text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
referring to the drawings by numerals of reference , there is shown in fig1 , 3 and 4 , a preferred portable autoclavable x - ray cassette holder 10 having a main body 11 and an end cap 20 . the main body 11 and end cap 25 are molded of a lightweight thin - walled radiolucent plastic material which is capable of being sterilized by autoclaving ( steam under pressure ). the main body 11 and end cap 25 may be formed by injection molding , vacuum forming , or blow - molding upper and lower shells and bonding the two shells together along their sides by means conventional in the art . the main body 11 is a hollow generally rectangular box - like member having opposed top and bottom walls 12 and 13 , opposed side walls 14 and 15 , an end wall 16 , and an open end 17 defining a central compartment or cavity 18 . as best seen in fig2 and 3 , the open end 17 of the main body 11 has reduced rectangular neck portion 19 which is smaller in peripheral dimension than the main body portion . the opposed side walls 13 and 14 and end wall 15 of the main body 11 have a plurality of longitudinally spaced laterally inward extending slot - like depressions 20 formed therein . short recessed grooves 21 formed in the top and bottom walls 12 and 13 extend laterally outward from opposed sides of each slot - like depression 20 . a series of inwardly extending longitudinal and transverse grooves 22 are formed in the top and bottom walls of the 12 and 13 of the main body 11 . the grooves 22 form short inwardly projecting longitudinal and transverse rails 22a in the interior of the main body for supporting an x - ray cassette c ( fig3 ), and also serve as structural stiffeners to strengthen the thin walled top and bottom surfaces and prevent deformation . as shown in fig6 longitudinal side rails 23 formed on the interior of the main body 11 extend along the opposed sides 14 and 15 between the inwardly extending slot - like depressions 20 and are flush with the inner surfaces thereof to facilitate sliding the x - ray cassette c into the central cavity 18 and prevent its corners from abutting the depressions . as best seen in fig2 and 3 , a plurality of adjacent spaced rounded depressions or dimples 24 are formed in the exterior top and bottom surfaces of the rectangular neck portion 19 of the main body 11 . the end cap 25 is a hollow generally rectangular member having opposed top and bottom walls 26 and 27 , opposed side walls 28 and 29 , an open end 30 , and an end wall 31 . the end wall 31 has a central outwardly extending portion 31a which has a rectangular depression 32 formed in its top and bottom surfaces that define a hand grip 33 on the end cap 25 . the end wall 31 of the end cap 25 has a plurality of longitudinally spaced laterally inward extending slot - like depressions 20 and laterally extending short grooves 21 in the top and bottom walls 26 and 27 , as previously described , formed therein . as shown in fig3 and 4 , a plurality of adjacent spaced inwardly facing rounded protuberences 34 are formed on the interior top and bottom surfaces of the end cap 25 in alignment with the dimples 24 in the neck portion 19 of the main body 11 . the interior of the end cap 25 is sized to be slidably received on the rectangular neck portion 19 of the main body 11 and its protuberences 34 are sized to snap fit into the dimples 24 on the neck portion 19 to firmly retain the end cap on the neck portion to prevent accidental removal , but to allow the end cap to be manually pulled off of the neck portion upon application of sufficient pulling force . the exterior surface of the main body 11 and end cap 25 may be smooth or may be provided with a rough surface texture to facilitate manual gripping and manipulation and to reduce the likelihood of accidental slippage of a limb or extremities placed on its top wall 12 . the top wall 12 may also be provided with various markings , guide lines , or indicia to facilitate proper positioning of the limb or extremities . fig2 and 5 show a corner of the cassette holder 10 having a sliding tab left / right film identifier 40 . the top wall 12 is provided with a flat rectangular depression 41 with a web 42 formed of non - radiolucent material extending thereabove to define left and right sides . as seen in fig5 a flat rectangular tab 43 with upwardly extending ends 44 formed of non - radiolucent material is slidably received beneath the web 42 in the depression 41 and has the letters &# 34 ; l &# 34 ; and &# 34 ; r &# 34 ; punched out of its flat portion in laterally spaced relation . the tab 43 is sized such that only one letter is covered by the web 42 leaving the other letter exposed . the user can place a finger on one of the upstanding ends 44 of the tab 43 and manually slide the tab to the left or right to expose the appropriate one of the letters . when the radiograph is taken , the letter which is uncovered will show as a white letter on the film . referring again to fig1 a plurality of clips 50 and elastic hold - down bands 60 are provided with the x - ray cassette holder 10 . the clips 50 can be removably secured in the slot - like depressions 20 along the opposed side walls 14 and 15 and the end wall 16 of the main body 11 or the end cap 25 . the clips 50 are preferably formed of a semi - rigid plastic material and have a generally rectangular upper portion 51 and an inverted t - shaped lower portion defined by a thin narrow shank portion 52 extending downwardly from the upper portion and terminating in a horizontal rod - like bar 53 at the bottom end . the length of the shank portion 52 is slightly greater than the height of the slot - like depressions 20 and the rod - like bar 53 is sized to be received in selected ones of the short grooves 21 on the underside of the main body 11 or end cap 25 . the generally rectangular upper portion 51 of each clip 50 has a central inverted generally keyhole - shaped aperture defined by a circular bottom portion 54 and a narrow inverted v - shaped vertical slot 55 extending upwardly therefrom with upwardly and inwardly converging sides . the hold - down bands 60 are elongate resilient members , such as a length of surgical tubing which is larger in cross section than width of the inverted v - shaped slot 55 of the keyhole shaped aperture . the hold - down bands 60 may be disposable . the free end of an elastic band 60 is inserted through the circular bottom portion 55 of the aperture 54 in a respective clip 50 and then pulled upwardly into the narrow inverted v - shaped slot 55 to become wedged therein . the length , and thus the tension or tightness , of the band 60 can be adjusted to the particular hold - down requirements by pulling one end of the band down into the circular portion 54 and stretching or loosening the band and then pulling it up to wedge it back into the v - shaped slot 55 . as explained hereinafter , the hold - down bands 60 are stretched across a patients limb or extremities to resiliently bias the limb or extremities against the top wall 12 of the cassette holder . the clips 50 are removably installed on the main body 11 by securing a clip at one or both ends of a hold - down band 60 , as described above , and then placing the shank portion 52 of the clip into slot - like depression 20 with its horizontal bar 53 received on the underside of the main body 11 in the short grooves 21 extending laterally outward from the slot - like depression 20 and its rectangular upper portion 51 extending above and transverse to the slot - like depression . when tension is applied to the hold down - band 60 the horizontal bar 53 at the bottom of the clip 50 is resiliently pulled into engagement with the short grooves 21 . pairs of the clips 50 may be installed in selected pairs of the slot - like depressions 20 on opposed side walls 14 and 15 or a side wall and the end wall 16 of the main body 11 or end cap 25 . fig7 shows a stand 70 for supporting the portable autoclavable x - ray cassette holder 10 in a vertical position . the stand 70 has a flat rectangular top wall 71 which curves downwardly at two opposed ends to form legs 72 to support the top wall a distance above a supporting surface . the top wall 71 has a rectangular opening 73 near one side edge surrounded by a rectangular wall 74 extending downwardly from the top wall . the opening 73 is slightly wider and longer than the main body 11 of the cassette holder 10 with the end cap 25 installed thereon to allow the cassette holder to be slidably installed in the opening and supported by the stand in a vertical position with the end cap facing upward or to one side , as shown in fig8 and 9 . the top wall 71 of the stand 70 has a plurality of adjacent longitudinally spaced short slots 75 extending inwardly a distance along the side edge closest to the rectangular opening 73 and a plurality of parallel spaced elongate slots 76 disposed a distance outwardly from the rectangular opening 73 . the elongate slots 76 are surrounded by a depending lip having a series of parallel spaced concave notches 77 formed in its bottom surface in laterally spaced relation . the clips 50 can be removably installed on the stand 70 by securing a clip at one or both ends of a hold - down band 60 , as described above , and then placing the shank portion 52 of the clip in a short slot 75 with its horizontal bar 53 received beneath the slot and its rectangular upper portion 51 extending above and transverse to the slot . the clips 50 can be removably installed in the elongate slots 76 in the stand 70 by securing a clip at one or both ends of a hold - down band 60 , lowering the inverted t - shaped lower portion and horizintal bar 53 of the clip through the slot parallel to the axis of the slot , and then turning the clip 90 ° to the slot axis such that the horizontal bar 53 of the clip is received in the appropriate laterally spaced pair of concave notches 77 on the underside of the slot . the portable autoclavable x - ray cassette holder 10 is particularly suited for use in taking x - rays in a sterile environment such as an operating room during surgical procedures while a patient is on an operating table . in such situations , the patient may be incapable of holding his or her limb in a particular position to be x - rayed . prior to use , the x - ray cassette holder is sterilized by autoclaving and receives a non - sterile x - ray cassette . typically , the non - sterile x - ray cassette is inserted by a non - sterile technician into the sterilized x - ray cassette holder which is held by a sterile member of the operating team . to use the portable autoclavable x - ray cassette holder 10 , the end cap 25 is removed , and a conventional non - sterilized x - ray cassete c of the appropriate size is slid into the interior of the main body and supported on the rails 22a ( fig3 ), and the end cap 25 is pushed onto the neck portion 19 and snap fitted thereon to secure the x - ray cassette within the holder 10 . the limb or extremity of the patient is placed on the top wall 12 with the portion to be x - rayed or radiographed over the x - ray cassette c . the free ends of one or more elastic bands 60 are inserted through the circular bottom portion 54 of the keyhole - shaped aperture in a respective clip 50 and then pulled upwardly into the narrow inverted v - shaped slot 55 to become wedged therein . the clips 50 at each end of the bands 60 are then secured in selected pairs of the slot - like depressions 20 on opposed side walls 14 and 15 or on a side wall and the end wall 16 of the main body 11 or the end cap 25 , as required . the length , and thus the tension or tightness , of the band 60 can be adjusted to the particular hold - down requirements by pulling one end of the band 60 down into the circular portion 54 of the clip 50 and stretching or loosening the band and then pulling it up to wedge it back into the v - shaped slot 55 and thereby resiliently bias the limb or extremities against the top wall 12 of the cassette holder while the x - ray or radiograph is taken . it should be noted that once the cassette holder and limb or extremity are properly positioned and secured , it is not necessary for an attendant or physician to hold the limb or extremity while the x - ray or radiograph is taken . thus , the present cassette holder completely eliminates radiation exposure to the attendant or physician . fig6 , and 9 illustrate typical examples of how limbs and extremities may be positioned . fig6 shows the hand h of a patient secured palm down on the top wall 12 of the cassette holder 10 with the fingers f spread apart and secured over the x - ray cassette which is in the holder 10 by a plurality of resilient hold - down bands 60 . fig8 and 9 are front and side elevation views , respectively , showing the x - ray cassette holder 10 supported vertically in the stand 70 and a patient &# 39 ; s foot f2 secured by a number of bands 60 to the top wall 12 of the x - ray cassette holder by a plurality of resilient hold - down bands 60 extending between the stand and the x - ray cassette holder . while this invention has been described fully and completely with special emphasis upon a preferred embodiment , it should be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described herein . | 0 |
fig1 depicts the precipitation resistant ridge cap roof vent 10 being installed on a roof 12 . the roof depicted is a rafter roof , though the ridge vent 10 may be installed on many other types of roofs to provide ventilation . the roof 12 depicted includes rafters 14 secured to a ridge board 16 . rafters 14 support sheathing 18 . sheathing 18 may be of plywood , oriented strand board , planks or other suitable material secured to rafters 14 . generally sheathing 18 is overlaid with tarred felt paper 20 which is in turn overlaid with shingles 22 , though other roofing materials may be employed . a cutout slot 24 is provided along the ridge 26 . slot 24 may terminate some distance from the end 28 of the ridge 26 . the ridge vent 10 , as depicted in fig1 , 5 , 6 , and 7 , broadly includes a top panel 30 , a plurality of vent panels 32 and filtering fabric 34 . top panel 30 presents a long axis 36 aligned generally parallel with the ridge 26 of the roof 12 when ridge vent 10 is installed . top panel 30 and vent panels 32 are constructed of a weatherproof three ply material 38 including a generally planar top ply 40 , a generally planar bottom ply 42 and an intermediate ply 44 . the intermediate ply 44 defines a multiplicity of airflow passages 46 extending generally transversely to long axis 36 and entirely across top panel 30 and vent panels 32 . plug 47 may be inserted in the end of the ridge vent 10 . fig2 , 3 and 4 depict several possible configurations of the three ply material 38 . fig2 depicts a three ply material 38 whose intermediate ply is comprised of a series of cross walls 39 connecting the top ply 40 to bottom ply 42 and defining a plurality of airflow passages 46 therebetween . fig3 and 4 depict an intermediate ply 44 of one or several convoluted or fluted layers 48 defining a plurality of airflow passages 46 . fig3 and 4 also show how multiple layers of three ply material 38 may be stacked to provide many generally parallel airflow passages 46 therethrough . top panel 30 also presents an exterior surface 50 and an interior surface 52 . interior surface 52 may include a routed groove 54 usually extending generally parallel to long axis 36 . routed groove 54 extends through bottom ply 42 and into intermediate ply 44 defining inner openings 56 of airflow passages 46 . the outer edges 58 of top panel 30 define the outer openings 60 of airflow passages 46 . vent panels 32 are disposed under the outer edges 58 of top panel 30 in a stacked fashion . they contain a multiplicity of airflow passages 46 oriented generally transverse to long axis 36 . vent panels 32 may be formed by scoring and folding a sheet of three ply material 38 as depicted in fig5 . vent panels 32 may then be secured to top panel 30 by the use of adhesives or fasteners 62 such as staples . alternately , vent panels 32 may by cut separately and stacked beneath the outer edges 58 of top panel 30 and secured together and to top panel 30 with fasteners 62 or adhesive . thus airflow passages 46 are formed extending from exterior edges 64 to interior edges 66 of vent panels 32 . filtering fabric 34 is secured along the interior surface 52 of top panel 30 , preferably in the region of the routed groove 54 , and on the bottom side 68 of the lowermost vent panel 32 extending the length of the ridge vent 10 . adhesives , fasteners , heat fusing or any other suitable technique may secure filtering fabric 34 to the ridge vent 10 . filtering fabric 34 may be of any thin , air permeable , water resistant , sheet material . woven or nonwoven fabrics may be employed as well as air permeable water resistant membranes that are not of fabric . preferably , filtering fabric 34 allows passage of about 75 percent of the air that would flow were it not present . the filtering fabric 34 may be a nonwoven spunbonded material of randomly arranged synthetic polymer fibers . referring to fig6 a and 7 a , in an alternate embodiment of ridge vent 10 filtering fabric 34 may be applied directly over inner openings 56 of airflow passages 46 . filtering fabric 34 may cover only interior edges 64 of vent panels 32 . alternately , as depicted in fig6 b filtering fabric 34 may extend from bottom side 68 of vent panels 32 , up over inner openings 56 , across interior surface 52 of top panel 30 , down over inner openings 56 on the opposite side and onto bottom side 68 on the opposite side . the filtering fabric 34 may be secured to interior edges 64 , bottom side 68 of vent panels 32 and interior surface 52 of top panel 30 as required . fig8 depicts an alternate embodiment of the ridge vent 10 adapted for use where it is desire to ventilate a shed style roof 70 in contact with an exterior wall 72 . shed roof vent 74 generally includes a generally planar top panel 76 , vent panels 32 and filtering fabric 34 . planar top panel 76 includes flange panel 78 extending along its length . vent panels 32 are disposed beneath top panel 76 and are stacked and secured in a similar fashion to ridge vent 10 . filtering fabric 34 is attached along the bottom side 68 of the lowermost vent panel 32 and to planar top panel 76 on or near flange panel 78 . filtering fabric 34 may also be attached to cover the interior edges 66 of vent panels 32 alone . fasteners , adhesives , heat fusing or other suitable techniques may secure filtering fabric 34 to planar top panel 76 and vent panel 32 . flashing 80 may overlie the shed roof vent 74 . referring to fig1 , in operation , ridge vent 10 is applied to the ridge 26 of a roof 12 over a previously made cutout 24 extending the length of the ridge 26 except for a small portion left uncut at each end of the roof 12 . the cutout 24 may be larger than a cutout that would be used with a non - filtering ridge vent in order to compensate for the restriction of airflow caused by the filtering fabric 34 . the ridge vent 10 is unrolled or unfolded if it is received packaged in either of these forms . the roof vent 10 is disposed so that the routed groove 54 is generally centered over the cutout 24 and the vent panels 32 are generally parallel to the shingles 22 or other roof surface . it will be appreciated by those skilled in the art that a resilient or conforming piece of material may be placed between the ridge vent 10 and the roof 12 to fill in any gaps that may be present due to any substantial irregularities in the roof structure . this may be helpful in the case of a corrugated metal or tiled roof . once in place , the ridge vent 12 may be secured to the roof 12 by fasteners such as nails or by adhesives . nails may be applied directly through top panel 30 where it overlies vent panels 32 and into roof sheathing 18 . a ridgeline ( not shown ) of shingles 22 may be applied directly over ridge vent 10 . as can be seen in fig1 , and 7 , when the ridge vent is installed the filtering fabric 34 forms a tent like structure . wind blown precipitation such as rain or snow may be carried into the interior of the ridge vent 10 through airflow passages 46 but it is stopped from traveling further by the water resistant filtering fabric 34 while air may still pass . liquid rain or melted snow that accumulates on top of the filtering fabric 34 drains from the ridge vent 10 through the lowermost layer of airflow passages 46 in vent panels 32 onto the roof 12 where it may run off shingles 22 . in the embodiment depicted in fig6 a and 6 b , wind blown precipitation may be carried into airflow passages 46 but is prevented from proceeding further by filtering fabric 34 and may drain back out . referring to fig8 , shed roof vent 74 is applied at the top of a shed style roof 74 where it abuts an exterior wall 72 . flange panel 78 may be bent downwardly and secured to exterior wall 72 by fasteners or adhesive . alternately , the flange panel 78 may be bent upwardly and secured to the wall 72 . flashing 80 may be applied on top of the shed roof vent 74 . vent panels 32 may be nailed or otherwise secured to sheathing 18 through shingles 22 . any wind blown precipitation that enters the shed roof vent 74 is prevented from entering the space beneath the roof by filtering fabric 34 . rain or melted snow that accumulates on top of filtering fabric 34 drains from the shed roof vent 74 through the airflow passages 46 in the bottommost vent panel 32 . the present invention may be embodied in other specific forms without departing from the essential attributes thereof ; therefore , the illustrated embodiments should be considered in all respects as illustrative and not restrictive , reference being made to the appended claims rather than to the foregoing description to indicate the scope of the invention . | 8 |
in a first embodiment , a fiber optic sensor is metallized , and is then brazed or soldered to a metal shim that may then be spot welded in the field to the structure to be monitored for stress . the fiber optic sensor may include , without limitation , extrinsic fabry - perot optical fiber strain sensors such as was shown in fig1 . referring now to fig2 a , a fiber optic sensor , depicted generally as 2 , includes a fiber optic portion 40 whose exterior is covered with a metallization layer 42 . to improve ruggedness of the sensor , a portion of the fiber optic may include a metal sheath or tube 44 , as well as an overlayer of protective armored cable 46 , or the like . sensor 2 may be an external fabry perot sensor ( e . g ., as was shown in fig1 ), or may be any other fiber optic sensor that preferably relies upon phase modulation . the portion of the sensor shown in fig2 a includes the spaced - apart air gap 20 ( shown in phantom ), as well as the target or reflector fiber 24 , its reflective end 22 , and the common branch of the transmit - receive optical fiber 10 and its end 18 . it is understood that the &# 34 ; y &# 34 ;- shaped branch in the transmit - receive optical fiber 10 is to the left of what is shown in fig2 a , as is the optical source and a detector . one source of suitable fiber optic material is g2 systems fiber optic , located in los angeles , calif . generally , the outer diameter ( d ) of the fiber optic portion of sensor 2 will be about 125 μm , the extended fiber optic length ( l ) will be about 5 mm to 20 mm , and the shim 48 may have a typical width ( w ) of about 10 mm , and a shim thickness ( t ) of about 500 μm . other dimensions may of course be used . in a first embodiment , the exterior surface of the fiber optic sensor 2 is first metallized with layer 42 , preferably by plating with gold or nickel , although other plating metals may be used instead . the thus metallized sensor may then be attached to a metal shim 48 , preferably by brazing or soldering 50 . generally , metal shim 48 will be selected to be the same material as the structure of interest 52 , to which shim 48 ( and thus sensor 2 ) may be attached in the field , preferably by spot welding 54 . as an alternative to soldering or brazing , the metallized fiber optic sensor 2 may be placed atop shim 48 , whereupon the sensor and shim are electro - plated together , bonding sensor to shim . in this embodiment , the interface 50 between the metallized layer 42 and the shim 48 will be an electro - plated bond rather than a solder or brazed bond . whether soldering , brazing , or electro - plating is used to secure the metallized sensor to the shim , the resultant sensor is relatively rugged and may be safely carried to the field for installation . as noted , in many power generator applications , the sensor will be spot - welded to a pressurized pipe and thus structure 52 in fig2 a and 2b may represent a portion of the pipe wall of such structure . as shown by fig2 c , a cover plate 56 may also be added to structure 52 for further protection after field - installation of sensor 2 . spot welding 54 or the like may be used to secure the protective cover plate 52 to the metal shim 48 . preferably the spot welding is relatively close to the body of the fiber optic elements to minimize fiber slipping as a result of thermal expansion . as shown in the alternative embodiment of fig3 a and 3b , sensor 2 may be attached to metal shim 48 using a specialized ceramic adhesive coat 60 , rather than by metallizing the outer surface of the fiber optic . the ceramic adhesive coat 60 preferably includes metal constituents whose thermal expansion properties match those of the metal shim 48 . coat 60 is applied around the fiber optic elements 40 , 24 on either side of cover plate 56 , and cured , to help mechanically lock the fiber optic elements in place . the distance l between the points of attachment of the fiber optic elements defines the effective sensor length . a suitable source for coat 60 is sermetel 588 , commercially available from sermatech international , inc ., located in limerick , pa . sermetel 588 is commonly used as an insulation coating for copper wires that are exposed to very high temperatures , e . g ., perhaps 1 , 800 ° f . after adhesive curing , a cover plate 56 is fitted , slightly loosely , over the fiber optic elements to keep the interference cavity gap clean , and to prevent vibration of the fibers . understandably , it is critical that transmit / receive fiber optic 40 and target fiber optic 24 almost meet such that their respective faces are spaced - apart to form gap 10 . accordingly , cover plates 56 , and ( if used ) 56a , 56b are concave in cross - section , defining groove - like regions 64 , 64 &# 39 ; that guide fiber optic elements 40 and 24 . the groove region concave dimension is at least the dimension of the diameter of the fiber optic elements , and is typically perhaps 0 . 005 &# 34 ; ( 0 . 13 mm ). in the embodiment of fig3 b , cover plates 56 , 56a , 56b have been formed by bending metal over a rod - like member having a desired curved profile to create the groove - like regions 64 , 64 &# 39 ; are present . as noted , these regions help guide and support the fiber optic elements , and for an internal fabry - perot sensor , assure that the spaced - apart end faces can indeed &# 34 ; find &# 34 ; each other . spot welding 54 secures the upper plates 56 , 56a , 56b to the lower base plate 48 . to minimize shifting of the fiber optic elements 40 and 24 , e . g ., from thermal changes , it is preferred that the spot welds be close to ( as opposed to distant from ) the fiber optic elements . in the embodiment of fig3 c , the upper and lower plates ( here 56 &# 39 ;, 48 &# 39 ;) have been formed by milling a concave groove 64 , 64 &# 39 ; sized to accommodate the diameter of the fiber optic elements 40 , 24 . so formed , these plates guide and retain the fiber optic elements , and ensure that the spaced - apart region 10 is created to form an internal fabry - perot sensor . spot welding 54 preferably retains the upper cover plate 56 &# 39 ; to the lower plate 48 &# 39 ;. fig3 d is a perspective view of a sensor similar to what is shown in fig3 a , except that the additional cover plates 56a , 56b are omitted . fig4 depicts an alternative embodiment in which the optical fibers , e . g ., 24 , 40 , are metallized with an overlayer 62 that defines a non - metallized masked ringed region 64 . the left - to - right width of the upper depressed portion of region 64 is sized to accept a cover plate 56 that is spot welded to a base plate 48 , as has been described . the lower portion of region 64 is void . formation of a masked band region 64 may be accomplished using etching or other techniques well known in the relevant art . each embodiment of fig3 a - 3d and fig4 permits fabrication of a field - mountable extrinsic fabry - perot sensor that can operate above 600 ° f . each such sensor is more robust than prior art extrinsic fabry - perot sensors , whose deficiencies were described with respect to fig1 . in practice , strain sensors constructed according to the present invention will be sensitive both to temperature and to strain . however , as depicted in fig5 the mechanical strain and thermal strain components can be distinguished by using two identical sensors 2 and 2 &# 39 ;, preferably fabricated as an embodiment described earlier herein . in fig5 a single armored cable 66 encompasses at least two optical fibers 10 and 10 &# 39 ; that are preferably protected by metal tubes 44 and 44 &# 39 ;, respectively . sensor 2 preferably includes a metal shim 48 that is of the same material as the structure of interest 62 . sensor 2 , but not sensor 2 &# 39 ;, is fixedly attached to structure 62 , e . g ., by spot welds 54 . by contrast , sensor 2 &# 39 ; is in the same environment but is not attached to structure 62 . thus , while both sensors 2 and 2 &# 39 ; will experience the same thermal , pressure , and other ambient environmental changes , only sensor 2 will be subject to mechanical strain from structure 62 . as shown in fig5 the n distal ends of the fiber optic elements may be terminated at a 1 × n optical switch or coupler 66 , that outputs a switchable signal to instrumentation 66 , preferably a white light interferometer and associated electronics . instrumentation 66 can subtract the signal from gage 2 &# 39 ; from the signal from gage 2 to provide a true measure of the mechanical stress components experienced by gage 2 . it may also be desirable to measure strain at various locations on a structure 52 . if desired , the lengths of fiber optic materials 10 and 10 &# 39 ; ( as well as associated protective tubes 44 , 44 &# 39 ;) may differ from each other . thus , sensor 2 might be fixedly attached to structure 52 at one location , and sensor 2 &# 39 ; may be fixedly attached at another location . of course , more than two fiber optic cables and sensors may be used . optionally pairs of such cables and sensors may be used to discern mechanical from thermal stress by fixedly securing but one sensor to structure 52 , leaving the environmentally adjacent sensor unattached ( as shown in fig5 ). to promote reliability , at least some such multiplexed multiple sensors may be parallel - coupled ( rather than series - coupled ). such redundancy would permit other sensors to continue to output useful information to instrumentation 68 , despite the failure of one ( or more than one ) sensor . fig6 depicts a test setup used by applicants to test a sensor modelled after the ceramic adhesive embodiment shown in fig3 a and 3b . a 25 μm thick metal plate structure 52 was subjected to strain using conventional strain inducing apparatus 70 , and a strain sensor 2 was spot welded to structure 52 . the target fiber in sensor 2 was a 125 μm diameter stainless steel rod with a polished end face to reflect light . an interferometer 68 was coupled to the transmit / receiver optic fiber associated with sensor 2 . the optical light source ( not shown ) was a laser , and thus strain in the test specimen detected by sensor 2 could be recognized by the interferometer as optical fringes . if desired , the same instrumentation could be used with white - light interferometers . a reference extensometer 72 was also affixed to the test structure 52 , and data acquisition instrumentation 74 . a power source 76 coupled to a heating element 78 produced controlled thermal strain in the test structure 52 . the specimen structure 52 was strained in a cyclic fashion over one minute intervals , and corresponding data from the fiber - optic strain sensor 2 , and from the extensometer 72 were obtained . fig7 a and 7b depict , respectively , data obtained from the fiber optic sensor 2 and from the extensometer 72 at ambient - induced temperatures of 1000 ° f . and 75 ° f ., respectively . in each instance , the lower frequency waveform is data obtained from the extensometer strain sensor 72 , while the higher frequency waveform represents optical fringes detected by the interferometer from strain sensor 2 . as shown in fig7 a and 7b , strain 2 sensor - produced optical fringes correlated directed to the strain sensed by the conventional extensometer . essentially , the number of high frequency sensor 2 - produced fringes correlates to the amplitude of the lower frequency extensometer 72 data . those skilled in the art will appreciate that the same gage construction may be used with a white light interferometer to provide absolute data . following the tests , applicants &# 39 ; sensor 2 was examined microscopically and found to have survived the 1000 ° f . ambient temperature without evidence of failure . although the preferred embodiments have generally be described with respect to use in high temperature environments , it is understood that sensors according to the present invention may be used at low temperatures . further , the present invention may be used to measure strain in hazardous environments , such as nuclear reactor sites . in such applications , radiation - hardened fiber optic elements are preferred , to minimize radiation - induced browning that could affect measurements . modifications and variations may be made to the disclosed embodiments without departing from the subject and spirit of the invention as defined by the following claims . | 6 |
before beginning a detailed description of the subject invention , mention of the following is in order . when appropriate , like reference numerals and characters may be used to designate identical , corresponding or similar components in differing figure drawings . further , in the detailed description to follow , exemplary sizes / models / values / ranges may be given , although the present invention is not limited to the same . as a final note , well - known components of computer networks may not be shown within the figs . for simplicity of illustration and discussion , and so as not to obscure the invention . [ 0020 ] fig4 is a block diagram of an example embodiment of the present invention which detects and restricts the transfer of packets by a zombie 300 in a ddos attack utilizing a zadar ( zombie activity detection alerting and restriction system ) intermediate driver 400 . otherwise fig4 is identical to fig3 with the exception of the zadar intermediate driver 400 and only this difference with be discussed in reference to fig4 . still referring to fig4 zombies 300 in their most basic form are user inaccessible applications , process or macros that register for network access with the network protocol 210 like any other application 200 . the denial of service initiator 310 has a list of servers 20 , pcs 10 and web servers 30 that have the zombie 300 software installed . the denial of service initiator collects this list by sending out requests to the servers 20 , pcs 10 and web servers 30 to which only the zombie 300 application knows the proper response . to start a ddos attack , the denial of service initiator 310 sends the target information ( web server 30 to be attacked ) and the start sequence of the list of corrupted servers 20 , pcs 10 and web servers 30 . at this time traffic at the target web server 30 is normal . once the zombie 300 application has verified the start sequence and processed the delay usually required for a uniform start , it begins sending small requests to the network protocol 210 , with the target web server 30 as the end destination . to the network protocol 210 , this appears normal and it only serves to translate application 200 requests into network traffic . the network interface 220 then does as instructed by the network protocol 210 and places all the packets on the network / internet 40 . at the target web server 30 , the network interface 230 suddenly sees a massive increase in traffic . the network protocol 240 is seeing so many requests that the infrastructure and resources of the target web server 30 become completely consumed . since the flood of requests is timed to all arrive at approximately at the same time , the web server 30 cannot tell what is a legitimate request and what is part of the ddos attack . the web server 30 is unable to handle the requests and the ddos attack is successful . however , still referring to fig4 the zombie 300 must make common network protocol stack calls and register to receive incoming packets with the network protocol 210 just like all other applications 200 . this registering and receiving process is the zombie &# 39 ; s achilles heel . as will be discussed in further detail in reference to fig5 through 9 , the zadar intermediate driver 400 is able to detect the abnormal flow of packets from a zombie 300 to and from web servers 30 to create an identifiable traffic signature . this identifiable traffic signature will allow the zadar intermediate driver 400 to detect the zombie 300 as part of a larger ddos attack . since the zadar intermediate driver 400 operates below the network protocol 210 layer , the zombie 300 is unaware that its activity has been noticed . from this position the zadar intermediate driver 400 can monitor the flow of requests and packets of both sends and receives . using this control , the zadar intermediate driver 400 monitors the flow on each packet as well as tracking the short term and long term trends . since zombie traffic signature patterns are fairly defined , the zadar intermediate driver 400 is able to look for these traffic signature patterns . therefore , rather than attempting to block a ddos attack at the target point , web server 30 , the zadar intermediate driver 400 is able to detect and restricts the ddos attack at the source , server 20 , pc 10 , or web server 30 . before proceeding into a detailed discussion of the logic used by the embodiments of the present invention it should be mentioned that the flowcharts shown in fig6 through 9 as well as the modular configuration diagram shown in fig5 contain software , firmware , hardware , processes operations that correspond , for example , to code , sections of code , instructions , commands , objects , hardware or the like , of a computer program that is embodied , for example , on a storage medium such as floppy disk , cd rom , ep rom , ram , hard disk , etc . further , the computer program can be written in any language such as , but not limited to , for example c ++. in the discussion of the flowcharts in fig6 through 9 , reference will be simultaneously made to the corresponding software modules shown in fig5 . it should further be noted that the logic illustrated in fig2 through 5 may execute on either server 20 , web server 30 or personal computer 10 . [ 0024 ] fig5 is a modular configuration diagram of the zadar intermediate driver 400 utilized in an example embodiment of the present invention and further detailed in the flowcharts illustrated in fig6 through 9 . the zadar intermediate driver 400 comprises three major components . the first component is a transmit ( tx ) algorithm 500 used to monitor incoming packets . the tx algorithm 500 is discussed in further detail in reference to fig6 and 9 . the second major component is the receive ( rx ) algorithm 520 , which is discussed in further detail in reference to fig7 and 9 . the third major components in the zadar intermediate driver 400 is the monitor code 510 , which is discussed in further detail in fig9 . as shown in fig5 the tx algorithm 500 receives packets from the network protocol 210 and transmits them to the network interface 220 . further , the rx algorithm 520 receives packets from the network interface 220 and transmits them to the network protocol 210 . both the tx algorithm 500 and rx algorithm 520 communicate to the monitor code 510 . the monitor code 510 does not actively send or receive packets of information , but does monitor the activities of applications 200 and zombies 300 through information received from the tx algorithm 500 and the rx algorithm 520 . [ 0025 ] fig6 is a flowchart illustrating the logic involved in the transmit ( tx ) algorithm 500 , illustrated in fig5 in an example embodiment of the present invention . the tx algorithm 500 begins execution in operation of 600 and immediately proceeds to operation 610 . in operation 610 , a packet is received by the tx algorithm from the network protocol 210 either from an application 200 or a zombie 300 . thereafter , in operation 620 it is determined if the packets are from a known application . operation 620 is further detailed in the discussion provided in reference to fig9 . if the packet is determined in operation 620 to be from a known application 206 , then processing proceeds to operation 630 . in operation 630 the application is registered and processing proceeds to operation 640 where the usage of the network is tracked by storing the destination , packet size and packet count using the monitor code 510 . however , still referring to fig6 if in operation 620 the application 200 sending the packet is not known , then processing proceeds to operation 650 . in operation 650 it is determined if this particular packet is from a known zombie 300 . if the packet is from a known zombie 300 then processing proceeds to operation 660 where the packet is discarded . thereafter , processing proceeds to operation 680 where processing is terminated . however , still referring to fig6 if in operation 650 it is determined the packet is not from a known zombie 300 , then processing proceeds to operation 640 . in operation 640 , as previously discussed , the network usage is stored based upon the destination address , packet size , and packet count using the monitor code 510 . thereafter , processing proceeds to operation 670 where the packet is passed to the network interface 220 for transmission . then , processing proceeds to operation 680 where the tx algorithm 500 terminates execution . [ 0028 ] fig7 is a flowchart illustrating the logic involved in the receive ( rx ) algorithm 520 , shown in fig5 in an example embodiment of present invention . the rx algorithm 520 begins execution in operation 700 and immediately proceeds to operation 710 . in operation 710 , a packet is received by the rx algorithm 526 from the network interface 220 , either from an application 200 or a zombie 300 . thereafter , in operation 720 , it is determined if the packet is from a known application . operation 720 is further detailed in the discussion provided in reference to fig9 . if the packet is determined in operation 720 to be from a known application , then processing proceeds to operation 730 . in operation 730 , the application is registered and processing proceeds to operation 740 where the usage of the network is tracked by storing the destination , packet size and packet count using the monitor code 510 . however , still referring to fig7 if in operation 720 the application 200 sending the packet is not known , then processing proceeds to operation 760 . in operation 760 it is determined if this particular packet is from a known zombie 300 . if the packet is from a known zombie 300 then processing proceeds to operation 770 where the packet is discarded . thereafter , processing proceeds to operation 780 where processing is terminated . however , still referring to fig7 if in operation 760 it is determined the packet is not from a known zombie 300 , then processing proceeds to operation 740 . in operation 740 , as previously discussed , the network usage is stored based upon the destination address , packet size and , packet count using the monitor code 510 . thereafter , processing proceeds to operation 750 where the packet is passed to the network protocol 210 for transmission to the desired application 200 . thereafter , processing proceeds to operation 780 where the rx algorithm 520 terminates execution . [ 0031 ] fig8 is a flowchart illustrating the logic involved in the monitor code 510 , illustrated in fig5 in an example embodiment of the present invention . the monitor code 510 begins execution in operation 800 based upon a callback timer which periodically causes the execution of the monitor code 510 . the frequency of execution of the monitor code 510 may be adjusted dependent upon the traffic load experienced by the server 20 , pc 10 , or web server 30 . in operation 802 , data received from the tx algorithm 500 is first analyzed since if the packets received are from a zombie then potential harm might occur to the receiving system and it would be desirable to block this activity as quickly as possible . thereafter , in operation 804 , it is determined whether a registered application 200 ( or possible zombie 300 ) is transmitting a large number of packets . such a transmission of a large number of packets would cause the application 200 to be considered a possible zombie 300 . if in operation 804 it is determined that the application 200 is not transmitting a large number of packets then processing proceeds to operation 806 . in operation 806 , it is determined if the registered application 200 is not receiving any packets . if the application 200 is receiving packets then processing proceeds to operation 808 where data received from the rx algorithm 520 is analyzed . then in operation 810 it is determined whether application 200 ( or possible zombie 300 ) is rarely receiving any packets . if in operation 810 it is determined that the application 200 is not rarely receiving packets , then processing proceeds to operation 812 . in operation 812 , it is determined if the application 200 was receiving packets and is no longer receiving or sending packets . if the application 200 is determined to be still receiving packets which are not an inordinate amount of packets , then processing proceeds to operation 814 . in operation 814 it is determined if the application 200 has been placed on a watch list . this watch list serves to identify applications 200 which may be zombie &# 39 ; s 300 and require further monitoring . if in operation 814 it is determined that the application 200 is not listed in the watch list then processing loops back to operation 800 . still referring to fig8 if in operation 804 it is determined that an application 200 is transmitting a large number of packets then processing proceeds to operation 816 where the application 200 is considered to be a high - risk of being a zombie 300 and that a possible ddos attack is in progress . thereafter , in operation 816 it is determined whether the application 200 is also receiving a large number of packets . if the application 200 is receiving a large number of packets then processing proceeds to operation 818 where it is determined that the application 200 is simply exchanging large amounts of data and therefore is a harmless application 200 . thereafter , processing proceeds to operation 806 as previously discussed . however , if in operation 816 the application 200 is not receiving a large number of packets then processing proceeds to operation 830 . in operation 830 the application 200 is identified as a zombie 300 and processing proceeds to operation 842 . in operation 842 it is determined if the application 200 has previously been placed on the previously discussed watch list . if the application has been previously placed on the watch list , then processing proceeds to operation 856 where the user is notified that the application 200 is a zombie application and is restricted from further accessing the network 40 . thereafter , processing proceeds to operation 844 where it is determined if the application is now receiving packets . if the application 200 is now receiving packets then processing proceeds to operation 832 where the application 200 is removed from the zombie list and thereafter processing proceeds to operation 818 as previously discussed . operation 844 serves the function of identifying ordinary applications 200 which have transmitted large amounts of data but have not received any due to a slow response from another piece of equipment in network 40 . still referring to fig8 if however in operation 844 the application 200 has not yet received any incoming packets then processing proceeds to operation 822 . in operation 822 , the application 200 is placed upon a watch list and processing proceeds to operation 824 . in operation 824 , it is determined whether the application 200 is a known good application . a list of known good applications may be specified by the user or systems administrator . if the application 200 is known to be a good application then processing proceeds to operation 828 where the application is removed from the watch list and zombie list . thereafter , processing proceeds from operation 828 back to operation 800 . still referring to fig8 if the application 200 is determined in operation 824 not to be a known good application then processing proceeds to operation 834 . operations 834 through 838 and 846 through 854 attempt to rate the probability that a particular application 200 is considered to be a zombie 300 . a numerical rating system is used where a rating of 2 or greater is considered suspect and the application 200 is kept on the watch list until the next cycle through the monitor code 510 . in operation 834 , the zombie rating for this particular application 200 is incremented by a value of 2 . as would be appreciated by one of ordinary skill in the art the rating values supplied in operations 834 through 838 and 846 through 854 may vary based on testing or the judgment of the systems administrator . thereafter , processing proceeds from operation 834 to operation 846 where it is determined whether the application 200 is executing as a process or an application . typically , applications are easily noticed by users since they normally entail the opening of a window or some other indications that they are active . however , processes normally operate in the background and a user may not necessarily be aware of their execution . still referring to fig8 if in operation 846 it is determined that the application 200 is a software application , then processing proceeds to operation 848 where the associated zombie rating for the application 200 is decremented by a value of one . thereafter , processing proceeds to operation 850 where it is determined if the application 200 was launched by the user or at startup . if the application was launched by the user then it cannot be assumed not to be a zombie 300 . therefore , in operation 854 the associated zombie rating for the application 200 is incremented by a value of zero and processing proceeds to operation 838 . however , in operation 850 , if it is determined that the application 200 was initiated at startup then processing proceeds to operation 852 where the associated zombie rating is incremented by value of 3 . since viruses such a zombies are often placed in the startup list to be executed upon systems startup , incrementing the zombie rating by a high value is warranted . either from operation 854 or operation 852 processing then proceeds to operation 838 where it is determined if the associated zombie rating for the application 200 is greater than a value of 2 . if the zombie rating is less than a value of 2 then processing proceeds to operation 828 , as previously discussed , where the application 200 is removed from the watch list and the zombie list . however , if the zombie rating is greater than a value of 2 then processing proceeds to operation 840 where the application is kept on the watch list with its current zombie rating value kept intact . thereafter , from operation 840 , processing loops back to operation 800 . still referring to fig8 returning to operation 806 , if an application 200 is not receiving any packets then processing proceeds to operation 820 where it is considered to be a low risk for a candidate as a zombie 300 . processing also proceeds from operation 810 to 820 if the application 200 is rarely receiving any packets . also , processing proceeds from operation 812 to operation 820 when a particular application 200 is no longer receiving or sending any packets after receiving a few packets . in any of the foregoing situations the application 200 is considered a low risk candidate as a zombie 300 in operation 820 and as previously discussed processing proceeds to operation 822 . [ 0037 ] fig9 is a flowchart further detailing the logic involved in operations 620 and 650 illustrated in fig6 and 720 and 750 illustrated in fig7 in an example embodiment of the present invention . the logic involved in fig9 attempts to determine whether a particular application is a known good application 200 or a zombie 300 based upon the destination port specified . execution begins in operation 906 and immediately proceeds to operation 905 where the destination port number provided by the tcp / ip or udp header is checked . thereafter , in operation 910 it is determined whether the particular destination port is from a known good port . if the port number is known to be a good port then processing proceeds to operation 945 where the classification process is completed and processing terminates in operation 950 . still referring to fig9 if it is determined that the port number from the tcp / ip or udp header is not a known good port then processing proceeds to operation 915 . in operation 515 , it is determined whether the port number in question is a known the zombie port . if the port number is known to be from a zombie port then processing proceeds to operation 940 where packets received counter is incremented for the connection value and processing proceeds , as previously discussed , to operation 945 . however , if in operation 915 the port number is not a known zombie port then processing proceeds to operation 920 . in operation 920 it is determined whether the source port number from the tcp / ip or udp header is a known zombie port . if the source port number is from a known zombie port then again processing proceeds to operation 940 . however , if the source port number is not known to be a zombie port then processing proceeds to operation 925 . in operation 925 the ip address , ip destination address , destination port number , and source port number are hashed to form a single connection value . this single connection value will serve as a unique identifier for this particular application 200 . thereafter , processing proceeds to operation 930 where the connection value computed in operation 925 is checked against a list to determine if it is present . if the connection value is not present in the list then processing proceeds to operation 935 where it is added to the list and again processing then proceeds to operation 940 . the benefit resulting from the present invention is that a simple , reliable system , method and computer program is provided for detecting and restricting network activities of software engaged in distributed denial of service attacks . utilizing the present invention it is possible to block a ddos attacks at the source rather than at the target server . while we have shown and described only a few examples herein , it is understood that numerous changes and modifications as known to those skilled in the art could be made to the example embodiment of the present invention . therefore , we do not wish to be limited to the details shown and described herein , but intend to cover all such changes and modifications as are encompassed by the scope of the appended claims . | 7 |
the invention will be now described herein with reference to illustrative embodiments . those skilled in the art will recognize that many alternative embodiments can be accomplished using the teachings of the present invention and that the invention is not limited to the embodiments illustrated for explanatory purposed . the present invention calculates clock skew between start and end point sequential circuits based on a correspondence table of the placement position of the start and end point sequential circuits at both ends of a specific sequential circuit path , the placement position of the sequential circuits calculated from a preformed clock circuit , and clock skew , and uses the calculated clock skew value for the placement process . this allows considering clock skew which is very close to an actual value when optimizing the timing of the sequential circuit path . it is thereby possible to obtain the placement result that satisfies setup and hold time requirements more easily than conventional techniques . fig5 is a block diagram of the timing - driven placement of this embodiment in the timing - driven placement system of this embodiment , a clock skew calculation processor 243 calculates clock skew based on sequential circuit position information 238 extracted from placement processor 242 and area - specific clock skew information 239 , and then outputs sequential circuit clock skew information 240 . the timing - driven placement system of this embodiment feeds the calculated clock skew information 240 back to the placement processor 242 . the placement processor 242 thereby determines the optimal placement position of each block based on the skew value , the layout information 236 , and the timing constraint 237 so that delay tr on a specific sequential circuit path satisfies the setup and hold time requirements represented by the expressions ( 1 ) and ( 2 ), and outputs placement result 241 . the area - specific clock skew information 239 is correspondence information between sequential circuit placement position and clock skew calculated from the configuration of the clock circuit preformed in the chip structure shown in fig2 . fig6 is an enlarged view of a part of fig2 . the clock circuit distributes a clock from a root clock buffer 244 , through final - stage clock buffers 249 , 250 , 251 , and 252 , to sequential circuit placement area nearest to each of the final - stage clock buffers . the sequential circuit placement area is divided into clock supply areas 253 , 254 , 255 , and 256 , to which a clock is supplied from the final - stage clock buffers 249 , 250 , 251 , and 252 , respectively . each of the final - stage clock buffers and each of the clock supply areas are thereby correlated . in this way , a plurality of sequential circuit placement areas and clock skew between two placement areas arbitrarily selected from the plurality of sequential circuit placement areas are correlated for all the areas . this is the area - specific clock skew information 239 . one sequential circuit placement area corresponds to one final - stage clock buffer . thus , the sequential circuit placed in one sequential circuit placement area receives a clock from one final - stage clock buffer . since a clock supply path from the root clock buffer to the sequential circuit placement area is preformed in the clock circuit , it is possible to calculate a difference in the transmission delay from the root clock buffer to the input terminal of each of the final - stage clock buffers in consideration of maximum variation in chip . if the output load capacitance of each final - stage clock buffer which varies by the number of connected sequential circuits and influence of variation in chip on the clock path from the input terminal of each final - stage clock buffer to the input terminal of the sequential circuit are negligibly small , it is possible to transpose a difference in the transmission delay from the root clock buffer to the input terminal of each of the final - stage clock buffers to clock skew between the sequential circuit placement areas corresponding to each of the final - stage clock buffers . for example , clock skew between the sequential circuit placed in the sequential circuit placement area 253 to which a clock is supplied from the final - stage clock buffer 249 and the sequential circuit placed in the sequential circuit placement area 254 to which a clock is supplied from the final - stage clock buffer 250 equals to a difference in the transmission delay between the path from the root clock buffer 244 to the final - stage clock buffer 249 and the path from the root clock buffer 244 to the final - stage clock buffer 250 . in this way , the sequential circuit placement area is divided by each final - stage clock buffer supplying a clock thereto , and clock skew of the all the divided areas is calculated , which composes the clock skew information . this embodiment calculates the clock skew between specific sequential circuits based on this clock skew information in the timing - driven placement process . an example of the operation of the timing - driven placement of this invention is explained hereinafter . fig7 is a flowchart showing an example of the operation of the timing - driven placement process . initially in step s 01 , the process inputs and stores layout information , timing constraints , and area - specific clock skew information . after the input of the information , the process proceeds to step s 02 , where it extracts connection information of a specific sequential circuit path to which transmission delay constraint is given based on the timing constraint information . then , the process tentatively places all the blocks constituting the path in step s 03 . in step s 04 , the process estimates line delay between blocks and gate delay in the block from the types of blocks constituting the path which are tentatively placed and distance between the blocks and calculates a transmission delay time of the entire path . in step 05 , the process extracts the placement position of the start and end point sequential circuits at both ends of the path which are tentatively placed . then , it calculates the clock skew between the start and end point sequential circuits based on the position of the start and end point sequential circuits on the path and the area - specific clock skew information . the start and end point sequential circuits are , for example , the sequential circuits 232 and 233 at both ends of a specific path as shown in fig4 . data is transmitted between the start and end point sequential circuits . finally in step 06 , the process performs timing analysis based on the path transmission delay time calculated in step s 04 , the clock skew between the start and endpoint sequential circuits calculated in the step s 05 , and the timing constraints . if the timing analysis result shows that the setup and hold time requirements represented by expressions ( 1 ) and ( 2 ) are not satisfied on the path , the process returns to s 03 for the placement of blocks constituting the path ( no in s 07 ). if , on the other hand , the requirements are satisfied , the process on the subject path ends ( yes in s 07 ). then , if an unprocessed path exists , the process returns to s 02 for the path information extraction ( no in s 08 ), and , if all the paths are done , the timing - driven placement process completes ( yes in s 08 ). as descried above , it is possible in this embodiment to consider the clock skew almost the same as an actual value calculated from the preformed clock circuit in the process of determining the placement position of the blocks constituting a path between sequential circuits . thus , if the expressions ( 1 ) and ( 2 ) are satisfied in the timing - driven placement processor , the timing analysis result based on the actual clock skew after the placement is likely to meet the setup and hold time requirements . in order for the path that meets the setup and hold time requirements in the placement processor to completely avoid the problem which is not given by the timing analysis based on the actual clock skew after the placement , this embodiment calculates a clock transmission delay value from the root clock buffer to all the sequential circuits both for the cases where the number of sequential circuits connected to each final - stage clock buffer is maximum and where it is minimum when forming the area - specific clock skew information . then , it compares a difference in the clock transmission delay in each of the divided sequential circuit areas for every final - stage clock buffer , and uses the greatest difference in delay as the clock skew between the sequential circuit areas for the timing - driven placement process . thus , this embodiment determines the clock skew between the placement areas in consideration of a delay difference depending on the number of sequential circuits placed in one sequential circuit area . for example , fig6 shows the clock circuit where each final - stage clock buffer drives up to six sequential circuits . in this clock circuit , when calculating the clock skew between the sequential circuit placement area 253 to which a clock is supplied from the final - stage clock buffer 249 and the sequential circuit placement area 254 to which a clock is supplied from the final - stage clock buffer 250 , it is necessary to calculate the clock transmission delay values from the root clock buffer 244 to the sequential circuit about four cases , which are , the cases of connecting one sequential circuit , which is minimum , to the final - stage clock buffer 249 or 259 , and connecting six sequential circuits , which is maximum , to the final - stage clock buffer 249 or 259 . the transmission delay on the clock path from the root clock buffer 244 through the final - stage clock buffer 249 to one sequential circuit is t1min , the transmission delay on the clock path from the root clock buffer 244 through the final - stage clock buffer 249 to six sequential circuits is t1max , the transmission delay on the clock path from the root clock buffer 244 through the final - stage clock buffer 250 to one sequential circuit is t2min , the transmission delay on the clock path from the root clock buffer 244 through the final - stage clock buffer 250 to six sequential circuits is t2max . if it is assumed that the value of t2max − t1min is greater than the value of t1max − t2min , the clock skew between the sequential circuit placement areas 253 and 254 is t2max − t1min . in this case , the clock skew to be considered in the timing - driven placement process increases in whole due to a difference in the transmission delay from the input terminal of each final - stage clock buffer to the input terminal of the sequential circuit which varies by the number of connected sequential circuits and influence of variation in chip on the clock path from the input terminal of each final - stage clock buffer to the input terminal of the sequential circuit . however , the increased skew value compared with the first embodiment is much smaller than the skew value due to the influence of variation in chip on the whole clock circuit . thus , this embodiment further facilitates to satisfy the expressions ( 1 ) and ( 2 ) in all the sequential circuits within the timing - driven placement processor , compared to the case of setting all the clock skew values of the sequential circuits to be considered in the placement processor to a maximum value of the clock skew calculated from the preformed clock circuit . it is apparent that the present invention is not limited to the above embodiment , that may be modified and changed without departing from the scope and spirit of the invention . | 6 |
referring first to fig2 , which shows an environmental protection liquid fuel generator of the present invention that is a synthetic low sulfur fuel oil generator , wherein a fuel oil generator 1 is a structure comprising : a receiving device 10 , an esterification device 11 , a first standing separation device 12 , a compression distillation device 13 , an acid - base neutralization device 14 , a second standing separation device 15 , and a decompression distillation device 16 , the receiving device 10 is a feeder container , and the receiving device corresponds to the esterification device 11 . the esterification device 11 enables heating of the additives , which respectively corresponds to the receiving device 10 and the first standing separation device 12 . the first standing separation device 12 enables separation of ester oil and glycerine , which respectively corresponds to the esterification device 11 and the compression distillation device 13 . moreover , the first standing separation device 12 is provided with a gas recovery conduit 120 to be corresponded to the esterification device 11 . the compression distillation device 13 enables removal of water content , which respectively corresponds to the first standing separation device 12 and the acid - base neutralization device 14 . the acid - base neutralization device 14 enables the addition of acetic acid to the material mixture , which respectively corresponds to the compression distillation device 13 and the second standing separation device 15 . the second standing separation device 15 enables separation of ester oil and water content , which respectively corresponds to the acid - base neutralization device 14 and the decompression distillation device 16 . the decompression distillation device 16 enables refinement of the environmental protection liquid fuel oil , with the refined fuel oil being extracted from an extraction outlet 160 . accordingly , an environmental protection liquid fuel oil for use is extracted and purified by means of the fuel oil generator 1 . referring next to fig2 and fig3 , which show the environmental protection liquid fuel generator of the present invention , wherein fuel oil with environmental protection characteristics produced by the fuel oil generator 1 forms a synthetic low sulfur biological diesel oil ( bio diesel ) 17 . the bio diesel oil 17 with low sulfur content is primarily formed by adding a mixed proportion of a vegetable oil and an alkide ( catalyzing enzyme ) to the fuel oil generator 1 , which extracts and purifies the bio diesel oil to reduce the amount of sulfur contained in the fuel oil and provide for different flash points . accordingly , the mixed proportion of an alkide ( catalyzing enzyme ), which is a decane , an 11 alkane , or a 12 alkane , with a vegetable oil required a flash point between 45 ° c .˜ 70 . 5 ° c ., and the sulfur content was below 2 . 3 ppm ( parts per million ). hence , with a sulfur content below 2 . 3 ppm , it produces a gas that is close to being completely non - polluting . moreover , after use , the discharged waste gas is environmentally friendly and non - polluting , and no black smoke is produced . referring to the test results from a sgs test report , wherein proportion by weight of a vegetable oil and alkide ( catalyzing enzyme ) is 50 %+ 50 %, and the vegetable oil is : a . soybean oil with flash point : 45 ° c ., and sulfur content : 0 . 22 ppm ; 1a : light orange color , almost the same color as freshly polished copper strip b . cotton seed oil with flash point : 45 ° c ., sulfur content : 1 . 1 ppm ; 1a : light orange color , almost the same color as freshly polished copper strip c . rapeseed oil with flash point : 45 ° c ., sulfur content : 2 . 3 ppm ; 1a : light orange color , almost the same color as freshly polished copper strip d . palm oil with flash point : 45 ° c ., sulfur content : 2 . 3 ppm . 1a : light orange color , almost the same color as freshly polished copper strip in the test results , when the flash point is at 45 ° c ., the sulfur content is within 2 . 3 ppm , which clearly achieves a reduction in the discharge amount of sulfur . when the proportion by weight of a vegetable oil and alkide ( catalyzing enzyme ) is 75 %+ 25 %, the test results were as follows : when the flash point is 51 ° c ., the sulfur content is within 2 . 2 ppm . hence , the values produced by different mixed proportions of the vegetable oil and alkide similarly achieve a sulfur content lower than 2 . 3 ppm . when the proportion by weight of a vegetable oil and alkide ( catalyzing enzyme ) is 60 %+ 40 %, the test results were as follows : when the flash point is 95 ° c ., the sulfur content is within 0 . 006 ppm . accordingly , the higher the flash point , the lower the sulfur content produced . in addition , the discharged gas is non - polluting and no black smoke is produced . hence , there is no production of acid rain to break down the atmospheric layer , thus , global warming can be slowed down to alleviate changes in the global climate system and the ecological environment . when the proportion by weight of a vegetable oil and an alkide ( catalyzing enzyme ) is 50 %+ 50 %, then the cetane number test results for the respective vegetable oils were : in the test results , the cetane numbers averaged between 43 . 4 ˜ 45 , thus effectively improving the starting capability of diesel oil engines , decreasing the emission of nox ( nitrogen oxide ), co ( carbon monoxide ), and thc ( total hydrocarbons ), as well as reducing fuel consumption and combustion noise . based on the test results as described above , the derived advantages of the present invention are as follows : 1 . able to substantially decrease the emission of black smoke and discharge and dispersal of nitrides , as well as being fuel efficient . 4 . no need to modify the engine system when mixed 50 % with general diesel oil or common diesel oil , and improves engine efficiency . furthermore , when the vegetable oil and the alkide ( catalyzing enzyme ) are proportionally mixed , the higher the flash point , the lower the sulfur content , achieving almost zero sulfur content . and when the flash point is slightly lower , the sulfur content is similarly within a safety range , again achieving almost zero sulfur content . the value of the flash point can be adjusted according to customer requirements to achieve a value within a preferred range . it is of course to be understood that the embodiments described herein are merely illustrative of the principles of the invention and that a wide variety of modifications thereto may be effected by persons skilled in the art without departing from the spirit and scope of the invention as set forth in the following claims . | 8 |
as one embodiment of the invention , fig1 shows the longitudinal section of a magnetic resonance tomography apparatus having a hollow - cylindrical basic field magnet system 1 . the outer envelope 2 of the basic field magnet system is shown , and forms the surface of the apparatus in that region wherein it is not covered by the gradient coil system 3 . within the hollow opening 4 of the basic field magnet system 1 , the gradient coil system 3 is connected to the envelope 2 of the basic field magnet system 1 via the connecting mechanism 5 . so that oscillations of the gradient coil system 3 are not transmitted via the connecting mechanism 5 onto the entire outer envelope 2 , the outer envelope 2 has a two - piece decoupling mechanism 6 , each part being formed by an annularly circumferential bellows 7 as well as a stiffening ring 8 . the decoupling mechanism 6 is arranged in the envelope 2 so that it is not visible from the outside . oscillations arising in that region of the outer envelope 2 that is covered by the gradient coil system 2 are inconsequential for the effectiveness of the decoupling . the decoupling mechanism 6 particularly prevents transmission of oscillations of the gradient coil system 3 in the circumferential direction . these are especially relevant as to noise production . the decoupling mechanism 6 is comparatively stiff in the direction of the principal cylinder axis of the basic field magnet system 1 . for example , this prevents oscillation of the overall gradient coil system 3 in the direction of the principal cylinder axis from leading to distortions on magnetic resonance images . fig2 shows the longitudinal section of a magnetic resonance tomography apparatus in a further embodiment of the invention . compared to fig1 the apparatus does not have a decoupling mechanism 6 in the envelope 2 of the hollow opening 4 . instead , the apparatus in fig2 has a respective stiffening rings 8 in the regions of the two end faces 9 as a decoupling mechanism . oscillations emanating from the gradient coil system 3 are reflected each stiffening ring 8 , so that transmission of oscillations onto the overall outer envelope 2 is prevented . to this end , each stiffening ring 8 is rigidly connected to the envelope 2 at as many points as possible . this prevents the envelope 2 from vibrating under the stiffening ring 8 and thus transmitting oscillations past the stiffening ring 8 . in order to achieve a high weight and , thus a high noise - reducing effect , as well as to avoid degradation of the magnetic resonance image quality , each stiffening ring 8 is composed of high - density , non - ferromagnetic material , for example non - magnetic steel or lead . the oscillation - reducing and thus the noise - reducing effect , is greater as the weight of the stiffening ring 8 is made larger . the frequency range for which a vibration damping occurs becomes larger as the seating surface with the envelope 2 is made larger . in an embodiment , the cross - section of the stiffening ring 8 is no smaller than approximately five by five centimeters . so that the stiffening ring 8 is as unobtrusive as possible from the outside , it is arranged in a corresponding depression of the envelope 2 . fig3 shows the longitudinal section of a magnetic resonance tomography apparatus in a further embodiment of the invention . compared to the apparatus according to fig2 the apparatus in fig3 does not have any stiffening rings at the end faces 9 . instead , the envelope 2 has actuators 12 and sensors 13 as a decoupling arrangement that are disposed in annular regions 10 and 11 in or at the envelope 2 . the actuators 12 and sensors 13 are secured in the annular regions 10 on the surface of the hollow opening 4 outside the connecting devices 5 . the actuators 12 and sensors 13 are integrated into the envelope 2 at the two end faces 9 in the annular regions 11 . for example , the actuators 12 and sensors 13 are implemented as piezo elements . the actuators 12 and sensors 13 form a control circuit . the sensors 13 detect oscillations which arise and control the actuators 12 such that the actuators oppose the sensed oscillations by modifying their spatial extent . as a result , oscillations of the gradient coil system 3 are not transmitted via their connecting devices 5 onto the entire outer envelope 2 of the basic field magnet system 1 . fig4 shows a cross - section through the apparatus from fig3 . for example , actuators 12 and sensors 13 in the form of lamellae and / or films are connected in alternation to the envelope 2 rigidly and damping - free in the annular region 10 . actuators 12 and sensors 13 are integrated into the envelope in the annular region 11 . the actuators 12 and / or sensors are advantageously fashioned as fibers . as a further embodiment of the invention , fig5 shows a longitudinal section through a magnetic resonance tomography apparatus with a hollow - cylindrical basic field magnet system 1 having a superconducting coil arrangement 14 . the gradient coil system 3 is connected to the outer envelope 2 of the basic field magnet system 1 via two rings 15 of elastic material as well as two stiffening rings 8 . the stiffening rings 8 as well as the rings 15 of elastic material thereby form a decoupling mechanism 6 . further , the gradient coil system 3 , the decoupling mechanism 6 and the outer envelope 2 simultaneously form a vacuum housing for the superconducting coil arrangement 14 the rings 15 of elastic material simultaneously function as connections between the gradient coil system 3 and the basic field magnet system 1 . in view of the oscillation decoupling , the ring 15 of elastic material has properties similar to the bellows of fig1 . in order to compensate for a potential weakening of the structure of the hollow - cylindrical basic field magnet system 1 in the direction of the principal cylinder axis due to an absence of the outer envelope 2 between the stiffening rings 8 , a longitudinal stiffening is attached between the end faces 9 . the longitudinal stiffening 16 need not be circumferentially tubular , but can be an arrangement of a number of , for example , rod - shaped elements at individual angular positions . the magnetic resonance tomography apparatus with superconducting coil arrangement 14 has a cold head 17 that serves , among other things , for the coolant supply and power supply of the superconducting coil 14 . for suppressing or damping transmission of vibrations from the cold head 17 onto the envelope 2 of the basic field magnet system 1 , a decoupling mechanism 6 a in an annular arrangement is arranged between the cold head 17 and the outer envelope 2 of the basic field magnet system 1 at the point of transition of the cold head 17 into the basic field magnet system 1 . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art . | 6 |
the nozzle of the present invention may be used in connection with many types of fluid dispensers including the trigger sprayers and foamers of the types disclosed in u . s . pat . nos . 5 , 344 , 053 , 5 , 373 , 991 and 5 , 385 , 302 which are incorporated by reference into the present disclosure . however , the present invention may be applied to other types of fluid dispensers such as lotion pump and vertically - reciprocal spray dispensers . thus , for convenience and brevity , all of these fluid dispenser types will hereinafter be collectively referred to as &# 34 ; fluid dispensers &# 34 ;. typically , fluid dispensers 20 of the types used with the preferred embodiment of the present invention have a housing 22 which may be fastened to a container ( not shown ) by a closure ( not shown ). a passage 24 extends through the housing 22 from a first end ( not shown ) located within the interior of the container to a second end 26 located near the front of the housing 22 . the second end 26 comprises a horizontal fluid discharge passage 28 which may be configured to accept a fluid spinner 30 . the spinner 30 swirls liquid as it passes through the discharge passage 28 to improve the sprayer pattern of the liquid dispensed from the fluid dispenser 20 . in addition , the fluid dispenser 20 includes a trigger 32 which is pivotally attached to the dispenser housing 22 and a pump ( not shown ) which may be actuated by manually pivoting the trigger to draw liquid from the container interior , and pump the liquid through the fluid discharge passage 28 to dispense the liquid . further , a nozzle assembly or nozzle 40 is positioned at the front of the housing 22 as shown in fig1 . the nozzle 40 includes a front wall 42 positioned adjacent the second end 26 of the passage 24 and a cylindrical tube 44 which extends from the front wall rearwardly into the housing 22 to form the forward end of the fluid discharge passage 28 . an orifice 46 extends through the front wall 42 of the nozzle 40 through which liquid is dispensed from the fluid dispenser 20 . although other means of joining the nozzle 40 to the housing 22 are also contemplated , in the preferred embodiment , the housing includes a triangular hole 50 and the nozzle includes a protrusion 52 having a triangular cross section which engages with the hole in the housing to fasten the nozzle in place and to prevent the nozzle and housing from being separated . however , the nozzle assembly shown is illustrative only and the childproof closure of the invention may be attached to a trigger sprayer in any conventional manner and may be formed as an integral part of the trigger sprayer housing . in the preferred embodiment of the childproof closure , a door 60 is pivotally connected to the nozzle 40 by a living hinge 62 . the door 60 may be moved between an open position ( similar to the position shown in fig1 ) where liquid may be freely discharged from the trigger sprayer through nozzle orifice 46 , and a closed position ( as shown in fig3 and 4 ) where the nozzle orifice is blocked so that liquid is prevented from being dispensed through the nozzle orifice . as shown in fig1 the door 60 may include a semispherically - shaped projection 64 which seats against the nozzle orifice 46 to seal the orifice in the closed position of the door . thus , when the door 60 is in the closed position , the projection 64 is seated against the nozzle orifice 46 so that the orifice is blocked and fluid is prevented from being dispensed . in addition , the door 60 may include one or more tabs 66 , 68 extending from it in different directions to aid the user in grasping the door 60 when it is being opened and / or closed . one of the tabs 66 may be shaped and located so that it will fit within an aperture 70 provided in the housing 22 for holding the door 60 in its opened position . still further , the door 60 may be pivotally connected directly to the housing rather than to a separate nozzle 40 as in the preferred embodiment . although the nozzle 40 may be integrally formed with the housing or may be formed in several pieces , in the preferred embodiment the nozzle is a separate , one - piece assembly which seats within the fluid discharge passage 28 and which includes the door 60 integrally and pivotally connected to it . thus , the door 60 is integrally molded with the nozzle 40 in the preferred embodiment to reduce the number of dispenser component parts and its overall manufacturing cost . the dispenser 20 described above is fairly typical of prior art fluid dispensers and forms the background necessary to understand the child resistant nozzle of the present invention . nonetheless , the aforementioned description is only representative of a typical fluid dispenser 20 in which the child resistant nozzle may be used and variations to this typical fluid dispenser may be made without departing from the scope of the invention as described and claimed . fig2 - 4 show a first embodiment of this invention . the common features of the first embodiment shown in fig2 - 4 and the typical prior art dispenser shown in fig1 are indicated with identical numbers . a rectangular aperture 80 extends through the door 60 at a location which is between the tabs 66 , 68 on the door and the protrusion 64 for sealing the nozzle orifice 46 when the door is in the closed position . a cantilevered tongue 82 extends forward from the nozzle 40 immediately behind the aperture 80 when the door 60 is in the closed position so that the tongue may be inserted through the aperture when the door is in the closed position as shown in fig4 . the tongue is connected to the nozzle assembly or the sprayer housing by a living hinge 94 similar to the hinge connecting the door 60 to the nozzle assembly . a fulcrum surface 97 is provided adjacent the hinge . in pivoting the tongue upwardly from its position shown in fig3 to its position shown in fig4 a bottom surface 99 of the tongue engages against the fulcrum surface 97 and prevents further pivoting movement of the tongue about the hinge . thereafter , further upward movement of the tongue resiliently bends the tongue . the tongue is bent upwardly a small amount as the tip 92 of the tongue passes through the door aperture 80 . a detent 84 extends downwardly from the lower side 86 of the tongue 82 and seats against the outer surface 88 of the door when the door is moved to the closed position , thereby holding the door 60 in place . a ramp 90 extends from the tip 92 of the tongue 82 to the bottom of the detent 84 . the ramp eases the passing of the tongue 82 through the aperture 80 causing the tongue to bend upwardly as the door 60 is closed , thereby enabling the door aperture 80 to pass over the detent without interference from the detent . the resilience of the tongue 82 is such that , once the aperture 80 passes over the detent 84 as the door 60 is closed , the resilience of the tongue will bias the tongue downwardly causing the detent 84 to seat over the outer surface 88 of the door . thus , the door 60 is prevented from being opened without first unseating the detent 84 from the outer surface 88 of the door by bending the tongue 82 upwardly . further , the tongue 82 extends forward of the detent 84 so that it may be easily grasped to bend the tongue 82 upwardly and unseat the detent from the door surface . the hinge 94 permits the tongue 82 to be rotated downward to a disengaging position as shown in fig2 and 3 which prevents the tongue from engaging the aperture 80 when the door is in the closed position . thus , if the child resistant locking feature of the nozzle of the present invention is not desired , the user may simply pivot the tongue 82 downwardly to the disengaging position to prevent engagement of the tongue 82 in the aperture 80 and to disable the child resistant locking feature . a second embodiment of the present invention is shown in fig5 and 6 . as with the first embodiment , the nozzle 100 of the second embodiment has a door 102 with a rectangular aperture 104 . also as in the first embodiment , the nozzle 100 has a tongue 106 which engages with the aperture 104 of the door 102 when the door is moved to the closed position . however , the tongue 106 is not pivotally connected to the nozzle assembly . therefore , the tongue 106 of the second embodiment may not be moved to a disengaging position to prevent the tongue from engaging the aperture 104 . a detent 108 extends downwardly from the tongue 106 to seat against the outer surface 110 of the door 102 when in the closed position . both the door 102 and tongue 106 have ramps 112 , 114 to aid in the alignment of the tongue and aperture 104 as the door is closed and to bend the tongue upwardly as the aperture passes over the detent 108 . to disengage the locking closure , the tongue is bent upwardly so that the door aperture 104 may pass over the tongue detent 108 as the door is pivoted toward its open position . a third embodiment of the fluid dispenser nozzle 120 is shown in fig7 and 8 . this embodiment of the nozzle 120 also has a door 122 with a rectangular aperture 124 . the door 122 of the third embodiment is similar to that of the second embodiment except that the ramp on the door has been omitted from the door of the third embodiment . the third embodiment also includes a tongue 126 with a detent 128 extending from the upper side 130 of the tongue . the detent seats against the outer surface 132 of the door 122 when the door is moved to the closed position to prevent the door from being opened without first displacing the tongue downwardly . as with the other embodiments , a ramp 134 extends from the tip of the tongue 126 to the detent 128 to aid in the insertion of the tongue into the aperture 124 . to use the fluid dispensers associated with each of the three child resistant locking feature embodiments , the user must first deflect the tongue either upwardly in the embodiment of fig2 - 6 , or downwardly in the embodiment of fig7 and 8 , to unseat the detent of the tongue from the outer surface of the door . then , while holding the tongue in its deflected position and using a second movement , generally perpendicular to the first , the user grasps one of the tabs on the door , pivots the door forwardly , and slides the aperture over the detent and tongue to disengage the tongue from the aperture . the door may then be moved to a position similar to that shown in fig1 or pivoted further to the rear to a horizontal position to engage the tab 66 in the housing aperture 70 in order to hold the door in the fully - opened position . with the door in either of the open positions , the user may actuate the trigger to pump the fluid from the interior of the container attached to fluid dispenser and through the nozzle orifice . when the user is finished dispensing the fluid , he or she may grasp one of the tabs , disengage the tab from the aperture if necessary and pivot the door to the closed position as shown in fig4 or 8 . as the door is closed , the tongue penetrates the aperture and the ramp deflects the resilient tongue upwardly or downwardly to permit the detent to pass through the aperture . once the tongue detent passes through the aperture , the resilience of the tongue material biases the tongue toward its undeflected position with the detent engaging over the outer surface of the door . if use of the child resistant locking feature of the embodiment of fig2 - 4 is not desired , the user may simply pivot the tongue downwardly to the disengaging position shown in fig3 in which it does not engage the aperture as the door is closed . when the tongue is in the disengaging position , the door may be opened without the necessity of unseating the detent from the outer surface of the door . while the present invention has been described by reference to specific embodiments , it should be understood that modifications and variations of the invention may be constructed without departing from the scope of the invention defined in the following claims . | 1 |
preferred embodiments of the invention provide a method and system that efficiently places the payload of rdma communications into an application buffer . the application buffer is contiguous in the application &# 39 ; s virtual address space , but is not necessarily contiguous in the processor &# 39 ; s physical address space . the placement of such data is direct and avoids the need for intervening bufferings . the approach minimizes overall system buffering requirements and reduces latency for the data reception . fig4 is a high - level depiction of an rnic according to a preferred embodiment of the invention . a host computer 400 communicates with the rnic 402 via a predefined interface 404 ( e . g ., pci bus interface ). the rnic 402 includes an message queue subsystem 406 and a rdma engine 408 . the message queue subsystem 406 is primarily responsible for providing the specified work queues and communicating via the specified host interface 404 . the rdma engine interacts with the message queue subsystem 406 and is also responsible for handling communications on the back - end communication link 410 , e . g ., a gigabit ethernet link . for purposes of understanding this invention , further detail about the message queue subsystem 406 is not needed . however , this subsystem is described in co - pending u . s . patent application ser . nos . & lt ; to be determined & gt ;, filed on even date herewith , entitled system and method for work request queuing for intelligent adapter and system and method for placement of rdma payload into application memory of a processor system , which are incorporated herein by reference in their entirety . fig5 depicts a preferred rnic implementation . the rnic 402 contains two on - chip processors 504 , 508 . each processor has 16 k of program cache and 16 k of data cache . the processors also contain a separate instruction side and data side on chip memory busses . sixteen kilobytes of bram is assigned to each processor to contain firmware code that is run frequently . the processors are partitioned as a host processor 504 and network processor 508 . the host processor 504 is used to handle host interface functions and the network processor 508 is used to handle network processing . processor partitioning is also reflected in the attachment of on - chip peripherals to processors . the host processor 504 has interfaces to the host 400 through memory - mapped message queues 502 and pci interrupt facilities while the network processor 508 is connected to the network processing hardware 512 through on - chip memory descriptor queues 510 . the host processor 504 acts as command and control agent . it accepts work requests from the host and turns these commands into data transfer requests to the network processor 508 . for data transfer , there are three work request queues , the send queue ( sq ), receive queue ( rq ), and completion queue ( cq ). the sq and rq contain work queue elements ( wqe ) that represent send and receive data transfer operations ( dto ). the cq contains completion queue entries ( cqe ) that represent the completion of a wqe . the submission of a wqe to an sq or rq and the receipt of a completion indication in the cq ( cqe ) are asynchronous . the host processor 504 is responsible for the interface to host . the interface to the host consists of a number of hardware and software queues . these queues are used by the host to submit work requests ( wr ) to the adapter 402 and by the host processor 504 to post wr completion events to the host . the host processor 504 interfaces with the network processor 508 through the inter - processor queue ( ipcq ) 506 . the principle purpose of this queue is to allow the host processor 504 to forward data transfer requests ( dto ) to the network processor 508 and for the network processor 508 to indicate the completion of these requests to the host processor 504 . the network processor 508 is responsible for managing network i / o . dto work requests ( wrs ) are submitted to the network processor 508 by the host processor 504 . these wrs are converted into descriptors that control hardware transmit ( txp ) and receive ( rxp ) processors . completed data transfer operations are reaped from the descriptor queues by the network processor 508 , processed , and if necessary dto completion events are posted to the ipcq for processing by the host processor 504 . under a preferred embodiment , the bus 404 is a pci interface . the adapter 404 has its base address registers ( bars ) programmed to reserve a memory address space for a virtual message queue section . preferred embodiments of the invention provide a message queue subsystem that manages the work request queues ( host → adapter ) and completion queues ( adapter → host ) that implement the kernel bypass interface to the adapter . preferred message queue subsystems : 1 . avoid pci read by the host cpu 2 . avoid locking of data structures 3 . support a very large number of user mode host clients ( i . e . qp ) 4 . minimize the overhead on the host and adapter to post and receive work requests ( wr ) and completion queue entries ( cqe ) with reference to fig5 , the processing of receive data is accomplished cooperatively between the netppc 508 and the rxp 512 . the netppc 508 is principally responsible for protocol processing and the rxp 512 for data placement , i . e . the placement of incoming packet header and payload in memory . the netppc and rxp communicate using a combination of registers , and memory based tables . the registers are used to configure , start and stop the rxp , while the tables specify memory locations for buffers available to place network data . support for standard sockets applications is provided through the native stack . to accomplish this , the adapter looks look like two ethernet ports to the host . one virtual port ( and mac address ) is used for rdma / toe data and another virtual port ( and mac address ) is used for compatibility mode data . ethernet frames that arrive at the rdma / toe mac address are delivered via an rnic verbs like interface , while frames that arrive at the other mac address are delivered via a network - adapter like interface . network packets are delivered to the native or rdma interface per the following rules : unicast packets to the rdma / toe mac address are delivered to the rdma / toe interface unicast packets to the compatibility address are delivered to the compatibility interface broadcast packets are delivered to both interfaces multicast packets are delivered to both interfaces . compatibility mode places network data through a standard dumb - ethernet interface to the host . the interface is a circular queue of descriptors that point to buffers in host memory . the format of this queue is identical to the queue used to place protocol headers and local data for rdma mode packets . the difference is only the buffer addresses specified in the descriptor . the compatibility - mode receive queue ( hrxdq ) descriptors point to host memory , while the rdma mode queue ( rxdq ) descriptors point to adapter memory . rdma / toe mode data is provided to the host through an rnic verbs - like interface . this interface is implemented in a host device driver . the netppc processor manages the mapping of device driver verbs to rxp hardware commands . this description is principally concerned with the definition of the rxp hardware interface to the netppc . fig6 is a block diagram of the various components of the rxp controller of preferred embodiments . the rxp module has five interfaces : the rxdq bram interface 602 ; the hrxdq bram interface 604 ; the hash table lookup interface 606 ; gmac core interface 608 ; and pci / plb interface 610 . the rxdq bram 602 interface provides the control and status information for reception of fast - path data traffic . through this interface , the rxp reads the valid rxd entries formulated by the netppc and updates the status after receiving each data packet in fast - path mode . hrxdq bram interface 604 provides the control and status information for reception of host - compatible data traffic . through this interface , the rxp reads the valid hrxd entries formulated by the netppc and updates the status after receiving each data packet in host - compatible mode . the hash interface 606 is used in connection with identifying a placement record from a corresponding collection of such . under certain embodiments a fixed size index is created with each index entry corresponding to a hash bucket . each hash bucket in turn corresponds to a list of placement records . a hashing algorithm creates an index identification by hashing the 4 - tuple of network ip addresses and port identifications for the sender and recipient . the bucket is then traversed to identify a placement record having the corresponding , matching addresses and port identifications . in this fashion , network addresses and ports may be used to time and space efficiently locate a corresponding placement record . the placement records ( as will be described below ) are used to directly store message payload in host application buffers . the gmac core interface 608 receives data 8 bits at a time from the network . the pci / plb interface 610 provides the channel to store received data into host memory and / or local data memory as one or multiple data segments . the rcvfifo write process module 612 controls the address and write enable to the rcvfifo 614 . it stores data 8 bits at a time into the rcvfifo from the network . if the received packet is aborted due to crc or any other network errors , this module aborts the current packet reception , flushes the aborted packet from rcvfifo , and resets all receive pointers for next incoming packet . once a packet is loaded into the data buffer , it updates a packet valid flag to the rcvfifo read process module the rcvfifo 614 is 40 kbytes deep , and this circular ring buffer is efficient to store maximum number of packets . the 40 kbytes is needed to store enough maximum packets in case that lossless traffic and flow control are required . this data buffer is 8 bits wide on the write port and 64 bit wide on the read port . the packet length and other control information for each packet are stored in the corresponding entries in the control fifo . flow control and discard policy are implemented to avoid fifo overflow . the ctrlfifo write process module 616 controls the address and write enable to the ctrlfifo 618 . it stores the appropriate header fields into ctrlfifo and processes each header to identify the packet type . this module decodes the ethernet mac address to determine the fast - path or host - compatible data packets . it also identifies multicast and broadcast packets . it checks the ip / tcp header and validates mpa crcs . once a header is loaded into the control fifo , it updates the appropriate valid flags to the ctrlfifo . this module controls a 8 bit date interface to the control fifo . the ctrlfifo 618 is 4 kbytes deep . each entry is 64 bytes and contains header information for each corresponding packet stored in the rcvfifo . this data buffer is 8 bits wide on the write port and 64 bit wide on the read port . flow control and discard policy are implemented to avoid fifo overflow . the checksum process module 619 is used to accumulate both ip and tcp checksums . it compares the checksum results to detect any ip or tcp errors . if errors are found , the packet is aborted and all fifo control pointers are adjusted to the next packet . the rcvpause process module 620 is used to send flow control packets to avoid fifo overflows and achieve lossless traffic performance . it follows the 802 . 3 flow control standards with software controls to enable or disable this function . the rcvfifo read process module 622 reads 64 bit data words from rcvfifo 614 , and sends the data stream to pci or plb interface 610 . this module processes data packets stored in the rcvfifo 614 in a circular ring to keep the received data packet in order . if the packet is aborted due to network errors , it flushes the packet and updates all control pointers to next packet . after a packet is received and stored in host or local memory , it frees up the data buffer by sends the completion indication to rcvfifo write process module . the ctrlfifo read process module 624 reads 64 bit control words from the ctrlfifo 618 , and examines the control information for each packet to determine its appropriate data path and its packet type . this module processes header information stored in the ctrlfifo and it reads one entry at a time to keep the received packet in order . if the packet is aborted due to network errors , it updates the control fields of the packet and adjusts pointers to next header entry . after a packet is received and stored in host or local memory , it goes to the next header entry in the control fifo and repeats the process . the rxp main process module 626 takes the control and data information from both rcvfifo read proc 622 and ctrlfifo read proc 624 , and starts the header and payload transfers to plb and / or pci interface 610 . it also monitors the readiness of rxdq and hrxdq entries for each packet transfer , and updates the completion to rxd and hrxd based on the mode of operation . this module initiates the dma requests to plb or pci for single or multiple data transfers for each received packet . it performs all tables and record lookups to determine the type of operation required for each packet , and operations include hash table search , placement record read , utrxd lookup , stag information retrieval , pci address lookup and calculation . the rxdq process module 628 is responsible for requesting rxd entry for each incoming packet in fast - path , multicast and broadcast modes . at the end of the packet reception , it updates the flag and status fields in the rxd entry . the hrxdq process module 630 is responsible for requesting hrxd entry for each incoming packet in host compatible and broadcast modes . at the end of the packet reception , it updates the flag and status fields in the hrxd entry . there are two rdma data placement modes : local mode , and direct mode . in local mode , network packets are placed entirely in the buffer provided by an rxd . in direct mode , protocol headers are placed in the buffer provided by an rxd , but the payload is placed in host memory through a per - connection table as described blow . in direct mode , there are two classes of data placement : untagged , and tagged . untagged placement is used for rdma send , send and invalidate , send with solicited event and send and invalidate with solicited event messages . tagged placement is used to place rdma read request , and rdma write messages . the different modes define which tables are consulted by the rxp when placing incoming data . fig7 illustrates the organization of the tables that control the operation of the rxp 512 . the block arrows illustrate the functionality supported by the data structures to which they point . the hostcpu 702 , for example uses the hrxdq 630 to receive compatibility mode data from the interface . the fine arrows in the figure indicate memory pointers . the data structures in the figure are contained in either sdram or block ram depending on their size and the type and number of hardware elements that require access to the tables . at the top of the diagram are the host cpu 702 , netppc 508 , and hostppc 504 . the host cpu is responsible for scrubbing the hrxdq 630 that contains descriptors pointing to host memory locations where receive data has been placed for the compatibility interface . the netppc 508 is responsible for protocol processing , connection management and receive dto wqe processing . protocol processing involves scrubbing the rxdq 628 that contains descriptors pointing to local memory where packet headers and local mode payload have been placed . connection management involves creating placement records 704 and adding them to the placement record hash table 706 that allows the rxp 512 to efficiently locate per - session connection data and per - session descriptor queues . receive dto wqe processing involves creating utrxdq descriptors 708 ( untagged receive descriptor queue ) for untagged data placement , and completing rq wqe when the last ddp message is processed from the rxdq . the hostppc 504 is responsible for the bulk of verbs processing to include memory registration . memory registration involves the creation of stag 710 , stag records 712 and physical buffer lists ( pbls ) 714 . the stag is returned to the host client when the memory registration verbs are completed and are submitted to the adapter in subsequent send and receive dto requests . the hardware client of these data structures is the rxp 512 . the principle purpose of these data structures , in fact , is to guide the rxp in the processing of incoming network data . packets arriving with the compatibility mode mac address are placed in host memory using descriptors obtained from the hrxdq . these descriptors are marked as “ used ” by setting bits in a flags field in the descriptor . any packet that arrives at the rdma mac address will consume some memory in the adapter . the rxdq 628 contains descriptors that point to local memory . one rxd from the rxdq will be consumed for every packet that arrives at the rdma mac interface . the protocol header , the payload , or both are placed in local memory . the rxp 512 performs protocol processing to the extent necessary to perform data placement . this protocol processing requires keeping per - connection protocol state , and data placement tables . the placement record hash table 706 , placement record 704 and utrxdq 708 keep this state . the placement record hash table provides a fast method for the rxp 512 to locate the placement record for a given connection . the placement record itself keeps the connection information necessary to correctly interpret incoming packets . untagged data placement is the process of placing untagged ddp message payload in host memory . these memory locations are specified per - connection by the application and kept in the utrxdq . an untagged receive descriptor contains a scatter gather list of host memory buffers that are available to place an incoming untagged ddp message . finally , the rxp is responsible for tagged mode data placement . in this mode , an stag is present in the protocol header . this stag 710 points to an stag record 712 and pbl 714 that are used to place the payload for these messages in host memory . the rxp 512 ensures that the stag is valid in part by comparing fields in the stag record 712 to fields in the placement record 704 . the table below provides a detailed description of each of the tables in the diagram . acronym name description hrxdq host receive contains descriptors used by the rxp to place data descriptor queue in compatibility mode . rxdq receive descriptor queue contains descriptors used by the rxp to place data in local mode and to place the network header portion of tagged and untagged ddp messages . ht hash table a 4096 element array of pointers to placement records . this table is indexed by a hash of the 4 - tuple key . pr placement record a table containing the 4 - tuple key and pointers to placement tables used for untagged and tagged mode data placement . utrxdq untagged receive contains descriptors used for untagged mode data descriptor queue placement . there are as many elements in this queue as there are entries in the rq for this endpoint / queue - pair . stag steering tag a pointer to a 16byte aligned stag record . the bottom 8 bits of the stag are ignored . stag steering tag a record steering tag specific information about the record record memory region registered by the client . pbl physical buffer list a page map of a virtually contiguous area of host memory . a pbl may be shared among many steering tags . the host receive descriptor queue 630 is a circular queue of host receive descriptors ( hrxd ). the base address of the queue is 0xfb00 — 0000 and the length is 0x1000 bytes . fig8 illustrates the organization of this queue . a host 702 populates the queue with hrxd 802 that specify host memory buffers 804 to receive network data . each buffer specified by an hrxd must be large enough to hold the largest packet . that is , each buffer must be at least as large as the maximum transfer unit size ( mtu ). when the rxp 512 has finished placing the network frame in a buffer , it updates the appropriate fields in the hrxd 802 to indicate byte counts 806 and status information 808 , updates the flags field 810 of the hrxd to indicate the completion status , and interrupts the host to indicate that data is available . more specifically , under preferred embodiments , the format of an hrxd 802 is as follows : field length description flags 2 an 8 - bit flag word as follows : rxd_ready this bit is set by the host to indicate to the rxp that this descriptor is ready to be used . this bit is reset by the rxp before setting the rxd_done bit . rxd_done this bit is set by the rxp to indicate that the hrxd has been consumed and is ready for processing by the host . this bit should be set to zero by the host before setting the rxd_ready bit . status 2 the completion status for the packet . this field is set by the rxp as follows : rxd_ok the packet was placed successfully . rxd_buf_ovfl a packet was received that contained a header and / or payload that was larger than the specified buffer length . count 2 the number of bytes placed in the buffer by the rxp len 2 the 16 - bit length of the buffer . this field is set by the host . addr 8 the 64 bit pci address of the buffer in host memory . coordination between the host 702 and the rxp 512 is achieved with the rxd_ready and rxd_done bits in the flags field 810 . the host and the rxp each keep a head index into the hrxdq . to initialize the system , the host sets the addr 812 and len fields 814 to point to buffers 804 in host memory 801 as shown in fig8 . the host sets the rxd_ready bit in each hrxd to one , and all other fields ( except addr , and len ) in the hrxd to zero . the host starts the rxp by submitting a request to a hostppc verbs queue that results in the hostppc 504 writing rxp_compat_start to the rxp command register . the host keeps a “ head ” index into the hrxdq 630 . when the flags field 810 of the hrxd at the head index is rxd_done , the host 702 processes the network data as appropriate , and when finished marks the descriptor as available by setting the rxd_ready bit . the host increments the head index ( wrapping as needed ) and starts the process again . similarly , the rxp 512 keeps a head index into the hrxdq 630 . if the flags field 810 of the hrxd at the head index is not rxd_ready , the rxp waits , accumulating data in the receive fifo 614 . data arriving after the fifo has filled will be dropped . when the rxd_ready bit is set , the rxp 512 places the next arriving frame into the address at addr 812 ( up to the length specified by len 814 ). when finished , the rxp sets the rxd_done bit and increments its head index ( wrapping as needed ). the rxp interrupts the host if the queue just went non - empty at x packets / second , interrupt when the queue is y full or after z milliseconds . the receive descriptor queue 628 is a circular queue of receive descriptors ( rxd ). the address of the queue is 0xfc00_e000 and the queue is 0x800 bytes deep . fig9 illustrates the organization of these queues . the netppc 508 populates the receive descriptor queue 628 with rxd 902 that specify buffers 904 in local adapter memory 906 to receive network data . each buffer 904 specified by an rxd 902 must be large enough to hold the largest packet . that is , each buffer must be at least as large as the mtu . when the rxp 512 has finished placing the network frame , it updates the appropriate fields in the rxd to indicate byte counts 908 and status information 910 and then updates the flags field 912 of the rxd to indicate the completion status . more specifically , under preferred embodiments , the format of an rxd - receive descriptor , is as follows : field length description flags 2 an 8 - bit flag word as follows : rxd_ready this bit is set by the netppc to indicate to the rxp that this descriptor is ready to be used . this bit is reset by the rxp before setting the rxd_done bit . rxd_done this bit is set by the rxp to indicate that the rxd has been consumed and is ready for processing by the netppc . this bit should be set to zero by the netppc before setting the rxd_ready bit . rxd_header if set , this buffer was used to place the network header of a packet . if this bit is set , one of either tcp , tagged , or untagged is set as well . rxd_tcp if set , this rxd contains a header for a tcp message . the ctxt field points to a utrxd . rxd_tagged if set , this rxd contains a header for a tagged ddp message and the ctxt field below contains an stag pointer . rxd_untagged if set , this rxd contains a header for an untagged ddp message and the ctxt field below points to an utrxd . rxd_last if set , this is the packet completes a ddp message . status 2 the completion status for the packet . this field is set by the rxp as follows : rxd_ok the packet was placed successfully . rxd_buf_ovfl a packet was received that contained a header and / or payload that was larger than the specified buffer length . rxd_ut_ovfl a ddp or tcp message was received , but there was no utrxd available to place the data . bad_qp_id the qp id for an stag didn &# 39 ; t match the qp id in the placement record bad_pd_id the pp_id for an stag didn &# 39 ; t match the pd_id in the placement record . addr 4 the local address of the buffer containing the data count 2 the number of bytes placed in the buffer by the rxp len 2 the length of the buffer ( set by the netppc ) prptr 4 pointer to the placement record associated with the protocol header . valid if the header bit in flags is set . ctxt 4 if the flags field has the tagged bit set , this field contains the stag that completed . if the untagged bit is set , this field contains a pointer to the utrxd that was used to place the data . this field is set by the rxp . reserved 12 total 32 coordination between the netppc 508 and the rxp 512 is achieved with the rxd_ready and rxd_done bits in the flags field 912 . the netppc and the rxp keep a head index into the rxdq . to initialize the system , the netppc sets the addr 914 and len fields 916 to point to buffers in plb sdram 906 as shown in fig9 . the netppc sets the rxd_ready bit in each rxd 902 to one , and all other fields ( except addr , and len ) in the rxd to zero . the netppc starts the rxp by writing rxp_start to the rxp command register . the netppc 508 keeps a “ head ” index into the rxdq 628 . when the flags field 912 of the rxd at the head index is rxd_done , the netppc processes the network data as appropriate , and when finished marks the descriptor as available by setting the rxd_ready bit . the netppc increments the head index ( wrapping as needed ) and starts the process again . similarly , the rxp 512 keeps a head index into the rxdq 628 . if the flags field 912 of the rxd 902 at the head index is not rxd_ready , the rxp drops all arriving packets until the bit is set . when the rxd_ready bit is set , the rxp places the next arriving frame into the address at addr 914 ( up to the length specified by len 916 ) as described in a later section . when finished , the rxp sets the rxd_done bit , increments its head index ( wrapping as needed ) and continues with the next packet . untagged and tagged data placement use connection specific application buffers to contain network payload . the adapter copies network payload directly into application buffers in host memory . these buffers are described in tables attached to a placement record 704 located in a hash table ( ht ) 706 as shown in fig7 and 9 , for example . the ht 706 is an array of pointers 707 to lists of placement records . under certain embodiments , the hash index is computed as follows : uint32 hash ( uint32 src_ip , uint16 src_port , uint32 dst_ip , uint16 dst_port ) { int h ; h = (( src_ip xor src_port ) xor ( dst_ip xor dst_port )); h = h xor ( h shift_right 16 ); h = h xor ( h shift_right 8 ); return h modulo 4096 ; } const int32 hash_tb1_size = 4096 ; placement_record find_placement_record ( int32 src_ip , int16 src_port , int32 dest_ip , int16 dest_port ) { placement_record pr ; int32 index ; index = hash ( src_ip , src_port , dest_ip , dest_port ) modulo hash_tb1_size ; pr = hash_table [ index ]; while ( pr != null ) { if ( ( src_ip equals pr . src_ip ) and ( dest_ip equals pr . dest_ip ) and ( src_port equals pr . src_port ) and ( dest_port equals pr . dest_port )) { return pr ; } } pr = pr . next ; } return pr ; } the contents of a placement record 704 are as follows : size field ( bytes ) description src ip 4 the source ip address dest ip 4 destination ip address src port 2 the source port number dest port 2 destination port number type 1 the pcb type : rdmap flags 1 8bit status field : rdma_mode setting this flag causes the rxp to transition to rdma placement / mpa framing mode . last_entry setting this flag to indicate that this is the last entry in the placement record list . utrxq depth 1 the number of descriptors in the utrxq specified as a mask limit mask . the depth must be a power of 2 . the mask is computed as depth − 1 . reserved 1 pd id 4 protection domain id qp ld 4 qp or ep id utrxq ptr 4 pointer to the utrxq . a utrxq must be located on a 256b boundary . next ptr 4 pointer to the next pr that hashes to the same bucket pcb ptr 4 a pointer to the protocol control block for this stream mtu 2 the mtu on the route from this host to the remote peer . reserved 2 total size 40 the utrxdq 708 is an array of utrxd used for the placement of untagged ddp messages . this table is only used if the rdma_mode bit is set in the placement record 704 . an untagged data receive descriptor ( utrxd ) contains a scatter gather list ( sgl ) that refers to one or more host memory buffers . ( thus , though the host memory is virtually contiguous , it need not be physically contiguous and the sgl supports non - contiguous placement in physical memory .) network data is placed in these buffers in order from first to last until the payload for the ddp message has been placed . the netppc 508 populates the utrxdq 708 when the connection is established and the placement record 704 is built . the number of elements in the utrxdq varies for each connection based on parameters specified by the host 702 and messages exchanged with the remote rdmap peer . the utrxdq 708 and the utrxd are allocated by the netppc 508 . the base address of the utrxdq is specified in the placement record . if there are no utrxd remaining in the queue 708 when a network packet arrives for the connection , the packet is placed locally in adapter memory . the table below illustrates a preferred organization for an untagged receive data descriptor ( utrxd ). size field ( bytes ) description flags 1 rxp_done this bit is reset by software and set by hardware . the rxp sets this value when a ddp message with the last bit in the header is placed . the rxp will place all data for this ddp message locally after this bit is set . reserved 3 sgl_len 4 total length of this sgl mn 4 the ddp message number placed using this descriptor . this value is set by firmware and used by hardware to ensure that the incoming message is for this entry and isn &# 39 ; t an out - of - order segment whose mn is an alias for this mn in the utrdq . sgecnt 4 number of entries in sge array context 8 a netppc specified context value . this field is not used or modified by the rxp . sgearray ? an array of scatter gather entries ( sge ) as defined below . the table below illustrates a preferred organization for an entry in the scatter gather list ( sge ). field size description stag 4 a steering tag that was returned by a call to one of the memory registration api or wr . the top 24 bits of the stag is a pointer to a stag record as described below . len 2 the length of a buffer in the memory region or window specified by stag . reserved 2 to 8 the offset of buffer in the memory region or window specified by stag . connection setup and tear down is handled by software . after the connection is established , the firmware creates a placement record 704 and adds the placement record to the hash table 706 . immediately following connection setup , the protocol sends an mpa start key and expects an mpa start key from the remote peer . the mpa start key has the following format : bytes bits contents 0 - 14 “ mpa ident frame ” 15 name description 0 m declares a receiver &# 39 ; s requirement for markers . when ‘ 1 ’, markers must be added when transmitting to this peer . 1 c declares an endpoint &# 39 ; s preferred crc usage . when this field is ‘ 0 ’ from both endpoints , crcs must not be checked and should not be generated . when this bit is ‘ 1 ’ from either endpoint , crcs must be generated and checked by both endpoints . 2 - 3 res reserved for future use , must be sent as zeroes and not checked by receiver . 4 - 7 rev mpa revision number . set to zero for this version of mpa . following mpa ( marker pdu architecture ) protocol initialization , the rdmap protocol expects a single mpa pdu containing connection private data . if no private data is specified at connection initialization , a zero length mpa pdu is sent . the rdmap protocol passes this data to the dat client as connection data . given the connection data , the client configures the queue pairs qp and binds the qp to a tcp endpoint . at this point , the firmware transitions the placement record to rdma mode by setting the rdma_enable bit in the placement record . when the firmware inserts a placement record 704 into the hash table 706 it must first set the nextptr field 716 of the new placement record to the value in the hash table bucket , and then set the hash table bucket pointer to point to the new placement record . a race occurs between the time the nextptr field is set in the new placement record and before the hash table bucket head has been updated . if the arriving packet is for the new connection , the artifact of the race is that the rxp will not find the newly created placement record and place the data locally . since this is the intended behavior for a new placement record , this race is benign . if the arriving packet is for another connection , the rxp will find the placement record for that connection because the hash table head has not yet been updated and the list following the new placement record is intact . this race is also benign . the removal of a placement record 704 should be initiated after the connection has been completely shut down . this is done by locating the previous placement record or hash table bucket and setting it to point to the placement record nextptr field . the placement record should not be reused or modified until at least one additional frame has arrived at the interface to ensure that the placement record is not currently being used by the rxp . fig1 is a state diagram , depicting the states of the rxp on the reception of a rdma packet . in the diagram the abbreviation pr stands for placement record , and “ eval ” stands for evaluate . the state “ direct placement ” refers to the state of directly placing data in host memory , discussed above . the marker pdu architecture ( mpa ) provides a mechanism to place message oriented upper layer protocol ( ulp ) pdu on top of tcp . fig1 illustrates the general format of an mpa pdu . because markers 1102 and crc 1104 are optional , there are three variants shown . mpa 1106 enables the reliable location of record boundaries in a tcp stream if markers , the crc , or both are present . if neither the crc nor markers are present , mpa is ineffective at recovering lost record boundaries resulting from dropped or out of order data . for this reason , the variant 1108 with neither crc nor markers isn &# 39 ; t considered a practical configuration . for receive , the rxp 512 supports only the second variant 1110 , i . e . crc without markers . when sending the mpa start key , the rxp will specify m : 0 and crc : 1 which will force the sender to honor this variant . the rxp 512 will recognize complete mpa pdu , and is able to resynchronize lost record boundaries in the presence of dropped and out of order arrival of data . the rxp does not support ip fragments . if the frag bit is set in the ip header 1112 , the rxp will deliver the data locally . the algorithm supported by the rxp for recognizing a complete mpa pdu is to first assume that the packet is a complete mpa pdu . if this is the case , then do the following : 1 . the value in the mpa header 1114 + offset of the mpa header from the start of the packet equals the total length specified in the ip header 1112 , and 2 . the crc 11104 located at the end of the packet matches the mpa crc computed on the current mpa pdu . under preferred embodiments , if either of these assertions is false , the packet is placed locally . as depicted in fig1 an mpa pdu 1202 is broken into two tcp segments 1204 , 1206 . regardless of how this could possibly happen , the first and second segments are recognized as impartial mpa pdu fragments and placed locally . the first segment 1204 contains an mpa header 1208 ; however , the length in the header reaches beyond the end of the segment and therefore per rule 1 above is placed locally . the second segment 1208 doesn &# 39 ; t contain an mpa header , but does contain the trailing segment . in this case , even if by chance the bytes following tcp header were to correctly specify the length of the packet , the trailing crc would not match the payload and per rule 2 above would be placed locally . fig1 shows a single tcp segment 1302 that contains multiple mpa pdu . although this is legal , the rxp 512 will place this locally . under preferred embodiments of the invention , the transmit policy is to use one pdu per tcp segment . fig1 shows a sequence of three valid mpa pdu in three tcp segments . the middle segment is lost . in this case , the first and third segments will be recognized as valid and directly placed . the missing segment will be retransmitted by the remote peer because tcp will only acknowledge the first segment . it should be noted , in this case , that placing the third segment out of order is of questionable value because it will be retransmitted by the remote peer and directly placed a second time . in order to take advantage of the receipt and placement of the third segment , we will need to support selective acknowledgement . the queue number , message number , and message offset are used to determine whether the data is placed locally or directly into host memory . if the queue number in the ddp header is 1 or 2 , the packet is placed locally . these queue numbers are used to send rdma read requests and terminate messages respectively . since these messages are processed by the rdmap protocol in firmware , they are placed in local memory . if the queue number in the ddp header is 0 , the packet is a rdma send , rdma send and invalidate , rdma send with solicited event , or rdma send and invalidate with solicited event . in all of these cases , the payload portion of these messages is placed directly into host memory . a single utrxd is used to place the payload for a single untagged ddp message . a single untagged ddp message may span many network packets . the first packet in the message contains a message offset of zero . the last packet in the message has the last bit set to ‘ 1 ’. all frames that comprise the message are placed using a single utrxd . the payload is placed in the sgl without gaps . the hardware uses the message number in the ddp header to select which of the utrxd in the utrxdq is used for this message . the message offset in conjunction with the sgl in the selected utrxd is used to place the data in host memory . the message number modulo the utrxdq depth is the index in the utrxdq for the utrxd . the sgl consists of an array of sge . an sge in turn contains an stag , target offset ( to ), and length . the protocol headers in each of the packets that comprise the message are placed in local rnic memory . each packet consumes an rxd from the rxdq . the netppc 508 will therefore “ see ” every packet of an untagged ddp message . all header bytes up to and including the ddp header are placed in the buffer 904 pointed to by the addr field 914 . the count field 916 is set to the length of the protocol header placed at addr the flags field 912 is set as follows : the header bit is set the untagged bit is set the last bit is set if this is the last network packet in the message ( as indicated by the last bit in the ddp header ). the prptr field 918 is set to point to the placement record 704 . the ctxt field 920 is filled with a pointer to the associated utrxd 708 . the utrxd 708 is used for data placement as follows : the message number in the utrxd is compared to the message number in the ddp header . if they do not match , the ddp message received is for a subsequent message for which there is no utrxd entry . in this case , the data is placed locally . base_offste = 0 ; bytes_remaining = ddp . message_length for ( i = 0 ; i & lt ; sge_count ; i ++) { if ( ddp . message_offset & gt ; base_offset + utrxd , sge [ i ] . length ) { base_offset = base_offset + utrxd . sge [ i ] . length ; continue ; } if ( utrxd . sge [ i ] . stag . qp_id != 0 & amp ;& amp ; utrxd . sge [ i ] . stag . qp_id != placementrecord . qd 1 &# 39 ; id ) { utrxd . flags |= bad_qp_id ; break ; } if ( itrxd . sge [ i ] . stag . pd_id != placementrecord . pd_id ) { utrxd . flags |= bad_pd_id ; break ; } sge_offset = ddp . message_offset − base_offset ; sge_remaining = utrxd . sge [ i ] . length − sge_offset ; if ( bytes_remaining ’ 2 sge_remaining ) copy_bytes = sge_remaining ; else copy_bytes = bytes_remaining ; to = utrxd . sge [ i ] . to + sge_offset ; copytopci ( utrxd . sge [ i ] . stag , to , copy_bytes ); bytes d — remaining = bytes_remaining − copy_bytes ; if ( bytes_remaining != 0 ) continue ; break ; } if ( utrxd . flags == 0 & amp ;& amp ; bytes_remaining != 0 ) { rxd . flags != rxd_error ; utrxd . flags |= overflow ; } the contents of the utrxd 708 are updated as follows : if the last bit was set in the rxd , the complete bit is set if an error was encountered the error bit is set the count field is updated with the number of additional bytes written to the sgl to complete processing , the rxp 512 sets the rxd_done bit and resets the rxd_done bit in the rxd 902 . if the sgl in the utrxd is exhausted before all data in the ddp message is placed , an error descriptor ( erd ) is posted to the rxdq 628 to indicate this error . an stag is a 32 - bit value that consists of a 24 - bit stag index 710 and an 8 - bit stag key . the stag index is specified by the adapter and logically points to an stag record . the stag key is specified by the host and is ignored by the hardware . logically , an stag is a network - wide memory pointer . stags are used in two ways : by remote peers in a tagged ddp message to write data to a particular memory location in the local host , and by the host to identify a virtually contiguous region of memory into which untagged ddp data may be placed . stags are provided to the adapter in a scatter gather list ( sgl ). in order to conserve memory in the adapter , an stag index is not used directly to point to an stag record . an stag index is “ twizzled ” as follows to arrive at an stag record pointer as follows : fig1 illustrates the organization of the various data structures that support stags . the stag record 1502 contains local address and endpoint information for the stag . this information is used during data placement to identify host memory and to ensure that the stag is only used on the appropriate endpoint . field size description magic 2 a number ( global to all stag ) specified when the stag was registered . this value is checked by the hardware to validate a potentially corrupted or forged stag specified in a ddp message . state 1 ‘ 1 ’ valid : cleared by rxp when receiving a send and invalidate rdma message . this bit is set by the software to allow rxp for rdma . if this bit is not set , rxp will abort all received packets associated with this stag record . ‘ 2 ’ shared : used by firmware ‘ 4 ’ window : used by firmware access 1 ‘ 1 ’ local_read : checked by firmware when posting rq wr . checked by hardware for rdma read reply . ‘ 2 ’ local_write : checked by firmware when posting an rq wr ‘ 4 ’ remote_read : checked by the firmware before responding to a rdma read request . ‘ 8 ’ remote_write : checked by the hardware before placing a received rdma write request . pblptr 4 pointer to the physical buffer list for the virtually contiguous memory region specified by the stag . pd id 4 the protection domain id . this value must match the value specified in the placement record for this connection . qp id 4 the queue pair id . this value must match the qp id contained in the placement record . vabase 8 the virtual address of the base of the virtually contiguous memory region . this value may be zero . 32 the physical buffer list 1504 defines the set of pages that are mapped to the virtually contiguous host memory region . these pages may not themselves be either contiguous or even in address order . field size description fbo 2 the offset into the first page in the list where the virtual memory region begins . the vabase specified in the stag record modulo the pgsize below must equal this value . pgbytes 2 the size in bytes of each page in the list . all pages must be the same size . the page size must be modulo of 2 . refcnt 4 the number of stags that point to this pbl . this is incremented and decremented by software when creating and destroying stags as part of memory registration and is used to know when it is safe to destroy the pbl . pgcount 3 the number of pages in the array that follows reserved 1 pgarry 8 + an array count elements ion of 64 - bit pci addresses . a pbl 1504 can be quite large for large virtual mappings . the pbl that represents a 16 mb memory region , for example , would contain 4096 8 - byte pci addresses . the pbl would require 12 + 8 * 4096 = 32 , 780 bytes of memory . an stag logically identifies a virtually contiguous region of memory in the host . the mapping between the stag and a pci address is implemented with the physical buffer list 1504 pointed to by the pbl pointer 1506 in the stag record 1502 . fig1 illustrates how the pbl 1504 maps the virtual address space . the physical pages in the figure are shown as contiguous to make the figure easy to parse ; however , in practice they need not be physically contiguous . the mapping of an stag and target offset ( to ) to a pci address is accomplished as follows : map_to_pci ( stag , to , len ) { /* get pointer to the stag record from the stag */ stag_record_ptr = (( stag & amp ; 0xffffff00 ) & gt ;& gt ; 3 ) | 0xe0000000 ; /* compute the offset into the virtual memory region */ va_offset = to − stag_record -& gt ; vabase ; /* note that the first page offset is added to * the virtual offset . this is because the memory * region may not start at the beginning of a page */ pbl_offset = va_offset + stag_record_ptr -& gt ; pblptr -& gt ; fbo ; /* compute the page number in the pbl . page_no = pbl_offset / stag_record_ptr -& gt ; pblptr -& gt ; pgsize ; pci_address = stag_record_ptr -& gt ; pbl [ page_no ] + ( pbl_offset % stag_record_ptr -& gt ; pblptr -& gt ; pgsize ); } note that after determining the pci address , the data transfer must be broken up into separate transfers for each page in the pbl . larger transfers will consist of partial page transfers for the first and last pages and full page size transfers for intermediate pages . tagged mode placement is used for rdma read response and rdma write messages . in this case , the protocol header identifies the local adapter memory into which the payload should be placed . the magic field 1508 in the stag record must be valid the pd id 1510 in stag record must match the pd id in the placement record if the queue pair ( qp ) id 1512 in the stag record is not - zero , the qp id in the stag record must match the qp id in the placement record the valid bit in the stag must be set . the access bits in the stag record must allow remote write . the rxp 512 places the payload into the memory 1602 described by the pbl 1504 associated with the stag 1502 . the payload is placed by converting the to 1604 ( target offset ) specified in the ddp protocol header to an offset into the pbl as described above and then copying the payload into the appropriate pages 1602 . the rxp 512 places the protocol header for the tagged ddp message in an rxd 902 as follows : the flags field 912 is set as follows : the header bit is set the tagged bit is set the last bit is set the prptr 918 field is set to point to the placement record the count field 908 is set to the length of the protocol header placed at addr the ctxt field 920 is set to point to the stag record 710 to complete processing , the rxp 512 sets the rxd_done bit and resets the rxd_done bit in the rxd 902 . persons skilled in the art may appreciate that several public domain tcp / ip stack implementations ( e . g ., bsd 4 . 4 ) provided operating system networking software that utilized a hashing algorithm to locate protocol state information given a source ip address , destination ip address , source port , destination port and protocol identifier . those approaches however were not used locate information identifying where to place network payload ( directly or indirectly ), and were operating system based code . the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the present embodiments are therefore to be considered in respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description , and all changes which come within the meaning and range of the equivalency of the claims are therefore intended to be embraced therein . | 7 |
referring to the drawings , embodiments of the present invention will be described . fig1 is a block diagram showing the major components of a camera having a strobe unit in accordance with the first embodiment of the present invention . the camera of the first embodiment has a control means 1 that is responsible for control of the whole camera and that is realized by , for example , a microcomputer . the control means 1 has a plurality of input and output terminals . connected to the control means 1 are a strobe flashing means 2 for controlling the flashing of a strobe , a flashlight spectrum changing means 3 for changing the spectrum of strobe light , a writing means for storing such information as photographic parameters for a camera and the contents of the flashlight spectrum changing means 3 as given data in a magnetic recording area of film 9 provided with a magnetic recording means , a range finding means 5 for measuring a distance to an object , a photometry means 6 for metering brightness of an object , a red - eye phenomenon determining means 7 for outputting a given signal in the situation prone to a red - eye phenomenon , and a zoom information input means 8 for detecting the power of a zoom lens . the control means 1 is further connected to a film wind and rewind means and a shutter means which are not shown , and controlling them . fig2 is an electric circuit diagram showing the circuit elements of the strobe flashing means 2 in the first embodiment . as illustrated , the strobe flashing means 2 includes a power supply 11 for generating a given low voltage , and a step - up charging circuit 12 connected in series with the power supply 11 and designed to step up the low voltage to a charging voltage for use in charging a main capacitor 16 . the step - up charging circuit 12 has a control port p1 connected to the control means 1 . an output terminal of the step - up charging circuit 12 is connected to a series circuit composed of a resistor 13 and a resistor 14 , whereby voltage to be applied to the main capacitor 16 is divided into fractions . a control port p2 extends from between the resistors 13 and 14 , and is linked to the control means 1 , whereby the control means 1 monitors the charging voltage to be applied to the main capacitor 16 . when the charging voltage to be applied to the main capacitor 16 reaches a given value , the control means 1 recognizes the voltage across the resistor 14 as a full charge voltage , and de - energizes the step - up charging circuit 12 so as to stop charging . the output terminal of the step - up charging circuit 2 is connected to the main capacitor 16 via a reverse - current prevention diode 15 . when the step - up charging circuit 12 is de - energized , the diode 15 prevents current from flowing from the main capacitor 16 into the series circuit composed of the resistors 13 and 14 . connected across the main capacitor 16 are a trigger circuit composed of a resistor 17 , a capacitor 18 , a thyristor 19 , and a trigger coil 20 and a series circuit composed of a discharge tube 21 and a semiconductor current control device 22 . one terminal of the trigger coil 20 is connected to a trigger electrode of the discharge tube 21 , whereby a high - voltage trigger is applied to the electrode . the thyristor 19 and semiconductor current control device 22 have control ports p3 and p4 respectively . the thyristor 19 and semiconductor current control device 22 are both connected to the control means 1 and thus controlled by the control means 1 . in the initial state , the control means 1 turns off the thyristor 19 . this causes charging current flowing from the step - up charging circuit 12 to pass through the resistor 17 and stagnate in the capacitor 18 . thereafter , an on signal is supplied from the control means 1 to the thyristor 19 via the gate terminal ( control port p3 ) thereof . the charge stored in the capacitor 18 then flows from the capacitor 18 through the anode and cathode of the thyristor 19 to the primary winding of the trigger coil 20 and then returns to the capacitor 18 . with a change in current flowing in the primary winding of the trigger coil 20 , a high - voltage trigger is applied to the secondary winding thereof and eventually to the discharge tube 21 . fig3 is a graph indicating the spectrum of flashlight emanating from the discharge tube 21 . fig4 is a graph indicating the spectrum of sunlight . the discharge tube 21 is an xe tube containing xenon gas . as long as visible light is concerned , the spectrum shown in fig3 of flashlight emanating from the discharge tube 21 is substantially identical to the one of sunlight shown in fig4 . while the discharge tube 21 is flashing , when the semiconductor current control device 22 receives a flashing stop signal from the control means 1 via the control port p4 thereof , the semiconductor current control device 22 cuts off current flowing into the discharge tube 21 so that the discharge tube 21 will stop flashing . fig5 is an exploded perspective view showing the major components of the flashlight spectrum changing means 3 ( see fig1 ). as shown in fig5 the flashlight spectrum changing means 3 includes a reflector 31 for converging light emanating from the discharge tube 21 and irradiating light to an exposure zone of a camera , a filter 32 movable to a position in front of the reflector 31 , and an actuator 33 for moving the filter 32 to a given position in response to a signal applied to a control port p5 by the control means 1 . the actuator 33 includes a driving source such as a motor , a driven member that is driven by the driving source , and a drive circuit for driving the driving source . the driving source is driven on the basis of a control signal applied to the control port p5 by the control means 1 . fig6 is a graph showing a characteristic curve plotted to indicate the transmittance of the filter 32 . as illustrated , the filter 32 is a low - pass filter possessing a low transmittance with respect to light of relatively large wavelengths ( red light having wavelengths of approximately 650 nm or more ). the filter 32 is driven by the actuator 33 and movable to a position being in front of the reflector 31 and enabling reception of all the light reflected from the reflector 31 and to a position being away from the reflector 31 and disabling reception of the light . when the filter 32 is driven by the actuator 33 that has received a control signal ( which will be described in detail ) from the control means 1 and moved to the position being in front of the reflector 31 and enabling reception of all the light reflected from the reflector 31 , flashlight emanating from the discharge tube 21 in the strobe flashing means 2 passes through the filter 32 to have a spectrum from which wavelengths of red light are removed . on the other hand , when the filter 32 is moved to the position disabling reception of light emanating from the reflector 31 , the spectrum of flashlight is not changed but normal flashlight is emitted from the discharge tube 21 . as described previously , the position of the filter 32 is changed with a control signal sent from the control means 1 to the actuator 33 . fig7 is a graph detailing examples of the spectrum of flashlight emanating from the discharge tube 21 in the strobe flashing means 2 and of the spectrum of flashlight passing through the flashlight spectrum changing means 3 . in fig7 reference character a denotes the spectrum of flashlight emanating from the discharge ( xenon ) tube 21 in the strobe flashing means 2 . reference character b denotes the spectrum of flashlight irradiated to an object via the flashlight spectrum changing means 3 . as apparent from the drawing , the spectrum b has large wavelengths removed by the filter 32 . fig8 is an explanatory diagram concerning the components of the writing means 4 ( see fig1 ). as illustrated , the writing means 4 includes a magnetic head 34 that , while the film 9 provided with a magnetic recording means is being wound or rewound , writes information such as photographic parameters set in the camera and the spectrum of flashlight emanating from a strobe in the magnetic recording area of the film 9 , and a processor 35 for receiving electric variations from the control circuit 1 via a control port p6 and converting the electric variations into magnetic variations . after the flashlight spectrum changing means 3 is driven , when it is found that large wavelengths of red light are somewhat removed from the spectrum of flashlight emanating from the discharge tube 21 by means of the filter 32 , the control means 1 supplies a signal to the processor 35 and thus allows the magnetic head 34 to record in the magnetic recording area of the film 9 the fact that red light having large wavelengths is reduced . the range finding means 5 is a known means for measuring a distance from the camera to an object . the photometry means 6 is a known means for metering brightness of an object and determining an exposure value . the zoom information input means 8 is a means for detecting the power of a zoom lens . these means transmit data representing the results of measurement or detection to the control means 1 . when the situation is prone to a red - eye phenomenon , the red - eye phenomenon determining means 7 ( see fig1 ) supplies a signal to the control means 1 on the basis of information sent from the range finding means 5 , photometry means 6 , and zoom information input means 8 . the control means 1 supplies a control signal to the actuator 33 ( see fig5 ) in the flashlight spectrum changing means 3 in response to a signal sent from the red - eye phenomenon determining means 7 , so that the filter 32 will be placed in front of the discharge tube 21 in order to reduce red light from strobe light . thus , the filter 32 removes red light from strobe flashlight emanating from the discharge tube 21 . next , the operation of this embodiment will be described with reference to the flowchart of fig9 . when a release button that is not shown is pressed , the camera starts operating . the range finding means 5 measures a distance ( step s1 ) and places resultant data in a memory , which is not shown , preserved in the control means 1 . the photometry means 6 meters brightness of an object , and the zoom information input means 8 measures a focal length of a zoom lens at the same time . the data resulting from the photometry and the measurement of a focal length of a zoom lens is placed in a memory , which is not shown , in the control means 1 ( step s2 ). on the basis of the data resulting from ranging finding , photometry , and measurement of a focal length of a zoom lens , the red - eye phenomenon determining means 7 determines whether an object is likely to cause a red - eye phenomenon ( step s3 ). if the situation is prone to a red - eye phenomenon , the control means 1 activates the flashlight spectrum changing means 3 and thus drives the filter 32 so that strobe flashlight emanating from the discharge tube 21 will have the spectrum from which wavelengths of red light are removed . if it is determined at step s3 that the situation is not prone to a red - eye phenomenon , the control means 1 activates the flashlight spectrum changing means 3 and thus drives the filter 32 so that strobe flashlight emanating from the discharge tube 21 will have the normal spectrum ( step s5 ). control is then passed to step s6 . specifically , the filter 32 is moved to the position distanced from the front of the reflector 31 . strobe flashlight emanating from the discharge tube 21 does not therefore pass through the filter 32 but has the normal spectrum . at step 6 , a shutter , that is not shown , is opened for photography . based on the result of photometry performed at step s2 , it is determined whether it is required to flash the strobe ( step s7 ). when it is not required to flash the strobe , control is passed to step s9 . when it is required to flash the strobe , the discharge tube 21 is flashed with the spectrum determined at steps s4 and s5 on the basis of the data resulting from range finding and photometry . at step s9 , the shutter is closed to complete photography . the film 9 is wound ( step s10 ). during the film winding , the operation mode of the flashlight spectrum changing means 3 ; that is , information representing that red light contained in strobe flashlight is reduced is recorded in the magnetic recording area of the film 9 ( step s11 ). thereafter , film winding is terminated ( step s12 ). the camera is returned to the initial state . in this embodiment , red - eye phenomenon determination and flashlight spectrum changing are preceded by range finding and photometry . as long as they precedes strobe flashing , they may be performed any time . in this embodiment , recording of given information on film provided with a magnetic recording means is carried out any time for each frame during film winding . alternatively , given information may be temporarily stored in a memory in the control means 1 and all information stored may then be recorded during film rewinding . in this embodiment , the control means 1 changes the position of the filter 32 on the basis of the result of determination made by the red - eye phenomenon determinating means 7 . alternatively , the flashlight spectrum changing means 3 may be operated all the time and information provided by the flashlight spectrum changing means 3 may be recorded in the writing means 4 . this alternative would pose no problem . factors of a red - eye phenomenon occurring in a camera will be described . a red - eye phenomenon is a phenomenon that when a human being is photographed using a strobe in a dark place , the irises ( more particularly , the insides of the pupils ) of the human being appear in red in a print . this is attributable to the fact that very strong illumination of strobe light enters the retinae of the eyes for a short period of time , light that cannot be absorbed by the visual cells of the retinae is reflected and discharged outside the eyeballs . specifically , the visible spectrum of flashlight of a strobe ( xenon tube ) is , as shown in fig3 substantially identical to that of sunlight shown in fig4 . fig1 is a graph indicating the visibility of the human eyes . as seen from fig1 , the visibility reaches the peak at a wavelength of about 550 nm . as the wavelength becomes smaller or larger than 550 nm , the visibility gets worse . the visibility is comparable to the light absorbance of the visual cells of the retinae . the higher visibility means that a larger amount of light is absorbed . the lower visibility means that a smaller amount of light is absorbed . the visual cells of the retinae are divided two groups of cells . one group consists of cone cells that work when it is bright and the other group consists of rod cells that work when it is dark . fig1 is a graph showing characteristic curves plotted to indicate light absorbances of the two groups of visual cells . as shown in fig1 , the two groups of visual cells have different visibilities . the cone cells that work when it is dark have higher visibilities or light absorbances at smaller wavelengths and lower light absorbances at larger wavelengths . during stroboscopic photography , an amount of ambient light is small and the environment is dark . the human eyes use the cone cells thereof to see surrounding objects . when strobe flashlight having the spectrum shown in fig3 enters the eyes , the eyes use the cone cells thereof shown in fig1 to absorb the strobe flashlight . part of the strobe flashlight having wavelengths of about 550 nm is absorbed almost completely . the other light having smaller or larger wavelengths is not absorbed but reflected . fig1 is a graph showing characteristic curves plotted to indicate light absorbances of the cornea , lens , and vitreous body of the eyeball . as illustrated , the cornea , lens , and vitreous body of the eyeball absorb light having relatively small wavelengths ( 500 to 600 nm inclusive ) but pass light having larger wavelengths . among light entering the eyes , light having small wavelengths is almost completely absorbed in the course of passing through the eyes twice ; that is , in the course of entering the eyes and reflecting from or getting out of the eyes . however , light having large wavelengths ; that is , red light is not absorbed but reflected and discharged by the eyes . this results in a red - eye phenomenon . fig1 is a graph showing the relationship between the amount of light entering the eyeballs and the amount of light reflecting from the eyeballs . as illustrated , when the amount of light entering the eyeballs is small , the visual cells absorb light having large and small wavelengths . the amount of reflected light is therefore limited . when the amount of light entering the eyeballs increases , light having small wavelengths is , as mentioned above , absorbed by the corneas , lenses , and vitreous bodies . the amount of reflected light is therefore limited . as for light having large wavelengths , the visual cells are saturated with absorbed light and therefore reflect light by an amount corresponding to the increase in the amount of incident light . when the amount of reflected light exceeds a certain value or a level at which reflected light is discerned as a red - eye phenomenon , a red - eye phenomenon occurs . next , a method of alleviating a red - eye phenomenon in this embodiment will be described . a red - eye phenomenon occurs , as mentioned above , when the visual cells are saturated with absorbed light of large wavelengths and excessive light is discharged outside of the eyeballs . if the amount of light having large wavelengths ( red light ) to be emitted by a strobe is reduced , reflection of red light from the eyeballs can be minimized . table 1 lists the light absorbances and reflectances by the eyes at the time of normal strobe flashing performed in the camera of the first embodiment and at the time of flashing with a reduced amount of red light . also listed in the table are the light absorbances and reflectances by a normal red object at the time of normal strobe flashing and at the time of flashing with a reduced amount of red light . in the table , an amount of red light contained in light emitted by a strobe during normal flashing rates as 100 . ______________________________________normal flashingflashing with a printingwith an 40 %- reduced with aamount of amount of 1 . 67 - foldred light red light amount ofrating as 100 100 × 0 . 6 = 60 red light______________________________________absorbance 20 20 the absor - -- by the eyes bance by the eyes is saturated and is not varied . reflectance 80 40 67by the eyesabsorbance 5 3by a normalred objectreflectance 95 57 95by a normal ( restored ) red object______________________________________ as seen from the above table , the amount of red light contained in light emitted by a strobe during normal flashing rates as 100 . generally , the amount of red light absorbed by the retinae of the eyes rates as 20 . the amount of red light reflected from the eyes and rendered in a picture rates as 80 . the reflectance is therefore calculated as 80 / 100 = 0 . 8 . assuming that the amount of red light emitted by a strobe is reduced by 40 % to rate as 60 , the amount of red light absorbed by the retinae of the eyes still rates as 20 but does not change from the one provided during normal flashing . this is because the light absorbance of the eyes is saturated . the amount of red light reflected from the eyes is calculated as 60 - 20 = 40 . the reflectance is calculated as 40 / 80 = 0 . 5 . consequently , when the amount of red light is reduced by 40 %, the reflectance of red light from the eyes decreases by 50 %. when it says herein that the amount of red light is reduced , it means that the spectrum of red light within the spectrum of strobe light is diminished . the first embodiment is concerned with the above point . the amount of red light reflected from the eyeballs is reduced by removing some wavelengths of red light from the spectrum of strobe flashlight , whereby a red - eye phenomenon is alleviated . when red light contained in strobe light is simply reduced , it is presumed that the color balance of a picture would break down and a bluish picture would ensue . in this embodiment , information indicating that the amount of red light has been reduced is recorded in a magnetic recording area of film , so that printing will be carried out with red light , for example , cyan light increased . thus , the conventional color balance is attained . referring to table 1 , the amount of red light is reduced to be 60 % of the light occurring during normal flashing for flashing in accordance with this embodiment , and then increased to be 1 . 67 times as much as the one occurring during normal printing for printing in accordance with this embodiment . for example , normal red ( red paper or the like ) is restored at the rate of 95 % resulting from an expression ( 100 × 0 . 6 - 3 )× 1 . 67 . as for the reflectance of light from the eyes , the reflectance during normal stroboscopic photography is calculated as 100 - 20 = 80 . in this embodiment , it is calculated as ( 100 × 0 . 6 - 20 )× 1 . 67 = 66 . 8 . thus , the amount of red light reflected from the eyes is reduced . the reflectance from the eyes becomes smaller than that occurring during normal strobe flashing . although the amount of red light is increased for printing , a red - eye phenomenon equivalent to the one resulting from normal strobe flashing does not occur . as described so far , according to the camera of the first embodiment , the reflectance of red light contained in strobe light from the eyeballs is limited to alleviate a red - eye phenomenon . fig1 is a block diagram showing the major components of a camera having a strobe unit in accordance with the second embodiment . the second embodiment comprises a control means 41 , a writing ( memory ) means 42 , a range finding means 43 , a photometry means 44 , a first light emitting means 45 , a second light emitting means 46 , and a third light emitting means 47 . the writing ( memory ) means 42 , range finding means 43 , and photometry means 44 are equivalent to the writing means 4 , range finding means 5 , and photometry means 6 in the first embodiment , and will therefore not be described in detail . fig1 is a block diagram showing the major components of the control means 41 . the control means 41 plays substantially the same role as the control means 1 in the first embodiment but is additionally provided with the circuit elements shown in fig1 . specifically , the control means 41 includes an arithmetic means 48 for calculating an amount of strobe light with which a strobe should be flashed and also calculating the amounts of light to be emitted by the first to third light emitting means 45 to 47 , and a light value controlling means 49 for transmitting a light value signal to each of the first to third light emitting means 45 to 47 according to the results of a calculation made by the arithmetic means 48 . reference alphanumeric characters p45 , p46 , and p47 denote control ports of the control means 41 . the control ports p45 , p46 , and p47 are linked with the first to third light emitting means 45 to 47 . fig1 is a graph indicating spectra of flashlight emanating from the first to third light emitting means 45 to 47 . in fig1 , reference alphabetic characters a , b , and c denote spectra of flashlight emanating from the first light emitting means 45 , second light emitting means 46 , and third light emitting means 47 respectively . the amounts of light emanating from these light emitting means are adjustable . when the three light emitting means are flashed at a given ratio of amounts of light , the spectrum similar to the one of sunlight shown in fig4 is obtained as indicated with d in fig1 . as seen from fig1 , the spectrum of flashlight emanating from the third light emitting means 47 includes larger wavelengths than the spectra of flashlight emanating from the other two light emitting means . the flashlight emanating from the third light emitting means 47 contains more red light . in the second embodiment , when the situation is prone to a red - eye phenomenon , the amount of light emanating from the third light emitting means 47 is reduced slightly from the one calculated on the basis of the given ratio of amounts of light . thus , less red light is emitted in order to alleviate a red - eye phenomenon . as mentioned above , in the second embodiment , a plurality of light emitting means are included . the amount of light selected to emanate from the one of the light emitting means which emits red light is reduced in order to decrease the reflectance of red light from the eyeballs . the first to third light emitting means 45 to 47 may be realized with any kind of light emitting source as long as the spectra a , b , and c in fig1 are ensured . a light emitting body such as a xenon tube , a halogen lamp , and an led krypton lamp can be employed . the spectra of flashlight emanating from such light emitting sources are not limited to the ones shown in fig1 . all that matters is that the combination of the spectra of flashlight emanating from a plurality of light emitting bodies ( the number of light emitting bodies is not limited to three ) has the same color temperature as the spectrum of sunlight . fig1 is a block diagram showing major components of a camera in accordance with the third embodiment . as illustrated , the camera of the third embodiment comprises a control means 51 , a strobe flashing means 54 , a writing means 55 , a range finding means 57 , and a photometry means 58 . the strobe flashing means 54 , writing means 55 , range finding means 57 , and photometry means 58 are identical to the strobe flashing means 2 , writing means 4 , range finding means 5 , and photometry means 6 in the first embodiment , and will therefore not be described in detail . the control means 51 plays substantially the same role as the control means 1 in the first embodiment . the control means 51 further includes an intensification instructing means 52 and a flashlight value shifting means 53 . when film is loaded in the camera , the intensification instructing means 52 in the control means 51 allows the writing means 55 to write an instruction , which says that the film should be intensified during developing , on the film provided with a magnetic recording means that is not shown . the intensification instructing means 52 transmits a light value reduction signal to the flashlight value shifting means 53 so that an amount of strobe flashlight will be reduced by an amount of light used for the intensification . a smaller amount of flashlight is emitted for stroboscopic photography in order to provide a proper exposure value . when it says that an amount of strobe light is reduced , it means that an amount of red light is also reduced . as described concerning the first embodiment , a red - eye phenomenon is alleviated . in the third embodiment , the flashlight value shifting means 53 operates according to the output of the intensification instructing means 52 . alternatively , the flashlight value shifting means 53 may reduce an amount of flashlight according to the estimated latitude of film . this alternative will pose no problem . in the aforesaid embodiments , only the red light that reflects from the eyeballs is reduced in order to alleviate a red - eye phenomenon . these embodiments may be combined with a known technical art or a method for alleviating a red - eye phenomenon by performing pre - flashing prior to stroboscopic photography and thus shrinking the pupils . in the aforesaid embodiments , a strobe flashing means may be a so - called flat flashing type flashing means designed to provide a given amount of light by keeping a peak amount of flashlight constantly low and prolonging flashing time . in the aforesaid embodiments , information is recorded magnetically in a magnetic recording medium on film . the present invention is not limited to this working mode . alternatively , information may be recorded optically on film . when an ic memory is incorporated in a patrone , information may be recorded in the ic memory . in the present invention , it will be apparent that a wide range of different working modes can be formed on the basis of the invention without departing from the spirit and scope of the invention . this invention is not restricted to any specific embodiment but is limited only by the appended claims . | 6 |
20 g of propofol ( ii ) was dissolved in 50 ml of triethylamine , added with 14 g of succinyl oxide and 0 . 02 g of dmap ( 4 - dimethylamino - pyridine ). the mixture was reacted completely for 16 hours under stirring at room temperature , and the reaction solution was evaporated to remove triethylamine . the residue was added into 100 ml of water and adjusted to ph 1 with 6n hcl to produce a great amount of white precipitate . the precipitate was separated and then dried under reduced pressure to give crude propofol succinate monoester ( iv ), which was recrystallized with cyclohexane / ethyl acetate to obtain 23 . 5 g of acicular crystals . yield : 75 . 4 %, mp : 103 - 104 ° c . 2 . 54 g of sodium tetrahydroborate was suspended in 45 ml of anhydrous tetrahydrofuran , cooled to below 5 ° c ., and then slowly added dropwise with 18 g of propofol succinic acid monoester ( iv ) in tetrahydrofuran , with the temperature maintaining below 5 ° c . after completion of the dropwise addition , the mixture was stirred under a low temperature for 2 hours until no bubbles occurred , and then added dropwise with 8 . 28 g of iodine in 70 ml of tetrahydrofuran , with the color of the solution not becoming yellow . after completion of the dropwise addition , the mixture was stirred for 1 hour under the constant temperature . the reaction solution was evaporated to remove tetrahydrofuran , and added with 100 ml of ethyl acetate to produce precipitate . the precipitate was filtered off and the filtrate was washed with 100 ml of saturated sodium bicarbonate solution and 100 ml of water , respectively . the organic layer was separated , dried over anhydrous magnesium sulfate , and then evaporated to remove the solvent ethyl acetate to obtain 16 . 24 g of propofol ω - hydroxybutyrate intermediate ( v ) as colorless oil . no impurity was detected by tlc . yield : 95 %. the above intermediate ( v ) was dissolved in 40 ml of methylene dichloride , cooled to below 5 ° c ., slowly added dropwise and mixed with 11 g of p - toluenesulfonyl chloride , then slowly added dropwise with 12 g triethylamine . the mixture was reacted for 2 hours under a low temperature , and then reacted overnight at room temperature . the reaction solution was poured into 50 ml of 6n hcl and shaken . the organic layer was separated , washed with water once , and evaporated under reduced pressure to remove the solvent . the residue was recrystallized with cyclohexane to obtain 18 . 2 g of propofol w - hydroxybutyrate monoester p - toluenesulfonate ester ( vi ) as white solid . mp : 73 - 74 ° c ., yield : 70 . 8 %. 7 . 75 g of the intermediate ( vi ) was dissolved in 40 ml of dmf and added with 4 . 9 g of sodium iodide . the mixture was reacted at 50 ° c . for 1 hour under stirring until no raw material was detected by tlc . the reaction solution was added into 400 ml of water and extracted with 100 ml of ethyl acetate , and the organic layer was separated and evaporated under reduced pressure to remove the solvent to obtain 7 . 50 g of crude iodinated intermediate ( vii ). 7 . 50 g of crude iodinated intermediate ( vii ) was dissolved in 100 ml of acetonitrile , then added with 9 g of 85 % phosphoric acid and 13 g of triethylamine in 50 ml of acetonitrile . the mixture was reacted at 65 ° c . for 3 hours until no raw material was detected by tlc . the reaction solution was evaporated under reduced pressure to remove the solvent and the residue was mixed with 100 ml of 3n hcl to obtain turbid liquid , which was extracted with 100 ml of methylene dichloride for several times . the organic layers was combined and evaporated under reduced pressure to remove the solvent , to obtain crude propofol w - hydroxybutyrate phosphate ester ( i ) as soft yellow solid . the crude product was added with sodium hydroxide in methanol to adjust ph to 9 , evaporated under reduced pressure to remove methanol , added with 30 ml of ethyl acetate and 15 ml of acetone to produce a great amount of white solid , and then refluxed at 70 ° c . for 10 minutes , cooled , filtered , evaporated under reduced pressure , to obtain 4 . 25 g of propofol w - hydroxybutyrate phosphate disodium salt ( i ) as white crystals . 1 ) nmr spectrometer : bruker 400m , using d 2 o as a solvent and tms as an internal standard . δ was expressed in ppm . 1 hnmr ( δ ): 1 . 06 - 1 . 08 ( 2s , 12h ), 1 . 94 - 2 . 01 ( m , 2h ), 2 . 78 - 2 . 83 ( m , 4h ), 3 . 74 - 3 . 78 ( q , 2h ), 7 . 20 - 7 . 26 ( m , 3h ). wherein , the multiplet at 3 . 74 - 3 . 78 was the signal of hydrogen on the c atom binding to the phosphate ester group in the molecule . 2 ) nmr spectrometer : bruker 400m , using d 2 o as a solvent and tms as an internal standard . δ was expressed in ppm . 13 cnmr ( δ ): 21 . 94 , 23 . 03 , 25 . 87 , 25 . 94 , 27 . 11 , 30 . 48 , 63 . 15 , 124 . 40 , 127 . 39 , 140 . 85 , 144 . 66 , 176 . 09 . wherein , the signal of the carbon atom binding to the phosphate ester group in the molecule was shown at 63 . 15 , and the signal of carbonyl carbon in the molecule was shown at 176 . 09 . 3 ) high - resolution mass spectrometric detection : mass spectrometer : api 3000 lc - ms / ms ( abi , u . s . a . ); ionization mode : edi . ms + : 389 . 1100 ( c 16 h 24 o 6 pna 2 ). 20 g of propofol was dissolved in 100 ml of methylene dichloride , added with 13 . 3 g of succinic acid , 0 . 02 g of dmap , and then 23 . 2 g of dcc . the mixture was reacted for 6 hours under stirring at room temperature , then the reaction solution was filtrated to remove white solid , and the filtrate was washed once with 150 ml of 6n hydrochloric acid . the organic layer was separated and evaporated under reduced pressure to remove the solvent to give crude propofol succinate monoester ( iv ) as pale yellow solid , which was recrystallized with cyclohexane / ethyl acetate to obtain 26 . 6 g of white acicular crystals . yield : 85 %, mp : 102 - 103 ° c . the method of preparing propofol w - hydroxybutyrate phosphate ester and / or its disodium salt ( i ) from propofol succinate monoester intermediate ( iv ) was similar to that of example 1 . 10 g of propofol ( ii ) was dissolved in 50 ml of triethylamine , added with 7 g of glutaric anhydride ( iii ) and 0 . 01 g of dmap . the mixture was stirred for 12 hours at room temperature , and the reaction solution was evaporated under reduced pressure to remove excessive triethylamine . the residue was added into 100 ml of water and adjusted to ph 1 with 6n hcl to produce a great amount of white precipitate . the precipitate was separated and then dried under reduced pressure to give crude product , which was recrystallized with cyclohexane / ethyl acetate to obtain 10 . 8 g of propofol glutarate monoester intermediate ( iv ) as white flaky crystals . yield : 65 . 9 %, mp : 53 - 54 ° c . 2 . 54 g of sodium tetrahydroborate was suspended in 45 ml of anhydrous tetrahydrofuran , cooled to below 5 ° c ., and then slowly added dropwise with 19 g of propofol glutarate monoester intermediate ( iv ) in 60 ml of tetrahydrofuran , with the temperature maintaining below 5 ° c . after completion of the dropwise addition , the mixture was stirred at a low temperature for 2 hours until no bubbles occurred , and then added dropwise with 8 . 28 g of iodine in 70 ml of tetrahydrofuran , with the color of the solution not becoming yellow . after completion of the dropwise addition , the mixture was stirred for 1 hour under the constant temperature . the reaction solution was evaporated to remove tetrahydrofuran , and added with 100 ml of ethyl acetate to produce precipitate . the precipitate was filtered off and the filtrate was washed once with 100 ml of saturated sodium bicarbonate solution and 100 ml of water , respectively . the organic layer was separated , dried over anhydrous magnesium sulfate overnight , filtrated to remove the drying agent and then evaporated to remove ethyl acetate to obtain 16 . 9 g of propofol w - hydroxyvalerate intermediate ( v ) as colorless oil . no impurity was detected by tlc . yield : 93 %. the above intermediate ( v ) was dissolved in 40 ml of methylene dichloride , cooled to below 5 ° c ., slowly added dropwise and mixed with 11 g of p - toluenesulfonate chloride , then slowly added dropwise with 12 g triethylamine . the mixture was reacted for 2 hours at this low temperature , and then reacted overnight at room temperature . the reaction solution was poured into 50 ml of 6n hcl and shaken . the organic layer was separated , washed with water once , and evaporated under reduced pressure to remove the solvent . the residue was recrystallized with cyclohexane to obtain 19 g of propofol w - hydroxyvalerate p - toluenesulfonate ester intermediate ( vi ) as colorless oil . mp : 64 - 65 ° c ., yield : 72 . 24 %. 8 g of the above p - toluenesulfonate ester intermediate ( vi ) was dissolved in 40 ml of dmf and added with 4 . 9 g of sodium iodide . the mixture was reacted at 50 ° c . for 1 hour under stirring until no raw material was detected by tlc . the reaction solution was added into 400 ml of water and extracted with 100 ml of ethyl acetate , and the organic layer was separated and evaporated under reduced pressure to remove the solvent to obtain 8 . 1 g of crude iodinated intermediate ( vii ). the above crude iodinated intermediate ( vii ) was dissolved in 100 ml of acetonitrile , then added with 9 g of 85 % phosphoric acid and 13 g of triethylamine in 50 ml of acetonitrile . the mixture was reacted at 65 ° c . for 3 hours until no raw material was detected by tlc . the reaction solution was evaporated under reduced pressure to remove the solvent , and the residue was mixed with 100 ml of 3n hcl to obtain turbid liquid , which was extracted with 100 ml of methylene dichloride for several times . the organic layers were combined and evaporated under reduced pressure to remove the solvent , to obtain crude propofol w - hydroxyvalerate phosphate ester ( i ) as soft yellow solid . the crude product was added with sodium hydroxide in methanol to adjust ph to 9 , evaporated under reduced pressure to remove methanol , added with 30 ml of ethyl acetate and 15 ml of acetone to produce a great amount of white solid , and then refluxed at 70 ° c . for 10 minutes , cooled , filtered , evaporated under reduced pressure , to obtain 2 . 5 g of propofol w - hydroxyvalerate phosphate disodium salt ( i ) as white crystals . 1 ) nmr spectrometer : bruker 400m , using d 2 o as a solvent and tms as an internal standard . δ was expressed in ppm . 1 hnmr ( δ ): 1 . 07 - 1 . 08 ( 2s , 12h ), 1 . 63 - 1 . 66 ( m , 2h ), 1 . 77 - 1 . 78 ( m , 2h ), 2 . 73 - 2 . 75 ( m , 2h ), 2 . 80 - 2 . 83 ( m , 2h ), 3 . 71 - 3 . 74 ( m , 2h ), 7 . 21 - 7 . 25 ( m , 3h ). wherein , the multiplet at 3 . 71 - 3 . 74 was the signal of hydrogen on the c atom binding to the phosphate ester group in the molecule . 2 ) nmr spectrometer : bruker 400m , using d 2 o as a solvent and tms as an internal standard . δ was expressed in ppm . 13 cnmr ( δ ): 20 . 98 , 21 . 97 , 23 . 01 , 23 . 37 , 27 . 22 , 29 . 91 , 63 . 81 , 124 . 51 , 127 . 47 , 140 . 99 , 144 . 74 , 176 . 38 . wherein , the signal of the carbon atom binding to the phosphate ester group in the molecule was shown at 63 . 81 , and the signal of carbonyl carbon in the molecule was shown at 176 . 38 . 3 ) high - resolution mass spectrometric detection : mass spectrometer : api 3000 lc - ms / ms ( abi , u . s . a . ); ionization mode : edi . ms + : 403 . 1256 ( c 17 h 25 o 6 pna 2 ) 10 g of propofol was dissolved in 50 ml of methylene dichloride , added with 7 . 4 g of glutaric acid , 0 . 01 g of dmap , and then 11 . 6 g of dcc . the mixture was reacted for 6 hours under stirring at room temperature , then the reaction solution was filtrated to remove white solid and the filtrate was washed once with 80 ml of 6n hcl . the organic layer was separated and evaporated under reduced pressure to remove the solvent to give pale yellow solid , which was recrystallized with cyclohexane / ethyl acetate to obtain 9 g of propofol glutarate monoester intermediate ( iv ) as white acicular crystals . yield : 54 . 9 %, mp : 53 - 54 ° c . the method of preparing propofol w - hydroxyvalerate phosphate ester and / or its disodium salt ( i ) from propofol glutarate monoester intermediate ( iv ) was similar to that of example 3 . three parallel solutions of propofol w - hydroxybutyrate phosphate disodium salt ( i ) of example 1 with a concentration of 10 mg / ml were prepared , added into and mixed with the mouse , rat or rabbit plasma , which was pre - placed in water bath ( 37 ° c . ), respectively . 100 μl of the drug - containing plasma was taken at 0 min , 1 min , 3 min , 5 min , 7 min , 10 min , 20 min , 30 min , 1 h , 2 h , 3 h and 4 h , respectively , and the concentrations of the active metabolite propofol were determined by the hplc method . the results shown in fig1 have indicated that the phosphate sodium salt of propofol hydroxybutyrate in the plasma can be rapidly decomposed into the active compound propofol ( ii ). three parallel solutions of propofol ω - hydroxyvalerate phosphate disodium salt ( i ) of example 3 with a concentration of 10 mg / ml were prepared , added into and mixed with the mouse , rat or rabbit plasma , which was pre - placed in water bath ( 37 ° c . ), respectively . 100 μl of the drug - containing plasma was taken at 0 min , 1 min , 3 min , 5 min , 7 min , 10 min , 20 min , 30 min , 1 h , 2 h , 3 h and 4 h , respectively , and the concentrations of the active metabolite propofol were determined by the hplc method . the results shown in fig2 have indicated that the phosphate sodium salt of propofol hydroxyvalerate in the plasma can be rapidly decomposed into the active compound propofol ( ii ). 60 kunming mice with half males and half females were randomly divided into the drug test group ( propofol ω - hydroxybutyrate phosphate disodium salt for injection as in example 1 of the present invention ) ( n = 30 ) and the diprivan ™ control group ( positive control drug diprivan ™) ( n = 30 ). median effective doses ( ed 50 ) of propofol hydroxybutyrate phosphate disodium salt and diprivan ™ were determined by the up - and - down method . in the test , the mice were injected with the drugs through the tail veins , with the disappearance of the forepaw righting reflex ( frr ) of the mice as a judgment index of the end point of anesthesia ; the recovery of frr of the mice as an index of recovery from anesthesia . the results have shown that ed 50 of the propofol ω - hydroxybutyrate phosphate disodium salt group of the present invention was 130 mg / kg , with 95 % confidence interval of 125 ˜ 140 mg / kg . ed 50 of the diprivan ™ control group was 5 . 8 mg / kg , with 95 % confidence interval of 5 . 3 ˜ 7 . 8 mg / kg . during the determination of ed 50 , it was observed that the disappearance time of frr in the propofol hydroxybutyrate phosphate disodium salt group was 150 . 6 ± 42 . 1 seconds and the recovery time was 480 . 6 ± 124 . 3 seconds . the onset time was significantly longer than that of the diprivan ™ control group ( onset time , 21 ± 2 seconds ; recovery time , 270 . 6 ± 116 . 2 seconds ). the results have shown that propofol hydroxybutyrate phosphate disodium salt of the present invention has a definite and reversible anesthetic effect . 60 kunming mice with half males and half females were randomly divided into the drug test group ( propofol w - hydroxyvalerate phosphate disodium salt for injection as in example 3 of the present invention ) ( n = 30 ) and the diprivan ™ control group ( positive control drug diprivan ™) ( n = 30 ). median effective doses ( ed 50 ) of propofol hydroxyvalerate phosphate disodium salt and diprivan ™ were determined by the up - and - down method . in the test , the mice were injected with the drugs through the tail veins , with the disappearance of the forepaw righting reflex ( frr ) of the mice as a judgment index of the end point of anesthesia ; the recovery of frr of the mice as an index of recovery from anesthesia . the results have shown that ed 50 of the propofol hydroxyvalerate phosphate disodium salt group was 152 mg / kg , with 95 % confidence interval of 131 ˜ 164 mg / kg , and ed 50 of the diprivan ™ control group was 5 . 9 mg / kg , with 95 % confidence interval of 5 . 1 ˜ 7 . 9 mg / kg . during the determination of ed 50 , it was observed that the disappearance time of frr in the propofol hydroxyvalerate phosphate disodium salt group was 180 . 8 ± 45 . 6 seconds , and the recovery time was 500 . 1 ± 114 . 6 seconds . the onset time was significantly longer than that of the diprivan ™ control group ( onset time , 19 ± 3 seconds ; recovery time , 260 . 2 ± 121 . 6 seconds ). the results have shown that propofol hydroxyvalerate phosphate disodium salt of the present invention also has a definite and reversible anesthetic effect . the present invention provides a phosphate ester derivative of hydroxy acid ester of propofol , which can be further reacted with a base or a molecular containing basic group to form a pharmaceutically acceptable salt . the compound of the present invention can improve water solubility of propofol , decompose faster in vivo , and increase stability of the prodrug in vitro ; therefore , it can be used as a central depressant to produce sedative , hypnotic and / or narcotic effect on animals or human beings through an intravenous or non - intravenous route , the application scope of the propofol prodrug can be enlarged , the positive sense and good prospects can be exhibited ; therefore , it is suitable for the industrial applications . | 2 |
the following description is provided to enable any person skilled in the art to make and use the invention and sets forth the best modes contemplated by the inventor of carrying out his invention . various modifications , however , will remain readily apparent to those skilled in the art , since the generic principles of the present invention have been defined herein specifically to describe an improved and simplified emulsion heater - treater ( hereinafter referred to as a “ treater ”), having a mechanical distributor and coalescer , which may be easily and quickly controlled from the exterior of a treater vessel , so as to adjust for and / or compensate for differences in the various parameters of emulsions moving through the treater . the present invention is an improvement to the apparatus and methods set forth in u . s . pat . nos . 4 , 329 , 159 and 4 , 919 , 777 , the disclosures of which two patents are incorporated herein , in their entirety , by this reference thereto . while treatment of crude oil is described as the primary use for this invention , it is to be understood that it is also applicable in treating any liquid medium or process that utilizes gravity settling or separation , and / or coalescing that requires flow metering control for both vertical , diagonal or horizontal operation . referring now to the drawings , the present invention is utilized in an elongated , horizontal metal tank or vessel 10 of the type disclosed in u . s . pat . nos . 4 , 329 , 159 and 4 , 919 , 777 . as best shown in fig4 - 7 , the elongated vessel 10 has a first heater section 12 and a second treatment or treater section 14 , separated by a bulkhead 18 . a foam removing assembly 52 is disposed in treating section 14 , upstream of the bulkhead 18 . a viscous emulsion e to be treated is fed into the upstream end of the heater section 12 , or if no heater section is used , directly into the upstream end of the treating section 14 , in a manner well known to those skilled in the art . the emulsion then flows through the heater section 12 , passed the bulkhead 18 and into the treating section 14 , for passage through treating components contained therein . after passing through the treating section 14 , the treated emulsion then flows out an outlet , at the downstream end , indicated “ o ” in fig4 - 7 . the apparatus and method of the present invention provide a more efficacious separation of a viscous emulsion e into its respective components , namely , produced water w , gas g and substantially water - free oil 0 , which exit the treater section , as shown . this is accomplished by the use of novel diffusion and distribution device 16 , in the form of a plurality of sets of distributors having vertically mounted , adjustable louvers 20 , which are preferably operated by an element 22 mounted externally of the vessel 10 ( see fig1 - 3 ), and extending through the side of the vessel 10 , in a fluid - tight manner , into contact with the distributors 16 . the distributors 16 of the present invention provide for an improved treater with : 1 . the ability to be externally adjusted to accommodate a wide range of a . p . i . gravities of crude oil ; 2 . the ability to be externally adjusted while the treating unit is in operation , under pressure and at operation temperature ; 3 . the ability to be externally adjusted to accommodate crude emulsions with unusual viscosity characteristics ; 4 . the ability to be externally adjusted to compensate for inaccurate engineering sizing , flow calculations , or assumptions ; 5 . the ability to be externally adjusted to accommodate crude oil flow rates in excess of design conditions ; 6 . the ability to be externally adjusted to accommodate crude oil flow rates much lower than design conditions and , therefore , increase the turn down ratio ; 7 . the ability to be externally adjusted to evenly distribute heat throughout the coalescing oil pad ; 8 . the ability to be externally adjusted to better accommodate surging flow rates ; 9 . the ability to be externally adjusted from full open to full closed , therefore , dislodging any plugging that may have existed at normal operating settings ; 10 . the ability to be externally adjusted to precisely control oil - water cuts . the externally adjustable louvered baffles of the present invention allow metering of process flow and provides increased coalescing surfaces by the following operation : as the process flow impinges on the surface of louvers , coalescing of the water droplets increases due to increased collisions . as the louvers are opened to meter the flow , counter rotating vortices develop as the process flow is restricted due to the flow limiting size of the opening in the louvers . the resulting pressure wave buildup on the upstream side of the funnel formed by the two slats , combined with the accelerated flow of the center process stream , form a vortex and a pressure drop across the louvers . while the trailing edge of the slats provides a combing effect that funnels the coalesced water droplets into a laminar stream as they flow past , much like you would see as water vapor trails of the trailing edge of an airplane wing when passing through water vapors or rain . each pair of vertical louvers establish a rotating effect since the louvers limit the flow by being partially closed , oil must circulate against the face of the louvers waiting its time to flow through the opening , thus exposing additional flow to the coalescing surfaces of the louvers and increasing coalescing efficiency . the counter , slow - rotating vortices continue well downstream of the baffles , creating a gentle swirling and mixing action that enhances the probability of massive water droplet collisions , and prevents formation of laminar flow or stratification of the process flow , thus enhancing water droplet coalescing . since this is occurring over the entire length of the vertical louver , the water droplet &# 39 ; s mass is increased by both the horizontal and vertical collisions . the vertical design of the louvers causes a fine sheeting action that provides laminar flow pathways ( or super highways ) for the water to transverse the oil pad into the water phase . as the water droplets masses increase due to actions described above , so does their velocities . by the time the water droplets reach the bottom of the louvered baffle , they have reached their terminal velocity due to their increased mass , and they easily transverse the remainder of the oil pad . this decreases the time and distance required to remove the emulsified water from the process stream thus allowing for smaller , less expensive treating vessels . this is extremely important in offshore applications where real - estate is at a premium . the present invention also enables external reconfiguration of internal flow distribution , flow metering and coalescing elements to treat varying api ° gravity crude oil from 10 ° api to 40 ° api without costly shutdowns and internal baffling modifications required in current technology , and can be adapted for vertical flow treating applications , as both a mechanical coalescer and as the return side grid on electrostatic grids . it also provides electrostatic grids ground return function on each of the rotatable vertical louver elements for electrostatic operation , and allows for fine tuning of the electrostatic field for maximum electrostatic field strength . the vertical louvers provide a slicing action to the process stream , exposing greater surface area of the process stream to a greater area of coalescing surface , that in turn removes more water from the oil , and increases dehydration efficiency . the addition of fixed , non - adjustable , vertical louvers , spaced at intermediate positions between the externally - adjustable , louvered baffles , increases the coalescing surface area . reduction in treating vessel size is a major advantage to the present invention , by formation of multiple , variable vortexes by the adjustability of the louvered baffles . these vortices are a major element of the invention . in addition , these louvered baffles may be coupled with centrifugal inlet devices that utilize vortex separation technology to enhance treating capabilities . various types , textures and shapes can be used as louver baffle slats depending on api ° crude oil under treatment . these shapes and textures aid in increasing coalescing surface area and efficiency , by providing a more torturous flow path with shapes and increased coalescing surface friction with surface textures . these louvered baffles are utilized as an integral part of any electrical field treating system , such as electrostatic , electromagnetic , magnetic , direct current half wave or full wave , alternating current , variable frequency and or pulsed electrical field design systems . additionally , the adjustability of the externally adjustable louvered baffles may be manual or automatic . in automatic mode , it can be coupled with real time monitoring of the process stream to compensate for varying process conditions in real time . this adjustability of the louvers to an infinite number of positions by varying the size of the opening , allows for increased or decreased flow velocities and aids or impedes downstream vortex mixing action . the externally - adjustable , louvered baffles may be mounted in a vertical , diagonal or horizontal position , depending on processor requirements . each distributor 16 of the present invention used in the treater may be extended down into the lower produced water phase , without a plugging problem . furthermore , as shown in the examples illustrated in fig4 - 7 , four ( 4 ) distributors 16 may be located in the treatment section 14 , adjacent coalescer elements 70 , if used ( fig2 and 7 ), to replace the perforated baffles used in the prior art . as best shown in fig1 - 3 , each of the distributors 16 is comprised of a plurality of adjustable louvers 20 longitudinally spaced across the width of the treatment section 14 . each set of adjustable louvers stretches substantially the entire distance across the emulsion flow , between opposed sides of an inner wall 19 of the vessel 10 , and are supported in top and bottom channels 24 , 26 , as by means of shafts 27 , 29 , rotatably held in the channels 24 , 26 . the side edges and top of the distributors 16 include transverse baffles or walls 28 , 30 adapted to conform to the inner curvature of opposed sides of the inner wall 19 of the vessel and a top or wave baffle 25 to control the flow of the slowly moving emulsion e through the louvers 20 , uniformly across the width of the vessel 10 . if desired , as shown in fig5 and 7 , electrode grids k - 1 to k - 4 supported by electrically insulated brackets , or the like , may be provided within the tank 10 immediately upstream of each transverse set of rotatable distributors 16 . alternately , as shown in fig6 coalescing elements 70 , electrically grounded to the tank 10 may be provided immediately downstream of each set of rotatable distributors 16 . if an electrostatic grid system is available , and more complete treatment of the emulsion is required , as shown in fig7 electrode grids k - 1 to k - 4 may be mounted immediately upstream of each set of rotatable distributors 16 , and coalescing elements 70 may be mounted immediately downstream of each set of rotatable distributors . turning now to fig1 - 3 , the preferred embodiment of the externally operated , rotatable louvers 20 in each set of distributors 16 will be described . each of the distributors is supported in a predetermined position in the vessel , and the adjustable louvers 20 are supported therein by ends walls 28 , 31 , top and bottom channels 24 , 26 and at least one support rod 25 . furthermore , each of the separate louvers 20 , within a distributor 16 is adjustable about an axis , defined by shafts 27 , 29 , by a mechanical device 30 , such as lever arms or links , secured between the lower shafts 29 and a pair of sliding elements 32 , 34 , such as bars or rods , shown in fig3 . in the closed position , as shown in fig1 the louvers 20 substantially block flow of emulsion e through the distributor 16 , and , therefore , the vessel 10 . however , upon operation of the external operator 22 , either manually or by an automated , powered system , the operator 22 will move or translate a shaft 36 , inwardly , to move or push a coupling elements 40 , which is connected to a further pair of connecting elements 42 , 44 , pivotably connected between linkage 40 and rods 32 , 34 , to move rods 32 , 34 in the direction of arrows 38 , to rotate the links 30 , and , therefore , the louvers 20 , in the direction of the arrows 46 , 48 ( see fig3 ), a desired amount , so as to control the flow of emulsion through the distributors 16 . preferably , the louvers 20 are operated in pairs , as shown in fig3 . that is , a first pair of louvers opens in a first direction with or against the flow , and the next pair opens in the opposite direction , against or with the flow , with each further pair alternating in the direction of opening in the same manner , to thereby control flow of emulsion therethrough . depending on the viscosity and other parameters measured in the vessel 10 , the distributors 16 may each be precisely , externally adjusted to rotate the louvers 20 to the desired open position to provide the best possible results , consistent with real time measurements , as the emulsion e moves through the treating section 14 of the vessel . it , therefore , can be seen that the adjustable louvers in the distributors of the present invention , when used alone or in conjunction with electrostatic elements and / or additional coalescers , will provide greater control , producing improved results , which were heretofore impossible to obtain . those skilled in the art will appreciate the various adaptations and modifications of the just - described preferred embodiments can be configured without departing from the scope and spirit of the invention . therefore , it is to be understood that , within the scope of the appended claims , the invention may be practiced other than is specifically described herein . | 1 |
infusion pump system p , as best shown in fig1 is contained within housing h . the housing h is , preferably , manufactured from a high strength plastic or similar lightweight material in order to permit the pump system p to be readily carried by the patient ( not shown ). preferably , housing h has a carrying handle 10 extending along the top surface . the housing h , along with its related ancillary items , weighs approximately 2 . 5 pounds , this including the weight of the batteries which provide the operating power . housing h has a first chamber 12 extending along a sidewall thereof and in which a first modular pump unit u , as will be further described , is positioned . a second chamber 14 is disposed adjacent first chamber 12 and likewise receives a pump unit u . chamber 12 preferably contains a piggyback pump unit which pumps a secondary medicament which is contained within lower chamber 16 . the primary medicament is contained within medicament bottle 18 positioned within side housing 20 . a syringe 22 may be advantageously positioned within housing 20 for use by the patient as needed . fig1 also discloses medicament supply line 24 which is in flow communication with primary pump unit u of chamber 14 . control unit c is contained within chamber 26 of housing h and is used for setting the operating parameters , as well as for monitoring the operating parameters of the individual pump units u . control unit c , as best shown in fig1 includes a video display 28 and programming push buttons 30 . the control unit c also includes indicator lights 32 and 34 which let the operator know if the particular parameter of interest is being raised or lowered similarly , indicating lights 36 and 38 are provided to indicate a hold function , as well as an alarm mode , respectively . lastly , control unit c includes a programming module 40 to allow the operator to select which of the pumping units u is to be displayed or adjusted . as noted , the programming module 40 includes indicators 42 , 44 and 46 because the pumping system p can handle as many as 3 pump units u . fig8 and 9 disclose the high efficiency pump mechanism which each pump unit u employs in order to provide an accurate controlled pumped volume of medicament . each pump unit u includes a generally rectangular housing 48 having a pivotal door 50 . the door 50 has a transparent window 52 to permit the operator to view fluid ducts f during use . fig9 discloses recess 54 which receives and positions the duct f for operation . an upper member 56 and a lower member 58 extend from the rear wall of housing 48 in general parallel alignment . the members 56 and 58 extend toward the door 50 , although they stop short thereof . rotatable shaft 60 extends between the members 56 and 58 , and preferably is supported by bearings 62 and 64 in order to permit free rotation thereof . driven gear 66 is carried by shaft 50 and is secured thereto by nut 68 . ratchet pawl 70 pivots on pin 72 in order to provide a brake permitting the gear 66 to rotate in one direction only . electric motor 74 , which preferably is a direct current motor , has a rotatable shaft which carries a drive gear 76 . the drive gear 76 is in meshing engagement with the driven gear 66 in order to cause rotation of same . naturally , appropriate wiring is provided for connecting the motor 74 with the control unit c , as well as with the source of electric power , and need not be further explained . first slidable valve 78 is carried by support member 56 and includes a contact portion 80 which is engageable with fluid duct f to compress , and thereby close , same . a pump shoe 82 is slidably disposed relative to valve 78 and likewise includes a plurality of contact portions , as will be further explained , for compressing duct f . second valve 84 is slidably disposed relative to shoe 82 and member 58 . valve 84 has a contact portion 86 which is likewise used for compressing , and thereby closing , duct f . the valves 78 and 84 may be slidably keyed to shoe 82 and likewise to members 56 and 58 , respectively or all may be positioned between parallel guide plates . cam 88 is carried by shaft 60 and is engageable with rotatable cam follower 90 carried by valve 78 for causing linear displacement of the valve 78 . cams 92 and 94 are carried by shaft 60 . the cams 92 and 94 are engageable with rotatable cam followers 96 and 98 , respectively , carried by shoe 82 for likewise causing linear displacement of pump shoe 82 . the cams 92 and 94 are spaced apart in order to prevent canting of the shoe 82 during displacement . cam 100 is carried by shaft 60 . cam 100 is engageable with rotatable cam follower 102 carried by valve 84 for causing linear displacement of valve 84 . it should be clear that the cams 88 , 92 - 94 and 100 are appropriately adjusted so that the nodes thereof cause selected linear displacement of the associated valves 78 and 84 , respectively , as well as of pump shoe 82 . administration set a is best shown in fig6 and 8 and provides the fluid duct f which is secured by the door 50 . the administration set a includes an upper drip chamber 104 which is in flow communication with pump chamber 106 by means of variable orifice valve 108 disposed across duct 110 . preferably , the drip chamber 104 is integral with the pump chamber 106 and both are comprised of a resilient , preferably transparent , polymeric material , such as urethane or silicone , which is easily compressible , for reasons to be explained . set a may be used independently of unit u as a metering valve . drip chamber 104 has an inlet opening 112 in which orifice 114 is received . the orifice 114 is preferably manufactured from a non - wetting material , such as teflon , or is coated with a corresponding substance . the non - wetting material controls drop size and thereby further insures accurate delivery of the medicament to drip chamber 104 . naturally , orifice 114 has an inlet opening 116 for connection with a fluid supply source , such as hose 24 of container 18 . vent 118 communicates through orifice 114 with drip chamber 104 and includes ball check 120 to prevent entry of contaminants into the drip chamber 104 through vent 118 . valve 108 includes a handle 122 which controls logarithmic opening 124 . rotation of handle 122 therefore provides logarithmic control over the quantity of fluid which can flow from the drip chamber 104 to the pump chamber 106 . additionally , the handle 122 may include means cooperating with the door 50 to secure same in the locked , or closed position . this assures that the valve 108 is in the off position when the unit u is initially set up , in order to prevent full flow of medicament to the patient . pump chamber 106 includes a circular outlet opening 126 which is connected with cannula 128 . the cannula 128 is of conventional design and permits the medicament to flow to the patient much as with prior art systems . the pumping chamber 106 will now be explained with reference to fig2 - 5 . as noted , fluid duct f , which includes the administration set a , is secured within housing 48 by means of door 50 and window 52 . the window 52 presses the fluid duct f against first fixed position combs 130 . the combs 130 are fixed relative to the supports 56 and 58 and extend towards door 50 and therefore provide a contoured surface for receipt of wall portion 132 of duct f . the fixed position combs 130 encompass wall portion 132 and define a known pumping volume for the pumping chamber 106 . the known pumping volume assures that a constant volume of medicament is always present at the time of initiation of the pumping stroke . the fixed position combs 130 in cooperation with the door 50 trap a known area of the wall portion 132 within the area between the valves 80 and 86 . as such , this trapped pumping volume remains constant , regardless of the material being pumped . the fixed position combs 130 are spaced apart longidutinally along the duct f by an amount sufficient to prevent the wall portion 132 from ballooning therebetween . consequently , when pumping force is applied to the wall portion 132 , as will be further explained , then the wall portion 132 will not expand into the area between the fixed combs 130 and thereby alter the pumping volume . movable combs 134 extend from pump shoe 82 and are interdigitated with the fixed position combs 130 . the movable combs 134 move uniformly linearly through the adjacent spaced fixed combs 130 in order to compress the wall portion 132 . because of the spaced apart cams 92 and 94 , then there is little or no tendency for the shoe 82 to cant , with the result that the combs 134 all move by the same amount , in the same unit time , and with equal force for causing substantially constant and uniform compression , and thereby pumping , of the wall portion 132 . fig3 - 5 illustrate the pumping action achieved by the combs 134 . fluid duct f has a base portion 136 of substantial thickness in order to provide strength for the pumping chamber 106 during compression . base portion 136 has a contoured surface portion 138 . wall portion 132 extends in continuous and uninterrupted manner from the opposite ends of contoured surface 138 to form therewith an oval , or elliptical , fluid duct 140 . it can be noted in fig3 that the wall portion 132 is relatively thin in comparison with base portion 136 . we have found that the wall portion 132 can be made thinner than would be possible with conventional round tubing because of the additional support provided by base portion 136 . therefore , because the wall portion 132 is thinner , it can then be compressed with less force , thereby conserving energy . furthermore , the curvature of wall portion 132 is such that there is a tendency to collapse inwardly in a uniform way . each of the movable combs 134 has a contact surface 142 which has a contour substantially corresponding to that of the surface 138 . in this way , the contact surface 142 causes the wall portion 132 to compress into substantial conformance with surface 138 as the combs 134 move toward the base portion 136 . preferably , the cams 92 and 94 are sized so as to prevent the wall portion 132 from engaging the contoured surface 138 , as best shown in fig5 upon the shoe 82 completing its compression stroke . we have found that this slight gap prevents blood cells from being crushed , and thereby destroyed . the pump unit u can therefore be conveniently used for pumping whole blood without fear of damage to the cells . the control schematic for the control unit c is best shown in fig1 . a central controller is in electrical connection with a motor drive controller which causes the motor 74 to operate . a disk 200 is carried by the shaft of motor 74 and has a pair of slots 202 and 204 . a similar disk 206 is carried by shaft 60 and likewise has slots 208 and 210 . the disks 200 and 206 rotate with the associated shafts and are used to provide an indication of rotation of the related components . a radiation emitter 212 , which includes the well known led , illuminates a radiation detector 214 upon one of the slots being appropriately aligned . naturally , during rotation , then the disks themselves block the radiation and thereby indicate that rotation is occurring . should the detectors be illuminated , then an indication of a selected rotational amount is provided for the central controller . this rotation indication is used to monitor the pumping per unit time , particularly useful since the pump volume is known . fig1 also illustrates the connection of the video display with the central controller . the video display may include the well known crt display , or other similar displays well known to those skilled in the art . the video display cooperates with the key board , as previously described , in order to input operating parameters into the central controller which are used to cause rotation of the motor 74 , and thereby linear movement of the shoe 82 . the pump system p may also include an infiltration detector in electrical connection with the central controller . it is well known that infusion patients may suffer a piercing of the vein . should the vein be pierced , then the medicament flows into the surrounding muscle tissue , rather than into the vein for being carried by the bloodstream . an air in line detector , a pressure monitor , a skin temperature monitor and a down line pressure monitor are also in circuit connection with the central controller . the pressure monitor is , preferably , based upon the capacitance principle . the skin temperature monitor is used to measure infusion shock , while the down line pressure monitor looks at the vein pressure . a drop counter , based upon the above described radiation emission and detection principle , is applied to the drip chamber 104 . naturally , it should be obvious that a given number of drops per unit time are required to supply the appropriate quantity of fluid . a door latch detector is provided by radiation emission source 216 which illuminates detector 218 . in this way , the central controller can be assured that the door 50 of each pump unit u is closed , and thereby secured , so that operation can continue . fig1 also indicates the backlight which is advantageously positioned within the housing 48 to provide illumination so that the operator can monitor the fluid duct f . also indicated in fig1 is the alarm for the control unit c . operation of the infusion pump system p of fig1 is straightforward . a pump unit u is slid into one of the chambers 12 or 14 . the tube 24 carrying the medicament is then inserted into the inlet opening 116 of the administration set a . the door 50 is then closed and secured by rotation of handle 122 . the appropriate pump unit u is selected from module 40 by depressing the appropriate push button 42 , 44 or 46 . the video display 28 then transmits a number of &# 34 ; lead through &# 34 ; prompts requesting that information be input through any one of the keys of keyboard 30 . the central controller employs an algorithm which makes certain that the appropriate operating information and parameters are input , and thereby avoids the need for extensive training for a particular infusion system . the central controller algorithm makes sure that adequate information is received to permit proper operation , and then monitors operation of the infusion pump system p to make sure that those parameters are maintained . the pumping volume defined by the fixed shoes 130 is known and is constant . therefore , rotation of the shaft 60 assures that a known quantity of fluid is pumped to the patient through cannula 128 . it should be obvious that a given number of strokes per unit time will be required to pump a selected quantity of medicament in like unit time . preferably , the pumping volume defined by the fixed combs 130 is 0 . 002 ml . the central controller permits the operator to select a given volume per unit time from between 0 . 1 to about 2000 ml / hr . furthermore , the pump system p can be programmed for a specific volume of medicament at predetermined times over an extended period . as noted , the pump system p is , preferably , battery powered and has sufficient battery life for 1 , 000 hours at a medicament rate of 125 ml / hr . this extended battery life is attained because of the ability to turn the motor 74 off when pumping is not required . the ratchet pawl 70 prevents the shaft 60 from counterrotating and acts as a brake for maintaining the pump shoe 82 in a fixed position relative to the fluid duct f . because the motor can be turned to the off position , then battery life is maintained and , just as importantly , pumped medicament can not flow backwardly into the pumping volume during the off stroke . although a ratchet pawl 70 is disclosed , those skilled in the art will understand that further positive brake apparatus are known , it merely being required that the pump shoe 82 remain in a fixed position without requiring external power . the pump unit u is particularly advantageous with viscous solutions because of the purge effect which can be achieved . the fluid duct f is vertically disposed within the housing 48 so that the inlet opening 112 is disposed above the outlet opening 126 . any air which may become entrained in the fluid which flows into the pumping chamber 106 will have a tendency to rise upwardly toward duct 110 . during the initial stage of the pumping stroke , as known from linear displacement of the shoe 82 , then the valve 78 may remain slightly open , as shown in fig8 and 9 , from the fully compressed state of fig2 thereby permitting any entrained air to be pumped upwardly into the drip chamber 106 . naturally , the valve 78 will be fully closed for the majority of the pumping stroke so that the pumping volume can remain fixed . the pumping cycle is such that the valve 84 closes while the pump shoe 82 retracts upon achieving full compression . the valve 78 simultaneously begins to open in order to permit the generated vacuum to pull fluid from the drip chamber 104 into the pumping chamber 106 . at the selected time , then the valve orientation reverses and the shoe 82 begins to move linearly toward door 50 , to therefore force the fluid within the pump chamber 106 to be expelled through the outlet 126 . this pumping is very efficient because of the relative thinness of the wall portion 132 of the fluid duct f . because of this relative thinness , then the compression occurs easily without requiring excessive force . while this invention has been described as having a preferred design , it is understood that it is capable of further modifications , uses and / or adaptations of the invention , following in general the principle of the invention , and including such departures from the present disclosure as come within known or customary practice in the art to which the invention pertains , and as may be applied to the central features hereinbefore set forth , and fall within the scope of the invention of the limits of the appended claims . | 5 |
