , and without violating any other rules of movement or attack , until all allowed moves have been finished . a player wins the game by being the last player in the game that owns one or more bases . a player loses the game if at the start of his or her turn , the player owns zero bases . if the player is unable to make a legal move for three consecutive turns , that player loses . if a player moves the same piece between the exact same two points for three consecutive turns ( while the other player ( s ) are able to make different moves ), that player loses . 2 ) all players in the game repeat the exact same move , with the exact same piece , between the exact same two points on the board , for three consecutive turns . 3 ) no player in the game is able to make a legal move . the following system of symbolic coordinate notation ( see fig1 ) may be used to record and replay games . the notation system could also be used to exchange moves in order to play games in real time with or without any game board or set — for example blindfolded games where moves are exchanged verbally , games by postal mail with moves exchanged in writing , games by email , or games played by any other means of relaying text verbally , electronically , or in writing . the following example outlines the general coordinate notation system , symbolic conventions , and examples of usage . the same system and conventions apply for both 2 - player and 4 - player games . sample game record demonstrating notation system the following game record shows 5 turns of an example game between two players . for four player games , an additional column is added for each additional player . the game is described herein without concern for the medium in which the components of the game are manifest . specific embodiments provide a physical playing grid with tangible playing pieces . alternative embodiments are adapted for play with an electronic device and provide a virtual playing environment wherein a virtual playing grid and virtual pieces are displayed electronically on a screen . a user interface may be provided for game play . examples of suitable user interfaces for electronic embodiments include but are not limited to interactive touch screens , keyboards , computer mice , virtual keyboards , voice recognition technologies and so forth . accordingly , for adaptation of the game to electronic embodiments , the present disclosure provides programs stored on machine readable media to operate computers and electronic devices according to the principles of the present disclosure to encode the rules of the game and to display the board and pieces . machine readable media include , but are not limited to , magnetic storage medium ( e . g ., hard disk drives , floppy disks , tape , etc . ), optical storage ( cd - roms , optical disks , etc . ), and volatile and non - volatile memory devices ( e . g ., eeproms , roms , proms , rams , drams , srams , firmware , programmable logic , thumb drives , downloadable files , etc .). furthermore , machine readable media include transmission media ( network transmission line , wireless transmission media , signals propagating through space , radio waves , infrared signals , etc .) and server memories . moreover , machine readable media includes many other types of memory too numerous for practical listing herein , existing and future types of media incorporating similar functionally as incorporate in the foregoing exemplary types of machine readable media , and any combinations thereof . the programs and applications stored on the machine readable media in turn include one or more machine executable instructions which are read by the various devices and executed . each of these instructions causes the executing device to perform the functions coded or otherwise documented in it . of course , the programs can take many different forms such as applications , for certain mobile devices applications that are known colloquially as “ apps ,” operating systems , perl scripts , java applets , c programs , compile - able ( or compiled ) programs , interpretable ( or interpreted ) programs , natural language programs , assembly language programs , higher order programs , embedded programs , and many other existing and future forms which provide similar functionality as the foregoing examples , and any combinations thereof . many modifications and other embodiments of the game , pieces , and playing apparatus described herein will come to mind to one skilled in the art to which this disclosure pertains having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is to be understood that the disclosure is not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation .	0
the present invention will preferably utilize microfabricated catheters for intravascular injection . the following description and fig1 - 8 provide three representative embodiments of catheters having microneedles suitable for the delivery of a neuromodulating agent into a perivascular space or adventitial tissue . a more complete description of the catheters and methods for their fabrication is provided in u . s . pat . nos . 7 , 141 , 041 ; 6 , 547 , 803 ; 7 , 547 , 294 ; 7 , 666 , 163 and 7 , 691 , 080 , the full disclosures of which have been incorporated herein by reference . the present invention describes methods and kits useful for the delivery of neuromodulating agents into the adventitia around renal arteries in order to reduce blood pressure in the treatment of hypertension . in each kit , a delivery catheter may be combined with instructions for use and a therapeutically effective amount of a neuromodulating agent as defined above . as shown in fig1 a - 2b , a microfabricated intraluminal catheter 10 includes an actuator 12 having an actuator body 12 a and central longitudinal axis 12 b . the actuator body more or less forms a u - shaped or c - shaped outline having an opening or slit 12 d extending substantially along its length . a microneedle 14 is located within the actuator body , as discussed in more detail below , when the actuator is in its unactuated condition ( furled state ) ( fig1 b ). the microneedle is moved outside the actuator body when the actuator is operated to be in its actuated condition ( unfurled state ) ( fig2 b ). the actuator may be capped at its proximal end 12 e and distal end 12 f by a lead end 16 and a tip end 18 , respectively , of a therapeutic catheter 20 . the catheter tip end serves as a means of locating the actuator inside a body lumen by use of a radio opaque coatings or markers . the catheter tip also forms a seal at the distal end 12 f of the actuator . the lead end of the catheter provides the necessary interconnects ( fluidic , mechanical , electrical or optical ) at the proximal end 12 e of the actuator . retaining rings 22 a and 22 b are located at the distal and proximal ends , respectively , of the actuator . the catheter tip is joined to the retaining ring 22 a , while the catheter lead is joined to retaining ring 22 b . the retaining rings are made of a thin , on the order of 10 to 100 microns ( μm ), substantially flexible but relatively non - distensible material , such as parylene ( types c , d or n ), or a metal , for example , aluminum , stainless steel , gold , titanium or tungsten . the retaining rings form a flexible but relatively non - distensible substantially “ u ”- shaped or “ c ”- shaped structure at each end of the actuator . the catheter may be joined to the retaining rings by , for example , a butt - weld , an ultra sonic weld , integral polymer encapsulation or an adhesive such as an epoxy or cyanoacrylate . the actuator body further comprises a central , expandable section 24 located between retaining rings 22 a and 22 b . the expandable section 24 includes an interior open area 26 for rapid expansion when