text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
in the preferred embodiment illustrated , there is provided a mobile phone having an internal printer which includes a separately detachable printhead and ink supply module . the printer phone can be produced at or close to a standard size phone for any system including phs , gsm and gprs , thereby conferring a higher level of convenience during operation . turning initially to fig1 , there is illustrated the preferred embodiment 1 in the form of a phs phone and which in many ways looks like and includes the features of a conventional mobile phone of this type including an ear piece 2 , microphone 3 , aerial 4 , loud speaker 5 , a series of push buttons 6 and a preferably color lcd screen 7 for the display of information . also included is a battery 8 as shown in fig4 . the phone 1 can optionally be equipped with a camera device 10 comprising lenses 11 and associated ccd chip or cmos sensor 12 . the ccd or cmos sensor enables the device to store images on demand , so that the phone can effectively act as a camera device for the printing out of images , or for their capture and forwarding across a mobile phone network . the operation of the relevant part of the internal control electronics can be substantially as set out in the applicant &# 39 ; s earlier pct application wo 99 / 04551 entitled “ a replenishable one time use camera system ” the contents of which are incorporated herein by reference . in other embodiments , the camera device may also be configured to enable video conferencing by facilitating simultaneous image processing during phone transmission . a camera function that is mounted for selective movable positioning on the phone device may be useful for this purpose . for example , it may be rotatable between a forward facing camera orientation and a rearward facing video conferencing orientation . the printer apparatus is shown generally at 15 and comprises a printhead and ink supply module 16 including a printhead 17 , an ink supply / distribution unit 18 and a print media feed apparatus 20 . the feed apparatus is of a conventional form including a motor 21 with associated gear train 22 which drive a series of feed rollers 23 . the packaging of the printer apparatus 15 is best shown in fig5 and 9 . in this regard the printer phone 1 is constructed around a rigid chassis molding 25 . the chassis is adapted to slidably receive and retain the printhead and ink supply module 16 by means of retaining flanges 26 provided on the outer casing of the printhead and ink supply module 16 which co - operate with under cut channels 27 provided on the chassis molding . the full operation of the printer apparatus 15 is best illustrated in fig9 . in use print media 30 , preferably in the form of business card sized paper or card sheets , is fed in through an entry slot 31 provided in the external phone casing 32 . this can be done manually or via a dispenser as described hereafter . the card 30 is then picked up by the powered entry feed rollers 23 and delivered to the printhead and ink supply module 16 . the printhead and ink supply module 16 can be substantially the same as that disclosed in australian provisional patent no . pp6534 filed 16 oct . 1998 ( u . s . ser . no . 09 / 425 , 419 filed 19 oct . 1999 ), the contents of which are also hereby incorporated by cross - reference . in such a device , the printhead is in the form of an elongate printhead chip that extends the full length of the print media pathway , so as to print the full width of the print media in a single pass without the need for any printhead traversing mechanisms . in this particular preferred embodiment , the printhead and ink module is formed as a sealed unit which is replaced in its totality after a predetermined amount of usage . the detailed structure of the ink supply and printhead module is shown more clearly in fig8 . the ink supply / distribution unit 18 is of a molded multi - part structure including a cover 35 , a macro channel molding 36 defining four separate ink supply chambers 37 - 40 having therein optional flow control baffles 41 . connected with converging outlets of the macro channel molding 36 is a micro - molding 42 which defines similarly converging ink flow nozzles 43 that accurately direct the ink to minute ink supply inlets on the rear of the printhead 17 . optionally , an ink filter 44 is provided between the two moldings . a capping device 47 is also provided as part of the module for sealing and protecting the nozzle outlets when the printer head is not in use . it is estimated that the ink supply will on average be sufficient for printing approximately 1000 pages at 15 % coverage of black or 100 photos of 50 % coverage of cmyk . an expanded technical description of the printhead and ink supply module can be found in the aforementioned provisional patent specification pp6534 and associated applications . the mobile phone system can be operated under the control of a series of one or more application specific integrated circuits ( asics ) which incorporate the usual mobile phone capabilities in addition to camera and image processing capabilities . an adaptation of the system outlined in pct patent application pct / au98 / 00544 filed by the present applicant ( also incorporated herein by reference ) can be utilised in the design of the asic . the electrical interconnections for the preferred embodiment are shown schematically as a block diagram in fig1 . other system designs well known to those skilled in this field may also be used . referring next to fig1 to 15 there is illustrated a print media dispenser 50 configured for use with the phs phone of the previous embodiments . the dispenser comprises a lower molding 51 that defines a media storage and dispensing region 52 and a cradle 53 which supports the printer phone 1 and aligns it with the outlet of the dispenser . the interactive operation of the print media dispenser with the phone 1 is best illustrated in fig1 . as can be seen , the dispenser 50 has a storage area 52 in which is disposed a quantity of print media in the form of business card sized paper or card sheets 54 . these cards are supported on a metal base plate 55 which is sprung by means of opposed spring fingers 56 as shown in fig1 . in this manner , the card supply is constantly biased upwardly toward a media ejector mechanism 58 . the ejector mechanism includes an ejector slider 59 which is operable upon manual sliding against a return spring 60 to pick up the top card and feed this out of the dispenser outlet 61 and into the media entry slot 31 on the phone 1 . on release , the slider automatically returns to the home position to engage the next card ready for further loading . desirably , the printer phone 1 and / or printhead and ink supply module 16 includes an authentication mechanism such as that outlined in the applicant &# 39 ; s earlier pct application no . pct / au98 / 00544 entitled “ a camera with an internal printing system ”. this can be used to ensure not only that an authenticated approved consumable ( such as the printhead and ink supply module ) is used with the printer phone , but can also be used to store data on the relative usages of the consumable components such as the ink or the printhead itself and can optionally be used to set a predetermined usage for these items . as noted above , the phone device of the invention may be any kind of mobile phone that sends and receives signals in a manner which can be processed into a printable form . further , while the preferred form described has a printhead and ink distribution unit which has an integrally formed and attached ink supply , the ink supply could be separate and optionally also separately replenishable . while the invention has been described with reference to specific examples , it will be appreciated by those skilled in the art that the invention may be embodied in many other forms . | 7 |
the current invention teaches the use of various cells and compositions derived from cells to induce immune modulation systemically , or in some cases locally in a mammal susceptible to pregnancy complications . cells such as mesenchymal stem cells , preferably adipose derived stromal vascular fraction cells , useful for the practice of the invention cause immune modulation locally and / or systemically depending on the specific embodiment . particularly , cells are chosen based on ability to counteract immunological abnormalities associated with rsa . specific abnormalities include : elevated natural killer cell numbers [ 32 ], reduced number of t regulatory cells [ 2 , 33 , 34 ] and increased th1 / th17 cytokines [ 35 ]. in one particular embodiment of the invention , standard svf therapeutic protocols for autoimmunity , such as published by ichim et al ( cell immunol . 2010 ; 264 ( 1 ): 7 - 17 ) are applied to a patient at risk for rsa . specifically svf may be extracted prior to conception , and administered approximately 1 - 3 months after conception . various regimens of administration may be used , however , in a preferred embodiment , 20 - 100 million svf cells are administered weekly in the first month , and biweekly in the second and third month of pregnancy . in one embodiment the cells used for treatment are autologous stromal vascular fraction cells . in another embodiment svf cells are administered while the female is trying to conceive . in another embodiment , svf cells are administered to increase probability of successful in vitro fertilization . in one embodiment of the invention , inflammatory and immunological abnormalities are identified in order to categorize risk of pregnancy complications , said pregnancy complications are defined as medical incidences that threaten the health of the mother or the offspring , and include resa , preterm birth , pre - eclampsia including hemolysis elevated liver enzymes low platelets ( help ), premature rupture of the membrane , antepartum hemorrhage including placental abruption , chorioamnionitis , intrauterine growth restriction , placenta pravaevia , sequalae of intraamniotic infection . in one particular embodiment , levels of circulating factors are assessed in maternal plasma , based on abnormally high levels , interventions are chosen for treatment . in one particular embodiment , the methodology of ruiz et al [ 36 ], is utilized for assessment of circulating il - 6 . specifically , plasma is analyzed in the second trimester of pregnancy and concentrations correlated with a baseline associated with non - complicated pregnancy . within the context of the invention , other markers of inflammation may be utilized such as c reactive protein [ 37 ], in females who have higher concentration of inflammatory proteins as compared to baseline values from non - complicated pregnancies , an agent is administered to reduce inflammation . numerous studies have demonstrated that rsa is associated with increased production of th1 cytokines such as interferon gamma and reduced production of il - 10 [ 38 , 39 ]. furthermore , treatments that have demonstrated some signal of efficacy in rsa such as ivig [ 40 ], g - csf [ 41 ], and plt [ 42 ], all have been shown to induce a th1 to th2 shift . within the context of the current invention , use of stem cell mixtures , particularly adipose svf for inducing immune modulation towards protecting the fetal allograft are envisioned . in one specific embodiment , svf is used to extract autologous treg , which are expanded and administered into a mammal suffering from rsa at a concentration sufficient to evoke a therapeutic response . such concentrations may be determined by monitoring nk activity , assessing inflammatory cytokine production by peripheral blood mononuclear cells after stimulation with a mitogen or mitogenic antibody , or by assessment of t regulatory ( treg ) cell numbers or activity . in one embodiment rsa patients are administered the cd4 + cd25 + cells at a concentration of 50 million cells , once per month . the invention teaches adipose tissue is an attractive alternative to bone marrow as a source of stem cells for treatment of rsa for the following reasons : a ) extraction of adipose derived cells is a simpler procedure that is much less invasive than bone marrow extraction ; b ) adipose tissue contains a higher content of mesenchymal stem cells ( msc ) as compared to bone marrow ; c ) msc from adipose tissue do not decrease in number with aging and can therefore serve as an autologous cell source for all patients ; and d ) adipose tissue is also a source of unique cell populations in addition to msc that have therapeutic potential , including endothelial cells and regulatory t cells . to date , clinical trials on adipose derived cells have all utilized ex vivo - expanded cells , which share properties with bone marrow derived msc [ 1 - 6 ]. preparations of msc expanded from adipose tissue are equivalent or superior to bone marrow in terms of differentiation ability [ 7 , 8 ], angiogenesis - stimulating potential [ 9 ], and immune modulatory effects [ 10 ]. given the extra processing steps associated with ex vivo expansion of adipose cells , a simpler and perhaps safer procedure would be the use of primary adipose tissue - derived cells for therapy . svf comprises the mononuclear cells derived from adipose tissue , which are acquired through a simple isolation procedure whereby fat is lipoaspirated and subjected to enzymatic digestion . currently bench top closed systems for autologous adipose cell therapy , such as cytori &# 39 ; s celution ™ system [ 11 ] and tissue genesis &# 39 ; tgi 1000 ™ platform [ 12 ], are entering clinical trials . although the majority of studies have focused on in vitro expanded adipose derived cells , svf derived from whole lipoaspirate alleviates the need for extensive processing of the cells , thereby also minimizing the number of steps where contamination could be introduced . an important consideration in clinical scenerios where bulk svf is utilized is the potential regenerative , angiogenic and immune regulatory contributions of the numerous cellular populations that are present . the mononuclear fraction of adipose tissue , referred to as the stromal vascular fraction ( svf ), was originally described as the proliferative component of adipose tissue by hollenberg et al . in 1968 [ 13 ]. the cells comprising svf morphologically resemble fibroblasts and were demonstrated to differentiate into pre - adipocytes and functional adipose tissue in vitro [ 14 ]. although it was suggested that non - adipose differentiation of svf may occur under specific conditions [ 15 ], the notion of “ adipose - derived stem cells ” was not widely recognized until a seminal paper in 2001 , where zuk et al demonstrated the svf contains large numbers of mesenchymal - like stem cells ( msc - like ) cells that could be induced to differentiate into adipogenic , chondrogenic , myogenic , and osteogenic lineages [ 16 ]. subsequent to the initial description , the same group reported that in vitro expanded svf derived cells had surface marker expression similar to bone marrow derived msc , displaying expression of cd29 , cd44 , cd71 , cd90 , cd105 / sh2 , and sh3 and lacking cd31 , cd34 , and cd45 expression [ 17 ]. msc are defined as adherent , non - hematopoietic cells expressing the surface markers cd90 , cd105 , and cd73 , while lacking expression of cd14 , cd34 , and cd45 , and having the ability to differentiate into adipocytes , chondrocytes , and osteocytes in vitro after treatment with the appropriate growth factors [ 18 ]. adipose tissue has also been used clinically as a source of regenerative and immune modulatory msc . cytori is currently conducting two european clinical trials using autologous , adipose - derived mononuclear cells , of which msc are believed to be the therapeutic population [ 19 ]. the precise trial is a 36 - patient safety and feasibility study in europe evaluating adipose - derived stem and regenerative cells as a treatment for chronic cardiac ischemia . the apollo trial is a 48 - patient safety and feasibility study in europe to evaluate adipose - derived regenerative cells as a treatment for heart attacks [ 20 ]. allogeneic uses of adipose derived msc included treatment of gvhd associated liver failure [ 5 ] and steroid refractory gvhd [ 6 , 21 ]. allogeneic placenta and cord blood - derived msc have also been used for treatment of heart failure [ 22 ] and buerger &# 39 ; s disease [ 23 ], respectively . from the above - mentioned clinical trials of allogeneic msc , graft versus host or pathological immunological reactions have not been reported . additionally , administration of msc intravenously , intrathecally , and intramuscularly have not been associated with ectopic tissue formation or teratoma . in addition to its stem / progenitor cell content , the svf is known to contain monocytes / macrophages . although pluripotency of monocytic populations have previously been described [ 59 , 60 ], we will focus our discussion to immunological properties , specifically , the apparent anti - inflammatory / angiogenic activities of these cells . initial experiments suggested that macrophage content of adipose tissue was associated with the chronic low - grade inflammation found in obese patients . this was suggested by co - culture experiments in which adipocytes were capable of inducing tnf - alpha secretion from macrophage cell lines in vitro [ 61 ]. clinical studies demonstrated that adipocytes also directly release a constitutive amount of tnf - alpha and leptin , which are capable of inducing macrophage secretion of inflammatory mediators [ 62 ]. interestingly , it appears from several studies in mice and humans that when monocytes / macrophages are isolated from adipose tissue , they exhibited some phenotype markers of m2 macrophages however the cells also had higher basal and induced levels of the pro - inflammatory mediators , tnf - alpha , il - 6 , il - 1 , mcp - 1 , and mip - 1 alpha , compared to levels induced by the pro - inflammatory m1 macrophages [ 63 - 65 ]. if indeed these adipose derived macrophages have an “ m2 ” phenotype , they may be similar to m2 cells observed in conditions of immune suppression such as in tumors [ 66 ], post - sepsis compensatory anti - inflammatory syndrome [ 67 , 68 ], or pregnancy associated decidual macrophages [ 69 ]. a recent paper suggested that it is the m2 component of svf that is associated with enhanced survival of fat grafts that are supplemented with svf [ 70 ]. it is estimated that the monocytic / macrophage compartment of the svf is approximately 10 % based on cd14 expression [ 71 ]. interestingly , administrations of ex vivo generated m2 macrophages have been demonstrated to inhibit kidney injury in an adriamycin - induced model [ 72 ]. in the context of multiple sclerosis , alternatively activated , m2 - like microglial cells are believed to inhibit progression in the eae model [ 73 ]. thus the potential m2 phenotype of adipose derived macrophages may be a mechanism of therapeutic effect of svf cells when isolated from primary sources and not expanded . it has been reported by us and others , that activation of t cells in the absence of costimulatory signals leads to generation of immune suppressive cd4 + cd25 + t regulatory ( treg ) cells [ 74 , 75 ]. thus local activation of immunity in adipose tissue would theoretically be associated with reduced costimulatory molecule expression by the m2 macrophages , which may predispose to treg generation . conversely , it is known that tregs are involved in maintaining macrophages in the m2 phenotype [ 76 ]. supporting the possibility of treg in adipose tissue also comes from the high concentration of local msc which are known to secrete tgf - beta [ 77 ] and il - 10 [ 78 ], both involved in treg generation [ 79 ]. indeed numerous studies have demonstrated the ability of msc to induce treg cells [ 18 , 78 , 80 , 81 ] the established cba × dba mouse model of immunologically mediated spontaneous abortion [ 24 ], was utilized to assess effects of probiotic administration on resorption at day 15 . wild type 8 - 10 week old virgin cba / j female mice and 8 - 14 week old dba / 2j male mice were paired and vaginal plug was assessed two times a day . day of formation of the vaginal plug was designated as day zero of pregnancy . ten pregnant female mice were intravenously administered 500 , 000 syngeneic svf cells . another 10 mice were used as controls and treated with saline . administration of cells was performed on day 3 of pregnancy , when animals were sacrificed and uterine horns were examined for presence of resorbed offspring . resorption was expressed as number of resorptions / total number of formed fetuses and resorptions . see fig1 . 1 . garcia - olmo , d ., et al ., a phase i clinical trial of the treatment of crohn &# 39 ; s fistula by adipose mesenchymal stem cell transplantation . dis colon rectum , 2005 . 48 ( 7 ): p . 1416 - 23 . 2 . stillaert , f . b ., et al ., human clinical experience with adipose precursor cells seeded on hyaluronic acid - based spongy scaffolds . biomaterials , 2008 . 29 ( 29 ): p . 3953 - 9 . 3 . garcia - olmo , d ., m . garcia - arranz , and d . herreros , expanded adipose - derived stem cells for the treatment of complex perianal fistula including crohn &# 39 ; s disease . expert opin biol ther , 2008 . 