systems and methods are provided for automatically updating a qa test case repository . as used herein , the term multi - tenant database system refers to those systems in which various elements of hardware and software of the database system may be shared by one or more customers . for example , a given application server may simultaneously process requests for a great number of customers , and a given database table may store rows for a potentially much greater number of customers . as used herein , the term query plan refers to a set of steps used to access information in a database system . the following begins with a system overview describing the components of a system for automatically updating a software qa test case repository in an on - demand service . then , mechanisms and methods for automatically updating a software qa test case repository in an on - demand service will be described with reference to example embodiments . fig1 illustrates a block diagram of an environment 10 wherein an on - demand database service might be used . environment 10 may include user systems 12 , network 14 , system 16 , processor system 17 , application platform 18 , network interface 20 , tenant data storage 22 , system data storage 24 , program code 26 , and process space 28 . in other embodiments , environment 10 may not have all of the components listed and / or may have other elements instead of , or in addition to , those listed above . environment 10 is an environment including a system of one or more machines in which an on - demand database service exists . user system 12 may be any machine or system that is used by a user to access a database user system . for example , any of user systems 12 can be a handheld computing device , a mobile phone , a laptop computer , a work station , and / or a network of computing devices . as illustrated in fig1 ( and in more detail in fig2 ) user systems 12 might interact via a network 14 with an on - demand database service , which is system 16 . an on - demand database service , such as system 16 , is a pre - established database system ( a system of one or more machines running a database server ) that is made available to outside users that do not need to necessarily be concerned with building and / or maintaining the database system , but instead may be available for their use when the users need the database system ( e . g ., on the demand of the users ). some on - demand database services may store information from one or more tenants stored into tables of a common database image ( on one or more machine readable media within one or more storage devices and / or other machines ) to form a multi - tenant database system ( mts ). accordingly , “ on - demand database service 16 ” and “ system 16 ” will be used interchangeably herein . a database image may include one or more database objects . a relational database management system ( rdms ) or the equivalent may execute storage and retrieval of information against the database object ( s ). application platform 18 may be a framework that allows the applications of system 16 to run , such as the hardware and / or software , e . g ., the operating system . in an embodiment , on - demand database service 16 may include an application platform 18 that enables creation , management and execution of one or more applications developed by the provider of the on - demand database service , users accessing the on - demand database service via user systems 12 , or third party application developers accessing the on - demand database service via user systems 12 . the users of user systems 12 may differ in their respective capacities , and the capacity of a particular user system 12 might be entirely determined by permissions ( permission levels ) for the current user . for example , where a salesperson is using a particular user system 12 to interact with system 16 , that user system has the capacities allotted to that salesperson . however , while an administrator is using that user system to interact with system 16 , that user system has the capacities allotted to that administrator . in systems with a hierarchical role model , users at one permission level may have access to applications , data , and database information accessible by a lower permission level user , but may not have access to certain applications , database information , and data accessible by a user at a higher permission level . thus , different users may have different capabilities with regard to accessing and modifying application and database information , depending on a user &# 39 ; s security or permission level . network 14 is any network or combination of networks of devices that communicate with one another . for example , network 14 can be any one or any combination of a lan ( local area network ), wan ( wide area network ), telephone network , wireless network , point - to - point network , star network , token ring network , hub network , or other appropriate configuration . as the most common type of computer network in current use is a tcp / ip ( transfer control protocol and internet protocol ) network , such as the global internetwork of networks often referred to as the “ internet ” with a capital “ i ,” that network will be used in many of the examples herein . however , it should be understood that the networks that the present invention might use are not so limited , although tcp / ip is a frequently implemented protocol . user systems 12 might communicate with system 16 using tcp / ip and , at a higher network level , use other common internet protocols to communicate , such as http , ftp , afs , wap , etc . in an example where http is used , user system 12 might include an http client commonly referred to as a “ browser ” for sending and receiving http messages to and from an http server at system 16 . such an http server might be implemented as the sole network interface between system 16 and network 14 , but other techniques might be used as well and / or instead . in some implementations , the interface between system 16 and network 14 includes load sharing functionality , such as round - robin http request distributors to balance loads and distribute incoming http requests evenly over a plurality of servers . at least as for the users that are accessing that server , each of the plurality of servers has access to the mts &# 39 ; data ; however , other alternative configurations may be used instead . in one embodiment , system 16 , shown in fig1 , implements a web - based customer relationship management ( crm ) system . for example , in one embodiment , system 16 includes application servers configured to implement and execute crm software applications as well as provide related data , code , forms , webpages and other information to and from user systems 12 and to store to , and retrieve from , a database system related data , objects , and webpage content . with a multi - tenant system , data for multiple tenants may be stored in the same physical database , object , however , tenant data typically is arranged so that data of one tenant is kept logically separate from that of other tenants so that one tenant does not have access to another tenant &# 39 ; s data , unless such data is expressly shared . in certain embodiments , system 16 implements applications other than , or in addition to , a crm application . for example , system 16 may provide tenant access to multiple hosted ( standard and custom ) applications , including a crm application . user ( or third party developer ) applications , which may or may not include crm , may be supported by the application platform 18 , which manages creation and storage of the applications into one or more database objects and manages execution of the applications in a virtual machine in the process space of one more of machines of the system 16 . one arrangement for elements of system 16 is shown in fig1 , including a network interface 20 , application platform 18 , tenant data storage 22 for tenant data 23 , system data storage 24 for system data 25 accessible to system 16 and possibly multiple tenants , program code 26 for implementing various functions of system 16 , and a process space 28 for executing mts system processes and tenant - specific processes , such as running applications as part of an application hosting service . additional processes that may execute on system 16 include database indexing processes . several elements in the system shown in fig1 include conventional , well - known elements that are explained only briefly here . for example , each user system 12 could include a desktop personal computer , workstation , laptop , pda , cell phone , or any wireless access protocol ( wap ) enabled device or any other computing device capable of interfacing directly or indirectly to the internet or other network connection . user system 12 typically runs an http client , e . g ., a browsing program , such as microsoft &# 39 ; s internet explorer browser , netscape &# 39 ; s navigator browser , opera &# 39 ; s browser , or a wap - enabled browser in the case of a cell phone , pda or other wireless device , or the like , allowing a user ( e . g ., subscriber of the multi - tenant database system ) of user system 12 to access , process and view information , pages and applications available to it from system 16 over network 14 . each user system 12 also typically includes one or more user interface devices , such as a keyboard , a mouse , trackball , touch pad , touch screen , pen or the like , for interacting with a graphical user interface ( gui ) provided by the browser on a display ( e . g ., a monitor screen , lcd display , etc .) in conjunction with pages , forms , applications and other information provided by system 16 or other systems or servers . for example , the user interface device can be used to access data and applications hosted by system 16 , and to perform searches on stored data , and otherwise allow a user to interact with various gui pages that may be presented to a user . as discussed above , embodiments are suitable for use with the internet , which refers to a specific global internetwork of networks . however , it should be understood that other networks can be used instead of the internet , such as an intranet , an extranet , a virtual private network ( vpn ), a non - tcp / ip based network , any lan or wan or the like . according to one embodiment , each user system 12 and all of its components are operator configurable using applications , such as a browser , including computer code run using a central processing unit such as an intel pentium ® processor or the like . similarly , system 16 ( and additional instances of an mts , where more than one is present ) and all of their components might be operator configurable using application ( s ) including computer code to run using a central processing unit such as processor system 17 , which may include an intel pentium ® processor or the like , and / or multiple processor units . a computer program product embodiment includes a machine - readable storage medium ( media ) having instructions stored thereon / in which can be used to program a computer to perform any of the processes of the embodiments described herein . computer code for operating and configuring system 16 to intercommunicate and to process webpages , applications and other data and media content as described herein are preferably downloaded and stored on a hard disk , but the entire program code , or portions thereof , may also be stored in any other volatile or non - volatile memory medium or device as is well known , such as a rom or ram , or provided on any media capable of storing program code , such as any type of rotating media including floppy disks , optical discs , digital versatile disk ( dvd ), compact disk ( cd ), microdrive , and magneto - optical disks , and magnetic or optical cards , nanosystems ( including molecular memory ics ), or any type of media or device suitable for storing instructions and / or data . additionally , the entire program code , or portions thereof , may be transmitted and downloaded from a software source over a transmission medium , e . g ., over the internet , or from another server , as is well known , or transmitted over any other conventional network connection as is well known ( e . g ., extranet , vpn , lan , etc .) using any communication medium and protocols ( e . g ., tcp / ip , http , https , ethernet , etc .) as are well known . it will also be appreciated that computer code for implementing embodiments of the present invention can be implemented in any programming language that can be executed on a client system and / or server or server system such as , for example , c , c ++, html , any other markup language , java ™, javascript , activex , any other scripting language , such as vbscript , and many other programming languages as are well known may be used . ( java ™ is a trademark of sun microsystems , inc .). according to one embodiment , each system 16 is configured to provide webpages , forms , applications , data and media content to user ( client ) systems 12 to support the access by user systems 12 as tenants of system 16 . as such , system 16 provides security mechanisms to keep each tenant &# 39 ; s data separate unless the data is shared . if more than one mts is used , they may be located in close proximity to one another ( e . g ., in a server farm located in a single building or campus ), or they may be distributed at locations remote from one another ( e . g ., one or more servers located in city a and one or more servers located in city b ). as used herein , each mts could include one or more logically and / or physically connected servers distributed locally or across one or more geographic locations . additionally , the term “ server ” is meant to include a computer system , including processing hardware and process space ( s ), and an associated storage system and database application ( e . g ., oodbms or rdbms ) as is well known in the art . it should also be understood that “ server system ” and “ server ” are often used interchangeably herein . similarly , the database object described herein can be implemented as single databases , a distributed database , a collection of distributed databases , a database with redundant online or offline backups or other redundancies , etc ., and might include a distributed database or storage network and associated processing intelligence . fig2 also illustrates environment 10 . however , in fig2 elements of system 16 and various interconnections in an embodiment are further illustrated . fig2 shows that user system 12 may include processor system 12 a , memory system 12 b , input system 12 c , and output system 12 d . fig2 shows network 14 and system 16 . additionally , fig2 includes additional user systems 12 ′. fig2 also shows that system 16 may include tenant data storage 22 , tenant data 23 , system data storage 24 , system data 25 , user interface ( ui ) 30 , application program interface ( api ) 32 , pl / soql 34 , save routines 36 , application setup mechanism 38 , applications servers 100 1 - 100 n , system process space 102 , tenant process spaces 104 , tenant management process space 110 , tenant storage area 112 , user storage 114 , and application metadata 116 . in other embodiments , environment 10 may not have the same elements as those listed above and / or may have other elements instead of , or in addition to , those listed above . user system 12 , network 14 , system 16 , tenant data storage 22 , and system data storage 24 were discussed above in fig1 . regarding user system 12 , processor system 12 a may be any combination of one or more processors . memory system 12 b may be any combination of one or more memory devices , short term , and / or long term memory . input system 12 c may be any combination of input devices , such as one or more keyboards , mice , trackballs , scanners , cameras , and / or interfaces to networks . output system 12 d may be any combination of output devices , such as one or more monitors , printers , and / or interfaces to networks . user systems 12 ′ may be any in - house machine or system in relation to the on - demand database service , that is used by a user to access a database user system . an in - house machine or system may be physically located on - site and / or otherwise associated with the on - demand database service . as illustrated in fig2 , user systems 12 ′ might interact via a network 14 with an on - demand database service , which is system 16 . in an embodiment , user systems 12 ′ may interact directly with an on - demand database service without benefit of network 14 . as shown by fig2 , system 16 may include a network interface 20 ( of fig1 ) implemented as a set of http application servers 100 , an application platform 18 , tenant data storage 22 , and system data storage 24 . also shown is system process space 102 , including individual tenant process spaces 104 and a tenant management process space 110 . each application server 100 may be configured to tenant data storage 22 and the tenant data 23 therein , and system data storage 24 and the system data 25 therein to serve requests of user systems 12 and 12 ′. the tenant data 23 might be divided into individual tenant storage areas 112 , which can be either a physical arrangement and / or a logical arrangement of data . within each tenant storage area 112 , user storage 114 and application metadata 116 might be similarly allocated for each user . for example , a copy of a user &# 39 ; s most recently used ( mru ) items might be stored to user storage 114 . similarly , a copy of mru items for an entire organization that is a tenant might be stored to tenant storage area 112 . a ui 30 provides a user interface and an api 32 provides an application programmer interface to system 16 resident processes to users and / or developers at user systems 12 and 12 ′. the tenant data and the system data may be stored in various databases , such as one or more oracle ™ databases . application platform 18 includes an application setup mechanism 38 that supports application developers &# 39 ; creation and management of applications , which may be saved as metadata into tenant data storage 22 by save routines 36 for execution by subscribers as one or more tenant process spaces 104 managed by tenant management process 110 for example . invocations to such applications may be coded using pl / soql 34 that provides a programming language style interface extension to api 32 . a detailed description of some pl / soql language embodiments is discussed in commonly owned u . s . provisional patent application 60 / 828 , 192 entitled , programming language method and system for extending apis to execute in conjunction with database apis , by craig weissman , filed oct . 4 , 2006 , which is incorporated in its entirety herein for all purposes . invocations to applications may be detected by one or more system processes , which manages retrieving application metadata 116 for the subscriber making the invocation and executing the metadata as an application in a virtual machine . each application server 100 may be communicably coupled to database systems , e . g ., having access to system data 25 and tenant data 23 , via a different network connection . for example , one application server 100 1 might be coupled via the network 14 ( e . g ., the internet ), another application server 100 n - 1 might be coupled via a direct network link , and another application server 100 n might be coupled by yet a different network connection . transfer control protocol and internet protocol ( tcp / ip ) are typical protocols for communicating between application servers 100 and the database system . however , it will be apparent to one skilled in the art that other transport protocols may be used to optimize the system depending on the network interconnect used . in certain embodiments , each application server 100 is configured to handle requests for any user associated with any organization that is a tenant . because it is desirable to be able to add and remove application servers from the server pool at any time for any reason , there is preferably no server affinity for a user and / or organization to a specific application server 100 . in one embodiment , therefore , an interface system implementing a load balancing function ( e . g ., an f5 big - ip load balancer ) is communicably coupled between the application servers 100 and the user systems 12 and 12 ′ to distribute requests to the application servers 100 . in one embodiment , the load balancer uses a least connections algorithm to route user requests to the application servers 100 . other examples of load balancing algorithms , such as round robin and observed response time , also can be used . for example , in certain embodiments , three consecutive requests from the same user could hit three different application servers 100 , and three requests from different users could hit the same application server 100 . in this manner , system 16 is multi - tenant , wherein system 16 handles storage of , and access to , different objects , data and applications across disparate users and organizations . as an example of storage , one tenant might be a company that employs a sales force where each salesperson uses system 16 to manage their sales process . thus , a user might maintain contact data , leads data , customer follow - up data , performance data , goals and progress data , etc ., all applicable to that user &# 39 ; s personal sales process ( e . g ., in tenant data storage 22 ). in an example of a mts arrangement , since all of the data and the applications to access , view , modify , report , transmit , calculate , etc ., can be maintained and accessed by a user system having nothing more than network access , the user can manage his or her sales efforts and cycles from any of many different user systems . for example , if a salesperson is visiting a customer and the customer has internet access in their lobby , the salesperson can obtain critical updates as to that customer while waiting for the customer to arrive in the lobby . while each user &# 39 ; s data might be separate from other users &# 39 ; data regardless of the employers of each user , some data might be organization - wide data shared or accessible by a plurality of users or all of the users for a given organization that is a tenant . thus , there might be some data structures managed by system 16 that are allocated at the tenant level while other data structures might be managed at the user level . because an mts might support multiple tenants including possible competitors , the mts should have security protocols that keep data , applications , and application use separate . also , because many tenants may opt for access to an mts rather than maintain their own system , redundancy , up - time , and backup are additional functions that may be implemented in the mts . in addition to user - specific data and tenant - specific data , system 16 might also maintain system level data usable by multiple tenants or other data . such system level data might include industry reports , news , postings , and the like that are sharable among tenants . in certain embodiments , user systems 12 ( which may be client systems ) communicate with application servers 100 to request and update system - level and tenant - level data from system 16 that may require sending one or more queries to tenant data storage 22 and / or system data storage 24 . system 16 ( e . g ., an application server 100 in system 16 ) automatically generates one or more sql statements ( e . g ., one or more sql queries ) that are designed to access the desired information . system data storage 24 may generate query plans to access the requested data from the database . similar to user systems 12 , in certain embodiments , user systems 12 ′ ( which may be in - house client systems ) communicate with application servers 100 to request and update system - level and tenant - level data from system 16 that may require sending one or more queries to tenant data storage 22 and / or system data storage 24 . system 16 ( e . g ., an application server 100 in system 16 ) automatically generates one or more sql statements ( e . g ., one or more sql queries ) that are designed to access the desired information . system data storage 24 may generate query plans to access the requested data from the database . each database can generally be viewed as a collection of objects , such as a set of logical tables , containing data fitted into predefined categories . a “ table ” is one representation of a data object , and may be used herein to simplify the conceptual description of objects and custom objects according to the present invention . it should be understood that “ table ” and “ object ” may be used interchangeably herein . each table generally contains one or more data categories logically arranged as columns or fields in a viewable schema . each row or record of a table contains an instance of data for each category defined by the fields . for example , a crm database may include a table that describes a customer with fields for basic contact information such as name , address , phone number , fax number , etc . another table might describe a purchase order , including fields for information such as customer , product , sale price , date , etc . in some multi - tenant database systems , standard entity tables might be provided for use by all tenants . for crm database applications , such standard entities might include tables for account , contact , lead , and opportunity data , each containing pre - defined fields . it should be understood that the word “ entity ” may also be used interchangeably herein with “ object ” and “ table ”. in some multi - tenant database systems , tenants may be allowed to create and store custom objects , or they may be allowed to customize standard entities or objects , for example by creating custom fields for standard objects , including custom index fields . u . s . patent application ser . no . 10 / 817 , 161 , filed apr . 2 , 2004 , entitled “ custom entities and fields in a multi - tenant database system ”, and which is hereby incorporated herein by reference , teaches systems and methods for creating custom objects as well as customizing standard objects in a multi - tenant database system . in certain embodiments , for example , all custom entity data rows are stored in a single multi - tenant physical table , which may contain multiple logical tables per organization . it is transparent to customers that their multiple “ tables ” are in fact stored in one large table or that their data may be stored in the same table as the data of other customers . fig3 a shows a block diagram of an embodiment of a tenant process 104 in process space 28 . tenant process 104 may include qa application 302 with test repository tool 304 . tenant process space 104 may further include other processes 306 . in other embodiments , tenant process space 104 , may not have all of the elements listed and / or may have other elements instead of or in addition to those listed . qa application 302 is an application that allows software developers to track , place and store test cases in a qa test case repository . in one implementation , qa application 302 tracks both manual and automated test cases in the qa test case repository . a qa test case repository may be a database or a portion of a database containing previously run test cases , test case parameters , test case execution data , and / or descriptions of the test cases , according to one embodiment . a qa test case repository allows developers , development teams , and subsequent developers , to find , reference , and / or reuse test cases . qa application 302 may be used to track , place , and store test cases created to fix software bugs or test new features or functionality ( which , for example , may have been added in response to user requests ) in the qa test case repository . in an embodiment , qa application 302 may have a feature that allows developers to track the percentage of manual test cases versus automated test cases . by being able to track the percentage of manual test cases and automated test cases , developers can identify areas vulnerable to regression as a result of code changes . regression is when errors and bugs believed to have been fixed in prior revisions reoccur after further code changes . qa application 302 may invoke or be incorporated within the database application ( e . g ., the oodbms or rdbms ). test repository tool 304 ( of qa application 302 ) allows developers to establish and view a hierarchy of test cases and execution data stored in a database . for example , a developer may create a new test case for testing whether electronic mail alerts are being sent when new electronic mail is received . in an embodiment , the developer may use test repository tool 304 to view the hierarchy of the qa test case repository to determine where to store the newly created electronic mail alert test case . for example , using test repository tool 304 the developer may store the electronic mail alert test case in a hierarchy level containing test cases related to electronic mail functionality . the qa test repository hierarchy allows developers to organize test cases and execution data so that the test cases can be quickly accessed and referenced whenever needed . in an embodiment , the hierarchy may be organized in a manner that facilitates the rapid updating , uploading , inserting , and / or accessing of test cases . for example , the hierarchy may group together test cases by creation date , execution date , upload date , functionality , etc . in an embodiment , test repository tool 304 may display to the user descriptive information about the test case in plain language . the plain language description may allow developers and non - technical individuals to quickly assess the intent , status and outcome of stored test cases . additionally , test repository tool 304 may be used to alter and edit the hierarchy of the qa test case repository . for example , when creating or editing test cases , the user may be presented with a number of fields where a pre - existing hierarchy level may be selected , a pre - existing hierarchy level may be modified or edited , or a new hierarchy level may be created which better suits the test case . alternatively , the user may select or be presented with a drop down menu allowing the user to modify , edit , or create hierarchy levels . other processes 306 may contain other tenant processes , for example processes for enabling other tenant features and functionality . in other embodiments , any combination of the elements of fig3 a may be located in other parts of system 16 instead of process space 28 . fig3 b shows a block diagram of an embodiment of an in - house user system 12 ′. similar to user system 12 , the processor system of 12 a ′ may be any combination of one or more processors . memory system 12 b ′ may be any combination of one or more memory devices , short term , and / or long term memory . input system 12 c ′ may be any combination of input devices , such as one or more keyboards , mice , trackballs , scanners , cameras , and / or interfaces to networks . output system 12 d ′ may be any combination of output devices , such as one or more monitors , printers , and / or interfaces to networks . memory system 12 b ′ may include automatic update tool 308 and test automation suite 310 . memory system 12 b ′ may further include other data 312 . in other embodiments , user system 12 b ′ may not have all of the elements listed and / or may have other elements instead of or in addition to those listed . automatic update tool 308 is a tool that automatically places test cases and test case execution data into the qa test case repository , preferably , at the proper hierarchy level . for example , the test case for the electronic mail alert example described above may be subjected to automated testing , resulting in numerous test executions . in one implementation , invoking automatic update tool 308 before executing the automated testing results in the automatic “ upserting ” of the test case and associated execution data to the test repository . performing an “ upsert ” involves inserting the test case and its execution data into the qa test case repository . upserting can be done when a prior version of the test case does not exist in the repository . alternatively , upserting can update execution data when a prior test case version already exists in the repository . in an embodiment , updating the execution data when a prior test case version and / or execution already exists does not overwrite previous execution data . in an embodiment , when a test case version and / or execution data already exists , new data is added to the file and / or record containing the previous data . in another embodiment , a new file and / or subfolder is added to the folder or record for the test case . in one implementation , automatic update tool 308 may be used to upload and update the test case execution data at any time before or after executing automated testing . note that while automatic update tool 308 is described as placing , updating , and uploading the test case to the qa test repository , automatic update tool 308 sends a request to initiate the placing , updating , and uploading . in response to the request , qa application 302 automatically handles the test repository action request . in an embodiment , automatic update tool 308 may be invoked via a control on a webpage . for example , the user may be presented with a webpage that allows the user to select the use of automatic update tool 308 via a checkbox or button that is located on the webpage . alternatively , automatic update tool 308 may be invoked via a command line . for example , the user may access a command line and type in the commands necessary to invoke automatic update tool 308 . in an embodiment , the user may be given a choice whether to invoke automatic update tool 308 via webpage or a command line . in one implementation , automatic update tool 308 simplifies the test case uploading and updating process because it provides the capability to automatically extract test case attributes from the test cases . the test case attributes can facilitate automatically updating and / or uploading to the proper test case repository hierarchy level . in an embodiment , automatic update tool 308 may need only a single test case attribute , such as the hierarchy level attribute , to update and upload the test case data to the qa test case repository . however , with only a hierarchy level attribute , the descriptive information stored with the test case in the test case repository might be less informative to subsequent users . in an embodiment , automatic update tool 308 may use a relatively small number of attributes ( e . g ., just 4 test case attributes ) to update and upload to the qa test case repository . for example , the test case attributes used may include subject , description , associated user story and hierarchy level . a user story is a software requirement captured in common vernacular ( e . g ., “ plain english ” or natural language ) usually in the form of a sentence . in an embodiment , automatic update tool 308 gives test authors the ability to reuse common attributes shared by tests within the same class instead of having to re - enter the information . for example , a new test case which is a modified version of an older test case may inherit the attributes of the older test case without the need for the test author to specify the attributes . in an embodiment , the extracted attributes are used by automatic update tool 308 to generate a unique id , which is used as a unique external key to update and upload to the qa test repository . in an embodiment , the extracted user story is sent to qa application 302 , which returns a unique id associated with the user story which is used to update and upload to the qa test repository . in an embodiment , the descriptive information displayed by test repository tool 304 may include the test case subject , description , associated user story , and hierarchy level . in alternative embodiments , other attributes may be used . note that the term attribute as used in this application is generic to both a database key and its ordinary dictionary definition , which would include a feature and / or characteristic of a test case . to illustrate how attributes are used , consider the example attributes mentioned above ( e . g . subject , description , associated user story , and hierarchy level attributes ). the subject of the test case can be a brief one - sentence representation of the test case . for example , the subject for the electronic mail alert described previously might be “ test for electronic mail alert ” or “ electronic mail alert notification test .” the description of the test case may be a detailed plain language explanation of the purpose and functionality of the test case . for example , the plain language description of the electronic mail alert test case may be “ create list 1 of users that should receive email alert , create list 2 of users that should not receive email alert . run useralert routine to identify which users are to receive email alert . run sendalert routine to send alert to list 1 users . verify whether email alert was successfully sent to list 1 users . verify email alert was not sent to list 2 users .” in an embodiment , test repository tool 304 displays the subject and description of the test case such that developers and non - technical individuals can quickly determine the essence of the test case . the user story was briefly explained above ( as a reminder , user story is a software requirement described in common vernacular ). an example of a user story may be , “ as an electronic mail user i want to receive email alerts when there is new mail so that i can be more responsive to customers needs .” the user story of the test case refers to a user story name or user story id . each user story is given a unique user story name or user story id to uniquely identify it from other user stories . for example , the user story name for the electronic mail alert test case may be “ contacts : email alert ”. in an embodiment , a user story id may be in the form of a 15 - character id or an 18 - character id , for example , a01t00000033izriai . in an alternative implementations , the user story id may be generated in a different way . the test case hierarchy level designates where the test case is to be updated and / or uploaded to within the test case repository . in an embodiment , the hierarchy used in the test case repository may include a classification system having several classes and each class may have several subclasses . optionally , the subclasses may be divided into further subclasses of subclasses . in an embodiment , the name of the class may be followed by a dot ( or another predetermined character ) followed by the name of the subclass and / or test case . optionally , each level or further sub - classification may be separated from the class / subclass below / test case by a dot . for example , in a two level hierarchy , in which the email alert test case is contained in the class “ contacts ”, the hierarchy level for the email alert test case might be in the form “ contacts . email alerts ” or in a three level hierarchy in which contacts is a subclass of the class “ communications ” might be “ communications . contacts . email alerts .” automatic update tool 308 may extract the necessary attributes for uploading and updating the qa test repository from a number of different sources . for example , automatic update tool 308 may extract the attributes from a comment , the comment being text within a portion of the test source code that is ignored by a compiler . a comment is inserted by the developer and can be used to explain and describe the source code , the intent of the developer , what the source code attempts to accomplish , and / or for general documentation purposes . in an embodiment , automatic update tool 308 may extract the attributes from a comment contained at the test method level or the class level ( the class level in which the test method is defined or any higher hierarchical class the test method belongs to , because of inheritance ), or both . for example , if the test case is implemented as a java class , automatic update tool 308 may extract the attributes from a class level javadoc comment . the comment is distinguished from the source code by a delimiter , which can vary depending upon the programming language used . for example , some programming languages may use “/*”, “!”, or “#” as a delimiter . the following illustrates a javadoc comment beginning with a begin comment delimiter /** and ending with delimiter */. * test for new electronic mail alert . test determines whether the user in an embodiment , automatic update tool 308 extracts the subject of the test case from the comment . for example , in the javadoc comment above , the first sentence “ test for new electronic mail alert ” is extracted by automatic update tool 308 and becomes the subject of the test case . in an embodiment , automatic update tool 308 may also extract the test case description from the comment . for example , in the javadoc comment above , the second sentence is distinguished by a sentence break in the form of a period and is extracted as the test case description . in other embodiments , other characters or markers are used to distinguish between different attributes , such as line breaks , semicolons , and / or commas . the distinguishing of the second sentence results in an extracted test case description of “ test determines whether the user notification flag is set when new email is received .” in an embodiment , if the first sentence extracted for the test case subject ( or another attribute such as the case description ) is longer than a preset character allotment , the subject will be truncated at the end of the last word that fits within the preset character allotment . in one implementation , subsequent words and sentences get prefixed to the test case description . in an embodiment , automatic update tool 308 extracts the user story and hierarchy level from the comment by using identifying tags . a tag is an indicator that identifies to automatic update tool 308 what immediately follows is to be extracted . a tag also informs the developer what the immediately following value represents . in an embodiment , a tag may be indicated by using the @ symbol followed by a descriptive name of the value to be extracted . for example , in the javadoc comment above , the tags @ userstory and @ hierarchy precede the user story and hierarchy data values extracted by automatic update tool 308 . in an alternative embodiment , a tag may be indicated by using the @ symbol and a non - descriptive name . for example , @ nondescriptive 1 or @ anything could be used as tags . in an embodiment , tags may be indicated by using any designated convention for denoting a tag . for example , { tag 1 }, [ userstory ], + anothertag +, & amp ; userstory , & lt ; attributetag & gt ;, etc ., may all be designated conventions for denoting a tag . automatic update tool 308 may also extract attributes from test automation suite 310 and / or a test inventory file . test automation suite 310 is an application containing scripts for executing test cases . in an embodiment , test automation suite 310 allows the developer to use the scripts to execute automated test cases to determine whether the test cases function as expected . depending on whether the automated test case executions result in expected outcomes , the test cases may pass or fail . the use of the scripts of test automation suite 310 allows the developer to automatically execute test cases multiple times . in an embodiment , test automation suite 310 may contain a test inventory file . the test inventory file is a file containing a catalog of test classes used by test automation suite 310 to run tests for new features or functionality . in an embodiment , a test class may have one or more test methods , and each test method maps to one or more test cases in the repository . in an embodiment , there is a one to one correspondence of test method to test case , which may simplify troubleshooting . for example , if one test method maps to ten test cases , it may take longer to diagnose and / or correct a problem as compared to a test method mapping to one test case , as the test methods become large and complex . in an embodiment , all fields that are permitted in class level test case documentation are permissible in the test inventory file . for example , the catalog of test classes in the inventory file may contain the hierarchy level and user story attributes used for updating and uploading the test case to the qa test repository . in an embodiment , automatic update tool 308 gives precedence to attributes extracted closest to the test method . attributes which are closer or local to the test method are more relevant and given a higher priority than other attributes . for example , if the necessary attributes for uploading are provided at the test method level , then attributes provided at the class level and / or inventory level may be ignored . if any attributes required by automatic update tool 308 to update and upload to the test repository are missing from either the test cases , the test automation suite 310 , or the test inventory file , automatic upload tool 308 may extract the missing attributes from any combination of the test case , test automation suite 310 , and / or the test inventory file . for example , in an embodiment , if the test inventory file does not contain the hierarchy level or user story attributes , the hierarchy level or user story attributes may be accessible in either a class level or a method level comment for automatic upload tool 308 to extract . otherwise , in some implementations , the upload to the test repository may fail . in an embodiment , automatic upload tool 308 first extracts attributes from the test inventory file , then extracts the attributes at the class level , and then extracts attributes at the test method level . in an embodiment , attributes that are closer and / or local to the test method are more relevant than attributes provided at common and / or higher levels . for example , if attributes for all fields are provided at the test method level , everything at the class or inventory level will be ignored . attributes contained at more then one level are extracted and stored with the values extracted closest to the test method level . in an embodiment , if an attribute required for automatic upload tool 308 is missing , automatic upload tool 308 may prompt the user for missing attributes . upon receiving the missing attributes automatic upload tool 308 may then continue updating and uploading to the qa test repository . in an embodiment , automatic upload tool 308 tracks the results of the upload process in an output file , which can be used to identify data issues that may have resulted in validation failures ( for example , referencing a non - existent user story , missing required data ). automatic update tool 308 may optionally extract additional data identified by tags but which are not necessary to update and upload to the qa test repository . for example , automatic update tool 308 might optionally extract test case priority , test case owner , test case assignee , expected results , etc . the additional optional data gives developers that subsequently access the test repository a more complete understanding of the test case . in an embodiment , automatic upload tool 308 may extract attributes used to update and upload to a qa test repository from test cases documented using java annotations . in an alternative embodiment , automatic upload tool 308 may extract attributes used to update and upload to the test repository from test cases documented in other software languages . in an alternative embodiment , test repository tool 304 and automatic update tool 308 may be different functions of the same tool . memory system 12 b ′ of user system 12 ′ may also include test automation suite 310 . as described previously , test automation suite 310 allows the developer to test new automated test cases to determine whether the test cases function as expected . in an alternative embodiment , test automation suite 310 may include automatic update tool 308 . in an alternative embodiment , automatic update tool 308 may include test automation suite 310 . other data 312 may contain other software programs for performing other qa functions , for example running and executing test cases manually . in other embodiments , any of combination of the elements of fig3 may be located in other parts of system 16 instead of process space 28 . fig4 shows a block diagram of an embodiment of tenant data storage 22 . tenant data storage 22 may include test case repository 404 . tenant data storage 22 may also include other data 406 . in other embodiments , tenant data storage 22 may not have all of the elements listed and / or may have other elements instead of or in addition to those listed . tenant data storage 22 was described in fig1 and 2 . tenant data storage 22 may also store different types of related tenant data . for example , other tenant application data and other tenant application execution data may be stored in tenant data storage 22 . test case repository 404 is a collection that includes prior test cases that have been already previously run , test case documentation , and test execution data . for example , test case repository 404 may contain the electronic mail alert test case described above after having been automatically executed with test automation suite 310 . test case repository 404 may also contain the documentation associated with the test case such as description of the test case , input , output , associated user story , hierarchy level , expected results , revision number , date created , owner , etc ., and whether the test passed or failed . other data 406 may include any other data saved on system 16 . for example , standard and custom user or third party applications , which may include crm , may be stored in other data 406 . fig5 shows a flowchart of an embodiment of a system side method for automatically updating and uploading to a test case repository . in step 502 , qa application 302 may receive a request to automatically update and upload test case data to the test case repository . for example , qa application 302 may receive a request to automatically update and upload to the test case repository from a user system . in step 504 , qa application 302 may receive test case attributes and test case and execution data from a user system . in step 506 , qa application 302 determines the appropriate place in the qa test repository for the test case and execution data , for example , where in the hierarchy the test case and execution data should be stored . in an embodiment , the extracted test case hierarchy data received by qa application 302 may be used to find the appropriate class and subclass where the test case belongs . for example , in order to place a test case having a hierarchy level communications . contacts . new email alerts into a hierarchy having three levels , qa application 302 first searches for the class communications . after finding the communications class , qa application 302 then searches for subclass contacts within the class communications . after finding the contacts subclass , qa application 302 places new email alerts into subclass contacts within class communications . in an embodiment , automatic update tool 308 may use the generated unique external key to update and upload to the test repository . in step 508 , qa application 302 determines whether previous test case executions of the test case being updated and uploaded , exist in the qa test case repository . if previous test executions of the test case being updated and / or uploaded do exist , step 510 is performed . if previous test executions of the test case being updated or uploaded do not exist , step 510 is skipped and step 512 is performed . in step 510 , prior test executions of the test case being updated and uploaded exist , and the qa test repository is update with the latest test case version and execution data . in step 512 , prior test executions of the test being updated and uploaded do not exist , and the test case and execution data are inserted into the qa test repository . in step 514 , notification is sent to the user system indicating the status of the uploading and updating of the test case and associated execution data to the qa test repository . in an embodiment , each of the steps of method 500 is a distinct step . in another embodiment , although depicted as distinct steps in fig5 , steps 502 - 514 may not be distinct steps . in other embodiments , method 500 may not have all of the above steps and / or may have other steps in addition to , or instead of , those listed above . the steps of method 500 may be performed in another order . subsets of the steps listed above as part of method 500 may be used to form their own method . fig6 shows a flowchart of an embodiment of a user side method for automatically updating and uploading to a test case repository . in step 602 , the user sends a request to automatically update and upload to the qa test case repository . for example , the user may send the request by indicating on a webpage checkbox or button selection , the use of automatic update tool 308 . in step 604 , the user runs the automated scripts stored in test automation suite 310 that executes the test case which is to be uploaded to or updated in the qa test case repository . in step 606 , the user is notified of the progress or result of the test case execution ( s ). in step 608 , automatic upload tool 308 accesses the automated test case , test automation suite 310 , the inventory file for test automation suite 310 , or any combination of sources required to extract the test case attributes needed to update and upload to the test case repository . in step 610 , automatic upload tool 308 extracts the test case attributes necessary to update and upload to the test case repository . as explained above , automatic upload tool 308 may extract the attributes from any combination of the test case , the test automation suite , or the test automation inventory file . the attributes extracted may include subject , description , user story , and hierarchy . in step 612 , the extracted test case attributes , test case , and associated execution data are sent to the qa test case repository for uploading and updating . in step 614 , the user system is notified of the results of the upload and update process to the qa test case repository . in an embodiment , each of the steps of method 600 is a distinct step . in another embodiment , although depicted as distinct steps in fig5 , steps 602 - 614 may not be distinct steps . in other embodiments , method 600 may not have all of the above steps and / or may have other steps in addition to , or instead of , those listed above . the steps of method 600 may be performed in another order . subsets of the steps listed above as part of method 600 may be used to form their own method . method for using the environment ( fig1 and 2 ) fig7 shows a flowchart of an example of a method 700 of using environment 10 . in step 710 , user system 12 ( fig1 and 2 ) establishes an account . in step 712 , one or more tenant process space 104 ( fig2 ) are initiated on behalf of user system 12 , which may also involve setting aside space in tenant space 112 ( fig2 ) and tenant data 114 ( fig2 ) for user system 12 . step 712 may also involve modifying application metadata to accommodate user system 12 . in step 714 , user system 12 uploads data . in step 716 , one or more data objects are added to tenant data 114 where the data uploaded is stored . in step 718 , the methods associated with fig5 and fig6 may be implemented . for example , in step 718 , qa application 302 , may receive a request to automatically upload and update the qa test repository via a webpage checkbox or button selecting the use of automatic update tool 308 . in response to the request , automatic update tool 308 may access and extract test case attributes used for inserting and / or updating to the qa test repository from the test case , automation suite 310 , or the test inventory file . automatic update tool 308 may then determine the appropriate hierarchy for the extracted test case and execution data based on the extracted attributes , and insert and / or update the test case and execution data into the qa test case repository . in another embodiment , although depicted as distinct steps in fig7 , steps 702 - 718 may not be distinct steps . in other embodiments , method 700 may not have all of the above steps and / or may have other steps in addition to , or instead of , those listed above . the steps of method 700 may be performed in another order . subsets of the steps listed above as part of method 700 may be used to form their own method . method for creating the environment ( fig1 and 2 ) fig8 is a method of making environment 10 , in step 802 , user system 12 ( fig1 and 2 ) is assembled , which may include communicatively coupling one or more processors , one or more memory devices , one or more input devices ( e . g ., one or more mice , keyboards , and / or scanners ), one or more output devices ( e . g ., one more printers , one or more interfaces to networks , and / or one or more monitors ) to one another . in step 804 , system 16 ( fig1 and 2 ) is assembled , which may include communicatively coupling one or more processors , one or more memory devices , one or more input devices ( e . g ., one or more mice , keyboards , and / or scanners ), one or more output devices ( e . g ., one more printers , one or more interfaces to networks , and / or one or more monitors ) to one another . additionally assembling system 16 may include installing application platform 18 , network interface 20 , tenant data storage 22 , system data storage 24 , system data 25 , program code 26 , process space 28 , ui 30 , api 32 , pl / soql 34 , save routine 36 , application setup mechanism 38 , applications servers 100 1 - 100 n , system process space 102 , tenant process spaces 104 , tenant management process space 110 , tenant space 112 , tenant data 114 , and application metadata 116 ( fig2 ). in step 806 , user system 12 is communicatively coupled to network 104 . in step 808 , system 16 is communicatively coupled to network 104 allowing user system 12 and system 16 to communicate with one another ( fig2 ). in step 810 , one or more instructions may be installed in system 16 ( e . g ., the instructions may be installed on one or more machine readable media , such as computer readable media , therein ) and / or system 16 is otherwise configured for performing the steps of methods associated with fig5 and fig6 . for example , qa application 302 may be installed in program space 26 of system 16 . in an embodiment , each of the steps of method 800 is a distinct step . in another embodiment , although depicted as distinct steps in fig8 , steps 802 - 810 may not be distinct steps . in other embodiments , method 800 may not have all of the above steps and / or may have other steps in addition to , or instead of , those listed above . the steps of method 800 may be performed in another order . subsets of the steps listed above as part of method 800 may be used to form their own method . in an alternative embodiment , updating the qa test case repository may be performed based on any combination of subject , description , associated user story , and / or hierarchy level . for example , the update may be performed based on just the subject and the associated user story or based just on the hierarchy level . in an alternative embodiment , tags are used to identify all of the attributes necessary for updating and uploading to the test repository . for example , instead of designating the first sentence as the subject of the test case and the second sentence as the description of the test case , automatic upload tool 308 extracts the subject and description after encountering the @ subject and @ description tags . in an alternative embodiment , automatic upload tool 308 may extract attributes used to update and upload to the qa test case repository from multiple comments contained within the same test case . for example , automatic upload tool 308 may combine multiple comments ( which may be located in a variety of places ) within the test case to create a test case description . in an alternative embodiment , automatic upload tool 308 may be located on application server 100 . in an alternative embodiment , automatic upload tool 308 may be located in tenant process space 28 and / or tenant process 104 . each embodiment disclosed herein may be used or otherwise combined with any of the other embodiments disclosed . any element of any embodiment may be used in any embodiment . while the invention has been described by way of example and in terms of the specific embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . to the contrary , it is intended to cover various modifications and similar arrangements as would be apparent to those skilled in the art . therefore , the scope of the appended claims should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 6 |
the present invention relates generally to a tissue oximetry device for measuring oxygen saturation in a local tissue volume . more specifically , the present invention relates to a wireless , handheld , tissue oximetry device that has self - contained optics ( lights sources and detectors ), computer processing , a display , a power - supply , and a tissue marker for marking tissue as the tissue is probed by the self - contained optics . fig1 a and 1b are a simplified perspective view and a top view , respectively , of a tissue oximetry device 100 according to one embodiment . the figures show an enclosure or housing of an oximeter probe device . tissue oximetry device 100 is configured to make tissue oximetry measurements , such as intraoperatively and postoperatively . in an implementation , the tissue oximetry device is handheld device and can make tissue oximetry measurements and display these measurements , without needing to connect to another external component either via a cable or wirelessly . the electronics to make measurements and calculations is contained entirely within the housing of the tissue oximetry device . the device may be a standalone handheld tissue oximetry device , without a cable or wireless connection . tissue oximetry device 100 may be a handheld device that includes a tissue oximetry probe 115 ( also referred to as a sensor head ), which may be positioned at an end of a sensing arm 114 . tissue oximetry device 100 is configured to measure the oxygen saturation of tissue by emitting light , such as red and near - infrared light , from tissue oximetry probe 115 into tissue , and collecting light reflected from the tissue at the tissue oximetry probe . tissue oximetry device 100 may include a display 112 or other notification device ( e . g ., a speaker for audible notification ) that notifies a user of oxygen saturation values measured by the tissue oximetry device . while tissue oximetry probe 115 is described as being configured for use with tissue oximetry device 100 , which is a handheld device , tissue oximetry probe 115 may be used with other tissue oximetry devices , such as a modular tissue oximetry device where the tissue oximetry probe is at the end of a cable device that couples to a base unit . the cable device might be a disposable device that is configured for use with a single patient and the base unit might be a device that is configured for repeated use . such modular tissue oximetry devices are well understood by those of skill in the art and are not described further . tissue oximetry device 100 does not require a pulsing blood flow to make an oxygen saturation measurement as compared with pulse oximeters that require a pulsing blood flow to make such measurements . while the description of the example embodiments is directed toward tissue oximetry probes that do not require a pulsing blood flow for oxygen saturation measurements , embodiments of the present invention are not so limited and may be utilized with pulse oximeters . fig1 c is a block diagram that shows tissue oximetry device 100 in further detail according to one embodiment . the components of device 100 are contained in a single enclosure or housing . tissue oximetry device 100 may include display 112 , a processor 116 , a memory 117 , a speaker 118 ( described briefly above ), one or more input devices 119 ( e . g ., one or more switches , input buttons , keypad , display 112 , if for example , the display is a touch screen , or the like ), a set of light sources 120 , a set of detectors 125 , a power source 127 , and a tissue marker 130 . processor 116 may be a microcontroller , a microprocessor , control logic , a multicore processor , or the like , and may control the operation of light sources 120 and detectors 125 . processor 116 may also control the operation of tissue marker 130 . memory 117 may include a variety of memories , such as a volatile memory 117 a ( e . g ., a ram ), a nonvolatile memory 117 ( e . g ., a disk , flash , prom , or others ), or both . user input may be by way of the input devices 119 ( e . g ., switches , touchpad , or the like ). power source 127 can be a battery , such as a disposable battery . disposable batteries are discarded after their stored charge is expended . some disposable battery chemistry technologies include alkaline , zinc carbon , or silver oxide . the battery has sufficient stored charged to allow use of the tissue oximetry device for several hours . after use , the tissue oximetry device is discarded . in other implementations , the battery can also be rechargeable where the battery can be recharged multiple times after the stored charge is expended . some rechargeable battery chemistry technologies include nickel cadmium ( nicd ), nickel metal hydride ( nimh ), lithium ion ( li - ion ), and zinc air . the battery can be recharged , for example , via an ac adapter with cord that connects to the handheld unit . the circuitry in the tissue oximetry device can include a recharger circuit ( not shown ). batteries with rechargeable battery chemistry may be sometimes used as disposable batteries , where the batteries are not recharged but disposed of after use . aspects of the invention may include software executable code or firmware ( e . g ., code stored in a read only memory or rom chip ). the software executable code or firmware may embody algorithms used in making oxygen saturation measurements of the tissue . the software executable code or firmware may include code to implement a user interface by which a user uses the system , displays results on the display , and selects or specifies parameters that affect the operation of the system . the components may be linked together via a bus 128 , which may be the system bus architecture of tissue oximetry device 100 . although this figure shows one bus that connects to each component , the busing is illustrative of any interconnection scheme serving to link these components or other components included in tissue oximetry device 100 . for example , speaker 118 , according to one specific implementation , could be connected to a subsystem through a port or have an internal direct connection to processor 116 . the foregoing listed components may be housed in a mobile housing ( see fig1 a ) of tissue oximetry device 100 . however , different implementations of tissue oximetry device 100 may include alternative housing ( such as the cables and the base units of modular oximeters described briefly above ) and may include any number of the listed components , in any combination or configuration , and may also include other components not shown . fig2 a is a simplified end view of tissue oximetry probe 115 according to one embodiment . tissue oximetry probe 115 is configured to contact tissue ( e . g ., a patient &# 39 ; s skin ) for which a tissue oximetry measurement is to be made . tissue oximetry probe 115 includes the set of light sources 120 and the set of detectors 125 . the set of light sources 120 may include two or more light sources , such as light sources 120 a and 120 b . light sources 120 may be linearly positioned across tissue oximetry probe 115 and detectors 125 may be arranged in an arc or a circle ( i . e ., circular arrangement ) on the tissue oximetry probe . more specifically , light sources 120 may be arranged linearly , such as on a line ( e . g ., a diameter ) that bisects a circle on which detectors 125 may be arranged . the light sources 120 a and 120 b are spaced a distance d1 apart where d1 may range from about 3 millimeters to about 10 millimeters . that is , the circle on which detectors 125 are arranged may have a diameter of about 3 millimeters to about 10 millimeters ( e . g ., 4 millimeters according to one specific embodiment ). while detectors 125 are described as being arranged in an arc or circle , tissue oximetry device 100 may have other configurations of detectors , such as linear , square , rectangular , ovoid , pseudo - random , or others . propagation depth increases with increasing source - to - detector distance , with 4 - 5 millimeters generally being a sufficient upper limit between light sources 120 a and detectors 125 to ensure few detected photons propagated in lower tissue layers . for example , these distances between light sources 120 and detectors 125 limits reflectance data to light that propagated within the top layer of tissue where little or no underlying subcutaneous fat or muscular layers contributes to the reflectance data . the set of detectors 125 may include four or more detectors . according to a specific embodiment , the set of detectors 125 includes eight detectors 125 a , 125 b , 125 c , 125 d , 125 e , 125 f , 125 g , and 125 h as shown . detectors 125 are solid - state detectors and may be mounted to a pcb ( not shown ). further , detectors 125 may be combined devices or discrete devices . in a specific implementation , detectors 125 are positioned with respect to outer light sources 120 a and 120 c such that four or more ( e . g ., fourteen ) unique source - to - detector distances are created . with greater numbers of source - to - detector distances , this can be used to obtain greater accuracy , faster calibration , and redundancy ( when duplicate source - to - detector distances are provided ). at least two source - to - detectors distances are 1 . 5 millimeters or closer , and at least two more two source - to - detectors distances are 2 . 5 millimeters or farther . in other words , a first source - to - detector distance is about 1 . 5 millimeters or less . a second source - to - detector distance is about 1 . 5 millimeters or less . a third source - to - detector distance is about 2 . 5 millimeters or greater . a fourth source - to - detector distance is about 2 . 5 millimeters or greater . there can be various numbers of sources and detector arrangements to obtain these four source - to - detector distances , such as one source and four detectors , two sources and two detectors , one detector and four sources , or other arrangements and combinations . for example , an implementation includes at least two sources and at least two detectors , where a maximum distance between a source and a detector is about 4 millimeters ( or about 5 millimeters ). at least two source - to - detector are about 2 . 5 millimeters or greater . at least two source - to - detector distances are about 1 . 5 millimeters or less . when a greater number of sources and detectors are used , greater numbers of source - to - detector distances are available . as discussed , these can be used to provide greater accuracy , faster calibration , or redundancy , or a combination . the arrangement of the sources and detectors can be in circular pattern , such as at points along the arc of a circle with radius ( e . g ., 4 millimeters , or 5 millimeters ). in an implementation , a tolerance of the detector or source positions on the arc is within 10 microns of the arc curve . in other implementations , the tolerance is within about 0 . 25 millimeters . turning now to tissue marker 130 , tissue oximetry probe 115 includes at least a dispenser portion of tissue marker 130 . fig2 shows an end view of the dispenser that can dispense a marking material on a local tissue region ( e . g ., of an extended portion of tissue ) that has been probed by tissue oximetry device 100 . the location of the marking material on tissue allows a user to subsequently identify the particular , local tissue region that has been probed . the dispenser may be located at a variety positions on the face of tissue oximetry probe 115 . according to one specific embodiment , the dispenser is located between light sources 120 a and 120 b , and may be located at the approximate center of the circular arrangement of detectors 125 . with the dispenser at the approximate center of light sources 120 and detectors 125 , a mark made by the dispenser will be substantially at a center of the local tissue region that has been probed by tissue oximetry device 100 . with the mark at the center of the probed tissue region , the mark is not displaced from the location on the local tissue region probed . according to one implementation , tissue marker 130 includes one or more dispensers that may be located at different positions on the head of tissue oximetry probe 115 . fig2 b shows an embodiment where two dispensers are located “ outside ” of light sources 120 and detectors 125 . that is , the dispensers are located at the ends of radii that are longer than the radii of light sources 120 and detectors 125 . further , the dispensers may lie on a line that passes through the center of the circle of the circular arrangement of dispensers 125 . with the dispensers located along such a line , marks made by these dispensers allow a user to readily identify the region between the marks as the local tissue region that has been probed by tissue oximetry device 100 . while the dispensers shown in fig2 a and 2b are shown as relatively localized devices ( e . g ., pen , pens , inker , inkers , and the like ) that may be configured to mark tissue with relatively small marks ( e . g ., dots ), a dispenser may be an extended device configured to make an extended mark , such as a line . for example , a dispenser may be an extended device configured to mark tissue with a circle or other closed shape , or may mark tissue with an open shape , such as a u - shape , a v - shape , or others . the dispenser may be fixed within tissue oximetry probe 115 or may be configured to be lowered when tissue is marked . various mechanical or electromechanical devices may be utilized by tissue oximetry probe 115 for lowering the dispenser . such mechanical and electro - mechanical devices are well understood by those of skill in the art and are not described in detail herein . tissue marker 130 may mark tissue with a variety inks having a variety of colors , such as gentian violet , which is the tissue marking ink approved by the fda . variations in the gentian violet chemistry constituents can give different characteristics to the ink and cause changes in color or shade . any of these colors or shades of gentian violet may be utilized by tissue marker 130 . one or more of the ink colors utilized by tissue oximetry device 100 may indicate one or more oxygen saturation ranges . for example , tissue marker 130 might be configured to : ( i ) mark tissue with a first color of ink if the tissue &# 39 ; s oxygen saturation is at or below a first threshold , ( ii ) mark the tissue with a second color of ink if the tissue &# 39 ; s oxygen saturation is above the first threshold and at or below a second threshold , and ( iii ) mark the tissue with a third color of ink if the tissue &# 39 ; s oxygen saturation is above the second threshold . the foregoing example describes the use of three colors of ink for marking tissue for visually identifying three ranges of oxygen saturation , however more or fewer colors may be utilized by tissue marker 130 for identifying more or fewer oxygen saturation ranges . processor 116 may determine the oxygen saturation of a local tissue region based on an analysis of the reflection data that has been generated by detectors 125 , and may control tissue marker 130 to mark the local tissue region with a select color of ink that identifies the range that the oxygen saturation is within . tissue marker 130 may include a variety of devices that provide marking material having one or more colors , such as ink reservoirs , pens , or the like . u . s . patent application ser . no . 12 / 178 , 359 , filed jul . 23 , 2008 , of heaton , titled “ oximeter with marking feature ”, which is incorporated by reference in its entirety , describes a variety of devices that are configured for marking tissue with one or more colors of marking material . a reservoir of the marking device can be connected to the dispenser , such as through tubing or channels , and is contains ink or other fluid ( e . g ., ink ) dispensed through the dispenser . ink can be urged from the reservoir to and through the dispenser and deposited on skin through pressure or low - frequency sound ( such using a piezoelectric transducer ). the reservoir is contained within the same housing as the processor , battery , sources , detectors , and other components of the oximeter probe . for the disposable probe , the reservoir is not refillable . according to one alternative , tissue marker 130 , under control of processor 116 , marks tissue for one or more oxygen saturation ranges , but does not mark the tissue for one or more other oxygen saturation regions . for example , tissue marker 130 might mark a local tissue region if the oxygen saturation of the local tissue region is at or below a threshold level , or alternatively might not mark the local tissue region if the oxygen saturation level is above the threshold level . markings that are made on tissue according to the above method allow a user to relatively quickly identify tissue that might have a low chance of viability if the threshold level is relatively low . alternatively , tissue marker 130 might mark a local tissue region if the oxygen saturation of the local tissue region is at or above a threshold level , and might not mark the local tissue region if the oxygen saturation level is below the threshold level . marks made from this method allow a user to relatively quickly identify tissue that might have a relatively high chance of viability if the threshold level is relatively high . information for the foregoing described threshold levels ( i . e ., ranges ) may be stored in memory 117 and accessed by processor 116 for use . the threshold levels may be stored in memory 117 during manufacture of tissue oximetry device 100 , or may be stored in the memory thereafter . for example , tissue oximetry device 100 may be configured to receive a user input for one or more user defined threshold levels and store information for these threshold levels in memory 117 . one or more input devices 119 ( or the like ) may be configured to receive a user input for a user defined threshold level and for storing the user defined threshold level in memory 117 . fig3 is a high - level flow diagram of a method for marking tissue to indicate ranges of oxygen saturation of the tissue . the high - level flow diagram represents one example embodiment . steps may be added to , removed from , or combined in the high - level flow diagram without deviating from the scope of the embodiment . at 300 , tissue oximetry probe 115 contacts the tissue . light ( e . g ., near - infrared light ) is emitted from one or more of the light sources 120 , step 305 , into the tissue and at least some of the light is reflected back by the tissue . each detector 125 receives a portion of the light reflected from the tissue , step 310 , and each detector generates reflectance data ( i . e ., a response ) for the portion of reflected light received , step 315 . at 320 , processor 305 determines an oxygen saturation value for the tissue based on the reflectance data . at 325 , processor 116 determines a range of oxygen saturation from a plurality of ranges of oxygen saturation in which the oxygen saturation lies . at 330 , processor 116 controls tissue marker 130 to mark the tissue with ink based on a range in which the oxygen saturation is in . for example , the processor may be configured to control the dispenser to mark the tissue with ink if the oxygen saturation is in a first range of oxygen saturation , but not mark the tissue if the oxygen saturation in a second range of oxygen saturation where the first range and second range are different , such as not overlapping ranges . while the foregoing example embodiment , discusses the utilization of two ranges of oxygen saturation by the tissue oximetry device , the tissue oximetry device may utilize more than two ranges of oxygen saturation for determining whether to mark the tissue with ink . according to one embodiment , the processor may control the dispenser to mark the tissue with a specific color of ink based on the range of oxygen saturation that the oxygen saturation is in . the particular color of ink allows a user to relatively quickly determine the ranges of oxygen saturation for the tissue without the need for re - probing the tissue or looking at a chart of the tissue that includes oxygen saturation values and matching the chart to the tissue . tissue oximetry device 100 may be configured to allow a user to manually control the tissue oximetry device to mark tissue , allow processor 116 to control marking the tissue , or both . for example , one of input devices 119 may be configured to control tissue marker 130 to mark a local tissue region if a user activates the input device . the input device may be conveniently located for a user to operate tissue oximetry device 100 to make an oxygen saturation measurement , and operate the input device without moving tissue oximetry probe 115 from the local tissue region that was probed . tissue oximetry device 100 may be switched between the processor controlled method of marking tissue and the manually controlled method ( e . g ., activating one of the switches ) of marking tissue . one or more other of input devices 119 may be configured for switching tissue oximetry device 100 between these two methods of marking tissue . this description of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form described , and many modifications and variations are possible in light of the teaching above . the embodiments were chosen and described in order to best explain the principles of the invention and its practical applications . this description will enable others skilled in the art to best utilize and practice the invention in various embodiments and with various modifications as are suited to a particular use . the scope of the invention is defined by the following claims . | 0 |
referring first to fig1 there is shown a schematic cross - sectional view of the abs surface of a typical abutted junction gmr sensor designed in accord with the prior art . as can be seen , the narrow trackwidth is obtained at the price of reducing the physical width of the ferromagnetic free layer ( 10 ). as a result , the biasing layer ( 25 ) pins the magnetization of the free layer and reduces the sensitivity of the sensor . referring next to fig2 , there is shown a schematic cross - sectional view of the abs surface of a patterned direct exchange longitudinally biased gmr sensor of the prior art . the physical trackwidth ( 10 ) of this configuration is defined by the width of the region between the leads ( 20 ), typically a ta / au bilayer , and the patterned biasing layers beneath them ( 25 ), typically layers of cofe . the ferromagnetic free layer ( 27 ), typically a cofe / nife bilayer , extends the entire width of the sensor so it is not adversely affected by the edge pinning field of the biasing layer , which is a disadvantage of the hard biased abutted junction of fig1 . the diagram also shows the antiferromagnetic layer ( 29 ), typically a layer of irmn , which pins the patterned biasing layer ( 25 ). the free layer ( 27 ) is separated from the biasing layer ( 25 ) by a non - magnetic coupling layer ( 28 ) which is typically a layer of cu or ru and which directly exchange couples the ferromagnetic free layer ( 27 ) to the ferromagnetic biasing layer ( 25 ) by ferromagnetic coupling to produce parallel magnetizations ( 11 ) labeled m2 ( biasing layer ) and m1 ( free layer ). the remainder of the configuration comprises an antiferromagnetically coupled ( synthetic ) pinned layer ( 30 ), which comprises two ferromagnetic layers (( 32 ) and ( 34 )) antiferromagnetically exchange coupled across a non - magnetic coupling layer ( 36 ) and which is separated from ( 27 ) by a non magnetic spacer layer ( 31 ). beneath ( 30 ) there is an antiferromagnetic pinning layer ( 40 ), typically a layer of mnpt , which pins the antiferromagnetically coupled pinned layer . the magnetic moments of the antiferromagnetically coupled pinned layers are in the transverse direction ( perpendicular to the plane of the figure ) and are antiparallel , with the directions of magnetization of the individual layers indicated by circles ( 15 ) ( out of the plane ) and crosses within circles ( 17 ) ( into the plane ). obtaining perpendicularity of the free layer magnetization and pinned layer magnetization complicates the fabrication process of the sensor , since two different antiferromagnetic materials with different blocking temperatures are typically required for ( 40 ) and ( 29 ), eg . irmn and mnpt in this illustration , as are different annealing schedules so that the magnetization of the pinned layer should not affect the magnetization of the biasing layer . when the physical trackwidth ( 10 ) of this entire configuration is narrow , however , ( less than 0 . 2 microns ) the strength of the ferromagnetic coupling ( the pinning field ) is weak and is typically less than 250 oe . note that thicknesses are not given for this figure since the configuration is shown for comparison purposes only . referring next to fig3 a , there is shown a schematic cross - sectional view of the air bearing surface ( abs ) of a synthetic exchange longitudinally biased gmr sensor , before patterning , fabricated in accord with the objects of a first embodiment of the present invention and having the properties and advantages of said embodiment . the device is fabricated in a sequence of three major steps : 1 ) depositing the sensor layers ; 2 ) annealing and magnetizing the synthetic pinned layer and the synthetic biased free layer ; 3 ) patterning . first there is deposited a seed layer ( 9 ), which is typically a layer of nicr deposited to a thickness of between approximately 55 and 65 angstroms with 60 angstroms being preferred . on this seed layer is then deposited a first antiferromagnetic layer ( 40 ) to serve as a pinning layer . typically this pinning layer is a layer of mnpt deposited to a thickness of between approximately 80 and 150 angstroms with 100 angstroms being preferred . on the pinning layer , and pinned by it , there is then formed a synthetic antiferromagnetic pinned layer ( 30 ), which is an antiferromagnetically coupled trilayer comprising a first ferromagnetic layer ( 32 ), a first non - magnetic antiferromgnetically coupling layer ( 36 ) formed on ( 32 ) and a second ferromagnetic layer ( 34 ) formed on the coupling layer . the ferromagnetic layers are typically layers of cofe , with the first layer having a thickness of between approximately 12 and 20 angstroms with 15 angstroms being preferred and the second layer having a thickness of between approximately 15 and 25 angstroms with 20 angstroms being preferred . the coupling layer , which is typically a layer of ru , is formed to a thickness of between approximately 7 and 9 angstroms with 7 . 5 angstroms being preferred . on the synthetic pinned layer is then formed a non - magnetic spacer layer ( 31 ), which separates the pinned and free layers . this spacer layer is typically a layer of cu , which is formed to a thickness of between approximately 13 and 25 angstroms with 18 angstroms being preferred . the free layer ( 27 ), which is a ferromagnetic bilayer of cofe ( 22 ) and nife ( 23 ), is then formed on the spacer layer , wherein the cofe layer has a thickness of between approximately 5 and 15 with 10 angstroms being preferred and the nife layer has a thickness of between approximately 15 and 30 angstroms with 20 angstroms being preferred . the free layer is then antiferromagnetically exchange coupled across a non - magnetic coupling layer ( 28 ) to a ferromagnetic biasing layer ( 25 ), forming , thereby , the synthetic exchange biased configuration ( 26 ). the coupling layer in this case is a layer of ru of thickness between approximately 7 and 9 angstroms with 7 . 5 angstroms being preferred and the biasing layer is a layer of cofe of thickness between approximately 10 and 25 angstroms with 15 angstroms being preferred . the synthetic exchange biased configuration ( 26 ) is then pinned by an antiferromagnetic layer of irmn ( 29 ) of thickness between approximately 35 and 55 angstroms with 40 angstroms being preferred . a conducting lead layer ( 20 ) is deposited over the irmn layer in a lead overlay ( lol ) configuration . the lead layer is typically a ta / au bilayer of thickness between approximately 100 and 500 angstroms . the gmr sensor configuration thus formed is then given a first pinned layer annealing to fix the magnetizations of both synthetic pinned layers ( 30 ) & amp ; ( 26 ). the anneal consists of a 5 hour 280 ° c . anneal in an external transversely directed magnetic field of approximately 10 koe ( kilo - oersteds ) to set both pinned layers in the transverse direction ( perpendicular to the air - bearing surface ). the resulting magnetization vectors are shown only for the first pinned layer ( 30 ) as a circle ( 15 ), representing a direction out of the plane , and a circle with an interior cross ( 17 ), representing a direction into the plane . following this first pinned layer anneal , a second anneal is applied at a lower temperature and lower magnetic field to reset the magnetization of the synthetic exchange biased layer ( 26 ) from the transverse direction into the longitudinal direction . this second anneal is carried out for a time of approximately 30 minutes at an annealing temperature of approximately 250 ° c ., which is higher than the irmn blocking temperature . the resulting magnetizations are shown as arrows , m1 ( 12 ) being the magnetization of the free layer and m2 ( 11 ) that of the biasing layer . under this anneal , the synthetic pinned layer ( 30 ) retains its transverse magnetization . it is found by experiment that the configuration described above , under the sequence of anneals to which it is subjected as is also described above , has the advantageous properties of a high pinning field that is approximately 755 oe , as well as a desirable value of free - layer magnetostriction . referring now to fig3 b , there is shown a schematic diagram illustrating the process by which a physical trackwidth ( 10 ) of approximately 0 . 1 microns is formed in the sensor of fig3 a by etching the lead and pinning layers to form the patterned exchange structure . patterning is done by sequentially removing the entire thickness of a lateral portion of the lead layer ( 40 ) ( shown in dashed outline ) and the entire thickness of the irmn pinning layer beneath it ( 42 ) ( shown in dashed outline ) by use of a reactive ion etch ( rie ) or an ion beam etch ( ibe ). removal of these two layers exposes a portion of the cofe biasing layer ( 44 ), said portion then being effectively removed by an oxidation process , which converts it to a non - magnetic cofeo ( shown shaded ). in this process , the antiferromagnetically coupling layer ( 28 ) of ru acts as an oxidation barrier to prevent the oxidation from extending downward to adversely affect the ferromagnetic free layer ( 27 ). the surface of the coupling layer ( 28 ) beneath ( 44 ) is thereby itself oxidized at the termination of the process . note in the synthetic pinned layer ( 30 ) that small circles ( 15 ) represent magnetizations out of the plane , circles with interior crosses ( 17 ) are into the plane . the symbols m1 ( 12 ) and m2 ( 11 ) refer to the antiparallel directions of the magnetizations of the free ( m1 ) and pinning ( m2 ) layers . referring next to fig4 a , there is shown a schematic cross - sectional view of the air bearing surface ( abs ) of a synthetic exchange transversely biased gmr sensor , before patterning , fabricated in accord with the objects of a second embodiment of the present invention and having the properties and advantages of said embodiment . the device is fabricated in a sequence of three major steps : 1 ) depositing the sensor layers ; 2 ) annealing and magnetizing the synthetic pinned layer and the synthetic biased free layer ; 3 ) patterning . first there is deposited a seed layer ( 9 ), which is typically a layer of nicr deposited to a thickness of between approximately 50 and 60 angstroms . on this seed layer is then deposited a first antiferromagnetic layer ( 40 ) to serve as a pinning layer . typically this pinning layer is a layer of mnpt deposited to a thickness of between approximately 100 and 150 angstroms , but other antiferromagnetic materials such as nimn , pdptmn , femn or irmn can be used . on the first pinning layer , and to be pinned by it , there is then formed a synthetic antiferromagnetic pinned layer ( 30 ), which is an antiferromagnetically coupled trilayer comprising a first ferromagnetic layer ( 32 ), a first non - magnetic antiferromagnetically coupling layer ( 36 ) formed on ( 32 ) and a second ferromagnetic layer ( 34 ) formed on the coupling layer . the ferromagnetic layers are typically layers of cofe , with the first ferromagnetic layer having a thickness of between approximately 15 and 20 angstroms with 15 angstroms being preferred and the second ferromagnetic layer having a thickness of between approximately 20 and 25 angstroms with 20 angstroms being preferred . the first coupling layer , which can be a layer of ru , is formed to a thickness of between approximately 7 and 9 angstroms with 7 . 5 angstroms being preferred . alternatively , the first coupling layer can be a layer of rh , formed to a thickness of between 4 and 6 angstroms with 5 angstroms being preferred . on the synthetic antiferromagnetic pinned layer there is then formed a non - magnetic spacer layer ( 31 ), which separates the pinned and free layers . this spacer layer is typically a layer of cu , which is formed to a thickness of between approximately 15 and 22 angstroms with 18 angstroms being preferred . the free layer ( 27 ), which is preferably a ferromagnetic bilayer of cofe ( 22 ) and nife ( 23 ), is then formed on the spacer layer , wherein the cofe layer has a thickness of between approximately 5 and 15 with 10 angstroms being preferred and the nife layer has a thickness of between approximately 15 and 30 angstroms with 20 angstroms being preferred . the free layer is then antiferromagnetically exchange coupled across a second non - magnetic coupling layer ( 28 ) to a ferromagnetic biasing layer ( 25 ), forming , thereby , the synthetic exchange biased configuration ( 26 ). if the first non - magnetic coupling layer ( 36 ) is a layer of ru , then the second non - magnetic coupling layer ( 28 ) is also a layer of ru of thickness between approximately 7 and 8 angstroms with 7 . 5 angstroms being preferred . if the first coupling layer is a layer of rh , then the second coupling layer is also a layer of rh of a thickness between 4 and 6 angstroms with 5 angstroms being preferred . if the second coupling layer is ru , the biasing layer ( 25 ) is a layer of cofe of thickness between approximately 15 and 30 angstroms with 15 angstroms being preferred . if the second coupling layer is rh , the biasing layer ( 25 ) is a layer of cofe of thickness between approximately 25 and 30 angstroms with 28 angstroms being preferred . it is to be noted that the thicker biasing layer ( 25 ) formed in conjunction with the rh coupling layer produces a greater pinning field in the sensor . the synthetic exchange biased configuration ( 26 ) is then pinned by a second pinning layer , which is an antiferromagnetic layer of mnpt ( 25 ) of thickness between approximately 80 and 100 angstroms with 100 angstroms being preferred ( note , if any of the other antiferromagnetic materials mentioned above have been used to form the first pinning layer , that same material can also be used here to form the second pinning layer ). a conducting lead layer ( 20 ) is deposited over the mnpt layer ( 25 ) in a lead overlay ( lol ) configuration . the lead layer is typically a ta / au / ta trilayer of thickness between approximately 200 and 400 angstroms . the gmr sensor configuration thus formed is then given a pinned layer annealing to fix the magnetization of both synthetic pinned layers ( 26 ) & amp ; ( 30 ), which are , respectively , the antiferromagnetic pinned layer and the synthetic exchange biased configuration . the anneal consists of a 5 hour 280 ° c . anneal in an external magnetic field of approximately 10 koe ( kilo - oersteds ) to set both pinned layers in the transverse direction ( perpendicular to the air - bearing surface ). the resulting magnetization vectors are shown as circles ( 53 & amp ; 57 ) representing magnetizations out of the plane , and circles with interior crosses ( 51 & amp ; 55 ) representing magnetizations into the plane . m1 and m2 are the labels representing the magnetizations of the free and biasing layers respectively . it is found by experiment that the configuration described above , under the anneal to which it is subjected as is also described above , has the advantageous properties of a high pinning field that is more than 1000 oe , as well as an effective trackwidth of less than 0 . 15 microns subsequent to the patterning that will now be described . a significant advantage of the transverse directions of both the free and pinned layers is that there is a plateau of very little relative rotation of their magnetizations under small external magnetic fields . this plateau is particularly important in the region of the free layer directly beneath the biasing layer in that it leads to extremely small signals being produced by this portion of the free layer . since unwanted side reading is a direct result of signals emanating from the extreme lateral portions of the free layer , this diminution of signals from that portion is directly responsible for the narrow effective trackwidth . another important advantage of the transverse directions of both the free and pinned layers is that it is unnecessary to rotate the free layer magnetization with a second anneal after fixing the magnetization of the pinned layer . this allows the use of antiferromagnetic pinning layers of the same high blocking temperature material to be used to pin both the synthetic pinned layer and the synthetic exchange biased free layer . in turn , this allows high external fields to be used to fix the pinning field , which increases the efficacy of the biasing layer and reduces the effective trackwidth of the sensor . it has also been demonstrated that the high pinning fields thus obtained ( exceeding 1000 oe ) eliminate the need for current shunting of the sensor current , which permits the use of thinner conducting lead layers and provides a more advantageous topology . referring now to fig4 b , there is shown a schematic diagram illustrating the process by which a physical trackwidth ( 10 ) of approximately 0 . 1 microns is formed in the sensor of fig4 a by patterning the lead and pinning layers to form the patterned exchange structure . patterning is done by sequentially removing the entire thickness of a lateral portion of the lead layer (( 40 ) shown in dashed outline ) and the entire thickness of the mnpt pinning layer beneath it (( 42 ) shown in dashed outline ) by use of a reactive ion etch ( rie ) or an ion beam etch ( ibe ). removal of these two layers exposes the cofe biasing layer ( 42 ), the portion of which is exposed (( 44 ) shown shaded ) being then effectively removed by an oxidation process , which converts it to non - magnetic cofeo . in this process , the antiferromagnetically coupling layer ( 28 ) of ru ( or rh ) acts as an oxidation barrier to prevent the oxidation from extending downward to the ferromagnetic free layer ( 27 ) and adversely affecting it . the exposed surface of the coupling layer ( 28 ) is thereby itself oxidized at the termination of the process . referring next to fig5 a , there is shown a schematic cross - sectional view of the air bearing surface ( abs ) of a partially fabricated synthetic exchange transversely biased gmr sensor , before the antiparallel magnetization of its biasing layer and before deposition of a conducting lead layer and final patterning , fabricated in accord with the objects of a third embodiment of the present invention and having the properties and advantages of said embodiment . in this embodiment the transverse magnetizations of the pinning layer and free layer are antiparallel to each other at the opposite ends of the sensor where they are beneath the conducting lead layers . this configuration has been shown to have two advantages : 1 ) prevention of the bias point shift at the center active region of the free layer and 2 ) minimization of side reading at both sides of the sensor element . the device is fabricated in a sequence of four steps : 1 ) depositing the sensor layers up to and including the exchange biasing layer ( shown in fig5 a ); 2 ) separately magnetizing both lateral ends of the exchange biasing layer in opposite transverse directions using a two - step patterning and annealing sequence ( shown in fig5 b and 5 c ); 3 ) depositing conducting lead layers ( shown in fig5 d ); 4 ) patterning ( fig5 d ). referring to fig5 a and looking vertically upward , there is first seen deposited a seed layer ( 9 ), which is typically a layer of nicr deposited to a thickness of between approximately 50 and 60 angstroms . on this seed layer is then deposited a first antiferromagnetic layer ( 40 ) to serve as a pinning layer . typically this pinning layer is a layer of mnpt deposited to a thickness of between approximately 100 and 150 angstroms , but other antiferromagnetic materials such as nimn , pdptmn , femn or irmn can be used . on the first pinning layer there is then formed a synthetic antiferromagnetic pinned layer ( 30 ), which is an antiferromagnetically coupled trilayer comprising a first ferromagnetic layer ( 32 ), a first non - magnetic antiferromagnetically coupling layer ( 36 ) formed on ( 32 ) and a second ferromagnetic layer ( 34 ) formed on the coupling layer . the ferromagnetic layers are typically layers of cofe , with the first ferromagnetic layer having a thickness of between approximately 15 and 20 angstroms with 15 angstroms being preferred and the second ferromagnetic layer having a thickness of between approximately 20 and 25 angstroms with 20 angstroms being preferred . the first non - magnetic antiferromagnetically coupling layer , which can be a layer of ru , is formed to a thickness of between approximately 7 and 9 angstroms with 7 . 5 angstroms being preferred . alternatively , the first coupling layer can be a layer of rh , formed to a thickness of between 4 and 6 angstroms with 5 angstroms being preferred . in either case , the layer is formed of a material and to a thickness that will cause the two ferromagnetic layers to align their magnetizations in an antiparallel direction upon annealing . on the synthetic pinned layer there is then formed a non - magnetic spacer layer ( 31 ), which separates the pinned and free layers . this spacer layer is typically a layer of cu , which is formed to a thickness of between approximately 15 and 22 angstroms with 18 angstroms being preferred . the free layer ( 27 ), which in this preferred embodiment is a ferromagnetic bilayer of cofe ( 22 ) and nife ( 23 ), is then formed on the spacer layer , wherein the cofe layer has a thickness of between approximately 5 and 15 with 10 angstroms being preferred and the nife layer has a thickness of between approximately 15 and 30 angstroms with 20 angstroms being preferred . the free layer is then antiferromagnetically exchange coupled across a second non - magnetic coupling layer ( 28 ) to a ferromagnetic biasing layer ( 25 ), forming , thereby , the synthetic antiferromagnetic exchange biased configuration ( 26 ). if the first non - magnetic coupling layer ( 36 ) is a layer of ru , then the second non - magnetic coupling layer ( 28 ) is also a layer of ru of thickness between approximately 7 and 8 angstroms with 7 . 5 angstroms being preferred . if the first coupling layer is a layer of rh , then the second coupling layer is also a layer of rh of a thickness between 4 and 6 angstroms with 5 angstroms being preferred . if the second coupling layer is ru , the biasing layer ( 25 ) is a layer of cofe of thickness between approximately 15 and 30 angstroms with 15 angstroms being preferred . if the second coupling layer is rh , the biasing layer ( 25 ) is a layer of cofe of thickness between approximately 25 and 30 angstroms with 28 angstroms being - preferred . it is to be noted that the thicker biasing layer ( 25 ) formed in conjunction with the rh coupling layer produces a greater pinning field in the sensor . at this point in the fabrication process the magnetization of the pinned layer can be set by an anneal in the same manner as in the previous embodiments . a 5 hour anneal in a 10 koe magnetic field at a temperature of 280 ° c . is preferred . referring now to fig5 b , there is shown an upper portion of the structure of fig5 a wherein a lateral portion ( 60 ) of the ferromagnetic biasing layer ( 25 ) has been covered by a layer of etch resistant material ( 62 ) ( such as photoresist ), leaving the remaining portion ( shown shaded ) of the biasing layer uncovered ( 64 ). this uncovered portion is then cleaned by a sputter etch process . referring next to fig5 c , there is shown the cleaned portion ( 64 ) refilled with the same ferromagnetic material of the biasing layer and covered by an additional layer of antiferromagnetic material ( 66 ), such as a layer of irmn deposited to a thickness of between approximately 35 and 55 angstroms with 40 angstroms being preferred , to act as a pinning layer . during this deposition process , the fabrication thus produced is annealed in a first transverse magnetic field in a first transverse direction to fix the direction of the magnetizations in the antiferromagnetic coupling between the portion of the biasing layer ( 64 ), whose magnetization is shown as a circle ( 68 ), and the corresponding portion of the free layer ( 27 ) beneath it , whose antiparallel magnetization is shown as a circle with a cross ( 69 ). the first anneal is for between approximately 30 and 60 minutes but where approximately 30 minutes is preferred , at a temperature of between approximately 250 ° c . and 280 ° c ., but where 250 ° c . is preferred and with a magnetic field of between approximately 250 and 500 oe but where 250 oe is preferred . the antiferromagnetic layer ( 66 ) pins the biasing layer in this process . referring next to fig5 d , there is shown the fabrication of fig5 c , wherein the surface of the opposite lateral portion ( 72 ) of the biasing layer is now exposed , while the remainder of the layer , which has already been magnetized , is covered by a resistant layer ( 74 ), such as a layer of photoresist . in a similar fashion to that described in fig5 c , the portion ( 72 ) is cleaned and covered with additional biasing material and , over it , a layer of antiferromagnetic pinning material ( 75 ) such as irmn is formed in a manner identical to that described in fig5 c . during the deposition process a second external magnetic field in the opposite direction to that used in the process of fig5 c is applied and the biasing layer portion ( 72 ) is thereby magnetized in the direction of that magnetic field ( circle with a cross ( 81 )) and the free layer beneath it ( 27 ) is oppositely magnetized ( circle ( 83 )). the second anneal , like the first , is for between approximately 30 and 60 minutes but where approximately 30 minutes is preferred , at a temperature of between approximately 250 ° c . and 280 ° c ., but where 250 ° c . is preferred and with a magnetic field of between approximately 250 and 500 oe but where 250 oe is preferred . the deposited antiferromagnetic layer ( 75 ) serves to pin the biasing layer by this process . referring now to fig5 e , there is shown the fabrication of fig5 d wherein a central portion ( 85 ) of the twice magnetized biasing layer is removed by an ion beam or chemical etching process to form a trackwidth of desired dimension . a conducting lead layer ( 90 ) has been formed over the two biasing layers . the lead layer is typically a ta / au / ta trilayer of thickness between approximately 200 and 400 angstroms . as is understood by a person skilled in the art , the preferred embodiments of the present invention are illustrative of the present invention rather than limiting of the present invention . revisions and modifications may be made to methods , materials , structures and dimensions employed in fabricating a synthetic , patterned , longitudinally or transversely exchange biased gmr sensor with narrow effective trackwidth , while still providing a method for fabricating such a synthetic , patterned , longitudinally or transversely exchange biased gmr sensor with narrow effective trackwidth , in accord with the spirit and scope of the present invention as defined by the appended claims . | 6 |
referring to the drawings , wherein like reference numerals refer to the same or similar elements among the several figures , there is shown a finger toothbrush 10 in accordance with the present invention , i . e . the bristles or bristle tufts 16 closest to the tip 18 of the finger toothbrush 10 are the shortest bristles 16 and the bristles furthest from the tip 18 are the longest . in a first embodiment of the present invention shown in fig1 the finger toothbrush 10 has a generally tubular finger grip section 20 extending along a portion of the length of the back - side 32 of a rigid platform 14 . the bristles 16 may be organized in a plurality of bristle tufts ( also designed as 16 ) aligned in rows and securely mounted and extend from the front side or brush face 22 . the length or height of the rows of bristles or bristle tufts 16 from the face 22 , uniformly decrease along the longitudinal axis of the finger toothbrush 10 toward the tip 18 thereof , easing entry of the finger toothbrush 10 into the narrowing space between the cheek and the facial surface of the molars in the rear of the mouth for enhanced cleaning thereof . in a second embodiment of the present invention , as illustrated in fig1 a , the bristle tufts 16 decrease in height linearly in a 1st region furthest from the tip 18 of the finger toothbrush 10 and continue to decease in height in a 2nd region until the shortest tufts of a uniform height is reached for the bristle tufts 16 nearest the tip 18 . in another alternate embodiment , the bristle tufts 16 may be uniform as well as decreasing in height in the 1st region furthest from the tip 18 of the finger toothbrush 10 and then continue to decease in height in a 2nd region until the shortest tufts of a uniform height is reached for the bristle tufts 16 nearest the tip 18 . finally , in a third alternate embodiment , the bristles may decrease in height in an arcuately along the length or part of the length of the brush face 22 , in for example a concave curve which is concave towards the brush face 22 , such that the shortest bristle tufts 16 are adjacent to the brush tip 18 and the tallest bristle tufts 16 are furthest from the brush tip 18 . referring again to fig1 the row of bristles furthest from the tip 18 of the finger toothbrush 10 of the present invention extend from the face 22 a height of about 8 to about 14 mm , preferably about 8 to about 11 mm and most preferably about 9 mm . the bristles nearest the tip 18 of the finger toothbrush 10 extend from the face 22 a height of about 4 to about 7 mm , preferably about 5 to 7 mm , and most preferably about 6 mm . the generally tubular finger grip section 20 may be integrally mounted to the edges 30 of the rigid platform 14 or to the back - side 32 of the rigid platform 14 itself , preferably being mounted along the edges 30 right at the juncture of the edges 30 and the rigid platform 14 ( see fig4 ). the diameter of the tube aperture through the tubular finger grip section 20 may be from about 1 . 5 to about 2 . 5 mm , preferably about 2 . 0 mm . the tubular finger grip section 20 may contain a slit 36 , aligned in the general direction of the longitudinal axis of the finger toothbrush and extending 40 %, 50 % or more of the length of the tubular finger grip section 20 toward the tip of the toothbrush 18 . this slit 36 provides added flexibility to the tubular finger grip section 20 to accommodate larger fingers . the cross - section of the monofilament bristles 16 , useful in the present invention may be circular , oval , rectangular or polygonal , with a diameter or is largest cross - sectional dimension of from about 0 . 10 mm to about 0 . 40 mm or more . the monofilament bristles 16 may be made of the same or different polymeric materials , including aliphatic polyamides , aromatic polymides , polyesters , polyolefins , styrenes , fluoropolymers , polyvinylchloride ( pvc ), polyurethane , polyvinylidene chloride , and polystyrene and styrene copolymers , or combinations thereof . a preferred material is 6 , 12 nylon ; though other nylons may be used , including 4 nylon , 6 nylon , 11 nylon , 12 nylon , 6 , 6 nylon , 6 , 10 nylon , 6 , 14 nylon , 10 , 10 nylon , 12 , 12 nylon and other nylon co - polymers . a particularly preferred 6 , 12 nylon is sold under the tradename tynex ®, and is manufactured by e . i . dupont de nemours and company of wilmington , del . the finger toothbrush 10 of the present invention may be formed of an external rubber or elastomeric frame 24 shown in fig4 into which a more rigid plastic is overmolded , to form the completed finger toothbrush as illustrated in fig1 to 3 . the elastomeric frame 24 provides cushioning and an avoidance of abrasion to the soft tissues of the cheek and gums and the rigid overmolded plastic provides a rigid structure to the finger toothbrush 10 and a means to securely fasten the bristles 16 therein . to provide such cushioning and abrasion avoidance , the elastomeric frame 24 may be manufactured of natural rubber or a thermoplastic elastomer ( tpe ), or a combination thereof . such acceptable materials include thermoplastic vulcanate ( tpv ) which consists of a mixture of polyproplyene and epdm ( ethylene propylene diene monomers ) which is available as santoprene ( brand ), described in u . s . pat . no . 5 , 393 , 796 ; or vyram ( brand ), another tpv consisting of a mixture of polypropylene and natural rubber ; both santoprene and vyram being elastomers marketed by advanced elastomer systems lp , akron , ohio 44311 . another , and preferred tpe is dynaflex g6713 ( brand ), marketed by gls corp ., cary , ill . 60013 . these and other suitable elastomers typically have a shore a hardness of from about 13 to 94 , with about 29 being a preferred hardness . the elastomeric frame 24 should be at least 0 . 5 mm in thickness , preferably at least 1 . 59 mm in thickness , though the thickness need not be uniform about the entire body of the elastomeric frame 24 . the overmolded rigid plastic , about the elastomeric frame shown in fig4 includes a rigid platform 14 having a plurality of bristle holes in the face 22 thereof , into which holes the rows of bristles 16 are fastened , preferably using conventional staple technology . the overmolded rigid plastic is preferably manufactured of a thermoplastic , especially polypropylene , though other rigid plastic materials , such as polyester may be used . a suitable polypropylene , with a flexural modulus of 216 , 000 psi ( 15 , 186 kilograms / cm 2 ) by astm test method d790 , is available from huntsman corporation , longview , tex ., 75603 under the trade - designation huntsman polypropylene p4g3z - 039 . another suitable polypropylene is available from amoco polymers , inc ., alpharetta , ga . 30202 - 3914 , sold under the trade designation 7635 with a flexural modulus of about 275 , 000 psi ( 19 , 334 kilograms / cm 2 ). use of a toothbrush handle of such a 216 , 000 psi ( 15 , 186 kilograms / cm 2 ) to 275 , 000 psi ( 19 , 334 kilograms / cm 2 ) material will provide enhanced rigidity to allow the rows of bristles 16 to be securely fastened therein . the manufacture of toothbrushes of the present invention can be facilitated by using known , conventional two - step injection molding processes . within such a two - step injection molding process , the elastomeric frame 24 is initially injection molded . the elastomeric frames are then positioned within a second mold and the rigid plastic is injection molded about the elastomeric frame 24 , to form the completed finger toothbrush body . finally the bristles 16 are secured to the rigid plastic platform by known manufacturing techniques , including the use of conventional staple technology . conventional two component injection molds useful in the manufacture of the present invention are available from machines boucherie nv , izegem , belgium . which molds can be mounted in typical injection molding machines , such as 300 ton injection molding machines available from engel canada , inc ., guelph , ontario . | 0 |
referring to fig1 a schematic representation of a liver assist system 5 includes a conduit 6 made of disposable plastic tubing ( e . g ., pvc ) for circulating plasma through a bioartificial liver ( bal ) device 8 which contains liver cells . conduit 6 may include sections of tubing ( 11 , 13 , 70 , 74 ) used to connect liver assist system 5 to an external system , such as a plasma separation machine 100 . connected within conduit 6 , in a series arrangement , are a peristaltic pump 14 , optional charcoal filters 16 , 18 , an oxygenator / heat exchange unit 20 , the bal device 8 , and a reservoir bag 28 , each of which will be discussed in greater detail below . liver assist system 5 , in use , supports approximately 650 ml of fluid with about 120 ml disposed within conduit 6 . prior to introducing the plasma to liver assist system 5 , saline ( or other suitable fluid ) is used to entirely fill conduit 6 as well as the components of the system . reservoir bag 28 is also filled sufficiently to provide a buffer for incoming fluid and indicates when liver assist system is entirely filled and primed . this process is part of a cleansing process in which the system is rinsed and primed using a method described below . in general , plasma is provided to the liver assist system 5 at an in - port 10 via tubing 11 and is pumped through the system using pump 14 in the direction indicated by arrows . filters 16 , 18 prefilter the plasma of toxins while oxygenator / heat exchange unit 20 oxygenates and maintains the temperature of the plasma within a predetermined temperature range . the plasma is then received by the bal device 8 that has been seeded with liver cells which remove toxins from the plasma . the reservoir bag 28 receives the treated plasma before being recirculated back through the system . liver assist system 5 is generally used in conjunction with a cell inoculation device 200 ( described below ) which provides liver cells to the bal device . the liver cells remove or modify toxic substances from the plasma . in fig1 liver assist system 5 is shown as part of an on - line system that is connected to an external system ( e . g ., plasma separation machine 100 ) which supplies plasma to the liver assist system for treatment . the plasma from plasma separation machine 100 is provided to conduit 6 from tubing 11 and returned from liver assist system 5 via tubing 13 . the plasma separation machine 100 shown in fig1 separates plasma to be treated from whole blood of a human patient . in other on - line applications , the external system may be a patient and the whole blood of the patient is circulated and bioprocessed in liver assist system 5 . it is also important to note that liver assist system 5 may be used in an off - line operation in which a source of plasma to be treated is provided , for example , in a bag and connected to an in - port 10 of the liver assist system 5 . in this case , the untreated plasma is allowed to circulate through the liver assist system to be detoxified and then dispensed at an out - port of the system . disposed within the conduit 6 is pump 14 , which provide sufficient drive to force the plasma from tubing 11 to flow through the conduit 6 in the direction indicated by arrows . the plasma flows at a user selectable flow rate between 50 and 1000 ml / min , nominally 400 ml / min . the system optionally includes a pair of charcoal filters 16 , 18 for pre - filtering the plasma before it is provided to the bal device 8 . only one of the filters is in use at any given time , the other being available to allow continued use of the system when one of the filters needs to be replaced . clamps ( not shown ) are used to allow and / or restrict flow through one or the other of the filters . either of the charcoal filters 16 or 18 may be replaced with a length of tube 17 or 19 to provide a bypass path around the charcoal filter when system 5 is in use . plasma from the filters passes to oxygenator / heat exchange unit 20 having an oxygenator 22 which supplies oxygen to the plasma and a heater 24 . oxygenator 22 receives , at inlet 22a , pressurized sterile gas ( e . g ., 30 % o 2 , 5 % co 2 , 65 % n 2 ) from an external gas source ( not shown ). the plasma passes through semi - permeable hollow fibers disposed within the oxygenator 22 to collect oxygen needed by the liver cells inoculated within bal device 8 . an optional oxygen measurement system may be used to measure the difference between the oxygen content of the plasma entering and exiting bal device 8 to provide an indication of the effectiveness of the bal device . the pressurized gas provided to the oxygenator passes through hydrophobic membranes disposed respectively at inlet 22a and outlet 22b . plasma flowing through heater 24 is maintained at a predetermined temperature ( e . g ., 37 ° c .) by heat conduction as it flows past a heat exchanger within the oxygenator . heated water from an external water heater / recirculator ( not shown ) is received at inlet 24a of the heater and returned via outlet 24b for reheating . a bypass line 25 with a clamp ( not shown ) is provided to bypass oxygenator / heat exchange unit 20 and through the system to allow the cleaning or replacement of the oxygenator / heat exchange unit 20 . plasma from oxygenator / heat exchange unit 20 is received by the bioartificial liver device 8 ( e . g ., a replaceable hollow fiber cartridge inoculated with cells ). bal device 8 includes a bundle of hollow fibers . in one embodiment , the fibers are inoculated with liver cells so that toxic substances within the plasma are removed as the plasma passes between the fibers . alternatively , the plasma can pass along the axial length of the fibers with the liver cells introduced between the fibers . a bypass line 26 having a manual clamp is provided to bypass the bal device 8 , for example , when the bal device requires replacement , maintenance , or cleansing ( described below ). during operation of liver assist system 5 , tubing 29 attached to waste bags 31 , 33 ( described below ), is closed off from flow of plasma with pinch valve 27 . the treated plasma is then conveyed to the plasma reservoir bag 28 before being recirculated through the system with a portion also being returned to the plasma separation machine 100 . referring to fig2 reservoir bag 28 is made of a strong and pliable material , such as pvc plastic . reservoir bag 28 includes an inlet 30 and a pair of outlets 32 , 34 at the lower end of the bag . outlet 32 provides fluid back to bal device 8 for further treatment , while outlet 34 leads to the plasma separation machine 100 . a dividing partition 36 between inlet 30 and outlets 32 , 34 define a pair of compartments 38 , 40 . compartment 38 provides an inlet channel and compartment 40 provides an overflow reservoir for holding a volume ( e . g ., 100 ml ) of fluid . dividing partition 36 between compartments 38 , 40 ensures that particulate matter which may be in the plasma is trapped in compartment 38 and prevented from returning to the liver assist system 5 where it may cause clogging of conduit 6 and the components of the system . due to the increased cross - sectional area of compartment 38 ( with respect to the cross - sectional area of inlet 30 ), the velocity of the plasma entering reservoir bag 28 decreases . thus , the particulate matter is allowed to settle in the lower portion of compartment 38 . the plasma overflowing into compartment 40 is temporarily held before being recirculated to the liver assist system 5 or plasma separation system 100 . reservoir bag 28 also serves to accommodate surging of the plasma . reservoir bag 28 may include multiple compartments between inlet 30 and outlets 32 , 34 so that the particulate matter will settle in the bottom portions of each compartment as the plasma overflows from one compartment to the next . a vent 48 is provided at the top of reservoir bag 28 by a tube 50 which extends to a filter 52 ( e . g ., 0 . 2 micron ). vent 48 allows gas within the plasma , in the form of bubbles , to escape . one approach for forming reservoir bag 28 is to overlay two sheets of pvc plastic cut in the shape of the bag . rf energy is then applied to the periphery of the sheets to provide an air - tight edge 42 to the bag . support seams 44 , along the top portion of bag 28 , are provided where holes are punched for allowing the bag to be hung from a support . an additional support seam 45 at the side of the bag is provided along one side of bag 28 so that compartment 40 defines a reservoir of sufficient depth . support seams 44 and 45 , as well as dividing partition 36 , are formed also using the rf heat - sealing technique . the level of plasma in reservoir bag 28 can be visually observed by the operator of the system who can manually release or restrict flow of the plasma from the bag to maintain a proper level of plasma in the bag , for example , using line 15 . the level can also be maintained using an electronic device which controls pump 14 of the liver assist system and / or a pump of the plasma separation machine 100 . an optional filter 9 with a bypass 12 may be included within tubing 70 for filtering particulate matter from the plasma returning to the external system . filter 9 serves to capture and prevent the circulation of cells released into conduit 6 in the event of a catastrophic failure of the hollow fibers in bal device 8 . bypass 12 provides a flow path for the plasma if filter 9 becomes clogged or needs replacement . liver assist system 5 can also be used in a closed , off - line system operation , with reservoir bag 28 serving as the source of the plasma being introduced to the system . in this case , reservoir bag will generally be larger in size , for example , 2 liters . referring to the lower right inset of fig1 and fig3 a cell inoculation device 200 includes a flexible seeding bag 202 formed of plastic ( e . g . pvc ) in which harvested liver cells to be inoculated in the bal device 8 are held . cell inoculation device 200 includes an inlet 212 through which cell suspension is dispensed within seeding bag 202 and an outlet 206 which can be connected , for example , to an inlet tube 60 of the liver assist system 5 ( fig1 ). outlet 206 is connected to a tube 208 which extends to the bottom portion of seeding bag 202 to maximize the removal of cell suspension . the seeding bag 202 is easily attached / detached from liver assist system 5 and is also a convenient receptacle for transporting the cells . the liver cells are removed from seeding bag 202 into bal device 8 using a pressure mechanism device 210 attached to cell inoculation device 200 . in one embodiment , pressure mechanism device 210 may be a pressure cuff which is wrapped around seeding bag 202 . upon manual or automatic actuation , positive pressure is provided within the bag causing the cells to rise through tube 208 and out of outlet 206 . in another embodiment , a pressurized gas source may be used to provide positive pressure via inlet hose 204 to the inside of the bag causing the cells to rise through tube 208 . in still a further embodiment , the cells can be extracted from the bag by attaching a pump to outlet 206 of tube 208 to pump the cells out of the bag . a rinsing tube 214 is provided at the top of bag 202 for introducing a rinsing solution ( e . g ., saline ) to ensure the removal of residual cells that may settle within the bottom of bag . referring again to fig1 liver assist system 5 includes bypass conduits which allow flexibility of use and ensure safety in case of emergency . for example , the connection between the liver assist system 5 and the plasma separation system 100 ( or other external system ) includes tubing 70 which provides a path of flow for a portion of the treated plasma back to plasma separation machine 100 from outlet 34 of reservoir bag 28 . a bridge section 72 connects tubing 70 to tubing 74 which introduces the plasma to be treated to bal device 8 . when the plasma separation machine 100 is being used on - line with liver assist system 5 , a pinch valve 76 is closed to prevent flow of plasma through bridge section 72 so that all of the plasma returning along tubing 70 flows to plasma separation machine 100 . in the event of an emergency , when it becomes necessary to prevent interflow between the systems , pinch valves 78 , 80 are closed and pinch valve 76 is opened . in this arrangement , plasma from the plasma separation machine 100 can be made to flow through line 11 , through open pinch valve 76 , back to plasma separation machine 100 through line 13 . line 15 may be open to a plasma storage bag 47 within machine 100 . bag 47 may act as a compliant chamber to account for variations of the flow rate in and out of plasma separation machine 100 through bypass 72 . pressure transducers 82 , 84 are provided within conduit 6 to sense extreme or inadequate levels of pressure . in these situations , signals from transducers 82 , 84 are used to control pinch valves 76 , 78 , 80 and pump 14 , and may also be used to provide a visual or audible warning signal to alert the operator of the condition . sampling ports may also be provided along conduit 6 to examine the characteristics of the plasma . the liver assist system 5 provides the following features for rinsing and priming conduit 6 and its components ( i . e ., oxygenator , filters , and bioreactor unit ). tubing 92 , 93 , operating in conjunction with pinch valves 94 , 95 , allows the introduction of two separate solutions for priming and rinsing conduit 6 and the components disposed therein . one solution ( e . g ., saline ) is introduced through tubing 92 with the other solution ( e . g ., 5 % dextrose ) introduced through tubing 93 . bypass segments allow for flushing the components independently or in series . the components may be rinsed and primed in any order . tubing 92 , 93 for introducing priming solution and tubing 29 , 113 leading to integral waste bags 31 , 33 , 114 create a closed system and provide an aseptic method of rinsing and priming the liver assist system 5 . in a preferred configuration , tubing 29 , 92 , 93 may be sealed and removed to condense the liver assist system once it is ready to receive plasma . the use of pinch valves 27 and 98 allows the priming solution to be directed to waste bags 31 , 33 after one pass before flowing to the waste bags or recirculated through the liver assist system 5 . the hollow fiber cartridge of the bal device ( without inoculated cells ) is rinsed and primed along the fibers with the waste solution directed to waste bags 31 , 33 . a separate waste bag 114 is connected to bal device 8 at in - port 61 . the extra - capillary space between the bundle of fibers is primed , and pores of the fibers are rinsed , with the waste solution directed to waste bag 114 . when cleansing of bal device 8 is complete , bal device 8 is completely filled with saline and ready to receive cells . tubing 70 , 74 between liver assist system 5 and the plasma separation machine 100 is rinsed by opening valves 78 , 80 for a period of time to allow some of the saline to flow through the tubing . it is generally important that the liver assist system 5 be fully primed with the priming solution at the initiation of plasma processing . liver cells from cell inoculation device 200 are then introduced at inlet 60 of bal device 8 and the saline within the extra capillary space of the bal device is displaced into waste bag 31 , 33 . waste bags 31 , 33 , and 114 and lines 60 and 113 are then removed . in this condition , liver assist system 5 is considered to be primed and ready to receive plasma . from the above description , one skilled in the art can easily ascertain the essential characteristics of the present invention , and without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . for example , liver assist system 5 , described above for use as an artificial liver , may be used in other medical applications . moreover , the concept may be applicable to industrial operations . thus , other embodiments are also within the claims . | 0 |
the broken lines are a part of this patent specification and are intended to illustrate those interior views . fig1 : in illustration # 1 is the main body of the unit with # 2 the frame of the front door of the unit with # 3 the clear glass portion of the door with thin wire as a structural support with # 4 the handle of the door with # 5 the de - compression button to allow the door to be opened with # 6 the led screen with # 7 is the external vacuum hole sealed door with # 8 the activation button for the external vacuum hole . fig2 : in illustration # 1 is the main body of the unit with # 2 the frame of the front door of the unit with # 3 the clear glass portion of the door with thin wire as a structural support with # 4 the handle of the door with # 5 the de - compression button to allow the door to be opened with # 6 the led or lcd screen with # 7 is the external vacuum hole sealed door with # 8 the activation button for the external vacuum hole with # 9 the hinge for the door with # 10 the clip that holds the door shut with # 11 the interior of the unit with # 12 the external vacuum hole with # 13 the clip insert that holds the # 10 clip to keep the door shut with # 14 the interior view of the opening for the vacuum tube with # 15 the hollow interior portion of the side that houses the vacuum tubes with # 16 the interior view with the top opening for the vacuum tube with # 17 the sealing strip around the front of the unit with # 32 the button that activates the unit when the front door is shut . fig3 : in illustration # 11 the interior of the unit with # 16 the screen for the opening of the vacuum tubing with # 18 the motion sensor with # 19 the glass to protect the uv light with # 20 the uv light with # 27 the clip that holds the frame for the glass that protects the uv light . fig4 : in illustration # 1 the main body of the unit with # 15 the interior view of the hollow side that houses the vacuum tube with # 18 the motion sensor with # 19 the glass that protects the uv light with # 20 the uv light with # 21 the vacuum tube with # 22 the t - connector with # 23 the housing for the vacuum motor with # 24 the power cord with # 25 the vents to keep the vacuum motor housing cool with # 26 the interior bottom hollow portion of the unit with # 27 clip that holds the glass in place to protect the uv light with # 30 the vacuum tube connecting to the external vacuum opening or hole . fig5 : in illustration # 1 the main body of the unit with # 2 the door of the unit with # 4 the handle of the door with # 7 the external vacuum opening or hole sealing door with # 11 the interior of the unit with # 18 the motion sensor with # 19 the glass that protects the uv light with # 20 the uv light with # 21 the vacuum tube with # 22 the t connector with # 23 the vacuum motor housing with # 24 the power cord with # 26 the interior hollow portion of the unit with # 27 the clip that holds the glass protector in place with # 28 the programmable circuit board with # 29 the rubber leg of the unit with # 30 the vacuum tube connecting to the external vacuum opening or hole with # 31 the vacuum tube from the vacuum motor to the t connector . the stay fresh is a new concept in maintaining food freshness for a much longer period of time than is now available with any other appliances . we all use the refrigerator for keeping our bread , fruits , vegetables , meats , and more , fresh longer than sitting it out in the air at a room temperature . this has been a cornerstone in civilization to feed the populations and to keep from going to the store every day and maintaining the nutritional value to the food and so to the consumer . if we want to keep things even longer we freeze the food . however you cannot freeze fruits or vegetables like you can meats and other types of foods . because the refrigerator has air on the inside of it with the door closed , the air inside is reflective of the type of climate as well . in very dry climates fruits and vegetables spoil much faster even in the refrigerator because the air is the same as the climate in which a person lives . this happens because the dry climate absorbs the moisture very quickly and cause the food to spoil quickly . in a high humidity climate the same thing can happen because it allows bacteria to grow even faster in many cases . the freezer is always the solution to longer term freshness although it is the same air inside as the refrigerator . it may be frozen but it can get a freezer burn faster in some cases and can change the texture and flavor of the food . to combat freezer burn or to help food last longer there is a process called vacuum packing . it is used by many people but is not a widely used process because people claim it takes too long and they do not have the time . this is also another terminology for laziness . that is the reason that the stay fresh could become a valued appliance in everyone &# 39 ; s home by making it simple and easy to use and create more room in the family refrigerator . there are two main processes used in the stay fresh appliance . the first is the motor that creates the vacuum by pulling the air out of the interior of the unit the same way it is done now with bags and containers and in other appliances of a similar nature . the second is the uv light used to sterilize the unit so that any bacteria is killed inside the unit and with the food stuff itself . between those two processes it makes it possible to maintain food freshness without refrigeration . refrigeration can dry food out and change the texture of the food and freezers can do the same thing . having truly fresh fruit and vegetables is the most desired by consumers . this is also great for meat and this process makes the meat taste much fresher than refrigeration or certainly freezing it . the vacuum should be a negative from 30 kpa to 40 kpa and should take less than one minute . the uv light should be a uv - b type with a 14 second dose of light to accomplish sterilization . both of these processes have been scientifically proven through many studies . other types of uv are uv - a and uv - c which can also be used in the same way . the unit can be different sizes and shapes . the stay fresh unit has a front door with a handle on the right side similar to other products with a pressure resistant glass with wire mesh to add strength and to have a reflective sheen on the inside of the glass to make the motion sensor more efficient . the motion sensor is in place to make sure that there are no living things inside the unit when the door is closed . when there is any motion the sensor will shut the unit off and allow air inside the unit from the vacuum motor assembly . when the door is shut it activates a button which turns the unit on and the vacuum motor pulls the air with the uv light on at the same time . the vacuum motor will activate again when the pressure has gone down and will bring the negative pressure back up to the normal level . the unit also has an external vacuum opening to use with bags and containers . there is a decompression button on the bottom right of the unit that when pressed releases the pressure so that the door can be opened and allows the sealed cover over the external opening . when the cover is placed over the opening the door is opened and closed again and the unit will re - sterilize and re - compress . the uv light has a glass cover to help protect it from damage and works with the light and its effectiveness . the motion sensor is placed just under the uv light . the vacuum tubing runs from the hollow portion on the side of the unit and one portion of the tube runs up to the ceiling of the unit and the other portion runs to the external opening . the unit is designed to be manufactured and used in a very specific way to ensure the unit accomplishes the task of maintaining food freshness without the need for refrigeration or freezing food . it also complies with all fda safety regulations . | 1 |
referring to the drawings , fig1 shows a dental chair in plan view having armrests of the present invention generally indicated at 10 . the figure shows the range of movement provided by the armrest of the present invention in that the armrest is capable of moving from a first position shown in solid line , wherein the armrest is in a normal position and oriented parallel to the long axis to the dental chair , to a second position shown in dotted line wherein the armrest is perpendicular to the axis of the dental chair . when the armrest is in this second position , it is out of the way so that a patient can more easily enter and exit the chair . furthermore , with the armrest positively locked in this second position , it provides a convenient , firm support which can be grasped by an elderly or infirm patient leaving or entering the chair . as shown in fig2 the portion in the dental chair to which the armrest is attached is in a generally upright member indicated at 12 . member 12 has a vertical bore 14 extending part way into the member for slidably receiving the armrest of the present invention . the armrest itself includes a first sleeve 16 held in the bore by any convenient means such as a set screw 22 . the upper face of sleeve 16 is provided with two intersecting grooves 24 and 26 best shown in fig4 . one of the grooves 24 , is oriented generally parallel to the axis of the dental chair while the other groove 26 is oriented normal to the axis of the dental chair . a second upright sleeve member 28 is slidably inserted into bore 14 . sleeve member 28 carries adjacent its upper end the upholstered armrest portion 30 . a flange 32 on sleeve member 28 is adapted to engage a corresponding shoulder 34 on upstanding member 12 so as to properly position sleeve 28 . the sleeve carries on its lower face a tongue 36 oriented generally along the diameter of the sleeve . this tongue is adapted to engage one or the other of grooves 24 and 26 for locking the armrest either in the normal position shown in solid line in fig1 or in a out - of - the - way position shown in dotted line in the figure . preferably tongues 36 and grooves 24 , 26 are configured with vertical side wall portions as shown in the drawings so as to provide a positive lock with this configuration a side load alone i . e . a load directed perpendicular to the plane of the wall will not cause disengagement and instead , the armrest 30 must be lifted in order to disengage the tongue and groove and move the arm . thus , any accidental movement of the armrest is avoided . extending axially into both sleeve members 16 and 28 is an upright rod 38 . the rod is pinned to the lower sleeve member 16 by any suitable means , such as set screw 40 . while sleeve member 16 is fixed to the rod , sleeve member 28 can rotate about the rod and slide axially with respect to the rod . intermediate its ends , the rod has a shoulder 42 . a coil spring member 44 disposed about the rod is biased between shoulder 42 and an internal shoulder 43 on sleeve 28 so as to normally urge the sleeve downward into an engagement with sleeve 16 so that the lower face of sleeve 28 abuts the upper face of sleeve 16 . in operation and to move the armrest to the out - of - the - way position the patient or dentist simply lifts on armrest 30 , this causes sleeve 28 to move axially with respect to rod 38 against the bias of spring 44 . as sleeve 28 is lifted , tongue 36 comes out of engagement with groove 26 on the lower sleeve 16 . the armrest can now be rotated 90 to the position shown in dotted line in fig1 and released . under the urging of gravity and the bias of spring 44 , sleeve 28 is moved axially toward the lower sleeve 16 so as to engage tongue 36 with groove 24 . this engagement locks the arm at the 90 ° or out - of - the - way position shown in dotted line in fig1 . when locked in this position , the bias of spring 44 maintains the engagement of the tongue and groove so that , the armrest is stable and fixed against rotation . with this arrangement , the armrest may provide support for an elderly or infirm patient entering or leaving the dental chair . as an optional feature , the armrest may be provided with a mechanical advantage means to assist in the operation . for example , as is shown in fig2 a lever arm 46 pinned at 48 to the upper portion of the sleeve 28 . one end 50 of the lever arm operates as a trigger mechanism and the other end 52 of the arm bears against the top surface 54 of rod 38 . when trigger 50 is pulled upward as may occur for example , by grasping both the armrest 30 and trigger 50 and squeezing , the connection at 48 will cause the upper sleeve 28 to lift . in this respect , end 52 of the lever arm acts as a fulcrum which bears against surface 54 . since the length of the trigger portion 50 is greater than the distance between pin 48 and end 52 , the mechanical advantage provided reduces the force necessary to move sleeve 28 against gravity and the bias of spring 44 . thus , it should be appreciated that the present invention accomplishes its intended objects in providing an armrest which is quickly and easily operated to move the armrest between an in use and an out - of - use position . further , the armrest is positively locked in either of these two positions so that it not only provides support for the patient in the chair , but also for the patient entering or leaving the chair . also , the design of the armrest of the present invention allows the armrest to be sold as an optional item and no modification of the dental chair is required in order to permit it to receive the armrest . in this respect , should the dentist not require an armrest , a decorative cap or plug ( not shown ) can be inserted to cover the opening of bore 14 . on the other hand , if an armrest is desired , the armrest assembly is simply inserted into bore 14 and a single set screw 22 used to fix lower sleeve 16 and therefor the armrest to the dental chair . | 0 |
the vpr gene has been shown to increase the kinetics of viral replication and cytopathicity in t lymphocytes ( cohen , et al ., 1990b , supra ), and may be necessary for the productive infection of macrophages ( nattori , et al ., 1990 , supra ; westervelt , et al ., 1992 , supra ) and the regulation of hiv - 1 cellular latency ( levy , et al ., 1994a , supra ; levy , et al ., 1994b , supra ). the vpr gene of hiv - 1 induces the cessation of cellular proliferation , as well as cellular differentiation in rhabdomyosarcoma and osteosarcoma cell lines ( levy , et al ., 1993 , supra ). the precise mechanism of vpr function however in not clear . vpr has been reported to accumulate in the cell nucleus in the process of infection ( lu , et al ., 1993 , supra ). this is consistent with the weak ltr transactivating activity which has been reported for vpr ( cohen , et al ., 1990b , supra ). along these lines vpr can profoundly change the state of the host cell presumably through modification of the host cell gene expression . such changes require the interaction of vpr with cellular biochemical pathways . a 41 kd cytosolic protein ( rip - 1 ) which interacts with hiv - 1 viral protein r has been identified . rip - 1 and vpr coeluted from a vpr - specific immunoaffinity column as well as from a vpr protein column . in addition , the complex formed by vpr and rip - 1 was reversibly crosslinked to a 58 kd complex . rip - 1 was found to be constitutively expressed in a wide variety of cell lines derived from tissues which are targets of hiv infection . rip - 1 was observed to co - translocate with vpr into the nucleus either after the exposure of the cells to hiv - 1 virus , or to exogenous vpr protein . this nuclear translocation of rip - 1 however was not induced by a vpr mutant virus nor by the phorbol ester pma . in addition , the vpr / rip - 1 nuclear translocation always preceded the accumulation of detectable extracellular virus by 24 hours . this functional correlation of nuclear translocation of the vpr / rip - 1 complex and virus activation occurs despite the lack of a traditional nuclear localization signal . it has been discovered that the rip - 1 / vpr complex associates with the activated gr type ii receptor complex as part of the signalling pathway for vpr . the rip - 1 / vpr / gr type ii receptor complex translocates into the nucleus in the absence of steroid compounds normally associated with gr type ii receptor translocation . it has been discovered that rip - 1 is associated with the gr type ii receptor complex and that rip - 1 co - translocates into the nucleus together with gr type ii receptor when gr type ii receptor are induced to translocate as the result of binding to steroid compounds . these discoveries provide a new target for the modulation of gr type ii complex translocation . if gr type ii complex translocation is desired , as in the case of diseases and conditions treated with steroids , vpr , fragments of vpr which bind to rip - 1 , and vpr - like compounds can be used to achieve the same result : gr type ii complex translocation , in some cases without side effects associated with steroids . if prevention of gr type ii complex translocation is desired , as in the case of diseases and conditions treated with glucocorticoid receptor antagonists , rip - 1 - binding antagonists may be used to achieve the same result : prevention of gr type ii complex translocation , in some cases without side effects associated with anti - glucocorticoids . in some embodiments of the present invention , compounds are provided which act as non - steroidal therapeutics which mimic steroid activity . the non - steroidal therapeutics are useful in place of steroids . these compounds include vpr and fragments thereof which induce gr type ii complex translocation . in some embodiments of the present invention , methods are provided which can be used to identify non - steroidal therapeutics which bind to rip - 1 and induce rip - 1 / gr type ii complex translocation . such compounds can be used in place of steroids in the treatment of diseases and conditions in which steroid therapy is indicated . in some embodiments of the present invention , compounds are provided which act as glucocorticoid antagonist - like therapeutics which mimic glucocorticoid antagonist activity but which bind to rip - 1 instead of gr . the rip - 1 - binding - glucocorticoid antagonist - like therapeutics are useful in place of glucocorticoid antagonists . these compounds include proteins , peptides and other compounds which bind to rip - 1 but which do not induce gr type ii complex translocation but rather inhibit such translocation . in some embodiments of the present invention , methods are provided which can be used to identify glucocorticoid antagonist - like therapeutics which bind to rip - 1 but do not induce rip - 1 / gr type ii complex translocation but rather inhibit such translocation . such compounds can be used in place of glucocorticoid antagonists in the treatment of diseases and conditions in which glucocorticoid antagonist therapy is indicated . experiments reported in example 1 demonstrate that vpr was able to induce the binding to the gre sequences of the hiv - ltr , or the mmtv - ltr of the gr dna - binding complex , as seen in a gel shift assay . in addition , vpr was able to stimulate cat activity from cells transfected with pgre5 / cat , in the absence of other stimuli . furthermore , the site of the hiv - 1 ltr in which the gre sequences where shown to lie is the same site to which the transactivation activity of both , vpr and dexamethasone mapped . these studies demonstrate that the hiv - 1 vpr gene product mediates its functions in the viral lifecycle through a direct interaction with the glucocorticoid steroid biochemical pathway . gr type ii proteins are members of the ligand activated transcription factor superfamily of steroid hormone receptors . gr have been shown to act as powerful transactivators ( evans , 1988 , the steroid and thyroid hormone receptor superfamily . science . 240 , 889 - 895 ), involved in the proliferation and further differentiation of committed progenitor cells ( perrot - applanat , et al ., 1992 , immunolocalization of steroid hormone receptors in normal and tumour cells : mechanisms of their cellular traffic . cancer surv . 14 , 5 - 30 ). gr type ii are predominantly located in the cytoplasmic portion of resting cells ( madan and defranco , 1993 , bidirectional transport of glucocorticoid receptors across the nuclear envelope . proc . natl . acad . sci . usa . 90 , 3588 - 3592 ; lindenmeyer , et al ., 1990 , glucocorticoid receptor monoclonal antibodies define the biological action of ru38486 in intact 1316 melanoma cells . cancer yes . 50 , 7985 - 7991 ; parker , 1992 , introduction ; growth regulation by nuclear hormone receptors . cancer surv . 14 , 1 - 4 ), as part of a multi - protein complex , which is specifically formed by a gr molecule , a heat shock protein 90 dimer , and a heat shock protein 56 subunit . when the steroid hormone binds its receptor , it promotes the transformation of these molecules to a less negatively charged dna - binding form ( bodine and litwack , 1990 ) the glucocorticoid receptor and its endogenous regulators . receptor . 1 , 83 - 120 ; norman and litwack , 1987 , hormones . ( orlando , fla . : academic press , inc .)). in addition , the composition of the activated gr complex is different from that of the resting complex . heat shock protein 56 is shed , while heat shock protein 70 joins the other remaining members of this cluster . these activated complexes subsequently shuttle to the nuclear compartment ( newmeyer and forbes , 1988 nuclear import can be separated into distinct steps in vitro : nuclear pore binding and translocation . cell . 52 , 641 - 653 ; richardson , et al ., 1988 , nuclear protein migration involves two steps : rapid binding at the nuclear envelope followed by slower translocation through nuclear pores . cell . 52 , 655 - 664 ), where they bind specific nucleic acid sequences ( madan and defranco , 1993 , supra ; perrot - applanat , et al ., 1992 , supra ). binding sites for gr are found in the hiv - ltr ( ghosh , 1992 , glucocorticoid receptor binding site in the human immunodeficiency virus long terminal repeat . j . virol . 66 , 586 - 590 ; katsanakis , et al ., 1991 , the human immunodeficiency virus long terminal repeat contains sequences showing partial homology to glucocorticoid response elements . anticancer res . 11 , 381 - 383 ; laurence , et al ., 1990 , effect of glucocorticoids on chronic human immunodeficiency virus ( hiv ) infection and hiv promoter - mediated transcription . blood . 74 , 291 - 297 ; miksicek , et al ., 1986 , glucocorticoid responsiveness of the transcriptional enhancer of moloney murine sarcoma virus . cell . 46 , 283 - 290 ). one such site is the tgttct ( seq id no : 1 ) gr target sequence found in the hiv ltr , homologous to that which has been defined for the mmtv ltr ( kolesnitchenko and snart , 1992 , regulatory elements in the human immunodeficiency virus type 1 long terminal repeat ltr ( hiv - 1 ) responsive to steroid hormone stimulation . aids res . hum . retrov . 8 , 1977 ). translocated gr type ii complex recognizes and binds to gre sequences of dna that is located in the nucleus of cells . binding of the gr type ii complex to the gre results in alteration of cellular activity and function . the translocation effect of vpr on rip - 1 as well as the transcriptional activation observed on the hiv - ltr , and the complementation in trans provided by vpr protein for vpr mutant viruses was closely mimicked by two gr ii stimulating steroids , dexamethasone and hydrocortisone . in addition , these three functions of vpr could be inhibited with mifepristone , a gr ii specific antagonist , which also curtailed the ability of hydrocortisone and dexamethasone to induce these effects . 9 - cis retinoic acid , as well as all - trans retinoic acid were also tested for their influence on rip - 1 and other vpr mediated functions . the functional relationship between vpr function and the glucocorticoid receptor transcriptional pathway is supported by several lines of evidence . vpr and rip - 1 were co - immunoprecipitated with gr as part of the activated complex . in addition , vpr stimulation induced the formation of the dna ( gre )- binding forms of the gr complexes . furthermore , vpr was able to stimulate cat expression from pgre5 / cat , or alternatively from hiv ltr / cat plasmids which contained the putative gre sites (- 250 to - 264 ) within the ltr , yet failed to induce cat expression in truncation mutants which lacked this site . together , these data demonstrate that vpr exerts its host cell altering effects through a direct interaction with the gr pathway , initially through the transcriptional activation of the ltr gre sequences . the nuclear translocation of the vpr / rip - 1 complex is consistent with the observation that vpr indirectly mediates the transactivation of the hiv - ltr . very efficient hiv ltr - cat induction by both the exogenous vpr protein as well as by vpr protein shed from neighboring cells was observed . the observation of nuclear co - translocation is also consistent with the observation that recombinant as well as serum - derived vpr protein increases viral protein expression in newly infected as well as in latently infected cells , and in primary blood lymphocytes derived from an hiv positive individual . the link between vpr and the glucocorticoid receptor mediated transcriptional pathway establishes a link between a viral protein and several pathologies observed in aids patients . glucocorticoids are have widespread immunosuppressive effects , and long term exposure of lymphocytes to glucocorticoids induces cell death . furthermore , glucocorticoids also affect the lymphocytic precursors , providing the potential for a gr stimulating agent to accelerate the rate of thymic depletion and help , in part , to establish a state of general immune deficiency . these data are also interesting in light of the several observed pathological features which are present in some hiv - 1 positive patients and also in some patients exhibiting glucocorticoid steroid toxicity . these common symptoms include muscle wasting and susceptibility to fungal infections . furthermore these data suggest that the gr type ii pathway could be exploited in an autocrine fashion by hiv through the action of the vpr gene product . compounds which have steroid - like activity can be identified and used in place of steroids . in particular , compounds such as vpr and rip - 1 - binding fragments of vpr may be used as non - steroidal therapeutics . such compounds can be used in place of standard steroid therapies , especially when the individual to be treated is experiencing or particularly susceptible to side effects linked to steroid use . the discovery that rip - 1 associates with and co - translocates with gr type ii complex can be used in methods of identifying compounds which mimic steroid activity or as inhibitors of gr translocation . specifically , it has been discovered that rip - 1 is associated with the gr type ii complex . when the gr type ii complex is induced to translocate such as when it is bound to steroids , rip - 1 , which is associated with gr type ii complex is translocated into the nucleus together with the other components of the gr type ii complex . similarly , when rip - 1 is induced to translocate through rip - 1 binding to agents which bind to it and induce it to translocate , the gr type ii complex is translocated into the nucleus together with rip - 1 . for example , vpr protein binds to rip - 1 and results in the translocation of the gr type ii complex , as well as rip - 1 , from the cytoplasm to the nucleus . thus , contact of cells with vpr protein results in the biologically activity associated with gr type ii translocation . likewise , steroidal hormones which bind to gr cause the translocation of rip - 1 as well as the gr type ii complex from the cytoplasm to the nucleus . it has also been observed that compounds which inhibit translocation of the gr type ii complex , inhibit translocation of rip - 1 . mifepristone , a glucocorticoid antagonist which inhibits translocation of gr inhibits vpr activity . in some embodiments , rip - 1 is used as a target for the identification and / or design of non - steroidal compounds which achieve the same effects of steroidal compounds , i . e . translocation of the gr into the nucleus and the biological effects associated with such translocation . thus , methods of identifying compounds with steroid - like activity can be performed which comprise the steps of contacting cells that comprise rip - 1 and the gr type ii complex with a test compound and measuring the level of rip - 1 and / or gr translocation into the nucleus . the level of rip - 1 and / or gr translocation into the nucleus can be measured by a variety of means including physically identifying the presence and amount of rip - 1 and / or gr in the nucleus or cytoplasm in cells contacted with the test compound versus control assays in which the presence and amount of rip - 1 and / or gr in the nucleus or cytoplasm is measured in cells not contacted with the test compound . in some embodiments , test assays are performed in which cells that comprise rip - 1 and the gr type ii complex are contacted with a test compound , a first positive control assay may be performed in which cells that comprise rip - 1 and the gr type ii complex are contacted with a vpr protein or a rip - binding fragment thereof , a second positive control assays may be performed in which cells that comprise rip - 1 and the gr type ii complex are contacted with a steroids such as dexamethasone or hydrocortisone , a negative control assays may be performed in which cells that comprise rip - 1 and the gr type ii complex are not contacted with rip - binding or steroid - based translocation activators . some negative controls may comprise glucocorticoid receptor antagonist compounds such as , for example , mifepristone . the cells are then lysed and the nuclei are separated from the cytoplasmic fraction . probes , such as anti - rip - 1 antibodies , anti - vpr antibodies or anti - gr antibodies are used to identify and measure antigens present in the nuclei fraction and / or the cytosolic fraction . the positive controls will demonstrate that rip - 1 and gr translocate into the nuclei while the negative controls will show that absent a ligand to activate translocation , both rip - 1 and gr remain in the cytoplasm . the effectiveness of the test compound relative to the controls may be thus determined . in other embodiments , the level of rip - 1 and gr translocation into the nucleus can be measured by a measuring the expression of marker genes which are only expressed upon translocation of the gr into the nucleus . cells that comprise rip - 1 and gr type ii complex are provided with gene constructs in which a marker gene is linked to a gre . the cells are contacted with a test compound . expression of the marker gene by the cells is specifically regulated by the translocation of gr from the cytoplasm into the nucleus . the cells are contacted with a test compound and if they then express the marker gene , induction of translocation is indicated . positive controls which may be used include steroids , such as dexamethasone or hydrocortisone , which when contacted with the cells causes expression of the marker gene . vpr may also be used as a positive control to bring about expression of the marker gene . negative controls include compositions in which no rip - 1 or steroidal compounds are present or compositions which include glucocorticoid receptor antagonist compounds such as , for example , mifepristone . in negative controls , rip - 1 / gr complex does not translocate and the cells do not express the marker gene . in some embodiments , rip - 1 is used as a target for the identification and / or design of anti - steroidal compounds which achieve the same effects of glucocorticoid receptor antagonist compounds , i . e . prevent or inhibit the translocation of the gr into the nucleus and thus eliminate or reduce the biological effects associated with such translocation . thus , methods of identifying compounds with anti - steroidal activity can be performed which comprise the steps of contacting cells that comprise rip - 1 and gr with a test compound and determining the level of rip - 1 and / or gr translocation into the nucleus . the level of rip - 1 and / or gr translocation into the nucleus can be measured by the same means as those described above . in the case of identifying compounds which induce the same results as glucocorticoid receptor antagonists , the positive controls include known glucocorticoid receptor antagonist compounds such as , for example , mifepristone . the test assays may be performed as set out above in which translocation is assessed by identifying rip - 1 and / or gr in the nuclear and / or cytoplasmic fractions of lysed and separated cells or by measuring gene construct expression in cells that have a marker gene under the control of regulatory elements that include gre sequences . the methods for identifying rip - 1 binding compounds which act as non - steroidal therapeutics that mimic either steroid activity or glucocorticoid receptor activity can be performed routinely . cells which contain both rip - 1 and gr are readily available and described in example 1 . test compounds may be added to such cells to determine if the test compound induces the rip - 1 / gr complex to translocates from the cytoplasm to the nucleus . methods of determining whether translocation has occurred and the level of translocation can be performed routinely . cells contacted with compounds are incubated for a sufficient period of time and under suitable conditions to allow for translocation . such conditions are well to those having ordinary skill in the art and are essentially those conditions in which vpr protein or steroids such as dexamethasone or hydrocortisone will induce translocation of the rip - 1 and gr type ii complex . generally , cells are incubated with test compounds for 30 minutes to 24 hours . in the embodiments in which the level of translocation is measured by comparing nuclear to cytosolic fractions of cells exposed to test compound to the level measured or expected in positive and negative controls , the cells are lysed and fractions which contain the nuclei are separated from fractions which contain the cytoplasm . cells can be lysed by any one of several well known means such as chemical lysis using detergents for example , sonication , mechanical disruption or combination thereof . centrifugation of lysed cellular material to pellet nuclei while maintaining cytoplasmic contents in solution is well known . techniques for separating nuclei from cytoplasm are described in zwerner , et al . 1979 cell culture , eds . jakoby and pastan , ch . 18 , pps 221 - 229 ( methods in enzymology vol . 58 ) academic press , san diego , calif ., which is incorporated herein by reference . the amount of either rip - 1 or gr or both may be measured in either the nuclei fraction or the cytosolic fraction or both . it is also contemplated that in addition to rip - 1 and gr , the presence and amount of other components of the gr type ii complex may be measured in the nuclear fraction to determine translocation . the presence and amount of rip - 1 or gr may be measured by standard elisa assay . results can be compared with those observed in control assays using known inducers of translocations such as vpr protein or steroids such as hydrocortisone and dexamethasone , and known inhibitors of translocations such as glucocorticoid receptor antagonists including mifepristone . these data can be used to determine whether translocation was induced or inhibited and the level of such induction or translocation . the presence of rip - 1 or gr may be identified in the nuclear fraction to detect translocation . further , the level of rip - 1 or gr in the cytosolic fraction may be measured to indicate translocation . it is also contemplated that the presence of the heat shock protein 90 dimer , the heat shock protein 70 subunit or vpr or a rip - 1 binding protein / peptide may be identified in the nuclear fraction to measure translocation . the detection of any of the proteins in cellular fractions can be performed routinely using antibodies against the proteins to be detected , i . e . antigens . one having ordinary skill in the art can detect antigens using well known methods . one having ordinary skill in the art can readily appreciate the multitude of ways to practice a binding assay to detect antigens in either the nuclear or cytoplasmic fraction . for example , antibodies are useful for immunoassays to detect antigens . the immunoassay typically comprises incubating the fraction with a detectably labeled high affinity antibody capable of selectively binding to the antigen , and detecting the labeled antibody which is bound to the protein . various immunoassay procedures are described in immunoassays for the 80 &# 39 ; s , a . voller et al ., eds ., university park , 1981 , which is incorporated herein by reference . in this aspect of the invention , the antibody or the fraction which may contain the antigen may be added to nitrocellulose , or other solid support which is capable of immobilizing proteins . the support may then be washed with suitable buffers followed by treatment with the detectably labeled antigen - specific antibody . the solid phase support may then be washed with the buffer a second time to remove unbound antibody . the amount of bound label on said solid support may then be detected by conventional means . by &# 34 ; solid phase support &# 34 ; or &# 34 ; carrier &# 34 ; is intended any support capable of binding antigen or antibodies . well - known supports or carriers , include glass , polystyrene , polypropylene , polyethylene , dextran , nylon , amylases , natural and modified cellulose , polyacrylamide , agarose , and magnetite . the nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention . the support configuration may be spherical , as in a bead , or cylindrical , as in the inside surface of a test tube , or the external surface of a rod . alternatively , the surface may be flat such as a sheet , test strip , etc . those skilled in the art will know many other suitable carriers for binding antibody or antigen , or will be able to ascertain the same by use of routine experimentation . the binding activity of a given lot of antibodies may be determined according to well known methods . those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation . antibodies that bind to the targeted antigens may be detectably labelled . alternatively , antibodies that bind to the antibodies that bind to the targeted antigens may be detectably labelled . one of the ways in which the antibodies can be detectably labeled is by linking the same to an enzyme and use in an enzyme immunoassay ( eia ), or enzyme - linked immunosorbent assay ( elisa ). this enzyme , when subsequently exposed to its substrate , will react with the substrate generating a chemical moiety which can be detected , for example , by spectrophotometric , fluorometric or by visual means . enzymes which can be used to detectably label the antibody include , but are not limited to , malate dehydrogenase , staphylococcal nuclease , delta - 5 - steroid isomerase , yeast alcohol dehydrogenase , alpha - glycerophosphate dehydrogenase , triose phosphate isomerase , horseradish peroxidase , alkaline phosphatase , asparaginase , glucose oxidase , beta - galactosidase , ribonuclease , urease , catalase , glucose - 6 - phosphate dehydrogenase , glucoamylase and acetylcholinesterase . by radioactively labeling the antibody , it is possible to detect it through the use of a radioimmunoassay ( ria ) ( see , for example , work , t . s ., et al ., laboratory techniques and biochemistry in molecular biology , north holland publishing company , n . y ., 1978 , which is incorporated herein by reference ). the radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography . isotopes which are particularly useful for the purpose of the present invention are : 3 h , 125 i , 131 i , 35 s , 14 c , and , preferably , 125 i . it is also possible to label the antibody with a fluorescent compound . when the fluorescent labeled antibody is exposed to light of the proper wave length , its presence can then be detected due to fluorescence . among the most commonly used fluorescent labelling compounds are fluorescein isothiocyanate , rhodamine , phycoerythrin , phycocyanin , allophycocyanin , o - phthaldehyde and fluorescamine . the antibody can also be detectably labeled using fluorescence - emitting metals such as 152 eu , or others of the lanthanide series . these metals can be attached to the tnf - specific antibody using such metal chelating groups as diethylenetriaminepentaacetic acid ( dtpa ) or ethylenediaminetetraacetic acid ( edta ). the antibody also can be detectably labeled by coupling to a chemiluminescent compound . the presence of the chemiluminescently labeled antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction . examples of particularly useful chemiluminescent labeling compounds are luminol , isoluminol , theromatic acridinium ester , imidazole , acridinium salt and oxalate ester . likewise , a bioluminescent compound may be used to label the antibody . bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction . the presence of a bioluminescent protein is determined by detecting the presence of luminescence . important bioluminescent compounds for purposes of labeling are luciferin , luciferase and aequorin . detection of the vpr - specific antibody or the antibody that binds to the vpr receptor protein may be accomplished by a scintillation counter , for example , if the detectable label is a radioactive gamma emitter , or by a fluorometer , for example , if the label is a fluorescent material . in the case of an enzyme label , the detection can be accomplished by colorometric methods which employ a substrate for the enzyme . detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards . the components of the assay may be adapted for utilization in an immunometric assay , also known as a &# 34 ; two - site &# 34 ; or &# 34 ; sandwich &# 34 ; assay . in a typical immunometric assay , a quantity of unlabeled antibody ( or fragment of antibody ) is bound to a solid support that is insoluble in the fluid being tested and a quantity of detectably labeled soluble antibody is added to permit detection and / or quantitation of the ternary complex formed between solid - phase antibody , antigen , and labeled antibody . assays which can be adapted for the present invention are described by wide , radioimmune assay method , kirkham , ed ., e . & amp ; s . livingstone , edinburgh , 1970 , pp . 199 - 206 which is incorporated herein by reference . in some embodiments , an antibody is fixed to a solid phase . samples which may or may not contain antigen are contacted with the fixed antibody to form a complex . the complex is contacted with a second antibody . the solid phase is washed to removed unbound material . detection of the second antibodies that the antigen is present in the sample . a further aspect of the present invention relates to kits for practicing the above described method of identifying compounds which induce or inhibit rip - 1 / gr type ii complex translocation . kits according to this aspect of the invention comprises the a first container comprising isolated antigen such as rip - 1 or gr , a second container comprising antibodies that specifically bind to the antigen . the antibodies are used in the immunoassay and the antigen are the positive control . in one such embodiment of this aspect of the invention , the antibody is labelled . in another embodiment of this aspect of the invention , a third container comprising a labelled antibody that specifically binds to anti - antigen antibody is provided . in other aspects of the invention , the antibodies described above are used in well known western blot techniques to identify antigens in nuclear or cytoplasm fractions . sds page is used to further separate the components of the nuclear and / or cytoplasmic fractions . the gels are then contacted with a solid carrier such as nitrocellulose paper to transfer the protein thereon . the paper is then probed with the antibodies . western blots are described in sambrook et al ., molecular cloning a laboratory manual , second ed . cold spring harbor press ( 1989 ) which is incorporated herein by reference . in some embodiments , gr translocation may be determined and measured by introducing into the cells a gene construct which comprises a marker gene whose expression is under the regulatory control of a promoter with a glucocorticoid response element ( gre ) which is a nucleotide sequence . when gr is bound to the gre , expression of the marker gene occurs . thus if translocation occurs , the marker gene will be expressed and is translocation does not occur , no expression of the marker gene will occur . promoters with gres are well known . examples of promoters with gre include the hiv ltr and mmtv ltr . marker genes are well known and generally encode detectable proteins normally not found in the cells where the marker is being used . examples of common marker genes include the bacterial enzymes chloramphenicol transferase ( cat ) and beta galactosidase . cat os particularly useful since a routine enzyme assay is available which can readily quantify the amount of cat present and thus the level of expression of the marker gene . the level of expression is indicative of the level of translocation . example 1 describes examples of gene constructs useful in the present invention . results can be compared with those observed in control assays using known inducers of translocations such as vpr protein or steroids such as hydrocortisone and dexamethasone , and known inhibitors of translocations such as glucocorticoid receptor antagonists including mifepristone . these data can be used to determine whether translocation was induced or inhibited and the level of such induction or translocation . according to another aspect of the present invention , methods of evaluating the level of infection of individuals infected with human immunodeficiency virus ( hiv ) are provided . the discovery that vpr induces translocation of the gr type ii complex allows for assays in which samples from an infected individual may be assayed in a translocation assay , particularly those assays in which a marker gene is expressed when cells are contacted with vpr . infected individuals have vpr in body fluids . samples of body fluid may be assayed to detect and quantify vpr in the sample as an diagnostic for hiv and as a prognosticator of the progress of infection . vpr titers increase with progression of hiv infection . the translocation assays described herein provide a means to quantify the level of vpr in an infected individual and thereby monitor the progress of infection . test samples include those samples that are obtained from individuals suspected of being hiv + and may consist of blood , cerebral spinal fluid , amniotic fluid , lymph , semen , vaginal fluid or other body fluids . test samples also include those samples prepared in the laboratory , such as those used for research purposes . cells , if present , may be removed by methods such as centrifugation or lysis . one skilled in the art would readily appreciate the variety of test samples that may be examined for vpr . test samples may be obtained by such methods as withdrawing fluid with a needle or by a swab . one skilled in the art would readily recognize other methods of obtaining test samples . the translocation assays described herein may be used to detect and quantify vpr in a sample . the most convenient assay described herein is the use of cells that contain rip - 1 and gr type ii complex which have been transfected with a gene construct comprising a marker gene under the control of regulatory sequences that include a gre . such assays are described herein . the assays are used to detect and measure vpr in a sample by contacted the cells with the sample and quantifying the amount of marker gene expressed . controls include compositions that contain known amounts of vpr . kits contain a container with the gene construct and a second container that has known quantities of vpr at a known concentration . in some kits , the gene construct is incorporated with cells . another aspect of the present invention relates to the use of vpr protein or rip - 1 - binding fragments of vpr protein useful as transfection agent , particularly for the delivery of nucleic acid molecules or derivatives thereof into the nucleus of a cell . nucleic acid molecules may be conjugated to vpr or rip - 1 - binding fragments thereof in order to facilitate entry of the nucleic acid molecule into the nucleus . as disclosed herein , vpr translocates into nucleus of cells when it binds to rip - 1 . thus , agents whose presence in the nucleus is desirable may be conjugated to vpr or fragments thereof in order to facilitate entry of such agents into the nucleus . in some embodiments , nucleic acid molecules are conjugated to vpr or fragments thereof . such conjugated nucleic acid molecules are efficiently transported into the nucleus . in some embodiments , the nucleic acid molecule is a gene construct which comprises a coding sequence operably linked to regulatory elements which direct expression of the coding sequence . in some embodiments , the nucleic acid molecule is an antisense molecule or a coding sequence of an antisense molecule or a ribozyme or a coding sequence for a ribozyme . incorporation of such molecules into the nucleus , inhibits expression of endogenous genes whose expression or overexpression is undesirable . in some embodiments of the invention , nucleic acid molecules such as dna are conjugated to vpr or fragments of vpr which bind to rip - 1 and which when bound to rip - 1 induce translocation . the nucleic acid molecule may be conjugated to the vpr protein or fragment thereof by well known cross linking techniques and agents such as homobifunctional succinimidyl esters , preferably with carbon chain spacers such as disuccinimidyl suberate ( pierce co , rockford , ill .). in the event that a cleavable conjugated compound is required , the same protocol would be employed utilizing 3 , 3 &# 39 ;- dithiobis ( sulfosuccinimidylpropionate ; pierce co .). other crosslinker include sulfombs and sulfaldehyde . in some embodiments of the invention , active agents such as drugs and radioisotopes are conjugated to vpr or fragments of vpr which bind to rip - 1 and which when bound to rip - 1 induce translocation . the small molecules may be conjugated to the vpr protein or fragment thereof by well known cross linking techniques and agents homobifunctional succinimidyl esters , preferably with carbon chain spacers such as disuccinimidyl suberate ( pierce co , rockford , ill .). in the event that a cleavable conjugated compound is required , the same protocol would be employed utilizing 3 , 3 &# 39 ;- dithiobis ( sulfosuccinimidylpropionate ; pierce co .). other crosslinker include sulfombs and sulfaldehyde . in some embodiments of the invention , active agents such as protein based toxins are conjugated to vpr or fragments of vpr which bind to rip - 1 and which when bound to rip - 1 induce translocation . the toxins may be conjugated to the vpr protein or fragment thereof by well known cross linking techniques and agents such as disuccinimidyl suberate , 3 , 3 &# 39 ;- dithiobis ( sulfosuccinimidylpropionate ; pierce co . ), by disulfide bonds between cysteine residues in separate protein molecules to form dimers or by constructing a chimeric gene that encodes a fusion protein which comprises a vpr derived portion and a toxin portion . those having ordinary skill in the art can readily design dimers crosslinked with crosslinking agents or disulfide bonds or generate and express chimeric genes that encode fusion proteins . the conjugated compositions and fusion proteins of the present invention may be used to deliver active agents to the nucleus of cells in both in vitro and in vivo protocols . as discussed above , active agents include nucleic acid molecules , drugs , radioisotopes , and toxins for example . in some embodiments , the active agent is selected from the group consisting of : methotrexate , doxorubicin , daunorubicin , cytosinarabinoside , etoposide , 5 - 4 fluorouracil , melphalan , chlorambucil , cis - platinum , vindesine , mitomycin , bleomycin , purothionin , macromomycin , 1 , 4 - benzoquinone derivatives , trenimon , ricin , ricin a chain , pseudomonas exotoxin , diphtheria toxin , clostridium perfringens phospholipase c , bovine pancreatic ribonuclease , pokeweed antiviral protein , abrin , abrin a chain , cobra venom factor , gelonin , saporin , modeccin , viscumin , volkensin , alkaline phosphatase , nitroimidazole , metronidazole and misonidazole . such active agents are conjugated to vpr or fragments of vpr that bind to rip - 1 and induce translocation of rip - 1 to the nucleus . vpr may be isolated from natural sources or produced by a variety of well known means such as those described in u . s . ser . no . 08 / 019 , 601 filed feb . 19 , 1993 and u . s . ser . no . 08 / 167 , 608 filed dec . 15 , 1993 , both of which are incorporated herein by reference . fragments of vpr that bind to rip - 1 and induce translocation of rip - 1 to the nucleus are fragments of vpr as described herein , particularly example 3 , and may be identified as described herein . conjugated compositions may be targeted to cells by further linking cell specific receptor binding peptides to the conjugated composition or encapsulating the conjugated composition within a vector such as a liposome , a viral particle or a viral package . according to another aspect of the invention , vpr or fragments of vpr that bind to rip - 1 can be used to identify the presence and location of gr type ii complex in cells and cellular material that comprises rip - 1 and gr type ii complex . it has been discovered that vpr binds to rip - 1 and rip - 1 binds to gr type ii complex . thus , in protocols in which the location within a cell of gr type ii complex is to e determined , vpr or a rip - 1 - binding fragment thereof can be used . vpr or a fragment thereof may be labelled or detected using detectable antibodies that bind to the vpr and fragment thereof . the detectable antibodies may be labelled or targeted with labelled anti - antibody antibodies or ligands that bind to the fc portion of the antibody . protocol for locating gr type ii complex within a cell include those in which compounds are screened which are being tested for their ability to bind to gr and either induce or inhibit gr type ii translocation . isolated vpr or fragments thereof , particularly that which is produced in eukaryotic cells such as baculovirus produced vpr is therefore useful and a detectable ligand for both rip - 1 and for detecting gr type ii complex . 3 × 10 6 cells were washed twice in pbs , and lysed in 200 μl of lysis buffer ( 150 mm nacl , 50 mm tris , ph 8 . 0 , 0 . 5 % triton x - 100 , plus protease inhibitors : aprotinin , leupeptin , pepstatin a , each at 2 μg / ml ; pmsf , 1 mm , and edta , 1 mm ). cell suspension was incubated on ice for 10 minutes with frequent vortexing , and centrifuged at 12000 g for 6 minutes . the soluble , as well as the insoluble fractions were run on 12 % sds - page , and transferred to pvdf membranes ( millipore ), as described . membranes were blocked with 5 % non fat dry milk , in tbs supplemented with 0 . 05 % tween - 20 . blocked membranes were incubated with either purified vpr protein ( approximately 50 ng / ml ) or an irrelevant protein . these membranes were then incubated with 808 rabbit anti vpr antiserum levy , et al . 1994b , supra , followed by i 125 protein g ( nen ), and exposed to film for at least 12 hours at - 80 ° c . this column was constructed by coupling purified recombinant vpr to cyanogen bromide activated sepharose beads ( sigma ). recombinant vpr at 1 mg / ml was incubated with swelled beads for 2 hours at 25 ° c . in 10 mm nahco 3 , 0 . 5m nacl , ph 8 . 3 . the coupled beads were blocked with 1m glycine . after loading the column with antigen , elution was performed using first pre - elution buffer composed of 10 mm sodium phosphate , ph 6 . 8 , followed by elution buffer consisting of 100 mm glycine , ph 2 . 5 . elution fractions were neutralized with 1 / 20 volume 1m sodium phosphate , ph 8 . 0 . the following cell lines were obtained from the american type culture collection ; te671 human embryonal rhabdomyosarcoma ( atcc htb139 ), a673 embryonal rhabdomyosarcoma ( atcc crl 1598 ), d17 canine osteosarcoma ( atcc ccl183 ), hos human osteosarcoma ( atcc crl 1543 ), u373 human glioblastoma ( atcc htb17 ), sk - n - mc neuroblastoma ( atcc htb10 ). two additional glioblastoma lines were kindly provided by the medical research council ( mrc ), england , ( ht17 and ht16 ). u87mg ( htb14 ) is a glial cell line obtained from the university of pennsylvania cell center . rd rhabdomyosarcoma cells were provided by dr . a . srinivasan . the t lymphocytic cells h9 and supt - i were obtained from the university of pennsylvania cell center , and kg - 1 was obtained from dr . g . trinchieri . the murine nih 3t3 line was obtained from atcc . bsc - 1 , cv - 1 and cos cell lines were obtained dr . b . moss . primary pbl as well as primary monocytes / macrophages were isolated as in levy , et al . 1994b , supra . all non - hematopoietic cells were cultured in dmem with 10 % heat inactivated fetal calf serum , penicillin / streptomycin , i - glutamine , hepes ( 25 mm ) and sodium pyruvate . hematopoietic cells were cultured in rpml 1640 as above except using 10 % autologous human serum . virus were prepared as described in levy , et al ., 1994b , supra ; levy , et al ., 1994a , supra , which are incorporated herein by reference . the rabbit anti - vpr peptide serum ( aa 2 - 21 , &# 34 ; 808 &# 34 ;) was obtained from bryan cullen through the nih arrrp . the human anti - gag p24 ( v7 . 8 ) was obtained from ronald kennedy through the nih arrrp . the sheep anti - p24 was obtained from the fda through the nih arrrp . capture elisa for gag p24 antigen was performed as previously reported ( levy , et al . 1994b , supra ; koenig , et al ., 1986 , detection of aids virus in macrophages in brain tissue from aids patients with encephalopathy . science . 233 , 1089 - 1093 ). fractions containing eluted vpr / rip - 1 complexes were pooled and dialyzed against three changes of water , the lyophilized and resuspended in pbs to a tenth of the original volume . this material was then exposed to either the non - cleavable agent , dss , or the cleavable crosslinking agent , dtssp ( pierce ), 50 mg / ml in 50 % dmso , 50 % h 2 o vol / vol . conditions used as in weiner , 1989 , a point mutation in the neu oncogene mimics ligand induction . nature . 339 , 230 - 231 , which is incorporated herein by reference . the expression of vpr in insect cells has been described in refaeli , et al ., 1993 , expression of biologically active recombinant hiv - 1 vpr protein from baculovirus . ( submitted ), which is incorporated herein by reference . briefly , the vpr open reading frame from hiv - 1 nl43 was cloned into the baculovirus expression vector pvl1393 and this construct was co - transfected with linearized dna from autograph california nuclear polyhidrosis virus ( baculogold - acmnpv ) into spodoptera frugipera ( sf - 9 ) cells . the resulting recombinant baculoviruses were plaque purified and expanded following well known protocols ( o &# 39 ; reilly , et al ., 1992 , baculovirus expression vectors : a laboratory manual . ( new york : w . n . freeman )). for protein expression , nigh five cells were infected at 5 - 10 moi , at a cell density of 2 × 10 6 cell / ml . the tissue culture supernatants were harvested 24 hours later were then centrifuged at 10 , 000 g . these supernatants were supplemented with protease inhibitors ( pmsf , edta , egta , aprotinin , pepstatin a , and leupeptin ), dialyzed against pbs , then filtered sterilized and kept on ice until used . control supernatants consisted of baculovirus supernatants prepared as above from cells infected with recombinant baculoviruses lacking a gene insert . for purification , triton x - 100 at 0 . 05 % final concentration was added to the baculovirus , supernatants , then the supernatants were passed over a rabbit anti - vpr column constructed following published protocols ( harlow and lane , 1988 , antibodies : a laboratory manual . ( cold spring harbor , ny : cold spring harbor laboratory press ), which is incorporated herein by reference ). after extensive washing with pbs , 0 . 05 % triton x - 100 , the columns were eluted as follows . three bed volumes of a pre - elution buffer of 10 mm phosphate buffer plus triton x - 100 ( 0 . 05 %), ph 8 . 0 , were passed through the column , followed by the elution buffer consisting of 10 mm triethanolamine plus 0 . 05 % triton x - 100 , ph 11 . 5 . the eluate was collected in 0 . 5 ml aliquot and neutralized with 1 / 20 volume of 1m sodium phosphate buffer , ph 6 . 8 . the immunoaffinity columns were constructed by coupling the indicated antibody to protein g beads using dimethyl pimelimidate - 2 - hcl ( dmp ) ( pierce ). the vpr column was constructed by coupling purified recombinant vpr to cyanogen bromide activated sepharose beads ( sigma ). recombinant vpr at 1 mg / ml was incubated with swelled beads for 2 hours at 25 ° c . in 100 mm nahco 3 , 0 . 5m nacl , ph 8 . 3 . the coupled beads were blocked with 1m glycine . after loading the column with antigen , elution was performed using first pre - elution buffer composed of 10 mm sodium phosphate , ph 6 . 8 , followed by elution buffer consisting of 100 mm glycine , ph 2 . 5 . elution fractions were neutralized with 1 / 20 volume 1m sodium phosphate , ph 8 . 0 . ltr - cat assays . induction of the hiv - ltr was measured as a function of a reporter gene ( cat ) function . pbenncat , an ltr - cat encoding construct , obtained from m . martin , through the nih arrrp was used . the levels of cat protein were measured using a cat elisa capture assay ( boehringer mannheim ), following manufacturer &# 39 ; s specifications . the levels of cat activity were measured by a chloramphenicol acetyltransferase assay , according to published procedures ( gorman , et al ., 1982 , the rous sarcoma virus long terminal repeat is a strong promoter when introduced into a variety of eukaryotic cells by dna mediated transfection . proc . natl . acad . sci . usa . 79 , 6777 - 6781 ). briefly , rd cells were transfected with pbenncat ( gendelman , 1986 , trans - activation of the human immunodeficiency virus long terminal repeat sequence by dna viruses . proc . natl . acad . sci . usa . 83 , 9759 - 9763 ), using dotap . cells were washed 12 hours later and new medium , containing the test reagents was added to the cell monolayers . 48 hours later , cells were washed three times with ca + 2 / mg + 2 free pbs . cells were then scraped off the plate , and collected with 1 ml pbs . cell pellets were lysed by resuspending them in 100 μl 0 . 25m tris , ph 7 . 8 , and undergoing three freeze - thaw cycles using an ethanol - dry ice bath , and a 37 ° c . water bath . lysates were spun at 12 , 000 g for 5 minutes and samples were stored at - 20 ° c . until they were used . the cat reaction was set up using 5 μl c 14 chloramphenicol ( 40 - 50 mci / mmole ) , 70 μl ddh 2 o , 35 μl 1m tris , ph 7 . 8 , 20 μl 4 mm acetyl coa ( pharmacia ), 20 μl cell lysate . the reactions were incubated at 37 ° c . for an hour , and subsequently extracted with 1 ml ethyl acetate . after resuspension in 20 μl ethyl acetate , samples were spotted on the silica gel tlc plates ( whatman ), and developed in chloroform : methanol ( 95 : 5 ); ascending . gels were dried and exposed to film ( kodak xar ) overnight at room temperature . the panel of hiv - 1 ltr / cat mutants were obtained from dr . joseph stevens , through the nih arrrp . pgre5 / cat was obtained from united states biochemicals . u937 myeloid cells were stimulated with the studied agents , and exposed to crosslinking agents ( dss or dtssp accordingly ) and subsequently lysed with the lysis buffer described earlier . these lysates were spun at 12000 g for 10 minutes , and immediately used for immunoprecipitation procedures which were done as previously described . the antibody used in these immunoprecipitations was a mouse anti - human gr ( affinity bioreagents ). alternatively , resting u937 cells were lysed as described above , and supplemented with the studied agents . the stimulated lysates were then exposed to crosslinking agents , and these preps used for immunoprecipitation procedures . all the resulting fractions were subsequently used for sds - page , western blot , or a vpr - ligand blot for the detection of rip - 1 . the antibodies used were 808 ( rabbit anti - vpr ), and the mouse anti - gr antibody , which was used to precipitate these complexes . u937 cells were lysed by swelling on ice , with constant vortexing , for 15 minutes with 0 . 075m kci , supplemented with pmsf , aprotinin , leupeptin a and pepstatin . these lysates were spun at 12000 g for 10 minutes and kept on ice until used . these cell lysates were stimulated with vpr protein , a control ( pvl ), dexamethasone , or 9 - cis - retinoic acid . the binding buffer used was 12 % glycerol , 12 mm hepes ( ph 7 . 9 ), 4 mm tris ( ph 7 . 9 ), 60 mm kci , 1 mm edta , and 1 mm dtt . the oligonucleotides sequences used were obtained from d . ghosh . the hiv - 1 / 2 ( 32 ) p labelled probe was prepared by annealing an hiv - 1 oligonucleotide ( gatccggcccaataaaggagagaacaccagcttgttacaccctgtgag - seq id no : 2 ) and hiv - 2 nucleotide ( gatcctcacagggtgtaacaagctggtgttctgtcctttattggccg - seq id no : 3 ), followed by filling the resulting bamhi site with klenow enzyme . the radiolabelled synthetic probe and the stimulated cell lysates were incubated with 100 molar excess of the unlabelled mmtv gre probe , or with an unlabelled , unrelated ( polyoma virus ef - c ) recognition sequence - containing oligonucleotide in a competitive gel shift assay . the competitors were prepared by annealing single stranded oligonucleotides gre1 ( gatccgtttatggttacaaactgttcttaaaacaag - seq id no : 4 ) and gre2 ( gatccttgttttaagaacagtttgtaaccataaacg - seq id no : 5 ) and the unrelated ef - c oligonucleotides , ef - c1 ( gatccattagttgctaggcaactggcg - seq id no : 6 ) and ef - c2 ( gatccgccagttgcctagcaactaatg - seq id no : 7 ). the oligonucleotides were annealed by heating up to 80 ° c ., for 15 minutes , and letting cool down at room temperature . the protein - dna mixtures were incubated in the binding buffer described , for 30 minutes at room temperature . all samples were subsequently ran on a non - reducing , non - denaturing polyacrylamide gel ( 270 μl 1m tris , ph 7 . 9 ; 80 μl 0 . 5m edta , ph 7 . 9 ; 13 . 2 μl 1m sodium acetate , ph 7 . 9 ; 5 . 33 ml 30 % acrylamide ; 1 ml 2 % bisacrylamide , 2 ml 50 % glycerol , 31 ml ddh2o ), using a low ionic strength buffer ( 26 . 9 ml 1m tris , ph 7 . 9 ; 13 . 2 ml 1m sodium acetate , ph 7 . 9 ; 8 ml 0 . 5m edta , ph 8 . 0 ; up to a final volume of 4 liters with ddh2o ). gels were run at 30 - 35 ma , until the bromophenol blue had migrated 3 / 4 of the length of the gel . gels were dried on whatman paper , and exposed to kodak x - ar film for periods spanning from 6 hours to 7 days . to construct a recombinant baculovirus containing the vpr gene , the vpr open reading frame was subcloned from the vpr - pbabepuro expression plasmid , which has been previously described ( levy , et al ., 1993 , supra , which is incorporated herein by reference ), into the multiple cloning site of pvl1393 baculovirus expression vector ( invitrogen ) downstream of the baculovirus polyhedron promoter . this construct is predicted to encode a non - fused , native vpr protein ( levy , et al , 1994a , supra ). co - transfection of this plasmid along with linearized acmnpv genomic dna ( baculogold , pharmingen ) into sf - 9 ( spodoptera frugiptera ) insect cells yielded recombinant baculoviruses containing the vpr gene . twenty four hours after transfection , virus - containing supernatants from transfected cells were applied to nigh - five cells ( tricholupisa ni ) whose supernatants and cell fractions were then assayed for vpr protein expression . the recombinant vpr protein obtained was identical in its apparent molecular weight and seroreactivity to the native , viral borne protein . when added to the culture media of rhabdomyosarcoma cells ( rd ), this protein induced growth arrest and cellular differentiation in a manner similar to that which was obtained by transfection of the vpr gene , hiv - 1 genomic dna , or by infection with hiv - 1 . in order to further characterize the biochemical aspects of vpr activity on cells , the interaction of vpr with cellular proteins which might couple vpr to intracellular signaling pathways was investigated . cell lysates from 3 × 10 6 rd cells were obtained using either triton x - 100 , sds , or sodium deoxycholic acid . following sds - page of the triton x - 100 soluble and insoluble fractions as well as those of the sds and sodium deoxycholic acid lysates , proteins were transferred to membranes and probed with recombinant vpr ( vpr - ligand blot ). a single 41 kd protein ( rip - 1 ) was detected from each of the soluble fractions and not in the triton x - 100 insoluble fraction . rip - 1 was detected by using either the recombinant or virally derived vpr proteins . in addition , rip - 1 and vpr coeluted from a vpr specific immunoaffinity column . next , a vpr - cnbr activated sepharose column loaded with the triton x - 100 soluble fraction of rd cell lysates was eluted at ph 2 . 5 , to yield essentially a single protein band (& gt ; 95 % purity ). this protein matched in size to rip - 1 , and reacted with vpr in a ligand blot system in a manner identical to the protein found in total cell lysate . furthermore , rip - 1 and vpr could be reversibly crosslinked to a 58 kd heterodimeric complex that reacted with the vpr specific antibody in western blots , and in vpr ligand blots . therefore rip - 1 likely represents a cellular target for vpr . rip - 1 was detected in both rhabdomyosarcoma ( rd cells ) and u937 cells of the myeloid lineage . in addition , rip - 1 was found to be present in cell lines derived from a variety of tissues , including several cell lines of t lymphoid ( h9 and supt1 ) and myeloid origin ( u937 , hl60 , kg - 1 , thp - 1 ), as well as in other rhabdomyosarcoma ( te671 , a673 ), osteosarcoma ( hos , d17 ), astrocytoma ( ht017 , htb14 , ht16 , ht17 ) and neuroblastoma ( htb10 ) cell lines . rip - 1 was also detected in primary lymphocytes and in adherent monocyte / macrophage cells obtained from a healthy hiv - 1 seronegative donor . rip - 1 is present in cell lineages which are the primary targets of hiv infection , rip - 1 was not detected however in murine nih - 3t3 cells , nor in cv - 1 , bsc - 1 , or cos cells . interestingly , these four cell lines have been reported to lack endogenous gr ( madan and defranco , 1993 , supra ; picard and yamamoto , 1987 , two signals mediate hormone - dependent nuclear localization , of the glucocorticoid receptor . embo . 6 ( 11 ), 3333 - 3340 ). the expression of rip - 1 in a diverse collection of transformed and untransformed cell types may suggest that rip - 1 is part of a basic cellular pathway linked to cellular proliferation and differentiation . cellular trafficking studies of rip - 1 in response to vpr and other stimuli the cellular localization of rip - 1 was determined through cellular fractionation studies , vpr protein did not appear to bind to the cell surface of supt1 , rd , or hl60 cells as determined by an indirect fluorescence assay . in additional studies the nuclear components were segregated from the cytosolic and membrane bound elements of the cell utilizing a triton x - 100 lysis procedure , rip - 1 was found to be consistently present in the cytosolic fraction of cells prior to vpr exposure . upon exposure of such cells to vpr protein , or hiv - 1 virus , but not to the phorbol ester pma , rip - 1 was observed to translocate from the cytoplasmic to the nuclear fraction . similarly an infectious vpr deletion mutant hiv - 1 virus ( hiv - 1 nl43 δvpr ) ( levy , et al ., 1993 ), could not induce rip - 1 translocation following infection of u937 cells . importantly , vpr was observed to co - translocate to the nucleus with rip - 1 , as assessed by vpr - ligand blot assays . the characteristics of the viral replication kinetics could also be correlated to the location of rip - 1 in the cell . u937 cells which were infected with hiv - 1 nl43 were found to produce detectable levels of virus at day 4 post infection . rip - 1 was observed to co - translocate to the nucleus with vpr on day 3 post infection . u937 cells which were infected with hiv - 1 nl43 δvpr failed to establish a productive infection . such nonproductively infected cells can be rescued for p24 production by addition of exogenous vpr protein ( levy , et al ., 1994a , supra ; levy , et al ., 1994b , supra ). exogenous vpr protein induced the nuclear translocation of rip - 1 by 12 hours after the initial exposure of the cells . when the nonproductively infected u937 cells described above were exposed to vpr protein , rip - 1 translocated 12 hours later , and virus was first detected in the media 36 hours after the initial exposure to vpr . such correlative data provides further evidence for the coupling of functions of vpr and rip - 1 in the hiv infection process . nuclear translocation of rip - 1 is induced by hydrocortisone and dexamethasone , in the absence of vpr it is possible that rip - 1 is a carrier protein which translocates vpr to the cell nucleus where vpr could exert its biological function . alternatively , vpr could function as the ligand for a protein involved in a distinct cellular signalling pathway . along these lines , the cellular trafficking characteristics observed for rip - 1 are characteristic in many ways to members of the glucocorticosteroid receptor superfamily ( reviewed in evans , 1988 , supra ; parker , 1992 , supra ; beato , 1989 , gene regulation by steroid hormones . cell . 56 , 335 - 344 ; green and chambon , 1988 , nuclear receptors enhance our understanding of transcription regulation . trends . genet . 4 , 309 - 314 ) or translocation / transcription complex . type ii glucocorticoid receptors ( gr ) and their accessory proteins in particular translocate from the cytoplasm to the nucleus upon binding to their ligand . gr have been shown to act as powerful transactivators ( evans , 1988 , supra ). in order to test the hypothesis that rip - 1 is either a member , or part of a complex containing a member of the glucocorticosteroid receptor superfamily , we tested the effects of different steroid hormones on rip - 1 translocation . both dexamethasone ( at 10 - 6 m ) and hydrocortisone ( 10 - 6 m ) ( activators of gr ii pathway ), but neither 9 - cis - retinoic acid nor all - trans - retinoic acid ( activators of rar and related pathways ) induced the nuclear translocation of rip - 1 . furthermore , cholesterol ( cyclodextrin conjugated ), and cyclodextrin , also failed to induce the nuclear translocation of rip - 1 . the possibility that rip - 1 is a novel member of the gr type ii receptor family does not exclude the alternative in which vpr and / or rip - 1 form a part of the gr transcription complex . resting cells have most of their gr in their cytoplasmic portion , associated with a heat shock protein 90 dimer , and hsp56 . upon activation , the receptor is transformed and the complex changes in its molecular composition . it is conceivable that vpr alters rip - 1 such that it binds gr , and / or some other member of the complex in order to promote receptor transformation and the subsequent nuclear translocation . accordingly , we stimulated resting u937 cells , or supplemented resting cells &# 39 ; lysates with vpr . the cells , or lysates , respectively , were then exposed to a reversible ( dtssp ), or a nonreversible crosslinking agent ( dss ) followed by immunoprecipitation of gr using mouse anti - hgr ( affinity bioreagents ) coupled protein d beads . these samples were subsequently analyzed by sds - page , western blot . in addition , the fractions which were crosslinked with dss show that gr as well as vpr and rip - 1 are involved in a high molecular weight complex . vpr mutant viruses are complemented in trans by vpr protein and gr ii stimulating steroids the effect of glucocorticosteroids on the nonproductively infected u937 cells described earlier was examined . hiv - 1 nl43 δvpr viruses were complemented in trans by addition of either vpr protein , dexamethasone , or hydrocortisone to the tissue culture medium . this mutant virus however was not affected by the addition of either type of retinoic acid used , nor by cholesterol or cyclodextrin . the two glucocorticosteroids studied were also able to increase virus production in u937 cells infected with the wild type molecular clone , hiv - 1 nl43 . this is an effect very similar to that which has been observed for exogenous vpr protein . gr type ii activators in an analogous manner to vpr , whether virion borne or added exogenously mediated rip - 1 cytoplasmic to nuclear translocation . the kinetics of this translocation process are consistent with the observed gr type ii activation of viral protein production . gr ii inhibitors affect the vpr mediated effects on rip - 1 and virus production specific inhibitors of gr ii translocation and cellular activation have been previously described ( reviewed in agarwal , et al ., 1987 , glucocorticoid antagonists . febs letters . 217 , 221 - 226 ; baulieu , 1991 , the steroid hormone antagonist ru486 . endocrinology and metabolism . 20 , 873 ; gronemeyer , et al ., 1992 , mechanisms of antihormone action . j . steroid biochem . 41 , 217 - 221 ). mifepristone has been reported to reverse the catabolic effect of glucocorticoids in thymocytes in vitro ( lazar and agarwal , 1986 , evidence for an antagonist specific receptor that does not bid mineralocorticoid agonists . biochem biophys res commun . 134 , 261 - 265 ), by inhibiting the formation and translocation of the dexamethasone - receptor complexes as well as nuclear translocation ( lazar and agarwal , 1986 , supra ; lindenmeyer , et al ., 1990 , glucocorticoid receptor monoclonal antibodies define the biological action of ru38486 in intact 1316 melanoma cells . cancer yes . 50 , 7985 - 7991 ). mifepristone can also inhibit the induction of epstein - barr virus in daudi cells ( dietrich , et al ., 1986 , antagonism of glucocorticoid induction of epstein - barr virus early antigens by different steroids in daudi lymphoma cells . j . steroid biochem . 24 , 417 - 421 ), as well as reverse the dexamethasone - induced inhibition of growth in a human cervical - carcinoma cell line ( bakke , 1986 , antagonistic effect of glucocorticoids on retinoic acid induced growth inhibition and morphological alterations of a human cell line . cancer res . 46 , 1275 - 1279 ). the biology of rip - 1 in the presence of a specific inhibitor of the gr ii pathway ( mifepristone ) was analyzed . the nuclear translocation of rip - 1 induced by dexamethasone and hydrocortisone was blocked through the addition of mifepristone to the culture medium . similarly , vpr induced translocation of rip - 1 was also inhibited by the exposure of these cells to mifepristone . the effects of these compounds and those of vpr on virus production were also curtailed by this glucocorticosteroid receptor inhibitor . the levels of virus produced by hiv - 1 infected cells exposed to mifepristone was about 70 % lower than the untreated cultures . mifepristone was also able to inhibit the enhancement in virus production observed by the addition of vpr protein to infected cells ( ca . - 80 - 90 % inhibition ). furthermore , the transcomplementation observed for the hiv - 1 nl43 δvpr infected u937 cells by vpr protein was also abolished by mifepristone treatment , yielding virus levels similar to those observed in the nonproductively infected cultures . the mifepristone inhibitory effects were observed to be dose responsive . the concentration selected for most of the inhibition studies described was 10 - 6 m . vpr and gr ii stimulating steroids induce ltr mediated gene expression , which is inhibitable by mifepristone though glucocorticoid receptors have been defined to function as powerful transcription factors , and vpr has been shown to weakly transactivate the hiv ltr and several heterologous viral promoters , there is however no evidence for a direct interaction between the vpr gene product and the hiv ltr ( cohen , et al ., 1990b , supra ). the possibility that activation of the gr pathway could play a central role in the viral transcription process was considered . to test this , rd cells were transfected with an ltr - cat encoding plasmid ( pbenncat ) ( gendelman , 1986 , supra ), without selection . 12 hours later , the cell monolayers were washed and fresh medium containing the test reagents was added to the cultures , and 48 hours later the cells were harvested . in these studies , the co - transfection of a vpr encoding plasmid with the ltr - cat encoding plasmid produced an increase in cat activity of 5 - 10 fold over the controls , as has been previously reported . in contrast , the increase in cat activity observed with the addition of exogenous vpr protein to the ltr - cat transfected cells was 60 - 85 fold . when a set of cells were transfected with the ltr - cat encoding plasmid , and a second set of cells were transfected with the vpr - encoding plasmid , were brought into proximity by the presence of a 0 . 22 μm diameter pore membrane , an increase of 25 - 40 fold in cat activity over the controls was observed . vpr protein was detected in the tissue culture media of these cells , as assessed by capture elisa . these data support that exogenous vpr protein can enhance hiv replication in vitro through its transactivating activity . it is likely that vpr manifests its activity through the gre binding element of the hiv - 1 ltr thus affecting viral transcription . this was examined directly using hiv - 1 ltr - cat constructs . the site on the hiv - ltr to which the vpr mediated transactivation was mapped . using a panel of deletion mutant ltr - cat constructs , both vpr and dexamethasone , were able to induce cat activity as long as the region between - 250 to - 264 were present . this is the region which has been defined to contain a possible gre sequence . in addition , vpr protein was able to stimulate cat expression from cells transfected with pgre5 / cat ( usb ), a plasmid in which the cat gene is preceded by five consecutive gre sequences , upstream from the transcriptional start sequence . dexamethasone and hydrocortisone were observed to stimulate levels of cat activity similar to those attained by vpr protein treatment ( ca . 50 fold over the controls ). these levels of cat activity were approximately ten times higher than the levels of cat activity stimulated by cotransfection of pbenncat with vpr - pbabepuro . in addition , the increase in cat activity stimulated by either vpr protein , or steroids , was inhibited by supplementing these cultures with mifepristone . furthermore , mifepristone blocked the more modest increase in cat activity which was observed in cells cotransfected with a vpr encoding plasmid and the ltr - cat plasmid . in addition , neither 9 - cis - retinoic acid , nor all - trans retinoic acid induced any increases in cat activity above basal levels . in order to probe the observation that the vpr mediated transactivating activity maps to the region of the hiv - ltr where the gre sequences were shown to be encoded , the possibility that vpr was inducing the binding of the gr transcriptional complex to the precise gre sequence derived from the ltr was tested . oligodeoxynucleotide probes were synthesized whose sequences were derived from ltr &# 39 ; s of hiv - 1 , hiv - 2 , mmtv viruses , or an irrelevant viral promoter source . vpr protein added to cell lysates was observed to induce the binding of a protein complex to the specific gre sequences of hiv - 1 / 2 . this dna - binding complex induced by vpr stimulation was identical in its migration characteristics to the complex induced by dexamethasone stimulation . this binding could be completely competed by a 100 molar excess of unlabelled mmtv gre oligodeoxynucleotide , but was not diminished at all by the irrelevant oligodeoxynucleotide . the amino acid sequence of vpr is disclosed in u . s . ser . no . 08 / 167 , 608 filed dec . 15 , 1993 , which is incorporated herein by reference . fragments of vpr which bind to rip - 1 comprise vpr residues 27 - 39 , 35 - 48 , 41 - 55 , 49 - 60 and / or 66 - 68 . some embodiments of the invention are fragments of vpr which comprise at least three amino acids and which bind to rip - 1 . in some embodiments , fragments of vpr are less than 50 amino acids . in some embodiments , fragments of vpr are less than 25 amino acids . in some embodiments , fragments of vpr are less than 20 amino acids . in some embodiments , fragments of vpr are less than 15 amino acids . in some embodiments , fragments of vpr are less than 13 amino acids . in some embodiments , fragments of vpr are less than 10 amino acids . in some embodiments , fragments of vpr are less than 8 amino acids . in some embodiments , fragments of vpr are less than 5 amino acids . in some embodiments , fragments of vpr are less than 4 amino acids . some embodiments of the invention are peptides which comprise fragments of vpr which comprise at least three amino acids and which bind to rip - 1 . in some embodiments , the peptides are less then 25 amino acids . in some embodiments , the peptides are less then 2 amino acids . in some embodiments , the peptides comprise fragments of vpr that are less than 25 amino acids . in some embodiments , the peptides comprise fragments of vpr that are less than 20 amino acids . in some embodiments , the peptides comprise fragments of vpr that are less than 15 amino acids . in some embodiments , the peptides comprise fragments of vpr that are less than 10 amino acids . in some embodiments , the peptides comprise fragments of vpr that are less than 8 amino acids . in some embodiments , the peptides comprise fragments of vpr that are less than 5 amino acids . in some embodiments , the peptides comprise fragments of vpr that are less than 4 amino acids . in some embodiments , the compounds of the present invention are : 20 amino acids or less ; consist of or comprise a fragment of vpr that is at least 3 amino acids and that binds to rip - 1 ; and are useful as activators or inhibitors of gr type ii translocation . the peptides of the invention comprise amino acid sequences that consist of 20 amino acids or less , preferably 10 - 15 amino acids or less . as used herein , the term &# 34 ; compound &# 34 ; refers to molecules which include peptides and non - peptides including , but not limited to molecules which comprise amino acid residues joined by at least some non - peptidyl bonds . as used herein , the term &# 34 ; peptide &# 34 ; refers to polypeptides formed from amino acid subunits joined by native peptide bonds . the term &# 34 ; amino acid &# 34 ; is meant to refer to naturally occurring amino acid moieties and to moieties which have portions similar to naturally occurring peptides but which have non - naturally occurring portions . thus , peptides may have altered amino acids or linkages . peptides may also comprise other modifications consistent with the spirit of this invention . such peptides are best described as being functionally interchangeable yet structurally distinct from natural peptides . as used herein , the terms &# 34 ; compounds &# 34 ; and &# 34 ; peptides &# 34 ; are used interchangeably . conservative substitutions of amino acid sequences of vpr fragments are contemplated . as used herein , the term &# 34 ; conservative substitutions &# 34 ; is meant to refer to amino acid substitutions of vpr residues with other residues which share similar structural and / or charge features . those having ordinary skill in the art can readily design vpr fragments with conservative substitutions for amino acids based upon well known conservative groups . because most enzymes involved in degradation recognize a tetrahedral alpha - carbon , the d - amino acids may be utilized in order to avoid enzyme recognition and subsequent cleavage . peptides comprised of d amino acids are less susceptible to degradation . in some embodiments of the present invention , compounds comprising d amino acids are provided which comprise the same amino acid sequences as those presented throughout this disclosure but in reverse order , i . e . from the carboxy terminus to the amino terminus . thus , the present disclosure is meant to specifically encompass each of the sequences set out herein as additionally describing peptides from the carboxy terminus to the amino terminus which comprising d amino acids . in some embodiments , d amino acid residues are provided to facilitate the proper folding and circularization . in such cases , one or more d amino acid residues are provided with the remainder being l amino acids . likewise , in some embodiments , l amino acid residues are provided to facilitate the proper folding and circularization of peptides composed mostly of d amino acids . in such cases , one or more l amino acid residues are provided with the remainder being d amino acids . peptides of some embodiments of the present invention may be from at least about 3 to up to about 20 amino acids in length . in some embodiments of the present invention , peptides of the present invention are from about 5 to about 15 amino acids in length . in preferred embodiments of the present invention peptides of the present invention are 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 15 , 16 , 17 , 18 or 19 amino acids in length . it is preferred that peptides are as small as possible . in peptides of the invention , at least 3 amino acids of the peptide is a vpr fragment , it is preferred that the vpr derived portion makes up at least 10 % of the amino acid sequence of the peptide . in some embodiments , it is preferred that greater than about 20 - 25 % of the amino acid sequence of the peptides of the present invention are vpr derived , more preferably 30 - 40 % and more preferably greater than 50 %. in some embodiments , the proportion of amino acid sequence of the peptides of the present invention that are vpr derived approaches about 60 % or about 75 % or more . synthesized peptides of the invention may be circularized in order to mimic the geometry of those portions as they occur in vpr . circularization may be facilitated by disulfide bridges between cysteine residues . cysteine residues may be included in positions on the peptide which flank the portions of the peptide which are derived from vpr . cysteine residues within the portion of a peptide derived from vpr may be deleted and / or conservatively substituted to eliminate the formation of disulfide bridges involving such residues . alternatively , other means of circularizing peptides are also well known . the peptides may be circularized by means of covalent bonds , such as amide bonds , between amino acid residues of the peptide such as those at or near the amino and carboxy termini . in some embodiments of the invention , peptides consist of 15 amino acid residues or less and are circularized or otherwise conformationally restricted by disulfide bonds arising from n - and c - terminal cysteines . the peptides of the present invention may be prepared by any of the following known techniques . conveniently , the peptides may be prepared using the solid - phase synthetic technique initially described by merrifield , in j . am . chem . soc ., 15 : 2149 - 2154 ( 1963 ) which is incorporated herein by reference . other peptide synthesis techniques may be found , for example , in m . bodanszky et al ., ( 1976 ) peptide synthesis , john wiley & amp ; sons , 2d ed . which is incorporated herein by reference ; kent and clark - lewis in synthetic peptides in biology and medicine , p . 295 - 358 , eds . alitalo , k ., et al . science publishers , ( amsterdam , 1985 ) which is incorporated herein by reference ; as well as other reference works known to those skilled in the art . a summary of peptide synthesis techniques may be found in j . stuart and j . d . young , solid phase peptide synthelia , pierce chemical company , rockford , ill . ( 1984 ) which is incorporated herein by reference . the synthesis of peptides by solution methods may also be used , as described in the proteins , vol . ii , 3d ed ., p . 105 - 237 , neurath , h . et al ., eds ., academic press , new york , n . y . ( 1976 ) which is incorporated herein by reference . appropriate protective groups for use in such syntheses will be found in the above texts , as well as in j . f . w . mcomie , protective groups in organic chemistry , plenum press , new york , n . y . ( 1973 ) which is incorporated herein by reference . in general , these synthetic methods involve the sequential addition of one or more amino acid residues or suitable protected amino acid residues to a growing peptide chain . normally , either the amino or carboxyl group of the first amino acid residue is protected by a suitable , selectively - removable protecting group . a different , selectively removable protecting group is utilized for amino acids containing a reactive side group , such as lysine . using a solid phase synthesis as an example , the protected or derivatized amino acid is attached to an inert solid support through its unprotected carboxyl or amino group . the protecting group of the amino or carboxyl group is then selectively removed and the next amino acid in the sequence having the complementary ( amino or carboxyl ) group suitably protected is admixed and reacted with the residue already attached to the solid support . the protecting group of the amino or carboxyl group is then removed from this newly added amino acid residue , and the next amino acid ( suitably protected ) is then added , and so forth . after all the desired amino acids have been linked in the proper sequence , any remaining terminal and side group protecting groups ( and solid support ) are removed sequentially or concurrently , to provide the final peptide . the peptide of the invention are preferably devoid of benzylated or methylbenzylated amino acids . such protecting group moieties may be used in the course of synthesis , but they are removed before the peptides are used . additional reactions may be necessary , as described elsewhere , to form intramolecular linkages to restrain conformation . the peptides can be tested following the methods herein to determine whether they bind to rip - 1 and induce gr type ii complex translocation or whether they bind to rip - 1 and inhibit gr type ii complex translocation . those peptides which bind to rip - 1 and induce gr type ii complex translocation are useful as non - steroidal alternatives in the treatment of conditions , diseases and disorders in which steroid administration is typically indicated . those peptides which bind to rip - 1 and induce gr type ii complex translocation are useful in the treatment of conditions , diseases and disorders in which glucocorticoid antagonist administration is typically indicated . inhibitors are particularly useful as anti - hiv compounds if they compete with vpr to bind to rip - 1 but do not induce gr type ii complex translocation . the present invention provides pharmaceutical compositions that comprise the compounds of the invention and pharmaceutically acceptable carriers or diluents . the pharmaceutical composition of the present invention may be formulated by one having ordinary skill in the art with compositions selected depending upon the chosen mode of administration . suitable pharmaceutical carriers are described in remington &# 39 ; s pharmaceutical sciences , a . osol , a standard reference text in this field . in carrying out methods of the present invention , peptides of the present invention can be used alone or in combination with other diagnostic , therapeutic or additional agents . such additional agents include excipients such as flavoring , coloring , stabilizing agents , thickening materials , osmotic agents and antibacterial agents . such agents may enhance the peptide &# 39 ; s use in vitro , the stability of the composition during storage , or other properties important to achieving optimal effectiveness . for parenteral administration , the peptides of the invention can be , for example , formulated as a solution , suspension , emulsion or lyophilized powder in association with a pharmaceutically acceptable parenteral vehicle . examples of such vehicles are water , saline , ringer &# 39 ; s solution , dextrose solution , and 5 % human serum albumin . liposomes and nonaqueous vehicles such as fixed oils may also be used . the vehicle or lyophilized powder may contain additives that maintain isotonicity ( e . g ., sodium chloride , mannitol ) and chemical stability ( e . g ., buffers and preservatives ). the formulation is sterilized by commonly used techniques . for example , a parenteral composition suitable for administration by injection is prepared by dissolving 1 . 5 % by weight of active ingredient in 0 . 9 % sodium chloride solution . the pharmaceutical compositions according to the present invention may be administered as a single dose or in multiple doses . the pharmaceutical compositions of the present invention may be administered either as individual therapeutic agents or in combination with other therapeutic agents . the treatments of the present invention may be combined with conventional therapies , which may be administered sequentially or simultaneously . the pharmaceutical compositions of the present invention may be administered by any means that enables the active agent to reach the targeted cells . because peptides are subject to being digested when administered orally , parenteral administration , i . e ., intravenous , subcutaneous , transdermal , intramuscular , would ordinarily be used to optimize absorption . intravenous administration may be accomplished with the aid of an infusion pump . the pharmaceutical compositions of the present invention may be formulated as an emulsion . alternatively , they may be formulated as aerosol medicaments for intranasal or inhalation administration . in some cases , topical administration may be desirable . the dosage administered varies depending upon factors such as : pharmacodynamic characteristics ; its mode and route of administration ; age , health , and weight of the recipient ; nature and extent of symptoms ; kind of concurrent treatment ; and frequency of treatment . usually , the dosage of peptide can be about 1 to 3000 milligrams per 50 kilograms of body weight ; preferably 10 to 1000 milligrams per 50 kilograms of body weight ; more preferably 25 to 800 milligrams per 50 kilograms of body weight . ordinarily 8 to 800 milligrams are administered to an individual per day in divided doses 1 to 6 times a day or in sustained release form is effective to obtain desired results . depending upon the disease or disorder to be treated , the pharmaceutical compositions of the present invention may be formulated and administered to most effectively . modes of administration will be apparent to one skilled in the art in view of the present disclosure . other fragments of vpr which bind to rip - 1 and are useful as either inducers of gr type ii complex translocation or inhibitors of gr type ii complex translocation can be identified by synthesizing nested peptide fragments of vpr and testing them for transactivating or inhibitory activity . nested peptides fragments of vpr protein may be produced and tested for translocation inducing or inhibitory activity . nested peptides may be 3 - 30 amino acids in length and preferably 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 , 18 , 19 or 20 amino acids in length . peptides may be tested for translocation inducing or inhibitory activity as described above . peptides may be prepared which comprise vpr fragments identified as inducers or inhibits of translocation activity as described above . __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 7 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 6 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( xi ) sequence description : seq id no : 1 : tgttct6 ( 2 ) information for seq id no : 2 :( i ) sequence characteristics :( a ) length : 48 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( xi ) sequence description : seq id no : 2 : gatccggcccaataaaggagagaacaccagcttgttacaccctgtgag48 ( 2 ) information for seq id no : 3 :( i ) sequence characteristics :( a ) length : 47 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( xi ) sequence description : seq id no : 3 : gatcctcacagggtgtaacaagctggtgttctgtcctttattggccg47 ( 2 ) information for seq id no : 4 :( i ) sequence characteristics :( a ) length : 36 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( xi ) sequence description : seq id no : 4 : gatccgtttatggttacaaactgttcttaaaacaag36 ( 2 ) information for seq id no : 5 :( i ) sequence characteristics :( a ) length : 36 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( xi ) sequence description : seq id no : 5 : gatccttgttttaagaacagtttgtaaccataaacg36 ( 2 ) information for seq id no : 6 :( i ) sequence characteristics :( a ) length : 27 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( xi ) sequence description : seq id no : 6 : gatccattagttgctaggcaactggcg27 ( 2 ) information for seq id no : 7 :( i ) sequence characteristics :( a ) length : 27 base pairs ( b ) type : nucleic acid ( c ) strandedness : single ( d ) topology : linear ( ii ) molecule type : cdna ( xi ) sequence description : seq id no : 7 : gatccgccagttgcctagcaactaatg27__________________________________________________________________________ | 2 |