an activating fluid is supplied to that area . the central section 24 is made of a thin , semi - flexible but relatively non - distensible or flexible but relatively non - distensible , expandable material , such as a polymer , for instance , parylene ( types c , d or n ), silicone , polyurethane or polyimide . the central section 24 , upon actuation , is expandable somewhat like a balloon - device . the central section is capable of withstanding pressures of up to about 200 psi upon application of the activating fluid to the open area 26 . the material from which the central section is made of is flexible but relatively non - distensible or semi - flexible but relatively non - distensible in that the central section returns substantially to its original configuration and orientation ( the unactuated condition ) when the activating fluid is removed from the open area 26 . thus , in this sense , the central section is very much unlike a balloon which has no inherently stable structure . the open area 26 of the actuator is connected to a delivery conduit , tube or fluid pathway 28 that extends from the catheter &# 39 ; s lead end to the actuator &# 39 ; s proximal end . the activating fluid is supplied to the open area via the delivery tube . the delivery tube may be constructed of teflon © or other inert plastics . the activating fluid may be a saline solution or a radio - opaque dye . the microneedle 14 may be located approximately in the middle of the central section 24 . however , as discussed below , this is not necessary , especially when multiple microneedles are used . the microneedle is affixed to an exterior surface 24 a of the central section . the microneedle is affixed to the surface 24 a by an adhesive , such as cyanoacrylate . alternatively , the microneedle maybe joined to the surface 24 a by a metallic or polymer mesh - like structure 30 ( see fig2 a ), which is itself affixed to the surface 24 a by an adhesive . the mesh - like structure may be - made of , for instance , steel or nylon . the microneedle includes a sharp tip 14 a and a shaft 14 b . the microneedle tip can provide an insertion edge or point . the shaft 14 b can be hollow and the tip can have an outlet port 14 c , permitting the injection of a neuromodulating or drug into a patient . the microneedle , however , does not need to be hollow , as it may be configured like a neural probe to accomplish other tasks . as shown , the microneedle extends approximately perpendicularly from surface 24 a . thus , as described , the microneedle will move substantially perpendicularly to an axis of a lumen into which has been inserted , to allow direct puncture or breach of body lumen walls . the microneedle further includes a neuromodulating or drug supply conduit , tube or fluid pathway 14 d which places the microneedle in fluid communication with the appropriate fluid interconnect at the catheter lead end . this supply tube may be formed integrally with the shaft 14 b , or it may be formed as a separate piece that is later joined to the shaft by , for example , an adhesive such as an epoxy . the microneedle 14 may be bonded to the supply tube with , for example , an adhesive such as cyanoacrylate . the needle 14 may be a 30 - gauge , or smaller , steel needle . alternatively , the microneedle may be microfabricated from polymers , other metals , metal alloys or semiconductor materials . the needle , for example , may be made of parylene , silicon or glass . microneedles and methods of fabrication are described in u . s . application ser . no . 09 / 877 , 653 , filed jun . 8 , 2001 , entitled “ microfabricated surgical device ”, the entire disclosure of which is incorporated herein by reference . the catheter 20 , in use , is inserted through an opening in the body ( e . g . for bronchial or sinus treatment ) or through a percutaneous puncture site ( e . g . for artery or venous treatment ) and moved within a patient &# 39 ; s body passageways 32 , until a specific , targeted region 34 is reached ( see fig3 ). the targeted region 34 may be the site of tissue damage or more usually will be adjacent the sites typically being within 100 mm or less to allow migration of the therapeutic or diagnostic agent . as is well known in catheter - based interventional procedures , the catheter 20 may follow a guide wire 36 that has previously been inserted into the patient . optionally , the catheter 20 may also follow the path of a previously - inserted guide catheter ( not shown ) that encompasses the guide wire . during maneuvering of the catheter 20 , well - known methods of x - ray fluoroscopy or magnetic resonance imaging ( mri ) can be used to image the catheter and assist in positioning the actuator 12 and the microneedle 14 at the target region . as the catheter is guided inside the patient &# 39 ; s body , the microneedle remains furled or held inside the actuator body so that no trauma is caused to the body lumen walls . after being positioned at the target region 34 , movement of the catheter is terminated and the activating fluid is supplied to the open area 26 of the actuator , causing the expandable section 24 to rapidly unfurl , moving the microneedle 14 in a substantially perpendicular direction , relative to the longitudinal central axis 12 b of the actuator body 12 a , to puncture a body lumen wall 32 a . it may take only between approximately 100 milliseconds and five seconds for the microneedle to move from its furled state to its unfurled state . the microneedle aperture , may be designed to enter body lumen tissue 32 b as well as the adventitia , media , or intima surrounding body lumens . additionally , since the actuator is “ parked ” or stopped prior to actuation , more precise placement and control over penetration of the body lumen wall are obtained . after actuation of the microneedle and delivery of the agents to the target region via the microneedle , the activating fluid is exhausted from the open area 26 of the actuator , causing the expandable section 24 to return to its original , furled state . this also causes the microneedle to be withdrawn from the body lumen wall . the microneedle , being withdrawn , is once again sheathed by the actuator . various microfabricated devices can be integrated into the needle , actuator and catheter for metering flows , capturing samples of biological tissue , and measuring ph . the device 10 , for instance , could include electrical sensors for measuring the flow through the microneedle as well as the ph of the neuromodulating being deployed . the device 10 could also include an intravascular ultrasonic sensor ( ivus ) for locating vessel walls , and fiber optics , as is well known in the art , for viewing the target region . for such complete systems , high integrity electrical , mechanical and fluid connections are provided to transfer power , energy , and neuromodulatings or biological agents with reliability . by way of example , the microneedle may have an overall length of between about 200 and 3 , 000 microns ( μm ). the interior cross - sectional dimension of the shaft 14 b and supply tube 14 d may be on the order of 20 to 250 um , while the tube &# 39 ; s and shaft &# 39 ; s exterior cross - sectional dimension may be between about 100 and 500 μm . the overall length of the actuator body may be between about 5 and 50 millimeters ( mm ), while the exterior and interior cross - sectional dimensions of the actuator body can be between about 0 . 4 and 4 mm , and 0 . 5 and 5 mm , respectively . the gap or slit through which the central section of the actuator unfurls may have a length of about 4 - 40 mm , and a cross - sectional dimension of about 50 μm to 4 mm . the diameter of the delivery tube for the activating fluid may be between 100 and 500 μm . the catheter size may be between 1 . 