8 ( 9 ): p . 1417 - 23 . 4 . fang , b ., et al ., treatment of severe therapy - resistant acute graft - versus - host disease with human adipose tissue - derived mesenchymal stem cells . bone marrow transplant , 2006 . 38 ( 5 ): p . 389 - 90 . 5 . fang , b ., et al ., using human adipose tissue - derived mesenchymal stem cells as salvage therapy for hepatic graft - versus - host disease resembling acute hepatitis . transplant proc , 2007 . 39 ( 5 ): p . 1710 - 3 . 6 . fang , b ., et al ., favorable response to human adipose tissue - derived mesenchymal stem cells in steroid - refractory acute graft - versus - host disease . transplant proc , 2007 . 39 ( 10 ): p . 3358 - 62 . 7 . hayashi , o ., et al ., comparison of osteogenic ability of rat mesenchymal stem cells from bone marrow , periosteum , and adipose tissue . calcif tissue int , 2008 . 82 ( 3 ): p . 238 - 47 . 8 . noel , d ., et al ., cell specific differences between human adipose - derived and mesenchymal - stromal cells despite similar differentiation potentials . exp cell res , 2008 . 314 ( 7 ): p . 1575 - 84 . 9 . kim , y ., et al ., direct comparison of human mesenchymal stem cells derived from adipose tissues and bone marrow in mediating neovascularization in response to vascular ischemia . cell physiol biochem , 2007 . 20 ( 6 ): p . 867 - 76 . 10 . keyser , k . a ., k . e . beagles , and h . p . kiem , comparison of mesenchymal stem cells from different tissues to suppress t - cell activation . cell transplant , 2007 . 16 ( 5 ): p . 555 - 62 . 11 . lin , k ., et al ., characterization of adipose tissue - derived cells isolated with the celution system . cytotherapy , 2008 . 10 ( 4 ): p . 417 - 26 . 13 . hollenberg , c . h . and a . vost , regulation of dna synthesis in fat cells and stromal elements from rat adipose tissue . j clin invest , 1969 . 47 ( 11 ): p . 2485 - 98 . 14 . gaben - cogneville , a . m ., et al ., differentiation under the control of insulin of rat preadipocytes in primary culture . isolation of homogeneous cellular fractions by gradient centrifugation . biochim biophys acta , 1983 . 762 ( 3 ): p . 437 - 44 . 15 . glick , j . m . and s . j . adelman , established cell lines from rat adipose tissue that secrete lipoprotein lipase . in vitro , 1983 . 19 ( 5 ): p . 421 - 8 . 16 . zuk , p . a ., et al ., multilineage cells from human adipose tissue : implications for cell - based therapies . tissue eng , 2001 . 7 ( 2 ): p . 211 - 28 . 17 . zuk , p . a ., et al ., human adipose tissue is a source of multipotent stem cells . mol biol cell , 2002 . 13 ( 12 ): p . 4279 - 95 . 18 . prockop , d . j ., marrow stromal cells as stem cells for nonhematopoietic tissues . science , 1997 . 276 ( 5309 ): p . 71 - 4 . 19 . meliga , e ., et al ., adipose - derived cells . cell transplant , 2007 . 16 ( 9 ): p . 963 - 70 . 21 . fang , b ., et al ., human adipose tissue - derived mesenchymal stromal cells as salvage therapy for treatment of severe refractory acute graft - vs .- host disease in two children . pediatr transplant , 2007 . 11 ( 7 ): p . 814 - 7 . 22 . ichim , t . e ., et al ., placental mesenchymal and cord blood stem cell therapy for dilated cardiomyopathy . reprod biomed online , 2008 . 16 ( 6 ): p . 898 - 905 . 23 . kim , s . w ., et al ., successful stem cell therapy using umbilical cord blood - derived multipotent stem cells for buerger &# 39 ; s disease and ischemic limb disease animal model . stem cells , 2006 . 24 ( 6 ): p . 1620 - 6 . 24 . bonney , e . a . and s . a . brown , to drive or be driven : the path of a mouse model of recurrent pregnancy loss . reproduction , 2014 . 147 ( 5 ): p . r153 - 67 . | 2 |
the following detailed description is merely illustrative in nature and is not intended to limit the invention or the application and uses of the invention . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . the invention may be described herein in terms of functional and / or logical block components and various processing steps . it should be appreciated that such block components may be realized by any number of hardware , software , and / or firmware components configured to perform the specified functions . for the purposes of conciseness , conventional techniques and systems related to electrical motors , magnetism , and the like are not described in detail herein . in general , the various embodiments are directed to a permanent magnet machine (“ pm machine ”), and more specifically an internal permanent magnet machine (“ ipm machine ”) that includes a rotor with additional slots near the rotor surface , thereby creating an additional slotting effect . in this way , the structure can cancel or lower the slotting effect of the rotor barriers through an averaging effect . in this way , torque ripple and cogging can be reduced . interior pm machines often incorporate one or more rotor barriers ( or simply “ barriers ”). fig1 ( a ) and ( b ), for example , illustrate partial cross - sections through various exemplary ipm machines 100 with single and double barrier rotors 106 more particular , fig1 ( a ) illustrates a rotor 106 with magnets 110 and air slots ( pockets ) or air barriers 125 incorporated into the structure at various locations with respect to magnets 110 . as is conventional , ipm 100 includes a stator 101 having a plurality of windings 102 magnetically interacting with magnets 110 within rotor 106 . various cavities are provided within region 104 of rotor 106 , and all or a portion of these cavities are filled with permanent magnets in the conventional manner , depending upon the number of layers incorporated into the structure . fig1 ( b ), more particularly , depicts a two - barrier pm rotor with the second barrier partially filed with magnets 110 . similarly , fig1 ( c ) illustrates a two - barrier pm rotor with no magnets in the second layer — i . e ., the second layer comprises only an air - filled cavity . the added second barrier shown in fig1 ( b ) adds resistance to the lower magnet barrier , lowering the air - gap magnet flux . however , as mentioned previously , addition of the second barrier in the rotor can mechanically weaken the rotor . also , for some machines , addition of any such second barrier is not geometrically feasible due to limited space ( e . g ., the rotor of fig1 ( a )). rotors with more than two barriers may also be provided ; however , such designs undesirably increase manufacturing complexity . increasing the number of barriers improves rotor saliency , and thus improves machine torque . moreover , the second rotor barrier often works as a barrier to the inner magnet layer , consequently lowering the magnet flux in the air - gap . lowering of magnet flux in the air - gap reduces the magnet torque , but is somewhat compensated by the increased saliency of the rotor . in hybrid applications , when the pm machine is part of a transmission , very often the machine is rotating in conjunction with a different gear - set even though machine is producing no torque or is producing very low torque . if the no - load or light load operation is a substantial portion of the machine drive cycle , the overall efficiency of the transmission is affected . rotating magnet flux also induces voltage in the stator winding , commonly referred to as back emf . the high magnet flux of a permanent magnet rotor may induce very high voltage in the stator , especially during high speed operation of the machine . therefore , lowering of the machine air - gap flux is very desirable for such machines . fig2 and 3 depicts various embodiments of an ipm machine 200 in accordance with one embodiment of the present invention in which additional rotor slots 235 are provided along the periphery — i . e ., near the rotor surface 202 . as shown , a cavity within rotor 106 is filled or partially filled by magnet 110 , in which case various air slots ( pockets ) or barriers are formed adjacent thereto , i . e . : air slots 125 . the term “ cavity ” is thus used to refer to the empty regions existing prior to insertion of magnet 110 . the term “ rotor barriers ” refers to all barriers or air slots 125 that are provided within the hub area of rotor 106 ( i . e ., excepting slots 235 ). while fig2 illustrates a cross - sectional view of magnets 110 and air slots 125 , it will be understood that the cavity extends into region 104 of the rotor of rotor 106 and will define a three - dimensional volume having any suitable shape . the size , location , and geometry of each additional slot may be selected to achieve the desired design objectives . such attributes are preferably chosen to produce an averaging effect with respect the rotor barriers existing within rotor 106 . such optimization may be performed empirically or through conventional computer modeling methods known in the art . fig2 and 3 show two different embodiments incorporating such additional slots in a single - barrier and double - barrier rotor , respectively . in fig2 , pairs of rectangular magnets 110 are configured angled toward each other — i . e ., defining an obtuse angle facing outward toward the stator surface . in one embodiment , two such additional slots 235 are included per pole ; however , any number of such slots 235 may be used . furthermore , the slots need not be distributed symmetrically or evenly with respect to magnets 110 . in the illustrated embodiment , the cross - sectional area of each slot 235 is preferably equal , though slots with varying sizes are comprehended by this invention . for example , the additional slots may have a cross - sectional area that is substantially less than an aggregate cross - sectional area of the rotor barriers . fig3 shows an alternate embodiment for a two - layer rotor , wherein two additional slots 235 are placed on the exterior of the two first layer magnets 110 . as with the above embodiment , additional slots 235 are located at a radius substantially corresponding to the corner of magnets 110 closest to surface 103 . the depth of slots 235 within region 104 of rotor 106 ( i . e ., the distance radially from surface 202 ) may also be selected to achieve particular design objectives . in one embodiment , for example , slots 235 are located 1 - 1 . 5 mm from surface 202 . it will be appreciated , however , that the invention is not so limited . while at least one example embodiment has been presented in the foregoing detailed description , it should be appreciated that a vast number of variations exist . for example , additional barrier layers may be incorporated in addition to the single layer illustrated . it should also be appreciated that the example embodiment or embodiments described herein are not intended to limit the scope , applicability , or configuration of the invention in any way . rather , the foregoing detailed description will provide those skilled in the art with a convenient road map for implementing the described embodiment or embodiments . it should be understood that various changes can be made in the function and arrangement of elements without departing from the scope of the invention and the legal equivalents thereof . | 7 |
reference will be now made in detail to the preferred embodiment of the present invention with reference to the attached drawings . as shown in fig3 , a sprinkler mounting device includes : a pair of t - shaped frames 10 mounted on a ceiling parallel with each other at a predetermined interval ; a pair of support units 20 perpendicularly standing and joined to the t - shaped frames 10 ; a support bar 30 disposed on upper portions of the support units 20 in such a way as to cross the t - shaped frames 10 ; and a mounting bracket 40 mounted on the support bar 30 in a laterally movable manner , so that a reducer 50 is joined thereto . each of the t - shaped frames 10 includes a projecting jaw portion 101 formed on an upper portion thereof and formed by an one - ply sidewall having a slot 102 , and is unfit for joining the support unit 20 thereto using a fastening screw 213 having a sharp tip portion 214 since a lower portion of the projecting jaw portion 101 is relatively weak . for this reason , typically , a blunt - ended tightening screw is mounted to a lower end of the projecting jaw portion 101 in such a way as to be caught to the lower end of the projecting jaw portion 101 , so that a joining portion 211 is not separated from the projecting jaw portion 101 . ( see fig1 ) as shown in fig3 and 4 , each of the support units 20 includes : a vertical body 200 ; a horizontal plane portion 201 bent to one side and formed at an upper portion of the vertical body 200 ; a first screw hole 202 formed on the horizontal plane portion 201 ; a fastening screw 203 joined to the support unit 20 and the support bar 30 through the first screw hole 202 and having a tip portion 204 penetrating the support bar 30 ; support portions 205 projecting from the horizontal plane portion 201 ; a pressurizing member 206 having both end portions , which are axially mounted to the support portions 205 , the pressurizing member 206 having pressure portions 207 pressing the support bar 30 when the pressurizing member 206 is laid down ; a rectangular hole 208 formed beneath the horizontal plane portion 201 for allowing an insertion of the support bar 30 ; an elastic member 209 having upper portions hingedly joined to a central portion of the vertical body 200 and a bent portion 210 formed on a lower portion thereof to clamp a lower end of the projecting jaw portion 101 ; a joining portion 211 formed on a lower portion of the vertical body 200 for fixing the projecting jaw portion 101 thereinto ; a second screw hole 212 formed on the joining portion 211 ; and the fastening screw 213 joined to the support unit 20 and the t - shaped frame 10 through the second screw hole 212 and having the sharp tip portion 214 penetrating the projecting jaw portion 101 . the vertical body 200 includes : hinge portions 215 formed at both sides of the center thereof for rotatably joining both ends of the elastic member 209 ; a retaining portion 216 put on an upper end of the projecting jaw portion 101 ; and an inclined retaining portion 217 put on a lower end of the projecting jaw portion 101 . the support bar 30 is a standardized pipe with a rectangular section , which is cut according to an interval of the support units 20 mounted on the t - shaped frames 10 . as shown in fig3 and 5 , the mounting bracket 40 includes : a body 400 having a mounting portion 401 for fitting the reducer 50 thereto from the front ; a rotating member 402 having one side axially mounted on the front of the body 400 for opening and closing the mounting portion 401 and the other side having a groove 403 ; a fastening member 404 to which the groove 403 is fit ; restricting jaw portions 405 formed on both sides of the rear part of the mounting portion 401 in such a way as to be bent upwardly for supporting the support bar 30 ; a first tightening screw 406 mounted on an upper portion of the rear part of the body 400 for tightening the support bar 30 ; and a second tightening screw 407 joined to the center of the rotating member 402 for closely contacting the reducer 50 to the support bar 30 . the body 400 includes a projecting portion 408 formed on one side of the front part thereof for supporting a standing state of the rotating member 402 . the fastening member 404 may be a tightening screw for tightening the rotating member 402 to the body 400 in a state where the groove 403 is fit thereto . as described above , as shown in fig6 , the support bar 30 is inserted into the rear part of the mounting bracket 40 in such a way as to be supported by the restricting jaw portions 405 in back and forth directions , and then , the first tightening screw 406 tightens and fixes the support bar 30 to the mounting bracket 40 . when the pressurizing member 206 axially mounted on the support portions 205 is rotated after both sides of the support bar 30 , to which the mounting bracket 40 is joined , are inserted into the rectangular holes 208 of the support units 20 , the pressure portion 207 presses and fixes the support bar 30 . after that , when the fastening screw 203 of the first screw hole 202 is tightened in such a way as to penetrate and fasten the support bar 30 in order to integrate the support bar 30 and the support units 20 with each other . when the joining portion 211 of each support unit 20 is fit to the projecting jaw portion 101 of each t - shaped frame 10 , the lower end of the projecting jaw portion 101 is supported by the bent portion 210 of the elastic member 209 and the inclined retaining portion 217 , and the upper end of the projecting jaw portion 101 is supported by the retaining portion 216 . in the above state , when the fastening screw 213 of the second screw hole 212 is tightened in such a way that the tip portion 214 penetrates the projecting jaw portion 101 in order to integrate the support unit 20 and the t - shaped frame 10 with each other , as shown in fig7 , the t - shaped frame 10 and the support bar 30 are mounted integrally to the support unit 20 by the fastening screws 203 and 213 . in a state where the t - shaped frame 10 and the support bar 30 respectively integrated to the support unit 20 are mounted on a ceiling , the reducer 50 having a head 60 is pushed into the mounting portion 401 , and then , the rotating member 402 is rotated until the groove 403 is caught to the fastening member 404 and an entrance of the mounting portion 401 is closed . after that , in the state where the entrance of the mounting portion 401 is closed , when the second tightening screw 407 is tightened , as shown in fig8 , the reducer 50 is mounted and fixed in a state where it is in a close contact with the support bar 30 , whereby mounting work of a sprinkler is finished . by conducting work to mount the reducer 50 to the mounting bracket 40 standing on a foothold and work to integrate the t - shaped frame 10 and the support bar 30 with the support units 20 on the floor , a user can rapidly and conveniently perform mounting work of the sprinkler . as described above , the sprinkler mounting device according to the present invention can achieve the same strong and firm joining structure as the integral type support bar even though the mounting device is in the separate type that the standardized rectangular pipe is used as the support bar 30 since the tip portions 204 and 214 of the fastening screws 203 and 213 penetrate and fasten the support bar 30 and the t - shaped frames 10 when the fastening screws 203 and 213 are tightened in a state where the support bar 30 and the t - shaped frames 10 are joined to the support units 20 by the elastic member 209 and the pressurizing member 206 . furthermore , the present invention can provide the user with an easy mounting work of the reducer 50 since the mounting bracket 40 is fixed by the first tightening screw 406 and the restricting jaw portion 405 and there is no need for the user to hold the mounting bracket 40 with the hand when the reducer 50 is mounted on the mounting portion 401 . while the present invention has been described with reference to the particular illustrative embodiment , it is not to be restricted by the embodiment but only by the appended claims . it is to be appreciated that those skilled in the art can change or modify the embodiment without departing from the scope and spirit of the present invention . | 1 |