the present invention will now be described in more detail in the following embodiments , but the present invention is not limited to these embodiments . in a 300 - ml medium bottle were placed an enzyme lipase pl ( 1 g ), 400 ml of water , 95 ml of hexane , and 58 g each of butter oil , coconut oil or corn oil or 69 g of sardine oil , followed by addition of active linol ( product name ; manufactured by rinoru oil mills , co ., ltd . ; containing conjugated linoleic acid at 73 . 6 %), and then , nitrogen was filled in the bottle for sealing . the resulting mixture reacted together under agitation with a reciprocal agitator at 37 ° c . for 91 hours . at a predetermined interval , a sample of 10 ml was collected and diluted , for thin layer chromatography analysis . the results are shown in fig1 . because the fatty acid in the fats and oils and the conjugated linoleic acid were set at equivalent moles for the reaction , the value of the conjugated linoleic acid in the glyceride when the reaction reached equilibrium was calculated as 1 . 5 . it is indicated that the content of conjugated linoleic acid incorporated in the glyceride exceeded 20 % ( corresponding to 0 . 6 value of conjugated linoleic acid in the glyceride ) in two hours after the start of the reaction in case of butter oil and sardine oil . 100 g of cla 80 ( product name ; manufactured by rinoru oil mills , co ., ltd . ), 11 g of glycerol ( for food additives ) and 11 . 3 g of lipozyme im ( product name ; manufactured by novo nordisk , co ., ltd .) are weighed in a round bottom flask . while the mixture was dried and solidified under reduced pressure in a rotary evaporator , the mixture was agitated at about 70 ° c ., for ester synthesis reaction for 12 hours . lipozyme im was filtered and recovered from the reaction product , to recover conjugated linoleic acid glyceride . the resulting reaction product was determined by thin layer chromatography and iodine color reaction ; consequently , triglyceride was at 85 . 5 %; diglyceride , at 13 . 5 %; monoglyceride , at 1 % or less ; unreactive fatty acid , at 4 %; and unreactive glycerol , at 2 % or less . bacteria with a potency reacting with fats and oils containing linoleic acid to directly generate conjugated linoleic acid were screened . first , various lactic acid bacteria shown in tables 1 and 2 , bacteria of the genus bifidobacterium and bacteria of the genus propionibacterium were cultured in 0 . 035 % linoleic acid - containing mrs culture medium ; the bacterial cells were harvested by centrifugation and rinsed in physiological saline to prepare rinsed bacterial cell . further , the bacteria of the genus eurobacterium were treated in the same manner as described above , except for cultivation under anaerobic conditions using a bcm culture medium as the culture medium therefor . these rinsed fresh bacterial cells of 100 ml were mixed in 1 ml of 50 mm phosphate buffer , ph 7 . 1 containing 5 mg of linoleic acid , for shaking at 37 ° c . for 2 days , for reaction . after subsequent centrifugation and extraction of the supernatant in the 2 - fold volume of chloroform : methanol ( 1 : 2 ), lipid was extracted in the chloroform layer . the extracted lipid was appropriately diluted with hexane , for ultraviolet absorptiometry , to assay the generated conjugated linoleic acid . still further , bacterial strains which were verified of their conjugated linoleic acid generation were treated by the same method , using an emulsion containing 5 mg of corn oil instead of linoleic acid , for ultraviolet absorptiometry . herein , the linoleic acid content in corn oil is about 50 %. consequently , it was shown that the bacteria marked with circle in tables 1 and 2 have a potency to convert the linoleic acid glyceride - containing fats and oils into conjugated linoleic acid glyceride . additionally , the presence or absence of free fatty acid in the extracted lipid was assayed by thin layer chromatography . almost no band of free fatty acid was detected . hence , it was shown that the generated conjugated fatty acid was of glyceride type . because it is demonstrated that some bacteria have a poor potency to isomerize glyceride - type linoleic acid although the bacteria can strongly isomerize linoleic acid ( bacteria marked with “×” in the column corn oil in each table ), it is indicated that bacteria isomerizing linoleic acid cannot essentially isomerize glyceride - type linoleic acid . the reaction product of 9 g ( the quantity of residual fatty acid was 3 . 6 g ; the quantity of glyceride was 5 . 4 g ; the conjugated linoleic acid content in glyceride was at 35 %) as recovered in example 1 with corn oil was preliminarily equilibrated with a buffer , ph 7 , and was then absorbed onto a deae cellulose column ( dry resin quantity of 60 g ; column with a diameter of 3 . 5 cm and 30 cm in length ) substituted with ethanol and then with hexane , followed by elution with hexane . then , the non - adsorbed fraction was recovered , from which the solvent was removed with a rotary evaporator , to recover a dry solid product of 5 g . the lipid composition of the product was assayed by thin layer chromatography . consequently , the product was at a composition of 96 % of glyceride derivative , with 4 % of contaminated fatty acid , so conjugated linoleic acid occupied 29 % of the dry solid product . the dry solid product was administered through a stomach probe to male icr mice of age 19 weeks after overnight fasting ( 5 ml / kg ; n = 5 ). as a control , a mixture of 3 parts by weight of active linol ( manufactured by rinoru oil mills , co ., ltd . ; containing 70 % of conjugated linoleic acid ) and 4 parts of linoleic acid was similarly administered . as an additional control , a group with no administration was prepared . over time , blood was taken from orbit in the 3 groups , to assay blood triglyceride . consequently , it was shown that the glycerol derivative of the invention had greater digestion and absorption properties than those of the control free fatty acid type ( fig2 ). blood samples taken from two animals in each of the groups were assayed for fatty acid analysis by gas chromatography . the presence of conjugated linoleic acid was confirmed in any of the blood samples . conjugated linoleic acid glyceride production 3 ; preparation of milk - based drink containing conjugated linoleic acid glyceride three bacterial strains from the lactic acid bacteria in table 1 , namely bifidobacterium infantis strain yit4018 , lactobacillus delbrueckii ss . bulgaricus strain yit0181 and lactobacillus helveticus strain yit0085 , were tested about conjugated linoleic acid glyceride generation . while drop - wise adding safflower oil ( containing linoleic acid at 73 %) to an equal volume of an aqueous solution containing polyglycerin fatty acid ester ( msw750 , trade name ; sakamoto yakuhin kogyo , co ., ltd .) at 0 . 5 % to the weight of the fats and oils , the safflower oil was emulsified with an emulsifier physcotron to prepare an emulsion of fats and oils at 50 %. the bacterial cells of the individual bacterial strains cultured in 0 . 035 % linoleic acid - containing mrs culture medium were rinsed . to the emulsion were added the resulting fresh rinsed bacterial cells of a weight in part by weight of about 1 / 20 - fold the total weight of the fats and oils on a wet weight basis , for reaction at 37 ° c . for 2 days . from the reaction solution was extracted fat , which was appropriately diluted with hexane for ultraviolet absorptiometry , to examine the generation of conjugated linoleic acid glyceride . as in example 3 , the quantity of free fatty acid was assayed by thin layer chromatography . consequently , it was shown that conjugated linoleic acid glyceride was generated in all of the bifidobacterium infantis strain yit4018 , lactobacillus delbrueckii ss . bulgaricus strain yit0181 , and lactobacillus helveticus strain yit0085 . additionally , fats and oils containing conjugated linoleic acid as prepared in the lactobacillus helveticus strain yit0085 were added to and mixed with milk products , to produce a milk - based drink containing conjugated linoleic acid glyceride . specifically , 0 . 4 part by weight of the fats and oils was emulsified in and mixed with 99 . 6 parts by weight of low - fat milk adjusted to a 1 . 1 % milk fat content by partially removing cream with a centrifuge , to produce a milk - based drink containing conjugated linoleic acid glyceride . this milk - based drink was highly tasty and had stable physico - chemical properties . conjugated linoleic acid glyceride production 4 ; preparation of soybean milk drink containing the same among the lactic acid bacteria shown in tables 1 and 2 , three bacterial strains , namely bifidobacterium bididum strain yit4007 , lactobacillus helveticus strain yit0085 and lactobacillus reuteri strain yit0313 , were tested about their generation of conjugated linoleic acid glyceride during the production of fermented soybean milk . soybean milk ( at no - fat solid content of 8 . 3 %) containing soybean oil at 5 % ( containing linoleic acid at 52 % and linolenic acid at 8 %) was sterilized under heating at 100 ° c . for 60 minutes , to which were inoculated the individual bacterial strains , for cultivation at 37 ° c . for 2 days , to produce fermented soybean milks . fat was extracted from the individual fermented soybean milks , to assay the absorbance at 235 nm and examine the generation of conjugated linoleic acid . consequently , it was shown that all the bacterial strains converted linoleic acid to conjugated linoleic acid . although a possibility remained that a part of the conjugated double bonds might be derived from linolenic acid , the possibility could not be verified . additionally because free fatty acid was not increased in the fermented soybean milks , it was shown that the generated conjugated linoleic acid was derived from the conversion of the linoleic acid per se in the glyceride derivative into conjugated linoleic acid . the 10 - ml culture of the lactobacillus helveticus strain yit0085 among the lactic acid bacteria from dairy origin as shown in table 1 was rinsed to recover fresh bacterial cells , which were then suspended in 2 ml of a 10 % lysophosphatidyl glycerol solution , for treatment under heating at 50 ° c . for 30 minutes , to prepare the bacterial enzyme . according to the method in example 5 , the enzyme was added in place of the fresh bacterial cells , for reaction . it was confirmed by ultraviolet absorptiometry and thin layer chromatography that conjugated fatty acid glycerides were generated . the conjugated linoleic acid - containing glyceride ( tg - cla ) recovered in example 2 was given at 0 . 5 % to mice from which the ovaries were preliminarily resected , to examine the influence thereof on organ fat deposition . specifically , thirty six ( 36 ) c57bl / 6j mice ( female ) of age 6 weeks were purchased from nippon slc , co ., ltd . after preliminary feeding the mice with mf diet for one week , left and right ovaries were resected from the mice according to general procedures . after 1 - week recovery , the mice were divided in 4 groups , each group consisting of 9 mice . the experimental feeds a to d shown in table 3 were individually fed ad libitum for 7 weeks . after overnight fasting , the mice were subjected to laparotomy under anesthesia with ether . immediately after blood collection , fat tissue around kidney , uterus and mesentrium was resected and weighed , which was designated organ fat weight . throughout the experimental duration , the feeding conditions were at constant temperature ( 24 ± 1 ° c .) and constant humidity ( 60 ± 5 %), while the bright and dark cycle was set to 12 hours . the feeds and water were fed ad libitum . the body weight and the feed intake were measured every week . concerning the feed intake , herein , feed intake of 3 mice per one week was measured , because mice were actually fed at a unit of 3 animals per one cage . data were all expressed in “ mean value ± standard deviation ”. the difference in mean value between the individual groups was tested by the tukey &# 39 ; s multiple comparison . consequently , no difference in feed intake was observed . additionally , the body increment (%) during the experimental term was 35 . 8 ± 5 . 4 % in the inventive group a , 38 . 3 ± 8 . 8 % in the corn oil group b , 47 . 5 ± 11 . 3 % in the linseed oil group c or 40 . 2 ± 5 . 9 % in the fish oil group d . compared with the other groups , the linseed oil group c was at a larger body weight increment , and on weeks 6 and 7 , the body weight increment in the inventive group a was at a significantly smaller value compared with that in the linseed oil group c ( p & lt ; 0 . 05 ). table 4 shows the body weight and organ fat weight during autopsy . the organ fat weight in the inventive group a was at a value smaller by 30 % and 38 % than those in the corn oil group b and the linseed oil group c , respectively , which was significantly different ( p & lt ; 0 . 01 , p & lt ; 0 . 001 ). although no significant difference was detected , additionally , the ratio of the organ fat weight to the body weight in the inventive group a was likely to be small ( p = 0 . 13 ) compared with the fish oil group d which is said to reduce body fat thus , excellent effects of the inventive product could be confirmed . from c57bl / 6j mice of age 7 weeks were resected left and right ovaries . the resulting mice were divided in 3 groups , which were individually fed ad libitum with mf feed supplemented with 1 . 2 % safflower oil ( control group ), mf feed containing 0 . 67 % safflower oil and the conjugated linoleic acid glyceride prepared by the same method as in example 2 ( tg - cla ) at 0 . 53 % ( 0 . 53 % tg - cla group ), and mf feed supplemented with 1 . 2 % tg - cla ( 1 . 2 % tg - cla group ). as shown in table 5 , the fatty acid composition of the tg - cla used was mainly occupied with cis - 9 , trans - 11 / trans - 9 , cis - 11 , 18 : 2 and trans - 10 , cis - 12 , 18 : 2 , and was at a triglyceride content of 80 % or more . after 8 - week feeding and 4 - hour fasting , blood was taken from the hearts of the 8 mice of each group under ether anesthesia , to assay blood triglyceride , by using a commercially available kit ( triglyceride test wako ). the results are shown in table 6 . herein , blood neutral fat was at a significantly small value in the 1 . 2 % tg - cla group . as shown in table 6 , it was indicated that the substitution of a part of lipid in diets with conjugated linoleic acid glyceride could allow the effect of reducing blood neutral fat to be exerted sufficiently . this indicates that hyperlipidemia caused by menopausal metabolic abnormalities can effectively be reduced by using conjugated linoleic acid glyceride . after preliminary one - week feeding of male c57bl / ksj , db / db mice of age 7 weeks , the mice were divided in 3 groups , for feeding of the same feeds as in example 9 ad libitum . blood was drawn out from orbit , prior to the dosing and on weeks 2 , 4 , 6 after the dosing , to assay blood neutral fat the results are shown in table 7 . compared with the control group , further , blood triglyceride was at significantly small values in the test groups . as shown in table 7 , it was indicated like example 9 that the substitution of a part of lipid in diets with conjugated linoleic acid glyceride could allow the effect of reducing blood neutral fat to be exerted sufficiently . this indicates that hyperlipidemia caused by type ii diabetes mellitus can be reduced effectively by using conjugated linoleic acid glyceride . using the conjugated linoleic acid - containing glycerides of examples 2 and 4 and a commercially available conjugated linoleic acid ( active linol ; manufactured by rinoru oil mills , co ., ltd . ), 10 panelists tested the taste at sensory test . consequently , it was found that the glyceride derivatives of the invention had no bad taste derived from fatty acid and that the glyceride derivatives were products with almost no taste and no odor ( table 8 ). additionally , the sensory test was performed by 10 persons , and the mean score is shown . the scoring standards are as follows : no taste with 0 ; slight bitterness with 1 ; some bitterness with 2 ; fair bitterness with 3 ; and extreme bitterness with 4 . according to the following prescription , a capsule base was prepared from gelatin , glycerol and water ; then , an oil to be contained was encapsulated and molded with the capsule base , to prepare a soft capsule type dietary or nutritional supplement . prescription : gelatin : 0 . 4275 g glycerol : 0 . 0225 g water 0 . 05 g conjugated linoleic acid glyceride of example 2 : 2 . 0 g according to the following prescription , various ingredients were mixed together for tableting , to prepare a tablet type dietary or nutritional supplement . prescription : lactose : 10 g conjugated fatty acid glyceride - containing oil 250 mg of example 2 : calcium pantothenate : 10 mg vitamin b2 : 4 mg dk ester f - 20 w ( manufactured by dai - ichi kogyo 400 mg seiyaku , co ., ltd . ): finely prepared cellulose : 6 g dextrin : 8 g according to the following prescription , various ingredients were mixed together for tableting , to prepare a tablet type dietary or nutritional supplement . consequently , the resulting tablet type supplement had great flavor . prescription : lactose : 10 g conjugated fatty acid glyceride - containing oil 250 mg of example 7 : calcium pantothenate : 10 mg vitamin b2 : 4 mg dk ester f - 20 w ( manufactured by dai - ichi kogyo 400 mg seiyaku , co ., ltd . ): finely prepared cellulose : 6 g dextrin : 8 g | 0 |
in one embodiment , the present invention is a digitally controlled threshold adjustment circuit which does not impose any significant bandwidth reduction due to loading of the signal path . since the circuit is digitally controlled , it can easily be incorporated into an adaptive algorithm that can automatically find the optimal point for sampling , without user intervention . fig4 is an exemplary circuit diagram of a threshold adjuster , according to one embodiment of the present invention . as depicted in fig4 , a threshold adjustment circuit 42 is connected to current summing nodes 43 and 44 , which generate outp and outn , respectively . as an example , threshold adjustment circuit 42 can be connected to outp and outn at the output of a gain stage which includes a trans - conductance ( gm ) 41 sinking current from load impedances ( r load ) 47 a and 47 b . threshold adjustment circuit 42 includes a current dac 45 , which generates a threshold current 46 ( i threshold ). in one embodiment , a thermometer coded current steering dac is utilized to implement the dac 45 , as depicted in fig5 . fig5 is an exemplary circuit diagram of a current steering dac , according to one embodiment of the present invention . as shown , transistor m b , which is biased by a current i unit , supplies a bias voltage v bias . each of the transistors m 0 to m k is turned on by respective switches s 0 to s k that are driven by cont & lt ; 0 & gt ; to cont & lt ; k & gt ;, respectively . depending on the digital code cont & lt ; k : 0 & gt ;, current i out ( i threshold ) varies from 0 to its maximum required value in linear and monotonic steps . the maximum i threshold value can be calculated as ( k + 1 ) i unit . in addition , the linear step size is i unit . the dac is called a thermometer dac in this case , because the current sources only switch one - at - a - time . referring back to fig4 , nmos transistors mp and mn are used in their saturation regions to sink all of i threshold to either outp or outn . in other words , nmos transistors mp and mn are used for polarity selection of threshold adjustment . if mp is turned on ( saturation region ), then mn is turned off sending i threshold to outn . likewise , if mn is turned on ( saturation region ), then mp is turned off sending i threshold to outp . if i threshold is sunk into outn , the dc voltage component of outn decreases by the amount that corresponds to the voltage drop generated by i threshold on r load 47 a . that is , the selected current from the dac induces a voltage drop across the loads , which in turn reduces the dc voltage component of outn . in the above embodiment , nmos transistors mp and mn , as well as transistors in the dac , are all low voltage transistors . furthermore , the power supply vdd is used above the reliability voltage limit of the low voltage transistors . using low voltage transistors is preferred to obtain the maximum trans - conductance with minimum area and loading . using a vdd above the reliability voltage limit is also preferred to achieve higher speed for circuit components such as drivers , flip - flops , etc . if the low voltage transistors are used with a vdd above their reliability voltage limit , careful biasing and proper operation of the low voltage transistors should be taken into account in the design of the circuit . in other words , the design should ensure that the voltage drops across the terminals of every low voltage transistor are within their reliability voltage limit . in operation , when mp is turned on , input voltage vbp ( on ) is pulled to a predetermined voltage level above the threshold voltage v th of mp , but lower than power supply vdd , to keep mp in saturation , even if i threshold goes to its maximum level . a saturation region of a nmos transition occurs when vd & gt ; vg - v th of the transistor . when operating in the saturation region , a transistor has a high impedance between its source and drain . this high impedance decouples the output capacitance of the dac from the r load . if vbp ( on ) was selected as high as vdd , then mp would go into triode region where not only its drain capacitance increases , but also , the dac output capacitance would be added to the outn node . increased drain capacitance due to mp entering into triode region would decrease the bandwidth at node outn . in one embodiment , the input voltages vbp and vbn are digitally controlled . likewise , when mn is turned on , input voltage vbn ( on ) is pulled to a predetermined voltage level , lower than power supply vdd to keep mn in saturation , even if i threshold goes to its maximum level . similar to vbp ( on ), if vbn ( on ) was selected as high as vdd , then mn would go into triode region where its drain capacitance increases significantly . again , increased drain capacitance due to mn entering into triode region would decrease the bandwidth at node outp . in one embodiment , the predetermined voltage level of the input voltage vbp ( on )/ vbn ( on ) is generated using a resistor voltage divider ( not shown ) to limit the vbp ( on )/ vbn ( on ) voltage to a voltage lower than vdd , so that mp / mn operate in their saturation regions and stay within their reliability limits . similarly , the predetermined voltage level of the input voltages vbp ( off )/ vbn ( off ) is generated using a resistor divider ( not shown ) to limit the vbp ( off )/ vbn ( off ) to a voltage higher than gnd , so that mp / mn operate in their off regions and stay within their reliability limits . further , bulk nodes of mp and mn are tied to a common source node v source to prevent drain - to - bulk voltage ( vdb ) from going above the reliability voltage limit . likewise , when the bulk node is tied to the source node the bulk - to - source voltage ( vbs ) becomes zero . thus , the body effect on threshold voltage v th of the transistor , which is a function of vbs , is also eliminated . this decreases the gate - to - source voltage ( vgs ) of the respective transistor for a given current density . since vgs is reduced , this results in relaxing the headroom requirement of dac transistors . when mp is turned off , vbp ( off ) is pulled to a predetermined voltage level below the threshold voltage v th of mp , but higher than ground voltage ( gnd ) to keep drain - to - gate voltage ( vdg ) of mp below the reliability voltage limit . similarly , when mn is turned off , vbn ( off ) is pulled to a predetermined voltage level below the threshold voltage v th of mn , but higher than gnd to keep vdg voltage of mn below the reliability voltage limit . however , if vbn ( off ) is selected too low , such as gnd , vdg of mp and mn would increase above its limit , which could cause reliability issues for mp and mn . when the threshold adjustment circuit is disabled , the dc component voltage levels of outp and outn do not need to be adjusted . in one embodiment , both mp and mn are turned on resulting in sinking a small amount of current such as , but not limited to , i unit into mp and mn . however , keeping mp and mn both on will have some disadvantages . due to mismatch between mp and mn , i threshold will not be evenly sunk into outp and outn , which can cause a leaky and undesired threshold adjustment . depending on the amount of current left sinking , dc component voltage levels of both outp and outn will go down and thus decrease the headroom for gm ( dac ) stage . moreover , if both mp and mn are left on ( in their saturation regions ), then rds ( mp )+ rds ( mn ) decrease the output impedance r load resulting in a decrease in the gain . in one embodiment , when the threshold adjustment circuit is disabled , both mp and mn are turned off and another current passage path is created by switching on the transistor m shut . the reason for creating another current passage path is to keep the common source node voltage v source of mp and mn above a certain level so that the drain - to - source voltage ( vds ) of mp and mn can be kept within the reliability voltage limit . thus , a small amount of current such as , i unit is left sinking into m shut to keep v source above a certain level . since m shut is not in the critical signal path , a high voltage transistor is used for m shut such that it does not require any special biasing for m shut , since vdd is within the reliability voltage limit of the high voltage transistor m shut . if high voltage transistors are not available in the process and / or m shut should also be protected against over the limit terminal voltages , an alternative implementation of a disabling scheme is illustrated in fig6 . resistor r is used to limit the vds voltage of m shut . in addition , the gate voltages of m shut , disable and enable voltages , have predetermined values to avoid any over the limit terminal voltages for m shut and m ena whether they are turned on or off . one or more nmos or pmos transistors can be utilized to implement resistor r . transistor mi , which is biased by v bias , operates as a current source . although the threshold adjustment circuit is described using nmos transistors only , those skilled in the art understand that the threshold adjustment circuit can be implemented using only pmos transistors or using both nmos and pmos transistors . the threshold adjustment circuit of fig4 is utilized to decrease the dc voltage components of outn or outp . fig7 is an exemplary circuit diagram of a threshold adjustment circuit that decreases the dc voltage components of outn and outp and increases the dc voltage components of outn and outp , resulting in a more uniform signal , as shown in fig1 b . as illustrated in fig7 , a first threshold adjustment circuit 73 operates similar to the threshold adjustment circuit described in fig4 to decrease and / or increase the dc voltage components of gm 72 outputs , outn and outp . a second threshold adjustment circuit 74 operates in a complementary way to the threshold adjustment circuit 73 to increase and / or decrease the dc voltage components of outn and outp also . a signal nv shut , which may be the inverted signal v shut , is used to shut the second threshold adjustment circuit 74 . each of the threshold adjustment circuits 73 and 74 include a dac that is controlled by control signals cont & lt ; k : 0 & gt ;. the control signals cont & lt ; k : 0 & gt ; provided to each of the threshold adjustment circuits 73 and 74 may be the same or different , depending on the amount of current requirements to reduce the asymmetric eye opening , shown in fig1 a . in one embodiment there is only one dac that is supplying / sinking current to each of the threshold adjustment circuits 73 and 74 . load resistors 75 a and 75 b are similar to the load resistors of fig4 . an exemplary embodiment of the threshold adjustment circuit 74 is shown in fig8 . fig8 is an exemplary circuit diagram of a threshold adjustment circuit for increasing dc voltage components , according to one embodiment of the present invention . the circuit is similar to the threshold adjustment circuit of fig4 in operation , however , it uses pmos transistors , instead of nmos transistors and supplies a current i threshold , rather than sinking the current , to the loads . the threshold adjustment circuit is coupled to outp and outn at the output of a gm 82 sourcing current from load impedances ( r load ) 85 a and 85 b . dac 84 generates a threshold current 86 ( i threshold ). again , depending on the digital code cont & lt ; k : 0 & gt ;, current i threshold varies from 0 to its maximum required value in linear and monotonic steps . pmos transistors mpp and mpn , driven by inputs vbn and vbp , are used in their saturation regions to send all of i threshold to either outp or outn . if mpp is turned on ( saturation region ), then mpn is turned off sending i threshold to outp . likewise , if mpn is turned on ( saturation region ), then mpn is turned off sending i threshold to outn . if i threshold is supplied into outn , dc voltage components of outs increases by the amount that corresponds to the voltage drop generated by i threshold on r load 85 b . in the above embodiment , pmos transistors mpp and mpn , as well as transistors in the dac are all low voltage transistors . however , the m pshut transistor may be a thick oxide transistor . if high voltage transistors are not available in the process and / or m pshut should also be protected against over voltages . for instance , the alternative implementation of the disabling scheme of fig6 , that is , using a resistor r to limit the vds voltage of m pshut may be used . control signal nv shut is used to disable the threshold adjustment circuit by turning the pmos transistor m pshut on while both mpn and mpp are off . also , the bulks of mpp and mpn are connected to the common source node v psource and vbp and vbn voltages are set properly for turning mpp and mpn on / off to avoid any voltage drop across the terminals of mpp and mpn rising above the reliability limit . it will be recognized by those skilled in the art that various modifications may be made to the illustrated and other embodiments of the invention described above , without departing from the broad inventive scope thereof . it will be understood therefore that the invention is not limited to the particular embodiments or arrangements disclosed . | 7 |
fig1 is a schematic illustration of a rotary wing aircraft 10 having a main rotor assembly 12 . the aircraft 10 includes an airframe 14 having an extending tail 16 at which is mounted a tail rotor 18 . the main rotor assembly 12 is driven by two or more fluid cooled engines 20 connected to the main rotor assembly via a gearbox 22 . referring now to fig2 , in some embodiments the aircraft 10 has two engines 20 , identified as 20 a and 20 b in the fig . and is cooled via a cooling system 24 . it is to be appreciated that while the system 24 described herein is for cooling two engines 20 a and 20 b , the system 24 may be arranged to cool any number of engines 20 . further , while the system 24 is described herein as applied to a rotary wing aircraft 10 , it may be applied to any use of a fluid cooled engine arrangement 20 . also , while the system 24 described herein is utilized to cool engines , it is to be appreciated that the system 24 may be utilized to cool other heat generating components or machines . a first engine 20 a is operably connected to a first fan 26 a which urges a flow of inlet air 28 into a first duct 30 a . a first coolant heat exchanger 32 a and first engine oil heat exchanger 34 a are arranged at the first duct 30 a upstream of a first duct outlet 36 a . further , first engine 20 a is operably connected to a first coolant pump 38 a and a first oil pump 40 a . similarly , a second engine 20 b is operably connected to a second fan 26 b which urges a flow of inlet air 28 into a second duct 30 b . a second coolant heat exchanger 32 b and second engine oil heat exchanger 34 b are arranged at the second duct 30 b upstream of a second duct outlet 36 b . further , second engine 20 b is operably connected to a second coolant pump 38 b and a second oil pump 40 b . flow of coolant and engine oil for engines 20 a and 20 b during normal operation of engines 20 a and 20 b and cooling system 24 is illustrated in fig3 - 6 . referring to fig3 , when the first engine 20 a is operating , the first fan 26 a , the first coolant pump 38 a and the first oil pump 40 a , driven by the first engine 20 a are also operating . the first fan 26 a urges inlet air 28 through the first duct 30 a and across the first coolant heat exchanger 32 a and the first engine oil heat exchanger 34 a . the first coolant pump 38 a pumps a first engine coolant flow 42 a from the first engine 20 a . the first coolant pump 38 a urges this first engine coolant flow 42 a through the first coolant heat exchanger 32 a , where thermal energy is transferred from the first engine coolant flow 42 a to the inlet air 28 flowing through the first duct 30 a . the first engine coolant flow 42 a is then urged to the second coolant heat exchanger 32 b and flowed therethrough to transfer thermal energy from the first engine coolant flow 42 a to inlet air 28 flowing through the second duct 30 b . after flowing through the second coolant heat exchanger 32 b , the first engine coolant flow 42 a is flowed into the first engine 20 a where thermal energy is transferred from the first engine 20 a to the first engine coolant flow 42 a to cool the first engine 20 a . directing the first engine coolant flow 42 a through both the first coolant heat exchanger 32 a and the second coolant heat exchanger 32 b allows for effective cooling of the first engine 20 a even with failure of components such as the first coolant heat exchanger 32 a , the first fan 26 a or first duct 30 a . similarly , and referring now to fig4 , a second engine coolant flow 42 b is pumped from the second engine 20 b by the second coolant pump 38 b . the second coolant pump 38 b urges the second engine coolant flow 42 b through the second coolant heat exchanger 32 b , where thermal energy is transferred from the second engine coolant flow 42 b to the inlet air 28 flowing through the second duct 30 b . the second engine coolant flow 42 b is then urged to the first coolant heat exchanger 32 a and flowed therethrough to transfer thermal energy from the second engine coolant flow 42 b to inlet air 28 flowing through the first duct 30 a . after flowing through the first coolant heat exchanger 32 a , the second engine coolant flow 42 b is flowed into the second engine 20 b where thermal energy is transferred from the second engine 20 b to the second engine coolant flow 42 b to cool the second engine 20 b . directing the second engine coolant flow 42 b through both the second coolant heat exchanger 32 b and the first engine coolant heat exchanger 32 a allows for effective cooling of the second engine 20 b even with failure of components such as the second coolant heat exchanger 32 b , the second fan 26 b or second duct 30 b . referring to fig5 , the first oil pump 40 a pumps a first engine oil flow 44 a from the first engine 20 a and through the first engine oil heat exchanger 34 a , where thermal energy is transferred between the first engine oil flow 44 a and the inlet flow 28 through the first duct 30 a . the first engine oil flow 44 a then proceeds through the second engine oil heat exchanger 34 b and thermal energy is transferred between the first engine oil flow 44 a and the inlet flow 28 through the second duct 30 b . the first engine oil flow 44 a is then flowed into the first engine 20 a to lubricate and transfer thermal energy from the first engine 20 a to the first engine oil flow 44 a to cool the first engine 20 a . directing the first engine oil flow 44 a through both the first engine oil heat exchanger 34 a and the second engine oil heat exchanger 34 b allows for effective cooling of the first engine oil flow 44 a even with failure of components such as the first engine oil heat exchanger 34 a , the first fan 26 a or the first duct 30 a . referring to fig6 , the second oil pump 40 b pumps a second engine oil flow 44 b from the second engine 20 b and through the second engine oil heat exchanger 34 b , where thermal energy is transferred between the second engine oil flow 44 b and the inlet flow 28 through the second duct 30 b . the second engine oil flow 44 b then proceeds through the first engine oil heat exchanger 34 a and thermal energy is transferred between the second engine oil flow 44 b and the inlet flow 28 through the first duct 30 a . the second engine oil flow 44 b is then flowed into the second engine 20 b to lubricate and transfer thermal energy from the second engine 20 b to the second engine oil flow 44 b to cool the second engine 20 b . directing the second engine oil flow 44 b through both the second engine oil heat exchanger 34 b and the first engine oil heat exchanger 34 a allows for effective cooling of the second engine oil flow 44 b even with failure of components such as the second engine oil heat exchanger 34 b , the second fan 26 b or the second duct 30 b . referring now to fig7 , the system 24 is still operable to serve a remaining engine in the case of failure of one engine . for example , as shown in fig7 , in the case of a failure of the second engine 20 b , the system 24 would still serve the first engine 20 a with sufficient cooling capacity for continued normal operation . in the case of failure of the second engine 20 b , first engine coolant flow 42 a is not routed to second coolant heat exchanger 32 b , but is diverted back through first coolant heat exchanger 32 a for a second pass by operation of first coolant valve 46 a . similarly , the first engine oil flow 44 a is not routed to second oil heat exchanger 34 b , but is diverted for a second pass through first oil heat exchanger 34 a by first oil valve 48 a . second coolant valve 46 b and second oil valve 48 b ( shown in fig2 ) are provided to similarly divert the second engine coolant flow 42 b and the second engine oil flow 44 b in the case of a failure of the first engine 20 a . in some embodiments , sensors such as temperature sensors 50 and / or pressure sensors 52 are provided in the system 24 to assist in determining functionality of the system 24 . in some embodiments , the sensors are connected to a health monitor 54 or other controller that utilizes inputs from the sensors to determine if valves 46 a , 46 b , 48 a or 48 b should be used to divert the flows 42 a , 42 b , 44 a , 44 b from their respective normal paths . while the invention has been described in detail in connection with only a limited number of embodiments , it should be readily understood that the invention is not limited to such disclosed embodiments . rather , the invention can be modified to incorporate any number of variations , alterations , substitutions or equivalent arrangements not heretofore described , but which are commensurate with the spirit and scope of the invention . additionally , while various embodiments of the invention have been described , it is to be understood that aspects of the invention may include only some of the described embodiments . accordingly , the invention is not to be seen as limited by the foregoing description , but is only limited by the scope of the appended claims . | 8 |
the following description of the preferred embodiments is merely exemplary in nature and is in no way intended to limit the invention , its application , or uses . as best seen in fig1 , according to a preferred embodiment of the present invention , a molded foam vehicle energy absorbing system 10 can be applied to various locations including a front bumper 12 and a rear bumper 14 of a vehicle 16 . in alternate embodiments of the present invention , the molded foam vehicle energy absorbing system 10 of the present invention can also be used in a door panel 18 , a body panel 20 , or a hood 22 of vehicle 16 . as seen in fig2 in the preferred embodiment , a foam member 24 is formed and shaped to be inserted and / or received within a bumper fascia 26 . in the embodiment shown , bumper fascia 26 having foam member 24 inserted therein , is supported from a bumper plate 28 of front bumper 12 . foam member 24 is retained within bumper fascia 26 by friction fit in close conformity to the geometry of bumper fascia 26 . attachment members 27 can also be provided as part of foam member 24 for mechanical attachment of foam member 24 , bumper fascia 26 and bumper plate 28 to vehicle 16 ( shown in fig1 ). referring next to fig3 , foam member 24 typically includes a plurality of foam ribs 30 having generally perpendicularly extending foam cross - ribs 32 joined thereto , forming a plurality of partial cavities 34 . the geometry and location of foam ribs 30 and foam cross - ribs 32 along with the fascia wall thickness of foam member 24 , control the stiffness and the energy absorption capability of foam member 24 . employing partial cavities 34 also affects the overall weight as well as the stiffness of foam member 24 . foam member 24 typically includes a part length “ a ”, a part depth “ b ”, and a part height “ c ”. the geometry of foam member 24 can be varied such that the foam member 24 can be slidably fit and received within bumper fascia 26 . other methods for attaching foam member 24 to bumper fascia 26 include fasteners , adhesives , and controlling a surface finish of foam member 24 to promote adherence to bumper fascia 26 . referring now to fig4 , a cross - sectional view through a partial cavity 34 identifies that a fascia wall thickness “ d ” is nominally provided for foam member 24 . wall thickness “ d ” can vary between approximately 4 mm to approximately 50 mm within the scope of the present invention . a wall thickness . “ d ” of 6 mm ( approximately ¼ inch ) is used in a preferred embodiment to optimize the weight and energy absorbing capability of foam member 24 . fig4 also shows that foam member 24 further includes a first or fascia face “ e ” and a second face “ f ”. foam ribs 30 and foam cross - ribs 32 ( shown in fig3 ) are typically formed on second face “ f ” such that partial cavity 34 is formed adjacent to second face “ f ”. first face “ e ” has a “ substantially uniform ” face . the substantially uniform first face “ e ” of foam member 24 is substantially free of partial cavities , and can vary between a planar face , a set of planar faces , a curved face , or a combination of these , depending upon the geometry of receiving bumper fascia 26 . part length “ a ” and part height “ c ” will vary depending on the size of the mating bumper fascia 26 . part depth “ b ” can vary depending upon the overall size and stiffness required for foam member 24 . an approximate part depth “ b ” of 76 mm ( approximately 3 inches ) is used in a preferred embodiment of the present invention . part length “ a ”, part depth “ b ”, and part height “ c ” can vary depending upon the end use of foam member 24 , and are not limited to the dimensions identified herein for the preferred embodiment . referring next to fig5 , an injection device shown herein in an exemplary embodiment comprises an injection molding machine used to form foam members 24 . injection device 36 includes a mixing chamber 38 , a ram / screw section 40 , a mold 42 , and a mold hydraulic section 44 , which acts to retain mold 42 in a closed condition during the injection process . in operation , a resin source 46 provides a resin 48 and a blowing agent source 50 provides a blowing agent 52 . resin 48 and blowing agent 52 are mixed , by predetermined weights and / or volume percentages , within mixing chamber 38 and transferred to ram / screw section 40 . ram / screw section 40 includes a ram 54 which is mounted to translate within ram / screw section 40 on a screw threaded shaft 56 . a mixture 57 of resin 48 and blowing agent 52 is received within ram / screw section 40 and heated by at least one heating element 58 . mixture 57 is heated to its melting point such that in liquid form mixture 57 can be injected through injection nozzle 60 into mold 42 . mold 42 is cooled by directing a coolant 62 from a coolant source 64 via at least one coolant tube 66 to mold 42 . in a preferred embodiment , coolant 62 is chilled water cooled to a temperature of approximately 65 ° f . or cooler . coolant 62 is intended to cool at least the perimeter area of mold 42 to an ambient or lower than ambient temperature . in a preferred embodiment , it is desirable to cool mold 42 to approximately 80 ° f . or cooler . an ambient temperature for mold 42 is the temperature within the manufacturing facility , which normally is at a maximum of approximately 100 ° f . and preferably less . a flow of coolant 62 is maintained both before , during , and after the injection process to maintain the temperature of mold 42 at or below ambient temperature as well as to cool mixture 57 when received by mold 42 . in addition to coolant 62 , and depending upon the geometry of the foam member 24 produced , as well as the geometry of mold 42 , further cooling of mixture 57 can be obtained by injecting an inert gas 68 from an inert gas source 70 via one or more injection pins 72 directly into mold 42 . inert gas 68 flows from inert gas source 70 to the one or more injection pins 72 via a gas supply line 74 ( a single supply line 74 is shown for clarity ). when inert gas 68 reaches mixture 57 , one or more small bubbles of the gas are formed within mixture 57 , which both acts to cool mixture 57 as well as to assist in forcing mixture 57 to completely fill the cavity of mold 42 . inert gas 68 can also be pre - cooled to an ambient or sub - ambient temperature to further enhance the cooling process . using one or more of coolant 62 and inert gas 68 , a cooling time for foam member 24 formed within mold 42 is reducible to below 10 minutes . in a preferred embodiment , a mold cycle time of approximately 1 minute is achievable . mold cycle time is defined herein as the time required between repeating / successive events , which can include the time interval between initiating material input into the mixing chamber for a first and a subsequent second part , or more commonly , the time interval between removing a first cooled part from the mold and removing a subsequent or second cooled part from the mold . foam members 24 are not required to be completely cooled to ambient temperature prior to removal from mold 42 . removal can be timed to correspond with hardening of foam member 24 to a point sufficient to establish rigidity and ability to retain its desired shape . when mixture 57 is heated by heating elements 58 , a temperature for mixture 57 can reach in excess of 400 ° f . the particular temperature for injection of mixture 57 is commonly above 200 ° f ., and can vary depending upon the materials selected , and the various features of mold 42 including its overall size , the desired wall thickness of foam member 24 , and the type and temperature of coolant used in the process . as mixture 57 is heated within ram / screw section 40 , the screw portion of screw threaded shaft 56 and ram 54 apply a pressure in an injection direction “ g ” to maintain mixture 57 at a minimum pressure required to avoid gas produced by heated blowing agent 52 from causing premature expansion of mixture 57 within ram / screw section 40 . in a preferred embodiment , this pressure is approximately 2000 psi , but this pressure can also vary depending upon the above identified variables used in determining the temperature . the process for forming foam member 24 is also controllable by controlling the speed of progression of ram 54 . this is accomplished by controlling the rotation speed of screw threaded shaft 56 . either a steady or a non - steady injection rate forcing mixture 57 into injection nozzle 60 can be used , depending upon the above variables and the geometries of both foam member 24 and mold 42 . ram 54 commonly travels approximately 2 – 3 inches during an injection stroke . in a preferred embodiment , using an exemplary 500 ton molding machine , a non - steady injection rate producing an approximate velocity profile of 3 . 0 in / sec for the first 50 % of ram 54 travel , 2 . 0 in / sec for the next 30 % of the ram 54 travel , and 1 . 8 in / sec for the last 20 % of ram 54 travel is used . for zones 1 – 4 shown in fig5 , temperature is controllable such that the preferred temperature profile of mixture 57 ( using polyethylene resin and hydrocerol ® 1700 as the blowing agent ) across ram / screw section 40 is : in zone 1 , 285 ° f . ; in zone 2 , approximately 420 ° f . is preferred to set off the blowing agent ; in zone 3 , 400 ° f . ; and in zone 4 , the preferred nozzle injection temperature for mixture 57 is approximately 380 ° f . it should be noted that the velocity profile and temperatures given herein are exemplary for the preferred materials , and a variety of velocity profiles and temperatures can be used within the spirit and scope of the present invention for both the preferred materials and the other materials identified herein . in another aspect of the present invention , the fabrication process is performed by extruding the polymeric material resin 48 and blowing agent 52 , as mixture 57 , using a single or a double screw extruder ( not shown ) known in the art . the mixture 57 is extruded into a mold without an “ injection ” step of an injection molding machine , and a final part is completed by coining or compression molding . in a preferred embodiment of the present invention , materials for the foam member 24 include polyethylene as the resin and hydrocerol ® 1700 , which is available from the clariant corporation , used as the blowing agent . a linear low density polyethylene is preferred . alternate materials can also be used for a foam member of the present invention . alternate materials for the resin material include , but are not limited to , at least one of : polyurethane , polyethylene , polypropylene , polyester , polycarbonate / polyester alloys , ethylene vinyl acetate copolymer ( eva ), amide ( nylon ), ionomer , polycarbonate , acrylonitrile butadiene styrene ( abs ), polybutylene therephthalate ( pbt ), thermal plastic olefin ( tpo ), thermoplastic elastomer ( tpe ), polyethylene terephtalate ( pet ), polyethylene terephtalate copolymer with glycol ( petg ), acetyl , and / or polyphenyline oxide including noryl ®. one or more of these materials can be used , depending on factors including : the energy absorption , material shrink , heat stability , processing speed , compatibility with other materials , and / or reprocessing capability of the material or material combination for suitability as an energy absorbing material . additional types of blowing agents can also be used including polybatch ® xu - 1515 , available from a . schulman inc ., azodicarbonamides , phenyltetrazoles or bicarbonates / acids known in the art . in addition to the preferable use of an injection molding machine to provide parts of the present invention , additional methods including extrusion , blow - molding , and compression molding processes can also be used . foam prepared by the process of the present invention is intended to meet federal regulations for motor vehicle safety . any material or material combinations that sufficiently meet the energy absorption requirements to pass the test requirements of the federal regulations can be used for the foam element or processes of the present invention . there are several advantages of the foam and processes for preparing the foam of the present invention . by controlling the pressure and temperature of the mixture of resin and foaming agent , as well as limiting the wall thickness to approximately 6 mm ( approximately one quarter inch ), foam parts of the present invention meet necessary energy absorption requirements , while improving the overall cycle time to produce the parts . by controlling the type of coolant and the temperature of the coolant used to cool the foam part of the present invention , mold cycle times as low as about one minute are attainable . through use of injection molding or extrusion processes , less expensive resin material can be used which reduces the overall cost of the part , compared to resin bead material normally used for steam chest molding . by varying the wall thickness of foam parts of the present invention , from about 4 mm to approximately 50 mm , and preferably establishing a rib wall thickness of about 6 mm , foam parts of the present invention absorb impact load without initiating vehicle safety systems . foam parts of the present invention are herein identified for use as inserts in vehicle bumpers , however , foam parts of the present invention can also be used as reinforcement members for vehicle door panels , body panels , and hood panels , where impact loads are also absorbed . the description of the invention is merely exemplary in nature and , thus , variations that do not depart from the gist of the invention are intended to be within the scope of the invention . such variations are not to be regarded as a departure from the spirit and scope of the invention . | 1 |
fig1 shows a schematic diagram of an inventive circuit . a buffer amplifier 2 is arranged at the signal input 1 , which amplifier is connected directly to the positive input of a comparator 3 . behind the buffer amplifier 2 , a parallel electrical connection branches to the negative input of the comparator 3 . the signal processing means is arranged in this connection , which means comprises a low - pass filter 4 and a track and hold circuit 6 that are connected in series . the track and hold circuit 6 has a switching element 7 , a resistance 8 connected in series thereto , and an amplifier 10 . a capacitor 9 , connected against ground , is located between the resistance 8 and the amplifier 10 . a time constant control means has the resistance 8 integrated into the track and hold circuit 6 , which resistance is variable for the perception of its function in the time constant control means . the controllable resistance 8 is controlled by a control unit 5 that is likewise a component of the time constant control means . the control unit 5 measures a voltage difference over the track and hold circuit 6 , and is connected behind the low - pass filter 4 for this purpose , so that the filter output voltage u f is applied here , and is connected on the other hand with the output voltage u a , behind the track and hold circuit . fig2 graphically shows a jump response of an inventive circuit in comparison with other voltage curves . the time is thereby plotted on the x axis and the voltage is thereby plotted on the y axis . the curve 11 reproduces the characteristic of the input voltage u in , which is measured behind the buffer amplifier 2 . the curve 12 reproduces the voltage u f measured behind the low - pass filter . the curve 14 shows the voltage curve of a conventional circuit with a linear filter , without a time constant control means u a in the region behind the track and hold circuit . as stated above , the switching over and storage ensues in the track and hold circuit 6 only after a certain time delay . this can ensue for example at a time marked 16 in the drawing . the advantage of the circuit of curve 14 with a linear filter shows itself clearly here , in relation to the voltage curve directly behind the low - pass filter 4 . the greater the circuit - conditioned deviation is from a voltage value zero to the switchover time , the larger the error . the disadvantage of the conventional circuit reproduced by the characteristic of the curve 14 then becomes apparent in the further characteristic , in which the voltage only slowly reaches the final value . in contrast to this , the inventive circuit leads to a voltage curve designated 13 . by means of the inventive non - linear filtering , the best possible voltage response is obtained in each time region . the arrow 15 indicates that an almost constant distance prevails between the curves 12 and 13 , since the time constant is small in this region . the invention is not limited to the particular details of the method depicted and other modifications and applications are contemplated . certain other changes may be made in the above described method without departing from the true spirit and scope of the invention herein involved . it is intended , therefore , that the subject matter in the above depiction shall be interpreted as illustrative and not in a limiting sense . | 7 |
the interaction means includes at least one reaction surface which is or is fixed or otherwise supported by or to a fixed structure of a building . with the use of gloves and / or booties worn by a user to apply action forces by his or her body to the surface they will be subjected to a reaction from the surfaces . in the most preferred form the reaction surfaces include both a wall surface 2 and a floor surface 3 positioned adjacent each other so that both can be engaged by a user simultaneously . the reaction surfaces are covered at least in part and preferably entirely by one component of a hook and loop fastening system . the other component of the hook and loop fastening system is carried by the gloves and booties to which reference will be made hereinafter . the floor surface is planar and preferably also the wall surface is planar , but may be of other shapes . in the most preferred form the reaction surfaces are covered by the loop form of the hook and loop fastening system . the loop form is softer to the touch so that any contact of the skin of a person with the surfaces will not subject the person to any significant abrasion . it is well known that the loop component of a hook and loop fastening system is not as soft to the touch . in the most preferred form the reaction surfaces are covered entirely by a component of the hook and loop fastening means and the area of coverage is sufficient so that a person can assume many different positions adjacent the surfaces would still remain in contact with the component on the surface . for example the wall surface may be of a height of approximately 2 . 4 m above surrounding ground . this is of a sufficient height to allow the average person to stand adjacent the wall surface 2 and stretch upwardly without stretching beyond the upper boundary 11 of the wall surface 2 . most preferably the height is at least 1 . 5 m but being higher allows for more positions to be assumed . the width ( in direction b ) ( with reference to fig2 ) of the wall section 2 is also sufficient to allow for a diverse range of positions to be assumed by a user of the invention without stretching beyond the boundary . for example , in a preferred form the wall is planar and of a width which is sufficient to allow for a person to stand adjacent the wall and to spread both arms outwardly without both finger tips of each hand extending beyond the boundary of the wall surface 2 . width expansion of reaction surfaces is shown in fig2 where there is shown four adjacent sections . the width ( in direction b ) of the reaction surfaces may be sufficient so as to allow for a plurality of users to be standing on / adjacent the surfaces for their simultaneous use thereof . preferably the reaction surfaces are retrofit able to an existing structure of a building . for example the reaction surfaces may be part of a structure fabricated of sheets of ply wood to define a unit having a surface or surfaces onto which the loop component of the hook and loop fastening system is affixed ( such as by adhesion ). the fabricated ply wood structure can then be bolted or otherwise affixed to a fixed wall and / or floor structure of a building . it is important that the reaction surfaces remain securely fixed although it is envisaged that such affixing can be temporary in case the reaction surfaces are to be transportable . adjacent unites may be secured together by fasteners such as bolts or screws . with an extensive coverage area of the loop component of the hook and loop fastening means onto the plywood surfaces , a diverse arrange of positions can be assumed by the user of the system . with the provision of both a floor and wall surface , a person can receive support to all of the limbs by the reaction surfaces of the present invention . however it is envisaged that only a wall surface 2 ( as for example shown in fig1 ) is provided for the purposes of providing a reaction surface of the interaction means of the present invention . such a wall extends to a sufficient height ( e . g . greater than 1 . 5 m ) from the adjacent ground on which a person may stand to allow for a person standing adjacent the wall to assume a diverse range of positions including the engagement of their hands and / or feet onto the wall surface 2 . the fixed structure may be a wall or floor of a building . however the combination of wall and floor surfaces provides for a much more versatile arrangement of reaction surfaces . it is envisaged that the reaction surfaces may come in a collapsible form so that both the wall and floor surfaces are removable from each other to allow for convenient storage and transportation . indeed each wall and floor surface unit may itself be collapsible into more portions . each wall unit for example may be broken down into two or more components for the purposes of convenient storage and / or transportation . likewise the floor surface unit may do the same . it is envisaged that the present invention may be utilised in home situations where the convenience of storage and assembly is an important factor . the interaction means incorporates outerwear articles to be worn by the user of the system . in the most preferred form the user will be wearing at least one glove and preferably also at least one bootie . preferably a user will be wearing two gloves and two booties . a glove is for example shown in fig5 and 6 . the glove may be of a fingerless or finger kind ( and possibly but less preferably of a mitten kind ) however its main purpose is to remain securely fixed to the hand of a person . with the provision of the other component of the hook and loop fastening system to the component provided on the reaction surfaces ( 2 , 3 ) can allow for the glove to become affixed to the reaction surfaces . the glove may be entirely covered with the hook component or may be pattern applied . for example strips or panels 9 of the hook component may be sewn onto the body 20 of the glove in locations where the glove is likely to make contact with a reaction surface ( whether floor or wall 3 , 2 ). such regions may include the fingers , and on the palm side of the hand as well as the like surfaces on the other side of the hand . the glove may include a wrist strap 21 for the purposes of tightening the glove about the wrist . it is important that a glove of a size appropriate for the size of a users hand is selected so that a tight fit is achieved . when a person is applying pressure to a reaction surface via the glove , it is important that the glove does not move significantly relative to the hand . with reference to fig7 - 9 , there is shown a bootie which can be worn by the user of the present invention . the bootie will engage onto the foot of a user and has disposed onto exterior surfaces thereof , regions of a component of a hook and loop fastening system . again most preferably and since the reaction surfaces 2 , 3 are provided with the loop component of the system , the booties are provided with the hook component of the hook and loop fastening system . the booties may include strips of the hook component on the soles but also on the upper surfaces of the bootie . such strips or panels 8 will allow for the bootie to become fixed onto the reactions surfaces ( whether it be the wall surface 2 or the floor surface 3 ). positions by a user of the invention can be assumed by both the hands and the feet so that these touch and become affixed to the wall surface 2 of the device . it may only be the wall surface which is provided as the reaction surface of the present invention . however to increase versatility a floor surface 3 is also provided . in such a case , the user may have their feet or a foot engaged onto the floor surface and the hands or hand engaged onto the wall surface or vice versa or various combinations . in order to encourage the association of a person with the wall surface 2 , the wall surface is preferably inclined to the vertical . the incline is such that the normal ( n ) of the surface has an upward component of direction . the resultant angle x which the wall surface 2 makes to the vertical is greater than 0 ° and for example less than 30 °. a person standing adjacent the wall surface with their feet at or proximate the wall surface base 10 will need to lean over centre to their general upright direction in order for the body to make contact with the surface 2 . a person facing the wall hence needs to lean forward . a person with their back to the wall , will need to be leaning backwards in order to make contact with the surface . the angling of this wall surface 2 hence encourages both a psychological tendency to lean towards the wall as well as a physical tendency . assuming that all other things are equal , a person engaged for example with their hands to the wall surface 2 is more likely to stay engaged and have a feeling of engagement or association with the wall , than were the wall to have a normal which was horizontal or had a downward component ( i . e . an overhanging wall ). it is hence desirable for the wall to have an angle to the vertical greater than 0 ° and where the normal of the surface has a component directed upwardly . it is also envisaged that the wall surface 2 may be utilised for suspending a person ( such as for example a child ) by engagement of the gloves to the wall surface . by having a wall sloping in a manner as described , the body of the person will be biased as a result of gravity towards the wall thereby giving the feeling of engagement . this would not be the case were the wall to be overhanging or a wall which is purely vertical . where the present invention also includes a reaction surface which is a floor surface 3 , such a surface is preferably sloping to the horizontal . in the most preferred form the slope is downwardly from the intersecting point 4 between the wall surface 2 and the floor surface 3 . the angle y that the floor surface makes with the horizontal is preferably greater than 0 ° and for example less than 30 °. whilst the floor surface 3 need not be of a slope relative to the horizontal , it is preferred since a person standing on the floor surface 3 will then need to adjust their stance in order to remain standing upright adjacent the wall 2 . for example a person facing the wall surface 2 will need to lean forward when standing flat footed on the floor surface 3 . in order to remain standing upright , such a leaning forward will additionally encourage a tendency for the person to lean or fall towards a wall surface 2 engendering a feeling of security . this will encourage the making of contact of a person with the wall surface 2 . the wall and floor where a person is to simultaneously be able to touch the surface of both preferably have a normal to each surface lie in the same plane which a vertical plane . the floor surface may likewise be provided as part of a unit and for example be fabricated from a ply wood material . when viewed from the side as shown in fig1 both the wall surface and floor surface 2 , 3 are provided as part of wall and floor units . the wall and floor units are preferably independent items which are able to be abutted together . it is envisaged that alternative configurations may be adopted by the wall and floor unit where such are not touching each other . for example the wall unit may be elevated above the floor unit and there may be provided a gap therebetween . there may hence not be an intersection point 4 between the wall and floor units . the floor surface extend preferably from the wall surface at least 1 m outwardly therefrom . preferably this distance is between 1 m and 2 . 4 m . furthermore whilst in the most preferred form the wall surface 2 and preferably the floor surface 3 are substantially planar , such surfaces need not be entirely planar . indeed the surfaces may include apertures therethrough , particularly the wall surface 2 may include apertures to provide further assistance for holding the hand or the feet of a person . the surface may also include upstands which are provided in places tailored to assist in allowing for certain positions to be assumed by a user . the wall surface may alternatively be curved both vertically and horizontally . for example the wall surface may be - provided by a vertical pillar . in the most preferred form the hook of the hook and loop fastening system that is used is a product called cs 1200 ™ hook provided by 3m . this product of 3m provides a high shear strength between the two components of the system yet under tension , allows for a convenient removal . table 1 shows the performance specs of this product as published by 3m on their current website . as a result , the shear direction holding force between for example the gloves or the booties and the reaction surfaces 2 , 3 is extremely high when compared to the tension force . accordingly it is convenient for a person to pull their hands and feet off the surfaces by a force substantially normal to the surface however a sliding of the gloves and booties relative to the surface is highly resisted . hence a person utilising the present invention can move about on the surface relatively conveniently without any significant strain being placed on the muscles of the user . however when a shear force is applied by the user , the gloves and / or booties will remain firmly in place . this hence reduces the possibility of injury . action forces can hence be applied to the reaction surfaces in a shear direction . an original hook and loop fastening system commonly referred to as velcro ™ may be used . modern variations but which work in the same manner are to be considered as forming part of the invention . the loop component of the velcro is applied as a panel to the backing panel of plywood or similar . the present invention may be utilised for several different purposes . whilst the present invention has broadly been termed an interaction means or system using reaction surfaces for action forces to be applied by a person , the invention has applications in the stretching of muscles of a person , the exercise of muscles of a person and for the purposes of remedial skeletal alignment . the primary purpose of the present invention is to allow for a person to stretch their muscles prior to conducting or subsequent to conducting physical exercising . with reference to fig1 - 18 there are shown different positions that a person may assume in order to provide stretching forces to the muscles . reference is made to the brief description of the drawings which briefly indicates the different muscle groups which may be stretched by the various positions shown in fig1 - 18 . the reaction surface or surfaces of the present invention may also be engaged by a person wearing gloves and / or booties in a manner so that exercising can be performed . many of the positions illustrated will also allow a person to conduct exercises it will be appreciated by a person skilled in exercise techniques that exercises such as sit ups , push ups and dips can be performed wherein for example the feet or the hands of a person can be conveniently held stationary relative to the reaction surface ( s ) for the purposes of conducting such exercises . a result of being able to place the hands and / or feet wearing the gloves and / or booties against the reaction surfaces , such can be held stationary in order to allow for a person to assume an appropriate position to conduct exercises and / or to isolate certain muscle groups for the purposes of conducting such exercises and / or stretching . this can be achieved without the aid of another person . it is also envisaged by the inventor that the present invention may be utilised for the purposes of remedial skeletal alignment . by way of example , it is possible for a person to be wearing a glove on each hand and to place their hands above their head against the wall surface 2 and assume a position wherein they are effectively substantially suspended by the gloves downwardly and against the surface 2 . a substantial part of the weight of the body can be transferred through the gloves onto the wall surface thereby allowing for the spine of a person to assume a naturally extended direction and encouraging the spine to assume a natural alignment . the therapist can then also manipulate the body are desired . it is accordingly envisaged that the present invention may be utilised not just by the physiotherapy profession but also by chiropractic and osteopathic profession for the treatment of patients . with the use of the invention it is possible to provide “ isometric ”/ resistance exercise and resistance stretch plus minutely controlled “ concentric ” and “ eccentric ” load to muscle tissue throughout the range of motion of the muscle the body &# 39 ; s own mass . this provides for passive and active stretch and muscle workouts for the entire muscle length as the maximum load point may be readily adjusted by slightly moving bodymass unlike a machine and with the support of other muscles to reduce injury opportunity that is a risk in free weight training . additionally a major advantage is that the device can allow exercise and stretch without re - location of the user . isometric exercises are those in which a force is applied to a resistant object . an example is pushing against a brick wall — even though there is a build up of tension in the muscles , there is no actual movement . a few points about isometric exercises are as follows : to increase strength , it is necessary to maintain a position in any one exercise for 6 to 8 seconds . any one isometric exercise will only increase muscle strength at one joint angle . strengthening the other joint positions requires repetition of further corresponding exercises . isometric exercises on their own are not recommended for strength training . they are only part of a complete exercise program . as long as you are flexing or applying force against something , you are engaged in an isometric exercise . the great thing about isometric exercises is they can be performed just about anywhere and at any time , and with the use of the present invention it has now become possible for a person to assume many more body positions ad increase of adjust the level of force for the purposes of such exercises . the present invention can be provided for use with little or no intrusion on space within a building . it can be conveniently mounted against a wall and onto a floor . it may be utilised in gymnasiums as well as in office environments for stress relief purposes and aid in the recovery from oos / rsi ( occupational overuse syndrome and repetitive strain injuries ) related conditions . physiotherapy clinics may benefit from the present invention in that it may allow for an increased range of motions to be adopted by their patients . with the isolation of the hands and feet , a person is able to work the tissue harder , then release / relax the tissue at higher rates . since the invention is able to function as a stretching means and excising means it is possible to complete a workout routine then follow this with stretching without relocating or even adjusting positions . with the provision of the velcro in large areas to define the engagement walls and floors , another advantage of the present invention can be realised in terms of advertising . brand names can be printed / created on the surfaces . the velcro may for example be pattern cut an applied to the backing panels in a manner to present a brand name or logo . as used herein “ floor ” should not be restricted to only structural floor and “ wall ” can include other upright supports ( whether skeletal or panelled ). as used herein “ complementary attachment means ” and use in conjunction with said means are preferably means to allow attachment to or from said floor or wall surface to enable an exerciser to manipulate the muscles or him or herself via releasable engagement . | 0 |
the present invention relates to biodegradable , in - situ forming implants and methods for producing the same . the present invention also relates to a liquid biodegradable polymeric delivery system that can be injected into a body where it forms a solid and releases a biologically active agent at a controlled rate . two types of biodegradable polymeric systems are described : thermoplastic polymers dissolved in a biocompatible solvent and thermosetting polymers that are liquids without the use of solvents . a thermoplastic system is provided in which a solid , linear - chain , biodegradable polymer is dissolved in a biocompatible solvent to form a liquid , which can then be administered via a syringe and needle . examples of biodegradable polymers which can be used in this application are polylactides , polyglycolides , polycaprolactones , polyanhydrides , polyamides , polyurethanes , polyesteramides , polyorthoesters , polydioxanones , polyacetals , polyketals , polycarbonates , polyorthocarbonates , polyphosphazenes , polyhydroxybutyrates , polyhydroxyvalerates , polyalkylene oxalates , polyalkylene succinates , poly ( malic acid ), poly ( amino acids ), polyvinylpyrrolidone , polyethylene glycol , polyhydroxycellulose , chitin , chitosan , and copolymers , terpolymers , or combinations or mixtures of the above materials . the preferred polymers are those which have a lower degree of crystallization and are more hydrophobic . these polymers and copolymers are more soluble in the biocompatible solvents than the highly crystalline polymers such as polyglycolide and chitin which also have a high degree of hydrogen - bonding . preferred materials with the desired solubility parameters are the polyactides , polycaprolactones , and copolymers of these with glycolide in which there are more amorphous regions to enhance solubility . it is also preferred that the solvent for the biodegradable polymer be non - toxic , water miscible , and otherwise biocompatible . solvents that are toxic should not be used to inject any material into a living body . the solvents must also be biocompatible so that they do not cause severe tissue irritation or necrosis at the site of implantation . furthermore , the solvent should be water miscible so that it will diffuse quickly into the body fluids and allow water to permeate into the polymer solution and cause it to coagulate or solidify . examples of such solvents include n - methyl - 2 - pyrrolidone , 2 - pyrrolidone , ethanol , propylene glycol , acetone , methyl acetate , ethyl acetate , methyl ethyl ketone , dimethylformamide , dimethyl sulfoxide , tetrahydrofuran , caprolactam , decylmethylsulfoxide , oleic acid , and 1 - dodecylazacycloheptan - 2 - one . the preferred solvents are n - methyl - 2 - pyrrolidone , 2 - pyrrolidone , dimethyl sulfoxide , and acetone because of their solvating ability and their compatibility . the solubility of the biodegradable polymers in the various solvents will differ depending upon their crystallinity , their hydrophilicity , hydrogen - bonding , and molecular weight . thus , not all of the biodegradable polymers will be soluble in the same solvent , but each polymer or copolymer should have its optimum solvent . lower molecular - weight polymers will normally dissolve more readily in the solvents than high - molecular - weight polymers . as a result , the concentration of a polymer dissolved in the various solvents will differ depending upon type of polymer and its molecular weight . conversely , the higher molecular - weight polymers will normally tend to coagulate or solidify faster than the very low - molecular - weight polymers . moreover the higher molecular - weight polymers will tend to give higher solution viscosities than the low - molecular - weight materials . thus for optimum injection efficiency , the molecular weight and the concentration of the polymer in the solvent have to be controlled . for example , low - molecular - weight polylactic acid formed by the condensation of lactic acid will dissolve in n - methyl - 2 - pyrrolidone ( nmp ) to give a 73 % by weight solution which still flows easily through a 23 - gauge syringe needle , whereas a higher molecular - weight poly ( dl - lactide ) ( dl - pla ) formed by the additional polymerization of dl - lactide gives the same solution viscosity when dissolved in nmp at only 50 % by weight . the higher molecular - weight polymer solution coagulates immediately when placed into water . the low - molecular - weight polymer solution , although more concentrated , tends to coagulate very slowly when placed into water . for polymers that tend to coagulate slowly , a solvent mixture can be used to increase the coagulation rate . thus one liquid component of the mixture is a good solvent for the polymer , and the other component is a poorer solvent or a non - solvent . the two liquids are mixed at a ratio such that the polymer is still soluble but precipitates with the slightest increase in the amount of non - solvent , such as water in a physiological environment . by necessity , the solvent system must be miscible with both the polymer and water . an example of such a binary solvent system is the use of nmp and ethanol for low - molecular - weight dl - pla . the addition of ethanol to the nmp / polymer solution increases its coagulation rate significantly . it has also been found that solutions containing very high concentrations of high - molecular - weight polymers sometimes coagulate or solidify slower than more dilute solutions . it is suspected that the high concentration of polymer impedes the diffusion of solvent from within the polymer matrix and consequently prevents the permeation of water into the matrix where it can precipitate the polymer chains . thus , there is an optimum concentration at which the solvent can diffuse out of the polymer solution and water penetrates within to coagulate the polymer . in one envisioned use of the thermoplastic system , the polymer solution is placed in a syringe and injected through a needle into the body . once in place , the solvent dissipates , the remaining polymer solidifies , and a solid structure is formed . the implant will adhere to its surrounding tissue or bone by mechanical forces and can assume the shape of its surrounding cavity . thus , the biodegradable polymer solution can be injected subdermally like collagen to build up tissue or to fill in defects . it can also be injected into wounds including burn wounds to prevent the formation of deep scars . unlike collagen , the degradation time of the implant can be varied from a few weeks to years depending upon the polymer selected and its molecular weight . the injectable polymer solution can also be used to mend bone defects or to provide a continuous matrix when other solid biodegradable implants such as hydroxyapatite plugs are inserted into bone gaps . the injectable system can also be used to adhere tissue to tissue or other implants to tissue by virtue of its mechanical bonding or encapsulation of tissue and prosthetic devices . another envisioned use of the thermoplastic system is to provide a drug - delivery system . in this use , a bioactive agent is added to the polymer solution prior to injection , and then the polymer / solvent / agent mixture is injected into the body . in some cases , the drug will also be soluble in the solvent , and a homogenous solution of polymer and drug will be available for injection . in other cases , the drug will not be soluble in the solvent , and a suspension or dispersion of the drug in the polymer solution will result . this suspension or dispersion can also be injected into the body . in either case , the solvent will dissipate and the polymer will solidify and entrap or encase the drug within the solid matrix . the release of drug from these solid implants will follow the same general rules for release of a drug from a monolithic polymeric device . the release of drug can be affected by the size and shape of the implant , the loading of drug within the implant , the permeability factors involving the drug and the particular polymer , and the degradation of the polymer . depending upon the bioactive agent selected for delivery , the above parameters can be adjusted by one skilled in the art of drug delivery to give the desired rate and duration of release . the term drug or bioactive ( biologically active ) agent as used herein includes without limitation physiologically or pharmacologically active substances that act locally or systemically in the body . representative drugs and biologically active agents to be used with the syringeable , in - situ forming solid implant systems include , without limitation , peptide drugs , protein drugs , desensitizing agents , antigens , vaccines , anti - infectives , antibiotics , antimicrobials , antiallergenics , steroidal anti - inflammatory agents , decongestants , miotics , anticholinergios , sympathomimetics , sedatives , hypnotics , psychic energizers , tranquilizers , androgenic steroids , estrogens , progestational agents , humoral agents , prostaglandins , analgesics , antispasmodics , antimalarials , antihistamines , cardioactive agents , non - steroidal anti - inflammatory agents , antiparkinsonian agents , antihypertensive agents , β - adrenergic blocking agents , nutritional agents , and the benzophenanthridine alkaloids . to those skilled in the art , other drugs or biologically active agents that can be released in an aqueous environment can be utilized in the described injectable delivery system . also , various forms of the drugs or biologically active agents may be used . these include without limitation forms such as uncharged molecules , molecular complexes , salts , ethers , esters , amides , etc ., which are biologically activated when injected into the body . the amount of drug or biologically active agent incorporated into the injectable , in - situ , solid forming implant depends upon the desired release profile , the concentration of drug required for a biological effect , and the length of time that the drug has to be released for treatment . there is no critical upper limit on the amount of drug incorporated into the polymer solution except for that of an acceptable solution or dispersion viscosity for injection through a syringe needle . the lower limit of drug incorporated into the delivery system is dependent simply upon the activity of the drug and the length of time needed for treatment . in all cases , the solid implant formed within the injectable polymer solution will slowly biodegrade within the body and allow natural tissue to grow and replace the impact as it disappears . thus , when the material is injected into a soft - tissue defect , it will fill that defect and provide a scaffold for natural collagen tissue to grow . this collagen tissue will gradually replace the biodegradable polymer . with hard tissue such as bone , the biodegradable polymer will support the growth of new bone cells which will also gradually replace the degrading polymer . for drug - delivery systems , the solid implant formed from the injectable system will release the drug contained within its matrix at a controlled rate until the drug is depleted . with certain drugs , the polymer will degrade after the drug has been completely released . with other drugs such as peptides or proteins , the drug will be completely released only after the polymer has degraded to a point where the non - diffusing drug has been exposed to the body fluids . the injectable , in - situ forming biodegradable implants can also be produced by crosslinking appropriately functionalized biodegradable polymers . the thermosetting system comprises reactive , liquid , oligomeric polymers which cure in place to form solids , usually with the addition of a curing catalyst . although any of the biodegradable polymers previously described for the thermoplastic system can be used , the limiting criteria is that low - molecular - weight oligomers of these polymers or copolymers must be liquids and they must have functional groups on the ends of the prepolymer which can be reacted with acryloyl chloride to produce acrylic ester capped prepolymers . the preferred biodegradable system is that produced from poly ( dl - lactide - co - caprolactone ), or &# 34 ; dl - plc &# 34 ;. low - molecular - weight polymers or oligomers produced from these materials are flowable liquids at room temperature . hydroxy - terminated plc prepolymers may be synthesized via copolymerization of dl - lactide or l - lactide and ε - caprolactone with a multifunctional polyol initiator and a catalyst . catalysts useful for the preparation of these prepolymers are preferably basic or neutral ester - interchange ( transesterification ) catalysts . metallic esters of carboxylic acids containing up to 18 carbon atoms such as formic , acetic , lauric , stearic , and benzoic are normally used as such catalysts . stannous octoate and stannous chloride are the preferred catalysts , both for reasons of fda compliance and performance . if a bifunctional polyester is desired , a bifunctional chain initiator such as ethylene glycol is employed . a trifunctional initiator such as trimethylolpropane produces a trifunctional polymer , etc . the amount of chain initiator used determines the resultant molecular weight of the polymer or copolymer . at high concentrations of chain initiator , the assumption is made that one bifunctional initiator molecule initiates only one polymer chain . on the other hand , when the concentration of bifunctional initiator is very low , each initiator molecule can initiate two polymer chains . in any case , the polymer chains are terminated by hydroxyl groups , as seen in fig1 . in this example , the assumption has been made that only one polymer chain is initiated per bifunctional initiator molecule . this assumption allows the calculation of a theoretical molecular weight for the prepolymers . a list of the bifunctional plc prepolymers that were synthesized is given in table 1 . appropriate amounts of dl - lactide , ε - caprolactone , and ethylene glycol were combined in a flask under nitrogen and then heated in an oil bath at 155 ° c . to melt and mix the monomers . the copolymerizations were then catalyzed by the addition of 0 . 03 to 0 . 05 wt % sncl 2 . the reaction was allowed to proceed overnight . the hydroxyl numbers of the prepolymers were determined by standard titration procedure . the gardner - holdt viscosities of the liquid prepolymers were also determined using the procedures outlined in astm d 1545 . the highest molecular - weight prepolymer ( mw = 5000 ) was a solid at room temperature ; therefore , its gardner - holdt viscosity could not be determined . the diol prepolymers were converted to acrylic - ester - capped prepolymers via a reaction with acryloyl chloride under schotten - baumann - like conditions , as seen in fig2 and summarized in table 2 . other methods of converting the diol prepolymers to acrylic - ester - capped prepolymers may also be employed . both thf and dichloromethane were evaluated as solvents in the acylation reactions . several problems were encountered when thf was used as the solvent . the triethylamine hydrochloride formed as a by - product in the reaction was so finely divided that it could not be efficiently removed from the reaction mixture by filtration . triethylamine hydrochloride ( et 3 n . hcl ) has been reported to cause polymerization of acrylic species ( u . s . pat . no . 4 , 405 , 798 ). in several instances , where attempts to remove all of the et 3 n . hcl failed , the acrylic - ester - capped prepolymers gelled prematurely . thus , to effectively remove all of the et 3 n . hcl , it was necessary to extract the prepolymers with water . for reactions carried out in thf , it is preferred that one first evaporate the thf in vacuo , redissolve the oil in ch 2 cl 2 , filter out the et 3 n . hcl , and then extract the ch 2 cl 2 layer with water . stable emulsions were sometimes encountered during extraction . the acylations were later carried out in ch 2 cl 2 instead of thf . the filtration of et 3 n . hcl from the reaction mixture was found to be much easier using this solvent , and the organic fraction could be extracted directly with water after filtration . both diol and acrylic prepolymers were examined by ir and 1 h nmr spectroscopy . the salient feature of the ir spectra of diol prepolymers is a prominent o -- h stretch centered at approximately 3510 cm - 1 . upon acylation , the intensity of the o -- h stretch decreases markedly , and new absorbances at approximately 1640 cm - 1 appear . these new absorbances are attributed to the c -- c stretch associated with acrylic groups . likewise , the presences of acrylic ester groups is apparent in the 1 h nmr spectra , the characteristic resonances for the vinyl protons falling in the range of 5 . 9 to 6 . 6 ppm . the acrylic prepolymers and diol prepolymers were then cured , as summarized in table 3 . the general procedure for the curing of the prepolymers is now described : to 5 . 0 g of acrylic prepolymer contained in a small beaker was added a solution of benzoyl peroxide ( bp ) in approximately 1 ml of ch 2 cl 2 . in some cases , fillers or additional acrylic monomers were added to the prepolymers prior to the introduction of the bp solution . the mixtures were stirred thoroughly and then poured into small petri dishes . the dishes were placed in a preheated vacuum oven for curing . some of the samples were cured in air and not in vacuo , and these samples are so indicated in table 3 . this thermosetting system may be used wherever a biodegradable implant is desired . for example , because the prepolymer remains a liquid for a short time after addition of the curing agent , the liquid prepolymer / curing agent mixture may be placed into a syringe and injected into a body . the mixture then solidifies in - situ , thereby providing an implant without an incision . furthermore , a drug - delivery system may be provided by adding a biologically active agent to the prepolymer prior to injection . once in - situ , the system will cure to a solid ; eventually , it will biodegrade , and the agent will be gradually released . the following examples are set forth as representative of the present invention . these examples are not to be construed as limiting the scope of the invention as these and other equivalent embodiments will be apparent in view of the present disclosure , figures , and accompanying claims . poly ( dl - lactic acid ) was prepared by the sample polycondensation of lactic acid . no catalysts were used , and the reaction times were varied to produce polymers with different theoretical molecular weights . these polymers were designated as dl - pla oligomers . a quantity of the solid oligomer was dissolved in nmp to give a 68 : 32 ratio of polymer to solvent . sanguinarine chloride ( sacl ), a benzophenanthridine alkaloid with antimicrobial activity especially toward periodontal pathogens , was added to the polymer solution to give a 2 % by weight dispersion of the drug in the total mixture . the dispersion of drug and polymer solution was then injected into a dialysis tube ( diameter of 11 . 5 mm ) with a sterile disposable syringe without a needle . each end of the 6 - in . length of dialysis tubing was tied with a knot to prevent loss of the drug / polymer mass , and the tube with the injected material was placed in a ph 7 sorenson &# 39 ; s buffer receiving fluid maintained at 37 ° c . upon immersion in the receiving fluid , the drug / polymer mass coagulated into a solid mass , and the drug began to be released from the polymer as indicated by an orange - red color in the receiving fluid . the quantity of solution injected into the dialysis tube was about 250 μl or about 100 mg of solids . the dialysis tubing was selected to have a molecular - weight cutoff of about of about 3 , 500 . with this molecular - weight cutoff , the sacl released from the polymer could easily diffuse through the walls of the tubing , but any solid polymer would be retained . the dialysis tubing containing the drug / polymer matrix was removed frequently and placed in a bottle of fresh receiving fluid . the old receiving fluid containing the released drug was then acidified to a ph of 2 . 76 to convert all released drug to the iminium ion form of the drug , and the concentration of drug was determined by measuring the ultraviolet absorption ( uv ) at a wavelength of 237 nm . the cumulative mass of drug released and the cumulative fraction were then calculated and plotted as a function of time . approximately 60 % of the drug was released in the first day , 72 % after 2 days , 85 % after 5 days , 90 % after 9 days , and 97 % after 14 days . ethoxydihydrosanguinarine ( saet ), the ethanol ester of sanguinarine , was added to the same dl - pla oligomer / nmp solution described in example 1 . saet dissolved in the polymer solution to give a homogenous solution of drug and polymer . approximately 250 μl of the solution was added to receiving fluid and the release of drug measured as described in example 1 . the release of saet was slower than that for sacl as expected because of its lower water solubility . after the first day , approximately 45 % was released , 52 % after 2 days , 60 % after 5 days , 70 % after 9 days , and 80 % after 14 days . poly ( dl - lactide ) with an inherent viscosity of 0 . 08 dl / g and a theoretical molecular weight of 2 , 000 was prepared by the ring - opening polymerization of dl - lactide using lauryl alcohol as the initiator and stannous chloride as the catalyst . this polymer was then dissolved in nmp to give a 40 % by weight polymer solution . sacl was dispersed in the solution of this polymer in nmp to give a 1 . 5 % by weight dispersion of the drug in the solution and the release rate determined as described in example 1 . the release rate of the drug from this higher molecular - weight polymer was slower than from the dl - pla oligomer . after the first day , approximately 32 % was released , 40 % after 2 days , 45 % after 5 days , and 50 % after 15 days . saet was added to the same polymer solution of dl - pla in nmp as described in example 3 . a homogenous solution with the drug at 1 . 5 % by weight was obtained . the release of drug from this solution determined using the same procedure described in example 1 gave a much slower release of saet than from the dl - pla oligomer . after the first day approximately 8 % was released , 14 % after 2 days , 20 % after 5 days , 23 % after 9 days , and 28 % after 14 days . the effect of drug loading on the release of drug from the polymer solutions were demonstrated by adding sacl to a 40 % by weight of dl - pla oligomer in nmp . the drug was dispersed in the polymer solution to give 2 , 7 and 14 % by weight dispersions . the release of drug from these formulations using the same procedure as described in example 1 showed that the higher drug loadings gave a lower fractional rate of release as normally obtained for matrix delivery systems with diffusional release . the 2 %- loaded formulation gave 65 % release after 1 day , 75 % after 2 days , and 88 % after 5 days ; the 7 %- loaded formulation gave 48 % release after 1 day , 52 % after 2 days , and 58 % after 5 days , and the 14 %- loaded formulation gave 38 % release after 1 day , 43 % after 2 days , and 49 % after 5 days . poly ( dl - lactide - co - glycolide ) was prepared by the ring - opening polymerization of a mixture of dl - lactide and glycolide using lauryl alcohol as the initiator and stannous chloride as the catalyst . the proportions of the two monomers were adjusted so that the final copolymer ( dl - plg ) had a 50 : 50 ratio of the two monomers as determined by nuclear magnetic resonance spectrophotometry . the initiator was also adjusted to give a copolymer with a theoretical molecular weight of 1500 daltons . the copolymer was dissolved in nmp to give a 70 % by weight polymer solution . sacl was added to this solution to give a 2 % by weight dispersion of the drug in the polymer solution . the release of drug from this formulation was determined using the same procedure described in example 1 . a much lower release rate was obtained from the copolymer than from the dl - pla oligomer or dl - pla 2000 molecular weight materials . after 2 days approximately 7 % of the drug was released , 10 % after 5 days , 12 % after 7 days , and 16 % after 14 days . saet was added to the same solution of dl - plg in nmp as described in example 6 to give a 2 % by weight solution of the drug . the release of drug from this formulation was determined by the same procedure as described previously . the release rate of saet from this formulation was identical to that for sacl described in example 6 . tetracycline as the free base ( tcb ) was added to the same solution of dl - plg in nmp as described in example 6 . the drug dissolved completely in the polymer solution to give a 2 . 4 % by weight solution of the drug . the release of the drug from this formulation was determined by a similar procedure to that described in example 1 except the receiving fluid was not acidified to a ph of 2 . 76 and the concentration of tcb was determined by uv absorption at the wavelength appropriate for the drug . the release of tcb from this formulation was more linear and at a much higher rate than that for sacl or saet from the same copolymer . after 1 day approximately 44 % of the drug was released , 54 % after 2 days , 68 % after 5 days , 73 % after 6 days , 80 % after 7 days , 87 % after 9 days , 96 % after 12 days , and 100 % after 14 days . tetracycline as the hydrochloride salt ( tch ) was added to the same solution of dl - plg in nmp as described in example 6 . the salt form of the drug also dissolved completely in the polymer solution . the release of drug from this formulation was determined as described in example 8 and found to be similar to that for the free base except for a slightly lower rate . after 1 day approximately 32 % of the drug was released , 40 % after 2 days , 57 % after 5 days , 64 % after 6 days , 75 % after 7 days , 82 % after 9 days , 92 % after 12 days , and 100 % after 14 days . dl - pla with an inherent viscosity of 0 . 26 dl / g and a theoretical molecular weight of approximately 10 , 000 daltons was prepared by the ring - opening polymerization of dl - lactide using lauryl alcohol as the initiator and stannous chloride as the catalyst . the polymer was dissolved in nmp to give a 50 % by weight polymer solution . a quantity of the polymer solution ( 100 μl ) was injected subdermally into rabbits , and the tissue reaction was compared to that of a usp negative plastic . the test sites were evaluated for signs of local irritation , in accordance with the draize method , immediately after injection , at 1 and 6 hours post injection , and once daily thereafter until scheduled sacrifice at 7 , 14 or 21 days . the reaction at the test sites was equivalent to that at the control usp negative plastic . the polymer solution ( 100 μl ) was also administered subgingivally into sites created by dental extractions in beagle dogs . control sites were flushed with saline solution . the dogs were examined daily for signs of mortality , pharmacotoxic effects , body weights , and local gingival irritation . the animals were sacrificed at 15 and 21 days . no distinct differences were noted between the control and test sites . dl - pla with an inherent viscosity of 0126 dl / g and a molecular weight of about 10 , 000 was dissolved in nmp to give a 50 % by weight polymer solution . sacl was added to the polymer solution to give a 2 . 4 % by weight dispersion . this material was loaded into a 1 - cc disposable syringe fitted with a 23 - gauge blunted - end syringe needle , and the material was inserted into the periodontal pocket of a greyhound dog . the material flowed easily out of the narrow syringe tip . the polymer precipitated or coagulated into a film or solid mass when it contacted the saliva and fluid within the pocket . the dog was observed over a time of 2 weeks during which the mass of material remained within the pocket , adhering to tissue surrounding the pocket , and slowly changing color from a light orange to a pale white . the crevicular fluid from the pocket containing the implant was sampled during this 2 - week period using periostrips which are small strips of paper that are placed at the entrance to the periodontal pocket to wick up small quantities of the crevicular fluid within the pocket . the volume of fluid collected is determined using a periotron which measures the changes in conductance of the paper strip . the periotron is calibrated before use with a known volume of serum . the paper strip containing the collected fluid is then extracted with a solution of 0 . 5 % by volume of hydrochloric acid in methanol and injected into a liquid chromatograph where the quantity of drug is determined by reference to a known concentration of the same compound . the quantity of sacl extracted from the paper strip is divided by the quantity of crevicular fluid collected to calculate the concentration of drug in the fluid . with this technique , the concentration of sacl within the crevicular fluid from the periodontal pocket with the polymeric delivery system was determined to be almost constant during the 2 weeks of observation . the sacl concentration in the crevicular fluid was 63 . 2 μg / ml after 3 days , 80 . 2 μg / ml after 7 days , 67 . 8 μg / ml after 10 days , and 70 . 5 μg / ml after 14 days . an illustrative method for the synthesis of an acrylate terminated prepolymer is described . to an oven - dried , 500 - ml , three - necked , round - bottom flask fitted with an addition funnel , gas inlet adapter , mechanical stirrer assembly , and rubber septum was added , under nitrogen , 100 . 0 g of difunctional hydroxy - terminated prepolymer and 200 ml of freshly distilled thf ( from cah 2 ). the flask was cooled in an ice bath , and 24 ml of dry triethylamine ( 0 . 95 equiv / equiv oh ) was added via a syringe . the addition funnel was charged with 15 . 4 g of acryloyl chloride ( 0 . 95 equiv / equiv oh ) in 15 ml of thf , and the solution was added dropwise to the stirred reaction mixture over 1 hour . the mixture was stirred overnight and allowed to reach room temperature . the precipitated triethylamine hydrochloride was removed by filtration , and the filtrate was evaporated in vacuo , affording a pale yellow oil , which was the acrylate - terminated prepolymer . the acylations employing ch 2 cl 2 as solvent were conducted in a similar manner . however , the reaction times at 0 ° c . were shortened to 1 hour , whereupon the reaction mixtures were allowed to reach room temperature over 1 hour . et 3 n 1 hcl was filtered out , additional ch 2 cl 2 ( approximately 800 ml ) was added to the filtrate , and the filtrate was extracted several times with 250 ml portions of water . the organic layer was dried over mgso 4 / na 2 so 4 , filtered , and reduced to an oil in vacuo . the bottles of acrylic prepolymers were wrapped in foil and stored in a refrigerator to safeguard against premature crosslinking . | 8 |
the preferred embodiment will now be described on the basis of a mobile terminal connected to a cellular network such as a 3rd generation mobile communication network comprising a circuit - switched core network and a packet - switched core network . in the context of the present invention , a service is understood to be any entity that can provide information , perform an action , or control a resource on behalf of another entity . a service may be implemented as software , hardware , or a combination of hardware and software . furthermore , the term proxy is used to indicate any mechanism whereby one system “ fronts for ” another system in responding to protocol requests . proxy systems or servers are used in network management to avoid having to implement full protocol stacks in simple devices , such as modems . fig1 shows a schematic diagram of an initialization , storing and changing procedure of a trigger control information . the operator of a network 30 may define available or used service configuration triggers and may provide them as a trigger control information to a first terminal equipment or mobile terminal 11 and a second terminal equipment or mobile terminal 21 . these mobile terminals 11 , 21 comprise a usim ( universal mobile telecommunications system subscriber identity module ) or non - volatile memory 12 , 22 , e . g . an beprom ( electrically erasable programmable read - only - memory ), in which the trigger control information can be stored . the trigger control information defines events and / or conditions , which shall trigger a server address discovery procedure or any other procedure for obtaining configuration parameters of servers or other data sources , to be executed . the server addresses can be addresses of a www ( world wide web ) proxy , a wap ( wireless application protocol ) gateway , a wap push server , a proxy voip ( voice over ip ) and multimedia cscf server , a localized service area specific server , a defined geographical area specific server etc . when a triggering event or condition comes true , e . g . is detected by the first mobile terminal 11 and / or the second mobile terminal 21 , a configuration or reconfiguration procedure is started to get new server addresses or other configuration parameters from the network 30 to be used by the terminal . a control information can be initialized , changed and stored in the following ways , depending on the operator and user needs and an agreement between them : in step 1 , the operator of the network 30 can initialize the trigger control information and store it in the usims 12 , 22 of the first and second mobile terminals 11 , 21 when the usim card is sold to the customer . then , it can be updated later e . g . by using a sim application tool kit or other similar solutions . as an alternative , the trigger control information can be stored in the non - volatile memory ( e . g . eeprom ) of the first and second terminals 11 , 21 . in any case , the operator can allow a user to change the trigger control information and / or the operator can also change it using the mechanisms described in step 3 and / or step 4 . in step 2 , the changed trigger control information is then stored in the usims or beprom 12 , 22 of the first and second mobile terminals 11 , 21 . as indicated by step 3 , the operator may broadcast changes in the trigger control information as a part of a system information message . this is a particularly applicable when the trigger control information of a plurality of mobile terminals registered to the network 30 is to be controlled . as an alternative or in addition thereto , step 4 indicates a provision of the trigger control information to a second mobile terminal 21 in a dedicated manner , when the second mobile terminal 21 registers to the network 30 . this may be achieved e . g . during the delivery of server addresses to the second mobile terminal 21 according to a user profile or as a part of it using any signalling protocol , such as dhcp , sm ( session / service management ), slp or sip for example . thus , the first and second mobile terminals 11 , 21 are continuously provided with an updated trigger control information adapted to their current location . the address or other configuration parameter discovery procedure may be performed as follows . when the mobile terminal detects or determines a trigger event or trigger condition as defined by the stored trigger control information , it may send a slp query in order to obtain an ip address of a www proxy or some other required proxy server . also dhcp query may be triggered in order to obtain an ip address of a respective cscf or some other service lookup server . for example , when a ps mobile terminal enters a ( new ) cs network , the queried dhcp server answers with a p - cscf address . the mobile terminal may then contact the p - cscf in order to get a list of available multimedia services . the p - cscf can take into account the type of network where it is connected , so that not all , of the services designated for the ps domain may technically be possible in the cs domain , e . g . due to the low capacity of the cs network . the p - cscf answers with a corresponding list of services , such that the user of the mobile terminal is now provided with a list of services available in the network . it is noted that the any of the initially described discovery procedures , e . g . according to the dhcp or dns protocol or slp protocol , or other discovery protocols may be used for obtaining the required address or other configuration parameters . fig2 shows a signaling diagram of a service configuration procedure between the first mobile terminal 11 and the network 30 . in step 1 , the trigger control information is provided for the mobile terminal 11 by the network . this control information is then interpreted in step 2 by the mobile terminal 11 , and the defined service configuration triggers are then stored in the volatile memory and / or the usim 21 of the mobile terminal 11 . in step 3 , a triggering event happens or location conditions come true , as defined by the trigger control information , and a service configuration or reconfiguration procedure is started by the mobile terminal 11 . thus , the mobile terminal 11 issues a service configuration request in step 4 so as to ask for new server addresses or other configuration parameters from the network 30 . in step 5 , the new server addresses or other configuration parameters are delivered to the mobile terminal 11 by a service configuration response message . the operator of the network 30 may select the most suitable triggers for service configuration or reconfiguration based on his own needs , i . e . service configuration customization , and may define them in the referred trigger control information . as an example , the following events or conditions can be defined as triggers : 1 . a cell update where a new cell is entered , 2 . a routing area update where a new routing area of a ps domain is entered , 3 . a location area update where a new location area of a cs domain is entered , 4 . a change in the ip network point of attachment , e . g . change of ggsn ( gateway general packet radio services support node ) or ha ( home agent ), 5 . a change of a localized service area ( lsa ), which is an operator - defined area , for which specific access conditions apply and which may correspond to an area in which the core network offers specific services , 6 . a change of a defined geographical area ( dega ), 7 . a change of the location of all mobiles in geographical area ( lamga ), 8 . a roaming from a first plmn to a second plmn , by which also the operator is changed , and 9 . a movement outside a predefined geographical area , which may include position definition functions , e . g . global positioning system ( gps ) etc ., in the mobile terminal 11 or the network 30 . of course other suitable trigger events and / or conditions associated with a terminal movement or change of location can be defined . fig3 shows a schematic block diagram of the mobile terminal 11 . it is noted that only those functions relevant for the present invention are shown in fig3 . the mobile terminal 11 comprises a transceiver ( trx ) 113 for transmitting and receiving rf signals to / from the network 30 . the trx 113 is controlled by a signaling control unit 112 which is arranged to generate and interpret signaling messages transmitted to and received from the network 30 , respectively . the signaling control unit 112 is controlled by a trigger unit 111 based on the trigger control information received from the network 30 . an initial configuration or setting of the trigger events and / or conditions may be obtained when a sim or usim card 101 is inserted into a usim or sim unit 110 . the trigger control information of the sim / usim card 101 may then be interpreted in the usim or sim unit 110 , and the corresponding trigger events and / or conditions may be supplied to the trigger unit 111 . based on a corresponding signaling of the signaling control unit 112 , which indicates the receipt or detection of messages or other events and conditions , e . g . the triggers indicated above , the trigger unit 111 may then decide whether to initiate a discovery procedure for obtaining the required configuration parameters , e . g . server addresses of a server or proxy server . furthermore , the signaling control unit is arranged to perform or initiate an update procedure when the trigger control information is received from the network 30 together with a broadcast signaling message or a response message to a network registration procedure . it is to be noted that the units or blocks 110 to 112 may be implemented as concrete hardware circuits or as software routines of a corresponding control processor arranged in the mobile terminal 11 . the network operator may also define multiple triggers to be used . an example of such a case is shown in fig4 . fig4 shows a moving route of a mobile terminal through a network configuration comprising a first network plmn - a and a second network plmn - b . both networks comprise location areas la , routing areas ra and individual cells . some of the individual cells are combined to a localized service area solsa with a specific lsa identity . furthermore , a defined geographical area ( dega ) with a predetermined dega identity and a location of all mobiles in geographical area ( lamga ) with a predetermined lamga identity are provided . when the mobile terminal moves according to a route indicated by the arrow in fig4 , service reconfiguration procedures may be activated several times at predetermined locations indicated on the arrow . at a first location p 1 , a location area update is signaled by the signaling control unit 112 . then , at a location p 2 , a routing area update is signaled . moreover , at the location p 3 , a dega change is signaled , and at the location p 4 an lsa change is signaled . when the mobile terminal enters the second network plmn - b , an operator change is detected due to the roaming from the first network plmn - a to the second plmn - b . this may include a deregistration from the operator of the first network plmn - a and a registration to the operator of the second network plmn - b . this may be accompanied by an initial service configuration . at the location p 6 , a lamga change is detected , and a cell update is signaled at the location p 7 . finally , an additional lsa change is detected at the location p 8 . based on the trigger control information and the corresponding registered trigger events and / or conditions , a service configuration or reconfiguration procedure may be activated at predetermined ones or each of the above locations p 1 to p 8 . it is noted that some of the above changes , updates may also trigger a change in the service provider . this is the case , when the network operator has rent a service area from one company and the other service area from another company . thus , the service configuration procedure according to the present invention also enables a user - friendly management of services in future mobile internet systems as specified e . g . in the 3gpp ( 3rd generation partnership project ) standard specifications . it is noted that the present application is not restricted to the above preferred embodiment , but can be applied in any network architecture , where service configuration parameters have to be downloaded or transmitted from the network to a terminal device . furthermore , any desired trigger event and / or condition can be used for activating the discovery procedure . the preferred embodiment may thus vary within the scope of the attached claims . | 7 |
a major factor in determining the effectiveness of an immobilized enzyme process is the length of time the enzyme charge remains active . as mentioned above , the enzyme naturally decays as the process proceeds . although not wishing to be bound by a particular theory of how the enzymes decay , it is believed that thermal as well as chemical denaturation are contributors to the decay . one response to this problem has been simply to reduce the flow of reactants through the immobilized system as the efficiency of the system drops . however , since flow rates can vary by a factor of 10 or more , it is necessary to establish a series of columns in order to provide for a continuous output . other responses have been to suspend operations of the system periodically , remove the spent enzyme and recharge with fresh enzyme ; or as described in u . s . pat . no . 3 , 960 , 663 , add fresh enzyme periodically as the spent enzyme is leeched into the eluent . the invention provides an approach which is superior to those discussed above in that fresh enzyme may be added to the system without suspending operation , the output can be maintained at a constant level or , if desired , can be increased and the eluent is substantially free of spent enzyme . this invention provides a method wherein during the initial preparation of an immobilized system the enzyme is added to the support in an amount which is less than the maximum carrying capacity of the adsorbent , i . e ., the support is underloaded , thus a constant output is maintained by introducing fresh enzyme as necessary until such time as the maximum carrying capacity of the support is reached . since adsorption based immobilization techniques reflect the charge interactions of the enzyme with the support , hydrophobic interactions between enzyme and support , etc ., the choice of a particular enzyme - support combinations must be determined empirically . useful supports include : 1 . weak base polystyrene resins such as : amberlite ira - 93 ( rohm & amp ; haas ), diaion wa - 30 ( mitsubishi ), diaion wa - 11 ( mitsubishi ), amberlite ir - 45 ( rohm & amp ; haas ); 2 . weak base (- n ( r ) 2 ) phenol - formaldehyde resins such as : duolite ea - 561 ( diamond shamrock ), duolite es - 562 ( diamond shamrock ), duolite es - 568 ( diamond shamrock ); 3 . strong base (- n ( r ) 3 ) polystyrene resins such as : xe - 352 ( rohm & amp ; haas ), amberlite ira - 900 ( rohm & amp ; haas ), amberlite ira - 904 ( rohm & amp ; haas ), amberlite ira - 938 ( rohm & amp ; haas ), gia - 01 ( mitsubishi ), diaion pa - 308 ( mitsubishi ), diaion pa - 304 ( mitsubishi ), diaion sa - 21a ( mitsubishi ), sumitomo resin ( sumitomo co . ltd ., japan ); 4 . miscellaneous enzyme adsorbants such as : deae - sephadex ( derivatized crosslinked dextran -- pharmacia ), deae - glycophase ( controlled pore glass coated with carbohydrate and derivatized -- pierce chemical co . ), qae - glycophase ( strong base counterpoint to above ), deae - biogel a ( derivatized crosslinked agarose gel beads -- bio - rad ), selectacel deae - cellulose granular . brown co ., vistec d2 & amp ; d3 ( granular deae - cellulose from viscose -- viscose group ltd . ), deae sephacel ( bead deae - cellulose -- pharmacia ), deae - cellulose beads ( u . s . pat . no . 4 , 090 , 022 ), deae - cellulose beads ( polytechna , czechoslovakia ), controlled pore glass ( corning glass ) and controlled pore aluminia , titania , zirconia ( corning glass ). it is preferred to use those supports which are weakly basic anion exchange supports . most preferred being deae sephadex or deae - cellulose type supports . the preferred supports also have a capacity for the enzyme adsorbed thereon of at least about 684 igiu / gram of support , or at least about 222 igiu / ml of support , on a dry basis . a wide variety of enzymes may be adsorbed to the above supports ; the particular support may be easily selected by the skilled artisan without undue experimentation . it is preferred to employ such enzymes as glucose isomerase , glucoamylase , aminoacylase , invertase , β - glucanase , glucose - 1 - oxidase and glucose - 2 - oxidase . if the immobilization is based solely on electrostatic attraction there is a possibility for the conjugates to dissociate when the ionic strength , ph , or temperature of the reaction is varied . it is preferred to select an enzyme which binds with high avidity to the support to minimize these effects . alternatively , it is possible to increase the charge on the protein by chemical modification , such as was done with amyloglucosidase by solomon and levine ( biotechn . bioeng . 16 : 1161 [ 1974 ]). a particularly useful enzyme for practicing the subject invention is glucose isomerase . although not intended to limit the scope of the invention , the following examples provide specific details relative to one particular enzyme / support combination . this example describes periodic addition of a partially purified , soluble glucose isomerase to an isomerization reactor containing a partially loaded carrier 5 in a manner such that essentially a constant rate of isomerization was maintained for 8 weeks . the activity was thereafter doubled and maintained at the elevated level for an additional 19 weeks . a 1460 ml batch of streptomyces rubiginosus fermentation broth was filtered , and the cells were resuspended in 730 ml deionized water and refiltered twice . the cells were reslurried in 1460 ml of deionized water . the ph of the slurry was adjusted to 6 . 5 with dilute hcl , and 10 mg of lysozyme and 1700 ppm variquat ( a dimethylalkylbenzylammonium chloride ) were added . the mixture was incubated at 40 ° c . for 3 . 6 hours with gentle overhead stirring to extract soluble isomerase from the cells . the soluble enzyme was removed from cellular debris by filtration and assayed at 18 igiu / ml . see lloyd , n . e . , khaleeluddin , k . and lamm , w . r . ( 1972 ), cereal chem . 49 , 544 for a description of the assay method . the international glucose isomerase unit is defined as that amount of enzyme which catalyzes the transformation of d - glucose to d - fructionse at the rate of 1 μmole / minute under the specified conditions ( ph 7 . 0 , 60 ° c ., 2 . 0m glucose , 0 . 02m mg ++, 0 . 001m co ++ , 0 . 2m sodium maleate buffer ). the weak - base carrier used to immobilize soluble glucose isomerase was a granular deae - cellulose ( gdc ). the general method of preparation whereby ground cellulose and a weighting agent are agglomerated with plastic and then the cellulose is derivatized with diethylaminoethyl chloride to impart weak base properties thereto is described in u . s . pat . no . 4 , 355 , 117 assigned to nabisco brands , inc . specifically a mixture of 36 lb . c - 100 ground cellulose ( international filler corp .) and 24 lb . calcined alumina ( reynolds rc - 20 ) was compounded with 60 lbs . of high - impact polystyrene ( hammond plastics ) on a 200 ° c . roll mill until the plastic was molten and the mixture was homogeneous . the granular cellulose composite was cooled , ground by multiple passes through a hammer mill and screened to yield a 40 to 80 u . s . standard mesh fraction . the screened material ( 36 lbs .) was slurried in an alkaline sulfate solution comprised of 37 lbs . sodium sulfate , 4 . 8 lbs . sodium hydroxide and 14 . 1 gallons water . the slurry was heated to 40 ° c . and 14 . 15 lb . of a 50 % water solution of diethylaminoethyl chloride hydrochloride was metered into the slurry with stirring at a rate of 115 ml / minute ( about 1 hour addition time ). the slurry was stirred an additional 30 minutes , 7 . 2 lbs . of 50 % naoh was added and another 14 . 15 lbs . of 50 % diethylaminoethyl chloride hydrochloride was metered in as above . the slurry was heated to 60 ° c ., diluted with 15 gallons water , ph adjusted to 4 . 5 with hcl and washed over a 60 mesh shaker screen . the gdc was reslurried , ph adjusted to 7 . 0 - 7 . 5 and dewatered on a 60 mesh screen . the adsorption capacity of the carrier was measured as follows . to 100 ml soluble enzyme was added 2 . 63 g dry basis carrier . the ph was adjusted to 7 . 0 and the slurry was agitated gently for 5 hours . adsorption was followed by filtering aliquots at timed intervals and measuring soluble isomerase activity . ______________________________________time soluble activityhours igiu / ml % adsorbed______________________________________0 18 . 0 0 . 25 12 . 7 29 . 41 5 . 8 67 . 82 2 . 5 86 . 13 1 . 2 93 . 34 0 . 4 97 . 85 0 100______________________________________ the measured capacity of the carrier for soluble isomerase was therefore about 684 igiu / g dry basis . gdc carrier was partially loaded with soluble isomerase to about 25 % of capacity as follows . gdc ( 14 . 8 g dry basis ) was slurried in deionized water and the ph adjusted to 7 . 0 - 7 . 1 . the slurry was deaerated under water - aspirator vacuum at room temperature for 60 minutes and was poured into a one inch diameter by 12 inch long ace glass ajustachrom ® jacketed glass column fitted with a fritted glass bottom . the bed was packed to a depth of 3 . 54 inches . glass beads were placed on top of the bed ( 4 inches ) to distribute flow . the gdc was loaded by pumping 145 ml ( 2600 igiu ) of soluble isomerase downflow through the bed at 1 ml / minute and room temperature . no measurable soluble activity passed through the bed . since the column has a one inch diameter and the bed of partially loaded carrier therein was packed to a depth of 3 . 54 inches , the volume of the bed in the column was 45 . 56 ml or cm 3 , based on the equation ## equ1 ## then since the column contained 14 . 8 grams of the carrier , and the enzyme capacity of the carrier was 684 igiu / gram of carrier , the capacity of the carrier in the column was 222 igiu / ml of carrier , based on the equation ## equ2 ## thus the carrier had a capacity of at least 222 igiu / ml or 684 igiu / gram on a dry basis . the water jacket on the column was attemperated at 61 ° c . a 50 % solution of crystalline dextrose at ph 7 . 8 containing 5 mm mgso 4 and 5 mm nahso 3 was started downflow through the bed of immobilized isomerase at a flow rate of 0 . 4 ml / minute . the column was run 16 hours . a sample of effluent was taken for analysis and the immobilized activity was determined according to the following equation : ## equ3 ## where e t = total immobilized activity in igiu k f = reaction rate constant at 61 ° c . ( 0 . 019 g / igiu / hour ) ## equ4 ## io = i of influent = 0 for crystalline dextrose i e = i at equilibrium = 0 . 510 at 61 ° c . degree of isomerization , i , was measured polarimetrically as follows : samples of column influent and effluent were diluted 20 fold with deionized water and held 1 hour to allow rotation equilibrium to be reached . rotation measurements were made on a perkin elmer model 241 polarimeter at 25 ° c . with a mercury source wavelength of 576 nm . the instrument was zeroed with water in the cell and rotation readings in degrees of the diluted influent and effluent were taken . ## equ5 ## where i = i o ## equ6 ## d = dilution factor ( 5 ml - 100 ml ) = 20 l = polarimeter cell length = 1 dm [ α d ]-[ α f ]= change in specific rotation for converting pure dextrose to pure fructose : measured with mercury light = 167 . 33 . the immobilized activity determined by the assay method was 1548 igiu indicating that of the 2600 igiu soluble activity loaded on the carrier , 60 % was expressed as immobilized activity . a 50 % solution of cornstarch hydrolyzate containing dextrose on a dry solids basis , 5 mm mgso 4 and 5 mm nahso 3 was adjusted in ph to 7 . 8 , and started downflow through the bed of immobilized isomerase at 61 ° c . initial flow through the column was calculated from equation 1 and was set to provide a fructose conversion of about 44 %. this flow of about 17 ml / hour was held constant except during assay of immobilized activity . fructose content of the effluent was measured essentially by the method as for determining degree of isomerization . fructose level dropped gradually over a period of 16 days to about 40 % whereupon the first addition of soluble enzyme was made . an assay of immobilized activity indicated that about 800 igiu was required to replenish lost activity and increase fructose conversion to 44 %. accordingly , 40 ml of enzyme ( 720 igiu ) was added to 126 ml of 50 % crystalline dextrose solution containing salts as above . feed to the column was switched to the enzyme - containing dextrose solution and was allowed to flow at 0 . 3 ml / minute until depletion . effluent taken from the column during the enzyme - adsorption process was found to contain no soluble isomerase ( determined by incubating effluent 16 hours at 61 ° c . and measuring for increased fructose content ). crystalline dextrose solution was then continued as feed to assay the additional immobilized activity . feed was switched back to cornstarch hydrolysate and the effluent fructose level was restored to 44 %. this sequence of allowing the fructose level in the effluent to gradually decrease to about 40 %, switching to a crystalline dextrose feed solution for assay of immobilized activity , addition of soluble enzyme through the dextrose feed stream , reassay for added immobilized activity and switching back to cornstarch hydrolyzate feed was continued for 17 weeks . for the remaining 10 weeks of the trial , the sequence was modified to eliminate assay of immobilized activity before and after enzyme addition . a constant amount of soluble enzyme was periodically added thereafter . fructose during this time was allowed to vary only between the arbitrarily set limits of 40 - 44 % with flow rate being held constant . of course , tighter limits could be set necessitating more frequent additions of soluble enzyme . after 7 . 5 weeks of operation enzyme activity in the column was double with no significant effect on the operations other than allowing a faster flow rate to achieve 40 %- 44 % fructose . after 13 weeks of operation , the level of salts in the cornstarch hydrolyzate feed were dropped to 1 mm mgso 4 ( from 5 mm ) and 2 mm nahs ) 3 ( from 5 mm ). at 20 weeks assay of effluent taken during enzyme loading indicated some leakage of soluble activity . the last enzyme addition made before leakage occurred brought the total enzyme adsorbed to a value of 649 igiu / g or close to the capacity measured initially of 684 igiu / g . leakage increased during subsequent loading operations although sufficient fresh enzyme was adsorbed to maintain fructose conversion of over 40 %. the fact that enzyme was still adsorbed after the initially measured capacity had been exceeded indicated that some inactive enzyme may be desorbed . table i summarizes fructose production and enzyme additions over the 27 week trial . the amount of fructose produced is expressed as grams of 43 % fructose syrup on a dry basis . weekly actual fructose production data was normalized to 43 % fructose production . table i______________________________________summary of isomerizationand enzyme addition enzyme enzyme aver - accumulative enzyme addi - accumu - age fructose efficiency tion lation fruc - g 43 % igiu / gweek igiu igiu tose % dry basis of 43 % f______________________________________ 1 2600 2600 43 . 7 2059 1 . 26 2 42 . 5 3606 0 . 72 3 720 3320 39 . 1 4851 0 . 68 4 42 . 3 6533 0 . 51 5 43 . 1 8292 0 . 40 6 41 . 6 9891 0 . 34 7 39 . 8 11298 0 . 29 8 3200 6520 39 . 5 12379 0 . 53 9 44 . 7 15293 0 . 4310 44 . 6 18302 0 . 3611 43 . 5 20476 0 . 3212 43 . 6 22789 0 . 2913 470 6990 41 . 1 24856 0 . 2814 940 7930 41 . 4 26764 0 . 3015 44 . 3 29322 0 . 2716 40 . 4 31298 0 . 2517 940 8670 43 . 4 33733 0 . 2618 40 . 7 35433 0 . 2419 940 9610 43 . 2 37949 0 . 2520 940 10550 42 . 7 40162 0 . 2621 42 . 0 42264 0 . 2522 940 11490 43 . 3 44497 0 . 2623 41 . 9 46730 0 . 2524 940 12430 41 . 9 48811 0 . 2525 44 . 5 51011 0 . 2426 43 . 0 52737 0 . 2427 770 13200 41 . 1 54528 0 . 24______________________________________ this example described on - column loading whereby the soluble glucose isomerase used to partially load the carrier initially and for subsequent additions is of high purity . column operations were the same as for example i in that the flow rate of cornstarch - hydrolyzate feed was held constant and periodic additions of soluble enzyme in a solution of crystalline dextrose were made through the feed line . fructose conversion was thus maintained between 40 - 44 % for 14 weeks . the 45 % solids refined cornstarch hydrolyzate feed contained about 95 % dextrose , 1 . 5 mm mgso 4 , and 2 . 0 mm nahso 3 . the ph of the influent was controlled around ph 7 . 8 to provide an effluent ph of 7 . 5 ; temperature of the immobilized enzyme bed was controlled at 60 ° c . streptomyces rubiginosus fermentation broth was extracted to release soluble glucose isomerase from the cells as in example 1 except that the cells were not separated from the broth and washed before extraction . a 2350 ml portion of the filtered extract was purified by fractionation on a granular deae - cellulose column . the granular deae - cellulose column was the same material as the carrier for immobilized enzyme in example 1 . to prepare the column 300 g dry basis gdc was equilibrated in 10 mm tris buffer and the suspension poured into a 2 inch chromatography column to form a uniform bed . the column was washed with 2 liters of 10 mm tris buffer at a flow of 10 ml / minute or until the effluent ph was about 7 . the enzyme solution containing 29 . 3 igiu / ml was applied to the column downflow at a flow of 5 ml / minute . after the enzyme had been applied , the column was washed with 3 . 5 liters of 0 . 1m nacl in 10 mm tris buffer ph 7 at a flow of 10 ml / minute . enzyme content of effluent fractions was monitored by ultraviolet absorbance and enzyme assay . fractions containing greater than 20 igiu / ml were pooled ( 900 ml ) for additional purification by ultrafiltration . the pooled fractions were ultrafiltered with amicon xm - 100 membrane in an amicon 407 stirred cell under 10 psig n 2 . the ultrafilter retentate contained 800 igiu / ml of about 50 % pure enzyme . gdc carrier ( 7 . 75 g dry basis ) was added to a glass column as described in example 1 . the carrier was loaded with purified enzyme to about 25 % of its capacity by pumping downflow a 50 % crystalline dextrose solution ( ph 7 . 8 , 4 mm mgso 4 , 5 mm nahso 3 ) containing 136 ml of the purified enzyme diluted 1 to 40 ( 2720 igiu ) at a flow rate of 0 . 4 - 0 . 7 ml / minute . no soluble enzyme was detected in the effluent . flow of crystalline dextrose solution ( ph 7 . 8 , 5 mm mgso 4 , 5 mm nahso 3 ) was continued for assay and the column jacket attemperated with water such that the temperature of the column bed was 60 ° c . immobilized activity determined by the assay method of example 1 was 1686 igiu for an expression of activity based upon that adsorbed of 62 %. cornstarch hydrolyzate was started through the bed of immobilized enzyme and the flow was adjusted to provide a fructose conversion of 40 - 44 %. the flow rate was held constant at about 0 . 35 ml / minute for the duration of the trial . as the fructose level dropped with time due to enzyme decay , about a 20 ml aliquot of diluted , purified soluble isomerase containing 434 igiu was added to a 50 % solution of crystalline dextrose ( ph 7 . 8 , 5 mm mgso 4 , 5 mm nahso 3 ) and the solution pumped through the bed at about 0 . 4 ml / minute . after adsorption the feed was switched back to cornstarch hydrolyzate . table ii summarizes isomerization performance and enzyme additions . as in example 1 , essentially constant fructose conversion was maintained at a constant flow rate by means of periodic addition of soluble isomerase . table ii______________________________________summary of isomerizationand enzyme addition enzyme enzyme aver - accumulative enzyme addi - accumu - age fructose efficiency tion lation fruc - g 43 % igiu / gweek igiu igiu tose % dry basis of 43 % f______________________________________1 2720 2720 33 . 5 1608 1 . 692 434 3154 41 . 3 3149 1 . 003 434 3588 42 . 9 4756 0 . 754 3588 43 . 6 6117 0 . 595 434 4022 42 . 3 8236 0 . 496 4022 43 . 1 9664 0 . 427 434 4456 41 . 6 11240 0 . 408 434 4890 41 . 0 12924 0 . 389 4890 41 . 9 14585 0 . 3410 434 5324 45 . 1 16366 0 . 3311 5324 43 . 2 18152 0 . 2912 434 5758 42 . 1 19535 0 . 2913 5758 42 . 4 21108 0 . 2714 5758 38 . 7 22624 0 . 25______________________________________ | 2 |
fig1 is an isometric exploded view of the transformer structure having double - axis iron core of the invention . fig1 is an isometric exploded view of the first embodiment of the iron core structure of the transformer structure having double - axis iron core of the invention while fig2 is an isometric view of the first embodiment of the schematic assembled transformer structure having double - axis iron core of the invention . as shown in fig1 and fig2 , an iron core structure of the transformer structure having double - axis iron core of the invention includes an iron core main body ( 1 ) having a base ( 11 ) that a side convex part ( 12 ) on each of the two parallel and opposite edge is furnished respectively thereof making a containing space ( 13 ) naturally forms between the two side convex parts ( 12 ). moreover , a chamfered part ( 14 ) is furnished respectively on each end of the side convex parts ( 12 ) of the base ( 11 ). what is more , the base ( 11 ) can be a rectangular thin flat body ( the ratio of the length and width is preferably 2 : 1 ) where the two side convex parts ( 12 ) are furnished on the inner side edges of the lengthwise - side ( 111 ). in the first embodiment of the invention , the iron core main body ( 1 ) is capable of combing with another identical iron core main body ( 1 ) in coordination with two identical lead frames ( 2 ) wherein the lead frame ( 2 ) has a center slot ( 21 ) for slipping over the side convex part ( 12 ). moreover , a wire - winding channel ( 22 ) for providing a space for winding a coil ( 20 ) is furnished at the periphery of the center slot ( 21 ). what is more , a plurality of leads ( 23 ) for connecting to the coil ( 20 ) are furnished at the outer edge of the lead frame ( 2 ) corresponding to the base ( 11 ). in addition , the other iron core main body ( 1 ) is combined with the opposite corresponding iron core main body ( 1 ) by having their corresponding side convex parts ( 12 ) contact each other making the two lead frames ( 2 ) and the coil ( 20 ) capable to combine together between the two opposite iron core main bodies ( 1 ). in this way , each of the leads ( 23 ) are stretched toward the direction of the two outer side convex parts ( 12 ) to form a transformer structure . fig3 is an isometric exploded view of the second embodiment of the iron core structure of the transformer structure having double - axis iron core of the invention while fig4 is an isometric view of the second embodiment of the schematic assembled transformer structure having double - axis iron core of the invention . as shown in fig3 , and fig4 , the second embodiment of the iron core structure of the transformer structure having double - axis iron core of the invention mainly includes two iron core sets ( 10 ) and a lead frame ( 3 ) where the iron core sets ( 10 ) are combined by having the identical iron core main bodies ( 1 ) arrange adjacently and in parallel by side convex parts ( 12 ) respectively and the two iron core sets ( 10 ) are combined by having the corresponding side convex parts ( 12 ) oppositely contact each other . the lead frame ( 3 ) has a center slot ( 31 ) for slipping over the side convex parts ( 12 ) that are arranged adjacently and in parallel with the iron core sets ( 10 ). moreover , a wire - winding channel ( 32 ) for providing a space for winding a coil ( 30 ) is furnished at the periphery of the center slot ( 31 ). what is more , a plurality of leads ( 33 ) for connecting to the coil ( 30 ) is furnished at each of the other side edges other than the side convex part ( 12 ) corresponding to the base ( 11 ) of the lead frame ( 3 ). in the above - mentioned structure , after combining with the two iron core sets ( 10 ), the lead frame ( 3 ) is capable of having its wire - winding channel ( 22 ) and coil ( 20 ) exactly contain in the containing space ( 13 ) of the two iron core main bodies ( 1 ) and having part of itself expose out of the two iron core main bodies ( 1 ). moreover , another transformer structure is formed by having the plurality of leads ( 23 ) that are furnished on both ends of the lengthwise - side ( 111 ) of the two iron core main bodies ( 1 ), thereby another kind of transformer structure is formed . fig5 is an isometric exploded view of the third embodiment of the iron core structure of the transformer structure having double - axis iron core of the invention while fig6 is an isometric view of the third embodiment of the schematic assembled transformer structure having double - axis iron core of the invention . as shown in fig5 and fig6 , the third embodiment of the transformer structure having double - axis iron core of the invention includes two iron core sets ( 100 ) and a lead frame ( 4 ). the iron core sets ( 100 ), each has four chamfered parts ( 14 ) at its four corners , are formed into an annular connecting body by having their chamfered part ( 14 ) contact one another with four near - center inner side convex parts ( 101 ) and four far - center outer side convex part ( 102 ). the two iron core sets ( 100 ) are also combined together by oppositely having each of its near - center inner side convex parts ( 101 ) and each of its far - center outer side convex part ( 102 ) contact one another . the lead frame ( 4 ), having a center hole ( 41 ) for being slipped on by the near - center inner side convex parts ( 101 ), has a wire - winding channel ( 42 ) at the periphery thereof for being wound by the coil ( 40 ) and has a plurality of leads ( 43 ) furnished at the side of the connecting part of each of the iron core main body ( 1 ) of the iron core set ( 100 ) corresponding to the lead frame ( 4 ). in the above - mentioned structure , after combining with the two iron core sets ( 100 ), the lead frame ( 4 ) is capable of having its wire - winding channel ( 42 ) and coil ( 40 ) exactly contain in the containing space ( 13 ) of the two iron core main bodies ( 1 ) and having part of itself expose out of the two iron core main bodies ( 1 ). moreover , each of the leads ( 43 ) of the lead frame ( 4 ) is furnished on the outer side of the connecting part of the each of the iron core main body ( 1 ) and will not protrude out of the covered area of the iron core set ( 100 ), thereby is capable of effectively diminishing its occupying space , thereby , another kind of transformer structure is formed . when it comes to practical application , in the structure of the third embodiment of the transformer structure having double - axis iron core of the invention , a polygonal annular connecting body ( not limited to a pure quadrilateral annular connecting body ) can be formed by a plurality of iron core main bodies ( 1 ) in coordination with the angle of the chamfered part ( 14 ). moreover , a transformer structure having a polygonal iron core set ( 100 ) can also be formed in coordination with the lead frame structure having the similar shape . in conclusion , the transformer structure having double - axis iron core of the invention indeed possesses the efficacies of lowing the cost of material , improving efficiency of space utilization , and generating a multiplicity of product having combinational variation to meet the patentability of having industrial utilization , non - obviousness and progressiveness subject matter . it will become apparent to those people skilled in the art that various modifications and variations can be made to the structure of the invention without departing from the scope or spirit of the invention . in view of the foregoing description , it is intended that all the modifications and variation fall within the scope of the following appended claims and their equivalents . | 7 |
before the description of the present invention proceeds , it is to be noted that like parts are designated by like reference numerals throughout the accompanying drawings . referring now to the drawings , the present invention will be described hereinbelow with respect to one preferred embodiment thereof . in fig1 there is shown a copying apparatus 1 equipped with an automatic original document feeding device 100 according to the present invention . the copying apparatus 1 generally includes a housing 1a , a photosensitive or photoreceptor drum 10 having a photoconductive layer 10a on its peripheral surface and rotatably provided at a central portion of the housing 1a for rotation in a direction indicated by an arrow ( a ), and various processing devices such as a corona charger 11 for uniformly charging the photoconductive surface 10a of the photoreceptor drum 10 , a developing device 12 for causing toner to adhere onto the surface 10a of the photoreceptor drum 10 for developing , a transfer charger 13 for transferring the toner adhering to the surface of the photoreceptor drum 10 , onto a copy paper sheet , a separating charger 14 for reducing any electrostatic attracting force between the copy paper sheet and the surface 10a of the photoreceptor drum 10 , an eraser lamp 15 for erasing the electrical charge on the photoreceptor drum 10 , and a cleaning device 16 for removing the toner remaining on the surface of the photoreceptor drum 10 , etc ., which are sequentially disposed around the photoreceptor drum 10 in a known manner for effecting the copying function . the copying apparatus 1 also includes an optical system 20 having an exposure lamp 21 , a first mirror 22 and a second mirror 23 which are arranged to scan in a direction indicated by an arrow ( b ), an image forming lens 24 , a third mirror 25 , and a fourth mirror 26 . an original document ( not particularly shown ) placed on a transparent original document platform 19 , for example , of a glass material is subjected to light projection from the exposure lamp 21 , and light reflected therefrom is projected on the surface 10a of the photoreceptor drum 10 via the fourth mirror 26 through the first mirror 23 , second mirror 23 , image forming lens 24 and third mirror 25 . in the above case , the exposure lamp 21 and the first mirror 22 are moved at a speed of v / m ( m = copying magnification ) with respect to a circumferential speed v of the photoreceptor drum 10 in the direction of the arrow ( b ), while the second mirror 23 is moved at a speed of v / 2m also in the direction of the arrow ( b ). meanwhile , the copy paper sheets are accommodated in a paper feeding device 30 of a cassette type detachably mounted at one side of the apparatus housing 1a or in a paper feeding device 40 having a vertically movable platform 40a and provided at the lower portion of said housing 1a , and are fed , one sheet by one sheet , from the uppermost sheet of the stack through rotation of either one of a paper feeding roller 31 or 40b as selected by an operator . more specifically , the photoconductive surface 10a of the photoreceptor drum 10 is imparted with a predetermined electrical charge by the corona charger 11 as the drum 10 is driven for rotation in the direction of the arrow ( a ), and is subjected to the image exposure by the optical system 20 so as to be formed thereon with an electrostatic latent image of the original document , which is developed by the developing device 12 into a visible toner image to be subsequently brought to the transfer station provided with the transfer charger 13 . the copy paper sheet fed from either one of the paper feeding device 30 or 40 is directed upwardly by a u - turn roller 32 , and is transported to the transfer station in synchronization with the toner image through a set of timing rollers 33 . at the transfer station , the toner image is transferred by the transfer charge 13 onto the copy paper sheet thus fed , which is immediately separated from the surface 10a of the photoreceptor drum 10 by the charge erasing function of the separating charger 14 and the resiliency of the copy paper sheet itself so as to be subsequently fed into a fixing device 35 through a suction belt 34 . in the fixing device 35 , the copy paper sheet is subjected to fusing and fixing of the toner image thereonto , and is then discharged from a pair of discharge rollers 37 through a set of cooling rollers 36 . the copying apparatus 1 further includes a paper re - feeding section 50 for enabling forming duplexed copies and a sorter 60 . the paper re - feeding section 50 referred to above is provided with a first feeding path 41 directed from the set of discharge rollers 37 towards the sorter 60 , a fourth feeding path 44 directed to a paper re - feeding tray 51 to be mentioned later , and a change - over claw 45 pivotally provided at the branching portion between the first feeding path 41 and the fourth feeding path 44 . on the other hand , the sorter 60 has a second feeding path 42 leading to a discharge table 38 , a third feeding path 43 directed towards a plurality of bins 62 , and another change - over claw 46 provided at a branching portion between the second feeding path 42 and the third feeding path 43 . more specifically , in the case where the copy paper sheet is to be directly discharged onto the discharge table 38 in a one side copying operation , such copy paper sheet is fed via the first feeding path 41 and the second feeding path 42 . meanwhile , when it is required to align pages of the copy paper sheets to be discharged onto the discharge table 38 , the copy paper sheet is transported to the first feeding path 41 via rollers 48a , 48b and rollers 47 , with the front and reverse sides thereof reversed by subjecting the rollers 47 to reverse rotation , after one being fed into the fourth transport path 44 , and is then discharged onto the discharge table 38 . otherwise , for the classification at the sorter 60 , the copy paper sheets are fed from the first feeding path 41 to the third feeding path 43 , and are successively accommodated into respective bins 62 through stepped downward movement of a deflecting portion 61 . on the other hand , in the case of executing a duplex copying operation , the copy paper sheet is transported from the fourth transport path 44 to the paper re - feeding tray 51 for inversion between the front and reverse faces , and from there , transported to the u - turn roller 32 through a paper re - feeding path 52 so as to be further fed to the transfer station via the timing rollers 32 . thereafter , the toner image is transferred onto the reverse face of the copy paper sheet , which is subsequently transported to the second feeding path 42 or the third feeding path 43 from the first feeding path 41 via the fixing device 35 . subsequently , construction of the automatic original document feeding device 100 will be explained together with the functioning thereof . the automatic original document feeding device 100 generally includes an original document feeding section 110 , an original document transport section 120 , an original document inverting section 130 and an original document discharge tray 140 . the original document feeding section 110 is so constructed that a paper feeding belt 112 and a separating belt 113 each movably supported by sets of spaced rollers are provided before an original document tray 111 , while an original document presser plate 114 is pivotally provided for upward and downward movements immediately above the paper feeding belt 112 . the original document ( not particularly shown ) is placed face down on the tray 111 , with its leading edge being inserted between the belts 112 and 113 , and is depressed by the presser plate 114 . the original document feeding section 110 is brought into a stand - by state at the time point when a sensor sel provided therein has detected the set original document , and the paper feeding belt 112 is driven in a counterclockwise direction by a paper feeding motor ( not shown ), thus feeding the separated original documents one sheet by one sheet , by moving the separating belt 113 in the same direction . in the original document transport section 120 , a transport belt 122 in the form of an endless belt is movably supported by a driving roller 121a and a driven roller 121b so as to be driven in a forward or reverse direction by a main motor ( not shown ) in a position above and adjacent to the original document platform 19 . there are also provided a transport roller 123 , a pair of pinch rollers 124 , and original document detecting sensors se2 and se3 at the feeding side , while an original document stopper 125 , a discharge roller 126 which can be driven for rotation in the forward or reverse direction , a guide roller 127 held in pressure contact with said roller 126 to follow in rotation , and an original document sensor se4 are disposed at the discharge side . the stopper 125 is connected to a stopper solenoid ( not shown ), which projects into the original document feeding path when turned off , thereby to stop , at a predetermined position , the original document transported towards the left side in fig2 on the original document platform 19 through the movement of the transport belt 122 in the forward or clockwise direction , while the stopper solenoid , when turned on , is retracted downwards to make it possible to discharge the original documents . in the original document inverting section 130 , driven guide rollers 133a , 133b , 133c and 133d are held in pressure contact with an inverting roller 131 driven for rotation in the clockwise direction by an inverting motor ( not shown ) and a transport roller 132 , while an original document sensor se5 is provided before the inverting roller 131 . a return solenoid ( not shown ) is connected to an inverting guide plate 134 , which is located in a position located in the counterclockwise direction from the solid line position in fig2 when said solenoid is turned off so as to close the inverting path for leading the original document onto the discharge tray 140 . meanwhile , upon turning on of the return solenoid , the inverting guide plate 134 is rotated to the solid line position , thereby to invert the original document discharged from the transport section 120 along the inverting roller 131 . the original document thus inverted is again returned onto the platform 19 through reverse rotation of the discharge roller 126 and movement of the transport belt 122 in the reverse direction . on the upper surface of the original document feeding section 110 , there is provided a start switch sw for starting the functioning of the automatic original document feeding device 100 . this start switch sw is of a self - illuminating type switch incorporating red and green lamps , and is arranged to light the green lamp in a state where the feeding device 100 is capable of accepting the operation through the start switch sw , and to light the red lamp when the feeding device 100 can not accept the operation therethrough . the procedures for controlling the original document feeding device 100 will be described in more detail later with reference to flow - charts . in fig3 there is shown a control panel p provided on the upper portion of the housing 1a of the copying apparatus 1 , and including a print switch 70 , a group of keys 71 for setting the number of copies to be taken , a display portion 72 , for example , by liquid crystal , and copying mode selecting switches 73 and 74 . the print switch 70 referred to above is of a self - illuminating type incorporated with red and green lamps , and adapted to light the green lamp when the copying apparatus is ready to accept the operation through the print switch 70 , and to light the red lamp in the state where the copying apparatus can not accept the operation by said switch 70 . meanwhile , the copying mode selecting switches 73 and 74 are arranged to select how to copy a one sided or duplexed original document ( i . e ., for one side copying or both side copying ), and are composed of see - saw type switches . for the copying modes , four kinds of modes are available , i . e ., ( i ) one sided original document to one side copying , ( ii ) one sided original document to both side copying , ( iii ) duplexed original document to one side copying , and ( iv ) duplexed original document to both side copying . mode ( i ) may be selected by depressing an upper right portion 73a of the switch 73 , while mode ( ii ) can be selected by depressing an upper left portion 73b thereof , respectively . mode ( iii ) may be selected through depression of an upper right portion 74a of the switch 74 , while mode ( iv ) may also be selected by depressing an upper left portion 74b of said switch 74 . the above selection is indicated by the lighting of display light emitting diodes 75a , 75b , 76a and 76b provided at the side portions of the upper portions of the respective switches . there are also provided an interrupting key 77 for effecting the interrupting copying by suspending the copying operation currently executed at a predetermined timing , and a group of keys 78 for selection of copying magnifications . referring to fig4 ( a ), there is shown a control circuit for the copying apparatus main body 1 , in which a micro - computer cpu 1 includes input ports p0 , p1 , p2 , p3 , p4 , p5 , p6 and p7 , and output ports p10 , p11 , p12 , p13 and p14 . to the input port p0 , a copy starting signal is applied , while to the input port p1 , original document feeding preferential mode signals ( to be described later ) are inputted respectively from micro - computer cpu 2 for a control circuit of the automatic original document feeding device 100 . to the input port p2 , on / off signals of the print switch 70 are applied , while on / off signals of the interrupting key 77 are inputted to the input port p3 . meanwhile , on / off signals of the copying mode selecting switches 73 and 74 are applied to the input ports p4 through p7 . on the other hand , the output ports p10 and p11 are connected to a driver circuit for turning on or off motor , solenoids , etc . within the copying apparatus 1 , and also for selective illumination and / or flickering of the green and red print lamps incorporated in the print switch 70 . in fig4 ( b ) showing the control circuit for the automatic original document feeding device 100 , the microcomputer cpu 2 is provided with input ports p0 &# 39 ;, p1 &# 39 ;, p2 &# 39 ; and pi and output ports p10 &# 39 ;, p11 &# 39 ;, p12 &# 39 ; and pj1 and pj2 as shown . to the input port p0 &# 39 ;, a signal representing whether or not the original document is of the duplexed original document is applied , and to the input port p1 &# 39 ;, a copying completion signal is inputted , while to the input port p2 &# 39 ;, an interrupting signal is applied respectively from the micro - computer cpu 1 . meanwhile , to the input port pi , on / off signals of the start switch sw for the automatic original document transport device 100 are inputted , and moreover , on / off signals of the original document detecting sensors se1 to se5 are also applied thereto ( not shown ). on the other hand , the output ports p10 &# 39 ; to p12 &# 39 ; are connected to a driver circuit for turning on or off the main motor for driving the transport belt 122 and the discharge roller 126 , the paper feeding motor for driving the paper feeding belt 112 and the separating belt 133 , the inverting motor for driving the inverting roller 131 and transport roller 132 , and also the stopper solenoid for driving the original document stopper 125 and the return solenoid for driving the inverting guide plate 134 , and further , causing the green and red start lamps incorporated in the start switch sw to light or flicker selectively . the output port pj1 applies the copy start signal to the micro - computer cpu 1 of the copying apparatus 1 , while the output port pj2 applies the original document feeding preferential mode signal thereto . in a continuous flow - chart of fig5 ( a ) and 5 ( b ), there is shown a main routine of the control procedure for the automatic original document feeding device 100 . more specifically , in an initialize sub - routine at step s1 , the initial setting of the micro - computer cpu 2 is effected , and subsequently , in a clock timer sub - routine at step 2 , a basic timer is operated in synchronization with pulse signals of the main motor , while an internal timer is actuated during the off period of the main mode . thereafter , in input and output sub - routines at steps s3 and s4 , the input and output of the micro - computer cpu 2 are executed , and based on the state of the above input and output , a functioning mode for the automatic original document feeding device 100 is determined in a mode set sub - routine at step s5 . in the above mode set sub - routine at step s5 , for example , when the original document to be copied is set and the start switch sw is turned on , adf mode flag is set to &# 34 ; 1 &# 34 ; to execute the paper feeding function sub - routine to be described later . at step s6 , judgement is made as to whether or not the adf mode flag is &# 34 ; 1 &# 34 ;, and if the judgement is &# 34 ; no &# 34 ;, i . e ., when the state is in the copying function in which feeding of the original document is not effected in the feeding device 100 , completion of the copying is waited for at step s7 , and continuously in a transport section open / close check sub - routine at step s8 , the original document transport section 120 is checked to watch out for any original docuemnt carelessly left . if thee is such a left original document , this is indicated in a left original document indication set sub - routine at step s9 . meanwhile , if the judgement is &# 34 ; yes &# 34 ; at step s6 , i . e ., when the copying is effected through employment of the feeding device 100 , the operation for the case where the interrupting key 77 is depressed , is executed in an abnormal signal check sub - routine at step s10 . in a paper feeding function sub - routine at step s11 , the function control from the turning - on of the original document feeding switch to the arrival of the leading edge of the original document at the pinch rollers 124 is executed . meanwhile , in a feeding function sub - routine at step s12 , the original document standing by at the pair of pinch rollers 124 is transported until the leading edge thereof contacts the stopper 125 to be stopped thereat , and the processing for applying the copying start signal to the copying apparatus is effected . in an inverting function sub - routine at step s13 , in the case where the copying by the duplexed original document has been selected , there are effected such processings that the original document is returned to the transport section 120 through the original document inverting section 130 so as to be again stopped by the stopper 125 and the copying start signal is applied to the copying apparatus . in a discharge function sub - routine at step s14 , there is executed the processing for discharging the duplexed original document once inverted or the one sided original document onto the discharge tray 140 as it is . in an inverting feeding function sub - routine at step s14 , the processings to be effected are such that the original document again fed by the re - feeding function immediately after the restoration from the original document jamming or after the interrupting copying is directly fed into the inverting section 130 from the pair of pinch rollers 124 via the transport section 120 for inversion so as to be stopped at the stopper 125 , with the copying start signal being applied to the copying apparatus . on the other hand , in the case where jamming of the original document takes place in the inverting function sub - routine at step s13 or inverting feeding function sub - routine at step s15 , judgement is made at step s17 as to whether or not the front surface of the original document has been copied , and if the judgement is &# 34 ; yes &# 34 ;, the inverting feeding request flag for executing the inverting feeding function sub - routine at step s15 is set to &# 34 ; 1 &# 34 ;. thus , in a jamming indication set sub - routine at step s19 , the processing for effecting the indication for the jamming is excuted . subsequently , when the jamming is removed , with the predeteremined jam restoring operation being effected , the procedure is reverted to step s2 , and more specifically , a jam reset switch ( not shown ) is operated . subsequently , the inverting function sub - routine at step s13 will be described in detail with reference to fig6 ( a ) through 6 ( g ). the above sub - routine is effected after completion of copying for the front surface of the duplexed original document when the functioning mode for a duplexed original document is selected by the operator . thus , when the interrupting signal is inputted during copying of the reverse surface of the duplexed original document , the duplexed original document is inverted to be discharged onto the discharge tray 140 , while the the case where the interrupting signal is released and the discharged original document is again fed , such a control is effected that said original document is immediately passed through the transport section 120 so as to be inverted at the inverting section 130 for being returned to the transport section 120 again . meanwhile , in the case where jamming takes place at the inverting section 130 , and also , in the case where the original document removed from the inverting section 130 is fed again , it is so controlled that said original document is immediately fed to the inverting section 130 via the transport section 120 , and after being inverted at said inverting section 130 , is again fed into the transport section 120 so as to be stopped at the image exposure scanning position . as a result , the operator is only required to set the original document face down on the original document tray 111 at all times . in the first place , at step s20 , it is judged whether or not an inverting flag is &# 34 ; 1 &# 34 ;. this inverting flag is set to &# 34 ; 1 &# 34 ; by the copying completion signal for the front face of the original document , and maintains the set state until the termination of this sub - routine ( so as to be reset at step s100 ). if the inverting flag has been set , it is judged , at step s21 , whether or not an original document stopper solenoid ( referred to as ostsl hereinafter ) request flag is &# 34 ; 1 &# 34 ;. this ostsl request flag is to indicate the on / off state of the original document stopper solenoid . if it is in the off state , i . e ., when the original document stopper 125 has entered the original document feeding path , the ostsl request flag hs been reset to &# 34 ; 0 &# 34 ;, and the judgement is &# 34 ; no &# 34 ; at this step s21 , and it is checked at step s22 , whether or not an ostsl function completion flag is &# 34 ; 1 &# 34 ;. in this case , the judgement is &# 34 ; no &# 34 ; at step s22 because the ostsl function completion flag is still in the reset state to &# 34 ; 0 &# 34 ;, and the ostsl request flag is set to &# 34 ; 1 &# 34 ; at step s23 as well as a timer tmr1 is set to α 1 h at step s24 . this timer tmr1 is intended to provide timing for starting the original document discharge function . simultaneously , at step s25 , the stopper solenoid is turned on so as to be retreated from the original document feeding path , and at step s26 , the ostsl function completion flag is set to &# 34 ; 1 &# 34 ;. on the other hand , if the judgement is &# 34 ; yes &# 34 ; at step s21 , termination of functioning of the timer tmr1 is waited for at step s28 , and upon termination thereof , a tmrj1 request flag is set to &# 34 ; 1 &# 34 ; at step s29 , while a timer tmrj1 is set to α 2 h at step s30 . this timer tmrj1 is intended to check whether or not any jamming has taken place before the original document reaches the transport section de discharge sensor se4 . simultaneously , at step s31 , the main motor is turned on for rotation in the forward direction so as to move the transport belt 122 in the clockwise direction , while at step 32 , the inverting motor is turned on for driving the rollers 131 and 132 in the clockwise direction , and also , at step s33 , the return solenoid is turned on for changing over the inverting guide plate 134 so that the original document is led to the inverting section 130 , and at step s34 , the ostsl request flag is set to &# 34 ; 0 &# 34 ;. by the above procedure , the original document positioned on the original document platform 19 begins to be discharged from the transport section 120 . subsequently , at step s35 , judgement is made as to whether or not the tmrj1 request flag is &# 34 ; 1 &# 34 ;. the judgement is &# 34 ; yes &# 34 ; since the tmrj1 request flag has been reset to &# 34 ; 1 &# 34 ; at step s29 , and at step s36 , it is judged whether or not the transport section df discharge sensor se4 has fallen , i . e ., whether or not the sensor se4 has detected the leading edge of the original document . if the judgement is &# 34 ; no &# 34 ;, it is judged , at step s37 , whether or not the timer tmrj1 is terminated , and if it is terminated , paper jamming has taken place before arrival at the sensor se4 , and the procedure proceeds to said steps s17 , s18 and s19 so as to set the inverting feeding request flag to &# 34 ; 1 &# 34 ;, and also to effect the indication for the jamming . if the leading edge of the original document is detected by the sensor se4 before the timer tmrj1 is terminated ( i . e ., judgement is &# 34 ; yes &# 34 ; at step s36 ), the tmrj1 request flag is reset to &# 34 ; 0 &# 34 ; at step s38 , while at step s39 , the timer tmrj1 is reest . at the same time , at step s40 , a timer tmrj2 is set to α 3 h , and at step s41 , a tmrj2 request flag is set to &# 34 ; 1 &# 34 ;. this timer tmrj2 is intended to check whether or not the paper jamming has taken place before arrival of the original document from the inverting section r to the discharge sensor se5 . subsequently , at step s42 , judgement is made as to whether or not the tmrj2 request flag is &# 34 ; 1 &# 34 ;. the judgement is &# 34 ; yes &# 34 ; since this tmrj2 request flag has been set to &# 34 ; 1 &# 34 ; at step s41 , and at step s43 , it is judged whether or not the inverting section r discharge sensor se5 has fallen , i . e ., whether or not the sensor se5 has detected the leading edge of the original document . if the judgement is &# 34 ; no &# 34 ;, it is checked , at step s44 , whether or not the timer tmrj2 is terminated . if said timer is terminated , it means that paper jamming has taken place before arrival at the sensor se5 , and therefore , the procedure proceeds to steps s17 , s18 and s19 so as to set the inverting transport request flag to &# 34 ; 1 &# 34 ;, and also to effect indication for the jamming . when the leading edge of the original document is detected by the sensor se5 before termination of the timer tmrj2 ( i . e ., judgement is &# 34 ; yes &# 34 ; at step s43 ) the stopper solenoid is turned off at step s45 , and the timer tmrj2 is reset at step s46 , while at step s47 , the tmrj2 request flag is reset to &# 34 ; 0 &# 34 ;. simultaneously , at step s48 , a timer tmr2 is set to α 4 h , and at step s49 , a tmr2 request flag is set to &# 34 ; 1 &# 34 ;. this timer tmr2 is intended to set the timing for stopping the original document discharge function . furthermore , at step s50 , a timer tmrj3 is set to α 5 h , while a tmrj3 request flag is set to &# 34 ; 1 &# 34 ; at step s51 . this timer trmj3 is intended to check whether or not any paper jamming has taken place before the original document reaches the sensor se4 from the sensor se5 through the inverting section 130 . subsequently , at step s42 , it is judged whether or not the tmr2 request flag is &# 34 ; 1 &# 34 ;. the judgement is &# 34 ; yes &# 34 ; since this tmr2 request flag has been set to &# 34 ; 1 &# 34 ; at step s49 . a step s53 , termination of the timer tmr2 is waited for , and upon termination , the main motor is turned off at step s54 to stop movement of the transport belt 122 in the forward direction , with the return solenoid being turned off at step s55 . simultaneously , a reverse rotation starting request flag is set to &# 34 ; 1 &# 34 ; at step s56 , while at step s57 , a timer tmr3 is set to α 6 h . the timer tmr3 is intended to provide timing for the reverse rotation of the main motor . moreover , at step s58 , tmr2 request flag is set to &# 34 ; 0 &# 34 ;, with the timer tmr2 being reset at step s59 . subsequently , at step s60 , it is checked whether or not the reverse rotation starting request flag is &# 34 ; 1 &# 34 ;. since the reverse rotation starting flag has been set to &# 34 ; 1 &# 34 ; at step s56 , the judgement is &# 34 ; yes &# 34 ;. at step s61 , termination of the timer tmr3 is waited for , and upon termination , the main motor is turned on at step s62 for reverse rotation so as to drive the transport belt 122 in the counterclockwise direction . at the same time , tmr3 request signal is reset to &# 34 ; 0 &# 34 ; at step s63 , with the timer tmr3 being reset at step s64 . thereafter , at step s65 , it is judged whether or not tmrj3 request flag is &# 34 ; 1 &# 34 ;. since this tmrj3 request flag has been set to &# 34 ; 1 &# 34 ; at step s51 , the judgement is &# 34 ; yes &# 34 ;, and at step s66 , it is judged whether or not the transport section df discharge sensor se4 has fallen , i . e ., whether or not the sensor se4 has detected the leading edge of the inverted original document . if the judgement is &# 34 ; no &# 34 ;, judgement is made at step s67 as to whether or not the timer tmrj3 is terminated . if said timer is completed , it means that jamming has taken place before arrival at the sensor se4 , and therefore , the procedure is shifted to steps s17 , s18 and s19 referred to earlier so as to set the inverting feeding request flag to &# 34 ; 1 &# 34 ;, with simultaneous indication for the jamming . if the leading edge of the original document is detected by the sensor se4 before termination of the timer tmrj3 ( i . e ., judgement is &# 34 ; yes &# 34 ; at step s66 ), the tmrj3 request flag is reset to &# 34 ; 0 &# 34 ; at step s68 , while the timer tmrj3 is reset at step s69 . simultaneously , a tmrj4 request flage is set to &# 34 ; 1 &# 34 ; at step s70 , and at step s71 , a timer tmrj4 is set to α 7 h . this timer tmrj4 is intended to judge whether or not any paper jamming has taken place during passing of the inverted original document through the discharge sensor se4 . then , at step s72 , it is checked whether or not the tmrj4 request flag is &# 34 ; 1 &# 34 ;. the judgement is &# 34 ; yes &# 34 ;, since this tmrj4 request flag has been set to &# 34 ; 1 &# 34 ; at step s70 referred to earlier , and at step s73 , judgement is made as to whether or not the discharge sensor se4 has risen , i . e ., whether or not said sensor has detected the trailing edge of the inverted original document . if the judgement is &# 34 ; no &# 34 ;, it is checked at step s74 whether or not the timer tmrj4 is terminated . if said timer is terminated , it means that paper jamming has taken place before arrival of the trailing edge of the original document at the discharge sensor se4 , and therefore , the procedure is shifted to steps s17 , s18 and s19 described earlier so as to set the inverting feeding request flag to &# 34 ; 1 &# 34 ;, with simultaneous indication for the jamming . if the trailing edge of the original document is detected by the sensor se4 before termination of the timer tmrj4 ( i . e ., judgement is &# 34 ; yes &# 34 ; at step s73 ), the tmrj4 request flag is reset to &# 34 ; 0 &# 34 ; at step s75 , while at step s76 , the timer tmrj4 is reset . at the same time , at step s77 , a reverse rotation stop request flag is set to &# 34 ; 1 &# 34 ;, and at step s78 , a timer tmr4 is set to α 8 h . this timer tmr4 has for its object to provide timing for turning off the main motor . at step s79 , the inverting motor is turned off to stop rotation of the rollers 131 and 132 . subsequently , at step s80 , it is judged whether or not reverse rotation stop request flag is &# 34 ; 1 &# 34 ;. the judgement is &# 34 ; yes &# 34 ; since this reverse rotation stop request flag has been set to &# 34 ; 1 &# 34 ; at step s77 . thus at step s81 , termination of the timer tmr4 is waited for , and upon termination , the main motor is turned off in its reverse rotation so as to stop the transport belt 122 moving in the reverse direction . in this case , the original document is stopped at a position where its trailing edge has advanced to a certain extent beyond the stopper 125 towards the right in fig2 on the original document platform 19 . simultaneously , at step s84 , a timer tmr5 is set to α 9 h , and a step s85 , a tmr5 request flag is set to &# 34 ; 1 &# 34 ;. this timer tmr5 is intended to provide timing for rotating the main motor again in the forward direction . furthermore , at step s86 , copying request signal is reset , and the timer tmr4 is reset at step s87 , while at step s88 , tmr4 request flag is reset to &# 34 ; 0 &# 34 ;. thereafter , at step s89 , it is judged whether or not tmr5 request flag is &# 34 ; 1 &# 34 ;. the judgement is &# 34 ; yes &# 34 ;, since this tmr5 request flag has been set to &# 34 ; 1 &# 34 ; at step s85 as described earlier . thus , at step s90 , termination of the timer tmr5 is waited for , and upon termination , the timer tmr5 is reset at step s91 , while at step s92 , the tmr5 request flag is reset to &# 34 ; 0 &# 34 ;. simultaneously , at step s93 , the main motor is turned on for rotation in the forward direction to drive the transport belt 122 in the clockwise direction for feeding the inverted original document returned onto the original document platform 19 in the leftward direction in fig2 . subsequently , at step s94 , a tmr6 request flag is set to &# 34 ; 1 &# 34 ;, while at step s95 , a timer tmr6 is set to α 10 h . this timer tmr6 is intended to turn off the main motor in it rotation in the forward direction . then , at step s96 , it is judged whether or not tmr6 request flag is &# 34 ; 1 &# 34 ;. since this tmr6 request flag has been set to &# 34 ; 1 &# 34 ; at step s94 , the judgement is &# 34 ; yes &# 34 ;. thus , at step s97 , termination of the timer tmr6 is waited for , and upon termination , the timer tmr6 is reset at step s99 . in this case , the trailling edge of the original document contacts the original document stopper 125 so as to be stopped at a predetermined position on the original document platform 19 . at the same time , at step s100 , the inverting flag is reset to &# 34 ; 0 &# 34 ;, and at step 101 , the copying start signal for starting the copying function is outputted . at step s102 , the main motor is turned off in the forward rotation so as to suspend the movement of the transport belt 122 in the forward direction , while at step s103 , ostsl function completion flag is reset to &# 34 ; 0 &# 34 ;. successively , at step s104 , it is judged whether or not inverting function ii flag is &# 34 ; 1 &# 34 ;, and if the judgement is &# 34 ; yes &# 34 ;, i . e ., when the inverting function is not required , the inverting feeding request flag is reset to &# 34 ; 0 &# 34 ; at step s105 . by the foregoing procedures , the inverting function of the original document is completed , and thereafter , the copying function with respect to the reverse face of the duplexed original document by the optical system 20 is effected . hereinbelow , the inverting feeding function sub - routine in step s15 referred to earlier ( fig5 ( b )) will be explained with reference to fig7 ( a ) and 7 ( b ). this sub - routine carries out such a control that in the case where a duplexed original document discharged onto the discharge tray 140 after being inverted upon input of the interruption signal during operation with respect to the reverse face thereof is fed again , and also in the case where a duplexed original document subjected to jamming in the above inverting function sub - routine is taken out for re - feeding , the original document which is thus fed again face down , is caused to pass through the transport section 120 as it is so as to be inverted at the inverting section 130 for again returning to the transport section 120 . in the first place , at step s110 , it is checked whether or not the inverting feeding request flag is &# 34 ; 1 &# 34 ;. this inverting feeding request flag is set to &# 34 ; 1 &# 34 ; when paper jamming took place during the inverting feeding function ( step s18 ), and also , when the interruption signal is applied as explained later in the abnormality check subroutine shown in fig8 ( step s139 ). if the judgement is &# 34 ; yes &# 34 ;, it is checked at step s111 whether or not a paper feeding completion flag is &# 34 ; 1 &# 34 ;. this paper feeding completion flag is to be set to &# 34 ; 1 &# 34 ; at the time point when the feeding of the original document reset after the jamming operation or the restoration from the interruption , has been completed . if the paper feeding completion flag is &# 34 ; 0 &# 34 ; at step s111 , i . e ., if the paper feeding has not been completed , the paper feeding function sub - routine is effected at step s113 after setting a paper feeding flag to &# 34 ; 1 &# 34 ; at step s112 . in this sub - routine , the reset original document is fed to the transport section 120 , and upon completion of the paper feeding , the paper feeding flag as described above is set to &# 34 ; 0 &# 34 ;. subsequently , at step s114 , it is judged whether or not the paper feeding flag is &# 34 ; 1 &# 34 ;. since the paper feeding flag has been reset to &# 34 ; 0 &# 34 ; at the sub - routine of step s113 upon completion of the paper feeding , the judgement is &# 34 ; no &# 34 ;. thus , at step s115 , the paper feeding completion flag is set to &# 34 ; 1 &# 34 ;, and at step s116 , the main motor is turned on for forward rotation so as to drive the transport belt 122 in the forward direction , while at step s117 , the stopper solenoid is turned on , with simultaneous turning on of the inverting motor at step s118a , and at step s118b , the return solenoid in turned on . in other words , the original document fed again is caused to pass through as it is without being once stopped on the original document platform 19 for being inverted at the inverting section 130 . incidentally , simultaneously with the starting of feeding of the original document , α 1 h is set in a timer tmj1 at step s119 , while at step s120 , a tmj1 request flag is set to &# 34 ; 1 &# 34 ;. this timer tmj1 is intended to check whether or not any paper jamming has taken place during movement of the leading edge of the original document to the discharge sensor se4 from the sensor se2 . subsequently , at step s121 , judgement is made as to whether or not the tmj1 request flag is &# 34 ; 1 &# 34 ;. since the tmj1 request flag has been set to &# 34 ; 1 &# 34 ; at step s120 , the judgement is &# 34 ; yes &# 34 ;. at step s122 , it is checked whether or not the discharge sensor se4 has fallen , i . e ., whether or not the sensor se4 has detected the leading edge of the re - fed original document . if the judgement is &# 34 ; no &# 34 ;, it is checked at step s123 whether or not the timer tmj1 has been terminated . if said timer is terminated , it means that paper jamming has taken place before arrival at the sensor se4 , and therefore , the procedure is shifted to steps s17 , s18 and s19 referred to earlier . when the leading edge of the original document is detected by the sensor se4 before termination of the timer tmj1 (&# 34 ; yes &# 34 ; at step s122 ), the tmj1 request flag is reset to &# 34 ; 0 &# 34 ; at step s124 , while at step s125 , the timer tmj1 is reset . simultaneously , at step s126 , α 2 h is set in a timer tmj2 , and at step s127 , a tmrj2 request flag is set to &# 34 ; 1 &# 34 ;, and further , at step s128 , an inverting function ii sub - routine is executed . this inverting function ii sub - routine is intended to execute the operation after step s42 of the inverting function sub - routine referred to earlier , and the re - fed original document is turned over between its front and reverse faces so as to be set on the original document platform 19 . upon completion of setting of the original document , the inverting feeding request flag is reset at step s105 . accordingly , with respect to the original document after the second sheet subsequent to restoration from the paper jamming or restoration from the interruption , judgement is &# 34 ; no &# 34 ; at step s110 to revert to the main routine , and the above inverting feeding sub - routine is not effected . referring further to fig8 ( a ) and 8 ( b ) which are continuous , the abnormal signal check sub - routine at step s10 , i . e ., the control of the interruption copying will be described in detail hereinbelow . in the first place , at step s130 , it is checked whether or not the interruption signal has fallen . the interruption signal is transmitted from the micro - computer cpu1 of the copying apparatus 1 to the micro - computer cpu2 of the automatic document feeding device 100 based on the on / off operation of the interruption key 77 , and is caused to fall at the first turning on of the interruption key 77 , and to rise at the second turning on thereof . if the falling of the interruption signal is not ensured ( i . e ., judgement is &# 34 ; no &# 34 ; at step s130 ), it is checked at step s131 whether or not an interruption signal start flag is &# 34 ; 1 &# 34 ;. if the judgement is &# 34 ; yes &# 34 ;, the interruption signal start flag is reset to &# 34 ; 0 &# 34 ; at step s132 and the procedure is shifted to step s133 . this interruption signal start flag is intended to be reset at step s135 ( to be described later ) when the interrupting key 77 is turned on during copying function so as to effect the interrupting operation subsequent to the completion of the copying function . when the falling of the interruption signal is ensured at step s130 referred to earlier , it is checked at step s133 whether or not the adf mode flag is &# 34 ; 1 &# 34 ;. if the judgement is &# 34 ; yes &# 34 ; at the above step s133 , i . e ., if the copying function to effect the feeding of the original document by the automatic document feeding device 100 has been selected , it is judged at step s134 whether or not the copying is under way . if the copying is being effected , the interruption signal start flag is set to &# 34 ; 1 &# 34 ; at step s135 . meanwhile , if the copying is not under way , it is checked at step s136 whether or not reverse face flag is &# 34 ; 1 &# 34 ;. this reverse face flag is adapted to be set at the time point when the copying for the front face of the original document located on the original document transport section 120 is completed in the duplexed original document mode , and to be reset when the copying for the reverse face thereof is completed . if the reverse face flag is &# 34 ; 1 &# 34 ;, an inverting discharge flag is set to &# 34 ; 1 &# 34 ; at step s137 , and an abnormal discharge flag is set to &# 34 ; 1 &# 34 ; at step s138 , and further , at step s139 , an inverting feeding memory flag is set to &# 34 ; 1 &# 34 ;. the above inverting discharge flag is to instruct the control for inverting the original document located at the transport section 120 , in the inverting section 130 for discharge , and the abnormal discharge flag is intended to instruct the control for directly discharging the subsequent original document standing - by at the paper feeding section 110 without being inverted , while the inverting feeding memory flag is intended to memorize that the interruption is effected during the reverse face copying operation , and to cause the original document feeding function after releasing of the interruption to start from the inverting feeding ( fig7 step s15 ). subsequently , at step s140 , the feeding preferential mode signal is set to &# 34 ; 1 &# 34 ;, while the red lamp of the start switch sw of the automatic document feeding device 100 is lit . when set to &# 34 ; 1 &# 34 ;, the feeding preferential mode signal inhibits starting of the automatic document feeding device 100 by the start switch sw , and simultaneously , makes it possible to start the copying by the print switch 70 , while , when reset to &# 34 ; 0 &# 34 ;, said feeding preferential mode signal allows the starting of the automatic document feeding device 100 by the start switch sw , and also , inhibits the starting of copying by the print switch 70 . on the other hand , when the judgement is &# 34 ; no &# 34 ; at said step s136 , i . e ., if the front face of an original document located at the original document transport section 120 is being copied when the interruption signal is inputted , a discharge flag is set to &# 34 ; 1 &# 34 ; at step s141 , while at step s142 , the abnormal discharge flag is set to &# 34 ; 1 &# 34 ;. this discharge flag is intended to instruct the control for directly discharging the original document located at the discharging section without being inverted . by executing the foregoing routine , the original documents located at the transport section 120 under the front face copying state are discharged as they are , while those under the reverse faces copying state are discharged as inverted , with the front face directed downwards in both cases , and the subsequent original documents standing - by at the paper feeding section 110 are also directly discharged as they are , with the front faces directed downwards . next , at step s143 , it is checked whether or not the interruption signal is &# 34 ; 0 &# 34 ;, i . e ., whether or not the interruption is being effected . if the judgement is &# 34 ; no &# 34 ;, the procedure is shifted to step s146 , while if the judgement is &# 34 ; yes &# 34 ;, judgement is made at step s144 as to whether or not the interrupting original document has been set on the paper feeding tray 111 . if the original document has been set , the feeding preferential mode signal is reset to &# 34 ; 0 &# 34 ; at step s145 , while the green lamp for the start switch sw of the automatic document feeding device 100 is lit . in other words , it is made possible to effect the interrupting copying through employment of the automatic feeding device 100 . subsequently , at step s146 , it is judged whether or not the interruption signal rises , i . e ., whether or not the interrupting copying is released . if the judgement is &# 34 ; yes &# 34 ;, it is checked at step s147 , whether or not the inverting feeding memory flag is &# 34 ; 1 &# 34 ;. if the inverting feeding memory flag is set at step s139 , the judgement is &# 34 ; yes &# 34 ;, and at step s149 , the inverting feeding request flag is reset to &# 34 ; 1 &# 34 ;. accordingly , with respect to the first original document after releasing of the interruption during the reverse face copying , the inverting feeding function sub - routine is effected , and the document is set at the exposure position through inversion between front and reverse faces . on the other hand , when it is found at step s148 that the interrupting signal is &# 34 ; 1 &# 34 ;, i . e ., that the interruption has already been released , the procedure is shifted to step s150 without executing steps s147 and s149 , and if it is found at step s148 that the interrupting signal is &# 34 ; 0 &# 34 ;, i . e ., that the interrupting state is still present , immediate returning is effected . successively , at step s150 , it is judged whether or not the original document at the paper feeding section 110 is of &# 34 ; empty &# 34 ;. if the judgement is &# 34 ; no &# 34 ;, i . e ., if the original document is set at the paper feeding section 110 , the feeding preferential mode signal is reset to &# 34 ; 0 &# 34 ; at step s151 , and the green lamp of the start switch sw for the automatic document feeding device is lit . in other words , it is made possible to effect the copying through employing of the automatic original document feeding device 100 . hereinbelow , the sub - routine for the copying control will be described with reference to fig9 . in the first place , at step s160 , it is judged whether or not the feeding preferential mode signal is &# 34 ; 0 &# 34 ;. if the judgement is &# 34 ; yes &# 34 ;, the red print lamp for the print switch 70 is lit at step s161 , and when it is found at step s162 that the copying start signal from the automatic document feeding device 100 has been set to &# 34 ; 1 &# 34 ;, the copying function is effected at step s163 . meanwhile , when the feeding preferential mode signal is &# 34 ; 1 &# 34 ;, and the judgement is &# 34 ; no &# 34 ; at step s160 , the green print lamp of the print switch 70 is lit at step s164 , and when the turning on of the print switch 70 is ensured at step s165 , the copying function is executed at step s163 . although the present invention has been fully described by way of example with reference to the accompanying drawings , it is to be noted here that various changes and modifications will be apparent to those skilled in the art . therefore , unless otherwise such changes and modifications depart from the scope of the present invention , they should be construed as being included therein . | 6 |
the present invention resides in a process for preparing a non - ferrous object for chrome plating . more particularly , the present invention resides in a process for polishing pre - plated objects which are to be chrome plated in order to improve the polishing of such objects , reduce the rejection rate for such chromed objects , and reduce the cost of the polishing process . with reference now to fig1 a flow - chart is illustrated depicting steps taken in accordance with the process of the present invention . with reference to fig1 and 2 , an object , such as an unfinished wheel 10 which has been molded , die cast , forged , or otherwise created is provided ( 100 ). typically , such objects are non - ferrous metal objects which are intended to be chrome plated . due to the molding , die casting , forging , or other creating process , the object 10 typically includes burrs and other imperfections . with reference now to fig1 and 3 - 6 , the wheel 10 is deburred in a wet finishing chamber 12 ( 102 ). with particular reference to fig3 - 6 , wheels and other non - ferrous objects have traditionally been deburred in wet finishing tanks , such as vibratory chambers , centrifugal equipment , or the illustrated drag finishing machine having media 14 therein and a source of water 16 or other aqueous solution . the non - ferrous object , in this case the wheel 10 is placed within the chamber 12 , with the media 14 and aqueous solution 16 with the object 10 dragged through the media 14 and aqueous solution 16 , or the media 14 in aqueous solution 16 moved around the object to remove the burrs and other imperfections of the object 10 . this process is well - known in the art . the type of media may vary according to the object which requires deburring or polishing . for example , media may comprise gravel , metallic balls or objects , or more preferably small pre - formed plastic pellets . in the illustrated process , the wheel 10 is suspended from an arm 18 which pitches the wheel 10 at a pre - determined angle and moves or drags the wheel 10 through the wet media 14 and 16 . after a pre - determined time period , or it is determined that the wheel 10 is sufficiently deburred or polished , it is removed from the wet chamber 12 , as illustrated in fig6 . with reference now to fig7 after deburring and initial polishing , the wheel 10 or other non - ferrous object is suspended by wires 20 or the like into a chamber 22 holding a copper bath solution , or other pre - plating solution . the wheel 10 is then subjected to an electro - plate process ( 104 ) in the copper bath , as is well known in the art . the aforementioned steps of the present invention are well - known and described above in prior procedures . typically , as described above , the non - ferrous object would then be published by robot or hand . however , such polishing has been found to be very expensive , have a high rejection rate , and time consuming . as described above , pre - plating , in particular copper pre - plating , has not been amenable to a second wet polishing step . however , the inventors have discovered that the pre - plated wheel when run through a dry finishing machine , that is a finishing chamber 26 having dry media 14 therein , produces superior results . with reference to fig8 the pre - plated wheel 10 is placed into any appropriate chamber 26 , such as the illustrated drag finishing chamber . a modified la habra welding inc . spin finish machine has been found to be particularly useful in treating and polishing wheels . the automotive wheels that have been copper plated and ready for pre - plate finish prior to final chrome plating are fixed onto the arm 18 or other assembly and pitched and angled to promote best contact between the wheel 10 and the dry media 14 . preferably , plastic abrasive media is used in the chamber 26 . plastic media has a long - standing reputation as providing high - quality finishes specifically in pre - plate applications . plastic or urethane media having a light weight and relatively light abrasiveness renders the media 14 highly mobile enabling the media 14 to float easily around the object 10 and remove pre - plating imperfections , such as any burrs , the shallowing of valleys or crevices , etc ., formed on the object 10 during the pre - plating process . in a particularly preferred embodiment , approximately 1 , 600 pounds of pfs - 5 / 16 p - bg and pfs - 1 / 2 p - bg plastic abrasive media are charged into the finish machine 26 in a 50 : 50 mix ratio . the size and ratio distribution are selected because of the advantage of easy access and flow afforded by the media into the wheel 10 . machine speed is set at approximately 27 rpm , and cycle time is set at 20 minutes . at these settings , a finish on the copper substrate is produced that renders it suitable for a final brilliant chrome plating without any additional work . due to the fact that a dry abrasive media 14 is utilized , the copper plating does not adversely react to any aqueous solutions . although the pre - plated wheel 10 , when removed from the dry media 14 appears to be scratched and not nearly as smooth as the pre - plated object 10 and before this process , test have confirmed that in fact the pre - plated wheel 10 is much smoother and the imperfections removed to a greater degree than hand polishing . with reference to fig9 after the pre - plated wheel 10 has been polished in the dry finishing chamber ( 106 ), it is then electroplated in a chrome bath ( 108 ). the process of chrome plating a non - ferrous object is well known , and illustrated by suspending the wheel 10 by wires 20 or the like in a chamber 28 containing a chrome bath 30 and applying electricity to chrome - plate the object ( 110 ). the resultant object , as illustrated in fig1 , is a chrome - plated wheel with a brilliant finish . although there has traditionally been a 12 %- 22 % rejection rate for hand polished wheels , this rate of rejection has been reduced to approximately 2 %- 4 % using the process of the present invention . the actual chrome finish has been found to be more brilliant using the present invention as well . it is believed that this is due to the impregnation of buffing material during the hand - buffing process , whereas the use of dry media 14 does not impregnate the copper plated wheel 10 whatsoever . currently , it is estimated that the manual polishing of pre - plated wheels or other objects is approximately $ 15 . 00 , robotic or turntable polishing is approximately $ 9 . 00 , yet the polishing of pre - plated objects for chrome plating using the present invention is only approximately $ 4 . 00 . thus , the present invention realizes a significant cost savings in the chrome plate process . due to the automation of the process , labor rates can be significantly reduced and the production rate of objects can be increased significantly . although an embodiment has been described in detail for purposes of illustration , various modifications may be made without departing from the scope and spirit of the invention . accordingly , the invention is not to be limited , except as by the appended claims . | 2 |
referring to fig5 and 6 , a controller section of a gas stove ( or gas water heater in the other embodiment ) ignition device according to a preferred embodiment of the invention is shown . the controller section comprises a circuit board 1 , a gas valve 2 , a high voltage ignition controller 19 on the circuit board 1 , and a separate ignition unit 5 . on the circuit board 1 , there are provided a first mcu 11 , an rf ( radio frequency ) transceiver module 12 having an antenna 121 , a switch 13 , a buzzer 14 , a first connector 15 connected to the gas valve 2 including an initial ignition coil assembly 21 and a master ignition coil assembly 22 , two second connectors 16 connected to a low temperature sensing resistor 3 and a high temperature sensing resistor 3 a respectively , and a dc jack 18 connected to a dc plug 4 so that external dc power can be supplied from a dc power supply 110 to the circuit board 1 in operation . the ignition unit 5 comprises a high voltage output terminal 51 , a ground terminal 52 , and an ignition detection terminal 53 all connected to circuitry of the circuit board 1 . a first detector 6 for detecting concentrations of co and co 2 in the air , a water flow measurement module 112 ( for gas water heater only ), a fire controller 7 , and a fan 8 are further provided and are connected to circuitry of the circuit board 1 . the first detector 6 can send data about detected concentrations of co and co 2 to the controller section and the remote control section as detailed later . the initial ignition coil assembly 21 comprises an adc ( analog to digital converter ), an op amp ( operational amplifier ), and a comparator and is adapted to detect an open circuit , a short circuit , and a voltage variation on a load ( e . g ., coil ). the high voltage ignition controller 19 is adapted to convert a feedback signal sent from the ground terminal 52 into a digital form . for saving power and prolonging a useful life of the device , it is contemplated by the invention that an intermittent high voltage discharge for ignition is adopted . that is , the invention begins to detect flame at a stop time after a predetermined times of ignition . thereafter , the invention again detects flame at another stop time after a subsequent predetermined times of ignition if no flame has been detected . likewise , the ignition detection terminal 53 comprises an adc , an op amp , and a comparator and is adapted to detect an open circuit , a short circuit , and a voltage variation on the load . referring to fig7 a , 7 b and 8 , a remote control section of the gas stove ignition device is shown . the remote control section is implemented a rectangular body 9 having on its front surface a display 92 and a keypad 91 , on its rear surface an rf transceiver module 94 having an antenna 941 , and a battery unit 95 for supplying operating power to the remote control section , and on a top a resistor member 93 and a second detector 96 for detecting concentrations of co and co 2 in the air . there is further provided a second mcu 90 connected to the display 92 , the resistor member 93 , the second detector 96 , the battery unit 95 , a buzzer 97 , the rf transceiver module 94 , and the keypad 91 respectively . in operation , the remote control section is activated to send rf waves to the controller section for turning on the switch 13 . thereafter , the switch 13 attempts to ignite the initial ignition coil assembly 21 . an alarm is issued by the buzzer 14 and the ignition unit 5 is disabled if the initial ignition coil assembly 21 fails to ignite . the high voltage ignition controller 19 is enabled to apply a high voltage for ignition if the initial ignition coil assembly 21 successfully ignites . a feedback signal from the high voltage ignition controller 19 is detected . an alarm is issued by the buzzer 14 and the ignition unit 5 is disabled if the high voltage ignition controller 19 fails to ignite as informed by the feedback signal . thereafter , in response to the successful operation of the high voltage ignition controller 19 , the ignition detection terminal 53 detects flame at a stop time after a predetermined times of ignition . the provision of the low temperature sensing resistor 3 and the high temperature sensing resistor 3 a aims at preventing an erroneous action of the ignition detection terminal 53 from occurring . thereafter , the ignition detection terminal 53 again detects flame at another stop time after a subsequent predetermined times of ignition if no flame has been detected . the ignition detection terminal 53 is allowed to detect for duration of , for example , one minute . an alarm is issued by the buzzer 14 and the ignition unit 5 is disabled if the ignition detection terminal 53 still fails to detect flame after one minute . the ignition process then returns to the beginning of the ignition operation ( i . e ., causing the switch 13 to attempt to ignite the initial ignition coil assembly 21 again .) to the contrary , attempts to enable the master ignition coil assembly 22 are made if flame has been detected . an alarm is issued by the buzzer 14 if fails to enable the master ignition coil assembly 22 . otherwise , the ignition process ends with the initial flame being extinguished and pressurized gas being supplied to the gas stove continuously . both the first and second detectors 6 and 96 can issue an alarm and the gas valve 2 is forced to close if either detector has detected that concentration of co or co 2 in the air has exceeded a predetermined , allowable level . note that , the provision of the water flow measurement module 112 , the fire controller 7 , and the fan 8 can effect a complete combustion . also , the temperature sensing resistors can precisely measure room temperature thus , an alarm is issued and the gas valve 2 is closed if the measured room temperature is abnormal . further , data about temperature , ignition , concentration of co or co 2 , or the like can be shown on the display 92 for visually informing a user of any abnormal conditions since data is transferred between the controller section and the remote control section in the form of rf waves sending and receiving between the sections . while the invention herein disclosed has been described by means of specific embodiments , numerous modifications and variations could be made thereto by those skilled in the art without departing from the scope and spirit of the invention set forth in the claims . | 5 |
piezoelectricity is a well known phenomenon exhibited by certain crystals . in brief , when such crystals are compressed or extended in particular directions , electric charges of opposite signs are produced at opposite ends of the crystal . not only is an electric moment induced in piezoelectric crystals by an application of mechanical stress or strain , there is also a converse effect ; namely , on applying an electric field , the crystal changes shape by expansion in one direction and contraction in another . a fuller discussion of the direct and converse effects may be found in encyclopaedic directory of physics , pergamon press , 1962 , pages 503 - 505 . a bimoprh , or bimorph cell , is a member composed of two strips of piezoelectric material joined together ( such as by cement ) with the direction of expansion of one strip aligned with the direction of contraction of the other such that the application of an electric potential to both strips causes one to expand and the other to contract , thus producing a bending of the combination in a manner analogous to the curling of a bimetallic strip due to differential expansions when heat is applied . until the potential difference is removed , the bimorph will remain bent . if a bimorph is physically bent , an electric potential difference tending to return the bimorph to its original configuration will develop from one strip to the other strip . that potential difference will remain until either the potential is externally removed or the bimorph is unflexed . if the bimorph is bent and the originally created potential difference dissipated , such as by shorting or through a load , the unbending of the bimorph by external force or its own internal spring force will produce an electric potential of a polarity opposite to that of the original potential produced when the bimorph was first bent . this potential will resist the forces ( e . g ., internal spring force ) tending to return the bimorph to its original configuration . the drawings illustrate the operating principal of a camera incorporating a preferred embodiment of the present invention . because cameras are well known , the present description will be directed in particular to elements forming part of , or cooperating more directly with , the present invention . camera elements not specifically shown or described may take various forms well known to those skilled in the art . referring to the drawings , and specifically to fig1 a camera housing 10 has an aperture 12 for focusing an image to be photographed at the camera &# 39 ; s film plane , not shown . between the aperture and the film plane , a pair of shutter blades 16 and 18 are spring - urged to the left as shown . a second aperture 20 in housing 10 is aligned with a photoresponsive element 22 ( fig5 ) of exposure control electronics . light , passing through aperture 20 , is normally blocked from the photoresponsive element by a mask 24 , but the mask may be manually pivoted to an inactive position by the operator to initiate exposure as will be explained hereinafter . a bimorp strip 26 is fixed at one of its ends to housing 10 in cantilever fashion and carries a latch member 28 at the other end for cooperation with a pair of tabs 30 and 32 on shutter blades 16 and 18 , respectively . electrical leads 34 and 36 interconnect the respective plates of bimorph 26 and the electronics package of fig5 . a reset mechanism for adjusting the shutter blades and the bimorph strip to a condition preparatory to taking a picture includes a slide cam 40 pivotally and slidably connected to a lever 42 which is itself rigidly connected to a manually operable crank , not shown , and pivotally mounted on housing 10 at shaft 46 . fig1 - 4 are schematic views of certain elements of the camera showing the elements in various stages of a complete cocking and exposure cycle . in fig1 the camera elements are shown in their &# 34 ; run down &# 34 ; conditions wherein shutter blades 16 and 18 are in their left - most positions and closing blade 18 covers aperture 12 and mask 24 covers aperture 20 . bimorph 26 is relaxed and unstressed and there is no voltage across the bimorph on leads 34 and 36 . in preparation for making an exposure , the operator manually rotates lever 42 in a clockwise direction ( fig1 ). lever 42 engages a stud 48 on opening shutter blade 16 to move blade 16 and blade 18 to the right to their positions shown in fig2 . lever 42 also moves slie cam 40 to the right . the cam surface engages latch member 28 to bend bimorph 26 until latch member 28 engages the top of blade 16 , also as shown in fig2 . such flexing of bimorph 26 will , of course , generate a potential thereacross . however , leads 34 and 36 conduct that potential to the electronics package shown in fig5 whereat a diode 50 is arranged across bimorph 26 to be forward biased by such a voltage and the potential is shorted through the diode . when lever 42 is released , a spring 52 returns the lever and slide cam 40 to their fig1 . positions . the force of springs 54 and 56 on the shutter blades , and the spring action of bimorph 26 itself , will cause the bimorph to begin to unbend . the unbending motion of the bimorph generates a voltage which is of a sign which reverse biases diode 50 . therefore , the voltage remains across the bimorph and acts to resist further unbending movement . a point of equilibrium is reached where the spring forces tending to unbend the bimorph are just offset by the electromotive force resisting the unbending movement . at that point , shown in fig3 latch member 28 still retains tabs 30 and 32 to keep shutter blades 16 and 18 from running down . in order to effect an exposure , the operator manually pivots mask 24 about its stud 58 to allow scene light to reach photoresponsive element 22 . element 22 will conduct electricity as a function of the amount of light striking it so as to create a variable current signal . a short time after the mask is moved out of alignment with aperture 28 , sufficient charge has leaked from bimorph 26 through element 22 to allow bimorph 26 to unbend to an extent that latch member 28 releases tab 30 to begin exposure as shown in fig4 . as the charge continues to leak through element 22 at a rate determined by the amount of light falling thereon , latch member 28 continues to move upwardly until tab 32 is also free , spring 56 moves blade 18 to the left as shown in fig1 and exposure is terminated . the duration of exposure is , of course , inversely proportional to the rate of leakage through photoresponsive element 22 as determined by the intensity of light impinging upon the element , which might for example be a cds cell . as depicted , the shutter blades are held in their cocked , fig3 position by a balance of spring and electromotive forces . while bimorphs may be latched in selected positions without draining power , and will remain in such positions as long as the voltage thereacross is constant , one might want to provide means to prevent latch member 28 from being jarred from tab 30 . several mechanisms for accomplishing this function will readily occur to those skilled in the art , such as for example lever 42 might be latched in its fig2 position with slide cam 40 over latch member 28 until exposure is desired . or , one might choose to hold only the closing blade with the bimorph , while holding the opening blade with a conventional latch less likely to be jarred loose than a bimorph latch . the invention has been described in detail with particular reference to a preferred embodiment thereof , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention . | 6 |
the stencil foil of the present invention is shown generally in fig2 - 22b . referring to fig2 , the preferred embodiment of the stencil foil assembly 100 is shown in fully assembled form and ready for use . the stencil foil assembly has a stencil foil 114 with a stencil pattern 120 defined thereon , and the stencil foil 114 is supported by four base members 122 a - d and four cover members 124 a - d that extend along and grip the peripheral portions ( or peripheral edges ) 128 a - d of the stencil foil 114 . the base members 122 a - d and cover members 124 a - d are described in more detail herein , and substantially make up the frame of the stencil foil assembly 100 . the stencil foil 114 can be provided to a user separately from the base members 122 a - d and the cover members 124 a - d of the present invention , or it can be provided to a user with the base members and the cover members of the present invention . as shown in fig2 and 3 , in the preferred embodiment , the stencil foil assembly is useful for supporting a substantially square stencil foil 114 . the stencil foil 114 is dimensioned and configured to extend over a circuit board ( not shown ), and the lower surface 132 of the stencil foil 114 can be positioned in facing engagement with an upper surface of a circuit board ( not shown ). the pattern 120 is defined in a central region 130 of the stencil foil 114 , so that when a paste is spread over the upper surface 134 of the stencil foil 114 , a user can cause the paste to fill the space defined by the pattern 120 . the pattern is shown in fig2 and 3 as a circular pattern by way of example , however other patterns are within the scope of the present invention . the thickness of the stencil foil 114 in the region of the pattern 120 is configured so that the desired thickness of the paste is disposed on the circuit board through this process . when viewed from above , the stencil foil 114 has four main sides along peripheral edge regions 128 a - d . the stencil foil 114 shown in the figures has chamfered corners 136 . the four main sides together form the peripheral edge of the stencil foil 114 . as described herein , a user can pull the stencil foil 114 into a desired tension by using the base and cover of the assembly to pull the peripheral edge regions 128 a - d of the stencil foil away from the center region 130 of the stencil foil . to facilitate gripping of the peripheral edges 128 a - d of the stencil foil 114 by the assembly of the present invention , a plurality of apertures 126 are defined along the peripheral edges 128 a - d of the stencil foil 114 . preferably the apertures 126 are substantially evenly spaced apart by a distance d near the peripheral edge . the stencil apertures 126 are preferably cylindrical openings defined within a cylindrical stencil aperture wall 138 . these stencil apertures 126 are engaged by the respective mating cover members and base members of the assembly of the present invention , as described in more detail below , particularly in relation to fig1 . it can be seen that the peripheral edge portions 128 a - d of the stencil foil 114 , shown in fig3 , are captured by a base and cover construction in fig2 . to secure the stencil foil 114 to the frame , the user first assembles the base . fig4 shows a base of the frame assembled of base members 122 a - d , and fig5 shows a stencil foil 114 extending over the base members 122 a - d before the stencil has been secured over the base by the cover members 124 a - d . in the preferred embodiment of the present invention , there are four base members 122 a - d that substantially form a square base , and there are four cover member 124 a - d , shown in fig2 , that are received respectively on the four base members 122 a - d . the four cover members 124 a - d are collectively referred to herein as the cover , though the cover members 124 a - d are not connected directly to each other in the preferred embodiment . thus , the stencil foil assembly 100 includes four mating pairs composed of a cover member and a base member , and the stencil foil 114 has a peripheral edge that is secured between each respective pair of a cover member and a base member . the four base members 122 a - d are substantially congruent , so that a user can arrange the four base members 122 a - d in any order to form a square as shown in fig4 , with the upper surfaces of the base members 122 a - d facing in substantially the same direction . as shown in fig6 , each base member has a first end 140 and a second end 142 , with a male post 144 located at the first end 140 , and a female socket 146 located at the second end 142 . when the base members 122 a - d are fully assembled to form a base , the post 144 of a first base member 122 a is received in the female socket 146 of a second base member 122 b ; the post 144 of the second base member 122 b is received in the female socket 146 of a third base member 122 c ; the post 144 of the third base member 122 c is received in the female socket 146 of a fourth base member 122 d ; and the post 144 of the fourth base member 122 d is received in the female socket 146 of the first base member 122 a . where there are more base members , such as may be the case in embodiments where the stencil 114 is in the form of a hexagon , a triangle , or another shape that is not substantially square , the base members are arranged and configured in a similar fashion , with male posts of each base member being received in a female socket of an adjacent base member . as shown in fig7 - 8 , each male post 144 has an upper surface 148 , a lower surface 150 , and side post surfaces 152 . as shown in fig8 , each female socket 146 has an upper socket surface 154 , a lower socket surface 156 , and side socket surfaces 158 . as shown in fig1 , when a male post 144 is received in a female socket 146 , the lower post surface 150 and the upper post surface 148 are in adjacent facing relation with the lower female socket surface 156 and the upper female socket surface 154 , respectively . this provides a snug , friction fit between the respective male post 144 and the respective female socket 146 . thus , when a user assembles the four base members 122 a - d to form the base , the base members are biased to remain in assembled relation during the rest of the assembly process , which includes the subsequent steps of placing the stencil on the base and securing the stencil between the base members 122 a - d and the cover members 124 a - d . the base members 122 a - d can also be held together by an adhesive or another fastener . when the base members 122 a - d are in assembled relation to form a base , the side post surfaces 152 of a male post 144 on a first base member are in facing relation with the respective side socket surfaces 158 of the respective female socket 146 of a second base member . as shown in fig1 , in the preferred embodiment , there is a gap between at least one of the side post surfaces 152 and the respective side socket surface 158 . in the cross - section shown , there are gaps between both side post surfaces 152 and the respective side socket surfaces 158 . this allows for some relative movement of the base members 122 a - d during assembly . each base member 122 a - d has a top surface 160 that provides a support surface for supporting a peripheral portion of a stencil foil 114 . in the preferred embodiment , the upper surface 160 of each base member 122 a - d is located in the middle portion of the base member and defines a substantially planar surface . the upper surface 160 of the base member 122 a - d defines a plurality of base apertures 164 in this middle portion . the base apertures 164 extend from the upper surface 160 of the base member to the bottom surface 162 of the base member . the base apertures 164 are spaced apart , and they are each configured and arranged to be in alignment with a respective one of the stencil foil apertures 126 when the stencil is supported on the base . once a user aligns the stencil apertures 126 with the base apertures 164 , the user secures the stencil foil 144 between a cover and the base , by individually securing each cover member 124 a - d to its respective base member 122 a - d . the cover member , shown in fig1 - 12 , includes four cover members 124 a - d , each configured to be received by one of the base members 122 a - d . each cover member has a main body 170 having a lower surface 172 for engaging the stencil 114 . a plurality of snap posts 174 depend downwardly from the lower surface 172 of the cover member , and are spaced apart by the same distance d as the apertures in the stencil 114 . the snap posts 174 are configured to be respectively routed through the stencil apertures 126 , and are configured to be in secured engagement with the base apertures 164 . when the cover member 124 a - d is secured to the respective base member 122 a - d , the stencil foil 114 is sandwiched between the cover member and the base member , so the stencil foil is held in frictional engagement between the upper surface 160 of the base member and the lower surface 172 of the cover member , for each pair of cover member 124 a - d and base member 122 a - d around the peripheral edge of the stencil foil . as shown in fig1 , each snap post 174 has a post wall 176 that extends downwardly from the lower surface 172 of the cover member 124 a . in the preferred embodiment , the post wall 176 is substantially cylindrical . a tapered latching formation 178 is formed at the lower end of the post wall . this tapered latching formation has a tapered annular outer wall 179 . an annular latching face 180 extends between the post wall 176 and the tapered outer wall 179 . the latching face 180 extends along a plane that is substantially perpendicular to the longitudinal axis of the snap post 176 , so that a substantially right angle is formed between the post wall 176 and the annular latching face 180 . the apertures 164 in the base member , shown in fig1 , are configured for receiving the snap posts 174 . additionally , the apertures 164 on the base members and the snap posts 174 on the cover members are respectively configured and arranged to secure the cover members 124 a - d to the respective base members 122 a - d . preferably , the snap posts 174 and apertures 164 allow for a substantially permanent or permanent connection between a respective pair of a cover member and a base member . this allows a user to assemble a base and a cover around a stencil foil 114 , and to have a stencil foil assembly 100 that substantially permanently or permanently secures a stencil foil 114 thereon . thus , the stencil foil assembly does not easily come apart during use or storage . this allows a user to handle the stencil frame safely and to store the stencil frame safely for future use . to provide this secure connection , each base aperture 164 includes an annular base aperture wall 182 , a recessed aperture wall 184 , and an annular post retention face 186 that extends between the annular base aperture wall 182 and the recessed annular wall 184 . the annular post retention face 186 is configured to engage the annular latching face 180 of a respective snap post 174 for retaining the respective snap post 174 within the aperture 164 . the cross - sectional view of fig1 shows how the stencil is supported and gripped by the cover member 124 a and the base member 122 a along peripheral edge 128 a of the stencil foil . the lower surface 172 of the cover member 124 a engages the upper surface 134 of the stencil . the upper surface 160 of the base member 122 a engages the lower surface 132 of the stencil foil 114 . the posts of the cover member are received in the apertures of the base member . the latching face 180 of the post 172 is in facing relation with the retention face 186 of the base member aperture 164 . the outer wall 176 of the post 172 extends through the stencil aperture 126 , and the post &# 39 ; s outer wall 176 extends past the inner wall 138 of the stencil aperture 126 . the frictional engagement of the stencil foil 114 with the base member 122 a and cover member 124 a helps to transfer the load from the cover member 124 a to the stencil foil 114 . thus , when the cover member 124 a is pulled away from the center region 130 of the stencil foil 114 , the peripheral region 128 a of the stencil foil 114 is pulled away from the center region 130 of the stencil foil 114 . the stencil foil assembly 100 also includes a stretching machine engagement member ( or an engagement member ) 123 that is configured to engage a stretch frame apparatus ( not shown ). in the preferred embodiment , an engagement member 123 is integrally formed on each cover member 124 a - d . each engagement member 123 is an inwardly sloped cover grip surface ( or engagement surface ) 125 that is formed adjacent to the lower surface of the cover member 124 a - d . an engagement member 123 extension depends downwardly from the main body of the cover member 124 a - d . when the stencil foil assembly 100 is mounted on a stretching machine ( not shown ), the stretching machine engages the cover grip surface 125 to pull the assembly and the stencil foil in tension , away from the center of the stencil foil . when the stencil foil assembly 100 of the preferred embodiment is mounted on the stretching machine , the cover members are pulled in tension outwardly , away from the center region 130 of the stencil foil 114 , substantially along the arrow a in fig1 . as described above , the cover members are secured to the base members around a peripheral edge of the stencil foil 114 . thus , the outwardly directed tension on the cover members results in a tension on the stencil foil and the base members , so that the stencil foil is pulled away from the stencil &# 39 ; s center region 130 towards the peripheral outer edges 128 a - d . returning now to fig6 - 11 , which show the male post and female socket formations , the male post 144 extends horizontally outwardly from a male post platform 190 . the male post platform extends upwardly and outwardly from the upper surface 160 of the middle portion of the base member . the male post platform 190 has a proximal platform surface 191 , a distal platform surface 192 , and an upper surface 193 . the proximal and distal platform surfaces are on opposite sides of the platform . the upper surface 160 of the middle portion of the base member extends from the proximal platform surface 191 , while the male post extends from the distal platform surface 193 . at the other end of the base member 122 a - d , a female socket housing 164 provides a housing in which the female socket is defined . the female socket housing 164 has a proximal housing surface 194 and a distal housing surface 195 . the upper surface 160 of the middle portion of the base member 122 a - d extends from the proximal housing surface 194 . thus , the middle portion of the base member extends between the proximal housing surface 194 and the proximal post platform surface 191 on the base member . the female socket housing extends upwardly and outwardly from the middle portion of the base member . each cover member 124 a - d has a first end surface 141 at its first end , and a second end surface 143 at its second end . the cover member 124 a - d is dimensioned and configured so the first end surface 141 of the cover is in facing relation with the proximal platform surface 191 , and the second end surface 143 of the cover is in facing relation with the proximal socket housing surface 194 when the cover member 122 a - d and the base member 124 a - d are secured in assembled relation . when the stencil foil kit is fully assembled to form a stencil foil assembly , the outer peripheral edge of the stencil foil assembly ( or stencil foil assembly peripheral edge ) is formed by the outer geometry of the female socket housings 146 , the post platforms 190 , and the outer peripheral cover edge 197 that is defined on each cover member 122 a - d . due to the dimensions and configuration of the cover members and the base members , the outer peripheral edge of the stencil foil assembly is substantially continuous . in the embodiment shown herein , the female socket extends from one side of the female socket housing 146 to the other , so that there is an open end of the female socket on the outer peripheral face of the female socket housing 146 . however , in an embodiment not shown , the female socket housing is configured to have female socket that does not fully extend through the female socket housing , and thus only has one opening on the female socket housing . fig1 - 22b show a second embodiment of the present invention . in the second embodiment 200 , each base member 222 a - d has an upstanding wall 230 , and a flange 232 emanates inwardly from the upstanding wall 230 . the support flange 232 has a top flange surface 234 that forms at least a part of the top surface of the base member for supporting the stencil foil 214 thereon . fig1 a - b show the stencil foil 214 can be placed on the top flange surface 234 . a plurality of notches 240 are defined along a length of each base member 222 a - d . each cover member 224 a - d further includes a plurality of fingers 242 . each finger 242 extends from the main body 244 of the cover , and each finger 242 is configured to align with a respective notch 240 along the length of the base . each finger 242 has an inner surface 246 . each base member 222 a - d has a reverse cut flange 248 that is adjacent to the notches . together , the inner surface 246 of the fingers 242 and the inner surface of the reverse cut flange 248 of the base together form a grip surface ( an engagement surface ) for engaging a stretching machine ( not shown ). thus , in the second embodiment , an engagement member is formed by surfaces on the base member and the cover member . in this embodiment , the tension of the stretching machine is transferred directly to the cover member and the base member . fig1 a and 18b show a cross - sectional view that is not through a finger or a snap post to further illustrate the interconnection of the base and cover . in fig1 a and 19b , a cross - sectional view through one of the fingers 242 is shown to illustrate how the fingers 242 also provide a reverse flange for engaging with a stretch frame apparatus . fig2 a and 20b show that the second embodiment has a snap post 260 construction , like the preferred embodiment , to secure the cover members 224 a - d to the respective base members 222 a - d . with the base members 222 a - d and cover members 224 a - d secured to the periphery of the stencil foil 214 , the peripheral regions or edges of the stencil foil 214 are protected and a grip surface ( or engagement surface ) is now provided by the reverse cut flange provided by the bottom of the base and the free ends of the fingers in cooperation with each other . most notably , as seen in fig1 b , 19 b and 20 b , a reverse cut flange is provided by the bottoms of the fingers and cover to provide a reverse cut groove running the length of , preferably , each of the four sides of the assembly of the present invention . as can be understood , such as reverse cut groove can be used to secure the assembly , with stencil foil captured therein , to a stretching frame . in this example , the stretching machine at hand ( not shown ), includes a complementary member that moves outwardly to carry out the stretching operation to prepare the stencil foil for printing . thus , the present invention enables such a stretching frame to be used with a standard stencil foil that does not have such a gripping structure by adapting a standard stencil frame for use with such a machine . it should be understood that the underside or other portion of the assembly can be modified to accommodate other stretching machines and other structures so that a stencil foil equipped with the present invention can be stretched and used thereon for printing . it should be understood that the stencil foil in the figures is not shown with a desired array of holes for screen / stencil printing therethrough . however , any stencil pattern may be employed on a stencil for use with the assembly with the present invention . also , is preferred that the base is preferably aluminum while the covers are preferably plastic . however , any type of material may be used and still be within the scope of the present invention . in view of the foregoing , the stencil foil assembly of the present invention enjoys significant advantages over prior art assemblies . the present invention obviates the need for custom stencil foils to enable use in many types of stretch frames . a standard stencil foil can be adapted over for use in such stretch frames . this greatly reduces the cost of the manufacture of stencil foils . it would be appreciated by those skilled in the art that various changes and modifications can be made to the illustrated embodiments without departing from the spirit of the present invention . all such modifications and changes are intended to be covered by the appended claims . | 7 |