5 and 15 french ( fr ). referring to fig4 a - 4d , an elastomeric component is integrated into the wall of the intraluminal catheter of fig1 - 3 . in fig4 a - d , the progressive pressurization of such a structure is displayed in order of increasing pressure . in fig4 a , the balloon is placed within a body lumen l . the lumen wall w divides the lumen from periluminal tissue t , or adventitia a , depending on the anatomy of the particular lumen . the pressure is neutral , and the non - distensible structure forms a u - shaped involuted balloon 12 similar to that in fig1 in which a needle 14 is sheathed . while a needle is displayed in this diagram , other working elements including cutting blades , laser or fiber optic tips , radiofrequency transmitters , or other structures could be substituted for the needle . for all such structures , however , the elastomeric patch 400 will usually be disposed on the opposite side of the involuted balloon 12 from the needle 14 . actuation of the balloon 12 occurs with positive pressurization . in fig4 b , pressure (+ δp 1 ) is added , which begins to deform the flexible but relatively non - distensible structure , causing the balloon involution to begin its reversal toward the lower energy state of a round pressure vessel . at higher pressure + δp 2 in fig4 c , the flexible but relatively non - distensible balloon material has reached its rounded shape and the elastomeric patch has begun to stretch . finally , in fig4 d at still higher pressure + δp 3 , the elastomeric patch has stretched out to accommodate the full lumen diameter , providing an opposing force to the needle tip and sliding the needle through the lumen wall and into the adventitia a . typical dimensions for the body lumens contemplated in this figure are between 0 . 1 mm and 50 mm , more often between 0 . 5 mm and 20 mm , and most often between 1 mm and 10 mm . the thickness of the tissue between the lumen and adventitia is typically between 0 . 001 mm and 5 mm , more often between 0 . 01 mm and 2 mm and most often between 0 . 05 mm and 1 mm . the pressure + δp useful to cause actuation of the balloon is typically in the range from 0 . 1 atmospheres to 20 atmospheres , more typically in the range from 0 . 5 to 20 atmospheres , and often in the range from 1 to 10 atmospheres . as illustrated in fig5 a - 5c , the dual modulus structure shown in fig4 a - 4d provides for low - pressure ( i . e ., below pressures that may damage body tissues ) actuation of an intraluminal medical device to place working elements such as needles in contact with or through lumen walls . by inflation of a constant pressure , and the elastomeric material will conform to the lumen diameter to provide full apposition . dual modulus balloon 12 is inflated to a pressure + δp 3 in three different lumen diameters in fig5 a , 5 b , and 5 c for the progressively larger inflation of patch 400 provides optimal apposition of the needle through the vessel wall regardless of diameter . thus , a variable diameter system is created in which the same catheter may be employed in lumens throughout the body that are within a range of diameters . this is useful because most medical products are limited to very tight constraints ( typically within 0 . 5 mm ) in which lumens they may be used . a system as described in this invention may accommodate several millimeters of variability in the luminal diameters for which they are useful . the above catheter designs and variations thereon , are described in published u . s . pat . nos . 6 , 547 , 803 ; 6 , 860 , 867 ; 7 , 547 , 294 ; 7 , 666 , 163 and 7 , 691 , 080 , the full disclosures of which are incorporated herein by reference . co - pending application ser . no . 10 / 691 , 119 , assigned to the assignee of the present application , describes the ability of substances delivered by direct injection into the adventitial and pericardial tissues of the heart to rapidly and evenly distribute within the heart tissues , even to locations remote from the site of injection . the full disclosure of that co - pending application is also incorporated herein by reference . an alternative needle catheter design suitable for delivering the therapeutic or diagnostic agents of the present invention will be described below . that particular catheter design is described and claimed in u . s . pat . no . 7 , 141 , 041 , the full disclosure of which is incorporated herein by reference . referring now to fig6 , a needle injection catheter 310 constructed in accordance with the principles of the present invention comprises a catheter body 312 having a distal end 314 and a proximal 316 . usually , a guide wire lumen 313 will be provided in a distal nose 352 of the catheter , although over - the - wire and embodiments which do not require guide wire placement will also be within the scope of the present invention . a two - port hub 320 is attached to the proximal end 316 of the catheter body 312 and includes a first port 322 for delivery of a hydraulic fluid , e . g ., using a syringe 324 , and a second port 326 for delivering the neuromodulating agent , e . g ., using a syringe 328 . a reciprocatable , deflectable needle 330 is mounted near the distal end of the catheter body 312 and is shown in its laterally advanced configuration in fig6 . referring now to fig7 , the proximal end 314 of the catheter body 312 has a main lumen 336 which holds the needle 330 , a reciprocatable piston 338 , and a hydraulic fluid delivery tube 340 . the piston 338 is mounted to slide over a rail 342 and is fixedly attached to the needle 330 . thus , by delivering a pressurized hydraulic fluid through a lumen 341 tube 340 into a bellows structure 344 , the piston 338 may be advanced axially toward the distal tip in order to cause the needle to pass through a deflection path 350 formed in a catheter nose 352 . as can be seen in fig8 , the catheter 310 may be positioned in a blood vessel bv , over a guide wire gw in a conventional manner . distal advancement of the piston 338 causes the needle 330 to advance into tissue t surrounding the lumen adjacent to the catheter when it is present in the blood vessel . the therapeutic or diagnostic agents may then be introduced through the port 326 using syringe 328 in order to introduce a plume p of agent in the cardiac tissue , as illustrated in fig8 . the plume p will be within or adjacent to the region of tissue damage as described above . the needle 330 may extend the entire length of the catheter body 312 or , more usually , will extend only partially into the therapeutic or diagnostic agents delivery lumen 337 in the tube 340 . a proximal end of the needle can form a sliding seal with the lumen 337 to permit pressurized delivery of the agent through the needle . the needle 330 will be composed of an elastic material , typically an elastic or super elastic metal , typically being nitinol or other super elastic metal . alternatively , the needle 330 could be formed from a non - elastically deformable or malleable metal which is shaped as it passes through a deflection path . the use of non - elastically deformable metals , however , is less preferred since such metals will generally not retain their straightened configuration after they pass through the deflection path . the bellows structure 344 may be made by depositing by parylene or another conformal polymer layer onto a mandrel and then dissolving the mandrel from within the polymer shell structure . alternatively , the bellows 344 could be made from an elastomeric material to form a balloon structure . in a still further alternative , a spring structure can be utilized in , on , or over the bellows in order to drive the bellows to a closed position in the absence of pressurized hydraulic fluid therein . after the therapeutic material is delivered through the needle 330 , as shown