cassia seeds ( both cassia tora l . and cassia obtusifolia l .) contain anthraquinones , naphtha - pyrones , fatty acids , amino acids and inorganic elements . the main constituents are anthraquinones including 0 . 8 - 1 . 6 % anthraquinone glycosides and 0 . 06 - 0 . 2 % anthraquinone aglycones . cassia seeds usually refer to mature dried seeds of cassia tora l . and cassia obtusifolia and are widely available . cassia occidentalis on the other hand is only used in some local areas of southern china . according to the distribution of the plants , cassia tora l . is distributed in the provinces south of the yangtze river , and can not be cultivated in the northern area as it is not able to bear flowers or fruits . on the other hand cassia obtusifolia l . can grow both in the north and south . the literature indicates that in ancient time , cassia seeds were from the above three species . research on the chemical components of cassia , has primarily been carried out by japanese scientists with japanese cassia seeds . some of the prominent chemicals isolated from japanese cassia , e . g . rhein and aloe - emodin , don &# 39 ; t seem to exist in chinese cassia seeds . scientists have so far paid very little attention to the chemical profile of chinese cassia seeds , except the knowledge of the existence of a few frequently occurring rheum anthraquinones . the active component of , and chemicals specific to chinese cassia seed , are as yet to be identified . at the moment the quality control method for raw material of cassia seeds and its preparation is based on the determination of the content of chrysophanol and total anthraquinones . the former ubiquitously exists in many medicinal plants containing anthraquinone derivatives while the measurement of the latter is even less specific . through a systematic phytochemical study on cassia seeds , the applicant has determined that plant material from north china mainly contained chrysophanol , physcion , obtusifolin , emodin , and aruantio - obtusin . two of them , aruantio - obtusin and obtusifolin seem to be the characteristic chemicals of chinese cassia seeds , while aruantio - obtusin was found to be the most prominent chemical in those fractions which produced a marked weight loss effect . based on the applicants &# 39 ; research , the amounts ( by weight ) of the active constituents in cassia tora were found to be lower than those in cassia obtusifolia . so cassia obtusifolia was selected for further investigation . there are many places producing cassia species and the contents of the anthraquinones and aurantio - obtusin varied significantly . the applicant investigated the samples from guangxi , anhui and hubei provinces in order to identify a most appropriate production site and to ensure the consistent quality of the raw materials . the raw materials from the above locations were quantified for their content of the anthraquinones and aurantio - obtusin , measured as , and calculated on the basis of , the total aglycone after acid hydrolysis , by uv spectrophotometry and hplc methods , respectively . the results of the investigation are illustrated in table 3 below : from table 3 it will be noted that the chemical content of the raw materials varied with location . based on the results applicant selected the cassia obtusifolia raw materials from hubei province . the marker compounds used to characterize the plant extract of the invention are noted below : 3 . 1 method of separation and purification of obtusifolin and aurantio - obtusin from cassia seeds referring to fig1 , 1 kg of cassia seeds were extracted with ethanol . the solution was filtered and the ethanol recovered under reduced pressure leaving a residue and extract ( 190 g ). the extract was partitioned with chloroform producing a chloroform layer — fraction a and the mother solution — fraction b . fraction a ( 20 g ) was absorbed onto a silica gel column , eluted with chloroform - methanol in gradient . the corresponding eluent was collected and re - crystallized with methanol . it contained 0 . 1 g of obtusifolin . fraction b was absorbed onto a macroporous resin column and eluted with ethanol . the eluent was further separated on a silica gel column and eluted with chloroform - methanol in gradient . the corresponding eluent was collected and re - crystallized with methanol . it contained 0 . 5 g of aurantio - obtusin . methanol and acetonitrile ( chromatographic grade ), dc - ionized water and phosphoric acid ( analytical grade ). eluted with methanol - water , methanol - 0 . 1 % phosphate , acetonitrile - water , and acetonitrile - 0 . 1 % phosphate in gradient , respectively , at different flow rates as shown in table 4 . referring to fig3 there is illustrated the preferred embodiment of a multi - stage process for preparing a plant extract of the invention . it comprises the following steps : 3 . 2 . 1 pulverize cassia seeds ( 25 kg ) into a coarse powder ; 3 . 2 . 2 carry out a reflux extraction with 4 - 20 folds in volume of 50 - 80 % ethanol for 0 . 5 - 3 hours ; 3 . 2 . 3 repeat 2 - 4 times ; 3 . 2 . 4 filter and recover ethanol from the solution under vacuum to obtain a crude extract ; 3 . 2 . 5 centrifuge the residue to remove any lipo - soluable oils ; 3 . 2 . 6 adjust concentration of the extract with distilled water to the ratio 1 : 1 - 1 : 10 ( material : solution ); 3 . 2 . 7 carry out separation and purification with a column filled with d 101 macroporous resin at the ratio 1 : 2 - 20 ( diameter : height ); 3 . 2 . 8 apply the extract with a quantity of less than 1 - 4 bv ( bv : resin bed volume ) to the column with dynamic absorption at the speed of 1 - 2 bv / h ; 3 . 2 . 9 wash with 1 - 8 bv of water and then with 1 - 8 bv of 20 % ethanol at a speed of 1 - 5 bv / h ; 3 . 2 . 10 elute with 1 - 10 bv of 70 % ethanol at the speed of 1 - 5 bv / h and collect the ethanol solution ; 3 . 2 . 11 recover ethanol and dry the extract under vacuum ; 3 . 2 . 12 dissolve the extract in 95 % ethanol . filter and recover the ethanol from the solution to obtain a concentrated extract ; 3 . 2 . 13 dry the refined extract under vacuum and then pulverize to give particles of a desired size for filling into capsules ( size 1 ). the resulting extract is a dark brown powder with a bitter taste . it is soluble in water , ethanol and methanol . the preferred extraction conditions were selected based on the following findings : pilot scale extractions were run at ethanol concentrations ranging from 0 % to 80 %, in 10 % increments , to determine optimum conditions . method : weigh 50 g of cassia seed coarse powder and add 300 ml of ethanol at selected concentrations , respectively . carry out reflex extraction for 1 . 5 hours , and repeat 3 times . filter and adjust the filtrate to 1000 ml . measurements : the content of aurantio - obtusin , and the anthroquinone fraction were quantified and yield measures obtained . from the above it can be seen that the percentage auratonin - obtusin and total anthraquinone content increased with increasing ethanol concentration but extract yield decreased . the optimum combination was at around 60 %. three commonly used ethanol extraction methods : percolation , cold - maceration and reflex extraction , were compared : percolation method : weigh 50 g of cassia seed coarse powder and add 100 ml of 60 % ethanol for 12 hours . percolate with 500 ml ethanol and collect the solution , adjust the volume with ethanol to 1000 ml . cold - maceration : weigh 50 g of cassia seed coarse powder and add 100 ml of 60 % ethanol to macerate for 12 hours . filter the solution under vacuum . add ethanol 250 ml to the residue and macerate for another 12 hours . filter the solution under vacuum . combine the two filtrates . adjust the solution with the solvent to 1000 ml . reflux extraction : weigh 50 g of cassia seed coarse powder and add 300 ml of 60 % ethanol and carry out reflux extraction for 1 . 5 hours . add 250 ml ethanol and carry out the extraction for another 1 . 0 hour . combine the two filtrates and adjust the solution with the solvent to the volume ( 1000 ml ). an orthogonal test was devised to determine the optimum volume / time / frequency for the extraction . the results ( not shown ) indicated that only frequency had a significant effect and accordingly reflux was repeated . the selected criteria were to use 8 folds of ethanol , to reflux for 1 hour and to repeat the process 3 times . the optimum purification conditions after the oils were removed with centrifugation were determined to be as follows : 3 . 6 . 1 conduct separation and purification with column filled with d 101 macroporous resin ; 3 . 6 . 2 employ a column ratio ( diameter to height ) of 1 : 20 ; 3 . 6 . 3 add the sample to the column with a dynamic absorption of less than 1 . 4 bv ( bv : resin bed volume ) preferably at a speed of 1 bv / h . 3 . 6 . 4 wash with 2 bv of water and then with 4 bv of 20 % ethanol at a speed of 2 bv / h ( this step is used to remove water soluble gums ); 3 . 6 . 5 elute with 4 bv of 70 % ethanol at a speed of 2 bv / h and collect 70 % ethanol solution ; 3 . 6 . 6 recover ethanol and dry the residue under vacuum ; 3 . 6 . 7 dissolve the extract in 95 % ethanol . filter and recover the ethanol from the solution under vacuum ; 3 . 6 . 8 dry the residue at 60 ° c . and pulverize to a desired particle size . fuller details and evidence supporting the selection of the above conditions are given below : both static and dynamic absorption ability was investigated in several resins . the selection criteria were the absorption and desorption efficiency of the resins . clean the column to prevent contamination . add half of the resin volume of 95 % ethanol into the column first , and then fill the column with macroporous resin . the level of ethanol solution should be 0 . 3 meter above the resin bed top . leave the ethanol solution in the column for 24 hours . use 2 bv ( 2 folds of bed volume of resin in the column , same as below ) of 95 % ethanol to wash the resin at a speed of 2 bv / h . leave the solution in the column for a further 4 - 5 hours . wash the resin again with 95 % ethanol at a speed of 2 bv / h until the eluent shows no cloudiness when diluted with 5 times of water . then wash the resin with distilled water at the same speed until the eluent does not smell of ethanol . use 2 bv of 5 % hcl solution to wash the resin at a speed of 4 - 6 bv / h and leave the solution in the column for 2 - 4 hours . use distilled water to wash the resin again at the same speed until the eluent has a neutral ph value . use 2 bv of 2 % naoh solution to wash the resin at the speed of 4 - 6 bv / h and leave the solution in the column for 2 - 4 hours . use distilled water to wash the resin again at the same speed until the eluent has a neutral ph value . method : the five resins selected were treated to remove surface water . a quantity of each resin was weighed and put into a stopped flask . the test solution was added to a hyper - saturated status and vibrated for 24 hrs to enable the resin to fully absorb the anthraquinones . quantify the content of the anthraquinones to evaluate the efficiency of the static absorption ability of the resin . filter and obtain filtrate 1 . add 80 ml of 95 % ethanol into the resin and vibrate for 24 hrs to desorb the compounds , then filter again and obtain the filtrate 2 . determine the contents of filtrate 1 and 2 ( not given ), and calculate the absorption and desorbtion rates . the result are given in table 8 below it can be seen from table 8 that the best all round macroporus resin was d 101 as it was bound relatively efficiently ( greater than 30 %) and in excess of 90 % of the bound material was desorbed . method : the eluent from the column was subjected to hplc . the addition of test solution to the column was stopped when aurantio - obtusin was detected . record the volume of the test solution added . wash the column with distilled water until the eluent is nearly colorless and collect the water solution . then elute with 95 % ethanol until the eluent is nearly colorless and collect the ethanol solution . determine the content of the anthraquinones in these two solutions and calculate the absorption and desorbtion rate , respectively . the results are provided in table 9 in the dynamic absorption test d101 resin showed better ability in both absorption and desorbtion than the others . in this regard the absorbing rate was in excess of 60 % and the desorbing rate in excess of 80 %. the static and dynamic absorption test results suggested that d 101 macroporous resin was better than the others so it was selected for separation and purification of the crude extract . 3 . 8 investigation of technical parameters in the column separation and purification of the anthraquinones sample solutions with different concentrations ( raw material : solution ) were flowed through the column filled with 50 g of pre - treated d 101 resin as for the dynamic absorption test . the absorbed quantity of the anthraquinones was determined . the results are given in table 10 below . from the above table it can be seen that the anthraquinones were more easily absorbed to resin when the concentration ratio increased and plateaued at 1 : 5 ( raw material : solution ). the sample solutions were flowed through the column filled with 50 g of pre - treated d 101 resin at the speeds of 1 , 2 , 3 bv / ht , respectively , for dynamic absorption test . elute with distilled water and then 95 % ethanol , collect the ethanol solution to determine the content of the anthraquinones . the sample solution was flowed through a column filled with 50 g of pre - treated d 101 resin with the conditions as for the dynamic absorption test . the eluent was collected in 10 ml fractions , and 10 fractions in total were collected . filter the fractions with 0 . 2 μm microporous film and determine the content of aurantio - obtusin by hplc . the result are given in table 12 . the sample solutions were flowed through 4 columns filled with 50 g each of pre - treated d 101 resin with conditions as for the dynamic absorption test . the 4 columns were eluted with distilled water until the eluent was nearly colorless and then eluted with 30 %, 50 %, 70 % and 90 % ethanol . the ethanol eluent was collected . the content of the anthraquinones was determined . the result are given in table 13 . the columns were filled with 50 g of pre - treated d 101 resin and after the dynamic absorption the column was eluted with 70 % ethanol at speeds of 1 , 2 , and 3 bv / h , respectively . the content of the anthraquinones in the ethanol solution was determined . the results are given in table 14 . from the table above , it was determined that the slower the elution speed , the better the desorption effect . the difference between 1 bv / h and 2 bv / h was not significant and 2 bv / h was selected in consideration of reducing processing time and increasing efficiency in large scale production . based on above selected conditions , apply the sample solution onto a column filled with 50 g of pre - treated d 101 resin . elute with ethanol . collect the ethanol solution with every 10 ml as one sample . after 15 th sample , collect 20 ml as one sample for further 20 samples . determine the content of aurantio - obtusin by hplc and prepare the elution curve . results are given in table 15 . from the table the 18 th sample showed a very low content of the anthraquinones , so the 18 th sample ( 200 ml ) was decided as the elution end point , i . e . 4 bv of the eluent to be used . the test solution was adjusted to ph 4 , 5 , and 6 ( ph 5 in the original solution ), respectively and the effect of ph on anthraquinone content determined — see table 16 . based on the above selected conditions for absorption and elution , 3 columns ( 20 mm × 300 mm ) were filled with the pre - treated macroporous resin 17 ml , 34 ml and 50 ml to have a diameter to height ratio 1 : 5 , 1 : 10 , and 1 : 20 , respectively . 1 . 4 bv of the sample solution was applied to the column and eluted as mentioned . the results are given in table 17 . the result showed that when the diameter to height ratio of resin bed was increased above 1 : 10 to 1 : 20 , the content of the anthraquinones increased . there are water soluble gum materials in the cassia seeds . it was found these gums could be dissolved in water and low concentrations of ethanol without eluting the anthraquinones . they could be effectively eluted out by 20 % ethanol while anthraquinones could not be eluted out at this concentration . accordingly a wash step with water followed by elution with 20 % ethanol to get rid of the gums was introduced . in addition , re - dissolving the extract in 95 % of ethanol and filtering removed water soluble residues . based on a process employing the parameters selected above , three batches of pilot scale extractions were conducted in order to confirm the feasibility of the process in the large scale production . the result are given in table 18 a plant extract obtainable by the method described above could be characterized as having an anthraquinone content in excess of 45 % and an aurantio obtusin content in excess of 4 . 5 %, measured as and calculated on the basis of the total aglycone after acid hydrolysis . it was subjected to further quality analysis as set out in 4 . 0 below : this product extracted from the seeds of cassia obtusifolia using ethanol as per the methodology described above was determined to contain a minimum of 4 . 5 % aurantio - obtusin ( total of the aglycone in both free form and in combined form which could be made to be free form with hydrolysis ), and have a total anthraquinone content of at least 50 %. the amount of obtusifolin was at least 0 . 25 %, more typically at least 0 . 5 %. based on pilot scale averages the anthraquinone content is about 50 %, the aurantio - obtusin content is about 5 . 2 % and the obtusifolin content ( based on table 19 ) is about 0 . 6 % ( all figures plus / minus 10 %). it can be characterized by way of hplc as described under 3 . 1 . 1 - 3 . 1 . 4 . weigh 10 mg sample , add 20 ml of methanol and 10 ml of 5 % hcl , and reflex for 30 minutes . extract the solution with 30 ml ether and remove the ether from the solution . dissolve the residue in methanol in a 25 ml volumetric flask , shake well and add further methanol to volume . filter through a 0 . 22 μm micro membrane before injection . inject 20 μl of sample solution , determine peak area of each component , substitute the value in the linear equations to calculate the content , the result is as follows ( unit : mg / g ): perform tlc based on the methods described in the chinese pharmacopoeia ( appendix vi b ). apply 1 μl of each of the above solutions onto a plate . ( activation at 105 ° c . for 30 mins before use ). pre - saturate tlc tank for 15 mins before the plate is put in . examine the tlc plates at uv365 nm and 254 nm . the results are illustrated in fig5 and 6 respectively . the dried extract can be used to fill capsules , in a unit dosage form , containing e . g . 250 mg of extract such that a daily does of 500 mg can be easily given . this is equivalent to a 50 g of the raw material . in animal studies the extract has been demonstrated to exhibit an anti - obesity activity . the sample pyn22 was prepared using the protocol described above . it is a dark brown powder . seventy five male sd rats , weighting 140 g ± 10 g each , were provided by the experimental animal centre , sichuan university . the animal lived in an environment with a temperature of 22 - 24 ° c . and a humidity of 65 - 70 %. they were fed on two diets : i ) basic feeding materials : barley powder 20 %, dehydrolized vegetables 10 %, bean powder 20 %, yeast 1 %, bone powder 5 %, corn flour 15 %, wheat bran 16 %, fish powder 10 % and salt 2 %. ii ) high fat and high nutrition feeding materials : to 100 g of the basic feeding materials were added 10 g milk powder , 10 g lard , one egg , 10 drops of concentrated fish liver oil and 50 g of fresh bean sprouts . based on a recommended daily dose of 0 . 5 - 0 . 6 g for humans , three doses , 0 . 05 g / kg · bw / day , 0 . 15 g / kg · bw / day and 0 . 30 g / kg · bw / day , were selected for the animal study , which were equivalent to 5 fold , 15 fold and 30 fold of the recommended human daily dose , respectively . each was given the test sample at the dose of 0 . 05 g / kg · bw / day , 0 . 15 g / kg · bw / day and 0 . 30 g / kg · bw / day , respectively . the normal control group was fed with the basic feeding materials . all other groups were fed with high fat and high nutrition materials . all the animals were free to take the food and drink . the test samples were given once a day , via the intragastric route , to the three testing groups at the dose mentioned above ( the volume of the liquid was 1 % of the body weight of the rat ). the normal control group and high fat control group were given distilled water instead of the testing sample . the experiment lasted for 36 days . the animals were then dissected . body fat weight ( testis and kidney surrounding fat ) and body fat / body weight ratio were determined and side effects noted . the effect on body weight is illustrated in table 20 below . from table 20 , the results showed that in the middle term of the experiment , the average body weight of the rats in the high fat control group was significantly higher than that in the normal control group , which meant that the fat animal model was set successfully . three groups took the testing materials for 36 days and in two of them , at the dose of 0 . 05 g / kg · bw / day and 0 . 15 g / kg · bw / day , their average body weight and increased body weight were significantly lower than that in the high fat control groups , which meant that the testing sample could reduce the animal body weight . no diarrhea and hair loss were observed during the experiment . the effect on body fat weight is illustrated in table 21 below . from the table 21 above it can be seen that , at the completion of the experiment , both the body fat content , and body fat / body weight ratio of the high fat control group were significantly higher than that in the normal group ( p & lt ; 0 . 01 ). this demonstrates that the fat animal model was set successfully . the body fat content in two testing groups ( 0 . 05 g / kg · bw / day and 0 . 15 g / kg · bw / day ) was significantly lower than that in the high fat control group ( p & lt ; 0 . 01 ); the body fat / body weight ratio in all three testing groups was significantly lower than that in the high fat control group ( p & lt ; 0 . 05 ). this demonstrated that the test sample could reduce the body fat content of the animals , i . e . it may act as an anti - obesity agent . the body weight , body fat content , body fat / body weight ration in high fat control group were significantly higher than that in the normal control group . the body weight , body fat content in two testing groups ( 0 . 05 g / kg · bw / day , 0 . 15 g / kg · bw / day ) was significantly lower than that in the high fat control group ( p & lt ; 0 . 