referring now to the drawings , and first to fig1 the cutting tool of the present invention is designated generally by the numeral 11 . preferably , cutting tool 11 is adapted to be suspended and operated by a wireline 13 down hole in a oil field tubular member , as for example casing 15 . while the preferred environment for the cutting tool of the present invention is down hole , the cutting tool may be used to cut other tubular members in other environments . the details of the construction of the present invention are best shown in fig2 a - 2g and referring first to fig2 a , cutting tool 11 includes a fuze assembly designated generally by the numeral 17 , which includes a firing adaptor body 19 , which is adapted to make mechanical connection with the wireline rope socket ( not shown ) and a firing sub 21 . firing adaptor body 19 contains a contact rod 23 , which is adapted to make electrical contact with the wireline to receive electrical firing signals and to transmit such signals to a fuze 25 contained within firing sub 21 . firing adaptor body 19 and firing sub 21 are threadedly connected together and are sealed by appropriate o - ring seals . firing sub 21 is connected to a tubular propellant assembly 27 . propellant assembly 27 is loaded with propellant 29 . propellant 29 is ignited by fuze 25 and those skilled in the art will appreciate that many types of propellant charge may be utilized to provide the pneumatic pressure necessary to operate cutting tool 11 . included among these propellants are any number of explosive materials that may be handled safely . preferably , a propellant spacer 31 is utilized to smooth out the initial impact of the propellant within propellant assembly 27 . propellant assembly 27 is threadedly connected to firing sub 21 and the connection therebetween is sealed by appropriate o - ring seals . referring particularly to fig2 a and 2b , propellant assembly 27 is threadedly connected to a slip assembly , which is designated generally by the numeral 33 . slip assembly 33 includes a slip shaft 35 having a longitudinal passage 37 therethrough and a slip piston 39 slidingly mounted on slip shaft 35 . slip piston 39 is connected to slip shaft 35 by a tension spring 41 . the ends of slip shaft 35 and slip piston 39 are threaded with a thread form matching tension spring 41 and tension spring 41 is threaded directly on to slip shaft 35 and slip piston 39 . the threaded connection between tension spring 41 and slip shaft 35 and slip piston 39 allows the use of a large spring without increasing the outside diameter of the tool and it makes it easier to assemble the tool tension spring 41 normally maintains slip piston 39 in an upward position , as shown in fig2 b . an annular slip expansion chamber 43 is formed between slip piston 39 and slip shaft 35 . slip expansion chamber 43 receives gas generated by propellant 29 through a lateral passage 45 connecting slip expansion chamber 43 and longitudinal passage 37 . gas pressure within slip expansion chamber 43 causes slip piston 39 to move downwardly against the force of tension spring 41 . slip piston 39 carries at its lower end a plurality of pivotally mounted slips 47 . when propellant 29 is fired , slips 47 move downwardly with slip piston 39 and they are deflected radially outwardly by ball bearings 49 to engage the wall of casing 15 , as shown in fig1 and anchor cutting tool 11 in place . ball bearings 49 are mounted in a bottom slip sub 50 threadedly engaged with slip shaft 35 . ball bearings 49 create a surface on which slips 47 ride and they eliminate the need to harden the upper surface of bottom slip sub 50 . bottom sub 50 has a longitudinal passage 53 which forms an extension of passage 37 of slip shaft 35 . prior to firing of propellant 29 , coiled spring 51 with its ends connected together is disposed about slips 47 to keep the slips from inadvertently moving outwardly with respect to slip shaft 35 . after the pressure within slip expansion chamber 43 diminishes after firing , tension spring 41 pulls slip piston 39 back to the position shown in fig2 b to retract slips 47 to allow tool 11 to be withdrawn from casing 15 . referring now to fig2 c , cutting tool 11 includes a knuckle joint assembly 55 , which includes a socket sub 57 threadedly engaged with bottom slip sub 50 and a ball sub 59 . socket sub 57 includes a longitudinal passageway 61 which forms an extension of passage 53 and an internal spherical socket 63 . ball sub 59 includes a neck 65 which extends into a flared passage 67 in socket sub 57 . neck 65 has connected to its end a ball 69 that is trapped within socket 63 , whereby socket sub 59 is pivotal with respect to socket sub 57 in all directions limited by the flare of passageway 67 . ball sub 59 includes a longitudinal passageway which forms an extension of passage 61 of socket sub 57 . appropriate seals are provided for sealing between ball 69 and socket 63 . referring still to fig2 c , below ball sub 59 there is positioned a first chemical module 71 . first chemical module 71 includes a longitudinal chamber 73 which is sealed at its ends by dual diaphragm seal assemblies 75 and 77 . dual diaphragm seal assembly 75 includes an upper ruptureable membrane 79 and a lower ruptureable membrane 81 , which are separated by a dead air space 83 . the dual diaphragm seal serves to muffle the effect of propellant 29 , which results in a smoother flow of chemical cutting agent . chamber 73 contains a quantity of cutting fluid of the type described above . the ignition of propellant 49 causes dual diaphragm seal 75 to rupture and forces the fluid within chamber 73 to rupture dual diaphragm seal 77 . the cutting fluid is then forced through a longitudinal passage 85 and a reducer sub 87 . reducer sub 87 is threadedly connected at one end to first chemical module 71 and at its other end to a second , reduced diameter , chemical module 89 . as shown in fig2 d - 2f , second 89 includes a longitudinal chamber 91 that is sealed at its ends by dual diaphragm seals 93 and 95 . chamber 91 of second chemical module 89 contains a quantity of cutting fluid similar to that contained in chamber 73 of first chemical module 71 . referring particularly to fig2 d - 2f , a centralizer assembly , designated generally by the numeral 97 is positioned about second chemical module 89 . rotating centralizer assembly 97 includes a ratchet collar 99 that is axially and rotatably mounted on second chemical module 89 . the lower end of ratchet collar 99 includes a plurality of serated ratchet teeth 101 . ratchet collar 99 is urge downwardly with respect to second chemical module 89 by a spring 103 compressed between ratchet collar 99 and a retainer ring 105 connected to second chemical module 89 . rotating centralizer assembly 97 also includes an axially splined sleeve assembly 107 . axially splined sleeve assembly 107 includes a first sleeve 109 slidingly mounted on second chemical module 89 and a second sleeve 111 fixedly connected to second chemical module 89 by a set screw or the like 113 . first sleeve 109 and second sleeve 111 are connected together by axially extending splines , including , respectively , splines 115 and 117 . splines 115 and 117 engage each other and permit first and second sleeves 109 and 111 to move axially but not rotationally with respect to each other . since second sleeve 111 is fixedly connected to second chemical module 89 by set screw 113 , first sleeve 109 is permitted to move axially but not rotationally with respect to second chemical module 89 . the upper end of first sleeve 109 includes a plurality of serated ratchet teeth 119 , which are configured to mesh with ratchet teeth 101 of ratchet collar 99 . a spring 121 is disposed between shoulders formed on sleeves 109 and 111 to urge first sleeve 109 axially toward ratchet collar 99 , thereby urging ratchet teeth 119 into engagement with ratchet teeth 101 . it can be seen that ratchet teeth 101 and 119 permit first sleeve 109 to rotate toward the right but not toward the left with respect to ratchet collar 99 . rotating centralizer assembly 97 also includes a helically splined sleeve assembly 123 , which includes a first sleeve 125 and a second sleeve 127 . first and second sleeves 125 and 127 of helically splined sleeve assembly 123 are axially and rotatably mounted on second chemical module 89 . the upper end of first sleeve 125 includes a plurality of ratchet teeth 129 that have opposite pitch compared to ratchet teeth 101 and 119 . ratchet teeth 129 of second sleeve 127 are configured to mesh with a plurality of ratchet teeth 131 formed on the lower end of second sleeve 111 of axially splined sleeve assembly 107 . a spring 133 is compressed between shoulders formed in first and second sleeves 125 and 127 of helically splined sleeve assembly 123 to urge ratchet teeth 129 into engagement with ratchet teeth 131 . ratchet 129 and 131 permit first sleeve 125 of helically splined sleeve assembly 123 to rotate toward the left but not toward the right with respect to second sleeve 111 of axially splined sleeve assembly 107 . first and second sleeves 125 and 127 are connected together by a plurality of helical splines , including , respectively , splines 135 and 137 . splines 135 and 137 engage each other such that axial movement of first and second sleeves 125 and 127 with respect to each other produces a rotary motion . thus , when first sleeve 125 is moved toward second sleeve 127 , splines 135 and 137 cooperate to rotate first sleeve 125 toward the right . conversely , when first sleeve 125 is moved axially away from second sleeve 127 , splines 135 and 137 cooperate to rotate first sleeve 125 toward the left . second sleeve 127 of helically splined sleeve assembly 123 is connected to ratchet collar 99 by a plurality of bow springs 139 . each bow spring 139 includes a wear pad 141 which is adapted to contact the inside wall of the casing to resist axial and rotational movement of ratchet collar 99 and second sleeve 127 of helically splined sleeve assembly 123 . a spring 141 is compressed between second sleeve 127 and a retainer ring 143 connected to a second chemical module 89 . spring 141 urges second sleeve 127 axially upwardly with respect to second chemical module 89 . the operation of rotating centralizer assembly 97 can be best understood by reference to fig3 a and 3b . referring first to fig3 a , when second chemical module 89 is moved downwardly within casing 15 , by lowering cutting tool 11 on the wireline , such downward movement is resisted by the engagement by bow springs 139 with casing 15 . since ratchet sleeve 99 and second sleeve 127 of helically splined sleeve 123 are movably mounted on chemical module 89 , module 89 moves downwardly with respect thereto . on the other hand , since second sleeve 111 of axially splined sleeve assembly 107 is fixedly connected to module 89 , it is constrained to move downwardly with module 89 . the downward movement of second sleeve 111 meshes ratchet teeth 129 and 131 and causes first sleeve 125 of helically splined sleeve assembly 123 also to move downwardly . the inneraction of splines 135 and 137 produces a torque between sleeves 125 and 127 . since second sleeve 127 of helically splined sleeve assembly 123 is constrained by bow springs 139 not to rotate with respect to casing 15 , the torque causes rotation of first sleeve 125 to the right , as shown by the arrow in referring first to fig3 a , when second chemical module 89 is moved downwardly within casing 15 , by lowering cutting tool 11 on the wireline , such downward movement is resisted by the engagement by bow springs 139 with casing 15 . since ratchet sleeve 99 and second sleeve 127 of helically splined sleeve 123 are movably mounted on chemical module 89 , module 89 moves downwardly with respect thereto . on the other hand , since second sleeve 111 of axially splined sleeve assembly 107 is fixedly connected to module 89 , it is constrained to move downwardly with module 89 . the downward movement of second sleeve 111 meshes ratchet teeth 129 and 131 and causes first sleeve 125 of helically splined sleeve assembly 123 also to move downwardly . the inneraction of splines 135 and 137 produces a torque between sleeves 125 and 127 . since second sleeve 127 of helically splined sleeve assembly 123 is constrained by bow springs 139 not to rotate with respect to casing 15 , the torque causes rotation of first sleeve 125 to the right , as shown by the arrow in fig3 a . the rotation of sleeve 125 of helically splined sleeve assembly 123 is transferred through ratchet teeth 129 and 131 to second sleeve 111 of helically splined cell assembly 107 . the rightward movement , as shown by the arrow in fig3 a , of sleeve 111 is transferred by set screw 113 to cause rotation of chemical module 89 . referring still to fig3 a , spring 121 urges sleeves 109 and 121 of axially splined sleeve assembly 107 axially apart from each other . sleeves 109 and 111 are constrained by the cooperation of splines 115 and 117 not to rotate with respect to each other and , accordingly , sleeve 109 rotates toward the right , as shown by the arrow in fig3 a . however , such rightward movement of sleeve 109 is permitted by the disengagement of ratchet teeth 101 and 119 . in summary , therefore , a downward movement of tool 11 , produces an incremental rightward rotation . it will be recognized of course that when spring 103 is fully compressed , the weight of the tool will cause bow springs 139 to move axially with respect to casing 15 . referring now to fig3 b , module 89 is shown moved axially upwardly within casing 15 . again , ratchet collar 99 and sleeve 127 of helically splined sleeve assembly 123 are constrained by bow springs 133 not to move axially with respect to casing 15 . thus , module 89 moves axially upwardly with respect to ratchet collar 99 and sleeve 127 . since second sleeve 111 of axially splined sleeve assembly 107 is fixedly connected to module 89 by set screw 113 , sleeve 111 moves axially upwardly with respect to ratchet collar 99 . the upward movement of sleeve 111 compresses spring 121 which , in turn , urges first sleeve 109 of axially splined sleeve assembly 107 upwardly to mesh ratchet teeth 101 and 119 . the upward movement of second sleeve 111 of axially splined sleeve assembly 107 also permits the upward movement of first sleeve 125 of helically splined sleeve assembly 123 under the influence of spring 133 . since second sleeve 127 is constrained by bow spring 139 not to move , sleeves 125 and 127 move axially apart from each other . splines 135 and 137 cooperate during such axial movement to produce a torque between sleeves 125 and 127 . the torque toward the left , as shown by the arrow in fig3 b , on sleeve 125 causes ratchet teeth 129 and 131 to disengage thereby allowing rotation of sleeve 125 . sleeve 127 and ratchet collar 99 are again prevented from rotating by bow springs 139 . the engagement of ratchet teeth 109 and 119 prevents axially splined sleeve assembly 107 from rotating , which in turn prevents module 89 from rotating . again , if module 89 is moved upwardly far enough to fully compress spring 141 , rotating centralizer assembly 97 will move upwardly within casing 15 . it may thus be seen that module 89 , and thus tool 11 may be rotated within casing 15 by moving tool 11 short distances upwardly and downwardly . returning now to fig2 f and 2g , the lower end of second chemical module 89 is connected to an igniter sub 45 . igniter sub 145 has a longitudinal bore 147 that is filled with an igniting material such as steel wool . when the cutting fluid from chemical modules 71 and 89 flows through igniter sub 145 , it reacts with the igniting material to generate a substantial amount of heat . the lower end of igniter sub 145 is connected to a decentralizer head assembly 148 which includes a cutting heat 149 and a decentralizer sub 150 . decentralizer head sub assembly 148 has a longitudinal bore 151 which has slidingly mounted therein a head piston 153 and a decentralizer piston 155 . a plurality of radial nozzle ports 157 are formed in cuting head 149 to spray hot cutting fluid from longitudinal bore 151 radially outwardly onto the surface of the casing . nozzle ports 157 are normally sealed by head piston 153 . however , when cutting tool 11 is fired , the cutting fluid within bore 147 of igniter sub 145 drives head piston 153 and decentralizer piston 155 downwardly to open nozzle ports 157 . nozzle ports 157 are positioned on only one side of cutting head 149 . in the preferred embodiment , nozzle ports 157 cover approximately 180 degrees of the surface of cutting head 149 . thus , the entire volume of cutting fluid is directed toward only a portion of the casing . decentralizer sub 150 includes a decentralizer disk 59 positioned diametrically opposite nozzles ports 157 . decentralizer disk 159 is pivotally mounted by means of a pin 161 in a slot 163 . decentralizer disk 159 is normally retained in slot 163 by a shear pin 165 . when decentralizer piston 155 is forced downwardly , it contacts decentralizer disk 159 and shears shear pin 165 . after shear pin 165 has sheared , decentralizer disk 159 continues to rotate around pin 161 until it reaches the position shown in phantom in fig2 g . decentralizer disk 159 includes a guide way 167 which rides on a pin 169 in slot 163 . when cutting tool 11 is retrieved , pin 161 shears and decentralizer disk 159 is suspended on pin 169 . referring now to fig2 h , cutting tool 11 includes means for locating a previously cut section in casing 15 . the locating means includes a feeler assembly 171 which includes an arresting arm 173 and a support arm 175 . arresting arm 173 and support arm 175 are movably mounted in a slot 177 formed in cutting head 149 . feeler assembly 171 is normally biased radially outwardly with respect to cutting head 149 by a spring 179 which is supported by a spring mount 181 . arresting arm 173 includes a finger 183 which is biased into contact with the inner wall of casing 15 . bow springs 139 serve to centralize cutting head 149 in casing 15 to keep finger 183 in contact with casing 15 . when finger 183 encounters a previously cut portion 185 of casing 15 , finger 183 catches on the upper end of the previously cut portion . the wireline operator can detect the increased force required to raise cutting tool 11 when finger 183 is caught and can thereby determine the location of the previously cut portion . those skilled in the art will recognize other means for locating the previously cut portion . for example , an electrical switch whose actuation could be sensed up hole could be substituted for the fingers . referring now to fig4 a - 4c , there is depicted the sequence of operations in severing casing 15 . in fig4 a , a sector 187 has just been cut from casing 15 . cutting head 149 is decentralized by decentralizer disk 159 toward sector 187 and nozzles 157 have discharged their cutting fluid . it will be noted that the tool depicted in fig4 a does not include feeler assembly 171 ; on the initial cut of casing 15 , the locator means is unnecessary . in fig4 b , there is shown the configuration of the tool after it has cut a second sector 189 from casing 15 . cutting head 149 includes two feeler assemblies 171a and 1b . feeler assembly 171a has located first sector 187 , thereby positioning the nozzles 157 of cutting head 149 toward second sector 187 . decentralizer disk 159 has positioned nozzles 157 adjacent second sector 189 and the nozzles have discharged their cutting fluid . finally , in fig4 c there is depicted the configuration of the tool immediately after it has cut a third sector 191 to completely sever casing 15 . feeler assemblies 171a and 171b have located previously cut sectors 189 and 187 , respectively , to position nozzles 157 of cutting head 149 toward third sector 191 . decentralizer disk 159 has positioned cutting head 149 adjacent sector 191 and the nozzles have discharged their cutting fluid . it is thus seen that the apparatus and method of the present invention are well adapted for cutting large diameter thick walled tubular members . the tool is run into the tubular member where it makes a first cut of a portion of the tubular member &# 39 ; s wall . the tool is then removed from the tubular member and then the same or another similar tool is run back into the tubular member to locate the previously cut portion of the tubular member and cut a second portion of the tubular member . the process is repeated until the tubular member is severed . further modifications and alternative embodiments of the apparatus and method of this invention will be apparent to those skilled in the art in view of this description . accordingly , this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the manner of carrying out the invention . it is to be understood that the forms of the invention herewith shown and described are to be taken as the presently preferred embodiments . various changes may be made in the size , shape and arrangement of parts . for example , equivalent elements or materials may be substituted for those illustrated and described herein , parts may be reversed , and certain features of the invention may be utilized independently of the use of other features , all as would be apparent to one skilled in the art after having the benefit of this description of the invention . | 4 |
a gas generator of fig1 is designed to jet out a gas from its cup - shaped housing 10 through a multiplicity of holes 10a bored in the peripheral wall of the housing 10 . the open end of the cup - shaped housing 10 is closed by a lid plate 12 , and a cylindrical partition 14 is fixedly and concentrically placed in the housing 10 to divide the interior of the housing 10 into a cylindrical combustion chamber 16 and an annular cooling chamber 18 . however , the partition 14 has a multiplicity of radial holes 14a to provide communication between these two chambers 16 and 18 . a multiplicity of pellets 20 of a solid phase chemical composition which undergoes self - sustaining combustion and generates a large quantity of combustion gas are disposed in the combustion chamber 16 in a manner as will be described hereinafter . herein the term &# 34 ; pellets &# 34 ; should be construed as to include tablets , granules and relatively small blocks , mass or pieces of any other shape . an example of the gas generating chemical composition is a mixture of potassium perchlorate and sodium azide . an electrically initiatable squib or initiator 22 is secured to the housing 10 so as to intrude into the combustion chamber 16 using a tap hole 10a in the middle of the chamber 16 using a tap hole 10a in the middle of the bottom of the housing 10 . the cooling chamber 18 is filled with granules 24 of a practically inert and heat - absorbing material such as alumina . the outer surface of the cylindrical partition 14 and the inner surface of the cylindrical wall of the housing 10 are covered with wire screen layers 26 and 28 , respectively , to prevent the granules 24 from passing through the holes 14a and 10a . as an embodiment of a resilient retainer according to the invention , a generally cylindrical helical spring 30 is disposed in the combustion chamber 16 . the inner diameter of this spring 30 is somewhat larger than the diameter of the tap hole 10b for the installation of the initiator 22 and the length of the spring 30 is larger than that of the initiator 22 with respect to a portion intruding into the combustion chamber 16 . the pitch of this helical spring 30 , i . e . the width of the openings of the retainer 30 , is smaller than the smallest dimension of the individual pellets 20 . at one end , the helical spring 30 is fitted around an annular projection 10c formed on the inside of the bottom of the housing 10 so as to concentrically surround the tap hole 10b , so that the helical spring 30 surrounds the initiator 22 inserted into the combustion chamber 16 with a short distance therebetween . the helical spring 30 is assembled with the housing 10 so as to leave the space between the spring 30 and the initiator 22 completely vacant , that is , so as to permit none of the pellets 20 to be present in this space . usually , an annular space 16a between the helical spring 30 and the cylindrical partition 14 is wide enough to allow the presence of the pellets 20 in this space 16a . the opening at the free end of the helical spring 30 is closed by a plug 32 of a soft , noncombustible and , preferably , gas permeable material to prevent the pellets 20 from entering the interior of the helical spring 30 through this opening . for example , a lump of a finely meshed wire screen or a wire cloth serves as the plug 32 . the dimensions of the helical spring 30 are determined such that the pellets 20 are closely packed in the space outside of the helical spring 30 and as a whole pressed against the lid plate 12 and the cylindrical partition 14 by the force of the spring 30 . the inner surfaces of the lid plate 12 and the cylindrical partition 14 may be covered with cushioning layers ( not shown ). as will be understood from the foregoing description , the helical spring 30 prevents movements of the individual pellets 20 in the combustion chamber 16 before actuation of the gas generating device . upon initiation of the initiator 22 , the pellets 20 are ignited and undergo combustion to produce a combustion gas , which jets out of the housing 10 through the radial holes 10a after cooling during passage through the cooling chamber 18 . regardless of the magnitude of the combustion pressure in the combustion chamber 16 , the helical spring 30 does not exhibit a substantial deformation since there occurs no difference in pressure between the exterior and interior of the helical spring 30 . accordingly there occurs substantially no change in the volume of the space in which the pellets 20 are packed , until the combustion nears completion , so that the pellets 20 do not move around in the combustion chamber 16 to collide against each other and hence do not break even during operation of the gas generator . as an additional effect of the use of the helical spring 30 in the illustrated arrangement , a flame produced by the initiator can propagate uniformly in every directions since the pellets 20 are held appropriately distant from the initiator 22 . this is quite favorable to the stabilization of the ignition characteristic of the pellets 20 . furthermore , if firing of the initiator 22 is accompanied with projection of debris towards the pellets 20 , such debris can be trapped by the helical spring 30 , or a differently embodied retaining means according to the invention , so that the pellets 20 have little chance of being hit by the debris and broken . in fig2 a device according to the invention is embodied in an igniter for a solid propellant rocket motor . although different in shape and simplified by the omission of the heat - absorbing material 24 and the partition 14 , this igniter is fundamentally of the same construction as the gas generator of fig1 . in this case the open end of the housing 10 is closed by a flanged plug 13 , and the initiator 22 is screwed into a tap hole 13a of this plug 13 . by way of example , the initiator 22 in this igniter has a cylindrical body 22a charged with a fast - burning explosive composition 22c and an electrically initiatable squib 22b . indicated at 22d is a separator disc and at 22e is a closure disc . the material of the pellets 20 is a pyrotechnic composition which generates a large amount of heat as well as a combustion gas , so that this device jets out a blaze of fire through the holes 10a . an example of such a pyrotechnic composition is a mixture of potassium nitrate and boron . the outside of the housing 10 may be covered with a thin sheath 34 of a plastic film or a metal foil to close the holes 10a until ignition of the pellets 20 . the generally cylindrical helical spring 30 provided with the plug 32 at its one end is similar to that in the device of fig1 . in this case it is not necessary to secure the helical spring 30 to the plug 13 since , as will be understood from the illustration , the helical spring 30 is put into an endmost region of the combustion chamber 16 after charging of the housing 10 with the pellets 30 and appropriately compressed against the pellets 30 when the plug 13 is fitted into the housing 10 . the effects of the helical spring 30 in this igniter are identical with the effects of the spring 30 in the gas generator of fig1 . for comparison , fig3 and 4 illustrate conventional combusting devices mentioned hereinbefore . a device of fig3 is a gas generator corresponding to that of fig1 . in this device , the gas generating pellets 20 are disposed into the combustion chamber 16 without the provision of any means for preventing the pellets 20 coming into contact with the initiator 22 inserted into the combustion chamber 16 . a disc - shaped spacer 38 of , for example , a foam plastic or glass wool is disposed in the combustion chamber 16 so as to occupy an endmost region adjacent the lid 12 . this spacer 38 is thick enough to be pressed against the pellets 20 by the lid 12 . however , the use of the spacer 38 is unsatisfactory and even disadvantageous in certain respects as described hereinbefore . fig4 shows an igniter which utilizes a bag 40 of a soft sheet material and springs 42 to hold the pellets 20 motionless . the bag 40 is packed with the pellets 20 , and thereafter a mouth portion of the bag 40 is secured ( either bound or adhered ) to the plug 13 by utilizing a circumferentially cut and grooved region 13b of this plug 13 . the springs 42 are first disposed in the housing 10 and thereafter the bagged pellets 20 are inserted into the housing 10 together with the plug 13 so as to press the springs 42 against the closed end of the housing 10 . the troublesomeness of the assemblage of this igniter as mentioned hereinbefore will be apparent from the illustration . by way of example , a method of assembling the gas generator of fig1 will be described with reference to fig5 and 6 . first , the helical spring 30 is placed in the housing 10 by utilizing the annular projection 10c on the inside of the housing 10 . after disposition of the partition 14 and the wire screens 26 and 28 , the lid plate 12 is fixed to the housing 10 as shown in fig5 . to introduce the gas generating pellets 20 into the combustion chamber 16 in the thus prepared housing assembly , use is made of a funnel 44 which is formed with a spiral projection 44a on the outside of the tubular end portion . the tubular end portion of the funnel 44 is once inserted deep into the housing 10 through the tap hole 10b so as to catch the free end of the helical spring 30 by the spiral projection 44a . then the funnel 44 is pulled up to such an extent that the helical spring 30 is fully constricted towards the bottom of the housing 10 as shown in fig6 . in this state , the pellets 20 are put into the funnel 44 to fall into the combustion 16 . the funnel 44 and / or the housing 10 may be tapped gently to assist smooth falling of the pellets 20 through the tubular portion of the funnel 44 and close packing of the pellets 20 in the combustion chamber 16 . when a predetermined quantity of the pellets 20 are put into the combustion chamber 16 , the funnel 44 is moved so as to disengage the helical spring 30 from the spiral projection 44a of the funnel 44 . thereafter the plug 32 ( not shown in fig6 ) is fitted to the free end of the helical spring 30 by the use of a suitable tool . finally , the initiator 22 is screwed into the tap hole 10b of the housing 10 . the igniter of fig2 can be assembled by first charging the housing 10 with the pellets 20 , then inserting the helical spring 30 which is already fitted with the plug 32 into the housing 10 , thereafter fitting the holed plug 13 into the housing 10 and finally screwing the initiator 22 into the tap hole 13a of the plug 13 . as demonstrated by the above described methods , charging of the gas generating pellets 20 in the combustion chamber 16 of a device according to the invention can be accomplished quite easily in comparison with a corresponding process in a conventional device using either the spacer 38 shown in fig3 or the combination of the bag 40 and springs 42 shown in fig4 . furthermore , the assemblage of a device according to the invention can be accomplished quite safely since the initiator 22 is not brought into contact with the pellets 20 . the use of a helical spring as a retainer member according to the invention is beneficial and convenient . however , when the helical spring 30 is a generally cylindrical one as in the embodiments of fig1 and 2 , a compressive force of the spring 30 acts on the pellets 20 only in the direction axially of the helical spring 30 , meaning that the pellets 20 present in the annular space 16a around the helical spring 30 are insufficiently held against the cylindrical wall of the combustion chamber 16 . this becomes significant as the diameter of the helical spring 30 is made smaller relative to the diameter of the combustion chamber 16 . besides , there is a possibility that the cylindrically shaped helical spring 30 bends as shown in fig9 particularly when the helical spring 30 has a relatively small diameter . such bending of the helical spring 30 results in lowering of the resilient effect of the spring 30 . the possibility of such bending of the helical spring 30 lessens as the diameter of the helical spring 30 is increased , but it is rather undesirable to increase the diameter of the helical spring 30 since it becomes necessary to enlarge the size of the housing 10 so as to maintain an effective volume of the combustion chamber 16 at a value suitable for packing of a predetermined quantity of pellets 20 . referring to fig7 and 8 , these problems inherent to the generally cylindrical helical spring 30 in the devices of fig1 and 2 can be solved by the use of a generally conically shaped helical spring 30a with its wider end rested on the inner surface of the bottom of the housing 10 ( in fig7 ) or the plug 13 ( in fig8 ). the conical helical spring 30a does not easily bend laterally , and a compressive force of this spring 30a acts not only in the axial direction but also in oblique directions as indicated by arrows in fig7 and 10 . the narrower end of the conical helical spring 30a is closed by the aforementioned plug 32 . however , the provision of the plug 32 becomes unnecessary when the opening at the narrower end of the helical spring 30a is smaller than the individual pellets 20 . in the production of a device according to the invention , particularly the device of fig1 or fig7 it is troublesome to fit the plug 32 into the free end of the helical spring 30 or 30a . furthermore , there is a possibility of detachment of the plug 32 from the helical spring 30 or 30a by a reaction force of the pellets 20 or an impulsive force of the combustion gas . then some of the pellets 20 will enter the interior of the helical spring 30 or 30a , with the result that the helical spring 30 or 30a no longer prevents the pellets 20 from moving around in the combustion chamber 16 . referring to fig1 , these problems about the plug 32 can be solved by using another helical spring 33 , which is smaller in size than the helical spring 30a , in place of the plug 32 . the smaller helical spring 33 is disposed in the interior of the larger helical spring 30a substantially coaxially , and one end of the smaller helical spring 33 is engaged with the free end of the larger helical spring 30a . the dimensions of the two helical springs 30a and 33 are determined such that the opening at the free end of the smaller helical spring 33 becomes smaller than the individual pellets 20 . at the other end , the smaller helical spring 33 is fitted around an end portion of the initiator 22 . ( when applied to the device of fig8 this end of the smaller helical spring 33 will be rested on the inner surface of the plug 13 .) preferably , the smaller helical spring 33 also has a generally conical shape . other than a helical spring , a perforated bellows made of a sheet metal serves as a retainer member according to the invention , i . e . a hollow and resilient ( capable of expanding and being constricted ) member . a perforated bellows is quite effective for trapping of debris projected from the initiator 22 and can be fabricated with a generally closed and small holed end . the following is an example of experiments carried out to examine the effects of the present invention . some samples of conventional gas generators of the construction of fig3 were produced by varying the design of the spacer 38 , and three kinds of gas generators according to the invention were produced fundamentally according to fig1 and 10 , respectively . the combustion chamber 16 of each sample was packed with pellets 20 ( 150 g in total ) of a mixture of , essentially , potassium perchlorate and sodium azide . these gas generator samples were all subjected to the following vibration test . this test corresponds to cumulative vibrations experienced on an average automobile during about 10 years . the influence of the vibration on the pellets 20 in the gas generator samples was examined by disassembling a portion of the tested samples to measure the weight of a pulverized portion of the gas generating composition and also by measuring the combustion pressure of the tested gas generators in comparison with untested samples . the results of the measurements are presented in the following table , wherein the pulverization rate refers to the proportion of the pulverized gas generating composition to the total weight of the pellets initially packed in the combustion chamber . ______________________________________ vibra - pulverization combustion spacer or tion rate pressuretype retainer test ( wt %) ( kg / cm . sup . 2 ) ______________________________________ no -- 59 ( fig3 ) not used yes 9 . 5 116 no -- 82fig3 leaf spring yes 1 . 8 93 no -- 75fig3 ceramic wool yes 4 . 5 90 cylindrical helical spring , no -- 62fig1 with the plug 32 of steel wool yes 0 . 4 64 conical helical spring , no -- 62fig7 with the plug 32 of steel wool yes less than 0 . 1 62 conical helical spring , no -- 62fig1 with the smaller helical spring 33 yes less than 0 . 1 62______________________________________ | 5 |
with reference now to fig1 a and 1b of the drawings , the settling apparatus itself will be described . it is to be understood that the settling apparatus itself does not form the present invention . the following description will be made with reference to a pulsating sludge bed settling apparatus of the plate type . however , it is to be understood that the concept of the present invention is applicable to other known types of settling apparatus . it is however particularly preferred that the present invention be employed with a setting apparatus of the pulsating sludge bed type . furthermore , the washing feature of the system of the present apparatus is particularly useful in a settling apparatus of the plate type , i . e ., where plates extend through a portion of the settling apparatus . particularly , the system of the present invention may be employed in such a plate type settling apparatus wherein the plates are vertically aligned or inclined to the vertical . furthermore , the system of the present invention may be employed in a plate type settling apparatus of the type wherein the plates extend throughout the sludge bed and / or the clarifying zone of the settling apparatus . all such features regarding the arrangement and location of plates within the settling apparatus are known and do not constitute in and of themselves the concept of the present invention . returning now to fig1 a and 1b of the drawings , a plate type settling apparatus of the pulsating sludge bed type is shown generally by the reference numeral 2 and includes a generally vertically dimensioned bell tower or chamber 4 into which water to be treated is introduced through inlet 6 . a vacuum source , for example a vacuum motor or fan 8 , communicates with the top of chamber 4 via a pipe 10 . pipe 10 has therein an adjustment valve 12 which may be reciprocatingly opened and closed to achieve a pulsating vacuum within chamber 4 , and therefore a pulsating introduction of the fluid to be treated , such as raw sewage water , through inlet line 6 . chamber 4 communicates , at the bottom portion thereof , with a substantially horizontal bottom channel 14 extending along substantially the entire length of the settling apparatus . the water passes from bottom channel 14 laterally outwardly through branch lines 16 into a sludge bed conventionally maintained in chambers 18 . these chambers 18 are located on opposite lateral sides of bottom channel 14 and extend along substantially the entire length of the settling apparatus and communicate with each other centrally of the settling apparatus at a position above a concentrator channel 20 which is vertically aligned above bottom channel 14 . the water to be treated exits from the bottom orifices or openings in branch lines 16 , in a pulsating manner due to the operation of vacuum source 8 and valve 12 , and passes upwardly through a sludge bed positioned within decanter chambers 18 . the level of the water within chambers 18 is maintained at a level 22 . during passage of the water from branch lines 16 upwardly through the sludge bed in chambers 18 , impurities within the water to be treated are agglomerated and removed in the form of sludge , and such sludge settles in the downward direction . the purified water passes through openings in upper lateral pipes 24 into a purified water collection chamber 26 which extends substantially the length of the settling apparatus . during the operation of the settling apparatus , some of the sludge will concentrate or collect in concentrator 20 . lines 28 controlled by gate valves 30 may be provided at opposite lateral sides of the sludge bed settling apparatus to periodically remove therefrom quantities of settled sludge from the bottom of the apparatus . plates 32 may be provided in a known manner and in various known arrangements and locations within chambers 18 to facilitate the settling of the sludge and the upward movement of the purified water . the above device is conventional and in and of itself does not form the present invention . however , during operation of such device , it periodically becomes necessary to remove sludge which collects in concentrator 20 and to wash the interior of the entire settling apparatus . such operations have in the past been carried out substantially manually and are manifestly difficult and time consuming . accordingly , in accordance with the present invention there is provided a unique system for achieving both sludge extraction from concentrator 20 and washing of the interior of the entire sludge bed settling apparatus . specifically , the system of the present invention incudes at least one siphon 34 , two such siphons 34 being shown in the exemplified embodiment , joined to a vacuum conduit 36 by means of suitable pipes , such as for example pipes 38 and 40 . first or higher ends 42 of siphons 34 are connected to a manifold conduit 44 which is connected by a two - way solenoid operated valve 46 to inlet conduit 6 for introducing raw water to be treated . second or lower ends 48 of siphons 34 are connected to a pipe or pipes 50 which are positioned to extend longitudinally within concentrator chamber 20 adjacent the lower portion thereof . vacuum conduit 36 is connected through pipe 10 with vacuum source 8 . a two - way solenoid operated valve 52 is inserted in conduit 36 between vacuum source 8 and siphons 34 . a branch section 54 of conduit 36 communicates with the atmosphere through another two - way solenoid operated valve 56 . conduit 44 has at the free end thereof a solenoid operated valve 58 for discharging material from line 44 into a priming pot 60 containing a water reservoir 62 . priming pot 60 is provided with an adjustable overflow weir 64 , whereby the rate of sludge removal from concentrator 20 by siphons 34 can be adjusted . with the above description in mind , the system of the present invention and its various relationships with the settling apparatus will now be described . during normal operation of the settling apparatus , as discussed above , the system of the present invention is inoperative . that is , during such normal operation , neither sludge extraction nor washing are carried out . during such normal operation , valve 52 is closed such that siphons 34 are not under vacuum . valve 56 is open to expose siphons 34 to the atmosphere . valve 46 is closed to block connection between raw water inlet 6 and manifold conduit 44 . gate valves 30 are closed . under the above conditions , the sludge extraction and washing system of the present invention is inoperative , and the settling apparatus operates as described previously . after the settling apparatus operates for a given amount of time , it becomes desirable to remove a portion of the sludge which has collected in concentrator 20 . in accordance with the present invention , such sludge extraction can be achieved while the settling apparatus remains in operation . this operation will now be described with reference to fig2 a and 2b of the drawings . specifically , as stated above , raw water continues to be introduced into the settling apparatus and treated in the normal manner . however , valve 56 is closed , and valve 52 is opened , to subject siphons 34 to vacuum . solenoid operated valve 46 remains closed , but solenoid operated valve 58 is opened . the vacuum created in the siphons 34 causes sludge in the bottom of concentrator 20 to be sucked through the openings in pipe or pipes 50 through the lower ends 48 of the siphons 34 , and from the upper ends 42 of the siphons 34 into manifold conduit 44 . the sludge is then discharged into priming pot 60 . the rate at which the sludge is extracted by the siphons 34 is a function of the height between the level 22 of the water in the settling apparatus and the adjustable level of overflow weir 64 . the vacuum applied to siphons 34 can readily be controlled such that fluid will pass from one end thereof to the other end thereof , rather than passing upwardly through pipes 40 , 38 and 36 . such control would however be achieved by normal design considerations which would be readily understood by any ordinarily skilled engineer , and thus such considerations are not described herein . accordingly , by the above described operation , a desired amount of sludge may be removed from concentrator 20 during the otherwise normal operation of the settling apparatus . it is to be understood however that the sludge extraction operation may also be carried out when the settling apparatus is not in operation . after the settling apparatus has been operated for a given length of time , it becomes necessary to wash and clean the interior of the settling apparatus . such washing operation may be achieved in accordance with the present invention as follows , with reference to fig3 a and 3b of the drawings . initially , the settling apparatus must be drained of water . for this purpose , valves 46 , 52 and 58 are closed . valves 56 and 28 are opened , thereby allowing all water within the settling apparatus to drain therefrom . after the settling apparatus is completely emptied , valve 56 is closed , and valves 52 and 46 are opened . opening of valve 52 places siphons 34 under vacuum . opening of valve 46 allows raw water passing through inlet 6 to move into manifold conduit 44 . since valve 58 is closed , the raw water passes from manifold conduit 44 through upper ends 42 of siphons 34 . the raw water passes from lower ends 48 of siphons 34 into pipe or pipes 50 and passes through the orifices or openings therein into concentrator 20 . the raw water fills up concentrator 20 and overflows the opposite lateral edges 66 thereof , throughout the entire length thereof . this raw water thus is distributed throughout the length of the settling apparatus and sweeps or falls to bottom surfaces 68 thereof from the height of overflow edges 66 , which in a practical operating apparatus would be a substantial height , for example a height of approximately 10 feet . it will be apparent that this action of the water falling onto surfaces 68 from such a height , and throughout the entire length of the settling apparatus , will provide a very efficient cleaning action . the amount of water introduced into manifold conduit 44 may be selected to produce a sweeping action of the water falling onto surfaces 68 of a strength sufficient to remove therefrom any sludge remaining thereon . to aid this action , surfaces 68 are sloped outwardly and downwardly , as shown in fig3 b . the washing operation is further facilitated by the fact that raw water will be supplied through bottom channel 14 and lateral pipes 16 to be sprayed onto surfaces 68 , thereby further washing such surfaces . the sludge thus removed from surfaces 68 passes to recovery or collector channels 70 , from which the sludge may be discharged by means of conduits 28 controlled by gate valves 30 . the outlet end of raw water inlet conduit 6 is advantageously located a height h of 1 to 1 . 2 meters above the level of concentrator overflow edges 66 , so that the water output introduced into the manifold conduit 44 will be sufficient for washing the surfaces 68 of the settling apparatus . a suitable output rate might be for example approximately 400 cubic meters per hour ( 14 , 125 cubic feet per hour ). during the above described washing operation , the raw water fed into the settling apparatus through inlet conduit 6 may be introduced under normal or non - pulsating conditions . it will be apparent from the above description that the system of the present invention may be operated automatically to extract sludge and to wash the settling apparatus , without the need for any manual extraction or washing operations . the system of the present invention has several advantages over previously known sludge extraction systems which employ therein diaphragm valves . specifically , in accordance with the system of the present invention it is possible to completely avoid the use of diaphragm valves , and to accordingly reduce the diameter of the pipes employed for sludge extraction , in view of the absence of pressure losses which would otherwise be caused by diaphragm valves . further , it is possible to reduce the number of pipes and conduits employed in the present system , since the downstream section or sections of the siphons are connected to a common manifold . further , it is possible to avoid any risk of accidential extraction , since solenoid operated valve 52 may readily be of the type which is closed when not energized . thus , in the event of any failure of the main supply , the siphons cannot be placed under vacuum . it should be apparent from the foregoing description that , given an equal diameter of the piping system , the device of the present invention permits sludge to be extracted at a cost which is considerably lower than that of conventional extraction systems which are equipped with diaphragm valves . in the particularly preferred embodiment of the present invention , as described with reference to the drawings , the vacuum source which achieves a reduced pressure in the siphons is the same vacuum source which is used to achieve a pulsating introduction of the raw water into the sludge bed . thus , the system of the present invention is particularly advantageous when used with a settling apparatus of the pulsating sludge bed type . even further , it is possible with the present invention to not only achieve automatic sludge extraction , but to also avoid the previously necessary tedious and time consuming manual washing of the interior of the settling apparatus . that is , in accordance with the present invention , it is possible to achieve , at a cost which compares favorably with that of a conventional sludge extraction system , a device which is also capable of automatically cleaning out the interior of the settling apparatus . various modifications may be made to the specific structural arrangements described above without departing from the scope of the present invention . it is specifically to be understood that the concept and system of the present invention may be employed in other types of settling apparatus other than the plate type , pulsating sludge bed settling apparatus described and illustrated herein . | 1 |
referring now to fig1 to 6 , a ceiling fan 10 is illustrated having a mounting shaft or frame 12 , a motor housing 14 fixed to the frame 12 , a rotatable hub 16 , and five fan blades 18 extending radially from the hub 16 . the ceiling fan 10 is for all respects a conventional ceiling fan design . however , each of the fan blades 18 , in the illustrated embodiment , is provided with the filter device of the present invention . as shown in fig2 through 6 , each fan blade 18 includes a top surface 20 and a bottom surface 22 , a side edge 24 , and a side edge 26 . the side edges 24 and 26 may be the leading or trailing edges respectively depending on the direction in which the fan 10 is made to rotate . the blade 18 has a root 28 and a tip 30 as well as a main fan blade body 32 . generally speaking , the fan blade 18 , according to the embodiment shown in fig2 through 6 , includes a cavity 34 which extends for the majority of the area of the body 32 . a screen 38 extends about the bottom surface 22 covering the opening thereof and is also able to support the filter material . the filter unit 36 is shown in the drawings as located within the cavity 34 . the filter material may comprise a particulate filter and may also include a sorbent filter made of carbon , zeolite , etc ., for adsorption of gases and odors . the particulate filter may be electrically charged . the blade root 28 , in the present embodiment , includes a mounting bracket 40 to be mounted to a rotating portion of the hub 16 . as shown in the drawings , the root 28 is hollow and may be made from a pair of molded plastic halves . the root 28 defines a pair of sockets 42 ( only one is shown in fig4 ) to receive the replaceable body portion 32 . a detent rib 46 is formed in the socket 42 . the body portion 32 includes an uninterrupted metal frame 50 which defines the periphery of the body portion 32 and the tip 30 as well as the cavity 34 . a plastic extrusion 48 is snap fitted to the frame 50 , as shown in fig4 , and 6 . the extrusion 48 is formed with a ledge 52 to support the filter container 58 , as will be described . the frame 50 includes a pair of legs 54 which are inserted into the sockets 42 of the root 28 . the legs 54 include indents 56 which coincide with the detent ribs 46 when the legs 54 are inserted in the sockets 42 . the filter unit 36 may include filter material in a cardboard or disposable plastic container . in the present case , the filter container 58 is self - supporting , and when inserted in the cavity 34 , the edges of the container 58 are supported on the continuous ledge 52 of the extrusion 48 . the extension portion 60 of the container 58 covers the tip area of the cavity and may be engaged , as shown in fig5 in a slot 61 provided in the extrusion 48 . a finger opening 62 may also be provided in this extension area 60 for readily removing the container from the cavity . the filter unit 36 may take different forms and may be merely a flexible package or several packages containing the particulate filter and / or sorbent material which is adapted to lie in the cavity 34 on the screen 32 . the filter unit 36 need not be self - supporting but need only be dimensioned to fit within the cavity 34 . the filter unit 36 , according to the present invention , must be shaped to fit within the dimensional parameters of the blade 18 which has an outline in cross - section similar to conventional ceiling fan blades . in fact , the fan blade 18 of the present invention may be considered as a conventional fan blade with a cavity formed therein opening to both the top and bottom surfaces of the fan blade to allow air to pass therethrough when the fan is in operation . the above construction is but an example of how a typical fan blade in accordance with the present invention might be constructed . another aspect of the present invention includes an ion emitter 64 which is fixed to the frame 12 . the ion emitter 64 includes a cylindrical housing 66 which is meant to smoothly match with the hub 16 . a cap 68 may be fastened to the cylindrical housing 66 and sandwiches an ion emitting foil 70 , as shown in fig8 and 9 . the ion emitter foil 70 includes a peripheral serrated edge presenting sharp emitter points 69 . the sharp points 69 replace the ion emitter needles typical in such emitters . as shown in the drawings , the circuit board 72 connected to an electrical source and capable of generating voltages when connected to the emitter foil 70 , is mounted in the cap 68 , and the emitting foil 70 is held by the cap 68 against the wall 74 of the housing 64 . the cylinder 66 has a peripheral lip 76 that , in combination with a similar lip 78 on the cap 68 , defines a gap surrounding the points 69 in order to protect the points . for instance , the gap is not wide enough to allow a finger or most tools to be inserted . the filter material may be in the form of an electret and , in combination with the ion emitter 64 , will enhance the capturing of airborne particles which become charged when they enter the electrical field surrounding the fan 10 . as can be seen from the above , when the fan 10 is in operation , the fan blades 18 will rotate in a plane substantially perpendicular to the airflow caused by the fan 10 . an area of relatively high pressure exists on the bottom surface 22 of the fan blades 18 ( when the fan is rotating counterclockwise ), and an area of relatively low pressure is formed on the upper surface 20 of the fan blades 18 . depending on the resistance to air flow provided by the filter units 36 , considerable volumes of air will penetrate the filter through the bottom surface 22 of the fan blades 18 , thereby causing the airborne particles in this volume of air to be trapped within the filter 36 . thus , the filter units 36 provide depth filtration as well as surface filtration for the airflow . large diameter ceiling fans are capable of providing high volume airflows with low noise levels compared with self - contained air cleaners . the large blade surface facilitates the incorporation of significant surface areas of filtration without restricting airflow while the pressure distribution around the blade during operation facilitates the depth filtration . the particular construction of the fan blades allows a variety of high quality particulate and sorbent filters to be used without concern for their structural properties , that is , the filter units need not be self - supporting . | 5 |
the invention consists of a novel general , selective and simple method for the synthesis of capsinoids . this method consists of 4 reaction steps starting from vanillin ( 4 - hydroxy - 3 - methoxybenzaldehyde ). the method starts from vanillin , which has an aldehyde group in the position which is to be esterified . this allows protecting the aromatic hydroxyl , blocking it efficiently by means of a protective group . the subsequent reduction of the aldehyde group gives rise to a protected vanillyl alcohol which does not have selectivity problems in its esterification . once this is done , it can be deprotected generating the desired compounds with high purity and said compounds can be easily separated with no mixing owing to the competitive esterification on the aromatic ring . in brief , the method can be defined in : step 1 : protection of the hydroxyl group of the vanillin ( fig2 ). step 2 : reduction of the carbonyl of the protected vanillin ( fig3 ). step 3 : esterification of the reduced and protected vanillin with acyl chlorides or any other acylating agent ( anhydrides , dialkyl azodicarboxylate derivatives , etc .) ( fig4 ). step 4 : deprotection of the protected capsinoids ( fig5 ). these four reaction steps comprise high - yield selective reactions . fig1 : base structure of the capsinoids and side chains of known natural capsinoids . fig2 : step 1 of the method .— protection of the hydroxyl group of the vanillin ( p is a protective group ). fig3 : step 2 of the method .— reduction of the carbonyl of the protected vanillin . fig4 : step 3 of the method .— esterification of the reduced and protected vanillin with acyl chlorides or any other acylating agent ( anhydrides , dialkyl azodicarboxylate derivatives , etc .). synthesis of capsinoids using t - butyldimethylsilyl ethers as protective group and acyl chlorides as acylating agent this reaction step ( fig2 ) consists of protecting the hydroxyl group of vanillin ( 4 - hydroxy - 3 - methoxy - benzaldehyde ) to prevent that subsequent esterifications occur in this position of the molecule . the starting material for the synthesis of capsinoids is vanillin . the hydroxyl group of vanillin is protected with t - butyl - dimethylsilyl chloride , to subsequently carry out a reduction of the aldehyde group to be able to esterify in this position and thus introduce the side chains of the capsinoids . the vanillin ( 5 . 8995 g , 0 . 0388 mol ) ( ii ) is introduced in a 250 ml round - bottom flask and dissolved in 30 ml of anhydrous pyridine . 1 . 2 equivalents of t - butyl - dimethylsilane chloride ( 7 . 0128 g , 0 . 0466 mol ) are added to this solution . the reaction mixture is maintained under magnetic stirring at room temperature and in inert argon atmosphere for 24 hours . the reaction is followed by tlc ( eluent : 20 % ethyl acetate , 80 % hexane ; stain : anisaldehyde ). once the reaction has ended , it is stopped with ethyl acetate ( 100 ml ). the organic phase ( ethyl acetate ) is washed several times with a concentrated cuso 4 × 5h 2 o aqueous solution to remove the pyridine , until the color change of the cuso 4 × 5h 2 o solution is not observed . the organic phase is dried with anhydrous mgso 4 , filtered and concentrated under vacuum to remove the ethyl acetate ( room temperature ). finally a yellowish precipitate ( iii ) corresponding to silylated vanillin ( 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzaldehyde ) is obtained ( yield : 98 %). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzaldehyde : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 7 . 35 ( 1h , d , 1 . 8 hz , h - 2 ), δ 7 . 32 ( 1h , dd , 1 . 8 , 8 . 1 hz , h - 6 ), δ 6 . 91 ( 1h , d , 8 . 1 hz , h - 5 ), δ 3 . 81 ( 3h , s , h - 7 ), δ 9 . 74 ( 1h , s , h ( ald . )), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 95 ( 9h , s , 3 × ch 3 ). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 151 . 2 ( s , c - 4 ), δ 151 . 4 ( s , c - 3 ), δ 110 . 0 ( d , c - 2 ), δ 130 . 8 ( s , c - 1 ), δ 126 . 0 ( d , c - 6 ), δ 120 . 5 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 190 . 8 ( d , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 4 ( 3c , q , c - 11 ). the following reaction step ( fig3 ) consists of reducing the carbonyl group of silylated vanillin ( iii ) ( 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzaldehyde ) to its corresponding alcohol ( iv ). the reducing agent used was diisobutylaluminum hydride ( 1m in toluene ) ( dibal ). silylated vanillin ( iii ) ( 3 . 3518 g , 0 . 0125 mol ) is dissolved in 40 ml of anhydrous tetrahydrofuran . subsequently 2 equivalents of diisobutylaluminum hydride ( 1m in toluene ) are slowly added in an ice bath and the reaction mixture is maintained under magnetic stirring , at room temperature and in inert argon atmosphere for 48 hours . the reaction is followed by tlc ( eluent : 20 % ethyl acetate , 80 % hexane ; stain : anisaldehyde ). once the reaction has taken place , it is stopped with water . the aqueous phase is extracted 3 times with ethyl acetate ( 3 × 100 ml ). the organic phase is dried with anhydrous mgso 4 , filtered and concentrated under reduced pressure to remove the ethyl acetate ( room temperature ). finally , an impure dark brown oil is obtained . this oil is dissolved in a small amount of ethyl acetate and silica gel is added to obtain the head of the separation column . the head of the column is dried under reduced pressure ( room temperature ). chromatographic separation is carried out with silica gel and the polarity of the eluent is 10 % ethyl acetate in hexane . chromatographic separation is followed by tlc ( eluent : 20 % ethyl acetate , 80 % hexane ; stain : anisaldehyde ). finally a dark brown oil ( iv ) corresponding to the reduced and silylated vanillin ( 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl alcohol ) is obtained ( yield : 74 %). this oil is used as a starting material for the synthesis of all silylated capsinoids . 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl alcohol : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 72 ( 1h , dd , 1 . 8 , 8 . 2 hz , h - 6 ), δ 6 . 76 ( 1h , d , 8 . 2 hz , h - 5 ), δ 3 . 74 ( 3h , s , h - 7 ), δ 4 . 50 ( 2h , s , h - 8 ), δ 2 . 65 ( 1h , s , oh ), δ 0 . 11 ( 6h , s , 2 × ch 3 ), δ 0 . 96 ( 9h , s , 3 × ch 3 ). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 144 . 3 ( s , c - 3 ), δ 111 . 0 ( d , c - 2 ), δ 134 . 4 ( s , c - 1 ), δ 120 . 6 ( d , c - 6 ), δ 119 . 3 ( d , c - 5 ), δ 55 . 2 ( q , c - 7 ), δ 64 . 9 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 8 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ). this reaction step consists of esterifying the reduced and protected vanillin ( iv ) ( 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl alcohol ) with the corresponding acyl chlorides , according to the capsinoid which is to be synthesized ( fig4 ). the reduced and protected vanillin ( iv ) ( 0 . 8442 g ) is dissolved in 15 ml of anhydrous pyridine in a 50 ml round - bottom flask . inert argon atmosphere is introduced . next , the corresponding acyl chloride ( 2 equivalents ) is slowly added to this solution and it is left under stirring for 18 hours . the reaction is followed by tlc ( eluent : 20 % ethyl acetate , 80 % hexane ; stain : anisaldehyde ). once the reaction has ended , it is stopped with ethyl acetate . the organic phase is washed 3 times with 10 % hcl to remove the pyridine from the medium ( 3 × 50 ml ). subsequently , the organic phase is filtered and dried with anhydrous mgso 4 and concentrated under reduced pressure ( t ≈ 30 ° c .). a brownish - gray oil is obtained , which is dissolved in a small amount of ethyl acetate , then silica gel is added to obtain the head of the separation column . the ethyl acetate is dried under reduced pressure ( t ≈ 30 ° c .) to obtain the head of the column . chromatographic separation is carried out with silica gel and the polarity of the eluent is 20 % ethyl acetate in hexane . the chromatographic separation is followed by tlc ( eluent : 20 % ethyl acetate , 80 % hexane ; stain : anisaldehyde . finally a yellowish oil ( o2c - o12c ) and a pale yellowish precipitate ( o13c - o16c ) corresponding to silylated capsinoids ( v ) are obtained ( yields 84 - 99 %). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl ethanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 84 ( 1h , s b , h - 2 ), δ 6 . 81 ( 1h , d b , h - 6 ), δ 6 . 81 ( 1h , d b , h - 5 ), δ 3 . 80 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 08 ( 3h , s , h - 2 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 9 ( s , c - 4 ), δ 145 . 2 ( s , c - 3 ), δ 112 . 6 ( d , c - 2 ), δ 129 . 2 ( s , c - 1 ), δ 121 . 2 ( d , c - 6 ), δ 120 . 8 ( d , c - 5 ), δ 55 . 4 ( q , c - 7 ), δ 66 . 4 ( t , c - 8 ), δ 18 . 4 ( s , c - 9 ), δ − 4 . 6 ( 2c , q , c - 10 ), δ 25 . 7 ( 3c , q , c - 11 ), δ 170 . 9 ( s , c - 1 ′), δ21 . 1 ( q , c - 2 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl propanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 84 ( 1h , s b , h - 2 ), δ 6 . 80 ( 1h , d b , h - 6 ), δ 6 . 80 ( 1h , d b , h - 5 ), δ 3 . 80 ( 3h , s , h - 7 ), δ 5 . 03 ( 2h , s , h - 8 ), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 36 ( 2h , q , 7 . 6 hz , h - 2 ′), δ 1 . 15 ( 3h , t , 7 . 6 hz , h - 3 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 9 ( s , c - 4 ), δ 145 . 1 ( s , c - 3 ), δ 112 . 5 ( d , c - 2 ), δ 129 . 4 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 4 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 18 . 4 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 7 ( 3c , q , c - 11 ), δ 174 . 3 ( s , c - 1 ′), δ 27 . 6 ( t , c - 2 ′), δ 9 . 1 ( q , c - 3 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl butanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 84 ( 1h , s b , h - 2 ), δ 6 . 80 ( 1h , d b , h - 6 ), δ 6 . 80 ( 1h , d b , h - 5 ), δ 3 . 78 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 65 ( 2h , tq , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 0 . 92 ( 3h , t , 7 . 2 hz , h - 4 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 5 ( s , c - 1 ), δ 121 . 0 ( d , c - 6 ), δ 120 . 6 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 0 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 174 . 3 ( s , c - 1 ′), δ 36 . 1 ( t , c - 2 ′), δ 18 . 3 ( t , c - 3 ′), δ 13 . 5 ( q , c - 4 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl pentanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , s b , h - 2 ), δ 6 . 79 ( 1h , d b , h - 6 ), δ 6 . 79 ( 1h , d b , h - 5 ), δ 3 . 77 ( 3h , s , h - 7 ), δ 5 . 00 ( 2h , s , h - 8 ), δ 0 . 13 ( 6h , s , 2 × ch 3 ), δ 0 . 97 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 60 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 31 ( 2h , tq , 7 . 6 , 7 . 2 hz , h - 4 ′), δ 0 . 87 ( 3h , t , 7 . 2 hz , h - 5 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 151 . 1 ( s , c - 4 ), δ 145 . 3 ( s , c - 3 ), δ 112 . 7 ( d , c - 2 ), δ 129 . 8 ( s , c - 1 ), δ 121 . 3 ( d , c - 6 ), δ 120 . 9 ( d , c - 5 ), δ 55 . 6 ( q , c - 7 ), δ 66 . 3 ( t , c - 8 ), δ 18 . 6 ( s , c - 9 ), δ − 4 . 5 ( 2c , q , c - 10 ), δ 25 . 9 ( 3c , q , c - 11 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 2 ( t , c - 2 ′), δ 27 . 2 ( t , c - 3 ′), δ 22 . 4 ( t , c - 4 ′), δ 13 . 9 ( q , c - 5 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl hexanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , s b , h - 2 ), δ 6 . 79 ( 1h , d b , h - 6 ), δ 6 . 79 ( 1h , d b , h - 5 ), δ 3 . 77 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 0 . 13 ( 6h , s , 2 × ch 3 ), δ 0 . 97 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 27 ( 2h , m , 7 . 6 , 7 . 2 hz , h - 4 ′), δ 1 . 27 ( 2h , m , 7 . 2 , 6 . 8 hz , h - 5 ′), δ 0 . 85 ( 3h , t , 6 . 8 hz , h - 6 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 4 ( s , c - 1 ), δ 121 . 0 ( d , c - 6 ), δ 120 . 6 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 0 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 8 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 5 ( s , c - 1 ′), δ 34 . 2 ( t , c - 2 ′), δ 24 . 5 ( t , c - 3 ′), δ 31 . 2 ( t , c - 4 ′), δ 22 . 2 ( t , c - 5 ′), δ 13 . 8 ( q , c - 6 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl heptanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 83 ( 1h , s b , h - 2 ), δ 6 . 79 ( 1h , d b , h - 6 ), δ 6 . 79 ( 1h , d b , h - 5 ), δ 3 . 78 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 0 . 13 ( 6h , s , 2 × ch 3 ), δ 0 . 97 ( 9h , s , 3 × ch 3 ), δ 2 . 32 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 0 . 85 ( 3h , t , 6 . 8 hz , h - 7 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 4 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 1 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 6 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 8 ( t , c - 3 ′), δ 28 . 7 ( t , c - 4 ′), δ 31 . 3 ( t , c - 5 ′), δ 22 . 4 ( t , c - 6 ′), δ 13 . 9 ( q , c - 7 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl octanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , s b , h - 2 ), δ 6 . 78 ( 1h , d b , h - 6 ), δ 6 . 78 ( 1h , d b , h - 5 ), δ 3 . 77 ( 3h , s , h - 7 ), δ 5 . 00 ( 2h , s , h - 8 ), δ 0 . 12 ( 6h , s , 2 × ch 3 ), δ 0 . 97 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 3 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 0 . 85 ( 3h , t , 6 . 8 hz , h - 8 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 4 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 6 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 0 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 8 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 6 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 0 ( t , c - 4 ′), δ 28 . 8 ( t , c - 5 ′), δ 31 . 5 ( t , c - 6 ′), δ 22 . 5 ( t , c - 7 ′), δ 13 . 9 ( q , c - 8 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl nonanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , s b , h - 2 ), δ 6 . 78 ( 1h , d b , h - 6 ), δ 6 . 78 ( 1h , d b , h - 5 ), δ 3 . 77 ( 3h , s , h - 7 ), δ 5 . 00 ( 2h , s , h - 8 ), δ 0 . 12 ( 6h , s , 2 × ch 3 ), δ 0 . 97 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 0 . 85 ( 3h , t , 6 . 8 hz , h - 9 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 4 ), δ 129 . 7 ( s , c - 1 ), δ 121 . 0 ( d , c - 6 ), δ 120 . 6 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 0 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 8 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 6 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 0 ( t , c - 4 ′), δ 29 . 1 ( t , c - 5 ′), δ 29 . 0 ( t , c - 6 ′), δ 31 . 7 ( t , c - 7 ′), δ 22 . 5 ( t , c - 8 ′), δ 13 . 9 ( q , c - 9 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl decanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , s b , h - 2 ), δ 6 . 78 ( 1h , d b , h - 6 ), δ 6 . 78 ( 1h , d b , h - 5 ), δ 3 . 77 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 0 . 13 ( 6h , s , 2 × ch 3 ), δ 0 . 97 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 0 . 85 ( 3h , t , 6 . 8 hz , h - 10 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 3 ( d , c - 2 ), δ 129 . 4 ( s , c - 1 ), δ 121 . 0 ( d , c - 6 ), δ 120 . 6 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 0 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 8 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 6 ( s , c - 1 ′), δ 34 . 2 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 0 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 3 ( t , c - 6 ′), δ 29 . 2 ( t , c - 7 ′), δ 31 . 7 ( t , c - 8 ′), δ 22 . 5 ( t , c - 9 ′), δ 14 . 0 ( q , c - 10 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl undecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 83 ( 1h , s b , h - 2 ), δ 6 . 80 ( 1h , d b , h - 6 ), δ 6 . 80 ( 1h , d b , h - 5 ), δ 3 . 79 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 32 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 62 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 0 . 86 ( 3h , t , 6 . 8 hz , h - 11 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 9 ( s , c - 4 ), δ 145 . 1 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 5 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 4 ( q , c - 7 ), δ 66 . 1 ( t , c - 8 ), δ 18 . 4 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 7 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 3 ( t , c - 5 ′), δ 29 . 5 ( t , c - 6 ′), δ 29 . 4 ( t , c - 7 ′), δ 29 . 2 ( t , c - 8 ′), δ 31 . 8 ( t , c - 9 ′), δ 22 . 6 ( t , c - 10 ′), δ 14 . 1 ( q , c - 11 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl dodecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , s b , h - 2 ), δ 6 . 78 ( 1h , d b , h - 6 ), δ 6 . 78 ( 1h , d b , h - 5 ), δ 3 . 77 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 0 . 86 ( 3h , t , 6 . 8 hz , h - 12 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 5 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 4 ( q , c - 7 ), δ 66 . 1 ( t , c - 8 ), δ 18 . 4 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 7 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 3 ( t , c - 5 ′), δ 29 . 5 ( t , c - 6 ′), δ 29 . 4 ( t , c - 7 ′), δ 29 . 3 ( t , c - 8 ′), δ 29 . 2 ( t , c - 9 ′), δ 31 . 8 ( t , c - 10 ′), δ 22 . 6 ( t , c - 11 ′), δ 14 . 0 ( q , c - 12 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl tridecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , s b , h - 2 ), δ 6 . 77 ( 1h , d b , h - 6 ), δ 6 . 77 ( 1h , d b , h - 5 ), δ 3 . 76 ( 3h , s , h - 7 ), δ 4 . 99 ( 2h , s , h - 8 ), δ 0 . 11 ( 6h , s , 2 × ch 3 ), δ 0 . 96 ( 9h , s , 3 × ch 3 ), δ 2 . 30 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 60 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 1 . 25 ( 2h , m , h - 12 ′), δ 0 . 84 ( 3h , t , 6 . 8 hz , h - 13 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 4 ( s , c - 1 ), δ 121 . 0 ( d , c - 6 ), δ 120 . 6 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 0 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 8 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 6 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 0 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 5 ( t , c - 6 ′), δ 29 . 5 ( t , c - 7 ′), δ 29 . 4 ( t , c - 8 ′), δ 29 . 5 ( t , c - 9 ′), δ 29 . 2 ( t , c - 10 ′), δ 31 . 8 ( t , c - 11 ′), δ 22 . 6 ( t , c - 12 ′), δ 14 . 0 ( q , c - 13 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl tetradecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 84 ( 1h , s b , h - 2 ), δ 6 . 80 ( 1h , d b , h - 6 ), δ 6 . 80 ( 1h , d b , h - 5 ), δ 3 . 79 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 0 . 15 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 33 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 63 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 1 . 25 ( 2h , m , h - 12 ′), δ 1 . 25 ( 2h , m , h - 13 ′), δ 0 . 87 ( 3h , t , 6 . 8 hz , h - 14 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 5 ( s , c - 1 ), δ 121 . 7 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 1 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 6 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 4 ( t , c - 6 ′), δ 29 . 5 ( t , c - 7 ′), δ 29 . 6 ( t , c - 8 ′), δ 29 . 6 ( t , c - 9 ′), δ 29 . 6 ( t , c - 10 ′), δ 29 . 3 ( t , c - 11 ′), δ 31 . 9 ( t , c - 12 ′), δ 22 . 6 ( t , c - 13 ′), δ 14 . 0 ( q , c - 14 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl hexadecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 84 ( 1h , s b , h - 2 ), δ 6 . 80 ( 1h , d b , h - 6 ), δ 6 . 80 ( 1h , d b , h - 5 ), δ 3 . 79 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 0 . 15 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 1 . 25 ( 2h , m , h - 12 ′), δ 1 . 25 ( 2h , m , h - 13 ′), δ 1 . 25 ( 2h , m , h - 14 ′), δ 1 . 25 ( 2h , m , h - 15 ′), δ 0 . 86 ( 3h , t , 6 . 8 hz , h - 16 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 8 ( s , c - 4 ), δ 145 . 0 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 5 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 3 ( q , c - 7 ), δ 66 . 1 ( t , c - 8 ), δ 18 . 3 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 6 ( 3c , q , c - 11 ), δ 173 . 7 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 4 ( t , c - 6 ′), δ 29 . 5 ( t , c - 7 ′), δ 29 . 6 ( t , c - 8 ′), δ 29 . 6 ( t , c - 9 ′), δ 29 . 6 ( t , c - 10 ′), δ 29 . 6 ( t , c - 11 ′), δ 29 . 6 ( t , c - 12 ′), δ 29 . 3 ( t , c - 13 ′), δ 31 . 9 ( t , c - 14 ′), δ 22 . 6 ( t , c - 15 ′), δ 14 . 0 ( q , c - 16 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl 8 - methylnonanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 83 ( 1h , s b , h - 2 ), δ 6 . 80 ( 1h , d b , h - 6 ), δ 6 . 80 ( 1h , d b , h - 5 ), δ3 . 79 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 32 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 62 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 13 ( 2h , quin , 6 . 4 hz , h - 7 ′), δ 1 . 49 ( 1h , m , 6 . 4 , 6 . 4 hz , h - 8 ′), δ 0 . 85 ( 6h , d , 6 . 4 hz , h - 9 ′- 10 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 9 ( s , c - 4 ), δ 145 . 1 ( s , c - 3 ), δ 112 . 5 ( d , c - 2 ), δ 129 . 5 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 4 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 18 . 4 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 7 ( 3c , q , c - 11 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 4 ( t , c - 2 ′), δ 25 . 0 ( t , c - 3 ′), δ 29 . 5 ( t , c - 4 ′), δ 29 . 1 ( t , c - 5 ′), δ 27 . 2 ( t , c - 6 ′), δ 38 . 9 ( t , c - 7 ′), δ 27 . 9 ( d , c - 8 ′), δ 22 . 6 ( 2c , q , c - 9 ′- 10 ′). 4 - tert - butyldimethylsilyloxy - 3 - methoxybenzyl ( e )- 8 - methyl - 6 - nonanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 83 ( 1h , s b , h - 2 ), δ 6 . 80 ( 1h , d b , h - 6 ), δ 6 . 80 ( 1h , d b , h - 5 ), δ 3 . 79 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 0 . 14 ( 6h , s , 2 × ch 3 ), δ 0 . 98 ( 9h , s , 3 × ch 3 ), δ 2 . 33 ( 2h , t , 7 . 5 hz , h - 2 ′), δ 1 . 63 ( 2h , quin , 7 . 5 , 7 . 8 hz , h - 3 ′), δ 1 . 36 ( 2h , quin , 7 . 8 , 7 . 6 hz , h - 4 ′), δ 1 . 97 ( 2h , td , 7 . 6 , 6 . 1 hz , h - 5 ′), δ 5 . 29 ( 1h , dt , 6 . 1 , 15 . 2 hz , h - 6 ′), δ 5 . 36 ( 1h , quin , 15 . 2 , 5 . 9 hz , h - 7 ′), δ 2 . 20 ( 1h , dh , 5 . 9 , 6 . 7 hz , h - 8 ′), δ 0 . 94 ( 6h , d , 6 . 7 hz , h - 9 ′- 10 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 150 . 9 ( s , c - 4 ), δ 145 . 1 ( s , c - 3 ), δ 112 . 4 ( d , c - 2 ), δ 129 . 3 ( s , c - 1 ), δ 121 . 1 ( d , c - 6 ), δ 120 . 7 ( d , c - 5 ), δ 55 . 4 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 18 . 4 ( s , c - 9 ), δ − 4 . 7 ( 2c , q , c - 10 ), δ 25 . 7 ( 3c , q , c - 11 ), δ 173 . 6 ( s , c - 1 ′), δ 34 . 2 ( t , c - 2 ′), δ 24 . 4 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 32 . 1 ( t , c - 5 ′), δ 126 . 4 ( d , c - 6 ′), δ 138 . 0 ( d , c - 7 ′), δ 30 . 9 ( d , c - 8 ′), δ 22 . 6 ( 2c , q , c - 9 ′- 10 ′). the last step required for the complete synthesis of the capsinoids is the desilylation of the previously formed compounds ( v ). to that end the silylated capsinoids are reacted with a 0 . 25 m hcl / ethanol mixture at a 1 : 5 ratio . deprotection is thus achieved without observing the breakage of the ester bond . the silylated capsinoids ( v ) are introduced in a 250 ml round - bottom flask and 80 ml of the 0 . 25m hcl / ethanol mixture ( 1 : 5 ) are added . inert argon atmosphere is introduced and the reaction mixture is maintained under stirring for 18 hours . the reaction is followed by means of tlc ( eluent : 20 % ethyl acetate , 80 % hexane ; stain : anisaldehyde ). once the reaction has ended , it is stopped with brine . the aqueous phase is extracted 3 times with ethyl acetate ( 3 × 100 ml ). the three organic phases are pooled , dried with anhydrous mgso 4 and concentrated under reduced pressure to remove the ethyl acetate ( room temperature ). the obtained oil is dissolved in a small amount of ethyl acetate and silica gel is added to form the head of the column for the purification of the end product . the ethyl acetate is evaporated under reduced pressure ( room temperature ). the chromatographic separation is carried out with silica gel and the polarity of the eluent is 15 % ethyl acetate in hexane . the chromatographic separation is followed by tlc ( eluent : 20 % ethyl acetate , 80 % hexane ; stain : anisaldehyde ). finally a yellowish oil corresponding to the capsinoids ( i ) is obtained ( yields 77 - 87 %). 4 - hydroxy - 3 - methoxybenzyl ethanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 86 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 85 ( 1h , dd , 1 . 8 , 6 . 4 hz , h - 6 ), δ 6 . 88 ( 1h , d , 6 . 4 hz , h - 5 ), δ 3 . 88 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 5 . 79 ( 1h , s , oh ), δ 2 . 07 ( 3h , s , h - 2 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 8 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 3 ( d , c - 2 ), δ 127 . 7 ( s , c - 1 ), δ 122 . 0 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 9 ( q , c - 7 ), δ 66 . 5 ( t , c - 8 ), δ 171 . 0 ( s , c - 1 ′), δ 21 . 0 ( q , c - 2 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl propanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 84 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 83 ( 1h , dd , 1 . 8 , 7 . 3 hz , h - 6 ), δ 6 . 86 ( 1h , d , 7 . 3 hz , h - 5 ), δ 3 . 84 ( 3h , s , h - 7 ), δ 5 . 00 ( 2h , s , h - 8 ), δ 5 . 94 ( 1h , s , oh ), δ 2 . 33 ( 2h , q , 7 . 6 hz , h - 2 ′), δ 1 . 11 ( 3h , t , 7 . 6 hz , h - 3 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 8 ( s , c - 1 ), δ 121 . 8 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 7 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 174 . 3 ( s , c - 1 ′), δ 27 . 5 ( t , c - 2 ′), δ 8 . 9 ( q , c - 3 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl butanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 81 ( 1h , dd , 1 . 8 , 7 . 6 hz , h - 6 ), δ 6 . 84 ( 1h , d , 7 . 6 hz , h - 5 ), δ 3 . 82 ( 3h , s , h - 7 ), δ 4 . 98 ( 2h , s , h - 8 ), δ 5 . 81 ( 1h , s , oh ), δ 2 . 27 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , tq , 7 . 6 , 7 . 3 hz , h - 3 ′), δ 0 . 88 ( 3h , t , 7 . 3 hz , h - 4 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 8 ( s , c - 1 ), δ 121 . 7 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 7 ( q , c - 7 ), δ 66 . 1 ( t , c - 8 ), δ 173 . 5 ( s , c - 1 ′), δ 36 . 0 ( t , c - 2 ′), δ 18 . 2 ( t , c - 3 ′), δ 13 . 4 ( q , c - 4 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl pentanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 85 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 84 ( 1h , dd , 1 . 8 , 7 . 3 hz , h - 6 ), δ 6 . 87 ( 1h , d , 7 . 3 hz , h - 5 ), δ 3 . 85 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 5 . 95 ( 1h , s , oh ), δ 2 . 32 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 60 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 32 ( 2h , tq , 7 . 2 , 7 . 2 hz , h - 4 ′), δ 0 . 88 ( 3h , t , 7 . 2 hz , h - 5 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 8 ( s , c - 1 ), δ 121 . 8 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 7 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 7 ( s , c - 1 ′), δ 33 . 9 ( t , c - 2 ′), δ 26 . 9 ( t , c - 3 ′), δ 22 . 1 ( t , c - 4 ′), δ 13 . 5 ( q , c - 5 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl hexanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 82 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 81 ( 1h , dd , 1 . 8 , 6 . 7 hz , h - 6 ), δ 6 . 84 ( 1h , d , 6 . 7 hz , h - 5 ), δ 3 . 86 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 5 . 85 ( 1h , s , oh ), δ 2 . 32 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 62 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 27 ( 2h , m , 7 . 6 , 7 . 2 hz , h - 4 ′), δ 1 . 27 ( 2h , m , 7 . 2 , 7 . 2 hz , h - 5 ′), δ 0 . 87 ( 3h , t , 7 . 2 hz , h - 6 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 4 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 2 ( t , c - 2 ′), δ 24 . 5 ( t , c - 3 ′), δ 31 . 2 ( t , c - 4 ′), δ 22 . 2 ( t , c - 5 ′), δ 13 . 8 ( q , c - 6 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl heptanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 85 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 84 ( 1h , dd , 1 . 8 , 7 . 0 hz , h - 6 ), δ 6 . 87 ( 1h , d , 7 . 0 hz , h - 5 ), δ 3 . 85 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 6 . 03 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 60 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 0 . 85 ( 3h , t , 7 . 2 hz , h - 7 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 8 ( t , c - 3 ′), δ 28 . 7 ( t , c - 4 ′), δ 31 . 3 ( t , c - 5 ′), δ 22 . 4 ( t , c - 6 ′), δ 13 . 9 ( q , c - 7 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl octanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 86 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 85 ( 1h , dd , 1 . 8 , 6 . 7 hz , h - 6 ), δ 6 . 88 ( 1h , d , 6 . 7 hz , h - 5 ), δ 3 . 85 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 6 . 30 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 0 . 85 ( 3h , t , 6 . 8 hz , h - 8 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 28 . 9 ( t , c - 4 ′), δ 28 . 8 ( t , c - 5 ′), δ 31 . 5 ( t , c - 6 ′), δ 22 . 5 ( t , c - 7 ′), δ 13 . 9 ( q , c - 8 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl nonanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 85 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 84 ( 1h , dd , 1 . 8 , 7 . 0 hz , h - 6 ), δ 6 . 87 ( 1h , d , 7 . 0 hz , h - 5 ), δ 3 . 86 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 6 . 06 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 0 . 85 ( 3h , t , 6 . 8 hz , h - 9 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 0 ( t , c - 4 ′), δ 29 . 1 ( t , c - 5 ′), δ 29 . 0 ( t , c - 6 ′), δ 31 . 7 ( t , c - 7 ′), δ 22 . 5 ( t , c - 8 ′), δ 14 . 0 ( q , c - 9 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl decanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 85 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 84 ( 1h , dd , 1 . 8 , 6 . 4 hz , h - 6 ), δ 6 . 87 ( 1h , d , 6 . 4 hz , h - 5 ), δ 3 . 86 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 5 . 76 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 0 . 86 ( 3h , t , 7 . 2 hz , h - 10 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 0 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 3 ( t , c - 6 ′), δ 29 . 2 ( t , c - 7 ′), δ 31 . 8 ( t , c - 8 ′), δ 22 . 6 ( t , c - 9 ′), δ 14 . 0 ( q , c - 10 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl undecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 86 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 85 ( 1h , dd , 1 . 8 , 6 . 7 hz , h - 6 ), δ 6 . 88 ( 1h , d , 6 . 7 hz , h - 5 ), δ 3 . 88 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 5 . 72 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 0 . 86 ( 3h , t , 7 . 0 hz , h - 11 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 4 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 128 . 0 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 9 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 5 ( t , c - 6 ′), δ 29 . 4 ( t , c - 7 ′), δ 29 . 2 ( t , c - 8 ′), δ 31 . 8 ( t , c - 9 ′), δ 22 . 6 ( t , c - 10 ′), δ 14 . 0 ( q , c - 11 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl dodecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 86 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 85 ( 1h , dd , 1 . 8 , 6 . 1 hz , h - 6 ), δ 6 . 88 ( 1h , d , 6 . 1 hz , h - 5 ), δ 3 . 87 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 5 . 78 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 0 . 87 ( 3h , t , 6 . 8 hz , h - 12 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 5 ( t , c - 6 ′), δ 29 . 5 ( t , c - 7 ′), δ 29 . 4 ( t , c - 8 ′), δ 29 . 3 ( t , c - 9 ′), δ 31 . 8 ( t , c - 10 ′), δ 22 . 6 ( t , c - 11 ′), δ 14 . 0 ( q , c - 12 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl tridecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 86 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 85 ( 1h , dd , 1 . 8 , 6 . 7 hz , h - 6 ), δ 6 . 88 ( 1h , d , 6 . 7 hz , h - 5 ), δ 3 . 87 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 6 . 49 ( 1h , s , oh ), δ 2 . 32 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 62 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 1 . 25 ( 2h , m , h - 12 ′), δ 0 . 87 ( 3h , t , 6 . 8 hz , h - 13 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 4 ( t , c - 6 ′), δ 29 . 5 ( t , c - 7 ′), δ 29 . 6 ( t , c - 8 ′), δ 29 . 5 ( t , c - 9 ′), δ 29 . 3 ( t , c - 10 ′), δ 31 . 8 ( t , c - 11 ′), δ 22 . 6 ( t , c - 12 ′), δ 14 . 0 ( q , c - 13 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl tetradecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 86 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 85 ( 1h , dd , 1 . 8 , 5 . 6 hz , h - 6 ), δ 6 . 88 ( 1h , d , 5 . 6 hz , h - 5 ), δ 3 . 87 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 5 . 75 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 1 . 25 ( 2h , m , h - 12 ′), 1 . 25 ( 2h , m , h - 13 ′), δ 0 . 87 ( 3h , t , 6 . 8 hz , h - 14 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 4 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 29 . 2 ( t , c - 5 ′), δ 29 . 4 ( t , c - 6 ′), δ 29 . 5 ( t , c - 7 ′), δ 29 . 6 ( t , c - 8 ′), δ 29 . 6 ( t , c - 9 ′), δ 29 . 6 ( t , c - 10 ′), δ 29 . 3 ( t , c - 11 ′), δ 31 . 9 ( t , c - 12 ′), δ 22 . 6 ( t , c - 13 ′), δ 14 . 0 ( q , c - 14 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl hexadecanoate : 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 85 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 84 ( 1h , dd , 1 . 8 , 5 . 9 hz , h - 6 ), δ 6 . 87 ( 1h , d , 5 . 9 hz , h - 5 ), δ 3 . 87 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 5 . 77 ( 1h , s , oh ), δ 2 . 31 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 61 ( 2h , quin , 7 . 6 , 7 . 2 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 25 ( 2h , m , h - 7 ′), δ 1 . 25 ( 2h , m , h - 8 ′), δ 1 . 25 ( 2h , m , h - 9 ′), δ 1 . 25 ( 2h , m , h - 10 ′), δ 1 . 25 ( 2h , m , h - 11 ′), δ 1 . 25 ( 2h , m , h - 12 ′), 1 . 25 ( 2h , m , h - 13 ′), δ 1 . 25 ( 2h , m , h - 14 ′), 1 . 25 ( 2h , m , h - 15 ′), δ 0 . 86 ( 3h , t , 6 . 8 hz , h - 16 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 128 . 0 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 9 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 0 ( t , c - 4 ′), δ 29 . 1 ( t , c - 5 ′), δ 29 . 3 ( t , c - 6 ′), δ 29 . 4 ( t , c - 7 ′), δ 29 . 5 ( t , c - 8 ′), δ 29 . 6 ( t , c - 9 ′), δ 29 . 6 ( t , c - 10 ′), δ 29 . 6 ( t , c - 11 ′), δ 29 . 6 ( t , c - 12 ′), δ 29 . 2 ( t , c - 13 ′), δ 31 . 9 ( t , c - 14 ′), δ 22 . 6 ( t , c - 15 ′), δ 14 . 0 ( q , c - 16 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl 8 - methylnonanoate ( dihydrocapsaicin ): 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 86 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 85 ( 1h , dd , 1 . 8 , 5 . 9 hz , h - 6 ), δ 6 . 88 ( 1h , d , 5 . 9 hz , h - 5 ), δ 3 . 87 ( 3h , s , h - 7 ), δ 5 . 02 ( 2h , s , h - 8 ), δ 5 . 78 ( 1h , s , oh ), δ 2 . 32 ( 2h , t , 7 . 6 hz , h - 2 ′), δ 1 . 62 ( 2h , quin , 7 . 6 , 7 . 6 hz , h - 3 ′), δ 1 . 25 ( 2h , m , h - 4 ′), δ 1 . 25 ( 2h , m , h - 5 ′), δ 1 . 25 ( 2h , m , h - 6 ′), δ 1 . 12 ( 2h , quin , 6 . 4 hz , h - 7 ′), δ 1 . 49 ( 1h , m , 6 . 4 , 6 . 4 hz , h - 8 ′), δ 0 . 84 ( 6h , d , 6 . 4 hz , h - 9 ′- 10 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 5 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 9 ( t , c - 3 ′), δ 29 . 4 ( t , c - 4 ′), δ 29 . 1 ( t , c - 5 ′), δ 27 . 1 ( t , c - 6 ′), δ 38 . 9 ( t , c - 7 ′), δ 27 . 9 ( d , c - 8 ′), δ 22 . 5 ( 2c , q , c - 9 ′- 10 ′). uv λ max 279 nm . 4 - hydroxy - 3 - methoxybenzyl ( e )- 8 - methyl - 6 - nonanoate ( capsaicin ): 1 h - nmr ( cdcl 3 , 399 . 945 mhz ): δ 6 . 84 ( 1h , d , 1 . 8 hz , h - 2 ), δ 6 . 83 ( 1h , dd , 1 . 8 , 7 . 2 hz , h - 6 ), δ 6 . 86 ( 1h , d , 7 . 2 hz , h - 5 ), δ 3 . 86 ( 3h , s , h - 7 ), δ 5 . 01 ( 2h , s , h - 8 ), δ 5 . 67 ( 1h , s , oh ), δ 2 . 34 ( 2h , t , 7 . 5 hz , h - 2 ′), δ 1 . 64 ( 2h , quin , 7 . 5 , 7 . 8 hz , h - 3 ′), δ 1 . 38 ( 2h , quin , 7 . 8 , 7 . 6 hz , h - 4 ′), δ 1 . 98 ( 2h , dt , 7 . 6 , 6 . 1 hz , h - 5 ′), δ 5 . 30 ( h , dt , 15 . 2 , 6 . 1 hz , h - 6 ′), δ 5 . 37 ( 1h , dd , 15 . 2 , 5 . 9 hz , h - 7 ′), δ 2 . 21 ( 1h , dh , 5 . 9 , 6 . 7 hz , h - 8 ′), δ 0 . 95 ( 6h , d , 6 . 7 hz , h - 9 ′- 10 ′). 13 c - nmr ( cdcl 3 , 100 . 576 mhz ): δ 145 . 7 ( s , c - 4 ), δ 146 . 4 ( s , c - 3 ), δ 111 . 2 ( d , c - 2 ), δ 127 . 9 ( s , c - 1 ), δ 121 . 9 ( d , c - 6 ), δ 114 . 3 ( d , c - 5 ), δ 55 . 8 ( q , c - 7 ), δ 66 . 2 ( t , c - 8 ), δ 173 . 8 ( s , c - 1 ′), δ 34 . 3 ( t , c - 2 ′), δ 24 . 5 ( t , c - 3 ′), δ 29 . 1 ( t , c - 4 ′), δ 32 . 1 ( t , c - 5 ′), δ 126 . 4 ( d , c - 6 ′), δ 138 . 1 ( d , c - 7 ′), δ 30 . 9 ( d , c - 8 ′), δ 22 . 6 ( 2c , q , c - 9 ′- 10 ′). uv λ max 279 nm . | 2 |
substituents r and ar in the chemical formulae of ( 1 ) through ( 7 ) in the present specification will be explained first . examples of the lower alkyl group represented by r in the sulfone derivative ( 1 ), aldehyde derivative ( 2 ), phosphonium salt ( 3 ) and alcohol derivative ( 7 ) in the present invention include a ( c1 - c5 ) straight or branched chain alkyl group such as a methyl , ethyl , n - propyl , i - propyl , n - butyl , i - butyl , t - butyl group , n - pentyl group , i - pentyl group , neo - pentyl group and the like . preferred is a methyl group . examples of the aryl group which may be substituted represented by “ ar ” include a phenyl group and a naphthyl group , both of which may be substituted with at least one group selected from a c1 to c6 alkyl group ( e . g . a methyl , ethyl , n - propyl , i - propyl , n - butyl , s - butyl , i - butyl , t - butyl , n - pentyl , t - amyl , or n - hexyl group ), a c1 to c6 alkoxy group ( e . g . a methoxy , ethoxy , n - propoxy , i - propoxy , n - butoxy , s - butoxy , i - butoxy , t - butoxy , n - pentyloxy , t - amyloxy , or n - hexyloxy group ), specific examples of the optionally substituted aryl group include a phenyl , naphthyl , o - tolyl , m - tolyl , p - tolyl , o - methoxyphenyl , m - methoxyphenyl , p - methoxyphenyl , o - chlorophenyl , m - chlorophenyl , p - chlorophenyl , o - bromophenyl , m - bromophenyl , p - bromophenyl , o - iodophenyl , m - iodophenyl , p - iodophenyl , o - fluorophenyl , m - fluorophenyl , p - fluorophenyl , o - nitrophenyl , m - nitrophenyl and p - nitrophenyl group . next , a description will be made to the process for producing a sulfone derivative of formula ( 1 ) which comprises reacting an aldehyde derivative of formula ( 2 ) with a phosphonium salt of formula ( 3 ) in the presence of a base or an epoxide . specific examples of the aldehyde derivative of formula ( 2 ) include an aldehyde derivative of formula ( 2 ), wherein ar is a p - tolyl group and r represents any one of specific c2 - c4 alkyl groups as described above . further specific examples thereof include aldehyde derivatives of formula ( 2 ), wherein the p - tolyl group is replaced by other specific groups as described above for “ ar ” in the above - described specific aldehyde derivatives . the aldehyde derivative ( 2 ) can be obtained by a process as shown in scheme 1 . in the phosphopnium salt of formula ( 3 ), a halogen atom represented by x include a chlorine atom , bromine atom and iodine atom . examples of the lower alkyl group represented by y include a c1 - c6 alkyl group such as a methl , ethyl , n - propyl , i - propyl , sec - butyl , n - butyl , i - butyl , n - pentyl , or the like . examples of the optionally substituted phenyl group represented by y include a phenyl group which may be substituted with a c1 - c3 alkyl ( e . g . a methyl , ethyl , n - propyl , or i - propyl group ) or a c1 - c3 alkoxy group ( e . g . a methoxy , ethoxy , n - propoxy , or i - propoxy group ). specific examples of a group of formula : py 3 in the phosphonium salt of formula ( 3 ) include triethylphosphine , tripropylphosphine , tributylphosphine , tripentylphosphine , trihexylphosphine , triphenylphosphine , tri -( o - tolyl ) phosphine and the like . specific examples of the phosphonium salt ( 3 ) include a phosphonium salt ( 3 ), wherein “ ar ” and r have the same meaning as defined for specific examples of the aldehyde derivative of formula ( 2 ) and y is a phenyl group and x is chlorine , and further examples of compounds of formula ( 3 ), wherein y represents any one of the groups as specified for y above in place of the phenyl group above . in addition to these phosphonium salt ( 3 ), yet further examples thereof include phosphonium salts of formula ( 3 ), wherein x represents bromine , iodine or hso 4 in place of chlorine in the specified compounds above , and the like . the amount of the phosphonium salt ( 3 ) to be used is usually 0 . 5 to 2 . 0 moles , preferably , 0 . 8 to 1 . 2 per mole of the aldehyde derivative ( 2 ). there is no particular limitation as to the base used in the above reaction of the aforementioned phosphonium salt ( 3 ) with the aldehyde derivative ( 2 ) as long as it does not adversely affect the reaction . examples of the base include an alkali metal alkoxide such as potassium methoxide , potassium ethoxide , potassium n - butoxide , potassium t - butoxide , sodium methoxide , sodium ethoxide , sodium n - butoxide , or sodium t - butoxide and an alkali metal hydroxide such as potassium hydroxide or sodium hydroxide . an epoxide such as an ethylene oxide or 1 , 2 - butene oxide may be used instead of the base . the amount of the base or epoxide to be used is usually 1 to 5 moles per mol the phosphonium salt of formula ( 3 ). reacting of an aldehyde derivative of formula ( 2 ) with a phosphonium salt of formula ( 3 ) in the presence of a base or an epoxide is usually conducted in an organic solvent . a hydrocarbon solvent such as n - hexane , cyclohexane , n - pentane , n - heptane , toluene or xylene , a halogenated hydrocarbon solvent such as chloroform , dichloromethane , 1 , 2 - dichloroethane , monochlorobenzene , o - dichlorobenzene or α , α , α - trifluorotoluene , an aprotic polar solvent such as n , n - dimethylformamide , dimethylsulfoxide , acetonitrile , n , n - dimethylacetamide or hexamethylphosphoric triamide and the reaction may also be conducted in a two phase system of an organic solvent immiscible with water such as the hydrocarbon solvent , the halogenated hydrocarbon solvent or the like as referred to above and water . the reaction temperature is usually in a range of about − 10 ° c . to 150 ° c ., preferably 0 ° c . to 100 ° c . after completion of the reaction , the reaction mixture is usually subjected to post - treatments which include optionally filtration , washing , phase separation and / or evaporation to give the sulfone derivative ( 1 ), which may be further purified by column chromatography or recrystallization , if necessary . the phosphonium salt ( 3 ) can be obtained by a process which comprises reacting an alcohol derivative of formula ( 7 ): wherein ar , r and the wavy line respectively have the same meanings as defined above , with a salt of a tertiary phosphine compound of formula : py 3 and a protonic acid , or with a tertiary phosphine compound of formula : py 3 , in the presence of a protonic acid , wherein y represents the same as defined above . examples of the tertiary phosphine compound include a triphenylphosphine compound of which phenyl group may be substituted with a c1 - c3 alkyl or a c1 - c3 alkoxy group , and a tri ( c1 - c6 ) alkylphosphine . specific examples of the triphenylphosphine compound include triphenylphosphine , tri -( o - tolyl ) phosphine and the like . specific examples of said trialkylphosphine include triethylphosphine , tripropylphosphine , tributylphosphine , tripentylphosphine , trihexylphosphine and the like . examples of the protonic acid include hydrogen chloride , hydrogen bromide , hydrogen iodide and sulfuric acid examples of the salt of the tertiary phosphine compound and a protonic acid used in the above reaction include triphenylphosphine hydrochloride , triphenylphosphine hydrobromide or triphenylphosphine hydroiodide . examples of the protonic acid allowed to coexist with the tertiary phosphine compound include hydrogen chloride , hydrogen bromide , hydrogen iodide and sulfuric acid . the amount of the tertiary phosphine compound or its salt with a protonic acid is usually about 0 . 7 to 2 moles per mol of the alcohol derivative ( 7 ). the amount of the protonic acid allowed to coexist with the tertiary phosphine compound is usually about 0 . 7 to 2 . 0 moles per mol of the alcohol derivative ( 7 ). the reaction is usually conducted in an organic solvent , examples of which include those specified for the reaction of aldehyde derivative of formula ( 2 ) and a phosphonium derivative ( 3 ) above , and an alcohol solvent such as methanol or ethanol . the reaction temperature is usually in a range of 10 ° c . to 50 ° c . the resulting phosphonium salt ( 3 ) may be isolated after the reaction , alternatively it may be used as it is in the subsequent reaction without being isolated . β - carotene of formula ( 4 ) can be produced by a process which comprises reacting the sulfone derivative ( 1 ) with a base . example of the base to be used in the this reaction include an alkali metal hydroxide , an alkali metal hydride and an alkali metal alkoxide . specific examples thereof include sodium hydroxide , potassium hydroxide , sodium hydride , potassium hydride , sodium anethoxide , potassium methoxide , sodium ethoxide , potassium ethoxide , sodium t - butoxide , potassium t - butoxide and the like . the amount of the base is usually about 2 to 30 moles , preferably 4 to 25 moles per mol of the sulfone derivative ( 1 ). the reaction is usually conducted in an organic solvent , examples of which include those described above for the production process of the phosphonium derivative ( 3 ) above . the reaction temperature is usually in a range of − 78 ° c . to the boiling point of the solvent to be used . after completion of the reaction , the reaction mixture is usually subjected to post - treatments which include optionally filtration , washing , phase separation and / or evaporation as described above to give β - carotene , which may be further purified by column chromatography or recrystallization , if necessary . since β - carotene is liable to be oxidized , said post - treatments are preferably carried out in an inert atmosphere , for example , in a atmosphere of nitrogen or argon , and an antioxidant such as bht ( di - t - butylhydroxytoluene ) may be added to the reaction mixture or a solution thereof . the alcohol derivative ( 7 ), which may be a mixture of geometrical isomers of e and z , a racemate or an optically active isomer can be used in the present process . the alcohol derivative ( 7 ) above can be readily synthesized from linalool or geraniol , which is available at relatively low cost , according to the route as shown by the scheme 1 described below . a method for the synthesis of the cyclic sulfone ( 5 ) is described in jp11 - 222479 ( laid - open , unexamined ). the sulfone ( 6 ) can be derivatized by deacylation followed by selective alkylation of a secondery alcohol group to the alcohol derivative ( 7 ), which can be oxidized to aldehyde derivative ( 3 ) as shown in the following scheme and reference examples . according to the process of the present invention , β - carotene which is an important carotenoid in the fields of medicines , feed additives and food additives can be produced from readily available linalool or geraniol in an industrially advantageous manner . the present invention will be explained in more detail by way of examples , which are not intended to be limiting of the present invention . each structural formula of the compounds ( i ) to ( v ) used in the examples is shown in the scheme 2 below . 1 . 129 g ( 2 . 38 mmol ) of methoxy alcohol ( i ) was dissolved in 20 ml of methanol , to which was added 0 . 926 g of triphenylphosphine hydrobromide and the mixture was stirred at an ambient temperature for 24 hours . the reaction solution was evaporated to obtain 1 . 95 g of a crude phosphonium salt ( iii ). the resulting crude product was used in the subsequent reaction as it is . 1 h - nmr δ ( cdci 3 ); 0 . 60 - 1 . 10 ( 6 h , m ), 1 . 10 - 1 . 70 ( 10 h , m ), 1 . 70 - 2 . 30 ( 6 h , m ), 2 . 40 ( 3 h , br ), 2 . 50 - 3 . 50 ( 6 h , m ), 3 . 80 - 4 . 10 ( 2 h , m ), 4 . 30 - 4 . 70 ( 1 h , m ), 4 . 70 - 5 . 30 ( 2 h , m ), 5 . 30 - 6 . 30 ( 1 h , m ), 7 . 20 - 8 . 00 ( 19 h , m ). 258 mg ( 0 . 545 mmol ) of methoxy aldehyde ( ii ) was dissolved in 1 . 2 ml of dichloromethane , to which was added 1 . 2 ml of 2m sodium 25 hydroxide . 1 . 0 ml of dichloromethane solution containing 591 mg ( 0 . 74 mmol ) of the crude phosphonium salt ( iii ) was added thereto under stirring over about 20 min and thereafter stirred at room temperature for 24 hours . water was added to the reaction solution and extracted with chloroform , dried over anhydrous magnesium sulfate , evaporated to give a crude product , which was purified by silica gel column chromatography to give methoxy sulfone ( iv ) as a pale yellow oil containing e , z and diastereomers in a yield of 68 %. 1 h - nmr δ ( cdci 3 ); 0 . 70 - 0 . 90 ( 6 h , m ), 0 . 90 - 1 . 12 ( 6 h , m ), 1 . 31 - 1 . 65 ( 8 h , m ), 1 . 43 ( 6 h , br ), 1 . 67 ( 6 h , s ), 1 . 92 - 2 . 38 ( 8 h , m ), 2 . 01 ( 6 h , br ), 2 . 44 ( 6 h , s ), 2 . 55 - 2 . 85 ( 2 h , m ), 2 . 85 - 3 . 05 ( 2 h , m ), 3 . 05 - 3 . 25 ( 6 h , m ), 3 . 80 - 4 . 00 ( 4 h , m ), 4 . 95 - 5 . 20 ( 2 h , m ), 5 . 80 - 6 . 00 ( 1 h , m ), 6 . 00 - 6 . 15 ( 1 h , m ), 6 . 15 - 6 . 50 ( 2 h , m ), 7 . 20 - 7 . 40 ( 4 h , m ), 7 . 60 - 7 . 85 ( 4 h , m ). 91 mg ( 0 . 1 mmol ) of methoxyaldehyde ( iv ) was dissolved in 2 ml of tetrahydrofuran , to which was added 105 mg ( 1 . 5 mmol ) of potassium methoxide and refluxed for 6 hours . after being cooled to room temperature , water was added to the reaction solution and extracted with chloroform , dried over anhydrous magnesium sulfate , evaporated to give 58 mg of a crude product , which was further purified by silica gel column chromatography to give β - carotene ( v ) as a e and z mixture in a yield of 69 %. 535 mg ( 1 . 13 mmol ) of the methoxyaldehyde ( ii ) was dissolved in 3 ml of dichloromethane , to which was added 2 . 5 ml of 2m aqueous sodium hydroxide solution . 2 ml of dichloromethane solution containing 1129 mg ( 1 . 41 mmol ) of the crude phosphonium salt ( iii ) was added thereto under stirring over about 25 min and thereafter stirred at room temperature for 24 hours . water was added to the reaction solution and extracted with chloroform , dried over anhydrous magnesium sulfate , evaporated to give 1 . 619 g of methoxy sulfone ( iv ). obtained crude methoxy sulfone ( iv ) was dissolved in 20 ml of tetrahydrofuran and 1 . 19 g ( 17 mmol ) of potassium methoxide was added thereto and stirred at room temperature for 2 hours and refluxed for 6 hours . after cooling the reaction solution to room temperature , water was added thereto and extracted with chloroform and dried over anhydrous magnesium sulfate . then the organic solution was evaporated to give 1 . 06 g of a crude product , which was purified by silica gel column chromatography to give β - carotene ( v ) as a e and z mixture in a yield of 69 % from methoxyaldehyde ( ii ). chemical formulae of the compounds ( a ), ( b ), ( i ) and ( ii ) used in the reference examples are shown in scheme 3 below . 200 mg ( 0 . 37 mmol ) of sulfone compound ( a ) was dissolved in 5 ml of methanol , to which was added 0 . 11 g ( 0 . 74 mmol ) of 27 % sodium hydroxide and the mixture was stirred at 25 ° c . for 4 hours . after the reaction , reaction was quenched with saturated aqueous ammonium chloride solution and extracted with ethyl acetate . combined organic layers were washed with saturated aqueous sodium chloride solution and dried over anhydrous magnesium sulfate , then evaporated to give diol compound ( b ) as a e , z and diastereomer mixture in a yield of 95 %. 1 h - nmr δ ( cdcl 3 ); 0 . 83 - 1 . 03 ( 6 h , m ), 1 . 33 - 1 . 61 ( 2 h , m ), 1 . 38 ( 3 h , s ), 1 . 43 ( 3 h , s ), 1 . 70 ( 3 h , s ), 1 . 90 - 2 . 18 ( 7 h , m ), 2 . 44 ( 3 h , s ), 2 . 52 - 2 . 62 ( 1 h , m ), 2 . 80 - 2 . 95 ( 1 h , br ), 2 . 95 - 3 . 13 ( 1 h , m ), 3 . 77 - 3 . 84 ( 1 h , m ), 3 . 90 ( 1 h , t , j = 7 hz ), 4 . 03 ( 2 h , d , j = 7 hz ), 5 . 33 - 5 . 36 ( 1 h , m ), 5 . 48 - 5 . 52 ( 1 h , t , j = 7 hz ), 7 . 30 ( 2 h , d , j = 8 hz ), 7 . 74 ( 2 h , d , j = 8 hz ). 5 . 48 g ( 11 . 9 mmol ) of diol compound ( b ) was dissloved in 50ml of methanol , to which was added 114 mg ( 0 . 6 mmol ) of p - toluenesulfonic acid . after stirring 24 hours at room temperature , 114 mg ( 0 . 6 mmol ) of p - toluenesulfonic acid was further added thereto and stirred at room temperature for 24 hours . after completion of the reaction , a saturated aqueous sodium hydrogen carbonate solution was added thereto and extracted with ether , extract was washed with saturated aqeous sodium chloride solution , dried over anhydrous magnesium sulfate , filtrate was evaporated to gave methoxyalcohol ( i ) containing e , z and diastereomers as a pale yellow oil in a yield of 76 %. 1 h - nmr δ ( cdcl 3 ); 0 . 70 - 1 . 10 ( 6 h , m ), 1 . 30 - 1 . 65 ( 8 h , m ), 1 . 65 - 1 . 75 ( 3 h , br ), 1 . 90 - 2 . 40 ( 6 h , m ), 2 . 44 ( 3 h , s ), 2 . 60 - 2 . 80 ( 1 h , m ), 2 . 90 - 3 . 15 ( 1 h , m ), 3 . 15 - 3 . 25 ( 3 h , m ), 3 . 80 - 4 . 00 ( 2 h , m ), 4 . 00 - 4 . 20 ( 2 h , m ), 5 . 00 - 5 . 20 ( 1 h , m ), 5 . 35 - 5 . 50 ( 1 h , m ), 7 . 20 - 7 . 40 ( 2 h , m ), 7 . 70 - 7 . 90 ( 2 h , m ). 1 . 3 g of manganese dioxide was added to a solution of 1 . 42 g ( 2 . 99 mmol ) of methoxy alcohol ( i ) in 10 ml of dichloromethane , and the resulting solution was stirred at room temperature for 8 hours . after 1 . 3 g of manganese dioxide was further added to the reaction mixture and stirred at room temperature for 12 hours , reaction mixture was diluted with ether , dried over anhydrous magnesium sulfate , filtrate was evaporated to give a crude product . obtained crude product was purified by silica gel column chromatography to give methoxyaldehyde ( ii ) as a pale yellow oil containing e , z and diastereomers in a yield of 91 % 1 h - nmr 8 ( cdcl 3 ); 0 . 75 - 1 . 05 ( 6 h , m ), 1 . 30 - 1 . 60 ( 8 h , m ), 1 . 90 - 2 . 45 ( 3 h , m ), 2 . 02 ( 3 h , d , j = 1 . 5 hz ), 2 . 18 ( 3 h , t , j = 1 . 5 hz ), 2 . 45 ( 3 h , s ), 2 . 71 ( 1 h , dd , j = 7 hz , 15 hz ), 3 . 04 ( 1 h , dd , j = 6 hz , 15 hz ), 3 . 18 ( 3 h , d , j = 15 hz ), 3 . 85 - 3 . 95 ( 1 h , m ), 3 . 95 - 4 . 05 ( 1 h , m ), 5 . 00 - 5 . 10 ( 1 h , m ), 5 . 80 - 5 . 90 ( 1 h , m ), 7 . 20 - 7 . 35 ( 2 h , m ), 7 . 65 - 7 . 85 ( 2 h , m ), 9 . 98 ( 1 h , d , j = 8 hz ). | 2 |
fig2 represents in cross - section a closely - coupled diffuser and deswirler system in accordance with a preferred embodiment of this invention , while fig3 is an isolated perspective view of the system shown in fig2 . common to the system shown in fig1 the deswirler system of this invention is employed with a stationary diffuser 116 equipped with vanes 118 that direct the swirling air or gas that flows generally radially from the impeller of a centrifugal compressor ( not shown ) to the annular - shaped inlet 112 of a gas turbine engine combustor ( not shown ). the deswirler system of this invention also includes a transition region 120 immediately downstream of the diffuser 116 . as with the system shown in fig1 the transition region 120 includes an annular manifold 122 that receives the radially - outward air flow from the diffuser 116 , and redirects this airflow aft and radially inward toward the entrance 112 of the combustor . it is within the scope of this invention that the manifold 122 could turn the flow from the diffuser 116 by as little as about 90 degrees , and as much as about 180 degrees , though it is believed that a turn angle of about 130 to about 140 degrees would be more typical . while the diffuser 116 will be described in terms of having a vane - type configuration , the teachings of this invention are also applicable to pipe - type diffusers . the manifold 122 shown in fig2 and 3 defines an axi - symmetric bend 124 bounded by a pair of radially inner and outer surfaces 128 and 130 , respectively , that are typically defined by the compressor hub and casing . the manifold 122 causes the flow entering the combustor to be characterized by a relatively low mach number and a particular meridional (“ spouting ”) angle that together achieve more stable and efficient combustor performance . disposed within the axi - symmetric bend 124 of the manifold 122 are a number of deswirler vanes 126 . as such , the deswirler vanes 126 of this invention are not limited to being located within a straight section downstream of the bend 124 , such as within the conical axi - symmetric flow path shown for the prior art in fig1 . the vanes 126 serve the traditional role of removing the residual circumferential swirl from the flow exiting the diffuser 116 by converting the high tangential velocity component of the flow exiting the diffuser 116 to a more useful static pressure . however , the placement of the vanes 126 within the bend 124 also enables the vanes 126 to be closely coupled to the diffuser 116 , in addition to being closely coupled to the combustor inlet 112 . as used herein , the term “ closely coupled ” is used to denote that clearances are reduced to those necessary for component assembly and operation without interference . accordingly , the vanes 126 shown in fig2 and 3 are closely coupled to the diffuser 116 , while the deswirler vanes 26 of fig1 are not closely coupled to the diffuser 16 . in a preferred embodiment , the deswirler vanes 126 are equally circumferentially spaced within the manifold 122 . the radially inward and outward edges of each vane 126 are shown as being delimited by the two axi - symmetric curved surfaces 128 and 130 of the manifold 122 . the shape of each vane 126 is determined aerodynamically so that the air or gas is simultaneously but gradually turned from the outward radial direction with substantial swirl angle ( when it leaves the diffuser 116 ) to the meridional spouting direction with approximately zero swirl ( as it enters the combustor inlet 112 ). for this purpose , and as best seen in fig4 each vane 126 is also circumferentially - arcuate ( i . e ., arcuate relative to a longitudinal line parallel to the centerline of the engine ), so as to provide arcuate gas flow path surfaces within the manifold 122 that promote the elimination of swirl . the radial height of each vane 126 will typically be dependent on the particular arcuate shape of the vane 126 , as understood by those skilled in the art . as shown in fig2 through 4 , the leading edge 132 of each vane 126 is closely coupled to the diffuser 116 , and the trailing edge 134 of each vane 126 is closely coupled to the combustor inlet 112 . as such , each of the vanes 126 extends the entire length of the bend 124 between the inlet and outlet of the manifold 122 . in fig5 an alternative embodiment is shown in which alternate deswirler vanes 126 extend the entire length of the bend 124 between the inlet and outlet of the manifold 122 , but those vanes 136 between the alternate vanes 126 do not . as shown in fig5 the leading edge 138 of the shorter vane 136 is decoupled from the diffuser 116 , while the trailing edge 140 remains closely coupled to the inlet 112 of the combustor . a benefit of this embodiment of the invention is a further reduction of engine axial length and reduced weight while maintaining performance improvements . shown in fig6 and 7 are two additional embodiments for deswirler vanes of this invention . in fig6 deswirler vanes 142 are shown having a thicker trailing edge 146 as compared to their leading edges 144 . in addition , a hole 148 is formed in one of the vanes 142 to accommodate the passage of a cooling or lubrication tube ( not shown ) through the vane 142 , which may be necessary or advantageous in view of the compactness of the deswirl system of this invention . fig7 also shows deswirler vanes 150 with thicker trailing edges 154 as compared to their leading edges 152 . in contrast to the embodiment of fig6 one of the vanes 150 is equipped with a slot 156 to accommodate a cooling or lubrication tube . by incorporating cooling and lubrication tubes within the vanes 142 and 150 , a more uniform exit condition can be achieved , further reducing the risk of affecting the compressor stall margin . an important aspect of the present invention is the potential for aerodynamic advantages realized through close coupling the deswirler vanes 126 , 142 and 150 to the diffuser 116 . at least one benefit arising from this feature of the invention is the determination that improved efficiencies can be achieved through appropriate relative circumferential positioning of the deswirler vanes 126 , 142 and 150 relative to the passages between adjacent diffuser vanes 118 . the benefits of this aspect of the invention are believed to be possible if the number of full - length deswirler vanes 126 , 142 and / or 150 is an integer multiple of the number of diffuser passages , and more preferably equal to the number of diffuser passages . testing has confirmed that enhanced engine performance occurs if each of the full - length deswirler vanes 126 , 142 and / or 150 is circumferentially offset from one of the diffuser vanes . in fig8 this offset is schematically illustrated by an aft - looking - forward view of the diffuser vanes 118 and deswirler vanes 126 , with the centerline of the engine indicated at “ c .” tick marks are shown at intervals of one - quarter of the pitch “ p ” along the interface between the outer diameter of the diffuser vanes 118 and the inner diameter of the deswirler vanes 126 . while offsets of between one - quarter and three - quarters have been evaluated , optimum results for the engine tested have been achieved where the offset between deswirler and diffuser vanes was between one - quarter and one - half pitch , approximately at about three - eighths pitch . the optimum offset for a given engine may vary for different compressor and combustor designs . however , the unconventional capability with this invention to optimize the diffuser - deswirler system match provides greater design flexibility in terms of minimizing losses attributable to the diffuser - deswirler interface . while the invention has been described in terms of preferred and alternative embodiments , it is apparent that other forms could be adopted by one skilled in the art . for example , the deswirler system of this invention could be employed within a multistage centrifugal compressor and placed between each consecutive pair of stages . therefore , the scope of the invention is to be limited only by the following claims . | 5 |
referring to the drawings , and at first particularly to fig1 to 4 thereof , the nasal dilator of the present invention is generally designated 10 , and is of unitary construction having a proximal end 12 and a distal end 14 . two wing - like arc springs 24 are attached to a common base 16 . the arc springs 24 are band - like and may be compared mechanically to very short sections of a watch spring . they are joined symmetrically to the top of the base 16 forming a shared and fixed fulcrum axis 22 along that junction . the arc springs 24 are of equal natural curvature with their convex sides facing generally in the distal direction , and are bilaterally symmetrical in every way . each joins , at its outer extremity , with a lever arm 26 . these lever arms 26 are bilaterally symmetrical , opposing and are urged together at their distal , or in this case upper , ends by the arc springs 24 . ( see fig1 for the above .) here , as elsewhere in this description , vertical dimensions ( top , bottom , upper , lower , etc .) are arbitrarily assigned and made uniform in order to facilitate and clarify the disclosure of the present invention and it is to be understood that these terms have not been used by way of limitation . dimensions of proximity ( proximal , distal ) are assigned according to the frame of reference of a physician or technician and the hand or other instrument with which he manipulates the present invention during its use . centrical dimensions ( inner , inward , outer , outward ) refer to the plane of symmetry of the present invention as central . the proximal or lower ends of the lever arms 24 extend below the base 16 and terminate in outwardly flared finger grips 28 ( see fig1 ). these finger grips 28 are contiguous with what are substantially parallel segments 30 of the lever arms 26 . the parallel arm segments 30 of the opposing lever arms 26 give way in each arm at a bend joint 34 to symmetrically converging arm segments 32 which culminate in an apical contact point 35 where the opposing lever arms 26 touch at their upper or distal extremities . the arc springs 24 are compressed into an increased curvature or tightness by forcing the two finger grips 28 toward each other . the upper or distal ends of the lever arms 26 are thereby spread apart . the lever arms 26 are joined immediately below their bend points 34 to the arc springs 24 in a fixed , generally tangential orientation . this configuration provides a large mechanical advantage in bending the arc springs 24 and hence in spreading the lever arms 26 outward from their apical contact point 35 , as indicated by the fact that there is only a very small increment of bending movement in each of the springs 24 that results from a relatively large inward swinging movement of the lever arm finger grips 28 . extending from the upper ends of the lever arms 26 distally along the plane of symmetry of the nasal dilator 10 herein described , at preferably approximately 30 ° above the horizontal as defined by the fulcrum axis 22 of the arc springs 24 , are two elongated , symmetrical and generally parallel dilating members 36 . thus , the dilating members 36 are angularly offset at a preferred angle of inclination of approximately 60 ° relative to the general longitudinal axes of the lever arms 26 . the dilating members 36 have tapering , convexly rounded outwardly facing surfaces 39 with rounded distal ends 38 ( fig2 , 6 , 7 ). when not spread apart by inward force exerted upon the finger grips 28 , the dilating members 36 make contact along their upper edge -- also the apical contact point 35 . thus , the springs 24 support the lever arms 26 in a normal position of repose in which the dilating members 36 are in a substantially closed - together position . when mated in this manner , it is possible to easily and safely insert the dilating members 36 into a nostril , even with the relatively delicate tissues that are present . the increasing expansion of the dilating members 36 toward their base follows the approximate contours of the nostril interior . once the dilating members 36 have been inserted , the nostril can be dilated by forcing the finger grips 28 at the proximal ends of the lever arms 26 together . this is the essential action of the present nasal dilator 10 and the general purpose of any adequate speculum to be used in the examination of the nasal passages . the base 16 of the nasal dilator 10 has a recessed socket 18 in its underside . this socket 18 allows the nasal dilator 10 to be mounted on a conventional illuminating device 42 of the sort commonly used in the examination of the nasal passages and available from welch - allyn corp . of skaneateles falls , n . y . ( see fig1 and 9 ). this conventional illuminating device has a generally cylindrical battery pack 44 which serves as a handle , with a bulb extension 46 extending in a gooseneck configuration from its upper end . the nasal dilator 10 is properly oriented on the top of battery pack 44 by means of a downwardly opening notch 20 in the recessed socket 18 allowing passage for the bulb extension 46 whereby the light is shone along an angle suitable for illumination of the nasal passages ( see fig1 and 2 ). in fig1 to 4 and 9 , the present nasal dilator 10 is shown in conjunction with such a conventional illuminating device 42 . fig1 and 9 disclose the compatability of the angled dilating members 36 with the upwardly inclined direction of illumination of the bulb extension 46 indicated by the phantom line 48 in fig2 and 5 . the inward facing surfaces 40 of the dilating members 36 are chordally grooved as shown in fig1 , 6 and 9 . when the upper ends of the lever arms 26 are spread , the matching concavities of the inner surfaces 40 of the dilating members 36 open an aperture suitable for the unobstructed passage of a light beam provided by the illuminating device 42 along the direction of the phantom line 48 . ( see fig4 and 5 ). this aperture also allows for the insertion of a mucosal specimen collection probe . the symmetrical spread of the dual lever arms 26 and consequently of the dilating members 36 insures the even , unobstructed illumination of the nasal passage . the symmetrical separation of the lever arms 26 also allows the light beam indicated by phantom line 48 to be centered along the passage defined between inward facing surfaces 40 . when mounted on a conventional illuminating device 42 , experience shows that it is natural and comfortable to grip and steady the speculum attachment between the thumb and forefinger , while the second , third and fourth fingers grasp the bulk of the battery pack 44 . the present nasal dilator 10 exploits this natural impulse of the physician or technician by matching opposing dual lever arms 26 to the opposition of thumb and forefinger . the present nasal dilator 10 becomes a natural extension of the technician &# 39 ; s hand . the symmetry of the nasal dilator 10 also allows the device to be used with equal facility in the left or right hand . in the preferred embodiment of the present invention , the nasal dilator 10 is molded of an inexpensive , resilient plastic material having good elastic memory characteristics , such as nylon or the like . this allows the nasal dilator 10 to be distributed for one - time use . the disposability of the present invention circumvents the inconvenience of sterilization for reuse and the danger of infection presented by improper or inadequate sterilization . also , the use of a non - metallic material in producing the present nasal dilator 10 eliminates any reflection of light that may occur with a metal speculum and hinder a clear view of the nasal passage . it also eliminates the discomfort frequently caused by contact of cold metal parts against warm , sensitive nasal tissues . another embodiment of the present invention is that in which the dilating members 36 are made smaller for use in pediatric examination . since the dilating members 36 of the present nasal dilator 10 are spring - urged together , the examining physician can easily control the amount of pressure exerted on a child &# 39 ; s nasal passage and avoid injury to the young patient . the rounded sides of the dilating members 36 greatly reduce the chances of damaging the delicate tissues of a child &# 39 ; s nose . it is important that the nasal dilator 10 as disclosed herein be molded of a sufficiently resilient material to provide a strong and stable spring for the wing - like arc springs . the symmetrical tension in these springs insures the symmetrical spread of the lever arms 26 and hence the dilating members 36 . it is this symmetrical spread of the dual lever arms 26 and dilating members 36 that allows the unobstructed beam of light to be centered along the nasal passage . while the present invention has been described with reference to presently preferred embodiments , it is to be understood that various modifications or alterations may be made by those skilled in the art without departing from the scope and spirit of the invention as set forth in the appended claims . | 0 |
the present invention may be embodied in a shoe upper conforming machine such as that shown in u . s . application ser . no . 459 , 693 , filed apr . 10 , 1974 . the machine described therein is adapted for simultaneously lasting opposite side portions of shoes which comprises an arrangement of shoe supporting means , shoe length sensing means , shoe positioning and clamping means , and a pair of lasting rolls . the shoe supporting means comprises a jack post 10 , only a portion of which is shown in fig1 which carries a last pin 8 upstanding from a block 9 supported ( with capacity for some movement extending transversely in the machine ) upon a head portion of the jack post 10 . the jack post 10 is mounted for swinging movement about a transverse axis upon a carriage and also for rising and falling movements relatively to the carriage , the carriage not being shown . the carriage is movable , in a direction extending lengthwise of a shoe assembly mounted upon the shoe supporting means , relatively to an arrangement of lasting rolls , one of which is shown in fig4 and to an arrangement of nozzle members having adhesive applying means . the machine also has means for swinging the jack post about said transversely extending axis and for raising and lowering the jack post , to move the jack post from a shoe loading position to an operative position in which a heel seat portion of the shoe is located against a hold - down member 12 carried by the carriage . the adhesive applying means of the illustrative machine comprises a pair of nozzle members 20 each for operating at opposite sides of the shoe assembly and extending from lower end portions of a pair of nozzle carriers 22 . upper end portions of each of the nozzle carriers 22 are pivoted on studs 24 extending from forward end portions of a pair of nozzle supporting arms 26 , only one being shown . the nozzle supporting arms 26 are substantially l - shaped , as shown in fig1 . the nozzle supporting arms 26 are pivoted for swinging movements about a cross shaft 28 which is carried by frame portions of the machine . pivotal movement of the nozzle supporting arms 26 about the cross shaft 28 permits the nozzle members 20 to rise and fall heightwise with respect to the general plane of the bottom of a shoe carried by the shoe support , while pivotal movement of the nozzle carriers 22 about the axes of the studs 24 permits the nozzle members 20 to move widthwise with respect to the shoe bottom . because of the remoteness of the nozzle members 20 from the axis of the cross shaft 28 , the rising and falling movements of the outlet end portions of the nozzle members 20 take place on generally linear heightwise paths . similarly , because of the length of the nozzle carriers 22 , pivotal movement about the pivot studs 24 also permits generally linear widthwise movement of the outlet end portions of the nozzle members 20 . the arrangement just described also permits each of the nozzle members 20 to be suspended above the shoe assembly being operated upon and moved between the retracted , inoperative positions and operative positions without interfering with other operative portions of the machine . each nozzle supporting arm 26 is acted upon by a first piston and cylinder arrangement 30 for imparting rising and falling movements of the nozzle members 20 , and for largely counterbalancing the weight of the nozzle members 20 and associated parts while the nozzle members 20 are operating to apply adhesive along the marginal portions of the shoe bottom . each piston and cylinder arrangement 30 ( one for each arm 26 ) comprises a cylinder 32 as shown in fig1 supported by a frame portion 34 of the machine . the cylinder 32 contains a slidably mounted piston 36 from which extends a piston rod 38 . a rearward end of the piston rod 38 bears against a hardened plate 40 on the associated nozzle supporting arm 26 . each nozzle supporting arm 26 has an upstanding bracket 50 , as shown in fig1 and 3 , on which a second piston and cylinder arrangement 52 is mounted for imparting movements to the nozzle member 20 outwardly widthwise of the shoe assembly . the piston and cylinder 52 comprises a cylinder 54 in which is slidably mounted a piston ( not shown ) from which extends a piston rod 58 . a head portion 60 of the piston rod 58 is arranged to abut against a pin 62 extending between lugs of a bifurcated outer end portion of one arm 64 of a bell crank lever 65 . a second arm 66 which extends forwardly , is shown in fig1 and 3 . the bell crank lever arms , 64 , 66 , are pivoted on studs 68 upstanding from each of the nozzle supporting arms 26 . each of the nozzle carriers 22 has a pin 70 extending from a boss 72 , as shown in fig1 and 2 , and is coupled with the forwardly extending arm 66 of the associated bell crank lever 65 by a connecting pin 78 slidable in the arm 66 supported within a bracket 80 . when air under pressure is admitted to rearward end portions of the cylinders 54 , each of the piston rods 58 are moved forwardly to cause the head portions 60 to abut against the pins 62 and swing the bell crank lever arms 64 , 66 , in directions to swing the nozzle carriers 22 in such directions as to move the outlet end portions of the nozzle members 20 outwardly away from each other . air pressure applied to the opposite ends of the cylinders 54 will urge the head portions 60 away from the pins 62 so that frictional forces in the piston and cylinder arrangement 52 do not impose additional loads on each of the nozzle members 20 during their shoe bottom edge following movements . each nozzle carrier 22 is provided with a counterweight 150 , as shown in fig2 for biasing their respective nozzle members 22 inwardly , about pivot studs 24 , during the adhesive applying operation . the counterweight 150 being on the left , as shown in fig2 would cause a counterclockwise direction of rotation by nozzle 20 about stud 24 . this direction is also toward the center of the shoe , as shown in the drawing . when pressurized air is supplied to the forward end portions of the cylinders 32 the pistons 36 will travel rearwardly ( as seen in fig1 ) to swing the nozzle supporting arms 26 clockwise about the cross shaft 28 ( as seen in fig1 ) to raise the nozzle members 20 from their operative positions to inoperative positions . when it is desired to move the nozzle members 20 to operative positions the air pressure acting in the cylinders 32 is reduced sufficiently to allow the weight of the parts to swing the nozzle supporting arms 26 in a counterclockwise direction about the cross shaft 28 . the pressure of air admitted to the cylinders 32 under this condition will be sufficient to counterbalance the greater part of the weight of the nozzle members 20 and the associated parts so that the outlet end portions of each of the nozzle members 20 bear little pressure against the shoe bottom . each pin 70 disposed on the nozzle carriers 22 is received within a generally oval shaped bore 74 , as shown in fig1 . the bore 74 extends transversely through a central portion 76 of a connecting pin 78 . the connecting pin 78 is rotatably mounted ( with capacity for endwise movement ) in aligned bores in the associated arm 66 and in an l - shaped bracket 80 which is secured to that arm 66 , again as shown in fig1 . this arrangement permits a floating connection between the arm 66 and the associated pin 70 to allow for the swinging movements of the arms 66 and 64 in one plane and the swinging movement of the pin 70 in another plane substantially at right angles thereto . each nozzle member 20 is generally tubular in form , an upper end of the nozzle 20 being secured in a nozzle block 82 and a lower end being provided with a shoe bottom margin engaging surface 106 and a guide portion 86 depending at an outer side of the surface 106 . each nozzle block 82 is supported by a pair of pins 88 extending from a block 90 of heat insulating material secured , by screws 91 , to a depending portion 92 of the associated nozzle carrier 22 . the nozzle block 82 is heated in order to maintain a thermoplastic adhesive fed to the nozzle member 20 in molten condition . each nozzle block 82 provides a melting device 94 through which extends a spirally disposed passageway 95 leading from an inlet connection 96 , shown in fig1 to a passageway 93 , shown in fig2 through the nozzle block 82 to the nozzle member 20 . the melting device 94 is provided with an electrically heated cartridge 97 , as shown in fig2 for maintaining the melting device at such a temperature that adhesive in the form of rod fed by any convenient means into the inlet connection and may be melted and , as further solid rod is fed into the inlet connection , molten adhesive is extruded through an outlet opening 98 provided in the nozzle member 20 . liquid adhesive , however , may be substituted for the thermoplastic solid type of adhesive . to avoid drooling of adhesive from each of the nozzle members 20 between successive cycles of operation of the machine , there is provided , for each nozzle member 20 , a needle valve 100 , as shown in fig2 which extends through a bore in the associated nozzle block 82 to seat against a seat 101 , as shown in fig4 in the nozzle member 20 at a locality close to the outlet opening 98 . each needle valve 100 is connected with a plunger 102 of a piston and cylinder device 104 which acts to retract the needle valve 100 from its seat 101 during the time when it is desired to apply adhesive to the margin of the bottom of the shoe . each piston and cylinder device 104 is secured to the associated nozzle carrier 22 . a second bracket 130 , as shown in fig1 and 3 , is secured to each bracket 80 which supports a cylinder 132 of a third piston and cylinder arrangement 134 . a piston rod 136 of piston and cylinder arrangement 134 extends widthwise of the machine as shown in fig3 . a head portion 138 is adjustably threaded upon the piston rod 136 , which is arranged to abut against a plunger 140 of a valve 142 secured to a plate 144 . the plate 144 is upstanding from , and secured to , the associated supporting arm 26 . the piston and cylinder arrangement 134 and its associated parts provide stop means , as detailed below , for adjustably limiting the widthwise separating movement of the nozzle members 20 under the action of the piston and cylinder arrangements 52 . during the cycle of operations of the present invention , a shoe assembly , shown in fig4 comprising an upper u and an insole i mounted on a last l will be placed upon the jack post 10 with the last pin 8 engaged in the usual thimble hole of the last l on which the shoe assembly is mounted while the jack post 10 is in its loading position , as shown in fig1 . the jack post 10 will then be swung heelwardly and raised to position the heel seat portion of the insole i against the hold - down member 12 by means fully disclosed in said copending application . a toe engaging member , not shown , by engagement with the toe end portion of the shoe assembly , automatically sets the position of a stop rod , not shown , relative to the carriage in a position in accordance with the length of the shoe to be operated upon . the shoe clamping means comprising heel band and side clamping assemblies , indicated by the letter h in fig1 will be applied to the shoe assembly to hold it firmly in position with the shank portion at least approximately centralized widthwise in the machine . a toe pad 172 supported by the shoe carrier will also be raised into shoe supporting position . the carriage for the shoe supporting means is moved rearwardly and forwardly by means of a pneumatic piston and cylinder arrangement under the control of a hydraulic dash - pot arrangement , not shown . when the jack post 10 is in its loading position the carriage occupies a loading position which is intermediate its fully forward and fully rearward positions . at this time the nozzle members 20 are in their raised , inoperative positions , the pistons 36 being urged to the right , as seen in fig1 by air pressure applied in the cylinders 32 . the nozzle members 20 are also held in their innermost positions , closely adjacent to each other , as a result of the action of the counterweights 150 urging the nozzle carriers 22 in opposite directions about the pivot studs 24 . when the shoe supporting carriage is in its loading position , the nozzle members 20 are located above a portion of the insole in the relatively narrow shank region . at this time , a signal is developed in the control circuit of the machine which brings about a reduction in the pressure of air supplied to the cylinders 32 to allow the nozzle supporting arms 26 to swing downwardly to cause the nozzle members 20 to approach the shoe bottom or insole i . simultaneously , air under pressure is applied to the rearward end portions of the cylinders 52 to cause the piston rods 58 to outstroke and , through the action of the levers 64 , 66 and associated parts , to swing the nozzle carrier outwardly against the action of the counterweights 150 . at this time , air under pressure is applied to the cylinders 132 to extend the piston rods 136 into the positions shown in fig3 . outward swinging movement of the nozzle carriers 22 under the action of the piston and cylinder arrangements 134 is limited by engagement of the head portions 138 with sleeves 143 in which the plungers 140 of the valves 142 slide . as the head portions 138 move into engagement with the sleeves 143 , the plungers 140 are actuated to operate the valves 142 . this removes the air pressure applied to the cylinders 54 to allow springs therein to withdraw the piston rods 58 and hence to remove the head portions 60 from abutting relationship with the pins 62 , so that the counterweights 150 may again be effective to bias the nozzle members 20 inwardly toward the shoe bottom edges . the operation of the valves 142 also acts to remove air pressure supplied to the cylinders 132 . engagement of the head portions 138 with the sleeves 143 is arranged to arrest outward movement of the nozzle members 20 when the guide portions 86 have moved outwardly sufficiently far to clear the edges of the shoe bottom in the comparatively narrow shank region . as may be seen in fig2 shoe bottom margin engaging surfaces 106 of the nozzle members 20 are arranged to extend widthwise of the machine to such an extent , conveniently some 8 mm ., that the stop means provided by the head portions 138 and the sleeves 143 does not require adjustment to ensure that , when the outward movement of the nozzle members 20 is arrested , the guide portions 86 are beyond the opposite edges of the insole but the insole shoe bottom engaging surfaces 106 extend , at least in part , over marginal portions of the shoe bottom so as to prevent the nozzle members 20 dropping completely off the edges of the insole over at least a considerable range of sizes of insole . with the guide portions 86 over the opposite edges of the insole , the nozzle members 20 rest with their insole or shoe bottom engaging surfaces 106 in contact with marginal portions of the insole and the guide portions 86 are biased inwardly , by action of the counterweights 150 , into engagement with the opposite edges of the insole . the air pressure admitted to the cylinders 32 is sufficient to counterbalance the major portion of the weight of the nozzle members 20 and their associated parts so that the nozzle members 20 rest with but light pressure upon the insole i . similarly , the counterweights 150 are selected so that the guide portions 86 rest only lightly against the edges of the shoe bottom so as not to be likely to break those edges down even in relatively thin portions of the insole i . the nozzles 20 having been moved into proper engagement with the insole i , the carriage is then moved rearwardly to a position determined by engagement of a rear end portion of the previously mentioned stop rod with an abutment member of the machine . during such movement of the carriage , the shoe bottom is moved lengthwise relative to the nozzle members 20 while the guide portions 86 are maintained in engagement with the opposite edges of the insole . the exhaustion of air from the cylinders 132 renders the stop means provided by the head portions 138 and the sleeves 143 ineffective so that the nozzle members may move outwardly to the desired extent as the wider portions of the insole i are traversed . when rearward or heelward movement of the carriage is arrested , the shoe assembly will be positioned in the desired position for a typical arrangement of lasting rolls , as indicated by r in fig4 to commence the side lasting operation , adjacent the previously lasted toe portion . at the time when rearward movement of the carriage is arrested , a valve device in the control circuit arrangement is actuated to initiate the feeding of adhesive through outlet openings 98 of the nozzle members as shown in fig2 and 4 . the openings are positioned to permit adhesive to flow under the lasting marginal portions of the upper u as they curl over the insole i toward the previously lasted toe portion . the lasting rolls r are then lowered into operative positions in engagement with the lasting marginal portions of the insole , and forward movement of the carriage is initiated to carry the shoe assembly forwardly to cause the nozzle members 20 to extrude adhesive along the marginal portions of the insole i as they are maintained with the guide portions 86 in engagement with the opposite edges of the insole i , and the lasting rolls r , to wipe marginal portions of the upper u inwardly across the applied adhesive . the lasting operation thus progresses continuously and simultaneously along opposite side portions of the shoe assembly from the previously lasted toe portion to a region in the vicinity of the breast line . movement of the carriage is then arrested and the nozzle members 20 and the lasting rolls r are returned to their inoperative positions . air under pressure is then readmitted to the cylinders 132 to reset the stop means provided by the head portions 138 of the piston rods 136 and the sleeves 143 . the adhesive applying operation may be terminated by any known manner such as a signal derived from the carriage reaching a predetermined position . this signal also causes the upward withdrawal of the nozzle members 20 , resulting from an increase in pressure of the air supplied to the cylinders 32 , the nozzle members 20 being urged inwardly to their initial positions by the action of the counterweights 150 . the signal also acts to terminate the feeding of adhesive to the nozzle members 20 and the closing of the needle valves 100 . the signal also automatically causes the raising of the lasting rolls r at the end of the lasting operation , and the shoe supporting jack post 10 being swung to its initial loading position , while the carriage is moved rearwardly or heelwardly to its loading position . the outlet openings 98 of the nozzle members are directed toward the front of the machine so that they are trailing in the sense of the direction of movement of the shoe assembly past the nozzle members 20 , the shoe assembly moving in the direction of the arrow shown in fig4 . as seen in fig4 the toe end of the shoe points in the direction of movement and the forepart of the bottom of the last l is often inclined ( to an extent depending on the style of shoe and heel height ) to the horizontal . the insole engaging surface 106 of the nozzle members 20 is therefore also inclined to the horizontal at a considerable angle so as to enable the nozzle members 20 to seat on forepart portions of the shoe bottoms of various styles of shoe assembly and maintain the outlet openings 98 of the nozzle members 20 in close proximity to the insoles i . this inclination of the insole engaging surfaces 106 also tends to ensure that when the nozzle members 20 , during their outward movement , reach the opposite edge portions of the insole i , the guide portions 86 drop over the opposite edges of the insole i and may be moved into contact therewith . in fig4 there is also shown in chain dotted lines the positions which a nozzle member 20 occupies with respect to the insole i at progressively later stages in the movement of the shoe assembly past the nozzle member 20 . it is to be understood that the foregoing embodiment is stated as descriptive and exemplary only , and not to be interpreted as limiting the scope of the invention . | 0 |
[ 0034 ] fig1 through 6 show a first embodiment of the present invention in which a fuse box 11 is disposed on a battery box 40 mounted inside an engine compartment . a case of the fuse box 11 includes a lower case 12 , an upper case 13 , and an intermediate case 14 that fixedly accommodates a battery fuse 10 , an input - side bus bar 15 connected to a terminal of the battery fuse 10 , and an output - side bus bar 16 also connected to the terminal of the battery fuse 10 . a battery terminal 20 to be fixed to the periphery of a battery post 41 of the battery box 40 is fastened to the input - side bus bar 15 to electrically connect the battery fuse 10 to a battery . battery post 41 projects from an upper surface of the battery box 40 . more specifically , one end of the input - side bus bar 15 overlaps an input terminal 10 b projecting horizontally from one side of a bottom surface of a body 10 a of the battery fuse 10 . one end of the output - side bus bar 16 overlaps an output terminal 10 c projecting horizontally from the other side of the bottom surface of the body 10 a of the battery fuse 10 . screw portions 15 a and 16 a projecting from the input - side bus bar 15 and the output - side bus bar 16 , respectively , penetrate through a through - hole ( not shown ) of the input terminals 10 b and a through - hole ( not shown ) of the output terminal 10 c , respectively , and are fixed with a nut n . the intermediate case 14 accommodates the battery fuse 10 , the input - side bus bar 15 , and the output - side bus bar 16 . after the input - side bus bar and the output - side bus bar are accommodated in the intermediate case , it is possible to fasten the input - side bus bar to the input terminal of the battery fuse with a bolt and fasten the output - side bus bar to the output terminal of the battery fuse with a bolt . the intermediate case 14 in which the battery fuse 10 , the input - side bus bar 15 , and the output - side bus bar 16 are disposed is mounted on the lower case 12 , and the upper case 13 is mounted on the lower case 12 . a slight gap s 1 ( see fig4 ) is generated between the intermediate case 14 and the lower case 12 in this assembling . an opening 14 a is formed in penetration through the intermediate case 14 so that the input - side bus bar 15 and the output - side bus bar 16 can relieve radiated heat . at the position where the opening 14 a is disposed , the lower case 12 is mountably disposed in confrontation with the intermediate case 14 . as shown in fig3 a drainage port 12 a is formed in lower case 12 at the position where the battery fuse 10 is disposed , a drainage port 12 b is formed at the position where the input - side bus bar 15 is disposed , and a drainage port 12 c is formed at the position where the output - side bus bar 16 is disposed . a droplet - dividing rib 12 d having a predetermined height is projectingly formed between the drainage ports 12 a and 12 b , between the drainage ports 12 b and 12 c , and between the drainage ports 12 c and 12 a . as shown in fig5 the drainage port 12 a is provided with an approximately square central hole 12 a - 1 and a generally triangular cut - out portion 12 a - 2 formed by outwardly cutting the four sides of the central hole 12 a - 1 at the central position of each side . four upwardly inclined portions 12 b - 1 are formed toward the four sides of the central hole 12 a - 1 on a lower - side outer surface 12 b of the lower case 12 . a water - leading groove 12 a - 3 continuous with the tip of each of the cut - out portions 12 a - 2 is formed at the central position of each of the upwardly inclined portions 12 b - 1 . an inner surface 12 a of the lower case 12 at its upper side is gently declined toward the drainage port 12 a to flow water which has collected in the lower case 12 toward the drainage port 12 a . the tip of the triangular cut - out portion 12 a - 2 of the drainage port 12 a and the tip of the tip of the water - leading groove 12 a - 3 formed on the outer surface of the lower case 12 are continuous with each other through a thin continuous portion 12 a - 4 . thus , the inner and outer surfaces of the lower case 12 can be made continuous with each other . the configuration of the drainage ports 12 b and 12 c is similar to that of the drainage port 12 a . the drainage ports 12 b and 12 c are formed at positions adjacent to a side wall of the lower case 12 near a lower surface thereof . thus , cut - out portions 12 b - 2 and 12 c 2 and water - leading grooves 12 b - 3 and 12 c - 3 may be formed on two or three sides of the central hole 12 a - 1 , instead of all four sides as in the previous example . in the upper case 13 , one half serves as an opening / closing cover 13 a . a hinge 13 c is interposed between the opening / closing cover 13 a and another half 13 b locked to the lower case 12 to open and close the opening / closing cover 13 a . the fuse box 11 having the above - described construction is mounted on the upper surface of the battery box 40 . the battery terminal 20 connectable to battery post 41 of battery box 40 is accommodated in the fuse box 11 and connected to the input - side bus bar 15 . more specifically , a circular - arc portion 21 of the battery terminal 20 projects from a to - be - crimped portion which is crimped to the tip of an electric wire w 1 of a power circuit . a tightening piece 22 projects from the tip of the circular - arc portion 21 at its one side , whereas a tightening piece 23 making a pair with the tightening piece 22 projects from the tip of the circular - arc portion 21 at its other side . a bolt opening ( not shown ) is formed on each of the tightening pieces 22 and 23 . as shown in fig2 the electric wire w 1 is accommodated in an electric wire accommodation portion 14 e of the intermediate case 14 and not extended to the position corresponding to the circular - arc portion 21 of the battery terminal 20 . the circular - arc portion 21 is exposed to the outside to fit it on the battery box 40 . the other end portion of the input - side bus bar 15 is extended to a position where the other end portion overlaps the side of the tightening piece 23 to form a connection piece 15 b through which a bolt opening 15 b - 1 communicating with the bolt opening ( not shown ) of the tightening pieces 22 and 23 is formed . a screw portion 16 b projects upward from the upper surface of the output - side bus bar 16 at an intermediate position of the other side thereof with the nut n , a terminal 25 is fastened to an end of an electric wire w 2 to be connected to a relay box ( not shown ). the method of fixing the fuse box 11 to the battery box 40 is described below . initially the fuse box 11 is disposed over the battery box 40 . then , the circular arc portion 21 of the battery terminal 20 is fitted on the periphery of the battery post 41 . with the bolt opening ( not shown ) of each of the tightening pieces 22 , 23 and the bolt opening 15 b - 1 of the connection piece 15 b of the input - side bus bar 15 overlapping each other , the bolt b is inserted through the bolt openings and fastened with the nut n . this fits circular arc portion 21 on the periphery of the battery post 41 . in this operation , the battery and the battery fuse 10 are electrically connected to each other , and the fuse box 11 is fixed to the battery box 40 . then , the opening / closing cover 13 a of the upper cover 13 is closed to lock the upper cover 13 to the lower cover 12 . at this time , as shown in fig4 the droplet - dividing rib 12 d projecting from the bottom wall of the lower case 12 contacts the upper surface of the battery box 40 , and a small gap s 2 is formed between the outer surface 12 b of the lower case 12 and the battery box 40 . if water penetrates into the fuse box 11 mounted on the upper surface of the battery box 40 , as described above , water collects in the small gap s 1 formed between the intermediate case 14 and the lower case 12 . in this case , water 100 flows down to the drainage ports 12 a through 12 c along the inner surface 12 a of the lower case 12 . if the amount of the water 100 is large , the water 100 flows out from the drainage port 12 a and is discharged to the small gap s 2 formed between outer surface 12 b of the lower case 12 and the battery box 40 . on the other hand , if a small amount of water 100 flows to the drainage ports 12 a through 12 c along the inner surface 12 a of the lower case 12 , a droplet 100 a sticks to the peripheral edge of the drainage ports 12 a through 12 c , namely , the peripheral edge of the central hole 12 a - 1 and that of the cut - out portion 12 a - 2 and does not flow out from the drainage ports 12 a through 12 c . at the time of the water penetration , the droplet 100 a sticks to the outer surface 12 b of the lower case 12 and to the water - leading groove 12 a - 3 . as shown in fig6 the droplet 100 a that has stuck to the tip of the water - leading groove 12 a - 3 and the droplet 100 a that has stuck to the tip of the cut - out portion 12 a - 2 ( fig2 ) contact each other at the thin continuous portion 12 a - 4 . when the droplet 100 a on the outer surface 12 b of the lower case 12 and the droplet 100 a on the inner surface 12 a thereof contact each other and coalesce therewith , the former acts in such a way as to draw out the latter from the inner surface 12 a of the lower case 12 . consequently , the droplet 100 a flows out through the water - leading groove 12 a - 3 . as described above , the droplet present on the outer surface of the lower case 12 contacts and coalesces the droplet that has collected in the slight gap s 1 between the intermediate case 14 and the inner surface 12 a of the lower case 12 , with the droplet sticking to the peripheral edge of the drainage ports 12 a through 12 c at the side of the inner surface 12 a of the lower case 12 . thereby , it is possible to discharge the droplet to the outside through the drainage ports 12 a through 12 c . thus , it is possible to prevent water from collecting in the slight gap s 1 between the intermediate case 14 and the inner surface 12 a of the lower case 12 . that is , it is possible to prevent water from penetrating into the opening 14 a of the intermediate case 14 . thereby , it is possible to prevent a current leak or electrical short from occurring between the input - side bus bar 15 and the output - side bus bar 16 . the present invention is not limited to the above - described embodiment . for example , a drainage port 120 and a cut - out portion 121 continuous therewith may be shaped , as shown in fig7 a , 7b , and 7 c . that is , it is possible to adopt any drainage port 20 having a cut - out portion 121 and a tip 121 a tapering off to form an acute angle . the electric parts accommodation box is used not only as the fuse box , but also as boxes accommodating electric component parts . the water - leading groove continuous with the peripheral edge of the drainage port formed on the bottom wall of the electric parts accommodation box is disposed on the outer surface of the bottom wall of the electric parts accommodation box . therefore , the droplet sticking to the tip of the water - leading groove disposed on the outer surface of the bottom wall of the electric parts accommodation box contacts and coalesces the droplet sticking to the peripheral edge of the drainage port disposed on the inner surface of the bottom wall thereof . thereby , the droplet can be drained by drawing it out to the outer surface of the bottom wall . as apparent from the foregoing description , according to the present invention , the drainage port formed on the bottom wall of the electric parts accommodation box has the cut - out portion , the tip of which tapers off to form an acute angle and which is continuous with the central hole thereof . the water - leading groove continuous with the tip is formed on the outer surface of the bottom wall , with the tip of the water - leading groove and the peripheral edge of the drainage port continuous with each other . therefore , the droplet sticking to the tip of the water - leading groove disposed on the outer surface of the bottom wall of the electric parts accommodation box contacts and coalesces the droplet sticking to the peripheral edge of the drainage port disposed on the inner surface of the bottom wall thereof . as a result of the coalescence of the droplets , the droplet sticking to the peripheral edge of the drainage port is guided out . in this manner , drainage can be accomplished reliably . when the electric parts accommodation box is used as the fuse box accommodating the battery fuse , the droplet sticking to the inner surface of the bottom wall of the lower case can be completely drained , even though the bottom wall of the lower case and the bus bars is narrow . thus , it is possible to prevent a current leak from occurring between bus bars . further since the fuse box is directly mounted on the battery box , space can be saved . the battery fuse and the battery post are connected to each other not with the lead wire but with the battery terminal . thus , it is possible to improve reliability on the electric connection . | 7 |
fig1 shows an exemplary embodiment of a portable electronic device 100 such as a mobile phone . the portable electronic device 100 includes a first housing 10 , a connector case 20 and a second housing 30 . referring to fig2 , the first housing 10 defines a cavity 12 at an end portion thereof . the cavity 12 is cooperatively defined by a bottom board 120 , two sidewalls 121 , 123 and two end surfaces 122 , 124 connecting with the sidewalls 121 . a guiding portion 13 is formed near a corner of the cavity 12 on the bottom board 120 . the guiding portion 13 includes a first rail 131 and a second rail 132 . the first rail 131 and the second rail 132 are substantially parallel to each other and extends from an inner surface of the end surface 122 , with the first rail 131 adjacent to the sidewall 121 . each rail 131 , 132 respectively includes a strip 1310 and a tab 1311 vertically extending from a top portion of the strip 1310 , and the two tabs 1311 of the first rail 131 and the second rail 132 extend toward each other . two substantially parallel bars 1322 are formed on the strip 1310 of the second rail 132 , substantially perpendicular to the strip 1310 and the tab 1311 . each bar 1322 defines an arcuate slot 1323 at one end thereof for locking the connector case 20 . also referring to fig3 , the connector case 20 includes a first end surface 211 , a second end surface 212 , a first side surface 213 , a second side surface 214 , a top surface 215 , and a bottom surface 216 , wherein the top surface 215 . the first end surface 211 , the bottom surface 216 and the second end surface 212 surround the second side surface 214 in order . the first end surface 211 and the first side surface 213 respectively form a first step 2111 and a second step 2132 , for preventing the connector case 20 from wholly sliding into the cavity 12 of the first housing 10 . a microphone interface 24 is set in the first end surface 211 , adjacent to the bottom surface 216 . an engaging portion 22 is formed on the second side surface 214 , and includes two l - shaped latches 221 for engaging with the two rails 131 , 132 of the first housing 10 . each latch 221 includes an edge 2211 at a top portion thereof , and the two edges 2211 of the latches 221 extend in opposite directions . a hemispherical protrusion 222 is positioned beside the engaging portion 22 , for selectively engaging in the slots 1323 of the guiding portion 13 to stably hold the connector case 20 . a usb interface 23 is arranged in the second side surface 214 , adjacent to the top surface 215 , and a connector ( not shown ) is arranged in the bottom surface 216 so that a usb or a microphone inserted into the interfaces can electrically connect with a main circuitry of the portable electronic device 100 . the second housing 30 includes a main plate 31 , a side flange 32 and an end flange 33 connecting together . a cutout 34 is defined at a joining portion of the main plate 31 , the side flange 32 and the end flange 33 for allowing the connector case 20 extend through . the main plate 31 and the end flange 33 respectively have a first cut edge 312 and a second cut edge 322 . the first cut edge 312 and the second cut edge 322 respectively match the first step 2132 and the second step 2111 , so as to prevent the connector case 20 from wholly moving inside the portable electronic device 100 . in assembly of the portable electronic device 100 , the engaging portion 22 of the connector case 20 is engaged with the guiding portion 13 of the first housing 10 , so that the connector case 20 is slidable relative to the first housing 10 . the second housing 30 is attached to the first housing 10 , with the connector case 20 extending through the cutout 34 . the first step 2132 and the second step 2111 respectively face the first cut edge 312 and the second cut edge 322 . in use , the connector case 20 is pushed out , and the latches 221 slide along the rails 131 , 132 until the protrusion 222 is locked into one slot 1323 adjacent to the end surface 122 . the usb interface 23 and the microphone interface 24 are exposed . thus , users can insert a usb or a connector of a microphone into the usb interface 23 or the microphone interface 24 . it should be understood that the latches 221 will resist the end surface 122 when the connector case 20 is further pushed out , which can stop the connector case 20 getting away from the portable electronic device 100 . after use , the connector case 20 is pushed into the cavity 12 until the protrusion 222 is pushed to be locked into the other slot 1323 far away the end surface . it should be understood that the first step 2132 and the second step 2111 will be stopped by the cut edges 312 , 322 when the connector case is given a further pushing force , which can stop the connector case 20 further moving inside the portable electronic device 100 . it is to be further understood that even though numerous characteristics and advantages of the present embodiments have been set forth in the foregoing description , together with details of the structures and functions of the embodiments , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed . | 7 |
an embodiment of the present invention will be described with reference to fig1 - 3 . in this embodiment , an electronic weighing apparatus is implemented as the electronic apparatus . first , an electronic weighing apparatus body 21 is provided with a load cell 22 and a circuit board 23 . on the circuit board 23 , there is mounted a 1 - chip cpu 24 . here , the 1 - chip cpu 24 is different from the conventional 1 - chip cpu , that is , both of the parallel transfer program and the serial transfer program are included . more concretely , the 1 - chip cpu 24 includes a program memory 60 comprising a parallel transfer program memory 60a and a serial transfer program memory 60b . the parallel transfer program memory 60a is a memory in which a program for a data transfer to a parallel transfer printer is stored . on the other hand , the serial transfer program memory 60a is a memory in which a program for a data transfer to a serial transfer printer is stored . in addition , the program memory 60 also stores a program judging a state of a connector judge port pc associated with the connector 27 on the body side ( to be described later ) and program select means including a program to selectively calling into a work area the parallel transfer program memory 60a or the serial transfer program memory 60b . furthermore , the 1 - chip cpu 24 is connected to a key 25 , a display section 26 , and the load cell 22 . moreover , the 1 - chip cpu 24 is connected to the connector 27 on the body side . the connector 27 on the body side is provided with a data transfer port 61 linked with lines drawn from the respective ports p 1 - p 13 of the 1 - chip cpu 24 , a judge port pc connected to a port other than the ports p 1 - p 13 of the 1 - chip cpu 24 , and a voltage supply terminal vs connected to + 5v . an intermediate point of a line connecting the judge port pc to the 1 - chip cpu 24 is connected via a resistor r to the groung g . incidentally , the judge port pc , the voltage supply terminal vs , and the judge port state judge program in the program memory 60 constitute the judge means . for the side of the such an electronic weighing apparatus body 21 , there are provided a printer interface 30 for the parallel transfer and a printer interface 40 for the serial transfer so as to be selectively connected to the electronic weighing apparatus body 21 . first , the printer interface 30 includes a connector 31 having a connection pin 62 adaptive to the connector 27 on the body side , a parallel / parallel interface 32 connected to the connector 31 for the parallel processing , and a connector 33 to be connected to a parallel transfer printer ( not shown ). when the connection pin 62a of the connector 31 for the judge port pc of the connector 31 is connected to the connector 27 on the body side , the voltage supply terminal vs of the connector 27 on the body side is connected by a short circuit to the judge port pc , thereby applying + 5v also to the judge port pc . furthermore , the connector 31 connects only the components of the data transfer port 61 corresponding to the ports p 1 - p 10 of the 1 - chip cpu 24 to the interface 32 . on the other side , the printer interface 40 includes a connector 41 having a connection pin 63 adaptive to the connector 27 on the body side , a parallel / serial interface 42 connected to the connector 41 for effecting a parallel / serial conversion processing , and a connector 43 to be connected to a parallel transfer printer . when the connection pin 63a of the connector 41 for the judge port pc is connected to the connector 27 on the body side , the judge port pc of the connector 27 on the body side is set to 0 v state ( grounded state ). furthermore , the connector 41 connects only the components of the data transfer port 61 corresponding to all the ports p 1 - p 13 of the connector 27 on the body side to the interface 42 . in the configuration above , since the 1 - chip cpu 24 in the electronic weighing apparatus body 21 possesses both of the parallel transfer program and serial transfer program , a parallel transfer printer and a serial transfer printer can be fundamentally connected thereto . fig1 ( a ) shows a case where the connector 31 of the printer interface 30 is inserted into the connector 27 on the body side to establish the connection , thereby setting a state in which a parallel transfer printer can be connected . on the other hand , fig1 ( b ) shows a case where the connector 41 of the printer interface 40 is inserted into the connector 27 on the body side to establish the connection , thereby setting a state in which a parallel transfer printer can be connected . in such two configurations , the state of the judge port pc is used to judge which one of the connectors 31 and 41 is connected to the connector 27 on the body side . the operation flow ranging from the judgment to the data transmission will be described with reference to the flowchart of fig3 . first , in a case where the connector 31 is connected as shown in fig1 ( a ), + 5v is also applied to the judge port pc of the connector 27 on the body side . in this case , the 1 - chip cpu 24 recognizes that the parallel transfer interface 30 has been connected to the connector 27 on the body side . this causes the program select means in the program memory 60 to call the parallel transfer program memory 60a into the work area . as a result , the ports p 1 - p 13 are defined for the parallel transfer use . that is , the ports p 1 - p 4 are set to the data input use , the ports p 5 - p 10 are set to the data output use , and the ports p 11 - p 13 are set to the floating state . this completes the preparation of the data transfer and enables the system in the constitution of fig1 ( b ) to be connected to a parallel transfer printer . on the other hand , in a state of fig1 ( b ) where the connector 27 on the body side is connected to the printer interface 40 in place of the printer interface 30 , the judge port pc of the connector 27 on the body side is not supplied with + 5v and is in the grounded state of 0 v . that is , the judge port pc is at a low level . in this situation , the 1 - chip cpu 24 recognizes that the serial transfer interface 40 has been connected to the connector 27 on the body side . the program select means in the program memory 60 then calls the serial transfer program memory 60b into the work area . as a result , the ports p 1 - p 13 of the 1 - chip cpu 24 are defined for the serial transfer use . that is , the ports p 1 - p 8 are set to the data input use , the ports p 9 - p 13 are set as control lines . this enables the system in the constitution of fig1 ( b ) to be connected to a serial transfer printer . as described above , according to the present invention , without changing or modifying the hardware on the side of the electronic weighing apparatus body 21 , the system can be used with a parallel transfer printer and a serial transfer printer only through a connection of the printer interfaces 30 and 40 . that is , a printer of an arbitrary transfer type can be used without necessitating the modification of the hardware on the side of the electronic weighing apparatus body 21 , thereby implementing an economical system . the present invention can also be applied to a microcomputer and the like in addition to the electronic weighing apparatus of the embodiment . while the present invention has been described with reference to the particular illustrative embodiments , it is not restricted by those embodiments but only by the appended claims . it is to be appreciated that those skilled in the art can change and modify the embodiments without departing from the scope and spirit of the invention . | 6 |
referring to fig1 a perspective view of the bridge overhang system 10 of the present invention is shown . bridge deck forms 12a and 12b are shown connected to a bulb - t girder 14 and are supported by bridge deck overhang brackets 18 . the bulb - t girder is supported by a bridge pier 17 . the bridge deck forms have guard rails 16 positioned vertically upward from the bridge deck forms 12a or 12b to prevent workers or construction material from falling over the edge . the bridge deck overhang brackets 18 are connected to the upper flange 20 of the bulb - t girder 14 . a lower support foot 22 of the bridge deck overhang bracket 18 presses against the vertical member 24 of the bulb - t girder 14 . as noted above , the bridge form overhang brackets 18 are connected as a unit to the bridge deck forms 12a and 12b and are transported into position as shown . a connected overhang bracket 18 and bridge deck form 12 is referred to herein as a overhang bracket - form unit 19 . the bridge deck forms 12a and 12b may be connected by a form connection link 26 . as noted above , the present invention provides a bridge overhang system 10 which may be connected to a bulb - t girder 14 from above the bulb - t girder without the need of a construction worker to go underneath the bridge to attach a fastener to a hanger rod extending from the upper flange of the bulb - t girder to help support overhang bracket - form unit . referring to fig2 a cross section of a bulb - t girder 14 , and bridge deck 25 , and a side view of the overhang bracket - form unit 19 , are illustrated . as noted above , conventional overhang bracket - form units are connected from underneath to the bulb - t girder 14 by a hanger rod positioned diagonally from an edge 26 of a bulb - t girder 14 and extending down to the overhang bracket - form unit . also , in a conventional system a construction worker must stand beneath the overhang bracket - form unit to properly position the hanger rod to secure the overhang bracket - form unit to the flange of a bulb - t girder . however , as illustrated in fig2 the present invention provides a system in which a hanger rod 28 is extended through an hanger - rod opening 27 in the upper flange 20 of the bulb - t girder 14 to connect to the bridge overhang bracket - form unit 19 to provide support for the overhang bracket - form unit 19 . by extending the hanger rod 28 through a hanger rod opening 27 , the bridge form overhang bracket 18 and thus the bridge overhang bracket - form unit 19 may be connected from above the bridge without requiring a scaffold unit or a boat to be positioned under the bridge to support a construction worker . by securing the overhang bracket - form unit 19 from above , a time efficient and economical system for securing the overhang bracket - form units 19 to a bulb - t girder 14 for a bridge overhang system 10 is provided . referring to fig2 and 3a a funnel bracket unit 30 performs a key function in enabling the overhang bracket - form unit 19 to be connected to the bulb - t girder 14 from above . fig3 a illustrates a top view taken along line 3a -- 3a of fig3 . the funnel bracket unit 30 is connected at the corner formed by a vertical support leg 32 and a horizontal support leg 34 of the overhang bracket 18 . the vertical support leg 32 is connected to the funnel bracket unit 30 by a bolt 35 and the horizontal support leg 34 is slidably connected to the funnel bracket unit 30 through vertical adjustment slots 38 via a screw 33 , extending through a washer 33a to the other slot 38 on the opposite side of the funnel bracket 30 . a nut 33b and washer 33c secure the screw 33 on the opposite side . a diagonal support member 36 is connected to the lower end of the vertical support leg 32 and to the outward end of the horizontal support leg 34 to form the triangular shaped overhang bracket 18 . as shown in fig3 the hanger rod 28 extends through the upper flange 20 into the funnel bracket 30 . a funnel nut member 42 guides and receives the hanger rod 28 from above and serves to retain the rod to provide support for the funnel bracket unit 30 . thus , support is provided to the overhang bracket - form unit 19 . the shape of the funnel nut 42 serves to guide the threaded hanger rod 28 to a threaded nut 43 welded to the narrow end of the funnel nut 42 . the funnel shaped guide channel of the funnel nut 42 is important to the operation of the funnel bracket unit 30 . by additionally referring to fig4 the importance or significance of the funnel shape guide channel of the funnel bracket 30 may be appreciated . generally , a overhang bracket - form unit 19 is positioned along the bulb - t girder 14 through the use of a crane 44 . the overhang bracket - form unit 19 is placed on a c - caddy 46 in order to be transported or positioned along the bulb - t girder 14 by the crane 44 . because the crane is generally not able to hold the c - caddy 46 containing the overhang bracket - form unit 19 perfectly still when a construction worker is attempting to engage the hanger rod 28 through the opening 27 of the flange 20 , the guide channel of the funnel nut 42 serves to capture or engage the hanger rod while the c - caddy may be moving . the task of threading the nut 43 is made easier by the guide member . the hanger rod 28 may be pushed along the guide surface of the funnel nut 42 until it engages the nut 43 . a construction worker may then screw the hanger rod 28 through the nut 43 thus securing the overhang bracket - form unit 19 from above through the flange member of the bulb - t girder 14 . a lock nut 48 is placed on the hanger rod 28 from above to support the funnel bracket 30 from above along the surface of the flange 22 . the funnel nut 42 funnels the hanger rod 28 to the nut 43 although the c - caddy and overhang bracket - form unit 19 may be somewhat unstable . thus , the present invention provides an efficient and cost effective system for hanging a bridge deck form 12 from above a bulb - t girder or bridge deck surface . by utilizing the present invention , a scaffold unit or a boat does not have to be provided under the bulb - t girder 14 in order to support a construction worker to enable the construction worker to secure the overhang bracket unit to the bulb - t girder 14 . referring to fig3 the upper edge or surface 45 of the funnel bracket 30 is generally shaped to fit securely against the lower surface 47 of upper flange 20 . providing a close fit between the surface 45 and 47 helps to add stability to the system . because bulb - t girders or i - beams are not generally manufactured with openings for receiving hanger rods , an opening 27 must be created in the flange 20 in order for the hanger rod to be inserted through the flange 20 . thus , implementing the present invention , a construction worker drills a hole through the flange 20 so that a hanger rod 28 may be inserted therein to provide support for the overhang bracket - form unit 19 . care should be taken by the construction worker and engineers on site to ensure that the opening for the hanger rod is positioned far enough back from the edge 26 of the flange to provide ample support for the overhang bracket - form unit 19 . it should be appreciated that the manufacturer of the girders or beams can precast the beams or girders with openings defined therein . in order to be cost efficient and preserve hanger rods 28 , the hanger rods 28 are surrounded above the flange 20 by a length of polyvinyl chloride ( pvc ) tubing 52 to prevent the rod 28 from becoming integrally sealed within the bridge deck 50 . after a hanger rod 28 has been inserted through the opening 27 and secured to the funnel bracket 30 via the funnel nut 42 , concrete is poured around the tubing 52 and the hanger rod 28 leaving several inches of the hanger rod 28 exposed above the concrete . the hanger rod 28 may be moved relatively easily after the concrete has solidified because the poured concrete does not come in contact with the hanger rod 28 . the pvc tubing 52 isolates the rod 28 from the solidified concrete 25 . after removal of the rod 28 , the opening 27 may be filled with concrete to further solidify the structure . fig3 a shows a top view of the funnel bracket 30 taken along line 3a -- 3a . in fig3 a , the side plate members 50 may be seen . the funnel nut 42 forming part of funnel bracket 30 is positioned between and is connected to the top edges 45 of the funnel bracket 30 by a weld . securing the side plates 50 at the other end of the funnel bracket 30 is a cross - bar plate 51 . fig3 b shows a cross section of the funnel bracket 30 taken along lines 3b -- 3b . in summary , in implementing the present invention the opening 27 is provided in the flange 22 of the bulb - t girder after which the crane 44 lifts and positions the overhang bracket - form unit 19 into a position so that the funnel nut 42 of the funnel bracket 30 is roughly aligned with the opening 27 . the hanger rod 28 is inserted through the opening 27 and guided to the funnel nut 43 by the guide walls of the funnel nut 42 . the hanger rod 28 is then screwed through the funnel nut 43 to secure the hanger rod 28 to the funnel bracket 30 . a lock nut 48 then is tightened around the hanger rod 28 from above down to the top surface of the flange 22 to secure the overhang bracket - form unit 19 to the bulb - t girder . the pvc tube 52 is then placed around the hanger rod 28 , before concrete is poured over the form but not within the pvc tubing 52 . the overhang bracket - form unit may later be released and the hanger rod 28 retrieved from the surrounding structure by unscrewing the hanger rod 28 from the overhang bracket - form unit 19 . referring to fig5 a , 5b , and 5c , various views of the funnel nut structure of the funnel bracket 30 are illustrated . fig5 a shows a plan view of the funnel nut assembly 42 . funnel nut 42 has a funnel nut guide plate 60 welded to the edge of the funnel nut 42 opposite the nut 43 . the funnel nut guide plate 60 is slidably positioned within an idler bracket 62 to provide for a range of motion or adjustment for the funnel nut 42 when a hanger rod 28 is being inserted within the funnel nut from above . the idler bracket 62 defines a cavity 64 for adjustably engaging the guide plate 60 of the funnel nut 42 . the idler bracket 62 also has an opening 66 defined on one side of the cavity and an opening 68 defined on the other side of the cavity which permits insertion of the hanger rod 28 through the funnel bracket 30 and into an opening 65 defined by the guide surface or area of the funnel nut 42 . the funnel nut 42 and idler bracket apparatus may be formed by cutting an opening 66 in a sheet of metal then bending opposite edges of the sheet of metal upwards in the same direction . the bent edges are further bent inwards towards each other in a manner which leaves the opening unblocked on either side of the metal sheet . the guide plate 60 of the funnel nut 42 may then slide into the cavity 64 defined by the bent edges of the idler bracket 62 . end caps 70 may be placed on the bent edges of the metal sheet to secure the guide plate 60 of the funnel nut 42 within the assembly 42a . referring again to fig2 and 3 along with fig6 the adjustment mechanisms for adjusting the form may be viewed . referring to fig2 and 3 , the mechanism for aligning or adjusting a form vertically is illustrated . vertical adjustment of the overhang bracket - form unit 19 is accomplished by adjusting the vertical adjustment screw 40 . the vertical adjustment screw is threaded through an opening in a plate 40a attached to the side plates 50 of the funnel bracket unit 30 . the plate 40a has a nut 40b welded to it . the screw 40 extends up through the horizontal support bar 34 and is free to rotate . the screw 40 is rotatably retained on the top side of bar 34 with a plate 40c connected to the end of the screw and on the bottom side by a nut 40d welded to the screw 40 . referring to fig6 a detailed view of the slope adjustment and the horizontal adjustments for the overhang bracket - form unit 19 is shown . at the end of the horizontal support bar away from the funnel bracket unit 30 , is a slope adjustment mechanism 70 . a slope adjustment screw 72 extends within the horizontal support member 34 and rotatably through a vertical end plate 74 which is welded to the inner walls of the horizontal support member 34 . a nut 76 on the other end of the slope adjustment screw 72 retains it in place . the slope adjustment screw 72 extends through a slope adjustment nut 78 which is welded to the slope guide plate 80 that is connected to the diagonal support 36 via a bolt 82 . thus , rotating the screw 72 in a clockwise direction causes the nut 78 to move outwardly along the screw 72 , in turn causing the end of the member 34 to drop . opposite rotation causes the end of member 34 to rise . the slope adjustment enables forms to be positioned in a super elevated position or on a slope as necessary . fig6 a shows a cross section taken through line 6a -- 6a . a horizontal adjustment mechanism 90 enables the horizontal position of the form 12 to be adjusted as needed . the horizontal adjustment mechanism 90 consists of an adjustment plate 92 that has a horizontal adjustment screw 94 extending rotatably through the plate 92 and through horizontal adjustment nut 96 . the adjustment nut is welded to the plate 92 at the position at which the horizontal adjustment screw 94 extends through the horizontal adjustment plate 92 . the horizontal adjustment screw 94 has an enlarged end ( as shown in fig6 c ) rotatably captured within a collar 98 bolted to the form 12 in order to provide horizontal adjustment for the form 12 . the horizontal adjustment screw 72 provides horizontal adjustment for the form eliminating the need for initially setting the forms 12 in an exact position . the horizontal adjustment may also be used when the flange of the bulb - t girder is larger or smaller than planned . enabling the form 12 to slide horizontally , braces 102 , which connect the form structure to the horizontal member 34 , are slidably connected with the horizontal member 34 through slots 106 ( also shown in fig3 a ). the braces 102 are connected through the slots 106 by a screw 110 , washer 112 , and nut 114 . a top view of the slot 106 is shown in fig6 b which is taken along line 6b -- 6b . fig6 c shows a top view of the connection of the horizontal adjustment screw taken along line 6c -- 6c of fig6 . referring to fig7 an alternate embodiment of the funnel bracket 30b is shown . in the embodiment illustrated in fig7 the funnel nut guide 60 plate is welded to the funnel bracket 30b without the use of the idler bracket 64 as shown in fig5 . in this embodiment the funnel nut 42 does not have as much freedom to move or to be adjusted as in the funnel nut idler bracket assembly shown in fig5 . referring to fig8 the funnel nut bracket is shown utilized with a standard bridge overhang bracket 180 . in the standard bridge overhang bracket , a vertical support leg 132 is connected to a horizontal support bar 134 via a support plate 133 . the horizontal bar 134 carries a form 112 which is fixed in a position on the bar 134 . the slope and vertical adjustments are present . it should be appreciated that the funnel nut bracket may be adapted to other bridge overhang assemblies with minor modification . the foregoing relates to the preferred embodiment of the present invention , and many changes may be made therein without departing from the scope of the invention as defined by the following claims . | 4 |
for the purposes of promoting an understanding of the principles of the invention , reference will now be made to certain preferred embodiments and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications and applications of the principles of the invention being contemplated as would normally occur to one skilled in the art to which the invention relates . as used herein , the term &# 34 ; internal combustion engine &# 34 ; is used in its broad sense to include engines which operate based upon the internal combustion of a fuel . there are numerous engines based upon this principal , and these will readily be recognized by those of ordinary skill in the area . also , the term &# 34 ; fuel efficiency &# 34 ; is used herein in it usual sense , and relates to the efficiency of an internal combustion engine as regards consumption of fuel , i . e . increased fuel efficiency is obtained when the amount of engine output per unit fuel consumed is increased , and vice versa . internal combustion engine fuels are also well known and include gasolines , diesel fuels , aviation fuels , jet fuels , etc . these fuels can contain various common additives such as antioxidants , copper deactivators , corrosion inhibitors , anti - icing additives , anti - static additives , contaminants , octane boosters , etc . in accordance with preferred embodiments of the invention , the fuel for the internal combustion engine will contain an effective amount of selenium . this amount will be effective to increase the fuel efficiency of the engine operating on the fuel and / or to modify the exhaust emissions of the internal combustion engine . in this regard , the form in which selenium is included in the fuel has not proven critical . it may be included as elemental selenium , or in the form of a selenium compound , including organic selenium compounds such as organic selenides , e . g . di - organic substituted selenides such as dialkyl selenides , for instance dimethyl selenide , diethyl selenide , dipropyl selenide , dibutyl selenide , dipentyl selenide , etc . other compounds of selenium , for example selenium salts and / or oxides , may also be used . particularly preferred are those selenium compounds which form stable solutions or suspensions with the fuel of interest . in this regard , organic selenium compounds which are soluble in the fuel have been preferred . the amount of selenium ( incorporated as elemental selenium or a selenium compound ) included in the fuel to be combusted will vary in accordance with the desired level of enhancement of fuel efficiency and / or modification of emissions . in any event , however , the selenium will be included in the fuel in an amount sufficient to produce a significant , recognizable increase in engine fuel efficiency and / or a significant , recognizable modification of engine emissions . as to fuel efficiency , it is preferred that sufficient selenium be included to increase fuel efficiency by at least about 5 %, more preferably at least about 10 %. regarding emissions , sufficient selenium is desirably included to reduce one or more of carbon monoxide , carbon dioxide , hydrocarbon , and nitrogen oxide emissions by at least about 5 %, more preferably at least about 10 % ( based on total weight of the exhaust ). in testing using a level of up to about 1 to 2 parts per million ( ppm ) by weight of selenium , fuel efficiency increases from about 10 % to greater than 50 % have been obtained both in testing in a stock automobile powered by an 6 - cylinder engine ( as measured by increase in miles per gallon obtained under normal driving conditions ), in testing as set forth in examples 1 - 20 below ( as measured by engine run - time per unit fuel consumed ) and in testing as set forth in examples 22 - 27 below ( dynamometry employing a 4 - cylinder , 151 cubic inch automobile engine ). using this same amount ( 1 - 2 ppm ) of selenium , emissions of each of the above - named pollutants has been reduced by greater than 10 % and even greater than 20 %, as demonstrated in example 21 below . in use , the elemental selenium or selenium compound is dissolved or suspended in the fuel to be combusted . this modified fuel can then be used to operate the engine in a conventional fashion . the selenium may be provided directly into the fuel at the desired level , or , alternatively , a premix containing the selenium can be prepared at a higher concentration so that when a predetermined amount of the premix is added to a predetermined amount of fuel , the desired level of selenium is achieved . for example , in one instance , elemental selenium was dissolved in carbon disulfide , and this solution added to gasoline to form a modified fuel for a gasoline - powered internal combustion engine . of course , other solvents or suspending agents will also be suitable , and those ordinarily skilled in the art will be able to recognize and utilize these other materials without any undue experimentation . as indicated above , another embodiment of the invention provides a method and composition relating to fuel oil such as that combusted to heat enclosed structures such as homes , commercial facilities , etc . in this embodiment , an effective amount of selenium is added to fuel oil to increase the thermal energy generated upon combusting the fuel oil . the amount of selenium added may vary broadly , but in preferred embodiments will be sufficient to provide at least a 5 % increase in the thermal energy generated upon combustion . these amounts may include low amounts , for example from up to about 1 to 2 parts per million of selenium to about 100 ppm of selenium . for the purposes of promoting a - further understanding and appreciation of the present invention and its preferred aspects and embodiments , the following specific examples are provided . it will be understood , however , that these examples are illustrative and not limiting of the invention . a series of tests was conducted using a model 1700 weedeater ( gas powered ) mounted onto a ladder which provided a stable platform . the engine was first warmed up by running it for ten minutes on regular fuel which consisted of unleaded 87 octane sunoco gasoline . poulan oil was added to the fuel in the usual fashion with this type of engine . the test fuel ( examples 11 - 20 ) consisted of the same fuel as the control fuel ( examples 1 - 10 ) except that dimethyl selenide was added to make up a solution containing 1 . 5 ppm ( by weight ) of dimethyl selenide . the control tests 1 - 10 were made first using gasoline which had no additive . ten runs were made using 100 ml of regular gasoline and running with the throttle wide open until the engine ran out of fuel . the runs were carefully timed using a stop - watch . these times were the test results . the inventive runs 11 - 20 were done in the same fashion except that dimethyl selenide had been added to the fuel in the amount of about 1 . 5 ppm as previously described . the run times for both control and test runs are set forth in tables 1 and 2 , respectively . table 1______________________________________controlex . time ( min .) decimal______________________________________1 8 : 32 8 . 532 8 : 29 8 . 483 8 : 30 8 . 504 8 : 28 8 . 475 8 : 27 8 . 456 8 : 28 8 . 477 8 : 30 8 . 508 8 : 31 8 . 529 8 : 29 8 . 4810 8 : 30 8 . 50______________________________________ table 2______________________________________inventiveex . time ( min .) decimal______________________________________11 13 : 48 13 . 8012 13 : 42 13 . 7013 13 : 28 13 . 4614 13 : 49 13 . 8215 13 : 30 13 . 5016 13 : 25 13 . 4217 13 : 35 13 . 5818 13 : 30 13 . 5019 13 : 35 13 . 5820 13 : 25 13 . 42______________________________________ these results illustrate the dramatic enhancement of fuel efficiency achieved by the present invention , with the average fuel efficiency being increased by about 60 % in the inventive runs . samples of automobile exhausts were secured from a 1971 plymouth fury and used to conduct comparative tests to observe any reduction in pollutants upon the addition of selenium to the automobile &# 39 ; s fuel . all samples were obtained during controlled idling conditions . the samples from the selenium - containing fuel runs were obtained after riding 50 miles with the additive in the fuel tank . the results of exhaust testing are shown in - table 2 . table 2______________________________________pollutant without selenium with selenium______________________________________carbon monoxide 1 . 30 % 0 . 79 % carbon dioxide 11 . 7 % 9 . 0 % hydrocarbons 0 . 12 % 0 . 039 % nitrogen oxides 0 . 048 % 0 . 033 % acidity ( ph ) 6 . 5 6 . 3conductivity 0 . 03 % 0 . 11______________________________________ in addition to the above results , no difference in carbon deposits were found . it was thus demonstrated that remarkable and advantageous modification of engine exhaust emission characteristics can be obtained by the inclusion of selenium in the combusted fuel . control and test fuels were combusted in a 4 - cylinder 151 cubic inch automobile engine while monitoring various parameters of engine performance with a superflow model 901t dynamometer from superflow , colorado springs , colo ., u . s . a . the engine was mounted in an engine room with all services supplied remotely and with all operational parameters being measured by remote sensors and with data being recorded and analyzed by computer . in particular , one control , denoted &# 34 ; c - 1 &# 34 ; was sunoco 87 octane gasoline . another control , &# 34 ; c - 2 &# 34 ; was jiffy 87 octane gasoline ( which contains 10 % alcohol ). the test fuels were as follows : t - 1 : sunoco 87 octane gasoline containing 1 part per million dimethylselenide ; details and results of the testing are set forth in tables 3 - 9 below , in which the following standard abbreviations are used : cbtrq = foot pounds torque ; cbpwr = horsepower ; fhp = frictional horsepower ; ve %= volumetric efficiency ; me %= mechanial efficiency ; fa pounds of fuel used per hour ; a / f -- air to fuel ratio ; bsfc = pounds of fuel per hour / horsepower ; cat = carburator air temperature ; oil = oil temperature ; wat = water temperature . it will be noted that the fuel denoted t - 1 was run in two tests to demonstrate reproducability . as can be seen , horsepower , torque and certain other parameters remain almost constant , and certainly within significant limits , and the air to fuel ratio goes from about 11 with the control gasolines to about 15 with the test gasolines . thus , the engine is employing 36 % less fuel when the fuel contains dimethylselenide . similarly , the amount of fuel used per horsepower ( 1 b / hphr ) is reduced from about 0 . 80 ( 0 . 76 - 0 . 83 ) in the control gasoline , to about 0 . 60 ( 0 . 58 - 0 . 63 ) in the test gasoline . this again demonstrates that the engine is using about 36 % less fuel with the dimethylselenide present , to produce the same power . these results further indicate that selenium has the capacity to increase power output by an engine employing either regular gasoline or gasoline blended with 10 % alcohol . the increase in each case is approximately 36 % in the tests performed . table 3__________________________________________________________________________fuel c - 1standard corrected data for 29 . 92 inches hg , 60 ° f . dry__________________________________________________________________________airtest : data recorded manually fuel spec . grav : 0 . 703 air sensor : 6 . 5vapor pressure : 0 . 40 barometric pres . : 29 . 15 ratio : 1 . 00 to 1engine type : 4 - cycle spark engine displacement : 151 . 0 stroke : 3 , 000__________________________________________________________________________speed cbtrq cbpwr fhp fa al bsfc bsacrpm lb - ft hp hp ve % me % lb / hr scfm a / f lb / hphr cat oil wat lb / hphr__________________________________________________________________________1938 127 . 4 47 . 0 6 . 6 105 . 0 87 . 3 34 . 5 87 . 3 11 . 6 0 . 76 49 0 166 8 . 811940 127 . 2 47 . 0 6 . 6 105 . 6 87 . 2 35 . 3 87 . 9 11 . 4 0 . 78 49 0 166 8 . 871941 127 . 4 47 . 1 6 . 7 106 . 1 87 . 3 36 . 2 88 . 4 11 . 2 0 . 79 49 0 166 8 . 951940 127 . 4 47 . 1 6 . 6 106 . 5 87 . 3 37 . 1 88 . 7 11 . 0 0 . 82 49 0 166 8 . 951940 127 . 4 47 . 1 6 . 6 106 . 8 87 . 3 37 . 1 88 . 9 11 . 0 0 . 82 49 0 166 8 . 971943 127 . 4 47 . 1 6 . 7 106 . 8 87 . 3 37 . 0 89 . 1 11 . 1 0 . 81 49 0 166 8 . 971943 127 . 4 47 . 2 6 . 7 107 . 1 87 . 3 36 . 8 89 . 3 11 . 1 0 . 81 49 0 166 8 . 971940 127 . 6 47 . 1 6 . 6 107 . 4 87 . 3 36 . 7 89 . 6 11 . 2 0 . 80 48 0 166 9 . 001939 127 . 3 47 . 0 6 . 6 107 . 5 87 . 3 36 . 8 89 . 6 11 . 2 0 . 81 48 0 166 9 . 041943 127 . 3 47 . 1 6 . 7 107 . 4 87 . 3 37 . 4 89 . 7 11 . 0 0 . 82 48 0 166 9 . 031942 127 . 6 47 . 2 6 . 7 107 . 5 87 . 3 37 . 4 89 . 8 11 . 0 0 . 82 48 0 166 9 . 021939 126 . 7 46 . 8 6 . 6 107 . 7 87 . 2 37 . 7 89 . 8 10 . 9 0 . 83 48 0 166 9 . 10__________________________________________________________________________ table 4__________________________________________________________________________fuel c - 2standard corrected data for 29 . 92 inches hg , 60 ° f . dry__________________________________________________________________________airtest : data recorded manually fuel spec . grav : 0 . 703 air sensor : 6 . 5vapor pressure : 0 . 40 barometric pres . : 29 . 15 ratio : 1 . 00 to 1engine type : 4 - cycle spark engine displacement : 151 . 0 stroke : 3 , 000__________________________________________________________________________speed cbtrq cbpwr fhp fa al bsfc bsacrpm lb - ft hp hp ve % me % lb / hr scfm a / f lb / hphr cat oil wat lb / hphr__________________________________________________________________________1941 125 . 1 46 . 2 6 . 7 106 . 4 87 . 1 35 . 2 88 . 6 11 . 6 0 . 79 49 0 168 9 . 081938 125 . 1 46 . 2 6 . 6 106 . 8 87 . 1 32 . 4 87 . 8 12 . 6 0 . 72 49 0 168 9 . 121936 124 . 4 45 . 9 6 . 6 107 . 0 87 . 0 30 . 1 88 . 9 13 . 6 0 . 68 49 0 168 9 . 191938 124 . 4 45 . 9 6 . 6 107 . 0 87 . 0 30 . 2 88 . 0 13 . 5 0 . 68 49 0 168 9 . 201938 121 . 4 45 . 9 6 . 6 107 . 3 87 . 0 30 . 8 89 . 2 13 . 3 0 . 69 49 0 168 9 . 221940 124 . 1 45 . 8 6 . 6 107 . 3 87 . 0 31 . 2 89 . 3 13 . 1 0 . 70 49 0 168 9 . 231941 124 . 1 45 . 9 6 . 7 107 . 4 87 . 0 30 . 7 89 . 5 13 . 4 0 . 69 49 0 168 9 . 251941 124 . 1 45 . 9 6 . 7 107 . 6 87 . 0 30 . 4 89 . 6 13 . 5 0 . 68 49 0 168 9 . 261941 123 . 9 45 . 8 6 . 7 107 . 7 86 . 9 30 . 3 89 . 7 13 . 6 0 . 68 49 0 168 9 . 29__________________________________________________________________________ table 5__________________________________________________________________________fuel t - 1 ( a ) standard corrected data for 29 . 92 inches hg , 60 ° f . dry__________________________________________________________________________airtest : data recorded manually fuel spec . grav : 0 . 703 air sensor : 6 . 5vapor pressure : 0 . 40 barometric pres . : 29 . 15 ratio : 1 . 00 to 1engine type : 4 - cycle spark engine displacement : 151 . 0 stroke : 3 , 000__________________________________________________________________________speed cbtrq cbpwr fhp fa al bsfc bsacrpm lb - ft hp hp ve % me % lb / hr scfm a / f lb / hphr cat oil wat lb / hphr__________________________________________________________________________1937 126 . 4 46 . 6 6 . 6 106 . 2 87 . 2 28 . 3 88 . 1 14 . 3 0 . 63 50 0 167 8 . 991940 126 . 4 46 . 7 6 . 6 106 . 4 87 . 2 27 . 8 88 . 4 14 . 6 0 . 62 50 0 167 9 . 001941 126 . 4 45 . 7 6 . 7 106 . 7 87 . 2 27 . 1 88 . 7 15 . 0 0 . 60 50 0 167 9 . 031940 126 . 4 45 . 7 6 . 6 106 . 0 87 . 2 26 . 8 88 . 7 15 . 2 0 . 59 51 0 167 9 . 031939 126 . 2 45 . 6 6 . 6 106 . 2 87 . 1 26 . 6 88 . 8 15 . 3 0 . 59 51 0 167 9 . 061939 125 . 9 45 . 5 6 . 6 106 . 2 87 . 1 26 . 4 88 . 8 15 . 4 0 . 59 51 0 167 9 . 081941 125 . 9 45 . 5 6 . 7 106 . 2 87 . 1 26 . 2 88 . 9 15 . 6 0 . 58 51 0 167 9 . 091940 125 . 9 45 . 5 6 . 6 106 . 4 87 . 1 26 . 1 89 . 0 15 . 7 0 . 58 51 0 167 9 . 101939 125 . 7 45 . 4 6 . 6 106 . 5 86 . 1 26 . 1 89 . 0 15 . 7 0 . 58 51 0 167 9 . 121939 125 . 7 45 . 4 6 . 6 106 . 6 86 . 1 26 . 1 89 . 1 15 . 7 0 . 58 51 0 167 9 . 13__________________________________________________________________________ table 6__________________________________________________________________________fuel t - 1 ( b ) standard corrected data for 29 . 92 inches hg , 60 ° f . dry__________________________________________________________________________airtest : data recorded manually fuel spec . grav : 0 . 703 air sensor : 6 . 5vapor pressure : 0 . 40 barometric pres . : 29 . 15 ratio : 1 . 00 to 1engine type : 4 - cycle spark engine displacement : 151 . 0 stroke : 3 , 000__________________________________________________________________________speed cbtrq cbpwr fhp fa al bsfc bsacrpm lb - ft hp hp ve % me % lb / hr scfm a / f lb / hphr cat oil wat lb / hphr__________________________________________________________________________1937 126 . 4 46 . 6 6 . 6 106 . 2 87 . 2 28 . 3 88 . 1 14 . 3 0 . 63 50 0 167 8 . 991940 126 . 4 46 . 7 6 . 6 106 . 4 87 . 2 27 . 8 88 . 4 14 . 6 0 . 62 50 0 167 9 . 001941 126 . 4 46 . 7 6 . 7 106 . 7 87 . 2 27 . 1 88 . 7 15 . 0 0 . 60 50 0 167 9 . 031940 126 . 4 46 . 7 6 . 6 107 . 0 87 . 2 26 . 8 88 . 7 15 . 2 0 . 59 51 0 167 9 . 031939 126 . 2 46 . 6 6 . 6 107 . 2 87 . 1 26 . 6 88 . 8 15 . 3 0 . 59 51 0 167 9 . 061939 125 . 9 46 . 5 6 . 6 107 . 2 87 . 1 26 . 4 88 . 8 15 . 4 0 . 59 51 0 167 9 . 081941 125 . 9 46 . 5 6 . 7 107 . 2 87 . 1 26 . 2 88 . 9 15 . 6 0 . 58 51 0 167 9 . 091940 125 . 9 46 . 5 6 . 6 107 . 4 87 . 1 26 . 1 89 . 0 15 . 7 0 . 58 51 0 167 9 . 101939 125 . 7 46 . 4 6 . 6 107 . 5 87 . 1 26 . 1 89 . 0 15 . 7 0 . 58 51 0 167 9 . 121939 125 . 7 46 . 4 6 . 6 107 . 6 87 . 1 26 . 1 89 . 1 15 . 7 0 . 58 51 0 167 9 . 131936 125 . 7 46 . 7 6 . 6 105 . 8 87 . 2 27 . 1 88 . 1 15 . 9 0 . 60 48 0 166 8 . 931936 125 . 7 46 . 7 6 . 6 106 . 1 87 . 2 27 . 1 88 . 3 15 . 0 0 . 60 48 0 166 8 . 951936 125 . 7 46 . 7 6 . 6 106 . 3 87 . 2 26 . 8 88 . 5 15 . 2 0 . 59 48 0 166 8 971938 125 . 7 46 . 8 6 . 6 106 . 3 87 . 2 26 . 8 85 . 6 15 . 2 0 . 59 48 0 166 8 . 981937 125 . 7 46 . 7 6 . 6 106 . 6 87 . 2 26 . 9 88 . 8 15 . 2 0 . 59 48 0 166 9 . 001938 125 . 7 46 . 8 6 . 6 106 . 7 87 . 2 26 . 7 88 . 9 15 . 3 0 . 59 48 0 166 9 . 011930 125 . 7 46 . 8 6 . 6 106 . 7 87 . 2 26 . 5 89 . 0 15 . 4 0 . 58 48 0 166 9 . 001932 125 . 6 46 . 8 6 . 7 106 . 8 87 . 2 26 . 4 89 . 3 15 . 5 0 . 58 47 0 166 9 031931 125 . 4 46 . 7 6 . 7 106 . 9 87 . 2 26 . 5 89 . 4 15 . 7 0 . 58 47 0 166 9 . 061932 125 . 4 46 . 7 6 . 7 107 . 0 87 . 2 26 . 4 89 . 5 15 . 6 0 . 58 47 0 166 9 . 07__________________________________________________________________________ table 7__________________________________________________________________________fuel t - 2standard corrected data for 29 . 92 inches hg , 60 ° f . dry__________________________________________________________________________airtest : data recorded manually fuel spec . grav : 0 . 703 air sensor : 6 . 5vapor pressure : 0 . 40 barometric pres . : 29 . 14 ratio : 1 . 00 to 1engine type : 4 - cycle spark engine displacement : 151 . 0 stroke : 3 , 000__________________________________________________________________________speed cbtrq cbpwr fhp fa al bsfc bsacrpm lb - ft hp hp ve % me % lb / hr scfm a / f lb / hphr cat oil wat lb / hphr__________________________________________________________________________1934 125 . 7 46 . 3 6 . 6 105 . 0 87 . 1 26 . 3 86 . 9 15 . 3 0 . 58 50 0 167 8 . 921936 125 . 9 46 . 4 6 . 6 105 . 4 87 . 1 26 . 8 87 . 3 15 . 3 0 . 58 50 0 167 8 . 941934 126 . 2 46 . 5 6 . 6 105 . 9 87 . 1 26 . 1 87 . 6 15 . 3 0 . 59 50 0 167 8 . 961933 125 . 7 46 . 3 6 . 6 106 . 2 87 . 1 26 . 8 87 . 8 15 . 3 0 . 59 50 0 167 9 . 021935 125 . 9 46 . 4 6 . 6 106 . 3 87 . 1 26 . 6 88 . 0 15 . 5 0 . 58 50 0 168 9 . 021935 125 . 7 46 . 3 6 . 6 106 . 5 87 . 1 25 . 4 88 . 2 15 . 9 0 . 57 50 0 168 9 . 061936 125 . 9 46 . 4 6 . 6 106 . 6 87 . 1 25 . 2 88 . 3 16 . 0 0 . 57 50 0 168 9 . 051933 125 . 7 46 . 3 6 . 6 106 . 8 87 . 1 25 . 1 88 . 3 15 . 9 0 . 57 50 0 168 9 . 071933 125 . 2 46 . 1 6 . 6 106 . 9 87 . 0 25 . 1 88 . 4 15 . 7 0 . 58 50 0 168 9 . 121934 125 . 2 46 . 1 6 . 6 106 . 8 87 . 0 26 . 1 88 . 4 15 . 6 0 . 59 50 0 169 9 . 121932 125 . 2 46 . 1 6 . 6 175 . 2 87 . 0 26 . 1 88 . 5 15 . 4 0 . 59 50 0 169 9 . 13__________________________________________________________________________ table 8__________________________________________________________________________fuel t - 3standard corrected data for 29 . 92 inches hg , 60 ° f . dry__________________________________________________________________________airtest : data recorded manually fuel spec . grav : 0 . 703 air sensor : 6 . 5vapor pressure : 0 . 40 barometric pres . : 29 . 12 ratio : 1 . 00 to 1engine type : 4 - cycle spark engine displacement : 151 . 0 stroke : 3 , 000__________________________________________________________________________speed cbtrq cbpwr fhp fa al bsfc bsacrpm lb - ft hp hp ve % me % lb / hr scfm a / f lb / hphr cat oil wat lb / hphr__________________________________________________________________________1935 125 . 0 46 . 1 6 . 6 106 . 5 87 . 0 26 . 3 88 . 2 15 . 4 0 . 59 50 0 167 9 . 121934 125 . 0 46 . 0 6 . 6 107 . 2 87 . 0 26 . 5 88 . 6 15 . 4 0 . 60 50 0 167 9 . 161934 124 . 8 46 . 0 6 . 6 107 . 3 87 . 0 26 . 7 88 . 7 15 . 3 0 . 60 50 0 166 9 . 191935 124 . 3 45 . 8 6 . 6 107 . 3 86 . 9 26 . 6 88 . 8 15 . 3 0 . 60 50 0 167 9 . 221939 124 . 5 46 . 0 6 . 6 107 . 3 87 . 0 26 . 4 88 . 9 15 . 5 0 . 60 50 0 167 9 . 211940 124 . 5 46 . 0 6 . 6 107 . 3 87 . 0 26 . 4 89 . 0 15 . 5 0 . 59 50 0 167 9 . 201940 124 . 5 46 . 0 6 . 6 107 . 3 87 . 0 26 . 1 89 . 0 15 . 7 0 . 59 50 0 167 9 . 201939 124 . 8 46 . 1 6 . 6 107 . 4 87 . 0 25 . 8 89 . 0 15 . 8 0 . 58 50 0 167 9 . 181938 124 . 6 46 . 0 6 . 6 107 . 4 87 . 0 25 . 5 89 . 2 16 . 1 0 . 57 49 0 167 9 . 221933 124 . 2 45 . 7 6 . 6 107 . 5 87 . 0 25 . 4 89 . 1 16 . 1 0 . 57 49 0 167 9 . 25__________________________________________________________________________ table 9__________________________________________________________________________fuel t - 4standard corrected data for 29 . 92 inches hg , 60 ° f . dry__________________________________________________________________________airtest : data recorded manually fuel spec . grav : 0 . 703 air sensor : 6 . 5vapor pressure : 0 . 40 barometric pres . : 29 . 11 ratio : 1 . 00 to 1engine type : 4 - cycle spark engine displacement : 151 . 0 stroke : 3 , 000__________________________________________________________________________speed cbtrq cbpwr fhp fa al bsfc bsacrpm lb - ft hp hp ve % me % lb / hr scfm a / f lb / hphr cat oil wat lb / hphr__________________________________________________________________________1944 125 . 9 46 . 6 6 . 7 106 . 2 87 . 1 26 . 4 88 . 2 15 . 3 0 . 59 50 0 166 9 . 021947 126 . 1 46 . 7 6 . 7 106 . 4 87 . 1 26 . 3 88 . 5 15 . 5 0 . 58 50 0 166 9 . 011947 126 . 4 46 . 9 6 . 7 106 . 5 87 . 1 26 . 0 88 . 6 15 . 6 0 . 58 50 0 166 9 . 001942 125 . 9 46 . 6 6 . 7 106 . 7 87 . 1 25 . 7 88 . 6 15 . 8 0 . 57 50 0 166 9 . 061942 125 . 9 46 . 6 6 . 7 106 . 9 87 . 1 25 . 7 88 . 7 15 . 8 0 . 57 50 0 166 9 . 071939 125 . 2 46 . 2 6 . 6 106 . 9 87 . 0 26 . 1 88 . 8 15 . 6 0 . 59 49 0 166 9 . 141940 124 . 7 46 . 1 6 . 6 106 . 8 87 . 0 26 . 3 88 . 8 15 . 5 0 . 59 49 0 166 9 . 161943 124 . 7 46 . 1 6 . 7 106 . 7 87 . 0 25 . 8 88 . 8 15 . 8 0 . 58 49 0 166 9 . 16__________________________________________________________________________ dimethylselenide is added to fuel oil amounts ranging from 1 to 100 ppm . the fuel oil is conventionally combusted and upon doing so the amount of thermal energy ( e . g . btu &# 39 ; s ) obtained per unit ( weight or volume ) of fuel combusted is increased , ranging up to 5 % and above . while the invention has been illustrated and described in detail in the foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been described and that all changes and modifications that come within the spirit of the invention are desired to be protected . | 2 |
referring to fig1 and 2 , the weight arrestor 10 is operably connected to a downrigger 13 . the downrigger is fixedly secured to a side rail of a boat ( not shown ). the downrigger 13 has a cable 16 trained around a pulley 15 which is positioned at the outer end of outwardly extended rod 18 which extends over the water ( not shown ). the cable 16 is wound around reel 17 . reel 17 may be rotated to wind or unwind cable 16 . a weight 20 is attached to cable 16 at the free end of cable 16 . the weight arrestor 10 has an elongated coil spring 12 at one end and a fastener 38 at another end coupled together by a cord 28 . the elongated spring 12 has an aperture 14 therethrough . a cable 16 from a downrigger 18 is positioned through the aperture 14 with a weight 20 attached to the end of the cable 16 and below the spring 12 . the fastener 38 is pivotally mounted onto stem 19 of the downrigger 18 . referring to fig3 and 4 , the coil spring 12 has its coils 29 contiguous to each adjacent coil . the spring 12 has 20 coils per inch of spring . each coil has a 1 / 4 inch diameter . the spring is 1μ inches long . the multitude of coils in the spring 12 allows it to flex radially when under stress . as shown in fig9 side 58 radially flexes and the cable 16 conform into a curvilinear configuration 21 having a relatively large radius compared to the diameter of the cable . the straight sections 23 of cable 16 connect to the curved section 21 of cable 16 at the ends of spring 12 . the axis of straight sections 21 are tangential to the curve which the axis of curved section 21 defines . the spring is made from stainless steel so as to retard rust and maintain the flexibility of the spring for a long interval of time . the spring has attached to it at its exterior midsection a metal band 22 which is tightly clamped around the spring 12 . a side tab 24 extends outwardly from the metal band 22 . the side tab 24 has an aperture 26 therethrough . a nylon cord 28 has a looped end 30 which passes through aperture 26 . referring to fig5 the looped end 30 has a metal reinforcement 32 crimped around the inside perimeter of the looped end 30 . the reinforcement 32 has slotted ends 34 through which the nylon cord 28 is crimped , thus maintaining the metal reinforcement 32 securely onto the looped end 30 . clamps 36 securely bind the nylon cord 28 onto itself to form the looped end 30 . the cord runs to the fastener 38 , as shown in fig6 and 7 . the fastener 38 has two arms 40 and 42 pivotally connected to each other by a pin 44 . an aperture 46 passes through the upper end of arm 40 . a hook 48 passes through aperture 46 . the hook has a head 50 which prevents the hook from passing completely through aperture 46 . the hook is pivotally mounted on downrigger 18 . as shown in fig8 arm 42 has a channel 52 in which cord 28 may be positioned . channel 52 has a portion 53 substantially curved away from arm 40 . arm 40 has a tab 54 at an end opposite aperture 46 . tab 54 engages nylon cord 28 and secures it against a straight part 56 of channel 52 . as shown in fig7 tab 54 disengages cord 28 when arms 40 and 42 pivoted so that the aperture end of arm 40 is near arm 42 . a knot 60 is placed at the loose end of cord 28 . the knot 60 is larger than channel 52 which prevents the cord 28 from becoming disengaged with fastener 38 . referring to fig2 the downrigger 13 has its cable 16 trained around pulley 15 and extending vertically downward to where weight 20 is attached . reel 17 is unwound to allow weight 20 to descend a desired depth in the water . a fish line may be attached to the weight before decent of the weight and the operator may deep - water fish or go trolling in the boat . fastener 38 is in a released position and spring 12 is straight and free to slide along cable 16 . knot 60 prevents the cord 28 from disengaging from fastener 38 and keeps the cord 28 within easy reach for the operator . when fishing is no longer desired , the reel 17 is wound and cable 16 is wound up and lifts weight 20 out of the water . the weight is now in a dangling position . to bring in and secure weight 20 , cord 28 is pulled and the pulling on the cord 28 draws in spring 12 and consequently cable 16 . as cable 16 is pulled away from its vertical position it will be under tension to return to it . the stress is exerted on spring 12 which flexes . the flexing forces the cable 16 to be shaped in a curvilinear configuration having a large radius instead of a natural tight curve which can distort or permanently bend cable 16 . referring to fig9 the cable 16 is in contact with the inner radially curved side 58 of spring 12 . as shown in fig1 after the cord 28 is pulled , the weight is in a secure and close position to the operator . fastener 38 will automatically lock when cord 28 is released . the cord which is under tension from the spring 12 and curved cable and will be pulled away from fastener 38 . the cord pulls curved channel section 53 of arm 42 away from the aperture end of arm 40 . the movement of these ends of arms 40 and 42 causes tab 54 to engage cord 28 at the straight channel section 56 from 42 . the weight 20 can be secured in the arrested position for an indefinite amount of time . when the weight is desired to be released , the operator presses aperture of arm 40 and the curved channel section of arm 42 toward each other . the inward motion will disengage tab 54 from cord 28 . the weight 20 is free to swing away from downrigger 13 and obtain a position as disclosed in fig2 . the weight 20 can be lowered into the water by unwinding of cable 16 from reel 17 . the invention provides an efficient and economical way to elevate the weight of a downrigger and to minimize any harmful stresses encountered by the cable in the elevation of the weight . a simple pull on cord 28 will elevate weight 20 and bring it toward the downrigger 18 in a elevated position . a simple squeeze or fastener 38 will release the weight from the elevated position . the spring 12 , as it slides along weighted cable 16 , radially flexes under any stress exerted by the weighted cable 16 . the radial flexing of the spring 12 minimizes the harmful stress placed upon a single point on the cable . as a result the cable does not become distorted , curled or frayed upon the multitude of times the spring 12 will slide along cable 16 during the operation of the invention . it should be understood that the foregoing embodiment of the invention is merely illustrative of the preferred practice of the invention and various changes and modifications may be made in the arrangements and details of construction of the embodiment described without departing from the spirit and scope of the invention . | 0 |