in fig8 , the needle is retracted and the catheter either repositioned for further agent delivery or withdrawn . in some embodiments , the needle will be retracted simply by aspirating the hydraulic fluid from the bellows 344 . in other embodiments , needle retraction may be assisted by a return spring , e . g ., locked between a distal face of the piston 338 and a proximal wall of the distal tip 352 ( not shown ) and / or by a pull wire attached to the piston and running through lumen 341 . the perivascular space is the potential space over the outer surface of a “ vascular wall ” of either an artery or vein . referring to fig9 , a typical arterial wall is shown in cross - section where the endothelium e is the layer of the wall which is exposed to the blood vessel lumen l . underlying the endothelium is the basement membrane bm which in turn is surrounded by the intima i . the intima , in turn , is surrounded by the internal elastic lamina iel over which is located the media m . in turn , the media is covered by the external elastic lamina ( eel ) which acts as the outer barrier separating the arterial wall , shown collectively as w , from the adventitial layer a . usually , the perivascular space will be considered anything lying beyond the external elastic lamina eel , including regions within the adventitia and beyond . turning now to fig1 a - c , the renal arterial location and structure are shown . in fig1 a , the aorta ( ao ) is shown as the central artery of the body , with the right renal artery ( rra ) and left renal artery ( lra ) branching from the aorta to lead blood into the kidneys . for example , the right renal artery leads oxygenated blood into the right kidney ( rk ). in fig1 b , the nerves ( n ) that lead from the aorta to the kidney are displayed . the nerves are shown to surround the renal artery , running roughly parallel but along a somewhat tortuous and branching route from the aorta to the kidney . the cross - section along line 10 c - 10 c of fig1 b is then shown in fig1 c . as seen in this cross - sectional representation of a renal artery , the nerves ( n ) that lead from aorta to kidney run through the arterial adventitia ( a ) and in close proximity but outside the external elastic lamina ( eel ). the entire arterial cross section is shown in this fig1 c , with the lumen ( l ) surrounded by , from inside to outside , the endothelium ( e ), the intima ( i ), the internal elastic lamina ( iel ), the media ( m ), the external elastic lamina ( eel ), and finally the adventitia ( a ). as illustrated in fig1 a - f , the methods of the present invention may be used to place an injection or infusion catheter similar to those illustrated by fig1 - 5 into a vessel as illustrated in fig1 c and to inject a plume ( p ) of neuromodulating agent into the adventitia ( a ) such that the agent comes in contact with the nerves ( n ) that innervate the adventitia of the renal artery . as can be seen in fig1 a , a catheter in the same state as fig4 a , wherein an actuator is shielding a needle so that the actuator can be navigated through the vessels of the body without scraping the needle against the vessel walls and causing injury , is inserted into an artery that has a media ( m ), an adventitia ( a ), and nerves ( n ) within the adventitia and just outside the media . a cross - section along line 11 d - 11 d from fig1 a is shown in fig1 d . it can be seen from this cross section that a therapeutic instrument comprised similarly to those in fig1 - 3 , with an actuator ( 12 ) attached to a catheter ( 20 ) and a needle ( 14 ) disposed within the actuator . turning to fig1 b and 11e , we see the same system as that in fig1 a and 11d , again where fig1 e is a view of the cross - section along line 11 e - 11 e from fig1 b . in fig1 b and 11e , however , the actuator that has been filled with a fluid , causing the actuator to unfurl and expand , and the needle aperture to penetrate the media and into the adventitia where nerves are located . after the needle penetrates to the adventitia , a plume ( p ) that consists of either diagnositic agent such as radio - opaque contrast medium or neuromodulating agent such as guanethidine or a combination of the diagnostic and therapeutic agents is delivered beyond the eel and into the adventitia . the plume ( p ) begins to migrate circumferentially and longitudinally within the adventitia and begins to come into contact with the nerve fibers that run through the adventitia . at this point , the physician may begin to notice the therapeutic effects . usually , the plume p that is used to diagnose the presence of the injection and the location of the injection is in the range from 10 to 100 μl , more often around 50 μl . the plume will usually indicate one of four outcomes : ( 1 ) that the needle has penetrated into the adventitia and the plume begins to diffuse in a smooth pattern around and along the outside of the vessel , ( 2 ) that the plume follows the track of a sidebranch artery , in which case the needle aperture has been located into the sidebranch rather than in the adventitia , ( 3 ) that the plume follows the track of the artery in which the catheter is located , indicating that the needle has not penetrated the vessel wall and fluid is escaping back into the main vessel lumen , or ( 4 ) that a tightly constricted plume is forming and not diffusing longitudinally or cyndrically around the vessel , indicating that the needle aperture is located inward from the eel and inside the media or intima . the plume is therefore useful to the operating physician to determine the appropriateness of continued injection versus deflation and repositioning of the actuator at a new treatment site . in fig1 c and 11f , where fig1 f is a cross - sectional view across the line 11 f - 11 f from fig1 c , one can see that after the plume is used to diagnose the appropriate tissue location of injection , further injection can be performed to surround the vessel with the neuromodulating agent . the extent of the final plume p is usually fully circumferential around the artery and usually travels longitudinally by at least 1 cm when the injection volume is between 300 μl and 3 ml . in many cases , less than these volumes may be required in order to observe a therapeutic benefit to the patient &# 39 ; s hypertension . at this point , the neuromodulating agent has penetrated the nerves around the entire artery , blocking the transmission of nerve signals and thereby creating chemical , neuromodulating , or biological denervation . the following experiments are offered by way of illustration , not by way of limitation . studies were performed in a normal porcine model to determine if adventitial delivery of guanethidine could reduce kidney norepinephrine ( ne ), a marker for successful denervation . successful denervation is well known to reduce blood pressure in hypertensive patients . renal denervation evidenced by ne reduction : guanethidine monosulfate was diluted in 0 . 9 % nacl to a concentration of 12 . 