01 ). the body fat / body weight ratio in all three testing groups was significantly lower than that in the high fat control group ( p & lt ; 0 . 05 ). all results suggested that the test sample had an anti - obesity effect in rat . the maximum dose of intra - gastric administration of the extract of cassia - seeds was 16 . 50 g / kg in a single dose . the ld 50 was 20 . 84 g / kg when administrated twice ( interval 4 hours ) and it was equivalent to 2511 times of proposed clinical dose ( kg / bw ). so it is safe for adult to take 0 . 5 g cassia extract ( pyn - 22 ) in two capsules , equivalent to 50 g raw material , per day . the rats were intragastriclly given the extract of cassia seed and the rats were dissected in the 16 th , 26 th week of the medication , and the 4 th week after the medication , respectively . there were no obvious histopathological changes in the organs from the testing group animals compared with those from the animals in the normal control group . a ) body weight and body fat ; b ) metabolic parameters ; and c ) liver indicators experimental design : forty c57 black ob / ob mice were allocated to five groups of eight for study over 40 days as follows : lean diet — no treatment ; high fat diet — no treatment ; high fat diet — 100 mg / kg / od pyn22 ; high fat diet — 300 mg / kg / od pyn22 ; high fat diet — 3 mg / kg / od rosiglitazone ( positive control ). mice were weighed twice per week and food intake measured daily throughout the study . any laxative effects of treatments were visually examined and recorded . oral glucose tolerance tests were conducted on day 7 , day 21 and day 35 . fasting plasma insulin and lipids were measured on days 7 , 21 and 35 . three days before sacrifice , 100 ul blood samples were taken from all animals to provide plasma glucose , insulin , free fatty acid , triglycerides , cholesterol and hdl - cholesterol . at sacrifice , body mass and fat mass were calculated ; the same parameters were also calculated for liver , heart and white adipose tissues . animal well - being / safety measures : all animals in each of the study group survived the treatment regimens until the scheduled sacrifice date . each group of animals was examined on a daily basis and no laxative effect was recorded in any treatment group . over the course of the study , animals in the rosiglitazone control group had an increased body weight that exceeded the other four groups ( fig7 a ), as reflected clearly in weight gain in the study period ( fig7 b ). however , the body fat gained was not significantly different than the treatment free high fat group . only high levels of pyn22 resulted in significantly less body fat gain relative to the high fat control , and 300 mg od pyn22 seemed to prevent body fat increasing above lean control levels , despite high fat intake in this group ( fig7 c ). in terms of circulating lipids , there was a possible dose - response trend of cholesterol reduction by pyn22 but only rosiglitazone gave a statistically significant reduction on total cholesterol in high fat diet groups ( fig8 a ). however , 100 mg od pyn22 gave a significant reduction in hdl cholesterol that became highly significant at 300 mg od and surpassed the effects of rosiglitazone ( fig5 b ). in terms of insulin levels , pyn22 consistently lowered fasting insulin in animals on a high fat diet , bringing levels part - way towards those receiving a lean diet , but not achieving the effects of rosiglitazone , a marketed anti - diabetic therapy . ( fig9 a - 9c ). in oral glucose tolerance tests ( ogtts ), pyn22 reversed the effects of the high fat diet towards the lean diet group ( fig1 a , 10 b and 10 c ) in a dose - dependent trend at all time points in the study but without statistical significance , and with less effect than rosiglirazone . pyn22 had no effect on alt levels ( but reduced ast levels in a dose - dependent trend but without statistical significance — fig1 a and 11b ). pyn22 also reduced actual and relative (% body weight ) liver weight ,—( fig1 c and 11d ) whereas rosiglitazone had no effect . pyn22 had little effect on liver glycogen levels ( fig1 e ) but reduced liver triglycerides substantially ( fig1 f ), although not significantly . the above results provide credible evidence that in addition to treating obesity the extract of the invention may also be used to treat metabolic disease or liver disease . the effect on lipid levels and on metabolic indicators is manifest in a statistically significant reduction in body fat . the data is additional suggestive of further clinical application in the treatment of : chronic inflammation of the liver resulting from metabolic overload and fat deposition ; fatty liver ; and fibrogenesis . | 0 |
[ 0026 ] fig1 through 3b are partial cross - sectional views illustrating the method of controlling polysilicon grain size in a polysilicon layer according to the present invention . in fig1 formed on substrate 100 is a dielectric layer 105 . substrate 100 may be a silicon substrate . formed on dielectric layer 105 is a polysilicon layer 110 . polysilicon layer 110 has a bottom surface 120 and a top surface 125 . polysilicon layer 110 may be formed , for example , by any number of well known means such as low - pressure chemical vapor deposition ( lpcvd ). dielectric layer 105 may be a thermal or deposited oxide layer formed to prevent epitaxial silicon growth during the lpcvd process in the case of substrate 100 having a crystalline structure . polysilicon layer 110 is formed of a multiplicity of polysilicon grains ( also called micro crystals ) 115 having an average as deposited grain size ( or diameter ) of gs 1 . should an anneal step ( as described below ) be performed immediately after deposition , polysilicon grains 115 would grow to an average post anneal grain size of gs 2 . in fig2 a grain size modulating ion implant of either antimony ( sb ) or carbon ( c ) is performed . if an sb ion implant is performed , then after an anneal step , polysilicon layer 110 will contain a multiplicity of polysilicon grains 130 having an average post anneal grain size of gs 3 where gs 3 is greater than gs 2 as illustrated in fig3 a . if a c ion implant is performed , then after an anneal step , polysilicon layer 110 will contain a multiplicity of polysilicon grains 135 having an average post anneal grain size of gs 4 where gs 4 is less than gs 2 as illustrated in fig3 b . should a doped polysilicon layer be desired , a dopant species such as arsenic ( as ) may be implanted before or after the sb or c ion implant . in a first example , polysilicon layer 110 is about 1000 to 2200 å thick and average as deposited grain size gs 1 varies from about 100 to 500 å , increasing in size from about 100 å near bottom surface 120 to about 300 to 500 å near top surface 125 . after an sb ion implant of about 1e15 to 1 . 5e16 atm / cm 2 and at an energy of about 30 to 70 kev followed by about a 900 to 1000 ° c . for about 5 to 20 second rta , the average post anneal grain size gs 3 is about 1370 å . ( if , with no sb ion implant , a 900 to 1000 ° c . for about 5 to 20 second rapid thermal anneal ( rta ) were performed , the average post anneal grain size gs 2 would be about 770 å ) should a doped polysilicon layer be desired , a dopant species may be implanted before or after the sb ion implant . in a second example , polysilicon layer 110 is about 1000 to 2200 å thick and the average as deposited grain size gs 1 from about 100 å near bottom surface 120 to about 300 to 500 å near top surface 125 . after a c ion implant of about a 1e14 to 1e16 atm / cm 2 and at an energy of about 15 to 35 kev followed by about a 900 to 1000 ° c . for about 5 to 20 second rta , the average post anneal grain size gs 4 is about 600 å . ( if , with no c ion implant , a 900 to 1000 ° c . for about 5 to 20 second rta were performed , the average grain size gs 2 would be about 770 å ). should a doped polysilicon layer be desired , a dopant species may be implanted before or after the c ion implant . [ 0030 ] fig4 is a flowchart of the method steps for controlling polysilicon grain size in a polysilicon layer according to the present invention . in step 140 , a polysilicon layer is formed on a substrate . in step 145 , an optional dopant ion species ( for example as ) is implanted . in step 150 , a decision is made as to whether the polysilicon layer is to have a larger or smaller post anneal grain size than would be obtained if no grain size modulating ion implant were performed . if it is decided that a larger post anneal grain size is desired , then in step 155 an sb ion implant is performed . if it is decided that a smaller post anneal grain size is desired , then in step 160 a c ion implant is performed . in step 165 , the polysilicon layer may be patterned using any number of well known photolithographic and reactive ion etch processes . in step 170 , an anneal step is performed which inhibits polysilicon grain size growth in the case of the c ion implant , or enhances polysilicon grain size growth in the case of the sb ion implant . in a first example , the polysilicon layer is about 1000 to 2200 å thick and the average as deposited grain size gs 1 varies from about 100 å near the bottom to about 300 to 500 å near the top surface of the polysilicon layer . after an sb ion implant at about a 1e15 to 1 . 5e16 atm / cm 2 and an energy of about 30 to 70 kev followed by a 900 to 1000 ° c . for about 5 to 20 second rta , the average post modulated anneal grain size is about 1370 å . ( if , with no sb ion implant , a 900 to 1000 ° c . for about 5 to 20 second rta were performed , the average post un - modulated anneal grain size gs 2 would be about 770 å ). in a second example , the polysilicon layer is about 1000 to 2200 å thick and the average as deposited grain size gs 1 varies from about 100 å near the bottom to about 300 to 500 å near the top surface of the polysilicon layer . after a c ion implant at about a 1e14 to 1e16 atm / cm 2 to and an energy of about 15 to 35 kev followed by a 900 to 1000 ° c . for about 5 to 20 second rta , the average post anneal modulated grain size is about 600 å . ( if , with no c ion implant , a 900 to 1000 ° c . for about 5 to 20 second rta were performed , the average un - modulated grain size would be about 770 å ). [ 0033 ] fig5 is a cumulative distribution plot of polysilicon grain diameter in polysilicon layers fabricated according to the present invention . three curves are plotted in fig5 . the uppermost curve plots the cumulative distribution of post anneal polysilicon grain size for a 1600 å thick polysilicon layer implanted with as at a dose of 1 . 6e16 atm / cm 2 and with c at a dose of 1e15 followed by a 5 second 900 ° c . rta . the 50 % point of the cumulative distribution corresponds to a polysilicon grain size of 59 . 7 nm . the middle curve plots the cumulative distribution of post anneal polysilicon grain size for a 1600 å thick polysilicon layer implanted with as at a dose of 1 . 6e16 atm / cm 2 followed by a 5 second 900 ° c . rta . the 50 % point of the cumulative distribution corresponds to a polysilicon grain size of 76 . 7 nm . the lowermost curve plots the cumulative distribution of post anneal polysilicon grain size for a 1600 å thick polysilicon layer implanted with as at a dose of 1 . 6e16 atm / cm 2 and with sb at a dose of 5e15 atm / cm 2 followed by a 5 second 900 ° c . rta . the 50 % point of the cumulative distribution corresponds to a polysilicon grain size of 136 . 8 nm . from fig5 it is clear that addition of carbon inhibits polysilicon grain size growth while the addition of antimony enhances polysilicon grain size growth during post ion implant anneals . sb and c ion implants are defined as polysilicon grain size modulation ion implants and sb and c are defined as polysilicon grain size modulating species . [ 0035 ] fig6 through 11 are partial cross - sectional views illustrating fabrication of a bipolar transistor according to the present invention . in fig6 partially formed bipolar transistor 180 includes deep trench isolation 185 surrounding an n + subcollector 190 . an n + subcollector reach - through 195 contacts subcollector 190 . a collector region 200 includes an n + deep collector 205 on top of subcollector 190 and an n + pedestal collector 210 on top of deep collector 205 . shallow trench isolation 215 separates collector region 200 from collector reach - through 195 . an upper portion 220 of collector region 200 extends above a top surface 225 of deep trench isolation 185 and a top surface 230 of shallow trench isolation 215 . pedestal collector 210 extends into upper portion 220 of collector region 200 . a base layer 235 overlays and contacts deep trench isolation 185 , upper portion 220 of collection region 200 , shallow trench isolation 215 and collector reach through 195 . base layer 235 includes p + polysilicon extrinsic base portions 240 contacting deep and shallow trench isolations 185 and 215 and n + subcollector reach - through 195 . base layer 235 also includes p + single - crystal extrinsic base portions 245 contacting upper portion 220 of collector region 200 . base layer 235 further includes a single - crystal intrinsic base portion 250 , contacting pedestal collector 210 between single p + single - crystal extrinsic base portions 245 . intrinsic base portion 250 of base layer 235 includes a sige layer 255 contacting pedestal collector 210 , a boron doped sige layer 260 on top of sige layer 255 and a silicon layer 265 on top of boron doped sige layer 260 . a first dielectric layer 270 extends on top of base layer 235 . an emitter opening 275 is formed in dielectric layer 270 over intrinsic base portion 250 of base layer 235 . an ultra - thin oxide layer of about 1 to 2 å is formed on a top surface 280 of silicon layer 265 , where the silicon layer is exposed in emitter opening 275 . a polysilicon emitter layer 285 is formed on top of first dielectric layer 270 and top surface 280 of silicon layer 265 . in one example , polysilicon emitter layer 285 is 1000 to 2200 å thick having an as deposited gradient of polysilicon grain size from about 100 å near first dielectric layer 270 to about 300 to 500 å at the top of the emitter layer . in fig7 an arsenic ion implantation into polysilicon emitter layer 285 is performed . in one example , the arsenic ion implantation is performed at a dose of about 1e15 to 2 . 3e16 atm / cm 2 of as + and at an energy of about 40 to 70 kev . in fig8 either an antimony or a carbon ion implantation into polysilicon emitter layer 285 is performed . in a first example , an antimony ion implantation is performed at a dose of about 1e15 to 2 . 3e16 atm / cm 2 and at an energy of about 30 to 70 kev . in a second example , a carbon ion implantation is performed at a dose of about 1 . 2e14 to 2e16 atm / cm 2 of c and at an energy of about 15 to 35 kev . in fig9 a second dielectric layer 290 is formed on polysilicon emitter layer 285 , a first anneal performed , and a third dielectric layer 295 formed on top of the second dielectric layer . in one example , first dielectric layer 290 is 100 to 140 å of plasma enhanced chemical vapor deposition ( pecvd ) silicon nitride , the first anneal is an rta for 5 seconds at 800 to 1000 ° c . and second dielectric layer 295 is 1500 to 1900 å of pecvd silicon nitride . in fig1 , polysilicon emitter layer 285 ( see fig9 ) is patterned to form polysilicon emitter 300 , and base layer 235 ( see fig9 ) is patterned to form base 305 . a fourth dielectric layer 315 is formed on polysilicon emitter 300 . a second anneal is performed to form single - crystal emitter 310 in silicon layer 265 . in one example , the anneal is an rta for 5 seconds at 800 to 1000 ° c . and fourth dielectric layer is about 100 å of pecvd silicon nitride . in fig1 , an fifth dielectric layer 320 is formed over entire device 180 ( see fig1 ). an emitter contact 325 is formed in fifth dielectric layer 320 through fourth dielectric layer 315 to contact polysilicon emitter 300 . a base contact 330 is formed in fifth dielectric layer 320 through first dielectric layer 270 to contact extrinsic base portion 240 of base 305 . a collector contact 335 is formed in fifth dielectric layer 320 through to contact emitter reach through 195 . an interlevel dielectric layer 340 is formed over fifth dielectric layer 320 and first metal conductors 345 are formed in the interlevel dielectric layer contacting emitter contact 325 , base contact 330 and collector contact 335 . in one example fifth dielectric layer 320 is boro - phosphorus - silicon glass ( bpsg ) formed by pecvd , interlevel dielectric layer 340 is tetraethoxysilane ( teos ) oxide formed by pecvd , contacts 325 , 330 and 335 are formed from tungsten by well known damascene processes and first metal conductors 345 are formed from aluminum , titanium or copper by well known damascene processes . metal silicide may be formed at the contact silicon interfaces . fabrication of bipolar transistor 180 is essentially complete . [ 0045 ] fig1 is a flowchart of the method steps for fabricating a bipolar transistor according to the present invention . in step 350 , normal processing is performed in the fabrication of a bipolar transistor up to and including formation of the polysilicon emitter layer as illustrated in fig6 and described above . note neither the polysilicon emitter layer or the base layer has been patterned and are blanket layers at this point in the fabrication process . also , the base layer has a polysilicon portion and a single - crystal portion . in one example , the emitter layer is 1000 to 2200 å thick having an as deposited gradient of polysilicon grain size from about 100 å from the bottom to about 300 to 500 å at the top of the polysilicon emitter layer . in step 355 , an arsenic ion implantation of the polysilicon emitter layer is performed . in one example , the arsenic ion implantation is performed at a dose of about 1e15 to 2 . 3e16 atm / cm 2 of as and at an energy of about 40 to 70 kev . in step 360 , a decision is made as to whether the polysilicon emitter layer is to have a larger or smaller post anneal grain size than would be obtained if no grain size modulating ion implant were performed . if it is decided that a larger post anneal grain size is desired , then in step 365 an sb ion implant is performed . in one example , the sb ion implantation is performed at a dose of about 1e15 to 2 . 3e16 atm / cm 2 and at an energy of about 30 to 70 kev . if it is decided that a smaller post anneal grain size is desired , then in step 370 a c ion implant is performed . in one example , the carbon ion implantation is performed at a dose of about 1 . 2e14 to 2e16 atm / cm 2 of c and at an energy of about 15 to 35 kev . in step 375 a first a cap layer is formed over the polysilicon emitter layer . in one example , the first cap layer is 100 to 140 å of plasma enhanced chemical vapor deposition ( pecvd ) silicon nitride . in step 380 , a first anneal performed . the purpose of the first anneal is to distribute the as throughout the polysilicon emitter layer . in one example the first anneal is an rta for 5 seconds at 800 to 1000 ° c . anneal . in step 385 , a second cap layer is formed over the first cap layer . in one example , second cap layer is 1500 to 1900 å of pecvd silicon nitride . in step 390 , the polysilicon emitter layer is patterned to form the polysilicon portion of the emitter of the bipolar transistor by any one of well known photolithographic and rie techniques . in step 395 , the base layer is patterned to form the base of the bipolar transistor by any one of well known photolithographic and rie techniques . in step 400 , a second anneal is performed to drive the as into the single - crystal portion of the base to form the single - crystal emitter of the bipolar transistor . in one example , the second anneal is an rta for 5 seconds at 800 to 1000 ° c . in step 405 , the bipolar transistor is completed as illustrated in fig1 and described above . [ 0051 ] fig1 is a plot of implanted species versus depth for the polysilicon emitter of a bipolar transistor fabricated according to the present invention . in fig1 , the topmost curve ( as only ) is for an as only implant of 1 . 7e16 atm / cm 2 , the middle curve ( as + sb ), which shows the as profile , is for a as implant of 1 . 2e16 atm / cm 2 followed by an sb ion implant of 5e15 atm / cm 2 and the bottom curve ( sb only ) is for an sb only implant of 5e15 atm / cm 2 . a 5 second 900 ° c . rta was performed after ion implantation . the measurement technique was secondary ion mass spectroscopy ( sims ). examination of the as only curve indicates that the as concentration declines steadily from about 13 nm to about 60 . examination of the sb only curve indicates that the sb concentration remains relatively level at near 1e20 atm / cm 3 from about 10 to 55 nm with a jump to about 9e20 atm / cm 3 at about 58 nm . examination of the as + sb curve indicates the as concentration remains relatively constant near about 9e20 atm / cm 3 from between about 10 to 55 nm with a jump to about 4e21 atm / cm 3 at about 58 nm . the as + sb curve pretty much mirrors the sb only curve , indicating the as is “ following ” the sb during the anneal . leveling and increasing the dopant concentration deeper into the emitter are desirable in advanced bipolar transistors ( as well as advanced fet transistors and resistors fabricated with polysilicon ). since implanting polysilicon grain size modulating species also modulates the dopant concentration profile of any dopant present in the polysilicon layer , the terms polysilicon grain size modulating ion implant or species and dopant concentration profile modulating ion implant or species are defined as equivalent terms for the purposes of the present invention and sb and c are examples of such species . [ 0053 ] fig1 is a plot of normalized base current versus selected combinations of implanted species and dose for a bipolar transistor fabricated according to the present invention . the measurements where made on a bipolar transistor fabricated as illustrated in fig6 through 12 and described above . measurements were made on four bipolar transistors having an as implant of 1 . 