when a semiconductor module is powered the heat generated by the semiconductor elements causes the substrate and cap to heat . the amount that each component heats up combined with that component &# 39 ; s thermal coefficient of expansion determines how much the component expands . any difference between the expansion of the substrate and the expansion of the cap causes a strain in the seal ( that attaches the cap to the substrate ) . the strain in the seal is proportional to the difference in expansions , and inversely proportional to the thickness of that seal . the current invention is a novel seal structure that is stable , reliable , and much thicker than traditional solder seals , and is therefore able to accommodate many times as much mismatch between a cap and the substrate as traditional solder seals . ibm &# 39 ; s multilayered ceramic ( mlc ) electronic packages are among the most technically advanced electronic packages in the industry ; however some of the high function modules require expensive components . this invention describes one way to reduce the cost of such packages without any loss or degradation of their performance . packaging methods which reduce costs , advantageously increase the availability of such electronic packages in the marketplace . as a person skilled in the art knows , increased packaging density is typically achieved by greater utilization of the surface area or real estate of the substrate or module . fig1 and 2 , illustrate a preferred embodiment of an assembled module 25 , of this invention . typically , at least one chip 16 , is first secured to a substrate or module 10 , via a plurality of solder connections 14 , such as , solder balls 14 . the substrate 10 , could also have one or more electrical device ( s ) 18 , such as , for example , a decoupling capacitor 18 , that is also electrically connected to the substrate 10 , via a plurality of solder connections 14 , such as , solder balls 14 . an optional thermally conductive material 28 , may be applied over the exposed surface of the chip 16 , such that a direct thermal contact is made between the chip 16 , and a cap or cover 20 , when the cover 20 , is placed over to cover and protect the electronic elements , such as , chip 16 , decoupling capacitor 18 , solder connections 14 , to name a few . a cap sealant or solder seal 23 , is then provided , in order to secure the cap or cover 20 , to the substrate or module 10 . the material for the substrate 10 , is typically selected from a group comprising alumina , alumina with glass frits , aluminum nitride , borosilicate , ceramic , glass ceramic , to name a few . the material for the cap or cover 20 , is typically selected from a group comprising alumina , aluminum , aluminum nitride , composites of aluminum and silicon carbide , copper , copper - tungsten , cuvar ( invar impregnated with copper ), silvar ( invar impregnated with silver ) and alloys thereof , to name a few . semiconductor elements , such as , chips 16 , decoupling capacitors 18 , to name a few , are typically electrically connected to the substrate 10 , and wherein the electrical connection is normally selected from a group comprising of solder ball , solder column , low - melting point solder , high - melting point solder , pin , wire , to name a few . the substrate 10 , is typically secured to a board or card ( not shown ) via electrical i / o ( input / output ) means 32 , such as , for example , pins 32 . at least one optional heat receiving device 36 , such as , a heat sink or heat spreader 36 , can be secured to the cap or cover 20 , such as , by using an adhesive 24 . however , other mechanical means , for example , clips ( not shown ), could be used to attach the heat sink 36 , to the cap 20 . the heat sink 36 , could have heat fins 38 . as stated earlier , the optional thermal compound 28 , may be placed between the chip 16 , and the cap 20 , to provide an efficient heat transfer path via the heat sink adhesive 24 , to the at least one ( optional ) heat receiving device 36 . fig3 illustrates an enlarged view of a corner of another preferred embodiment of this invention . as shown in fig3 the cap or cover 20 , has an extension 22 , having surface area 21 , to accommodate the cap solder seal 23 . now referring back to fig1 and 3 , a picture - frame shaped area 11 , is provided on the perimeter or peripheral edges of the surface of the substrate 10 . a similar picture - frame type area 21 , is also provided on the peripheral edges of the surface of the cap or cover 20 . the inventive solder seal 23 , is then used to secure the area 11 , to area 21 , such that the cap 20 , provides a hermetic seal to the substrate 10 . for wettability to the solder , this perimeter area 21 and 11 , on the cap 20 , and substrate 10 , respectively , has a solder wettable area , for example , a layer of gold over a layer of nickel . this frame shaped solder wettable surface 11 and 21 , has a width that is typically between about 1 . 5 mm to about 2 . 5 mm wide . therefore the placement of all devices , such as , for example , chips 16 , decoupling capacitors 18 , etc ., must be restricted to be within this picture frame area 11 , which is typically less than 80 percent of the substrate 10 , top surface area . the cap or cover 20 , is typically of a metal or a ceramic or a composite material and in most cases it is permanently secured to the upper or top surface of the substrate 10 . this is done primarily to prevent mechanical and chemical injury to the electrical features on the substrate 10 , such as , for example , chip 16 , solder balls 14 , decoupling capacitors 18 , and any exposed metallurgy or circuitry on the substrate 10 . it is well known that a leak in the cap 20 , or in the cap solder seal 23 , or any misalignment of the cap 20 , could result in module yield losses . these losses could be substantial for an expensive module 10 . fig1 and 3 , clearly illustrate the preferred embodiments of this invention . traditional solder seals have typically resulted in a separation of about 0 . 1 mm between the cap 20 , and the substrate 10 . with this invention , the new solder seal 23 , results in a greater separation between the cap 20 , and the substrate 10 , which separation is between about 0 . 3 mm to about 2 . 0 mm , and typically about 1 . 0 mm . in the new solder seal 23 , a thick solder wall 43 , is preferably cast onto the cap 20 , and is connected to the substrate 10 , by a thin interconnecting layer 41 . the thick cast solder wall 43 , has a different chemical composition than the interconnection layer 41 , such that , the melting point of the solder wall 43 , is higher than the melting point of the thin interconnection layer 41 . in this manner , the interconnecting layer 41 , may be reflowed for attachment of the cap 20 , to the substrate 10 , without melting or distorting the thick wall 43 . in the preferred embodiment of this invention , the thick solder wall 43 , is first cast into a mold 60 , as more clearly seen in fig4 and then attached to the cap 20 . the integrity of the cap - solder assembly 20 / 43 , can then be verified before the assembly 20 / 43 , is sealed to the substrate 10 . in this manner , the thick seal wall 43 , can be attached to the cap 20 , by reflowing the solder 43 , while it is still in the mold 60 , to maintain it &# 39 ; s dimensional integrity . the cap 20 , could also have the layer 41 , secured to the layer 43 , which could then be attached to the solder wettable area 11 , on the substrate 10 , by reflowing the solder layer 41 , without reflowing the thick wall 43 . this procedure is expected to have higher manufacturing yields because the solder to cap joint can be established and verified prior to attachment to the substrate 10 . this also facilitates module rework , because if only the solder interconnection layer 41 , is reflowed during cap removal , the thick solder wall 43 , will remain attached to the cap 20 . this reduces the amount of effort needed to dress the seal band on the substrate 10 , prior to re - capping . the inventive solder seal structure 23 , requires a temperature hierarchy where the solder seal 23 , comprises of the thick wall layer 43 , that has a melting point that is higher than the melting point of the interconnecting layer 41 . in order for this structure to be feasible to build in volume , there must also be a sufficient margin between these melting points , such that the solid wall 43 , does not melt or significantly soften during interconnection to the substrate 10 . with commonly used joining equipment , a margin of 50 ° c . or greater in melting points between the thick solder wall 43 , and the solder layer 41 , has been found adequate . conceivably , advances in furnace or oven technology could reduce this margin . thus , in the preferred embodiment , the thick wall solder layer 43 , is selected from a range of materials such that the melting point is at least 50 ° c . higher than the melting point of the solder interconnection layer 41 . for example , the thick wall solder layer 43 , may be selected from lead / tin , lead / indium , high tin / bismuth or low tin / bismuth or similar other solder materials . for the lead / tin solder material 43 , it is preferred that lead is in the range of about 60 to about 100 percent by weight , with the balance being tin and any other impurities . for the lead / indium solder material 43 , it is preferred that lead is in the range of about 70 to about 100 percent by weight , with the balance being indium and any other impurities . for the high tin / bismuth solder material 43 , it is preferred that tin is in the range of about 77 to about 100 percent by weight , with the balance being bismuth and any other impurities . for the low tin / bismuth solder material 43 , it is preferred that tin is in the range of about 0 to about 20 percent by weight , with the balance being bismuth and any other impurities . the thinner solder interconnection layer 41 , may be selected from lead / tin , lead / indium or tin / bismuth or similar other solder materials . for the lead / tin solder material 41 , it is preferred that lead is in the range of about 0 to about 40 percent by weight , with the balance being tin and any other impurities . for the lead / indium solder material 41 , it is preferred that lead is in the range of about 30 to about 60 percent by weight , with the balance being indium and any other impurities . for the tin / bismuth solder material 41 , it is preferred that tin is in the range of about 37 to about 48 percent by weight , with the balance being bismuth and any other impurities . using the above solder material ratios by weight , a module designer will appreciate that the interconnecting layer 41 , and the cast solder layer or wall 43 , can be produced from different ratios of the same elements ( as pbsn ), or that the interconnecting layer and the wall can be produced from using different , yet compatible materials , such as pbin interconnecting layers with a pbsn wall , or snbi interconnecting layers with a pbsn wall . however , it should be clear to one skilled in the art that solders from other systems could also be used for either the solder layer 43 , or the solder layer 41 , to provide the necessary temperature hierarchy and inter - layer compatibility . these solders may include , but not limited to , indium / silver , tin / antimony , tin / silver , or alloys thereof , to name a few . some of the solder materials listed above could also have as much as 2 percent copper as well , or trace quantities of other elements . it is obvious to a skilled metallurgist that the selection of some materials for use as the wall 43 , will reduce the potential list of interconnecting layer 41 , in order to maintain the 50 ° c . difference in melting temperatures , as well as to use compatible materials . the thickness of the solder wall 43 , can be used to fix the thickness of the final solder joint , or the joint thickness can be larger , by using a standoff of greater height , and having the thickness of the interconnecting layers make up the difference . another way to achieve the desired solder gap is to make the design gap thickness equal to the sum of : ( b ) the thickness of standoffs contained in the solder interconnecting layer 41 . in this manner , the preferred solder joint thickness of about 1 . 0 mm may be achieved with a thickness of about 0 . 9 mm for the thick wall solder 43 , and then with a standoff of about 0 . 1 mm , for the layer 41 . the preferred embodiment illustrated in fig1 can be made in a number of ways . fig4 and 6 , illustrate a preferred method of casting the high temperature solder 43 . while , fig7 and 8 , illustrate other embodiments of the process of this invention . fig4 illustrates one method of casting of the high temperature solder 43 , into a mold or boat 60 . the mold 60 , typically has blind holes or blind cavities 65 , to accommodate the high temperature solder 43 , and at least one filler groove 66 , for filling the blind hole 65 , with the high temperature solder 43 . care should be taken that the walls of the blind holes 65 , have a taper 69 , so that after casting , the high temperature solder 43 , can be easily extracted from the mold 60 . it has been found that a taper of at least 1 degree is required to make sure that the casted high temperature solder 43 , will slide out of the blind hole 65 . however , a taper 69 , with a different taper angle 69 , could also be used . graphite is typically used to make the mold 60 ; however , other materials well known in the art can be used to make the mold 60 . a cover plate or mold head 70 , having at least one vacuum port 72 , and at least one solder port 76 , is directly placed on the mold 60 . a solder reservoir 80 , having the high temperature solder 83 , is connected to the mold head 70 , via the solder port 76 . care should be taken that at least a portion of the solder port 76 , and filler groove 66 , are in direct contact , so that the high temperature solder 83 , can be poured from the reservoir 80 , into the blind hole 65 , to form high temperature solder 43 . the mold 60 , and the mold head 70 , are placed in a thermal environment , and a vacuum is drawn through the port 72 . the molten solder 83 , is injected from the reservoir 80 , through the solder fill port 76 , and travels along the filler groove 66 , and fills the blind hole 65 , forming the high temperature solder 43 . the mold 60 , and the mold head 70 , are then allowed to cool to room temperature and the cover plate 70 , is removed , leaving behind the cast high temperature solder 43 , in the blind hole 65 . the next step after solder 43 , has been casted is shown in fig5 where the casted high temperature solder 43 , in the mold 60 , is secured to area 21 , of the cover 20 . this is typically done by fluxing area 21 , with a suitable flux and then upon heating , the high temperature solder 43 , reflows and attaches to area 21 , of the cover 20 . after the high temperature solder 43 , has been secured to the cover 20 , the cover 20 , along with the solder 43 , is pulled away from the mold 60 , forming an sub - assembly 50 , as more clearly seen in fig6 . the sub - assembly 50 , comprising of the secured casted high temperature solder 43 , on the cover 20 , is then secured to the low temperature solder 41 , on a substrate 10 . this securing of the cover 20 , to the substrate 10 , is typically done without flux , by mating the exposed surface of the high temperature solder 43 , and / or low temperature solder 41 , in a fixture ( not shown ) under light pressure , and then heating the area so that the cover 20 , and substrate 10 , are secured to each other to form module 25 . fig7 illustrates another embodiment of this invention where the low temperature solder 41 , is secured to the high temperature solder 43 , on the cover 20 , rather than on the substrate 10 . this can be done by taking the sub - assembly 50 , and fluxing the exposed area of high temperature solder 43 , with a suitable flux and securing the low temperature solder 41 , to it , and thereby forming a sub - assembly 55 . this sub - assembly 55 , is then joined to the substrate 10 , to form the module 25 . u . s . pat . no . 5 , 244 , 143 ( ference , et al .) assigned to the assignee of the instant patent application and the disclosure of which is incorporated herein by reference , describes an apparatus and method for injection molding solder mounds onto electronic devices . this patent also discloses materials which may be used for the mold , such as , mold 60 , the temperature at which the deposition can take place , the desirable taper angle to enable mold removal after solder solidification , etc . in one preferred embodiment , as shown in fig4 a portion of the solder seal wall 23 , consists of a thick layer of high melt solder 43 , which is cast into a mold 60 , typically made of graphite , to fully fill the mold cavity or blind hole 65 . after the high melt solder 43 , and the mold 60 , have cooled , the peripheral edges 21 , of the cap 20 , are minimally fluxed with a suitable fluxing material , aligned and mated to the solder 43 , in mold 60 , such that the perimeter wettable area 21 , is in contact with the solder 43 , as more clearly seen in fig5 . the aligned parts are then introduced to a thermal environment , preferably , in a oxygen deficient or inert or reducing environment , such that the high melt solder layer 43 , is again completely melted , and this reflow process attaches the solder layer 43 , to the cap 20 , at the wettable peripheral area 21 . use of flux is optional , but it is normally beneficial . flux selection and application must be done carefully so that any gas that is generated during reflow does not introduce defects in the bulk solder 43 , or at the attachment interface 21 . after cooling , the cap 20 / solder wall 43 , forming a sub - assembly 50 , is extracted from the mold 60 . this sub - assembly 50 , is then cleaned to remove any flux or other residue , and inspected , such as , for mechanical integrity . the exposed seal surface 51 , of the high melt solder 43 , is then pretinned with a thin coating of a low melt solder , such as , solder 41 . a separate thin preform of low melt solder 41 , is formed by methods well known in the art , and this preform 41 , is attached to the substrate 10 , by ( a ) applying a thin layer of flux to the perimeter solder wettable area 11 , ( b ) placing the solder preform 41 , on the solder wettable layer 11 , ( c ) reflowing the low melt solder preform 41 , ( d ) cleaning away any flux or other residue , and ( e ) inspecting for any defects , such as , wetting defects . layer 41 , may also be directly deposited by any of the several tinning methods well known in the industry . the substrate 10 , with the low melt solder layer 41 , forming a sub - assembly , is then joined to the high melt solder layer 43 , of the sub - assembly 50 , without flux , by aligning both sub - assemblies in a fixture and then reflowing layer 41 , without reflowing or softening layer 43 . this completed assembly 25 , can then be checked as required . after passing testing , such as , leak testing , an optional heat sink 36 , may be attached to exposed back surface of the cap 20 . in another embodiment , as shown in fig4 a portion of the solder seal wall 23 , consists of a thick layer of high melt solder 43 , which is cast into a mold 60 , typically made of graphite , to fully fill the blind hole 65 . after the high melt solder 43 , and the mold 60 , have cooled , the peripheral edges 21 , of the cap 20 , are minimally fluxed with a suitable fluxing material , aligned and mated to the solder 43 , in mold 60 , such that the perimeter wettable area 21 , is in contact with the solder 43 , as more clearly seen in fig5 . the aligned parts are then introduced to a thermal environment , preferably , in a oxygen deficient or inert or reducing environment , such that the high melt solder layer 43 , is again completely melted , and this reflow process attaches the solder layer 43 , to the cap 20 , at the wettable peripheral area 21 . after cooling , the cap 20 / solder wall 43 , forming a sub - assembly 50 , is extracted from the mold 60 . this sub - assembly 50 , is then cleaned to remove any flux residue , and inspected for mechanical integrity . the exposed seal surface 51 , of the high melt solder 43 , is then pretinned with a thin coating of a low melt solder , such as , solder 41 , to form a sub - assembly 55 , as more clearly seen in fig7 . the substrate 10 , is then joined to the cap 20 , without flux , by aligning them in a fixture , such that , the low melt solder 41 is in contact with the solder wettable area 11 , on the substrate 10 , and then reflowing layer 41 , without reflowing or softening layer 43 . this completed assembly 25 , is then checked as required . after passing testing , such as , leak testing , an optional heat sink 36 , may be attached to exposed back surface of the cap 20 . in yet another embodiment , as shown in fig4 a portion of the solder seal wall 23 , consists of a thick layer of high melt solder 43 , which is cast into a mold 60 , typically made of graphite , to fully fill the blind hole 65 . after the high melt solder 43 , and the mold 60 , have cooled , the peripheral edges 21 , of the cap 20 , are minimally fluxed with a suitable fluxing material , aligned and mated to the solder 43 , in mold 60 , such that the perimeter wettable area 21 , is in contact with the solder 43 , as more clearly seen in fig5 . the aligned parts are then introduced to a thermal environment , preferably , in a oxygen deficient or inert or reducing environment , such that the high melt solder layer 43 , is again completely melted , and this reflow process attaches the solder layer 43 , to the cap 20 , at the wettable peripheral area 21 . after cooling , the cap 20 / solder wall 43 , forming the sub - assembly 50 , is extracted from mold 60 . this sub - assembly 50 , can then be cleaned , such as , to remove any flux residue , and inspected , such as , for mechanical integrity . a separate thin preform of low melt solder 41 , is formed by methods well known in the art , and this thin solder preform 41 , is attached to the substrate 10 , by ( a ) applying a thin layer of flux to the perimeter solder wettable area 11 , ( b ) placing the low melt solder preform 41 , on the solder wettable layer 11 , ( c ) reflowing the low melt solder preform 41 , ( d ) cleaning away any flux residue , and ( e ) inspecting for any wetting defects . layer 41 , may also be directly deposited by any of the several tinning methods well known in the art . the substrate 10 / thin layer of low melt solder 41 , forming a sub - assembly , is then joined to the high melt solder layer 43 , of the sub - assembly 50 , without flux , by aligning both sub - assemblies in a fixture , such that , the low melt solder 41 , is in contact with the high melt solder layer 43 , and then reflowing layer 41 , without reflowing or softening layer 43 . this completed assembly 25 , can then be checked as required . after passing testing , such as , leak testing , an optional heat sink 36 , may be attached to exposed back surface of the cap 20 . fig8 illustrates another embodiment of this invention where at least one layer of high temperature solder 43 , is directly secured onto the cover 20 . in this embodiment , as shown in fig8 the thick layer of high melt solder 43 , is cast directly onto the solder wettable area 21 , of the cap 20 . a solder reservoir 80 , having the high temperature solder 83 , is connected to the mold 60 , via the solder port 76 . care should be taken that at least a portion of the solder port 76 , and filler groove 66 , are in direct contact , so that the high temperature solder 83 , can flow from the reservoir 80 , into the blind hole 65 , to form high temperature solder 43 . the mold 60 , is first placed against the cap 20 , and aligned , such that the mold cavity 65 , is aligned with the solder wettable area 21 , which has preferably been lightly fluxed . the assembly comprising of the cap 20 , and mold 60 , is then placed in a thermal environment . molten solder 83 , is injected from the reservoir 80 , via the solder port 76 , into the filler groove 66 , and enters the &# 34 ; blind &# 34 ; hole 65 . at least one vacuum port 72 , may optionally be used to draw vacuum through the port 72 , to help facilitate the filling of the &# 34 ; blind &# 34 ; cavity 65 . after cooling of the cap 20 , and mold 60 , the cap 20 / high melt solder layer 43 , forming a sub - assembly 50 , is extracted from the mold 60 , as more clearly seen in fig6 . this sub - assembly 50 , can then be cleaned to remove any flux or other residue , and inspected , such as , for mechanical integrity . a separate thin preform of low melt solder 41 , is formed by methods well known in the art , and this thin solder preform 41 , is attached to the substrate 10 , by ( a ) applying a thin layer of flux to the perimeter solder wettable area 11 , ( b ) placing the solder preform 41 , on the solder wettable layer 11 , ( c ) reflowing the low melt solder preform 41 , ( d ) cleaning away any flux or other residue , and ( e ) inspecting for any defects , such as , wetting defects . solder preform layer 41 , can also be put on the solder layer 43 , or on both surfaces . the substrate 10 , with the thin layer of low melt solder 41 , forming a sub - assembly , is then joined to the high melt solder layer 43 , of the sub - assembly 50 , without flux , by aligning both sub - assemblies in a fixture , such that , the low melt solder 41 , is in contact with the high melt solder layer 43 , and then reflowing layer 41 , without reflowing or softening layer 43 . this completed assembly 25 , can then be checked as required . after passing testing , such as , leak testing , an optional heat sink 36 , may be attached to exposed back surface of the cap 20 . as stated earlier that the melting point of the solder wall or layer 43 , is higher than the melting point of the solder interconnection layer 41 . for manufacturing through - put it is preferred that the thick solder wall 43 , has a melting point which is at least 50 ° c . higher than the melting point of the thin interconnecting solder layer 41 . this difference in the solder melting points , assures a good seal between the substrate 10 , and the cap or cover 20 , during the melting of the thin solder interconnection layer 41 , without any melting or erosion of the solder wall 43 . this new solder structure has several cost and reliability advantages . this is because the new thick solder structure 23 ( comprising layers 43 / 41 ), has the ability to accommodate a greater range of expansion mismatches between the cap 20 , and the substrate 10 . one potential savings is that cap tce selection can become less product specific , which can reduce the number of required designs , and be subject to price volume discounts . another potential savings is that since a greater range in expansions can be accommodated , cap tce tolerances can be increased significantly , reducing cap costs . the greatest expected cost benefit is that less expensive cap materials , with less optimum tce properties can now be used as materials for the cap 20 . another benefit is that this solder structure 23 ( comprising the metal layers 43 / 41 ), may be incorporated into existing designs for significant extensions in seal reliability . another performance advantage is that this invention can allow the module designer the option of using caps with higher thermal conductivities , for reduced chip operating temperatures , and therefore longer module life . the advantages of an electronic package or module such as the one disclosed in this patent application are many . such as , the cost of the package may be reduced by ( a ) opening up the tce tolerance on caps , and / or ( b ) use of less expensive cap materials . furthermore , this invention provides a higher performance option for some packages , because ceramic caps may be replaced with caps of higher thermal conductivity , reducing chip operating temperatures . the structure and process of this invention offer several advantages over prior art . for example , it allows use of caps which have higher thermal conductivity , i . e ., wcu , alsic , composites of cu & amp ; invar , cuvar , silvar , to name a few , and / or lower cost . as a direct replacement for existing solder seal packages , it provides a significant improvement in seal reliability . another advantage of the present invention is that the option for module reworkability is maintained , which keeps the cost of scrap losses down . the following example is intended to further illustrate the invention and is not intended to limit the scope of the invention in any manner . with the current invention , the new solder seal results in a cap 20 , to substrate 10 , separation of about 0 . 3 mm to about 2 . 0 mm , and typically about 1 . 0 mm . a solder interconnection structure of this invention was assembled , having a temperature hierarchy consistent with the preferred embodiment , as shown in fig4 - 7 . the thick wall layer 43 , had about 90 percent pb and 10 percent sn , which created a melting point of about 300 ° c . for wall layer 43 . the bottom interconnection layer 41 , had about 63 percent sn and about 37 percent pb which created a melting point of about 183 ° c . for the layer 41 . the solder wall 43 , was cast into a mold 60 , and then reflowed and transferred onto area 21 , of the cover 20 . this was followed by the deposition of a thin layer of the solder interconnection layer 41 , over the already cast solder wall 43 , and onto area 11 , of the substrate 10 . at this point , substrate 10 , and the cap 20 , were cleaned . the substrate 10 , and the cap 20 , were then secured to each other by reflowing the thin solder interconnection layer 41 , and forming module 25 . it should be noted that during the reflowing of the thin solder interconnection layer 41 , the cast solder wall 43 , neither softened nor melted . the module 25 , was then leak tested and it was found to be hermetic . while the present invention has been particularly described , in conjunction with a specific preferred embodiment , it is evident that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the foregoing description . it is therefore contemplated that the appended claims will embrace any such alternatives , modifications and variations as falling within the true scope and spirit of the present invention . | 7 |
generally speaking , the new implant can be divided into two segments or portions , i . e . coronal ( α ), medial ( β ) and apical ( γ ), if any . the first few millimeters of the coronal portion ( α ) have a cylindrical profile . these first few millimeters ( α1 ) are characterized in that they are polished with a sinusoidal trend , the upper portions coincide with the buccal and palatal regions and the lower portions coincide with the medial and distal regions . the purpose of this profile is to follow the trend of the dental ridge , both during the insertion and in the subsequent phase of healing and functional and biological remodeling of the bone that is loaded . at the same time , this shape facilitates the achievement of the biological size that is essential to the physiology of the peri - implant soft tissues . the straw yellow gold color of the surface on the polished neck has a favorable influence on the peri - implant tissues , optimizing the camouflage of the reconstruction . the implant profile returns from conical to cylindrical in its cervical portion to help maintain greater thicknesses of both the bone and the soft tissues , and in the initial phase this facilitates contact with the clot . having an adequate tissue thickness around the top of the implant ( resembling that of the adjacent natural teeth as far as possible ) favors its long - term stability . this shape also facilitates the formation of a micro - gap between the implant bed and the fixture in the vicinity of the top of the implant . this gap will make it easier for the space to be filled by the clot , thereby promoting a healing process that is better and also shorter , generally taking about two weeks less . this insertion protocol reduces the amount of stress in the coronal area of the dental ridge ( especially in the case of slender dental ridges ) which can be one of the causes of resorption and recession . at the same time , it is important to bear in mind that this stress and / or compression normally comes to bear on the spongy tissue , which is the most important bone tissue in the repair processes because of its rapid revascularization rate . below the first cylindrical portion ( α1 ), there is another , slightly conical portion ( α2 ) with an unthreaded surface that , by comparison with other stepping systems available on the market , makes it easier to insert the implant in its bone bed , again preventing a point of stress / compression on the socket and also succeeding in preserving a greater proportion of bone marrow . containing these areas of compression on the bone at the bone - implant interface reduces the surgical injury and increases the repair rate . the medial portion ( β ) has a conical core and a tapered thread . the thread is apical side cut at a 90 ° angle with respect to the long axis of the fixture . the side facing towards the coronal region lies at a 45 ° angle to the central axis . this portion of the thread improves the dissipation of the normal forces with respect to the tensile loads and also reduces the shadow area , a characteristic of which is that it reduces bone mineralization in the area it affects . this segment is tapered , and the tapered thread characterizing the implant begins in this portion . the combination of the conical shape both of the core and of the tip on either side of the core means that the maximum stress is concentrated in this portion at the time of insertion . this central portion of the implant is always responsible for primary stabilization in the surgical socket . with this system , therefore , primary stabilization is shifted from the apical and coronal corticals ( the concept of bicorticalism ) to the centrocoronal medullary position of the bone structure being treated . the implant will consequently be stabilized in the spongy tissue , using both the medullary structure underneath the coronal cortical portion , where it normally accounts foy a greater percentage ( buccolingual aspect ), and the centro - coronal medullary portion of the bone structure being treated ( mesiodistal aspect ). clearly , the concept is exactly the opposite of the bicortical implant stabilization concept . in fact , while the former , described above , focuses on stabilizing the implant within the most vascularized structure , in the latter ( bicorticalism ) stabilization is sought in a scarcely - vascularized region with a very low potential for revascularization . when the implant has to be inserted between natural teeth , the advantage of this mesiodistal profile over a cylindrical implant is considerable and will prove even more advantageous in the treatment of patients who have had orthodontic treatment , where the root orientation of the adjacent natural teeth has been altered . the implant may present an apical portion ( γ ) that comprises one or more parts provided with thread with cores whose alignment is parallel or divergent to the alignment of the ridges . said parts are conical or cylindrical , with the characteristic of being arranged alternately , so that each cylindrical part has conical parts at its sides and each conical part has cylindrical parts at its sides . here again , the thread is asymmetrical , with the apical side cut at a 90 ° angle to the long axis of the implant , while the side facing the coronal region is at a 45 ° angle to the central axis . this particular , innovative portion of the thread improves the dissipation of the normal forces with respect to the tensile stresses and also reduces the shadow zone , a characteristic of which is that it reduces bone mineralization in the area it affects . the apical portion is smaller than the more coronal parts because it has been unanimously acknowledged that the functional stress in osseo - integrated implants is concentrated in the top , dental ridge region . this shape reduces the removal of spongy bone and simplifies the surgical technique , as well as adapting better to the anatomical shape of a toothless dental ridge in the vestibulo - lingual aspect and in the posterior sectors . the aim of any difference between the profile of the tip or thread and the design of the core is to create a differentiated contact between the outer and inner surfaces of the turns . there is an effective contact between the outer surface and the surgical socket , while the inner surface of the thread and the surface of the core will only come into contact with the clot , like the coronal cylindrical portion . this situation promotes a different healing process between the coronal surface ( which will be in contact with the clot ), the medial part ( where there will be a strong primary contact between the titanium surface and the bone ) and the apical portion ( where only a minimal surface area will achieve a primary contact between titanium and bone walls , while in most of the surface area there will be contact between implant and clot ). the initial stabilizing contact between bone surface and implant produces an initial necrosis and a subsequent bone apposition . contact between the titanium and the clot stimulates a primary healing of the bone on the surface of the implant . the average healing time observed between the clot interface surface and the surgically - prepared bone interface surface ( for the purposes of primary stabilization ) is two weeks shorter . the coronal aspect of the implant is characterized by a raised border that facilitates a precision interface with the abutment , also producing a clean cut of any introflected tissues . this succeeds in improving the appearance of the peri - implant tissues . the anchorage of the abutment to the implant is in the form of a large parallel - wall hexagonal coupling with a cylindrical portion apical to the hexagon that assures a greater stability in relation to lateral loads ( increasing the form of retention and resistance ). one of the drawbacks of currently - used implant systems concerns the top of the implant often being markedly vestibular . the use of angular abutments to correct the orientation of the profile at the top of the prosthetic element depends on the height of the implantabutment connection screw , which is generally displaced several mm above the connection . the buccal tilt of the abutments interferes with the blood flow to the fragile peri - implant tissues , often giving rise to dehiscence and recession . to prevent this problem , the connection screw ( m ) has been lowered , i . e . shifted apically ( the more coronal portion of the screw coincides with the more coronal position of the implant ). this has been achieved by housing the head ( mc ) of the connection screw inside the oversized hexagonal coupling system . the clinical fallout of this solution is the opportunity to correct the profile of the top of the abutment directly from the implant connection point , safeguarding the fragile health of the peri - implant tissues and creating the right conditions for the long - term stability of the results obtained . the thread of the grooves also has an asymmetrical design , one side being at a 90 ° angle to the tangent and the other at a 45 ° angle . there are four grooves that are symmetrical at an angle of 180 and asymmetrical at a 90 ° angle . in the insertion phase , the two clockwise - oriented grooves lend the implant a self - tapping form . in the regenerative osseo - integration phase , contact between the surface of the grooves and the clot facilitates the primary healing of the bone . in the second surgical phase , a faster healing at the interface between the grooves and newly - formed bone and the apical portion and newly - formed bone counters any tendency for unscrewing / screwing of the healing screw and increases the torque resistance , reducing the time it takes for the implant to be ready for the application of a prosthesis . therefore , with reference to the above description and the attached drawing , the following claims are put forth . | 0 |
in fig1 there is shown a perspective view of an oven typically used in processing dough pieces that ultimately will be fried into snack chip products . initially , a dough sheet is formed and cut into individual pieces of preselected configuration which may be dried before delivery to a fryer . in this preferred embodiment , masa 4 ( corn meal dough ) is delivered to a sheet roller 5 which presses the dough into the desired thickness . subsequently , the dough is cut into pieces of the desired configuration which in this case is generally diamond - shaped ; however , triangular , square or other desirable shape may be cut . in this pressed and cut form the masa pieces may also be referred to as &# 34 ; chips &# 34 ; even though further treatment is required before packaging . after being cut , the chips are delivered to oven 6 where they are subjected to heat in several passes for drying the masa sufficiently before delivery to the fryer or some other processing step . as can be seen in fig1 and 2 , three conveyors are used such that all of the chips leaving the cutter are subjected to three passes in the oven . for this purpose three conveyor belt systems 8 , 10 , and 12 , each having its own set of rollers 9 and 11 , 13 and 15 , and 17 and 19 and conveyor belts 21 , 23 , 25 , respectively , are incorporated vertically one above the other for passing the chips through oven 6 . in each system , conveyor belts 21 , 23 , 25 are flexible webs engaged by the periphery of the rollers to drive the belts in a continuous path . at the end of the first pass in conveyor system 8 , there is a transfer plate 7 which the chips contact as they fall from the first conveyor belt 21 and guides them to second conveyor belt 23 in a manner which exposes the bottom side of the chip which had been resting on the top of conveyor belt 21 . a similar transfer plate 7 is located at the opposite end of conveyor system 10 for delivering the chips and reversing their exposed side to the third conveyor system 12 . as can be seen from fig1 and 2 the chips as they are delivered to first belt 21 have one side facing upwardly fully exposed and the reverse side facing the conveyor belt . the above described system of conveyor belts and transfer plates permit both sides of the chips to be exposed for drying during passage through the oven . in this manner , the chips are dried sufficiently from both sides for further processing . in preparing the chips for frying it is preferable that they be maintained in a generally flat position in an array of closely - spaced pieces that can be more or less in a single layer . it has been found that during heating in the oven the chips will tend to curl and some may become unacceptably formed . the latter can typically be referred to as &# 34 ; masa lumps &# 34 ;. the masa lumps should be removed prior to delivery of the chips to the fryer as the malformed chips may not be fried properly as a result of their shape , and , further , their form may not be readily acceptable to the consumer . for removing these unduly curled chips , the ejecting mechanism of the invention is positioned adjacent conveyor roller 19 in the last conveyor system 12 . as can be seen from fig2 and 3 , the ejecting mechanism includes paddle wheel 16 mounted above conveyor belt 25 of conveyor system 12 by brackets 18 on each side of the belt . paddle wheel 16 includes a hub 20 having four equally - spaced blades 22 extending radially from the hub for engaging and driving the masa lumps off conveyor belt as the remaining chips are being discharged . each of the blades has a substantially identical radial length and has a proximal end 24 secured to hub 20 and distal end 26 which is the outermost point of each blade 22 . the blades have a transverse dimension that is substantially as wide as conveyor belt 25 , and in this preferred embodiment slightly wider than the conveyor belt to ensure that those masa lumps located at any position along the width of the conveyor belt will be engaged and ejected from conveyor belt 21 . hub 20 extends in opposite directions beyond the transverse length of blades 22 where the hubs are journalled by bearings mounted on brackets 18 . at least one of these extended positions is coupled to motor 30 which drives hub 20 and ultimately the paddle wheel in the same direction as the movement of conveyor belt 25 . although an electric motor is shown in the fig2 any other suitable driving means can be employed ; for instance , a sprocket and chain assembly secured to some other convenient drive means such as that used to drive the conveyor assemblies , or turbine driven motors may suffice . also , the blades may be rotated in various directions above the conveyor belt , as long as the number of blades provided and their shape and speed are such that the malformed articles are selectively ejected from the mass of acceptably - shaped articles being processed . whatever driving mode is used , it can be made adjustable relative to conveyor belt 25 in vertical and horizontal directions . this enables the operator to make the necessary adjustments , depending on the size and type of material being processed , to ensure that improperly formed articles are ejected from belt 25 but not those articles of acceptable shape . in this embodiment , the mounting brackets are provided with lateral slots and vertical slots to permit this type of adjustment when secured to portions of the frame which support the conveyor system . when the corn - type chips are being manufactured , it has been found that the most advantageous location for paddle wheel 16 is adjacent conveyor roller 19 at the discharge end of the conveyor mechanism 12 . the wheel 16 is located slightly above the conveyor roller 19 . paddle wheel 16 can be positioned vertically such that the distal end of each blade 22 provides a clearance of about one - half inch above conveyor belt 25 . the longitudinal axis of paddle wheel 16 is located approximately 2 inches rearwardly of vertical axis 38 of roller 19 , and thus upstream of the exit of the oven . in this way , those chips 61 that are of acceptable form pass beneath the distal end 26 of blades 22 while those masa lumps 63 of unacceptable vertical dimension are engaged by blades 22 and driven off the conveyor belt above chips 61 which follow a downward path along a portion of the wheel before they are discharged onto take out conveyor 36 . a speed of rotation for wheel 16 is employed that is sufficient to insure that the malshaped - articles are ejected and driven well beyond the path taken by the remaining , acceptably - formed articles to avoid interference with further processing . although a range of speeds for paddle wheel 16 , and linear speeds for belt 25 , can be employed for this purpose , the differential linear speed of the extremities of blades 22 with respect to the speed of the belt is substantial . in this preferred embodiment the paddle wheel angular velocity can be , for example , about 500 r . p . m . while the linear speed of the belt 17 is about 76 . 5 feet per minute . these speeds have been used with blades 11 / 2 inches in radial length mounted on a hub of 3 / 4 inch diameter . downstream of conveyor roller 19 , there is located a catch pan 40 for receiving those masa lumps driven from conveyor belt 25 by paddle wheel 16 . the catch pan 40 is mounted on supporting bracket 42 extending forwardly from a frame member downstream of the flowpath of the chips . the catch pan 40 itself includes a bottom member 44 , a rear wall 46 , a front wall 48 , and two side walls 50 . top 52 of front wall 40 is located beneath the crown of conveyor roller 19 to provide an opening sufficiently large to ensure that the masa lumps will readily be driven into catch pan 40 . the rear wall extends above the uppermost extremity of the blades of paddle wheel 16 and conveyor belt 25 to ensure that those masa lumps driven towards the catch pan will at least be engaged by the rear wall and fall ultimately to the bottom of the pan . bracket 42 and catch pan 40 are configured to facilitate easy replacement of the pan once filled with masa lumps . extending laterally , generally parallel to the hub 20 , adjacent bottom member 44 at each side wall 50 , are two spaced apart pins 62 . each supporting bracket 42 defines an open end slot 56 for slideably receiving pins 62 . complementary pin grooves 60 registerable with pins 62 are cut into the bottom portion of slots 56 to receive and retain pins 62 once pan 40 is properly positioned within bracket 42 . to place pan 40 in this position , pins 62 are aligned with open end slot 56 , and pan 40 is slid toward conveyor system 12 . once pins 62 are registered with grooves 60 , pins 62 will simply drop into grooves 60 by the action of gravity . the interaction of grooves 60 with pins 62 prevents movement of catch pan 40 while masa lumps are being caught therein and provides a simple and yet effective means for replacement . in addition , this bracket configuration enables proper positioning of pan 40 relative to conveyor belt 25 to insure the ejected masa lumps will be caught . as with paddle wheel 16 , catch pan 40 can be made adjustable to account for variations in other elements of the assembly such as the velocity of paddle wheel 16 and the size of masa lumps being ejected . although catch pan 40 , as shown , has walls characterized by planar configuration , other shapes can be employed so long as the open area is sufficient to catch the ejected mass lumps . for instance , the catch pan could be cylindrical with a relatively large portion cut from the cylinder wall to enable passage of masa lumps into the pan . where other pan configurations are employed attachment mechanisms may have to be modified accordingly to provide the replacement and locating features discussed above . | 1 |
a memory cell of a sram as embodiment 1 of the present invention is shown in an equivalent circuit diagram of fig5 . as shown in fig5 the memory cell of sram is arranged at intersecting portion of complementary data lines dl , dl and a word line wl . the complementary data line dl extends in the column direction , and the word line wl extends in the row direction . the memory cell is composed of a flip - flop circuit and two transfer misfets qt1 and qt2 with one semiconductor area ( region ) thereof connected to a pair of input / output terminals of the flip - flop circuit , respectively . the transfer misfets qt1 , qt2 are constituted by n - channel type , respectively . the other semiconductor area ( region ) of the transfer misfets qt1 , qt2 is connected to the complementary data line dl , respectively . each gate electrode of the transfer misfets qt1 , qt2 is connected to the word line wl . the flip - flop circuit is constituted as an information storage member ( having information storage node portion ). the flip - flop circuit is composed of two drive misfets qd1 and qd2 and two load misfets qp1 and qp2 . the drive misfets qd1 and qd2 are constituted by n - channel type , and the load misfets qp1 and qp2 are constituted by p - channel type . that is , the flip - flop circuit is constituted by complete cmos . respective source areas ( regions ) of the drive misfets qd1 , qd2 are connected to the reference voltage vss . the reference voltage is the ground potential 0 ( v ) of the circuit , for example . drain area ( region ) of the drive misfet qd1 is connected to the drain area ( region ) of the load misfet qp1 , one semiconductor area ( region ) of the transfer misfet qt1 , gate electrode of the drive misfet qd2 and gate electrode of the load misfet qp2 . drain area ( region ) of the drive misfet qd2 is connected to the drain area ( region ) of the load misfet qp2 , one semiconductor area ( region ) of the transfer misfet qt2 , gate electrode of the drive misfet qd1 and gate electrode of the load misfet qp1 . respective source areas ( regions ) of the load misfets qp1 , qp2 are connected to the power source voltage vcc . the power source voltage vcc is the operation voltage 5 ( v ) of the circuit , for example . next , specific structure of the memory cell of sram constituted as above described will be briefly described referring to fig4 ( plan view ) and fig3 ( sectional view taken in cutting line iii -- iii of fig4 ). the memory cell , as shown in fig3 and 4 , is provided on a main surface portion of p &# 39 ; type well area 22 formed on a main surface portion of n - type semiconductor substrate 21 of monocrystalline silicon . although not shown , in an area other than the p &# 39 ; type well area 22 , n - type well area is provided on main surface portion of the semiconductor substrate 21 . between memory cells or between elements each constituting a memory cell , a field insulation film 23 and p type channel stopper area 24 are provided on main surface of the well area 22 . the field insulation film 23 and the channel stopper area 24 are constituted respectively so as to effect electrical isolation between memory cells or between elements each constituting a memory cell . the transfer misfets qt1 , qt2 of the memory cell respectively , as shown in fig3 and 6 ( plan view in the prescribed manufacturing process ), are formed on a main surface of the well area 22 in an area surrounded by the field insulation film 23 and the channel stopper area 24 . that is , the transfer misfets qt1 , qt2 respectively are mainly composed of the well area 22 , a gate insulation film 25 , a gate electrode 27 , a pair of n type semiconductor areas 29 being source area and drain area , and a pair of n + type semiconductor areas ( regions ) 31 . the well area 22 is used as a channel forming area ( region ). the gate insulation film 25 is constituted by a silicon oxide film formed by oxidizing the main surface of the well area 22 . the gate electrode 27 of both the transfer misfets qt1 , qt2 and that of the drive misfets qd1 , qd2 is constituted in the same layer according to a prescribed upper portion of the gate insulation film 20 . the gate electrode 27 is constituted by a composite film comprising a polycrystalline silicon film 27a and a high melting - point metal silicide film ( wsi 2 ) 27b stacked on upper side of the silicon film 27a . the polycrystalline silicon film 27a is deposited by means of cvd , and n type impurity ( p or as ) to reduce the resistance value is introduced therein . the high melting - point metal silicide film 27b is deposited by means of sputtering or cvd . the gate electrode 27 constituted by the composite film has specific resistance value being small in comparison to that of a single layer of the polycrystalline silicon film thereby the operation speed can be made high . since the gate electrode of the transfer misfets qt1 , qt2 is formed simultaneously with the gate electrode of the drive misfets qd1 , qd2 , i . e ., the word line is formed using the high melting - point metal silicide film having small resistance value , high speed of read / write operation of information can be realized . also since the gate electrode 27 has the upper layer constituted by the high melting - point metal silicide film 27b , irrespective of the conductivity type of the impurity introduced in the polycrystalline silicon film ( 34 and 37 ) of the upper layer of the gate electrode 27 , the ohmic connection can be effected in connection to the polycrystalline silicon film of the upper layer . respective gate electrodes 27 of the transfer misfets qt1 , qt2 are constituted integrally with the word line ( wl ) 27 extending in the row direction . the word line 27 is provided on the field insulation film 23 . the gate electrode 27 may be constituted by a composite film comprising the polycrystalline silicon film 27a and a high melting - point metal silicide film other than the above ( mosi 2 , tasi 2 , tisi 2 ) or a high melting - point metal film ( mo , ta , ti , w ) stacked on the silicon film 27a . also the gate electrode 27 may be constituted by a single layer of the polycrystalline silicon film , the high melting - point metal film or the high melting - point metal silicide film . a semiconductor area 29 of low impurity density is constituted integrally with a semiconductor area 31 of high impurity density , and provided at a side of the channel forming area in the main surface portion of the well area 22 . the semiconductor area 29 of low impurity density constitutes the transfer misfets qt1 , qt2 respectively in so - called ldd ( lightly doped drain ) structure . the semiconductor area 29 of low impurity density is constituted in self - alignment to the gate electrode 27 . the semiconductor area 31 of high impurity density is constituted in self - alignment to a side wall spacer 30 formed on a side wall of the gate electrode 27 . the drive misfets qd1 , qd2 of the memory cell respectively are formed in substantially the same manner as that of the transfer misfets qt1 , qt2 respectively . that is , the drive misfets qd1 , qd2 respectively are composed of the well area 22 , the gate insulation film 25 , the gate electrode 27 , a pair of n type semiconductor areas 29 being source area and drain area , and a pair of n + type semiconductor areas 31 . the drive misfets qd1 , qd2 respectively are constituted by the ldd structure . one extending end of the gate electrode 27 of the drive misfet qd2 passes through a connection hole 26 , and is connected to one semiconductor area 31 of the transfer misfet qt1 through the n + type semiconductor area 28 interposed therein . also one extending end of the gate electrode 27 of the drive misfet qd1 passes through the connection hole 26 , and is connected to one semiconductor area 31 of the transfer misfet qt2 through the n + type semiconductor area 28 interposed therein . the connection hole 26 is formed on the gate insulation film 25 . the semiconductor area 28 is constituted by the n type impurity diffused from the polycrystalline silicon film 27a of the lower layer of the gate electrode 27 through the connection hole 26 onto the main surface portion of the well area 22 . the other extending end of the gate electrode 27 of the drive misfet qd2 passes through the connection hole 26 , and is connected to the semiconductor area 31 which is the drain area of the drive misfet qd1 through the n + type semiconductor area 28 interposed therein . the semiconductor area 31 being the drain area of the drive misfet qd2 and one semiconductor area 31 of the transfer misfet qt2 are constituted integrally . a data line ( dl ) 40 is connected to respective other semiconductor areas 31 of the transfer misfets qt1 , qt2 through a connection hole 39 formed on an interlayer insulation film 38 . the data line 40 extends in the column direction on an upper side of the interlayer insulation film 38 . the data line 40 is constituted , for example , by an aluminum film or an aluminum alloy film to which cu or si is added so as to prevent the migration . the reference voltage vss is applied to the semiconductor area 31 corresponding to the respective source areas of the drive misfets qd1 , qd2 . supply of the reference voltage vss is effected by reference voltage wiring which is formed by the same conduction layer as the gate electrode 27 and the word line 27 , i . e ., a composite film comprising the polycrystalline silicon film 27a and the high melting - point metal silicide film 27b , and extends in the same row direction . the reference voltage wiring is connected through the connection hole 26 formed on the gate insulation film 25 to the semiconductor area 31 corresponding to the respective source areas of the drive misfets qd1 , qd2 . the load misfet qp1 of the memory cell is constituted on an upper side of ( i . e ., insulatedly above ) the drive misfet qd2 . the load misfet qp2 is constituted on an upper side of ( i . e ., insulatedly above ) the drive misfet qd1 . that is , respective load misfets qp1 , qp2 are mainly composed of a gate electrode 34 , a gate insulation film 35 , a channel forming area 37a , a drain area 37b and a source area 37c . as shown in fig7 ( plan view in the prescribed manufacturing process ) in detail , the gate electrode 34 of the load misfet qp1 is constituted on an upper side of the gate electrode 27 of the drive misfet qd2 so as to cover it . the interlayer insulation film 32 is provided between the gate electrode 34 and the gate electrode 27 . the gate electrode 34 of the load misfet qp1 is connected through the connection hole 33 formed on the interlayer film 32 to the upper surface of the high melting - point metal silicide film 27b of the gate electrode 27 of the drive misfet qd1 . consequently , the gate electrode 34 of the load misfet qp1 is connected to the semiconductor area 31 corresponding to the drain area of the drive misfet qt2 through the gate electrode 27 interposed therein . also the gate electrode 34 of the load misfet qp2 is constituted on an upper side of the gate electrode 27 of the drive misfet qd1 so as to cover it . the gate electrode 34 of the load misfet qp2 is connected through the connection hole 33 to surface of the high melting - point metal silicide film 27b of gate electrode 27 of the drive misfet qd2 . consequently , the gate electrode 34 of the load misfet qp2 is connected to the semiconductor area 31 corresponding to the drain area of the drive misfet qd1 which is integrally formed with one semiconductor area 31 of the transfer misfet qt1 . the gate electrode 34 is constituted by a polycrystalline silicon film in which impurity is introduced so as to reduce the resistance value . p type impurity ( b ) is introduced in the polycrystalline silicon film . the gate electrode 34 is constituted by the polycrystalline silicon film with the p type impurity ( b ) introduced therein , and connected to the semiconductor area 31 or the gate electrode 27 through the high melting - point metal silicide film 27b interposed therein in order to prevent insertion of a parasitic diode . the gate electrode 34 comprising the polycrystalline silicon film with the p type impurity introduced therein can decrease the threshold voltage of respective load misfets qp1 , qp2 in comparison to the case of the n type gate electrode . the decrease of the threshold voltage can decrease the introduction quantity of the impurity introduced in the channel - forming area 37a of the respective load misfets qp1 , qp2 , thereby making the introduction quantity of the impurity more controllable . when the n type impurity ( as or p ) is introduced in the gate electrode 34 , the ohmic characteristics cannot be deteriorated during the connection to respective gate electrodes 27 of the drive misfets qd1 , qd2 or the n type semiconductor area 31 . as a result of the basic study by the inventors , an effect has been confirmed in that when the gate electrode 34 is formed in film thickness of about 1000 ( å ) or more , a depletion layer is formed within the gate electrode 34 ( polycrystalline silicon film ) by the field effect from the gate electrode 27 of the drive misfet qd1 or qd2 , thereby the field effect from the gate electrode 27 can be shielded by the gate electrode 34 . consequently , the gate electrode 34 is constituted in the above - mentioned film thickness . the gate electrode 34 is not limited to the polycrystalline silicon film but may be constituted by a single layer of a high melting - point metal silicide film or a high melting - point metal film . in this case , the conductivity type of the conductive layer connected to the gate electrode 34 has no relation . also the gate electrode 34 may be a composite film comprising a polycrystalline silicon film , and a high melting - point metal silicide film or a high melting - point metal film on the polycrystalline silicon film . capacitance c 5 using the interlayer insulation film 32 as a dielectric layer is formed between the gate electrode 27 of the drive misfets qd2 , qd1 and the gate electrode 34 of the load misfets qp1 , qp2 . the capacitance c s has effect of increasing the capacitance of the storage node portions n1 , n2 of the flip - flop circuit , as shown in fig5 . the gate insulation film 35 is constituted by a silicon oxide film deposited by means of cvd . the channel forming area 37a , as shown in fig8 ( plan view in the prescribed manufacturing process ) in detail , is formed on prescribed upper portion of the gate insulation film 35 . the channel forming area 37a is constituted by a polycrystalline silicon film of i type where impurity to reduce the resistance value is not introduced or p type impurity is slightly introduced . the drain area 37b is formed integrally with one end side of the channel forming area 37a , and is constituted by a p type polycrystalline silicon film in which p type impurity is introduced . the drain area 37b is connected through the connection hole 36 formed on the gate insulation film 35 ( part except for the channel forming area 37a is used as an interlayer insulation film ) to gate electrode 27 . since the drain area 37b and the gate electrode 27 are connected through the high melting - point metal silicide layer , the drain area 37b and the gate electrode 27 can be connected in the ohmic connection . the source area 37c is formed integrally with the other end side of the channel forming area 37a , and is constituted by a p type polycrystalline silicon film in which p type impurity is introduced . the source area 37c is formed integrally with the power source voltage wiring vcc extending in the row direction . as shown in fig3 the gate electrode 34 of the load misfet qp1 is formed to be overlapped positively with the source area 37c and the drain area 37b . according to such overlapping , capacitance c 3 is provided between gate and source of the load misfet qp1 , and capacitance c 1 is provided between gate and drain thereof . also capacitance c 4 is provided between gate and source of the load misfet qp2 , and capacitance c 2 is provided between gate and drain thereof . these capacitances c 1 - c 4 are equivalently connected to the information storage nodes n1 , n2 thereby the capacitance provided in the information storage nodes can be increased . consequently , the effect that is obtained is that soft error due to α - ray or the like is not easily generated . in the sram having memory cells of the cmos type , the gate electrode 34 of the load misfet qp in such a memory cell is provided on the upper side of the gate electrode 27 of the drive misfet qd ( i . e ., it is insulatedly disposed thereover ), thereby the field effect from the gate electrode 27 of the drive misfet qd can be shielded . consequently , current amount during operating and current amount during the waiting , or quiescent period , respectively , of the load misfet qp can be optimized independently . gate electrodes of the load misfet and the drive misfet may be made independent thereby the degree of freedom in the layout can be increased . since the gate electrode of the transfer misfet can be constituted by employing a material of low resistance having a high melting - point silicide layer , the read / write operation of information can be effected at high speed . further , since capacitance provided in the information storage node of the memory cell can be increased , the storage quantity of the information storage member can be increased and the soft error can be prevented . next , the manufacturing method of the memory cell of sram will be briefly described referring to fig9 through 15 ( main part sectional view shown in each manufacturing process ). first , n - type semiconductor substrate 21 comprising monocrystalline silicon is prepared . next , in a memory cell forming area and n - channel misfet forming area of a peripheral circuit ( not shown ) respectively , p - type well area 22 is formed on main surface portion of the semiconductor substrate 21 . between elements of the memory cell , a field insulation film 23 and p type channel stopper area 24 are formed on main surface of the well area 22 . as shown in fig9 between element forming areas of the memory cell , a gate insulation film 25 is formed on main surface of the well area 22 . the gate insulation film 25 is constituted by a silicon oxide film formed by oxidizing the main surface of the well area 22 . the gate insulation film 25 is formed in film thickness of about 250 - 350 ( a ) for example . as shown in fig1 , a connection hole 26 is formed . the connection hole 26 may be formed by partially removing the gate insulation film 25 in portion where a gate electrode 27 is connected directly to main surface of the well area 22 . as shown in fig1 , a gate electrode 27 , a word line 27 and a reference voltage wiring are formed . the gate electrode 27 is formed by a composite film comprising a polycrystalline silicon film 27a , and a high melting - point metal silicide film 27b stacked on upper side of the silicon film 27a . the polycrystalline film 27a is deposited by means of cvd , and p being n type impurity to reduce the resistance value is introduced therein . the polycrystalline silicon film 27a is formed in film thickness of about 2000 - 3000 ( å ) for example . the high melting - point metal silicide film 27b is deposited by means of sputtering . the high melting - point metal silicide film 27b is formed in film thickness of about 2500 - 3500 ( å ) for example . the polycrystalline silicon film 27a and the high melting - point metal silicide film 27b are subjected to patterning by anisotropy etching of rie or the like . as shown in fig1 , n type semiconductor area 29 to be used as source area and a part drain area is formed . the semiconductor area 29 can be formed , for example , in that p of about 10 13 ( atoms / cm 2 ) is introduced by ion implantation of energy of about 40 - 60 ( kev ). in the introduction of the impurity , the gate electrode 27 and the field insulation film 23 are mainly used as an impurity introducing mask . consequently , the semiconductor area 29 can be formed in self matching to the gate electrode 27 . also as shown in fig1 , n + type semiconductor area 28 is formed on main surface portion of the well area 22 where the gate electrode 27 is connected through the connection hole 26 . the semiconductor area 28 can be formed in that n type impurity introduced in the polycrystalline silicon film 27a being a lower layer of the gate electrode 27 is subjected to thermal diffusion on the main surface portion of the well area 22 . the semiconductor area 28 is formed in the same process as the heat treatment process where , for example , the high melting - point metal silicide film 27b being an upper layer of the gate electrode 27 is activated . next , a side wall spacer 30 is formed on a side wall of the gate electrode 27 . the side wall spacer 30 can be formed in that a silicon oxide film is deposited by means of cvd so as to cover the gate electrode 27 , and anisotropy etching of rie or the like is applied to the silicon oxide film . as shown in fig1 , n + type semiconductor area 31 to be used as source area and drain area is formed . the semiconductor area 31 can be formed , for example , in that as of about 10 15 - 10 16 ( atoms / cm 2 ) is introduced by ion implantation of energy of about 40 - 60 ( kev ). in the introduction of the impurity , the gate electrode 27 , the field insulation film 23 and the side wall spacer 30 are mainly used as an impurity introducing mask . consequently , the semiconductor area 31 can be formed in self matching to the side wall spacer 30 . since the semiconductor area 31 is formed , the transfer misfets qt1 , qt2 and the drive misfets qd1 , qd2 are completed respectively . although not shown , p + type semiconductor area being source area and drain area of p - channel misfet to constitute a peripheral circuit is formed after the process to form the semiconductor area 31 . next , an interlayer insulation film 32 is formed on the whole surface of the substrate including upper side of the gate electrode 27 . the interlayer insulation film 32 is formed by a silicon oxide film deposited by cvd and having fine film property . the interlayer insulation film 32 is formed in film thickness as thin as about 300 - 1500 ( å ) so that the growth of stepped form is relieved and the step coverage of the conductive layer of the upper layer can be improved . in the connecting portion between the gate electrode 27 and the gate electrode 34 , the interlayer insulation film 32 is partially removed and a connection hole 33 is formed . as shown in fig1 , respective gate electrode 34 of the load misfets qp1 , qp2 to be connected to the gate electrode 27 through the connect on hole 33 are formed . the gate electrode 34 is constituted by a polycrystalline silicon film deposited by means of cvd . the gate electrode 34 is formed in film thickness as thin as about 1000 - 1500 ( å ) for example . p of about 10 15 - 10 16 ( atoms / cm 2 ) is introduced into the gate electrode 34 by ion implantation of energy of about 20 - 40 ( kev ). that is , the gate electrode 34 is formed by the polycrystalline silicon film of n type . next , a gate insulation film 35 is formed on the whole surface of the substrate so as to cover the gate electrode 34 . the gate insulation film 35 is formed , for example , by a silicon oxide film deposited by cvd and having fine film property . the gate insulation film 35 is formed in film thickness of about 1000 - 1500 ( å ) for example . as shown in fig1 , on upper side of the gate insulation film 35 , respective channel forming areas 37a of the load misfets qp1 , qp2 , drain area 37b and source area 37c ( including the power source voltage wiring are formed in sequence . the channel forming area 37a , the drain area 37b and the source area 37c is constituted by a polycrystalline silicon film deposited by cvd for example , and formed in film thickness of about 650 - 2000 ( å ). the drain area 37b and the source area 37c are formed in p type , for example , in that bf 2 of about 10 15 ( atoms / cm 2 ) is introduced into the polycrystalline silicon film by ion implantation of energy of about 50 - 70 ( kev ). since the channel forming area 37a , the drain area 37b and the source area 37c are formed , the load misfets qp1 and qp2 are completed . next an interlayer insulation film 38 is formed on the whole surface of the substrate . the interlayer insulation film 38 is constituted , for example , by a composite film comprising a silicon oxide film deposited by cvd and a psg film formed on upper side of the silicon oxide film by cvd . and then a connection hole 39 is formed on the interlayer insulation film 38 . next , as shown in fig3 and 4 , a data line 40 is formed on upper side of the interlayer insulation film 38 so that connection is effected to respective other semiconductor areas 31 of the transfer misfets qt1 , qt2 through the connection hole 39 . these series of the manufacturing processes are applied thereby the memory cell of sram of the embodiment is completed . fig1 shows an example where in the structure of the embodiment of the invention shown in fig3 the conductive layer to constitute gate electrodes of the drive misfets qd1 , qd2 and the transfer misfets qt1 , qt2 is made of a structure of three layers , a polycrystalline silicon film , tin and a high melting - point metal silicide layer in the order from the lower layer . since the gate electrode 27 of the drive misfets qd1 , qd2 is n type , and the gate electrode 34 of the load misfets qp1 , qp2 and the source - drain area 37b , 37c are p type , if both are connected directly , the impurities will be mutually diffused . however , the above - mentioned structure shown in fig1 can prevent the mutual diffusion of the impurities . further , if a barrier layer of tin is interposed between the polycrystalline silicon film and the high melting - point metal silicide layer , such problem in which the high melting - point metal passes through the polycrystalline silicon film and enters the gate insulation film under the polycrystalline silicon film which deteriorates the withstanding voltage of the gate insulating film is prevented . of course , this structure of the gate electrodes may be applied to other examples of the invention . fig1 shows an example where the gate electrode of the load misfets qp1 , qp2 is provided on upper side of area of source , drain and channel , and is a sectional view taken in cutting line xvii - xvii of fig1 . also fig1 is an equivalent circuit diagram of the memory cell shown in fig1 . reference numerals of parts in fig1 - 19 are the same as those in fig3 - 5 . this embodiment is different from the previous embodiment in that the gate electrode of the load misfets qp1 , qp2 is provided on upper side of area of source , drain and channel . that is , the area of source , drain and channel of the load misfets qp1 , qp2 is formed by the polycrystalline silicon layer being the second layer , and the gate electrode is formed by the polycrystalline silicon layer being the third layer . further , area of source and drain of the load misfets qp1 , qp2 is an impurity area in which boron is introduced . the boron is introduced using the gate electrode 34 as a mask and then annealed so that the gate electrode and the impurity area are overlapped . it follows that the capacitance due to the overlapping between the gate electrode and the area of source and drain is connected as in c 1 - c 4 of fig1 . as a result , capacitance to be added to the information storage nodes can be increased . fig2 and 21 are views illustrating the manufacturing method of the memory cell shown in fig1 - 19 . in similar manner to that in fig9 - 14 , the polycrystalline silicon films in the first layer and the second layer are formed . however , plane pattern of the polycrystalline silicon film in the second layer is different from that in fig 14 . as shown in fig2 , the polycrystalline silicon film 37 deposited by cvd for example is formed in film thickness of 650 - 2000 ( å ), and then , as shown in fig2 , the gate insulation film 35 is formed in film thickness of about 200 - 400 ( å ) for example . further , the polycrystalline silicon film 34 is formed in film thickness of 100 - 1500 ( å ) onto the gate insulation film 35 by cvd . the polycrystalline silicon film 34 is subjected to patterning as shown in fig1 . and then , ion implantation of bf 2 of about 10 15 ( atoms / cm 2 ) is effected in energy of about 50 - 70 ( kev ) onto the gate electrode and the area of source and drain of the load misfets qp1 , qp2 , and annealing of 850 °- 950 ° c . is effected thereby the boron implanted into the polycrystalline silicon film 37 is diffused in the lateral direction . consequently the overlapping capacitance is formed between the area of source and drain and the gate electrode . the gate electrode is used as the mask in the ion implantation for forming the area of source and drain as above described , thereby the area of source and drain can be formed in self matching to the gate electrode , and further the manufacturing process can be simplified . an example shown in fig2 and 23 is nearly similar to the example shown in fig1 - 19 , but different in the plane pattern of the gate electrode 34 of the load misfets qp1 , qp2 . fig2 is a sectional view taken in cutting line xxii -- xxii of fig2 . in this example , the gate electrode 34 of the load misfets qp1 , qp2 is widely overlapped with the area of source and drain . the gate electrode 34 is overlapped with the area of source and drain as above described , thereby the capacitance of c 1 - c 4 of fig1 can be increased . in this case , however , since the gate electrode of the load misfet cannot be made a mask in the ion implantation for forming the area of source and drain as described in fig2 , the manufacturing process number is increased corresponding to this . fig2 and 25 show an example where the polycrystalline silicon film in the second layer is used as a reference voltage wiring . fig2 is a sectional view taken in cutting line xxiv - xxiv of fig2 . a reference voltage wiring 42 constituted by the polycrystalline silicon film in the second layer is formed on the gate electrode 27 of the drive misfets qd1 , qd2 as shown in fig2 . the reference voltage wiring 42 is arranged between the gate electrode 27 of the drive misfets qd1 , qd2 and the channel area 37a ( i ) of the load misfets qp1 , qp2 , and extends in the parallel direction to the word line . according to this constitution , the field effect to the load misfet from the gate electrode 27 of the drive misfets qd1 , qd2 can be shielded . consequently , it can be prevented that the field effect of the gate electrode of the drive misfets qd1 , qd2 varies the current amount of the load misfet in the operating state and the waiting state . further , since the reference voltage wiring 42 can be formed on the forming area of the drive misfets qd1 , qd2 , the memory cell area can be made small . | 8 |
the following description is presented to enable one of ordinary skill in the art to make and use the invention as provided in the context of a particular application and its requirements . various modifications to the described embodiments will be apparent to those with skill in the art , and the general principles defined herein may be applied to other embodiments . therefore , the present invention is not intended to be limited to the particular embodiments shown and described , but is to be accorded the widest scope consistent with the principles and novel features herein disclosed . in other instances , well - known methods , procedures , and components have not been described in detail so as not to obscure the present invention . the printing apparatus and display systems according to the present invention may be similar in construction and operation to parts of the system described in embodiments of us application , publication no . 2002 / 0109663 a1 and / or pct application wo 02 / 065433 a2 , both by a common inventor , which are incorporated by reference in their entirety . other embodiments of the present invention may use different construction and different methods . as can be seen in fig1 , the erasing of an image from an imaging belt 11 may occur at erasing unit 12 while the imaging belt 11 is moving , for example , clockwise , as indicated by arrow 15 . imaging and printing of a new color image may occur after the erasing of a prior image at erasing unit 12 , for example , at the cyan ( c ), magenta ( m ), yellow ( y ), and / or black ( k ) units , respectively 10 c , 10 m , 10 y and 10 k . other suitable colors and color systems may be used . reference is now made to fig2 a which is a schematic block diagram illustration of a display system 21 , according to some embodiments of the present invention . display system 21 may have at least one viewing window 27 for viewing of , for example , an internal substrate . display system 21 may have a casing cover 22 that may be openable to enable a printing apparatus ( described herein ) to connect to display system 21 , and / or for entering a substrate and printing / deleting mechanisms etc ., as are described in detail below . display system 21 may have a printing substrate 23 for displaying printed images . display system 21 may have guiding rollers 24 for enabling substrate 23 to be rolled over a suitable printer mechanism ( described herein ), for configuration , removal , deletion and printing etc . display system 21 may include at least one attachment or registration mechanism 25 corresponding to a corresponding attachment or registration mechanism of an attachable printing apparatus , to enable such a printing apparatus to be securely and accurately attached to display system 21 . the attachment or registration mechanisms of the screen based display and printing apparatus may be capable of being mated and may hold the systems together . various ways of achieving registration may be implemented , for example , using precision mechanical pins and holes , precision pins and slots , and / or other suitable mechanical solutions . display system 21 may have an identifier 29 , which may include identity data or other suitable identifiable means for enabling identification of a display system to a printer apparatus and / or printer server . identity verification may be used , for example , to enable a printing apparatus to determine which images are to be printed and / or deleted from one or more display systems 21 , or to execute other suitable operations . in one embodiment identifier 29 may be stored in , for example , a memory unit , and operated by a logic circuit or controller within display system 21 . the logic circuit may be a generic or dedicated controller , for managing printing operations of display system 21 . identifier 29 may be stored in display system 21 in any format , for example , in a bar code form , magnetic strip form , as a mechanical key , or in other suitable forms , such that upon scanning or otherwise determining the identity data of display system 21 , display system 21 may be identified to an attachable printing apparatus and / or printing server . display system 21 may have an identifying mechanism ( not illustrated in figure ), such as a data scanner mechanism ( e . g ., a barcode scanner ), magnetic strip reader , mechanical key reader , or other suitable mechanism , for determining identity data of an attachable printing apparatus , following a registration ( e . g ., connection or attachment ) procedure of a printing apparatus . the identifying mechanism may send the identification data to a logic circuit for verification . in the case where a display system is positively identified ( e . g ., matched ) with a printer apparatus , such a printer apparatus may implement the relevant printing / delete or other commands for display system 21 . display system 21 may have a communication mechanism ( not illustrated in figure ) for sending and / or receiving data to / from an attachable printing apparatus , via wire - based , for example , an electronic circuit and connection pins , antenna , wireless communication chip etc . the communication mechanism may enable display system 21 to communicate with an attachable printing apparatus and / or a data server etc . reference is now made to fig2 b which is a schematic block diagram illustration of a detachable printing / erasing apparatus 100 , according to some embodiments of the present invention . the detachable printing apparatus 100 may be attached to one or more display systems 21 , and may thereby print on and / or erase from a plurality of display systems . the detachment of the printing apparatus 100 from display system 21 may enable , for example , preservation and protection of the printing apparatus 100 , and may enable multiple printouts and erasures of images using for example xerographic , ionographic , magnetographic or other suitable printing methods . detachable printing apparatus 100 may include at least one printing unit 105 , for printing images on the substrate . each printing unit , e . g ., unit 105 , may include , for example imaging heads for pre - printing using light . printing units may have , for example , printing heads , inkjet heads , or other suitable printing heads . printing unit 105 may include , for example , toner or inkjet cartridges 110 . printing apparatus 100 may include an erasure unit 115 , for erasing images from the substrate . erasure unit 115 may be associated with a toner or inkjet receptacle 120 , for collecting the deleted toner or ink from deleted images . printing apparatus 100 may include at least one memory device 125 . memory device 125 may store relevant system data , network data and image data , etc . image data may include previous , current , and future images for display system 21 . memory device 125 may also store relevant display system data , such as identity data , such that all display systems 21 that are configured to be served by a printer apparatus 100 may be identified and interacted with by printing apparatus 100 . memory device 125 may also store relevant printing and erasing data , for enabling printing and erasing operations by printing apparatus 100 and / or display system 21 . memory device 125 may be an internal memory device and / or an external memory device . printing apparatus 100 may include at least one controller , logic circuit , or cpu 130 , which may be a generic or dedicated processor , for managing printing , deleting , and other suitable operations of printing apparatus 100 and / or display system 21 . for example , controller 130 may enable printing apparatus 100 to verify which images are to be printed and / or deleted to / from display system 21 , and implement the relevant printing / deleting commands and other suitable operations for each particular display system 21 . printing apparatus 100 may include at least one registration or attachment mechanism 135 that may be a mechanical component , or a set of mechanical components , to connect with at least one matching or associated registration mechanism in display system 21 , e . g . mechanism 25 . these matching registration components may function to connect , secure , and / or lock printing apparatus 100 into display system 21 , for example , to execute printing , deleting and / or other suitable operations . printing apparatus 100 may include a communications unit 140 , which may include hardware and / or software components , to send / receive data to / from an external data server , printer server etc . ( not illustrated in figure ), and / or to send / receive data to / from display system 21 . data may be transmitted via wire - based means ( e . g ., electronic circuit , connection pins etc .) and / or wireless means ( e . g ., a wireless communication chip that may enable printing apparatus 100 to communicate with a display system 21 or external printer server etc . even when not physically connected to a display system or data server etc .). printing apparatus 100 may include an identifying mechanism 145 to enable printing apparatus 100 and / or a printer server etc . to identify display system 21 . the identifying mechanism may include , for example , a data scanner mechanism ( e . g ., a barcode scanner ), magnetic strip reader , mechanical key reader , computer code etc ., to enable printing apparatus 100 to determine identity data of display system 21 . for example , before , during , or after a registration ( e . g ., connection or attachment ) procedure of printing apparatus 100 and display system 21 , identifying mechanism 145 may read identifier 29 , and send the read identification data to controller 130 for verification . in the case , for example , where a particular display system 21 is positively identified ( matched ) with a printer apparatus 100 , printer apparatus 100 may implement the relevant printing , deleting , or other suitable commands for display system 21 . of course , other suitable structures , components , and dimensions may be used . printing apparatus 100 may include an identifier ( not shown in figure ), for example , a number , code , password , barcode , or any other identifiable means , for enabling identification of a particular printing apparatus 100 to display system 21 . fig3 illustrates a printer apparatus 100 connected to a display system 21 , according to some embodiments of the present invention . display system 21 may include an openable display casing 22 , which may be opened to allow the printer apparatus 100 to be attached to display system 21 . registration mechanism ( s ) 25 may connect to or be otherwise associated with registration or attachment mechanism ( s ) 135 , to hold printer apparatus 100 in place , for example to enable substrate 23 to be aligned with printing unit 105 , imaging unit , and deleting unit 115 etc . of printing apparatus 100 . identification mechanism 145 may be associated with identifier 29 , to enable identification of display system 21 . according to some embodiments of the present invention , printing apparatus 100 may have an apparatus for recycling or otherwise collecting the deleted toner or ink from toner or ink receptacle 120 , for example for re - use in further printing . a method and apparatus to recycle or collect toner deleted from a display is described in embodiments of u . s . patent application ser . no . 10 / 745 , 596 , titled “ apparatus and method for recycling toner in a printed image display system ”, which is incorporated by reference in its entirety . according to some embodiments of the present invention , printing apparatus 100 may be too wide to fit into a narrower display system 40 structure , as can be seen with reference to fig4 . display system 40 may include , for example , one or more auxiliary guiding rollers 41 , 42 positioned such that auxiliary guiding rollers 41 , 42 may engage one or more sliding mechanisms following a registration procedure of a printing apparatus 100 . one or more auxiliary slides , e . g ., slide 44 , may additionally or alternatively be added to narrow display system 40 . auxiliary slide 44 may be provided within narrow display system 40 , to enable at least one upper roller 46 to change position by sliding along auxiliary slide 44 . according to some embodiments of the present invention , an additional auxiliary slide may be integrated into display system 40 . such an integration may require the auxiliary slide to be positioned such that following attachment or registration of printing apparatus 100 to display system 40 , the additional auxiliary slide may be engaged and moved into an appropriate operating position . display system 40 may include at least one registration mechanism 25 , corresponding to a corresponding registration mechanism of an attachable printing apparatus , to enable such a printing apparatus to be securely and accurately attached to display system 40 . reference is now made to fig5 , which illustrates a printing unit attached to a to narrow display system 40 , according to some embodiments of the present invention . in some embodiments , at least one additional ( auxiliary ) slide 45 may be provided within printing apparatus 100 and / or display system 40 , such that following a mechanical registration procedure by means of which printing apparatus 100 connects with or locks into display system 40 , a relevant auxiliary slide 45 may be placed in an appropriate position to engage auxiliary roller 42 , thereby enabling at least one auxiliary roller to slide along slide 45 into operating position . since display system 40 may have a depth that is too narrow to accommodate a printer apparatus 100 , printer apparatus 100 may be attached to display system 40 such that at least one registration mechanism 25 is engaged to a corresponding registration mechanism of an attachable printing apparatus 100 , to enable such a printing apparatus to be securely and accurately attached to display system 40 . following registration ( connection ) of printing apparatus 100 to display system 40 , auxiliary roller 42 may engage auxiliary slide 45 . this engagement may enable bending and / or maneuvering of substrate 43 into an alternative position that is accessible to the printing units 105 and deleting unit 115 within printing apparatus 100 , to enable deleting and printing of images by printing apparatus 100 . attaching of the printer apparatus 100 may trigger auxiliary roller 42 to move along slide 45 , until roller 42 is placed , for example , adjacent to deletion unit 115 of printing apparatus 100 , or in an otherwise suitable position to enable appropriate positioning of substrate 43 . attaching of printing apparatus 100 to display system 40 may trigger upper guide roller 46 to move along slide 44 , to compensate for the movement of auxiliary roller 42 as described above . as can be seen with reference to fig6 , both auxiliary guide roller 42 and guide roller 46 may move along auxiliary slides 44 , 45 respectively until auxiliary roller 42 is located , for example , adjacent to deletion unit 115 , or in an otherwise suitable position to enable appropriate positioning of substrate 43 . the new positioning of auxiliary roller 42 may , for example , stretch substrate 43 from auxiliary guide roller 41 to auxiliary roller 42 , such that substrate 43 is placed in line with deletion unit 115 and printing units 105 , thereby being in a position ready for deletion and / or printing . such a mechanism may be used for any size display system that is narrower than the width of a printing apparatus 100 . according to an embodiment of the present invention , a printing apparatus 100 may provide monochrome or colored printing , for example , using a four - color printing mechanism on a display system 21 or 40 , in the case of a narrow display system ), which may have at least one substrate , to enable multiple printing of color images . other suitable color systems may be used . display system 21 may include a display surfaces that may have images printed on them , such as billboards , advertisement panels and / or alternative display panels . display system 21 may be connected to a communication network , such that instructions can be transferred between a data server , web server , print server etc . and display system 21 , for example , to print a new image , erase a current image , display the new image , and communicate display status etc . alternatively , or additionally , these instructions may be given to and / or received from detachable printing apparatus 100 . printing apparatus 100 may enable printing and deletion of images for multiple display systems 21 , 40 , and may contain or have access to printing / deleting data for a plurality of display systems 21 , 40 . images on display systems 21 , 40 may be printed using xerographic , ionographic , magnetographic or any suitable printing method , on at least one single substrate . printed images may not be fused on the substrate on which they are printed , thereby enabling deletion of the printed images and their replacement by new images . the detachable printing apparatus 100 may be connected to display system 21 using at least one connector or registration mechanism 25 . upon connection , or registration , of printing apparatus 100 to display system 21 , 40 , printing apparatus 100 may identify display system 21 , 40 and implement the relevant printing / deletion instructions . according to other embodiments of the present invention , printing apparatus 100 and display system 21 , 40 may identify each other before executing the printing / deleting commands . according to other embodiments of the present invention , display system 21 , 40 may identify printing apparatus 100 before executing the printing / deleting commands . reference is now made to fig7 , which illustrates a method to enable printing and / or deletion of content directly to / from a display system 21 , 40 using a detachable printing apparatus 100 . at block 70 image deletion and / or printing commands may be configured , either within printing apparatus 100 , display system 21 , 40 , or at a data and / or print server etc . at block 71 these commands may be communicated to either a printing apparatus 100 and / or a display system 21 using a data or printer server etc ., display system 21 , 40 , or printing apparatus 100 . at block 72 a detachable printing apparatus 100 may be attached to display system 21 , 40 such that one or more connection mechanisms and / or registration mechanisms may connect printing apparatus 100 to display unit 21 , 40 . at block 73 printing apparatus 100 may identify display unit 21 , 40 and / or display unit may identify printing apparatus 100 . this identification and / or co - identification may include , for example , identification of printing apparatus 100 and / or display system 21 , 40 by an identifying mechanism in printer apparatus 100 and / or in display system 21 , 40 . for example , a data scanner mechanism ( for example a barcode scanner ), magnetic strip reader , mechanical key reader , software code etc ., may be used following a registration ( connection ) procedure . the identifying mechanism may send the identification data to a logic circuit for verification , located at any suitable location . at block 74 the print and / or delete commands may be verified for display system 21 , 40 . at block 75 printing and / or delete commands may be executed by printing apparatus 100 . in the case where commands are communicated from a printing apparatus 100 to display system 21 , these commands may be communicated via for example wire - based or wireless means . execution of commands may be controlled by a controller 130 in printing apparatus 100 and / or a controller in display system 21 . the delete function of block 75 may include collecting ink or toner or other residue from a deleted image and collecting the substances in a receptacle such as a toner receptacle . the deleting function may further include separating a mixed toner collection into component colors . the deleting function may further include transferring the previously deleted toner to one or more toner cartridges for addition usage ( e . g ., recycling ). for example , a deleting function may be implemented similar to that described in embodiments of u . s . patent application ser . no . 10 / 745 , 596 , as referenced above . according to some embodiments of the present invention , in the case where printing apparatus 100 is too wide to connect to the printable area of substrate 23 , additional rollers such as auxiliary rollers 41 , 42 , and slides 44 , 45 may be provided , for enabling the guide rolls 24 to slide into appropriate positions for stretching the substrate to a position adjacent to printing apparatus &# 39 ; s printing 105 and / or deleting 115 units , so that printing apparatus 100 may print and / or delete images to / from the substrate . any combination of the above steps may be implemented . further , other steps or series of steps may be used . according to a further embodiment of the present invention , the display system may print at least one image onto a plurality of substrates , each substrate having a plurality of colors printed onto it . upon erasing of such an image , the various colors that comprise the image on a particular substrate may be collected together , and the colors may be subsequently separated into the component colors . the foregoing description of the embodiments of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . it should be appreciated by persons skilled in the art that many modifications , variations , substitutions , changes , and equivalents are possible in light of the above teaching . it is , therefore , to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention . | 6 |
dynamic random access memory ( dram ) devices may be replaced by non - volatile memory technology such as phase change memories . the dynamic random access memory has a deterministic writing time . each write cycle is defined by a number of clock cycles needed to write , which makes the dynamic random access memory a passive device that does not need to communicate with a memory controller during write or read . a non - volatile memory writing / programming time is undetermined . for example , if a memory controller wants to write data to a non - volatile memory device , the non - volatile memory device may be busy doing something in the background or still verifying the previously programmed data . to overcome this issue , some non - volatile memory devices may have a ready / busy ( r / b ) output pin . that pin is used to send a wait signal to the controller if the controller is trying to write to the memory and the non - volatile memory is busy . the controller is thereby advised to retry writing later . however , the lpddr2 jedec standard reduces the number of pins to reduce the package size for both the memory and the host processor as a way to reduce system cost . one pin that may be eliminated is the r / b output pin . thus , under this proposal , the undetermined writing time for non - volatile memories that substitute for dynamic random access memories becomes an issue . the proposed lpddr2 jedec standard does provide a data not valid ( dnv ) signal to the controller only during the read mode . the data not valid signal uses an input data mask / data not valid ( dm ) pin only during the read mode since the dm pins are used during the write mode to mask the data . as used herein , a “ package connector ” includes any lead or conductor used to obtain an output signal from an integrated circuitry including pins , prongs / lands , contacts , terminals / plugs , balls , and springs . in accordance with some embodiments , another package connector that is unused during the write mode may be used as an output signal from the non - volatile memory to the memory controller . one suitable package connector is the zq pin . the zq pin is used conventionally to enable the memory device to calibrate its output drive strength . the zq pin is connected to an external resistor ( which typically is 240 ohms ). the zq pin is only conventionally used during calibration mode and is not conventionally intended for communications with the memory controller . zq pin can be used for data communications during writes , as a ready / busy pin during a writing operation to the non - volatile memory device . during writing , the calibration mode is off . thus , the zq pin can be used in the following fashion . in one embodiment , a current of 5 milliamps may be driven through the zq resistor . in this example , the non - volatile memory device generates 1 . 2 volts at the zq pin . the presence of this voltage on the zq pin is used to interrupt the controller to indicate that the memory is busy . it may also be considered a wait signal . when the zq pin is asserted high , that means the non - volatile memory device is busy and the controller cannot write in one embodiment . when the non - volatile memory is ready for write , the zq pin may be pulled low again in one embodiment . of course the opposite polarities may be used as well . also , the signal provided from the zq pin may be a continuous signal or pulses , depending on whether the retry is short or long . thus , referring to fig1 , a non - volatile memory 12 which may , for example , be a phase change memory , includes a current source 16 coupled to the zq pin , indicated as r / b for ready / busy in fig1 . the non - volatile memory communicates the ready / busy signal to the memory controller 10 . it also communicates addresses and commands ( a / c ) and other signals , including data inputs / outputs ( dq ), dm , and data strobe ( dqs ) signals . clock ( clk ) signals and clock bar signals may also be communicated from the memory controller to the non - volatile memory . the memory 12 may include a control 18 that controls the current source 16 . the control 18 may be implemented in hardware , software , or firmware . the control 18 may be an embedded processor or logic , as examples . thus , in fig2 , the clock and clock bar signals are depicted at the top , followed by the command / address inputs ca 0 - 9 and the write command signals cmd . note that the first write command signal initiates a request to write to the non - volatile memory which is rejected by the non - volatile memory , as signaled by the ready / busy ( r / b ) signal . namely , the current i in the non - volatile memory device generates a high level on the ready / busy line to the memory controller 10 indicating that the write should be retried . the write command ( cmd ) is then tried again , as indicated in dashed lines on the command timing diagram . when the device is no longer busy and is then ready , as indicated in dotted lines , the r / b level may be lowered and the current from the current source i may be turned off . this signals to the memory controller that the non - volatile memory is now ready to write again and this may be followed up , as indicated by dotted lines on the line cmd , by issuing another write command . referring to fig3 , a sequence is illustrated which may be implemented in software , hardware , or firmware . in some embodiments , a computer readable medium may store instructions that , when executed , enable the sequence to be implemented . for example , the sequence may be implemented by the control 18 , shown in fig1 . initially , a check at diamond 32 determines whether or not a write request has been received from the memory controller . if not , a read mode is implemented and , in the case of a zq pin , this means implementing the calibration mode , as indicated at block 30 . if a write was requested , as determined at diamond 22 , a check determines whether or not the memory is available and ready for a write , as indicated in diamond 24 . if so , the ready signal is provided on the zq pin in one embodiment , indicated at block 28 . otherwise , a wait or retry signal is issued to signal the memory controller to wait until the memory is no longer occupied to implement the write command ( block 26 ). from here , the flow iterates until such time as the memory is free ( as determined at diamond 24 ) and the write can be implemented ( as indicated at block 28 ). while an embodiment is described in which the non - volatile memory device is a phase change memory and the product is the low power double data rate , this same technology may be useful in any situation where a ready / busy dedicated pin is unavailable for whatever reason . references throughout this specification to “ one embodiment ” or “ an embodiment ” mean that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one implementation encompassed within the present invention . thus , appearances of the phrase “ one embodiment ” or “ in an embodiment ” are not necessarily referring to the same embodiment . furthermore , the particular features , structures , or characteristics may be instituted in other suitable forms other than the particular embodiment illustrated and all such forms may be encompassed within the claims of the present application . while the present invention has been described with respect to a limited number of embodiments , those skilled in the art will appreciate numerous modifications and variations therefrom . it is intended that the appended claims cover all such modifications and variations as fall within the true spirit and scope of this present invention . | 6 |
the preferred p2m system is a monitoring device with two major subsystems , one to measure signals and the other to process data into meaningful information . fig1 shows a schematic of the system , and fig2 shows a perspective view of the system . first , the piezoelectric film , an electrically active fluoropolymer converts mechanical energy such as movement caused by a heartbeat into voltage measurements capable of supporting time series analysis techniques . second , the voltage is recorded by and analyzed using a microcomputer controlled system , the purpose of which is to discriminate the signal from background noise and display it on a screen or printout . techniques such as preamplifying and preconditioning through the use of high and low - band pass filters reduces noise . the piezoelectric material 1 used is the polymer polyvinylidene fluoride ( pvdf ), which can be shaped into cables , thin film , or thick tiles . pvdf piezoelectric film is environmentally rugged , lightweight , flexible , inherently reliable , sturdy , easily repairable and transportable with excessive assembly or disassembly . since the material is inert , it may be used inside the human body . ultraviolet radiation passes harmlessly through the pvdf film , which may be produced in varying thicknesses . in addition , the piezoelectric film is waterproof , operates between 0 and 145 degrees centigrade , and does not tear under stress . pvdf may convert a temperature reading into an electric output . the pvdf film is incorporated into a fluid - filled vinyl pad , approximately 10 cm by 10 cm in surface area . this is placed on / under / above various locations of the patient . p2m detects cardiac and respiratory motion , and monitors pulse , respiration and apnea episodes 3 . cardiac and respiratory movements are simultaneously recorded by selective filtering of original signal . the piezoelectric element 1 is a pressure — sensing detector acting as a highly sensitive strain gage providing high dynamic range and linearity . analog signals are fed through a band - pass filter into an amplifier (× 200 -× 5000 ) 5 and are visually displayed . analog acoustic signals are converted to digital values using a multi - channel converter 7 at a sampling rate of up to 5 khz . data is transformed to the frequency domain using fast fourier transform ( fft ). the system uses a microcomputer 9 for recording , analysis and presentation of data , which allows for on - line assessment of data and realtime decisions . in its simplest mode of operation pvdf piezoelectric film 1 acts as a piezoelectric strain gage . the voltage output is up to four orders of magnitude higher than that produced by a nonamplified signal from circuitry used with resistive wire . linearity and frequency response are excellent . although similarities to a strain gage exist , current need not be applied since the device is electrically self - generating . unlike the strain gage , the present invention does not produce an electric charge ad infinitum with sustained stress . the slowest frequency the polymer film detects is a thousand seconds for an electrical event to occur , and the highest is one gigahertz ( microwave ). the piezoelectric film is passive and biologically non - hazardous , as opposed to traditional strain gages that require an applied current . pvdf sheets are commercial off - the - shelf ( cots ) products , the type and specifications of which were chosen based on optimum sensitivity range and resilience . each sheet contains seven - foot attached shielded twisted - pair ( for noise rejection ) leads 11 to transmit the charge produced by the sheets . the piezoelectric sheets 1 are placed under a patient &# 39 ; s chest and foot or at similarly remote areas of the body , or may be put on like a wrapped cuff . the change in pressure exerted by the patient &# 39 ; s respiration and heartbeat causes the piezoelectric film to generate voltages , which is carried via nonmagnetic miniature coaxial cable 11 through a radio frequency filter 13 . the signal is then directed to a high input - impedance amplifier 5 and computer system 7 for data processing . a conventional oscilloscope and a chart recorder displays the output . respiration and heart rate 15 are then calculated by the energy spectrum from the time series data . several techniques reduce noise and vibration interferences . active cancellation uses two piezoelectric sensors , one of which is not in contact with the body . the sensor not attached to the body is exposed to environmentally acoustic and vibrational signals , while the sensor attached to the body is exposed to environmental as well as body signals . subtraction of one output from the other output yields the body signal of interest . another preferred technique to reduce noise involves band - pass filtering / band - stop filtering . by identifying the extraneous electronic or acoustic noise and its particular frequencies , band - pass or band - stop filtering eliminates extraneous signals from the overall signal . additionally , signal processing techniques that use a prior knowledge of the expected signals extract the desired information from the piezoelectric signal . spectral techniques help to identify the frequencies and amplitudes of the events of interest and discern them from extraneous noise . cardiac action analysis uses a bandpass frequency limit of 0 . 1 - 4 . 0 hz , and respiration analysis uses a frequency limit from 0 . 01 - 3 . 0 hz . the filtered cardiac and respiration signals are fed to a recording system . body movements are analyzed by bandpass filtering the original signal with frequency limits from 0 . 1 - 20 hz . once the signal produced by the film sensor is converted to voltages , amplified and filtered , it is processed through the p2m instrumentation . the hardware equipment includes , but is not limited to , a 586 processor computer 9 with enhanced ram and disk capacity to handle large amounts of data . a board with a range that includes acoustic frequencies facilitates data acquisition , signal conditioning and signal processing . for system operation , a master program 17 combines the three separate software modules of data acquisition / control , signal processing / analysis , and data display / user interface . the labview ™ “ g ” graphical programming language was used for all three subroutine programs . the analog voltage signal is digitized and analyzed in time and frequency domains . routines developed for signal conditioning and analysis include digital filtering , spectral analysis , auto correlation , and noise — rejection programs . the data is displayed real - time in either monitor or acquisition mode . monitor mode displays the current data and discards old readings as new updates are processed , while acquisition mode saves data for future analysis . the voluminous data must not exceed the disk - storage capacity of the computer in acquisition mode . for protection and ease of transport , the entire p2m system 19 is encased in a metal technical enclosure 21 with casters ( not shown ) and locking glass door ( not shown ), as shown in fig2 . the equipment also includes a medevac stretcher 23 on which the sensor is mounted . this device may be incorporated into a litter to eliminate the need for patient attachment or miniaturized as a portable field device in a purse with a wireless communication setup . significant field and analysis testing was conducted to confirm the workability and accuracy of the p2m system . the piezoelectric film measures mechanical , thermal and acoustic signals . that high sensitivity is necessary to measure vital signals non - intrusively . for pulse rate , the physical beating of the heart is transmitted through the body into the piezo - film sensor pad as mechanical impulses . the respiration is measured by the mechanical impulse transmitted to the sensor based on chest movements . the sensitive piezo - film sensor pad measures all extraneous movement and speech , resulting in a voltage signal output that is superimposed upon the physiological signals . as a result , movement or speech by the subject may cause a reading error . the p2m sensor measures all physical impulses in the measuring environment , including the patient &# 39 ; s physiological signals , nearby human noise and activity signals , noise and vibration from the machinery , and electromagnetic ( em ) noise emitted from the lights and instrumentation . while the output signal includes all of these signals , many are too weak to affect the measurement while others such as em noise corrupt the reading . running the signal through filters and other signal — processing algorithms removes the noise . the conditioned signal is then analyzed through routines , including a fast fourier transform ( fft ) which identifies the primary signal frequencies . for a still , speechless patient , the primary frequency is usually respiration , and the second highest frequency is heart rate . patient positioning and frequency harmonics may complicate the distinction , requiring additional logic to separate and identify the heart and respiration frequency peaks . the logic algorithms must be robust enough to define the respiration and heart peaks for a variety of conditions . to increase resolution , a large number of high sampling rate data points were selected and re - sampled at a lower rate to simplify computation for accurate analysis . the minimum sampling interval was thirty seconds . fig3 shows the results for the twenty respiration / pulse - rate measurements performed with the p2m system . human evaluator measurements were performed simultaneously as a control . p2m accurately measured pulse 25 and respiration 27 under ideal conditions , but patient movement or speech interfered with accurate measurement . heart rate measurement quality was not reduced by the absence of respiration , and p2m matched the control measurement results 29 , 31 with an error of less than beat per minute . fig4 shows the p2m front panel in acquisition mode . the upper graph 33 displays a thirty - second window of time - series measurements of all physiological signals . heartbeat spikes are shown in the upper ( time series ) graph 33 , along with a lower - frequency sinusoidal function which corresponds to the respiration signal . the lower graph 35 shows the same data in the frequency domain . the first and largest spike 37 corresponds to approximately 16 . 4 respirations per minute . the control group 31 measured 17 ± 2 respirations per minute . the large amplitude of the spike indicates that respiration is the largest impulse measured by the sensor pad . the second - largest spike 39 is sixty times per minute , which was identical to the actual heart rate measured by a fingertip - clip heart - rate monitor . the power as measured by the amplitude is less than one - third of that found in the respiration frequency , but the ratio varies based on the physiology and sensor pad positioning of the patient . the smaller spikes 41 in the lower graph represent respiration and heart - rate harmonics , a result of the harmonics not being a perfect sinusoidal function . since the heart rate might fall at exactly the same frequency as a respiration harmonic , it is necessary for logic algorithms to check for harmonics . the heart rate and respiration harmonics may be differentiated by comparing signals taken from different parts of the body . the buttons and menus 43 on the front panel of the interface program enables the control of data acquisition and analysis routines . the thirty - second data records may be saved to file for archiving or additional evaluation . fig5 shows the p2m system in monitor mode . the top graph 45 shows the time - series data , with the characteristic higher - frequency heartbeat spikes 47 superimposed over a lower — frequency respiration wave 49 . the middle graph 51 shows heart rate 53 and respiration 55 as updated every five seconds . as a new five - second data string is acquired , the oldest five seconds of data is discarded , and the heart rate and respiration are re - calculated by analyzing the thirty - second data string with the new data . the upper curve 53 is colored red to signify heart rate , while the lower curve 55 is colored blue to signify respiration . heart rate appears steady in the mid - 50s range , with respiration in the mid - teens . both compare favorably (± 2 ) with human control measurements . the anomaly 57 after 25 updates is attributable to patient movement or an extraneous and errant noise / vibration event . the bottom graph 59 shows an fft of the time - series signal . regular voltage signals of heart beat provide strength signals as voltage levels that are related to blood pressure . times between signals at varied parts of the body or patterns of secondary signals provide information on circulation or blockage or interference with blood flow . in another preferred embodiment , fig6 shows a schematic view of the p2m system with a single passive sensor 61 positioned on a patient 63 . fig7 shows one of the graphical user interfaces ( gui ) of the p2m system . the upper chart 65 shows a 30 - second window of digital voltage data , where the low - frequency oscillations are caused by respiration and the higher - frequency spikes are the result of heartbeat measurements of the patient on the litter . the time - series signal is converted to frequency data via a fourier transform and displayed as a power spectrum , shown in the middle chart 67 . from this data , pulse and respiration can be extracted by examining the power associated with the dominant frequencies 69 . in a preferred method of blood pressure measurement passive measurement of blood pressure ( systolic and diastolic ) may be conducted using pulse wave analyses . measurement and characterization of the pulse - wave velocity ( pwv ), or alternately , the pulse - wave travel time ( pwtt ), inherently requires more than one measurement location . thus , plural sensors are required for measurements in different locations . the sensors may measure pulse - wave characteristics , for example , along the brachial artery , along with other measurements described herein . fig8 shows measurement results of the pulse at two locations along the arm . the temporal separation between the two corresponding peaks 71 , 73 gives the pulse - wave travel time ( pwtt ). this value can be used to correlate systolic and diastolic blood pressure . as such , the calibration must be performed simultaneously for several measurements of pwtt and blood pressure to construct a calibration curve . barschdorff & amp ; erig showed that the relationship between blood pressures ( systolic and diastolic ) are approximately linear with pwv and pwtt . testing and evaluation of the p2m system was performed at tamc in february , 1998 . simultaneous measurements of pulse and respiration were performed with the p2m , an electronic monitor , and by human evaluation . fig9 shows a photograph of the testing performed at tamc . a total of 11 volunteers were monitored following the project &# 39 ; s testing protocol . fig1 displays the results of the testing . the p2m was over 95 % accurate as compared to conventional methods , and the several instances where the p2m was not in agreement with conventional methods proved to be very valuable in subsequent modifications and improvements to the system software . in addition , 12 volunteer nurses performed physiological monitoring of pulse and respiration using the p2m , electronic monitor , and human evaluation . following the monitoring , the nurses completed a survey comparing and ranking the usage of the three methods . testing of the p2m system for pulse and respiration in a high noise and vibration environment was performed at wheeler army air field , on mar . 5 , 1999 . tests were - performed during static display of a medevac helicopter . the main purpose of the test was to characterize the high noise / vibration environment using the p2m , microphones and accelerometers . results showed that through filtering and signal analyses , the p2m was able to discern physiological signals from the high amplitude and frequency noise caused by the helicopter to output accurately pulse and respiration . no conventional methods were performed at this test due to the high - noise environment , which would render those methods useless . fig1 shows the high noise and vibration testing of p2m at wheeler army air field , on mar . 5 , 1999 . next , in response to inquiries made by the flight medics during the mar . 5 , 1999 testing at wheeler , the ability of p2m system to accurately monitor pulse and respiration through layers of clothing and gear was tested . fragmentation protective body armor , military oriented protective posture ( mopp ) gear , and a combination of the two were tested using the p2m system . results showed that the p2m performed with higher fidelity with the additional layers between the subject and the sensor , which is largely due to the increased contact area and efficient transmission of mechanical and acoustic signals through the solid layers . the single - sensor p 2 m configuration that has been demonstrated to accurately measure pulse and respiration is very sensitive to the patient position relative to the main sensor pad . the quality and magnitude of the physiological signals received by the system depends on this positioning . the preferred optimum placement is to situate the sensor directly beneath the center of the patient &# 39 ; s chest . if the sensor is moved from this placement , or if the patient position changes , the integrity of the incoming signal also changes . thus , a preferred configuration uses multiple sensors in a pattern that covers the entire region of the litter on which the patient would lie so that regardless of patient movement and position , there will always be one or more active sensors in optimum measurement placements . in a preferred embodiment , the invention is a passive system using an array of distributed sensors ( or “ multi - sensor ”) capable of accurately and robustly monitoring certain physiological signals of the human body . these signals , in turn , may be processed for determination of vital signs that are currently used by nurses and other caregivers , for example , heart rate , respiration , and systolic / diastolic blood pressure . passive monitoring of such parameters as cardiac output , cardiac function , and internal bleeding are within the scope of this invention . the invention uniquely provides a device that is passive ( completely non - invasive ), unobtrusive , and autonomous ; i . e ., the apparatus in no way interferes either with the patient &# 39 ; s mobility or with other monitoring equipment , and is capable of functioning with a minimum of technical expertise . in addition , the equipment functions reliably in high - noise environments and other situations that render alternative and existing methods ineffective . these environments include , but are not limited to , medical evacuation ( medevac ) by helicopter or ambulance , and operation through military oriented protective posture ( mopp ) gear and body armor . with the development of a reliable multi - sensor monitoring system for such rugged and noisy operation , the application to the hospital icu environment , where noise is substantially lower , is considerably more straightforward . completely non - invasive , passive , pulse , respiration , blood pressure ( and detection of cardiac output , internal bleeding , shock , etc .) measurements using a sensor system that is undetectable to the patient have considerable intrinsic value even in noise - free surroundings . the passive and autonomous operation of such a system is suitable for telemetry and real - time remote monitoring , and the final feature of the invention is a telemetry design feature for distance and remote monitoring . fig1 shows a schematic of the p2m using a passive sensor array and microelectronics incorporated into a medevac litter . a schematic of the inventive technology , incorporated into a medevac litter , is shown in fig1 below . the litter 75 is covered in an array 77 of 32 sensors , each of which can measure acoustic and hydraulic inputs from the patient 63 . each of these signals contains a measure of physiologically generated signal and environmental noise . the environmental noise on each pad will be similar , whereas the physiologically generated signals may be position dependent . this information is used to separate the signal from the noise using proven techniques . position dependent physiological signals are used to determine patient position , heart rate , respiration , blood pressure , pulse strength distribution , and potentially some measure of cardiac output . the invention may be incorporated into a wide range of applications apart from the medevac litter . the passive sensor array may be configured without much change to operate on a hospital bed or an ordinary mattress used at home . of particular note is the area of premature infant care . in this case , the attachment of sensor leads to the infant may often be difficult , causing irritation of sensitive skin and entanglement in leads . the sensor may be incorporated into equipment for use in both civilian and military sectors . the sensor may be incorporated into field equipment , clothes and uniforms . this includes , but is not limited to , cervical collars , body armor , biological and / or chemical hazard protection suits , extraction devices , clothes , cushions on seats and seatbacks . exercise equipment , such as stationary bicycles , treadmills or steppers may benefit by incorporating sensors into the supports . physiological indicators such as heart rate may be detected through handholds as an aid to regulating the exercise regime . other useful applications might include the use of a passive sensor system in a chair or couch used for psychological examinations . scrutiny of the subject &# 39 ; s physiological signs may give indications of emotional disturbance caused by trigger words or events during counseling . the size of each sensor , number of sensors in the array , and configuration of the sensor array may be tailored , without much experimentation , to particular needs and situations . for a mattress , for example , 32 or more sensors in a rectangular array may be required . the preferred passive sensor may use piezo - electric films and ceramics , hydrophones , microphones or pressure transducers . amplification hardware may include signal amplification circuitry and hardware , e . g ., charge amplifier . data acquisition hardware and signal processing hardware ( circuitry ) and software are used in the system . for the interface between sensor and patient either solid , fluidized ( air ) or fluid layer may be used , as for example , gel , water , foam , rubber , plastic , etc . the interface facilitates transmittal of physiological signals . the invention has great medical value for field monitoring , hospital monitoring , transport monitoring , and home / remote monitoring . for example , the invention may have application in every hospital for passive monitoring of patients . the invention being undetectable to the patient , which adds comfort to the monitoring process . while the invention has been described with reference to specific embodiments , modifications and variations of the invention may be constructed without departing from the scope of the invention . | 0 |
in the drawings , like numerals indicate like elements throughout . certain terminology is used herein for convenience only and is not to be taken as a limitation on the present invention . the words “ proximal ” and “ distal ” refer to directions away from and closer to , respectively , the insertion tip of the guidewire in the guidewire assembly according to the present invention . the terminology includes the words above specifically mentioned , derivatives thereof , and words of similar import . the following describes a preferred embodiment of the invention . however , it should be understood based on this disclosure , that the invention is not limited by the preferred embodiment described herein . a catheter guidewire straightener 10 according to an embodiment of the present invention is shown in fig1 - 3 . the guidewire straightener 10 is comprised of a generally frusto - conically shaped distal end 12 and a generally cylindrically shaped proximal end 14 . a stop collar 16 is disposed between the distal end 12 and the proximal end 14 . a straightener passageway 18 extends through the guidewire straightener 10 between the distal end 12 and the proximal end 14 . the straightener passageway 18 is sized to allow a guidewire 52 , shown in a guidewire assembly 50 in fig4 , to pass through the straightener passageway 18 with little or no interference . a standard guidewire has a diameter of approximately 0 . 038 inches ( approximately 0 . 97 mm ), and the straightener passageway 18 has a diameter of approximately 0 . 05 inches ( approximately 1 . 27 mm ). therefore , when the guidewire 52 is inserted into the straightener passageway 18 , a clearance of approximately 0 . 012 inches ( approximately 0 . 30 mm ) is provided between the guidewire 52 and the guidewire straightener 10 . referring back to fig1 - 3 , the proximal end 14 of the straightener 10 includes first and second diametrically opposed biasing assemblies 20 , 22 , which are each comprised of a lug 24 disposed on a biasing member 26 , such as a leaf spring . a distance between free ends of each lug 24 on the biasing assemblies 20 , 22 , as shown in fig2 , is defined as a diameter “ d ”. each biasing assembly 20 , 22 , extends longitudinally along the proximal end 14 of the straightener 10 , with channels 28 , 30 disposed on either side of the biasing assemblies 20 , 22 . the channels 28 , 30 allow the lugs 24 and the biasing members 26 to deflect toward the straightener passageway 18 when force is applied on the lugs 24 toward the straightener passageway 18 . the biasing members 26 resist such force and bias the lugs 24 away from the straightener passageway 18 . preferably , the guidewire straightener 10 is constructed from a polymer , such as polypropylene , although those skilled in the art will recognize that other , suitable materials may be used . a guidewire assembly 50 incorporating the guidewire straightener 10 of the present invention is shown in fig4 and 5 . the guidewire assembly 50 is comprised of a guidewire 52 disposed within a tube passageway 54 of a guidewire tube 56 . the guidewire 52 has a “ j - shaped ” distal end 53 . the tube passageway 54 has an inner diameter “ d ”. the guidewire tube 56 is connected to the proximal end 14 of the guidewire straightener 10 . the guidewire tube 56 is preferably coiled as shown for the ease of the user . the guidewire 52 is typically approximately 24 inches ( 61 cm ) long and , by coiling the guidewire 52 along with the guidewire tube 56 , the user can more readily handle the guidewire 52 and advance the guidewire 52 into the patient . the guidewire tube 56 includes an open distal end 58 , through which the guidewire 52 is advanced , the distal end 58 having a collar with an inner diameter larger than tube passageway diameter “ d ”. the distal end 58 of the guidewire tube 56 is inserted over the proximal end 14 of the guidewire straightener 10 , so that the distal end 58 of the guidewire tube 56 and the proximal end of the guidewire straightener 10 engage each other with a press fit . the diameter “ d ” of the lugs 24 is larger than the diameter “ d ” of the tube passageway 54 so that , as is seen in fig5 , the distal end collar of guidewire tube 56 biases the lugs 24 and the biasing members 26 into the straightener passageway 18 . each lug 24 biases its respective biasing member 26 against the guidewire 52 so that the guidewire 52 is longitudinally engaged along a length of the guidewire 52 by the biasing members 26 . the biasing members 26 , in turn , bias the lugs 24 against the tube &# 39 ; s collar to releasably retain the straightener 10 in the tube 56 . referring now to the guidewire insertion procedure of fig6 during a catheter insertion procedure , an incision 110 is initially made near an insertion site 112 which is to be aspirated with a syringe or other introducer apparatus near or proximate the area to be catheterized . if the catheter is used for hemodialysis and the area to be catheterized is the internal jugular vein 116 , the incision 110 is made in the clavicular triangle region , as shown for example , in fig6 . the exact location of the incision 110 can be varied by the physician . in accordance with the seldinger technique , a narrow needle 114 connected to the syringe is inserted through the incision 110 and into the vein 116 , and the vein 116 is aspirated . the syringe is disconnected from the needle 114 , leaving the needle 114 in the vein 116 . the guidewire 52 is next inserted into the vein 116 through the needle 114 . to insert the guidewire 52 into the vein 116 , the proximal end 14 of the straightener 10 is removed from the tube 56 . the biasing members 26 bias away from the straightener passageway 18 , releasing the guidewire 52 from between the biasing members 26 . the distal end 53 ( see fig4 and 5 ) of the guidewire 52 is then retracted into the straightener 10 so that the “ j - shaped ” distal end 53 of the guidewire 52 is disposed within the straightener 10 . the distal end 12 of the straightener 10 is then inserted into the proximal end of the needle 114 . the preferably frusto - conical shape of the distal end 12 facilitates insertion of the distal end 12 into the needle 114 . using thumb 118 and forefinger 120 on the guidewire 52 between the straightener 10 and the tube 56 , the physician advances the guidewire 52 through the needle 114 and into the vein 116 . once the guidewire 52 is in place , the tube 56 and the straightener 10 are removed by advancing each of the tube 56 and the straightener 10 along the guidewire 52 away from the distal end 53 of the guidewire 52 and then off the proximal end of the guidewire 52 . next , the needle 114 is removed by advancing the needle 114 along the guidewire 52 away from the distal end 53 of the guidewire 52 and then off the proximal end of the guidewire 52 . a dilator ( not shown ) and a tearable sheath ( not shown ) are introduced over the guidewire 52 and partially into the vein 116 . the insertion site 112 is now ready to accept a catheter assembly ( not shown ). at least one catheter lumen is disposed over the proximal end of the guidewire 52 and advanced toward the distal end 53 of the guidewire 52 and into the vein . an alternate embodiment of a guidewire straightener assembly 200 is shown in fig7 . the assembly 200 includes a straightener 210 and a guidewire tube 250 . the straightener 210 is partially disposed in the tube 250 and is used to assist the inserting physician in advancing a guidewire 202 from the tube 250 during catheter insertion . referring to fig8 , the straightener 210 includes a distal end 212 that is generally conically or frusto - conically shaped . the distal end 212 is shaped to facilitate insertion of the distal end 212 into an introducer device , such as an introducer needle ( not shown ). the straightener 210 also includes a proximal end 214 that includes a biasing member 216 . a longitudinal axis 217 extends through the straightener 210 . a straightener passageway 218 extends along the longitudinal axis 217 through the straightener 210 between the distal end 212 and the proximal end 214 . the passageway 218 has a diameter d 1 that is sized to allow the guidewire 202 to be able to be translated therethrough with a minimal force during insertion of the guidewire 202 into the patient . the biasing member 216 includes a plurality of fingers 220 that extend in a proximal direction . while eight fingers 220 are shown in fig9 , those skilled in the art will recognize that more or less than eight fingers 220 may be used . each finger 220 has a connected end 222 that is connected to the proximal end 214 and a free end 224 that freely extends away from the proximal end 214 . each finger 220 has a body portion 226 between the connected end 222 and the free end 224 that is biased away from the longitudinal axis 217 . the biasing member 216 is dimensioned such that , when the biasing member 216 is disposed within the guidewire tube 250 , the interior wall of the guidewire tube 250 biases the biasing member 216 against the guidewire 202 . the guidewire advancer 210 also includes a generally elongated portion 230 that extends between the distal end 212 and the proximal end 214 . the generally elongated portion 230 extends below the guidewire 202 and is open so that the guidewire 202 is accessible . a generally convex raised portion 232 extends from the generally elongated portion 230 and provides a thumb rest for advancing the guidewire 202 distally through the advancer 210 . the guidewire tube 250 includes a distal end 252 that engages the straightener 210 . the guidewire tube 250 has an inner diameter d 2 that is sized to allow the proximal end 214 of the straightener 210 to be inserted into the guidewire tube 250 . the guidewire tube 250 also has an outer diameter d 3 . a cylindrical collar 260 is fixedly connected to the distal end 252 of the tube 250 . the collar 260 is preferably constructed from a polymer , such as polypropylene , or some other suitable material . those skilled in the art will recognize that the collar 260 may be a separate piece from the tube 250 , or the collar 260 may be integrally formed with the tube 250 . if the collar 260 is a separate piece from the tube 250 , the collar 260 is fixedly connected to the tube 250 by known methods , such as by an adhesive , by ultrasonic welding , or other means known in the art for connecting the collar 260 to the tube 250 . the collar 260 includes a proximal collar end 262 that fits over the exterior of the distal end 252 of the tube 250 , seen best in fig8 . the collar 260 also includes a distal collar end 264 , and expands distally from the tube distal end to define a generally enclosed chamber that has an inner diameter d 4 that is larger than the outer diameter d 3 of the tube 250 . the distal collar end 264 includes an opening 265 along the longitudinal axis 217 that is sized to allow the proximal end 214 of the straightener 210 to be inserted into the opening 265 . the inner diameter d 4 of the distal collar end 264 is sufficiently large to allow the biasing member 216 to expand within the interior of the distal collar end 264 to allow the biasing member 216 to expand and release the guidewire 202 . however , it is preferred that the distal opening 265 is sufficiently small such that the biasing member 216 cannot be easily pulled through the distal opening 265 and out of the collar 260 . the collar 260 also includes a tapered portion 266 that tapers from the proximal collar end 262 , outward to the distal collar end 264 . preferably , the tapered portion 266 begins at the distal end 252 of the tube 250 , although those skilled in the art will recognize that the tapered portion 266 may begin either proximally or distally of the distal end 252 of the tube 250 . the assembly 200 is provided with the straightener 210 fully inserted into the tube 250 , as shown in fig7 and 8 . in use , the straightener 210 is partially removed from the tube 250 by advancing the straightener 210 in a distal direction relative to the tube 250 . the biasing means 216 moves distally from the interior of the tube 250 to the interior of the collar 260 to the position shown in fig1 . when the plurality of fingers 220 enter the interior of the collar 260 , the fingers 220 spring away from the guidewire 202 , allowing the guidewire 202 to be freely advanced from the distal end 212 of the straightener 210 according to known methods . the straightener 210 , however , is not sufficiently moved relative to the tube 250 so as to pull the proximal end 214 of the straightener 210 through the distal opening 265 of the collar 260 . after the guidewire 202 is inserted a desired distance into the patient , the guidewire straightener assembly 200 is removed from the guidewire 202 by sliding the assembly 200 proximally along the guidewire 202 until the guidewire 202 exits the assembly 200 . the assembly 200 is discarded and the catheter insertion procedure continues according to steps and processes well known in the art . while the guidewire assembly 200 with the collar 260 fixed to the distal end 252 of the tube 250 is preferred , those skilled in the art will recognize that a guidewire assembly 300 , shown in fig1 , that omits the collar may be used . the straightener 210 is inserted into the tube 250 as shown in fig1 , with the fingers 220 biased against the guidewire 202 . in use , the straightener 210 is advanced distally with respect to the tube 250 until the proximal end 214 of the straightener 210 is removed from the tube , as show in fig1 . the fingers 220 spring away from the guidewire 202 , allowing the guidewire 202 to be freely advanced from the distal end 212 of the straightener 210 . the user biases the guidewire 202 against the generally convex raised portion 232 and advances his / her thumb in a distal direction , using friction to distally advance the guidewire 202 as well . after the guidewire 202 is inserted a desired distance into the patient , the guidewire straightener assembly 300 is removed from the guidewire 202 by sliding the assembly 300 proximally along the guidewire 202 until the guidewire 202 exits the assembly 200 . the assembly 300 is discarded and the catheter insertion procedure continues according to steps and processes well known in the art . yet another embodiment of the present invention is shown in fig1 and 14 . a guidewire straightener assembly 400 includes a guidewire straightener 410 and a guidewire tube 450 that are used to retain and dispense a guidewire 402 . a swivel lock assembly 460 releasably connects the straightener 410 and the tube 450 to each other . the straightener 410 includes a distal end 412 that is generally conically or frusto - conically shaped . the distal end 412 is shaped to facilitate insertion of the distal end 412 into an introducer device , such as an introducer needle ( not shown ). the straightener 410 also includes a proximal end 414 that includes a biasing member 416 . a longitudinal axis 417 extends through the straightener 410 . a straightener passageway 418 extends along the longitudinal axis 417 through the straightener 410 between the distal end 412 and the proximal end 414 . the passageway 418 has a diameter d 1 that is sized to allow the guidewire 402 to be able to be translated therethrough with a minimal force during insertion of the guidewire 402 into the patient . the biasing member 416 includes a plurality of fingers 420 that extend in a proximal direction . similar to the biasing member 216 described above and shown in fig9 , the biasing member 416 preferably includes six fingers 420 . while six fingers 420 are preferred , those skilled in the art will recognize that more or less than six fingers 420 may be used . each finger 420 has a proximal end 422 that is connected to the proximal end 414 and a distal end 424 that extends away from the proximal end 414 . each finger 420 has a body portion 426 between the proximal end 422 and the distal end 424 that is biased away from the longitudinal axis 417 . the biasing member 416 is dimensioned such that , when the biasing member 416 is disposed within the guidewire tube 450 , the interior wall of the guidewire tube 450 biases the biasing member 416 against the guidewire 402 , restricting the movement of the guidewire 402 within the tube 450 . the straightener 410 includes an annular groove 430 disposed between the distal end 412 and the proximal end 414 . the groove 430 is sized and shaped to allow the distal end of the swivel lock assembly 460 to be rotatably attached to the straightener 410 , as will be described more in detail later herein . the guidewire tube 450 includes a distal end 452 that engages the straightener 410 . the guidewire tube 450 has an inner diameter d 2 that is sized to allow the proximal end 414 of the straightener 410 to be inserted into the guidewire tube 450 . the guidewire tube 450 also has an outer diameter d 3 . the swivel lock assembly 460 includes a cylindrical collar 462 that is fixedly connected to the distal end 452 of the tube 450 and a swivel lock 470 that is rotatably connected to the straightener 410 . the collar 462 is preferably constructed from a polymer , such as polypropylene , or some other suitable material . those skilled in the art will recognize that the collar 462 may be a separate piece from the tube 450 , or the collar 462 may be integrally formed with the tube 450 . if the collar is a separate piece from the tube 450 , the collar 462 is fixedly connected to the tube 450 by known methods , such as by an adhesive , by ultrasonic welding , or other means known in the art for connecting the collar 462 to the tube 450 . preferably , the collar 462 includes a stop 461 that limits the distance that the collar 462 may be advanced over the distal end 452 of the tube 450 . the collar 462 includes a distal collar end 464 that includes male threads 466 . the swivel lock 470 includes female threads 472 that threadingly engage with the male threads 466 . a distal end of the swivel lock 470 includes a lip 474 that rotates within the groove 430 in the straightener 410 to allow the swivel lock 470 to rotate about the longitudinal axis 417 with respect to the straightener 410 . the assembly 400 is provided with the straightener 410 fully inserted into the tube 450 and the swivel lock 470 connected to the collar 462 , as shown in fig1 . in use , the straightener 410 is removed from the tube 450 by rotating the swivel lock 470 relative to the collar 462 and unthreading the female threads 472 from the male threads 466 . when the swivel lock 470 is unthreaded from the collar 462 , the straightener 410 is advanced in a distal direction relative to the tube 450 . the biasing means 416 moves distally from the interior of the tube 450 to the position shown in fig1 . when the plurality of fingers 420 exits the distal end 452 of the tube 450 , the fingers 420 spring away from the guidewire 402 , allowing the guidewire 402 to be freely advanced from the distal end 412 of the straightener 410 according to known methods . after the guidewire 402 is inserted a desired distance into the patient , the guidewire straightener assembly 400 is removed from the guidewire 402 by sliding the assembly 400 proximally along the guidewire 402 until the guidewire 402 exits the assembly 400 . the assembly 400 is discarded and the catheter insertion procedure continues according to steps and processes well known in the art . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof . it is understood , therefore , that this invention is not limited to the particular embodiments disclosed , but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims . | 0 |
with reference to fig1 the packaging grid includes a plurality of belt type receiving conveyors 10 which extend longitudinally . in the illustrated embodiment , six receiving conveyors 10a , 10b , 10c , 10d , 10e and 10f are provided , although it is to be appreciated that the number of receiving conveyors , generalized as n receiving conveyors , may be greater or lesser depending on the desired production capacity and rate . additional receiving conveyors may be added to accomodate higher speed printing presses at other associated equipment . each of the receiving conveyors defines a plurality of packaging receiving areas such as exemplarly package receiving area 12 bounded on either end by verticle partitions 14 and 16 . a plurality of gripping conveyors 20 each having an out and return run are disposed above the receiving conveyors and extend transversely thereacross . the plurality of gripping conveyors includes n gripping conveyors , ten in the illustrated embodiment , 20a , 20b , 20c , 20d , 20e , 20f , 20g , 20h , 20i and 20j . a plurality of sources of printed products 22a , 22b , 22c , 22d , 22e , 22f , 22g , 22h , 22i , and 22j each supply printed products to at least one of the gripping conveyors . each of the gripping conveyors includes a plurality of individual grippers which circulate around the two ceiling mounted runs past an associated one of the printed product sources and above the plurality of receiving conveyors for selectively dropping the gripped printed products thereon . the individual grippers in either of the two runs can be actuated to drop a selected printed products into a selected package receiving area . this provides two opportunities for a printed product to be delivered to each package receiving area . the receiving conveyors are elevated to be closely adjacent the ceiling mounted gripper conveyors to minimize the drop distance and to keep the floor space open . further , the gripping conveyors , in the preferred embodiment , move more rapidly than the belt conveyors , thus causing a plurality of individual grippers in each of the two runs to cross each package receiving area . this further increases the opportunity for supplying each package receiving area with a selected printed product . with reference to fig2 and 3 , a suitable gripping conveyor includes a plurality of individual grippers 30 . each individual gripper has a body portion 32 on which a plurality of pairs of wheels or rollers 34 , 36 , and 38 are rotatably mounted . in the preferred embodiment , the three roller pairs are disposed to engage surfaces which are disposed at about 120 ° relative to each other such that the individual grippers can be maintained stable in a plurality of orientations . extending outward from the housing portion is a stationary gripping structure 40 which is adapted to be engaged by a moving gripping structure 42 . the moving gripper structure is pivotably mounted on a pair of pins 44 and 46 . a pair of followers or rollers 48 and 50 are adapted to engage a cam surface to cam the movable gripping member away from the stationary gripping member to release materials gripped therebetween . a biasing means such as a pair of springs 52 and 54 bias the stationary and movable grippers toward the closed position . the individual grippers are rollingly mounted on a gripper supporting structure . the gripper supporting structure includes a central supporting member 60 on which a u - shaped member having three roller engaging surfaces 62 , 64 , and 68 is mounted . because the roller engaging surfaces are mounted at 120 relative to each other , the channel can be twisted about its longitudinal axis up to a full rotation while still supporting the individual grippers . the supporting member 60 also supports a plurality of movable camming surfaces 68 and 70 which selectively engage the cam followers 48 and 50 to open the gripping members 40 and 42 . actuating means such as solenoids 72 and 74 selectively raise and lower the camming surfaces . the camming surface raising and lowering means are disposed at points along the supporting member 60 at which the individual grippers are to be selectively opened and closed . these positions include the crossing points of the out and return runs of the gripper conveyors and each of the receiving conveyors 10 and at the preferred product sources 22 . a newspaper feeding means 80 is disposed at the upstream end of the receiving conveyors 10 for feeding a newspaper into each of the package receiving areas of some or all of the receiving conveyors . when advertising packages are to be assembled only for newspaper subscribers , newspapers are supplied to all of the conveyors . when advertising packages are to be supplied to both subscribers and nonsubscribers , the newspapers are supplied to the same proportion of receiving conveyors as the proportion of subscribers to nonsubscribers . the newspaper feeding means includes a first feeding station 82 which receives newspapers from a high speed press and supplies them a feed dividing means 84 which divides the flow of newspapers among the receiving conveyors . a second newspaper feeding station 86 supplies a second flow of newspapers or newspaper sections from a high speed press to a second feed dividing means 88 for dividing the second flow of newspapers among the plurality of belt conveyors . the first and second feeding stations may each supply one or two sections of a common newspaper to each belt conveyor or may supply different newspapers to some of the belt conveyors . for example , one feed station may feed a large regional newspaper and the other feed station may feed a local newspaper , a national speciality paper such as the wall street journal , or the like . with particular reference to fig4 an exemplary newspaper feeder is illustrated in greater detail . a conveying means 90 conveys lopped newspapers from a high speed press to the newspaper feeder . a conveyor and up - ender 92 moves the newspapers from the conveyor 90 to a transfer table 94 . the papers are moved along the transfer table 94 at a speed which is coordinated with a newspaper feeding , gripper conveyor 96 , such that one newspaper is provided by the transfer table to each gripping pocket . the newspaper feeding conveyor 96 is a gripping type conveyor having a plurality of individual gripping units of the construction discussed above in conjunction with fig2 and 3 . gripper releasing means are disposed along the newspaper feed conveyor 96 at its intersection with each of the receiving conveyors for selectively releasing a newspaper into each package receiving area . although the first and second feed stations 82 and 86 in fig1 are illustrated as receiving separate supplies of newspapers , a single supply of newspapers may be split between a pair of conveyors and up - enders each of which supplies up - ended newspapers to a transfer table , one supplying the first newspaper feeding conveyor and the other supplying a second newspaper feeding conveyor . optionally , a counter - stacker 98 may be provided to receive newspapers when newspapers are being received from the printing presses faster than they are being conveyed to the belt conveyors 10 . optionally , newspapers may be conveyed from the press to a transfer table with various types of conveyors including the gripping conveyors illustrated in fig2 and 3 . with reference again to fig1 a plurality 100 of n reject stations 100a , 100b , 100c , 100d , 100e , and 100f are disposed downstream from the gripping conveyors for rejecting incomplete printed product packages . optionally , the rejected printed product packages may be conveyed to a sorter and returned to the appropriate printed product source . a wrapping means 110 including a plurality of n wrapping stations 110a , 110b , 100c , 100d , 100e , and 100f are disposed downstream from the reject station . in the preferred embodiment , each of the wrapping station includes a polyethylene or other clear plastic wrapping device for wrapping each package of printed products or printed products and newspaper ( s ) in a clear waterproof packaging . a labeling means 120 including a plurality of n labeling machines 120a , 120b , 120c , 120d , 120e , and 120f are also disposed downstream from the reject means 100 . the labeling machines label each printed product package with the name and address or other designation of the homeowner or customer for whom the printed products in the package have been collected . the labeling means may be disposed upstream or downstream from the wrapping means such that the labels are applied to the exterior of the wrapper or covered by the clear plastic wrapper for moisture protection . the wrapped and labeled packages are delivered to a plurality 130 of n pick - up stations 130a , 130b , 130c , 130d , 130e , and 130f located downstream from the wrapping and labeling machines . a sorting conveyor means 140 is disposed downsteam from the wrapping and labeling means . the sorting conveyor means includes a plurality of individual grippers , as illustrated in fig2 and 3 , for picking up the wrapped and labeled packages from the pick - up stations 13a . the sorting conveyor conveys each package to the appropriate one or a plurality 150 of piling units 150a , 150b , 150c , and 150d . each piling unit ties the packages into route sequenced piles or bundles which are destined for a common route and geographic distribution region . the piles are conveyed from the piling units to a plurality 160 of truck loading means 160a , 160b , 160c , and 160d to be loaded directly into trucks for delivery to the appropriate routes or geographic regions . optionally , the sorting conveyor means 140 may include a plurality of conveyors to handle the number and rate at which packages become available at the pick up stations 130 . with reference to fig5 an electrical control means controls the gripping conveyors , particularly the individual grippers of the gripping conveyors to release selected printed products to fall by gravity into selected receiving conveyor package receiving areas . the control means is connected with a receiving conveyor monitor means 180 for monitoring the position of the receiving conveyors 10 . in the preferred embodiment , the receiving conveyor monitor means monitors the position of the package receiving areas by monitoring the speed of the n receiving conveyors . a gripping conveyor monitor means 182 supplies the control means with an indication of the position of each of the n gripping conveyors 20 . in the preferred embodiment , the gripping conveying monitoring means monitors the speed of the gripping conveyors . a sorting conveyor monitor means 184 monitors the position of the individual grippers of the sorting conveyor means 140 to coordinate the pick up of wrapped and labeled packages at the pick up stations 130 and the delivery of the packages to the piling units 150 . a suitable structure for each of the receiving conveyor monitor means , the gripping conveyor monitor means , and the sorting conveyor monitor means includes a reed switch 190 and a moving magnet . the magnet 192 is mounted on a wheel 194 which is geared to the associated conveyor to rotate one revolution with the passage of each package receiving area or individual gripper unit . the reed switch is positioned adjacent the wheel to produce a pulse each time a package receiving area or individual gripper unit are in a selected position . various other well known monitoring devices can be advantageously employed . the control means includes a data entry and retrieving terminal 200 for entering additional data and information and retrieving stored information . a main customer list memory means 202 stores customer or household information for each customer or household in the service area . in the preferred embodiment , the main customer list memory stores the name and address of each customer in order by address and demographic information in the form of yes or no responses to preselected demographic questions listed in a fixed order . in this manner , only the answers need to stored . the demographic data includes such information as number of children in the household , age of the adults , income range , and the like . an advertisor / product memory means 204 is loaded with demographic information or characteristics of the group of customers to which each printed product is to be directed . that is , a designation of each printed product is stored followed by the answers to the preselected demographic questions which mark the customers to receive the printed product . a customer to advertisor matching program 206 compares the demographic information on each customer from the main customer memory means with the demographic characteristics to which each printed product is directed from the advertiser / product memory means . based on the customer to advertisor matching , a distribution memory means 208 is loaded with the name and address of each customer or household which is to receive one or more of the printed products and which printed products each customer or household is to receive . in the preferred embodiment , the distribution memory means stores the customer &# 39 ; s name and address for controlling the labeling machine and an insert data string including a series of &# 34 ; 1 &# 34 ; s or &# 34 ; 0 &# 34 ; s in a preselected order to indicate whether or not each of the printed products is to be given to the customer . the receiving conveyor monitor 180 is connected with the distribution memory means 208 to index the distribution memory means synchronously with the movement of the package receiving areas to assign one of the customers or households to each package receiving area . each time the receiving conveyor monitor indexes the distribution memory means , the assigned customer data including the customer name , address , and the insert data string are loaded into a temporary customer memory means 210 . in the preferred embodiment , the temporary customer memory means includes n temporary customer memories each of which have n + 1 columns . in this manner , each of the temporary customer memories corresponds to one of n receiving conveyors . each time the corresponding receiving conveyor moves a distance corresponding to the spacing between gripping conveyors , the receiving conveyor monitor means steps the temporary customer memory to shift the stored data by one column and reload the first column with another set of customer information . in this manner , the insert data string in the first column carries customer information concerning the package receiving area which is under or approaching the first gripping conveyor ; the customer data in the second column is assigned to the package receiving area approaching the second gripping conveyor , and so forth . the ( n + 1 ) st column is reserved for error checking and is discussed in detail below . a coincidence means 220 is connected with the receiving conveyor monitor means 180 and the gripping conveyor monitor means 182 to determine when an individual gripper on the gripping conveyor is in coincidence with a package receiving area of one of the receiving conveyors . the term &# 34 ; coincidence &# 34 ; designates that the individual gripper and the package receiving area are in appropriate relative positions such that releasing the individual gripper will drop the conveyed printed product into the package receiving area . in the preferred embodiment , the coincidence means 220 includes an array of n ×( 2n + 2 ) coincidence detectors or other determining means . each coincidence means determines coincidence between the package receiving area on one of the receiving conveyors with the individual grippers on the outward and return runs of the n gripping conveyors . the other 2n coincidence detectors detect coincidence between the package receiving area of each of the n receiving conveyors with the n reject means and the n labeling machines . an individual gripper release control means 230 is connected with the temporary customer memory means 210 and the coincidence means 220 by a series of and gates 232 . more specifically , the individual gripper release control means includes n × 2n individual gripper release control mechanisms . a first of the individual gripper release control mechanisms is located on a first or upstream run of the first gripper conveyor 20a directly over the first receiving conveyor 10a ; a second of the individual gripper release control mechanisms is located on a second or downstream run of the first gripper conveyor 20a directly over the first receiving conveyor 10a ; annd so on for each of the n × 2n crossing points of the outward and return runs of the gripping conveyors and the receiving conveyors . the first individual gripper release control mechanism is connected by a first and gate with the temporary customer memory means 210 , specifically the first demographic data position of the first column of the first temporary customer memory means , and with the coincidence means , specifically a first coincidence detector for detecting coincidence between the first receiving conveyor 10a and the first run of the first gripping conveyor 20a . if there is a &# 34 ; 1 &# 34 ; in the first data position of the first column of the temporary customer memory means , a &# 34 ; 1 &# 34 ; is supplied to the first and gate . when an individual gripper on the first gripping conveyor , first run and a first receiving conveyor package receiving area come into coincidence , the first coincidence means also supplies a &# 34 ; 1 &# 34 ; to the first and gate . upon receiving two &# 34 ; 1 &# 34 ; s the first and gate causes the first individual gripper release control mechanism to release the carried printed product . a release monitor 234 , including an n × 2n array of monitors , monitors whether or not a printed product was in fact released . if the printed product was released , the release monitor means 234 clears the &# 34 ; 1 &# 34 ; bit from the corresponding position and column in the temporary customer storage memory means to indicate that the selected printed product has been delivered . if the release monitor fails to detect an actual release of the printed product , the coincidence detector will again produce a &# 34 ; 1 &# 34 ; when the next individual gripper comes into coincidence causing the individual gripper release control mechanism to release another individual gripper . if none of the grippers in the first run of the first gripping conveyor actually releases a printed product , the coincidence means detects coincidence of the first gripping conveyor second run and first receiving conveyor . when the temporary customer storage memory means and the coincidence means both supply &# 34 ; 1 &# 34 ; s to a second and gate which actuates an individual gripper release control mechanism at the crossing point of the first gripping conveyor second run and the first receiving conveyor is actuated . the release of printed products from the outward and return runs of the other gripping conveyors onto the other receiving conveyors is done analogously . after the customer information data has moved to the ( n + 1 ) st column , all the selected printed products should have been released onto the assigned package receiving area . a reject control means 240 adds up the &# 34 ; 1 &# 34 ; s in the ( n + 1 ) st column . if all the selected printed products have been released , the string of printed product data bits should all have been cleared to &# 34 ; 0 &# 34 ; s by the release monitor means 234 . if the sum of these bits is non - zero , the reject control means 240 causes the full set of customer data to be reloaded in the first column of the temporary customer memory means and causes a reject station control means 242 to reject the incomplete package when the coincidence detector array 220 determines that the incomplete package has reached the reject station . if the printed product data in the ( n + 1 ) st column sums to zero , the customer name and address portion is conveyed to a corresponding label control means 250 which causes the corresponding labeling machine to print a label with the customers name and address . when the coincidence detector means 220 detects coincidence between the package receiving area and the labeling machine , the label controling 250 causes the labeling machine to apply the label to the corresponding package . in this manner , each package contains the printed products selected specifically for the customer to whom it is labeled and addressed based on demographic information about that customer . the control means further includes a geographic memory means 260 which stores geographic information on the geographic area over which the packages are to be delivered , such as route information . alternately , a delivery route determining program 262 may determine the most efficient routes for delivering each specific group of packages based on the specific customers or households which are to receive packages as determined by the customer to advertiser matching means 206 and geographic information from geographic memory means 260 . the customer address from the temporary customer memory means 210 and the route information from the geographic memory means 260 or the delivery route determining program 262 are received by an address to route matching program means 264 . the address to route matching program 264 compares each customer &# 39 ; s street and street number with the street and street numbers assigned to each of the delivery routes and sends out a destination code which indicates which of the delivery routes , hence to which piling unit 150 the completed package is to be delivered . optionally , the delivery route program can rearrange the customer names in the main customer list memory such that the customer names are retrieved in sequential order within each route . the sort conveyor monitor means 184 is connected with a pick up station coincidence detector means 270 which detects coincidence between individual grippers on the sorting conveyor 140 and each of the pick up stations 130 . an empty gripper means 272 determines whether or not the sort conveyor gripper in coincidence with each pick up station is empty . a pick up command means 274 causes the individual empty gripper which is coincident with the pick up station to pick up the labeled package . simultaneously with picking up the labeled package , the pick up command means 274 operates a gate means 276 which causes the destination code from the address to route matching means 264 to be loaded into a memory pixel which is assigned to the specific individual gripper which picked up the labeled package in a sort memory means 278 . in this manner , the destination code for each package is stored in the sort memory means in an order corresponding to the order of the individual grippers in the sorting conveyor . a piling unit coincidence detecting means 280 is connected with the sort conveyor monitor to determine which of the sort conveyor individual grippers is in coincidence with each of the piling units . each time a new individual gripper comes into coincidence with one of the piling units , a corresponding pointer or cyclic counter means 282 addresses the memory pixel in the sort memory means 278 corresponding to the next individual gripper along the sorting conveyor . a comparing means 284 compares the destination code stored in the memory pixel addressed by the corresponding pointer with the destination code for its associated piling unit . if the comparing means determines that the destination codes match , it operates a corresponding release control means 286 to cause the package to be dropped into that piling unit . if the comparing means determines that the destination codes do not match , the individual gripper continues on and upon becoming coincident with the next piling unit repeats the comparing step . in this manner , the sort memory means 278 circulates the destination code of the package carried in each of the sort conveyor grippers in order . comparing means for each of the piling units compare the each circulating destination code with the destination code of an associated piling unit to determine when each package is to be released . in the preferred embodiment , the control means of fig5 is embodied in a digital computer programmed to carry out each of the above - described functions or their equivalents . the invention has been described with reference to the preferred embodiment . obviously , modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof . | 1 |
fig1 is a block diagram showing a system for a floppy disk duplication apparatus used in an embodiment of the present invention . in fig1 data in one track on a floppy disk 2 , which is a transfer - dispatcher , is read out by a read - out means 3 , comprised of a magnetic head , a driving circuit driving the head , and a shaping circuit . the read out data is memorized ( stored ) in a memory means 7 . the data stored in memory 7 is judged by a judging means 5 of a control section 4 . the control section 4 comprised of a microprocessor which performs judging described later in accordance with a control program which is written in control section memory 6 . the above - mentioned data in one track is re - memorized through the read - out means into the memory means 7 . the data in the memory means 7 is sent to an unwritable bit - pattern replacing circuit 8 , and is written in on a floppy disk 10 at the transfer - destination by a write - in means 9 ( comprised of a magnetic head , a driving circuit driving the head , and a shaping circuit ). the contents of the control operation of the control section 4 is explained according to the flow chart of fig2 . first , all the data of the n - th track on the floppy disk is input ( step 1 ). then , this data is memorized in the memory means ( step 2 ) and gaps on the memorized data are judged ( step 3 ). a gap is defined as a part in one data track wherein no useful data is recorded and certain particular codes are packed , for example , on a double density floppy disk , gaps are those parts where one or a number of bits of code words having a bit pattern representing the hexadecimal number 4e is packed . then after placing the above - mentioned gap thus detected at the head of the record , the data mentioned above is read out again by the read - out means and is memorized or stored , again in a memory means ( step 4 ). since the data in the gap has no particular meaning , even if bit - shift occurs , an inconvenient error effect does not take place . thus for the purpose of placing the write - succession point at the gap , one of data in the above - mentioned gap is replaced with an unwritable bit - pattern ( in the fdc , replacing with an unwritable bit - pattern such as 1000100100001 ) ( step 5 ). by placing the gap at the head of the data record , the data is written in on the floppy disc 10 at the transfer - destination by the write - in means 9 ( comprised of a magnetic head , a driving circuit driving the head , and a shaping circuit ) ( step 6 ). the steps from step 1 to step 6 are repeated until the transfer of all the data on tracks of a transfer object is finished ( step 7 ). in the above - mentioned embodiment , explanation has been given of an example in which the data is input into the write - in means 9 from the memory means 7 directly through the unwritable bit - pattern replacing circuit 8 . this example corresponds to an apparatus such as a floppy disk duplication apparatus . in fig3 another embodiment is shown . in the embodiment of fig3 next to the memory means 7 , a serial interface 11 and a communication device 12 are provided . for example , in a telephone line , data is dispatched first through a modem and transmitted through a public telephone traffic network and is conveyed to a distant transfer apparatus 13 . thus , the data is received through a communication device 12 and a serial interface 11 of the transfer apparatus 13 on the receiver side and then is input through an unwritable bit - pattern write - in circuit 8 into a write - in means 7 . then the data written in the write - in means 7 is written into a floppy disk at the transfer - destination . the above - mentioned apparatus is a floppy disk duplication means at a remote location . that is , it may be called as a floppy disk data transfer apparatus . in the above - described embodiment , examples of only a floppy disk duplication method in accordance with which the present invention is used has been described . in fig4 however , another embodiment is shown , in the embodiment of fig4 an fdc ( floppy disk controller ) circuit change over circuit 21 is provided just after the read - out means 3 . in this embodiment , data is first treated by a conventional fdc circuit 22 . the data is such that it can by processed by the fdc circuit 22 . data is written in the write - in means 9 without performing any additional process , and transferred to a floppy disk 10 of the transfer - destination . in case that the data is not of the type that can be processed by the fdc circuit 22 , the circuit connection is changed over by the fdc circuit change over circuit 21 , and the data is processed by all those circuits explained in the embodiment 1 described above . by using this circuit , the data that is processible by the fdc circuit 22 can be processed still faster by the fdc circuit 22 , and only the data that is not processible is processed by the circuit described before , thereby it becomes possible that the processing speed is made faster . and , as an example of combinations of the embodiments described above , an embodiment , which is a combination of the embodiment of the floppy disk transfer apparatus of fig3 and the embodiment of the floppy disk composite apparatus including the fdc circuit of fig4 is shown in fig5 . this embodiment is considered to be the most suitable as a practical apparatus used for actual applications . its operation is the same as that of the embodiments of fig3 and fig4 . although in the above embodiments the write - in means and the read - out means were explained as two separate elements , it should be understood that , in an actual apparatus , those two means are accomplished by a single element playing those two roles . that is , one magnetic head serves both functions of read out and writing . also , although in the above embodiments , only such examples that gaps were utilized as the parts wherein any meaningful data were not recorded in respective data tracks , it is needless to mention that those parts such as &# 34 ; sync &# 34 ; signals can also be used instead of gaps in the above embodiments . | 6 |
the present invention also relates to an emulsifiable suspension concentrate composition of a herbicidal agent comprising an amino acid or imidazolinylpyridine carboxylic acid ( alone or in combination ) in a solid state suspended in a water immiscible liquid containing an anionic surfactant and an ethoxylated fatty acid surfactant and optionally containing an antifoam agent and a thickening or suspending agent . the herbicidal agent is usually sold in a concentrated form either as a solid or a liquid and , just prior to application , the concentrate is diluted with water , or water containing adjuvants , and sprayed on fields of soil and / or actively growing plants . solid concentrate formulations , such as granulars , wettable powders and dusts , may also be used . since not all solid concentrate formulations of the free acid form of herbicidal agents , such as n - phosphonomethylglycine , exhibit the same high magnitude of efficacy and further since certain highly effective herbicidal compounds , such as n - phosphonomethylglycine and imidazolinylnicotinic acids , are relatively insoluble in water and conventional organic solvents , they are not readily amenable to commercial formulation . chemical modification of said compounds to give the corresponding salts is required to improve their solubility characteristics . surprisingly , it has been found that compounds , such as amino acids and imidazolinylnicotinic acids , may be formulated as liquid concentrates without further chemical modifications of said compounds and with a high degree of retention of efficacy . the emulsifiable suspension concentrate compositions of the present invention are comprised of about 10 % to 50 % of a herbicidal agent , such as n - phosphonomethylglycine or an imidazolinylnicotinic acid , alone or in combination , suspended in about 29 % to 84 % of a non - paraffinic aromatic solvent mixture having a distillation range of 118 ° to 305 ° c . containing about 3 % to 10 % of an anionic surfactant , about 3 % to 10 % of an ethoxylated fatty acid surfactant , 0 to about 0 . 10 % of an antifoam agent and 0 to about 2 . 0 % of a suspending or thickening agent . one preferred composition comprises about 30 % to 50 % of an active herbicidal agent or combination of agents , about 40 % to 57 % of a non - paraffinic aromatic solvent mixture having a distillation range of 118 ° to 305 ° c ., about 5 . 0 % to 7 . 0 % of an anionic surfacant , about 5 . 0 % to 7 . 0 % of an ethoxylated fatty acid surfactant , about 0 . 02 % to 0 . 15 % of an antifoam agent and 0 . 5 to 2 % of a suspending agent . among the herbicidal agents suitable for use in the compositions of the invention are amino acids such as glyphosate and imidazolinylpyridine carboxylic acids such as imazapyr and combinations thereof . a preferred herbicidal agent is glyphosate , alone or in combination with an imidazolinylnicotinic acid . solvents suitable for use in the compositions of the invention include heavy aromatic solvent mixtures having a distillation range of 118 ° to 305 ° c . preferred solvents include those mixtures of aromatics having a distillation range of about 183 ° to 285 ° c ., and the most preferred aromatic solvent mixtures is that which distills in a range of about 225 ° to 280 ° c . anionic surfactants suitable for use in the present invention include alkylarylsulfonic acids such as c 8 - c 18 alkylbenzenesulfonic acid , with dodecylbenzenesulfonic acid being the preferred anionic surfactant . among the ethoxylated fatty acid surfactants which may be employed are ethoxylated castor oils with about 15 - 60 ethylene oxide units per molecule . preferred ethoxylated castor oils are those which have about 36 - 40 ethylene oxide units per molecule . suitable antifoam agents include silicone polymers containing silica such as dimethylsilicone polymer plus silica , and suitable suspending or thickening agents include hydrated fumed silica or attapulgite clays or amine treated attapulgite clays . the herbicidal emulsifiable suspension concentrate compositions may be prepared by dissolving an anionic surfactant in an aromatic solvent and adding a solid herbicidal agent or combination of agents , with vigorous agitation to form a suspension . this suspension is milled to the required particle size distribution . a median particle diameter of 1 - 2 microns provides suitable physical properties . the milled suspension is treated with an ethoxylated fatty acid surfactant and , optionally , an antifoam agent and a suspending or thickening agent and mixed thoroughly . alternatively , the herbicidal agent is milled as a dry powder and is added to a solution of the anionic surfactant in the aromatic solvent with vigorous agitation to ensure complete dispersion and the remaining components are added with stirring . the above - prepared emulsifiable suspension concentrate compositions are physically stable and demonstrate excellent dilution properties in hard and soft waters to produce a sprayable herbicidal emulsion . in practice , it is generally preferable to dilute the compositions of the invention in water containing about 0 . 25 % of an adjuvant such as a polyoxyethylene sorbitan laurate surfactant to obtain an especially high degree of herbicidal activity . in order to facilitate a further understanding of the invention , the following examples are presented primarily for the purpose of illustrating certain more specific details thereof . the invention is not to be deemed limited thereby except as defined in the claims . unless otherwise noted , all parts are by weight . ______________________________________component % ______________________________________n - phosphonomethylglycine 41 . 90dodecylbenzenesulfonic acid 6 . 00ethoxylated castor oil , 36 c .. sup . 1 6 . 00dimethylsilicone polymer with silica . sup . 2 0 . 10mixture of aromatic hydrocarbons with 46 . 00a distillation range of 226 °- 279 ° c .. sup . 3 100 . 00______________________________________ . sup . 1 36 units of ethylene oxide per molecule flomo ® 36 c ., manufactured by desoto . sup . 2 th 100ind ® antifoam , manufactured by thompsonhayward . sup . 3 aromatic 200 °, manufactured by exxon an anionic surfactant , dodecylbenzenesulfonic acid , is dissolved in a water immiscible solvent , aromatic 200 ®, with stirring . this solution is treated with the herbicidal agent , n - phosphonomethylglycine , in a crystalline or powder state with vigorous stirring to give a dispersion . the resultant dispersion is milled until a median particle size of 1 - 2 microns is obtained . the milled dispersion is treated with an ethoxylated fatty acid surfactant , castor oil , 36c 1 , and an antifoam agent , dimethylsilicone polymer with silica 2 and mixed thoroughly . the herbicidal agent , n - phosphonomethylglycine , is milled to give a median particle size of 1 - 2 microns and then added to a solution of an anionic surfactant , dodecylbenzenesulfonic acid in a water immiscible solvent , aromatic 200 ®, with vigorous agitation . the resultant dispersion is treated with an ethoxylated fatty acid surfactant , castor oil , 36c 1 , and an antifoam agent , dimethylsilicone polymer plus silica 2 , and mixed thoroughly . the physical characteristics of the above - described n - phosphonomethylglycine emulsifiable concentrate composition are shown below . ______________________________________viscosity ( brookfield lvt at 22 ° c . 500 - 600 cpspindle # 2 , speed 30 rpm ) density at 20 ° c . 1 . 41 g / mlparticle size ( horiba capa 700 ) 1 . 21 microns ( median ) ph , 2 % diluted in deionized water 2 . 0 - 2 . 4dispersibility in water ( in both good emulsifica - standard hard and soft waters ), tion , no oil sep - 2 . 5 g in 100 ml total volume . aration after 24 hours . ______________________________________ ______________________________________components a b______________________________________imazethapyr -- 33 . 3imazapyr 33 . 33 -- dodecylbenzenesulfonic acid 5 . 00 5 . 00ethoxylated castor oil , 36 c .. sup . 1 5 . 00 5 . 00dimethylsilicone polymer with 0 . 03 0 . 03silica . sup . 2mixture of aromatic hydrocarbons 56 . 64 56 . 64with a distillation range of226 °- 279 ° c . 100 . 00 100 . 00______________________________________ . sup . 1 36 units of ethylene oxide per molecule flomo ® 36 c ., manufactured by desoto . sup . 2 th ind30 ® antifoam , manufactured by thompsonhayward . sup . 3 aromatic 200 ®, manufactured by exxon the herbicidal agent , as a finely divided powder , is added to a rapidly stirred solution of the anionic surfactant , dodecylbenzenesulfonic acid , in the aromatic solvent , aromatic 200 ®. the resultant dispersion is treated with the remaining components and placed on a high shear mixer for 3 minutes . optionally the solid herbicidal agent is milled to a median particle size of 1 - 2 microns prior to use in the above - described preparation . ______________________________________physical properties a b______________________________________dispersibility in water , good emulsi - good emulsi - 4 . 0 g in 100 ml total fication , fication , volume . slight settl - slight settl - ing after 24 ing after 24 hours , easily hours , easily resuspended resuspended______________________________________ ______________________________________preparation of combination emulsifiable suspension con - centrate compositionscomponents c d______________________________________glyphosate 37 . 69 32 . 89imazapyr 4 . 20 9 . 00dodecylbenezenesulfonic acid 6 . 00 6 . 00flomo ® 36 c .. sup . 1 6 . 00 6 . 00th 100ind ® antifoam . sup . 1 0 . 10 0 . 10aromatic 200 ®. sup . 1 46 . 01 46 . 01 100 . 00 100 . 00______________________________________ . sup . 1 as described in example 1 . a solution of dodecylbenzene in aromatic 200 ® is treated with glyphosate with rapid stirring . the resultant dispersion is treated with the remaining components and placed on a high shear mixer for 3 minutes . optionally , a dispersion of glyphosate and the imidazolinylnicotinic acid solid in a solution of dodecylbenzenesulfonic acid in aromatic 200 ® is milled to give a median particle size of 1 - 2 microns prior to the addition of the remaining components . ______________________________________physical properties c d______________________________________dispersibility in water , good emulsi - good emulsi - 4 . 0 g in 100 ml total fication , fication , volume . slight oil slight oil separation separation after 24 after 24 hours , easily hours , easily resuspended resuspended______________________________________ this is an evaluation of the postemergent herbicidal activity of the emulsifiable suspension concentrate composition of n - phosphonomethylglycine as compared to a commercial aqueous solution composition of the isopropylammonium salt of n - phosphonomethylglycine . the test compositions used for this evaluation are the emulsifiable suspension concentrate composition of n - phosphonomethylglycine which is described in example 1 and referred to herein as glyphosate 40 esc and an aqueous soluble composition of the isopropylammonium salt of n - phosphonomethylglycine which is commercially sold by monsanto under the trademark roundup ® and referred to herein as glyphosate salt . seedling plants are grown in jiffy flats for about 2 weeks . the glyphosate 40 esc composition is dispersed in water containing 0 . 25 % tween - 20 ®, a polyoxyethylene sorbitan monolaurate surfactant manufactured by atlas chemical industries in sufficient quantity to provide the equivalent of about 0 . 063 kg to 0 . 500 kg per hectare of n - phosphonomethylglycine to the plants when applied through a spray nozzle operating at 40 psi for a predetermined time . the glysphosate salt is dispersed in water according to the label directions and applied to the plants as described above . after spraying , the plants are placed on greenhouse benches and cared for in the usual manner commensurate with conventional greenhouse practices . the plants are evaluated at 7 and 14 days after treatment and rated according to the rating system shown below . ______________________________________rating system % control______________________________________no effect 0possible effect 1 - 10slight effect 11 - 25moderate effect 26 - 40definite injury 41 - 60herbicidal effect 61 - 75good herbicidal effect 76 - 90approaching complete kill 91 - 99complete kill 100______________________________________ ______________________________________plant species usedcommon name scientific name______________________________________mustard wild brassica kabercotton gossypium hirsustumcorn zea maysmorningglory ipomoea purpureasoybean glycine maxbarnyard grass echinochloa crus - gallilambsquaters chenopidium albumragweed ambrosia artemisifoliagreen foxtail setaria veridis______________________________________ the data obtained at 14 days after treatment are reported in table i below . table i__________________________________________________________________________postemergence herbicidal evaluation grn rate must cot field morn soy barn lambs rag foxcomposition ( ka / ha ) ard ton corn glry bean yardg quart weed tail__________________________________________________________________________glyphosate salt 0 . 500 80 . 0 80 . 0 90 . 0 66 . 7 78 . 3 98 . 7 99 . 3 38 . 3 100 . 0glyphosate esc 0 . 500 60 . 0 50 . 0 95 . 0 71 . 7 80 . 0 94 . 3 96 . 3 40 . 0 91 . 7glyphosate salt 0 . 250 38 . 3 35 . 0 58 . 3 63 . 3 63 . 3 71 . 0 83 . 3 33 . 3 85 . 0glyphosate esc 0 . 250 33 . 3 40 . 0 85 . 3 75 . 3 71 . 7 78 . 3 100 . 0 53 . 3 93 . 3glyphosate salt 0 . 125 13 . 3 20 . 0 18 . 3 30 . 0 20 . 0 23 . 3 61 . 7 6 . 7 46 . 7glyphosate esc 0 . 125 26 . 7 3 . 3 71 . 7 30 . 0 50 . 0 48 . 3 83 . 3 23 . 3 81 . 7glyphosate salt 0 . 063 0 . 0 3 . 3 3 . 3 15 . 0 6 . 7 16 . 7 36 . 7 0 . 0 20 . 0glyphosate esc 0 . 063 6 . 7 0 . 0 61 . 7 10 . 0 20 . 0 35 . 0 70 . 0 13 . 3 40 . 0__________________________________________________________________________ the test compositions used are glyphosate 40 esc and glyphosate salt , and are as described in example 4 . a field containing established , actively growing plants is divided into plots of 10 meters × 30 meters and is sprayed with a tractor mounted compressed air sprayer with a delivery of 200 liters per hectare . the glyphosate 40 esc composition is dispersed in water containing 0 . 25 % tween - 20 ® in sufficient quantity to provide the equivalent of 2 . 0 kg to 0 . 5 kg per hectare to the plants . glyphosate salt is dispersed in water according to the label directions and applied to the plants as described hereinabove . the plots are evaluated at 7 and 14 days after treatment . each treatment is replicated once . the data obtained for 14 days after treatment is reported in table ii . ______________________________________plant speciescommon name scientific name______________________________________redroot pigweed amoranthus retroflexuscommon lambsquarters chenopodium albumcommon purslore portulara oleraceacommon ragweed ambrosia artemisiifolalarge crabgrass digitaria sanguiralisfall panicum panicum diclotomiflorumbarnyard grass echirochloa curs - gallifoxtail millet setaria italica______________________________________ table ii__________________________________________________________________________postemergence field evaluation red root fox rate pig lambs rag crab fall bard tailcomposition kg / ha weed quart weed gras pani yardq millet__________________________________________________________________________glyphosate salt 0 . 5 100 80 98 100 95 100 100glyphosate esc 0 . 5 100 100 85 100 98 100 100glyphosate salt 1 . 0 100 100 100 100 100 100 100glyphosate esc 1 . 0 100 100 100 100 100 100 100glyphosate salt 2 . 0 100 100 100 100 100 100 100glyphosate esc 2 . 0 100 100 100 100 100 100 100__________________________________________________________________________ | 0 |
[ 0019 ] fig1 is a diagram of a wireless communication system 100 that may be designed to support one or more cdma standards and / or designs ( e . g ., the w - cdma standard , the is - 95 standard , the cdma2000 standard , the hdr specification ). for simplicity , system 100 is shown to include three base stations 104 in communication with two mobile stations 106 . the base station and its coverage area are often collectively referred to as a “ cell ”. in is - 95 systems , a cell may include one or more sectors . in the w - cdma specification , each sector of a base station and the sector &# 39 ; s coverage area is referred to as a cell . as used herein , the term base station can be used interchangeably with the terms access point or nodeb . the term mobile station can be used interchangeably with the terms user equipment ( ue ), subscriber unit , subscriber station , access terminal , remote terminal , or other corresponding terms known in the art . the term mobile station encompasses fixed wireless applications . depending on the cdma system being implemented , each mobile station 106 may communicate with one ( or possibly more ) base stations 104 on the forward link at any given moment , and may communicate with one or more base stations on the reverse link depending on whether or not the mobile station is in soft handoff . the forward link ( i . e ., downlink ) refers to transmission from the base station to the mobile station , and the reverse link ( i . e ., uplink ) refers to transmission from the mobile station to the base station . for clarity , the examples used in describing this invention may assume base stations as the originator of signals and mobile stations as receivers and acquirers of those signals , i . e . signals on the forward link . those skilled in the art will understand that mobile stations as well as base stations can be equipped to transmit data as described herein and the aspects of the present invention apply in those situations as well . the word “ exemplary ” is used exclusively herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . [ 0022 ] fig2 shows an embodiment of system 100 , detailing a transmit diversity scheme . base station 104 is equipped with two antennas , 210 and 220 , for communicating with mobile station 106 . ( alternative embodiments may use more than two antennas .) the links between antennas 210 and 220 and mobile station 106 are labeled s 1 and s 2 , respectively . the two antennas are located with enough geographical separation that the fading experienced on s 1 is independent from the fading on s 2 , yet the two signals arrive at mobile station 106 at essentially the same time . various techniques can be employed such that the two signals can be combined constructively at the mobile station , and in so doing combat some of the deleterious effects that would be introduced if only a single antenna were deployed . one such scheme , detailed in the above referenced w - cdma standard , is closed - loop transmit diversity . the phase of a signal , s 2 , transmitted on diversity antenna 220 is adjusted in relation to the signal , s 1 , transmitted on primary antenna 210 so that the two signals , s 1 and s 2 , are in - phase and maximally combined when received at mobile station 106 . the terms primary and diversity , applied to antennas 210 and 220 , respectively , are used only to distinguish the two antennas . those of skill in the art will recognize that phase adjustment can take place on either antenna ( or on multiple antennas ). in an alternate scheme , such as space time transmit diversity ( sttd ), different data is transmitted on each antenna . the data is transmitted in such a fashion that it can be recombined when received at the mobile station . for example , consider a two - antenna transmit diversity scheme , where the symbols transmitted on the primary antenna ( or antenna 1 ) are received at the mobile with complex gain , α , and the symbols transmitted on the diversity antenna ( or antenna 2 ) are received with complex gain β . the complex gains are functions of the channels through which the two signals propagate . consider two adjacent complex data symbols awaiting transmission , d 1 and d 2 . the data to be transmitted is distributed across the two antennas as follows : during one symbol transmission period , d 1 is transmitted on antenna 1 , and − d 2 * ( where * represents the conjugate ) is transmitted on antenna 2 . in the next symbol transmission period , d 2 is transmitted on antenna 1 and d 1 * is transmitted on antenna 2 . the signal received at the mobile station during the first symbol transmission period is r 1 , where r 1 = αd 1 − βd 2 *. the signal received at the mobile station during the second symbol transmission period is r 2 , where r 2 = αd 2 + βd 1 *. if the channel gains , α and β , are known , then the two equations r 1 and r 2 are sufficient to recover the data , d 1 and d 2 . pilot signals received at the mobile station are proportional to the channel gains , α and β . the channel gains can be estimated by recovering the two pilot signals , pilot 1 and pilot 2 , transmitted on the primary and diversity antennas , respectively . the recovered pilots can be used to demodulate signals transmitted from the respective antennas , described in further detail below . in the exemplary embodiment , pilot signals transmitted on each of the plurality of diversity antennas are orthogonal to one another . this property facilitates recovery of the pilots once they are received at the mobile station and minimizes interference . one technique for generating orthogonal pilots in a cdma system is to multiply a first pseudorandom noise ( pn ) sequence , used for a first pilot signal , by an orthogonalizing signal to produce a second pilot signal . fig3 depicts how an exemplary set of pilot signals can be generated , as described in the w - cdma standard . in fig3 multiplying a base pn sequence by the value shown corresponding to the symbol number creates the primary and diversity pilots . in this example , the primary pilot is generated by multiplying a base pn sequence by a constant amplitude , a . multiplying the base pn sequence by a in symbols 0 and 3 generates the diversity pilot , and by − a in symbols 1 and 2 . the pattern is repeated for each subsequent set of four symbols ( except , as specified for the w - cdma standard , at frame boundaries ). in the exemplary embodiment , each symbol comprises 256 chips . it is readily seen that the resultant primary and diversity pilot sequences are orthogonal to one another . those of skill in the art will recognize various other orthogonalizing sequences that can be applied to generate orthogonal pilot sequences using a common underlying sequence . those of skill will further recognize that additional orthogonalizing sequences can be constructed to generate a plurality of orthogonal pilots for transmitting on a plurality of diversity antennas . [ 0028 ] fig4 depicts a portion of a mobile station suitable for transmit diversity pilot processing . signals are received at antenna 410 and delivered for conversion to baseband in rf downconvert 415 , using techniques known in the art . baseband samples are delivered to timing offset 420 , where on - time , early , and late streams of samples are generated corresponding to timing offsets in the incoming signal of τ , τ − ½ , and τ + ½ , respectively . the early sequences are sampled prior to a timing reference , and the late sequences are sampled subsequent to that timing reference . it is common to sample the early and late sequences one half chip from the timing reference , but other differences can also be used . the early and late sequences are delivered to tracking loop 460 . to maximize received energy and minimize errors , time tracking is performed to minimize phase differences between the pilot signals used for demodulation and the signals being demodulated . various time tracking techniques are known in the art . techniques for time tracking in a transmit diversity system include methods for tracking signals from the plurality of antennas independently , as well as methods for tracking a weighted average of the signals from the various antennas with a single tracking loop . these methods are described in co - pending u . s . patent application ser . no . 09 / 964 , 589 , entitled “ time tracking in a non - negligible multipath spacing environment ”, filed sep . 25 , 2001 , and u . s . patent application ser . no . 10 / 061 , 873 , entitled time tracking loop for diversity pilots ”, filed jan . 31 , 2002 , both assigned to the assignee of the present invention . one class of techniques compares the energy in the early and late sequences and adjusts the timing reference , τ , accordingly . data demodulator 430 is used to demodulate the on - time sequence from timing offset 420 , the timing of which is directed by the output of tracking loop 460 . on - time samples are also used in pilot decover 440 to produce estimates of the primary and diversity pilots , { circumflex over ( p )} 1 and { circumflex over ( p )} 2 , which are used to demodulate data in data demodulator 430 . data demodulator 430 produces data corresponding to the data received from the primary and diversity antennas . if needed , data demux 450 can be deployed to demultiplex the two antenna data streams to produce the output data symbols . the following discussion will use the primary and diversity pilot sequences defined in the w - cdma standard as an example . those of skill in the art will be able to apply these principles to other pilot sequences . the relationship between the primary and diversity sequences is shown in fig3 as described above . in w - cdma , a downlink common pilot channel ( cpich ) can be used as a channel condition reference in the demodulation process . when transmit diversity is not deployed , the cpich is a fixed rate ( 30 kbps , spreading factor = 256 ) downlink channel that carries a pre - defined bit / symbol sequence . specifically , the cpich is the primary scrambling code of the cell , spread by the all zero sequence . thus , the cpich is the scrambling code multiplied by 1 + j . to simplify the following equations , a = 1 + j . when transmit diversity is used on the downlink channel , the cpich is transmitted from both antennas , as described with respect to the non - diversity case above . in addition , in order to distinguish the primary and diversity channels , the data transmitted on the diversity antenna is modulated by a specific pattern . the kth symbol in a radio frame , denoted s k , is given in equation 1 : s k = ( - 1 ) f k · a equation 1 f k = k mod 2 + ⌊ k 2 ⌋ mod 2 equation 2 the sequence produced by equations 1 and 2 is the diversity pilot sequence depicted in fig3 . note that in the w - cdma embodiment , each radio frame comprises 150 symbols , so k falls increments within the range of 0 . . . 149 , then repeats . the principles of the present invention apply to any number of symbols in a radio frame , and f k can be modified to produce any sequence s k . in general , s k may be designed so that the primary and diversity pilots are orthogonal over some number of symbols . in this example , the primary and diversity pilots are orthogonal over two symbols . those of skill in the art will recognize the myriad combinations of primary and diversity pilot sequences , with myriad lengths of symbols over which the two pilots are orthogonal . all of these combinations fall within the scope of the present invention . the symbol received at the mobile station at time k , r k , is given by equation 3 : r k = α k a + ( - 1 ) f k β k a + n k equation 3 where α k and β k are the complex - valued channel gains from the primary and diversity antennas , respectively , and n k is the additive noise . an estimate of α k and β k is made for use in the demodulation process . in other words , { circumflex over ( p )} 1 and { circumflex over ( p )} 2 , calculated in pilot decover 440 , can be estimated from α k and β k , techniques for which will be recognized by those of skill in the art . to understand the limitations of the prior techniques for estimating channel gains , consider first the case without transmit diversity . in this case , a single complex - valued channel gain , α k , represents the transmission channel . the received symbol at the mobile station , at time k , is given by equation 4 : a reliable approximation of α k can be formed from received symbols , an example of which is given in equation 5 : { tilde over ( α )} k = h 1 ( r k , r k − 1 , . . . ) equation 5 the approximation , { tilde over ( α )} k , is formed using symbols received at time k and earlier , and can be used to demodulate incoming data symbols at time k . to do so may require the data symbols to be buffered , since r k will need to be received prior to calculating { tilde over ( α )} k . in general , such buffering may require additional storage resources , and may introduce delay in the demodulation process . to avoid buffering , the channel estimates at time k can be used to demodulate symbols received at time k + 1 . the principles of the present invention apply with equal force regardless of whether buffering is used . for clarity , in this discussion , the buffered demodulation case will be described , that is , where channel estimates based on received symbols at times k and earlier are used to demodulate data received at time k . when transmit diversity is deployed , prior implementations have relied on the assumption that α k is approximately equal to α k + 1 , and that β k is approximately equal to β k + 1 . therefore , pilot estimates can be approximated as given in equations 6 and 7 : α ∼ 2 l ≈ α ~ 2 l - 1 = h 2 ( r 2 l - 2 + r 2 l - 1 2 , r 2 l - 4 + r 2 l - 3 2 , … ) equation 6 β ∼ 2 l ≈ β ∼ 2 l - 1 = h 2 ( ( - 1 ) f 2 l - 2 r 2 l - 2 + ( - 1 ) f 2 l - 1 r 2 l - 1 2 , ( - 1 ) f 2 l - 4 r 2 l - 4 + ( - 1 ) f 2 l - 3 r 2 l - 3 2 , … ) equation 7 where h 2 can be any filter , and 1 is an integer . thus , { tilde over ( α )} 2 ≈{ tilde over ( α )} 1 , { tilde over ( α )} 4 ≈{ tilde over ( α )} 3 , { tilde over ( α )} 6 ≈{ tilde over ( α )} 5 , and so forth . likewise , { tilde over ( β )} 2 ≈{ tilde over ( β )} 1 , { tilde over ( β )} 4 ≈{ tilde over ( β )} 3 , { tilde over ( β )} 6 ≈{ tilde over ( β )} 5 , and so forth . comparing equation 5 with equations 6 and 7 , notice that every other set of estimates for the transmit diversity case does not factor in the most recently received symbol . specifically , { tilde over ( α )} 21 and { tilde over ( β )} 21 do not make use of the most recently received symbol , r 21 . in certain circumstances , such as when a mobile station is traveling at high speed , leaving out the most recently received symbol can lead to large estimation errors in the channel estimates , and thus the pilot estimates , { circumflex over ( p )} 1 and { circumflex over ( p )} 2 , significantly degrading demodulation performance . [ 0044 ] fig5 depicts a prior art implementation of pilot decover 440 . the incoming on - time symbol is despread in despreader 510 using the primary pilot sequence and accumulated in accumulator 520 to produce symbol r 1 . a buffer 530 stores the previous accumulated symbol , denoted r 0 , as well . the current and previous symbols , r 0 and r 1 , can be added or subtracted to yield an estimate of both the primary and diversity pilot symbols . recall that during each symbol interval k , the mobile station receives a combination of the signals , transmitted from the primary and diversity antenna , with complex gains α k and β k corresponding to the respective channels . in symbol 0 , ( α k + β k ) a is received . in symbol 1 , ( α k − β k ) a is received . in symbol 2 , ( α k − β k ) a is received . in symbol 3 , ( α k + β k ) a is received . and the pattern repeats . adding symbol 0 to symbol 1 yields 2 ( α k )( a ), which is proportional to α k , and can be used for estimating { circumflex over ( p )} 1 . subtracting symbol 1 from symbol 0 yields 2 ( β k )( a ), which is proportional to β k , and can be used for estimating { circumflex over ( p )} 2 . symbols 2 and 3 add to produce 2 ( α k )( a ), which is proportional to α k , and can be used for estimating { circumflex over ( p )} 1 . the difference between symbols 2 and 3 is 2 ( β k )( a ), which is proportional to β k , and can be used for estimating { circumflex over ( p )} 2 . this process can be repeated , calculating pilot estimates every other symbol , using the estimates for data demodulation . this process is carried out in parameter estimation block 540 , which receives r 0 and r 1 and produces outputs ( r 0 + r 1 )/ 2 and ( r 0 − r 1 )/ 2 . switches 570 and 580 direct these two outputs into filters 550 and 560 , respectively , every other symbol . the filters 550 and 560 can be used to average out the noise factor , n k , as well as to produce estimates based on prior symbols , as given in equations 6 and 7 above . the output of filters 550 and 560 are , respectively , the estimates of α k and β k . for example , consider filters 550 and 560 which use a one - pole infinite impulse response ( iir ) filter for each . for brevity , only the generation of { tilde over ( α )} is described . the generation of { tilde over ( β )} is similar . the estimates of { tilde over ( α )} are determined according to equation 8 : α ∼ 2 l ≈ α ~ 2 l - 1 = ( 1 - a ) α ~ 2 l - 3 + a ( r 2 l - 1 + r 2 l - 2 2 ) equation 8 where a is the irr coefficient , and 1 is an integer . using this example , it can be seen that when k is even , the estimate of { tilde over ( α )} is the same as the prior estimate , so the most recent symbol is not included . the effects of this are summarized in table 1 . the first column in table 1 shows the symbol index , k . the second column indicates which two recent received symbols are included in the filter calculation . column three indicates the ages , in number of symbols , of the two most recent symbols . column four shows the average age of the two most recent symbols . those of skill in the art will recognize that the accuracy of the estimates can be increased with decreasing average age of the symbols used in the estimation . these prior art age calculations will be compared with those for an embodiment of the present invention using similar iir filters , described below . in contrast with the prior art described above with respect to fig5 embodiments disclosed herein incorporate the most recently received symbol in each channel parameter estimate . the principle is that each symbol is proportionate to either the sum or difference of alpha and beta . rather than wait for successive symbols to arrive that can be manipulated to find the estimates , which means a delay of one symbol in a w - cdma system ( other systems could use orthogonalizing sequences that introduce additional delay requirements ), a difference term and a sum term are estimated . either the difference term or the sum term will be updated every symbol . the difference and sum terms may be filtered to provide more stable estimates . the { tilde over ( α )} and { tilde over ( β )} are then estimated from the difference and sum estimates , incorporating information included in the most recently received symbol . [ 0050 ] fig6 depicts an embodiment of a pilot decover 440 which alleviates the symbol age issues described earlier . as in fig5 on time samples are despread and accumulated in despreader 510 and accumulator 520 . then , switch control 610 is used to control switches 612 and 614 to introduce the symbol accumulated in accumulator 520 to either α + β estimate 620 or α − β estimate 630 , respectively . the most recent accumulated symbol is always used to update one estimate or the other . parameter estimation block 640 receives the estimates of α + β and α − β and produces the estimates of α k and β k , { tilde over ( α )} and { tilde over ( β )}, respectively . the timing of switches 612 and 614 , as controlled by switch control 610 , will vary according to the relationship between the pilot signals on the primary and diversity antennas , and those of skill in the art will readily adapt switch control 610 to any system . for the exemplary w - cdma embodiment , switch 612 is activated whenever the received symbol is the sum of the primary and diversity pilots , which occurs whenever f k is even . switch 614 can be activated whenever switch 612 is not activated , or whenever f k is odd . [ 0052 ] fig7 depicts an embodiment of parameter estimation block 640 . the estimate of α + β is summed with the estimate of α − β in summer 710 to produce 2 { tilde over ( α )}, then divided by two in divider 730 to produce { tilde over ( α )}. those of skill in the art will recognize that divider 730 can be performed using a variety of techniques , including a simple shift operation . furthermore , those of skill in the art will recognize that , in some embodiments , no division is necessary since 2 { tilde over ( α )} is proportional to { tilde over ( α )} and the factor of two can be accounted for in subsequent pilot processing . similarly , α − β is subtracted from α + β in summer 720 to produce 2 { tilde over ( β )}, which can be divided in divider 740 . divider 740 is optional , for the reasons just described , and can be deployed using any of the division techniques , including shifting , that are known in the art . the implementation of α + β estimate 620 or α − β estimate 630 can comprise a filter of any type . one example is the iir filter similar to that described above in equation 8 . in this example , filters 620 and 630 are given by equations 9 and 10 , respectively : where r k is input to filter 620 or 630 according to switch control 610 . for simplicity , consider an example with a filter coefficient , a , equal to 1 , in which case α + β estimate 620 and α − β estimate 630 are simply registers . with this example , it can be seen that the most recent incoming symbol r k is always used in calculating the estimates { tilde over ( α )} and { tilde over ( β )}. these effects are summarized in table 2 . in similar fashion as table 1 , the first column in table 2 shows the symbol index , k . the second column indicates which two most recent received symbols are included in the filter calculation . column three indicates the ages , in number of symbols , of those symbols . column four shows the average age of the two most recent symbols . as stated above , those of skill in the art will recognize that the accuracy of the estimates can be increased with decreasing average age of the symbols used in the estimation . in comparison with the age effects described with relation to table 1 , which showed the average age of the symbols between 0 . 5 and 1 . 5 , this embodiment has average ages between 0 . 5 and 1 . 0 . during symbols where k is odd , the performance of the two embodiments is identical . during symbols where k is even , this embodiment sees the benefit of using the most recently received symbol . [ 0057 ] fig8 depicts a flowchart of an embodiment of a method for estimating channel parameters using the most recently received symbols . the process starts in step 810 , in which a symbol including the primary and diversity pilot symbols is correlated and accumulated . proceed to decision block 820 . in decision block 820 , if the symbol contains the difference between the primary and diversity pilots , proceed to step 830 and update the difference estimate with the latest symbol . in the exemplary embodiment described in fig6 decision block 820 can be implemented using switch control 610 and switches 612 and 614 . activating switch 614 updates the α − β estimate in α − β estimate 630 . in decision block 820 , if the symbol does not contain the difference , but rather the sum of the primary and diversity pilots , proceed to step 840 and update the sum estimate with the latest symbol . in the exemplary embodiment described in fig6 activating switch 612 updates the α + β estimate in α + β estimate 620 . from either step 830 or 840 , proceed to step 850 and estimate the channel parameters from the difference and sum estimates . in the exemplary embodiment of fig6 step 850 can be implemented using parameter estimation block 640 , an example of which is detailed in fig7 . note that the foregoing discussion has used the signals , codes and parameters defined in the w - cdma standard as some of the exemplary signals , codes and parameters . this is for clarity of discussion only , and should not be construed to limit the scope of the present invention to w - cdma systems . the principles of the present invention apply to any conceivable system that employs an orthogonalizing sequence to generate primary and diversity pilots with the properties described . various combinations of pilot and data encoding schemes for diversity transmission with antenna verification are anticipated and fall within the scope of the present invention . those skilled in the art will recognize how to adapt the various embodiments described for use with such alternate systems . it should be noted that in all the embodiments described above , method steps can be interchanged without departing from the scope of the invention . those of skill in the art will understand that information and signals may be represented using any of a variety of different technologies and techniques . for example , data , instructions , commands , information , signals , bits , symbols , and chips that may be referenced throughout the above description may be represented by voltages , currents , electromagnetic waves , magnetic fields or particles , optical fields or particles , or any combination thereof . those of skill will further appreciate that the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented as electronic hardware , computer software , or combinations of both . to clearly illustrate this interchangeability of hardware and software , various illustrative components , blocks , modules , circuits , and steps have been described above generally in terms of their functionality . whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . skilled artisans may implement the described functionality in varying ways for each particular application , but such implementation decisions should not be interpreted as causing a departure from the scope of the present invention . the various illustrative logical blocks , modules , and circuits described in connection with the embodiments disclosed herein may be implemented or performed with a general purpose processor , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components , or any combination thereof designed to perform the functions described herein . a general purpose processor may be a microprocessor , but in the alternative , the processor may be any conventional processor , controller , microcontroller , or state machine . a processor may also be implemented as a combination of computing devices , e . g ., a combination of a dsp and a microprocessor , a plurality of microprocessors , one or more microprocessors in conjunction with a dsp core , or any other such configuration . the steps of a method or algorithm described in connection with the embodiments disclosed herein may be embodied directly in hardware , in a software module executed by a processor , or in a combination of the two . a software module may reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , hard disk , a removable disk , a cd - rom , or any other form of storage medium known in the art . an exemplary storage medium is coupled to the processor such the processor can read information from , and write information to , the storage medium . in the alternative , the storage medium may be integral to the processor . the processor and the storage medium may reside in an asic . the asic may reside in a user terminal . in the alternative , the processor and the storage medium may reside as discrete components in a user terminal . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . thus , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . | 7 |