5 mg / ml , then further diluted in iodinated contrast medium to a final concentration of 10 mg / ml . this solution was injected using a mercator medsystems bullfrog micro - infusion catheter ( further described in this application and detailed in fig1 a - f ) into the adventitia of both renal arteries , approximately halfway between the aorta and the hilum of the kidney . the injection was monitored with x - ray visualization of contrast medium to confirm adventitial distribution , which was confirmed to carry the injectate longitudinally and circumferentially around the artery , as well as transversely into the perivascular tissue . no injection was made into control animals , and historical controls from connors 2004 were used as comparators . twenty - eight days after injection , kidneys and renal arteries were harvested . kidney samples were taken using the method established by connors 2004 . briefly , cortex tissue samples from the poles of the kidneys were removed and sectioned into approximately 100 mg segments . from each kidney , samples from each pole were pooled for analysis . renal arteries were perfusion fixed in 10 % neutral buffered formalin an submitted for histopathology . histology : arteries appeared normal at 28 days , with no signs of vascular toxicity . perivascular indications of denervation were apparent from lymphocyte , macrophage and plasma cell infiltration into adventitial nerve bodies , with nerve degeneration characterized by hypervacuolization and eosinophilia . radio - immunoassay : ne levels in renal cortex tissue revealed average levels of 64 nanograms ( ng ) ne per gram ( g ) of renal cortex . when compared to normal controls of 450 ng / g , this represents a reduction in renal cortex ne of 86 %. these data are shown in fig1 . additional comparison can be made to the reduction in renal cortex ne from surgical denervation , which connors 2004 reported as 97 % and krum 2008 reported as 94 %. furthermore , the reduction in kidney ne reported with the use of radiofrequency catheter ablation of the renal nerves has been reported as 86 %. the radiofrequency method has since been used in clinical trials and evidence has been shown that the ablation of the nerves , resulting in reduced ne by 86 %, directly translates to reduced hypertension in patients , with reports of systolic pressure reduction of 27 mmhg and diastolic reduction of 17 mmhg , twelve months after treatment . while the above is a complete description of the preferred embodiments of the invention , various alternatives , modifications , and equivalents may be used . therefore , the above description should not be taken as limiting the scope of the invention which is defined by the appended claims .	0
the following representative descriptions of the present invention generally relate to exemplary embodiments and the inventors &# 39 ; conception of the best mode , and are not intended to limit the applicability or configuration of the invention in any way . rather , the following description is intended to provide convenient illustrations for implementing various embodiments of the invention . as will become apparent , changes may be made in the function and / or arrangement of any of the elements described in the disclosed exemplary embodiments without departing from the spirit and scope of the invention . a detailed description of an exemplary embodiment , namely an ejectable grid fin adapted for releasable engagement with a missile , is provided as a specific enabling disclosure that may be generalized to any application of the disclosed system , device and method for improving aerodynamic stability and / or control of an aeronautic vehicle in accordance with various other embodiments of the present invention . in accordance with a representative and exemplary embodiment , the present invention allows missiles to be safely launched and separated from an aircraft . thereafter , the disclosed stability augmentation device ( e . g ., grid fin ) may be jettisoned such that subsequent flight performance is not negatively affected . many aerodynamic structures ( conventional fins , ballutes , etc .) have been previously employed to improve the stability of a vehicle in a launched configuration ; however , conventional aerodynamic structures have not provided stability solutions that fit within specified geometric constraints . in an exemplary embodiment , the present invention provides a stability solution that meets the geometric constraints associated with the stowed disposition of missiles on the eject launcher of an aircraft where the stability solution is adapted for use during the launch phase and jettisoned subsequent to missile deployment . in a representative application , an ejectable aerodynamic stability augmentation device using grid fins , in accordance with an exemplary embodiment of the present invention as generally depicted for example in fig1 , provides a novel solution for passive static aerodynamic stability control for otherwise uncontrolled store separation . grid fin 100 comprises a plurality of grid array elements 130 , which generally provide turbulation surfaces configured to impart control forces on an attached aeronautic vehicle ( e . g ., a missile ). accordingly , grid fin 100 generally permits an attached missile to separate from its carrier vehicle in a more controlled fashion as compared with conventional separation techniques . in general , grid fin 100 may be suitably configured to impart aerodynamic stability and / or control forces which are capable of modifying the pitch , yaw and / or roll of the aeronautic vehicle attached thereto , as well as the lift or drag . conventional missile deployment systems have utilized autopilot systems to steer missiles away from their associated carrier vehicles ; however , launch separation safety issues related to missile stability immediately incident upon separation have generally remained unaddressed . specifically , the center of gravity of the missile must generally be concurrently disposed substantially in front of the center of pressure in order to accomplish a clean separation from the carrier vehicle . in accordance with a representative embodiment of the present invention , grid fin 100 may be configured to dispose the center of gravity of a missile substantially in front of the center of pressure in order to produce adequate lift concurrent with separation so as to maintain the pitch orientation of the missile during the separation sequence . when the separation sequence is substantially complete , grid fin 100 may be ejected to permit the air - vehicle to proceed with its mission . grid fin 100 may be configured with engagement / dis - engagement mechanisms for releasable attachment to a missile or other aeronautic vehicle . in general , this may be accomplished with a ball - lock , exploding bolt or other release mechanism , whether now known or otherwise hereafter described in the art . ejectable release of grid fin 100 from the missile may be actuated by a sensor or other device responsive to , for example : baric pressure ; relative orientation of the missile ( or other aeronautic vehicle ); relative orientation of grid fin 100 ; a timing sequence ; gps data ; and / or remote controlled deployment . it will be appreciated , however , that a variety of other release actuation mechanisms may be alternatively , conjunctively or sequentially employed to produce a substantially similar result in accordance with various other embodiments of the present invention . a variety of grid fin geometries may be employed . for example , grid fin 100 may comprise planar shape or a planar shape . for example , grid fin 100 may comprise a regular solid , an irregular solid , a regular polygon , an irregular polygon or a circular shape . additionally , the grid fin geometry may have a point , line and / or plane of symmetry . in the case of the grid fin 100 generally depicted in the figures , the geometry may conform , for example , to the c 2v point group . furthermore , the geometry of grid fin 100 may comprise occlusion areas 110 , 120 to accommodate packing of a plurality of missiles or other attached stores . in the case of a plurality of missiles , occlusion areas 110 , 120 may be configured to permit stored disposition of the missiles , for example , on an eject rail of an aircraft without the missile body fins contacting or otherwise substantially impeding the deployment of grid fins 100 corresponding to proximately disposed missiles . for example , the ‘ snow angel ’ shape representatively depicted in the figures , generally provides a grid fin geometry suitably adapted for mounting a trio of missiles on the triple eject rail of a fighter / bomber aircraft . it will be appreciated that various embodiments of the present invention may find useful application with a variety of aeronautic vehicles including , for example : missiles ; bombs ; munitions ; sub - munitions ; rockets ; pods ; sub - vehicles and / or the like . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments ; however , it will be appreciated that various modifications and changes may be made without departing from the scope of the present invention as set forth in the claims below . the specification and figures are to be regarded in an illustrative manner , rather than a restrictive one and all such modifications are intended to be included within the scope of the present invention . accordingly , the scope of the invention should be determined by the claims appended hereto and their legal equivalents rather than by merely the examples described above . for example , the steps recited in any method or process claims may be executed in any order and are not limited to the specific order presented in the claims . additionally , the components and / or elements recited in any device claims may be assembled or otherwise operationally configured in a variety of permutations to produce substantially the same result as the present invention and are accordingly not limited to the specific configuration recited in the claims . benefits , other advantages and solutions to problems have been described above with regard to particular embodiments ; however , any benefit , advantage , solution to problem or any element that may cause any particular benefit , advantage or solution to occur or to become more pronounced are not to be construed as critical , required or essential features or components of any or all the claims . as used herein , the terms “ comprise ”, “ comprises ”, “ comprising ”, “ having ”, “ including ”, “ includes ” or any variation thereof , are intended to reference a non - exclusive inclusion , such that a process , method , article , composition or apparatus that comprises a list of elements does not include only those elements recited , but may also include other elements not expressly listed or inherent to such process , method , article , composition or apparatus . other combinations and / or modifications of the above - described structures , arrangements , applications , proportions , elements , materials or components used in the practice of the present invention , in addition to those not specifically recited , may be varied or otherwise particularly adapted to specific environments , manufacturing specifications , design parameters or other operating requirements without departing from the general principles of the same .	5
turning to fig1 there is shown a block diagram of a system within which the method of the present invention could reside and be utilized . system 10 comprises a microprocessor 12 interoperatively connected to monitor 14 for viewing the representation of the medium ( such as an envelope or label ) to be acted upon by the design application 22 . the viewing of the media representation on monitor 14 promotes ease of use in selecting the various options available to the system user while formatting the medium , and provides an example of the human interface that can be brought to system 10 . the monitor 14 , under control of the design application 22 , is able to show the system user : the medium representation ; available menus from which option selections may be made ; the medium &# 39 ; s indicia ; the amount of postage that will be incorporated into the indicia ; and varied print fields available for printing to the selected medium . microprocessor 12 is interoperatively connected to scanner 16 . scanner 16 provides system 10 with the ability to scan address field data , barcodes , or other scannable data sources as an input to design application 22 . printer 26 is also interoperatively connected to microprocessor 12 and serves as the output device by which the print fields are printed to the selected medium . additionally , keyboard 20 is interoperatively connected to microprocessor 12 and serves as an input device for the input of data . modem 18 gives system 10 the ability to communicate with other systems via communications means of varied types or to download print fields for remote storage ; and , memory 24 allows the system to retain data for use in maintaining records or for storing data for future use . turning to fig2 there is shown a drawing of the face of an envelope 30 , and its component parts , which is representative of the medium that the subject invention is directed toward preparing . envelope 30 is shown comprising address block 32 which can be input by direct entry from the keyboard 20 or can be derived from access to a database introduced to the design application through the microprocessor 12 in connection with modem 18 , or by accessing memory 24 . the address indicated by the address block 32 can be subject to address hygiene routines prior to being saved within the print field represented by the face of envelope 30 . envelope 30 further comprises : return address block 34 ; postnet barcode 36 ; single - line message 38 ; graphic image 40 ; and , indicia 42 . bearing in mind the environment suggested by fig1 and 2 , we now turn to fig3 where there is shown an upper level flowchart of the method of the present invention . [ 0038 ] fig3 begins with the initialization of the design application at step 100 . from step 100 , the method advances to step 102 where the first of the application &# 39 ; s user screens is displayed to the system user on a monitor . the user screens will present menus , lists , and queries to the system user as the application routines are utilized ; this will provide the step - by - step building of the medium print field for printing . the system and method will guide the system user in the selection of a medium format beginning with the query at step 104 . at step 104 , the method queries as to whether or not an envelope design routine is required . if the response to the query is “” no ,” then the method displays a label routine for the system operator at step 106 . step 106 advances to step 110 where the characteristics of the selected medium are defined . if the response to the query at step 104 is “ yes ,” however , then the method displays an envelope routine for the system operator at step 108 . step 108 advances to step 110 where the characteristics of the selected medium are defined . the method advances from step 110 to step 112 where the selection of a printer type is made . printer characteristics may limit the characteristics available for designing the envelope or label media . the face of the envelope or label to be designed through the application is the print field for that medium . the print field is in turn comprised of component print field that , taken together , form the print field . from step 112 , the method advances to step 114 where the component print fields can be modified . after modification , the method queries , at step 116 , as to whether or not a component such as graphics , postnet barcodes , postal indicia , or single - line messages are to be attached at the request of the system operator . if the response to the query is “ yes ,” then the method advances to step 118 where the appropriate component is attached to the print field . from step 118 , the method advances to step 120 where confirmation of the modification and attachment , if any , is made . if , however , the response to the query , at step 116 , is “ no ,” then the method advances directly to step 120 . the modification , together with any attachments , define the design field to be printed to the medium . from step 