7e16 atm / cm 2 followed by c ion implants of 1e15 , 5e16 , 1e15 and 5e14 atm / cm 2 respectively , on four bipolar transistors having only as implants of 1 . 2e16 atm / cm 2 , on two bipolar transistors having an as implant of 1 . 2e16 atm / cm 2 followed by sb ion implants of 1e15 and 5e16 atm / cm 2 respectively and on two bipolar transistors having an as implant of 1 . 7e16 atm / cm 2 followed by sb ion implants of 5e15 atm / cm 2 . [ 0054 ] fig1 shows carbon decreases the base current and antimony substantially increases the base current . increased base current is desirable in advanced bipolar transistors . since implanting polysilicon grain size modulating species also modulates the base current of the bipolar transistor , the terms polysilicon grain size modulating ion implant or species and base current modulating ion implant or species are defined as equivalent terms for the purposes of the present invention and sb and c are examples of such species . [ 0056 ] fig1 is a plot of emitter resistance versus selected combinations of implanted species and dose for a bipolar transistor of fabricated according to the present invention . the emitter resistance measurements where made on a bipolar transistor fabricated as illustrated in fig6 through 12 and described above . measurements were made on four bipolar transistors having an as implant of 1 . 7e16 atm / cm 2 followed by c ion implants of 1e15 , 5e16 , 1e15 and 5e14 atm / cm 2 respectively , on four bipolar transistors having only as implants of 1 . 7e16 atm / cm 2 , on two bipolar transistors having an as implant of 1 . 7e16 atm / cm 2 followed by sb ion implants of 1e15 and 5e15 atm / cm 2 respectively and on two bipolar transistors having an as implant of 1 . 7e16 atm / cm 2 followed by sb ion implants of 5e15 atm / cm 2 . [ 0057 ] fig1 shows carbon increases the emitter resistance and as the carbon dose is increased the emitter resistance increases and antimony substantially decreases the emitter resistance . decreased emitter resistance is desirable in advanced bipolar transistors . since implanting polysilicon grain size modulating species also modulates the emitter resistance of the bipolar transistor , the terms polysilicon grain size modulating ion implant or species and emitter resistance modulating ion implant or species are defined as equivalent terms for the purposes of the present invention and sb and c are examples of such species . while not illustrated a c ion implant into the emitter increases the sheet resistance ( ω /□) of the emitter by about 50 % while an sb ion implant into the emitter decrease the sheet resistance of the emitter by about 50 %. decreased emitter sheet resistance is desirable in advanced bipolar transistors . since implanting polysilicon grain size modulating species also modulates the sheet resistance of the emitter of the bipolar transistor , the terms polysilicon grain size modulating ion implant or species and emitter sheet resistance modulating ion implant or species are defined as equivalent terms for the purposes of the present invention and sb and c are examples of such species . therefore , it has been shown that c and sb ion implants into bipolar transistors can modulate the concentration of the emitter dopant , the base current , the emitter resistance and the emitter sheet resistance and that an sb ion implant will move these parameters in the direction most helpful in the design of advanced bipolar transistors . [ 0062 ] fig1 through 20 are partial cross - sectional views illustrating fabrication of a field effect transistor according to the present invention . in fig1 , a partially fabricated nfet 410 is illustrated . nfet 410 includes sti 415 formed in formed in a p well 420 . a thin gate oxide layer 425 is formed on a top surface 430 of p well 420 and sti 415 . a polysilicon gate 435 is formed on top of gate oxide layer 425 over p well 420 and first spacers 440 are formed on sidewalls 445 of the polysilicon gate . in fig1 , an halo ion implant is performed to form source / drain ( s / d ) extensions 450 in p well 420 , near top surface 430 . in one example the halo implant includes an as implantation at a dose of about 8e14 atm / cm 2 and an energy of about 15 kev . in fig1 , second spacers 455 are formed over first spacers 440 and an s / d ion implant is performed to form s / ds 460 . in one in one example the s / d implant includes a as implantation at a dose of about 5e15 atm / cm 2 and an energy of about 30 to 70 kev . in fig1 , a polysilicon grain size profile modulation ion implant is performed . in one example the polysilicon grain size profile modulation ion implant is sb implanted at a dose of about 1e15 to 1e16 atm / cm 2 and an energy of about 15 kev . an optional masking step , covering s / ds 460 but leaving polysilicon gate 435 exposed may be performed to stop the modulating ion implant penetrating into s / ds 460 . in fig2 , an anneal is performed to increase the concentration of as in a lower region 465 of polysilicon gate 435 . in one example , the anneal is a 5 second 900 ° c . rta . because the antimony has enhanced the diffusion of arsenic in polysilicon gate 435 , depletion of dopant in the gate electrode due to channeling during ion implantation as well as dopant diffusion effects are mitigated . [ 0067 ] fig2 is a partial cross - sectional view of a thin film resistor fabricated according to the present invention . formed on top of an insulating layer 470 formed on a substrate 475 is a polysilicon thin film resistor 480 , having a upper region 485 and a lower region 490 . upper region 485 contains sb and as and lower region 490 contains sb and an enhanced concentration of as . optional spacers 495 are formed on sidewalls 500 of thin film resistor 480 . upper and lower regions 485 and 490 of thin film resistor 480 are formed by processes similar to those illustrated in fig1 through 20 for nfet 410 and such processes are further illustrated and described in fig2 . [ 0068 ] fig2 is a partial cross - sectional view of a damascened thin film resistor fabricated according to the present invention . formed on a substrate 505 is an interlevel dielectric layer 510 or other dielectric layer . formed in interlevel dielectric layer 510 is a damascened polysilicon resistor 515 having an upper region 520 and a lower region 525 . damascened polysilicon resistor 515 is formed by well known damascene techniques . upper region 520 contains sb and as and lower region 525 contains sb and an enhanced concentration of as . upper and lower regions 520 and 525 of damascened thin film resistor 515 are formed by processes similar to those illustrated in fig1 through 20 for nfet 410 and such processes are further illustrated and described in fig2 . [ 0069 ] fig2 is a flowchart of the method steps for fabricating a field effect transistor according to the present invention . in step 530 , normal processing is performed in the fabrication of an nfet transistor up to and including formation of the polysilicon gate as illustrated in fig1 and described above . in one example , the emitter layer is 1000 to 2200 å thick . in step 535 , a halo implantation of the p well on either side of the gate is performed . in one example , the halo implant implantation includes an as implantation at a dose of about 8e14 atm / cm 2 and an energy of about 15 kev . in step 540 , a s / d implantation is performed . in one example , the s / d implant implantation includes an as implantation at a dose of about 1e15 to 1e16 atm / cm 2 at an energy of about 40 to 70 kev . in step 545 , an optional masking step , covering the s / d regions of the nfet but leaving the polysilicon gate exposed may be performed to stop the polysilicon grain size modulation ion implant of step 550 from modulating the dopant concentration profile of the s / ds . in step 550 , a polysilicon grain size modulation ion implant is performed . in one example , the polysilicon grain size modulation ion implant is an sb ion implantation performed at a dose of about 1e15 to 1e16 atm / cm 2 and at an energy of about 30 to 70 kev . in step 555 , an anneal is performed . the purpose of the anneal is to distribute the dopant species ( for example as ) and the sb throughout the polysilicon emitter layer and especially increase the dopant concentration near the polysilicon gate / gate oxide interface . in one example , the anneal is an rta for 5 seconds at 800 to 1000 ° c . anneal . in step 560 , the nfet transistor is completed by forming contacts to the s / ds and gate by processes well known in the art . [ 0076 ] fig2 is a flowchart of the method steps for fabricating a thin film resistor according to the present invention . in step 565 , normal processing is performed in the fabrication of a thin film resistor up to and including formation of a polysilicon line . in one example , the polysilicon line is 1000 to 2200 å thick . in step 570 , a dopant species is implanted . in one example , the dopant species is as implanted at a dose of about 1e15 to 1e16 atm / cm 2 at an energy of about 40 to 70 kev . in step 575 , a polysilicon grain size modulation ion implant is performed . in one example , the polysilicon grain size modulation ion implant is an sb ion implantation performed at a dose of about 1e15 to 1e16 atm / cm 2 and at an energy of about 30 to 70 kev . in step 580 , an anneal is performed . the purpose of the anneal is to distribute the dopant species ( for example as ) and the sb throughout the polysilicon line and especially more uniformly distribute the dopant than with otherwise occur without the dopant concentration profile modulation ion implant of step 575 . in one example , the anneal is an rta for 5 seconds at 800 to 1000 ° c . anneal . in step 585 , the thin film resistor is completed by forming contacts to the ends of the polysilicon line by processes well known in the art . the thin film resistor thus produced has improved resistance over conventional damascene resistors due to the improved dopant concentration profile caused by of the dopant concentration profile modulation ion implant . [ 0081 ] fig2 is a flowchart of the method steps for fabricating a damascened thin film resistor according to the present invention . in step 590 , a substrate having a dielectric layer formed thereon is provided . in one example , the dielectric is an interlevel dielectric of teos oxide . in step 595 , a trench is formed in the dielectric layer by well known photolithographic and rie techniques . in one example , the trench is 1000 to 2200 å deep . in step 600 , the trench is filled with polysilicon by depositing polysilicon on the surface of the dielectric and in the trench and performing a chemical - mechanical - polish ( cmp ) to excess remove polysilicon from the surface of the dielectric layer and polish the polysilicon in the trench substantially flush with the surface of the dielectric layer . in step 605 , a dopant species is implanted . in one example , the dopant species is as implanted at a dose of about 1e15 to 1e16 atm / cm 2 at an energy of about 40 to 70 kev . in step 610 , a polysilicon grain size modulation ion implant is performed . in one example , the polysilicon grain size modulation ion implant is an sb ion implantation performed at a dose of about 1e15 to 1e16 atm / cm 2 and at an energy of about 30 to 70 kev . in step 615 , an anneal is performed . the purpose of the anneal is to distribute the dopant species ( for example as ) and the sb throughout the polysilicon line and especially more uniformly distribute the dopant than with otherwise occur without the dopant concentration profile modulation ion implant of step 610 . in one example , the anneal is an rta for 5 seconds at 800 to 1000 ° c . anneal . in step 620 , the damascene resistor is completed by forming contacts to the ends of the polysilicon line by processes well known in the art . the damascene resistor thus produced has improved resistance over conventional damascene resistors due to the improved dopant concentration profile caused by the dopant concentration profile modulation ion implant . it has been shown that the present invention provides a method to control emitter resistance and base current in bipolar transistors and to overcome depletion of dopant in the gate electrode in fets and the line of thin film and damascened resistors . the description of the embodiments of the present invention is given above for the understanding of the present invention . it will be understood that the invention is not limited to the particular embodiments described herein , but is capable of various modifications , rearrangements and substitutions as will now become apparent to those skilled in the art without departing from the scope of the invention . therefore it is intended that the following claims cover all such modifications and changes as fall within the true spirit and scope of the invention . | 8 |
fig1 shows a block diagram of a system for detecting and illuminating the vasculature in a patient the system shown in the block diagram of fig1 is used for detecting the location of veins on a patient and illuminating the veins . the disclosures of u . s . patent application ser . no . 12 / 804 , 506 , now issued as u . s . pat . no . 8 , 463 , 364 are incorporated herein by reference . in a preferred embodiment , fig3 - 47 of application ser . no . 12 / 804 , 506 illustrates an assembly of a housing that may be used in the present invention . in the present invention , circuit boards 43 , 44 and 15 of application ser . no . 12 / 804 , 506 may be modified to contain the circuitry described by the block diagram in fig1 . the remainder of the device in fig3 - 47 can remain substantially the same . in fig1 an fpga 1 ( field programmable gate array ) is configured to control a red laser drive 2 which in turn drives a red laser 3 . the output of the red laser 3 is controlled in a manner so as to illuminate the detected veins . a red laser feedback 4 detects the output of the red laser 3 and sends the information to the fpga 1 . accordingly , a closed loop is formed whereby the fpga 1 can both drive the red laser 3 and receive feedback as to the red laser 3 state . fpga 1 outputs data to an ir laser drive 5 which in turn drives an ir laser 6 . the output of the ir laser 6 is controlled to output an intensity of ir light , aimed at the area of the body where veins are located , sufficient to detect the veins . an ir laser feedback 7 detects the output of the ir laser 6 and sends the information to the fpga 1 . accordingly , a closed loop is formed whereby the fpga 1 can both drive the ir laser 6 and receive feedback as to the ir laser 6 state . fpga 1 communicates to both a x - mirror drive 8 and a y - mirror drive 9 to drive x - mirror 10 and y - mirror 11 in such a manner that a raster pattern is formed on the patient when the red laser 3 and the ir laser 6 are coaxially projected thereon . x - mirror feedback 12 and y - mirror feedback 13 detect the positions of the x - mirror 10 and y - mirror 11 , respectively , and communicates such information to the fpga 1 . top photodiode 23 and bottom photodiode 22 receive the ir laser 6 reflected off the patient , converts the light into an analog signal which is provided to top fe 25 and bottom fe 24 , and then to top adc 27 and bottom adc 25 , respectively . the top fe 25 and the bottom fe 24 are front end circuits that provide analog filtering , gain control and threshold of the analog signals . the top adc 27 and bottom adc 26 are analog to digital converters that convert the analog signals to digital representations thereof to be communicated to the fpga 1 . control lines are provided from the fpga 1 to the top fe 25 and the bottom fe 24 to set parameters such as , for example , gain control and analog filtering . from a mechanical standpoint , the red laser 3 and the ir laser 6 are co axially aligned and projected off of mirrors x - mirror 10 and y - mirror 11 to form a pattern , such as for example , a raster pattern on the patient . the ir laser 6 reflects off the patient and is received by top photodiode 23 and photodiode 22 . the reflected ir light contains information as to the location of the veins ( ir light is absorbed by the blood in the veins and therefore the amount or reflected ir light is lower when the ir laser 6 is aimed at a vein . the fpga 1 time sequentially receives in the signal form the top adc 27 and the bottom adc and can form two partial and / or full frame images of the reflected ir light ( hereinafter a top channel data and a bottom channel data wherein the top channel data is received from the top adc 27 and the bottom channel data is received from the bottom adc ). the fpga 1 processes one or both of the partial and / or full image to detect and enhance the image of the veins . the enhanced image is time sequentially projected by the red laser 3 onto the patient . a cpld is provided for controlling an lcd 19 with displays user information related to the operating status of the device . it also controls an audio 20 output to provide audible tones to the user . finally the cpld 18 controls the switches 21 on the unit for turning on and off the units as well as selecting user modes and entering data . a microprocessor pic mcu 17 is provided for receiving and monitoring the ir laser feedback 7 signal , the red laser feedback 4 signal , the x - mirror feedback 12 signal and the y - mirror feedback 13 signal . since these signals are also provided to the fpga 1 , redundancy monitoring of the signals is provided by the pic mcu 17 . this is particularly important when regulatory requirements require redundant monitoring of the laser power and movement to comply with safety requirements . the nc mcu 17 also monitors the device power management 14 , the li - ion battery management 15 circuitry and the li - ion fuel gauge 16 . fig2 shows an example of the signal processing flow of the fpga fig2 shows an embodiment of the signal processing algorithm of the fpga of fig1 . as described with reference to fig1 , the image of the reflected ir laser 6 is time sequentially stored in the fpga 1 as top channel data 30 t and bottom channel data 30 b . the x - mirror 10 oscillates about a single axis to move the laser beam from the ir laser 6 to form a line . the beam moves first in one direction and then back in the other direction . it is critical that the left to right image data be in convergence with the right to left data . the top line correlator 31 t measures the shift in the convergence of the top channel data 30 t and supplies the information to the mirror convergence control 34 . similarly , the bottom line correlator 31 b measures the shift in the convergence of the bottom channel data 30 b and supplies the information to the mirror convergence control 34 . the mirror convergence control 34 can adjust the control signals provided from the fpga 1 to the x - mirror drive 8 so as to converge the data . a top histogram 32 t receives the top channel data 30 t and generates a histogram based upon an entire frame of the top channel data 30 t . similarly , a bottom histogram 32 b receives the top channel data 30 b and generates a histogram based upon an entire frame of the bottom channel data 30 b . the histograms contain information describing the characteristics of the images , including but not limited to contrast and intensity levels . the top histogram 32 t and the bottom histogram 32 b are provided to exposure control 35 . exposure control 35 communicates appropriate signals the ir laser drive 5 to adjust the power of the ir laser 6 on a frame by frame basis until the histograms indicate appropriate images . the exposure control 35 also communicates with the top fe 25 and bottom fe 24 to adjust parameters such as setting thresholds and setting electrical gain . a top vein processing 33 t block receives the top channel data 30 t and performs image processing to detect vein patterns and provides the enhanced vein image to fused vein projection 36 . similarly , bottom vein processing 33 b block receives the bottom channel data 30 b and performs image processing to detect vein patterns and provides the enhanced vein image to fused vein projection 36 . the fused vein projection 36 forms a single image and communicates the image to the alpha blended projection 38 . the fused vein projection 36 can form the single image by merging the images from the top vein processing 33 t and bottom vein processing 33 b . alternative , the fused vein projection 36 can simply select the best image received from the top vein processing 33 t and the bottom vein processing 33 b . alpha channel 37 forms an image that contains graphical data , such as text or characters . alpha channel 37 and fused vein projection 36 are provided to alpha blended projection 38 with drives the ir laser drive 5 to display an image which is the combination of the fused vein projection 36 and the alpha channel 37 . fig3 shows an example of the internal bus architecture of the fpga fig4 shows details of the top vein processing 33 t and bottom vein processing 33 b . fig5 shows the vein processing at the boundary of the image frames . fig6 shows further detail of the vein processing at the boundary of the image frames . | 0 |