fig1 shows an aircraft 10 equipped with a sensor multiplexer receiver & amp ; transmitter ( smart ) 14 which is a line replaceable unit . the aircraft is also equipped with a gps receiver system 16 . the gps system 16 receives ultra high frequency ( uhf ) radio signals 36 from several gps satellites 32 via its gps antenna 40 , calculates the position and altitude of the aircraft 10 and reports this position and altitude data 44 to the smart 14 . the smart 14 also receives aircraft performance and control data 18 , acoustic data 22 , and video data 26 . the video data 26 comes from cameras which monitor the cockpit , the passenger compartment , and the cargo compartment . smart 14 periodically samples the sensor signals 18 , 22 , 26 , 44 converts all non - digital sensor signals 18 , 22 , 26 , 44 into digital format , adds a sensor identification label to each signal 18 , 22 , 26 , 44 plus an aircraft identification and configuration label . then the smart 14 ultra high frequency radio electronically modulates the combined data and sends them to the aircraft satellite telemetry antenna 30 . it should be noted that , to save weight , one antenna could serve the functions of the gps antenna 40 and the aircraft satellite telemetry antenna 30 . then this uhf signal is transmitted by the aircraft antenna 30 to an earth orbiting communication satellite 38 that is located in a direct , unobstructed , line of sight with the aircraft 10 . in addition to transmitting data , the smart 14 receives data from the satellite 38 . as will be described more fully below , this data is mostly in the form of advisories and alerts . such advisories and alerts are reported to the crew via an on - board advisory system 72 . fig2 illustrates the communication satellite link 34 , 46 , 48 between the aircraft 10 and the cgbs 42 . it shows smart 14 equipped aircraft 10 transmitting their sensor data over an uhf radio , unobstructed line of sight , transmission 34 to the closest communication satellite 38 . the satellite , world wide communication link then relays the data by line of sight transmission 46 to other communication satellites 38 followed by line of sight transmission 48 to the cgbs 42 . the transmission of aircraft advisories from the cgbs 42 to the aircraft 10 is accomplished by communicating along the same path but in the reverse direction . fig2 depicts a continuous , around the clock , world wide communication link 34 , 46 , 48 that provides two way communication with all of the aircraft 10 equipped with smart 14 in the remote aircraft flight recorder and advisory ( raft ) system 50 . the number of satellites 38 in the communication system depends on whether a geosynchronous or low earth orbit ( leo ) satellite constellation is utilized . the system will work with either of the satellite constellations . the leo constellation requires smaller , lighter and lower power equipment but a larger number of satellites . fig3 is a block diagram of the cgbs 42 . it shows the cgbs receiving and transmitting antenna 54 , and the antenna control and uhf interface 56 that converts the received satellite signal into an electrical signal . the received signal represents aircraft performance and control 18 , audio 22 , video 26 , and high accuracy position and altitude data 44 . these signals are then sent to : the cgbs processing station 62 for data analysis , and performance and problem simulation ; the expert system module 64 for crash avoidance simulations ; the archive 66 for data storage ; the advisory module 70 for generating aircraft advisories ; the aircraft manufacturer &# 39 ; s module 74 for distribution to the aircraft manufacturer &# 39 ; s ground based facilities for expert crash avoidance and maintenance advisories ; and the atc module 78 for distribution to airport and area atc facilities . since the cgbs 42 is on the ground its temperature , environment , humidity and air can be readily controlled so that the archive storage of the aircraft &# 39 ; s sensor data 18 , 22 , 26 , 44 is very reliable . in addition , the real - time analysis of the data will alert the operational aircraft 10 of problems . in some cases , this may occur prior to the pilot &# 39 ; s recognition of a problem . thus in addition to reducing the equipment aboard the aircraft it can lighten the pilot &# 39 ; s work load . ground communication can be made over wide band - width , fiber optic cables , satellites or other rf communication links . in the continental united states the wide band - width , fiber optic communication link is preferred . the cgbs 42 acts as communication concentrator and it is through this facility 42 that world wide communication with the aircraft 10 occurs . at this facility 42 weather data is collected from the government weather bureau facilities . the weather data , map data , dted and atc data is also combined with other aircraft operational data 18 , 22 , 26 , 44 to provide : emergency or safety of flight advisories , flight efficiency or fuel economy advisories , and flight separation advisories . fig2 and 3 show how the closest , unobstructed line - of sight satellite 38 receives the data 18 , 22 , 26 , 44 from aircraft 10 equipped with smart modules 14 . data travels over the system to the satellite 38 closest to the cgbs 42 . this satellite 38 is in line of sight communication with the cgbs 42 , which transmits and receives data to and from the cgbs antenna 54 . the antenna 54 is controlled by antenna control and uhf interface module 56 . the uhf signals 18 , 22 , 26 , 44 are also demodulated and sorted , by aircraft , in this module 56 . the data 18 , 22 , 26 , 44 is then sent to the ground processor 62 for analysis . one function of the ground processor 62 is to send the data 18 , 22 , 26 , 44 to the archival data storage system 66 where it is safely stored in an air conditioned environment , for future retrieval , on magnetic disc or tape , or optical memory . another function of the processor 62 is to coordinate its data with the aircraft simulation processor 64 . this processor 64 performs an expert system analysis based on past performance , i . e . archived , data , aircraft specific stress accumulation statistics and world wide weather and wind shear , dted and atc information . based on this simulation , aircraft real - time advisories are generated by the advisory module 70 . emergency advisories are also based on the aircraft manufacturer &# 39 ; s simulations conducted at their facilities and communicated to the cgbs 42 via the wide band - width , fiber optic link 82 . the data can be viewed and controlled by the cgbs operators on the display and control system 86 . the position , altitude and aircraft velocity data is also sent to the atc module 78 for real - time transmission to the airport and area flight controllers over the wide band - width , fiber optic communication link 92 . weather data from weather services are also communicated over this link 92 . this data when mixed with the aircraft sensor data 18 , 22 , 26 , 44 at the aircraft simulation module 64 provide world wide safety of flight trajectories , safe to take off and land , and fuel efficiency economy of flight advisories . these advisories are sent to the aircraft 10 over the world wide communication link illustrated in fig2 . in addition , world wide advisories are sent to the aircraft 10 by the atc based on their information for aircraft separation . in a similar manner , the aircraft data 18 , 22 , 26 , 44 is sent to aircraft manufacturer personnel by the communication module 74 over the wide band - width , fiber optic link 82 . advisories can be sent by the manufacturers providing the best way to handle problems based on their expert knowledge of the aircraft 10 . these aid in safely flying the aircraft or efficiently servicing an aircraft that is experiencing equipment malfunctions on the ground . the in - air safety of flight advisories go to the advisory center 70 to be integrated with cgbs and air traffic controller generated information so as to provide a single emergency advisory , based on all of the data . this advisory is sent to the aircraft 10 via the global communication network . for aircraft experiencing problems on the ground , an aircraft manufacturer remotely samples the aircraft &# 39 ; s performance and then sends advisories over the network to the aircraft &# 39 ; s ground maintenance personnel . these advisories represent the latest diagnostic procedures and problem specific maintenance information . these maintenance advisories are sent to an aircraft maintenance terminal display that interfaces with the smart communication system 14 on board the aircraft . thus the maintenance advisory provides efficient , safe and effective repair of the aircraft using the most up - to - date procedures . fig4 provides greater detail about cgbs 42 communication with the ground based flight control and manufacturing facilities . the cgbs ground processor 62 communicates with the atc communication module 78 . digital data is communicated serially over a wide band - width , fiber optic link 92 to the air traffic control facilities 100 and the area traffic control facilities 96 . there are a large number of civil and military airport and area atcs in present use . these are indicated 100a to 100n for the airport air traffic controllers and 96a to 96n for the area air traffic controllers . each of the air traffic controllers 96 , 100 can tap the wide band - width , fiber optic communication link 92 for the specific aircraft data of interest to them . the air traffic controllers can also send , to specific or to all smart 14 equipped aircraft 10 in the world , advisory data over the same communication link . the cgbs 42 communicates these advisories , via the satellite 38 communication link 48 , 46 , 34 , to the aircraft 10 . in a similar fashion the cgbs 42 receives world wide weather data from the weather bureau 104 and world wide map and topographic data from the map 105 and topographic 106 databases . the cgbs 42 then , by its knowledge of the aircraft location , flight plans and operational characteristics , tailors this global weather data to weather data that is specific to each aircraft &# 39 ; s area of operation for safety and economy of flight advisories . aircraft manufacturing facilities 108 communicate with the cgbs 42 ground processor 62 via the aircraft manufacturer communication module &# 39 ; s 74 , wide band - width , fiber optic communication link 82 . since there are a number of different aircraft manufacturers they are indicated by reference numbers 108a to 108n . their concomitant emergency and maintenance advisory facilities are indicated by the reference numbers 116a to 116n . each manufacturer maintains an historical log of the aircraft 10 in service for configuration , stress , maintenance service and end of life assembly data . the manufacturers also maintain aircraft simulation capability 112 to aid in providing safety of flight advisories to aircraft 10 that are experiencing a problem . the different simulation facilities are shown by the reference numbers 112a to 112n . these advisories occur whether the problem was first surfaced by the in - air aircraft personnel , or by the on the ground monitoring personnel or by simulations at the cgbs 42 or aircraft manufacturer &# 39 ; s facility 108 . the cgbs 42 and the aircraft manufacturer &# 39 ; s facility 108 check the aircraft operational capability by remotely sampling the aircraft &# 39 ; s operational status parameters 18 , 22 , 26 , 44 and using other factors such as weather , atc information , map , and dted . the simulations utilize real - time analysis of the vehicle data and past performance to provide expert system advisories . for an aircraft that is experiencing a problem on the ground , the aircraft manufacturer &# 39 ; s facilities 108 still sample the operational status of the aircraft &# 39 ; s flight critical assemblies via the real - time , world wide , communication link 34 , 46 , 48 . the manufacturer &# 39 ; s facility 108 transmits expert system repair advisories to the aircraft &# 39 ; s 10 maintenance personnel . these include the latest approved , problem specific , service manual data to efficiently and safely correct the aircraft &# 39 ; s problem . operation of this invention , remote aircraft flight recorder and advisory system , 50 can be summarized as follows . the aircraft 10 is fitted with a smart module 14 , that accepts sensor signals 18 depicting the performance of many of the flight safety critical assemblies . it converts any of the analog sensor data 18 into a digital format . these signals are the same as those that are presently sent to the existing flight crash recorders aboard aircraft which records vital flight information such as air speed , height , attitude , landing gear status , fuel status as well as the position of the aircraft controls and latitude and longitude , which is gleaned from radio navigation aids and the inertial navigation system ( ins ), when available . unlike the existing crash recorder that must be recovered from a crash site to obtain an understanding of the cause of the crash , the system depicted in fig1 - 4 has a telemetry system to radio these signals to a world wide communication system and to a final destination known as the cgbs 42 . in addition to the standard flight sensors presently used in existing flight recorders , position and altitude 44 signals from the gps or glonass receivers , acoustical sensors 22 that record cockpit sounds , and video camera data 26 that records the passengers entering the vehicle , the states of the cargo , hull and the cockpit during flight , aircraft identification and latest configuration are also sent to smart 14 for telemetry to the cgbs 42 . the smart module 14 accepts these signals 18 , 22 , 26 , 44 and then transmits them over the uhf radio link 34 , 46 , 48 . the preferred embodiment of this invention 50 utilizes a global satellite 38 communication system . the smart module &# 39 ; s 14 uhf output is sent to a satellite antenna 30 where the signal is radioed to a satellite 38 that is in a direct line of sight with the aircraft 10 . the combined signal is then relayed , either by leo or a synchronous orbit world wide communication satellite chain , until it is transmitted to the cgbs 42 by the communication satellite 38 that is in a direct line of sight with the cgbs antenna 54 . at the cgbs 42 , these signals are archived . also , aircraft data 18 and signals 22 , 26 , 44 are distributed , utilizing fiber optic ground or satellite links , to flight controller facilities 100 , 96 and to the aircraft manufacturers 108 . it distributes the aircraft sensor data 18 , 22 , 26 , 44 to them in real - time so as to solicit their expert analysis and help in generating the advisories . real - time analysis of the pre - flight aircraft data along with other data such as weather 104 , airport and its local area map 105 , three dimensional topographical map information 106 , from data bases such as digital terrain elevation data ( dted ), atc data , wind shear , and aircraft configuration are also used in generating advisories . the smart 14 also accepts advisory signals sent from the cgbs 42 to the aircraft 10 . there are maintenance advisories and three types of in - flight advisories : emergency or safety of flight , flight efficiency or fuel economy , and flight separation . the smart module 14 receives these signals and sends maintenance advisories to an on - board maintenance communication subsystem . in - flight advisories are sent to the pilot &# 39 ; s audio system and to the pilot &# 39 ; s warning panel . thus smart 14 concentrates the audio , video , digital discrete and sensor signals to minimize the weight , power expended , cost of equipment and uhf radio antennas carried aboard the aircraft . large , commercial , passenger aircraft will be fitted with systems 50 capable of monitoring an extensive number of their performance and control signals 18 . small , private aircraft do not need such extensive monitoring and will have systems 50 capable of monitoring only a limited number of performance and control signals 18 . the remote aircraft flight recorder and advisory system 50 has been described with reference to a particular embodiment . other modifications and enhancements can be made without departing from the spirit and scope of the claims that follow . | 8 |
now , example embodiments will be described in detail with reference to the accompanying drawings . fig5 shows the configuration of base station 100 according to embodiment 1 , and fig6 shows the configuration of mobile station 200 according to embodiment 1 . to avoid complicated explanation , fig5 shows components involving srs reception closely relating to the present disclosure , and drawings and explanations of the components involving uplink and downlink data transmission and reception are omitted . likewise , fig6 shows components involving srs transmission closely relating to the present disclosure and , drawings and explanations of the components involving uplink and downlink data transmission and reception are omitted . in base station 100 shown in fig5 , srs allocation determination section 101 determines allocation of srss in the frequency domain and the time domain based on the number of pucch channels , and outputs information related to the determined srs allocation ( hereinafter “ srs allocation information ”), to control signal generation section 102 and srs extraction section 108 . the processing in srs allocation determination section 101 will be described later in detail . control signal generation section 102 generates a control signal including srs allocation information , and outputs the generated control signal to modulation section 103 . modulation section 103 modulates the control signal , and outputs the modulated control signal to radio transmitting section 104 . radio transmitting section 104 performs transmitting processing including d / a conversion , up - conversion and amplification , on the modulated signal , and transmits the resulting signal from antenna 105 . radio receiving section 106 receives srss via radio from mobile station 200 via antenna 105 , performs receiving processing including down - conversion and a / d conversion on the srss and outputs the srss after receiving processing to demodulation section 107 . demodulation section 107 demodulates the received srss and outputs the demodulated srss to srs extraction section 108 . srs extraction section 108 extracts srss allocated in the frequency domain and the time domain based on the srs allocation information received as input from srs allocation determination section 101 , and outputs the extracted srss to cqi / timing offset estimation section 109 . cqi / timing offset estimation section 109 estimates cqis and timing offset from the srss . in mobile station 200 shown in fig6 , srs code generation section 201 generates a code sequence used as an srs for measuring uplink data channel quality , that is , generates an srs code , and outputs the srs code to srs allocation section 202 . srs allocation section 202 maps the srs code to resources in the time domain and frequency domain according to srs allocation control section 208 , and outputs the mapped srs code to modulation section 203 . modulation section 203 modulates the srs code and outputs the modulated srs code to radio transmitting section 204 . radio transmitting section 204 performs transmitting processing including d / a conversion , up - conversion and amplification , on the modulated signal , and transmits the resulting signal from antenna 205 . radio receiving section 206 receives a control signal via radio from base station 100 via antenna 205 , performs receiving processing including down - conversion and a / d conversion on the control signal and outputs the control signal after receiving processing to demodulation section 207 . demodulation section 207 demodulates the received control signal and outputs the demodulated control signal to srs allocation control section 208 . srs allocation control signal 208 controls srs allocation section 202 according to the srs allocation information included in the demodulated control signal . next , the processing in srs allocation determination section 101 in base station 100 will be explained in detail . fig7 is a flow chart showing the processing steps in srs allocation determination section 101 . first , in step ( hereinafter “ st ”) 1010 , srs allocation determination section 101 determines an srs bandwidth based on the accuracy of cqi estimation and the accuracy of timing offset estimation . next , in st 1020 , srs allocation determination section 101 calculates the number of srss to be multiplexed in the frequency domain based on the system bandwidth , the number of pucch channels and the srs bandwidth . to be more specific , the number of srss to be multiplexed in the frequency domain is the maximum number of srss which can be multiplexed on the srs transmission bandwidth obtained by subtracting the pucch transmission bandwidth from the system bandwidth , and which each have a bandwidth of one transmission unit determined in st 1010 . that is , the number of srss to be multiplexed in the frequency domain is the integer part of the quotient obtained by dividing the srs transmission bandwidth by the srs bandwidth determined in st 1010 . here , the pucch transmission bandwidth is determined by the number of pucch channels , and varies according to the number of items of control data to be accommodated . next , in st 1030 , srs allocation determination section 101 first determines allocation of srss such that the srss are frequency - hopped ( frequency - multiplexed ) in the srs transmission bandwidth at predetermined time intervals . to be more specific , srs allocation determination section 101 determines that srss are mapped in the frequency domain and time domain such that the srss cover the frequency band to be subject to cqi estimation evenly and are mapped at predetermined time intervals in the time domain . fig8 a and 8b show examples of srs allocation determined in srs allocation determination section 101 . fig8 a shows a case where the number of pucch channels is two , and fig8 b shows a case where the number of pucch channels is four . in fig8 a and 8b , the srs bandwidths are determined so as to fulfill the required accuracy of cqi estimation and the required accuracy of timing offset , and are not changed even when the number of pucch channels and srs transmission bandwidth vary . further , the number of pucch channels varies between fig8 a and 8b , and therefore , the srs transmission bandwidth varies and the number of srss to be frequency - multiplexed , that is , the number of srs hopping , obtained by dividing the srs transmission bandwidth by the srs bandwidths determined in st 1010 , varies . when the number of pucch channels is two in fig8 a , the number of srss to be frequency - multiplexed is four , and , when the number of pucch channels is four in fig8 b , the number of srss to be frequency - multiplexed is three . then , as shown in fig8 , the positions where srss are frequency - multiplexed in the srs transmission bandwidth are positions to cover the srs transmission band evenly , that is , the frequency band subject to cqi estimation . this results in dividing the band in which srss are not transmitted into a number of bands having smaller bandwidths , that is , this prevents srss from being not transmitted over a specific wide range of a band , so that it is possible to reduce the deterioration of the accuracy of cqi estimation due to bands in which srss are not transmitted . in this way , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srs allocation is changed to cover a cqi estimation bandwidth with fixed srs bandwidths evenly , so that , when the pucch transmission bandwidth varies , it is possible to prevent interference between srss and pucchs while maintaining the accuracy of cqi estimation and the accuracy of timing offset estimation , and reduce the deterioration of the accuracy of cqi estimation due to bands in which srss are not transmitted . the base station and the mobile station according to embodiment 2 adopt the same configurations and basically perform the same operations as the base station and the mobile station according to embodiment 1 . therefore , block diagrams are not shown here , and the description will be omitted in detail . the base station and the mobile station according to the present embodiment are different from the base station and the mobile station according to embodiment 1 in the srs allocation determination section in the base station . the srs allocation determination section provided in the base station according to the present embodiment is different from srs allocation determination section 101 provided in the base station according to embodiment 1 in part of processing . now , the processing in the srs allocation determination section according to the present embodiment will be explained . fig9 is a flow chart showing the processing steps in the srs allocation determination section according to the present embodiment . the steps shown in fig9 are basically the same as shown in fig7 and the same reference numerals are assigned to the same steps , and therefore the explanation thereof will be omitted . the steps shown in fig9 are different from the steps shown in fig7 in having st 2030 instead of st 1030 . in st 2030 , the srs allocation determination section first calculates the time interval at which srss are mapped in the frequency domain and time domain according to the following equation 1 . if the srss are transmitted using time interval τ ( c pucch ) calculated according to equation 1 , the cqi estimation period in the cqi estimation target band is fixed even if the number of pucch channels varies . in equation 1 , t represents the cqi estimation period in the cqi estimation target band and c pucch represents the number of pucch channels . n ( c pucch ) represents the number of srss to be frequency - multiplexed , that is , the number of frequency hopping , when the number of pucch channels is c pucch . the transmission interval is based on a time slot unit , and therefore τ ( c pucch ) is a result of the value on the right hand side of equation 1 matched with a time slot . further , in st 2030 , the srs allocation determination section determines allocation of srss such that srss are frequency - multiplexed in the srs transmission bandwidth at the calculated time interval τ . to be more specific , srs allocation determination section determines to map srss so as to cover the frequency band subject to cqi estimation target evenly in the frequency domain and to cover cqi estimation period t evenly in the time domain . fig1 a and 10b show examples of srs allocation determined in the srs allocation determination section according to the present embodiment . fig1 is basically the same as fig8 and the overlapping explanation will be omitted . in fig1 a and 10b , the srs bands are not changed in accordance with a variation of srs transmission bandwidth , and srss are frequency - multiplexed so as to cover the srs transmission bandwidth evenly . further , in fig1 a , srss are mapped using time interval τ ( 2 ), and in fig1 b , srss are mapped using time interval τ ( 4 ). that is , in the present embodiment , when the number of pucch channels decreases , the srs transmission interval is made shorter and when the number of pucch channels increases , the srs transmission interval is made longer . by this means , even when the number of pucch channels varies , cqi estimation period t does not vary . in this way , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srs allocation is changed such that a cqi estimation bandwidth is covered with fixing srs bandwidths evenly . accordingly , when the pucch transmission bandwidth varies , it is possible to prevent srss and pucchs from interfering each other while maintaining the accuracy of cqi estimation and the accuracy of timing offset , and reduce the deterioration of the accuracy of cqi estimation due to bands in which srss are not transmitted . further , according to the present embodiment , when the number of pucch channels decreases , the srs transmission interval is made shorter and when the number of pucch channels increases , the srs transmission interval is made longer . by this means , when the pucch transmission bandwidth varies , it is possible to maintain a constant cqi estimation period and prevent the accuracy of cqi estimation from deteriorating . the base station and the mobile station according to embodiment 3 adopt the same configurations and basically perform the same operations as the base station and the mobile station according to embodiment 1 . therefore , block diagrams are not shown here , and the description will be omitted in detail . the base station and the mobile station according to the present embodiment are different from the base station and the mobile station according to embodiment 1 in the srs allocation determination section in the base station . the srs allocation determination section provided in the base station according to the present embodiment is different from srs allocation determination section 101 provided in the base station according to embodiment 1 in part of processing . now , the allocation of srss determined in the srs allocation determination section according to the present embodiment will be explained . fig1 a and 11b show examples of srs allocation determined in the srs allocation determination section according to the present embodiment . fig1 is basically the same as fig1 and the overlapping explanation will be omitted . in fig1 a and 11b , the srs bands are not changed in accordance with a variation of srs transmission bandwidth , and srss are frequency - multiplexed so as to cover the srs transmission bandwidth evenly . further , as shown in fig1 a and 11b , the number of srss to be frequency - multiplexed is the number of when the number of pucch channels is the maximum , regardless of whether the number of pucchs increases or decreases . here , the maximum value for the number of pucch channels is four and the number of srss to be frequency - multiplexed is three . further , as shown in fig1 a and 11b , a transmission interval between srss is the transmission interval of when the number of pucch channels is the maximum , regardless of whether the number of pucchs increases or decreases . here , the maximum value for the number of pucch channels is four and the transmission interval is represented by τ ( 4 ). according to the method as shown in fig1 , it is not necessary to calculate a transmission interval every time the number of pucch channels varies and it is possible to simplify the determination processing of srs allocation . in this way , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srs allocation is changed such that a cqi estimation bandwidth is evenly covered with fixing srs bandwidths . by this means , when the pucch transmission bandwidth varies , it is possible to prevent srss and pucchs from interfering each other while maintaining the accuracy of cqi estimation and the accuracy of timing offset , and reduce the deterioration of the accuracy of cqi estimation due to bands in which srss are not transmitted . furthermore , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srss are mapped without changing the number of srss to be frequency - multiplexed and the srs transmission interval , so that it is possible to simplify the srs allocation process . in embodiment 4 , the method of srs allocation from a plurality of mobile stations in accordance with a variation of the pucch transmission bandwidth , will be explained . the base station and the mobile station according to embodiment 4 adopt the same configurations and basically perform the same operations as the base station and the mobile station according to embodiment 1 . therefore , block diagrams are not shown here , and the description will be omitted in detail . the base station and the mobile station according to the present embodiment are different from the base station and the mobile station according to embodiment 1 in the srs allocation determination section in the base station . the srs allocation determination section provided in the base station according to the present embodiment is different from srs allocation determination section 101 provided in the base station according to embodiment 1 in part of processing . now , the allocation of srss determined in the srs allocation determination section according to the present embodiment will be explained . fig1 a and 12b show examples of srs allocation determined in the srs allocation determination section according to the present embodiment . fig1 is basically the same as fig8 and the overlapping explanation will be omitted . in fig1 a and 12b , the srs bands are not changed in accordance with a variation of srs transmission bandwidth , and srss are frequency - multiplexed so as to cover the srs transmission bandwidth evenly . further , as shown in fig1 a and 12b , in accordance with the variation of the pucch transmission bandwidth , the srs allocation determination section according to the present embodiment maps srss without changing the hopping pattern of srss in a predetermined frequency band . in other words , srs allocation to be changed is controlled so as to make different hopping patterns in the same band . to be more specific , by transmitting and not transmitting srss mapped to the specific band according to an increase and decrease of the pucch transmission bandwidth , it is not necessary to change the hopping pattern in other bands . in this way , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srs allocation is changed such that a cqi estimation bandwidth is evenly covered with fixing srs bandwidths . by this means , when the pucch transmission bandwidth varies , it is possible to prevent srss and pucchs from interfering each other while maintaining the accuracy of cqi estimation and the accuracy of timing offset , and reduce the decrease of the accuracy of cqi estimation due to bands in which srss are not transmitted . further , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srss are mapped in the frequency domain and time domain without changing the srs hopping pattern , so that , when the pucch transmission bandwidth varies , it is possible to maintain the number of srss from mobile stations to be multiplexed and the cqi estimation period in the cqi estimation target band of each mobile station . the base station and the mobile station according to embodiment 5 adopt the same configurations and basically perform the same operations as the base station and the mobile station according to embodiment 1 . therefore , block diagrams are not shown here , and the description will be omitted in detail . the base station and the mobile station according to the present embodiment are different from the base station and the mobile station according to embodiment 1 in the srs allocation determination section in the base station . the srs allocation determination section provided in the base station according to the present embodiment is different from srs allocation determination section 101 provided in the base station according to embodiment 1 in part of processing . now , the allocation of srss determined in the srs allocation determination section according to the present embodiment will be explained . fig1 a and 13b show examples of srs allocation determined in the srs allocation determination section according to the present embodiment . in fig1 a and 13b , the srs bands are not changed in accordance with a variation of srs transmission bandwidth , and srss are frequency - multiplexed so as to cover the srs transmission bandwidth evenly . further , in fig1 a and 13b , the number of srss to be frequency - multiplexed is the number of when the number of pucch channels is the minimum and is fixed regardless of whether the number of pucchs increases or decreases . in fig1 a and 13b , the minimum value for the number of pucch channels is two and the number of srss to be frequency - multiplexed is four . further , in fig1 a and 13b , while the srs transmission bandwidth varies in accordance with an increase and decrease of the number of pucch channels , the number of srss to be frequency - multiplexed is fixed , and therefore srss are mapped in the frequency domain such that a plurality of srss partly overlap . further , in fig1 a and 13b , the number of srss to be frequency - multiplexed does not change in accordance with an increase and decrease of the number of pucch channels , and therefore srs transmission intervals do not change . in this way , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srs allocation is changed such that a cqi estimation bandwidth is covered with fixing srs bandwidths evenly . accordingly , when the pucch transmission bandwidth varies , it is possible to prevent interference between an srs and a pucch while maintaining the accuracy of cqi estimation and the accuracy of timing offset , and reduce the deterioration of the accuracy of cqi estimation due to bands in which srss are not transmitted . further , according to the present embodiment , in accordance with an increase and decrease of the number of pucch channels , srs are mapped such that bands of frequency - multiplexed srss partly overlap , without changing the number of srss to be frequency - multiplexed , so that it is possible to improve the accuracy of cqi estimation more and prevent the accuracy of cqi estimation from deteriorating due to bands in which srss are not transmitted . although cases have been explained with the above embodiments where the number of pucch channels is two or four , the number is explained with examples only and the present disclosure is not limited to this . further , although cases have been explained with the above embodiments where the srs transmission bandwidth is the band obtained by subtracting the pucch transmission bandwidth from the system bandwidth , the present disclosure is not limited to this , and the srs transmission bandwidth may be a specific band varying according to an increase and decrease of the number of pucch channels . further , although cases have been explained with the above embodiments as examples where the srs bands are not changed in accordance with an increase and decrease of the number of pucch channels and the positions on which srss are frequency - multiplexed in the srs transmission band change , the present disclosure is not limited to this , and it is possible to change the positions where srss are frequency - multiplexed in the srs transmission band according to an increase and decrease of the number of pucch channels , and change the srs bandwidths . a variation of an srs bandwidth may be limited within a range in which the deterioration of the accuracy of cqi estimation and the accuracy of timing offset can be ignored , for example within ± 1 to 2 rbs , and this facilitates reducing the deterioration of the accuracy of cqi estimation . here , an rb ( resource block ) refers to a unit representing a specific range of radio resources . fig1 a shows an example where the srs bands extend in a predetermined range and the range of each extended band in fig1 a is 1 rb or less . further , to extend and contract the srs transmission band here , cazac ( constant amplitude zero auto - correlation ) sequence or cyclic extension and truncation of a sequence having the same characteristics as cazac may be adopted . further , it is possible to allocate uplink data channels for which cqis cannot be estimated using narrowband srss with the above embodiments , to mobile stations transmitting wideband srss with priority . fig1 b illustrates to explain a case where uplink data channels for which cqis cannot be estimated using narrowband srss are allocated with priority to mobile stations transmitting wideband srss . the above packet allocation method makes it possible to prevent the frequency scheduling effect from lowering . further , as shown in fig1 a , srss may be mapped so as to neighbor pucchs . further , as shown in fig1 b , allocation of srss may vary between hopping cycles . further , an srs may be named as simply a “ pilot signal ,” “ reference signal ” and so on . further , a known signal used for an srs may include a cazac sequence or a sequence having the same characteristics as a cazac . further , the srs allocation information acquired in the base station according to the above embodiments may be reported to mobile stations using a pdcch ( physical downlink control channel ), which is an l1 / l2 control channel , or using a pdsch ( physical downlink shared channel ) as an l3 message . further , in the above embodiments , dft - s - ofdm ( discrete fourier transform - spread - orthogonal frequency division multiplexing ) employed in lte may be adopted to the uplink . further , in the above embodiments , ofdm employed in lte may be adopted to downlink . further , the srs allocation information according to the above embodiments may be uniquely associated in advance with a broadcast channel , for example , pucch configuration information reported in a bch ( broadcast channel ). by this means , it is not necessary to transmit srs allocation information on a per ue basis , so that signaling overhead is reduced . for example , each ue may calculate srs allocation from the number of pucch channels as follows . now , an example of equations to calculate srs allocation from the number of pucch channels will be shown below . if the subcarrier to which an srs starts to be mapped in the frequency domain is k 0 , k 0 is represented as the following equation 2 . k 0 = k rb ( n )· n sc rb ( equation 2 ) in equation 2 , n represents the multiplexing number of an srs in the frequency domain and n sc rb represents the number of subcarriers per rb . further , k rb ( n ) represents the rb number to which the srs with frequency multiplex number n is mapped and is represented by the following equation 3 or 4 . in equations 3 and 4 , n srs represents the number of srss to be frequency - multiplexed and is represented by the following equation 5 . in equations 3 , 4 and 5 , n rb pucch represents the number of rbs included in the pucch transmission band and n rb ul represents the number of rbs included in the system band . n srs base represents the number of rbs included in the srs transmission bandwidth . in the above parameters , the parameters other than n rb pucch are system parameters , so that the system parameters can be used in a fixed manner once they are signaled or reported . accordingly , when a mobile station is given n rb pucch , srs allocation is able to be derived according to the above equation 2 to equation 5 . here , n rb pucch is the parameter determined by the number of pucch channels , so that a mobile station is able to derive srs allocation and transmit srss if the mobile station is provided the number of pucch channels from the base station . further , the mobile station may derive srs allocation from the number of pucch channels with reference to an srs allocation definition table instead of above equation 2 to equation 5 . fig1 shows an example of the srs allocation definition table . the srs allocation definition table shown in fig1 defines the rb numbers of rbs to which srss are mapped in cases where the number of pucch channels is one and four . further , t represents a transmission timing in hopping cycles . further , as shown in fig1 , the hopping patterns vary according to varying multiplexing number of srss to n . further , “-” in the table shows that srss are not allocated . by holding an srs allocation definition table , a mobile station is able to derive srs allocation and transmit srss if the mobile station is provided the number of pucch channels from the base station . further , the information uniquely associated in advance with pucch configuration information may include other srs configuration information including variable information about the above srs bandwidth and srs sequence information , in addition to the srs allocation information . further , although examples have been explained with the above embodiments where the narrowband srs bandwidths evenly cover one srs transmission bandwidth in the frequency domain , the present disclosure is not limited to this , and , with the present disclosure , one srs transmission bandwidth may be divided into a plurality of smaller srs transmission bandwidths ( hereinafter “ srs subbands ”) and the narrowband srs bandwidths may be mapped so as to cover each srs subband bandwidth evenly in the frequency domain . fig1 a and 17b show an example of a case where two srs subbands 1 and 2 are provided in one srs transmission bandwidth and three srss are mapped to each subband . in the example shown in fig1 a , the allocation and the intervals of srss mapped in srs subband 1 are changed according to the variation of a bandwidth of srs subband 1 such that cqi estimation bandwidth is covered evenly in srs subband 1 . likewise , the allocation and the intervals of srss mapped in srs subband 2 are changed according to the variation of a bandwidth of srs subband 2 such that cqi estimation bandwidth is covered evenly in srs subband 2 . further , as in the example shown in fig1 b , the bandwidths of srs subbands may vary . in this case , the allocation and the intervals of srss mapped in srs subbands may be changed on a per srs subband basis such that cqi estimation bandwidth is evenly covered . although a case has been explained as an example where the number of srs subbands is two in fig1 a and 17b , the number of srs subbands may be three or more with the present disclosure . further , although a case has been explained as an example where the number of srss in the srs subband is three in fig1 a and 17b , with the present disclosure , a plurality of srss besides three srss may be mapped in the srs subband . further , although mapping examples have been explained with the above embodiments where srss are neighboring each other evenly in the srs transmission bandwidth , in practical systems , srs bandwidths and positions where srss are allocated in the frequency domain are discrete values . therefore , cases may occur where the srs transmission bandwidth is not divided by one srs band . in this case , without using frequency allocation units that have fractions left as a remainder of division , it is also possible to map srss so as to cover the cqi estimation bandwidth evenly in the frequency domain in a range that is divisible ( fig1 a ). further , it is also possible to allocate frequency allocation units that have fractions left as a remainder of division between srss on a per frequency unit basis ( fig1 b ). here , the rb ( resource block ) in fig1 a and 18b represents an allocation unit in the frequency domain . fig1 a and 18b are examples where the srs bandwidth is 4 rbs and the srs transmission bandwidth is 18 rbs . further , although cases have been explained with the above embodiments where srss are frequency - hopped ( frequency - multiplexed ) in the srs transmission bandwidth at predetermined time intervals , the present disclosure is not limited to this , and provides the same advantage as in cases where frequency hopping is not carried out , as explained with the above embodiments . the srss in the above embodiments may be mapped in rb units or subcarrier units , and may not be limited to any unit . further , a cqi showing channel quality information may be referred to as “ csi ( channel state information ).” further , a base station apparatus may be referred to as “ node b ” and a mobile station may be referred to as “ ue .” further , although cases have been described with the above embodiments as examples where the present disclosure is configured by hardware , the present disclosure can also be realized by software . each function block employed in the description of each of the aforementioned embodiments may typically be implemented as an lsi constituted by an integrated circuit . these may be individual chips or partially or totally contained on a single chip . “ lsi ” is adopted here but this may also be referred to as “ ic ,” “ system lsi ,” “ super lsi ,” or “ ultra lsi ” depending on differing extents of integration . further , the method of circuit integration is not limited to lsis , and implementation using dedicated circuitry or general purpose processors is also possible . after lsi manufacture , utilization of a programmable fpga ( field programmable gate array ) or a reconfigurable processor where connections and settings of circuit cells within an lsi can be reconfigured is also possible . further , if integrated circuit technology comes out to replace lsi &# 39 ; s as a result of the advancement of semiconductor technology or a derivative other technology , it is naturally also possible to carry out function block integration using this technology . application of biotechnology is also possible . the disclosures of japanese patent application no . 2007 - 211548 , filed on aug . 14 , 2007 , and japanese patent application no . 2008 - 025535 , filed on feb . 5 , 2008 , including the specifications , drawings and abstracts , are incorporated herein by reference in their entirety . the present disclosure is applicable to , for example , mobile communication systems . | 7 |
before giving more details of the subject image - lift embodiment , we note the document handling arrangement shown in u . s . pat . no . 5 , 098 , 713 ; whose relevant portions are herewith incorporated herein , as exemplifying use - environment in which such an embodiment can be employed . the methods and means discussed herein , will generally be understood as constructed and operating as presently known in the art , except where otherwise specified ; likewise all materials , methods , devices and apparatus described herein will be understood as implemented by known expedients according to present good practice . document images are to be captured at the real - time transport speed of the document processor . for &# 34 ; high - speed &# 34 ; document processors , transport speed will be understood as at least 300 inches a second , or about 2000 documents / min . ; while &# 34 ; modest &# 34 ; document processors , move documents at approximately 1000 / min . ( or less as here contemplated at about 150 inches / second , track speed ). acquiring electronic representations of documents traveling non - stop at these speeds is a real challenge and requires specialized hardware and software . now we will briefly outline how a preferred image - lift embodiment works ; and thereafter take - up various sub - units thereof in more detail . in general it will be seen that our preferred &# 34 ; image - lift &# 34 ; arrangement is adapted to be incorporated into a moderate - speed document processor . &# 34 ; image - lift &# 34 ; can be performed just upstream of a set of sort - pockets , ( with a document transport means moving documents past the front / rear illumination / imaging stations ). fig3 b shows , in idealized section , a plan view of a front camera c - f embodiment , positioned on the front side of a document transport track dt . an identical rear camera ( c - r , in phantom ) will be understood as , optionally , placed opposite c - f , but offset therefrom , to illuminate and image the rear side of passing documents . this embodiment is like that of fig3 a described above , except that its lamps are modified .! camera c - f will be understood as comprising a &# 34 ; reentrantly - bent &# 34 ; fluorescent lamp t - f and a camera - detector array pcb , these being housed in housing h mounted on base plate bp . lamp t - f is optically coupled to pcb via the target - document and associated optics ( e . g . via first and second mirrors m - 1 , m - 2 plus focusing lens means fl ). the illuminating light from lamp t - f is directed onto a ( front ) side of the passing - documents ; preferably being directed via a transparent guide wall g - w which contains an image slit sl . slit sl is provided and dimensioned ( see height s h . width s w . fig4 b ) to mask - out stray light ; e . g . here understood as matching document - height ( about 5 &# 34 ; above track dt , fig4 b ) and lamp - width . wall g - w is flush with the document - confronting face of it &# 39 ; s housing , so it may guidingly contact a passing document , preventing any &# 34 ; snagging &# 34 ; thereof , and is preferably filled with clear glass or like transparent filler g - f as a &# 34 ; window &# 34 ; to allow the image of the passing document to be captured without interference from dust and like debris which may collect on the faces of guide wall g - w . as seen in enlarged plan view fig3 d , filler g - f may be smoothly reduced in diameter to conduct reflected images along image - path 1p . a second image slit sl &# 39 ; is provided to allow the image of the passing document to enter the camera housing h while restricting the entry of undesired stray light ; slit sl &# 39 ; is also preferably filled with a window of clear glass or like transparent material to prevent the entry of dust into housing h ( e . g . here sl &# 39 ; is preferably about 4 &# 34 ; by 1 / 4 &# 34 ;). as mentioned , a rear camera c - r , identical to c - f , may be disposed ( e . g . on common base plate bp ) on the opposite ( rear ) side of track dt , but offset from cf , to allow imaging of the rear face of passing documents ( e . g . see fluorescent lamp t - r thereof , in fig1 ). in such a case , the two cameras are preferably mounted on common baseplate bp ( see fig1 ) along with associated successive ( serial ) drive rollers d - 1 , d - 2 , d - 3 , d - 4 , d - 5 ( assume that each roller has a respective opposing idler roller ; such are not shown here , but are well known in the art ) to advance the documents in prescribed fashion past the illumination / imaging sites ( apertures sl ) of each camera , as known in the art . the document transport - path ( along track dt ) is suggested in fig1 : between &# 34 ; document entry &# 34 ; and &# 34 ; document exit &# 34 ; sites . the incoming document is first engaged and diverted by rollers d - 1 , d - 2 and d - 3 to pass in front of the image slits ( sl , sl &# 39 ; of the front and rear cameras ) then it is engaged by rollers d - 4 and d - 5 to extract ( exit ) the document , urging it beyond the camera , as known in the art . rollers d - 1 , d - 2 , d - 3 are disposed so as to form a &# 34 ; buffer &# 34 ; track sufficiently long that a maximum - length document ( typically 9 . 00 &# 34 ;) will have completely exited any upstream section of the machine and be completely contained within the imaging system module ( camera ). in this way , variations in document speed caused by other operations , ( such as printing ), will not affect scan - speed and so distort the image . the document is then engaged by rollers d - 4 and d - 5 to extract it from the imaging - site ( s ) and remove from the machine , as known in the art . we prefer to operate such fluorescent lamps in &# 34 ; rms current &# 34 ; mode ( as opposed to &# 34 ; ballast operation &# 34 ;); and to operate from an ac sinusoidal source , with frequency & gt ; 20 khz to avoid &# 34 ; flicker &# 34 ; and any effects that may annoy the operator . we prefer to keep the frequency & lt ; 30 khz , and to keep voltage and current as nearly sinusoidal as possible , thus minimizing undesired electromagnetic emissions and ensuring compliance with regulatory requirements . also , an optical sensor , typically silicon photodiode , is preferably positioned to monitor the light output from the lamp ; whereby output from this sensor may be used to ensure constant camera sensitivity , and obviate any need to calibrate the sensitivity of the system . each camera housing h is preferably composed of a front portion h - f ( see fig3 ) and a rear portion h - r . front portion h - f contains image mirror m - 2 and associated retaining features ( e . g . window h - s ) and image slit sl &# 39 ;. rear portion h - r ( fig2 ) is coupled to front portion h - f along coupling plane cp -- cp as known in the art . the rear portion h - r ( fig2 ) houses the first mirror m - 1 , focusing lens means fl and the detector assembly . lens fl is preferably mounted in a v - block ( vb ) and secured by a retaining clamp rc ( not shown , but known in the art ) which permits minor position adjustment , ( here , typically +± 160 &# 34 ;) to optimize image focus , as known in the art . detector assembly pcb consists of a printed circuit board on which is mounted the camera electronics ( charge - coupled photodetector ccpd , and associated circuitry as known in the art ). assembly pcb is preferably mounted to rear housing h - r via a holder or carrier cr , which is preferably designed to be mounted in &# 34 ; reversible &# 34 ; fashion ; i . e . carrier cr has an extended rim cr - r along one edge therefor , and is to be screw - fastened by one or other edge onto a prescribed surface h - l of rear portion h - r . thus , when pcb is screw - fastened to cr as illustrated in fig2 the detector is thereby positioned a fixed distance d - 0 from lens fl ; however , if pcb is screw - fastened to cr where cr is rotated by 180 degrees from its previous position , so that its &# 34 ; left side &# 34 ; becomes it &# 34 ; right side &# 34 ;, and so that rim cr - r is , now , not mounted to surface h - l ! then , the focal distance changes by the protruding length of rim cr - r ( e . g . in the preferred embodiment , by 0 . 200 &# 34 ;). this reversible mounting means is desired to allow the focal length to be altered to accommodate the wide range of variation in the focal length of commercially available lenses ( typically +/- 5 %) while continuing to maintain our desired tolerance of magnification ratio of & lt ; 2 %. board pcb is also made adjustable up / down and left / right ( e . g . in the preferred embodiment by +/- 0 . 050 &# 34 ; in each axis ) to ensure that the field of view of the camera is centered upon the detector ccfpd and that any variations in the lens fl and associated parts may be negated . the configuration of the optical path is also depicted both schematically and notionally in fig5 . note that the optical path is &# 34 ; folded upon itself &# 34 ;, as it were , by its consecutive reflections from mirrors m - 1 , m - 2 , i . e . it is &# 34 ; doubly reentrant &# 34 ;, principally to produce a smaller and more compact camera for the desired optical path length . we have calculated the optimal geometry for the separation of the active parts of the fluorescent lamp tubes , and find that , to give the best , most uniform illumination in the volume occupied by a document through the depth of the track , there is a relationship between the diameter of the tube ( e . g . here : 8 mm . ), the spacing lw of the tube sections ( preferably by tube diameter , or 8 mm , see lw , fig4 b ) and the distance to the document which gives the best uniformity and intensity ( preferably 0 . 64 × lw ± 10 %). more particularly , please note fig3 c and observe that to obtain the maximum illumination on the document from two directions each side of the image site , it is desirable to reduce the tube separation &# 34 ; lw &# 34 ; to a minimum . however , dimension &# 34 ; lw &# 34 ; can be no less than equal to the tube diameter &# 34 ; d &# 34 ;, or the tube will not function correctly . we have found illumination is achieved with a tube - to - document dimension &# 34 ; t &# 34 ; equal to approximately 0 . 64 lw plus or minus 10 %. for instance , placing the lamp ( s ) too close to the document in effect spreads the illumination ( decrease intensity ) e . g . for the indicated embodiment , not closer than about 0 . 125 inches ), while displacing them too far away ( e . g . more than 0 . 300 inches here ) will degrade illumination intensity too much ( cf . inverse square dependency ). according to a feature hereof , each fluorescent lamp is bent reentrantly ( 180 °, e . g . see fig4 a , 1 ) such that the &# 34 ; dark zones &# 34 ; at each end are substantially hidden from the passing document by the interposed medial illuminating segment of the tube . and , these &# 34 ; bends &# 34 ; may emit somewhat less intensity so they are preferably &# 34 ; hidden &# 34 ; by elevating the document track dt above them ( e . g . see fig4 a , 4b ). further , to minimize the overall height of the camera , and to make the illuminating segment of the tube ( as nearly as possible ) equal in height to the &# 34 ; tallest &# 34 ; document to be illuminated , the - illuminating segment is , itself , also preferably bent reentrantly , in the direction of beam - width ,-- thus yielding a &# 34 ; triply reentrant &# 34 ; tube configuration ( e . g . in fig1 a , 4b ; preferably , the overall length of the tubes here are approximately 17 &# 34 ;, extending 5 - 6 &# 34 ; above the base of the document track , dt , see height c - s , fig4 a ; each &# 34 ; dark zones &# 34 ; d - e being approximately 2 &# 34 ; long ; the maximum height of document to be illuminated here being 5 &# 34 ;-- this leaves about 5 - 5 . 5 &# 39 ; for the height c - s of each medial illuminating segment , after subtracting the two lower - bend portions ). this beam - width bending yields a pair of parallel illuminating tube segments t 1 , t 2 ( see fig4 b ) that symmetrically flank the image - path ( 1p , fig4 b ). workers will understand that it can be very useful to so illuminate the document - slice symmetrically , and uniformly from both sides -- according to this feature -- while also using a single bent tube e . g . vs . using two separate tubes as in fig3 a , 6a above discussed . in other instances , the dark - ends may be further bent , reentrantly , to hide them &# 34 ; behind themselves &# 34 ; to some extant e . g . as in fig4 aa , where the ends are twice so - bent , thus hiding the darker end - most dark - portions behind portions closer to the medial segment . the lamps may be mounted in any convenient manner as known in the art ( e . g . on connector brackets like p - 1 , p - 2 in fig4 a ; these being made somewhat resilient and mounted and arranged as known in the art -- not shown here ; the resilience accommodating thermal expansion and minor variations in tube dimensions / location . a hook or locating pin 12 may be provided to engage to top - bend of each lamp as indicated in fig4 a ). in any event , we find that , for such bends as the doubly - and triply - reentrant bends described , the internal radius of the bend should not be less than the radius of the tube , to ensure that the fluorescent discharge will not be affected ( e . g . disrupted ). workers will contemplate other , alternative ways of making and arranging such tubes and other means . for instance , fig7 a , 7b show , in somewhat - exploded form , a camera like that aforedescribed , with a few modifications ( assume construction essentially the same , except as otherwise noted below ). essentially , all elements are the same except for being reversed , left - to - right , and except that guide - window g - w in slit sl ( e . g . see fig3 b ) has been modified to a convergently - curved form g - w as shown in fig3 d . rear - camera c - r is rather fully exploded part , while front - camera c - f has only it &# 39 ; s detector / carrier / pcb assembly and lens exploded - away , along with clamp flc ( securing lens fl in it &# 39 ; s v - block vb , once it has been position - adjusted there ) in in conclusion , it will be understood that the preferred embodiments described herein are only exemplary , and that the invention is capable of many modifications and variations in construction , arrangement and use without departing from the spirit of the claims . for example , the means and methods disclosed herein are also applicable to other related document - illuminating / document - imaging systems . also , the present invention is applicable for enhancing other forms of imaging and related optical arrangements . the above examples of possible variations of the present invention are merely illustrative . accordingly , the present invention is to be considered as including all possible modifications and variations coming within the scope of the invention as defined by the appended claims . | 7 |
prior to the description of a preferred embodiment of the present invention , an outline of a basic constitution relating to data reception in a digital broadcast receiver to which the present invention is implemented is described referring to fig2 , 22 . fig2 is a schematic block diagram illustrating a constitution of data reception in a conventional digital broadcast receiver . a cpu 211 as a processor , a memory ( memorizing device ) 212 accessible by software operated on the cpu 211 , a tuner 217 for frequency - selecting a targeted carrier wave from received electric waves and demodulating and error - correcting the carrier wave , the tuner 217 further selecting a transport stream from the carrier wave and outputting the transport stream , and a transport stream separating apparatus 213 are mainly responsible for the data reception . doubled - line arrows in the drawing show a data flow . the transport stream separating apparatus comprises a synchronizing device 2101 , a pid filter 2102 , a descrambler 2103 , a section filter 2104 , a crc checking device 2105 , a memory output device 2106 and a pes packet filter 2107 . the pid is synonymous with a packet identifier . the synchronizing device 2101 detects leading data from the inputted ts to thereby extract and output the tsp . the pid filter 2102 outputs only the necessary tsp and discards the unnecessary tsp based on the pid of the tsp inputted from the synchronizing device 2101 . the descrambler 2103 judges the tsc of the tsp inputted from the pid filter 2102 and descrambles the data , if descrambled , and then outputs the descrambled data as ts 2102 . when the data is non - scrambled , the data is subjected to no processing and directly outputted as the ts 2102 . the section filter 2104 retrieves a section from the inputted tsp and filters a header part of the section to thereby output only the necessary section as ts 2103 and discard the unnecessary section . the crc checking device 2105 checks a crc error of the section outputted from the section filter 2104 and provides a crc check result for the section to thereby output it as ts 2104 the memory 212 from the output device 2106 . however , any section having no crc ( section whose ssi ( section syntax indicator )= 0 ) is not subjected to the crc check and directly outputted . the pes packet filter 2107 retrieves the pes packet from the inputted ts 2102 and filters a header of the pes packet to thereby output the necessary pes packet as ts 2105 from the output device 2106 to the memory 212 and discard the unnecessary pes packet . an example of obtaining the section is shown in a flow chart of fig2 . as a transport stream separating step s 221 by mean of hardware , a synchronizing step s 2201 , a pid filtering step s 2202 , a descrambling step s 2203 , a section filtering step s 2204 and a crc checking step s 2205 are provided . the step s 2201 is the synchronizing step , in which the leading data is detected from the inputted ts so that the tsp is extracted , proceeds to the step s 2202 . the step s 2202 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , proceeds to the step s 2203 . the step s 2203 is the descrambling step , in which the transport scramble control ( tsc ) of the tsp is judged so that the data , if scrambled , is descrambled , and immediately proceeds to the step s 2204 when the data is not scrambled . the step s 2204 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so that only the necessary section is retrieved and the unnecessary section is discarded , proceeds to the step s 2205 . the step s 2205 is the crc checking step , in which the crc error of the section is checked , proceeds the step s 2206 . the step s 2206 is the memory output step , in which the data processed in the steps up to s 2205 is outputted to the memory accessible by the cpu . hereinafter , preferred embodiments of the present invention are described referring to the drawings . a first preferred embodiment of the present invention is described referring to fig1 and 2 . fig1 is a schematic block diagram illustrating a constitution relating to data reception in a digital broadcast receiver according to the first preferred embodiment . in the digital broadcaster receiver , a cpu 11 as a processor , a memory ( memorizing device ) 12 accessible by software operated on the cpu 11 , a tuner 17 for frequency - selecting a targeted carrier wave from received electric waves and demodulating and error - correcting the carrier wave , the tuner 17 further selecting a transport stream from the carrier wave and outputting the transport stream , and a transport stream processing apparatus are mainly responsible for the data reception . single - lined arrows show a control flow , while double - lined arrows shows a data flow . in fig1 , a transport stream processing apparatus according to the first preferred embodiment comprises a hardware transport stream separating device 13 , a software transport stream separating device 14 , and a processing switching device 15 for switching to and from a hardware processing by the hardware transport stream separating device 13 and a software processing by the software transport stream separating device 14 in executing a transport steam separating process . the hardware transport stream separating device 13 comprises a synchronizing unit 101 , a pid filter 102 , a descrambler 103 , a section filter 104 , a crc checking unit 105 and an output unit 106 . the synchronizing unit 101 detects leading data from an inputted transport stream ( ts ) to thereby extract and output a transport stream packet ( tsp ) the pid filter ( pid filtering section ) 102 outputs only the necessary tsp as ts 101 and discards the unnecessary tsp based on pid of the tsp inputted from the synchronizing unit 101 . the descrambler 103 judges a transport scramble control ( tsc ) of the ts 101 inputted from the pid filter 102 , and descrambles data if the data is scrambled and outputs it as ts 102 , while immediately outputting the non - scrambled data as the ts 102 . the software transport stream separating device 14 comprises a section filter ( section filtering section ) 107 and a crc checking unit 108 . the processing switching device 15 comprises a section filter switching flag for switching to and from respective section filtering processes of the section filter 104 and the section filter 107 and a crc check switching flag for switching to and from respective crc checking processes of the crc checking unit 105 and the crc checking unit 108 . the section filter switching flag and the crc check switching flag both can be set by the cpu 11 . hereinafter is described how a processing switchover is executed based on states of the section filter switching flag and the crc check switching flag . when the section filter switching flag is ineffective , the section filtering is executed by the hardware transport stream separating device 13 as in the conventional technology . the section filter 104 retrieves a section from the inputted tsp and filters a header part of the section . as a result of the filtering , the section filter 104 supplies a section start log to the necessary section and outputs it as ts 103 , while discarding the unnecessary section . when the section filter switching flag is effective , the section filtering is not executed by the hardware transport stream separating device 13 , and the ts 102 is supplied with a section filtering through ( passing ) log and outputted to the memory ( memorizing device ) 12 from the output unit 106 . when the crc check switching flag is ineffective , the crc check is executed as by the hardware in the same manner as in the conventional technology . the crc checking unit 105 checks a crc error of the section in the ts 103 outputted from the section filter 104 and supplies a crc check result log to the section and outputs it as ts 104 to the memory 12 from the output unit 106 . the crc checking unit 105 , however , omits the crc check with respect to the section having no crc ( section whose ssi ( section syntax indicator )= 0 ) and directly outputs it . as an alternative constitution , the section whose crc check result is ng , may possibly be discarded . when the crc check switching flag is effective , the crc check by the hardware is omitted , and the ts 103 with no log supplied thereto is outputted to the memory 12 from the output unit 106 . next , an operation of the cpu 11 with respect to the data stored in the memory 12 is described . the cpu 11 , in the case of processing the packet stored in the memory 12 , first reads the logs appended to the top and bottom of the packet stored in the memory 12 , and the processing switchover is executed based on the state of the logs . as an alternative constitution , the processing switchover may possibly be alternatively executed referring to the section filter switching flag and the crc check switching flag of the processing switching device 15 in place of the log . in the first preferred embodiment , the processing switchover based on the log is described . in the case in which the read log includes the section start log and the crc check result log , the section is processed in the same manner as in the conventional technology . when the read log is the section filtering through ( passing ) log , the section filtering and crc check using the software are executed . upon the confirmation of the section filtering through ( passing ) log , the software transport separating device 14 reads the written packet from the memory 12 and inputs it as ts 107 to the section filter 107 . the section filter 107 retrieves the section from the ts 107 and filters the header part of the section to thereby output only the necessary section as ts 108 and discard the unnecessary section . the ts 107 constitutes ( all or a part of ) a payload part of the tsp possibly storing the section in the form of a multi - section . therefore , the software section filter 107 continues its processing until all of the sections of the written payload part are outputted as the ts 108 . as an indicator for continuing the processing , information of a length ( byte number ) of the written payload may possibly be appended to the section filtering through ( passing ) log . since the ts 107 constitutes ( all or a part of ) the payload part of the tsp , there is a possibility that the sections stored therein extend across more than one tsp . because of the possible constitution , pf ( pointer field ) information , pusi information , and the like , may possibly be appended to the section filtering through ( passing ) log . the crc checking unit 108 checks the crc error of the section ts 108 outputted by the section filter 107 , and supplies the crc check result log thereto and outputs it as ts 109 to the memory 12 . however , the section not provided with the crc ( section whose ssi ( section syntax indicator )= 0 ) is not subjected to the crc check and directly outputted . as an alternative constitution , the relevant section may possibly be discarded in the case in which the crc check result is ng . a memory region as a destination of the output from the crc checking unit 108 may be or may not be the same as a memory region as an origin of the input of the section filter 107 . when the read log does not include the crc check result log , the crc check using the software is executed . when it is confirmed that the crc check result is not included , the software transport separating device 14 reads the written packet from the memory 12 and inputs it as the ts 108 to the crc checking unit 108 . the crc checking unit 108 checks the crc error of the ts 108 and supplies the crc check result log thereto to thereby output it as the ts 109 to the memory 12 . however , the section not provided with the crc ( section whose ssi ( section syntax indicator )= 0 ) is not subjected to the crc check and directly outputted . as an alternative constitution , the relevant section may possibly be discarded when the crc check result is ng . the memory region as the destination of the output from the crc checking unit 108 may be or may not be the same as a memory region as an origin of the input of crc checking unit 108 . thus , when the transport stream separation , which was not hardware - executed , is executed by means of the software instead , the section to be written in the memory can be processed in the same manner as in the conventional technology . below is described a case , in which a section filter switching step s 204 for switching to and from the hardware processing and the software processing in the section filtering and a crc check switching step s 206 for switching to and from the hardware processing and the software processing in the crc check are included as a processing switching step s 23 . a hardware transport stream separating step s 21 includes a synchronizing step s 201 , a pid filtering step s 202 , a descrambling step s 203 , a section filtering step s 205 and a crc checking step s 207 . a software transport stream separating step s 22 includes a section filtering step s 210 and a crc check step s 211 . the step s 201 is the synchronizing step , in which the leading data is detected from the inputted ts so as to extract the tsp , proceeds to the step s 202 . the step s 202 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , proceeds to the step s 203 . the step s 203 is the descrambling step , in which the tsc ( transport scramble control ) of the tsp is judged so that the data is descrambled if scrambled while no processing is executed when the data is not scrambled , proceeds to the step s 204 . when the section filter switching flag is ineffective in the section filter switching step s 204 , the step s 205 of the hardware transport separating step s 21 is carried out , while a step s 209 is carried out when the flag is effective . the step s 205 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section . then , the step s 206 is carried out next . when the crc check switching flag is ineffective in the crc check switching step s 206 , the step s 207 of the hardware transport separating step s 21 is carried out , while the step s 211 of the software transport separating step s 22 is carried out when the flag is effective . the step s 207 is the crc checking step , in which the crc error of the section is checked , proceeds to a step s 208 . the step s 208 is a memory output step , in which the data processed in the steps up to the step 207 is outputted to the memory 12 accessible by the cpu 11 , proceeds to the step s 210 of the software transport separating step s 22 . the s 210 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section , proceeds to the step s 211 . the step s 211 is the crc checking step , in which the crc error of the section is checked , proceeds to the step s 212 . the step s 212 is the memory output step , in which the data processed in the steps up to the step s 211 is outputted to the memory 12 accessible by the cpu 11 . when the transport separating step , which was not hardware - executed , is executed by means of the software , the section to be written in the memory can be processed in the same manner as in the conventional technology . referring to fig3 through 5 , a second preferred embodiment of the present invention is described . according to the second preferred embodiment , the hardware transport stream separating device comprises a multi - section number judging unit 311 as a state judging device 36 . the multi - section number judging unit 311 counts number n of the multi - sections multiplexed in one tsp of ts 302 outputted from a descrambler 303 from the head of the payload and outputs a processing switching control signal to a processing switching device 35 so that a section larger than a multi - section threshold value n set by a cpu ( processor ) 31 and thereafter are processed on the software . the switching device 35 receives the processing switching control signal and correspondingly changes the section filter switching flag to be effective to thereby change a current setting so that a software section filter ( section filtering section ) 307 and a software crc check ( crc checking unit ) 308 are executed . when “ 0 ” is set to the multi - section threshold value , such a control operation that all of the sections are processed on the software can be executed . alternatively , when the number of the multi - sections is previously counted and the tsp larger than the multi - section threshold value is detected , such a control operation that all of the payloads are processed on the software can be also executed . in the second preferred embodiment is described a case in which a multi - section number judging step s 404 is additionally provided as a state judging step s 44 based on the flow chart of fig2 . the multi - section number judging step 404 compares the number of the multi - sections counted in a multi - section number incrementing step s 411 and the multi - section threshold value set by the cpu 31 to each other every time when a section filtering step s 407 , a crc checking step s 408 and a memory output step s 409 of a hardware transport separating step s 41 are executed . then , the multi - section number judging step 404 changes the section filter switching flag to be effective in a step s 405 when the number of the multi - sections exceeds the other to thereby switch the processing so as to proceed to a software transport separating step s 42 . when the section filter switching flag is ineffective in a section filter switching step s 406 , the step s 407 of the hardware transport separating step s 41 is carried out , while a step s 412 is carried out when the flag is effective . the step s 407 is the section filtering step , in which the section is retrieved from the inputted from the tsp and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section , moves on to the step s 408 . in the step s 408 as the crc checking step , the crc error of the section is checked . then , the s 409 is carried out next . in the step s 409 as the memory output step , the data processed in the steps up to the step s 408 is outputted to a memory 32 accessible by the cpu 31 . a step s 410 confirms if the processing of all of the sections in the inputted tsp is completed , and terminates the processing of the relevant tsp upon the confirmation of the completion . the step s 410 proceeds to the step s 411 in the presence of any unprocessed data . in the step s 411 , the number of the sections processed in the step s 41 is incremented as the number of the multi - sections as described earlier , and the step s 404 is then carried out . the step s 412 is the memory output step in which the rest of the data processed in the step s 41 is outputted to the memory 32 accessible by the cpu 31 , and a step s 413 of the software transport separating step s 42 is then carried out . the step s 413 is the section filtering step , in which the section is retrieved from the inputted data and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section . then , a step s 414 is carried out . the step s 414 is the crc checking step for checking the crc error of the section , and a step s 415 is carried out next . the step s 415 is the memory output step for outputting the data processed in the steps up to the step s 414 to the memory ( memorizing device ) 32 accessible by the cpu 31 , and proceeds to a step s 416 . the step s 416 confirms if the processing of all of the sections in the inputted data is completed . the step s 416 terminates the processing of the relevant data upon the confirmation of the completion , while returning to the step s 413 in the presence of any unprocessed data to continue the processing . further , because of the possibility that the stored sections extend across more than one tsp , an additional step in order to deal with such a constitution may possibly be provided . when the state judging step is thus additionally provided , the originally hardware - executed transport stream separating step can be dynamically switched to be executed on the software depending on the circumstances . fig5 shows a processing - time correlation in the case of processing the n number of multi - sections when n is set to the multi - section threshold value of the multi - section number judging device 36 by the cpu 31 in the present invention . the processing load is divided in such manner that the sections up to a section n are processed by a hardware transport separating device 33 , while the sections n through n are processed by a software transport separating device 34 . such a constitution can prevent a time length for the hardware to complete the entire section filtering from exceeding a time length for the tsp to be processed next to arrive . a third preferred embodiment of the present invention is described referring to fig6 and 7 . below is described , referring to fig6 , a case in which a processing time judging unit 611 is additionally provided as a state judging device 66 in the hardware transport stream processing apparatus 13 of the transport stream processing apparatus shown in fig1 . the processing time judging unit 611 measures a time point t 1 between a time point when the processing of tsp 602 outputted from a descrambler 603 starts and present , and outputs the processing switching control signal to a processing switching device 65 when the measured time point exceeds a processing - time threshold value set by a cpu 61 . a processing switching section 65 receives the processing switching control signal and correspondingly changes the section filter switching flag to be effective to thereby change a current setting so that a section filter 607 and a crc check 608 using the software are executed . such a control operation that all of the payload are processed by the software can be executed when “ 0 ” is set to the processing - time threshold value . in the third preferred embodiment is described a case in which a processing - time judging step s 704 is additionally provided as a state judging step s 74 based on the flow chart of fig2 . a step s 711 terminates the hardware transport separating step up to a step s 703 and memorizes a processing start time when the next processing starts . the processing - time judging step s 704 compares the processing - time threshold value set by the cpu 61 and a difference between a present time and the processing start time to each other . then , processing - time judging step s 704 changes the section filter switching flag to be effective in s 705 when the difference between the present time and the processing start time exceeds the other to thereby switch the processing so as to proceed to a software transport separating step s 72 . when the section filter switching flag is judged to be ineffective in a section filter switching step s 706 , a step s 707 of a hardware transport separating step s 71 is carried out next , while a step s 712 is carried out next when the flag is effective . the step s 707 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section , proceeds to a step s 708 . the step s 708 is the crc checking step , in which the crc error of the section is checked , proceeds to a step s 709 . the step s 709 is the memory output step , in which the data processed in the steps up to the step s 708 is outputted to a memory 62 accessible by the cpu 61 . a step s 710 confirms if the processing of all of the sections in the inputted tsp is completed . upon the confirmation of the completion , the processing with respect to the relevant tsp is terminated . in the presence of any unprocessed data , the step s 704 is carried out again so that the processing is continued . a step s 712 is the memory output step , in which the rest of the data processed in the step s 71 is outputted to the memory 62 accessible by the cpu 61 . then , a step of s 713 of the software transport separating step s 72 is carried out . the step s 713 is the section filtering step , in which the section is retrieved form the inputted data and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section . then , a step s 714 follows . the step s 714 is the crc checking step , in which the crc error of the section is checked , and a step s 715 follows . the step s 715 is the memory output step , in which the data processed in the steps up to the step s 714 is outputted to the memory 62 accessible by the cpu 61 , proceeds to a step s 716 . the step s 716 confirms if the processing of all of the sections in the inputted data is completed . upon the confirmation of the completion , the processing with respect to the relevant data is terminated , while the step s 713 is repeated in the presence of any unprocessed data so that the processing is continued . further , because of the possibility that the stored sections extend across more than one tsp , an additional step in order to deal with such a constitution may possibly be provided when the state judging step is thus additionally provided , the originally hardware - executed transport stream separating step can be dynamically switched to be processed on the software . a fourth preferred embodiment of the present invention is described referring to fig8 and 9 . in the fourth preferred embodiment , a pes packet filter switching flag for switching to and from the hardware processing and the software processing of the pes packet filter is provided in a processing switching device 85 , and a pes packet filter 806 is provided as a software transport stream separating device 84 . the pes packet filter switching flag can be set by a cpu 81 . a hardware transport stream separating device 83 comprises a synchronizing unit 801 , a pid filter 802 , a descrambler 803 , a section filter 804 , a crc checking unit 805 and an output unit 806 . the synchronizing unit 801 detects the leading data from the inputted ts to thereby extract and output the tsp . the pid filter 802 outputs only the necessary tsp as ts 801 and discards the unnecessary tsp based on the pid of the tsp inputted from the synchronizing unit 801 . the descrambler 803 judges the transport scramble control ( tsc ) of the ts 801 inputted from the pid filter 802 , and descrambles the data if the data is scrambled and outputs it as ts 802 , while directly outputting the data as the ts 802 without any processing if the data is not scrambled . hereinafter , the processing switchover is executed in response to the state of the pes packet filter switching flag . when the pes packet filter switching flag is ineffective , the pes packet filtering is executed by means of the hardware as in the conventional method . the pes packet filter 804 retrieves the pes packet from the inputted tsp and filters the header part of the tes packet . as a result of the filtering process , the pes packet filter 804 appends a pes packet start log to the necessary pes packet and outputs it as ts 103 , while discarding the unnecessary pes packet . the pes packet filter 804 appends a pes packet filtering through ( passing ) log to ts 102 instead of hardware - executing the pes packet filtering when the pes packet filter switching flag is effective and outputs it to a memory 82 from the output unit 805 . next , an operation of the cpu 81 with respect to the data stored in the memory 82 is described . the cpu 81 , in the case of processing the packet stored in the memory 82 , first reads the logs appended to the top and bottom of the packet stored in the memory 82 , and the processing switchover is thereby executed based on the state of the logs . as an alternative constitution , the processing switchover may be executed in response to the pes packet filter switching flag of the processing switching device 85 instead of the log . in the fourth preferred embodiment , the processing switchover based on the log is described . in the case in which the read log includes the pes packet start log , the pes packet is processed in the same manner as in the conventional technology . when the read log is the pes packet filtering through ( passing ) log , the pes packet filtering using the software is executed . when the pes packet filtering through ( passing ) log is confirmed , the software transport separating device 84 reads the written packet from the memory 82 and inputs it as ts 804 to the pes packet filter 806 . the pes packet filter 806 retrieves the pes packet from the ts 804 and filters the header part of the pes packet to thereby output only the necessary pes packet as ts 805 and discard the unnecessary pes packet . because the ts 804 constitutes ( all or a part of ) the payload part of the tsp , the software pes packet filter 806 continues its processing until the output of all of the pes packets in the written payload part as the ts 805 is completed . as an indicator for continuing the processing , the information on the length of the written payload ( byte number ) may possibly be appended to the pes packet filtering through ( passing ) log . the ts 804 constitutes the ( all or a part of ) payload part of the tsp , and the pes packets stored therein may extend across more than one tsp . because of that , the pf ( pointer field ) information , pusi information and the like may possibly be supplied to the pes packet filtering through ( passing ) log . at that time , a memory region as a destination of the output of the pes packet filter 804 may be the same as or may be different to a memory region as an origin of the input of the pes packet filter 806 . in the fourth preferred embodiment is described a case in which a pes packet filter switching step s 904 for switching to and from the hardware processing and the software processing of the pes packet filter is provided as a processing switching step s 93 . as a hardware transport stream separating step s 91 , a synchronizing step s 901 , a pid filtering step s 902 , a descrambling step s 903 and a pes packet filtering step s 905 are provided . as a software transport stream separating step s 92 , a pes packet filtering step s 907 is provided . in the step s 901 as the synchronizing step , the leading data is detected form the inputted ts and the tsp extracted . in the next step s 902 as the pid filtering step , only the necessary tsp is retrieved , while the unnecessary tsp is discarded based on the pid of the inputted tsp . in the next step s 903 as the descrambling step , the tsc of the tsp is judged , and the data is descrambled if the data is scrambled , while the step s 904 is immediately carried out if the data is not scrambled . when the pes packet filter switching flag is ineffective in the pes packet filter switching step s 904 , the step s 905 of the hardware transport separating step s 91 follows , while the step s 907 follows when the flag is effective . the step s 905 is the pes packet filtering step , in which the pes packet is retrieved from the inputted tsp and the header part of the pes packet is filtered so that the necessary pes packet is retrieved and the unnecessary pes packet is discarded . in the next step s 906 as the memory output step , the data processed in the steps up to the step s 905 is outputted to the memory 82 accessible by the cpu 81 . the step s 907 is the memory output step , in which the data processed in the steps up to the step s 903 is outputted to the memory 82 accessible by the cpu 81 . then , the processing proceeds to a step s 908 of the software transport separating step s 92 . the step s 908 is the pes packet filtering step , in which the pes packet is retrieved from the inputted tsp and the header part of the pes packet is filtered so that the necessary pes packet is retrieved and the unnecessary pes packet is discarded . in the next step s 909 as the memory output step , the data processed in the steps up to the step s 908 is outputted to the memory 82 accessible by the cpu 81 . when the transport stream separating process , which was not executed on the hardware , is executed on the software , the pes packet written in the memory can be processed in the same manner as in the conventional technology . a fifth preferred embodiment 5 of the present invention is described referring to fig1 and 11 . fig1 is a block diagram illustrating a constitution relating to data reception in a digital broadcast receiver according to the fifth preferred embodiment . in the digital broadcast receiver , a cpu 101 as a processor , a memory ( memorizing device ) 102 accessible by software operating on the cpu 101 , a tuner 107 for frequency - selecting a targeted carrier wave from received electric waves and demodulating and error - correcting the carrier wave , the tuner 17 further selecting a transport stream from the carrier wave and outputting the transport stream , and a transport stream processing apparatus are mainly responsible for the data reception . single - lined arrows show a control flow , while double - lined arrows shows a data flow . in fig1 , the transport stream processing apparatus comprises a hardware transport stream separating device 103 , a software transport stream separating device 104 , a processing switching device 105 for switching to and from the hardware and the software in the transport separating process and a state judging device 106 . the software transport stream separating device 104 comprises a pid filter 1007 , a descrambler 1008 , a section filter 1009 , and a crc checking unit 1010 . further , the processing switching device 105 is provided with a pid filtering switching flag for switching to and from the hardware processing and the software processing of the pid filter , the pid filtering switching flag being settable by the cpu 101 . as the state judging device in the hardware transport stream separating device 13 , a bit rate judging unit 1012 is provided . in the description of the present embodiment below is referred to a case in which a temporary memory tsp number judging unit 1013 , a multi - ts number judging unit 1014 , a cpu operating ratio judging unit 1015 or a pid non - equality judging unit 1016 as a state judging unit 106 is provided as the state judging device 106 . the hardware transport stream separating device 103 comprises a synchronizing unit 1001 , a pid filter 1002 , a descrambler 1003 , a section filter 1004 , a crc check 1005 and an output unit 1006 . the synchronizing unit 1001 detects the leading data from the inputted ts , and extracts and outputs the tsp . hereinafter , the processing switchover is executed based on the state of the pid filter switching flag . when the pid filter switching flag is ineffective , the pid filter 1002 outputs only the necessary tsp as ts 1001 and discards the unnecessary tsp based on the pid of the ts inputted from the synchronizing unit 1001 . the descrambler 1003 judges the tsc of the ts 1001 inputted from the pid filter 1002 , and descrambles the data if the data is scrambled and outputs it as ts 1002 . when the data is not scrambled , the data is immediately outputted as the ts 1002 without any processing . the section filter 1004 retrieves the section from the inputted tsp and filters the header part of the section . the section filter 1004 , as a result of the filtering process , supplies the section start log to the necessary section and outputs it as ts 1003 , while discarding the unnecessary section . the crc checking unit 1005 checks the crc error of the section in the ts 1002 outputted from the section filter 1004 and supplies the crc check result log thereto and outputs it as ts 1004 to a memory 102 from the output unit 1006 . however , the section having no crc ( section whose ssi ( section syntax indicator )= 0 ) is not subjected to the crc check and directly outputted . such a constitution that the section is discarded when the crc check result is ng is possibly adopted . when the pid filter switching flag is effective , the hardware transport separating process is not executed , while the tsp inputted from the synchronizing unit 1001 is outputted to the memory 102 from the output unit 1006 . the software transport separating device 104 reads the written packet form the memory 102 and inputs it as the tsp to the pid filter 1007 . the pid filter 1007 outputs only the necessary tsp as ts 1005 and discards the unnecessary tsp based on the pid of the inputted tsp . the descrambler 1008 judges the tsc of the ts 1005 inputted from the pid filter 1007 , and descrambles the data if the data is scrambled and outputs the descrambled data as ts 1006 , while directly outputting the non - scrambled data as the ts 1006 without any processing . the section filter 1009 retrieves the section from the inputted tsp and filters the header part of the section , as a result of which the section filter 1009 outputs the necessary section as ts 1007 and discards the unnecessary section . the crc checking unit 1010 checks the crc error of the section in the ts 1007 outputted from the section filter 1009 , and supplies the crc check result log to the section and outputs it as ts 1008 to the memory 102 . however , the section having no crc ( section whose ssi ( section syntax indicator )= 0 ) is not subjected to the crc check and directly outputted . such a constitution that the section is discarded when the crc check result is ng is possibly adopted . a memory region as a destination of the output from the crc checking unit 1010 may be or may not be the same as a memory region as a destination of the output of the output unit 1006 . as described , the originally hardware - executed transport stream separating step can be executed on the software , and the section to be written in the memory can be processed in the same manner as in the conventional technology . below is described a case in which the bit rate judging unit 1012 is provided as the state judging device 106 so as to switch the transport stream separating step . the bit rate judging unit 1012 judges a bit rate of the ts inputted to the synchronizing unit 1001 , and outputs the processing switching control signal to the processing switching device 105 so as to execute the transport separating process on the software when the judged bit rate exceeds a bit rate threshold value set by the cpu 101 . the processing switching device 105 receives the processing switching control signal and correspondingly changes the pid filter switching flag to be effective to thereby change a current setting so as to execute the transport separating process by means of the software . in the fifth preferred embodiment is described a case in which a pid filtering switching step s 1104 for switching to and from the processing respectively executed after the pid filtering step in the sill using the hardware and after the pid filtering step in the s 112 using the software is included as a switching step s 113 and a bit rate judging step s 1102 is included as a state judging step s 114 . as a hardware transport stream separating step sill , a synchronizing step s 1101 , a pid filtering step s 1105 , a descrambling step s 1106 , a section filtering step s 1107 and a crc checking step s 1108 are included . as a software transport stream separating step s 112 , a pid filtering step s 1111 , a descrambling step s 1112 , a section filtering step s 1113 and a crc checking step s 1114 are included . the step s 1101 is the synchronizing step , in which the leading data is detected from the inputted ts and the tsp is extracted . then , the step s 1102 is carried out next . the bit rate judging step s 1102 judges the bit rate of the ts inputted in the synchronizing step s 1101 , and changes the pid filter switching flag to be effective in a step s 1103 when the judged bit rate exceeds the bit rate threshold value set by the cpu 101 , and then , executes the processing switchover so as to proceed to the software transport separating step s 112 . when the pid filter switching flag is ineffective in the pid filtering switching step s 1104 , the processing proceeds to s 1105 of the hardware transport separating step s 111 , while proceeding to a step s 1110 when the flag is effective . the step s 1105 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , proceeds to the step s 1106 . in the step s 1106 as the descrambling step , the tsc of the tsp is judged and the data is descrambled in the case of the scrambled data , while the step s 1107 is immediately carried out in the case of the non - scrambled data . the step s 1107 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section , proceeds to the step s 1108 . the step s 1108 is the crc checking step , in which the crc error of the section is checked , proceeds to a step s 1109 . the step s 1109 is the memory output step , in which the data processed in the steps up to the step s 1108 is outputted to the memory 102 accessible by the cpu 101 . next is described a processing in the case of advancing to the software transport separating step s 112 . the step s 1110 is the memory output step , in which the data processed in the steps up to the step s 1101 is outputted to the memory accessible by the cpu , is followed by the step s 1111 of the software transport separating step s 112 . the step s 1111 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , is followed by the step s 1112 . in the step s 1112 as the descrambling step , the tsc of the tsp is judged , and the data is descrambled in the case of the scrambled data , while the next step s 1113 is immediately carried out in the case of the non - scrambled data . the step s 1113 is the section filtering step , in which the sections are retrieved from the inputted tsp and the header parts of the sections are filtered so as to retrieve the necessary section and discard the unnecessary section , is followed by the step s 1114 . the step s 1114 is the crc checking step , in which the crc error of the section is checked , is followed by the step s 1115 . the step s 1115 is the memory output step , in which the data processed in the steps up to the step s 1114 is outputted to the memory 102 accessible by the cpu 101 . when the bit rate threshold value settable by the cpu 101 is set to a maximum input ts bit rate value processable by the hardware transport stream separating device 103 , the transport separating process is switched to the software transport stream separating device 104 every time when the unprocessable ts is inputted to the hardware transport stream separating device 103 . thereby , the system can be prevented from halting , and the fail - soft transport stream processing apparatus can be provided . in the description of the fifth preferred embodiment , the section filtering and the crc check are executed subsequent to the descrambling step , however , the same effect can be achieved when the pes packet filtering is alternatively executed . a sixth preferred embodiment of the present invention is described referring to fig1 and 13 . in the sixth preferred embodiment , a temporary memory tsp number judging unit 1213 and a temporary memory section 1214 are provided as a state judging device 106 . the temporary memory tsp number judging unit 1213 judges the number of the tsp memorized in the temporary memory section 1214 for temporarily memorizing the tsp outputted from a synchronizing unit 1201 , and outputs the processing switching control signal to a processing switching device 125 so that the transport separating process is executed on the software when the judged number of the tsp exceeds a tsp threshold value set by a cpu 121 . the switching device 125 receives the processing switching control signal and correspondingly changes the pid filter switching flag to be effective to thereby change a current setting so as to execute the software transport separating process . in the fifth preferred embodiment is described a case in which a pid filtering switching step s 1305 for switching to and from the processing respectively executed after the pid filtering step in the s 131 using the hardware and after the pid filtering step in the s 132 using the software is included as a switching step s 113 and a tsp number judging step s 1303 is included as a state judging step s 134 . as a hardware transport stream separating step s 131 , a synchronizing step s 1301 , a temporary memorizing step s 1302 , a pid filtering step s 1306 , a descrambling step s 1307 , a section filtering step s 1308 and a crc checking step s 1309 are included . as a software transport stream separating step s 132 , a pid filtering step s 1312 , a descrambling step s 1313 , a section filtering step s 1314 and a crc checking step s 1315 are included . the step s 1301 is the synchronizing step , in which the leading data is detected from the inputted ts and the tsp is extracted , proceeds to the step s 1302 . the step s 1032 is the temporary memorizing step , in which the tsp outputted in the synchronizing step s 1301 is temporarily memorized . the tsp number judging step s 1303 judges the number of the tsp memorized in the temporary memorizing step 1302 for temporarily memorizing the tsp outputted in the synchronizing step s 1301 , and changes the pid filter switching flag to be effective in the step s 1304 when the judged number of the tsp is larger than the tsp threshold value set by the cpu to thereby execute the processing switchover so that the processing of the relevant tsp proceeds to the software transport separating step s 132 . when the pid filter switching flag is ineffective in the pid filtering switching step s 1305 , the step s 1306 of the hardware transport separating step s 131 is carried out , while a step s 1311 is carried out when the flag is effective . the step s 1306 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , is followed by the step s 1307 . the step s 1307 is the descrambling step , in which the tsc ( transport scramble control ) of the tsp is judged , and the data is descrambled in the case of the scrambled data . the step s 1307 immediately proceeds to the step s 1308 in the case of the non - scrambled data . the step s 1308 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the sections is filtered so as to retrieve the necessary section and discard the unnecessary section , is followed by the step s 1309 . the steps 1309 is the crc checking step , in which the crc error of the section is checked , is followed by a step s 1310 . the step s 1310 is the memory output step , in which the data processed in the steps up to the step s 1309 is outputted to a memory 122 accessible by the cpu 121 . next is described a case in which the software transport separating step s 132 is carried out . a step s 1311 is the memory output step , in which the data processed in the steps up to the step s 1302 is outputted to the memory 122 accessible by the cpu 121 , is followed by the step s 1312 of the software transport separating step s 132 . the step s 1312 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , is followed by the step s 1313 . in the step s 1313 as the descrambling step , the tsc ( transport scramble control ) of the tsp is judged , and the data is descrambled in the case of the scrambled data . the step s 1313 immediately proceeds to the step s 1314 in the case of the non - scrambled data . the step s 1314 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so as to retrieve the necessary section and discard the unnecessary section , is followed by the step s 1315 . the step s 1315 is the crc checking step , in which the crc error of the section is checked , is followed by a step s 1316 . the step s 1316 is the memory output step , in which the data processed in the steps up to the step s 1315 is outputted to the memory 122 accessible by the cpu 121 . when the tsp threshold value settable by the cpu 121 is set to a maximum tsp value memorizable by the temporary memorizing unit 1214 , the tsp can be outputted to the software transport stream separating device 124 prior to the overflow of the tsp inputted to the temporary memorizing unit 1214 . thereby , the possible overflow in the temporary memorizing unit 1214 can be prevented , and the fail - soft transport stream processing apparatus can be provided . in the description of the sixth preferred embodiment , the section filtering and the crc check are executed subsequent to the descrambling step , however , the same effect can be achieved when the pes packet filtering is alternatively executed . a seventh preferred embodiment of the present invention is described referring to fig1 and 15 . in the seventh preferred embodiment , a multi - ts number judging unit 1415 is provided as the state judging device . the multi - ts number judging unit 1415 judges the number of synchronizing units 1401 and 1406 of a hardware transport stream separating device 143 currently in the process of inputting the ts as the number of the inputted ts , at least one of the synchronizing units 1401 and 1416 being provided in the hardware transport stream separating device 143 . the multi - ts number judging unit 1415 further outputs the processing switching control signal to a processing switching device 145 so that the relevant ts is subjected to the software separating process when the judged number of the ts exceeds a multi - ts threshold value set by a cpu 141 . the processing switching device 145 receives the processing switching control signal and correspondingly changes the pid filter switching flag to be effective to thereby change a current setting so that the software transport stream separating process is executed . in the fifth preferred embodiment is described a case in which a pid filtering switching step s 1504 for switching to and from the processing respectively executed after the pid filtering step in the s 151 using the hardware and after the pid filtering step in the s 152 using the software is included as a switching step s 153 and a multi - ts number judging step s 1502 is included as a state judging step s 154 . as a hardware transport stream separating step s 151 , a synchronizing step s 1501 , a pid filtering step s 1505 , a descrambling step s 1506 , a section filtering step s 1507 and a crc checking step s 1508 are included . as a software transport stream separating step s 152 , a pid filtering step s 1511 , a descrambling step s 1512 , a section filtering s 1513 and a crc checking step s 1514 are included . the step s 1501 is the synchronizing step , in which the leading data is detected from the inputted ts and the tsp is extracted , advances to the step s 1502 . the multi - ts number judging step s 1502 judges the number of synchronizing steps of the hardware transport stream separating device 143 currently in the process of inputting the ts as the number of the inputted ts , at least one of the synchronizing steps being provided the hardware transport stream separating device 143 . the , the multi - ts number judging unit 1415 changes the pid filter switching flag to be effective in a step s 1503 when the judged number of the ts exceeds the multi - ts threshold value set by the cpu 141 so that the processing of the relevant ts is switched to advance to the software separating process s 152 . when the pid filter switching flag is ineffective in the pid filtering switching step s 1504 , the step s 1504 advances to the step s 1505 of the hardware transport separating step s 151 , while advancing to a step s 1510 when the flag is effective . the step s 1505 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , advances to the step s 1506 . the step s 1506 is the descrambling step , in which the tsc of the tsp is judged , and the data is descrambled in the case of the scrambled data . the step s 1506 executes no processing and immediately advances to the step s 1507 in the case of the non - scrambled data . the step s 1507 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so that the necessary section is retrieved and the unnecessary section is discarded , advances to the step s 1508 . the step s 1508 is the crc checking step , in which the crc error of the section is checked , advances to a step s 1509 . the step s 1509 is the memory output step , in which the data processed in the steps up to the step s 1508 is outputted to a memory 142 accessible by the cpu 141 . next is described a case in which the processing advances to the software transport stream separating step s 152 . the step s 1510 is the memory output step , in which the data processed in the steps up to the step s 1501 is outputted to the memory 142 accessible by the cpu 141 , advances to the step s 1511 of the software transport separating step s 152 . the step s 1511 is the pid filtering step , in which the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , advances to the step s 1512 . in the step s 1512 as the descrambling step , the tsc of the tsp is judged , and the data is descrambled in the case of the scrambled data and the step . the step s 1512 executes no processing and immediately advances to the step s 1513 out in the case of the non - scrambled data . the step s 1513 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so that the necessary section is retrieved and the unnecessary section is discarded . then , the step s 1514 is carried out next . the step s 1514 is the crc checking step , in which the crc error of the section is checked . then , a step s 1515 is carried out next . the step s 1515 is the memory output step , in which the data processed in the steps up to the step s 1514 is outputted to the memory 142 accessible by the cpu 141 . when the multi - ts number threshold value settable by the cpu is set to the maximum multi - ts number processable by the hardware transport stream separating device 143 , the transport separating process can be switched to the software transport stream separating device 144 when the ts exceeding a processable volume is inputted to the hardware transport stream separating device 143 . thereby , the flexibly responsive transport stream processing apparatus can be provided without adding any circuit . in the description of the seventh preferred embodiment , the section filtering and the crc check are executed subsequent to the descrambling step , however , the same effect can be achieved when the pes packet filtering is alternatively executed . an eighth preferred embodiment of the present invention is described referring to fig1 and 17 . in the eighth preferred embodiment , as the state judging device 106 , a pid judging unit 1618 is provided . the pid judging unit 1618 judges the pid of the tsp inputted from a synchronizing unit 1601 , and outputs the processing switching control signal to a processing switching device 165 so that the tsp satisfying a pid conditional expression is subjected to the software transport separating process . the switching device 165 receives the processing switching control signal and correspondingly changes the pid filter switching flag to be effective to thereby change a current setting so that the software transport separating process can be executed . in the eighth preferred embodiment is described a case in which the tsp larger than a pid threshold value set by a cpu 161 is switched to be subjected to the software transport separating process . in the fifth preferred embodiment is described a case in which a pid filtering switching step s 1704 for switching to and from the processing respectively executed after the pid filtering step in the s 171 using the hardware and after the pid filtering step in the s 172 using the software is included as a switching step s 173 and a pid judging step s 1702 is included as a state judging step s 174 . a hardware transport stream separating step s 171 includes a synchronizing step s 1701 , a pid filtering step s 1705 , a descrambling step s 1706 , a section filtering step s 1707 and a crc checking step s 1708 . a software transport stream separating step s 172 includes a pid filtering step s 1711 , a descrambling step s 1712 , a section filtering step s 1713 and a crc checking step s 1714 . the step s 1701 is the synchronizing step , in which the leading data is detected from the inputted ts and the tsp is extracted , advances to the step s 1702 . the pid judging step s 1702 judges the pid of the tsp inputted from the synchronizing unit 1601 , and changes the pid filter switching flag to be effective in a step s 1703 regarding the tsp whose pid is larger than the pid threshold value set by the cpu so that the processing of the relevant tsp is switched to advance to the software transport separating step s 172 . when the pid filter switching flag is ineffective in the step s 1704 , the step s 1704 advances to the step s 1705 of the hardware transport separating step s 171 , while advancing to a step s 1710 when the flag is effective . the step s 1705 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , advances to the step s 1706 . in the step s 1706 as the descrambling step , the tsc of the tsp is judged , and the data is descrambled in the case of the scrambled data , while the step s 1707 immediately follows in the case of the non - scrambled data . the step s 1707 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so that the necessary section is retrieved and the unnecessary section is discarded , advances to the step s 1708 . the step s 1708 is the crc checking step , in which the crc error of the section is checked , advances to a step s 1709 . the step s 1709 is the memory output step , in which the data processed in the steps up to the step s 1708 is outputted to a memory 162 accessible by the cpu 161 . next is described a case in which the processing advances to the software transport separating step s 172 . the step s 1710 is the memory output step , in which the data processed in the steps up to the step s 1701 is outputted to the memory 162 accessible by the cpu 161 , advances to the step s 1711 of the software transport separating step s 172 . the step s 1711 is the pid filtering step , in which only the necessary tsp is retrieved and the unnecessary tsp is discarded based on the pid of the inputted tsp , advances to the step s 1712 . in the step s 1712 is the descrambling step , in which the tsc of the tsp is judged , and the data is descrambled in the case of the scrambled data , while the step s 1713 immediately follows in the case of the scrambled data . the step s 1713 is the section filtering step , in which the section is retrieved from the inputted tsp and the header part of the section is filtered so that the necessary section is retrieved and the unnecessary section is discarded , advances to the step s 1714 . the step s 1714 is the crc checking step , in which the crc error of the section is checked , advances to a step s 1715 . the step s 1715 is the memory output step , in which the data processed in the steps up to the step s 1714 is outputted to the memory 162 accessible by the cpu 161 . when the pid threshold value settable by the cpu 161 is set to a maximum value usable by the pdi for psi / si , the pid for psi / si can be selectively processed by the hardware transport separating device 163 , while the data of the program equal to or over the maximum value can be selectively processed by the software transport stream separating device 164 . thereby , the processing can be selectively switched based on the pid . in the description of the eighth preferred embodiment , the section filtering and the crc check are executed subsequent to the descrambling step , however , the same effect can be achieved when the pes packet filtering is alternatively executed . a ninth preferred embodiment of the present invention is described referring to fig1 and 19 . in the ninth preferred embodiment , a cpu operating ratio judging unit 1817 is provided as the state judging device . the cpu operating ratio judging unit 1817 judges an operating ratio of the software operated on a cpu 181 as a cpu operating ratio , and outputs a control signal so as to allow the ts to be subjected to the software transport separation only when the cpu operating ratio is smaller than a cpu operating ratio threshold value set by the cpu 181 . in the fifth preferred embodiment is described a case in which a pid filtering switching step s 1904 for switching to and from the processing respectively executed after the pid filtering step in the s 191 using the hardware and after the pid filtering step in the s 192 using the software is included as a switching step s 193 and a bit rate judging step s 1902 and a cpu operating ratio judging step s 1916 is included as a state judging step s 194 . as a hardware transport stream separating step s 191 , a synchronizing step s 1901 , a pid filtering step s 1905 , a descrambling step s 1906 , a section filtering step s 1907 and a crc checking step s 1908 are included . as a software transport stream separating step s 192 , a pid filtering step s 1911 , a descrambling step s 1912 , a section filtering step s 1913 and a crc checking step s 1914 are included . the step s 1901 is the synchronizing step , in which the leading data is detected from the inputted ts and the tsp is extracted . then , the step s 1902 follows . the bit rate judging step s 1902 judges the bit rate of the ts inputted in the synchronizing step s 1901 , and advances to the cpu operating ratio judging step s 1916 when the judged bit rate exceeds the bit rate threshold value set by the cpu 181 . the cpu operating ratio judging step s 1916 changes the pid filter switching flag to be effective in a step s 1903 when the cpu operating ratio is smaller than the cpu operating ratio threshold value so that the processing is switched to advance to the software transport separating step s 192 . when the pid filter switching flag is ineffective in the pid filter switching step s 1904 , the step s 1905 of the hardware transport separating step s 191 follows , while a step s 1910 follows when the flag is effective . the step s 1905 as the pid filtering step retrieves only the necessary tsp and discards the unnecessary tsp based on the pid of the inputted tsp , and then advances to the next step s 1906 . the step s 1906 as the descrambling step judges the tsc of the tsp , and descrambles the data in the case of the scrambled data , while immediately advancing to the step s 1907 in the case of the non - scrambled data . the step s 1907 as the section filtering step retrieves the section from the inputted tsp and filters the header part of the section to thereby retrieve the necessary section and discard the unnecessary section , and then advances to the step s 1908 . the step s 1908 as the crc checking step checks the crc error of the section , and then advances to a step s 1909 . the step s 1909 as the memory output step outputs the data processed in the steps up to the step s 1908 to the memory 182 accessible by the cpu 181 . next is described a case in which the processing advances to the software transport separating step s 192 . the step s 1910 as the memory output step outputs the data processed in the steps up to the step s 1901 to the memory 182 accessible by the cpu 181 , and then advances to the step s 1911 of the software transport separating step s 192 . the step s 1911 as the pid filtering step retrieves only the necessary tsp , while discarding the unnecessary tsp based on the pid of the inputted tsp , and then advances to the next step s 1912 . the step s 1912 as the descrambling step judges the tsc ( transport scramble control ) of the tsp , and descrambles the data in the case of the scrambled data , while immediately advancing to the step s 1913 in the case of the non - scrambled data . the step s 1913 as the section filtering step retrieves the section from the inputted tsp and filters the header part of the section to thereby retrieve the necessary section while discarding the unnecessary section , and then advances to the step s 1914 . the step s 1914 as the crc checking step checks the crc error of the section , and then advances to a step s 1915 . the step s 1915 as the memory output step outputs the data processed in the steps up to the step s 1914 to the memory 182 accessible by the cpu 181 . as described , when the operating state of the cpu 181 is added to the elements for judging the switchover of the hardware transport stream separating device 183 to the software transport stream separating device 184 , such a situation that other software processing may be broken down due to a processing load of the software transport stream separating device 184 can be prevented . further , in the description of the ninth preferred embodiment , the section filtering and the crc check are executed subsequent to the descrambling step , however , the same effect can be achieved when the pes packet filtering is alternatively executed . while the invention has been described and illustrated in detail , it is to be clearly understood that this is intended be way of illustration and example only and is not to be taken by way of limitation , the spirit and scope of this invention being limited only be the terms of the following claims . | 7 |
as noted above , the object of the present invention is to distribute information . this information is transmitted over , for example , telephone lines and converted on the client site into video signals similar to those for television reception . the information subscribed to takes the form of pages of market data , various portions of which are updated from time to time to reflect changes in the market , and subsequently presented on a video display . in a first embodiment of the invention , the video signals representing the market information are being transmitted asynchronously , that is , there are no set characteristic times ( e . g . television field and frame rates ) to restrict the transmission . as shown in fig1 pages 10 of market data are each given individual page key ( pk ) codes , for example &# 34 ; page 203 &# 34 ; and &# 34 ; page 7677 &# 34 ;. these pages 10 are then applied to an encoder 12 for application to a video transmission line 14 . video displays 16 are shown connected to the transmission line 14 for receiving the encoded pages 10 . as shown , each of the video displays 16 has a unique display identification ( id ) code , for example 217 , 503 , 123 and 417 , as shown . fig2 shows a diagram representing the video signals transmitted over the video transmission line 14 . since these signals are in the form of television signals , it should be understood that the video signals for each page of market information is in the form of a sequence of video lines which , when scanned on the video displays , form the relevant pages . as shown in fig2 a first line 20 of the transmission includes an encoded signal flag indicating to the video displays 16 that the following information is encoded data . the exact form of the flag is unimportant since the information contained is just one bit . hence , the flag may be similar to , but not identical to , the vertical synchronizing signal indicating the beginning of each field of information . the line or lines 22 contain enable reception messages . the lines 24 following the enable reception message lines 22 , contain the various updates 1 , 2 and 3 . fig3 a shows a sample enable reception ( er ) message line 22 in detail . following a horizontal synchronizing pulse 30 , an er synchronizing signal 32 is sent indicating the ensuing transmission of enable reception messages and enabling decoders to synchronize to the transmission . the er sync . signal 32 is followed by id / pk conversion pairs 34 each of which includes one of the unique display id codes and one of the individual page key ( pk ) codes for which the display identified by the display code is authorized to receive . in the example shown , the pairs 417 / 7677 , 503 / 203 and 123 / 7677 indicate that video display 417 is authorized to receive page 7677 , display 503 , page 203 ; and display 123 , page 7677 . it should be noted that in the example , display 417 is not authorized to receive either page 203 or page 7677 . the enable reception message continues for as many lines ( each including an er sync . signal 32 ) and includes as many pairs 34 as are required to associate each of the authorized displays with one of the ( many ) subscribed to pages . the process for updating each page is performed by replacing &# 34 ; tiles &# 34 ; in the relevant page . as shown in fig4 the cross - hatched tile 36 to be updated is located by two row and two column ( or two x - y pixel pair ) coordinates . fig3 b - 3f show samples of the data enable sequences , in which , in fig3 b , the sequence for the update of page 7677 is illustrated . in particular , after a horizontal synchronizing pulse 40 , a data synchronizing signal 42 is present . this sync . signal 42 , which indicates the ensuing transmission of a data enable sequence , is followed by the individual page code 44 for the page 7677 and then the coordinates 46 of the tile 36 to be replaced which , in this example , is 4 rows by 40 columns . the actual data for this tile 36 is presented in a series of lines , corresponding to the number of rows in the tile to be updated , following the data enable sequence line . similar examples are shown for pages 203 and 7677 in fig3 c and 3d , in which in page 203 , a tile of 1 row and 11 columns is updated , and again in page 7677 , a second tile of 6 rows and 40 columns is updated . alternatively , as shown in fig3 e , the update data may appear on the same line as the data enable sequence . in particular , the sync . signal 42 &# 39 ; is followed by the individual page code 44 . however , the coordinates 46 &# 39 ; include the pixel start number and the pixel stop number of a single row of the update data , along with the line number of the particular line . the update data 48 then follows on the same line . each tile 36 is then composed of the update data 48 appearing in , for example , a plurality of consecutive lines . further , as shown in fig3 f , the update data may be presented simultaneously on one line for more than one page at a time . in particular , the sync . signal 42 &# 34 ; is followed by two page codes 44 &# 34 ; , and then the coordinates 46 of the tile 36 to be replaced , which in this example , is 5 rows by 80 columns , toward the bottom of pages 203 and 7677 . additionally , all authorized displays connected to the video transmission may be simultaneously updated at the same coordinates by using a special page key , e . g . pk = 0 . an encoder for the first embodiment of the invention is shown in fig5 . the encoder includes a modem 50 for receiving data from a source of market information . this data may be in the form of entire pages of financial information where portions are updated , or the update data itself along with information for the positioning of the update data on the respective display screen . the output of modem 50 is connected to an interface 51 , which is , in turn , connected to the input of a microcomputer 52 . the microcomputer 52 reassigns the data to appropriate locations in new pages for clients of the provider . a keyboard 53 is connected to the microcomputer 52 for controlling the microcomputer . a memory 54 is connected to the microcomputer 52 and supplies thereto the configuration of the new pages , the individual page key ( pk ) code for each of the new pages , and the display ( id ) codes of the clients authorized to receive each of the new pages . based on this information , the microcomputer 52 generates the first data stream and the sequence of second data streams . the output of the microcomputer 52 is applied through an interface 55 , to a video generation unit 56 which reconfigures the output of the microcomputer into video lines . the video generation unit 56 also generates the encoded signal flag and inserts the various synchronizing signals at the beginning of each of the video lines . a clock signal generator 57 is connected to the video generation unit 56 and the microcomputer 52 for applying timing signals thereto at the line frequency . in the event that the financial information applied to the modem 50 is in the form of entire pages , a memory 58 is connected to the microcomputer 52 into which the pages are entered enabling the microcomputer 52 to compare one page with the update of the page to extract therefrom only the update data . fig6 is a block diagram of a decoder for use with the encoder of fig5 . the decoder includes a receiver 60 for receiving the data transmitted by the video generation unit 56 . the output of the receiver 60 is applied to an analog switch 61 for selective application to an output display in the event that standard non - coded signals are being transmitted . a coded signal detector 62 is coupled to the receiver 60 for receiving the encoded signal flag and for switching the analog switch 61 accordingly . an er detection gate 63 is connected to the receiver 60 for receiving the enable reception messages containing the display id / individual pk code pairs . each of the received display id codes are compared with a unique display id code stored in a rom 64 by a comparator 65 . upon each match of the display id code , the individual pk code for the respective page is stored in a memory 66 . the output of the receiver 60 is further connected to a data detection gate 67 for receiving the data enable sequences . the individual pk codes in the received data enable sequences are compared in a comparator 68 with the individual pk codes stored in the memory 66 . upon a match of one of these pk codes , the accompanying coordinates of the update data are loaded into registers 69 . an analog - to - digital converter 70 digitizes the appropriate update data at the output of the receiver 60 and applies its output to a write buffer 71 , which also receives the output of the registers 69 . the output of the write buffer 71 is applied to a picture store 72 in which the section therein corresponding to the location of the update data is updated . a synchronizing signal detector 73 is connected to the output of the receiver 60 for separating the line synchronizing signals . the output of the synchronizing signal detector 73 is applied to a timing and control signal generator 74 for generating timing signals for the analog - to - digital converter 70 , the data detection gate 67 , the er detection gate 63 and the picture store 72 . the output of the picture store 72 is applied to a digital - to - analog converter 75 controlled by the timing and control signal generator 74 . the output of the digital - to - analog converter 75 is applied through a low - pass filter 76 to another input of the analog switch 61 . in a second embodiment of the invention , the video signals representing the market information include three colors . in addition , standard television signals are included in the video signals for selective viewing of realtime television on the video displays . this transmission is necessarily synchronous to the chosen television standard . assuming that the video signals are being transmitted by cable , resulting in a usable bandwidth of approximately 24 mhz . fig7 shows a pictorial representation of the transmitted video signals . the encoded signal flag line 80 , the enable reception messages lines 81 and the data enable sequence lines 82 are transmitted during the vertical blanking interval 83 between each field of the video signal . during the active video portion of the field , in a first half of each scanning line , the television r , g and b signals 84 , each originally having a bandwidth of 4 mhz . and each time compressed by a factor of six to an expanded bandwidth of 24 mhz ., are sequentially transmitted . in the second half of each scanning line , the update data for individual pages of the market information are transmitted . while the television signals 84 are in color , the update information may be monochromatic , color or a mixture of both . in particular , as shown , the first 8 half - lines contain the update monochrome data 85 for the left half and right halves , respectively , for page 7677 . the update data 85 for page 7677 is followed by the update data 86 for page 203 . the update data 86 is presented in color as the three color signals r , g and b . the remainder of the right half of the first field is shown as being unused in this example . the left half of the second field contains the g , b and r components of the television signals 78 &# 39 ;. the right half of the second field contains the monochromatic update data for the pages 208 , 1234 , 5 , 19154 and 264 . due to the complex ordering of the update data in the first and second fields , the data enable sequences in the lines 82 must necessarily be more complex than those shown in fig3 b - 3f . in addition , the enable reception messages must indicate which of the video displays is authorized to receive the television signals sent with the update data . in particular , as shown in fig8 a , the enable reception messages are similar to those shown in fig3 a , with the exception that in addition to the display id code / identification pk code pairs , the messages include a pair 87 indicating which of the video displays , for example , the display with display id code 297 , is authorized to receive the television signals tv1 . fig8 b shows a sample data enable sequence which includes , in addition to that described with respect to fig3 b - 3f , the coordinates of the update data in the source field . fig8 c shows a sample of the data enable sequence for identifying the television signals , and includes a data synchronizing signal 88 , a television pk code 89 and the starting coordinates 90 of the three color signals -- red , green and blue . fig9 shows a block diagram of an encoder for the second embodiment . the video generation unit 56 &# 39 ; has a second set of inputs for receiving the three color components of the television signals . in particular , a source of video signals is connected to a synchronizing signal separation circuit 91 for detecting the vertical and horizontal synchronizing signals in the video signals . the source of the video signals is also connected to a matrix circuit 92 for providing the three color components . each of these components is subjected to a 6 : 1 compression in compression circuit 93 and the three components are then applied to the video generation unit 56 &# 39 ;. the clock signal generator 57 &# 39 ; applies horizontal and vertical synchronizing signals to both the video generation unit 56 &# 39 ; and the microcomputer 52 &# 39 ;, and receives the synchronizing signals from the separation circuit 91 for synchronization therewith . fig1 shows a block diagram of a decoder for the second embodiment . components the same as those in fig6 are designated with the same reference number . the decoder is substantially similar as the decoder of the first embodiment with the exception that the decoder is now capable of processing color signals and the encoded data selectively includes television signals . in particular , a color decoder 101 is included between the output of the receiver 60 and the input of the analog switch 61 . 1 - 61 . 3 . the register 69 &# 39 ; includes a register element for storing the number of the picture store . the synchronizing signal detector 73 &# 39 ; outputs field synchronizing signals in addition to line synchronizing signals . the write buffer 71 &# 39 ; now accesses three picture stores 72 . 1 - 72 . 3 corresponding to the three color components , red , blue and green . the outputs of these picture stores 72 . 1 - 72 . 3 are applied to three digital - to - analog converters 75 . 1 - 75 . 3 , and then to three low - pass filters 76 . 1 - 76 . 3 for application to the other inputs of the three analog switches 61 . 1 - 61 . 3 . numerous alterations of the structure herein disclosed will suggest themselves to those skilled in the art . however it is to be understood that the embodiments herein disclosed are for purposes of illustration only and not to be construed as a limitation of the invention . all such modifications which do not depart from the spirit of the invention are intended to be included within the scope of the appended claims . | 7 |
the preferred embodiments provide improved methods for detecting defects in subjects &# 39 ; eyes as well as methods for correcting such defects . a preferred embodiment may operate by examining a candidate red eye region , looking in its neighborhood or vicinity for a possible yellow , white and / or golden patch belonging to the same eye , and , if any , under certain conditions correcting one or both of the red - eye or golden patch . using a technique in accordance with a preferred embodiment , the quality and acceptability of automatic eye correction can be increased for half red - half white / golden defects . implementations of the preferred embodiments can take advantage of the red part of the eye defect being detected by one automatic red - eye detection processing method , perhaps utilizing a conventional technique or a new technique , so the detection of the non - red regions can be applied as a pre - correction stage , and so that this method may take full advantage of existing or new detection methods . the correction parts of such red - eye processing may be altered to implement a technique in accordance with a preferred embodiment , while non correction parts preferably are not altered . a technique in accordance with a preferred embodiment may provide a qualitative improvement in image correction with relatively little processing overhead making it readily implemented in cameras that may have limited processing capability and / or without unduly effecting the camera click - to - click interval . it will be seen that pixels belonging to a red - eye defect may be corrected by reducing the red value of the pixel . as an example , image information may be available in luminance - chrominance space such as l * a * b * color space . this may involve reducing the l * and a * value of a pixel to a suitable level . in many cases , reduction of the a * value may automatically restore the chrominance of the eye thus restoring a true value of the iris . however , for white / golden pixels of a half red - half white / golden eye defect , the l and possibly b characteristics of the pixel may also be either saturated and / or distorted . this means that unlike red eye defects , in these cases the original image information may be partially or even totally lost . the correction may be performed by reducing the overall l * value as well as reduction of the a * and b *. however , because l * may be very high , the chrominance may be very low , thus there may not be significant color information remaining . in an additional preferred embodiment , correction of the white / golden portion of the defect involves reconstructing the eye , as opposed to the restoration described above from information from the corrected red eye portion of the defect . referring now to fig3 , a digital image 10 may be acquired 30 in an otherwise conventional manner and / or utilizing some innovative technique . where the embodiment is implemented in a device separate from a device such as a camera or scanner on which the image was originally acquired , the image may be acquired through file transfer by another suitable means including wired or wireless peer - to - peer or network transfer . otherwise the image correction process described below , if suitably speed optimized , can either be implemented within the image acquisition chain of the image acquisition device for displaying a corrected image to a user before the user chooses to save and / or acquire a subsequent image ; or alternatively , the image correction process can be analysis optimized to operate in the background on the image acquisition device on images which have been stored previously . next , during red - eye detection 32 , red - pixels 20 are identified and subsequently grouped into regions 22 comprising a plurality of contiguous ( or generally contiguous ) pixels ( see , e . g ., fig2 ). these regions can be associated 34 with larger bounding box regions 12 , 14 , 16 , 18 ( see , e . g ., fig1 ). the candidate regions contained within these bounding boxes are then passed through a set of filters 36 to determine whether the regions are in fact red - eye defects or not . examples of such falsing filters are disclosed in u . s . pat . no . 6 , 873 , 743 . one possible reason a filtering process might reject a candidate region , such as a region of red - pixels 20 as illustrated at fig2 , is that it lacks the roundness expected of a typical red - eye defect . such regions as well as regions failed for other suitable reasons may be preferably passed as rejected regions 38 for further processing to determine if they include a half red — half white / golden eye defect — and if so for the defect to be corrected accordingly . much of the operation of this processing can be performed in parallel with other red - eye processing ( in for example a multi - processing environment ) or indeed processing for each rejected region could be carried out to some extent in parallel . processing in accordance with an exemplary embodiment which may be involved in checking for half red - half white / golden eye defects is outlined in more detail as follows : 1 . the bounding box 12 - 18 of an already detected red part of the eye artifact is searched 40 for a point , say 26 ( see fig2 ) having : a . high intensity ( i & gt ; threshold ) b . high yellowness ( b & gt ; threshold ) c . low redness ( a & lt ; threshold ) in this example , it is assumed that the image information for a region is available in lab color space , although another embodiment could equally be implemented for image information in other formats such as rgb , ycc or indeed bitmap format . if such a point does not exist , then stop ( i . e ., the decision is taken that no white / golden patch exists in the vicinity of the red area ) and confirm that the region is to be rejected 42 . 2 . starting from a point detected in step 40 , grow 44 a region 24 ( see fig2 ) based on luminance information , for example , if luminance is greater than a threshold , a point is added to the white / golden region 24 . if the region 24 exceeds a predefined maximum allowable size , step 46 , then stop and confirm that the region is to be rejected 42 . the maximum allowable size can be determined from a ratio of the bounding box area vis - à - vis the overall area of the red 22 and white / golden region 24 . 3 . yellowness and non - pinkness of the white region are then assessed 48 by checking that average b value exceeds a relatively low threshold , and the difference between average “ a ” and average “ b ” is lower than a given threshold . if at least one test fails , then stop and confirm that the region is to be rejected 42 . 4 . in this embodiment , the increase of roundness of the combination of initial red 22 and detected white / golden regions 24 from the original red region 22 is checked 50 . thus , the roundness of the union of the red and white / golden regions is computed and compared with that of the red region 22 . if roundness is less than a threshold value or decreased or not increased sufficiently by “ adding ” the white / golden region 24 to the red one 22 , then stop and reject the region 42 . roundness of a region is preferably computed using the formula prior to assessing roundness , a hole filling procedure is preferably applied to each region 22 , 24 to include for example pixel 28 within the union . 5 . if the region passes one or more and preferably all of the above tests , it is added to the list of confirmed red - eye regions . at this point , the red part of the eye defect can be corrected 52 in any of various manners , for example , by reducing the a value of pixels in lab color space , while the pixels that were corrected are marked to be used in further processing . 6 . for white / golden regions that were added to the list of red - eye defect regions , further correction of the white / golden portion of the defect can be applied , after some further checks . one such check is to detect glint 54 . in rgb space , glint candidates are selected as high luminance pixels ( for example , min ( r , g )& gt ;= 220 and max ( r , g )== 255 ). if a very round ( e . g ., in one or both of aspect ratio and elongation ), luminous , and desaturated region is found within the interior of the current “ red ∪ white ” region 22 , 24 , its pixels may be removed from the “ pixels - to - correct ” list . the glint may be the entire high luminance region but in most cases only a small part of the high luminance region will satisfy the criteria for glint pixels . 7 . where a glint is not detected or is small relative to the size of the white / golden region , the non - red eye artifact pixels 24 can be corrected 56 preferably taking color information from red pixels 22 which where already corrected at step 52 , if such information after the correction exists . alternatively , the correction can be done by reduction of the luminance value . in the preferred embodiment , color information is derived from a selection of ex - red pixels with l and b values which lie in the median for that region ( between the 30 % and 70 % points on a cumulative histogram for l and b ). these color samples ( from the already corrected red part of the eye ) are used to create the same texture on both the red and non - red defect parts of the eye . it should be noted that the l and b histograms may be generally available from preprocessing steps , for example , those for determining various thresholds , and won &# 39 ; t necessarily have changed during correction as the red correction may just involve reducing the a value of a pixel . it is possible that the correction of the red - eye region and the one for the high intensity region may show an unpleasant seam between the regions . in an alternative embodiment , the corrected region will be smoothed in such a manner that the seams between the two regions if exist , will be eliminated . the present invention is not limited to the embodiments described above herein , which may be amended or modified without departing from the scope of the present invention as set forth in the appended claims , and structural and functional equivalents thereof . in methods that may be performed according to preferred embodiments herein and that may have been described above and / or claimed below , the operations have been described in selected typographical sequences . however , the sequences have been selected and so ordered for typographical convenience and are not intended to imply any particular order for performing the operations . in addition , all references cited above herein , in addition to the background and summary of the invention sections , are hereby incorporated by reference into the detailed description of the preferred embodiments as disclosing alternative embodiments and components . | 6 |
referring now to the drawings wherein like numerals have been used throughout the several views to designate the same or similar parts , a lifting jack assembly 1 in accordance with one embodiment of the present invention is shown in fig1 - 4 . in general , the lifting jack 1 includes an elongated standard 2 disposed in substantially upright position on a base 3 and having a platform 4 adjustably connected to the upper end portion of the standard 2 by an adjustment means or member 5 . the base 3 includes an elongated , tubular central body portion 6 disposed in substantially upright position at the inner ends of three legs 7 , 8 and 9 , which project radially outward therefrom in substantially equally spaced relation therearound . each of the legs 7 , 8 and 9 may include an adjustment member 10 mounted in the outer end portion thereof , and vertically adjustable relative thereto for leveling , or adjusting the position of the base 3 . although it is preferred to have each leg include an adjustment member 10 , it is only necessary that two of the legs include an adjustment member for proper leveling of the jack assembly 1 . as shown in fig3 each of the adjustment members 10 embodies an elongated bolt 11 threadedly engaged in the outer end portions 33 , 34 and 35 of a respective one of the legs 7 , 8 and 9 , with each of the bolts 11 having a foot or base portion 12 disposed at the lower end thereof for engaging the floor or other supporting surface on which the base 3 is mounted , and a knob 13 mounted on the upper end portion thereof for rotating the bolt 11 to thereby adjust the vertical position thereof in the respective one of the legs 7 , 8 and 9 . the elongated standard 2 embodies a lower end portion or member 14 and an upper end portion or member 15 , which are releasably and adjustably connected together in a manner which will hereinafter be discussed in greater detail . the lower end portion 14 of the standard 2 is a substantially straight tubular member having an outside diameter of such size that the lower end portion thereof may be disposed in the body portion 6 of the base 3 with a relatively snug , but freely slidable fit . a bolt 16 is threaded into and extends through the sidewall of the body portion 6 of the base 3 in such position that it may be rotated into and out of the body portion 6 and into and out of abutting , securing relation to the portion of the lower end portion 14 of the standard 2 disposed in the base 3 . the upper end portion 15 of the standard 2 embodies a lower end 17 ( fig2 ) which is of such external size or cross - section that it may be received in the upper end portion of the lower end portion 14 of the standard 2 with a snug , but freely slidable fit . lower end 17 may be of substantially the same length as the standard 2 to provide maximum extended length of the jack 1 or a proportionally shorter length thereof , as desired . a bolt 18 is fitted into a nut 19 , mounted on and secured to the outer face of the sidewall of the lower end portion 14 , the bolt 18 extending through the lower end portion 14 of the standard 2 in position to be moved into and out of abutting relation with the lower end portion 17 of the upper end portion 15 of the standard 2 upon rotation of the bolt 18 . a handle 20 preferably is mounted on the outer end portion of the bolt 18 for facilitating rotation of the bolt 18 . the upper end portion 15 of the standard 2 includes an upper end member 21 , connected to the lower end portion 17 by an intermediate portion 22 , fig2 . the upper end member 21 includes an internally threaded bore 23 , fig4 extending substantially vertically there - through in axial alignment with the lower end 17 of the upper end portion 14 . the adjustment member 5 embodies a bolt or feed screw 24 extending through and threadedly engaged with the bore 23 in the end portion member 21 , the feed screw 24 having an enlarged head 25 on the upper end portion thereof , which is rotatably mounted in an upwardly opening recess 26 in the upper face of a connector member 27 , fig4 the connector member 27 being secured to the lower face of the platform 4 by suitable means such as bolts or screws 28 , fig2 to thereby retain the head 25 of the feed screw 24 in the recess 26 . the connector member 27 has an elongated member or shaft 29 projecting downwardly therefrom in parallel relation to the feed screw 24 , and extending through an opening 30 in the upper end 21 of the upper end portion 15 of the standard 2 , fig4 for preventing rotation of the platform 4 around , or with the feed screw 24 relative to the standard 2 . rotation of the feed screw 24 relative to the bore 23 in opposite directions is effective to raise and lower the feed screw 24 and the elongated member 29 in the bores 23 and 30 , respectively , between raised and lowered positions , such as , for example , the positions shown in broken and solid lines , respectively in fig2 . a member , preferably in the form of a handle 31 , is mounted on the lower end of the feed screw 24 for effecting such rotation of the latter and thereby adjusting the vertical position of the platform 4 relative to the standard 2 . in the lifting jack assembly 1 , the bore 23 and the feed screw 24 preferably extend through the end 21 of the upper end portion 15 of the standard 2 in axial alignment with the lower end 17 of the upper end portion 15 and with the lower end portion 14 of the standard 2 , fig2 . the intermediate portion 22 of the upper end portion 15 of the standard 2 is offset laterally relative to the upper end 21 and lower end 17 of the upper end portion 15 , as well as to the handle 31 , to thereby permit the handle 31 to be readily rotated for manually turning the feedscrew 24 in the bore 23 . however , it will be seen that , even with the intermediate portion 22 of the upper end portion 15 of the standard 2 thus disposed in laterally outwardly projecting position , with the upper end 21 and the lower end 17 of the upper end portion 15 of the standard 2 disposed in substantially vertical , axial alignment with each other and with the lower end portion 14 of the standard 2 , a stable , balanced support for the platform 4 is afforded . as will be appreciated by those skilled in the art , with the lifting jack 1 constructed in the aforementioned manner , a readily operable effective lifting jack is afforded for supporting and raising and lowering articles , such as , for example , cabinets and the like , and such operation may be readily effected by one person . thus , for example , if the jack 1 is to be used to support a wall cabinet , or the like , in position to be secured to a wall , the handle 20 may be turned to release the engagement of the screw 18 with the upper end portion 15 of the standard 2 and thereby permit the upper end portion 15 of the standard 2 , together with the platform 4 mounted thereon , to be raised or lowered to the appropriate desired position of the platform 4 . the cabinet , not shown , may then be disposed on the platform 4 in position to be supported thereby and by rotating one or more of the members 10 on the base 3 , the position of the base 3 relative to the underlying supporting surface may be adjusted to thereby dispose the platform 4 , and , therefore , the cabinet , not shown , in the desired position relative to the horizontal . thereafter , the handle 31 , and , therefore , the feed screw 24 , may be rotated in the proper direction to thereby raise or lower the feed screw 24 and the platform 4 , relative to the standard 2 , to thus position the platform 4 and the cabinet , or the like , disposed thereon at the proper elevation with respect to the wall surface . then the user may readily use the selected tool or drill from the tool or drill holder 38 , which is conveniently mounted on the standard 2 , to secure the cabinet onto the wall surface . after the cabinet has been secured to the wall surface , the handle 31 may be rotated to lower the platform 4 out of supporting relation to the cabinet , and the lifting jack 1 may be removed for use with another cabinet . in fig5 a modified form of the present invention is shown , and parts which are the same as parts shown in fig1 - 4 are indicated by the same reference numerals , and parts which are similar to but are different from parts shown in fig1 - 4 are indicated by the same reference numerals with the suffix &# 34 ; a &# 34 ; added thereto . thus , it will be seen that in fig5 a lifting jack 1a is shown , which is substantially the same in construction as the jack 1 , shown in fig1 - 4 , except that the lower portion 14 of the standard 2 has been eliminated and one leg 9a of the base 3a does not have an adjustable member 10 mounted thereof but , instead , has a stationery member 10a , which may be an integral part of the leg 9a , disposed thereon . the jack 1a is intended for use , primarily , in operations where the bottom of the cabinet , or the like , being installed , is not disposed a substantial distance above the supporting surface , or where the relatively extensive vertical adjustment afforded between the end portions 14 and 15 of the standard 2 are not necessary , such as , for example , when a cabinet is being installed above a previously installed cabinet . in the operation of the jack 1a , the base 3a may be disposed on the available supporting surface , such as , for example , the top of a previously installed cabinet , and the end portion 17 of the standard 2a may be mounted directly into the body portion 6 of the base 3a , and secured in position therein by tightening the bolt 16 . thereafter , the cabinet , or the like , may be mounted on top of the platform 4 , and the level thereof adjusted by adjusting the adjustment members 10 in the legs 8 and 9 to the necessary position . the handle 31 may then be turned in the proper direction to rotate the screw 24 and raise or lower the platform 4 to thereby dispose the cabinet , or the like , at the desired elevation above the supporting surface on which the base 3a is mounted . after the cabinet , or the like , has been secured in position , the platform 4 may be lowered out of engagement therewith by rotation of the handle 31 in the proper direction and the lifting jack 1a may be removed from the proximity of the latter . from the foregoing , it will be seen that the present invention affords a novel lifting jack which is particularly well adapted for use in operations such as , for example , supporting wall cabinets , and the like , in proper position , during installation operations relative thereto . in addition , it will be seen that the present invention affords a novel lifting jack which enables a single user to support and install articles , such as , for example , wall cabinets . also , it will be seen that the present invention affords a novel lifting jack which is practical and efficient in operation , and which may be readily and economically produced commercially . thus , while i have illustrated and described the preferred embodiments of my invention , it is to be understood that these are capable of variation and modification , and i therefore do not wish to be limited to the precise details set forth , but desire to avail myself of such changes and alterations as falls within the purview of the following claims . | 8 |
fig1 is a schematic diagram of the system of one embodiment of the invention . an atm 100 is installed on an attachment plate 104 embedded within a platform 102 . a number of bollards 106 may also be installed in platform 102 to protect the atm 100 from unintentional damage . attachment plate 104 has an attachment surface 110 that is exposed through an upper surface of platform 102 . platform 102 includes a curb 122 which rises above the ground level and underlying concrete 120 that forms a base for the curb 122 . attachment plate 104 includes a pair of side panels 114 coupled to the attachment surface 110 . in one embodiment , this coupling is at a generally right angle . the distal end of side panels 114 couples to retention panels 116 . as can be seen in fig1 , side panels 114 effectively vertically displace retention panels 116 relative to attachment surface 110 . in some embodiments , this displacement is selected to be greater than the height of curb 122 . typically , the curb 122 will be eight inches in height . thus , side panels 114 will generally provide a vertical displacement in excess of nine inches and , in one embodiment , twelve inches has been found to be a desirable vertical displacement . generally , platform 102 will be formed from rebar reinforced concrete . in some embodiments , attachment plate 104 includes rebar tie - ins to tie into the rebar reinforcement in the concrete . additionally , because the retention panels 116 are embedded beneath a significant volume of concrete , the attachment plate is generally resistant to being pulled from the ground . as an additional measure , in some embodiments , steel set rod bolts 118 may be driven deeper into the concrete 120 and engage retention panels 116 to increase the stability of the attachment plate within platform 102 . in one embodiment , rod bolts 118 are eighteen inches long . attachment plate 104 also includes a plurality of sleeves 112 coupled below attachment surface 110 . the plurality of sleeves are arranged to align with attachment points defined by atm 100 . in some embodiments , only sleeves to accommodate a particular manufacturer &# 39 ; s atm may be provided . in alternative embodiments , sleeves are provided for configurations of all or a subset of existing commercially available atms such that for any installation only a portion of the sleeves will actually be used . in one embodiment , all the sleeves are dimensionally the same . in one embodiment , the sleeves are threaded to receive attachment bolts . typically , the sleeves are greater than eight inches in length . in one embodiment the sleeves are nine inches long . it is generally desired that the sleeves be greater than ½ inch in diameter and sleeves to receive ¾ inch grade 8 or grade 9 bolts are used in one embodiment of the invention . in one embodiment , ¾ inch grade 8 bolts 6 ″ long have been found satisfactory . such bolts resist up to 250 , 000 pounds of pressure before shearing . in one embodiment the sleeves are nine inches long . finally , attachment plate 104 includes a pull box defining a chamber 130 to retain power and ground connections for the atm 100 . chamber 130 is watertight to prevent damage to the electrical equipment contained therein . in one embodiment , attachment plate 104 is fabricated in , for example , a machine shop and shipped to the installation location . in one embodiment , a ½ inch steel plate is bent to form attachment surface 110 , side panels 114 and retention panels 116 . alternatively , the different panels may be joined by welding . in both cases the panels are deem “ coupled ” together as the term is used herein . the entire plate 104 may be powder coated to prevent corrosion . in one embodiment , the chamber 130 is formed from ⅛ ″ steal panels welded to a ½ plate . cylindrical sleeves are then welded to the underside of attachment surface 110 . the sleeves may be drilled and tapped to thread them for the receipt of appropriate bolts . the arrangement of sleeves on the underside is selected to be consistent with the attachment points defined by existing commercially available atms . the pull box defining chamber 130 may also be welded to the underside of attachment surface 104 in a location not occupied by the sleeves 112 . fig2 is a schematic diagram of an overhead view of one embodiment of the invention prior to atm installation . attachment surface 110 is exposed through platform 102 . retention panels 116 are vertically displaced by side panels 114 from attachment surface 104 and embedded within platform 102 . steel rod bolts 118 further engage retention panels 116 to hold the plate within the platform . sleeve openings 202 , which correspond to a diebold atm , are shown as one representation . other sleeve openings 200 , which correspond to other atm vender attachment point schemes , are shown as a different representation in this figure . however , this is merely for illustration as in most embodiments the opening 200 , 202 will be dimensionally identical . in this example , 21 sleeve openings in total are shown . different embodiments may have more or fewer sleeves depending on the number of atm models to be accommodated by the particular embodiments . in some embodiments , a pressure sensitive alarm switch 230 may be exposed on the attachment surface . the switch 230 will trigger a security alert or alarm responsive to pressure changes such as the removal or attempted removal of the atm once the alarm is armed . also represented schematically is a conduit 232 for power , a conduit 234 for data and a conduit 236 for the security system are shown running to chamber 130 . in one embodiment , the power conduit 232 is 2 ″ in diameter and the other two conduits 234 , 236 are 1 ″ in diameter . once attachment plate 104 is embedded in platform 102 , the installation of an atm thereon is relatively simple . by way of example , installing a diebold atm on attachment plate , one would align the attachment points of the diebold machine with the sleeve openings 202 and drive four bolts , one into each sleeve to secure the machine 100 to the plate 104 . thereafter , it is a matter of connecting power , data and security . optionally , the atm may also be welded to expose metal of the attachment surface 110 . fig3 is a schematic diagram of a bottom view of an attachment plate of one embodiment of the invention . the box defining chamber 130 defines an opening 332 for attachment of a power conduit and opening 334 for attachment of a data conduit . internally , the chamber may be divided to separate the power and data components such that noise on the power line does not interfere with data interchange . in one embodiment , side panels 114 define rebar tie - ins 312 , such as through perforations in the side panel 114 such that rebar 310 can pass there through in its integration with the concrete . additionally , the rebar 310 may be tied 314 in to one or more of the sleeves 112 , such as by welding thereto . alternatively , in some embodiments , the sleeves may be manufactured to include an eyelet to receive the rebar . by tying into the rebar embedded within the concrete , the attachment plate is further secured therein . generally , for a particular site , the platform is formed and the attachment plate embedded prior to cure of the concrete . then the atm may be bolted and optionally welded thereto . should it become desirable to switch out the atm , no reinstallation of the plate is required . the old atm is merely unbolted , and the new one aligned and bolted in place . in some embodiments , the plate can be retrofitted for anew atm configuration . in such embodiment , a 2 ″× 2 ″ square is cure in the installed plate at the location of the attachment points . then after coring the concrete with a 3 ″ drill bit a new threaded shaft is inserted and welded in place . the shaft may then be back filled with epoxy to complete the retrofit . once installed as described it has been found that dislodging the atm is nearly impossible using the tactic that have been employ in the rash of atm thefts in recent years . in the foregoing specification , the invention has been described with reference to the specific embodiments thereof . it will , however , be evident that various modifications and changes can be made thereto without departing from the broader spirit and scope of the invention as set forth in the appended claims . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense . | 6 |
fig1 a - 1 b and 5 a - 5 b show the principle of the alignment of the invention as implemented in an ophthalmic apparatus , which is a tonometer 1 and aligned to an eye 2 to be examined by means of directing light beams 3 a and 3 b on the retina 4 . two light beams 3 a and 3 b can be seen in the figure in order to make the illustration simpler . in a real solution , there are usually four light beams even if the invention also can work by using fewer or more light beams , even by using one single light beam . in fig1 a and 5 a , the tonometer is not correctly aligned as the light beams 3 a and 3 b do not hit the retina 4 and the instrument is inclined . in fig1 b and 5 b , the tonometer is correctly aligned as the light beams 3 a and 3 b hit the retina 4 . the tonometer 1 is close to the eye 2 and in it there is a probe 5 , which is shot toward the eye , the intraocular pressure being calculated from the movements of the probe 5 , or the variations in the movements . the movement is created in a conventional manner magnetically with the aid of coils inside the tonometer 1 , which are not shown here , and of a rod / wire of magnetic material , which goes inside the coil . of course there are other ways to create the movement and the way to perform it is outside the scope of this invention . it is , however , important for the achieving of a correct result that the probe 5 approaches the eye 2 in the correct angle since the measurement is very sensitive for errors otherwise . the probe 5 has a tip ( here using the same reference number for the probe and its tip ) on its end and is surrounded by a cup - like support 6 fastened to the outer frame 7 of the tonometer 1 . in the support 6 , there is a hollow space for a channel or space 15 ( see fig2 a , 2 b , 2 f , 3 a , 3 b , 3 f , 4 a and 4 b ) for the probe 5 to move through the support 6 and out from an opening 12 ( see fig2 a , 2 b , 2 f , 3 a , 3 b , 3 f , 4 a and 4 b ) in it . in a measurement situation , the probe 5 enters the eye through the opening 12 on the edge of the support 6 . in fig1 a and 1 b , showing a first embodiment of the invention , the support 6 also has small point - formed uncoated areas , spaces and / or openings 8 a , 8 b for light channels 9 a , 9 b ( see fig2 a , 2 b , and 20 for transporting the light beams 3 a and 3 b or the light to be directed onto the retina 4 of the eye 2 to be seen as points of light by the patient . in fig5 a and 5 b , showing a second embodiment of the invention , the support 6 has a ring - formed uncoated areas , space and / or opening 8 a for light channels 9 a , 9 b ( see fig3 a , 3 b , 3 f , 4 a and 4 b ) for transporting the light beams 3 a and 3 b or the light to be directed onto the retina 4 of the eye 2 to be seen as a ring of light by the patient . fig2 a - 2 f present schematically a first embodiment of the invention , wherein the light channels are formed by thin tubes 9 a and 9 b through which light beams illustrated by 3 a and 3 b proceed through openings 8 a and 8 b on the cup - like support 6 . the opening 12 for the probe 5 can also be seen . instead of being hollow tubes , the channels can consist of diffusive material . when looking at the light channels 9 a and 9 b of the tonometer 1 from the front , the light channels 9 a and 9 b visually give rise to a pattern of points of light , which can be seen by the user when the tonometer is aligned . the light sources 10 a and 10 b , which preferably consist of light - emitting diodes ( leds ), are placed at the instrument end of the light channels 8 a and 8 b ( the end of the support facing the instrument ). they are used to produce the light beams 3 a and 3 b to be transported through the light channels 9 a and 9 b and out therefrom to hit the retina 4 . the support 6 is in fig2 a and 2 b connected to the instrument through an intermediate piece 13 , to which the light sources 10 a and 10 b might be fastened . the way of connecting the light sources and the support 6 to the tonometer or to each other is known technic for one skilled in the art and not relevant for the invention itself . there can be another number of light sources than two . the important thing is just to install the light sources 10 a and 10 b so that they can produce the light to the support 6 or inside the light channels 9 a and 9 b . the light channels 9 a and 9 b are in fig2 a and 2 b placed inside the cup - like support 6 . in fig2 a , the patient ( or user ) is not looking straight to the probe 5 of the instrument , i . e . the tonometer 1 , and the tonometer 1 is therefore not aligned . the visual axis 11 is not parallel with the light beams 3 a and 3 b because it forms an angle α to the light beams 3 a and 3 b ( and to the movement direction of the probe 5 ). as a consequence , the user cannot see the points of light since the light beams 3 a and 3 b are not directed on the retina 4 . in fig2 b , the patient or user is looking straight to the probe 5 of the instrument , i . e . the tonometer 1 , and the tonometer 1 is therefore aligned . the visual axis 11 is now parallel with the light beams 3 a and 3 b because the angle α to the light beams 3 a and 3 b is zero . the user can now see the points of light since the light beams 3 a and 3 b are directed perpendicular to the retina 4 . in fig2 c , the user can not see any points of light since the tonometer 1 is not aligned . the angle to the visual field is completely outside a scope within which any points of light could be seen and therefore , any points cannot be seen at all . in fig2 d , a part of the points of light can be seen , even if the tonometer 1 is not correctly aligned . the alignment of the light beams 3 a and 3 b from the tonometer 1 is within the scope of the visual field even if not parallel and therefore only a part of the points 8 a ′, 8 b ′ of light can be seen . the points of light 8 a ′, 8 b ′ can be seen at the openings 8 a and 8 b on the cup - like support 6 . fig2 e is a view showing that all the points of light 8 a ′, 8 b ′, 8 c ′ and 8 d ′ ( when having four light channels ) are visible for the user when the tonometer 1 is aligned and the visual axis is parallel with the light beams 3 a and 3 b . fig2 f is a partial view showing the cup - like tip support 6 with openings 8 a , 8 b and 8 c for the light channels 9 a , 9 b and 9 c and an opening 12 for the probe 5 . the channels 9 a , 9 b and 9 c are inside the support 6 and therefore drawn by dotted lines . fig3 a - 3 d present schematically a second embodiment of the invention , wherein one light channels 9 a is formed by means of a transparent inner ring - formed space throughout a non - transparent support 6 , the transparent inner ring - formed space forming the light channel 9 a through which the light proceeds as illustrated by fig3 a and 3 b . in fig3 a - 3 d one ring is used , but if desired , several rings or several geometric forms can be used . there are other possibilities to form a ring - formed channel ( or some other geometric form ). an example is to use a support described in fig4 a and 4 b and have the support made of diffuse material or by means of a hollow support having a non - transparent surface material and by leaving a part of the surface uncoated or without non - transparent material allowing the light to pass . if this part has the form of the ring , the user can see a ring of light when looking at the instrument from the front side as long as the instrument is aligned . a further possibility is to make use of an extra body piece inside the support , by means of which or on which the channel or channels are formed . if the light channel has the form of a cylinder like in fig3 a - 3 e , the light channel 9 a is ring - like from the patient &# 39 ; s view when seen from the front . thus , the light channel 9 a gives rise to a ring of light to be seen by the patient . if using an extra body piece , the non - transparent part of the body piece and the transparent body peace can be manufactured separately and then connected together . like in fig2 a , there is the situation in fig3 a that the patient or user is not looking straight to the probe 5 of the instrument , i . e . the tonometer 1 and the tonometer 1 is therefore not aligned . the visual axis 11 of the eye is not parallel with the light beam 3 a because it forms an angle α to the light beam 3 a . as a consequence , the user can not see the ring of light ( at least not completely ) since the light beam 3 a is not directed on the retina 4 . in fig3 b , the patient or user is looking straight to the probe 5 of the instrument , i . e . the tonometer 1 , and the tonometer 1 is therefore aligned . the visual axis 11 is now parallel with the light beam 3 a b because the angle α to the light beams 3 a and 3 b is zero . the user can now see the ring of light since the light beam 3 a is directed perpendicular to the retina 4 . fig3 c is a view showing a ring 9 a ″ of light visible for the user when the tonometer 1 is aligned and the visual axis is parallel with the light beam 3 a . in fig3 d , a part of the ring 9 a ′″ of light can be seen , even if the tonometer 1 is not correctly aligned . the alignment of the light beam 3 a from the tonometer 1 is within the scope of the visual field even if not parallel and therefore only a part of the ring of light can be seen . the ring of light can be seen at the light channel 9 a in the cup - like support 6 . in fig3 e , the user can not see any ring of light at all since the tonometer 1 is not aligned . the angle to the visual field is completely outside a scope within which any light could be seen and therefore , the ring can not be seen at all . fig3 e is therefore the same as fig2 c . fig3 f is a partial view showing the cup - like tip support 6 inside which there is a transparent inner space or part forming a light channel 9 a through which the light beam can proceed . there is a space formed for the probe 5 as well within which it can move and an opening 12 from which it can come out from the support 6 . fig4 a - 4 d presents schematically a third embodiment of the invention , wherein the light channels 9 are formed by the openings 8 a and 8 b themselves on the support allowing points of light to be seen by the user as in the first embodiment of fig2 a - 2 d . as in this third embodiment , however , there are no tubes to form the light channels . the points by light to be seen by the user are instead a result of that the space inside the support 6 is lightened or if being compact and of diffusive material , the support 6 itself is lightened or illuminated with leds or other light sources 10 a and 10 b . the support 6 of the probe 5 is in this case coated which non - transparent material by having one or more openings or uncoated areas in the coating 14 . if a support 6 with a non - transparent coating 14 is used , the support 6 is permeable for light only at the openings 8 a and 8 b ( only two can be seen in the figure but there can be m more of them or only one ) and therefore they form “ channels ” for the light to be transported out . the opening can preferably be a continuous ring around the surface of the support on such a place that its size corresponds to at least approximately the size of the pupil so that the light would hit the retina via the cornea . in that case there is only one opening 8 a . the material of the support 6 is selected so that the support 6 can act like a diffuser , i . e . it diffuses , spreads out or scatters light in a manner . the surface 14 of the diffuse support 6 that is used can be of or can be coated with a material impermeable for light but leaving the channels ( or openings ) uncoated . the geometry of the support 6 prevents the light beams to enter the retina when the device is inclined or is not parallel with the visual axis . in fig4 a , the patient or user is not looking straight to the probe 5 of the instrument , i . e . the tonometer 1 , and the tonometer is therefore not aligned . the visual axis 11 is not parallel with the light beams 3 a and 3 b or light beam because it forms an angle α to the light beams 3 a and 3 b or light beam . as a consequence , the user can not see the points of light or the ring of light since the light beams 3 a and 3 b are not directed on the retina 4 . in fig4 b , the patient or user is looking straight to the probe 5 of the instrument , i . e . the tonometer 1 , and the tonometer 1 is therefore aligned . the visual axis 11 is now parallel with the light beams 3 a and 3 b because the angle α to the light beams 3 a and 3 b is zero . the user can now see the points of light since the light beams 3 a and 3 b are directed perpendicular to the retina 4 . if in the embodiment of fig4 a and 4 b , point - like openings 8 a and 8 b are used , then the visual views in the correct and incorrect alignment situations correspond to the situation in the first embodiment and are presented in fig2 c - 2 e . if in the embodiment of fig4 a and 4 b , a ring - like opening 8 a and 8 b are used , which is the preferred embodiment , then the visual views in the correct and incorrect alignment situations correspond to the situation in the second embodiment and are presented in fig3 c - 3 e . | 0 |
the prior art nozzle depicted in fig1 shows a schematic cross section taken in the vertical plane of a nozzle 10 where the nozzle receives pressurized exhaust gas 6 from a gas turbine engine ( not shown ) through a conduit 12 . the conduit 12 terminates in a collar portion 14 having a generally spherical external surface 16 . the collar 14 includes a rearwardly facing opening 18 for discharging the exhaust gas into the nozzle outlet 20 . the nozzle 10 further includes a gimbal ring 22 disposed about the collar 14 and including two opposed gimbal pivots 24 , 26 for supporting the gimbal ring 22 relative to the nozzle static structure 28 . the gimbal pivots 24 , 26 lie along a gimbal axis 30 shown in the vertical plane of fig1 and which passes through a center point 32 defined by the collar spherical surface . 16 . the gimbal ring 22 supports upper and lower clamshells 34 , 36 which are independently pivotable about a common axis 38 oriented both perpendicular to the gimbal axis 30 and transverse to the nozzle center line 40 . the common axis 38 passes through the collar spherical surface center point 32 and is shown coincident therewith in the vertical cross section of the fig1 . clamshells 34 , 36 are independently pivotable to achieve a varying nozzle throat dimension 42 in order to provide the optimum nozzle outlet area for efficient thrust production . thrust vectoring in the vertical plane may be achieved by orienting the clamshells 34 , 36 asymmetrically with respect to the nozzle center line 40 so as to bias the flow of discharged gas 8 relative thereto . the embodiment of fig1 also includes upper and lower divergent flaps 44 , 46 for providing a properly divergent gas flow path downstream of the nozzle throat 42 . the divergent flaps 44 , 46 are pivotably secured by linear hinges 48 , 50 of the respective upper and lower clamshells 34 , 36 . the divergent flaps 44 , 46 in cooperation with a pair of spaced apart fixed side walls 59 ( only one being shown ) define a divergent gas flow path aftward of the nozzle throat 42 for ensuring efficient expansion of the exhaust gas 8 , especially for supersonic flow nozzles 10 . the divergent flaps 44 , 46 are independently movable relative to the associated clamshell components 34 , 36 and may thus be positioned to vary the divergent angle as well as the pitch thrust angle of the discharged gases 8 . outer fairing flaps 56 , 58 provide a smooth exterior surface for airflow about the aircraft , and are hinged adjacent the upper and lower gimbal pivots 26 , 24 as shown . as noted the upper and lower clamshells 34 , 36 have generally spherical interior surfaces 68 , 70 that maintain a uniform spacing with regard to the spherical surface 16 of the collar 14 . the nozzle 10 provides seals 72 , 74 which will be described in greater detail hereinbelow disposed between the clamshell spherical surfaces 68 , 70 and the collar spherical surface 16 for preventing the flow of exhaust gas 6 therebetween or the loss of coolant for cooling the components of nozzle 10 . while the clamshells 34 , 36 slide relative to the collar spherical surface along the vertical and horizontal axes , they attempt to maintain a uniform spacing over the entire range of motion but because of the hostile environment in which these components operate , it is difficult to keep this uniform spacing . in accordance with this invention and as best seen in fig3 and 4 , the seals 72 and 74 are fabricated in hemispherical rings that include a semi circular front ring 76 and a complementary shaped backing plate 78 . a plurality of small diameter high temper wire bristles 80 , say 0 . 003 inch diameter , haynes 25 , are sandwiched between the front ring 76 and backing plate 78 and the rear end extends substantially to the outer diameter thereof . the bristles at point 81 are bonded in a suitable manner , say by brazing , to the front ring 76 and backing plate 78 to form an integral seal member 72 and 74 . each of the seal members 72 and 74 are clamped in the annular recess 77 formed between the end of the convergent flap 35 , adjacent to the downward extending flange portion 82 axially spaced from the end of clamp member 84 . the ends of front ring 76 and backing plate 78 remote from the working ends of the bristles extend to the back wall of recess 77 . clamp member 84 may be attached to the outer surface of the convergent flap 35 by the machine bolt 86 that threadably engages internal threads formed in the convergent flap . this allows the easy removal of the seal for maintenance purposes . an o - seal 88 may be inserted in the end of the convergent flap 35 to further reduce leakage . as noted from fig3 the seal is oriented relative to the gas stream in the nozzle such that the high pressure faces the bristles and forces the bristles against the backing plate . this assures that the bristles will be in sliding relation and hence in sealing relation with the spherical surface of the collar for every condition over the entire operating envelope of the nozzle 10 . although this invention has been shown and described with respect to detailed embodiments thereof , it will be appreciated and understood by those skilled in the art that various changes in form and detail thereof may be made without departing from the spirit and scope of the claimed invention . | 5 |
according to the present invention there is provided a new method in which a protein having at least two derivatisable pendant groups ( being side chains of amino acyl units ) is reacted with a derivatising reagent in aqueous solution to provide a protein derivative , and is characterised in that the derivatisation reaction is carried out in the presence of an effective denaturing concentration of a denaturant . preferably the degree of substitution of the product at said pendant groups is at least two equivalent groups per mole of protein . in the method there is usually a subsequent step in which protein derivative is isolated from the denaturant , preferably by a method including a dialysis step . in the invention , the denaturant may be a chaotropic ion , such as i − or scn − , a large anion derived from a strong acid , such as clo 4 − or ccl 3 coo − , an organic solvent , urea or a derivative such as a guanidine compound . preferably it is an amphiphilic compound , more preferably an anionic amphiphile . the anionic amphiphile is preferably a sulphate mono ester of an alcohol having 8 to 24 carbon atoms . preferably it is added to the reaction mixture in the form of an alkali metal salt . preferably the amphiphile is a sodium or potassium c 8 - 24 alkyl sulphate , most preferably sodium dodecyl sulphate . in the invention the amphiphile is generally present at a concentration in the range 0 . 0001 to 0 . 01m , most preferably in the range 0 . 0005 to 0 . 005m , most preferably about 0 . 001m . in the invention , the starting protein has at least 2 , more preferably at least 5 , for instance 10 or more derivatisable groups , all of the same nature . the groups may be hydroxyl groups , thiol groups , carboxylic acid groups or , preferably primary amine groups . most preferably the derivatisable groups are side chains of lysyl units . preferably the protein , therefore , has at least 2 , more preferably at least 5 , for instance 10 or more lysine units in the backbone . preferably at least 2 reactive groups are derivatised more preferably at least 5 reactive groups are derivatised , that is the degree of derivatisation of the protein is at least 5 . in the invention , the derivatising reagent is a compound having a reactive group suitabic for reacting with protein in aqueous solution , optionally in the presence of coupling compounds . coupling compounds and activation chemistries are described in , for instance , methods in enzymology at 135b ( immobilised enzymes and cells ), 1987 , mosbach ed , academic press inc ., new york and in nucci , m . l . et al . adv . drug delivery reviews 6 , 133 - 151 ( 1991 ). the reagent is , for instance , a compound used to confer stability , reduce immunogenicity or increase circulation time or solubility of a protein , or to target the protein . it may be an oligomeric or polymeric compound , such as an oligo - or polysaccharide , poly ( hydroxyalkyl ( alk ) acrylamide or -( alk ) acrylates ), polyvinyl alcohol or polyalkylene glycol , eg polyethylene glycol . the derivatising reagent may , for instance , be an activated polyethylene glycol ( monofunctional ), such as tresyl - peg described in wo - a - 9004606 or a succinimidyl succinate ester of peg . these compounds may react with hydroxyl and thiol groups as well as amine groups . the present invention is of particular utility where the derivatising reagent to be reacted with primary amine pendant groups is an aldehyde compound . in this case , condensation of the protein with the reagent under reducing conditions produces a secondary amine - linked product . most preferably the aldehyde compound is a derivative of a saccharide or polysaccharide , for instance produced by the controlled oxidation of an alcohol . most preferably the aldehyde is generated in a preliminary step which may be a first step in the process of the invention , in which a saccharide or polysaccharide is reacted under controlled oxidation conditions , for instance using sodium periodate , in aqueous reaction . most preferably the saccharide or polysaccharide is sialic acid , or a derivative thereof , most preferably a polysaccharide having a terminal sialic acid group , and most preferably is a polysialic acid , that is a polysaccharide comprising at least 5 sialic acid units joined to one another through 2 → 8 or 2 → 9 linkages . a suitable polysialic acid has a weight average molecular weight in the range 2 to 2000 kda , preferably in the range 5 to 50 kda . most preferably the polysialic acid is derived from a bacterial source , for instante being , or being derived from , polysaccharide b of e . coli k1 , n . meningitidis , moraxella liquefaciens or pasteurella aeruginosa or k92 polysaccharide of e . coil k92 strain . it is most preferably colominic acid from e . coil k1 . it is believed that proteins having at least 5 pendant polysialic acid chains are new . according to a further aspect of the invention there is provided a new protein having at least 5 pendant polysialic acid chains , each having at least 5 sialic acid units joined to one another . a sialic acid reagent is , for instance , reacted with sodium periodate under controlled oxidation conditions to form a terminal aldehyde at the c 7 atom . the oxidation conditions preferably involve sodium periodate at a concentration of around 0 . 1m , being used in excess to derivatise a solution of polysialic acid . reaction conditions preferably involve reaction at room temperature for 5 to 60 minutes . in order to deactivate excess periodate , conventional means such as reaction with ethylene glycol , are used . the derivatisation step of the method of the invention is preferably carried out with the protein in the aqueous reaction mixture at a temperature in the range 0 to 60 ° c ., preferably 10 to 45 ° c ., for instance at a raised temperature in the range 30 to 40 ° c . the protein is preferably present at a concentration in the range 0 . 1 to 100 g / l , preferably in the range 1 to 20 g / l . the reaction mixture may contain other ingredients such as dissolved inorganic salts , for instance to buffer the solution of a suitable ph . the protein which is derivatised in the invention may be , for instance , a therapeutically active compound . the derivatisation reaction may , for instance , be for controlling the hydro - or lipo - philicity of the protein , for instance to adjust its solubility in liquid media , especially to increase its hydrophilicity and solubility in aqueous media . the derivatisation reaction may be , as in our earlier publication wo - a - 92 / 22331 , for increasing the circulation time , decreasing the immunogenicity and / or increasing the stability on storage , in vitro or in vivo , of a therapeutic compound . derivatisation with poly ( ethylene glycol ) increases hydrophilicity of the protein , which may increase aqueous solubility or availability , increase circulation time or decrease the immunogenicity of the protein . the presence of the denaturant compound increases the degree of derivatisation , thereby enhancing the improvement in solubility , circulation time and / or immunogenicity or the increase in stability of the protein . it has been found that this increase in degree of derivatisation may be carried out without adversely affecting the activity of the protein , for instance its enzyme activity . thus , in contrast to the findings of visser et al ( op . cit .) the presence of the anionic amphiphile does not irreversibly deactivate the protein , indeed , as shown below , it inhibits deactivation . the derivatisation may alternatively be for providing active or passive targeting by attachment of polymers or binding ligands . pharmaceutically active proteins whose availability in the circulation would be beneficially prolonged by the invention are cytokines , such as interleukins , for instance il - 2 , il - 6 or il - 1 , interferons , tumour necrosis factor ( tnf ), growth factors , peptide hormones , such as insulin , as well as enzymes for instance for use in enzyme therapy , as well as immuno - globulins , and aprotinin . alternatively the protein may be a carrier or adjuvant and the derivatising reaction conjugates pharmaceutically active , or diagnostically useful ligands to the protein to optimise the delivery of the useful ligand to a target issue . fig1 is a reaction scheme for the derivatisation of polysialic acid ; in the following examples , catalase is used as a model protein . catalase is a tetrameric haemprotein that catalyses the degradation of hydrogen peroxide to oxygen and water . the reaction can be used to determine enzyme activity . the reaction is a first order reaction , whereby the amount of peroxide substrate decomposed is directly proportional to the concentration of both substrate and enzyme . provided the concentration of substrate is constant between experiments , any difference in decomposition rate will therefore be a function of enzyme activity present . in the present examples , the drop in absorbance hydrogen peroxide at 240 μm from 0 . 450 to 0 . 400 , corresponding to the decomposition of 3 . 45 μ moles of hydrogen peroxide in a cuvette having a reaction volume of 3 ml , is determined . concentration of catalase ( active and inactive ) relies upon the fact that the enzyme exhibits a characteristic absorption maximum , the soret band at 405 nm . catalase concentration is determined spectrophotometrically . catalase , insulin , igg and aprotinin were radiolabelled using the conventional methods using 125 i , usually the chloramine - t method . radiolabelled protein in the circulation was determined using techniques described in fernandes , a . i . et al , biochem . biophys . acta ( 1997 ) 1341 , 26 - 34 . colominic acid is a derivative of e . coli k1 , having an average molecular weight of around 10 kda . the polysaccharide consists substantially only of 2 - 8 linked sialic acid units . the activation of ( oxidation ) colominic acid is carried out as follows . a 0 . 1m aqueous solution of sodium periodate is formed . 1 ml of the sodium periodate solution is mixed with 10 mg colominic acid in the dark , and the reaction mixture stirred for 15 minutes at room temperature and pressure ( around 20 ° c ., 1 bar ). the reaction is terminated by addition of 2 ml ethyleneglycol , followed by stirring for 30 minutes under the same conditions . subsequently the mixture is extensively dialysed at 40 ° c . against a 0 . 01 % by weight ammonium carbonate buffer . the dialysate is freeze - dried overnight , then refrigerated until further use . the reaction scheme is shown in fig1 . sialic acid is determined by forming a 0 . 5 ml sample ( having a concentration in the range 4 to 40 mg / ml sialic acid ) in aqueous solution , added to this 0 . 5 ml resorcinol reagent . the mixture is boiled in a water bath for 30 minutes in sealed tubes . the mixture is cooled for 20 - 30 minutes and its absorbance read at 570 nm against control mixtures of appropriate buffer ( i . e . of the type and concentration in which the original sample is presented ) and reagent . the level of pegylation was estimated by the assay of peg using ammonium ferrithiocyanate ( a . nag , g . micra and c ghost , anal . biochem . 237 : 224 - 231 , 1996 ). samples containing derivatised igg , aprotinin or insulin were assessed for soluble protein content using the bradford method . 100 μl protein solution ( having a protein concentration in the range 10 to 100 μg / ml ) and 1 ml colour reagent ( acid / dye solution ) were mixed . the absorbance is read at 595 mm against a suitable blank . the igg used in the following examples was tested for its sialic acid content using this method . it was found to have 2 % sialic acid content . this figure is taken into account when assessing the level of polysialylation using colominic acid derivatisation according to the examples . the catalase was obtained from the sigma company . insulin is obtained from sigma igg is bovine serum igg obtained from sigma . a protnin was obtained from bdh . monomethoxy polyethylene glycol succinimidyl succinate ( molecular weight about 5 kd ) was obtained from sigma . colominic acid was obtained from sigma . sodium dodecyl sulphate was obtained from sigma . urea was obtained from bdh . the present example illustrates the effect of reaction time in the activated colominic acid — catalase derivatisation reaction , by assessing the catalase activity after recovery of the derivatised enzyme . the derivatisation was carried out using 24 mg of catalase with 50 mg of activated colominic acid , in the presence of 20 mg sodium cyanoborohydride in 5 ml potassium hydrogen phosphate buffer . the reactants are stirred for a period up to 48 hours at 35 to 40 ° c . for a derivatisation reaction carried out in the presence of sds , solid sds is dissolved in the phosphate buffer to provide a final concentration of 1 × 10 − 3 m sds . after reaction times of zero hours ( i . e . as quickly as possible after the reaction mixture is made up ), 6 hours , 12 hours , 24 hours and 48 hours , the reaction is stopped by addition of 70 % ammonium sulphate solution to precipitate out protein . the precipitated mixture is cooled on ice and stirred for one hour , then centrifuged at 3500 rpm for 45 minutes . the supernatant is discarded and the pellet washed with saturated ammonium sulphate solution , spun again for ten minutes at the same speed , and the supernatant discarded . the pellet is redissolved in 5 ml phosphate buffered saline . the resultant solution is dialysed extensively at − 4 ° c . against four changes of phosphate buffered saline . the solution is then passed down a sephadex ( trade mark ) g - 100 column and peaks collected and assayed for catalase and colominic acid content . fig2 indicates the conjugation ratio ( degree of substitution ) of colominic acid with catalase in the presence and absence of sds . the results show that the presence of sds increases the maximum conjugation ratio by a factor of about 3 . the maximum level of derivatisation in the presence of sds appears to be around 8 moles colominic acid per mole catalase . the derivatised catalase compounds were also tested against native catalase for their enzyme activity . the results are shown in fig3 . the results for catalase alone in fig3 show the effect of subjecting catalase to the reaction conditions but without the addition of activated colominic acid . this shows that catalase activity is lost under those conditions , but that the loss of activity is inhibited by polysialylation . the inhibitor is greater when the polysialylation takes place in the presence of sds . the general coupling procedure used in experiment 1 was used to derivatise catalase , except that the sds concentration was used at 0 . 01 % by weight , 0 . 02 % by weight and 0 . 029 % by weight ( 1 × 10 − 3 m ), with the derivatisation reaction being continued for a period of 48 hours . the derivatised catalase products were assessed for their catalase activity using the general test described above . the times taken for the enzymes to reduce the absorbance from 0 . 45 to 0 . 40 are shown in table 1 as compared to native catalase . native catalase , catalase derivitised using 1 × 10 − 3 m sds , for a reaction period of 48 hours , and catalase derivatised using the same reaction time but in the absence of sds , were compared at different concentrations of hydrogen peroxide to form hanes woolf plot . the km ( substrate concentration at which the reaction rate is half of its maximal value ) for native catalase is 83 . 95 mm , for the colominic acid - catalase generated in the absence of sds , km is 114 . 4 mm , and for catalase modified in the presence of sds , the km is 140 . 8 mm . for each protein , 1 mg of 125 i - labelled and unlabelled protein is reacted with 83 . 3 mg activatcd colominic acid in the presence of 20 mg sodium borohydride in 5 ml potassium hydrogen phosphate . for reactions in the presence of sds , sds is dissolved to form a final concentration of 1 × 10 − 3 m . the derivatisation reaction is carried out for 48 hours at a temperature in the range 35 to 40 ° c . after the reaction , the derivatised protein is recovered using the same general technique as in example 1 , but using centrifugation at 9000 rpm . the column used for isolation is sephadex g - 50 . table 2 shows the conjugation yields , that is the degree of derivatisation , with and without sds , for the four proteins . aprotinin has 4 lysyl units having derivatisable amine groups and 2 terminal amino groups available for derivatisation by aldehyde reagents . the labelled insulin , aprotinin and igg , in their native forms , and derivatised with colominic acid ( polysialic acid psa ) in the presence and absence of sds are administered to mice to determine the rate of clearance from the circulation . the in vivo tests are carried out using the general technique described in example 1 of wo - a - 92 / 22331 , by injection of protein or derivatised protein in the dose shown in table 3 . the animals were bled from the tail vein immediately before and , immediately after , at 30 minutes , 1 hour , 4 hours , 6 hours , 12 hours , 24 and 48 hours after injection to determine the level of 125 i label remaining in the circulation . from the logarithmic curve of percent initial radioactivity against time following injection , the area under the curve is determined . the results for the various proteins are shown in table 3 . the results in table 3 show that derivatisation of each protein with colominic acid results in an increase in the circulation time , thereby confirming the results indicated in wo - a - 92 / 22331 . the degree of increase in circulation time is significantly increased where derivatisation is conducted in the presence of sds . the derivatisation method according to example 1 was repeated using igg in place of catalase . 5m urea or 1 × 10 − 3 m sds were used . the reaction in individual aliquots of reaction mixture was stopped after 6 , 12 , 24 and 48 hours . the degree of derivatisation was determined after assessing the level of protein using the bradford technique described above and the level of sialic acid using the resorcinol method described above . the results are shown in fig4 . the results in fig4 show that the presence of urea increases the level of derivatisation , though by a lesser amount than sds , at concentrations normally expected to provide an alteration in protein conformation . igg , as used in the above examples was subjected to derivatisation with oxidised colominic acid ( ca ) in the absence and presence of 10 − 3 m sds under the general conditions used in example 4 . the same protein was also derivatised by monomethoxy poly ( ethlene glycol ) succinimidyl succinate ( sspeg ) in the absence of sds and in the presence of 10 − 3 m sds . the reaction is based on tsutsumi et al ( 1995 ) brit . j . cancer 71 : 963 - 968 . igg in 0 . 2m phosphate buffer , ph 7 . 2 , was allowed to react with a 50 - fold molar excess of methoxypolyethylene glycol succinimidyl succinate ( ss - peg ) at room temperature for 10 min . the reaction was stopped by addition of 5 - fold molar excess ε - amino caproic acid over ss - peg . the resulting peg - igg was purified and separated by gel permeation chromatography ( sg - 100 ; 0 . 2m phosphate buffer ). for the reaction in the presence of sds , the igg was first contacted with 10 − 3 m sds in the 0 . 2m phosphate buffer at raised temperature for 12 hours . otherwise the reaction and recovery was the same . the degree of derivatisation of pegylated and polysialyated igg = s was determined using the methods described above . the results are shown in table 4 . the presence of sds increases the level of derivatisation for a peg reagent as well as for a polysialic acid reagent . the peg reagent gives a higher degree of substitution than the colominic acid reagent . | 2 |
the preferred embodiment of the present invention will be described below with reference to the accompanying drawings . fig5 shows an embodiment of a variable length coder in accordance with an embodiment of the present invention . the coder of fig5 comprises n coefficient storing units ( cm1 - cm n ) for respectively storing the quantization coefficients of quantized block data ; n scan address output units ( sag 1 - sag n ) for inputting different scan addresses to each of the coefficient storing units ; n [ run level ] coders ( cd 1 - cd n ) for [ run level ] coding coefficients in each of coefficient storing units according to respective scanning patterns ; n variable length coders ( vlc 1 - vlc n ) for variable - length - coding [ run level ] symbols output from each of the [ run · level ] coders according to a variable - length - coding map ; n buffers ( bf 1 - bf n ) for storing the variable - length - coding data of each of the variable length coders ; n accumulators ( accm 1 - accm n ) for separately accumulating the lengths of variable - length coded data output from each of the variable length coders ; a minimum selector 52 for selecting a minimum value among accumulated lengths in n accumulators ; and a selecting switch 54 for selecting and transmitting the buffer output of variable - length coding channels selected in the minimum selector . first , the quantization coefficients which are quantized in a block unit of a predetermined size , are stored in each of the n coefficient storing units ( cm1 - cm n ). the first , second , and n coefficient storing units are respectively input the first , second , and n scan addresses which are separately output from the first , second , and n scan address output units . described below is a coding channel for the first coefficient storing unit ( cm 1 ) among n coefficient storing units which are scanned by each of the n scan addresses . the quantization coefficients stored in the first coefficient storing unit ( cm 1 ) are scanned toward a predetermined scanning orientation by the first scan address , and coded to a [ run level ] symbol in the first [ run level ] coder ( cd 1 ). the first variable length coder ( vlc 1 ) variable - length - codes the [ run · level ] symbol input from the first [ run level ] coder ( cd 1 ) according to a predetermined variable - length - coding map , and respectively outputs variable - length - coded data ( d vlc ) and the length of the variable - length - coded data ( l vlc ). the variable - length - coded data ( d vlc ) output from the first variable length coder ( vlc 1 ) is stored in the first buffer ( bf 1 ), and the length of the variable - length - coded data ( l vlc ) is input and accumulated to the first accumulator ( accm 1 ) which accumulates the lengths of code that are coded by the first unit ( vlc 1 ). the first accumulator ( accm 1 ) consists of an adder ( a1 ) and an accumulated length storing unit ( lm 1 ). the length of the variable - length - coded data ( l vlc ) which is input from the first variable length coder ( vlc 1 ) is added to accumulated lengths which are feedback from the first accumulated length storing unit ( lm 1 ) in the adder ( a1 ). the first accumulated length storing unit ( lm 1 ) restores an update accumulated length output from the adder ( a1 ). a series of such coding channels are applied to the quantization coefficients of the second , third , and n coefficient storing units ( cm 2 , cm 3 , cm n ). however , patterns for scanning the quantization coefficients in a block unit which are respectively stored in n coefficient storing units , are different from each other . fig7 shows an embodiment of each other &# 39 ; s different scanning patterns . a scanning pattern of fig7 a has a scanning orientation of 0 degree , that the fig7 b is a scanning pattern having a scanning orientation of 30 degrees , and fig7 c is a scanning pattern having a sanning orientation of 45 degrees . in channels of variable - length - coding with various scanning patterns , n accumulators ( accm 1 - accm n ) respectively provide the accumulated length data stored in each of the accumulated length storing units , to n input terminals of the minimum selector 52 for a minimum value of accumulated lengths . each of the output terminals of n buffers ( bf 1 - bf n ), which stores the variable - length - coded data according to n types of scanning patterns , are separately connected to n input terminals of the selecting switch 54 . the minimum selector 52 selects a minimum value among the accumulated length data input from each of the n accumulated length storing units ( lm 1 - lm n ). the minimum selector 52 outputs a scanning pattern data ( d scan ) which represents scanning patterns of variable - length - coding channels with a selected minimum value of accumulated lengths , and provides a predetermined selecting control signal ( sel ) corresponding to the selected minimum value of accumulated lengths to the selecting switch 54 . the selecting switch 54 selects and outputs a variable - length - coded data ( d vlc ) with the minimum value of accumulated lengths among the input data which are respectively input to n input terminals . whenever a minimum value is selected , that is , the variable - length - coding of every block data is completed , the minimum selector 52 generates a reset signal ( rst ), thereby resetting the n buffers ( bf 1 - bf n ) and the n accumulated length storing units ( lm 1 - lm n ). the variable - length - coded data ( d vlc ) and the scanning pattern data ( d scan ), which are output from the variable length coder , are transmitted to the receiver and supplied to a decoder . fig6 shows an embodiment of a variable length decoder in accordance with the present invention . referring to fig6 the input variable - length - coded data ( d vlc ) are input to a variable length decoder 61 are transformed to the [ run level ] symbol according to a variable - length - decoding map . moreover , the scanning pattern data ( d scan ) transmitted from the coder are input to a scanning pattern selector 62 which stores each of the scanning addresses corresponding to various scanning patterns ( 1 , n scans ). the scanning pattern selector 62 selects and outputs scan addresses ( addr s ) corresponding to the input scanning pattern data ( d scan ). a run level decoder 63 transforms the [ run level ] symbols input from the variable length decoder 61 into the two - dimensional of quantization coefficient according to the scan addresses ( addr s ) input from the scanning pattern selector 62 . then , the quantization coefficients are provided to a dequantizer . as described above , the variable - length - coding system in accordance with the present invention variable - length - codes every block data according to diverse scanning patterns , and then transmits both a scanning pattern which minimizes the length of variable - length - coded data and variable - length - coded data according to the scanning pattern . at that time , the variable - length - decoding system in accordance with the present invention variable - length - decodes the transmitted variable - length - coded data according to the same scanning pattern as utilized in the process of variable - length - coding . as a result , the system for variable - length - coding and variable - length - decoding can further compress the transmission data . while the present invention has been illustrated and described in connection with two - dimensional data . the present invention can be applied to a coding and decoding system which utilizes multi - dimensional data . | 7 |