120 , the method advances to step 122 where the design field is printed to the medium . the method then queries , at step 124 , as to whether or not another envelope or label is to be prepared . if the response to the query is “ yes ,” then the method returns to enter the method flow at step 104 . if the response to the query is “ no ,” however , then the method concludes its flow and the application is exited at step 126 . turning to fig4 there is shown a flowchart of the method utilized to create the address object 300 which is further described with reference to fig5 b . a detailed discussion of object oriented programming is not required for a full understanding of the method described hereunder . the creation of the address object 300 begins at step 150 when a system user initializes a data processing system which has an object creation functionality resident therein . from step 150 , the method advances to step 152 where the method instantiates an indicia control object by registering an object class with the object creation functionality . registration of the class establishes , at step 154 , a programming interface that will be used as a port of entry into the object . the port of entry will allow the system to place class properties within the object . the system user will determine the properties of the class at step 156 . the specific properties of the indicia control object are discussed in the description of fig5 a . from step 156 , the method advances to step 158 where object methods are placed within the indicia control object by entering them through the programming interface . the method then advances to step 160 where mailpiece ( envelope ) production functionality is placed within the indicia control object 300 by entering it through the programming interface . in succession , indicia production data tables , and a human interface are placed within the indicia control object by entering them through the programming interface in steps 162 and 164 respectively . it should be noted that steps 160 through 164 can be performed in any order so long as each of the step actions are performed prior to utilization of the object . when the properties of the indicia control object 300 have been placed into the object , the method advances to step 166 where the indicia control object is embedded or linked ( ole ) where the indicia control object can be used for its intended purpose when invoked at step 168 . the use of the indicia control object 300 reduces the steps necessary to apply mailpiece production functionality and is thus a significant improvement over the prior art . the properties of the indicia control object will now be discussed in detail with reference to fig5 a and 5b . turning to fig5 a , there is shown a block diagram of the indicia control object properties 200 that are input to the object through a programming interface 302 . the indicia control object properties 200 are divided into functional groupings 210 , 230 , and 240 . functional grouping 210 comprises table data ( hereinafter 210 ) that can be utilized by the object methods 230 or production functionality tools 240 within the indicia control object 300 or in its general environment . the data tables 210 further include : rules 211 for linking the indicia control object with postal rating engines of the type used to determine postage values so that a postal indicia can be printed ; print field data 212 ; rules 214 for determining sub - fields ; rules 216 for use of print field data ; rules 218 for calculating a postnet barcode ; and , rules 220 for linking the indicia control object 300 with a postal indicia printer . functional grouping 230 comprises object methods ( hereinafter 230 ) which include : display methods 306 for displaying the indicia characteristics to the system user ; storage methods 308 for storing document layouts within an associated memory of system 10 ; and , printing methods 310 which cause human interface 314 to direct a printer , such as printer 26 , to print data under the direction of the object . additional functionality for address object 300 is provided by functional group 240 . this functionality performs a unique role and includes : an envelope design functionality 242 which comprises a set of rules for indicia requirements with respect to placement of data on the face of the mailpiece ; mailpiece display functionality 244 which displays the face of the mailpiece or envelope on a monitor 14 for ease of use and manipulation by a system user ; and , mailpiece printing functionality 246 which includes those controls and interfaces for causing a printer 26 to produce a printed envelope . each of the functionalities works together so that the printed envelope effectively embodies the mailpiece that was intended by the system user . turning to fig5 b , there is shown a block diagram of the indicia control object 300 and its constituent sub - elements . the mailpiece object 300 contains a programming interface 302 which serves as the portal by which properties of the indicia control object 300 can be entered into it . the programming interface 302 is returned by the data processing system when the indicia control object 300 is instantiated , thus allowing the indicia control object 300 to be invoked as needed . in applications such as visual basic , an object oriented designer would use a command such as “ createobject ” to instantiate the object . the “ createobject ” command returns a programming interface such as “ interface . ______ ” which will allow the designer to place the necessary properties into the object by entering their file name after the interface command . the mailpiece object 300 has specific requirements ; therefore , through the programming interface 302 will come : a human interface 314 ; indicia production data tables 304 - 304 n ; indicia production functionality 312 ; and , a set of methods comprising display method 306 , storage method 308 , and printing method 310 . each of these elements is described in more detail hereinbelow . human interface 314 allows indicia control object 300 to provide a visual interface to the system user ; additionally , printing methods 310 as contained in indicia control object 300 cause human interface 314 to direct a printer , such as printer 26 , to print data under the direction of the object . thus , the purpose of human interface 314 is to provide the path for user interface functionality . additional functionality for indicia control object 300 is provided by indicia production functionality 312 . this functionality performs a unique role . indicia production functionality 312 includes : a indicia design functionality 242 which comprises a set of rules for applying postal coding requirements with respect to placement of data on the face of the envelope ; envelope display functionality which displays the face of the envelope , together with the indicia , on a monitor 14 for ease of use and manipulation by a system user ; and , indicia printing functionality which includes those controls and interfaces for causing a printer 16 to produce a printed envelope with its associated indicia . each of the functionalities works together so that the printed envelope effectively embodies the mailpiece that was intended by the system user . indicia production data tables 304 - 304 n provide much of the production capability data utilized by the indicia control object 300 . indicia production data tables 204 - 204 n include a number of fields from which an optimal data field will be constructed by indicia control object 300 ; these further include : print field data 212 ; rules 214 for determining indicia print field sub - fields ; rules 216 for use of print field data ; rules 218 for calculating a postnet barcode ; and , rules 222 for linking the mailpiece object 300 with a