description will be given of an embodiment according to the present invention . fig5 a - 5b are explanatory diagram useful to respectively explain nodes and sub - trees in an embodiment of the present invention , whereas fig6 a - 6d are explanatory diagrams useful to explain a series of sequential data in the embodiment of the present invention . in a tree traversal method of the present embodiment , sets of nodes constituting a tree as an object of the traversal are beforehand classified depending on an evaluation order of each node . as a result of the classification , it is assumed that subsets separated by dotted lines corresponding to the classification of the diagram are assigned with kinds a - c , respectively . each node retains a name of a kind to which the pertinent node belongs , and a tree of an object of a traversal is colored depending on the kind a , b , c , or d as shown in fig5 b . ( i ) a root of the entire tree or a node having a kind different from that of the parent thereof is a root of a sub - tree to which the node belongs . ( ii ) when a kind of a child of a node belonging to a sub - tree matches with a kind of the parent thereof , the child belongs to the sub - tree . ( iii ) a node for which a leaf or all children thereof is or are of a kind different from that of the node is a leaf of the sub - tree to which the node belongs . consequently , according to the definitions above , as shown in fig5 b , the areas separated by dotted lines indicate the sub - trees thus defined . in addition , each sub - tree is identified depending on a position of a root of the pertinent sub - tree . when the object tree is colored as described above , a tree traversal is first achieved so as to sequentially recognize each sub - tree , as shown in fig6 a , by a position of a node undergone the traversal , a kind of the node , and a mark indicating a positional relationship between the node and a boundary of an area to which the node belongs . depending on the recognition , a tree structure of fig5 b is developed into a series of sequential data in a configuration like that shown in fig6 b . in this operation , at a node having a kind different from that of the parent thereof , the node is recognized as a root of a new sub - tree according to the preorder , and then a position of the node , a kind thereof , and data ( start symbol data ) keeping a start symbol are arranged at an end of a series of sequential data . furthermore , at a node , when the traversal stage is i ( i & gt ; 1 ), if the kind of the i - th child is different from that of the node , the kind and data ( intermediate symbol data ) keeping an intermediate symbol are arranged at an end of the series of sequential data . moreover , the intermediate symbol data last appeared in a sub - tree is deleted from the end , and for a root of the sub - tree , a kind and data ( end symbol data ) keeping an end symbol are arranged according to the postorder at the end of the series of sequential data . assuming that the series of sequential data thus generated is a tree including as units thereof sub - trees indicating the respective kinds a - c as shown in fig6 e , the tree can be expressed by a parenthesis structure of fig6 d . consequently , the start symbol , the end symbol , and the intermediate symbol of the series of sequential data respectively correspond to a left parenthesis , a right parenthesis , and a separation of the parenthesis structure . in addition , the series of sequential data is called a series of initial sequential data . an object series of sequential data is attained by sequentially achieving a search of a series of sequential data beginning from the younger kind according to the kind indicating the evaluation order . incidentally , for the kind associated with the first search , the initial sequential data series is regarded as an original sequential data series , whereas for the kind associated with the second and subsequent searches the previous object sequential data series is regarded as an original sequential data series . in a case where such an original sequential data series is searched to develop an object sequential data series , a sequential search is first accomplished for the series of original sequential data ranging from the top to the end thereof . if the kind of the respective data does not match with the pertinent kind , the data is arranged at the end of the series of object sequential data . when start symbol data having a kind identical to the pertinent kind is reached during the search , a sub - tree traversal is initiated from a position of a node keeping the data . when a node with a kind different from the kind appears , the sub - tree traversal becomes inactive , or when the sub - tree traversal is completed , the search is resumed beginning from the next data . when intermediate symbol data or end symbol data each having a kind identical to the pertinent kind is reached during the search , the sub - tree traversal temporarily set to be inactive because of a preceding appearance of a node having a kind different from the pertinent kind is reactivated ; furthermore , the sub - tree traversal is made to be inactive due to an appearance of a node having a kind different from the pertinent kind , or after the sub - tree traversal is completed , the traversal is resumed beginning from the next data . incidentally , if the pertinent sub - tree traversal is already finished at a point of the indication , the traversal is continued beginning from data immediately following the data . as described above , in a process to generate an object sequential data series from an original sequential data series through the search of the sequential data of the pertinent kind , a traversal is started for a sub - tree having the indicated node as a root thereof , and if an attribute corresponding to a traversal stage is required for each node to be subjected to the tree traversal , an evaluation is carried out at the point so as to arrange the value at the end of the series of object sequential data . for example , at a node , if the i - th child does not belong to the sub - tree , the traversal is made to be inactive in a state immediately before a traversal stage i so as to wait for an indication . in this case , if the sequential data is intermediate or end symbol data having a kind identical to the pertinent kind , a reactivation is indicated and then the corresponding sub - tree traversal already inactivated is reactivated beginning from a traversal stage i of the node where the traversal is made to be inactive . incidentally , when the corresponding sub - tree traversal is missing , namely , the sub - tree traversal is already finished , the state waiting for an indication is set again . in a search of an original sequential data series , if the termination of processing of the end data of the original sequential data series means a completion of search of the original sequential data series associated with a kind and a completion of a sub - tree traversal and there exists the next kind , in order to attain sequential data of the next kind by assuming the object sequential data series so far to be an original sequential data series , a search of the original sequential data series is initiate beginning from the top thereof . furthermore , according to the tree traversal method of the present embodiment , in a case where a sub - tree traversal in process is made to be inactive because a kind of a node does not match with the pertinent kind , and since the mark of the sequential data is an intermediate symbol or an end symbol , a reactivation is indicated so as to resume the sub - tree traversal activated from start symbol data corresponding to the intermediate symbol data and the end symbol data at the point , a location to keep information ( sub - tree traversal information ) indicating a position for a reactivation of the sub - tree traversal such as the environment , a node , and a traversal stage necessary for the respective sub - tree traversal , namely , the sub - tree traversal information pointer is controlled in a stack structure . for a reactivation of a tree traversal , the sub - tree traversal information pointer is used as information to indicate a start point of the corresponding sub - tree traversal . consequently , at an arrival of the new start symbol data , the sub - tree traversal information pointer used so far is pushed into the stack , whereas at an arrival of the end symbol data , the pointer is popped from the stack . fig1 is a configuration diagram of a tree traversal apparatus in an embodiment according to the present invention . in this configuration , a tree traversal apparatus 1 of the embodiment includes a tree traversal controller 2 , an initial tree traversal circuit 3 , a tree traversal information storage 4 , a tree structure storage 5 , a sequential data search circuit 6 , a sub - tree traversal control information storage 7 , a sub - tree traversal circuit 8 , a sub - tree traversal information storage 9 , a sequential data read / write change - over circuit 10 , and sequential data storage 11 - 12 . the tree structure storage 5 beforehand accumulates tree structure data such as tree structure information 26 and attribute information 27 of each node so as to output node information items 22 and 29 for a reference of structure information such as locations of the elder child and a younger brother of a node , a reference of attribute information of each traversal stage of a node , or tree structure accesses 21 and 28 such as an update request . on receiving a tree traversal start signal 13 , the tree traversal control circuit 2 outputs an initial signal 17 to the sequential data read / write change - over circuit 10 . furthermore , on receiving a kind information 14 , if the input is effected after an output of the start signal 15 to the initial tree traversal circuit 3 and after an output of a start signal to the sequential data search circuit 6 , the tree traversal control circuit 2 waits for an input of an end signal 16 send from the initial tree traversal circuit 3 and an input of an end signal transmitted from the sequential data search circuit 6 . when the end signal 16 or 20 is inputted , a change - over signal 18 is delivered to the sequential data read / write change - over circuit ; furthermore , the start signal 19 to start a search associated with the pertinent kind is fed to the sequential data search circuit 6 . when the initial signal 17 is inputted , the sequential data read / write change - over circuit 10 , in order to allocate the sequential data storage 11 as a location to accumulate a series of object sequential data , connects channels of sequential data 25 and 35 to be inputted to a channel of sequential data 41 as write data to be written in the sequential data storage 11 and connects a channel of sequential data 37 outputted from the sequential data read / write change - over circuit 10 to a channel of sequential data 47 read from the sequential data storage 12 , thereafter a reset signal 40 is delivered to the sequential data storage 11 . after this point , each time sequential data 25 is inputted , sequential data 41 to be written in the sequential data storage 11 is outputted . when the change - over signal 18 is inputted and if the channels of sequential data 25 and 35 to be inputted are connected to the channel of sequential data 41 to be written in the sequential data storage 11 , the sequential data read / write change - over circuit 10 changes over the channels of the input data 25 and 35 to the channel of the sequential data 45 to be written in the sequential data storage 12 for the connection . if the channels of the input data 25 and 35 are connected to the channel of the sequential data 45 to be written in the sequential data storage 12 , the channels of the input data 25 and 35 are changed over for the connection to the channel of the sequential data 41 to be written in the sequential data storage 11 . moreover , in a case where the channels of the read signal 36 and the sequential data 37 to be outputted to the sequential data search circuit 6 are connected to a channel of the sequential data 47 read from the sequential data storage 12 , the channels of the read signal 36 and the sequential data 37 to be outputted to the sequential data search circuit 6 are changed over for connection to the channels of a read signal 42 and sequential data 43 , and then a reset signal 44 is delivered to the sequential data storage 11 . furthermore , contrarily , in a case where the channels of the read signal 36 and the sequential data 37 are connected to the channels of a read signal 42 and sequential data 43 , the channels of the read signal 36 and the sequential data 37 are changed over for connection to the channels of the read signal 46 and the sequential data 47 , and then the reset signal 44 is fed to the sequential data storage 12 . after this point , each time the sequential data 35 is inputted , the sequential data read / write change - over circuit 10 outputs the sequential data 42 or 46 to be written in the sequential data storage 11 or 12 to which the channels are connected . furthermore , each time the read signal 36 is inputted , the read signal 42 or 46 is outputted to the sequential data storage 11 or 12 to which the channels are connected and then the sequential data read / write change - over circuit 10 receives as an input thereto the sequential data 43 or 47 respectively read from the sequential data storage 11 or 12 so as to produce output data 37 . the sequential data storages 11 - 12 each includes a storage section in which inputted data are sequentially arranged and a pointer indicating a location of data last arranged . when the sequential data 41 and 45 are inputted as write data , the current pointer is incremented by a data item so as to store the write data 41 and 45 in the location indicated by the resultant content of the pointer . when the read signals 42 and 46 are inputted , the sequential data 43 and 47 in the location indicated by the current pointer are outputted as read data and then the pointer is incremented by a data item . these data are data comprising three fields , namely , a node field , a kind field , and a mark field or attribute data . the node field keeps a location of the node data , the kind field contains a kind of the node , and the mark field retains a start symbol , an intermediate symbol , or an end symbol of the data . consequently , the data constituted from the node , kind , and mark fields represent information concerning a sub - tree of a kind which has not been developed , whereas the attribute data indicates attribute information itself of a node already developed . incidentally , each circuit in the tree traversal apparatus 1 of fig1 can be configured by means of a processor such as a microcomputer or a storage device . moreover , the tree traversal apparatus 1 itself may be configured by means of a processor and a common memory so as to implement the functions of the respective circuits by use of programs in the processor . fig2 is a flowchart of an operation to generate a series of initial sequential data in the initial tree traversal circuit 3 in the embodiment according to the present invention . incidentally , node indicates a location of the current node in the traversal , whereas node1 represents a location of a child of the current node . as shown in fig1 the first tree traversal circuit 3 effects the push operation and the pop operation for the tree traversal information storage 4 , which inputs and accumulates saved information 23 at the end of the stack structure in response to the push operation of the initial tree traversal circuit 3 and which fetches information at the end of the stack structure and outputs attained information as return information 24 in response to the pop operation of the initial tree traversal circuit 3 . as shown in fig2 when the tree traversal control circuit 2 first outputs the start signal 15 , the initial tree traversal circuit 3 inputs the start signal 15 so as to initiate a traversal beginning from a root of the tree structure stored in the tree structure storage 5 . when node indicating a location of the current node in this tree traversal is a root or when the kind of the node is different from that of the parent thereof , the node is assumed to be a root of the sub - tree ( step 60 ), and start symbol data is generated for the node ( step 61 ) so as to be written in the object sequential data storage 11 via the sequential data read / write change - over circuit 10 ( step 62 ). next , in order to achieve a traversal of the elder child of the descendant beginning from the elder child of the node , the current node , node1 , and the kind of the parent are pushed into the tree traversal information storage 4 ( step 65 ), information about the child is set again ( step 66 ), and then control returns to label 1 so as to determine whether or not the kind of the node is equal to that of the parent ( step 60 ). at the root of the sub - tree , if the younger brother is missing ( step 67 ) and if intermediate symbol data exists at the end of the sequential data series , the intermediate symbol data is deleted ; thereafter , end symbol data is generated and arranged at the end of the sequential data series ( step 68 ). furthermore , when control returns from the traversal of the children , the tree traversal information storage 4 effects a pop operation so as to restore the current information ( step 69 ). if there does not exist any information to be popped , the processing is terminated . when the kind of the child is judged to be different from the pertinent kind ( step 70 ), intermediate signal data is generated for the node ( step 71 ) and then is written in the object sequential data storage 11 via the sequential data read / write changeover circuit 10 ( step 72 ). when intermediate symbol data is completely written as described above , the younger brother of the node1 is set to the node1 ( step 73 ) and then control returns to label 2 so as to determine whether or not the content of the node 1 is nil ( step 64 ). fig3 is a flowchart of processing to develop an original sequential data series into an object sequential data series in the sequential data search circuit of the embodiment according to the present invention . incidentally , the sequential data storages 11 and 12 respectively accumulate the original sequential data series and the object sequential data series , and description will not be given here of the operation through the sequential data read / write change - over circuit 10 . as shown in fig1 the sequential data search circuit 6 achieves a push operation for the sub - tree traversal control information storage 7 , which receives as an input thereto saved information 30 . the saved information 30 is stored at the end of the stack structure and is thereafter fetched in response to a pop operation of the sequential data search circuit 6 so as to be outputted as return information 31 . as shown in fig3 on receiving the start signal 19 from the tree traversal control circuit 2 , the sequential data search circuit 6 first reads data for a search of the original sequential data series beginning from the top thereof in the sequential data storage 11 ( steps 80 and 93 ). if the data to be read is null data ( step 81 ), an end signal 20 is outputted to the tree traversal control circuit 2 and then control enters a state waiting for a start signal 19 from the tree traversal control circuit 2 . if there exists data to be read ( step 81 ), it is determined whether or not the value of the kind field of the data is equal to the present kind ( step 82 ). if the kinds are different from each other , the data is written in the sequential data storage 12 ( step 84 ). when the value of the kind field of the data matches with the current kind , the mark of the data is then checked ( step 83 ). if the mark field contains a start symbol , a value ( sub - tree traversal information pointer ) indicating a location in the sub - tree traversal information storage 9 is selected from information necessary for the traversal of the present sub - tree and is pushed as saved information 30 into the sub - tree traversal control information storage 7 ( step 85 ), and then a sub - tree traversal start or activate signal 32 associated with a location of a node in the node field is sent to the sub - tree traversal circuit 8 to indicate the start