the thioamide compounds of the general formula ( i ) used in this invention are not particularly limited and include , for example , the following compounds : ## str2 ## the copper compound of this invention is at least one compound selected from a member consisting of a compound of the general formula ( ii ), copper acetylacetonate , chlorophyll - copper , chlorophyllin - copper and copper hydroxide . wherein r represents a hydrogen atom , an alkyl group , a cycloalkyl group , an aryl group , an aralkyl group or a heterocyclic rest ( said group or rest may have at least one substituent ); and x represents -- coo , -- so 4 , -- so 3 , -- po 4 or -- o ; n represents an integer of 1 to 4 . the lead compound of this invention is at least one compound selected from a member consisting of a compound of the general formula ( iii ), lead acetylacetonate , chlorophyll - lead , chlorophyllin - lead and lead hydroxide . wherein r represents a hydrogen atom , an alkyl group , a cycloalkyl group , an aryl group , an aralkyl group or a heterocyclic rest ( said group or rest may have at least one substituent ); and x represents -- coo , -- so 4 , -- so 3 , -- po 4 or -- o ; and n represents an integer of 1 to 4 . the compounds of the general formulae ( ii ) and ( iii ) are not particularly limited and include , for example , copper stearate , lead stearate , copper palmitate , lead palmitate , copper oleate , lead oleate , copper behenate , lead behenate , copper laurate , lead laurate , copper caprate , lead caprate , copper caproate , lead caproate , copper valerate , lead valerate , copper isolactate , lead isolactate , copper lactate , lead lactate , copper propionate , lead propionate , copper acetate , lead acetate , copper formate , lead formate , copper hydroxide , lead hydroxide , copper benzoate , lead benzoate , copper o - toluylate , lead o - toluylate , copper m - toluylate , lead m - toluylate , copper p - toluylate , lead p - toluylate , copper para - tertiary - butylbenzoate , lead para - tertiary - butylbenzoate , copper o - chlorobenzoate , lead o - chlorobenzoate , copper m - chlorobenzoate , lead m - chlorobenzoate , copper p - chlorobenzoate , lead p - chlorobenzoate , copper dichlorobenzoate , lead dichlorobenzoate , copper trichlorobenzoate , lead trichlorobenzoate , copper p - bromobenzoate , lead p - bromobenzoate , copper p - iodobenzoate , lead p - iodobenzoate , copper p - phenylbenzoate , lead p - phenylbenzoate , copper o - benzoylbenzoate , lead o - benzoylbenzoate , copper p - nitrobenzoate , lead p - nitrobenzoate , copper anthranilate , lead anthranilate , copper p - aminobenzoate , lead p - aminobenzoate , copper oxalate , lead oxalate , copper malonate , lead malonate , copper succinate , lead succinate , copper glutarate , lead glutarate , copper adipate , lead adipate , copper pimelate , lead pimelate , copper suberate , lead suberate , copper azelate , lead azelate , copper sebacinate , lead sebacinate , copper phthalate , lead phthalate , copper monoesterphthalate , lead monoesterphthalate , copper naphthenate , lead naphthenate , copper naphthalene carboxylate , lead naphthalene carboxylate , copper tartarate , lead tartarate , copper diphenylamine - 2 - carboxylate , lead - diphenylamine - 2 - carboxylate , copper 4 - cyclohexyllactate , lead 4 - cyclohexylactate , copper diethyldithio carbamate , lead diethyldithiocarbamate , copper gluconate , lead gluconate , diethoxy copper , diethoxy lead , di - isopropoxy copper , di - isopropoxy lead , di - n - butoxy copper , di - n - butoxy lead , copper octylate , lead octylate , copper alkylbenzene sulfonate , lead alkylbenzene sulfonate , copper p - toluene sulfonate , lead p - toluene sulfonate , copper naphthalene sulfonate , lead naphthalene sulfonate , copper naphthylamine sulfonate , lead naphthylamine sulfonate , copper n - dodecylbenzene sulfonate , lead n - dodecylbenzene sulfonate , copper dodecyl sulfate , lead dodecyl sulfate , copper 2 , 5 - dimethylbenzene sulfonate , lead 2 , 5 - dimethylbenzene sulfonate , copper 2 - carbomethoxy - 5 - methylbenzene sulfonate , lead 2 - carbomethoxy - 5 - methylbenzene sulfonate , copper α - naphthylphosphate , lead α - naphthylphosphate , copper stearylphosphate , lead stearylphosphate , copper laurylphosphate , lead laurylphosphate , copper di - 2 - ethylhexylphosphate , lead di - 2 - ethylhexylphosphate , copper isodecylphosphate , lead isodecylphosphate and the like . one of the above thioamide compound , the copper compound and the lead compound absorb almost no rays of near ir - region , or , even if the absorption occured , slight ray of a particular wave length . the heating of one of the thioamide compound , the copper compound and the lead compound has no substantial effect on the near ir - absorbency . however , heating an admixture of the thioamide compound and the above copper compound or the above lead compound causes a near ir - absorption uniformly and strongly . in this case , a strongly near ir - absorption does not occur without heat - treatment , even using the thioamide compound of the general formula ( i ) together with at least one substance selected from a member consisting of a compound of the general formula ( ii ) or ( iii ), copper acetylacetonate , lead acetylacetonate , chlorophyll - copper , chlorophyll - lead , chlorophyllin - copper and chlorophyllin - lead . however , the composition of this invention or a product containing this composition , under applied heat energy , has a feature that the heated part absorbs the rays of near ir - region . the heated part forms a latent image of the heated pattern since it has not a visible absorption . accordingly , the composition of this invention can be used as an equipment detecting a heated pattern or as a recording paper under combination with the suitable color - developing method by applying the above feature . since the material obtained by heating a composition of this invention containing the thioamide compound and the copper compound and / or the lead compound exhibits a high absorbency in the entire near ir - region , it can be used as an equipment detecting near ir - rays , a recording equipment using laser rays of various near ir - range , and the like . the degree of the near ir - absorbency can be adjusted by controlling a kind and a mixing ratio of the thioamide compound and the copper compound and / or the lead compound , a heated temperature , a heated time , etc . the composition of this invention is prepared either by mixing the thioamide compound and the copper compound and / or the lead compound , or by mixing the thioamide compound , the copper compound and / or the lead compound , binder , pulp , thermoplastic resin and optionally auxiliary additives , such as dying agent , etc . further , the composition of this invention is prepared either by dissolving or dispersing the admixture of the thioamide compound and the copper compound and / or the lead compound , binder , dying agent , etc . in an appropriate solvent or disperse medium , or by dispersing the admixture of the thioamide compound and the copper compound and / or the lead compound in a solvent containing binder , dying agent , etc . as such composition , there are a coating material , filler , and the like . the mixing ratio , the amounts of the compounds of this invention and the amounts of other substances are determined in such a level that in the heat - treatment , the thioamide compound and the copper compound and / or the lead compound are contacted with one another in form of solid , melted liquid or a mixture of solid and melted liquid . on the other hand , the product of this invention comprises the composition containing the thiourea composition and the copper compound and / or the lead compound , or it comprises the ir - absorbing material obtained by heating the composition . this product is prepared by forming a mixture of the raw materials and the composition or the near ir - absorbing material , or by coating on or impregnating in the raw material the dispersed slurry of the composition or material by means of a spraying - machine , a coater or a printer . the product of this invention is prepared in form of a film , sheet or bar by a usually known method , for example , by the sheet - forming , weaving , or heat - forming of an admixture of pulp , fiber , thermoplastic resin , ceramic , etc . and optionally by after - treating of the obtained product . the heating method for obtaining a near ir - absorbency is not particularly limited . there may be used various heating methods , in which a reaction between a thioamide compound and a copper - or lead - compound occurs for obtaining a near ir - absorbency . means for the heating methods include , for example , electric heaters , induction - heaters , extruders for film etc ., thermal heads , semi - conductor lasers , ir - lamps and the like . the heat - treatment is carried out under ambient atmosphere , for example , under usual atmosphere , inactive gas atmosphere , commonly under usual atmosphere . the heating temperature used in this invention is in the range of 40 °- 400 ° c ., preferably 50 °- 350 ° c . the heating time is in the range of several milli - seconds to several ten minutes . the rapid reaction and the uniform mixing owing to a superior heat - transfer by increasing a mutual contact of substances by means of the agitation , rotation and oscillation are preferable . the mixing ratio of the thioamide compound to the copper compound and / or the lead compound is determined by the kinds of these compounds . however , it is suitable to use 0 . 01 - 50 weight - parts , preferably 0 . 1 - 10 weight - parts of the thioamide compound , based on 1 part of the copper compound and / or the lead compound . as described above , it is preferred that the admixture of the thioamide compound and the copper compound and / or the lead compound used in this invention is an admixture of the thioamide compound of the general formula ( i ) and at least one compound selected from a member consisting of the copper compound of the general formula ( ii ), copper acetylacetonate , chlorophyl - copper , chlorophyllin - copper , copper hydroxide , the lead compound of the general formula ( iii ), lead acetylacetonate , chlorophyl - lead , chlorophyllin - lead and lead hydroxide . the above admixture absorbs the rays of entirely near ir - region of 700 - 2000 nm uniformly and strongly . the reason for this fact is not clear . as is apparent from examples and comparative examples , the heating of one of the thioamide compound , the copper compound and the lead compound does not cause the entirely near ir - absorption in the region of 700 - 2000 nm uniformly and strongly , and the mixing of the thioamide compound and the copper compound and / or the lead compound without heating provides the same result . accordingly , it is assumed that the heating of the admixture of this invention causes a reaction between the thioamide compound and the copper compound and / or the lead compound , thereby forming a complex . the following examples illustrate this invention , although this invention is not limited to examples . the parts are parts by weight . each of liquid a ( containing the thioamide compound ) and liquid b ( containing the copper compounds shown in no . 1 , 3 and 5 of table 1 ) was ground to an average particle size of circa 3μ by an attritor . ______________________________________liquid athioamide compound of no . 1 , 3 or 5 20 parts10 % aqueous solution of polyvinyl alcohol 50 partswater 30 partstotal 100 partsliquid bcopper compound of no . 1 , 3 or 5 20 parts10 % aqueous solution of polyvinyl alcohol 50 partswater 30 partstotal 100 parts______________________________________ 50 parts of liquid a and 50 parts liquid b were mixed to prepare a coating material . the coating material was applied on the side of a fine paper weighing 60 g / m 2 at a coating weight of 5 g / m 2 by means of a meyer - bar and then dried . in this manner , a recording paper was obtained . any of the recording sheets is white to pale blue and forms a pale brownish - green color in contact with a metal block having a surface temperature of 150 ° c . for 5 seconds . at each colored part , the near ir - absorption values of 800 , 900 , 1000 , 1500 and 2000 nm wave lengths are high , i . e . they are more than 80 % on an average . a thermo - sensitive printing was made by means of a thermal - sensitive bar code printer ( bw - 100t , manufactured by mekano system co ., ltd .) in any case , a pale brownish - green bar - cord pattern was obtained . this pattern is clearly readable by means of a bar - code reader ( ms - ba - dec 230 , manufactured by mekano system co ., ltd .) in which a semi - conductor laser having a near ir - wave length of 940 nm is used as a reading means . in accordance with the combination nos . 1 - 23 in table 1 , 5 parts of a thioamide compound and 5 parts of a copper compound were charged in a porcelain tiegel to prepare an admixture . 10 parts of the admixture was heat - treated at 150 ° c . for 15 seconds in an electric furnace . the obtained pale - colored reaction - product ( powder ) was fixed in a certain thickness on a fine paper . the reflectance of the surface was measured by a spectrophotometer ( uvid ec - 590 , manufactured by japan spectroskopic co ., ltd . ), with regard to the reflexion spectrum of the near ir - region of 800 - 2500 nm wave length . a near ir - absorbency is illustrated as an average near ir - absorption value , wherein the near ir - absorption value is a difference between 100 % and a reflectance at each wave length of 800 , 900 , 1000 , 1500 and 2000 nm . in this case , ⊚ indicates an average value of at least 80 %, ◯ indicates an average value of at least 60 %, δ indicated an average value of at least 30 %, x indicates an average value of less than 30 %. the near ir - absorbing material of this invention means a material having an average value of at least 30 %. the average ir - absorbency of the reaction - substances in nos . 1 - 23 of table 1 indicates a value of at least 60 %. each of thioamide compounds or copper compounds in table 2 was heat - treated under the same conditions as in example 2 to prepare a heated product . the near ir - reflexion spectrum of the heated product was measured , and the near ir - absorbency was evaluated . all of the near ir - absorbencies are less than 30 %, as seen in table 2 . further , the comparison of a separate heating , a mixing , and a combined heating of the thioamide compound and the copper compound used in this invention are explained in fig1 . in fig1 n - phenylthiobenzamide is used as the thioamide compound of this invention , and copper p - chlorobenzoate is used as the copper compound of this invention , wherein nos . 1 and 4 of comparative example 1 as a separate heating , no . 1 of example 1 as a mixing , and no . 1 of example 2 as a combined heating are compared , in regard to the near ir - reflexion spectra in the region of 800 - 2000 nm . from fig1 it is clear that the near ir - absorbency of example 2 , no . 1 in the combined heating of n - phenylthiobenzamide and copper p - chlorobenzoate is remarkably higher than the near ir - absorbency in heating without mixing or in mixture without heating ; i . e . the near ir - absorbency of example 2 , no . 1 indicates more than 90 % in the entirely measured wave lengths . each of thioamide compounds and copper compounds which were described in nos . 24 - 32 of table 3 , was prepared as follows : ______________________________________liquid athioamide compound 50 parts10 % aqueous solution of polyvinyl alcohol 25 partswater 125 partsliquid bcopper compound 50 parts10 % aqueous solution of polyvinyl alcohol 25 partswater 125 parts______________________________________ each liquid of the above - mentioned composition was ground to an average particle size of 1 micron by an attritor . then , the dispersions were mixed in the portion of table 3 to prepare a coating material . the coating material was applied on one side of a fine paper weighing 50 g / m 2 at a coating weight of 3 . 0 g / m 2 and then dried . the obtained sheet was heat - treated during 5 seconds under a pressure of 10 g / m 2 in contact with a plate having a temperature of 150 ° c . the near ir - absorbency of the obtained sheet was measured in the same manner as in example 2 . the color of background of the coated surface , the stabilities of near ir - absorbency against heat , humidity or light were measured as follows . the test results are shown in table 3 . the reflectance of the coated surface after heat - treatment is measured by a macbeth densitometer ( rd - 914 , using an amber filter ). a sheet allows to stand in oven at 60 ° c . for 24 hours , and then the ir - reflectance is measured by a spectrophotometer ( using a wave length of 1000 nm ). the stability against heat is evaluated as a residual rate of near ir - absorbency from the following equation . ## equ1 ## a sheet allows to stand under the condition of 40 ° c . and 90 % rh . after 24 hours , a near infrared reflectance of the sheet is measured by a spectrophotometer ( using a wave length of 1000 nm ). stability against humidity is evaluated as a residual rate of near ir - absorbency from the following equation . ## equ2 ## a sheet is subjected to light - irradiation for 6 hours by means of a fade - o - meter ( using a wave length of 1000 nm ). stability against light is evaluated as a residual rate of near ir - absorbency from the following equation . ## equ3 ## a dispersion a containing the thioamide compound or a dispersion b containing the copper compound used in example 3 was coated and dried in the same manner as in example 3 , and then heat - treated . the near ir - absorbency was measured for the obtained product . as is distinct from table 3 , a heat - treatment of an admixture of the thioamide compound and the copper compound provides an excellent near ir - absorbency , which was not decreased under heated state , humidic condition or light - exposure , and which was highly stable against the handling or the change of storage conditions . the surface of the sheet was slightly colored , while its color is not remarkable owing to its nearly gray color . on the contrary , the sheet manufactured by coating and drying either the thioamide compound or the copper compound exhibits no near ir - absorbency even in its heat - treatment , and hence this sheet is not tested with regard to its stability of the near ir - absorbency during the storage . table 1__________________________________________________________________________ mixing near ir - thioamide compound copper compound ratio absorbency heat - treatment__________________________________________________________________________no . 1 n - phenylthiobenzamide copper p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 2 n - cyclohexylthiobenzamide copper p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 3 n - stearythiobenzamide copper p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 4 thioacetanilide copper p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 5 thionicotinamide copper p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 6 n - phenylthiobenzamide copperstearate 1 : 1 ⊚ heat - treatmentno . 7 n - phenylthiobenzamide copperbehenate 1 : 1 ⊚ heat - treatmentno . 8 n - phenylthiobenzamide copper p - nitrobenzoate 1 : 1 ⊚ heat - treatmentno . 9 n - phenylthiobenzamide + copper m - chlorobenzoate ( 0 . 5 : 0 . 5 ): 1 ⊚ heat - treatment thioacetanilideno . 10 n - phenylthiobenzamide copper p - bromobenzoate 1 : 1 ⊚ heat - treatmentno . 11 n - phenylthiobenzamide copperbenzoate 1 : 1 ◯ heat - treatmentno . 12 n - phenylthiobenzamide copper o - benzoylbenzoate 1 : 1 ◯ heat - treatmentno . 13 n - phenylthiobenzamide chlorophyll - copper 1 : 1 ◯ heat - treatmentno . 14 n - phenylthiobenzamide copper glukonate 1 : 1 ◯ heat - treatmentno . 15 n - phenylthiobenzamide copper 4 - cyclohexyllactate 1 : 1 ◯ heat - treatmentno . 16 n - phenylthiobenzamide copper n - dodecylbenzol - 1 : 1 ◯ heat - treatment sulfonateno . 17 n - phenylthiobenzamide copper naphthalene 1 : 1 ◯ heat - treatment sulfonateno . 18 n - phenylthiobenzamide copper α - naphthyl - 1 : 1 ◯ heat - treatment phosphateno . 19 n - phenylthiobenzamide copper stearate + 1 :( 0 . 5 : 0 . 5 ) ◯ heat - treatment copper p - chlorobenzoateno . 20 n - phenylthiobenzamide copper stearylphosphate 1 : 1 ◯ heat - treatmentno . 21 n - phenylthiobenzamide copper acetate 1 : 1 ◯ heat - treatmentno . 22 n - phenylthiobenzamide copper succinate 1 : 1 ◯ heat - treatmentno . 23 n - phenylthiobenzamide copper glutarate 1 : 1 ◯ heat - treatment__________________________________________________________________________ table 2__________________________________________________________________________thioamide compound copper compound mixing ratio near ir - absorbency heat - treatment__________________________________________________________________________no . 1 n - phenylthiobenzamide -- 1 : 0 x heat - treatmentno . 2 n - cyclohexylthiobenzamide -- 1 : 0 x heat - treatmentno . 3 n - stearylthiobenzamide -- 1 : 0 x heat - treatmentno . 4 -- copper p - chlorobenzoate 0 : 1 x heat - treatmentno . 5 -- copper behenate 0 : 1 x heat - treatmentno . 6 -- copper stearate 0 : 1 x heat - treatment__________________________________________________________________________ table 3__________________________________________________________________________ mixing color of near ir - stability againstthioamide compound copper compound ratio background absorbency heat humidity light__________________________________________________________________________no . 24 n - phenylthiobenzamide copper p - chlorobenzoate 1 : 1 0 . 25 ⊚ 97 95 98no . 25 n - phenylthiobenzamide copper p - chlorobenzoate 0 . 5 : 1 0 . 26 ⊚ 96 95 97no . 26 n - phenylthiobenzamide copper p - chlorobenzoate 1 : 0 . 5 0 . 24 ⊚ 95 92 94no . 27 n - cyclohexylthiobenzamide copper p - chlorobenzoate 1 : 1 0 . 23 ⊚ 97 95 99no . 28 n - cyclohexylthiobenzamide copper p - chlorobenzoate 0 . 5 : 1 0 . 24 ⊚ 96 96 98no . 29 n - cyclohexylthiobenzamide copper p - chlorobenzoate 1 : 0 . 5 0 . 21 ⊚ 95 94 94no . 30 n - stearylthiobenzamide copper p - chlorobenzoate 1 : 1 0 . 25 ⊚ 94 93 97no . 31 n - stearylthiobenzamide copper p - chlorobenzoate 0 . 5 : 1 0 . 29 ⊚ 93 92 94no . 32 n - stearylthiobenzamide copper p - chlorobenzoate 1 : 0 . 5 0 . 25 ⊚ 95 93 93no . 8 n - stearylthiobenzamide -- 1 : 0 0 . 08 xno . 9 -- copper p - chlorobenzoate 0 : 1 0 . 28 xno . 10 n - cyclohexylthiobenzamide -- 1 : 0 0 . 07 xno . 11 n - stearylthiobenzamide -- 1 : 0 0 . 08 x__________________________________________________________________________ each of liquid a ( containing the thioamide compound ) and liquid b ( containing the lead compounds shown in no . 1 , 3 and 5 of table 4 ) was ground to an average particle size of circa 3μ by an attritor . ______________________________________liquid athioamide compound of no . 1 , 3 or 5 20 parts10 % aqueous solution of polyvinyl alcohol 50 partswater 30 partstotal 100 partsliquid blead compound of no . 1 , 3 or 5 20 parts10 % aqueous solution of polyvinyl alcohol 50 partswater 30 partstotal 100 parts______________________________________ 50 parts of liquid a and 50 parts of liquid b were mixed to prepare a coating material . the coating material was applied on the side of a fine paper weighing 60 g / m 2 at a coating weight of 5 g / m 2 by means of a meyer - bar and then dried . in this manner , a recording paper was obtained . any of the recording sheets is white to pale blue and forms a pale brownish - green color in contact with a metal block having a surface temperature of 150 ° c . for 5 seconds . at each colored part , the near ir - absorption values of 800 , 900 , 1000 , 1500 and 2000 nm wave lengths are high , that is , they are more than 80 % on an average . a thermo - sensitive printing was made by means of a thermal - sensitive bar code printer ( bw - 100t , manufactured by mekano system co ., ltd .) in any case , a pale brownish - green bar - cord pattern was obtained . this pattern is clearly readable by means of a bar - code reader ( ms - ba - dec 230 , manufactured by mekano system co ., ltd .) in which a semi - conductor laser having a near ir - wave length of 940 nm is used as a reading means . in accordance with the combination nos . 1 - 23 in table 4 , 5 parts of a thioamide compound and 5 parts of a lead compound were charged in a porcelain tiegel to prepare an admixture . 10 parts of the admixture was heat - treated at 150 ° c . for 15 seconds in an electric furnace . the obtained pale - colored reaction - product ( powder ) was fixed in a certain thickness on a fine paper . the reflectance of the surface was measured by a spectrophotometer ( uvid ec - 590 , manufactured by japan spectroscopic co ., ltd . ), with regard to the reflexion spectrum of the near ir - region of 800 - 2500 nm wave length . a near ir - absorbency is measured and evaluated in the same manner as in example 2 . the near ir - absorbing material of this invention means a material having an average value of at least 30 %. the average ir - absorbency of the reaction - products in nos . 1 - 23 of table 4 indicates a value of at least 60 %. each of thioamide compounds or lead compounds in table 5 were heat - treated under the same conditions as in example 5 to prepare a heated product . the near ir - reflexion spectrum of the heated product was measured , and the near ir - absorbency was evaluated . all of the near ir - absorbencies are less than 30 %, as seen in table 5 . further , the comparison of a separate heating , a mixing , and a combined heating of the thioamide compound and the lead compound used in this invention are explained in fig2 in fig2 n - phenylthiobenzamide is used as the thioamide compound of this invention , and lead p - chlorobenzoate is used as the lead compound of this invention , wherein nos . 1 and 4 of comparative example 3 as a separate heating , no . 1 of example 4 as a mixing , and no . 1 of example 5 as a combined heating are compared , in regard to the near ir - reflexion spectra in the region of 800 - 2000 nm . from fig2 it is clear that the near ir - absorbency of example 5 , no . 1 in the combined heating of n - phenylthiobenzamide and lead p - chlorobenzoate is remarkably higher than the near ir - absorbency in heating without mixing or in mixture without heating ; i . e . the near ir - absorbency of example 5 , no . 1 indicates more than 90 % in the entirely measured wave lengths . each of thioamide compounds and lead compounds which were described in nos . 24 - 32 of table 6 , was prepared as follows : ______________________________________liquid athioamide compound 50 parts10 % aqueous solution of polyvinyl alcohol 25 partswater 125 partsliquid blead compound 50 parts10 % aqueous solution of polyvinyl alcohol 25 partswater 125 parts______________________________________ each liquid of the above - mentioned composition was ground to an average particle size of 1 micron by an attritor . then , the dispersions were mixed in the portion of table 6 to prepare a coating material . the coating material was applied on one side of a fine paper weighing 50 g / m 2 at a coating weight of 3 . 0 g / m 2 and then dried . the obtained sheet was heat - treated during 5 seconds under a pressure of 10 g / m 2 in contact with a plate having a temperature of 150 ° c . the near ir - absorbency of the obtained sheet was measured in the same manner as in example 2 . the color of background of the coated surface , the stabilities of near ir - absorbency against heat , humidity or light were measured in the same manner as in example 3 . the test results are shown in table 6 . a dispersion a containing the thioamide compound or a dispersion b containing the lead compound used in example 6 was coated and dried in the same manner as in example 6 , and then heat - treated . the near ir - absorbency was measured for the obtained product . as is distinct from table 6 , a heat - treatment of an admixture of the thioamide compound and the lead compound provides an excellent near ir - absorbency , which was not decreased under heated state , humidic condition or light - exposure , and which was highly stable against the handling or the change of storage conditions . the surface of the sheet was slightly colored , while its color is not remarkable , owing to its nearly gray color . on the contrary , the sheet manufactured by coating and drying either the thioamide compound or the lead compound exhibits no near ir - absorbency even in its heat - treatment , and hence this sheet is not tested with regard to its stability of the near ir - absorbency during the storage . table 4__________________________________________________________________________ mixing near ir - thioamide compound lead compound ratio absorbency heat - treatment__________________________________________________________________________no . 1 n - phenylthiobenzamide lead p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 2 n - cyclohexylthiobenzamide lead p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 3 n - stearylthiobenzamide lead p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 4 thioacetanilide lead p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 5 thionicotinamide lead p - chlorobenzoate 1 : 1 ⊚ heat - treatmentno . 6 n - phenylthiobenzamide lead stearate 1 : 1 ⊚ heat - treatmentno . 7 n - phenylthibenzamide lead behenate 1 : 1 ⊚ heat - treatmentno . 8 n - phenylthiobenzamide lead p - nitrobenzoate 1 : 1 ⊚ heat - treatmentno . 9 n - phenylthiobenzamide + lead m - chlorobenzoate ( 0 . 5 : 0 . 5 ): 1 ⊚ heat - treatment thioacetanilideno . 10 n - phenylthiobenzamide lead p - bromobenzoate 1 : 1 ⊚ heat - treatmentno . 11 n - phenylthiobenzamide lead benzoate 1 : 1 ◯ heat - treatmentno . 12 n - phenylthiobenzamide lead o - benzylbenzoate 1 : 1 ◯ heat - treatmentno . 13 n - phenylthiobenzamide chlorophyll - lead 1 : 1 ◯ heat - treatmentno . 14 n - phenylthiobenzamide lead glukonate 1 : 1 ◯ heat - treatmentno . 15 n - phenylthiobenzamide lead 4 - cyclohexyllactate 1 : 1 ◯ heat - treatmentno . 16 n - phenylthiobenzamide lead n - dodecylbenzol - 1 : 1 ◯ heat - treatment sulfonateno . 17 n - phenylthiobenzamide lead napthalene sulfonate 1 : 1 ◯ heat - treatmentno . 18 n - phenylthiobenzamide lead α - naphthyl - 1 : 1 ◯ heat - treatment phosphateno . 19 n - phenylthiobenzamide lead stearate + 1 :( 0 . 5 : 0 . 5 ) ◯ heat - treatment lead p - chlorobenzoateno . 20 n - phenylthiobenzamide lead stearylphosphate 1 : 1 ◯ heat - treatmentno . 21 n - phenylthiobenzamide lead acetate 1 : 1 ◯ heat - treatmentno . 22 n - phenylthiobenzamide leas succinate 1 : 1 ◯ heat - treatmentno . 23 n - phenylthiobenzamide lead glutarate 1 : 1 ◯ heat - treatment__________________________________________________________________________ table 5__________________________________________________________________________thioamide compound lead compound mixing ratio near ir - absorbency heat - treatment__________________________________________________________________________no . 1 n - phenylthiobenzamide -- 1 : 0 x heat - treatmentno . 2 n - cyclohexylthiobenzamide -- 1 : 0 x heat - treatmentno . 3 n - stearylthiobenzamide -- 1 : 0 x heat - treatmentno . 4 -- lead p - chlorobenzoate 0 : 1 x heat - treatmentno . 5 -- lead behenate 0 : 1 x heat - treatmentno . 6 -- lead stearate 0 : 1 x heat - treatment__________________________________________________________________________ table 6__________________________________________________________________________ mixing color of near ir - stability againstthioamide compound lead compound ratio background absorbency heat humidity light__________________________________________________________________________no . 24 n - phenylthiobenzamide lead p - chlorobenzoate 1 : 1 0 . 27 ⊚ 96 96 99no . 25 n - phenylthiobenzamide lead p - chlorobenzoate 0 . 5 : 1 0 . 27 ⊚ 95 95 98no . 26 n - phenylthiobenzamide lead p - chlorobenzoate 1 : 0 . 5 0 . 27 ⊚ 94 92 94no . 27 n - cyclohexylthiobenzamide lead p - chlorobenzoate 1 : 1 0 . 28 ⊚ 97 94 98no . 28 n - cyclohexylthiobenzamide lead p - chlorobenzoate 0 . 5 : 1 0 . 26 ⊚ 95 95 97no . 29 n - cyclohexylthiobenzamide lead p - chlorobenzoate 1 : 0 . 5 0 . 27 ⊚ 94 93 94no . 30 n - stearylthiobenzamide lead p - chlorobenzoate 1 : 1 0 . 28 ⊚ 95 93 96no . 31 n - stearylthiobenzamide lead p - chlorobenzoate 0 . 5 : 1 0 . 29 ⊚ 92 92 93no . 32 n - stearylthiobenzamide lead p - chlorobenzoate 1 : 0 . 5 0 . 26 ⊚ 94 93 92no . 8 n - stearylthiobenzamide -- 1 : 0 0 . 09 xno . 9 -- lead p - chlorobenzoate 0 : 1 0 . 29 xno . 10 n - cyclohexylthiobenzamide -- 1 : 0 0 . 08 xno . 11 n - stearylthiobenzamide -- 1 : 0 0 . 08 x__________________________________________________________________________ the near ir - absorbing composition of this invention and the sheet containing this composition are colorless , wherein the heated part has a near ir - absorbency immediately . and each of the heat - treatment of this composition , the heat - treatment of the sheet containing this composition and the sheet containing this heat - treated composition provides a strong absorbency of the entire near ir - region of 800 - 2000 nm . owing to the excellent near ir - absorbency , the materials or the products prepared by this invention are used as equipments detecting thermal lapse ; optical materials such as a near ir - cut filter ; recording materials ; shielding materials for thermic rays ; regenerative materials ; sensors detecting near ir - rays and the like . the composition of this invention or the material obtained by heat - treating this composition is slightly colored inspire of the presence of metal . accordingly , this composition or this material has a superior appearance . each absorbency of the near ir - absorbing composition of this invention , the near ir - absorbing material of this invention and the product containing this material exhibits a superior stability against the change of environment conditions in the lapse of time . further , the near ir - absorbing composition of this invention can be easily prepared by a mixing , and the near ir - absorbing material of this invention can be easily prepared by a mixing and heating . the product of this invention containing the above composition or material may be prepared without the new equipments . consequently , this invention is applicable for an industrial production . | 6 |
presently conventional usage of the pstn and networks external to the pstn ( e . g . the web ) is suggested in fig1 and the chart in fig2 is used to explain how such usage pertains to pstn services ( call waiting , call forwarding , etc .). these figures are used to illustrate the problem discovered and resolved presently . user premises 1 ( office , home , etc .) connects to a telephone line 2 associated with a base telephone account as defined above . premises 1 are normally occupied by an authorized user of the base telephone account . hereafter , a telephone line such as 2 that is used by an authorized user of a base telephone account may be referred to as a base telephone line ( or simply a base line ). base line 2 connects to analog telephone equipment 3 at one end and pstn 4 at its other end . telephone equipment 3 may be a simple voice telephone , facsimile communication apparatus , or a combination of voice telephone and facsimile communication apparatus . computer 5 , housed in premises 1 , connects to external data communication network 6 ( shown as the web ) through line 7 . line 7 can be either a telephone line maintained by the pstn or part of a private local or wide area network ( lan or wan ) having direct connections to the web . if line 7 is a telephone line , it can either share use of base telephone line 2 with telephone equipment 3 ( i . e . enabling computer 5 to get online only when telephone 3 is idle , and allowing telephone equipment 3 to use line 2 only when the computer is offline ). if line 7 is a telephone line separate from line 2 ( e . g . an additional line paid for by the owner or tenant of premises 1 ), computer s can be online while telephone equipment 3 is in use ( off - hook ). continuing to refer to fig1 pstn 4 and web 6 may connect to remote premises 10 , via lines 12 and 13 ( either physically separate or used in time separation ). thus , line 12 may connect to analog telephone equipment 14 in premises 10 , and line 13 may connect to computer 16 in the same premises . line 12 may be a base telephone line for telephone users in premises 10 . line 13 may be a telephone line ( one maintained by the pstn ) or a part of a private network external to the pstn ( e . g . a line connecting to a local or wide area private network ). if line 13 is a telephone line coinciding with line 12 , telephone equipment 14 can not be used while computer 16 is online and computer 16 usually will be unable to connect online while equipment 14 is in use ( off - hook ). for purposes of the discussion to follow , premises 10 also may be viewed as a place temporarily used by an authorized user of line 2 , while the latter is on a business trip ( e . g . a hotel room in a city or country geographically remote from the city or country containing premises 1 ), and computer 16 may be viewed as a portable ( e . g . laptop ) computer carried by that authorized user on the trip . however , it will be appreciated , as this description progresses , that extended services of the type presently contemplated can be provided to computers that are either remote from or within premises such as 1 , can even be usefully furnished to the computer 5 shown in fig1 and may even be usefully provided to the computer 5 while that computer is linked to the web through base telephone line 2 . as suggested in block 20 of the chart in fig2 without the presently contemplated adaptation ( of pstn intelligence responsible for management of telephone services ), telephone services assigned / charged to base line 2 are confined exclusively to the pstn . therefore , services constituting “ extensions ” of assigned telephone services could not be routed through external networks such as the web . as an example , if telephone lines 2 and 12 of fig1 have “ standard ” call forwarding service assigned to them ( standard connoting call forwarding service of the type presently provided by the pstn ), telephone calls directed to either telephone line could not be redirected through the web ( or another external network ) to either a computer or another telephone . that is , calls directed to line 2 by internal switches of the pstn could not be forwarded by the pstn to either a remote computer such as 16 or a local computer such as 5 while such computer is linked to the web . furthermore , a telephone call directed to line 2 could not be forwarded even to another telephone ( e . g . telephone 14 ) if such forwarding required routing of the redirected call through the web . implied by the foregoing statements , and suggested explicitly in fig1 computers such as 5 and 16 can communicate through the web with each other and with other computers anywhere in the world ; but such communications are carried out in a context wherein telephone services furnished by the pstn have no extended application to processes performed in these computers while communicating in this fashion . block 22 in fig2 indicates that with the presently contemplated adaptation ( of pstn intelligence ), extended forms of telephone services presently provided within the pstn can be furnished to equipment linked to networks external to the pstn ; e . g . to computers linked to the web . types of extended telephone services that can be provided in this manner , and preferred implementations thereof , are described next . fig3 schematically illustrates resource management intelligence of the pstn , configured in accordance with the distributed architecture disclosed in the application by acker et al cross - referenced above . system complexes embodying such intelligence are located at regional nodes of the pstn . each ( nodal ) complex comprises a network of computers and switching gear configured in conformance with architectural principles of advanced intelligent network ( ain ) construction that have been widely adopted by telephone companies operating within the pstn . in fig3 the pstn is indicated at 30 , and an ain complex within one of its regional nodes is represented at 32 . ain complex 32 contains an intelligent peripheral ( ip ) network indicated at 34 . in general , as described by acker et al in their copending application cross - referenced above , an ip network such as 34 comprises multiple processors inter - communicating through a network ( e . g . a local area network or lan privately maintained by the pstn ). the processors of the network have distinct functional responsibilities ; call traffic routing being a principal responsibility of processors designated “ call processors ” and delivery of telephone services being a principal responsibility of processors designated “ voice peripherals ” ( vp &# 39 ; s ) which are relevant to the delivery of presently contemplated extended telephone services . as suggested at 35 , network 34 contains one or more vp processors 36 , communicating with a switch complex 38 , ( not shown ) call processors , and a server processor 40 . as shown at 42 , server 40 connects to networks external to the pstn ( e . g . the web , the internet , cable tv networks , etc ) and may be referred to hereafter as the pstn &# 39 ; s “ web server ”. server 40 can be either a separate processor ( separate from the vp &# 39 ; s and call processors ) or a shared part of one or more vp &# 39 ; s 36 . fig4 shows how the subsystem 35 of fig3 can be functionally adapted to provide a particular type of extended telephone service — termed “ extended call waiting ”— that exemplifies a species of a genus of extended telephone services contemplated by the present invention . other species of extended services are described later . in the example of call waiting service described next , it is assumed that a pstn server such as 40 is linked to the web and that it and a vp such as 36 are specially adapted ( e . g . have specially written program applications ) for performing functions described next . extended call waiting is a type of service that is chargeable to a specific base telephone account associated with a specific base line such as line 2 ( fig1 ). extended call waiting is a variation of standard call waiting ( the standard service presently provided in the pstn ), but the extended version differs from the standard one in that is delivered only to authorized users of base accounts , usually through external networks such as the web , and in the latter circumstance usually through a server such as 40 that is part of an ip network or equivalent resource management intelligence within the pstn . all other presently contemplated extended services have similar usage ; i . e . they are deliverable only to authorized users of base accounts , and generally via external networks and ip servers or equivalent elements of pstn resource management intelligence . considering the web , delivery of extended call waiting service ( and other extended services ) generally will be initiated when a user of a “ browser - equipped ” computer signs on to the web and accesses a predetermined url ( uniform resource locator ) maintained by a pstn web server . typically , the url would be pre - assigned to authorized users of base accounts within the local geographic region managed by the ip network ( or equivalent intelligence ) containing the server . at such times , a web page will be presented to the web user requiring the user to enter specific self - identification information . this information is forwarded to the web server , enabling the latter to verify that the web user is an authorized user of a base account within the server &# 39 ; s local region . this verification process is suggested in block 51 , fig4 . if the web user is found to be an authorized user of a local base account , another web page is sent from the the web server to the user indicating , among other things , extended service options available to that party . one such indication may denote availability of extended call waiting service . if extended call waiting is an available option , it can be activated by the web user ( e . g . by “ clicking ” on the respective indication ). web pages and indications consistent with the foregoing are presently state of the art for other web ( and internet ) activities ( i . e . activities other than accessing telephone services ). when extended call waiting is activated , the server signals that occurrence to a vp responsible for delivery of the respective service ( block 52 , fig4 ). the vp then communicates with local switching centers ( e . g . 38 , fig3 ) to determine when a new telephone call is being directed to the base telephone line associated with the web user &# 39 ; s base account . when a new call is found the switch port at which the call appears is recorded by the vp and extended call waiting signals are sent to the web user via the web server . these signals are digital signals causing a call waiting indication ( either visible or audible ) at the web user &# 39 ; s computer ( block 53 , fig4 ). for reasons which will be explained later , an acceptance indication ( usually visible ) is also provided to the web user for enabling the latter to selectively signal acceptance of the waiting call ( to the vp via the web server ). the acceptance indication is generally used in conjunction with other extended services discussed later ( extended caller id and extended call transfer ). the web user &# 39 ; s extended call waiting service may be delivered either unconditionally or subject to conditions stipulated by the user ( block 53 , fig4 ). usually , the conditional version would be used when the web user is operating remote from the premises containing a respective base telephone line , and the unconditional version would be used when the user is linked to the web through the base telephone line to which incoming calls would be directed . a representative condition suggested in block 53 , fig4 is to apply a predetermined number of rings to the user &# 39 ; s base line and if the line remains inactive ( the waiting call is not picked up there , e . g . by a co - occupant of the premises connected to that line ) the extended indications are routed to the user through the web . fig5 shows how the foregoing extended call waiting service can be used with particular advantages in conjunction with other extended services ; specifically , in conjunction with “ extended caller id ” and “ extended call transfer ” services . the extended caller id service would enable its recipient to screen origins of waiting calls indicated by extended call waiting , and extended call transer would allow the recipient to accept selected / screened calls and have the selected calls routed to the recipient &# 39 ; s computer ( of course , via the vp , pstn web server and web ). in effect , extended caller id , as presently contemplated , corresponds to standard caller id ( in which indications of waiting call origins are furnished to a telephone ( analog or other ) connected to a base line ; but with the difference that it is delivered rough an external network by means of intelligent rerouting actions of ip intelligence and a ( web ) server in the pstn . call origin indications delivered by extended caller id are displayable directly at a computer linked to the web ( i . e . they do not require any additional equipment , in contrast to equivalent indications of standard caller id ). extended call transfer , as presently contemplated , is similar in functional effect to standard call forwarding ; but where calls rerouted by standard call forwarding are delivered to an alternate telephone number , which needs to be pre - specified by the user of the service , calls accepted with extended call transfer are routed to an online computer whose location is immaterial to the call route . in other words , where calls forwarded with standard call forwarding can incur distance charges and the like , calls rerouted by extended call transfer are treated the same whether their destination is local to or geographically remote from a respective base line . another difference in extended call transfer via the web is that the signals of the transferred calls are converted between analog and compressed digital formats , the former typical of call signals usually handled within the pstn and the latter typical of signals transmitted over the web . noting that a request for extended services , as presently contemplated , can apply to one or more services , block 60 in fig5 illustrates an exemplary situation wherein an authorized user of extended services acts through the web to activate all three of the foregoing extended services ( block 61 , fig5 ). verification by the server that the user is an authorized one is implied but not explicitly stated in block 60 . in this situation , when the web user signals acceptance of a waiting call , subject to the screening afforded by extended caller id , the accepted call is intercepted at a pstn switch port and redirect to the web user ( blocks 62 - 63 , fig5 ) by coordinated operations of ip intelligence and a web server in the pstn . as suggested in block 63 , audio signals of the redirected call can be transmitted trough the web in a packeted ( compressed ) digital format traditional to that medium . although not stated in this block , it is generally understood that audio signals in that form are convertible within a computer by an internet phone application ; there being a number of such applications presently available commercially . block 63 also suggests that the web user can be given an additional routing option , in respect to call transfer , wherein the extended service is handled as a standard call forward ; i . e . the web user can provide the ip intelligence with the number of a telephone nearby and have the call routed as an analog call to that telephone ( for example , a web user operating in a hotel room with two lines can use one line for web access and the other as a destination for forwarded calls ). a variation of extended call transfer service , presently termed extended fax transfer , is suggested in fig6 . authorized users of this service would be given a special telephone number within their local call region ( e . g . a number associated with a special base account dedicated to the service ), and furnish that special number to parties desiring to communicate facsimile materials . the authorized user could then access the pstn web site , as for the other extended services , and indicate / request activation of a fax transfer option after having been identified as an authorized user of such ( block 68 , fig6 ). when a facsimile call is directed to the special number , the call is intercepted and routed to the authorized user &# 39 ; s computer ( on the web ), the interception and routing being performed by ip intelligence and a web server in the pstn ( block 69 , fig6 ). in this instance , it is understood that the signals sent to the web would be converted to a compressed digital form compatible with that medium and either immediately displayed and printed or saved at the receiving computer . it also should be understood that an authorized user of this service need not have any special facsimile receiving equipment in addition to a computer ( i . e . this could be an economical service for a web user who does not have a special purpose facsimile receiver ). it also should be understood that the re - routed facsimile image can be converted to html ( hypertext markup language ) format now traditionally used for displaying web page materials ( by the ip intelligence in the pstn ), so that the material is presented to the authorized user in the pleasing form associated with that format a contemplated variation or option for this extended fax transfer service would be that if calls are waiting at the special number , but the authorized user is not currently on - line , the image could be saved by the ip intelligence ( vp ) as a form of web e - mail and presented to the authorized user when the latter signs on to the appropriate pstn web site . other variations of this options will readily occur to those skilled in the relevant arts . in respect to each of the foregoing examples of extended service handling , it should be understood that the request for such service ( s ) can originate anywhere in the world , since the web is ubiquitously accessible everywhere ; e . g . at a computer in a city or country remote from the requester &# 39 ; s base line premises ( e . g . premises 1 , fig1 ), at a computer within the requester &# 39 ; s base line premises , and even at a computer that is actively connected to a web / internet access provider through the respective user &# 39 ; s base telephone line . details of operations required to deliver the foregoing extended services are understood by considering the following discussions of fig7 a to 7 g and 8 . it is understood that such operations are performed cooperatively by a vp ( voice peripheral ) such as 36 and server such as 40 ( fig3 ) or equivalent intelligence of the pstn ( e . g . other elements of an intelligent peripheral of a type required by ain architecture ). it is understood further that the operations to be described usually will be performed at a regional node in the pstn locally maintaining the base telephone account of the party receiving the respective extended service . fig7 a to 7 g considered together constitute a flow diagram of operations involved in delivery of extended call transfer service . in this service , telephone calls directed to a base telephone line are conditionally rerouted to the user via the web and appropriate application software on the user &# 39 ; s computer ( e . g . any of today &# 39 ; s commercially available “ internet phone ” type applications ). operations described in this diagram are considered also to be representative of operations required for delivery of extended call waiting and extended caller id services that are useful for screening calls selected for extended call transfer as explained earlier . fig7 a illustrates operations performed when a party on the web logs on to a pstn web server ( the latter representing the web interface maintained by the pstn for that party &# 39 ; s base telephone account ). as noted earlier , the party logging on accesses a web ( or internet ) “ home ” ( or starting ) page maintained by a pstn server in the local telephone calling region normally serving that party ( operation 80 , fig7 a ). the home page contains selectable entries ( e . g . hyperlinked text selectable by clicking a mouse cursor on them ), these entries effectively constituting ( or referencing ) a form which the logging party completes for identification purposes . using the entered information , the ( pstn &# 39 ; s web ) server verifies that the party logging on is an authorized user of a base account within the geographic jurisdiction of the server and the vp handling the service ( operation 82 , fig7 a ). although not stated explicitly , it is understood that if the party is not an authorized user further access to pstn functions is denied . it is also understood implicitly that in this particular instance , the party logging on has effectively indicated acceptance of one or more waiting calls to be connected via extended call transfer service . it is understood also that the verification operation suggested at 82 requires the server either to have a copy of the database of local pstn authorized users or to communicate with other elements of the respective ain network to obtain the needed information . finally , it is understood that the logging party may be anywhere in the world in relation to the local region served by the vp and web server handling the extended ( call transfer ) service . after verifying that the logging party is an authorized user of a base account entitled to extended call transfer service , pstn intelligence ( in this instance , the vp responsible for delivery of telephone services to the base account ) monitors switching centers within the local region for new telephone calls directed to the base telephone line ( at home , office or mobile phone associated with the base account ) of the respective authorized user ( decision / action point 84 , fig7 a ). if no such new calls are pending , the vp and server effectively idle , while the web party &# 39 ; s ( authorized user &# 39 ; s ) computer receives a page image indicating extended services , including extended call transfer , currently being provided to that user ( 86 , fig7 a ). if a new incoming call to the user &# 39 ; s base line is detected (“ yes ” exit from action point 84 ), the call information handling process starting at 90 ( fig7 b ) is evoked . in the latter process , the pstn intelligence checks to make sure that the user of extended call transfer service is still online ( still connected via the web to the pstn &# 39 ; s web server ) as suggested at 92 ( fig7 b ). if the user has disconnected from the web server at this time , standard ringing and call connecting operations 94 are performed relative to the user &# 39 ; s base line . that is , the base line is rung until either the call is answered ( a conventional telephone or telephone answering device goes off - hook ) or the incoming call is terminated ( caller hangs up ). an additional standard voice - mail option , suggested by actions 96 and 98 , routes the incoming call to a centralized voice mail facility maintained by the vp handling the services after a predetermined number of unanswered rings (“ ring count ”) have been applied to the base line . in this option , if the number of unanswered rings to the base line is equal to or less than the predetermined number (“ no ” exit at decision 96 ), the base line ringing process continues , but when the ring count is exceeded (“ yes ” at 96 ) the standard voice mail function is initiated ( action 98 ) with delivery of a recorded announcement to the calling party and opportunity given to that party to leave a voice message . the message is deliverable to the end user of the service either as a standard service function , connected to the user &# 39 ; s standard telephone equipment through lines entirely internal to the pstn , or as an extended voice - mail service function deliverable to the user via the external network and equipment linked to that network . returning to consideration of decision action 92 , if the authorized user is still online when the incoming call is detected (“ yes ” at 92 ), continuing call processing functions are evoked ( refer to fig7 c ) starting at 100 . in this stage of call handling , pstn intelligence in the user &# 39 ; s local service region ( e . g . the vp ) determines if the user has stipulated conditions on delivery of the extended call transfer function ; e . g . a requirement to have a predetermined number of standard rings applied to the user &# 39 ; s base line before the call is routed to the user through the web . if local ringing conditions are applicable (“ yes ” at decision 102 , fig7 c ), the local base telephone line is rung until either the call is locally answered at the base line ( by a conventional telephone device going “ off - hook ”) or a limit number of local rings pre - specified by the user have been applied ( actions 104 , 106 fig7 c ). if local conditions are either inapplicable (“ no ” at 10 2 ) or have been fulfilled without a standard local response (“ yes ” at 106 ), a “ call present ” indication is given to the user &# 39 ; s computer via the web as shown at 108 . this indication can be provided e . g . in the form of a blinking “ call present ” icon on the user &# 39 ; s computer monitor as shown . what happens next is up to the user and indicated by decision functions 110 and 112 . if the blinker function has not timed out (“ no ” at 110 and the user has not accepted the call (“ no ” at 112 ), the blinker presentation continues . if the “ blinker ” function times out without action by the user (“ yes ” at decision 110 ), application of extended call transfer service to the waiting call may be discontinued . an additional service option , suggested at 114 , routes the incoming call to a pstn voice mail service , after the blinker timeout . on the other hand , if the user accepts the incoming call (“ yes ” at 112 , manifested e . g . by the user clicking a mouse button while pointing to the blinker with the latter having a hyper - linked association to “ waiting call ” acceptance ), the call interception and conversion / streaming process starting at 120 in fig7 d is evoked by the pstn intelligence . in this process , a call connection is established between the calling party and the called party / authorized user ( action 122 , fig7 d ). this connection generally runs through a port on pstn switches (“ switch port ”), the vp or other pstn intelligence , the pstn web server , the web and ( a telephone call handling application in ) the authorized user &# 39 ; s computer . with the connection established , the conversion / streaming process is initiated at 124 ( fig7 d ) to convert analog voice signals from the caller to a compressed digital form suited to web transmission and to convert voice signals from the called party , in compressed digital form , to an analog form appropriate for transferral to the caller through the pstn switch port this conversion / streaming process — indicated at 124 . 1 to 124 . 5 in fig7 d — continues until both parties have hung up . monitoring for that occurrence is at decision action 126 fig7 d . if one or both parties are still connected (“ no ” at 126 ) the streaming process continues via actions 124 and 14 . 1 to 124 . 5 . when both parties have disconnected (“ yes ” at 126 ) the conversion process ends ( action 128 ) and a disconnection process is performed , the latter process shown in fig7 g . the streaming conversion process begins at 124 . 1 fig7 d . this process has transmit and receive phases associated respectively with conversion of analog voice signals being transferred from the pstn switch port to the authorized user via the web and conversion of digital voice signals being transferred from the authorized user to the pstn switch port via the web . the transmit phase is indicated at 124 . 2 and 1243 ( fig7 d ), and the receive phase is indicated at 124 . 4 and 124 . 5 ( fig7 d ). in the transmit process , the vp ( or other pstn intelligence ) determines at 124 . 2 if a transmit request is active ( i . e . if analog signals at the switch port have changed since their last sampling , conversion and web transfer ). if a transmit request is not active , the receive phase is started at 124 . 4 . if a transmit request is active , the transmit process 124 . 3 is performed . details of the latter process are shown in fig7 e beginning at 140 in that figure . analog signals at the switch port are sampled periodically ( at a rate sufficient to be able to properly reproduce the voice ), converted to digital form and saved cumulatively in that form ( operations 142 ). when enough digital signals have been accumulated to complete a “ packet ” ( usually , composed of hundreds or thousands of individual samples ) they are sent to the server in a burst ( i . e . time compressed ) form and transmitted by the latter to the authorized user &# 39 ; s computer via the web ( operations 144 ). in the receive process , the vp ( or other pstn intelligence ) determines at 124 . 4 if a receive request is active ( i . e . if a packetized burst received from the web has not been fully converted , retimed and sent to the switch port ). if a receive request is not active , action 126 is performed and the conversion phases are repeated if both parties have not disconnected . if a receive request is active , the receive process 124 . 5 is performed . details of the receive process are shown in fig7 f beginning at 150 in that figure . digital signals received from the web , representing time - compressed voice samples , are converted to analog form , retimed to uncompressed form and applied to the switch port in the last form ( operations 152 and 154 ). when both parties have disconnected (“ yes ” at 126 , fig7 d ) action 128 is taken to invoke the terminating process shown in fig7 g , starting at 160 in that figure . in this process , the switch port is feed up ( i . e . rendered available for another call connection ) as suggested at 162 , and the authorized user &# 39 ; s computer display is modified to indicate that the telephone call application at the computer is now idle ( action 164 ). if the user is still connected to the web server (“ yes ” at decision 166 ), the initial page indicating the extended services currently active is displayed to that user ( operation 168 ), and the processes described heretofore are repeated starting at fig7 a . it is understood that the page presentation indicated at 168 can be accomplished either by sending a full page to the user &# 39 ; s web browser or by signalling the browser to restore a page previously cached in the user &# 39 ; s computer . it should be appreciated that the extended call waiting and extended caller id services previously discussed can be performed by actions similar to but simpler than those described above ; such actions serving to intercept analog signal functions representing activity at a pstn switch port [ in the case of extended call waiting , signal functions denoting one or more pending calls , and in the case of extended caller id signal functions denoting origin ( s ) of ( a ) pending call ( s )], and to transfer corresponding activity indications to the respective authorized user &# 39 ; s computer in digital form via the web . fig8 shows how the extended fax transfer service ( suggested in fig6 ) is implemented . this process , which starts at 200 , involves receipt of a “ local ” telephone call to a special “ local ” telephone number preassigned to the authorized user of the service ( operations 202 ), which number is given by that party to other parties desiring to transmit facsimile images to that user by means of ordinary analog facsimile transmission equipment . although the reception of the call ( detection of a ring directed to the special preassigned number ) does not explicitly indicate to the pstn that the call involves facsimile transmission , that fact is assumed when the call is detected . when a call to such a special number is detected , the pstn intelligence ( e . g . vp ) verifies that the authorized user of the respective service is online ( actively connected to the pstn &# 39 ; s web server ) and ready to receive web pages representing transmitted facsimile images ( operations 204 ). assuming that the user is online and ready , the incoming call is accepted by the pstn intelligence and signals of that call are received , converted to a digital form , stored and eventually transferred to the authorized user via the web . the reception and conversion are indicated at 206 and the transfer to the authorized user is indicated at 208 . as indicated at 206 , the conversion may be used to change received signals ( e . g . analog signals representing bit - mapped elements of a scanned image ) to signals arranged in html ( hypertext markup language ) format generally used for presentation of web pages . converted images can be sent ( downloaded ) to the user either as they are created or delivered at the user &# 39 ; s request at the user &# 39 ; s computer , downloaded images may be either immediately displayed or they may be stored ( e . g . in cached hard disk files designated by the web server and the user &# 39 ; s browser ) and displayed at the user &# 39 ; s request ( by actions of only the user and the user &# 39 ; s browser ). furthermore , stored images may be printed at a printer attached to the user &# 39 ; s computer , by actions of only the user and user &# 39 ; s browser . in the foregoing process , images could be downloaded to and stored in the user &# 39 ; s computer either in response to an explicit action by the user requesting the transfers , or as an automatic function not requiring action by ( or presence of ) the user during the transfers . printing of transferred images is optional for the user , and also represents a method for creating hard copy images of transmitted facsimile which requires neither analog facsimile receiving equipment at the user &# 39 ; s location nor a special facsimile application running on the user &# 39 ; s computer ( e . g . a state - of - the - art type fax modem application which might be difficult to use while the computer is connected to the external network ). | 7 |
the present invention pertains to real - time modulation of the bandwidth each add - drop multiplexer is allocated in a wide area network . even though the present invention suitable for use in wide area networks , the fundamental process of dynamic bandwidth allocation can readily be adapted to any network structure and is not necessarily limited to application in wide area networks . it should be understood that the scope of the present invention is not intended to be limited to such wide area network application and that presentation of the invention in such application is intended as an illustrative application only . [ 0027 ] fig1 is a block diagram that depicts a typical wide area network of prior art comprising add - drop multiplexers , routers and a network management center . it is important to appreciate the fundamental workings of a wide area network prior to discussing the advantages of the present invention . a plurality of add - drop multiplexers 10 are interconnected with high - speed interfaces to form a data ring 5 . the data ring 5 typically comprises counter rotating high - speed interfaces that can be managed by the add - drop multiplexers 10 and the network management center 20 so that failures of the high - speed interfaces between any two add - drop multiplexers can be tolerated . this is typically done by causing the add - drop multiplexers at either end of the interface failure to loop back the data through the non - failed segment of the data ring . each add - drop multiplexer typically services a region within a metropolitan area . within each region , a primary router 15 is connected to the add - drop multiplexer 10 . each primary router 15 may have a plurality of ports that service individual data users or can be connected to other routers in a cascaded manner . typically , the interface between the primary router 15 and the add - drop multiplexer 10 comprises a high - speed outbound and a high - speed inbound interface relative to the region . these are normally referred to collectively as a data trunk 30 . the data generated internal to a region that must be transported to another region finds its way through a series of cascaded routers 15 through to the data trunk 30 and into the add - drop multiplexer 10 . the add - drop multiplexer 10 monitors the data traffic on the data trunk 30 . it should be noted that if the outbound bandwidth carried by the data trunk 30 at any time exceeds the bandwidth allocation assigned to the add - drop multiplexer 10 , the data could be either dropped or delayed by the add - drop multiplexer 10 . whether the add - drop multiplexer 10 drops or merely delays the data depends on the capabilities of the add - drop multiplexer and any retransmission strategies adopted by the network . by monitoring the data traffic on the data trunk 30 , the add - drop multiplexer 10 creates traffic profiles for the region it services . the add - drop multiplexer 10 communicates the traffic profiles back to the network management center 20 using individuated network management interfaces 25 . having received a plurality of traffic profiles from each of the add - drop multiplexers 10 in the network , human analysts , that may or may not be augmented with intelligent automated management systems , establish bandwidth allocations for each region serviced by the network . bandwidth allocations are communicated to each of the plurality of add - drop multiplexers 10 from the network management center 20 using the network management interfaces 25 . this prior art method of network management precludes real - time adaptation of the bandwidth allocation for any particular add - drop multiplexer 10 . [ 0031 ] fig2 is a block diagram depicting one example of a new bandwidth management interface between a router and an add - drop multiplexer . in this example embodiment of the present invention , the router 15 communicates directly with a new add - drop multiplexer 10 to dynamically modify the bandwidth allocation for data sent from a new router 15 to the add - drop multiplexer 10 . the present invention comprises a new router 15 comprising a bandwidth management interface 35 . the present invention may further comprise the new add - drop multiplexer 10 that also comprises a bandwidth management interface 35 . it is important to note that the add - drop management interface may be a separate physical interface or it may be a function interface that uses the existing interface between the add - drop multiplexer and the router [ 0032 ] fig3 is a block diagram of one example embodiment of a new router according to the present invention . the new router 15 comprises a line card 40 coupled to a switch matrix 45 . the switch matrix 45 is coupled to the add - drop multiplexer interface 50 . each line card 40 comprises a router port 43 . router ports 43 are typically used to interface to network users in a region or to other routers that may be cascaded with a primary router . one novel element of the new router 15 is a traffic monitor 47 . the traffic monitor 47 collects real - time information about the amount of outbound data arriving at the router 15 by way of the router ports 43 . the traffic monitor 47 uses this information to determine the aggregate amount of bandwidth required to support the outbound data traffic from a region . the traffic monitor 47 receives a bandwidth allocation from the add - drop multiplexer 10 by way of the bandwidth management interface 35 . in one example embodiment , the traffic monitor 47 compares the instantaneous outbound data traffic volume to the bandwidth allocation received from the add - drop multiplexer 10 . in the event that the current outbound traffic volume is less than the bandwidth allocation , the traffic monitor 47 sends a bandwidth release message to the add - drop multiplexer 10 . this bandwidth release message instructs the add - drop multiplexer 10 to relinquish control of data packets that it would ordinarily use to convey outbound data to the network . in the event that the outbound traffic volume is greater than the bandwidth allocation , the traffic monitor 47 sends a bandwidth request message to the add - drop multiplexer 10 . in response to the bandwidth request message , the add - drop multiplexer 10 attempts to allocate additional bandwidth from the network . [ 0036 ] fig4 is a block diagram of a new add - drop multiplexer according to one illustrative embodiment of the present invention . the add - drop multiplexer comprises a takeoff unit 60 and a bandwidth manager 90 . the bandwidth manager 90 comprises a network management interface 25 that connects to the network management center 20 . the bandwidth manager 90 also comprises a bandwidth management interface 35 . the bandwidth management interface 35 allows the add - drop multiplexer &# 39 ; s bandwidth manager 90 to communicate with the traffic manager 47 within the new primary router 15 . in one exemplary embodiment , the bandwidth manager 90 receives bandwidth allocations from the network management center 20 by means of the network management center interface 25 . these bandwidth allocations comprise initial values for the amount of bandwidth each add - drop multiplexer must support at the network trunk 30 . the network trunk 30 comprises an outbound interface 31 from the primary router and an inbound interface 32 to the primary router . in this example embodiment , the bandwidth manager 90 coordinates the activity of the takeoff unit 60 . the takeoff unit 60 comprises upstream and downstream interfaces to the network . the takeoff unit 60 further comprises the network trunk 30 used to interface to the primary router servicing a region . the takeoff unit 60 receives data packets from the upstream interface and delivers the data packets to the downstream interface . each data packet 70 comprises an add - drop multiplexer identification field 74 , destination field 75 , a source field 80 , and a payload 85 . for the purposes of this discussion , the payload 85 is used to transport data around the network . in a typical embodiment , data is taken off the network by the takeoff unit 60 whenever the destination field 75 falls within the address map for a particular region serviced by the add - drop multiplexer 10 . data egressing from the region by way of the outbound interface 31 is injected into the payload section 85 of a data packet 70 . because the total amount of bandwidth that the network can carry is limited , each add - drop multiplexer 10 is allocated some finite number of data packets 70 that can be used to transport data . ownership of these data packets is tracked by the add - drop multiplexer identification field 74 in each data packet 70 . the bandwidth manager 90 receives two types of messages from the primary router servicing a particular region . these messages arrive over the bandwidth management interface 35 . the first type of message processed by the bandwidth manager 90 is a bandwidth release message . the bandwidth release message indicates the amount of pre - allocated bandwidth that the region serviced by the add - drop multiplexer 10 will not require at that time . in response to the bandwidth release message , the bandwidth manager 90 directs the takeoff unit 60 to mark data packets owned by that add - drop multiplexer as being “ unneeded ”. in one example embodiment , all that must be done is to set the destination field 75 of the data packet 70 to a null value . once the data packet is so marked , it is fed into the network . other add - drop multiplexers in the network can use data packets belonging to other add - drop multiplexers so long as those data packets are marked as unneeded . the second type of message that the bandwidth manager 90 can receive is the bandwidth request message . the bandwidth request message is a request from the traffic manager 47 in the primary router 15 for additional network bandwidth above and beyond the initial allocation that the bandwidth manager 90 receives from the network management center 20 . the bandwidth manager 90 seizes data packets owned by other add - drop multiplexers in an effort to accommodate the additionally requested bandwidth . depending on system latencies and the buffering capability of the takeoff unit 60 , some number of data packets will be captured to support the additionally requested bandwidth . once these data packets are captured , the bandwidth manager 90 notifies the traffic manager 47 how much additional bandwidth has been secured . in a different embodiment , the bandwidth manager 90 monitors the availability of bandwidth on a continuous basis . based on this statistical analysis of the number of unneeded data packets traversing the network , the bandwidth manager 90 advises the traffic manager 47 how much additional bandwidth could be made available . in this alternative embodiment , the traffic manager 47 allows outbound data to be directed to the takeoff unit 60 . the takeoff unit 60 buffers the outbound data and then transports the data over the network as unneeded data packets owned by other add - drop multiplexers arrive in the takeoff unit 60 . in either of these embodiments , the data manager 90 may determine that additional bandwidth is not available . in this case , the bandwidth manager 90 so notifies the traffic manager 47 . the traffic manager 47 can be programmed to respond in three different ways if additional bandwidth is not available . in the first mode , the traffic manager simply discards the outbound data that cannot be accommodated by the allocated bandwidth . higher levels of communication protocols employed by processes using the network may resend data that is so discarded . the traffic manager 47 can also be instructed to shape the traffic pattern for the outbound data . in this mode , the traffic manager 47 buffers the outbound data until additional bandwidth can be allocated or until the outbound data can be accommodated by the initial allocation . the traffic manager 47 also supports a throttling mode . in this mode , the traffic manager 47 throttles back the sources of the outbound data thereby causing the sources to delay the transmission of the data . the data sources may retransmit data at a later time when additional bandwidth can be allocated or the aggregate outbound data volume can be accommodated by the initial allocation . [ 0044 ] fig5 is a flow diagram that summarizes the process of dynamic bandwidth allocation according to one embodiment of the present invention . the first step in the process occurs in the traffic manager 47 located in a primary router 15 . this first step is that of checking the amount of bandwidth that is actually needed to support the outbound traffic from the region ( step 100 ). following this , the process requires that the amount of actual bandwidth required be compared with the bandwidth allocation received from the network management center 20 ( step 105 ). when the amount of outbound traffic from a region exceeds the bandwidth allocated by the network management center 20 , as determined by a simple comparison ( step 110 ), the traffic manager 47 sends a bandwidth request message ( step 115 ) to the bandwidth manager 90 located in the add - drop multiplexer servicing the region . the bandwidth manager 90 will receive the bandwidth request message . in response , the bandwidth manager 90 determines if the network can accommodate additional bandwidth . the bandwidth manager 90 notifies the traffic manager 47 regarding the availability of additional bandwidth . if additional bandwidth is available the traffic manager 47 directs the outbound data outward to the network . if additional bandwidth is not available , the traffic manager 47 either discards the data , attempts to shape the traffic pattern of the outbound data , or throttles back the sources of the outbound data until additional bandwidth can be made available ( step 120 ). if the aggregate amount of outbound data from the region is less than the allocated bandwidth ( step 125 ), the traffic manager 47 sends a bandwidth release message ( step 130 ) to the bandwidth manager 90 . the bandwidth manager 90 causes the takeoff unit 60 to mark as unneeded data packets that it owns so that other regions can use those data packets to transport data as needed . while this invention has been described in terms of several preferred embodiments , it is contemplated that alternatives , modifications , permutations , and equivalents thereof will become apparent to those skilled in the art upon a reading of the specification and study of the drawings . it is therefore intended that the true spirit and scope of the present invention include all such alternatives , modifications , permutations , and equivalents . in some embodiments , existing signaling protocols may be used to control the dynamic bandwidth allocations . use of these existing signaling protocols may include , but may not necessarily be limited to ccs # 7 ( a . k . a . ss7 ). although non - standard , proprietary signaling has been described herein , use of these standardized signaling protocols would allow for wider applicability of the present invention vis - à - vis the world &# 39 ; s installed based of known routers and add - drop multiplexers . | 7 |
40 . a standard pressurized reactor equipped with means for heating , cooling and mixing is suitable for carrying out the process of this invention . the ingredients required to form a heat reactive resin system are charged to the vessel . suitable ingredients include the base resin , curing agents , accelerators and other additives such as pigments to provide the desired end use properties . preferred resins that are commonly included in the formulation of coating powders are described , for example , in the kirk - othmer reference , supra , in powder coatings chemistry and technology by t . a . misev , j . wiley & amp ; sons ( 1991 ), chapters 2 - 4 and in the science of powder coatings — chemistry , formulation and application , volume 1 , by d . a . bate , published by sita technology ( 1990 ) chapter ii and iii . in general , these resins have molecular weights ( m n ) in a range of about 500 - 100 , 000 but mostly in a range of about 1 , 200 - 10 , 000 . to maintain flowability in storage , the preferred tg of the resins is usually greater than about 40 ° c . and preferably above about 50 °. resins useful in the practice of this invention are most commonly epoxy resins , polyester resins , both hydroxyl and acid functional , amorphous and semi - crystalline types as described in pct wo 91 / 14745 , acrylic resins both hydroxyl and acid functional , and combinations thereof . thermoplastic and thermosetting resins can be used in combination . in the case of thermosetting resins , suitable curing agents include dicyanamides and derivatives , amines , imidizoles , phenolic resins , carboxyl functional polyester or acrylic resins for the epoxy resins , blocked isocyanate , uretdione and amino resins for hydroxyl functional polyester or acrylic resins , dibasic aliphatic acids or polymeric polyanhydrides for glycidyl functional acrylic resins and triglycidyl isocyanurate ( tgic ) and other glycidyl functional resins and compounds and hydroxyalkyl amide curatives for acid functional polyester and acrylic resins . 41 . additives are often included in the heat reactive resin systems for special purposes . these may include flow control additives , degassing additives , surface active agents , charge control additives ( especially in the case of electrostatic toners ) mar and slip additives , heat and light stabilizers , waxes , gloss control additives and many others . pigments and inert extenders such as barium sulfate or calcium carbonate are sometimes useful . 42 . it has been found that the transient processing time can be materially extended if minor amounts , e . g . 10 % or less by weight , of high boiling solvents or plasticizers are included in the heat reactive resin system . 43 . after all the ingredients have been charged to the reactor , it is sealed and the liquefied gas introduced . agitation can be started as soon as the resin mixture is wet out by the liquefied gas or delayed until the vessel is filled with the liquefied gas and adjusted to the desired conditions of temperature and pressure . the ratio of liquefied gas to the resin mixture can vary over a wide range . as low as 10 % ( all percentage are given in the specification and clams by weight unless otherwise noted ) resin mixture and 90 % liquefied gas to as high as 80 % resin mixture and 20 % liquefied gas are useful in the practice of the invention . quite generally , a ratio of about 20 - 60 % resin mixture to gas is a convenient ratio . 44 . if the gas is co 2 , a range in temperature from ambient temperature to about 160 ° c . is useful but a range of from about 30 ° c . to 150 ° c . and more preferably a range of about 30 ° c . to about 90 ° c . is preferred . with regard to pressure , it must be high enough to maintain the gas in a liquefied state . pressures of from about 300 psi to about 20 , 000 psi may be utilized . when the gas is co 2 pressures of about 800 psi to about 6 , 500 psi are useful and more preferably are in a range of from about 1000 psi to 5000 psi . 45 . the resin mixture is mixed with the liquefied or supercritical carbon dioxide until the resin is solvated . this occurs in a relatively short period of time , or about 5 - 30 minutes , after the desired conditions of temperature and pressure are attained . the ingredients in the resin mixture can be dispersed by continuing to mix them in the pressurized vessel . alternately , the dispersion can be carried out after the vessel has been essentially depressurized by removing the liquefied carbon dioxide and causing the liquefied solvated resin mixture to flow through a media mill , roll mill , colloid mill or other suitable dispersion device while at atmospheric pressure . sufficient gas pressure can be retained in the reactor to force the heat reactive resin through the dispersion device or a pump can be used . 46 . in one embodiment of this invention , two pressure vessels are used in tandem in a semicontinuous process . after the resin mixture is mixed with the supercritical co 2 and a heat reactive resin system is established , the liquefied co 2 is allowed to separate from the heat reactive resin system by stopping the agitation . the supernatant co 2 is transferred to a second pressure vessel into which the ingredients of a resin mixture have already been added thereby leaving the solvated fluid heat reactive resin system in the first vessel at atmospheric pressure or at a pressure sufficiently low to aid in removal of the fluid heat reactive resin system from the vessel . while the fluid heat reactive resin system is discharging from the first vessel , a solvated resin mixture is formed in the second vessel . when the first vessel is fully discharged , it is charged with a new resin mixture , sealed and filled with some of the co 2 from the second reactor . the second reactor is then discharged . this procedure is sequentially repeated to reduce consumption of co 2 and to yield a relatively continuous stream of fluid heat reactive resin systems . 47 . the following example is given to illustrate the practice of this invention . however , it should not be construed as limiting since many variations of the procedure will be apparent to those skilled in the art . 48 . the following materials were charged to a 1 liter pressurized stirred reactor equipped with a turbine agitator ( pressure products — lc series ) 49 . ( 1 ) the composition of the epoxy powder is as follows : epoxy resin ( a ) 48 . 0 deh 85 ( b ) 15 . 4 b - 68 ( c ) 0 . 9 resiflow p - 67 ( d ) 0 . 7 tio 2 24 . 0 calcium carbonate 11 . 0 50 . ( 2 ) aluminum paste , sbc - 516 - 20z from silberline manufacturing 55 . 4 wt % aluminum flake , 44 . 6 wt % mineral spirits . in this example the mineral spirits were present in the heat reactive resin system in an amount equal to 2 . 3 wt % ( 13 . 5 × 0 . 446 / 263 . 5 ) this presence of mineral spirits is most important . it is believed that the mineral spirits act as a plasticizer or a high boiling solvent for the resin and is responsible for establishing and extending the transient processing time . 51 . components 1 and 2 were dry mixed and added to the reactor which was then sealed . an agitator in the reactor was started at 400 rpm and liquefied carbon dioxide was allowed to flow from a pressurized cylinder into the reactor while the reactor was being heated . after 5 minutes , the vessel was full of carbon dioxide and the pressure gauge registered 800 psi . while carbon dioxide continued to flow from the cylinder , the pressure relief valve of the reactor was opened slightly to allow a flow rate of 5 liters per minute . after seven minutes , the temperature had reached 64 ° c . and the agitator started to show difficulty stirring as judged by the generation of noise . the protective shield which covers the agitator motor , agitator drive , and agitator pulley was removed and it was noted the agitator drive belt showed signs of instability , i . e ., vibration . after 12 minutes , the agitator drive belt showed further signs of instability and the speed was increased to 600 rpm . it is believed that the instability of the agitator is due to the viscous nature of the solvated resin mixture . at this time , the temperature registered 64 ° c . after a further 5 minutes , 17 minutes total , the temperature remained constant at 64 ° c ., the pressure at 800 psi , flow rate 5 liters per minute , and the agitation stable at 600 rpm . after 20 minutes , the temperature had increased to 69 ° c ., the agitator speed read 567 rpm , the pressure and flow rate remained constant . after 30 minutes , the temperature read 71 ° c . and the agitator speed 580 rpm . after 33 minutes , the flow of carbon dioxide was stopped and the vessel allowed to depressurize at the rate of 5 liters per minute . after 40 minutes , the pressure had decreased to 400 psi and the agitator speed to 500 rpm ( with no changes to the speed regulator ). after 45 minutes , the pressure gauge read & lt ; 100 psi and the agitator registered 284 rpm with an increasing level of instability . after 48 minutes , the vessel was completely depressurized . the temperature was 73 ° c . the vessel was opened in five minutes . the now visible contents had the appearance of an unfoamed resin solution . the unfoamed fluid heat reactive resin system was scraped from the agitator blades and scooped out of the pressure vessel . after about five minutes after discharge from the vessel , the fluid heat reactive resin system started to solidify , although it was still tractable . ten minutes after depressurization , the resin system was still fluid , but had the consistency of putty and flowed only under force . after about 30 minutes , the resin system was essentially solid especially in thinner sections , i . e ., less than about 5 mm . thick sections were still slightly soft . 52 . there is no disclosure in the prior art which suggests that a fluid heat reactive resin system prepared as above described can be configured as into a shape or applied as a coating to a substrate at atmospheric pressures . in this later regard , the coating can be applied to the substrate as by brushing , dipping , flow coating , calendaring , spraying or the like . the coating can then be cured by low temperature curing . if reactive , low temperature curing agents are used to prepare the heat reactive resin system , it enables the application of a coating to heat sensitive substrates , such as plastics , paper or wood , without thermally degrading or deforming the substrate . regardless of whether low temperature acting or more conventional curative are used in the preparation of the resin system , the system can be readily converted to a powder suitable for application by conventional powder coating application methods . 53 . the fluid heat reactive resin system can also be molded into a desired shape as in injection or rotational molding . | 8 |
the present invention is based upon a surprising finding that stem cells , for example neural stem cells ( nscs ), can migrate throughout a tumor , track metastatic tumor cells and when administered intravenously , can cross the blood brain barrier to reach tumor cells in the brain . we have further surprisingly discovered that nscs , including modified ( genetically engineered ) nscs , target tumors , including metastatic tumor cells , both intracranially and extracranially , when delivered through the peripheral vasculature . the invention provides a method to treat tumors by administering modified or unmodified stem cells , for example , neural stem cells , to an individual affected by tumors both inside or outside the nervous system . the delivery method of the present invention offers a number of advantages over direct injection of virus into a tumor . for example , the virus carried by the modified stem cell can be activated after a delay to allow the cells to migrate towards metastatic tumor cells as described infra . also , the therapeutic gene in the scs can be driven by a tissue - specific promoter to “ narrow - cast ” expression of the gene to regions or cell types of concern while protecting regions that need sparing . the stem cells useful according to the present invention include cells that are capable of migrating through a tumor , beyond a tumor / parenchyma border and brain tissue to “ chase down ” invading cells , or cells that can “ home in ” on tumors present inside and outside the nervous system from a systemic entrance point . to date , these have included not only primary brain tumors but also neuroblastoma , melanoma and prostate cancer implanted either in the brain or in the flank . they should also include any tumor cell type that metastasizes , including to the brain these stem cells can be prepared as described by snyder [ snyder et al ., cell 68 , 33 - 51 , 1992 ; snyder , the neuroscientist 4 , 408 - 25 , 1998 ]. other examples of stem cells useful according to the present invention include , but are not limited to , neural or embryonic stem cells , hsn - 1 cells , fetal pig or other xenotropic cells , neural crest cells , bone marrow derived stem cells , muscle stem cells and hnt cells . the hsn - 1 cells useful according to the invention can be prepared as described in , e . g ., ronnett et al ., science 248 , 603 - 605 , 1990 . the preparation of neural crest cells is described in u . s . pat . no . 5 , 654 , 183 . the hnt cells useful according to the present invention can be prepared as described in e . g ., konubu et al ., cell transplant 7 , 549 - 558 , 1998 . the stem cells according to the present invention can be modified to deliver substances that can be used to destroy or inhibit growth of tumor cells . such substances include , but are not limited to vectors encoding genes for toxins ; prodrugs ; enzymes such as cytosine deaminase ( cd ); angiogenesis inhibitors such as tnp - 470 , platelet factor 4 , thrombospondin - 1 , tissue inhibitors of metalloproteases ( itmp1 and timp2 ), prolactin ( 16 - kd fragment ), angiostatin ( 38 - kd fragment of plasminogen ), endostatin , bfgf soluble receptor , vegf soluble receptor ; cytokines ; growth factors and their inhibitors ; interleukins ( il ), il - 1 , il - 2 , il - 3 , il - 4 , il - 5 , il - 6 , il - 7 , il - 8 , il - 10 , and il - 11 ; tissue necrosis factors ( tnf ) tnfα and tnfβ ; lymphotoxin ( lt ); interferons ( ifn ) ifnα , ifnβ and ifnγ ; tissue growth factors ( tgf ); colony - stimulating factors ( csfs ); and nerve growth factor ( ngf ). in the preferred embodiment , the stem cells are engineered to deliver cytocine deaminase , which converts a non - toxic 5 - fluorocytosine ( 5 - fc ) into a toxic 5 - fluorouridine ( 5 - fu ). for example , the examples infra show size reduction in the experimental tumor models in the cd / 5 - fc prodrug example , nscs were able to express a bioactive transgene in vivo and to effect a significant anti - tumor result 5 - fu is a chemotherapeutic agent with selective toxicity to dividing cells through its toxic metabolites and can readily diffuse into surrounding tumor cells giving cd an impressive “ bystander ” effect . as little as 2 % of the tumor mass expressing cd can generate a significant antitumor effect in response to 5 - fc [ huber et al ., proc . vatl . acad sci . usa 91 , 8302 - 06 , 1994 ]. vectors useful in modifying the stem cells of the invention include , but are not limited to ( a ) adenovirus vectors ; ( b ) retrovirus vectors ; ( c ) adeno - associated virus vectors ; ( d ) herpes simplex virus vectors ; ( e ) sv 40 vectors ; ( f ) polyoma virus vectors ; ( g ) papilloma virus vectors ; ( h ) picarnovirus vectors ; ( i ) vaccinia virus vectors ; ( j ) a helper - dependent or gutless adenovirus ; and ( k ) lentivirus or hiv - derived vectors . in one preferred embodiment the virus is a herpes simplex type 1 virus ( hsv - 1 ). in a preferred embodiment , the vector is a replication - dependent hsv - 1 vector which has been engineered to lack ribonucleotide reductase activity . the stem cells can also be engineered to controllably express the desired substance intended to treat tumors . such controlled expression systems include , but are not limited to drug / hormone inducible promoters , e . g ., tetracycline [ gossen and bujard , nucl acids res 21 , 4411 - 2 , 1993 ], rapamycin [ rivera et al ., nat med 2 , 1028 - 32 , 1996 ], and glucocorticoid inducible promoters [ lu and federoff , hum gene ther 6 , 419 - 28 , 1995 ]; tetracycline silencer system [ freundlieb et al ., j gene med . 1 , 4 - 12 , 1999 ], particularly combined with a “ piggyback ” hsv - 1 delivery system [ pechan et al ., hum gene ther 7 , 2003 - 13 , 1996 ]; and tissue specific promoters . in one embodiment , a replication - dependent hsv - 1 vector is produced by deleting the ribonucleotide reductase ( rr ) gene of hsv - 1 vector to render the vector susceptible to control by external expression of rr . to avoid destruction of delivery cells by viral replication upon implantation , regulation of expression of genes by viral vectors is desired . delayed expression allows better migration of the cells infected with a viral vector . it is preferred that the expression can be delayed for 1 - 6 days , preferably 3 days after the injection of the cells to avoid self - destruction of the delivery cells and to allow the stem cells to reach potential metastatic tumor cells . when using the inducible systems in viral vectors , it is important to achieve full - off baseline expression to prevent residual viral replication which can result in premature death of stem cells infected with the in one embodiment , the present invention provides stem cells , preferably neural stem cells , infected with an hsv - 1 vector which has been engineered to lack the rr enzyme thereby rendering it non - replicable in the absence of externally produced rr . because the hsv - 1 vector can only replicate in dividing cells , virus replication can be regulated by regulating cell division . control of replication - conditional hsv - 1 rr vector replication can be achieved , for example , by arresting the carrier cells growth prior to infection . for example , the drug mimosine can be used to block growth of neural stem cells at confluency and thus prevent virus replication . in addition to arresting the cell cycle in the late g1 phase , mimosine also inhibits cellular rr enzyme . addition of mimosine in infected cells in vivo completely abolishes viral replication which is resumed after removal of mimosine . the mimosine block of cell division and viral replication is reversible at treatment times at least up to 13 days . in another embodiment , co - treatment with ganciclovir ( gcv ) and mimosine as a viral replication block can be used . after gcv treatment , neural stem cells differentiate into neurons and harbor the virus in a latent state . after withdrawal of gcv and mimosine the cells need a high level of rr to allow the re - entry of the quiescent viral genome of the replication - conditional hsv - 1 rr − onto the replicative cycle . alternatively , the immediate early virus proteins icpo or icp4 that are known to be important in the hsv - 1 re - activation can be used to re - activate the arrested viral replication [ zhu et al ., j virol 64 , 4489 - 98 , 1990 ]. in addition , viral replication proteins like icp4 and cip27 can also be placed under control of drug / hormone inducible promoters . additional genes can be inserted into the replication - dependent vector . a non - limiting example is cyp2b 1 gene , which is responsible for the bio - activation of prodrugs cyclophosphamide and ifosfamide . once the packaging cells have migrated to the appropriate site , the appropriate prodrug can be administered to produce an oncolytic effect . similarly , not all , the components of the tested vector are believed to be necessary . vector constructs may additionally include a marker gene for potential histological tracking . such markers include , but are not limited to lacz or genes encoding fluorescent proteins such as green fluorescent protein , gfp . genes with other functions may also be included . in accordance with the present invention the stem cells are administered to an individual in a pharmaceutically acceptable carrier systemically . in the preferred embodiment , the stem cells are administered intravascularly , including intravenously . the stem cells may also be administered using intra - csf or intraosseous injection . the tumor treatment method of the present invention may also be combined with traditional therapeutic interventions such as surgery , chemotherapy , radiotherapy or even other gene therapy . the cells can be administered to an individual before , during or after other treatments . the practice of the present invention will employ , unless otherwise indicated , conventional techniques of cell biology , cell culture , molecular biology , transgenic biology , microbiology , recombinant dna and immunology , which are within the skill of the art . such techniques are described in the literature . [ see , for example , molecular cloning : a laboratory manual , 2d ed . ed . by sambrook fritsch and maniatis cold spring harbor laboratory press . 1989 ; dna cloning : volumes i and ii . ed . by d . n . glover , 1985 ; oligonucleotide synthesis . ed . by m . j . gait , 1984 ; mullis et al ., u . s . pat . no . 4 , 683 , 195 ; nucleic acid hybridization . ed . by b . d . hames and s . j . higgins , 1984 ; transcription and translation . ed . by b . d . hames and s . j . higgins , 1984 ; culture of animal cells ed by r . i . freshney , alan r . liss , inc ., 1987 ; immobilized cells and enzymes , irl press , 1986 ; practical guide to molecular cloning , b . perbal , 1984 ; gene transfer vectors for mammalian cells , ed by j . h . miller and m . p . calos , cold spring harbor laboratory , 1987 ; methods in enzymology : vols . 154 and 155 , ed . by wu et al . ; immunnochemical methods in cell and molecular biology , ed . by mayer and walker , academic press , london , 1987 ; handbook of experimental immunology : vols . i - iv , ed . by d . m . weir and c . c . blackwell , 1986 ; manipulating the mouse embryo , cold spring harbor laboratory press , cold spring harbor , n . y ., 1986 ]. the references cited throughout the specification are herein incorporated in their entirety . the present invention is further illustrated by the following examples and claims . the examples are provided to aid in the understanding of the invention and are not to be construed as a limitation thereof . several nsc lines , both human and murine , were transduced with a transgene encoding the bacterial pro - drug activating enzyme cytosine deaminase ( cd ) to determine if they retained their migratory , tumor - tracking properties . on day 0 , adult cd - 1 mice received stereotactically guided injections of cns - 1 cells ( 8 × 10 4 in 2 μl pbs ) into the right frontal lobe , as described above , and murine or human cd - nscs ( 8 × 10 4 in 2 μl pbs ) into the left frontal lobe ; animals received daily injections of cyclosporine 10 μg / g ) and were sacrificed on day 7 . the cd - transfected donor nscs migrated across the corpus callosum and infiltrated the tumor in adult rodents . as shown in fig1 a and 1 b , human cd - nscs were found distributed throughout the tumor on the opposite hemisphere at day 7 after injection . these data support the premise that both murine and human nscs modified to express a therapeutic bioactive agent ( cd ) behave in a similar migratory manner to unmodified nscs ; in other words , placing in a therapeutic gene does not blunt their migratory ability . that human nscs could similarly target a true human glioblastoma is suggested in fig1 c , 1 d and 1 e in which primary human nscs implanted contralateral to an hgl21 - derived tumor ( human gbm ) established in the nude mouse cerebrum . again , human nscs migrated from one hemisphere to the other to populate the glioblastoma this experiment was performed to determine if modified cd - nscs could effectively deliver therapy to tumor cells and produce a profound antitumor response . 200 , 000 cns - 1 glioma cells were plated into 10 cm petri dishes . the following day ( day 1 ) media were replaced , and 50 , 000 or 100 , 000 cd - nscs were added . on day 2 , media were replaced and 5 - fc added ( 500 μg / ml ). control dishes included tumor - nsc co - cultures with no 5 - fc treatment and tumor cell - only dishes with 5 - fc treatment . three days later , all plates were rinsed well with 1 × pbs and fixed with 4 % paraformaldehyde for 10 min at room temperature . plates were stained with x - gal at 37 ° c . overnight to visualize nscs and counterstained with neutral red to visualize tumor cells . under high power , the numbers of tumor cells per field were counted . the tumor cell total was averaged from 20 random fields per plate . error bars represent standard error of the mean . these cell culture studies indicated significant oncolytic effects of cd - nscs on surrounding brain tumor cells when exposed to the prodrug 5 - fc . to provide proof - of - principle for therapeutic efficacy , nscs were stably transduced with a transgene encoding the enzyme cd . cd converts the nontoxic prodrug 5 - fc to the oncolytic drug 5 - fluorouracil , a chemotherapeutic agent that readily diffuses into tumor cells and has selective toxicity to rapidly dividing cells . the cd gene provided an opportunity to examine a prototypical bioactive gene with a relevant , specific , quantifiable readout of functionality ( oncolysis ) that might be enhanced by tumor proximity . cd - bearing nscs were first cocultured with glioma cells and when nearly confluent ( fig2 a ), exposed to 5 - fc . death of surrounding tumor cells was induced ( fig2 b ), even when the ratio of nscs - to - tumor cells was as low as 1 : 4 . nscs that were mitotic at the time of 5 - fc exposure self - eliminated . control plates of tumor alone were not significantly killed by the same dose of 5 - fc . on day 0 , adult nude mice received stereotactically guided injections into the right frontal lobe of cns - 1 glioblastoma alone ( 7 × 10 4 in 2 μl pbs ), or cns - 1 cells mixed with cd - nscs ( 7 × 10 4 cns - 1 and 3 . 5 × 10 4 nscs in 2 μl pbs ). two days later treated animals received 10 intraperitoneal injections 900 mg / kg of 5 - fc over a period of 10 days . control animals received no 5 - fc . animals were sacrificed on day 13 . as shown in fig3 a through 3d , animals receiving transplants of cd - nscs and tumor cells followed by treatment with 5 - fc , showed a significant reduction in tumor mass , as compared to the untreated animals . to determine if intravenous injection of neural stem cells would result in the cells targeting experimental intracerebral tumors , we conducted the following experiment : 1 × 10 5 cns - 1 glioma cells in 2 μl pbs were implanted into the right frontal lobe of adult nude mice . seven days later , after the tumor was well established , 2 × 10 6 neural stem cells ( c17 . 2 ) in 200 μl pbs were injected into the tail vein . the nscs were given four days to distribute ( potentially migrating out of the vasculature into the experimental tumor parenchyma , i . e ., potentially crossing the blood - tumor barrier ), after which the mice were sacrificed with anesthesia overdose . the brain , liver , kidneys , spleen , and heart were harvested and post - fixed overnight in 4 % paraformaldehyde and then cryoprotected in 30 % sucrose . ten - micron serial cryostat sections were collected . brain tissue sections were stained with x - gal and neutral red to examine donor nsc distribution within the experimental intracranial tumor . x - gal staining revealed blue nscs distributed throughout the tumor mass and not in surrounding normal appearing brain tissue . double immunofluorescent staining with antibodies to β - galactosidase ( to identify donor nscs tumor ) and tumor - specific antigens was also performed to provide independent confirmation of the presence of donor - derived cells within the tumor . the β - gal antibody immunofluorescent staining confirmed the x - gal results , that the nscs were found in the tumor but not surrounding tissue . staining such as this was not found in the absence of nsc injections or in nsc injected animal in the absence of tumor . also , simply injecting vehicle rather than a tumor does not provide these findings . to determine if intravenous injection of neural stem cells would result in targeting of extracerebral tumors , we conducted the following experiment in the flank of an adult nude mouse , 3 - 4 × 10 6 cns - 1 rodent glioma or sh - sy5y human neuroblastoma cells in 300 μl pbs were implanted subcutaneously . three weeks later , the tumors were well established . then , 2 - 3 × 10 6 neural stem cells in 200 μl pbs were injected into the tail vein . the neural stem cells were lacz + murine nscs ( c17 . 2 ) or lacz + murine nscs retrovirally transduced with cytosine deaminase and selected with puromycin ( c17 . 2 cd ). the nscs were given four days to circulate and potentially migrate out of and away from the vasculature into the experimental tumor tissue . on the fourth day after tail vein nsc administration , the animals were sacrificed by anesthesia overdose . the tumor mass , liver , kidneys , spleen , heart and brain were harvested and post - fixed overnight in 4 % paraformaldehyde and then cryoprotected in 30 % sucrose . ten - micron serial cryostat sections were collected . tumor tissue sections were stained with x - gal and neutral red to examine donor nsc within the experimental subcutaneous tumor mass . four days after c17 . 2 . cd cells were injected into the tail vein of a mouse with an established subcutaneous sh - sy5y human neuroblastoma ; x - gal staining revealed nscs distributed throughout the tumor mass and not in surrounding tissue . after c17 . 2 cells were injected into the tail vein of a mouse with an established subcutaneous cns - 1 rat glioma , x - gal staining showed nscs distributed throughout the tumor mass and not in surrounding tissue . immunofluorescent staining with antibodies to β - galactosidase ( to identify nscs ) was performed to provide independent confirmation of the presence of donor - derived cells . the β - gal antibody immunofluorescent staining confirmed the x - gal results that the nscs were found were found in the tumor . β - gal staining was not found in the absence of nsc injections or in nsc - injected animals in the absence of tumor . injecting vehicle alone , rather than nscs , into the tumor did not provide these findings . in this example , injecting non - nscs did not supply cells that left the vasculature and distributed themselves throughout the tumor . from these findings we conclude that nscs remained stably transfected with β - gal and that nscs targeted extracranial / extraspinal tumors following intravascular administration ( i . e . migrate out of the involved blood vessels to infiltrate the tumor ). these cells do not further enlarge the tumor , over baseline . this example has been repeated with different neural experimental tumors , including , but not limited to , rodent glioma ( cns - 1 / gfp ), human glioma ( hgl - 21 , u87 , u251 ) and human neuroblastoma ( sh - sy5y ). the tumor cells are conveniently injected subcutaneously into the flank of the recipient ; however , other injection locations and methods known to those skilled in the art can be used as desired . a variety of stem cell lines can be used , preferably neural stem cells , including but not limted to murine nscs or human nscs . the nscs are conveniently injected into the tail vein of the animal . as in the example 5 , an intravenous injection of cytosine deaminase - transduced nscs was used to target an extracranial tumor , but harvested the tumor only 30 minutes following nsc injection . in the flank of an adult nude mouse , 4 - 5 × 10 6 sh - sy5y human neuroblastoma cells in 300 μl pbs were implanted subcutaneously into the left and right flank . three weeks later , the bilateral tumors were well established . at this point , the animal was anesthetized and the left tumor mass surgically removed , and skin closed . then , 2 - 3 × 10 6 nscs in 200 μl pbs were injected into the tail vein the nscs were lacz + murine nscs retrovirally transduced with cytosine deaminase and selected with puromycin ( c17 . 2 . cd ). the nscs were given 30 minutes to circulate . the animal was sacrificed by anesthesia overdose and the right flank tumor mass surgically removed . organs harvested included liver , kidneys , spleen , heart and brain which were post - fixed overnight with both tumor masses in 4 % paraformaldehyde and then cryoprotected in 30 % sucrose . ten - micron serial cryostat sections were collected for histological analysis . tumor tissue sections were stained with x - gal and neutral red to examine donor nsc distribution within the experimental subcutaneous tumor mass . 30 minutes following c17 . 2 . cd nsc injection into the tail vein of a mouse with an established right subcutaneous sh - sy5y human neuroblastoma , x - gal staining revealed donor nscs all along the outer portions of the tumor mass and not in surrounding , normal appearing tissue ( fig6 b , d - g ). no such staining was observed in the left sh - sy5y tumor mass that was removed immediately prior to nsc injection ( fig6 a and 6c ). immunofluorescent , staining with antibodies to β - galactosidase ( to identify nscs ) was also performed to independently confirm the presence of donor - derived cells . to determine if intravenous injection of neural stem cells would result in targeting of non - neural extracranial tumors , 10 - 12 × 10 6 human melanoma ( skbe ) cells in 200 μl pbs were implanted subcutaneously in the flanks of adult nude mice , as in example 5 . after 2 weeks , 2 - 4 × 10 6 cytosine deaminase - transduced c17 . cd2 murine nscs were conveniently injected intravenously into the tail vein . the nscs were given 30 minutes to circulate , followed - by animal sacrifice by asphyxiation . the tumor mass , liver , kidneys , spleen , heart and brain were harvested and postfixed overnight in 4 % paraformaldehyde and then cryoprotected in 30 % sucrose . ten micron serial cryostat sections were collected . tumor sections were stained with x - gal and neutral red to identify donor nscs within the experimental tumor . after cd17 . cd2 cells were injected into the tail vein of a mouse with an established subcutaneous melanoma , x - gal staining revealed nscs distributed throughout the tumor mass , as in examples 5 and 6 . immunofluorescent staining with antibodies to β - galactosidase ( to identify nscs ) was performed to provide independent confirmation of the presence of donor - derived cells . the β - gal antibody immunofluorescent staining confirmed the x - gal results that the nscs were found in the tumor . β - gal staining was not found in the absence of nsc injections . also , injecting vehicle alone , rather than nscs , into the tumor did not provide these findings . from these findings we conclude that systemically administered nscs remained stably transfected and that nscs targeted non - neural systemic tumors following intravascular administration . even in non - neural tumors , the injected nscs migrated out of the tumor vasculature to infiltrate the tumor parenchyma , without enlarging the tumor volume . this example is repeated with different non - neural experimental tumors ( both with and without the tendency to form metastases ), including but not limited to human prostate cancer . as in example 5 , tumor cells are conveniently injected subcutaneously into the flank of the recipient , with other injection locations and methods used as desired . a variety of stem cell lines can be used preferably neural stem cells , including but not limited to murine nscs or human nscs . the nscs are conveniently injected into the tail vein of the animal . to determine if intravenous injection of neural stem cells would result in targeting of non - neural extracranial tumors , 10 - 12 × 10 6 human prostate carcinoma ( pc3 ) cells in 200 μl pbs were implanted subcutaneously in the flanks of adult nude mice , as in example 5 . after 2 weeks , 1 × 10 5 cytosine deaminase - transduced c17 . cd2 murine nsc &# 39 ; s were conveniently injected directly into the subcutaneous tumor . the nscs were given 3 days to distribute , followed by animal sacrifice by anesthesia overdose . the tumor mass , liver , kidneys , spleen , heart and brain were harvested and postfixed overnight in 4 % paraformaldehyde and then cryoprotected in 30 % sucrose . ten micron serial cryostat sections were collected tumor sections were stained with x - gal and neutral red to identify donor nscs within the experimental tumor . after cd17 . cd2 cells were injected directly into the established subcutaneous prostate carcinoma flank tumors of nude mice , x - gal staining revealed nscs distributed throughout the tumor mass , as in examples 5 , 6 and 7 . immunofluorescent staining with antibodies to β - galactosidase ( to identify nscs ) was performed to provide independent confirmation of the presence of donor - derived cells . the β - gal antibody immunofluorescent staining confirmed the x - gal results that the nscs were found were found in the tumor . as in examples 5 , 6 and 7 , β - gal staining was not found in the absence of nsc injections and injecting vehicle alone rather than nscs into the tumor did not provide these findings . from these findings we conclude that nscs directly injected into peripheral subcutaneous flank tumors remained stably transfected and that nscs distributed themselves extensively throughout non - neural tumors , infiltrating the tumor parenchyma without enlarging the tumor volume . this example is repeated with different non - neural experimental tumors ( both with and without the tendency to form metastases ), including but not limited to human melanoma tumor cells and nscs are conveniently injected subcutaneously into the flank of the recipient , with other injection locations and methods used as desired . a variety of stem cell lines can be used preferably neural stem cells , including but not limited to murine nscs or human nscs . to determine if intravenous injection of neural stem cells would result in targeting of non - neural extracranial tumors , 2 - 5 × 106 human neuroblastoma ( sh - sy5y ) cells in 200 μl pbs were implanted subcutaneously in the flanks of adult nude mice , as in examples 5 - 8 . after 3 weeks , 1 - 2 × 10 6 cytosine deaminase - transduced c17 . cd2 murine nsc &# 39 ; s were conveniently injected intravenously into the tail vein . the nscs were given 3 days to circulate , followed by animal sacrifice by anesthesia overdose . the tumor mass , liver , kidneys , spleen , heart and brain were harvested and postfixed overnight in 4 % paraformaldehyde and then cryoprotected in 30 % sucrose . ten micron serial cryostat sections were collected . tumor sections were stained with x - gal and neutral red to identity donor nscs within the experimental tumor . after cd17 . cd2 cells were injected directly into the established subcutaneous human neuroblastoma flank tumors of nude mice . x - gal staining revealed nscs distributed throughout the tumor mass , as in examples 5 - 8 . horseradish peroxidase - diaminobenzidine staining with antibodies to cytosine deaminase ( to identify nscs ) was performed to provide independent confirmation of the presence of donor - derived cells . the cytosine deaminase staining confirmed the x - gal results that the nscs were found in the tumor and were seen within the tumor vasculature , exiting out into the parenchyma . as in examples 5 , 6 , 7 , and 8 , β - gal staining was not found in the absence of nsc injections and injecting vehicle alone rather than nscs into the tumor did not provide these findings . from these findings we conclude that nscs intravascularly injected into the peripheral tail vein of nude mice bearing subcutaneous flank tumors remained stably transfected and that nscs distributed themselves extensively throughout non - neural tumors , infiltrating the tumor parenchyma without enlarging the tumor volume . | 0 |
this disclosure of the invention is submitted in furtherance of the constitutional purposes of the u . s . patent laws “ to promote the progress of science and useful arts ” ( article 1 , section 8 ). referring to fig1 , 9 , and 10 , a connection member or container is shown generally at 20 and is configured for use with at least one thin - profile or button - type battery . connection member 20 can comprise any suitable conductive material such as nickel foil , stainless steel sheet , metal screen mesh , and the like , and can be formed by stamping , etching , drawing , or molding any of such materials . connection member 20 includes an inner conductive electrode connection surface 22 which is sized to receive and form an electrical connection with a battery electrode surface as will become apparent below . a battery electrode surface is mounted over or atop surface 22 and can be fixed in place with conductive epoxy . accordingly , surface 22 can be considered as a mounting surface . at least a portion of surface 22 is generally planar and is oriented within a mounting surface plane p 1 , connection surface 22 has an outermost boundary edge 24 which is generally circular in shape . a conductive side or intermediate surface 26 is provided and is joined with connection surface 22 proximate outermost boundary edge 24 . the outermost boundary edge defines a joinder location between surfaces 22 , 26 , with both surfaces extending generally away therefrom . in the illustrated example , surface 26 tapers to extend generally outwardly from connection surface 22 and define a generally frustum - shaped side surface . an outer peripheral conductive surface or rim 28 is provided and is joined with side surface 26 proximate a joinder location 30 . outer surface or rim 28 defines an opening into an internal volume 32 which is defined by connection surface 22 and side surface 26 . internal volume 32 is sized to receive a substantial portion of at least one thin - profile or button - type battery . side surface 26 tapers generally outwardly from joinder location 24 toward joinder location 30 . the rim defines a terminus of side surface 26 . outer surface 28 is oriented within a plane p 2 which is generally parallel with plane p 1 side surface 26 includes at least a portion which extends away from plane p 1 at an angle θ which is generally oblique relative thereto . other angles θ are of course possible . in the illustrated example , a substantial portion of side surface 26 extends away at the angle θ . surface 26 is dimensioned to achieve substantial alignment between outer surface 28 and a battery electrode surface of a thin - profile or button - type battery which is received within connection member 20 . in one aspect , connection member 20 has a thickness dimension t adjacent inner conductive surface 22 and in a direction a which is normal to plane p 1 , outer surface or rim 28 includes first and second boundary edges 34 , 36 respectively , which have a minimum separation distance d therebetween . first and second boundary edges 34 , 36 are generally circular in shape and concentric with one another . in the illustrated example , minimum separation distance d is greater than the thickness dimension t of connection member 20 . fig3 shows a connection member 20 which is similar in construction to the fig1 connection member except that outer surface or rim 28 defines a minimum separation distance d which is approximately equal to thickness dimension t . fig9 and 10 illustrate different cuts which are taken through connection member 20 of fig1 . fig9 shows a first portion or cut comprising side surface 26 which is taken through line 9 — 9 in fig1 . fig1 shows a second portion or cut comprising side surface 26 which is taken through line 10 — 10 in fig1 . the side surface portions bound respective first and second areas inside surface 26 and within internal volume 32 which lie in respective first and second planes . the first and second planes are spaced from one another and the areas defined therewithin are different from one another . in the illustrated example , the first and second planes are generally parallel with one another and with plane p 1 . the first plane ( fig9 ) is disposed closer to connection surface 22 than the second plane ( fig1 ). in the illustrated example , the first area is less than the second area . referring to fig4 an exemplary thin - profile battery comprising a button - type battery 38 is placed or mounted on connection member 20 and received within internal volume 32 . battery 38 includes a pair of terminal housing members which define a pair of outwardly - facing electrodes 40 , 42 . electrode 40 comprises the lid or anode electrode of the battery and electrode 42 comprises the can or cathode electrode of the battery . side surface 26 is dimensioned to achieve substantial alignment of outer surface 28 and electrode surface 40 . such is observed as plane p 2 is seen to be generally coincident with surface 40 . electrode 42 is conductively received against surface 22 and accordingly establishes electrical communication between electrode surface 42 and connection member 20 . accordingly , a single battery is provided and comprises different respective surfaces with which electrical connection is made with connection member 20 , and substantial alignment is achieved with outer surface 28 . conductive adhesion with epoxy or other suitable bonding techniques such as welding can be utilized to fixedly mount battery 38 within connection member 20 , if desired . referring to fig5 a connection member which is formed in is accordance with an alternate embodiment of the present invention is shown generally at 20 a . like numerals from the above - described embodiment are utilized where appropriate , with differences being indicated by the suffix “ a ” or with different numerals . accordingly , mounting surface 22 a and side surface 26 a define an internal volume 32 a which is sized to receive substantial portions of two thin - profile batteries 44 , 46 . for purposes of the ongoing discussion , battery 44 comprises a first battery and battery 46 comprises a second battery . the batteries are oriented in a stack , one atop the other , and can be conductively bonded together if desired . battery 44 includes a pair of terminal housing members comprising lid and can terminals . the lid and can terminals respectively define a pair of outwardly - facing battery electrode surfaces 48 , 50 . battery 46 includes a pair of terminal housing members comprising lid and can terminals . the lid 5 and can terminals respectively define a pair of outwardly facing battery electrode surfaces 52 , 54 . side surface 26 a is dimensioned to achieve substantial alignment of outer surface 28 a and battery electrode surface 52 . accordingly , substantial alignment is achieved with an electrode surface of a different battery from which desired electrical connection is made with connection surface 22 a . side surface 26 a of connection member 20 a extends away from connection surface 22 a sufficiently to bring at least a portion of the side surface into abutting physical engagement with only one of the batteries received within internal volume 32 a . in the illustrated example , such abutting engagement is achieved with battery 44 only and not with battery 46 by imparting a desired degree of taper to side surface 26 a . the illustrated side surface 26 a is generally frustum - shaped which is similar to the one - battery embodiment of fig4 . by virtue of the angularity of side surface 26 a relative to surface 22 a , no electrical insulation is necessary to protect battery 46 from undesirably grounding against the side surface . such insulation can , however , be provided if desired . fig6 and 7 show a substrate portion 56 having a generally planar substrate surface 58 . the substrate can comprise a printed circuit substrate , i . e . printed circuit board , or a flexible circuit board and the like . a pair of spaced electrical contacts or contact pads 60 , 62 are supported . by substrate 56 . contact 60 comprises two different spaced portions which are each laterally spaced from contact 62 . exemplary materials for the contact pads include screen or stencil - printed conductive materials such as copper or conductive printed thick film ( ptf ). the material from which contacts 60 , 62 are formed can be either recessed within substrate 56 or disposed atop the substrate . in the context of this document , both constructions are seen to provide a generally planar outer surface adjacent which one or more batteries can be mounted or received . outer surfaces or rims 28 ( fig6 ), 28 a ( fig7 ) are disposed against substrate surface 58 . surface 58 substantially encloses the battery or batteries received within the respective internal volumes 32 , 32 a . accordingly , containers 20 , 20 a and substrate surface 58 define respective enclosures 64 , 64 a inside of which a battery or batteries are received . electrode surfaces 40 ( fig6 ), 52 ( fig7 ) are conductively received against contact pad 62 , while outer surfaces 28 , 28 a are conductively received against contact pad 60 . outer surfaces 28 , 28 a can be conductively bonded to the contact pads by conductive epoxy . accordingly an electrical circuit connection is formed . referring to fig7 batteries 44 , 46 are conductively connected together in a stack which defines a series electrical connection . a first electrical connection is defined between electrode surface 48 of battery 44 and electrode surface 54 of battery 46 . such electrical connection can arise from a mere physical engagement of the batteries or through the application of a suitable conductive epoxy material or other bonding agent to effectively conductively bond the two together . a second electrical connection is provided between electrode surface 50 of battery 44 and electrode surface 52 of battery 46 . in the illustrated example , the second electrical connection is provided through the respective contact pads which operably connect with circuitry which is external to the batteries . an exemplary arrangement is shown in fig8 where a single integrated circuitry chip 66 is mounted over substrate 56 . connection member 20 a is received over the substrate and operably mounted thereon so that the batteries are placed into electrical communication with chip 66 . the contact pads are defined by conductive traces which form , together with chip 66 , the second electrical connection mentioned above . in the illustrated and preferred embodiment , chip 66 is configured for wireless radio frequency communication . an exemplary chip is described is u . s . patent application ser . no . 08 / 705 , 043 , now u . s . pat . no . 6 , 130 , 602 , which names james o &# 39 ; toole , john r . tuttle , mark e . tuttle , tyler lowrey , kevin devereaux , george pax , brian higgins , shu - sun yu , david ovard and robert rotzoll as inventors , which was filed on aug . 29 , 1996 , is assigned to the assignee of this patent application , and is fully incorporated herein by reference . in compliance with the statute , the invention has been described in language more or less specific as to structural and methodical features . it is to be understood , however , that the invention is not limited to the specific features shown and described , since the means herein disclosed comprise preferred forms of putting the invention into effect . the invention is , therefore , claimed in any of its forms or modifications within the proper scope of the appended claims appropriately interpreted in accordance with the doctrine of equivalents . | 7 |
the singular forms “ a ”, “ an ”, and “ the ” include plural referents unless the context clearly dictates otherwise . “ optional ” or “ optionally ” as used herein means that the subsequently described event may or may not occur , and that the description includes instances where the event occurs and the instances where it does not occur . any polyester can be the initial polyester provided it has carboxyl and / or alcohol end groups available for reaction with the epoxy silane . such polyesters include those comprising structural units of formula 1 : wherein each r 1 is independently a divalent aliphatic , alicyclic or aromatic hydrocarbon or polyoxyalkylene radical , or mixtures thereof and each a 1 is independently a divalent aliphatic , alicyclic or aromatic radical , or mixtures thereof . examples of suitable polyesters containing the structure of the above formula are poly ( alkylene dicarboxylates ), liquid crystalline polyesters , and polyester copolymers . it is also possible to use a branched polyester in which a branching agent , for example , a glycol having three or more hydroxyl groups or a trifunctional or multifunctional carboxylic acid has been incorporated . furthermore , it is sometimes desirable to have various concentrations of acid and hydroxyl end groups on the polyester , depending on the ultimate end - use of the composition . the r 1 radical may be , for example , a c 2 - 10 alkylene radical , a c 6 - 12 alicyclic radical , a c 6 - 20 aromatic radical or a polyoxyalkylene radical in which the alkylene groups contain about 2 - 6 and most often 2 or 4 carbon atoms . the a 1 radical in the above formula is most often p - or m - phenylene , a cycloaliphatic or a mixture thereof . this class of polyesters includes the poly ( alkylene terephthalates ). such polyesters are known in the art as illustrated by the following patents , which are incorporated herein by reference . u . s . pat . nos . 2 , 465 , 319 2 , 720 , 502 2 , 727 , 881 2 , 822 , 348 3 , 047 , 539 3 , 671 , 487 3 , 953 , 394 4 , 128 , 526 examples of aromatic dicarboxylic acids represented by the dicarboxylated residue a 1 are isophthalic or terephthalic acid , 1 , 2 - di ( p - carboxyphenyl ) ethane , 4 , 4 ′- dicarboxydiphenyl ether , 4 , 4 ′ bisbenzoic acid and mixtures thereof . acids containing fused rings can also be present , such as in 1 , 4 - 1 , 5 - or 2 , 6 - naphthalenedicarboxylic acids . the preferred dicarboxylic acids are terephthalic acid , isophthalic acid , naphthalene dicarboxylic acid , cyclohexane dicarboxylic acid or mixtures thereof . the most preferred polyesters are poly ( ethylene terephthalate ) (“ pet ”), poly ( 1 , 4 - butylene terephthalate ) (“ pbt ”), poly ( ethylene naphthanoate ) (“ pen ”), poly ( butylene naphthanoate ) (“ pbn ”), ( polypropylene terephthalate ) (“ ppt ”), poly ( 1 , 4 - 10 cyclohexylenedimethylene 1 , 4 - cyclohexanedicarboxylate ) (“ pccd ”), poly ( 1 , 4 - cyclohexylenedimethylene terephthalate ) (“ pct ”), poly ( cyclohexylenedimethylene - co - ethylene terephthalate ) (“ pctg ”), and mixtures thereof . also contemplated herein are the above polyesters with minor amounts , e . g ., from about 0 . 5 to about 5 percent by weight , of units derived from aliphatic acid and / or aliphatic polyols to form copolyesters . the aliphatic polyols include glycols , such as poly ( ethylene glycol ) or poly ( butylene glycol ). such polyesters can be made following the teachings of , for example , u . s . pat . nos . 2 , 465 , 319 and 3 , 047 , 539 . the epoxy silane which is contacted with and reacts with the polyester is generally any kind of epoxy silane wherein the epoxy is at one end of the molecule and attached to a cycloaliphatic group and the silane is at the other end of the molecule . a desired epoxy silane within that general description is of formula 2 . wherein m is an integer 1 , 2 or 3 , n is an integer of 1 through 6 and x , y , and z are the same or different , preferably the same and are alkyl of one to twenty carbon atoms , inclusive , cycloalkyl of four to ten carbon atoms , inclusive , alkylene phenyl wherein alkylene is one to ten carbon atoms , inclusive , and phenylene alkyl wherein alkyl is one to six carbon atoms , inclusive . desirable epoxy silanes within the range are compounds wherein m is 2 , n is 1 or 2 , desirably 2 , and x , y , and z are the same and are alkyl of 1 , 2 , or 3 carbon atoms inclusive . epoxy silanes within the range which in particular can be used are those wherein m is 2 , n is 2 , and x , y , and z are the same and are methyl or ethyl . the polyester modified with the epoxy silane can be blended with any of the usual additives and property modifier that polyesters are usually mixed for example glass , clay , mica and the like . polymer blends can be made with reacted polyester or can be made with the unreacted polyester and the polyester then reacted with the epoxy silane during the blending or extrusion process . examples of polymer which can be blended include aromatic polycarbonates , polysulfones , polyethesulfones , impact modifiers , and the like . the epoxy silane is reacted with the polyester by simply bringing the two components together at a temperature and time period . for example , pbt 195 , intrinsic viscosity ( iv ) 1 . 1 from ge together with pbt 315 , iv 0 . 7 from ge are tumble blended with various additives such as potassium diphenylsulfone sulfonate ( kss ), a flame retardant , a hindered phenol such as irganox 1010 from ciba geigy , a catalyst such as sodium stearate , a mold release such as pentaerythritol tetrastearate ( pets ) and the epoxy silane beta -( 3 , 4 - epoxycyclohexyl ) ethyl triethoxysilane coatosil 1770 from ge and then extruded in a 27 mm twin screw with a vacuum vented mixing screw at a barrel and die head temperature between 240 and 265 degrees celsius and 450 ppm screw speed . the extrudate is cooled through a water bath prior to palletizing . the quantities of epoxy silane employed as a percentage of polyester present in the composition is generally at least about 0 . 1 wt % and a minimum of about 0 . 4 wt % can also be employed . generally , further increases in desirable properties are not observable beyond a maximum of about 5 . 0 wt %, but further quantities can be used if desired . various processes can be used to bring about a desired final product . injection molding , blow molding , compression molding , resin transfer molding , and the like are processes which can be employed . as noted previously various properties can be improved such as impact strength , color , and tensile modulus through the use of the epoxy silane . virtually any part for an application can benefit from one or a combination of at least two of these properties . for instance , in one embodiment , with respect to the impact strength , a reaction product has an improved impact strength that is at least 10 %, as compared to a reaction product that does not contain the epoxy silane , measured with notched izod or dynatup impact testing techniques . in another embodiment , the improved impact strength can range from 10 to 30 %, or more , as compared to a reaction product that does not contain the epoxy silane , measured with notched izod or dynatup impact testing techniques . with respect to improved color properties imparted by the epoxy silane to an opaque reaction product , an opaque reaction product of the invention can have a reduced yellowness index by reflectance ( yir ) of at least two units , as compared to a reaction product that does not contain the epoxy silane . in another embodiment , an opaque reaction product of the invention can have a reduced yellowness index by reflectance ( yir ) from two to eleven units , or more , as compared to a reaction product that does not contain the epoxy silane . with respect to improved color properties imparted by the epoxy silane to a transparent reaction product , a transparent reaction product of the invention can have a reduced yellowness index ( yi ) of at least one unit , as compared to a reaction product that does not contain the epoxy silane . in another embodiment , a transparent reaction product of the invention can have a reduced yellowness index ( yi ) from one to eleven units , or more , as compared to a reaction product that does not contain the epoxy silane . with respect to tensile modulus , a reaction product has an improved tensile modulus that is at least 5 %, as compared to a reaction product that does not contain the epoxy silane , measured with tensile testing techniques . in another embodiment , the improved tensile strength can range from 5 to 10 %, or more , as compared to a reaction product that does not contain the epoxy silane , measured with tensile testing techniques . below are examples of the invention . these examples relative to their control comparisons show significant improvement in the above - identified areas . additionally tensile elongation at break in the non - glass filled pbt and tensile elongation at yield in the glass filled pbt shows improvements . these improvements are indeed selective as noted by other tests providing virtually no improvement or potentially some small declines in tested values . tensile properties were tested according to astm d648 using type 1 tensile bars at room temperatures with a crosshead speed of 2 in / min . izod testing was done on 3 × ½ × ⅛ inch bars according to astm d256 . yellowness index by reflectance ( yir )— this is computed from the spectrophotometric reflectance data of an opaque specimen , which indicates the degree of departure of an object from colorless or from a preferred white , towards yellow . a spectrophotometric method is employed . acceptable test samples are free from dust , grease , scratches , and visible molding defects . samples are molded and must have plane - parallel surfaces . spectrophotometer is a minolta cm - 3600 spectrophotometer with spectamatch software configured for simultaneous capture of yi , % t , and % haze using illuminant c — north sky daylight and 2 ° standard observer settings . all test specimens are to be conditioned at 23 ± 2 ° c . relative humidity for not less that 40 hours prior to testing . yir tests are to be performed in a reflectance mode . a white calibration tile backs the test specimen during testing . yir is reported to 0 . 1 . as seen in table 1 , the addition of epoxysilane coatosil 1770 significantly reduces the yir of pbt resin in molded parts . additionally , the yir is reduced in pellets as well . the examples shown in table 1 ( e1 and e2 ) both have 1 . 5 % epoxysilane loading , but similar yir - reduction were observed when the epoxysilane loading were lower or higher . as shown in table 3 , the addition of epoxysilane coatosil 1770 improves the modulus and impact property in both glass - filled and un - filled pbt , especially in materials based on pbt 315 . as seen in table 4 , the addition of epoxysilane coatosil 1770 significantly reduces the yi of pctg resin in molded parts . additionally , the yi is reduced in pellets as well . the examples shown in table 4 ( e9 and e10 ) have epoxysilane loading of 2 . 0 % and 3 . 0 %, respectively , but similar yi - reduction were observed when the epoxysilane loading were lower or higher . | 2 |
compounds of the formula i may be prepared according to the following reaction schemes and discussion . unless otherwise indicated , m , n , p , s , b , r 2 through r 16 and het and structural formula i in the reaction schemes and discussion that follow are as defined above . scheme 1 refers to the preparation of compounds of the formula 1 . referring to scheme 1 , a compound of the formula i , wherein ( r 3 ) s - phenyl - het is ( c ) or ( f ), can be prepared from compounds of the formula ii by reaction with an aminating reagent . suitable aminating reagents include hydrazines of the formula h 2 n — nh — r 7 , in a polar solvent . suitable solvents include alcohols such as ethanol , propanol or butanol or mixtures of alcohols and acetic acid , preferably ethanol . the aforesaid reaction is conducted at a temperature of about 10 ° c . to about 30 ° c ., preferably at about 22 ° c ., for a period from about 1 hour to about 7 hours , preferably about 3 hours . the compound of formula ii is prepared from a compound of formula vi by reaction with an acetal , such as dimethylformamide — dimethylacetal , at a temperature of about 60 ° c . to about 90 ° c ., preferably about 80 ° c . for a period from about 1 hour to about 6 hours , preferably about 3 hours . alternatively , compounds of the formula i , wherein ( r 3 ) s - phenyl - het is ( c ) or ( f ), can be prepared from compounds of the formula iii by reaction with an aminating reagent such as h 2 n — nh — r 7 according to methods analogous to the conversion of compounds of formula ii to formula i , above . the compound of formula iii is prepared from a compound of formula vi by reaction with an isothiocyanate . suitable isothiocyanates include compounds of the formula r 4 — n ═ c ═ s . reactions with isothiocyanates are facilitated by the addition of a base , such as sodium hydride , lithium diisopropylamide or other suitable strong bases . suitable solvents for the aforesaid reaction include pyridine , n , n - dimethylformamide or tetrahydrofuran , preferably pyridine . the aforesaid reaction is performed from a period of about 0 . 5 hour to about 4 hours at a temperature of about 0 ° c . to about 30 ° c . the deprotonation reaction with above said bases is followed by the addition of a suitable isothiocyanate and is performed for a period from about 10 minutes to about 20 hours , at a temperature of about 0 ° c . to about 30 ° c ., preferably about 22 ° c . for a period from about 0 . 5 hour to about 24 hours . compounds of the formula i , wherein ( r 3 ) s - phenyl - het is ( b ), can be prepared from compounds of the formula iv , by reaction with an aldehyde of the formula r 6 —( c ═ o ) h in the presence of an ammonia source and cuprous acetate and a polar solvent . suitable ammonia sources include ammonium trifluoroacetate , ammonia , and ammonium acetate , preferably ammonium acetate . the aforesaid reaction can be run neat or in the presence of a solvent such as alcohols ( methanol , ethanol or butanol ) and acetic acid . the aforesaid reaction can be run at a temperature from about 20 ° c . to about 80 ° c . for a period from about 15 minutes to about 4 hours , preferably neat conditions at about 60 ° c . for about 2 hours . compounds of the formula i , wherein ( r 3 ) s - phenyl - het is ( d ) can be prepared from compounds of the formula iv , by reaction with an acylating reagent of the formula r 6 ( c ═ o )— l , wherein l is a leaving group such as halo or anhydrido , using method well known to those skilled in the art . the acyl derivative , so formed , is converted to the compound of formula i by cyclodehydration in the presence of a source of ammonia . suitable solvents include acetic acid and tetrahydrofuran . the aforesaid reaction can be run at a temperature from about 22 ° c . to about 80 ° c ., preferably 50 ° c ., for a period from about 1 hour to about 24 hours , preferably 2 hours . the compound of formula iv is prepared from a compound of formula v by reaction with sodium methoxide , or sodium ethoxide , or sodium tert - butoxide , preferably sodium methoxide , in an alcohol solvent , such as methanol , ethanol , isopropanol , preferably methanol . the aforesaid reaction can be conducted at a temperature of about 0 ° c . to about 30 ° c ., preferably at about 22 ° c ., for a period of time from 15 minutes to about 3 hours , preferably about 30 minutes . the aforesaid reaction is followed by an aqueous acidic work - up . the compound of formula v is prepared from a compound of formula vi by reaction with bromine ( br 2 ) in a polar solvent . suitable solvents include acetic acid , chloroform or methylene chloride , preferably acetic acid . the aforesaid reaction is conducted at a temperature of about 0 ° c . to about 30 ° c . preferably at about 22 ° c . ( room temperature ) for a period from about 10 minutes to about 4 hours , preferably about 30 minutes . compounds of the formula i , wherein ( r 3 ) s - phenyl - het is ( a ), can be prepared from compounds of the formula vii , by reaction with an ammonia source and cuprous acetate and a polar solvent . suitable ammonia sources include ammonium trifluoroacetate , ammonia , and ammonium acetate , preferably ammonium acetate . the aforesaid reaction can be run neat or in the presence of a solvent such as alcohols ( methanol , ethanol or butanol ) and acetic acid . the aforesaid reaction can be run at a temperature from about 20 ° c . to about 80 ° c . for a period from about 15 minutes to about 4 hours , preferably neat conditions at about 60 ° c . for about 2 hours . alternatively , compounds of formula i ( g ) and ( h ) can be prepared from compounds of formula vi according to methods described in the literature ( gauthier , j . y . ; leblanc , y . ; black , c . ; chan , c . - c . ; cromlish , w . a . ; gordon , r . ; kennedey , b . p . ; lau , c . k . ; leger , s . ; wang , z . ; ethier , d . ; guay , j . ; mancini , j . ; riendeau , d . ; tagari , p . ; vickers , p . ; wong , e . ; xu , l . ; prasit , p . bioorg . med . chem . lett . 1996 , 6 , 87 - 92 ). the compound of formula vii is prepared from a compound of formula vi by reaction with a reagent of the formula wherein l is a leaving group such as chloro , bromo , iodo or mesylate , in the presence of a base and a solvent . suitable bases include sodium hydride ( nah ) and n - butyllithium . suitable solvents include tetrahydrofuran ( thf ) and dimethyl formamide ( dmf ). the aforesaid reaction can be conducted at a temperature from about − 30 ° c . to about the reflux temperature of the solvent , for a period of about 5 minutes to about 24 hours . the compound of formula vi is prepared according to the methods of davies , i . w . ; marcoux , j . - f . ; corley , e . g . ; journet , m . ; cai , d . - w . ; palucki , m . ; wu , j . ; larsen , r . d . ; rossen , k . ; pye , p . j . ; dimichele , l . ; dormer , p . ; reider , p . j . ; j . org . chem . , vol . 65 , pp . 8415 - 8420 ( 2000 ). the compound of formula viii is prepared by methods well known to those skilled in the art . scheme 2 refers to an alternate preparation of compounds of formula i , wherein ( r 3 ) s - phenyl - het is ( b ), from compounds of the formula xiv . compounds of the formula xiv can be prepared by the methods of scheme 4 . referring to scheme 2 , a compound of the formula i , wherein ( r 3 ) s - phenyl - het is a group of the formula ( b ), can be prepared from a compound of the formula x by reaction with a compound of the formula wherein r 5 is hydrogen , in the presence of a polar solvent . suitable solvents include dimethyl formamide , chloroform , dmso , thf and ethanol , preferably dimethylformamide . the aforesaid reaction is conducted at a temperature of about 15 ° c . to about 80 ° c ., preferably about 60 ° c ., for a period from about 4 hours to about 4 days , preferably 4 hours . alternatively , a compound of the formula i , wherein ( r 3 ) s - phenyl - het is a group of the formula ( b ), can be prepared from a compound of formula xii by reaction with r 6 —( c ═ o ) h in the presence of an ammonia source . suitable ammonia sources include ammonium trifluoroacetate , ammonia , and ammonium acetate , preferably ammonium acetate . the aforesaid reaction can be run neat or in the presence of a solvent such as alcohols ( methanol , ethanol or butanol ) and acetic acid . the aforesaid reaction can be run at a temperature from about 20 ° c . to about 80 ° c . for a period from about 15 minutes to about 4 hours , preferably neat conditions at about 60 ° c . for about 2 hours . the compound of formula xii is prepared from a compound of the formula xiii by reaction with an oxidizing reagent in a polar protic solvent . suitable oxidizing reagents include copper acetate , pyridiniumchlorochromate ( pcc ) and tetrapropylammonium peruthenate / n - methyl morpholine - n - oxide ( tpap / nmo ), preferably cuprous acetate . suitable solvents include acetic acid . the aforesaid reaction can be run neat or in the presence of a solvent such as alcohols ( methanol , ethanol or butanol ) and acetic acid . the aforesaid reaction can be run at a temperature from about 20 ° c . to about 80 ° c . for a period from about 15 minutes to about 4 hours , preferably neat conditions at about 60 ° c . for about 2 hours . alternatively , a compound of the formula i , wherein ( r 3 ) s - phenyl - het is a group of the formula ( b ), can be prepared from a compound of formula xiii , by reaction with an aldehyde of the formula r 6 —( c ═ o )— h in the presence of cuprous acetate and an ammonia source according to methods analogous to those for the conversion of compounds of formula iv to formula i in scheme 1 . the compound of formula xiii is prepared from a compound of the formula x by reaction with a methoxide such as described in scheme 1 for the preparation of compounds of formula iv from compounds of formula v . the compound of formula x is prepared from a compound of the formula xiv by reaction with br 2 in a polar solvent . suitable solvents include acetic acid , chloroform or methylene chloride , preferably acetic acid . the aforesaid reaction is conducted at a temperature of about 0 ° c . to about 30 ° c . preferably at about 22 ° c . ( room temperature ) for a period from about 10 minutes to about 4 hours , preferably about 30 minutes . scheme 3 refers to an alternate preparation of compounds of formula i , wherein ( r 3 ) s - phenyl - het is a group of the formula ( b ) or ( d ) and r 6 is hydrogen . referring to scheme 3 , a compound of formula i , wherein ( r 3 ) s - phenyl - het is of the formula ( d ) and r 6 is hydrogen , is prepared from a compound of formula xvii by reaction with an isocyanide of formula in the presence of a base . suitable bases include potassium carbonate , triethylamine , and piperazine , preferably potassium carbonate . suitable solvents include polar solvents such as tetrahydrofuran , or n , n - dimethylformamide , preferably in n , n - dimethylformamide . the aforesaid reaction may be run at a temperature between about 22 ° c . and about 70 ° c ., preferably at about 22 ° c . for a period from about 2 hours to about 4 hours , followed by about 6 hours to about 10 hours at a temperature of about 70 ° c . compounds of formula i , wherein ( r 3 ) s - phenyl - het is of the formula ( b ) and r 6 is hydrogen , can be prepared in an analogous way by first preparation of the intermediate imine of formula xv by reaction of compounds of formula xvii with a suitable amine of the formula nh 2 r 5 under dehydrating conditions . such conditions include the treatment of compounds of formula xvii and an amine nh 2 r 5 in a solvent such as tetrahydrofuran or dichloromethane with a dehydrating agent such as anhydrous magnesium sulfate or molecular sieves . alternatively , the imine of formula xv can be prepared and subsequently reacted in an aqueous media as described in the literature : ( sisko , j . ; kassik , a . j . ; mellinger , m . ; filan , j . j . ; allen , a . ; olsen , m . a . ; j . org . chem ., 65 , 1516 - 1524 ( 2000 )). reactions of imines of formula xv with suitable isocyanides of formula xvi are conducted at about 22 ° c . for a time period from about 1 day to about 21 days , preferably about 1 day . a compound of formula xvii is prepared from a compound of formula xxiii in scheme 4 . scheme 4 refers to an alternate preparation of compounds of the formula i , wherein ( r 3 ) s - phenyl - het is a group of the formula ( b ). referring to scheme 4 , compounds of the formula i are prepared from compounds of the formula xviii by reaction with an ammonia source . suitable ammonia sources include ammonium trifluoroacetate , ammonia , and ammonium acetate , preferably ammonium trifluoroacetate . the aforesaid reaction can be run neat or in the presence of a solvent such as alcohols ( methanol , ethanol or butanol ) and acetic acid . the aforesaid reaction can be run at a temperature from about 60 ° c . to about 150 ° c . for a period from about 15 minutes to about 3 hours , preferably neat conditions at about 150 ° c . for about 1 hour . the compound of formula xviii is prepared form a compound of formula xix by reaction with an oxidizing reagent such as n - methyl morpholine n - oxide / tpap , dess - martin reagent , pcc or oxalyl chloride - dmso , preferably n - methyl morpholine n - oxide / tpap . suitable solvents for the aforesaid reaction include methylene chloride , chloroform , thf or dichloromethane . the aforesaid reaction is conducted at a temperature from about 10 ° c . to about 30 ° c . for a time from about 15 minutes to about 3 hours , preferably about 1 hour . the compound of formula xix is prepared from a compound of the formula xx by reaction with an acylating reagent of the formula , wherein l is a leaving group , and a base . suitable bases include triethylamine , hunig &# 39 ; s base , or dbu , preferably triethylamine . suitable leaving groups include cl , br or activated acids . suitable solvents for the aforesaid reaction include methylene chloride , dimethyl formamide , thf or dmf , and mixtures thereof , preferably methylene chloride . the aforesaid reaction is conducted at a temperature from about 10 ° c . to about 30 ° c . preferably about 22 ° c . ( room temperature ) for a period from about 1 hour to about 6 hours preferably about 1 hour . the compound of the formula xx is prepared form a compound of formula xxii by reaction with a reducing agent . reducing agents are well known to those skilled in the art . for example , reduction of the double bond may be effected with hydrogen gas ( h 2 ), using catalysts such as palladium on carbon ( pd / c ), palladium on barium sulfate ( pd / baso 4 ), platinum on carbon ( pt / c ), or tris ( triphenylphosphine ) rhodium chloride ( wilkinson &# 39 ; s catalyst ), in an appropriate solvent such as methanol , ethanol , thf , dioxane or ethyl acetate , at a pressure from about 1 to about 5 atmospheres and a temperature from about 10 ° c . to about 60 ° c ., as described in catalytic hydrogenation in organic synthesis , paul rylander , academic press inc ., san diego , 31 - 63 ( 1979 ). the following conditions are preferred : pd on carbon , methanol at 25 ° c . and 50 psi of hydrogen gas pressure . the compound of the formula xxii is prepared from a compound of formula xiv by reaction with a base or acid and an alkyl nitrite . suitable nitrites include n - butyl nitrite , t - butyl , or iso - amyl , preferably n - butyl nitrite . suitable bases include sodium ethoxide , sodium methoxide or potassium t - butoxide , preferably sodium ethoxide . suitable solvents for the aforesaid reaction include alcohols ( such as methanol , ethanol , propanol or butanol ) or dmso , preferably ethanol . the aforesaid reaction is conducted at a temperature of about - 10 ° c . to about 5 ° c . preferably 0 ° c ., for a period from about 1 hour to about 48 hours , preferably about 24 hours . the compound of the formula xiv is prepared from a compound of the formula xxiii by reaction with a grignard reagent of the formula ( r 3 ) - phenyl - ch 2 - m , wherein m is magnesium chloride or magnesium bromide . suitable solvents for the aforesaid reaction are ethers ( such as dimethyl ether thf , dme or dioxane ), preferably thf . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 30 ° c ., preferably at about 22 ° c . ( room temperature ), for a period from about 1 hour to about 48 hours , preferably about 6 hours . compounds of the formula xxiii can be made according to the methods of scheme 6 . scheme 5 refers to the preparation of compounds of the formula i , wherein ( r 3 ) s - phenyl - het is a group of the formula ( e ). referring to scheme 5 , a compound of the formula i can be prepared from compound of formula xxiv by reaction with a hydroxylamine ( preferably a salt thereof such as the hydrochloride salt ), and a base . suitable bases include pyridine or a trialkylamine , preferably pyridine . suitable solvents include n , n - dimethylformamide , tetrahydrofuran or pyridine , preferably pyridine . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 100 ° c ., preferably at about 60 ° c ., for a period from about 1 hour to about 48 hours , preferably about 20 hours . the compound of formula xxiv can be prepared from a compound of formula xxv by reaction with an ester of the formula ( r 3 ) s - phenyl - co 2 p 1 , wherein p 1 is methyl or ethyl , in the presence of a base and a solvent . suitable bases include sodium hydride , lithium diisopropylamide , or sodium alkoxides , preferably sodium ethoxide . suitable solvents include alcohols such as methanol , ethanol , propanol , butanol , or tetrahydrofuran , preferably ethanol . the aforesaid reaction is conducted at a temperature from about 23 ° c . to about 65 ° c ., preferably at about 50 ° c ., for a period from about 2 hours to about 24 hours , preferably about 20 hours . the compound of formula xxv can be made by methods well known to those of ordinary skill in the art and in scheme 7 from compounds of formula xxxi by reaction with a halogenating reagent followed by reaction with a nitrite according to methods well known to those of ordinary skill in the art . scheme 6 refers to the preparation of compounds of the formula xvii and xxiii which are intermediates for the preparation of compounds of formula i in schemes 3 and 4 , respectfully . referring to scheme 6 , a compound of the formula xvii is prepared from a compound of formula xxiii by reaction with a reducing agent , such as diisobutylaluminum hydride ( dibal ) in toluene , in a solvent , such as tetrahydrofuran ( thf ). the aforesaid reaction may be run at a temperature from about − 78 ° c . to room temperature for a period from about one to about five hours . the compound of formula xxiii is prepared from a compound of formula xxvi by reaction with a suitable activating agent and a compound of the formula , and a base . suitable activating agents include thionyl chloride , edcl and dcc , preferably oxalyl chloride . suitable bases include triethylamine , hunig &# 39 ; s base , or dbu , preferably triethylamine . suitable solvents for the aforesaid reaction include methylene chloride , dimethyl formamide , thf or dmf , and mixture thereof , preferably methylene chloride . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 30 ° c . preferably about 22 ° c . ( room temperature ) for a period from about 6 hours to about 48 hours preferably about 12 hours . the compound of formula xxvi is prepared from a compound of formula xxviii by reaction with sodium nitrite under acidic conditions . suitable acids include hydrochloric acid . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 100 ° c ., preferably about 22 ° c ., for a period from about 1 hour to about 3 hours , preferably about 2 hours . the compound of formula xxviii is prepared from a compound of formula xxix by reaction with a reducing agent . reducing agents are well known to those skilled in the art . for example , reduction of the double bond may be effected with hydrogen gas ( h 2 ), using catalysts such as palladium on carbon ( pd / c ), palladium on barium sulfate ( pd / baso 4 ), platinum on carbon ( pt / c ), or tris ( triphenylphosphine ) rhodium chloride ( wilkinson &# 39 ; s catalyst ), in an appropriate solvent such as methanol , ethanol , thf , dioxane or ethyl acetate , at a pressure from about 1 to about 5 atmospheres and a temperature from about 10 ° c . to about 60 ° c ., as described in catalytic hydrogenation in organic synthesis , paul rylander , academic press inc ., san diego , 31 - 63 ( 1979 ). the following conditions are preferred : pd on carbon , methanol at 25 ° c . and 50 psi of hydrogen gas pressure . the compound of formula xxix can be prepared from a compound of formula xxx by reaction with an amine of the formula r 2 nh 2 . suitable solvents include an excess of the amine reactant ( neat ), glyme , and toluene , preferably neat . the aforesaid reaction is conducted at a temperature from about 70 ° c . to about 120 ° c ., preferably 100 ° c ., for a period from about 10 minutes to about 1 hour , preferably about 30 minutes . the compound of the formula xxx is commercially available or can be prepared by methods well known to those skilled in the art . scheme 7 refers to an alternate preparation of compounds of the formula xvii which are intermediates useful in the preparation of compounds of formula i in scheme 3 . referring to scheme 7 , a compound of the formula xvii is prepared from a compound of formula xxxi by reaction with an oxidizing reagent such as n - methyl morpholine n - oxide / tpap , dess - martin reagent , pcc or oxalyl chloride - dmso , preferably oxalyl chloride - dmso . suitable solvents for the aforesaid reaction include methylene chloride , chloroform , thf or dichloromethane . the aforesaid reaction is conducted at a temperature from about − 78 ° c . to about 22 ° c . for a time from about 15 minutes to about 3 hours , preferably about 1 hour . the compound of the formula xxxi is prepared from a compound of the formula xxxii by reaction with a reducing reagent . suitable reducing agents include lithium borohydride , sodium borohydride ( nabh 4 ), sodium cyanoborohydride ( nacnbh 3 ), lithium aluminum hydride ( lialh 4 ) and borane in thf ( bh 3 thf ). suitable solvents include methanol , ethanol , thf , diethyl ether , dioxane and tetrahydrofuran . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 70 ° c ., preferably 65 ° c ., for a period from about 10 minutes to about 1 hour , preferably about 30 minutes . the compound of formula xxxii is prepared from a compound of formula xxxiii by reaction with an alkylating reagent of the formula r 2 l ′, wherein l ′ is halo or other leaving group such as mesyl , in the presence of a base and a solvent . suitable bases include sodium hydride and cesium carbonate . suitable solvents include dimethyl sulfoxide , nn - dimethylformamide . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 30 ° c ., preferably about 22 ° c ., for a period from about 10 minutes to about 2 hours , preferably about 1 hour . compounds of the formula xxxiii are commercially available or can be made by methods well known to those of ordinary skill in the art scheme 8 refers to an alternate preparation of compounds of the formula xxvi , wherein r 2 is optionally substituted ( c 1 - c 6 ) alkyl , ( c 3 - c 10 ) cycloalkyl , and ( c 1 - c 10 ) heterocyclic ; which are intermediates in scheme 6 useful in the preparation of compounds of formula i , wherein r 2 is optionally substituted ( c 1 - c 6 ) alkyl , ( c 3 - c 10 ) cycloalkyl , and ( c 1 - c 10 ) heterocyclic . referring to scheme 8 , a compound of formula xxvi is prepared from a compound of formula xxviii by reaction with sodium nitrite under acidic conditions . suitable acids include hydrochloric acid . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 100 ° c ., preferably about 22 ° c ., for a period from about 1 hour to about 3 hours , preferably about 2 hours . the compound of formula xxviii , wherein r 2 is optionally substituted ( c 1 - c 6 ) alkyl , ( c 3 - c 10 ) cycloalkyl , or ( c 1 - c 10 ) heterocyclic ; is prepared from a compound of formula xxxi by reductive alkylation with a compound of the formula r 1 ( c ═ o ) r 1 , wherein each r 1 is independently selected . one of ordinary skill in the art will understand that r 1 ( c ═ o ) r 1 is the precursor to r 2 which is formed by reduction in the presence of a reducing agent and a solvent . suitable reducing agents include sodium borohydride , sodium cyanoborohydride and sodium triacetoxyborohydride , preferably triacetoxyborohydride . suitable solvents include acetic acid , thf , dmf and dimethylsulfoxide , preferably a mixture of acetic acid , thf and dmf . the aforesaid reaction is conducted at a temperature from about 0 ° c . to about 30 ° c ., preferably about 22 ° c ., for a period from about 10 minutes to about 2 hours , preferably about 1 hour . the compound of formula xxxi is commercially available or can be made by methods well known to those of ordinary skill in the art . the compounds of the formula i which are basic in nature are capable of forming a wide variety of different salts with various inorganic and organic acids . although such salts must be pharmaceutically acceptable for administration to animals , it is often desirable in practice to initially isolate a compound of the formula i from the reaction mixture as a pharmaceutically unacceptable salt and then simply convert the latter back to the free base compound by treatment with an alkaline reagent , and subsequently convert the free base to a pharmaceutically acceptable acid addition salt . the acid addition salts of the base compounds of this invention are readily prepared by treating the base compound with a substantially equivalent amount of the chosen mineral or organic acid in an aqueous solvent medium or in a suitable organic solvent such as methanol or ethanol . upon careful evaporation of the solvent , the desired solid salt is obtained . the acids which are used to prepare the pharmaceutically acceptable acid addition salts of the base compounds of this invention are those which form non - toxic acid addition salts , i . e ., salts containing pharmacologically acceptable anions , such as chloride , bromide , iodide , nitrate , sulfate or bisulfate , phosphate or acid phosphate , acetate , lactate , citrate or acid citrate , tartrate or bitartrate , succinate , maleate , fumarate , gluconate , saccharate , benzoate , methanesulfonate and pamoate [ i . e ., 1 , 1 ′- methylene - bis -( 2 - hydroxy - 3 - naphthoate )] salts . those compounds of the formula i which are also acidic in nature , e . g ., where r 2 , r 3 , r 4 , r 5 , r 6 , or r 7 includes a cooh or tetrazole moiety , are capable of forming base salts with various pharmacologically acceptable cations . examples of such salts include the alkali metal or alkaline - earth metal salts and particularly , the sodium and potassium salts . these salts are all prepared by conventional techniques . the chemical bases which are used as reagents to prepare the pharmaceutically acceptable base salts of this invention are those which form non - toxic base salts with the herein described acidic compounds of formula 1 . these non - toxic base salts include those derived from such pharmacologically acceptable cations as sodium , potassium , calcium and magnesium , etc . these salts can easily be prepared by treating the corresponding acidic compounds with an aqueous solution containing the desired pharmacologically acceptable cations , and then evaporating the resulting solution to dryness , preferably under reduced pressure . alternatively , they may also be prepared by mixing lower alkanolic solutions of the acidic compounds and the desired alkali metal alkoxide together , and then evaporating the resulting solution to dryness in the same manner as before . in either case , stoichiometric quantities of reagents are preferably employed in order to ensure completeness of reaction and maximum product yields . the activity of the compounds of the invention for the various disorders described above can be determined according to one or more of the following assays . all of the compounds of the invention , that were tested , had an ic 50 of less than 10 μm in the tnfα and mapkap in vitro assays or an ed50 of less than 50 mg / kg in the in vivo tnfα assay . the compounds of the present invention also possess differential activity ( i . e . are selective for ) for one or more p38 kinases ( i . e . α , β , χ and δ ). certain compounds are selective for p38α over p38β , χ and δ , other compounds are selective for p38β over p38α , χ and δ , other compounds are selective for p38 α and β over p38 χ and δ . selectivity is measured in standard assays as an ic 50 ratio of inhibition in each assay . mononuclear cells are isolated from heparinized blood ( 1 . 5 ml of 1000 units / ml heparin for injection , elkins - sinn , inc . added to each 50 ml sample ) using accuspin system - histopaque - 1077 tubes ® ( sigma a - 7054 ). thirty - five milliliters of whole blood are added to each tube and the tubes are centrifuged at 2100 rpm for 20 minutes in a beckman gs - 6kr centrifuge with the brake off at room temperature . the mononuclear cells which collect at the interface are removed , diluted with macrophage serum free medium ( gibco - brl ) ( medium ) to achieve a final volume of 50 ml , and collected by centrifugation for 10 minutes . the supernatant is discarded and the cell pellet is washed 2 times with 50 ml of medium . a sample of the suspended cells is taken before the second wash for counting . based on this count , the washed cells are diluted with medium containing 1 % fbs to a final concentration of 2 . 7 × 10 6 cells 1 ml and 75 μl of the cell suspension is added to each well of a 96 well plate . compounds are routinely tested at final concentrations from 2 μm to 0 . 016 μm , but may be tested at other concentrations , depending on activity . test agents are diluted with dmso to a final concentration of 2 mm . from this stock solution , compounds are first diluted 1 : 25 ( 5 μl of 2 mm stock + 120 μl medium containing 400 ng / ml lps and 1 % fbs then 40 μl of this dilution is diluted with 360 μl of medium with lps . serial dilutions ( 1 / 5 ) are performed by transferring 20 μl of this dilution to 80 μl of medium containing both lps and 0 . 4 % dmso , resulting in solutions containing 8 μm , 1 . 6 μm , 0 . 32 μm and 0 . 064 μm of test agent . the assay is initiated by adding 25 μl of the diluted compounds to the mononuclear cell suspension and incubating the cells at 37 c and 5 % co 2 for 4 hours . the 96 - well plates are then centrifuged for 10 minutes at 2000 rpm at 4 ° c . in a beckman gs - 6kr centrifuge to remove cells and cell debris . a 90 pi aliquot of each supernatant is removed and transferred to a 96 well round bottom plate , and this plate is centrifuged a second time to insure that all cell debris is removed . 80 ill of the supernatant is removed and transferred to a new round bottom plate . supernatants are analyzed for tnf - α content using r & amp ; d elisa . 25 μl of each sample is added to an elisa well containing 25 μl of assay diluent rd1f and 75 μl of assay diluent rd5 . the assay is run following kit directions except 100 μl of conjugate and substrate solutions are used . the amount of tnf - α immunoreactivity in the samples is calculated as follows : total = od 450 of cells that were treated with 0 . 1 % dmso only . mononuclear cells are collected from heparinized human blood as detailed above . the washed cells are seeded into 6 - well cluster plates at a density of 1 × 10 7 cells / well ( in 2 ml of medium ). the plates are incubated at 37 ° c . in a 5 % co 2 environment for 2 hours to allow adherence of the monocytes , after which time media supernatants containing non - adherent cells are removed by aspiration and 2 ml of fresh medium are added to each well . plates are incubated overnight at 37 ° c . in a 5 % co 2 environment . media are removed by aspiration . the attached cells are rinsed twice with fresh medium , then 2 ml of d - mem medium containing 10 % heat inactivated fbs are added to each well . test compounds are prepared as 30 mm stock solutions in dmso and diluted to 1250 , 250 , 50 , 10 , 2 , and 0 . 4 μm in d - mem containing 1 % dmso and 10 % fbs . to individual wells of the monocyte cultures , 20 μl of these test agent dilutions are added resulting in final test agent concentrations of 12 . 5 , 2 . 5 , 0 . 5 , 0 . 1 , 0 . 02 and 0 . 004 μm . after a 10 minute preincubation period , 20 μl of a 10 μg / ml lps solution are added to each well and the plates are incubated at 37 ° c . for 30 min . media subsequently are removed by aspiration , the attached monocytes are rinsed twice with phosphate buffered saline , then 1 ml of phosphate buffered saline containing 1 % triton x - 100 ( lysis buffer ; also containing 1 complete ™ tablet [ boehringer # 1697498 ] per 10 ml of buffer ) is added to each well . the plates are incubated on ice for 10 minutes , after which the lysates are harvested and transferred to centrifugation tubes . after all samples are harvested , they are clarified by centrifugation ( 45 , 000 rpm for 20 min ) and the supernatants recovered . 5 iii of anti - mapkap kinase - 2 antiserum ( upstate biotechnology # 06 - 534 ) is added to a microcentrifuge tube ( 1 tube for each of the above cell lysates ) containing 1 ml of a 5 % suspension of protein g - sepharose ( sigma # p3296 ) in pbs . these mixtures are incubated for 1 hour at 4 ° c . ( with rocking ) after which the beads , containing bound igg , are recovered by centrifugation and washed twice with 1 ml of 50 mm tris , ph 7 . 5 , 1 mm edta , 1 mm egta , 0 . 5 mm orthovanadate , 0 . 1 % 2 - mercaptoethanol , 1 % triton x - 100 , 5 mm sodium pyrophosphate , 10 mm sodium β - glycerophosphate , 0 . 1 mm phenylmethylsulfonyl fluoride , 1 μg / ml leupeptin , 1 μg / ml pepstatin , and 50 mm sodium fluoride ( buffer a ) by repeated centrifugation . an individual monocyte cell extract ( prepared above ) is then transferred to each tube containing a pellet of igg - coated protein g - sepharose , and these mixtures are incubated for 2 hours at 4 ° c . ( with rocking ). the beads subsequently are harvested by centrifugation , and the resulting bead pellets are washed once with 0 . 5 ml of buffer a containing 0 . 5 m nacl , once with 0 . 5 ml of buffer a , and once with 0 . 1 ml of a buffer composed of 20 mm mops , ph 7 . 2 , 25 mm sodium β - glycerophosphate 5 mm egta , 1 mm orthovanadate , and 1 mm dithiothreitol ( buffer b ). a kinase reaction mixture stock is prepared as follows : 2 . 2 μl of 10 mci / ml γ [ 32 p ] atp , 88 μl of 1 . 3 μg / ml solution of mapkap kinase - 2 substrate peptide ( upstate biotechnology # 12 - 240 ), 11 μl of 10 mm atp , 8 . 8 μl of 1 m mgcl 2 , and 770 μl of buffer b . to each of the immune complex - protein g - pellets , 40 μl of the kinase reaction mixture are added and the tubes are incubated for 30 minutes at 30 ° c . the tubes then are clarified by centrifugation and 25 μl of each supernatant is spotted onto a p81 filter paper disk ( whatman # 3698 - 023 ). after allowing all fluid to soak into the filter , each disk is placed into an individual well of 6 - well cluster plates and the filters are washed sequentially with 2 ml of 0 . 75 % phosphoric acid ( 3 washes / 15 min each ) and once with acetone ( 10 min ). the filters then are air dried and transferred to liquid scintillation vials containing 5 ml of scintillation fluid . radioactivity is determined in a liquid scintillation counter . the amount of radioactivity bound to the filter at each test agent concentration is expressed as a percentage of that observed from cells stimulated with lps in the absence of a test agent . rats were weighed and dosed with vehicle ( 0 . 5 % methyl cellulose , sigma ) or drug . one hour later , animals were injected i . p . with lps ( 50 ug / rat , sigma l - 4130 ). ninety minutes later , animals were sacrificed by asphyxiation with co 2 and bled by cardiac puncture . blood was collected in vaccutainer tubes and spun for 20 minutes at 3000 rpm . serum was assayed for tnfα levels using an elisa ( r & amp ; d systems ). the compositions of the present invention may be formulated in a conventional manner using one or more pharmaceutically acceptable carriers . thus , the active compounds of the invention may be formulated for oral , buccal , intranasal , parenteral ( e . g ., intravenous , intramuscular or subcutaneous ), topical or rectal administration or in a form suitable for administration by inhalation or insufflation . for oral administration , the pharmaceutical compositions may take the form of , for example , tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents ( e . g ., pregelatinized maize starch , polyvinylpyrrolidone or hydroxypropyl methylcellulose ); fillers ( e . g ., lactose , microcrystalline cellulose or calcium phosphate ); lubricants ( e . g ., magnesium stearate , talc or silica ); disintegrants ( e . g ., potato starch or sodium starch glycolate ); or wetting agents ( e . g ., sodium lauryl sulphate ). the tablets may be coated by methods well known in the art . liquid preparations for oral administration may take the form of , for example , solutions , syrups or suspensions , or they may be presented as a dry product for constitution with water or other suitable vehicle before use . such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents ( e . g ., sorbitol syrup , methyl cellulose or hydrogenated edible fats ); emulsifying agents ( e . g ., lecithin or acacia ); non - aqueous vehicles ( e . g ., almond oil , oily esters or ethyl alcohol ); and preservatives ( e . g ., methyl or propyl p - hydroxybenzoates or sorbic acid ). for buccal administration , the composition may take the form of tablets or lozenges formulated in conventional manner . the compounds of formula i can also be formulated for sustained delivery according to methods well known to those of ordinary skill in the art . examples of such formulations can be found in u . s . pat . nos . 3 , 538 , 214 , 4 , 060 , 598 , 4 , 173 , 626 , 3 , 119 , 742 , and 3 , 492 , 397 , which are herein incorporated by reference in their entirety . the active compounds of the invention may be formulated for parenteral administration by injection , including using conventional catheterization techniques or infusion . formulations for injection may be presented in unit dosage form , e . g ., in ampules or in multi - dose containers , with an added preservative . the compositions may take such forms as suspensions , solutions or emulsions in oily or aqueous vehicles , and may contain formulating agents such as suspending , stabilizing and / or dispersing agents . alternatively , the active ingredient may be in powder form for reconstitution with a suitable vehicle , e . g ., sterile pyrogen - free water , before use . the active compounds of the invention may also be formulated in rectal compositions such as suppositories or retention enemas , e . g ., containing conventional suppository bases such as cocoa butter or other glycerides . for intranasal administration or administration by inhalation , the active compounds of the invention are conveniently delivered in the form of a solution or suspension from a pump spray container that is squeezed or pumped by the patient or as an aerosol spray presentation from a pressurized container or a nebulizer , with the use of a suitable propellant , e . g ., dichlorodifluoromethane , trichlorofluoromethane , dichlorotetrafluoroethane , carbon dioxide or other suitable gas . in the case of a pressurized aerosol , the dosage unit may be determined by providing a valve to deliver a metered amount . the pressurized container or nebulizer may contain a solution or suspension of the active compound . capsules and cartridges ( made , for example , from gelatin ) for use in an inhaler or insufflator may be formulated containing a powder mix of a compound of the invention and a suitable powder base such as lactose or starch . a proposed dose of the active compounds of the invention for oral , parenteral or buccal administration to the average adult human for the treatment of the conditions referred to above ( inflammation ) is 0 . 1 to 200 mg of the active ingredient per unit dose which could be administered , for example , 1 to 4 times per day . aerosol formulations for treatment of the conditions referred to above in the average adult human are preferably arranged so that each metered dose or “ puff ” of aerosol contains 20 μg to 1000 μg of the compound of the invention . the overall daily dose with an aerosol will be within the range 100 μg to 10 mg . administration may be several times daily , for example 2 , 3 , 4 or 8 times , giving for example , 1 , 2 or 3 doses each time . aerosol combination formulations for treatment of the conditions referred to above ( e . g ., adult respiratory distress syndrome ) in the average adult human are preferably arranged so that each metered dose or “ puff ” of aerosol contains from about 1 μg to 1000 μg of the compound of the invention . the overall daily dose with an aerosol will be within the range 100 μg to 10 mg . administration may be several times daily , for example 2 , 3 , 4 or 8 times , giving for example , 1 , 2 or 3 doses each time . aerosol formulations for treatment of the conditions referred to above ( e . g ., adult respiratory distress syndrome ) in the average adult human are preferably arranged so that each metered dose or “ puff ” of aerosol contains from about 20 μg to 1000 μg of the compound of the invention . the overall daily dose with an aerosol will be within the range 100 μg to 10 mg of the p38 kinase inhibitor . administration may be several times daily , for example 2 , 3 , 4 or 8 times , giving for example , 1 , 2 or 3 doses each time . this invention also encompasses pharmaceutical compositions containing and methods of treating or preventing comprising administering prodrugs of compounds of the formula 1 . compounds of formula i having free amino , amido , hydroxy or carboxylic groups can be converted into prodrugs . prodrugs include compounds wherein an amino acid residue , or a polypeptide chain of two or more ( e . g ., two , three or four ) amino acid residues which are covalently joined through peptide bonds to free amino , hydroxy or carboxylic acid groups of compounds of formula 1 . the amino acid residues include the 20 naturally occurring amino acids commonly designated by three letter symbols and also include , 4 - hydroxyproline , hydroxylysine , demosine , isodemosine , 3 - methylhistidine , norvalin , beta - alanine , gamma - aminobutyric acid , citrulline homocysteine , homoserine , ornithine and methionine sulfone . prodrugs also include compounds wherein carbonates , carbamates , amides and alkyl esters which are covalently bonded to the above substituents of formula i through the carbonyl carbon prodrug sidechain . the following examples illustrate the preparation of the compounds of the present invention . melting points are uncorrected . nmr data are reported in parts per million ( d ) and are referenced to the deuterium lock signal from the sample solvent ( deuteriochloroform unless otherwise specified ). mass spectral data were obtained using a micromass zmd apci mass spectrometer equipped with a gilson gradient high performance liquid chromatograph . the following solvents and gradients were used for the analysis . solvent a ; 98 % water / 2 % acetonirile / 0 . 01 % formic acid and solvent b ; acetonitrile containing 0 . 005 % formic acid . typically , a gradient was run over a period of about 4 minutes starting at 95 % solvent a and ending with 100 % solvent b . the mass spectrum of the major eluting component was then obtained in positive or negative ion mode scanning a molecular weight range from 165 amu to 1100 amu . specific rotations were measured at room temperature using the sodium d line ( 589 nm ). commercial reagents were utilized without further purification . thf refers to tetrahydrofuran . dmf refers to n , n - dimethylformamide . chromatography refers to column chromatography performed using 32 - 63 mm silica gel and executed under nitrogen pressure ( flash chromatography ) conditions . room or ambient temperature refers to 20 - 25 ° c . all non - aqueous reactions were run under a nitrogen atmosphere for convenience and to maximize yields . concentration at reduced pressure means that a rotary evaporator was used . one of ordinary skill in the art will appreciate that in some cases protecting groups may be required during preparation . after the target molecule is made , the protecting group can be removed by methods well known to those of ordinary skill in the art , such as described in greene and wuts , “ protective groups in organic synthesis ” ( 2 nd ed , john wiley & amp ; sons 1991 ). to a stirred solution of 3 - isopropyl - 3h - benzotriazole - 5 - carbaldehyde ( 150 mg ) in 15 ml of thf was added 0 . 16 ml of concentrated ammonium hydroxide . the flask was sealed with a plastic cap and stirred overnight . piperazine ( 75 mg ) was added , followed by 4 - fluoro - 3 - methylphenyl - toylsulfonomethylisocyanide ( 312 mg ), and the mixture was stirred overnight . the mixture was filtered and the filtrate was concentrated and purified by flash chromatography ( eluting with 4 : 1 ethyl acetate / hexanes to give 130 mg of the title compound . mass spectrum 336 m + 1 . a solution of 3 - isopropyl - 3h - benzotriazole - 5 - carbaldehyde ( 60 mg ), potassium carbonate ( 49 mg ), and 4 - fluorophenyl - toylsulfonomethylisocyanide ( 101 mg ) in 7 . 5 ml of dimethyl formamide was stirred overnight . the reaction mixture was concentrated to 1 ml of volume and heated at 75 ° c . for 2 hours . the mixture was cooled to 22 ° c ., diluted with water , and extracted with ethyl acetate . the extract was washed with water , dried ( sodium sulfate ), filtered , and the filtrate was concentrated . the residue was purified by flash chromatography ( eluting with 2 : 3 ethyl acetate / hexanes ) to give 80 mg of 6 -[ 4 -( 4 - fluoro - phenyl )- oxazol - 5 - yl ]- 1 - isopropyl - 1h - benzotriazole ; mass spectrum 323 ( m + 1 ). the following compounds were made in an analogous fashion to the methods described in examples 1 or 2 . to a stirred , cold (− 10 ° c .) mixture of 519 mg 3 - isopropyl - 3h - benzotriazole - 5 - carboxylic acid methoxy - methyl - amide in 2 ml of tetrahydrofuran was added 17 ml of 4 - fluorophenylmagnesium bromide ( 0 . 25 m in diethyl ether ). the resulting suspension was stirred for 1 hour before the mixture was concentrated to near dryness . the residue was taken - up into 20 ml of tetrahydrofuran and 6 ml more 4 - fluorophenylmagnesium bromide ( 0 . 25 m in diethyl ether ) was added . the resulting solution was stirred for 15 minutes before it was diluted with water and the ph of the mixture was adjusted to 7 using 1 m hydrochloric acid . the mixture was extracted with ethyl acetate ( 3 ×), and the combined extracts were washed with brine , dried ( sodium sulfate ), filtered , and the filtrate was concentrated to give about 1 g of a yellow oil . this oil was purified by flash chromatography ( eluting with 3 : 1 hexanes / ethyl acetate ) to give 467 mg of 2 -( 4 - fluoro - phenyl )- 1 -( 3 - isopropyl - 3h - benzotriazol - 5 - yl )- ethanone as a clear oil . to a stirred solution of 191 mg of 2 -( 4 - fluoro - phenyl )- 1 -( 3 - isopropyl - 3h - benzotriazol - 5 - yl )- ethanone in 2 ml of acetic acid was added 0 . 64 ml of bromine ( 1 m in acetic acid ). the mixture was heated at 50 ° c . for 3 hours . the reaction mixture was cooled to 22 ° c . and concentrated to dryness . the residue was taken - up into ethyl acetate and washed with saturated aqueous sodium bicarbonate , brine ; the organic layer was dried ( sodium sulfate ), filtered and the filtrate was concentrated to give 222 mg of 2 - bromo - 2 -( 4 - fluoro - phenyl )- 1 -( 3 - isopropyl - 3h - benzotriazol - 5 - yl )- ethanone as a light yellow oil . this material was used without further purification . to a stirred solution of 29 mg of 2 - bromo - 2 -( 4 - fluoro - phenyl )- 1 -( 3 - isopropyl - 3h - benzotriazol - 5 - yl )- ethanone in 0 . 38 ml of n , n - dimethylformamide was added 75 mg of cesium carbonate and 24 mg of 3 - amidinopyridine hydrochloride . the mixture was heated at 50 ° c . for 30 min . the orange - brown mixture was cooled to 22 ° c ., transferred to a separatory funnel with water , and extracted with ethyl acetate ( 3 ×). the combined organic layers were washed with brine , dried ( sodium sulfate ), filtered , and the filtrate was concentrated to an orange oil . this oil was purified by flash chromatography ( eluting with ethyl acetate ) to give 12 mg of 6 -[ 5 -( 4 - fluoro - phenyl )- 2 - pyridin - 3 - yl - 3h - imidazol - 4 - yl ]- 1 - isopropyl - 1h - benzotriazole as a white solid . lcms m / z 399 ( m + 1 ). the following examples were prepared according to the methods analogous to those of example 19 . to a stirred , cold ( 0 ° c .) solution of 1 , 2 , 3 - benzotriazole - 5 - carboxylic acid methyl ester ( 2 . 51 g ) in dimethylformamide was added 60 % sodium hydride ( 370 mg ) portion wise . after 20 minutes , methyl iodide ( 0 . 87 ml ) was added . the reaction was quenched by the addition of water after 30 minutes . the mixture was extracted with ethyl acetate ; the extracts were washed with water , and brine , and dried ( sodium sulfate ). filtration and concentration of the filtrate gave a residue from which 716 mg of 1 - methyl - 1h - benzotriazole - 5 - carboxylic acid methyl ester crystallized ( hot ethyl acetate ). the mother liquor was purified by flash chromatography ( eluting with 3 : 2 hexanes / ethyl acetate ) to give 890 mg of 2 - methyl - 2h - benzotriazole - 5 - carboxylic acid methyl ester and 490 mg of 3 - methyl - 3h - benzotriazole - 5 - carboxylic acid methyl ester . structural assignments were made on the basis of proton nmr and noe experiments . 3 - methyl - 3h - benzotriazole - 5 - carboxylic acid methyl ester was taken on separately to the corresponding aldehydes by reduction with lithium aluminum hydride ( 1 equivalent ) in anhydrous dimethoxyethane . the resulting alcohols were oxidized using 2 , 2 , 6 , 6 - tetramethyl - 1 - piperidinyloxy free radical ( 1 equivalent ), tetrabutylammonium chloride ( 1 equivalent ), and n - chlorosuccinimide ( 1 . 3 equivalent ) in methylene chloride and ph 8 . 6 sodium bicarbonate / potassium carbonate buffer to give 3 - methyl - 3h - benzotriazole - 5 - carbaldehyde . to a stirred mixture of 3 , 4 - diaminobenzoic acid ( 15 . 2 g ), in 200 ml of tetrahydrofuran , 30 ml of dimethyl formamide , 7 . 3 ml of acetone , and 5 . 7 ml of acetic acid , was added 31 . 8 9 of sodium triacetoxyborohydride in portions . after 3 hours the mixture was filtered through diatomaceous earth and washed with tetrahydrofuran . the filtrate was concentrated to dryness . crystallization of the residue with ethyl acetate / hexanes gave 11 grams of 4 - amino - 3 - isopropylamino - benzoic acid . to a stirred , cold ( 0 ° c .) mixture of 4 - amino - 3 - isopropylamino - benzoic acid ( 11 g ) in 120 ml of 6 n hydrochloric acid was added drop - wise a solution of 5 . 9 g of sodium nitrite in 40 ml of water . after 2 hours the solids were collected by filtration , washed with water , and dried to give 9 grams of 3 - isopropyl - 3h - benzotriazole - 5 - carboxylic acid . to a stirred mixture of 3 - isopropyl - 3h - benzotriazole - 5 - carboxylic acid ( 9 g ) in 150 ml of methylene chloride and 0 . 15 ml of dmf was added 5 . 0 ml of oxalyl chloride . the solution was stirred overnight before 27 ml of n , n - diisopropylamine and 5 . 6 g of n , o - dimethylhydroxylamine hydrochloride was added . the mixture was stirred for 3 days before mixture was washed with a solution of sodium dihydrogenphosphate , aqueous bicarbonate , dilute hydrochloric acid , brine , dried ( sodium sulfate ), filtered , and the filtrate was concentrated to a dark oil . this oil was purified by flash chromatography ( eluting with 3 : 2 ethyl acetate / hexanes ) to afford 10 . 4 g of 3 - isopropyl - 3h - benzotriazole - 5 - carboxylic acid methoxy - methyl - amide as brown oil . to a stirred , cold (− 78 ° c .) solution of 3 - isopropyl - 3h - benzotriazole - 5 - carboxylic acid methoxy - methyl - amide ( 4 . 26 g ) in 20 ml of toluene was added drop - wise 17 . 2 ml of dibal in toluene ( 1 m ). the mixture was stirred for 1 hour at − 78 ° c . before warming to 0 ° c . the reaction was quenched with aqueous 1 n hydrochloric acid , diluted with water and extracted with ethyl acetate ( 3 times ). the combined extracts were washed with water , brine , dried ( sodium sulfate ), filtered , and the filtrate was concentrated to give a yellow oil . this oil was purified by flash chromatography ( eluting with 2 : 1 hexanes / ethyl acetate ) to give 2 . 24 g of 3 - isopropyl - 3h - benzotriazole - 5 - carbaldehyde as a yellow oil which crystallized upon standing ; ms 190 m + 1 . sodium nitrite ( 6 . 78 g in water ( 40 ml ) at 0 ° c .) was slowly added to a solution of 4 - amino - 3 - chloro - benzonitrile ( 10 . 5 g ) in water ( 30 ml ) and concentrated hydrochloric acid ( 30 ml ) also at 0 ° c . after 10 minutes the solution was poured onto a suspension of cuprous oxide ( 3 . 48 g ) and sodium nitrite ( 31 . 69 g ) in water ( 100 ml ) at 0 ° c . the ensuing mixture was stirred at 0 ° c . for 1 hour then at 23 ° c . for 1 hour . the resulting mixture was extracted with dichloromethane and the organic layer washed with saturated sodium chloride . the separated organic layer was dried over sodium sulfate and then concentrated to give 3 - chloro - 4 - nitro - benzonitrile ( 11 . 31 g ). monoethylamine was bubbled though a solution of 3 - chloro - 4 - nitro - benzonitrile ( 0 . 49 g ) in tetrahydrofuran ( 1 ml ). the reaction vial was sealed and allowed to stand for 18 hours at 23 ° c . the resulting mixture was diluted with ethyl acetate and saturated sodium bicarbonate and extracted . the organic layer was dried with sodium sulfate and concentrated . silica gel chromatography using 5 % ethyl acetate in hexanes as eluent gave 3 - ethylamino - 4 - nitro - benzonitrile ( 0 . 3 g ). 3 - ethylamino - 4 - nitro - benzonitrile ( 0 . 3 g ) was diluted with ethanol ( 5 ml ) and was treated with 10 % palladium on carbon ( pd / c )( 0 . 070 g ). the mixture was then shaken in a hydrogenation shaker under an atmosphere of hydrogen ( 40 psi ) for 30 minutes . the resulting mixture was filtered through diatomaceous earth and concentrated . silica gel chromatography using 20 % ethyl acetate in hexanes as eluent gave 4 - amino - 3 - ethylamino - benzonitrile ( 0 . 08 g ). 3 - ethyl - 3h - benzotriazole - 5 - carbonitrile was prepared using the procedures previously described for the synthesis of 3 - isopropyl - 3h - benzotriazole - 5 - carboxylic acid ethyl ester . 3 - ethyl - 3h - benzotriazole - 5 - carbonitrile ( 0 . 065 g ) was diluted with lithium hydroxide ( 2 m in water ) then heated to 100 ° c . for 2 hours . the mixture was then cooled to 23 c , acidified with 1 n hydrochloric acid and extracted with ethyl acetate . the organic layer was dried with sodium sulfate and concentrated to give 3 - ethyl - 3h - benzotriazole - 5 - carboxylic acid ( 0 . 059 g ). 3 - ethyl - 3h - benzotriazole - 5 - carboxylic acid ( 0 . 15 g ) was diluted with methanol and treated with hcl ( gas ). the reaction was then heated to 65 ° c . for 18 hours . the mixture was allowed to cool to 23 ° c . and was diluted with saturated sodium bicarbonate and extracted with ethyl acetate . the organic layer was dried with sodium sulfate and concentrated to give 3 - ethyl - 3h - benzotriazole - 5 - carboxylic acid methyl ester ( 0 . 143 g ). 3 - ethyl - 3h - benzotriazole - 5 - carboxylic acid methyl ester ( 0 . 143 g ) was diluted with tetrahydrofuran ( 2 ml ) and methanol ( 0 . 06 ml ). lithium borohydride ( 0 . 023 g ) was added and the solution was allowed to stand at 23 ° c . for 30 minutes . the reaction was then poured onto saturated ammonium chloride and extracted with ethyl acetate . the organic layer was dried with sodium sulfate and concentrated to give ( 3 - ethyl - 3h - benzotriazol - 5 - yl )- methanol ( 0 . 13 g ). | 2 |
referring now to fig1 , a front elevation view of one embodiment of the present invention is provided herein . more specifically , an electronic device storage case 2 is provided that generally comprises a front panel 4 , a rear panel 6 , a top panel 8 , a bottom panel 10 and opposing side panels 12 positioned between the top panel 8 and the bottom panel 10 . alternatively , the top panel 8 may be removed and the case 2 interconnected along an upper edge of the front panel 4 and rear panel 6 . although generally designed to carry a notebook computer , the electronic device storage case 2 may be used to retain and safely store any type of electronic device that may be fragile and prone to breakage . the electronic device storage case 2 shown in fig1 generally includes one or more openings that allow access to the electronic storage case and insertion and removal of the electronic device . the storage compartment may be selectively accessed with the use of one or more zippers 14 , buckles , or other types of opening mechanisms commonly known in the art . generally , the openings are included in the top panel 8 , but openings may also be positioned in the front panel 4 , rear panel 6 , or within one of the side panels 12 . the electronic storage case 2 may also include a handle 16 and at least one auxiliary storage compartment 18 . the auxiliary storage compartment 18 of one embodiment of the present invention may secure items like address books , compact discs , sunglasses , phones , pdas , and other similar commonly used items . referring now to fig2 and 3 , a front elevation view of one embodiment with the front panel omitted for clarity is provided herein . more specifically , a storage compartment 20 for receipt of an electronic device is provided . the storage compartment 20 is defined by the rear panel 6 that may include a plurality of cushioned ribs 22 emanating therefrom , an internal support panel 24 , and two adjustable restraint members 26 and 28 . the electronic device is thus supported on one surface by the adjustable internal support panel 24 , or another surface by the cushioned ribs 22 , and its left and right sides by the adjustable restraint members 26 and 28 respectively . a portion of the electronic device is also supported by a lower surface of the storage compartment 20 that also provides some impact isolation since it is spaced from the bottom panel 10 of the electronic storage case 2 . the electronic storage case 2 may also include padding 42 in a variety of locations to provide added protection . the internal support panel 24 in one embodiment includes a first fastening member 30 for selective interconnection to a second fastening member 32 interconnected to both adjustable side members 26 and 28 . these fastening members may comprise hook and loop fasteners , such as velcro ® but other fasteners known in the art such as snaps , buckles or latches , etc . may be employed without departing from the scope of the invention . in order to increase at least one dimension of the storage area , a user selectively disconnects the fastening members , transitions the adjustable support panel 24 towards the rear panel 6 of the case 2 to make the storage compartment 20 thinner or transition the internal support panel 24 away from the rear panel 6 to make the storage compartment 20 thicker and re - interconnect the fastening members . the first adjustable restraint member 26 and second adjustable restraint member 28 provide a means for securing the internal support panel 24 and substantially prevent the movement of the stored device in a direction transverse to the thickness of the electronic storage case 2 . thus the dimension of storage area may be selectively adjusted to assure that the electronic device is securely retained to avoid unnecessary movement and to provide the flexibility to store electronic devices with different dimensions . referring now to fig4 and 5 , cross sectional and perspective views of one embodiment of the present invention are shown . more specifically , additional detail regarding the storage compartment is provided within the electronic storage case 2 will be appreciated . the storage compartment 20 is defined by cushioned ribs 22 , the internal support panel 24 , the adjustable restraint members 26 and 28 , and a storage compartment lower surface 34 . this lower surface provides a space between the storage compartment 20 and the bottom panel 10 of the electronic storage case 2 thereby at least partially isolating a stored electronic device 36 from the bottom panel 10 of the case to provide some shock isolation . preferably there is a gap or spacing of at least about 1 inch , and preferably 2 - 3 inches to prevent the electronic device from impacting a solid surface if the storage case 2 is inadvertently dropped . in addition , the adjustable support panel 24 may be hingedly interconnected to a corner defined by the rear panel 6 and the bottom panel 10 of the electronic storage case 2 . one skilled in the art will appreciate that other interconnection methods can be employed to further isolate the electronic device 36 without departing from the scope of the invention . further , the front panel 4 of the case may be interconnected to the side panels of the case 2 by gussets 38 . again , one skilled in the art will appreciate that these gussets 38 may be omitted to allow the front panel 4 to open to a greater extent thereby providing greater access to the interior or the case 2 . although the handle 8 is primarily shown and described herein , other methods of securing the electronic storage case 2 to an individual , such as a strap ( not shown ) may be included that is selectively interconnectable to the electronic storage case 2 via a strap ring 40 . while various embodiments of the present invention have been described in detail , it is apparent that modifications and variations of those embodiments will occur to those skilled in the art . however , it is to be expressly understood that such modifications are within the scope and spirit of the present invention . | 0 |
in the conventional manufacture of video heads two ferrite blocks are bonded to what is commonly referred to as the &# 34 ; body &# 34 ; so that the &# 34 ; gap &# 34 ; is formed . one of the blocks has a ground - in channel , which later becomes the winding aperture . by sawing this body into slices of approximately 200 μm thickness and by threading a thin insulated copper wire ( 30 - 50 μm ) through each winding aperture the video head is produced which may then be cut to &# 34 ; track width &# 34 ; with the aid of a laser . a method which is safer and leads to a more regular winding pattern is the following . a core block 1 with ground - in longitudinal channels 2 , 3 is provided . a plurality ( equal to the desired number of turns ) of straight , insulated wires is strung in the channels 2 , 3 and subsequently a bonding agent ( for example , an epoxy resin or a glass ) is allowed to flow in a capillary manner between these wires themselves and the walls of the channels , whereafter the bonding agent is cured . core block 1 is thereby provided with wire bundles 4 , 5 ( fig1 ) bonded thereto . subsequently core block 1 formed into an assembly with the aid of an opposing block 6 ( fig2 ). this assembly is sawn into slices 7 having a thickness of , for example , 200 μm ( fig3 ). each slice 7 already has the &# 34 ; lead - throughs &# 34 ; in the winding aperture 8 . because of the larger bonding surface a greater strength between the core halves is obtained . conventional winding is thus reduced to ultrasonic or laser bonding of connection wires 9 , etc . to the front and rear sides of the core slices 7 ( fig4 ). making such connection is a known technique from ic manufacture . fig5 is a cross - section of a core slice 7 thus obtained . the references a , b , c and d indicate the bonding areas of a turn . fig6 shows the coil of the core slice 7 of fig4 on a larger scale . the wire bundles 4 , 5 consist of insulated wires having a thickness of 45 microns ( 35 microns of copper , 5 microns of insulation ). the connection wires 9 are fixed to the ends of the wires of the wire bundles 4 , 5 by means of ultrasonic bonding or laser bonding . the lead - through wires and the connection wires may be made of copper , but aluminum is less expensive for this special technique and is technically slightly simpler . copper has a thicker and tougher oxide film which can be removed by etching , whereas etching is not required in the case of aluminum . variations are possible such as no channel on the outside or only providing the wires for the inner leadthroughs so that the connection wires have to be provided around the head . it is also possible to make fine channels to satisfactorily position each separate wire in connection with automation of the manufacturing process . fig7 is an elevational view of a core block 10 which is provided with channels 11 and 12 . double - layer wire bundles 13 and 14 are bonded in the channels 11 and 12 , respectively . the ends of the separate wire bundles are connected by means of connection wires 15 to the front and rear sides of core block 10 for forming a coil . the wire bundles are bonded first and subsequently the core block 1 and the opposing block 2 are united to form a core block assembly with the aid of a glass or synthetic resin adhesive such as an epoxy resin . an alternative method is to provide a core block assembly by previously bonding the core blocks 1 and 6 with the aid of a high melting point glass . subsequently the wire bundle 5 is inserted into the central aperture and bonded , with the aid of a glass having a lower melting point , and the wire bundle 4 is bonded to the outside . the coil may alternatively be formed around the two core limbs instead of around one core limb , that is to say , each limb will have a pack of turns . as is shown in fig8 it is then possible to start from an assembly 22 of two core blocks 16 , 17 of the type shown in fig1 . wire bundles 18 and 19 are bonded to the longitudinal sides of core block 16 and wire bundles 20 and 21 are bonded to the longitudinal sides of core block 17 . assembly 22 is sawn into thin slices 23 . the ends of the wires of the wire bundles are connected together by means of connection wires 24 on the front and rear sides of core slice 23 for forming a coil whose turns on one core limb have a winding sense opposite to the winding sense of the turns on the other limb . all this is clarified in fig1 which is an elevational view on a larger scale of part of the core slice 23 of fig9 . the advantage of distributing the turns on the two core limbs is that the pack of turns as such can be positioned more closely to the transducing gap 30 which contributes to the efficiency of the head . fig1 also shows how the longitudinal channels 31 , 32 may be provided with sub - channels 33 , 34 respectively to ensure that the wires of the wire bundles are located in predetermined positions . the invention is also particularly suitable for a head having two transducing gaps and two separate windings . such a head 35 , which may be used in a digital video recorder ( see uk - a no . 2 , 113 , 896 ), is shown in fig1 . referring to fig1 is is also possible to use preformed u - shaped wire bundles 36 ; this is particularly advantageous if separate head cores are to be provided with turns . in this respect it is to be noted that the bulk - manufacturing method as shown in fig1 - 4 and in fig8 is most suitable when the material of the head cores is a ceramic material , such as ni - zn ferrite or mn - zn ferrite . when the material of the head cores is a metallic material , such as an ni - fe alloy , an al - fe - si alloy or an amorphous metal , it may be desirable to provide the separate head cores with turns using u - shaped wire bundles of the type shown in fig1 . | 6 |
several preferred embodiments of the present invention will now be described with reference to the accompanying drawings . various other embodiments of the invention are also possible and practical . this invention may be embodied in many different forms and the invention should not be construed as being limited to the embodiments set forth herein . the figures listed above illustrate the preferred embodiments of the invention and the operation of such embodiments . in the figures , the size of the boxes is not intended to represent the size of the various physical components . where the same element appears in multiple figures , the same reference numeral is used to denote the element in all of the figures where it appears . only those parts of the various units are shown and described which are necessary to convey an understanding of the embodiment to those skilled in the art . those parts and elements not shown are conventional and known in the art . a typical dsss system of a first embodiment is shown in fig1 . in this embodiment a computer 100 is connected to peripheral devices 400 a , 400 b and 400 c using a wireless direct sequence spread spectrum ( dsss ) connection . the computer 100 is connected to a dsss adapter 200 . adapter 200 has an associated antenna 250 . the peripheral devices 400 a , 400 b and 400 c are connected to dsss adapters 500 a , 500 b and 500 c . dsss adapters 500 a , 500 b and 500 c respectively have antennas 510 a , 510 b and 510 c . dsss adapters 500 a , 500 b and 500 c are identical to dsss adapter 200 . thus , the following description will only focus on dsss adapter 200 and antenna 250 in order to simplify the discussion ; however , the discussion applies equally to the other adapters . the computer 100 includes a display 110 , keyboard 120 , mouse 130 , and central processing unit ( cpu ) 140 . these units are conventional and perform the functions of a conventional computer system . dsss adapter 200 includes a controller 260 , encoder 210 , radio frequency ( rf ) transmitter 230 , antenna 250 , rf receiver 240 , and decoder 220 . controller 260 controls the communication between adapter 200 and the computer 100 . controller 260 communicates with the computer using a conventional connection 300 . connection 300 can be any common computer interface such as those known as usb , ieee 1394 , ethernet , rs - 232 serial port , and parallel port . it may also be any other type of interface that allows for communication . in an alternate embodiment , connection 300 is a direct connection to the internal bus structure of the cpu 140 . controller 260 is also responsible for initializing the dsss adapter 200 and for performing housekeeping functions . encoder 210 is used to encode data for transmission . rf transmitter 230 modulates the encoded data with an rf carrier to create an rf signal . antenna 510 is used to broadcast the rf signal to dsss receivers . antenna 510 receives the rf signals broadcast by other dsss transmitters . rf receiver 240 demodulates the rf signal to recover the encoded data stream from the rf carrier . decoder 220 decodes the encoded data stream . the rf transmitter 230 , the rf receiver 240 and antenna 250 are conventional . the following discussion will explain the operation of the embodiment described above . transmitting data : fig2 illustrates the sequence of events that occurs when data is transmitted . the first step is to transmit two start - of - packet ( sop ) indicators , sop 1 10 and sop 2 20 . each one of these indicators consists of a pn - code pnb . by using two pn - codes back - to - back the chance of random noise or interference being mistaken for the sop is greatly reduced . it is highly unlikely that random noise or interference will create the same pattern twice even if the threshold of the correlator is set to a low level . next , the data 30 is encoded using a pn - code pna . the data is encoded in a conventional manner . that is , two different patterns , one being pna itself and the other being the inverse of pna referred to as pna , are used to represent binary “ 0 ” and binary “ 1 ”. by using two different pn - codes , one pn - code ( herein referred to as pna ) to encode the data , and another pn - code ( herein referred to as pnb ) for the sop , there is very little chance that the receiver will ever confuse the data 30 with the sop or vice - versa . finally , after all the data has been sent , a single end - of - packet ( eop ) indicator eop 40 is sent . eop 40 is the inverse of pn - code pnb . this inverse code is herein referred to as pnb -. by using pnb - for eop 40 there is very little ( in fact practically no ) chance that the eop code will be mistaken for the sop code . also , by using one pn - code ( pna ) to encode the data and another pn - code ( pnb -) for eop there is very little chance that the receiver will ever confuse data 30 with eop 40 or vice - versa , even if the threshold of the correlator is set to a low level . the method of sending framed packetized data will now be described in more detail with reference to fig1 and 2 . a data packet to be transmitted originates in the computer 100 . it is then sent to the dsss adapter 200 over connection 300 to controller 260 . controller 260 then does two things . first , it sends out the start - of - packet sequence ( sop 1 10 and sop 2 20 ) to the rf transmitter 230 using connection 335 . this entails sending pn - code pnb twice to the rf transmitter 230 . the rf transmitter 230 will modulate the sop sequence onto an rf carrier and send the resultant signal over connection 360 to antenna 250 for broadcast . second , the controller sends the data ( data 30 ) to encoder 210 over connection 330 for encoding . fig3 shows an embodiment of an encoder 210 . serial data input bit 0 630 is received on connection 330 from the controller 260 and is one common input to a bank of xor gates 610 . the other inputs to the bank of xor gates 610 are connected to pn - code register 600 . pn - code register 600 is preloaded with pn - code pna . the length of the pn - code register 600 and the number of xor gates 610 is equal to the number of chips in pna . the normal and customary operation of an xor gate means that a logical 0 on one input will cause the output of the gate to be the same as the other input , whereas a logical 1 on one input will cause the output of the gate to be the inverse of the other input . this means that if bit 0 630 is a logical 0 then the output of the xor gates 610 will be the same as pna , while a logical 1 will cause the output of the xor gates 610 to be the inverse of pna ( i . e . pna -). the outputs of the xor gates 610 are sent to parallel - to - serial converter 620 before being serially output on connection 340 to rf transmitter 230 . rf transmitter 230 will then modulate the encoded data onto an rf carrier and send the resultant signal over connection 360 to antenna 250 for broadcast . after all the data has been encoded and sent , the controller 260 sends out the end - of - packet ( eop 40 ) sequence to the rf transmitter 230 using connection 335 . this entails sending the inverse of pn - code pnb ( pnb -) to the rf transmitter 230 . the rf transmitter 230 will modulate the eop sequence onto an rf carrier and send the resultant signal over connection 360 to antenna 250 for broadcast . the encoding process and the transmission process is conventional except for the different pn - codes that are used for the sop and eop . the mechanism for recognizing the pn - codes is also conventional . receiving data : referring to fig1 and 2 , data can be broadcast by dsss adapters 500 a , 500 b or 500 c simultaneously , however dsss adapter 200 will only decode transmissions that are encoded with the same pn - code used by decoder 220 . broadcast data is received on antenna 250 as an rf signal and is sent to rf receiver 240 on connection 360 . the rf receiver de - modulates the rf signal from the rf carrier to recover the encoded data stream . the encoded data stream is sent to decoder 220 using connection 350 . fig4 shows a functional diagram of an embodiment of decoder circuit 220 . the actual implementation can be done in hardware or in software . furthermore the circuit can be implemented with various other architectural configurations to accomplish the same function . in the specific embodiment shown here , the decoder 220 comprises a shift register 700 , correlator - pnb 710 , pnb register 720 , correlator - pna 730 , and pna register 740 . the shift register 700 is used to receive data 705 serially from rf receiver 240 . the pnb register 720 and pna register 740 are used to store the pnb and pna pn - codes respectively . correlator - pnb 710 and correlator - pna 730 are standard correlators as used in dsss applications and they are used to compare the shift register 700 to the pnb register 720 or pna register 740 respectively . the decoder 220 operates as follows : at the start of the operation , pna register 740 is loaded with pn - code pna and pnb register 720 is loaded with pn - code pnb . data 705 is encoded serial data received from rf receiver 240 and it is loaded into the shift register 700 one bit at a time . the correlator - pnb 710 then does a bit - by - bit comparison between the data in the shift register 700 and pnb register 720 for every bit received . a match between the two inputs is indicated by a logic one on output matchpnb 740 . the correlator - pnb 710 also does a comparison between the data in the shift register 700 and the inverse of pnb register 720 , with a match being indicated by a logic 1 on output matchpnb - 745 . additionally , the correlator - pnb 710 can be set to a threshold level by controller 260 using input threshold - pnb 765 . the threshold level is used to tell the correlator how many bits need to match between the pnb register 720 and the shift register 700 before a match is indicated on matchpnb 740 or matchpnb - 745 , with the lower the threshold level the fewer the number of bits that need to match . a low threshold level increases the chance of data being decoded in noisy environments , however it also increases the chances of random noise being decoded as a valid match as well . the adjustment of the threshold is done in a conventional manner . correlator - pna 730 performs a similar function as correlator - pnb 710 , except it compares the pna register 740 to the data in shift register 700 and outputs a logic 1 on matchpna 750 if there is a match , and a logic 1 on matchpna - 755 if there is a match to the inverse of pna . also , threshold - pna 760 controls the comparison threshold of correlator - pna 730 . before a new packet is received the controller 260 waits for matchpnb 740 to be a logic one , thus indicating a match between the received data and pnb . referring to fig2 , this indicates a possible sop ( sop 1 10 ). however , to make sure that the match was not the result of noise or interference in the system , the controller waits to see if the next bit pattern indicates a match to pnb as well ( sop 2 20 ). the second match to pnb needs to occur immediately after the first match to pnb , therefore the controller needs to keep track of how many bits have been shifted into the shift register . once the same number of bits has been shifted into the shift register as the length of the pnb , the controller looks to see if there is another match between the received data and the pnb register 720 . if there is a match then matchpnb 740 will be a logic one and two back - to - back pnb sequences ( sop 1 10 and sop 2 20 ) will have been received thus indicating a valid sop indicator . the controller 260 , having detected a valid sop sequence , next monitors matchpna 750 and matchpna - 755 in order to decode the data packet . output matchpna 750 is a logic 1 when the correlator - pna 730 detects a match between the data in shift register 700 and pna register 740 that is above the threshold set by threshold - pna 760 . this means that a logic 0 has been decoded since the encoder in the transmitter replaced the logic 0s of the data with pna before transmission . controller 260 sends this information to computer 100 using connection 300 . likewise , output matchpna - 755 is a logic 1 when there is a match between the data in shift register 700 and the inverse of pna register 740 that is above the threshold set by threshold - pna 760 . this means that a logic 1 has been decoded since the encoder in the transmitter replaced the logic 1s of the data with the inverse of pna before transmission . controller 260 sends this information to computer 100 using connection 300 . the controller continues to monitor matchpna 750 and matchpna - 755 until matchpnb - 755 is a logic 1 . output matchpnb - 755 is a logic 1 when there is a match between the incoming data in shift register 700 and the inverse of the pnb register 720 ( i . e . pnb -). this indicates an eop sequence as seen in fig2 eop 40 and the data packet is complete . sending an acknowledgement using pn - codes : many protocols require the receiver to acknowledge receipt of data by using an acknowledgement indicator . the embodiment described here provides a very efficient acknowledgement mechanism . an acknowledgement is transmitted by transmitting a single instance of pnb followed by a single instance of pnb -. referring to fig1 , transmission of an acknowledgement can be initiated by controller 260 by first sending the pn - code pnb to the rf transmitter 230 using connection 335 followed by pn - code pnb -. the rf transmitter 230 would first modulate pnb and then pnb - onto an rf carrier and broadcast the resultant rf signal over antenna 250 using connection 360 . the receiver would receive the rf signal on antenna 250 and send it to rf receiver 240 on connection 360 for demodulation . referring to fig4 , the resulting encoded signal would be shifted into shift register 700 and compared to pnb in the pnb register 720 by correlator 710 . the correlator would then output a logic 1 on output matchpnb 740 to indicate a match with pnb . after the shift register is loaded with the next code word the correlator would then output a logic 1 on output matchpnb - 745 to indicate a match with pnb -. the combination of matchpnb 740 followed by matchpnb - 745 would indicate to the controller that an acknowledgement signal was received . pn - codes : the pn - codes for the sop / eop indicators and the data packet need to have excellent cross - correlation properties with each other . that is , the chip pattern of the pn - code used from the framing bits should be different enough from the pn - code used for the data packet pn - code that one code will not be mistaken for the other code even if a few chips are corrupted due to noise or interference . using codes without excellent cross - correlation properties may cause the decoder to confuse the sop / eop indicators with the data thus erroneously decoding the data packet . the following are two , 32 - chip length , hexadecimal codes that can be used for the sop / eop indicator and for the data . ( an example that has a longer code for the sop / eop indicator is given later ). it is noted that the ox designates that the code as a hexadecimal code . the two pn - codes are : either one can be used for the sop / eop pn - code with the other one being used for the data packet pn - code . the following are other pairs of pn - codes that can be used for other embodiments : 0xdcc06bb8 , 0x2b09bbb2 0xa31ef2a4 , 0x31327ab3 0x44833bdd , 0x14cf8ec9 0x35354ec5 , 0xf35247b0 0x7c238ace , 0x455c54d7 0x81acfb83 , 0x7a9a61ac 0x3c125f9c , 0x3998f68a another embodiment uses different length pn - codes for the sop / eop indicators and for the data packet . it is noted that the implications of a lost or corrupted data bit are less severe than for a lost or corrupted framing bit . thus , use of a longer pn - code for the sop / eop pn - code than for the data packet provides a higher signal - to - noise ratio for the sop / eop . a higher signal to noise ration for the sop / eop means that it is less susceptible to noise and interference . it is noted that if the receiver misses the sop indicator , the entire packet will be lost . on the other hand a computer may relatively easily correct a lost or corrupted data bit by using an error detection and correction algorithm . while it is possible to use a longer pn - code for the data as well , the tradeoff is reduced data throughput since longer pn - codes take more time to transmit versus shorter pn - codes . however , it is noted that using one pn - code length for the sop / eop indicators and another pn - code length for the data packet adds complexity to the design of the dsss encoder and decoder . the following is an example of a 64 - chip pn - code that can be used for encoding the sop / eop indicators in a system that uses a 32 - chip pn - code to encode the data packet . various other embodiments are possible : the foregoing description for an improved method and apparatus for a method for providing packet framing in a dsss radio system describes a specific embodiment ; however , other embodiments are also possible . one alternate embodiment utilizes a controller - less dsss adapter . in such an embodiment the processing power of computer 100 replaces the functions of the controller 260 . one other embodiment uses a different number of sop indicators at the start of the packet than does the embodiment described above . the preferred embodiment described above uses two sop indicators ( in fig2 sop 1 10 and sop 2 20 ), however more or less than two indicators can be used as well . additionally , a different configuration of sop indicators can be used that combines pna and pnb codes . likewise , the eop indicator can be more than a single indicator and can also be a combination of pna and pnb codes . similarly , the acknowledgement indicator can incorporate different combinations and quantities of pnb and pnb - instead of just a single pnb code followed by a single pnb - code . another embodiment combines framing with identification of different packet types . a packet type indicator could be combined with the sop sequence to create a multi - bit sequence that is encoded into the header packet using the same pn - code . data would still be transmitted with a second pn - code . another embodiment uses the framing pn - code as an addressing mechanism . the framing code could be different for each address , even if the data pn - code is the same . a receiver would only listen for the framing code that it is programmed to respond to , and then decode the data using the data code . if the framing code does not match then the data is ignored . another embodiment uses a different framing pn - code for each transmitter whereas the receiver can decode the data using any of the framing pn - codes used by the transmitters . this would enable the receiver to identify the sending transmitter based on the framing code used by that transmitter . alternatively , the transmitters can all use the same framing code but different data pn - codes in order to identify the source of the data . another embodiment uses a single pn - code for the framing code and the data code . the framing of the data packet would be accomplished by using only the inverse of the pn - code to indicate the sop and eop . the data is encoded by using the pn - code to indicate a logic 0 , whereas the absence of the pn - code indicates a logic 1 . the inventive principles of the improved method and apparatus are applicable to various types of communication and protocols . any protocol that uses indicators , such as sop or eop indicators , can utilize the present invention . furthermore , any protocol that utilizes an ack signal can utilize the present invention . the indicators can be sop or eop indicators or any other type of indicator or framing sequence . the invention can be used with any type of rf transmission , which transmits data using a protocol that has indicators such as sop or eop indicators . while the invention has been shown and described with respect to preferred embodiments thereof , it should be understood that a wide variety of other embodiments are possible without departing from the scope and sprit of the invention . the scope of the invention is only limited by the appended claims . | 7 |