postal indicia printer . paths of movement are further dictated by indicia control object 300 through the use of its distinct method elements . display method 306 is used for instructing the data processing system 10 to display data on monitor 14 . storage method 308 is used for maintaining instructions for the data processing system 10 to store data in its associated memory or within a peripheral device . printing method 310 is used for instructing the data processing system 10 to print data on output means such as printer 26 . turning to fig6 there is shown a flowchart of the use of the indicia control object within a particular application . a preferred embodiment of the method flow begins at step 400 where the ocx control for the postal indicia is instantiated within an envelope design application . from step 400 , the method advances to step 402 where the design application attaches control to a windows routine within the application . the indicia control utilizes its programming interface to link with data being generated by a postage meter and the data is passed to the indicia control object at step 404 . the method advances from step 404 to step 406 where the method queries as to whether or not a postage value is to be entered into the indicia print field . if the response to the query is “ yes ,” then the method enters the postage value at step 410 before inquiring at step 412 as to whether or not postage meter data is to be entered into the indicia field as well . postage meter data includes an identification number , a zip code , and postage value determining data . if the response to the query at step 412 is “ no ,” then the method advances to step 414 . if , however , the response to the query at step 412 is “ yes ,” then the data is entered into the indicia fields at step 416 and the method then advances to step 418 . returning to step 406 , if the response to the query is “ no ,” then the default postage is set and placed into the indicia field at step 408 . step 408 then advances to step 412 where the method queries as to whether or not postage meter data is to be entered into the indicia field as well . if the response to the query at step 412 is “ no ,” then the method advances to step 414 . if , however , the response to the query at step 412 is “ yes ,” then the data is entered into the indicia fields at step 416 and the method then advances to step 418 . at step 418 , a representation of the envelope with its associated print fields is displayed to the system operator . the representation will show the indicia located in the upper right hand of the envelope field . the method advances from step 418 to a query at step 420 . step 420 queries as to whether or not the system operator would like to re - size the envelope within the design application framework . if the response to the query is “ yes ,” then the method repositions the indicia in accordance with the re - sized envelope field before advancing to a query at step 424 . if the response to the query at step 420 is “ no ,” however , then the method advances directly to the query at step 424 . at step 424 , the method queries as to whether or not sufficient postage value is available to the data processing system for this print transaction . if the response to the query is “ no ,” then the method advances to step 432 where the method queries as to whether the envelope should be printed anyway . if the response to the query is “ yes ,” the envelope fields , less the indicia which has exercised its control function because of the insufficient postage , will be printed at step 434 . from step 434 , the method exits , at step 436 , the application for this particular print transaction . if the response to the query at step 432 is “ no ,” then the method advances directly to the exit at step 436 . returning to step 424 , if the response to the query is “ yes ,” then the method causes the indicia to print , at step 426 , the indicia to the application print field which in turn causes the system to decrement the postage value of the transaction from available funds at step 428 . the method advances from step 428 to a query at step 430 . the query at step 430 questions as to whether or not another envelope is to generated . if the response to the query is “ yes , then the method advances along path a to re - enter the method flow at step 404 . if the response to the query at step 430 is “ no ,” then the method advances directly to the exit at step 436 . turning to fig7 there is shown a flowchart of the print function utilization of the present indicia printing application . the method begins at step 500 where the printer setup function is initiated . the method advances from step 500 to a query at step 502 which inquires as to whether the indicia is displayed to the system user on the system monitor . if the response to the query at step 502 is “ no ,” then the method advances to the query at step 504 where the system is prompted as to whether printing of the envelope print fields is required exclusive of the indicia . if the response to the query at step 504 is “ no ,” then the method advances to step 506 where the printer is re - initiated before the method returns to step 500 . if continuous re - initiation of the printer is not desired , then the system user can terminate the flow by exiting at any time . if the response to the query at step 504 is “ yes ,” however , then the method advances to step 516 where the envelope print fields are printed to the envelope without the associated indicia . the method advances from step 516 to step 520 . returning to step 502 , if the response to the query is “ yes ,” then the method advances to step 508 where the delivery point zip code is entered into the indicia print field . the method then advances from step 508 to the query at step 510 . at step 510 , the method queries as to whether or not the delivery point address has been cleansed . address correction and cleansing ensures more accurate delivery and may qualify the postage for automation discounts offered by the postal service and available to the indicia &# 39 ; s linking control methods . if the response to the query is “ no ,” then the method advances to step 512 where address cleansing is performed before advancing to step 514 . if the response to the query at step 510 is “ yes ,” then the method advances directly to step 514 . step 514 queries as to whether or not postage is to be dispensed for this transaction . if the response is to the query is “ no ,” then the method advances to step 516 where the envelope print fields are printed to the envelope without the associated indicia before advancing to step 520 . however , if the response to the query is “ yes ,” then the method advances to step 518 where the envelope print field , together with the indicia , is printed to the envelope . from step 518 , the method advances to step 520 which inquires as to whether or not another envelope is to be printed . if the response to the query is “ yes ,” then the method returns along path a to re - enter the method at step 502 ; otherwise , if the response is “ no ,” then the method advances to step 522 and exits the application . while certain embodiments have been described above in terms of the system within which the address object methods may reside , the invention is not limited to such a context . the system shown in fig1 is an example of a host system for the invention , and the system elements are intended merely to exemplify the type of peripherals and software components that can be used with the invention . in the foregoing specification , the invention has been described with reference to specific embodiments thereof . it will , however , be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense .	6

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.