of a new sub - tree traversal ( step 86 ); thereafter , control waits for a sub - tree traversal stop or inactivate signal 34 from the sub - tree traversal circuit 8 ( step 87 ). incidentally , the sub - tree traversal stop signal 34 includes a sub - tree traversal information pointer for the new sub - tree traversal and is temporarily kept in the sequential data search circuit 6 until the location of the environment of the present sub - tree traversal is pushed into the sub - tree traversal control information storage 7 . after this point , when the sub - tree traversal stop or inactivate signal 34 is inputted , data is read again from the sequential data storage 11 ( step 93 ). furthermore , if the mark field contains an intermediate symbol , a sub - tree traversal reactivate signal 33 including the current sub - tree traversal information pointer 30 is sent to the sub - tree traversal circuit 8 to indicate a reactivation of the sub - tree traversal ( step 88 ), and then control waits for a sub - tree traversal inactivate signal 34 from the sub - tree traversal circuit ( step 89 ). when the sub - tree traversal inactivate signal 34 is thereafter inputted , data is read again from the sequential data storage 11 ( step 93 ). moreover , when the content of the mark field is an end symbol , like in the case of the intermediate symbol ( steps 88 and 89 ), a reactivation of the current sub - tree traversal is indicated ( step 90 ) and control waits for the sub - tree traversal inactivate signal 34 from the sub - tree traversal circuit 8 ( step 91 ); thereafter , the latest sub - tree traversal information pointer 31 is popped from the sub - tree traversal control information accumulate circuit 7 ( step 92 ) and then data is read again from the sequential data storage 11 ( step 93 ). fig4 is a flowchart of processing to develop a tree structure into an object sequential data series in the sub - tree traversal circuit of the embodiment according to the present invention . incidentally , node indicates a location of the current node in the traversal , node1 designates a location of a child of the present node , and stage denotes a traversal stage of the node . like in the case of fig1 according to a generate operation of the sub - tree traversal circuit 8 , the sub - tree traversal information storage 9 reserves an area corresponding to a new sub - tree when a generate signal 48 is received as an input thereto and then outputs the location ( sub - tree traversal information pointer 49 ) to the sub - tree traversal circuit 8 . thereafter , in response to a push operation of the sub - tree traversal circuit 9 , saved information 38 is inputted and is then accumulated at the end of the stack structure in an area specified by the sub - tree traversal information pointer included in the saved information . in response to a pop operation of the sub - tree traversal , similarly , information at the end of the stack structure in an area specified is fetched and is outputted as return information 39 . as shown in fig4 on receiving as an input thereto a start signal 32 including a location of a node from the sequential data search circuit , the sub - tree traversal circuit 8 effects a traversal of a tree structure in the tree structure storage 5 with the node set as the root thereof . in this operation , the sub - tree traversal circuit 8 outputs a generation signal 48 to the sub - tree traversal information storage 9 so as to receive the sub - tree traversal information pointer 49 ( steps 100 and 101 ). when the kind of the node is different from the pertinent kind ( step 102 ), a sub - tree traversal inactivate signal 34 including the sub - tree traversal information pointer is delivered to the sequential data search circuit 6 and the operation is inactivated ( step 103 ). on receiving the sub - tree traversal reactivate signal 33 from the sequential data search circuit 6 , the sub - tree traversal information pointer associated with the sub - tree traversal reactivate signal 33 is set as a pointer to indicate the current area in the sub - tree traversal information storage 9 , and then the operation is reactivated ( step 104 ). when the kind of the node matches with the pertinent kind ( step 102 ), an attribute of the node for stage = 0 is written as sequential data 50 in the sequential data storage 12 ( steps 105 and 106 ). furthermore , the elder child of the node is set to the node1 ( step 107 ). when the node1 is other than nil ( step 108 ), in order to effect a traversal of the elder children of the descendant beginning from the elder child of the node , the current node , node1 , and stage are pushed into the current area of the sub - tree traversal information storage 9 ( step 109 ), information about the child is set again ( step 110 ), and control is returned to the label 1 so as to determine whether or not the kind of the node matches with the present kind ( step 102 ). when the node is nil ( step 108 ), the pop operation is achieved on the current area of the sub - tree traversal information storage 9 at a point where control returns from the operation on the child , thereby restoring present information ( step 111 ). in this case , if data to be popped is missing ( step 112 ), the traversal of this sub - tree is completed , the area indicated by the sub - tree traversal information pointer is abandoned , a sub - tree traversal inactivate signal 34 is outputted to the sequential data search circuit 6 , and then control waits for a sub - tree traversal activate signal 32 or a sub - tree traversal reactivate signal 33 . if restore information is present ( step 112 ), the stage undergoes a count - up operation ( step 113 ), sequential data 50 indicating the attribute of the node at the stage is written in the sequential data storage 12 ( step 114 ), the younger brother of the node1 is set to the node1 for the traversal of the younger brother ( step 115 ), and then control returns to the label 2 to determine whether or not the node1 is nil ( step 108 ). incidentally , in a case where an area indicated by the sub - tree traversal information pointer associated with the sub - tree traversal reactivate signal 33 has already been abandoned , the sub - tree traversal inactivate signal 34 is outputted without executing the processing above , and then control waits for a sub - tree traversal activate signal 32 or a sub - tree traversal reactivate signal 33 . according to the embodiment described above , in a tree traversal to process data in a tree structure , nodes can be processed in an order of the traversal of the nodes , and when a plurality of traversals are necessary , the traversal is achieved only in the neighborhood of the object nodes for the respective traversal , which enables to improve the processing efficiency . also in a case where even a plurality of traversals cannot cope with an object situation to be processed because information necessary for processing each node cannot be reattained in a batch , the method according to the present invention enables to attain a node processing result similar to the result obtained when the entire tree is processed by a traversal operation . next , an alternative embodiment of the present invention will be described with reference to the drawings . fig1 , 13 , 14a , and 14b are explanatory diagrams useful to explain nodes and sub - trees in the alternative embodiment according to the present invention ; whereas fig1 a - 11d are explanatory diagrams useful to explain a series of sequential data in the alternative embodiment according to the present invention . in the tree traversal method of this embodiment , as shown in fig1 a , a set of nodes 1 - 17 constituting a tree as an object of the traversal is beforehand classified depending on the evaluation order of the respective nodes 1 - 17 and subsets separated by dotted lines are assigned with the kinds a - d of the nodes . each node retains a name of the kind to which the node belongs , and a tree as an object of the traversal is colored depending on the kinds a - d as shown in fig4 b . incidentally , the sub - trees constituting a tree structure are defined as follows . ( i ) a root of an entire tree or a node with a kind different from that of the parent thereof is a root of the sub - tree to which the node belongs . ( ii ) when the kind of a child of a node belonging to a sub - tree matches with the kind of the parent thereof , the child belongs to the sub - tree . ( iii ) a node with a kind different from the kinds of leaves or all children thereof is a leaf of a sub - tree to which the node belongs . consequently , according to the definitions above , as shown in fig1 b , the areas separated by the dotted lines represent sub - trees for the respective kinds . furthermore , each sub - tree is identified by a location of a root of the sub - tree . moreover , according to the tree traversal method of this embodiment , in a case where at an evaluation of a node attribute based on the kind , if information possessed by the ancestor of the node , namely , propagation information is required to be referenced , the propagation information is readily propagated for the reference . propagation information is propagated from a node where the value thereof is defined to a node of a descendant where the value may possibly be referenced . for example , in a case where there does not exist any possibility that propagation information is referenced in a descendant of a node y which is a child of a node x , or another value is propagated as propagation information at the node y , the node x does not transfer the propagation information to the node y . in this case , the node y is called a separation point of propagation information . as described above , an area where propagation information can be propagated , namely , a propagation enable area is defined as a sub - tree as follows . ( i ) a node where propagation information is defined is a root of the sub - tree . ( ii ) a node having the parent which belongs to the sub - tree and not being a separation point belongs to the sub - tree . ( iii ) a node which belongs to the sub - tree and of which the leaves or all children are separation points is a leaf of the sub - tree . according to the definitions above , for example , as shown in fig1 , a propagation enable area of an attribute a i ranges from a node 9 generating the attribute a i and a position immediately before a node 14 which a separation point of the attribute a i . consequently , the sub - tree including the nodes 9 - 13 is the propagation enable area of the attribute a i , whereas the sub - tree including the nodes 14 - 17 is an area in which the attribute a i is not referenced . furthermore , a propagation enable area is in general ( i ) included in a sub - tree or ( ii ) included in a plurality of sub - trees . in the case ( i ), only at a traversal of the sub - tree , pertinent propagation information is generated and referenced . in the case ( ii ), in a traversal other than a traversal associated with a generation of propagation , pertinent propagation information is required to be propagated . namely , a traversal associated with a generation of propagation must be effected prior to a traversal associated with a reference of the propagation information , and the evaluation order of each sub - tree according to the tree traversal method of this embodiment is assumed to satisfy the condition . moreover , propagation information is classified into several kinds and is propagated according to the assigned kinds . that is , generation and reference of propagation information are effected by specifying a kind with the identical name at the respective nodes . consequently , in a propagation enable area of a certain information item , the value of the propagation information item is unique and the propagation information item is propagated by means of an attribute value vector keeping values of propagation information for each kind . for example , group nodes constituting a tree structure are colored according to the kinds a - d indicating the attribute evaluation order as shown in fig1 such that the sub - trees are configured depending on the colors . furthermore , independent of the sub - trees according to the kinds , there are identified such sub - trees based on attribute propagation areas as a sub - tree including a node 9 of the propagation source of the attribute a i and the nodes 10 - 13 of the propgation enable area , a sub - tree comprising the node 2 of the propagation source of the attribute a i , and a sub - tree including the node 14 of the separation point of the attribute a i and the nodes 15 - 17 of an area in which the attribute a i is not referenced . after the color operation by the kinds and the classification based on the kinds of attributes to be propagated , a sub - tree is first recognized while effecting a traversal of a tree as an object . in this recognition , the sub - tree is recognized by the location of a node undergone a sequential traversal , the kind of the node , and a mark ( a start symbol , an intermediate symbol , or an end symbol ) indicating a positional relationship between the node and the boundary to which the node belongs . moreover , when a node generating a propagation information item is reached in the preorder , as shown in fig5 b , a location to which a value of the attribute to be propagated , namely , a unit of a store location of the attribute vector areas a 1 , a 2 , a 1 &# 39 ;, and a 2 &# 39 ; is reserved , and then an attribute value vector pointer indicating the location is stored in the node . based on this recognition , according to the tree structure of fig1 , the sequential data configured as shown in fig1 a is developed into a sequential data series of fig1 b . as described above , when a node of which the kind is different from that of the parent thereof is reached in the preorder , the node is recognized as a root of the new sub - tree , the location of the node , the kind thereof , and data ( start symbol data ) keeping an attribute value vector pointer reserved by the ancestor nearest to the node are arranged at the end of the sequential data series . in addition , at a node , if the traversal stage is i ( i ≧ 1 ) and if the kind of the first child is different from that of the node , the kind and data ( intermediate symbol data ) keeping an intermediate symbol are arranged at the end of the sequential data . moreover , intermediate symbol data last appearing in a sub - tree is deleted therefrom , and when a root of the sub - tree is reached in the postorder , the kind and data ( end symbol data ) keeping the end symbol are arranged at the end of the sequential data series . the sequential data series thus created can be , assuming that the tree of fig1 includes as units thereof the sub - trees associated with the respective kinds a - d as shown in fig . llc , represented by a parenthesis structure as shown in fig1 d . consequently , the start symbol , the end symbol , and the intermediate symbol in the sequential data series of fig1 b respectively correspond to the left parenthesis , the right parenthesis , and the separation in this parenthesis structure . furthermore , this sequential data series is called an original sequential data series . an object sequential data series is attained by sequentially effecting a search of the sequential data series according to the kind indicating the evaluation order of the attribute beginning from the youngest kind as many time as there are the kinds . incidentally , for the kind associated with the first search , the initial sequential data series is regarded as the original sequential data series ; whereas for the kinds associated with the second and subsequent searches , the previous object sequential data series is regarded as the original sequential data series . in a case where the original sequential data series is searched to develop an object sequential data series , while effecting a sequential search of the original sequential data series from the top to the end thereof , if the kind of each data does not match with the pertinent kind as the object , the data is arranged at the end of the object sequential data series . during the search , if start symbol data having a kind matching with the pertinent kind , and start indicating data including an attribute vector pointer in the start symbol data is generated , a sub - tree traversal is initiated beginning from the location of the node kept in the data . when the sub - tree traversal is inactivated or terminated , the search is resumed beginning from the subsequent data . in a case where intermediate or end symbol data with a kind matching with the pertinent kind is reached during the search , the system resumes the sub - tree traversal which has been inactivated because of an appearance of a node with a kind different from the pertinent kind before the arrival of the intermediate or end symbol data . moreover , when a node having a kind different from the pertinent kind appears in the resumed sub - tree traversal , the search is restarted beginning from the subsequent data when the sub - tree traversal is inactivated or terminated . incidentally , if the sub - tree traversal is already ended at the indicated point , the search is continued from the next data . as described above , in a process in which the sequential data of the pertinent kind is searched so as to attain an object sequential data series from an original sequential data series , a sub - tree traversal is commenced with the indicated node set as a root . in this operation , the attribute value vector pointer in the start indication data indicating an initiation of the sub - tree traversal is retained as a location of the current attribute value vector . moreover , in the sub - tree traversal , a stack structure is created to appropriately propagate the present attribute vector pointer . during this traversal , when a node generating a propagation attribute is reached in the preorder , the present attribute vector pointer value is pushed into the stack before an initiation of processing in the node , and then a vector value reflecting the propagation attribute evaluation result is stored in the storage location by regarding the attribute value vector storage location already assigned to the node as the current attribute value vector pointer . in addition , when the node is reached in the inorder and in the postorder and the processing in the node is completed , a pointer value popped from the stack is assumed to be the current attribute value vector pointer so as to return the processing to the parent . as described above , for each node to be subjected to the tree traversal , if necessary , an attribute corresponding to the traversal stage is evaluated at the point so as to arrange the value at the end of the object sequential data series . for example , at a node , if the i - th child does not belong to the sub - tree , the traversal is inactivated in a state immediately before the traversal stage i and control enters a state waiting for an indication . in this case , if the sequential data is intermediate or end symbol data with a kind matching with the pertinent kind , the inactivated sub - tree traversal is reactivated beginning from the traversal stage of the node where the traversal has been inactivated . incidentally , if the associated sub - tree traversal does not exist , namely , the traversal of the sub - tree has already been completed , control again enters a state waiting for an indication . in a traversal of such an original sequential data , the completion of processing of the end data of the original sequential data means the completion of the search of the original sequential data series for a kind and the completion of the sub - tree traversal , and if there exists another kind , the object sequential data series in the search above is regarded as an original sequential data series and the search is initiated on the original sequential data series beginning from the top thereof so as to attain the sequential data of the kind . furthermore , according to the tree traversal method of this embodiment , in a case where the sub - tree traversal is inactivated because a kind of a node does not match with the pertinent kind ; moreover , since the mark of the sequential data contains an intermediate or end symbol , in response to a reactivation indication , the sub - tree traversal initiated from the start symbol data corresponding to the intermediate symbol data and the end symbol data at the point is to be resumed , a location keeping information ( sub - tree traversal information ) indicating a position to reactivate the sub - tree traversal including the environment , the node , and the traversal stage necessary for each sub - tree traversal , namely , the sub - tree traversal information pointer is controlled in a stack structure . this sub - tree traversal information pointer is used , when a resumption of the tree traversal is indicated , as information indicating the initiating position of the associated sub - tree traversal . consequently , the sub - tree traversal information pointer used so far is pushed into the stack and is thereafter popped therefrom when the end symbol data is reached . fig7 is a