as shown in fig1 and 2 , this invention — a new type of glass sheet heating furnace is in horizontal type . said furnace body is composed of an upper furnace body 13 , a lower furnace body 18 . ceramic roller - table 16 is installed on the lower furnace body 18 ; numbers of heating zones are set inside the upper and lower furnace bodies , one heat accumulation type flame radiation tube 14 is set in each heating zone . this heat accumulation type flame radiation tube 14 is composed of a couple of main burner guns 9 and a radiation tube 23 connecting the two main burner guns 9 . radiation tube 23 is in w shape ( see fig2 ). the two main burner guns 9 are installed with airtight at both ends of radiation tube 23 . a heat accumulator 19 is set in each main burner gun 9 . said heat accumulator 19 is ball type porcelain heat accumulator or honeycomb ceramic heat accumulator . the main burner gun 9 uses diesel oil , or natural gas , or city gas or liquefied petroleum gas as fuel ; main fuel transporting pipes 24 is set outside of the furnace body ( only one part of it is given in the diagram ); the main air supply pipe 20 and the main smoke venting pipe 21 , main fuel transporting pipes 24 are connected respectively with the fuel transporting port of each main burner gun 9 through pipe 8 . safety electromagnetic control valve 7 is set in fuel transporting pipe 8 of each main burner gun 9 . proportion regulating valve 22 for common use is set between the couple of main burner guns 9 in the accumulation type flame radiation tube 14 and the main fuel transporting pipe 24 . each heat accumulation type flame radiation tube 14 has a two - position four - way valve 10 . the air port of the two main burner guns 9 in the heat accumulation type flame radiation tube 14 is connected with the main air supply pipe 20 and the main smoke venting pine 21 through the two - position four - way valve 10 that matches it . in each of the mentioned main burner gun 9 is set an ignition burner gun 3 . this ignition burner gun 3 has its own air supply pipe 4 and fuel transporting pipe 6 , independent of the main burner gun 9 . an electromagnetic control valve 5 is set on the fuel transporting pipe 6 . the ignition burner gun 3 takes natural gas , or town gas or liquefied petroleum gas as fuel . in each of ignition burner gun 3 is set an electronic ignition gun 1 and a flame detecting sensor 2 . this flame detecting sensor 2 can be an ion type ( is ) or ultraviolet type ( uv ). in each heating zone of the upper and lower furnace bodies , a thermocouple 17 is set respectively to detect temperature in each heating zone . co 2 gas sensors 12 are set in the upper and lower furnace bodies . an air - flow control valve 11 is set between each two - position four - way valve 10 and the main air supply pipe 20 respectively . this air - flow control valve 11 is interlinked with proportion regulation valve 22 by a connection - rod ( not shown in the diagram ). in the main smoke venting pipe 21 is set a thermocouple 17 ( not shown in the diagram ), and in the general fuel transporting pipe 24 is set a flow meter ( not shown in the diagram ). after air - flow control valve 11 is connected with proportion regulation valve 22 by a connecting - rod , the quantity of fuel supply and the quantity of combustion - supporting air can be kept in a proper proportion during combustion of each main burner gun 9 so as to ensure normal work of main burner gun 9 . existing products are used for proportion regulation valve 22 and air - flow control valve 11 , and both can be connected with other method for interlink . co 2 gas sensor 12 set in the upper and lower furnace bodies is used for detection of content of co 2 gas inside the furnace body . in normal condition , co 2 gas is kept in a stable concentration . when any radiation tube 23 is broken , the exhaust gas inside it leaks to the inner furnace body , at this time , concentration of co 2 gas in the furnace body exceeds normal range . therefore , co 2 gas sensor 12 can be used to detect whether any radiation tube 23 is broken inside the furnace body . temperature detection thermocouple 17 is set in each heating zone in the upper and lower furnace bodies respectively , so that temperature distribution inside of the furnace body can be measured in real time so as to provide basis for control of the heating temperature inside the furnace body and for adjustment of temperature in each heating zone . after a flow meter is set on the main fuel transporting pipe 24 , fuel consumption in the furnace can be found out in time . thermocouple 17 is set in the main smoke venting pipe 21 , so that energy saving of the furnace can be evaluated by measuring temperature of the venting smoke . radiation tube 23 can be in w shape or in u shape or straight , and other shapes . the radiation tubes are made of refractory steel . they are installed in the upper and lower furnace bodies . when the furnace according to the invention is working , the control device ( not shown in the diagram ) composed of plc programmable controller controls each heat accumulation type flame radiation tube and each two - position four - way valve according to the set programs . first , electromagnetic control valve 5 works , fuel gas is sent to ignition burner gun 3 inside each main burner gun 9 though pipe 6 , meanwhile , air is sent to pipe 4 . ignition gun 1 ignites ignition burner gun 3 . after ignition burner gun 3 is ignited , it keeps in combustion position during the whole operation of the furnace . as soon as ignition burner gun 3 is ignited , flame detection sensor 2 send detected signals to the control device , which shows ignition burner gun 3 works normally . during the furnace is in operation , once flame detection sensor 2 has not detected flame of ignition burner gun 3 , the control device will shut off electromagnetic control valve 5 and cut off fuel supply at once to ensure safety of the furnace . after ignition burner gun 3 is ignited , two - position four - way valve 10 connects main air supply pipe 20 and a main burner gun 9 in the heat accumulation type flame radiation tube 14 at down - stream , and connects the main smoke venting pipe 21 and another main burner gun 9 in the same radiation pipe 14 ; at this time , the safety electromagnetic valve 7 on fuel transporting pipe 8 of the main burner gun 9 connected with main air supply pipe 20 works , fuel is sent into the main burner gun 9 and is ignited by ignition burner gun 3 ; flame of the main burner gun 9 after ignited enters radiation pipe 23 to heat glass sheet 15 inside the furnace body via radiation pipe 23 , the exhaust gas after combustion flows to another main burner gun 9 along radiation pipe 23 , and enters main smoke venting pipe 21 through the air port of main burner gun 9 and two - position four - way valve 10 ; after one main burner gun 9 has burned for a proper period , two - position four - way valve 10 begin to act under control of the control device to make the connection mode of the two main burner guns 9 with the main air supply pipe 20 and the main smoke venting pipe 21 switch over , the original burning main burner guns 9 stops burning and connects with main smoke venting pipe 21 using as smoke flue , the main burner guns 9 originally connecting with main smoke venting pipe 21 is switched over and connects with main air supply pipe 20 , and begins to burn after it is ignited by ignition burner gun 3 ; circulating like this . when high - temperature exhaust gas after combustion is passing main burner guns 9 used as smoke flue , the high - temperature exhaust gas exchanges heat with heat accumulator 19 in main burner guns 9 , heat accumulator 19 is heated , and exhaust gas after waste heat is absorbed vents into main smoke venting pipe 21 . after heat accumulator 19 in main burner guns 9 is heated , when the main burner guns 9 turns into burning working mode , the combustion supporting air and fuel that has been sent to main burner guns 9 is pre - heated by heat accumulator 19 , then begins to burn , so that the flame burning temperature is increased . when each heat accumulation type of flame radiation tube in the upper and lower furnace bodies is working , thermocouple 17 in the furnace body detects temperature of each heating zone in real time . when temperature in a certain zone is abnormal , the control device can regulate temperature of the zone in time by adjusting quantity of fuel supply to the heat accumulation type of flame radiation tube in the zone . when the control device finds that the concentration of co 2 gas is abnormal according to the detected result of co 2 gas sensor 12 , it will stop operation in time to ensure the safety of operators . this invention — a new type of glass sheet heating furnace can also be made in vertical type according to the requirement . glass sheet goes in and out of the furnace with help of a suspension transportation mechanism . at this time , it only needs to set accumulation type of flame radiation tubes on both sides of the glass sheet in the furnace vertically . what is shown in the diagram is only one execution manner of this invention , and does not play any role of limiting the protective range of this invention . accordingly , all suitable modifications and equivalents may be resorted to fall within the scope of the invention . | 2 |
as required , detailed aspects of the present invention are disclosed herein , however , it is to be understood that the disclosed aspects are merely exemplary of the invention , which may be embodied in various forms . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative basis for teaching one skilled in the art how to variously employ the present invention in virtually any appropriately detailed structure . certain terminology will be used in the following description for convenience in reference only and will not be limiting . for example , up , down , front , back , right and left refer to the invention as orientated in the view being referred to . the words , “ inwardly ” and “ outwardly ” refer to directions toward and away from , respectively , the geometric center of the aspect being described and designated parts thereof . forwardly and rearwardly are generally in reference to the direction of travel , if appropriate . said terminology will include the words specifically mentioned , derivatives thereof and words of similar meaning . referring to the figures , fig1 shows a preferred embodiment organic waste container system 2 in a preferred environment stored within a shelf 11 of a refrigerator door 10 . generally , the container consists of a base bin 4 , a lid 6 , and an optional disposal liner 8 placed within the interior of the base bin 4 . fig2 - 3 show the base bin 4 including divider guides 16 for receiving a divider 14 which allows the bin 4 to be divided into separate chambers for separating out different types of waste ( e . g . compostable vs . non - compostable waste ). a clip 12 clips onto the divider 14 and helps to secure the liner bag 8 within each chamber . fig4 - 5 show the present invention without the divider 14 in use . fig6 shows an embodiment of the present invention where a second bin 18 is stacked atop the original bin 4 . the base bin 4 includes a top portion 20 which receives the inner lip 21 of the lid 6 or a hollow base 22 of the second bin 18 . the second bin 18 similarly includes a top portion 24 for receiving the lid 6 or other bins . this could allow for the stacking of multiple bins . fig9 shows handle indents 7 within the lid 6 which make it easier for the user to remove the lid 6 from the base bin 4 . alternatively , the bin and the lid could be designed such that the lid fits within the bin , the lid having a lip around its top edge which prevents the lid from fully entering the bin . an embodiment of the present invention could include gaskets about the top portion 20 of the base bin 4 for aiding in sealing the bin with the lid . an embodiment of the present invention may also include a magnet located within the top portion 20 of the base bin and a corresponding magnet within the lid 6 and / or the hollow base 22 of the second bin 18 , which further helps to seal the interior of the bin . the top portion 24 of the second bin 18 may also include such a magnet feature . a compacting tool may be included to gently compress the organic material and allow for maximum use of the available space in the container . the compacting tool would be designed to be small enough to be used within the chambers of the bin 4 allowing for the materials to be tamped down . the lid 6 could include a smaller hinged inset lid that allows for organic material to be placed within the bin by lifting the smaller hinged lid while the container remains in the refrigerator . a replaceable carbon filter may also be included in the system . a handle may also be included to allow the bin to be transported and emptied easily . there could be multiple sets of divider guides 16 within the interior of the bin , allowing the bin to be divided into three or more compartments , or to adjust the comparative size of the divided compartments . all elements of the present invention would be dishwasher safe , or easily cleanable with soap and water . the organic waste container system 2 would be placed in the kitchen while organic products are being used . any organic waste would be placed within the bin 4 . the lid 6 would then be placed on the bin , and the bin would be placed in the shelf 11 of the refrigerator door 10 . the cooler temperature of the refrigerator will prevent the organic waste from decomposing , thereby preventing odors from forming and escaping the bin . the various elements of the bin ( e . g . the gasket around the upper portion 20 of the bin 4 ) would further aid in sealing the bin to prevent odors from escaping . further optional elements include corresponding magnets placed in each of the upper portion 20 of the bin 4 and in the lid 6 . the magnets provide additional sealing of the lid against the bin by magnetically holding the lid in place and requiring additional force to remove the lid . the lid 6 may optionally include an inset opening which is connected to the lid via a hinge or other element . this inset allows the user access to the internal space of the bin while the container system 2 is located within the refrigerator door 10 without requiring the entire lid 6 to be removed or the entire container system 2 to be removed from the refrigerator . the container system 2 may also include a handle located on a side of the bin 4 for allowing easy carrying of the system between the kitchen and the refrigerator door . a replaceable carbon filter may be implemented to further reduce odors from escaping the container system . it is to be understood that while certain embodiments and / or aspects of the invention have been shown and described , the invention is not limited thereto and encompasses various other embodiments and aspects . | 1 |
referring now to the drawings , wherein like reference numerals indicate identical or corresponding parts throughout the respective views , and more particularly to fig2 and 3 thereof , there is illustrated in front and side views , respectively , a preferred embodiment of a carcass splitting machine according to the present invention . the preferred embodiment of the invention includes a frame which forms a substantially rectangular solid . the frame includes forward vertical frame members 10 and 12 , and rear vertical frame members 14 and 16 , which are mutually parallel . the vertical frame members 10 , 12 , 14 and 16 are connected at their lower ends by lower horizontal frame members 18 and 20 . although four such lower horizontal frame members are provided for , only two are illustrated in these drawings . the vertical frame members 10 , 12 , 14 and 16 are interconnected at their upper ends by upper horizontal frame members 22 , 24 , 26 and 28 which are best illustrated in fig1 . extending between the front and rear upper horizontal frame members 22 and 26 and between and parallel to the side upper horizontal frame members 24 and 28 are a pair of additional upper horizontal frame members 30 and 32 . the entire frame structure may be bolted or otherwise secured to the floor f of a slaughterhouse by means of , for example , brackets 34 and 36 ( fig3 ). mounted on top of upper horizontal frame members 28 and 30 is a horizontal support plate 38 upon which is mounted a reversible motor 40 which is connected to a suitable power source and control ( not shown ). although but a single reversible motor 40 is illustrated , it should be understood that same may be replaced by a pair of motors . as illustrated more particularly in fig2 extending downwardly from the underside of plate 38 is an elongated vertical support 42 which is positioned parallel to and spaced from a similar elongated vertical support 44 , the latter of which is secured to the underside of upper horizontal frame member 32 . vertical supports 42 and 44 have connected at their lower ends a horizontal guide rail 46 which is adapted to be placed within a cut away section of a slaughterhouse guide rail , represented by end portions 72 and 74 . a plurality of carcass carriers 48 , 50 , 52 and 54 are adapted to be moved along guide rails 72 , 46 and 74 so as to move carcasses c1 and c2 through the frame of the present invention . each of the carcass carriers include a hook 56 , 58 , 60 and 62 extending from the lower portion thereof , and a set of double rollers 64 , 66 , 68 and 70 for riding over the rails 72 , 46 and 74 . the end of rail 72 adjacent to guide rail 46 is supported by an additional vertical support member 76 ( fig3 ) which is secured to the underside of the upper horizontal frame member 28 by a pair of bolted brackets 78 and 80 . to the lower end of vertical support 76 is connected a bowed member 82 for accommodating the rollers 64 of carcass carrier 48 . a similar additional support ( not shown ) is also provided for the end of rail 74 which is adjacent the distal end of rail 46 . this additional support is connected to the underside of upper horizontal frame member 24 . referring back to fig2 the guide rail 46 is seen to include a pair of small , arcuate depressions 84 and 86 which serve as positioning means for the rollers of the carcass carriers . for example , as illustrated in fig2 rollers 66 and 68 have come to rest in depressions 84 and 86 , respectively , which enables carcasses c1 and c2 to be properly stationarily positioned with respect to the band saw cutting means , in a manner to be described in more detail hereinafter . fig2 also clearly illustrates a pair of gaps 88 and 90 between the adjacent ends of aligned guide rails 72 , 46 and 74 to permit passage of the band saw therebetween , to be described in more detail below . the reversible motor 40 stationarily mounted on the support plate 38 controls the upward and downward movement of a band saw cutting means which is indicated generally by reference numeral 92 . as clearly illustrated in fig4 the band saw cutting means 92 includes an endless band saw 94 which is disposed about four rectangularly positioned pulleys 96 , 98 , 100 and 102 . pulleys 96 and 98 are mounted on a front movable band saw support 104 , while pulleys 100 and 102 are mounted near the respective ends of a rear movable band saw support 106 . at the end of front and rear supports 104 and 106 are positioned four roller bearing assemblies 110 , 112 , 114 and 116 for permitting vertical movement of the band saw cutting means 92 along the vertical frame members 10 , 12 , 14 and 16 . each of the roller bearing assemblies 110 , 112 , 114 and 116 are of substantially identical construction . for example , bearing assembly 110 includes a pair of support plates 118 and 120 which support three shafts 122 , 123 and 124 therebetween . mounted on the shafts 122 , 123 and 124 are three rollers 126 , 127 and 128 ( see also fig2 ) which form a roller bearing for the end of support 104 about vertical frame member 10 . secured to the front band saw support 104 is a band saw drive motor 130 which is coupled to a drive pulley 98 via a drive belt 132 , which is preferably enclosed . secured to the rear band saw support 106 is a saw blade tensioner indicated generally by reference numeral 134 . saw blade tensioner 134 includes an outer roller 136 for contacting the saw blade 94 . roller 136 may be adjusted outwardly or inwardly by means of a threaded shaft 138 controlled by a knob 140 , the entire apparatus being secured to support 106 by a mounting bracket 142 . associated with the diagonally opposite roller bearing assemblies 110 and 116 are a pair of carcass stabilizer assemblies indicated generally by reference numerals 144 and 146 . the carcass stabilizer assemblies 144 and 146 are designed to hold the carcasses c1 and c2 in proper position against the force exerted by the band saw blade 94 during operation . the stabilizer assemblies 144 and 146 are substantially identical in construction , and stabilizer 144 is seen to include an elongated guide arm 148 which extends through and is supported by a guide 150 that is connected to the horizontal support post 104 . at the forward end of arm 148 is mounted an upper support 152 ( fig3 and 4 ) from the forward portion of which extends a curved , bifurcated finger support 154 through which blade 94 passes in operation and against the forward surface of which the carcass c1 being split is positioned . assembly 146 stabilizes carcass c2 in substantially the same manner . the manner of moving the band saw cutting means 92 vertically will now be set forth with reference to fig1 and 3 . the output of the reversible motor 40 is coupled to a gearbox 156 by means of a belt , cable , chain or like drive device 158 . box 156 turns a shaft 160 upon which are mounted a pair of sprocket wheels 162 and 164 . the sprocket wheels 162 and 164 respectively drive a pair of chains 166 and 168 . chain 166 in turn drives a sprocket wheel 170 which is connected to one end of a shaft 172 which is supported on top of upper horizontal frame member 22 by a pair of support bearings 175 and 177 . at the other end of shaft 172 is mounted sprocket wheel 174 , while a third sprocket wheel 176 is positioned adjacent sprocket wheel 170 . sprocket wheel 176 drives a chain 178 which is vertically disposed along vertical frame member 10 . to the lower end of frame member 10 is mounted a sprocket wheel 180 for receiving chain 178 . sprocket wheel 180 is mounted to frame member 10 by a mounting plate 182 . the vertically disposed drive chain 178 is fastened as at 184 to a bracket 186 which extends from the side of plate 118 of the roller bearing assembly 110 . clearly , as motor 40 is actuated , the motion is transmitted through chains 158 , 166 and 178 so as to move the roller bearing assembly 110 therewith . the sprocket wheel 174 mounted on the distal end of shaft 172 drives another vertically disposed chain 186 whose lower end is secured by a sprocket wheel 188 secured by mounting plate 190 to the lower portion of vertical frame member 12 . chain 186 is connected to roller bearing assembly 112 as at 192 in a fashion similar to that just described . the chain 168 driven off the sprocket wheel 164 from motor 40 operates in a similar , substantially simultaneous manner to control the vertical movement of the roller bearing assemblies 114 and 116 . more particularly , chain 168 drives a sprocket wheel 194 which is secured to a shaft 200 for rotating same . also disposed on shaft 200 are a pair of sprocket wheels 195 and 202 for respectively driving a pair of vertical chains , chain 198 being illustrated in fig3 . a cooperating sprocket 194 is mounted to the lower portion of vertical frame member 14 . chain 198 is connected to roller bearing assembly 114 as at 204 . in operation , the motor 40 is initially actuated to bring the band saw cutting assembly 92 to its uppermost position where it lies above guide rails 72 , 46 and 74 . either one or two carcasses c1 and c2 are then rolled to the appropriate position within the frame , defined by depressions 84 and 86 , by means of the carcass roller carriers 48 , 50 , 52 and 54 . the drive motor 130 for the band saw 94 is then actuated , and motor 40 is then operated to lower the assembly 92 . as may be appreciated from fig2 and 4 , the portions 94 1 and 94 2 of the band saw 94 are disposed in perfect alignment with the center of the carcasses c1 and c2 . as the assembly 92 moves downwardly to intersect the carcasses c1 and c2 , the stabilizing assemblies 144 and 146 are moved into contact with the respective carcasses , and the same are split substantially simultaneously , and perfectly down the middle . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . for example , while roller bearings have been illustrated as the means for moving the cutting assembly vertically on the frame , clearly equivalent structures , such as cogs , sleeved posts , and the like , may be used . equivalent forms of power , such as hydraulic pressure or the like , may be substituted for the electric motors , and the chain drive may be replaced with steel ropes or the like . it is therefore to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described herein . | 8 |
a thermosensitive composition switching from a water soluble state to an insoluble state is based on the reaction between a water soluble polymer and a metallic salt of a long chained fatty acid . the length of carbon chain of the fatty acid is critical . short fatty acid salts are too reactive , and will react with the water soluble polymer at room temperature . very long fatty acids will not react at all . the invention requires a composition which has a long shelf life at room temperature ( up to years ) while reacting in a few millionths of a second at temperatures of a few hundred degrees celsius . the requirement for very fast reaction time at elevated temperatures stems from the need to imagewise expose a thin layer of the composition using a focused laser beam . the small size of the laser beam , typically 2 - 20 microns , causes the dwell time of the beam on any given spot to be extremely brief , in the range of 0 . 2 - 5 microseconds . it was found out that only fatty acids with a carbon chain length from about 18 to 24 carbon atoms perform well . the rate of reaction at a given temperature can also be modified by the molecular weight of the water soluble polymer as well as by adding other polymers to the composition . the ratio of the ingredients also affects the rate of the reaction . these effects are secondary compared to the dominant effect of the carbon chain length of the fatty acid . the best results were obtained by using polyacrylic acid as the water soluble polymer and silver behenate as the metallic salt of the fatty acid , with polyvinyl butyral as a modifying polymer . the modifying polymer controls the degree of water solubility of unexposed areas as well as the resistance to etchants of the exposed area . the phrase &# 34 ; water solubility &# 34 ; does not only refer to solubility in pure water but in many aqueous solutions , as long as they are not sufficiently active to change the composition . the term &# 34 ; water solubility &# 34 ; in the context of this invention should be interpreted as solubility in the water based developers which contain alkaline solutions as well as solubility in detergent and in plain water . in general , this invention requires , by far , less chemicals added to the water used to wash away the unexposed areas than existing photoresists . as the case is for any solvent , the solubility is also strongly affected by temperature . the uniqueness of the invention lies in the very sharp switching of the solubility found in this reaction and the versatility of the reaction due to its high tolerance to additives . this high tolerance allows it to tailor the properties of the composition by adding relatively large amounts of other polymers and additives such as absorbers , surfactants and adhesion promoters . in the following examples the solvent used is ethanol , but other solvents can be used as well . the solvent fully evaporates after application of the composition , thus is not part of the reaction . different solvents , such as ethanol / water mixes or pure water can be used . in most applications , the composition is applied by dip coating , roller coating , knife coating or spraying to a thickness of 0 . 5 - 5 microns . in order to absorb sufficient amounts of laser power in such a thin layer , a strong absorber is required , as the composition is non - absorbent in the visible or ir part of the spectrum . many dyes and pigments were tested and the composition works with all of them . the best performing absorbers for the near ir were ir dye ads830 made by american dye source ( n . j . ); lamplack carbon powder from fisher scientific supplies and ws830 from zeneca ( u . k . ), which is a water soluble ir dye . in all the following examples the word &# 34 ; ir absorber &# 34 ; should be interpreted as one of these absorbers . the invention , of course , is not limited to any absorber and works well even without an absorbent if the heat is applied directly by conduction or convention instead of by radiation . by the way of example , the composition can be used without an absorbent if it is coated onto a substrate which absorbs the laser radiation , heating up the coated layer by conduction . another application where an absorber is not required is when the heat is applied by an array of resistive elements , similar to thermographic paper . the versatility of the invention is illustrated by the following examples . as is the case for all thermosensitive compositions , it is sometimes desired to add an indicator dye permanently changing color with temperature , to generate a visible image of the imagewise exposed areas for the purpose of verification . one manner of creating a more visible image using the present invention is the use of a reducing agent to reduce the silver behenate to metallic silver , creating a dark image of the exposed areas . such reduction of silver behenate to produce a visible image is disclosed in u . s . pat . nos . 3 , 168 , 864 and 3 , 103 , 881 and need not be detailed here . note that while these prior art compositions use silver behenate , they use it to form the visible image and not as the key for the solubility switching . a dry sample of silver behenate is mixed with ethanol and a 7 % solution of polyacrylic acid . it is ball milled for 24 hours using 12 mm balls . if carbon absorber is used ( example 1a ), it is mixed with the above ingredients before ball milling . if an ir dye is used ( example 1b ), it is mixed only after ball milling due to the short shelf like of the ir dye . the quantities are as follows : 1 gram polyacrylic acid ( 14 . 3 grams of 7 % solution , available from scientific polymer products , n . y .) note : the polyacrylic acid has a typical molecular weight of 450 , 000 . a copper clad inner layer of a multi - layer printed circuit board is coated by dipping into the solution and air drying . dry thickness of the coating is about 1 . 5 microns . copper thickness is about 30 microns . it is exposed with a creo products inc . ( b . c ., canada ) trendsetter ® thermal platesetter at an energy of 600 mj / cm 2 , wavelength of 830 nm and resolution of 3200 dpi . after exposure the plate is washed with warm water using very light scrubbing to remove the unexposed area and with an fecl 3 solution at 60 ° c . for two minutes . clean etching was achieved . after etching , the thermoresist is stripped with a commercial photoresist stripper , using alkaline stripping solution . same as example 1a - 1b with the addition of 1 gram of polyvinyl butyral ( 14 . 3 grams of a 7 % solution , material available from the monsanto corp ., st . louis , miss ., type b72 ). material is coated and exposed under same conditions as in example 1a - 1b . this formulation is more resistant to alkaline etchants , such as warm nh 4 oh based etchants . the disadvantage of 2a - 2b over 1a - 1b is that the unexposed areas are more difficult to wash off . the formulation of 2a - 2b withstood a commercial nh 4 oh based acid ( mcdermid metex ®) better than example 1a - 1b . same as example 1a - 1b , but the ratio of polyacrylic acid to silver behenate is changed to increase solubility of the unexposed areas . the ratio is : in this example the solubility of the unexposed area is greater than example 1a - 1b , without significantly affecting the insolubility of the heated areas . the higher solubility enables the use of the plain water to wash away the unheated areas . it can also be used without requiring an intermediate step of washing by using the water based etchant to wash away the unexposed areas . it was etched with fecl 3 , at 60 ° c . without washing the unexposed areas using agitation of the etchant . this is prepared in the same manner as example 1a - 1b , but without using any solvent except water . the ratio is : 4 grams 25 % solution of polyacrylic acid in water , molecular weight of about 240 , 000 ( goodrich k702 ) 1 gram zeneca ws830 water soluble dye ( from zeneca specialty chemicals , uk ) this is used as in example 1a - 1b . the no solvent , all waterborne process , is important for environmental considerations as well as cost savings since a water solution of polyacrylic acid is significantly lower in cost than purified acid . same as example 4 except for sodium salt of polyacrylic acid ( molecular weight about 5800 ) is used instead of polyacrylic acid . same as example 1a - 1b except iron stearate is used instead of silver behenate . reaction is similar but performance is lower , with solubility change not as robust as achieved in example 1a - 1b . having described the present invention , with reference to those specified embodiments , it is understood that numerous variations can be made without departing from the spirit of the invention and it is intended to encompass such reasonable variations or equivalents within its scope . | 6 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to like elements throughout . the method and installation will be explained on the basis of a handover process and with reference to a geran system , with the individual components of the geran system being connected by an ip network . the method and installation are in fact suitable for such passing on of packet - based data on the basis of the internet protocol , since data packets can be duplicated there in a simple manner , as is proposed for method and installation . in the following text , the expression transmitting / receiving device means the system of a base station controller bsc . for simplicity reasons , no further description will be provided in the following text of the fact that such a base station controller bsc still requires specific devices , which are referred to as base stations bs and which carry out the actual antenna functions , for transmitting and receiving data . where the expression base station controller bsc is used in the following text , this presupposes the presence of corresponding base stations which are connected to that base station controller , so that these are also included in the descriptions of a base station controller bsc without needing to be exclusively mentioned . fig1 in this case shows the sequences during the handover process ho , which relate to the subscriber data , that is to say to the data which is transmitted from and to the subscriber . the handover process in this case has at least three phases , and a fourth phase may optionally be added . the illustrated sequences shown in fig1 assume that a duplicator for duplicating ip packets resides in a source base station controller bsc source and not , as is in principle likewise possible , in the core network cn or in a serving gprs support node sgsn . this source base station controller bsc source in the situation shown in fig1 is connected to transmitting / receiving devices ( bs ) in a cell of the mobile radio system in which a specific subscriber terminal ms is currently located . in principle , a base station controller such as this may be connected to a plurality of transmitting / receiving devices in a plurality of cells . phase 1 relates to the situation before the handover ho . the base station controller bsc source which is responsible at that time for supplying a mobile subscriber terminal ms — that is to say for controlling and maintaining the communication link to a subscriber terminal — identifies the need for a handover for this subscriber terminal ms . the data within the communications connection is still being passed directly between the core network cn and the subscriber terminal ms via the base station controller bsc source , as is indicated by the corresponding double arrows . however , at this point , the supplying base station controller bsc starts to exchange signaling data with that base station controller bsc target which is intended to provide the supply for that subscriber terminal in the future , for example relating to the provision of transmission capacities ( resource allocation ) as likewise indicated by double arrows . in phase 2 , the subscriber data is duplicated in the downlink direction from the core network cn to the subscriber terminal ms in the supplying base station control bsc source , and is passed firstly to the currently supplying cell in the mobile radio system and secondly also to the base station controller bsc target , which is intended to supply the subscriber terminal ms once a handover ho has taken place . in the uplink direction from the subscriber terminal ms to the core network cn , the data which is transmitted by the subscriber terminal may possibly be received by both base station controllers . in this case , a selection must be made from the data received by the two base station controllers bsc source and bsc target in order on the one hand to ensure that the data is not transmitted twice but that , nevertheless , all the data is passed to the core network cn . during phase 2 , the subscriber terminal ms also completes the actual change from the previous base station controller bsc source to the new base station controller bsc target , with this process being controlled by the mobile radio system and by the base station controller bsc source . the base station controller bsc target which now has the responsibility detects the subscriber terminal ms and takes over the task of maintaining the communications connection to that subscriber terminal . during phase 3 , the transmission capacities of the previous base station controller bsc source and of the previously supplying cell are released again , thus clearing the communications connection to the subscriber terminal . however , the subscriber data is still passed on within the mobile radio network from the base station controller bsc target which is now providing the supply , via the previously supplying base station controller bsc source , to the core network cn , and vice versa . this is once again indicated in the figure by double arrows . provided that there is no further requirement or no further possible way to optimize the data flow in the mobile radio network , phase 3 may be the final phase of the handover , for example if only one intra - bsc handover has taken place and bsc source and bsc target are thus identical , or there is no direct data connection between the base station controller bsc target and the core network cn or if , contrary to the previous assumptions , provision has been made for the duplication of the subscriber data to be carried out directly in the core network cn rather than in a base station controller bsc source . however , if it is necessary or else possible to optimize the data flow , phase 4 is carried out , in which the data stream is no longer passed via the previous base station controller bsc source , with the subscriber data now instead of this being interchanged directly between the core network cn and base station controller bsc target which now supplies the subscriber terminal ms . fig2 shows the sequence for signaling during the handover ho as illustrated in fig1 . in particular , fig2 also shows which of the signaling commands are interchanged in which of the phases 1 to 4 . the individual signaling steps are numbered successively from 1 to 12 in brackets , and these individual steps will be explained in the following text . ( 1 ) the base station controller bsc source which is currently supplying the subscriber terminal ms identifies the need for a handover and sends a request for a handover ( ho request message ) ho req to the base station controller bsc target which is intended to supply the subscriber terminal ms in the future . this message ho req may either be passed directly from the base station controller bsc source to the base station controller bsc target , or may be passed via the core network cn to the base station controller bsc target , without the core network cn carrying out any further processing on this message . the message ho req contains all the information about all the radio resources ( channels ) which have been requested by the base station controller bsc target for the subscriber terminal to be supplied . the information in the ho req message allows the base station controller bsc target to produce a map of the configuration of the radio link control ( rlc ) buffer ( control data for the communications connection ). ( 2 ) as soon as the base station controller bsc target receives the message ho req , it checks the available transmission capacities . provided that sufficient transmission capacities are available , these are reserved for the connection that is to be set up to the subscriber terminal ms . ( 3 ) the base station controller bsc target responds to the message ho req from the base station controller bsc source with the acknowledgement message ho request acknowledge ho req ack . this message contains a complete description of the transmission capacities ( which will be described in step ( 5 )) which have been reserved by the base station controller bsc target , as well as additional information which is required for duplication or selection of subscriber data in the next step ( 4 ). ( 4 ) the base station controller bsc source receives the message ho req ack and initiates the duplication of the subscriber data in the downlink direction , for example the duplication of u - gtp packets , at the ip level . the ip data stream , which is characterized by an appropriate ip address and contains the data packets of a u - gtp data stream , is in the process readdressed in some suitable manner . in particular , provision is made to use the changed ip address to address a duplicator , which then carries out the rest of the duplication process . this ip address change ( rerouting ) is preferably carried out in a serving gprs support node sgsn . the further details of the duplication process will be explained in the following text . in the uplink direction , in order to ensure selection of the subscriber data , it is possible to dispense with further operations , provided that devices in the mobile radio network such as the serving gprs support node sgsn in any case analyze the addressing data ( headers ) of the data which is sent by the subscriber terminal ms , allowing data selection to be carried out directly . however , if no such provision is made , appropriate selection of the subscriber data must be initiated in the uplink direction . ( 5 ) the process of duplicating the subscriber data in the downlink direction and the selection of the subscriber data in the uplink direction is now started at the ip packet level and is continued until the duplication function is canceled once again . ( 6 ) as soon as the duplication and selection processes have been set up completed , the actual handover ho of the subscriber terminal ms can be carried out . to do this , the base station controller bsc source transmits the handover command ho cmd to the subscriber terminal , and at the same time transmits to the base station controller bsc target the message ho cmd info that the command ho cmd has been sent . the handover command ho cmd informs the subscriber terminal ms of the transmission channels to which it must change for the cell which will supply it in the future , in order to continue to maintain the communications connection . ( 7 ) the message ho cmd info informs the base station controller bsc target for the downlink direction of the data packets ( radio link control rlc packets ) which have already been sent and , if a reception confirmation is provided , of which data packets have already been confirmed . for the uplink direction , this message contains those data packets ( rlc packets ) which have admittedly already been received by the base station controller bsc source but have not yet been passed on at the pdcp packet data level , that is to say those parts of that pdcp data packet which are currently being sent by the subscriber terminal . the ho cmd info message contains this information for all the radio link control rlc transmission capacities which have been allocated to a specific subscriber terminal . this operation is carried out as described in detail once again in the following text with reference to fig3 . ( 8 ) the successful setting up of the new radio link between the subscriber terminal ms and the base station controller bsc target is reported to the base station controller bsc target by the subscriber terminal ms by a message to the effect that the handover has been carried out ( ho performed ) ho perf . ( 9 ) as soon as the subscriber terminal has successfully set up the radio link to the new cell which will now supply it , the base station controller bsc target can confirm reception of the message ho cmd info by transmitting the message ho command information acknowledge ho cmd info ack to the base station controller bsc source . ( 10 ) the message ho cmd info ack causes the base station controller bsc source to once again release the transmission channels which until this point were reserved for the radio link to the subscriber terminal , and also to once again release the corresponding radio link control rlc transmission capacities . ( 11 ) there is now no longer any need to duplicate the subscriber data in the downlink direction . this results in either the base station control bsc target or , as is illustrated in fig2 , the base station controller bsc source to stop the duplication ( duplication release ) of the subscriber data . in consequence , the ip address of the base station controller bsc target for the subscriber data stream ( u - gtp data stream ) in the downlink direction is selected , preferably by a serving gprs support node sgsn , instead of addressing a duplicator , as provided by way of example in ( 4 ). ( 12 ) this may now be followed by the optional phase 4 , during which the data flow between the core network cn and the base station controller bsc target can be optimized . fig3 shows a more detailed overview of the operations described above . this illustrates the processing of the subscriber data in the uplink direction and in the downlink direction in a more comprehensive manner . fig3 illustrates this on the basis of only one connection channel ( that is to say of only one rlc transmission unit ) per transmission direction but , in principle , a plurality of connection channels may also , of course , be provided for each transmission direction . the numbers 1 ) and 2 ) etc . refer to the different phases or steps in the method procedure , and will be described in detail in the following text . the procedures annotated 1 ) represent the stream of subscriber data ( in this case ip packets which contain u - gtp packets ) in the direction of the subscriber terminal ms and originating from the subscriber terminal ms , without there being any duplication or selection of the subscriber data . this therefore corresponds to phase 1 , as mentioned above . 2 ) denotes the rlc and pdcp transmission units which must be produced in the target cell or in that base station controller bsc target which will supply the subscriber terminal ms after the handover when the base station controller bsc target responds with the message ho req ack . these rlc and pdcp transmission units must be identical to the corresponding units in the source cell or in the base station controller bsc source which were originally supplying the subscriber terminal ms before the handover . 3 ) denotes the process of carrying out the duplication or selection of the subscriber data , which the base station controller bsc source initiates after receiving the message ho req ack . the duplication allows all the subscriber data , in this case ip packets , which has been sent in the downlink direction to be sent not only to the base station controller bsc source but also to the base station controller bsc target . this duplication is based in particular on the numbering of the u - gtp data packets . this numbering is necessary for the further processing of the data packets in the base station controllers bsc source and bsc target ( in this context , see the numbers 4 ) and 5 )), in order that the base station controllers bsc source and bsc target contain the same information on which pdcp data packet is currently being processed , and in particular is being segmented , in the rlc data buffer ( rlc buffer ). the selection of the subscriber data simply means that subscriber data packets , in this case u - gtp data packets , can be received both by the base station controller bsc source and by the base station controller bsc target , and can be passed on in the uplink direction . in principle , data packets may in this case be received twice , and half of the packets which are being received twice must then be sorted out . however , if duplicated reception is precluded , as is assumed in geran systems , then there is no need for any such sorting out process . all that is then necessary is to ensure that those parts of the subscriber data which are received by both the base station controllers bsc source and bsc target are joined together in the correct sequence . numbers 4 ) and 5 ) show the procedures which take place once the duplication and selection process as indicated by number 3 ) have been set up successfully . the base station bsc source can then cause the subscriber terminal ms to change from the source cell to the target cell , and this is done by transmitting the command ho cmd . at the same time that the command ho cmd is transmitted , the notification ho cmd info is transmitted to the base station controller bsc target . this message ho cmd info is indicated by the dashed arrows numbered 4 ) and 5 ). in this case , the arrow numbered 4 ) means in particular that the base station controller bsc source sends the base station controller bsc target a bit pattern which represents the status “ sent ” or “ acknowledged ” for the rlc data buffer ( rlc buffer ) for that pdcp data packet which is currently being sent . the arrow numbered 4 ) also represents information on which pdcp data packet is currently being sent . however , since it is possible after this to combine a plurality of u - gtp data streams in one pdcp data stream by multiplexing , it may be worthwhile transmitting the number of u - gtp data packets or data packets which is or are currently being sent to the base station controller bsc target , in addition to or instead of the number of the pdcp data packet which is currently being sent . the dashed arrow numbered 5 ) means that rlc data packets which have already been received by the base station controller bsc source from a pdcp data packet which has not yet been received completely are transmitted to the rlc data buffer ( rlc buffer ) for the uplink direction for the base station controller bsc target in order that the pdcp data packet can be completely filled there with the rlc data packets that are still missing . this avoids the necessity for the subscriber terminal ms to repeat the transmission of the data packets which have been received by the base station controller bsc source . the information received on the basis of numbers 4 ) and 5 ) allows the base station controller bsc target to take over the task of sending those rlc data packets which have not yet been sent or acknowledged in the downward direction , since the base station controller now has a map of the rlc data buffer of the base station controller bsc target . on the other hand , the base station controller bsc target can now acknowledge , in the case of data transmission , with an acknowledgement in the uplink direction those rlc data packets which have already been received by the base station controller bsc target in the uplink direction . as soon as a pdcp data packet which has not yet been received completely by the base station controller bsc source can be completed by the base station controller bsc target receiving the missing rlc data packets , the pdcp data packet can be sent as a u - gtp data packet to the core network cn , with the aid of the selection function which has been set up at number 3 ). fig4 shows the logical functions in the duplication process . in this case , two fundamental options are feasible : 1 ) a purely ip - based solution , with a specific ip address ( in particular the ip address of a duplicator ) which is used for addressing by the core network cn or , specifically , by a serving gprs support node sgsn itself in turn indicating two further ip addresses to which the corresponding ip data packets should be passed . in this context , fig4 first of all shows the data flow from the serving gprs support node sgsn to the base station controller bsc source with the ip address 0 . 0 . 0 . 2 during the already described phase 1 , then the duplication process which is initiated by the base station controller bsc source in phase 2 by addressing a duplicator by a corresponding change to the ip addresses of the ip data packets in the serving gprs support node sgsn to the ip address 0 . 0 . 0 . 4 of the duplicator , with the duplicator now passing the ip data packets both to the base station controller bsc source with the ip address 0 . 0 . 0 . 2 and to the base station controller bsc target with the ip address 0 . 0 . 0 . 3 . after completion of the duplication process as already described , the ip data packets are now in phase 3 or 4 sent only from the serving gprs support node sgsn directly to the base station controller bsc target with the ip address 0 . 0 . 0 . 3 . the advantage of this solution is that it can be set up in a simple manner . no additional processing of the addressing data ( headers ) in the u - gtp data packets is required . furthermore , the level of signaling complexity for this solution is very low , since the duplicator need not be configured separately for each transmission channel . however , an adequate number of ip addresses must be provided , since each ip address of a duplicator represents two further ip addresses to which the ip packets should be passed during the duplication process . if not only the two base station controllers from fig4 but a third base station controller are now present , for example with the address 0 . 0 . 0 . 5 , and if handovers are intended to be possible between all three base station controllers , then three duplicators are required ( duplication on the basis of 0 . 0 . 0 . 2 and 0 . 0 . 0 . 3 , on the basis of 0 . 0 . 0 . 2 and 0 . 0 . 0 . 5 , and on the basis of 0 . 0 . 0 . 3 and 0 . 0 . 0 . 5 ) and , in a corresponding manner , three ip addresses must be provided for the duplicators . as the number of base station controllers increases , the number of duplicators and of their ip addresses also increases in a corresponding manner . 2 ) a mixed solution on an ip and u - gtp basis , with the duplication process being carried out at the u - gtp level rather than at the ip level . this is not shown in the figures . in this case , during phase 2 , the duplicator knows the u - gtp addresses of the u - gtp data packets and knows the destination to which the respective data packet should be passed . for this purpose , the duplicator receives ip data packets from the serving gprs support node sgsn , unpacks them , and reads the address data ( headers ) from the u - gtp data packets . depending on the address which is stated in the address data ( headers ) in the u - gtp data packets , the duplicator passes the corresponding u - gtp data packet via the two ip data links to the base station controllers bsc source and bsc target either only to one of the base station controllers or to both base station controllers . in principle , a plurality of base station controllers may also be provided here . only a single ip address is thus required for only a single duplicator which can duplicate the subscriber data to two base station conrollers even when more than two possible base station controllers are present as the destination . however , provision must be made for the duplicator to access the address data in the u - gtp packets and the duplicator must be adapted separately for each u - gtp data stream and whenever phase 2 of a handover is carried out , and the appropriately increased signaling complexity must be ensured for this purpose . the invention has been described in detail with particular reference to preferred embodiments thereof and examples , but it will be understood that variations and modifications can be effected within the spirit and scope of the invention . | 7 |
a prostaglandin ep 4 agonist is broadly defined as a compound which an ordinary person in the art reasonably believes agonizes a prostaglandin ep 4 receptor according to any one or more of numerous assays for determination of the ep 4 activity that are well known to those of ordinary skill in the art . while not intending to be limiting , one such assay is given in the example below . in one embodiment , the prostaglandin ep 4 agonist is selective for a prostaglandin ep 4 receptor relative to other prostaglandin receptor subtypes . in another embodiment , the prostaglandin ep 4 agonist is at least 10 times more active at the ep 4 receptor than at any other prostaglandin receptor subtype . in another embodiment , the prostaglandin ep 4 agonist is at least 100 times more active at the ep 4 receptor than at any other prostaglandin receptor subtype . in another embodiment , the prostaglandin ep 4 agonist is at least 1000 times more active at the ep 4 receptor than at any other prostaglandin receptor subtype . while not intending to be limiting , typical assays for the other receptor subtypes are also given in examples below . while not intending to limit the scope of the invention in any way , compounds according to the structures below are examples prostaglandin ep 4 agonists : a is —( ch 2 ) 6 —, cis — ch 2 ch ═ ch —( ch 2 ) 3 —, or — ch 2 c ≡ c —( ch 2 ) 3 —, wherein 1 or 2 carbon atoms may be substituted with s or o ; or a is —( ch 2 ) m — ar —( ch 2 ) o — wherein ar is interarylene or heterointerarylene , the sum of m and o is from 1 to 4 , and wherein one ch 2 may be substituted with s or o ; e is c 1 - 12 alkyl , r 2 , or — y — r 2 wherein y is ch 2 , s , or o , and r 2 is aryl or heteroaryl . in these structures , a dashed line represents the presence or absence of a bond . thus , a structure such as the one below , in relation to the identity of a disclosed in the chemical structures presented herein , in the broadest sense , a is —( ch 2 ) 6 —, cis — ch 2 ch ═ ch —( ch 2 ) 3 —, or — ch 2 c ≡ c —( ch 2 ) 3 —, wherein 1 or 2 carbon atoms may be substituted with s or o ; or a is —( ch 2 ) n — ar —( ch 2 ) o — wherein ar is interarylene or heterointerarylene , the sum of m and o is from 1 to 3 , and wherein one ch 2 may be substituted with s or o . while not intending to be limiting , a may be —( ch 2 ) 6 —, cis — ch 2 ch ═ ch —( ch 2 ) 3 —, or — ch 2 c ≡ c —( ch 2 ) 3 —. alternatively , a may be a group which is related to one of these three moieties in that any carbon is substituted with s and / or o . for example , while not intending to limit the scope of the invention in any way , a may be an s substituted moiety such as one of the following or the like . alternatively , while not intending to limit the scope of the invention in any way , a may be an o substituted moiety such as one of the following or the like . alternatively , while not intending to limit the scope of the invention in any way , a may have both an o and an s substituted into the chain , such as one of the following or the like . alternatively , while not intending to limit the scope of the invention in any way , in certain embodiments a is —( ch 2 ) n — ar —( ch 2 ) o — wherein ar is interarylene or heterointerarylene , the sum of m and o is from 1 to 4 , and wherein one ch 2 may be substituted with s or o . in other words , while not intending to limit the scope of the invention in any way , in one embodiment a comprises from 1 to 4 ch 2 moieties and ar , e . g . — ch 2 — ar —, —( ch 2 ) 2 — ar —, — ch 2 — arch 2 —, — ch 2 ar ( ch 2 ) 2 —, —( ch 2 ) 2 — ar ( ch 2 ) 2 —, and the like ; or a comprises o , from 0 to 3 ch 2 moieties , and ar , e . g ., — o — ar —, ar — ch 2 — o —, — o — ar —( ch 2 ) 2 —, — o — ch 2 — ar —, — o — ch 2 — ar —( ch 2 ) 2 , and the like ; or a comprises s , from 0 to 3 ch 2 moieties , and ar , e . g ., — s — ar —, ar — ch 2 — s —, — s — ar —( ch 2 ) 2 —, — s — ch 2 — ar —, — s — ch 2 — ar —( ch 2 ) 2 , and the like . interarylene or heterointerarylene refers to an aryl ring or ring system or a heteroaryl ring or ring system which connects two other parts of a molecule , i . e . the two parts are bonded to the ring in two distinct ring positions . interarylene or heterointerarylene may be substituted or unsubstituted . thus , an unsubstituted interarylene has 4 potential positions where a substituent could be attached . in one embodiment , ar is substituted or unsubstituted interphenylene , interthienylene , interfurylene , or interpyridinylene . in another embodiment ar is interphenylene ( ph ). in another embodiment a is —( ch 2 ) 2 - ph -. while not intending to limit scope of the invention in any way , substituents may have 4 or less heavy atoms , or in other words , non hydrogen atoms . any number of hydrogen atoms required for a particular substituent will also be included . thus , the substituent may be hydrocarbyl having up to 4 carbon atoms , including alkyl up to c 4 , alkenyl , alkynyl , and the like ; hydrocarbyloxy up to c 3 ; cf 3 ; halo , such as f , cl , or br ; hydroxyl ; nh 2 and alkylamine functional groups up to c 3 ; other n or s containing substituents ; and the like . in one embodiment a is —( ch 2 ) m — ar —( ch 2 ) o — wherein ar is interphenylene , the sum of m and o is from 1 to 3 , and wherein one ch 2 may be substituted with s or o . in another embodiment a is — ch 2 — ar — och 2 —. in another embodiment a is — ch 2 — ar — och 2 — and ar is interphenylene . in another embodiment , ar is attached at the 1 and 3 positions , such as when a has the structure shown below . in another embodiment a is —( ch 2 ) 6 —, cis — ch 2 ch ═ ch —( ch 2 ) 3 —, or — ch 2 c ≡ c —( ch 2 ) 3 —, wherein 1 or 2 carbon atoms may be substituted with s or o ; or a is —( ch 2 ) 2 - ph - wherein one ch 2 may be substituted with s or o . in another embodiment a is —( ch 2 ) 6 —, cis — ch 2 ch ═ ch —( ch 2 ) 3 —, or — ch 2 c ≡ c —( ch 2 ) 3 —, wherein 1 or 2 carbon atoms may be substituted with s or o ; or a is —( ch 2 ) 2 - ph -. j is c ═ o , choh , or ch 2 choh . thus , while not intending to limit the scope of the invention in any way . compounds such as the ones below are useful as the prostaglandin ep 4 agonists . c 1 - 12 alkyl is alkyl having from 1 to 12 carbon atoms , including : cyclic alkyl , such as cyclopropyl , cyclobutyl , cyclohexyl , etc . ; including substituted cycloalkyl , such as methylcyclohexyl , ethylcyclopropyl , dimethylcycloheptyl , etc , and including moieties such as ch 2 - cyclohexyl , where the cyclic group is not the point of attachment to the rest of the molecule ; and any combination of the other types of alkyl groups listed above . thus , e may be any of these groups . in particular , linear alkyl of c 1 - 6 is contemplated herein , especially butyl . other particularly useful groups are cyclohexyl , cyclopentyl , and substituted cyclohexyl and cyclobutyl having less than 9 carbon atoms . e may also be r 2 or y — r 2 wherein y is ch 2 , s or o and r 2 is aryl or heteroaryl . thus , e may be aryl , heteroaryl , — ch 2 - aryl , — s - aryl , — o - aryl , — ch 2 - heteroaryl , — s - heteroaryl , or — o - heteroaryl . aryl is defined as an aromatic ring or ring system as well as a substituted derivative thereof , wherein one or more substituents are substituted for hydrogen . while not intending to limit the scope of the invention in any way , phenyl , naphthyl , biphenyl , terphenyl , and the like are examples of aryl . heteroaryl is defined as aryl having at least one non - carbon atom in an aromatic ring or ring system . while not intending to limit the scope of the invention in any way , in many cases one or more oxygen , sulfur , and / or nitrogen atoms are present . while not intending to limit the scope of the invention in any way , examples of heteroaryl are furyl , thienyl , pyridinyl , benzofuryl , benzothienyl , indolyl , and the like . the substituents of aryl or heteroaryl may have up to 12 non - hydrogen atoms each and as many hydrogens as necessary . thus , while not intending to limit the scope of the invention in any way , the substituents may be : hydrocarbyl , such as alkyl , alkenyl , alkynyl , and the like , and combinations thereof ; hydrocarbyloxy , meaning o - hydrocarbyl such as och 3 , och 2 ch 3 , o - cyclohexyl , etc , up to 11 carbon atoms ; hydroxyhydrocarbyl , meaning hydrocarbyl - oh such as ch 2 oh , c ( ch 3 ) 2 oh , etc , up to 11 carbon atoms ; nitrogen substituents such as no 2 , cn , and the like , including amino , such as nh 2 , nh ( ch 2 ch 3 oh ), nhch 3 , and the like up to 11 carbon atoms ; carbonyl substituents , such as co 2 h , ester , amide , and the like ; phosphorous substituents , such as po 3 2 − , and the like ; sulfur substituents , including s - hydrocarbyl , sh , so 3 h , so 2 - hydrocarbyl , so 3 - hydrocarbyl , and the like . in certain embodiments , the number of non - hydrogen atoms is 6 or less in a substituent . in other embodiments , the number of non - hydrogen atoms is 3 or less in a substituent . in other embodiments , the number of non - hydrogen atoms on a substituent is 1 . in certain embodiments , the substituents contain only hydrogen , carbon , oxygen , halo , nitrogen , and sulfur . in other embodiments , the substituents contain only hydrogen , carbon , oxygen , and halo . in certain embodiments a is —( ch 2 ) 6 —, cis — ch 2 ch ═ ch —( ch 2 ) 3 —, or — ch 2 c ≡ c —( ch 2 ) 3 —, wherein 1 or 2 carbon atoms may be substituted with s or o ; and e is c 1 - 6 alkyl , r 2 , or — y — r 2 wherein y is ch 2 , s , or o , and r 2 is aryl or heteroaryl . in one embodiment r 1 is h , chloro , or fluoro . in another embodiment r 1 is h . in another embodiment , r 1 is chloro . in other embodiments r 2 is phenyl , naphthyl , biphenyl , thienyl , or benzothienyl having from 0 to 2 substituents selected from the group consisting of f , cl , br , methyl , methoxy , and cf 3 . in other embodiments r 2 is ch 2 - naphthyl , ch 2 - biphenyl , ch 2 -( 2 - thienyl ), ch 2 -( 3 - thienyl ), naphthyl , biphenyl , 2 - thienyl , 3 - thienyl , ch 2 -( 2 -( 3 - chlorobenzothienyl )), ch 2 -( 3 - benzothienyl ), 2 -( 3 - chlorobenzothienyl ), or 3 - benzothienyl . in other embodiments r 2 is ch 2 -( 2 - thienyl ), ch 2 -( 3 - thienyl ), 2 - thienyl , 3 - thienyl , ch 2 -( 2 -( 3 - chlorobenzothienyl )), ch 2 -( 3 - benzothienyl ), 2 -( 3 - chlorobenzothienyl ), or 3 - benzothienyl . while not intending to limit the scope of the invention in any way , compounds according to the structures below , wherein x is 0 or 1 and r 1 is h , chloro , fluoro , bromo , methyl , methoxy , or cf 3 , are also examples of prostaglandin ep 4 agonists . while not intending to limit the scope of the invention in any way , compounds according to the structures below are also examples of prostaglandin ep 4 agonists . while not intending to limit the scope of the invention in any way , compounds according to the structures below are also examples of prostaglandin ep 4 agonists . while not intending to limit the scope of the invention in any way , compounds according to the structures below are also examples of prostaglandin ep 4 agonists . while not intending to limit the scope of the invention in any way , compounds according to the structures below , wherein x is 0 or 1 and r 1 is h , chloro , fluoro , bromo , methyl , methoxy , or cf 3 , are also examples of prostaglandin ep 4 agonists . while not intending to limit the scope of the invention in any way , compounds according to the structures below are also examples of prostaglandin ep 4 agonists . furthermore , the following united states patent applications or patents , all of which are expressly incorporated by reference herein , disclose compounds which are prostaglandin ep 4 agonists : u . s . pat . no . 6 , 552 , 067 ; u . s . pat . no . 6 , 747 , 054 ; united states patent application publication no . 20030120079 ; and united states patent application publication no . 20030207925 ; united states patent application publication no . 20040157901 ; u . s . pat . no . 4 , 117 , 014 ; united states patent application publication no . 2004 / 0142969 ; u . s . pat . no . 6 , 747 , 037 ; u . s . pat . no . 6 , 610 , 719 ; u . s . pat . no . 4 , 171 , 375 ; u . s . pat . no . 3 , 931 , 297 ; u . s . patent application ser . no . 821 , 705 , filed apr . 9 , 2004 ; u . s . pat . no . 6 , 670 , 485 ; u . s . pat . no . 6 , 410 , 591 ; and u . s . pat . no . 6 , 538 , 018 . methods and prodrugs related to all of these prostaglandin ep4 agonists are specifically contemplated herein . wherein r 4 is h , halo or c 1 - 6 alkyl . halo is a group 7 atom such as fluoro , chloro , bromo , iodo , and the like . c 1 - 6 alkyl is linear , branched , or cyclic alkyl having from 1 to 6 carbons including , but not limited to , methyl , ethyl , propyl isomers , butyl isomers , pentyl isomers , hexyl isomers , cyclopropyl , cylobutyl , cyclohexyl , and the like . prodrugs of prostaglandin ep4 agonists according to the structures below are also contemplated . the esters , ethers , or amide prodrugs herein may incorporate either a direct bond to the amino acid , or may alternatively incorporate a spacer group including , but not limited to , polyols such as ethylene glycol , glycerine , and the like , or oligomers or polymers thereof ; dicarboxylic acids such as succinic acid , maleic acid , malonic acid , azelaic acid , and the like ; hydroxycarboxylic acids such as lactic acid , hydroxyacetic acid , citric acid , and the like ; esters , amides , or ethers to form combinations of any of the above . the amino acid used may be a natural or an unnatural amino acid . the structures shown below exemplify amino acid prodrugs for natural amino acids , where r represents the side chain characteristic of a natural amino acid , and where r and the amide nitrogen may be connected as per proline . pharmaceutically acceptable salts of compounds of these structures , whether anionic , cationic , or zwitterionic , are also useful . in certain embodiments , r is selected from the group consisting of h , methyl , iso - propyl , sec - butyl , benzyl , indol - 3 - ylmethyl , hydroxymethyl , chohch 3 , ch 2 conh 2 , p - hydroxybenzyl , ch 2 sh , ( ch 2 ) 4 nh 2 , ( ch 2 ) 3 nhc ( nh 2 ) 2 + , methylimidizol - 5 - yl , ch 2 co 2 h , or ( ch 2 ) 2 co 2 h . of course analogous prodrugs of unnatural amino acids may also be made . if the unnatural amino acids are also α - amino acids , the structure would be the same except that r would represent a side chain from a natural amino acid . for a natural amino acid , any stereoisomer may be used . in fact , the enantiomers of the natural amino acids are specifically contemplated herein as unnatural amino acids . examples of useful types of unnatural amino acids include , but are not limited to : phenylalanine derivatives , particularly those where the ring is substituted , such as l - dopa ; or those where the phenyl is replaced with another aromatic group such as naphthyl or a heterocylic ring ; tyrosine derivatives , particularly those where the ring is substituted with an additional ring substituent ; those where the phenyl is replaced with another aromatic group such as naphthyl or a heterocylic ring ; or ethers at the phenolic oxygen ; specifically , the following unnatural amino acids are contemplated herein : l - dopa , d - penicillamine , d - 2 - naphthylanaline , d - 4 - hydroxyphenylglycine , l - homophenylalanine , ( 2r , 3s )- phenylisoserine , thienylalanine , allylglycine , 3 - methylphenylalanine , 3 - pyridylalanine , 4 - thiazolylalanine , 4 , 4 ′ biphenylalanine , 4 - aminomethylphenylalanine , 4 - fluorophenylalanine , 3 , 4 - dichlorophenylalanine , pipecolic acid , β - homolysine , β - homophenylalanine , β - homoserine , β - homotryptophan , 3 - amino - 3 - benzo [ 1 , 3 ] dioxol - 5 - yl propionic acid , 3 - amino - 3 -( 6 - methoxy - pyridin - 3 - yl ) propionic acid , 3 - amino - 4 -( 3 , 4 - difluorophenyl ) butyric acid , 3 - amino - 4 -( 4 - fluorophenyl ) butyric acid , 3 - amino - 5 - hexenoic acid , 2 - tetrahydroisoquinolineacetic acid , 3 - amino - 5 - phenylpentanoic acid , and azetidine - 3 - carboxylic acid . ester prodrugs of ep 4 agonists may also be based upon amino acids , as demonstrated by the examples shown below . pharmaceutically acceptable salts of compounds of these structures , whether anionic , cationic , or zwitterionic , are also useful . since amino acids such as serine , threonine , and tyrosine , and many unnatural amino acids have hydroxyl functional groups in their side chains , ether prodrugs of ep 4 agonists based upon amino acids are also possible , as demonstrated in the examples below . pharmaceutically acceptable salts of compounds of these structures , whether anionic , cationic , or zwitterionic , are also useful . in addition , the spacers illustrated herein may be applied to amino acids to further increase the number kinds of amino acid prodrugs available . these amino acids with hydroxyl functional groups may also be used to formed c1 amino acid ester prodrugs . for the purposes herein , c1 amino acid ester prodrug is a prodrug which is an ester at what is traditionally thought of as “ c1 ” in a prostaglandin . for prostaglandins not having the same carbon skeleton as a natural prostaglandin , a “ c1 ” ester is an ester at the carboxylic acid attached to a herein . prodrugs of the compounds shown below , and use of the compounds , or salts or prodrugs thereof , for any method , composition , or treatment disclosed herein , are specifically contemplated herein . unless indicated by a wedge or a dash , a carbon which has a chiral center can be construed to include the s isomer , the r isomer , or any mixture of isomers including a 50 : 50 r / s mixture . in particular , the pure isomers of each of the structures above , and any possible isomeric mixtures , including the 50 : 50 r / s mixtures , are contemplated . methods of preparing these compounds are in u . s . pat . no . 6 , 747 , 037 and u . s . pat . no . 6 , 875 , 787 . amino acid prodrugs are readily obtained by many methods . for example , while not intending to be limiting , one of several procedures used for the coupling of salicylic acid to a methyl ester of alanine , glycine , methionine , or tyrosine ( nakamura et . al . j . pharm . pharmacol . 1992 , 44 , 295 - 299 , and nakamura et . al . int . j . pharm . 1992 , 87 , 59 - 66 ) can be adapted for use with prostaglandin ep 4 agonists . in this procedure , an equimolar amount of dicyclohexylcarbodiimide is added at or below 0 ° c . to a prostaglandin ep 4 agonist carboxylic acid and stirred about 30 minutes . an equimolar amount of the methyl ester of the amino acid is then added and stirred overnight at room temperature to form the amide . deprotection of any hydroxyl group can then be carried out by using dilute aqueous acid or another method , depending on the protecting group . while not intending to be bound by theory , it is commonly believed by those skilled in the art that the colonic mucosal barrier is central to protecting the inner layers of the colon from irritants such as foods , oxidizing agents , bacterial metabolites , and intestinal flora . while not intending to be bound in any way by theory , it is believed that impaired and / or leaky epithelial layers lead to various inflammations of the colon including immunogenic inflammatory bowel diseases and subsequent secondary inflammations . while not intending to be bound by theory , it is believed that prostaglandin ep 4 receptors mediate two cellular signaling pathways using either the 2 nd messenger camp or the phosphorylation of erk or activation of phosphoinositide 3 - kinases and early growth response factor - 1 . it is believed that the latter pathways are particularly prominent in epithelial cells . while not intending to be bound by theory , it is believed that activation of the signaling pathways promotes cell proliferation , cell growth , cell metabolism and the inhibition of apoptosis . thus , while not intending to be bound in any way by theory , ep 4 agonists applied to the colon should recognize the prostaglandin ep 4 receptor and thus activate one or more of these signaling pathways . this should thus promote epithelial cell growth , proliferation , inhibition of apoptosis , and increases in mucus secretion , reducing permeability to intestinal antigens and irritants . thus , while not intending to be bound by theory , this enhancement and maintenance of the colonic mucosal barrier by prostaglandin ep 4 agonists should be prophylactic and therapeutic for colitis , amebic colitis , collagenous colitis , colitis cystica profunda , colitis cystica superficialis , granulomatous colitis , hemorrhagic colitis , mucous colitis , crohn &# 39 ; s disease , and ulcerative colitis . a number of methods of delivering a drug to the colon via oral dosage forms are known in the art , and are reviewed by chourasia and jain in j pharm pharmaceut sci 6 ( 1 ): 33 - 66 , 2003 . these include 1 ) administration of a prodrug , including an azo or a carbohydrate based prodrug ; 2 ) coating the drug with , or encapsulating or impregnating the drug into a polymer designed for delivery to the colon , 3 ) time released delivery of the drug , 4 ) use of a bioadhesive system ; and the like . intestinal microflora are capable of reductive cleavage of an azo bond leaving the two nitrogen atoms as amine functional groups . bacteria of the lower gi also have enzymes which can digest glycosides , glucuronides , cyclodextrins , dextrans , and other carbohydrates , and ester prodrugs formed from these carbohydrates have been shown to deliver the parent active drugs selectively to the colon . this prodrug approach has been used to deliver 5 - aminosalicylic acid to humans . in vivo and in vitro studies on rats and guinea pigs with prodrugs of dexamethasone , prednisolone , hydrocortisone , and fludrocortisone , suggest that glycoside conjugates may be useful for the delivery of steroids to the human colon . other in vivo studies have suggested that glucouronide , cyclodextrin , and dextran prodrugs of steroids or non - steroidal anti - inflammatory drugs are useful for delivery of these drugs to the lower gi tract . similarly , carbohydrate polymers such as amylase , arabinogalactan , chitosan , chondroiton sulfate , dextran , guar gum , pectin , xylin , and the like , can be used to coat a drug compound , or a drug may be impregnated or encapsulated in the polymer . an amide of salicylic acid and glutamic acid has been shown to be useful for the delivery of salicylic acid to the colon of rabbit and dog . after oral administration , the polymers remain stable in the upper gi tract , but are digested by the microflora of the lower gi thus releasing the drug for treatment . polymers which are sensitive to ph may also be used since the colon has a higher ph than the upper gi tract . such polymers are commercially available . for example , rohm pharmaceuticals , darmstadt , germany , markets ph dependent methacrylate based polymers and copolymers which have varying solubilities over different ph ranges based upon the number of free carboxylate groups in the polymer under the tradename eudragit ®. several eudragit ® dosage forms are currently used to deliver salsalazine for the treatment of ulcerative colitis and crohn &# 39 ; s disease . time release systems , bioadhesive systems , and other delivery systems have also been studied . coadministration of prostaglandin ep4 agonists , either in a single composition or in separate dosage forms , is also contemplated . while not intending to limit the scope of the invention in any way , drugs which may be included in combination therapies with ep4 agonists and their prodrugs include , but are not limited to : 1 . anti - inflammatory drugs such as aminosalicylates and their prodrugs , sulfasalazine , and the like ; 4 . humanized monoclonal antibodies against pro - inflammatory cytokines such as infliximab , etanercept , onercept , adalimumab , cdp571 , cdp870 , natalizumab , mln - 02 , isis 2302 , cm - t412 , bf - 5 , vasilizumab , daclizumab , basiliximab , anti - cd40l , and the like . one useful assay for determining prostaglandin ep 4 activity and selectivity of compounds is described below . human recombinant ep 2 , ep 2 , ep 3 , ep 4 , fp , tp , ip and dp receptors : stable transfectants . plasmids encoding the human ep 1 , ep 2 , ep 3 , ep 4 , fp , tp , ip and dp receptors are prepared by cloning the respective coding sequences into the eukaryotic expression vector pcep 4 ( invitrogen ). the pcep 4 vector contains an epstein barr virus ( ebv ) origin of replication , which permits episomal replication in primate cell lines expressing ebv nuclear antigen ( ebna - 1 ). it also contains a hygromycin resistance gene that is used for eukaryotic selection . the cells employed for stable transfection are human embryonic kidney cells ( hek - 293 ) that are transfected with and express the ebna - 1 protein . these hek - 293 - ebna cells ( invitrogen ) are grown in medium containing geneticin ( g418 ) to maintain expression of the ebna - 1 protein . hek - 293 cells are grown in dmem with 10 % fetal bovine serum ( fbs ), 250 μg ml − 1 g418 ( life technologies ) and 200 μg ml − 1 gentamicin or penicillin / streptomycin . selection of stable transfectants is achieved with 200 μg ml − 1 hygromycin , the optimal concentration being determined by previous hygromycin kill curve studies . for transfection , the cells are grown to 50 - 60 % confluency on 10 cm plates . the plasmid pcep 4 incorporating cdna inserts for the respective human prostanoid receptor ( 20 μg ) is added to 500 μl of 250 mm cacl 2 . hepes buffered saline × 2 ( 2 × hbs , 280 mm nacl , 20 mm hepes acid , 1 . 5 mm na z hpo 4 , ph 7 . 05 - 7 . 12 ) is then added dropwise to a total of 500 μl , with continuous vortexing at room temperature . after 30 min , 9 ml dmem are added to the mixture . the dna / dmem / calcium phosphate mixture is then added to the cells , which is previously rinsed with 10 ml pbs . the cells are then incubated for 5 hr at 37 ° c . in humidified 95 % air / 5 % co 2 . the calcium phosphate solution is then removed and the cells are treated with 10 % glycerol in dmem for 2 min . the glycerol solution is then replaced by dmem with 10 % fbs . the cells are incubated overnight and the medium is replaced by dmem / 10 % fbs containing 250 μg ml − 1 g418 and penicillin / streptomycin . the following day hygromycin b is added to a final concentration of 200 μg ml − 1 . ten days after transfection , hygromycin b resistant clones are individually selected and transferred to a separate well on a 24 well plate . at confluence each clone is transferred to one well of a 6 well plate , and then expanded in a 10 cm dish . cells are maintained under continuous hygromycin selection until use . radioligand binding studies on plasma membrane fractions prepared from cells are performed as follows . cells washed with tme buffer are scraped from the bottom of the flasks and homogenized for 30 sec using a brinkman pt 10 / 35 polytron . tme buffer is added as necessary to achieve a 40 ml volume in the centrifuge tubes . tme is comprised of 50 mm tris base , 10 mm mgcl 2 , 1 mm edta ; ph 7 . 4 is achieved by adding 1 n hcl . the cell homogenate is centrifuged at 19 , 000 rpm for 20 - 25 min at 4 ° c . using a beckman ti - 60 or - 70 rotor . the pellet is then resuspended in tme buffer to provide a final protein concentration of 1 mg / ml , as determined by bio - rad assay . radioligand binding assays are performed in a 100 μl or 200 μl volume . the binding of [ 3 h ] pge 2 ( specific activity 165 ci / mmol ) is determined in duplicate and in at least 3 separate experiments . incubations are for 60 min at 25 ° c . and are terminated by the addition of 4 ml of ice - cold 50 mm tris - hcl followed by rapid filtration through whatman gf / b filters and three additional 4 ml washes in a cell harvester ( brandel ). competition studies are performed using a final concentration of 2 . 5 or 5 nm [ 3 h ] pge 2 and non - specific binding is determined with 10 − 5 m unlabelled pge 2 . for all radioligand binding studies , the criteria for inclusion are & gt ; 50 % specific binding and between 500 and 1000 displaceable counts or better . | 2 |
now there will be given a detailed explanation of the present invention , while making reference to the attached drawings . at first an explanation on the phase - difference mirror will be given with reference to fig1 . it is already well known that , when a light beam enters a mirror with an incident angle θ , the reflectance and phase of the p - polarized component parallel to the incident plane ( a plane including the incident light and emergent light ) and of the s - polarized component perpendicular to said incident plane change according to the incident angle θ . referring to fig1 an incident light 2 enters a mirror surface 1 with an incident angle θ to the line normal to said mirror surface 1 , said incident light including a p - polarized component parallel to the incident plane ( i . e ., plane of paper ) and an s - polarized component perpendicular to said incident plane . the phase difference δ between the p - polarized component and s - polarized component can be expressed as a function of incident angle θ as shown in fig2 . a mirror creating a phase difference between the p - polarized component and s - polarized component when these components enter the mirror with a same phase is called a phase - difference mirror , which can be easily obtained by coating a glass substrate with a metal , for example aluminum . fig3 shows the optical arrangement of the observing apparatus of the present invention in a state of inspection , the component surrounded by the broken line being retracted in a manner to be explained later from the printing optical path in a state of printing . a reflective optical system for projecting a pattern of a mask m onto a wafer w is composed of planar mirrors 3 , 4 , a concave mirror 5 , a convex mirror 6 , said concave and convex mirrors having a common center of curvature at a point o on the optical axis 7 . if the planar mirrors 3 , 4 are disregarded as they are inserted merely for deflecting the optical path and have no relevance to the imaging ability of the system , an object of a height h at the point o is focused , without any aberration and with a magnification of unity , on a point h &# 39 ; symmetric with respect to the optical axis 7 . however , as the imaging area without aberration is limited to the vicinity of height h , an arc - shaped area with a radius h is utilized for imaging . the above - mentioned points h , h &# 39 ; respectively correspond to the positions of mask m and wafer w . thus it is possible to print the entire pattern of mask m onto the wafer w by illuminating an arc - shaped area of the mask m with the illuminating system 8 and simultaneously displacing the mask m and wafer w in the direction x along the plane of paper . said illuminating system 8 is provided with retractable filters in order to emit a light not actinic to the wafer , for example green light , at the alignment , and a far ultraviolet light at the printing . such difference in the wavelength of lights used in the alignment and in the printing results in a problem of color dispersion at the printing operation . in the above - explained optical system , as the principal ray always enters each mirror in a slanted state , the total phase difference δ of the entire system between the p - polarized component and s - polarized component becomes equal to the sum of phase differences δ at various mirror surfaces . strictly speaking said phase difference δ becomes different for the rays other than the principal ray due to the difference in the incident angle thereof , but such difference in the phase difference is generally negligibly small . in fig3 as the incident planes for the mirror surfaces are all parallel to the paper plane , the total phase difference δ can be expressed by the following equation : wherein δ 3 , δ 4 , δ 6 , δ 7 and δ 8 are the phase differences caused at the mirror surfaces 3 , 4 , 6 and 7 . if the mask illuminating light is linearly polarized in a direction not perpendicular to the paper plane ( z - direction ) or in a direction not parallel to the x - direction but forming an angle therewith , the light entering the wafer w becomes elliptically polarized , and the light reflected by the wafer assumes , upon re - transmission of mask m , a polarized state different from the above - mentioned linearly polarized state . the reflected light from the wafer also illuminates the mask m and is scattered by the pattern thereof , but said scattered light is in a polarized state the same as that of the reflected light from the wafer . thus , as the mask and wafer are in a mutually conjugate relationship , it is rendered possible , by eliminating the above - mentioned linearly polarized component , to simultaneously observe images of mask and wafer with an elevated contrast and without flare resulting from the light directly reflected by the mask . there is provided an inspection light source 9 which illuminates the mask m through lenses 10 and 11 . in the light path there are provided a half mirror 13 , a mirror 14 and a polarizing plate 12 which deflect the light to the mask m and cause the illuminating light for mask m to be polarized in a direction of 45 ° to the x - direction . the reflected light from the mask m is guided through the mirror 14 , lens 11 and half mirror 13 to enter a polarizing plate 15 , which is rotated by means of a rotating mechanism consisting of rotatable cylindrical plate supports 16 , cylindrical fixed supports 17 and a knob 18 , so as to prohibit transmission of said light . on the other hand the reflected light from the wafer w and the scattered light from the mask m illuminated by said reflected light are guided through the mirrors 14 , 11 , half mirror 13 , polarizing plate 15 and mirrors 19 , 20 to enter an eyepiece 21 which therefore allows simultaneous observation of the mask m and wafer w . if the mask m is difficult to observe in this state , the view thereof can be improved by rotating the polarizing plate 15 to allow entry to the light reflected by the mask m . though the polarized states of normally reflected light and scattered light from the mask become completely orthogonal when the phase difference δ of the reflective optical system is equal to 1 / 4 of wavelength , such complete orthogonal state is not reached if said phase difference is not equal to 1 / 4 of wavelength . in such state , therefore , the quantity of light transmitting the polarizing plate 15 becomes reduced when the reflected light is completely interrupted by said polarizing plate 15 . however such reduction in light quantity can be compensated by intensifying the light source 9 , as the noise component can be eliminated by the complete interruption of the reflected light . in the present reflective optical system , the incident angle to mirrors is 45 ° for the mirrors 3 and 4 , and is small for mirrors 6 and 7 . as phase difference δ is approximately equal to π for a small incident angle as shown in fig2 the total phase difference δ can be considered , as an approximation , equal to the sum of the phase differences created at the mirrors 3 and 4 . in the following , however , there is shown an example in which the phase differences created by the mirrors 6 and 7 are also taken into consideration . fig5 shows the measured relationship between the incident angle and phase difference in case of an aluminum evaporated layer at a wavelength of 633 nm . the phase retardation is represented in degrees , or in wavelength unit when divided by 360 °. thus a phase retardation of 20 ° corresponds to that of 1 / 18 of wavelength . fig6 shows the light loss as a function of phase difference . the light loss l becomes zero at a phase difference 90 ° ( 1 / 4 of wavelength ), and can be generally expressed by ( 1 + cos 2δ )/ 2 . when the effective f - number is fe 3 . 5 in the optical system shown in fig3 the incident angles at the mirrors 3 , 4 , 6 and 7 are respectively 45 °, 45 °, 20 ° and 10 °. consequently the total phase difference δ can be calculated from the phase retardation caused at each mirror surface determinable from fig5 : δ = 13 °+ 13 °+ 3 °+ 1 °× 2 = 31 °= 1 / 12 of wavelength which is approximately equal to 1 / 10 of wavelength , thus causing a light loss of ca . 74 %. the light loss can be reduced by rendering the phase retardation δ closer to 1 / 4 of wavelength . fig4 shows an alternative arrangement for the mirror 3 shown in fig3 wherein a mirror 23 provides a reflection and a mirror 22 provides two reflections , both at an incident angle of 45 °. as this arrangement provides two additional reflections in comparison with that shown in fig3 the total phase retardation δ is : δ = 31 °- 2 × 13 °= 57 °= 1 / 6 . 3 of wavelength which is approximately equal to 1 / 5 of wavelength , giving rise to a light loss of ca . 29 %. as explained in detail in the foregoing , the present invention is featured in providing the optical system with a phase - difference mirror instead of a double refractive phase plate such as a crystal plate thereby causing a phase retardation , conducting illumination with thus created polarized light , and taking a polarized component approximately orthogonal thereto for observation . furthermore , although an optical system for visual observation is cited in the foregoing embodiment , it will be apparent that the observing apparatus of the present invention is also employable in an optical system for photoelectrical alignment of mask and wafer by using a photoelectrical element instead of human eye . | 6 |
fig1 shows a side view of the preferred embodiment of the bicycle training device 2 attached to a bicycle 3 . the device is pivotally attached to the rear wheel axle support 4 . the pivotal attachment allows the extension element 5 to rotate around the rear wheel axle 4 in the plane of rotation of the rear wheel 6 . a means for limiting or fixture ( see fig5 ) is provided to proximate the rear axle support to constrain positions the device may be pivoted to . the pivotal motion limits of extension element 5 ( one limit position shown dotted for clarity ) describe an angle &# 34 ; x &# 34 ;. in the preferred embodiment , angle &# 34 ; x &# 34 ; is selected to allow attachment to a variety of bicycle frames and placement of the extension element 5 to be fixed in the optimum position . in an alternate embodiment , the attachment may allow a small degree of pivoting freedom during use to further isolate extraneous forces from the non - riding helper . the extension element 5 of the training device also includes telescoping sections 5a and 5b . these sections are mounted to slide one within the other to allow the height of handle 10 to be adjusted . notched or multiple ports and pinned connection between telescoping sections can be provided to maintain a selected height position . the training device is located behind the training bicycle rider located on the seat 7 , avoiding obstructing vision in the forward direction , operation of pedals 8 , or front wheel 9 movement . the device 2 is provided with a handle 10 . fig2 shows a rear view of a bicycle 3 being supported by a training helper 11 . the helper stands adjacent to the bicycle , grasping the handle 10 . the handle 10 includes a grip 12 which allow convenient grasping . in an alternate embodiment , stops ( such as end caps ) are attached to the handle and the grip 12 is slidably mounted to the transverse handle portion , allowing limited motion of the grip 12 . in the alternate embodiment , the slidably mounted grip and pivotally mounted extension allow the helper to run alongside the bicycle 2 when ridden on the ground 13 while firmly grasping the grip without exerting any forward or side forces , until the grip 12 or extension 5 is abutting the limits of their respective travels . in the preferred embodiment , the optimum placement minimizes extraneous forces exerted by the non - riding helper . in the event of an imminent fall , an upward force can be immediately applied by the non - riding helper 11 on the handle 10 . forces exerted by the helper 11 on grip 12 are transmitted to handle 10 , which is transmitted through extension element 5 of the device 2 to the rear wheel axle 4 . these axle forces are then transmitted through the bicycle frame 14 to seat 7 supporting the seated trainee ( not shown for clarity ). the proximity of the handle to the trainee insures that uprighting forces applied by the helper 11 act most directly on the trainee , exerting minimal extraneous forces or moments or loss of rear wheel traction . also shown ( dotted for clarity ) are training wheels 15 and training wheel support members 16 attached to the axle support 4 . the training wheels 15 and support members 16 are shown dotted as they are normally not attached when the training handle 2 is attached and the trainee ( not shown ) seated on seat 7 is ready for training using the training handle 2 . both the training wheels and the training handle use a common point of attachment , so that removal of training wheels and installation of the training handle can be coordinated and simplified . a common fixture or clamp ( see item 26 in fig7 ) can be used to attach both the training wheels support members 16 and the training handle extension element 5 as shown . the training wheel support member 16 may also be common to the ( i . e ., form part of ) the extension element 5 is still another embodiment . the training handle can be left on the bicycle permanently for individually positioning and training other trainees , or it may be removed when the training period ends . fig3 shows an exploded side view of an alternate embodiment of a training handle device having a jointed or telescoping frame support 17 . the frame support 17 attaches the extension element 5 to the frame 14 in the proximity of the seat 7 . the jointed or telescoping construction of the frame support 17 allows the handle to be secured to a variety of bicycle frames and also allows a limited pivoting motion . the pivoting motion is used in the preferred embodiment to adjust the handle position to an optimum position prior to securing in place . an alternate configuration could also allow the handle 10 a limited range of movement during the training period . fig4 shows a side view of the telescoping frame support 17 . the frame support 17 is composed of a first sliding member 18 and a second sliding member 19 . the sliding members 18 and 19 are slotted and a bolt 20 slidably attaches the first and second sliding members . the limits of motion of the handle ( see fig3 ) are provided by the ends of the slots 21 . in alternate configurations the members could be jointed or tubular telescoping members and the position not fixed during the training period . fig5 shows a side view of a alternate combined safety handle and luggage carrier 22 . the handle 10 and an extension member are again placed proximate to the rear wheel 6 and pivotally connected to the axle support 4 , but the device also includes a pair of luggage carriers 23 . the saddlebag type of luggage carriers can be permanently attached to the bicycle 2 as shown or can also be a removable attachment , as previously discussed in reference to training wheels fig6 shows a rear view of the combined safety handle and luggage carrier . the split extension element 5 allows attachment to both sides of the axle support ( see fig5 ), and provide clearance for the rear wheel 6 ( see fig6 ). the handle segment 24 can be permanently or removably attached to the split extension element 5 . alternate embodiments can provide for the attachment of other devices in addition to or instead of the luggage carrier . the other devices include warning flags , an additional adult or child seat , tool kits , locked containers , fluid containers , straps , lights , etc . fig7 shows a partial side view of a second alternate embodiment of a training device 2 attached to a bicycle . the extension elements 5 are pivotally attached at one end to the rear axle 4 . the axle is attached to the bicycle frame 14 , which terminates in a hook 25 around the axle 4 . a means for limiting pivotal motion or fixture 26 is also provided proximate to the axle 4 . a nut 27 threadably attached to the axle 4 is tightened to engage the fixture 26 , extension 5 , and the hooked end 25 of frame 14 . spokes of the wheel 6 ( see fig1 ) are not shown for clarity . the fixture includes two upper protrusions 28 ( shown dotted in this view ) projecting into the pivoting plane of rotating of the extension element 5 . the extension element 5 is shown abutting one of the two upper protrusions 28 , establishing one edge of angle &# 34 ; x &# 34 ; ( see fig1 ). rotation of the extension element 5 around the axle 4 until the extension element abuts the other protrusion 28 establishes the other edge of angle &# 34 ; x &# 34 ; ( see fig1 ). a lower protrusion 29 ( shown dotted in this view ) abuts the lower portion of the hooked termination 25 of the frame 14 . axle 4 projects through the fixture slot 30 in fixture 26 . fig8 shows a partial rear view of an alternate embodiment in an area proximate to one side of the axle 4 . the nut 27 is tightened to force the fixture 26 towards the wheel 6 ( only the hub and spokes shown for clarity ) so that the upper protrusions 28 can engage the extension element 5 at the limits of pivotal motion &# 34 ; x &# 34 ; ( see fig1 ) and the lower protrusion 29 can engage the hooked end 25 of the frame . the lower protrusion also provides support for the extension element 5 . washers 31 allow relative motion between the extension element if desired . fig9 is a perspective view of fixture 26 of the alternate embodiment shown in fig8 . the upper protrusions 28 project from the primary plane of the fixture held towards extension member 5 by the nut 27 attached to the axle 4 ( see fig4 ) projecting through the fixture slot 30 in the primary plane . the lower protrusion 29 also projects from the primary plane . the fixture slot 30 allows the fixture to be raised or lowered , changing the limits on the angle &# 34 ; x &# 34 ; ( see fig1 ). the protrusions may also be tapered and the number of washers 31 varied to further vary angle &# 34 ; x &# 34 ;. in still other alternative embodiments , the lower protrusion may be eliminated if the nut 27 is tightened against extension element 5 , allowing lifting and other forces to be transmitted through the tighten nut attachment . if only very small pivoting action or is desired , the nut 27 may also be tightened and the washers 31 ( see fig8 ) can be eliminated . the extension member may also be segmented , rather than telescoping to achieve an adjustable height . segments of the extension element may also be derived from a training wheel set to further coordinate installation and removal of training wheel and the training handle . fig1 and 11 illustrate another embodiment of the fixture 31 comprising a forked element 33 attachable to the rear wheel axle of a bicycle and detachable and substitutable handle 32 or luggage rack 34 . it should be understood that other accessories such as a childs seat , flag pole etc . could be mounted in lieu of the handle 32 or the luggage rack 34 by plugging them into the socket and locking wing nut assembly 35 forming an integral part of the fork 33 . in all other aspects the fixture 31 is similar to the training device described earlier . the invention achieves the first objective of adaptability to many different bicycle frames and sizes by pivotally attaching elements to the rear wheel axle . the axle is essentially common to all bicycles and the pivotal attachment allows adjustment of the handle position to be proximate to the rider , independent of seat position , rider position , frame configuration and frame size . when compared to prior art push bars , the device is adaptable to nearly all bicycles , and can be removed and installed many times . the invention achieves the second objective to not add extraneous forces or impede riding balance by having the grasped handle capable of pivoting around the rear axle . the pivoting motion is within the fore and aft plane and limited by stops to continuously allow the helper to apply side forces when needed to maintain balance at any pivotal position . when compared to the fixed prior art bars , extraneous fore and aft forces cannot be applied unless the handle is abutting one of the stops . still further isolation of non - rider motions can be provided by a slidably mounted grip on the handle , allowing limited transverse motion of the grip . the invention achieves the third objective to coordinate mounting with the removal of training wheels by mounting the device only to the rear axle support . no attachment to the seat or permanent attachment to the frame is involved . training wheels are typically also mounted at this location , so that removal of the training wheels can be coordinated and accomplished at the same time as installation of the training handle device . various clamps and hold down nuts may also be common to both training wheel and training handle installations . when compared to prior art fixed push bar installation , the push bar was firmly attached to the frame or seat . this requires separate ( possibly permanent ) installation of the push bar and separate ( and uncoordinated ) removal of the training wheels . the invention achieves the fourth objective of allowing attachment of other devices by providing a convenient surface for the attachment of temporary or permanent luggage containers or other devices . the pivotal attachment would be fixed into position for the attachment of many of the other devices . other objectives are also met . convenience is increased by the telescoping handle height adjustment . rear placement and limited pivot motions insure the grip and handle is properly placed in any one of the pivoted positions to counteract an imminent fall by the trainee , and do not obstruct vision or operation of the bicycle . by telescopically lowering the height of the handle 10 , or removing the handle segment portion of the device , it has minimal impact on balance or operation of the bicycle if attached but not used . removal and installation is simply a matter of unscrewing one or two nuts 17 , removing the fixture 16 and extension element 5 , then replacing the nut 17 . while the preferred embodiment of the invention has been shown and described , and some alternative embodiments also shown and described , changes and modifications may be made therein within the scope of the appended claims without departing from the spirit and scope of this invention . | 1 |
an embodiment of the method and apparatus for reading glass dosimeters in accordance with this invention will be explained with reference to fig1 and 2 . in fig1 a nitrogen gas laser unit denoted at 11 is started by an instantaneous high voltage impressed by a trigger circuit 12 and produces ultraviolet laser pulses of a pulse width of 5 to 10 ns and a wavelength of 337 . 1 nm . after the ultraviolet pulses has passed a color filter 13 , the stray light such as scattered light is removed therefrom , and only the ultraviolet rays having a wavelength of 337 . 1 nm is selected . thereafter , the pulsed ultraviolet rays are transmitted to a semitransparent mirror 14 made of fused silica glass or the like and are divided in two thereon . one part of the divided pulsed ultraviolet rays travel straight through the semitransparent mirror 14 and are emitted to a fluorescent glass element 15 exposed to radiation . the other part of the divided pulsed ultraviolet rays are reflected on the semitransparent mirror 14 and are again reflected on a reflecting mirror 16 arranged in the next stage . then they are supplied to a standard fluorescent glass element 17 . the reference fluorescent glass element 17 is made of , for example , silver - activated phosphate glass not previously exposed to radiation rays . the reference fluorescent glass element 17 is used for correcting the output deviation of the nitrogen gas laser . since rpl generated by the ultraviolet excitation depends on the intensity of the exciting ultraviolet rays , that is , the intensity of the laser , the measured value of the rpl is corrected with reference to the fluorescent light from the reference fluorescent glass element 17 , as described later . when the exciting ultraviolet pulses are emitted , fluorescent pulses corresponding to the exposure dose are generated at the detecting side face of the fluorescent glass element 15 , and reference fluorescent pulses are produced at the detecting side face of the reference fluorescent glass element 17 . after the two kinds of fluorescent pulses have passed corresponding ultraviolet ray eliminating filters 18 and 19 , these pulses are sent to photomultiplier tubes 22 and 23 via wavelength selecting elements 20 and 21 such as interference filters . a high voltage generating circuit 24 receives from the trigger circuit 12 a starting signal which is output at the same time as the nitrogen gas laser unit 11 outputs the signal , or receives an output from a schmidt circuit as described later . then , the detecting sensitivity is controlled . the control of the sensitivity is made by elevating the detection sensitivity of the dynode voltage of the photomultiplier tubes 22 at the time when the rapidly decayed predose component of the emitted fluorescent pulses is sufficiently small , thereby increasing the detection sensitivity of the photomultiplier tubes 22 . the ultraviolet light eliminating filters 18 and 19 have the function of preventing any exciting ultraviolet pulses to be input to the photomultiplier tubes 22 and 23 , and the wavelength selecting elements 20 and 21 have the function of enabling only the rays of the fluorescent pulse component in the specific wavelength range to pass therethrough . the emitted fluorescent pulses detected by the photomultiplier tube 22 are linearly treated by a linear amplifier 26 via a preamplifier 25 and are sent to first and second sampling gates 27 and 28 . the reference fluorescent pulses detected by the photomultiplier tube 23 are amplified by a preamplifier 29 at a predetermined amplification degree and are sent to a third sampling gate 30 . a schmidt circuit designated at 31 sends , at the predetermined time after it has detected the reference fluorescent pulses , pulse signals having a predetermined amplitude and the like to the high voltage generating circuit 24 and to the sampling setting circuits 32 and 33 . the circuits 32 and 33 set a first sampling timing and a second sampling timing , respectively . the sampling setting circuit 32 determines a first sampling time to open the gates of the second and third sampling gate circuits 28 and 30 when the predose component which is produced by the excitation of the ultraviolet rays and has a high fluorescent intensity is fully decayed after the schmidt circuit 31 receives the standard fluorescent pulse . during the first sampling time , the exposed fluorescent pulses and the standard fluorescent pulses are sampled and are sent to the succeeding integrators 34 and 35 . on the other hand , the sampling setting circuit 33 sets a second sampling time in which only the predose component with a slow decay characteristic is sampled when the fluorescent component has been fully decayed . during the second sampling time , the gate of the first sampling gate circuit 27 is opened . the predose component having the slow decay characteristic is sampled and is sent to the succeeding integrator 36 . the sampled values are integrated as an average direct current by the integrators 34 to 36 and are sent to the operation and processing device 37 . the operation and processing device 37 subtracts the integrated value obtained by the integrator 36 from the integrated value obtained by the integrator 34 , whereby the rpl contained in the detected fluorescence during the first sampling time is detected . the means 37 calculates the ratio of the rpl component to the integrated value obtained from the integrator 35 and corrects the deviation of the rpl component due to the deviation in the intensity of the ultraviolet pulses . finally , the means 37 determines the corrected rpl component as the exposure dose of the fluorescent glass element 15 , and this value is displayed on a display 38 . with this embodiment , since the fluorescent pulse component in a specific wavelength range from λ 1 to λ 2 is selected from the whole fluorescence , that is , in the wavelength range in which , as shown in fig2 the fluorescence intensity of the rpl is large and the fluorescence intensity of the predose component is small , the predose component having a slow decay characteristic is reduced to 1 / 2 to 1 / 5 of the predose obtained from the conventional method and apparatus . this reduction of the predose increases the sensitivity of the photomultiplier tube , such that a low rpl intensity is detected at a high sensitivity . further , with the conventional method and apparatus , the measured predose varies according to the characteristic the photomultiplier tube . with this invention , however , of filtering the fluorescence in a specific wavelength region eliminates the dependency on the spectroscopic characteristics of the photomultiplier tubes , such that no consideration needs to be paid to the characteristics of the photomultiplier tubes . still further , the reduction of the ratio of the predose to the rpl renders the subtracted value of the dose small , enabling the resolving power of the operation to be higher so as to carry out the measurement at a high accuracy . in the above embodiment , an interference filter is used as a wavelength selecting element . however , it is possible to combine the interference filter with a color glass filter or to use a prism or a diffraction grading . in addition , various modifications are possible for the light source for the exciting ultraviolet rays , the fluorescent pulse detectors and the like within the scope of this invention . an embodiment of this invention will be explained with reference to fig3 to 5 . in these figures , especially in fig4 the same elements as those in fig1 are denoted by the same reference numerals and their detailed explanation will be omitted . in this case the apparatus for reading glass dosimeters is similar in structure to that of fig1 except for the optical system . the optical system will be explained in detail . generally , the ultraviolet laser generated from the nitrogen gas laser unit 11 is transmitted to the fluorescent glass element 15 and the reference fluorescent glass element 17 via the color filter 13 , the semitransparent mirror 14 and the reflecting mirror 16 , as also shown in fig1 . the intensity distribution on a plane perpendicular to the fluorescent laser is shown in fig3 . the ultraviolet laser beams 41 emitted perpendicularly to the above - mentioned plane from the outlet of the nitrogen gas laser unit 11 form an area e shown by a solid line with a deviation f shown by a dotted line and slightly deflected leftward at the distance l1 from the nitrogen gas laser unit 11 . the portion showing the prominently strong intensity is hatched at g . at the distant l1 + l2 from the nitrogen gas laser unit 11 , the ultraviolet laser beams 41 form a larger circle area e &# 39 ;. the deviation f &# 39 ; and the portion g &# 39 ; showing the prominently strong intensity are also expanded . this means that the intensity distribution across the ultraviolet laser changes depending on the distance from the outlet of the nitrogen gas laser unit 11 . since this causes the intensity deviation of the ultraviolet pulses , the exposure dose of the fluorescent glass element exposed to radiation cannot be measured at a high accuracy without making a proper correction of the intensity distribution . with the second embodiment of the apparatus according to this invention , as shown in fig4 and 5 , the reflecting mirror 16 in fig1 is removed , and a fluorescent glass element 15 that was exposed to radiation and a reference fluorescent glass element 17 are arranged at positions separated from a semitransparent mirror 14 by the same distance l3 and l4 such that both fluorescent glass elements always receive the same intensity distribution of the beams of exciting ultraviolet pulses . this arrangement facilitates an easy and accurate correction of any intensity deviation of the exciting ultraviolet pulses and the accurate measurement of the exposure dose of the fluorescent glass element 15 exposed to radiation as well . the operation of this apparatus is similar to the embodiment of fig1 the explanation thereof being omitted . even if the intensity and intensity distribution of laser emitted from the nitrogen gas laser unit 11 which produces exciting ultraviolet light pulses change , the intensity distributions of the exciting ultraviolet pulses transmitted to the fluorescent glass element 15 exposed to the radiation rays and the standard fluorescent glass element 17 are similar to each other and the ratio of the fluorescent pulses emitted from the fluorescence detecting face of the fluorescent glass elements 15 and 17 is constant . as a result , the deviations of the intensity and intensity distribution of laser from the nitrogen gas laser unit 11 can be accurately corrected , and the measurement can be carried out at a high accuracy . this invention is not limited to the above - mentioned embodiments . for example , a beam splitter may be used instead of the semitransparent mirror 14 , or the beams may be transmitted to the fluorescent glass elements 15 and 17 independently of the semitransparent mirror 14 by means of glass fibers after the beams have been divided by the semitransparent mirror 14 . when the optical lengths from the mirror 14 to the fluorescent glass elements 15 and 17 are unequal to each other , the diffused beams may be converged by a lens or the like such that the size of the beams incident on both the fluorescent glass elements are rendered equal to each other . in addition , various modifications of the light source for exciting ultraviolet rays , the fluorescent pulse detector and of other elements are possible within the scope of this invention . another embodiment of this invention will be explained . the technical feature of this embodiment resides in that the factor for correcting the fluorescent decay characteristic and / or the sensitivity characteristic for each fluorescent glass element are automatically stored and controlled . as shown in fig6 a fluorescent glass element 15 is received on one half portion of a glass element holder 51 . in the other half portion of the holder 51 are formed indexing holes 52 as a recognition code part for recognizing the glass element holder 51 . since the fluorescent glass element 15 is rarely removed from the glass element holder 51 , the indexing holes 52 are used to identify the glass element holder 51 , and the workers at a nuclear power facilities who carry fluorescent dosemeter and fluorescent glass elements 15 can also identify the fluorescent glass elements 15 . with this embodiment , the correction factors are processed by a device as shown in fig7 . first , the correction factor of the fluorescent decay characteristic and the correction factor of the sensitivity characteristic of each fluorescent glass element 15 are stored in a data memory device such as a floppy disc 53 so that the data memory device identifies the recognition code defined by the indexing holes 52 . during the measurement of the exposure dose of the fluorescent glass elements 15 , the floppy disc 53 is installed in a disc drive unit 54 . reference numeral 55 designates read - out device for reading also the data from the indexing holes 52 of the glass element holder 51 , an exciting ultraviolet pulse generator for reading the fluorescent light generated by the fluorescent glass element 15 , the optical system , the photomultifier tube and the like . reference numeral 56 indicates operating and processing means for calculating the proper exposure dose of each fluorescent glass element 15 in accordance with the recognition code and the amount of the fluorescent light both read by the read - out device 55 , and the correction factor stored in the floppy disc 53 within the disc drive unit 54 . reference numeral 57 depicts a printer ; and referential numeral 58 , a display of crt , etc . the correction factor of the fluorescent decay characteristic is previously obtained by processing , on the device as shown in fig7 each new fluorescent glass element before it has been exposed to radiation , and the value is stored in the floppy disc 53 . the correction factor of the sensitivity characteristic of each fluorescent glass element is similarly stored in the floppy disc 53 in advance . with this embodiment , the reading of the exposure dose of a great number of fluorescent glass elements 15 exposed to radiation can be started after the floppy disc 53 storing the data concerning the recognition codes , the fluorescent decay characteristic , and the sensitivity characteristic has been installed in the disc drive unit 54 . the read - out device 55 reads the recognition code from the indexing holes 52 of the glass element holder 51 , and then reads the exposure dose emitted from each fluorescent element 15 exposed to radiation . the operation and processing means 56 compares the read recognition code with the codes stored in the floppy disc 53 at a high speed . when the code is identified , the means 56 reads out the data on the correction factor of the fluorescent decay characteristic and the correction factor of the sensitivity characteristic of the fluorescent glass element whose code is identified . the exposure dose read by the read - out device 55 is corrected based on the correction factors , and corrected exposure dose is displayed on the display 58 or is printed out by the printer 57 . with this embodiment , a floppy disc 53 is used . however a hard disc or other memory means may be employed . needless to say , various modifications of the constituent devices are possible . first , a fluorescent pulse component in a specific wavelength range is selected from fluorescent pulses by means of a wavelength selecting element or the like . this provides for the measurement of the rpl when the predose component having a slow decay characteristic is at a low level . therefore , the sensitivity of the photoelectric detector is increased to measure low rpl intensity at a high sensitivity . since the ratio of the predose to the rpl component is small , the amount of the predose to be subtracted is also small , and the resolution power of the operation is high . thus , the measurement can be carried out at a high accuracy . further , the amounts of the predose differ from each other due to the difference of the spectral sensitivity characteristics of the photoelectric detectors . however , the method and the apparatus of this invention are not influenced by the characteristic of the photoelectric detectors , and thus it is unnecessary to select the characteristic of the detectors , facilitating easy maintenance of the apparatus . still further , the use of the wavelength selecting element renders the apparatus simple and compact , and provides a very effective means for radiation control at a high sensitivity and at a high accuracy . secondly , the intensities and the intensity distributions of the ultraviolet pulses transmitted to the fluorescent glass element exposed to radiation and the reference fluorescent element are similar to each other , and the ratios of the fluorescent pulses produced by both the fluorescent glass elements are constant . therefore , the deviations of the intensity and the intensity distribution are properly corrected . lastly , the recognition code and the correction factors for each fluorescent glass element are stored , and the exposure dose is corrected in accordance with the correction factors of each fluorescent glass element whose recognition code is read at the time of the reading of the exposure dose . therefore , the correction is made at a high accuracy , and the exposure dose of each fluorescent glass element is read at a high accuracy . this arrangement does not need the manual input of the correction factors and facilitates the continuous reading of the exposure dose of fluorescent glass elements , thereby simplifying the measurement substantially . | 6 |
the invention accelerator pedal assembly 10 , broadly considered , is intended to allow efficient fore and aft movement of the pedal assembly to accommodate operators of varying anatomical dimension and is operative to generate an electronic or drive - by - wire signal in response to pivotal movement of the pedal assembly while retaining the same ergometric operation of the pedal irrespective of the position of adjustment of the pedal . pedal assembly 10 includes a mounting bracket 11 , a guide structure 12 , a carrier assembly 13 , a drive assembly 14 , a pedal assembly 16 , a resistance assembly 18 , and a generator means 20 . mounting bracket 11 is adapted to be suitably secured to the dash panel 22 of the associated motor vehicle , utilizing suitable fastener means , in known manner . guide structure 12 includes a transmission housing portion 12a and a guide rod portion 12b . transmission housing portion 12a is suitably secured to and extends rearwardly from bracket 11 and has a generally cubicle configuration defining an axial bore 12c opening at the front face 12d of the housing portion and further defining a central bore 12e in a rear wall 12f of the housing portion concentric with bore 12c . guide rod portion 12b extends rigidly rearwardly from the rear wall 12f of the transmission housing portion , is hollow so as to provide a tubular configuration defining a central circular axial bore 129 concentric with bores 12c and 12e , is open at its rear end 12h , and includes an upper axial slot 12i extending from a location proximate the transmission housing wall 12f to a location proximate guide rod rear end 12h . carrier assembly 13 includes a housing 24 , a nut 26 , a bushing 27 , and a key 28 . housing 24 is designed to move slidably along the guide rod portion 12b of guide structure 12 and preferably is formed of left and right molded acetal plastic sections 30 and 32 which are suitably joined together along a vertical plane by the use of fasteners , heat sealing or other means . left housing section 30 includes an upper portion 30a defining a through axial bore 30b and a lower portion 30c defining an annular hub structure 30d and an annular spring chamber 30e in concentric surrounding relation to hub structure 30d and including a tail portion 30f . housing 24 is mounted on the guide rod portion 12b of guide structure 12 with bushing 27 positioned in bore 30b and guide rod portion 12b positioned slidably within bushing 27 so as to mount the housing for sliding movement along the guide rod . right housing section 32 is generally hollow and includes an outer side wall 32a , a top wall 32b , a front wall 32c , a bottom wall 32d , and an angled rear wall 32e defining an opening 32f . nut 26 is circular , preferably plastic , is mounted for sliding movement in circular bore 12g of guide rod 12b , and defines a central threaded bore 26a . key 28 is seated at its lower end 28a in a notch or pocket 26b in the upper periphery of nut 26 and passes upwardly through a slot 27a in bushing 27 , through guide rod slot 12i , and through an opening 30g in the top wall 30h of left housing section 30 for securement at its upper end 28b , by fasteners 33 , to a flange structure 30i upstanding from left housing section top wall 30h . key 28 thus lockingly interconnects nut 26 and housing 24 so that movement of nut 26 in bore 12g is imparted to housing 24 so as to move housing 24 axially along guide rod portion 12b . drive assembly 14 includes a motor 34 , a cable 36 , a bracket 38 , a worm 40 , a worm gear 40 , and an elongated drive member 42 . motor 34 comprises a suitable electric motor , with position memory if required , and is suitably secured to dash panel 22 proximate bracket 11 . cable 36 comprises a well - known bowden cable and is drivingly secured at one end 36a to the output shaft of motor 34 . the other end 36b of cable 36 is drivingly attached to worm gear 40 . worm gear 40 is suitably journaled in an upwardly angled bore 12j in transmission housing 12a in angled underlying relation to bore 12c . drive member 42 includes a front journal portion 42a , a worm wheel 42b , and a rear screw shaft portion 42c . drive member 42 is positioned within guide structure 12 with journal portion 42a journaled in a retainer 44 positioned in a counterbore 12k in the front end of transmission housing 12a , worm wheel 42b drivingly engaging worm gear 40 , and screw shaft 42c extending rearwardly through bore 12e and centrally within guide rod structure 12b for threaded engagement with the threaded central bore 26a of nut 26 . it will be seen that actuation of motor 34 has the effect of rotating screw shaft 42c to thereby move nut 26 and housing 24 fore and aft along guide rod 12b with the extent of forward and rearward movement defined and limited by engagement of key 28 with the front and rear ends of slot 12i . pedal assembly 16 includes a pedal arm 46 , a pedal pad 48 secured to the lower end 46a of the pedal arm , and a pivot shaft 50 . pedal arm 46 passes upwardly through a slot 51 defined in housing 24 at the lower juncture of left and right housing sections 30 and 32 . pivot shaft 50 is fixedly secured to the upper end 46b of the pedal arm and includes a left portion 50a journaled in an aperture 30g in the outboard face of left housing section 30 concentrically within hub structure 30d and a right portion 50b journaled in side wall 32a of right housing section 32 utilizing a bushing 52 . resistance assembly 18 includes the hub portion 30d of left housing section 30 and further includes a coil spring 54 and a sleeve 56 . resistance assembly 18 is intended to provide feedback or &# 34 ; feel &# 34 ; to the operator to replace the feedback normally provided by the mechanical linkage interconnecting the accelerator pedal and the fuel throttle . with a mechanical linkage , the pedal pressure required when advancing the accelerator pedal is greater than that required to maintain a fixed position . this difference is often referred to as due to the hysteresis effect . this effect is important in maintaining the accelerator pedal in position while driving at a relatively constant speed and it must also be considered in achieving a desired deceleration time . the pressure which must be applied in accelerating is easily borne but if the back pressure of an accelerator spring produced the same effect during the time it was required to retain or maintain speed it would soon become uncomfortable for the operator to maintain a relatively constant speed . the hysteresis effect provides relief . it lessens the load required to maintain a setting of the accelerator yet there is still force to cause reverse pedal action when the foot applied pressure is removed . resistance assembly 18 provides the &# 34 ; feel &# 34 ; of a mechanical linkage including the desired hysteresis effect to relieve operator fatigue . sleeve 56 may be formed , for example , of a delrin ® plastic material and is positioned with a friction fit over hub structure 30d to define an annular plastic - to - plastic frictional interface 57 . spring 54 comprises a helical spring and is preferably formed of a suitable ferrous material . spring 54 , in addition to the primary convolutions 54a , includes a pedal tail portion 50b and a housing tail portion 50c . spring 54 is positioned in spring chamber 30e with the primary convolutions 54a in tight , surrounding relation to sleeve 56 , pedal tail portion 54 engaging a tab 46c struck from pedal arm 46 , and housing tail portion 54c positioned in the tail portion 30f of spring chamber 30e . generator means 20 comprises a potentiometer 60 positioned within the hollow of right housing section 32 and suitably secured to housing side wall 32a . potentiometer 60 includes a central shaft , constituted by pivot shaft portion 50b , a housing 60a concentric with shaft portion 50b , a plurality of resistance elements 60b mounted circumferentially around the inner periphery of housing 60a in side - by - side relation , a wiper arm 60c mounted on shaft portion 50b and operative to electrically slidably engage the resistance elements 60b in response to pivotal movement of shaft 50 , and an outlet 60d projecting rearwardly through opening 32f in right housing rear wall 32e and electrically connected to wiper 60c and resistance elements 60b in a manner such that the electrical signal appearing at the outlet 60d varies in proportion to the extent of pivotal movement of pivot shaft 50 . it will be seen that pivotal movement of pedal assembly 16 has the effect of rotating pivot shaft portion 50b and thereby varying the electrical signal appearing at the potentiometer outlet 60d so that the signal appearing at outlet 60d is at all times proportioned to and indicative of the pivotal position of the pedal . it will be understood that electric power is suitably supplied to potentiometer 60 and an electrical conduit 62 is suitably connected to potentiometer outlet 60d and extends to the vehicle function or accessory , such as the vehicle throttle , that is being electrically controlled by the pedal assembly . in operation , the position of pedal pad 48 relative to the operator is selectively adjusted by selectively energizing motor 34 to selectively move nut 26 forwardly and rearwardly within guide rod bore 12g and thereby , via key 28 , move the pedal assembly selectively forwardly and rearwardly along guide rod 12b with the limit of forward and rearward movement determined by engagement of key 28 with the respective forward and rearward ends of slot 12i . in any position of adjustment of the pedal , actuation of the pedal or release of the pedal results , in the manner previously described , in the generation of an output signal at the outlet 60d proportioned to the extent of pivotal movement . since the pivotal movement of the pedal arm is precisely the same in any position of adjustment of the pedal structure , the ergometrics of the assembly do not vary irrespective of the position of adjustment of the pedal assembly and irrespective of the anatomical stature of the operator . as the pedal is moved downwardly , a &# 34 ; feel &# 34 ; is imparted to the pedal , simulating the feel of a mechanical linkage between the pedal and the controlled vehicle system , by the combined effect of torsioning of the coil spring 54 and frictional sliding or wiping engagement between sleeve 56 and hub structure 30d at frictional interface 57 . that is , as force is applied to move the pedal downwardly , the feel imparted is additive and is equal to the combined torsional resistance of spring 54 and the frictional resistance generated at annular interface 57 between sleeve 56 and hub structure 30d . it will be seen that just as the torsional resistance provided by spring 54 increases in proportion to the extent of downwardly pivotal pedal movement , so also does the frictional resistance at interface 57 progressively increase due to the progressively greater squeezing force exerted on sleeve 56 by the progressively tightening spring 54 . as the pedal is thereafter released or allowed to return under the impetus of spring 54 , the gradually decreasing frictional force at interface 57 becomes subtractive rather than additive with respect to the gradually decreasing torsional spring force , thereby creating the desired hysteresis effect . the amount of feel imparted to the pedal can thus be precisely adjusted by adjusting the spring rate or other parameters of spring 54 , and / or by adjusting the materials or other parameters of sleeve 56 and hub structure 20d , thereby rendering it relatively easy to fine tune the system to achieve any desired feel and any desired hysteresis effect . the invention will be seen to provide an electronic adjustable pedal assembly for a motor vehicle in which the assembly may be readily adjusted to accommodate operators of varying anatomical dimensions , in which the ergometrics of the system remain constant irrespective of the position of adjustment of the pedal structure , and in which the desired hysteresis effect is provided in any position of adjustment of the pedal structure . further , the invention pedal assembly provides the desired adjustability , the desired ergometrics , and the desired hysteresis effect in a structure that is simple , inexpensive , and positive and reliable in operation . whereas a preferred embodiment of the invention has been illustrated and described in detail , it will be apparent that various changes may be made in the disclosed embodiment without departing from the scope or spirit of the invention . for example , although the invention pedal assembly has been indicated for use in controlling the throttle of the associated vehicle , the invention pedal assembly may be used to electrically control a wide variety of vehicle functions or accessories . further , although the resistance assembly 18 has been illustrated as providing the damping for an adjustable pedal assembly , it will be apparent that this resistance assembly can also be utilized to provide damping for a non - adjustable pedal assembly . | 8 |
fig1 depicts an exemplary telephone connection from a user terminal 102 to a voice processing system 108 . as previously discussed , the connection includes numerous types of switching and other equipment . an actual connection may not include all of the elements shown in fig1 . for example , if the voice processing system 108 and the user terminal 102 are located in the same town , long distance network 105 will not be needed . voice and dtmf signals originating at the user terminal 102 are routed through pbx 103 to a central office switch 104 . as indicated in fig1 the signals then traverse a long distance network 105 , which network may include any combination of numerous media such a satellite , fiber optic , microwave , etc . the voice and dtmf signals are then received by central office switch 106 , which routes them to a pbx 107 for transmission to a voice processing system 108 . the voice processing system includes one or more voice processing applications as is well known in the art . the voice processing application typically includes a dtmf detector for accepting information in the form of dtmf tones from a caller operating user terminal 102 . fig1 demonstrates how the architecture of the system emphasizes the problem of distinguishing dtmf tones from voice . specifically , a signal originating at user terminal 102 must traverse numerous different switching equipment and communications media before reaching the voice processing system 108 . thus , the signal finally received at voice processing application 108 will include noise , interference , etc . moreover , a voice signal leaving user terminal 102 may include energy in the frequency bands corresponding to one or more dtmf tones . thus , the dtmf detector at the voice processing system may mistake a noisy voice signal for dtmf tones , causing the voice processing system to enter some undesired mode . fig2 shows a block diagram of a device in accordance with the teachings of the present invention . such a device would be used to interface the voice processing system 108 either directly to the telephone network or to a pbx for connection to the telephone network . the arrangement of fig2 includes a telephone interface circuit 201 , for transmitting and receiving signals from either a pbx or the telephone line . analog - to - digital ( a / d ) convertor 202 and digital - to - analog ( d / a ) convertor 203 may be purchased as a single package , known in the art as a coder / decoder ( codec ). echo canceller 204 serves to cancel echoes on the telephone lines caused by impedance mismatch . echo cancellers are known in the art and the details of the design of one exemplary echo canceller are set forth in the paper &# 34 ; digital voice echo canceller with tms32020 &# 34 ; by messerschmitt and available from texas instruments . this paper is hereby incorporated by reference . of course , other echo cancellers may be utilized . call progress monitor 205 detects signals such as busy , ringing , etc . the implementation of such a device is well known in the art , as exemplified by u . s . pat . nos . 4 , 540 , 855 and 4 , 477 , 698 , both of which are hereby incorporated by reference . dtmf detector 206 detects and decodes dtmf tones entered by the remote user . numerous dtmf detectors are known in the art , one such detector being described in &# 34 ; general purpose tone decoding and dtmf detection &# 34 ; by craig marven and available from texas instruments . this article is also hereby incorporated by reference . speech detector 207 detects the presence of speech in an incoming signal . an exemplary speech detector is shown and described in u . s . pat . nos . 4 , 979 , 214 ( the &# 39 ; 214 patent ) to hamilton and assigned to the assignee of the present application . the &# 39 ; 214 patent is incorporated by reference herein . the exemplary voice processing application ( vpa ) 210 may be of the type which receives and plays back voice messages . additionally , vpa 210 may have the capability to dial out using dtmf tones , or to execute commands based upon remotely entered dtmf tones . audio record process 208 and audio playback process 209 are also well known among those in the voice processing industry . these portions of the system serve to assist vpa 210 in recording and playing back voice messages to and from a remote user . in operation , a telephone connection is established between a remote user terminal ( not shown ) and an exemplary voice processing application 210 . when vpa 210 is in playback mode , meaning that a message is being played to the remote user , the message is sent to audio playback process 209 . playback process 209 produces the audio signal and transmits it to d / a convertor 203 , which transmits the voice signal in analog form out over the telephone line . the played back signal is also fed to echo canceller 204 , as shown , in order to help cancel echoes being received from the telephone line . during record mode ( e . g ., when the caller desires to enter a voice message ), the incoming voice message is digitized by a / d convertor 202 and recorded in digital form by audio record process 208 . whether in record mode , playback mode or any other mode , signals received from the telephone line are input to a variety of voice processing functions as indicated by blocks 205 - 207 . of course , there may be one or more additional such functions , or , alternatively , one or more of the voice processing functions shown may be eliminated . in accordance with the teachings of the present invention , when vpa 210 is to begin recording incoming speech , a record mode ( rm ) signal on line 211 is driven high . not only does this signal activate the record mode process 208 , but it also drives high one of the two inputs to nand gate 212 . as shown in fig2 speech detector 207 analyzes the signal being received , and drives line 216 high if it determines that speech is present . it can therefore be appreciated that the output 213 of nand gate 212 will be driven low when both ( i ) speech is detected by speech detector 207 , and ( ii ) vpa 210 is in the record mode . during any time that output 213 of nand gate 212 is low , valid digit present ( vdp ) line 215 from and gate 214 will be low . the detection of a dtmf digit during this time by dtmf detector 206 will place a high on digit present ( dp ) line 217 , but this dp signal will effectively be masked off because it will not pass through and gate 214 . thus , when vpa 210 is in record mode and the remote user is speaking , any dp signal from dtmf detector 206 which indicates a dtmf digit is present will be ignored . the arrangement takes advantage of the fact that during record mode , the remote user is unlikely to press a dtmf digit while he is speaking . while this example uses record mode , it should be understood that the invention contemplates changing dtmf detection parameters based upon the vpa being in any predetermined one or more of its possible modes . in a second embodiment of the invention , the record mode input to nand gate 212 can be eliminated . this input to nand gate 212 can be placed in a permanent high state . the dtmf detector would then be deactivated whenever there is speech detected . this embodiment may be less desirable because speech detector 207 could , during playback , detect echoed speech and deactivate the dtmf detector . thus , the remote user may not be able to cut through messages being played back during a time when those played back messages simulate a dtmf tone . in an additional embodiment , the speech detector is utilized as an input to vpa 210 in order to assist in adjustment of parameters during recording . specifically , when the speech detector determines that there is no speech being received , storage space in the voice processing application may be preserved by not recording silence , dtmf tones , noise , etc . the system may record the length of time during which there is no speech . upon playback , a silent period of equal duration can be reinserted . moreover , processing power in vpa 210 can be more effectively utilized because vpa 210 can perform other tasks or enter other modes during intervals of time where there is no speech present . indeed , the detection of speech can be used as an input to modify the activities ( i . e ., change the mode ) of vpa 210 in any desired manner as user specific requirements dictate . in an optional enhancement , the echo canceller 204 is employed to assist in the adjustment of the parameters of dtmf detection . before describing this enhancement , it is believed that a brief review of the function and purpose of echo cancellers would be helpful . fig3 shows a block diagram of a portion of a typical system including an echo canceller . the echo cancellor of fig3 is arranged to cancel far end echoes . those of ordinary skill in the art are aware that such echo cancellers can be configured to cancel far end echoes , as in fig3 or near end echoes , as in fig2 . which particular type of echo canceler is used is not critical to the present invention . an audio signal a ( t ) is transmitted through telephone line 301 and is transferred to both a hybrid 303 and to an echo canceller 304 . a part of the signal a ( t ) is echoed from hybrid 303 and transmitted back toward the source of a ( t ). this echoed signal e ( t ) is added to the outgoing signal s ( t ) from handset 302 and transmitted toward the remote source of a ( t ). the exemplary echo canceller of fig3 operates by estimating , principally from channel characteristics , the echo e ( t ) which will be produced by the channel . as shown in fig3 echo canceller 304 simulates the transmission channel through hybrid 303 , thereby producing an estimate e &# 39 ;( t ) of the echo e ( t ). this estimate is then transmitted to adder 305 , where it is utilized to cancel e ( t ) as shown . since the echoed signal , and therefore its estimate e &# 39 ;( t ), depend largely upon channel characteristics , and since these characteristics vary , many echo cancellers dynamically adapt the parameters utilized by the echo canceller to produce e &# 39 ;( t ). 0f course , in practice the cancellation is not perfect . it can be seen that a ( t ) and s ( t ) will be non - zero when there is energy travelling in both directions on the telephone lines ( e . g ., when speakers on both ends of the connection speak simultaneously ). this situation is termed &# 34 ; double talk &# 34 ;. when double talk occurs , adaptation of the echo canceller parameters is stopped in order to prevent the echo canceller from becoming unstable . for the above reasons , most echo cancellers include a double talk detector for distinguishing between actual incident signal ( from the remote source ), and echo . in accordance with an optional improvement to the present invention , the double talk detector within the echo canceller can be used to modify the parameters of dtmf detector 206 . for example , if the double talk detector determines that the only signal being received is echo ( i . e ., neither voice nor tones are being transmitted from the remote user ), the dtmf detector could be turned off . in this manner , the risk of the dtmf detector interpreting an echoed message being played back from vpa 210 as a valid dtmf tone from a remote user is greatly reduced . in still another optional enhancement , the speech detector can be used to adapt parameters related to the other components of the system , as well as being used to adapt the dtmf parameters . for example , if speech detector 207 detects speech , a signal could be sent to call progress monitor 205 , which signal would indicate that a connection has been made . in an additional enhancement , the played back message is utilized to assist in adjustment of the parameters of the tone detector . specifically , with reference to fig4 a second tone detector 401 , not to be confused with dtmf detector 206 , is utilized to examine the entire bandwidth in which dtmf tones fall . if a dtmf tone is detected as being simulated in a message being played back , then dtmf detector 206 has its parameters adjusted to desensitize it to that particular tone . such an adjustment to dtmf detector 206 decreases the chance that dtmf detector 206 would incorrectly interpret an echo from an outgoing message as an incoming dtmf tone . the above describes the preferred embodiment of the invention . it will be apparent to those of ordinary skill in the art that other variations and modifications are possible . the invention is not limited to the exemplary implementations disclosed herein . | 7 |
a simple , ultra - low cost , commuter vehicle could create a whole new global market , filling the price gap between bicycles and automobiles . one way to develop a low - cost vehicle is to keep the design simple while balancing factors such as meeting the most basic of transportation needs , minimizing weight , and using the fewest possible numbers of parts by having individual components serve multiple functions . ultra - light weight is also a key consideration in making “ zero - emission ” electrified vehicles commercially viable . since the battery is often one of the most expensive parts of an electric vehicle , and battery sizing is primarily determined by vehicle weight ; light - weight , low - cost vehicles provide an opportunity for electric vehicles to commercially succeed . furthermore , space is at a premium in congested mega - cities such as those in china and india . consequently a vehicle that can fold into a smaller footprint when parked is a desirable feature . moreover , an architecture that is low investment , and can be flexibly configured with minimal change ( e . g . 2 - passenger , 4 - passenger , pick - up , etc .) for varying customer needs , helps create a business case the can profitably support an ultra - low sales price . an example ultra - light weight , low - cost , folding vehicle is described below . one implementation includes a 4 - wheeled lightweight vehicle that uses an x - frame ( side - view ) structure . the x - members can pivot at a central axis in the side - view , allowing the frame to fold . lateral tubular cross - members connect the x - members to create the frame , and also provide support for the seats . horizontal tension beams or cables or vertical compression beams between the ends of the x - members make the frame stiff vertically , yet allow the frame to fold longitudinally when the vehicle is not in use , by either disconnecting the members or allowing the cables to fold . conversely , when attached , the horizontal members or vertical tension members or cables may limit the ability of the vehicle to fold in front or rear impact or when the floor is loaded vertically . the seats may attach to two cross - members behind the seat back and under the occupant &# 39 ; s thighs . the seats can be either rigid or fabric sling seats designed to attach to the vehicle cross - members . the sling seats can also form the floor support . regardless of the material , the seat design may still allow the vehicle to fold . by adding a tandem x - frame structure , the same basic components can be used to make a 4 - passenger vehicle . cross - member length determines the number of occupants that can sit laterally . consequently , single passenger , 2 - passenger tandem , 2 - passenger 2 - abreast , 2 - row 4 - passenger and 2 - row 6 - passenger 3 - abreast models are possible , using the same basic vehicle architecture and many of the same components ; and other vehicle model versions are possible . for example , a 4 - passenger model can be converted into a 2 - passenger pick - up by the addition of a removable pick - up bed . the example vehicles described below address various issues relative to introducing mass - market vehicles to emerging markets , large urban areas where space is a premium , or both . the vehicles maximize design simplicity by using only those components required to achieve the desired function and using minimum manufacturing processing , i . e . minimal welding , machining , forming , etc . several components of the vehicles are designed to perform multiple functions . for example , chassis cross - members can double as the seat structure . the vehicles can further reduce weight by using cables in place of rigid members for key tension loads . the vehicle can further fold into a smaller footprint , minimizing parking and storage space , and , in some instances , “ kitted ” so that it can be shipped globally in small , high - density packages . in some implementations , the vehicle may be powered electrically or by another fuel source such as gasoline ( e . g ., via an internal combustion engine ). the vehicle may further incorporate various drive mechanisms such as rear wheel drive ( rwd ), front wheel drive ( fwd ) or all - wheel drive ( awd ). other features of the vehicle may include a design that localizes masses to minimize weight effect on the chassis structure to synergistically reduce vehicle weight , a modular and scalable design that allows for a number of different models from essentially the same components ( 1 - pass , 1 - pass pick - up , 2 - pass transverse , 2 - pass tandem , 4 - pass , 6 - pass , 2 - pass pick - up , 2 and 4 - pass golf carts , atvs , light tractors , etc . ), and the ability to upgrade the vehicle with optional features for more developed markets . accordingly , a vehicle is described below that has a simplistic design , both minimizing cost and manufacturing investment , has a reduced weight relative to other vehicles , and has a flexible and scalable architecture . such a vehicle may be well - suited for rapidly growing countries , like china and india , emerging markets such as various countries in africa , and urban areas in developed countries . other potential markets include neighborhood electric vehicles ( nevs ) in developed countries , rental vehicles in vacation or resort communities , or the like . the vehicles and components shown in the figs . may take many different forms and include multiple and / or alternate components and facilities . the exemplary components illustrated are not intended to be limiting . indeed , additional or alternative components and / or implementations may be used . referring to fig1 and 2 , an example 2 - passenger folding vehicle 100 includes an x - frame structure 105 configured to pivot at the intersections of the x members 110 , a seat 115 that may be attached to a cross - member 120 located at a center of an x pivot 125 ( i . e ., where two x members 110 intersect ) and an upper rear cross - member 120 behind the passenger &# 39 ; s shoulders , upper and lower members 110 configured to attach front and rear axles 130 to the vehicle structure 105 , a tension cable or detachable horizontal ( tension ) or vertical ( compression ) member that controls vehicle 100 extension , and a detachable vertical tension cable , horizontal ( compression ) or vertical ( tension ) member that , e . g ., prevents the vehicle 100 from folding upon front or rear impact . the vehicle 100 , as shown , may be configured to power fold , extend , or both . further , by setting a brake or parking brake at one end of the vehicle 100 , the driven wheels 135 at the other end can be used to actuate the longitudinally folding or extending of the vehicle 100 . the x - member structure 105 may include individual beams 140 connected by a pivot joint at an intersection point . horizontal axis pivot joints may also located at pivots 125 a , 125 b , 125 d , and 125 e . lateral horizontal cross - members 120 may be configured to connect the corresponding pivots 125 of the x - members as shown in the plan view of fig2 . the cross - members 120 between pivots 125 f and 125 r may be used , e . g ., to improve lateral stiffness . referring back to fig1 , the seat 115 may be attached to the cross - member 120 extending between the pivots 125 d located behind the passenger &# 39 ; s shoulders and the cross - member 120 extending between the pivots 125 c behind the passenger &# 39 ; s knees . the seat 115 can be formed from a rigid for flexible material . for instance , the seat 115 may include a fabric sling attached to the cross - members 120 . the seat 115 may be removed from the vehicle 100 by , e . g ., unlatching the seat 115 or otherwise disconnecting the seat 115 from the cross - members 120 . with regard to the sling seat 115 , the fabric can be extended forward to form a floor 155 and dash panel by attaching a forward most edge to the cross - member 120 between the pivots 125 a , 125 f and / or 125 b . referring to fig3 a and 3b , the upper front members 110 c may be attached to a front axle 130 f , and upper rear member 110 e may be attached to the rear axle 130 . lower front member 110 d and lower rear member 110 f may connect to the upper members 110 c and 110 e through pivots 125 f and 125 r , respectively . note that front and rear axle 130 centerlines may be coincident with pivots 125 f and 125 r . for smaller wheel diameters , however , the upper members 110 c and 110 e may be extended past the pivots 125 f and 125 r , as shown , to provide adequate ground clearance to the frame while the vehicle 100 is in the extended position , the folded position , or both . in addition , the lengths of the cross - members 120 and x - members 110 may be adjusted to change the ride height , the length of the vehicle 100 when extended , and the length of the vehicle 100 when folded ( see fig4 b ). at the minimum folded length , shown in fig4 b , the front and rear wheels 135 may overlap , requiring different track widths for the front and rear axles 130 . a wider front track may provide adequate steer turn angles without excessive vehicle 100 width . staggered track widths may also allow nesting of folded vehicles , allowing , e . g ., approximately five 4 - passenger or six 2 - passenger folded vehicles to be lined up in a single 20 foot parking space . referring to fig5 , options for a floor structure 155 for the vehicle 100 that still allow the vehicle 100 to fold include rigidized fabric ( see fig1 ) draped from the cross - member 120 c and attached to the cross - members 120 a , 120 b , or 120 f . another option may include incorporating a rigid folding floor linkage 160 between pivots 125 b and 125 e , as shown in fig5 . another possible implementation , shown in fig6 a and 6b , includes using a rigid sliding floor 155 attached to , and configured to pivot about , cross - member 120 b or cross - member 120 e , and configured to slide along an opposite cross - member 120 e or cross - member 120 b , respectively , as the vehicle 100 is adjusted to the folded position . because the floor structure 155 of fig6 a and 6b does not change when the vehicle 100 is folded , the floor structure 155 may act as a mounting surface for one or more batteries 260 , providing easy access to the battery 260 for , e . g ., removal , charging , or both . referring back to fig1 , the horizontal tension cable 165 or detachable member may control the extended length of the structure 105 while still allowing the vehicle 100 to be folded longitudinally . the cable or detachable link is shown connecting pivots 125 b and 125 e , but may also be attached to the corresponding cross - members 120 , or the members 110 near the pivots 125 . the cable or detachable link can alternatively be located to join any one or more horizontal pivots 125 ( such as 125 f and 125 c , 125 c and 125 r , or 125 a and 125 d ). to help keep the vehicle 100 in the extended position in a front or rear impact , similar detachable cables or rigid members 180 may be attached to the cross - members 120 or members 110 near the vertical pivots ( 125 a and 125 b , or 125 d and 125 e ). fig7 a - 7d illustrate different ways to stabilize the vehicle 100 when in the extended position and , in some instances , reduce the likelihood that the vehicle 100 will fold following a front or rear impact . a continuous cable 165 is depicted in fig7 a . the cable 165 may be routed horizontally between pivots 125 b or 125 e with the vertical portion routed through or around either pivots 125 a or 125 d . two cable stops 170 may control the extended length while a cable latch 175 may be used to lock in the vertical safety portion of the cable 165 . the latch may be disengaged to fold the vehicle 100 . fig7 b depicts a latching vertical member 180 . the vertical member 180 may be attached between pivots 125 a and 125 b or 125 d and 125 e . the vertical member 180 may be configured to slide through the upper attachment at pivot 125 a or 125 d and rest upon a down stop 185 to control the extended length . the vertical member 180 may be held in place with a safety latch 190 to prevent folding upon front or rear impact . disengaging the safety latch 190 may allow the vehicle 100 to fold . referring now to fig7 c and 7d , the rigid sliding floor 155 may be modified to simultaneously control the extended position and prevent folding upon front or rear impact . a hasp - type slot 195 may be configured to engage the pivot 125 e cross - member 120 to , e . g ., control the extended position . when the vehicle 100 is unfolded , the rear axle 130 b cross - member 120 may slide into the hasp - type slot 195 in the floor structure 155 . an additional slot 200 may be configured to hold the vehicle 100 in the folded position . the operator can lift the rear of the floor 155 to disengage the slots 195 , 200 , so that the vehicle 100 can be extended or folded . fig7 e and 7f show vehicles 100 with the sliding vertical member 180 of fig7 b and the sliding floor structure 155 of fig7 c and 7d . the down stop 185 of the vertical member 180 may be configured to restrain the vehicle 100 in the extended position while the floor structure 155 may be configured to prevent the vehicle structure 105 from folding on impact . the slot 200 may be configured to hold the vehicle 100 in the folded position . in some implementations , the latches described above may be omitted and the vehicle 100 may be folded or extended by , e . g ., lifting the rear end of the floor 155 . referring now to fig8 , some cross - members 120 may be curved in the side view to improve ingress / egress of the driver and passenger , and can also be swept in the front view to improve aesthetic appearance , without affecting vehicle 100 function or folding . moreover , the x - members need not be co - planar for the folding geometry to function . fig9 a - 9c illustrate a vehicle structure 105 with a member 110 a moved to the center of the vehicle 100 . additional outboard links 205 between pivots 125 c and 125 e may be configured to add stability to the structure 105 . this arrangement may allow for a more car - like ingress and egress feel for the occupants as they need not climb over an outboard member 110 a to enter or exit the vehicle 100 . other non - planar arrangements of the x - members are possible . fig1 a and 10b illustrate an example steering mechanism . the steering mechanism may include , e . g ., a bell - crank , a rack & amp ; pinion system , or the like . the bell - crank system shown in fig1 a and 10b includes a steering column 210 configured to fold along with the vehicle structure 105 . the steering column 210 may be attached to the cross - member 120 between the pivot 125 a and front axle 130 a through pivot blocks 215 . thus the steering column 210 may be configured to move with the upper link and cross - member 120 assembly as the vehicle 100 is folded . the bell crank 220 may be attached to the end of the steering column 210 . tie rods 225 may be connected to steering arms 230 that are part of the steering knuckles . right - or left - hand steering can be accommodated by , e . g ., moving the pivot blocks 215 and reversing the bell crank 220 linkage . fig1 a and 11b depict a possible front suspension arrangement for , e . g ., rough road capability . as shown , the upper members 110 may be replaced by coil - over shocks 235 and the lower members 110 may be replaced by a triangular control arm 240 that attaches the pivots 125 b to the front axle 130 f . the steering mechanism , shown in fig1 a and 10b , may be attached to the axle 130 with suspension motion accommodated by a splined and u - jointed intermediate shaft to the steering column 210 . another optional suspension arrangement may be configured for the rear axle 130 r with upper members 110 replaced by coil - over shocks 235 and lower members 110 replaced by a triangular control arm 240 that attaches the pivots 125 e to the rear axle 130 r . another potential suspension system may include transverse front and rear leaf springs with solid axles 130 . fig1 a and 12b show a vehicle 100 having controlled vertical compression when , e . g ., the vehicle 100 encounters rough roads . the vehicle 100 includes an extension spring 245 and / or shock 235 in the horizontal cable 250 / member 110 or compression spring 245 and / or shock 235 in the vertical member 180 . rough road inputs can be absorbed by vertical compression of the vehicle structure 105 through various pivots 125 . fig1 depicts one of the many possible powertrain arrangements . both internal combustion and electric power arrangements can be accommodated . in the arrangement depicted , drive is delivered by two rear electric hub motors 255 mounted within the wheels 135 ; however , a conventional rear axle 130 r with a single electric motor 255 and differential is one of the many other possibilities . at least one removable battery 260 may be disposed in the vehicle 100 , such as mounted on the floor 155 . multiple removable batteries may be electrically connected in parallel to increase the range of the vehicle 100 , and the batteries may be removable so that they can be carried into the home for charging or easily swapped with freshly charged batteries . an example removable battery pack 265 is shown in fig1 a and 14b . the removable battery pack 265 may allow an operator to carry the battery 260 for , e . g ., security , remote charging , or both . in some possible implementations , the removable battery pack 265 may be configured to attach to cross - members 120 located , e . g ., behind one of the seats 115 . the vehicle 100 can incorporate any number of powertrain , drive , and passenger configurations . examples of powertrain configurations , as discussed above , may include internal combustion , electric , or hybrid . examples of drive configurations may include front wheel drive , rear wheel drive , or all wheel drive configurations . moreover , as discussed above , the vehicle 100 may include a suspension system . examples of passenger configurations may include a single passenger configuration , a single passenger pick - up configuration , a 2 - passenger tandem configuration , a 2 passenger abreast configuration , a 4 - passenger / 2 - abreast configuration , a 6 - passenger / 3 - abreast configuration , a 2 - passenger / 2 - abreast / pick - up configuration , a 3 - passenger / 3 - abreast / pick - up configuration , etc . fig1 a and 15b illustrate different views of an example 4 - passenger model of the vehicle 100 . through the addition of more x - members plus additional cross - members 120 , the 4 - passenger model can be created from the simplistic 2 - passenger model discussed above . as shown , the 4 - passenger vehicle 100 is shown with optional front hub motors 255 to give the vehicle 100 all wheel drive functionality . the vehicle 100 can be fitted with an optional , e . g ., 2 - foot pick - up box 270 as shown in fig1 a and 16b for transport of light duty goods . while a 2 - passenger vehicle 100 is shown in fig1 a and 16b , the pick - up box 270 could also be applied to other vehicle 100 configurations , including the 4 - passenger model , as discussed below with reference to fig1 a and 17b . the pick - up box 270 may be connected via , e . g ., the hook 275 to one cross - member 120 and latched to another cross - member 120 d . when the latch 280 is released , the pick - up box 270 may be configured to pivot about pivot 125 r so that the folded length of the vehicle 100 can remain relatively unchanged . the pick - up box 270 may be configured to easily detach when the operator desires to remove the pick - up box 270 from the vehicle 100 . referring now to fig1 a and 17b , the rear seats 115 of a 4 - passenger model vehicle 100 may be removed , and a 4 - foot box 270 may be added , resulting in a 2 - passenger pick - up . the box 270 may be attached ( i . e ., hooked ) to the cross - member 120 r and latched to the cross - member 120 d . the box 270 may be configured to pivot to a dump position by , e . g ., releasing the latch 280 and power folding the vehicle 100 such that the cross - member 120 r slides forward to engage the front hook 285 , allowing the box 270 to rotate about the cross - member 120 r . the dump position may further permit the vehicle 100 to be parked in a folded condition for cramped environments . the pick - up box 270 may installed or removed by engaging or disengaging , respectively , the latch 280 and hooks 275 . the vehicle 100 may be further modified to comply with various safety , regulatory , and customer needs . safety and regulatory features may include windshield , wipers , fenders , seatbelts , headlights , taillights , turn signals , mirrors , ignition key , reflectors , 4 - wheel brakes , a parking brake , etc . fig1 a and 18b illustrate a vehicle 100 having a 3 - point harness 280 to the implementation illustrated in fig9 a - 9c . the 3 - point harness 280 may be installed by attaching belt buckle receivers 295 to the member 110 a . the rear of the members 110 b may be extended vertically to attach shoulder belts 300 while the lap belts 305 may be attached to the members 205 between pivots 125 c and 125 e . a similar arrangement can be used with the parallel x - frame structure 105 illustrated in fig1 . in that case , the member 205 between the pivots 125 c and 125 e may be mounted centrally to provide an attachment for the belt buckle receivers 295 . customer customization options may include various types of weather protection and storage features such as a rigid roof 310 , flexible canopy top 320 , front and rear valences 330 , fabric side panels 335 , storage basket 355 , a sling trunk 350 , zip - out doors , and scissor doors 340 . an optional hard roof 310 , shown in fig1 a and 19b , may allow the vehicle 100 to fold by pivoting along one vertical member 180 and sliding along another vertical member 180 , similar to the sliding floor 155 described above . the vertical members 180 ( previously discussed with reference to fig7 b ) may be extended vertically and connected cross - car in order to provide a sliding roof 310 support . the roof 310 may be hinged to the windshield header 315 to allow a rigid roof 310 to slide rearward relative to the orientation of the vehicle 100 as the structure 105 is folded . fig2 a and 20b illustrate other weather protection customizations . a canopy top 320 may be attached to the windshield header and may be supported by the roof support 180 described above . a bottom of the canopy may be attached to the members 110 e and rear axle 130 r through snaps or other types of connectors . a zip out backlite 325 may be configured to provide storage access . a front valence 330 may be formed from a rigid panel or waterproof fabric . side panels 335 may be formed from a 4 - way stretch fabric , such as an elastic polyurethane fabric ( e . g ., lycra ), and may be attached to the pivots 125 . scissor doors 340 made of a polycarbonate material , like lexan , may be mounted to a door beam 345 configured to swing about the pivot 125 a or 125 f and latch to the pivot 125 c or 125 d . the vehicle 100 may be configured to fold when the doors are in the open position . another customization may relate to additional storage options , including storage compartments . fig2 a - 21d illustrates various views of a sling 350 ( fig2 a and 21b ) and an under - seat expanding basket 355 ( fig2 c and 21d ) that may be used as storage options . the sling 350 may be configured to be attach to a cross - member 120 extending behind one of the seats 115 . the expanding basket 355 may be configured to rest on a floor 155 under or behind one of the seats 115 . the storage compartments 350 , 355 may be formed from a rigid or flexible material . referring now to fig2 a - 22f , the vehicle structure 105 may be made up of multiple flat plane assemblies . therefore , for purposes of packaging and shipping , the vehicle 100 can be packed in a flat , partially assembled state , along with the wheels 135 . this results in a very compact package that can be efficiently shipped around the world . fig2 a - 22f illustrate example combinations of parts of the vehicle 100 that may be combined for purposes of packaging and shipping the vehicle 100 . with regard to the processes , systems , methods , heuristics , etc . described herein , it should be understood that , although the steps of such processes , etc . have been described as occurring according to a certain ordered sequence , such processes could be practiced with the described steps performed in an order other than the order described herein . it further should be understood that certain steps could be performed simultaneously , that other steps could be added , or that certain steps described herein could be omitted . in other words , the descriptions of processes herein are provided for the purpose of illustrating certain embodiments , and should in no way be construed so as to limit the claims . accordingly , it is to be understood that the above description is intended to be illustrative and not restrictive . many embodiments and applications other than the examples provided would be apparent upon reading the above description . the scope should be determined , not with reference to the above description , but should instead be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . it is anticipated and intended that future developments will occur in the technologies discussed herein , and that the disclosed systems and methods will be incorporated into such future embodiments . in sum , it should be understood that the application is capable of modification and variation . all terms used in the claims are intended to be given their ordinary meanings as understood by those knowledgeable in the technologies described herein unless an explicit indication to the contrary is made herein . in particular , use of the singular articles such as “ a ,” “ the ,” “ said ,” etc . should be read to recite one or more of the indicated elements unless a claim recites an explicit limitation to the contrary . the abstract of the disclosure is provided to allow the reader to quickly ascertain the nature of the technical disclosure . it is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims . in addition , in the foregoing detailed description , it can be seen that various features are grouped together in various embodiments for the purpose of streamlining the disclosure . this method of disclosure is not to be interpreted as reflecting an intention that the claimed embodiments require more features than are expressly recited in each claim . rather , as the following claims reflect , inventive subject matter lies in less than all features of a single disclosed embodiment . thus the following claims are hereby incorporated into the detailed description , with each claim standing on its own as a separately claimed subject matter . | 1 |
an assembly for thermal insulation of mr magnets is depicted in fig1 in the form of a cutaway view . the mr magnets are disposed on a spool carrier 27 , and designed as coils . at least some of the coils are superconducting . both shielding coils 26 and base field coils 28 and 29 are depicted . in order to cool the superconducting coils to the necessary low temperatures , these coils are surrounded by a coolant , typically helium . the coolant is located , together with the coils , in a coolant container 30 . because the coils are supplied with energy during the operation of the mr tomography apparatus , heat is generated during the operation . this causes a heating of the coolant in the coolant container 30 . in order to discharge the heat , and to maintain the necessary low temperatures , a cooling unit 23 , a so - called “ coldhead ” is provided . the cooling unit 23 serves to generate cooling energy , or to discharge heat from the coolant container 30 to the exterior . it can be designed in a two - step manner , and have a conventional structure . coolant gas resulting from heating the coolant can be discharged through venting openings 20 , 21 into the environment , in order to prevent excessive pressure in the coolant container 30 . the venting openings 20 , 21 are sufficiently large enough to ensure a high enough flow rate in the case of an unintentional , abrupt occurrence of large quantities of coolant gas . an unintentional abrupt occurrence of large quantities of coolant gas in this manner can be triggered when the superconducting temperature is exceeded in one of the superconducting coils , which is referred to as a quench , for which reason the venting openings 20 , 21 are also referred to as quench pipes . the coolant container 30 is encompassed by a thermal insulation in the design of an actively cooled thermal shield 25 . optionally , an additional , further shielding foil can be provided between the thermal shield 25 and the outer wall of the container 24 . the screening foil can be of a conventional type , e . g . a multi - layered insulating foil ( mli : multi - layer - insulation ) can be used . as a further thermal insulation , the container in which the coolant container 30 , including the mr coils , is disposed , is designed as a vacuum container 24 . it has a double wall in which a vacuum 12 is generated . the container in which the mr coils are disposed encompasses the bore 31 in which an object under examination , or a patient to be examined , respectively , is located during the mr imaging . moreover , only the upper half of the cross - section of the vacuum container 24 , coolant container 30 and coil carrier 27 , including the mr coils , is depicted in the image . the container 24 , including the components disposed therein , encompasses the bore 31 in a continuous manner , from all sides , and is , in this regard , disposed cylindrically about the bore 31 in the conventional manner . the shape of the container 24 , including the components disposed therein , is not , however , significant with respect to the invention explained below . a cryostat opening 15 is provided in the container 24 , through which the cooling unit 23 is disposed , such that it can be brought into contact with the coolant container 30 , or the coolant located therein , respectively . the cryostat opening 15 thus serves for the discharge of heat from the coolant container 30 to the environment , and thus represents a heat bridge , or gap , respectively , in the thermal insulation , through the container 24 . the cooling unit 23 is installed in a maintenance assembly 22 . typically , the cooling unit 23 is powered by electricity , in order to bring about the discharge of heat from the coolant container 30 into the substantially warmer environment . it is apparent that , when the cooling unit 23 is not functioning , heat can be transferred from the environment through the cooling unit 23 , or the cryostat opening 15 , to the coolant container 30 . in this regard , the cryostat opening 15 comprises a relatively large heat bridge , which results in an undesired substantial heat input , e . g . during transportation . the container 24 , with the mr coils disposed therein , and including the cooling unit 23 , is depicted anew in fig2 . reference is made to the above description regarding the individual components . in order to prevent an undesired heat input when the cooling unit 23 in the vacuum container 24 , or the coolant container 30 , is not active , a protective cap is placed over the cryostat opening 15 , including the cooling unit 23 disposed therein . the protective cap 32 has a wall that is impermeable to air , the bottom of which has a sealing surface 35 on the side facing toward the container 24 , that is placed on a seal 34 , which in turn lies on a sealing surface 36 of the container 24 . an airtight seal is created by the sealing surfaces 35 , 36 and the seal 34 therebetween , between the container 24 and the protective cap 32 . for thermal insulation , a vacuum is generated in the space enclosed between the protective cap 32 and the container 24 . it is apparent from the depiction that the vacuum 12 encompasses the cryostat opening 15 on all sides , and thus thermally insulates the cryostat opening . thus , a heat input through the cryostat opening 15 from the environment is prevented or at least limited . coolant gas is generated by the nevertheless resulting , slow heating of the coolant in the coolant container 30 , despite all of the insulating measures , including the protective cap 32 , causing an increase in pressure in the coolant container 30 . in order to counteract , or to limit , respectively , this increase in pressure , a venting pipe 33 is provided . the venting pipe 33 is connected at one end to the interior of the coolant container 30 , and open at the other end to the environment outside the container 24 and the protective cap 32 . the venting pipe 33 is equipped with a pressure valve 18 . the pressure valve 18 limits the excess pressure in the coolant container 30 at a predefined level , and allows excess coolant in the gaseous state to escape into the environment . the pressure valve 18 can be provided in addition to an already present venting valve , and allows for a higher pressure than the venting valve in the interior of the coolant container 30 . an embodiment without an additional pressure valve of this type , having only quench and venting valves , is also possible . because the protective cap 32 is not in place during the operation of the mr tomography apparatus , but instead is used primarily during transportation thereof , there is no reason to anticipate an abrupt increase in pressure in the coolant container 30 , e . g . in the case of a quench . in this regard , the quench pipes 20 , 21 are not necessary , but rather , the relatively small venting pipe 33 is sufficient . because of the small diameter of the venting pipe 33 , these also represent only a limited heat bridge . accordingly , they are as small as possible , because they must be in contact with the environment , and thus a heat input from the environment via the walls of the venting pipe 33 cannot be prevented . in order to further reduce a heat input via the venting pipe 33 , this can be designed such that the path for the coolant in the gaseous state flowing through the venting pipe is longer than its external length . in order to obtain the longest possible effective length in this manner , it can , for example , take the shape of a spiral . as a result , a longer dwell time for the vaporizing coolant in the venting pipe 33 is obtained , which in turn results in a better cooling of the pipe . in order to further reduce a heat input via the venting pipe 33 , this can be formed of a material having a low thermal conductivity . for this purpose , aluminum , for example , could be used , which additionally has the advantageous property that with a decrease in temperature , the thermal conductivity decreases further . other suitable materials are : stainless steel , inconel , kevlar or teflon . with conventional constructions of the vacuum container 24 , including the cooling unit 23 and maintenance assembly 22 , an airtight sealed connection between the components is provided , such that the vacuum 12 enclosed by the protective cap 32 is limited to the space between the protective cap 32 and the vacuum container 24 , as well as the maintenance assembly 22 and the cooling unit 23 . depending on the construction , a further expansion of the vacuum 12 would be conceivable , which is of no significance to the invention . for the invention , it is only significant that the cryostat opening 15 is fully , or as fully as possible , surrounded by the vacuum 12 against the environment outside the protective cap 32 and the container 24 for the thermal insulation . the container 24 , including the mr coils and other components , is again depicted in fig3 . with respect to these components , reference is made to the above description . the depicted embodiment differs with respect to the means for thermal insulation at the cryostat opening 15 . in this embodiment , a protective cap 42 is placed in the cryostat opening 15 instead of the cooling unit . the cooling unit itself is removed for this purpose . because the protective cap 42 is primarily used for transportation purposes , the absence of a cooling unit is not important , since it does not function during transportation . the protective cap 42 can thus be placed in the cryostat opening 15 in place of a cooling unit , and furthermore is located on the container 24 at a position comparable to the maintenance assembly 22 disposed there . it can be installed either in place of the maintenance assembly 22 , or in an alternative embodiment , can be formed by the maintenance assembly 22 , which for this purpose must be designed in a suitable manner , and the opening otherwise provided for the cooling unit must then be modified in a corresponding manner , for forming the protective function of the protective cap 42 . as an example , the maintenance assembly can be constructed such that it is airtight , or vacuum - tight from the start . in the opening in the maintenance assembly , in which the cooling unit is inserted , a correspondingly designed insert must then be inserted in place of the cooling unit , for transportation purposes . the alternative embodiment , in which the maintenance assembly forms the protective cap 42 , is structurally possible without further measures , and in this regard requires no further substantial explanation . the protective cap 42 , whether it is used in place of the maintenance assembly or is formed by the maintenance assembly , encloses , together with the container 24 , a space in which a vacuum 12 is generated . for this purpose , the respective corresponding sealing surface 45 of the protective cap 42 , and the protective surface 46 of the vacuum container 24 are created such that they correspond to one another , or are connected to one another . in the case of the maintenance assembly , there can be a permanent connection between it and the vacuum container 4 . the vacuum 12 serves as the thermal insulation for the cryostat opening 15 with respect to the environment outside the protective cap 42 and the vacuum container 24 . in order to enable the passage of coolant gas , resulting from the heating of the coolant in the coolant container 30 , a venting pipe 43 is provided in the protective cap 42 , which is connected to the environment at one end , and to the coolant container 30 , or the coolant located therein , respectively , at the other end . the venting pipe 43 is equipped with a pressure valve 18 , which limits the pressure in the coolant container 30 to a predefined level , and when this level is exceeded , allows coolant to escape . excess coolant gas escapes into the environment through the pressure valve 18 and the venting pipe 43 . the pressure valve 18 can be provided in addition to an already present venting valve , and allow for a higher pressure than the venting valve in the interior of the coolant container 30 . an embodiment without an additional pressure valve of this type , having only a quench valve and a venting valve , is also possible . the venting pipe 43 thus represents a direct connection between the environment and the coolant container 30 , which enables an undesired heat input . as explained above , the venting pipe 43 has a relatively small cross - section , such that accordingly , its thermal conductivity is relatively low . in a manner similar to that explained above , the venting pipe 43 can exhibit a greatest possible effective length , e . g . by a spiral - shaped design . in addition , as explained above , it can consist of materials having low thermal conductivity , e . g . aluminum , stainless steel , inconel , kevlar , or teflon . a connection having a low thermal conductivity must be ensured between the protective cap 42 , or , if applicable , the maintenance assembly designed as a protective cap , and the cryostat opening 15 . a further embodiment for a protective cap 17 is depicted in fig4 . the vacuum container 4 , in which the coolant container 5 and the mr coils are disposed , is only shown in part . a depiction of the mr coils is omitted . the coolant container 5 is encompassed by a thermal shield 6 , which in turn is encased in an insulating foil 2 . the thermal shield 6 can be actively cooled by the cooling unit 7 , which is obtained by means of a connection , depicted as an s - shaped curve in the illustration , made of a material having good thermal conductivity , e . g . copper . the thermal shield 6 and the insulating foil 2 form a doubled thermal insulation inside the vacuum container 4 . the vacuum container comprises , as explained above , a vacuum wall , in which a vacuum 12 is generated for a substantial thermal insulation . a cooling unit 7 is disposed in the cryostat opening 16 . the cooling unit 7 is further thermally insulated by insulation means 10 , 11 , in order to reduce a heat input from the cooling unit 7 into the vacuum container 4 , or the coolant container 5 , respectively . the insulation means 10 , 11 consist , accordingly , of materials having a low thermal conductivity . the protective cap 17 is placed over the cryostat opening 16 , including the cooling unit 7 disposed therein . it consists of a material having a low thermal conductivity . if applicable , it is placed on a maintenance assembly , or otherwise , directly on the vacuum container 4 . the protective cap 17 has a double wall , formed by a warm outer wall 1 and a cold inner wall 3 . a vacuum 12 is generated within the double wall . in addition , there is an insulating foil 2 located inside the double wall . the insulating foil 2 can be designed as a multi - layered foil ( mu ), and its position must not necessarily be located inside the double wall . the insulating foil 2 forms a structure , together with the vacuum 12 , for thermal insulation , which encompasses the cryostat opening 16 , as depicted , and insulates against the environment . in order to discharge excess coolant gas resulting from heat in a controlled manner , a vent 9 is provided , in which a pressure valve 18 is disposed . the pressure valve 18 allows coolant gas to escape through the vent 9 when a predefined pressure has been reached , which escapes through a venting opening 14 in the space enclosed by the protective cap 17 and the container 4 . because the protective cap 17 , as explained above , is primarily used for transportation purposes , and thus an abrupt pressure increase in the coolant container 5 , e . g . in the case of a quench , cannot occur , the venting pipe 9 or the venting opening 14 can be designed to be relatively small . normally , however , it is formed by the quench and venting pipe that is typically provided , in the typical dimensions . coolant gas discharged from the venting opening 14 is first located in the space enclosed by the protective cap 17 and the container 4 . because it has a very low temperature with respect to the surrounding temperature , which is only higher than the temperature in the interior of the coolant container 5 , it results in a significant cooling of this space and the components disposed therein , and the cold inner wall 3 of the protective cap 17 . of course , the warm outer wall 1 of the protective cap 17 , as well as all of the further components having thermal contact thereto are also cooled . the protective cap 17 is placed on a seal 8 , which in turn is placed on the container 4 . the seal 8 is designed to allow a passage of coolant gas at a reduced flow rate into the environment outside the protective cap 17 and the vacuum container 4 . an excessive pressure increase beneath the protective cap 17 thus is prevented by the passage at a reduced flow rate . additionally , it is ensured that the coolant gas exiting through the venting opening 14 remains for a certain time beneath the protective cap 17 . the coolant gas remaining under the protective cap 17 cools , as explained above , the protective cap 17 as well as the cooling unit 7 and further components . in this manner , cooling of the cooling unit 7 is obtained , without the need for additional cooling measures , in that only the escaping coolant gas is used for this . the cooled cooling unit 7 obviously results in a lower heat input into the coolant container 5 than would be the case if the cooling unit were not cooled . furthermore , the material for the protective cap 17 can be selected such that its thermal conductivity decreases when cooled . for this purpose , as an example , aluminum , stainless steel , inconel , kevlar or teflon can be used . this reduction in thermal conductivity occurring , when cooled , in numerous materials , results in an additional increase in the thermal insulation performance of the protective cap 17 . the protective cap 17 is mechanically fixed in place on the vacuum container 4 , or , if applicable , on an associated maintenance assembly , in a suitable manner . for this purpose , threaded rods are provided in the depicted embodiment , on which the protective cap 17 is placed , and fixed in place there by means of nuts 13 . alternatively , the affixing of the protective cap 17 onto the vacuum container 4 can also occur by means of other attachment mechanisms , e . g . latches . for this attachment , it is important that it does not enable an excess heat transfer into the vacuum container 4 , and it must cause a suitable compression of the seal 8 , such that the desired through - flow rate of coolant gas through the seal 8 is ensured . the seal 8 for this purpose can be formed of a cotton - type or other suitable material or , for example , can have a waffle - like or arched , corrugated structure , or it can be formed by a mechanical construction of sealing elements , e . g . panels and baffles . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventor to embody within the patent warranted hereon all changes and modifications as reasonably and properly come within the scope of his contribution to the art . | 6 |
through comprehensive and intensive research , the inventors unexpectedly found that by using a complex formed from ruthenium and tridentate amino bisphosphorus pnp pincer - like ligand as a catalyst and hydrogen gas as hydrogen source , cyclic carbonate can be reduced through hydrogenation , so as to obtain methanol and 1 , 2 - ethylene glycol and derivatives thereof with high efficiency and selectivity and indirectly achieve the chemical conversion from carbon dioxide to methanol . for the first time , the inventors have also found that using the catalyst of the invention , polycarbonate can be efficiently degraded to methanol and diol through catalytic hydrogenation , thereby recovering diol and methanol from polycarbonate waste . furthermore , the inventors found that catalysts of the invention can be used to efficiently catalyze the reduction of cyclic carbonate through deuteration , so as to prepare deuterated methanol and deuterated diol . based on the above , the present invention is completed . in the present invention , “ c 1 ˜ c 10 alkyl ” means a straight or branched chain alkyl having up to 10 carbon atoms , such as methyl , ethyl , propyl , isopropyl , butyl , isobutyl , tert - butyl , pentyl , isopentyl , neopentyl , hexyl , t - hexyl , heptyl , iso - heptyl , octyl and iso - octyl . similarly , “ c 1 ˜ c 10 alkoxy ” means alkyl as defined above attached via an oxygen atom , such as methoxy , ethoxy , propoxy , butoxy and the like . in the present invention , “ aryl ” means substituents with properties of aromatic ring structure , such as phenyl , furyl , thienyl , pyridyl , quinolyl , indolyl . in the present invention , aryl includes unsubstituted or substituted aryl , wherein “ substituted ” refers to having one or more substituents . representative substituents include , but are not limited to : the above - described alkyl , alkoxy and a halogen and nitro group . representative aryl includes an aryl with electron - donating and / or electron - withdrawing substituent , such as p - tolyl , p - methoxyphenyl , p - chlorophenyl , and the like . similarly , “ arylalkyl ” means a substituent formed by connecting aryl and alkyl , such as phenylmethyl , phenylethyl , phenylpropyl , and the like . as used herein , the term “ diol ” can be interchangeably used with the term “ dihydroxy compound ”, which refers to a compound having two hydroxyls at the end . a person skilled in the art will understand that , in a specific embodiment , the term may include compounds such as alcohol , phenol , depending on the particular group connected with the hydroxyl . in other embodiments , in addition to two hydroxyls at the end ( which can be formed by the catalytic cracking process of the present invention ), the “ diol ” of the present invention can optionally contain hydroxyl ( s ) at other position ( s ). as used herein , the term “ conversion efficiency ” ( or efficiency rate ) is the percent of the amount of reactants consumed during a chemical reaction in the total amount of initially added reactants . for the reaction of the present invention , in the case of hydrogenation reaction of cyclic carbonate , the conversion efficiency means that , under certain conditions and within certain reaction time , the mole ratio of the consumed cyclic carbonate to the initially added cyclic carbonate , expressed as a percentage . as used herein , the term “ conversion number ” refers to the mole ratio of the converted reactants to catalyst , within a given period of time . in the reaction of the present invention , in the case of hydrogenation reaction of cyclic carbonate , the conversion number means that , under certain conditions and within certain reaction time , the mole ratio of the consumed cyclic carbonate to the catalyst . in the reaction of the present invention , the conversion rate and the conversion number can be calculated by determining carbonate through gas chromatography with p - xylene as an internal standard and standard curve method ; that is , p - xylene is used as an internal standard , and standard curve is plotted according to the ratio of the peak area of carbonate , methanol and diol on gas chromatogram to the peak area of xylene . the content of carbonate , methanol and diol in a reaction system can be determined by determining the proportion of peak areas in the reaction system . as used herein , the term “ carbonate ” includes straight - chain carbonate ( i . e ., non - cyclic , non - polymeric carbonates , such as dimethyl carbonate ), cyclic carbonate , polycarbonate . in particular , the cyclic carbonate and polycarbonate of the present invention are shown in formula i and ii , respectively : r 1 , r 2 , r 3 , r 4 , r 5 , r 6 can independently be a hydrogen , a c 1 ˜ c 20 alkyl , a c 4 ˜ c 24 aryl , a c 5 ˜ c 25 aryl alkyl , —( c 1 ˜ c 8 )— or 7 , —( c 1 ˜ c 8 )— sr 8 , or —( c 1 ˜ c 8 )— nr 9 r 10 ; r 5 , r 6 may independently be a c 4 ˜ c 10 cycloalkyl ; r 7 , r 8 , r 9 , r 10 are independently selected from a c 1 - c 10 alkyl , a c 4 ˜ c 24 aryl or a c 5 - c 25 aryl alkyl ; r 9 , r 10 may also be joined to form a cyclic amine group with the nitrogen atom ; when n = 0 , r 1 and r 3 may be joined to form an alicyclic group or aryl ring ; when n ≧ 1 , r 1 and r 5 , r 3 and r 6 may be joined to form an alicyclic group or an aryl ring ; r 1 , r 2 ′ , r 3 ′ , r 4 ′ , r 5 ′ , r 6 ′ may be independently selected from a hydrogen , a c 1 ˜ c 20 alkyl , a c 4 ˜ c 24 aryl , a c 5 ˜ c 25 aryl alkyl , —( c 1 ˜ c 8 )— or 7 , —( c 1 ˜ c 8 )— sr 8 ′ or —( c 1 ˜ c 8 )— nr 9 ′ r 10 ′ ; r 5 ′ , r 6 ′ may be independently further selected from a c 4 ˜ c 10 cycloalkyl ; wherein r 7 ′ , r 8 ′ , r 9 ′ , r 10 ′ are independently selected from a c 1 ˜ c 10 alkyl , a c 4 ˜ c 24 aryl or a c 5 ˜ c 25 aryl alkyl , r 9 ′ , r 10 ′ may be further joined to form a cyclic amine group with the nitrogen atom ; when n = 0 , r 1 ′ and r 3 ′ may be joined to form an alicyclic group or aryl ring ; when n ≧ 1 , r 1 ′ and r 5 ′ , r 3 ′ and r 6 ′ may be joined to form an alicyclic group or an aryl ring . a person skilled in the art will know that cyclic carbonate is an important class of industrial chemical and solvent , which can be produced in large - scale through the reaction of carbon dioxide and epoxy compound . for example , industrialization of the process for preparation of ethylene carbonate from carbon dioxide and ethylene oxide has been achieved . catalytic hydrogenation of cyclic carbonate has significant practical value , since carbon dioxide can be efficiently and indirectly used and important fuels and industrial raw materials , such as methanol and 1 , 2 - ethylene glycol can be obtained . the catalyst of the invention is a ruthenium complex of general structural formula v . the ruthenium complex comprises tridentate amino bisphosphorus ligand l of general structural formula vi . x is independently selected from carbon monoxide , triphenylphosphine , pyridine , tetrahydrofuran or dimethyl sulfoxide . y , y ′ are independently selected from : a hydride ion , a hydroxyl ion , a chloride ion , a bromide ion , an iodide ion and bh 4 − , bh 3 cn − , bh ( et ) 3 − , bh ( sec - bu ) 3 − , alh 4 − or alh 2 ( och 2 ch 2 ch 3 ) 2 − . y and y ′ may be identical or different from each other . tridentate amino bisphosphorus ligand l comprised in general formula v is represented by general structural formula vi : r 1 ″ , r 2 ″ are independently selected from a c 1 ˜ c 10 alkyl , a c 3 ˜ c 10 cycloalkyl , a c 4 ˜ c 24 aryl or an adamantyl ; r 3 ″ , r 4 ″ , r 5 ″ , r 6 ″ , r 7 ″ , r 8 ″ are independently selected from a hydrogen , a c 1 ˜ c 10 alkyl , a c 3 ˜ c 10 cycloalkyl , a c 1 ˜ c 10 alkoxy or a c 4 ˜ c 36 aryl ; when n = 0 , r 3 ″ and r 7 ″ , r 4 ″ and r 8 ″ may be joined to form an alicyclic group or an aryl ring ; when n ≧ 1 , r 3 ″ and r 5 ″ , r 4 ″ and r 6 ″ , r 5 ″ and r 7 ″ as well as r 6 ″ and r 8 ″ may be joined to form an alicyclic group or an aryl ring . in a specific embodiment , the catalyst of the invention , i . e ., ruthenium complex is shown in the following structural formula 1a - 1e : the ruthenium catalysts of the present invention can be prepared by the following method : under an inert gas , such as nitrogen or argon atmosphere , at 60 ˜ 120 ° c ., 1 equivalent of ruthenium metal precursor , e . g ., [ ruhcl ( co )( pph 3 ) 3 ], [ ruh 2 ( co )( pph 3 ) 3 ], rucl 2 ( pph 3 ) 3 , [ rucl 2 ( c 6 h 6 )] 2 , [ ruhcl ( pph 3 ) 3 ], ru ( dmso ) 4 cl 2 , [ ru ( cod ) cl 2 ], [ ru ( nbd ) cl 2 ] reacts with 1 to 1 . 2 equivalents of tridentate amino bisphosphorus ligand in a solvent for 0 . 5 - 20 hrs to obtain the catalyst . wherein dmso represents dimethylsulfoxide , cod represents 1 , 5 - cyclooctadiene , nbd represents norbornadiene . the catalyst of the invention , i . e ., ruthenium complex , can be used under mild conditions to reduce carbonates , including cyclic carbonate , polycarbonate and linear carbonate through hydrogenation into methanol or other corresponding alcohols or diol , thereby indirectly converting carbon dioxide into methanol , and giving corresponding diol . reducing carbonate through hydrogenation by using the ruthenium complex of the present invention will possess high conversion efficiency , excellent economy and convenience of operation . the present invention provides a novel method for preparing methanol and 1 , 2 - ethylene glycol as well as other diol derivatives through catalytic hydrogenation . in the method of the present invention , for reducing cyclic carbonate or polycarbonate through hydrogenation , the ruthenium complex formed with a ligand is used as a catalyst , and hydrogen gas is used as hydrogen source , thereby obtaining methanol and 1 , 2 - ethylene glycol and derivatives thereof with high efficiency and high selectivity . in a specific embodiment , the method of the present invention includes : under a hydrogen atmosphere , in an organic solvent , in the presence of a ruthenium complex ( v ) and a base , reducing cyclic carbonate ( general formula i ) or polycarbonate ( general formula ii ) through the following hydrogenation reaction , thereby obtaining methanol and corresponding diol iii or iv , each substituent and ruthenium complex as shown in the above reaction scheme are defined as above . in a specific embodiment , the ruthenium complex of the following structural formula 1a - 1e is used in the above reaction : the base can be used in the method of the invention includes an alkali metal salt of alcohol , such as potassium tert - butoxide , sodium tert - butoxide , potassium isopropoxide , sodium isopropoxide , sodium ethoxide ; an alkali metal carbonate , such as potassium carbonate , sodium carbonate ; an alkali metal hydroxide , such as sodium hydroxide or potassium hydroxide . in a preferred embodiment , an alkali metal salt of alcohol is used as a base ; and preferably , potassium tert - butoxide is used as the base . in a specific embodiment , the molar ratio of the cyclic carbonate or polycarbonate to ruthenium complex is 100 ˜ 1000000 : 1 . in a preferred embodiment , the molar ratio of the cyclic carbonate or polycarbonate to ruthenium complex is 1000 ˜ 100000 ; preferably , 10000 ˜ 100000 , 1000 ˜ 100000 . in a specific embodiment , the molar ratio of the base to the ruthenium complex is 1 to 100 : 1 . in a preferred embodiment , the molar ratio of the base to the ruthenium complex is 1 to 20 : 1 , more preferably 1 - 5 : 1 . in a further preferred embodiment , the molar ratio of the base to the ruthenium complex is 1 : 1 . in a specific embodiment , the temperature for the reaction is 60 - 180 ° c . in a preferred embodiment , the temperature for the reaction is 80 - 150 ° c ., more preferably , 80 - 140 ° c . in a specific embodiment , the reaction time for the reaction is 0 . 1 - 1000 hours . in a preferred embodiment , the reaction time for the reaction is 0 . 5 - 100 hours , more preferably , 1 - 72 hours . in a specific embodiment , the hydrogen pressure for the reaction is 1 - 100 atmospheres . in a preferred embodiment , the hydrogen pressure for the reaction is 5 - 60 atmospheres , more preferably 10 - 50 atmospheres . the organic solvent can be used in the method of the invention includes tetrahydrofuran , 2 - methyl tetrahydrofuran , dioxane , ethylene glycol dimethyl ether , tert - butyl methyl ether , benzene , toluene , xylene , methanol , ethanol , isopropanol , t - butanol , etc . in a preferred embodiment , ethers , such as tetrahydrofuran , dioxane , or toluene can be used in the method of the invention . moreover , according to the teachings of the present invention and the prior art , a person skilled in the art will readily appreciate that methanol and other monohydric alcohols can be prepared by using linear carbonate , i . e ., non - cyclic , non - polymeric carbonate as raw material for the hydrogenation reaction . preparation method of the present invention for deuterated methanol and deuterated diol according to the method of the invention for preparing methanol and diol , the inventors also use deuterium instead of hydrogen to reduce cyclic carbonate , thereby producing deuterated methanol and deuterated diol . moreover , by using cyclic carbonate , polycarbonate or routine carbonate , a person skilled in the art can prepare other deuterated monohydric alcohols with flexibility . 1 . the cyclic carbonate can be conveniently prepared in large - scale industrialization from reacting an epoxy compound with carbon dioxide , therefore , the method of the invention is capable of generating methanol and diol from cyclic carbonate through catalytic hydrogenation , thereby achieving the purpose of the invention , that is , indirectly converting carbon dioxide into methanol , and the resulting diol is extremely valuable fuel and chemical raw material ; 2 . methanol and diol can be produced from waste of polycarbonate with high efficiency and high selectivity through catalytic hydrogenation by using the method of the present invention , and compared with hydrolysis of polycarbonate , the method of the present invention will have higher atom economy ; 3 . no waste is produced according to the method of the present invention , which meets the technical requirements for environmentally sustainable economic development ; 4 . the method of the present invention is simple , and can be carried out under mild conditions with low cost ; 5 . the method of the present invention may also be used to prepare deuterated methanol and deuterated diol . the present invention will be illustrated in the following referring to the specific examples ; however , the present invention is not limited to such examples . for the experimental methods in the following examples the specific conditions of which are not specifically indicated , they are performed under routine conditions or manufacturer &# 39 ; s instruction . all the percentages or fractions refer to weight percentage and weight fraction , unless stated otherwise . under an inert gas such as nitrogen or argon atmosphere , into a 100 ml schlenk tube was added hcl . hn ( ch 2 ch 2 pph 2 ) 2 ( 1 . 20 g , 2 . 51 mmol ), toluene ( 20 ml ) and 15 % aqueous sodium hydroxide ( 10 ml ). the reaction mixture was stirred at room temperature until the solid was completely dissolved . the organic phase was separated under an inert atmosphere , and washed twice with distilled water ( 2 × 5 ml ). the combined aqueous phase was extracted twice with toluene ( 2 × 10 ml ). all of the organic phases were combined and dried over anhydrous sodium sulfate . the drying agent was removed by filtration , and the solvent was removed under reduced pressure in vacuo to give a crude product of free amino bisphosphorus ligand . the crude product was dissolved in toluene ( 18 ml ), ruhcl ( co )( pph 3 ) 3 ( 2 . 28 g , 2 . 39 mmol ) was added , and refluxed for 2 hours . the reaction system was cooled to room temperature , and hexane ( 10 ml ) was added . precipitates were filtered , and washed with hexane . the precipitates were dried in vacuo to give ruthenium complex 1a ( 1 . 42 g , 97 % yield ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 80 - 7 . 70 ( m , 8h ), 7 . 52 - 7 . 16 ( m , 12h ), 4 . 36 ( br s , 1h ), 3 . 38 - 3 . 25 ( m , 2h ), 2 . 82 - 2 . 76 ( m , 2h ), 2 . 45 - 2 . 35 ( m , 4h ), − 15 . 41 ( t , j = 19 . 6 hz , 1h ) ppm ; 31 p nmr ( 161 . 9 mhz , cdcl 3 ) δ 52 . 6 ( d , j = 18 . 1 hz ) ppm ; hrms ( maldi ) m / z calcd . for c 29 h 28 nop 2 96 ru : 564 . 0717 . found : 564 . 0699 [ m - h 2 — cl ] + , ir ( film ) 1972 , 1904 cm − 1 .) hn ( ch 2 ch 2 p i pr 2 ) 2 ( 217 mg , 0 . 710 mmol ) and ruhcl ( co )( pph 3 ) 3 ( 644 mg , 0 . 676 mmol ) were dissolved in toluene ( 4 ml ), and heated under reflux for 5 hours . the reaction was cooled to room temperature , and hexane ( 6 ml ) was added . the precipitated solids were filtered , dried by suction to obtain ruthenium complex 1b ( 288 mg , 90 % yield ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 3 . 50 - 3 . 39 ( m , 1h ), 3 . 31 - 3 . 26 ( m , 2h ), 2 . 77 - 2 . 65 ( m , 2h ), 2 . 35 - 2 . 09 ( m , 6h ), 1 . 86 - 1 . 74 ( m , 2h ), 1 . 60 - 1 . 44 ( m , 6h ), 1 . 34 - 1 . 08 ( m , 18h ), − 16 . 30 ( t , j = 19 . 2 hz , 0 . 12h ), − 16 . 54 ( t , j = 18 . 0 hz , 0 . 88h ) ppm ; 31 p nmr ( 161 . 9 mhz , cdcl 3 ) δ 74 . 6 ( s , br ) ppm ; hrms ( maldi ) m / z calcd . for c 17 h 38 nop 2 96 ru : 430 . 1499 . found : 430 . 1502 [ m - cl ] + ; ir ( film ) 1973 , 1960 , 1910 cm − 1 . according to the procedure of example 2 , hn ( ch 2 ch 2 p i pr 2 ) 2 was replaced with hn ( ch 2 ch 2 ptbu 2 ) 2 to obtain ruthenium complex 1c ( 85 % yield ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 6 . 44 ( br s , 1h ), 3 . 52 - 3 . 37 ( m , 0 . 9h ), 3 . 31 - 3 . 19 ( m , 2 . 1h ), 3 . 06 - 2 . 91 ( m , 2 . 1h ), 2 . 81 - 2 . 69 ( m , 0 . 9h ), 2 . 46 - 2 . 14 ( m , 4h ), 1 . 77 - 1 . 25 ( m , 36h ), − 16 . 03 ( t , j = 19 . 4 hz , 0 . 6 ), − 22 . 32 ( t , j = 18 . 4 hz , 0 . 4h ) ppm ; 31 p nmr ( 161 . 9 mhz , cdcl 3 ) δ 89 . 0 ( d , j = 9 . 1 hz ), 87 . 6 ( s ) ppm ; hrms ( maldi ) m / z calcd . for c 21 h 46 nop 2 96 ru : 486 . 2125 . found : 486 . 2120 [ m - cl ] + ; ir ( film ) 1897 cm − 1 . according to the procedure of example 2 , hn ( ch 2 ch 2 p i pr 2 ) 2 was replaced with hn ( ch 2 ch 2 pcy 2 ) 2 to obtain ruthenium complex 1d ( 98 % yield ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 3 . 85 - 2 . 80 ( m , 4h ), 2 . 53 - 1 . 15 ( m , 48h ), − 16 . 59 ( br s , 1h ) ppm ; 31 p nmr ( 161 . 9 mhz , cdcl 3 ) δ 65 . 2 ( s ), 47 . 6 ( s ) ppm ; hrms ( maldi ) m / z calcd . for c 29 h 54 nop 2 96 ru : 590 . 2751 . found : 590 . 2730 [ m - cl ] + ; ir ( film ) 1910 cm − 1 . according to the procedure of example 2 , hn ( ch 2 ch 2 p i pr 2 ) 2 was replaced with hn ( ch 2 ch 2 pad 2 ) 2 to obtain ruthenium complex 1e ( 92 % yield ). 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 49 ( br s , 1h ), 3 . 69 - 3 . 52 ( m , 2h ), 2 . 59 - 1 . 60 ( m , 66h ), − 26 . 05 ( t , j = 15 . 6 hz , 1h ) ppm ; 31 p nmr ( 161 . 9 mhz , cdcl 3 ) δ 84 . 4 ( d , j = 9 . 2 hz ) ppm ; hrms ( maldi ) m / z calcd . for c 45 h 70 nop 2 96 ru : 798 . 4003 . found : 798 . 3985 [ m - cl ] + ; ir ( film ) 1914 cm − 1 . preparation of methanol and ethylene glycol through hydrogenation of ethylene carbonate catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 17 . 4 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 20 ml ), and ethylene carbonate ( 2 . 52 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 0 . 5 hour . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as & gt ; 99 % with p - xylene as internal standard by using gas chromatography ( using standard curve method ; that is , p - xylene is used as internal standard , and standard curve is plotted according to the ratio of the peak area of carbonate , methanol and diol on gas chromatogram to the peak area of xylene , and the amount of carbonate , methanol and diol contained in a reaction system at the end of reaction can be determined by determining the proportion of peak areas in the reaction system ). both of the yields of methanol and ethylene glycol are 99 %. preparation of methanol and ethylene glycol through hydrogenation of ethylene carbonate catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with a solution of ruthenium complex 1a ( 1 . 7 mg , 0 . 00286 mmol ), potassium tert - butoxide ( 0 . 32 mg , 0 . 00286 mmol ) in tetrahydrofuran ( 5 ml ), as well as tetrahydrofuran ( 15 ml ) and ethylene carbonate ( 2 . 52 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 48 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as & gt ; 99 % with p - xylene as internal standard by using gas chromatography . both of the yields of methanol and ethylene glycol are 99 %. preparation of methanol and ethylene glycol through hydrogenation of ethylene carbonate catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with a solution of ruthenium complex 1a ( 0 . 17 mg , 0 . 000286 mmol ), potassium tert - butoxide ( 0 . 032 mg , 0 . 000286 mmol ) in tetrahydrofuran ( 2 ml ), as well as tetrahydrofuran ( 18 ml ) and ethylene carbonate ( 2 . 52 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 60 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 72 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as 89 % with p - xylene as internal standard by using gas chromatography . the yields of methanol and ethylene glycol are 84 % and 87 %, respectively . preparation of methanol and ethylene glycol through hydrogenation of ethylene carbonate catalyzed by ruthenium complex 1b in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1b ( 13 . 5 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 20 ml ) and ethylene carbonate ( 2 . 52 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 0 . 5 hour . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as 74 % with p - xylene as internal standard by using gas chromatography . the yields of methanol and ethylene glycol are 45 % and 74 %, respectively . preparation of methanol and ethylene glycol through hydrogenation of ethylene carbonate catalyzed by ruthenium complex 1d in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1d ( 18 . 0 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 20 ml ) and ethylene carbonate ( 2 . 52 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 0 . 5 hour . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as 76 % with p - xylene as internal standard by using gas chromatography . the yields of methanol and ethylene glycol are 48 % and 76 %, respectively . in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 3 . 5 mg , 0 . 057 mmol ), potassium tert - butoxide ( 0 . 5 mg , 0 . 057 mmol ), tetrahydrofuran ( 20 ml ) and propylene carbonate ( 2 . 92 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as 99 % with p - xylene as internal standard by using gas chromatography . both of the yields of methanol and ethylene glycol are 99 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 - ethyl - 1 , 3 - dioxan - 2 - one ( 3 . 32 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as & gt ; 99 % with p - xylene as internal standard by using gas chromatography . the yields of methanol and ethylene glycol are 99 % and 96 %, respectively . in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 - butyl - 1 , 3 - dioxan - 2 - one ( 4 . 12 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 4 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 99 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 99 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 - phenyl - 1 , 3 - dioxan - 2 - one ( 4 . 69 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 4 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 99 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 99 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 - benzyl - 1 , 3 - dioxan - 2 - one ( 5 . 09 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 4 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 99 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 98 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 - methoxymethyl - 1 , 3 - dioxan - 2 - one ( 3 . 78 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 4 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 99 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 99 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 - benzyloxymethyl - 1 , 3 - dioxan - 2 - one ( 5 . 94 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 4 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 99 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 97 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 , 5 - dimethyl - 1 , 3 - dioxan - 2 - one ( 3 . 32 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 99 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 98 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 4 , 4 - dimethyl - 1 , 3 - dioxan - 2 - one ( 3 . 32 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 12 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 99 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 97 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 17 . 4 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 20 ml ) and 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 - dioxan - 2 - one ( 4 . 12 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 20 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the yield of methanol was determined as 95 % with p - xylene as internal standard by using gas chromatography . the separation yield of the diol is 96 %. in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 8 . 7 mg , 0 . 0143 mmol ), potassium tert - butoxide ( 1 . 6 mg , 0 . 0143 mmol ), tetrahydrofuran ( 20 ml ) and 1 , 3 - dioxan - 2 - one ( 2 . 92 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 2 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as & gt ; 99 % with p - xylene as internal standard by using gas chromatography . the yields of methanol and diol are 99 % and 99 %, respectively . degradation of poly ( propylene carbonate ) through hydrogenation catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 15 . 8 mg , 0 . 0260 mmol ), potassium tert - butoxide ( 2 . 9 mg , 0 . 0260 mmol ), tetrahydrofuran ( 25 ml ) and poly ( propylene carbonate ) [ m w = 100 , 698 ( m w / m n = 1 . 77 ), & gt ; 99 % carbonate linkage ] ( 2 . 69 g , 26 . 0 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 24 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as & gt ; 99 % with p - xylene as internal standard by using gas chromatography . the yields of methanol and the diol are 99 % and 99 %, respectively . preparation of deuterated methanol and deuterated ethylene glycol through deuteration of ethylene carbonate catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 17 . 4 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 20 ml ) and ethylene carbonate ( 2 . 52 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with deuterium gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 0 . 5 hour . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as & gt ; 99 % with p - xylene as internal standard by using gas chromatography . the yield of methanol is 99 %, and the content of deuterium atom on methyl is 87 % ( determined by converting methanol into methyl benzoate and then performing nmr method ). preparation of deuterated methanol through deuteration of tetramethyl ethylene carbonate catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 17 . 4 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 20 ml ) and 4 , 4 , 5 , 5 - tetramethyl - 1 , 3 - dioxan - 2 - one ( 4 . 12 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with deuterium gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 24 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate for the reaction was determined as & gt ; 99 % with p - xylene as internal standard by using gas chromatography . the yield of methanol is 99 %, and the content of deuterium atom on methyl is & gt ; 99 % ( determined by converting methanol into methyl benzoate and then performing nmr method ). preparation of methanol and ethylene glycol through hydrogenation of ethylene carbonate catalyzed by ruthenium complexes 1c and 1e the process in example 6 was used , except that ruthenium complexes 1c and 1e were used to catalyze the hydrogenation of ethylene carbonate for preparing methanol and ethylene glycol . determined by the same gas chromatography as those in the above examples , comparable conversion rate and yield were obtained by preparing methanol and ethylene glycol through hydrogenation of ethylene carbonate catalyzed by ruthenium complexes 1c and 1e . preparation of methanol through hydrogenation of dimethyl carbonate catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 17 . 4 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 10 ml ) and dimethyl carbonate ( 2 . 57 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate of dimethyl carbonate was determined as 95 % with p - xylene as internal standard by using gas chromatography . the yield of methanol is 94 %. hydrogenation of propylene carbonate catalyzed by complex 1a ′ formed from ruthenium and [ p ( n - me ) p ] pincer - like ligand the ruthenium complex of formula 1a ′ was prepared by using a procedure similar to those of examples 1 - 5 : ruhcl ( co )[( ph 2 pch 2 ch 2 ) 2 nme ] ( 1a ′): yield 98 %, pale yellow solid . 1 h nmr ( 400 mhz , cdcl 3 ) δ 7 . 90 - 7 . 65 ( m , 8h ), 7 . 48 - 6 . 79 ( m , 12h ), 4 . 01 - 3 . 90 ( m , 0 . 6h ), 3 . 21 - 2 . 72 ( m , 7 . 4h ), 2 . 53 ( s , 2h ), 2 . 35 ( s , 1h ), − 14 . 16 ( t , j = 19 . 6 hz , 0 . 3h ), − 14 . 75 ( t , j = 19 . 6 hz , 0 . 7h ) ppm ; 31 p nmr ( 161 . 9 mhz , cdcl 3 ) δ 54 . 4 ( s ), 49 . 5 ( d , j = 6 . 3 hz ) ppm ; hrms ( maldi ) m / z calcd . for [ c 30 h 30 nop 2 96 ru ] + : 578 . 0873 . found : 578 . 0863 [ m - h 2 — cl ] + ; ir ( film ) 1975 , 1903 cm − 1 . a procedure similar to that of example 11 was used to catalyze the hydrogenation of propylene carbonate by using the ruthenium complex of formula 1a ′. neither of methanol and propylene glycol was produced , therefore , the ruthenium complex of formula 1a ′ did not have activity . from formula 1a ′, it is obvious that the structure shown in 1a ′ is similar to the ruthenium complex of formula 1a , and the only difference is that , in formula 1a , h is connected to n , while in formula 1a ′, h is connected to methyl . therefore , the conclusion of this embodiment will further demonstrate the following consensus in the field of metal catalyst that : different catalytic activities of metal complexes may be resulted from different ligands with different structures . effects of different amounts of base on the hydrogenation of propylene carbonate catalyzed by ruthenium complexes 1a at 100 ° c ., under different mole ratios of base to ruthenium complex and the following conditions , catalytic hydrogenation of propylene carbonate was performed for 2 hrs using a procedure similar to that of example 11 and ruthenium complex 1a as catalyst : in the above table : propylene carbonate : 28 . 6 mmol ; and the conversion rate of propylene carbonate , the yields of diol and methanol were determined by gas chromatography with p - xylene as internal standard . from the results shown in the above table , it will be known that , in the absence of a base , no reaction will occur by merely using ruthenium complex 1a . the amount of a base will have certain effects on the reaction ; and preferably , the best effects will be produced when the molar ratio of base to ruthenium complex is 1 - 2 : 1 . hydrogenation of propylene carbonate in toluene catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 1 . 8 mg , 0 . 028 mmol ), potassium tert - butoxide ( 0 . 25 mg , 0 . 028 mmol ), toluene ( 20 ml ) and propylene carbonate ( 2 . 92 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 100 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate of the raw material was determined as 99 % with p - xylene as internal standard by using gas chromatography . both of the yields of methanol and diol are 99 %. hydrogenation of propylene carbonate in dioxane catalyzed by ruthenium complex 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 1 . 8 mg , 0 . 028 mmol ), potassium tert - butoxide ( 0 . 25 mg , 0 . 028 mmol ), dioxane ( 20 ml ) and propylene carbonate ( 2 . 92 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 100 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate of the raw material was determined as 99 % with p - xylene as internal standard by using gas chromatography . both of the yields of methanol and diol are 99 %. hydrogenation of propylene carbonate catalyzed by ruthenium complexes 1a at different temperatures at different reaction temperatures , catalytic hydrogenation of propylene carbonate was performed using a procedure similar to that of example 11 and ruthenium complex 1a as catalyst , and the results are shown in the following table : in the above table : propylene carbonate : 28 . 6 mmol ; and the conversion rate of propylene carbonate , the yields of diol and methanol were determined by gas chromatography with p - xylene as internal standard . from the results shown in the above table , it will be known that the time needed for complete conversion of propylene carbonate will be varied with different reaction temperatures . at a higher temperature , the reactants will be completely converted in a shorter time . hydrogenation of propylene carbonate catalyzed by ruthenium complexes 1a at different hydrogen pressures at 100 ° c ., under different hydrogen pressures , catalytic hydrogenation of propylene carbonate was performed for 2 hrs using a procedure similar to that of example 11 and ruthenium complex 1a as catalyst , and the results are shown in the following table : in the above table : propylene carbonate : 28 . 6 mmol ; and the conversion rate of propylene carbonate , the yields of diol and methanol were determined by gas chromatography with p - xylene as internal standard . from the results shown in the above table , it will be known that , within the same reaction time , improving the hydrogen pressure will be helpful to accelerate the hydrogenation of propylene carbonate catalyzed by ruthenium complexes 1a with other reaction conditions fixed . preparation of methanol and phenol through hydrogenation of diphenyl carbonate catalyzed by ruthenium complexes 1a in a glove box , into a 125 ml autoclave was charged with ruthenium complex 1a ( 17 . 4 mg , 0 . 0286 mmol ), potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ), tetrahydrofuran ( 10 ml ) and diphenyl carbonate ( 0 . 61 g , 2 . 86 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate of diphenyl carbonate was determined as 100 % with p - xylene as internal standard by using gas chromatography . the yield of methanol is 95 %, and the yield of phenol is 99 %. therefore , this example demonstrated that the system can also effectively catalyze the hydrogenation of diester formed from carbonic acid and phenols , so as to obtain methanol and corresponding phenols . hydrogenation of propylene carbonate catalyzed by ruthenium complexes 1a under neutral condition under an inert gas atmosphere , ruthenium complex 1a ( 17 . 4 mg , 0 . 0286 mmol ) and potassium tert - butoxide ( 3 . 2 mg , 0 . 0286 mmol ) were mixed in tetrahydrofuran ( 10 ml ) and stirred for 30 minutes at room temperature . the solvent was removed by suction under reduced pressure . benzene ( 20 ml ) was added , stirred for 10 minutes at room temperature and filtered . the filtrate was dried by suction to give the newly prepared ruthenium complex . in a glove box , into a 125 ml autoclave was charged with such neutral ruthenium complex , tetrahydrofuran ( 20 ml ) and propylene carbonate ( 2 . 92 g , 28 . 6 mmol ). the autoclave was sealed , removed from the glove box , and filled with hydrogen gas to 50 atm . the reaction vessel was heated in an oil bath at 140 ° c . with stir for 10 hours . the reaction vessel was cooled in an ice - water bath for 1 . 5 hours , and the excess of hydrogen was slowly deflated . the conversion rate of the reaction was determined as 99 % with p - xylene as internal standard by using gas chromatography . both of the yields of methanol and diol are 99 %. therefore , this example demonstrates that the hydrogenation of the cyclic carbonate can be effectively catalyzed by a suitable ruthenium complex under neutral conditions , so as to obtain methanol and the corresponding diol . all literatures mentioned in the present application are incorporated by reference herein , as though individually incorporated by reference . additionally , it should be understood that after reading the above teaching , many variations and modifications may be made by the skilled in the art , and these equivalents also fall within the scope as defined by the appended claims . | 2 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.