configuration diagram of the tree traversal apparatus of an alternative embodiment according to the present invention . a tree traversal apparatus 71 of this embodiment includes a tree traversal control circuit 72 , an initial tree traversal circuit 73 , a tree traversal information storage 74 , a tree structure storage 75 , a sequential data search circuit 76 , a sub - tree traversal control information storage 77 , a sub - tree traversal circuit 78 , a sub - tree traversal information storage 79 , a sequential data read / write change - over circuit 80 , and sequential data storages 81 - 82 . the tree structure storage 75 beforehand accumulates tree structure data such as tree structure information 26 and attribute information 27 of each node and outputs pertinent node information items 22 and 29 for the reference to the structure information such as locations of the elder child and the younger brother of a node or for the tree structure accesses 21 and 28 such as an update request . the tree traversal control circuit 72 , on receiving the tree traversal initiate signal 83 , outputs an initial signal 87 to the sequential data read / write change - over circuit 80 and then delivers an initiate signal 85 to the initial tree traversal circuit 73 . the tree traversal control circuit 72 waits , on receiving kind information 84 , if the input takes place after the output of the initiate signal 85 to the initial tree traversal circuit 73 and after the output of the initial signal 19 to the sequential data search circuit 76 , for an input of a terminate signal 86 sent from the initial tree traversal circuit 73 and the terminal signal 20 delivered from the sequential data search circuit 76 , respectively ; and when the terminate signal 86 or 20 is inputted , a change - over signal 18 is outputted to the sequential data read / write change - over circuit 80 and then an initiate signal 19 for a search of the pertinent kind is outputted to the sequential data search circuit 76 . on receiving the initial signal 87 as an input thereto , the sequential data read / write change - over circuit 80 connects , in order to allocate the sequential data storage 81 as an accumulate location of an object sequential data series , channels of input sequential data 25 and 35 to the channel of write data to be stored in the sequential data storage 81 ; moreover , channels of a read signal 36 to the sequential data read / write change - over circuit 80 and sequential data 37 to be delivered from the sequential data read / write change - over circuit 80 are connected to channels of a read signal 46 to the sequential data storage 82 and sequential data 47 read from the sequential data storage 82 , and then a reset signal 40 is outputted to the sequential data storage 81 . thereafter , each time the sequential data 25 is inputted , sequential data 41 is delivered so as to be written in the sequential data storage 81 . furthermore , on receiving a change - over signal 18 as an input thereto , in a case where the channels associated with the inputted sequential data 25 and 35 have been connected to the channel associated with the sequential data 41 to be written in the sequential data storage 81 , the sequential data read / write change - over circuit 80 changes over for connection the channels associated with the sequential data 25 and 35 to be supplied as input data to the channel of the sequential data 45 to be written in the sequential data storage 82 ; whereas , in a case where the channels of the input data 25 and 35 have been connected to the channel of the sequential data 45 to be written in the sequential data storage 82 , the sequential data read / write change - over circuit 80 changes over for connection the channel of the input data 25 and 35 to the channels of the sequential data 41 to be written in the sequential data storage 81 . moreover , on receiving the change - over signal 18 , in a case where the channels of the read signal 36 and the sequential data 37 to be delivered to the sequential data search circuit 76 have been connected to the channel of the sequential data 47 to be read from the sequential data storage 82 , the sequential data read / write change - over circuit 80 changes over for connection the channels of the read signal 36 and the sequential data 37 to be delivered to the sequential data search circuit 76 to the channels of the read signal 42 and the sequential data 43 so as to supply a reset signal 44 to the sequential data storage 81 . to the contrary , in a case where the channels of the read signal 36 and the sequential data 37 to be delivered to the sequential data search circuit 76 have been connected to the channels of the read signal 42 and the sequential data 43 , the sequential data read / write change - over circuit 80 changes over for connection the channels associated with the read signal 36 and the sequential data 37 to the channels of the read signal 46 and the sequential data 47 so as to supply a reset signal 44 to the sequential data storage 82 . thereafter , each time the sequential data 35 is inputted thereto , the sequential data read / write change - over circuit 8 outputs the sequential data 41 or 45 to be written in the sequential data storage 81 or 82 having the channels thus connected . furthermore , each time a read signal 36 is inputted , a read signal 42 or 46 is respectively supplied to the sequential data storage 81 or 82 having the channels thus connected . when the sequential data 43 or 47 is respectively received from the sequential data storage 81 or 82 , an output data 37 is outputted . the sequential data storages 81 - 82 each includes a storage section in which inputted data are sequentially arranged and a pointer indicating a location of data last arranged . when the rest signals 40 and 44 are inputted as write data , the pointer is set to the first position of the storage section . when the sequential data 41 and 45 are inputted as write data , the current pointer is incremented by a data item so as to store the write data 41 and 45 in the location indicated by the resultant content of the pointer . when the read signals 42 and 46 are inputted , the sequential data 43 and 47 in the location indicated by the current pointer are outputted as read data and then the pointer decremented by a data item . these data are data comprising four fields , namely , a node field , a kind field , a mark field , an attribute value vector pointer field or attribute data . the node field keeps a location of the node data , the kind field contains a kind of the node . in addition , the mark field retains a start symbol , an intermediate symbol , or an end symbol of the data ; whereas the attribute value vector pointer field contains an attribute value vector pointer indicating a setting location ( attribute value vector ) of the value of an attribute to be propagated . consequently , the data constituted from the node , kind , mark , and attribute value vector pointer fields represent information concerning a sub - tree of a kind which has not been developed , whereas the attribute data indicates attribute information itself of a node already developed . incidentally , each circuit in the tree traversal apparatus 71 of fig7 can be configured by means of a processor such as a microcomputer or a storage device . moreover , the tree traversal apparatus 1 itself may be configured by means of a processor and a common memory so as to implement the functions of the respective circuits by use of programs in the processor . fig8 is a flowchart of an operation to generate a series of initial sequential data in the initial tree traversal circuit in the alternative embodiment according to the present invention . incidentally , node indicates a location of the current node in the traversal , whereas node1 represents a location of a child of the current node . as shown in fig7 the first tree traversal circuit 73 effects the push operation and the pop operation for the tree traversal information storage 74 , which inputs and accumulates saved information 23 at the end of the stack structure in response to the push operation of the initial tree traversal circuit 73 and which fetches information at the end of the stack structure and outputs attained information as return information 24 in response to the pop operation of the initial tree traversal circuit 73 . as shown in fig8 when the tree traversal control circuit 72 first outputs the start or initiate signal 85 , the initial tree traversal circuit 73 inputs the start signal 85 so as to initiate a traversal beginning from a root of the tree structure stored in the tree structure storage 75 . when the node is a node to generate a propagation information item ( step 274 ), a unit of the storage location of the attribute value vector is reserved ( step 275 ), and the location is set to the current attribute value vector pointer ( step 276 ). if the node is other than a node to generate propagation information ( step 274 ), the attribute value vector pointer set by the parent thereof is assumed to be the current attribute value vector pointer . next , when the node is a root or when the kind of the node is different from that of the parent thereof , the node is assumed to be a root of the sub - tree ( step 260 ), and start or initiate symbol data is generated for the node ( step 261 ) so as to be written in the object sequential data accumulate circuit 81 via the sequential data read / write change - over circuit 80 ( step 262 ). furthermore , the elder child of the node is set to the node1 ( step 263 ). when the node1 is other than nil ( step 264 ), in order to effect a traversal of the elder children of the descendant beginning from the elder child of the node , the current node , node1 , and the kind of the parent as well as the current attribute value vector pointer are pushed into the current area of the sub - tree traversal information storage 74 ( step 265 ), the information is set again ( step 266 ), and control is returned to the label 1 . when the node is nil ( step 264 ) and the younger brother is missing in the root of the sub - tree ( step 267 ), if intermediate symbol data is found at the end of the sequential data series , the intermediate symbol data is deleted and then end symbol data is created so as to be arranged at the end of the sequential data series ( step 268 ). thereafter , the pop operation is achieved on the sub - tree traversal information storage 74 at a point where control returns form the traversal on the child , thereby restoring present information ( step 269 ). in this case , if data to be popped is missing ( step 270 ), the processing is terminated . if it is judged that the kind of the child is different from the own kind ( step 270 ), intermediate symbol data is created for the node ( step 270 ), intermediate symbol data is created for the node ( step 271 ) so as to be written in the sequential data storage 81 via the sequential data read / write change - over circuit 80 ( step 272 ). next , the younger brother of the node1 is set to the node1 ( step 273 ) and then control is passed to the label 2 . fig9 is a flowchart showing an operation to develop an original sequential data series into an object sequential data series in the sequential data search circuit of the alternative embodiment according to the present invention . incidentally , the sequential data storages 81 and 82 respectively accumulate the original sequential data series and the object sequential data series , and description will not be given here of the sequential data read / write change - over circuit 80 . as shown in fig7 the sequential data search circuit 76 achieves a push operation for the sub - tree traversal control information storage 77 , which receives as an input thereto saved information 30 . the saved information 30 is stored at the end of the stack structure and is thereafter fetched in response to a pop operation of the sequential data search circuit 76 so as to be outputted as return information 31 . as shown in fig9 on receiving the start signal 19 from the tree traversal control circuit 72 , the sequential data search circuit 76 first reads data for a search of the original sequential data series beginning from the top thereof in the sequential data storage 81 ( steps 380 ). if the data to be read is null data ( step 381 ), an end signal 20 is outputted to the tree traversal control circuit 72 and then control enters a state waiting for a start signal 19 from the tree traversal control circuit 72 . if there exists data to be read ( step 381 ), it is determined whether or not the value of the kind field of the data is equal to the present kind ( step 382 ). if the kinds are different from each other ( step 382 ), the data is written in the sequential data storage 82 ( step 384 ). in addition , when the value of the kind field of the data matches with the current kind , the mark of the data is then checked ( step 383 ). if the mark field contains a start or initiate symbol ( step 383 ), a value ( sub - tree traversal information pointer ) indicating a location in the sub - tree traversal information storage 79 is selected from information necessary for the traversal of the present sub - tree and is pushed as saved information 30 into the sub - tree traversal control information storage 77 ( step 385 ), and then a sub - tree traversal start or activate signal 32 associated with a location of a node in the node field and the attribute vector pointer of the initiate symbol data is sent to the sub - tree traversal circuit 78 to indicate the start of a new sub - tree traversal ( step 386 ); thereafter , control waits for a sub - tree traversal stop or inactivate signal 34 from the sub - tree traversal circuit 8 ( step 387 ). incidentally , the sub - tree traversal stop signal 34 includes a sub - tree traversal information pointer for the new sub - tree traversal and is temporarily kept in the sequential data search circuit 76 until the location of the environment of the present sub - tree traversal is pushed into the sub - tree traversal control information storage 77 . after this point , when the sub - tree traversal stop or inactivate signal 34 is inputted , data is read again from the sequential data storage 81 ( step 393 ). furthermore , if the mark field contains an intermediate symbol ( step 383 ), a sub - tree traversal reactivate signal 33 including the current sub - tree traversal information pointer is sent to the sub - tree traversal circuit 78 to indicate a reactivation of the sub - tree traversal ( step 388 ), and then control waits for a sub - tree traversal inactivate signal 34 from the sub - tree traversal circuit 78 ( step 389 ). thereafter , when the sub - tree traversal inactivate signal 34 is inputted , data is read again from the sequential data storage 81 ( step 393 ). moreover , when the content of the mark field is an end symbol , like in the case of the intermediate symbol ( steps 388 and 389 ), a reactivation of the current sub - tree traversal is indicated ( step 390 ) and control waits for the sub - tree traversal inactivate signal 34 from the sub - tree traversal circuit 78 ( step 391 ); thereafter , the latest sub - tree traversal information pointer associated with return information 31 is popped from the sub - tree traversal control information storage 77 ( step 392 ). thereafter , data is read again from the sequential data storage 81 ( step 393 ), and if the data is null data ( step 381 ), an end signal 20 is outputted to the tree traversal control circuit , and then control waits for an initiate signal 19 from the tree traversal control circuit 72 . fig1 is a flowchart of processing to develop a tree structure into an object sequential data series in the sub - tree traversal circuit of the alternative embodiment according to the present invention . incidentally , node indicates a location of the current node in the traversal and node1 designates a location of a child of the present node . moreover , stage denotes a traversal stage of the node . like in the case of fig7 according to a generate operation of the sub - tree traversal circuit 78 , the sub - tree traversal information storage 79 reserves an area corresponding to a new sub - tree when a generate signal 48 is received as an input thereto and then outputs a sub - tree traversal information pointer 49 indicating the location to the sub - tree traverse circuit 78 . thereafter , in response to a push operation of the sub - tree traversal circuit 79 , saved information 38 is inputted and is then accumulated at the end of the stack structure in an area specified by the sub - tree traversal information pointer associated with the saved information . in response to a pop operation of the sub - tree traversal circuit 78 , similarly , information at the end of the stack structure in an area specified is fetched and is outputted as return information 39 . as shown in fig1 , on receiving as an input thereto a start signal 32 including a location of a node and an attribute vector pointer from the sequential data search circuit 76 , the sub - tree traversal circuit 78 sets the attribute vector pointer value as the value of the present attribute value vector pointer and effects a traversal of the tree structure in the tree structure storage 75 with the node set as the root thereof . in this operation , the sub - tree traversal circuit 78 outputs a generation signal 48 to the sub - tree traversal information storage 79 so as to receive the sub - tree traversal information pointer 49 ( steps 100 and 101 ). next , it is checked whether or not the kind of the node matches with the current kind ( step 102 ). when the kind of the node is different from the pertinent kind ( step 102 ), a sub - tree traversal inactivate signal 34 including the sub - tree traversal information pointer is delivered to the sequential data search circuit 76 and the operation is inactivated ( step 103 ). thereafter , on receiving the sub - tree traversal signal 33 from the sequential data search circuit 76 , the sub - tree traversal information pointer associated with the sub - tree traversal reactivate signal 33 is set as a pointer to indicate the current area in the sub - tree traversal information storage 9 , and then the operation is reactivated ( step 104 ). when the kind of the node matches with the pertinent kind ( step 102 ), if it is determined ( step 116 ) that a propagation information item is to be generated for the node depending on the attribute value vector pointer of the node ( step 105 ), the storage location of the attribute value vector assigned to the node is set at the current attribute value vector pointer ( step 117 ). next , an attribute of the node for stage = 0 is written as sequential data 50 in the sequential data storage 82 ( step 106 ). furthermore , the elder child of the node is set to the node1 ( step 107 ). when the node1 is other than nil ( step 108 ), in order to effect a traversal of the elder children of the descendant beginning from the elder child of the node , the current node , node1 , stage , and the attribute value vector pointer value are pushed into the current area of the sub - tree traversal information storage 9 ( step 109 ), information about the child is set again ( step 110 ), and control is returned to the label 1 . when the node is nil ( step 108 ), the pop operation is achieved on the current area of the sub - tree traversal information storage 79 at a point where control returns from the operation on the child , thereby restoring present information ( step 111 ). in this case , if data to be popped is missing ( step 112 ), the traversal of this sub - tree is assumed to have been completed , the area indicated by the sub - tree traversal information pointer is abandoned , a sub - tree traversal inactivate signal 34 is outputted to the sequential data search circuit 76 , and then control waits for the sub - tree traversal initiate signal 32 or the sub - tree traversal reactivate signal 33 . if there exists return information , the stage undergoes a count - up operation ( step 113 ), the attribute of the node at the stage is written as the sequential data 50 in the sequential data storage 82 ( step 114 ), the younger brother of the node1 is set to the node1 for the traversal of the younger brother ( step 115 ), and then control returns to the label 2 . in a case where the area indicated by the sub - tree traversal information pointer associated with the sub - tree traversal reactivate signal 33 has already been abondoned , the sub - tree traversal inactivate signal 34 is outputted without effecting the processing above , and then control waits for the sub - tree traversal initiate signal 32 or the sub - tree traversal reactivate signal 33 . according to the present invention , for a tree traversal to process data in a tree structure , in a case where the processing of nodes in the traversal order thereof is impossible and hence a plurality of traversals are necessary , the traversal is effected only in the periphery of the object node , which can consequently improve the processing efficiency . furthermore , also in a case where the object processing cannot be coped with a plurality of traversals , for example , because information necessary for the processing of the respective nodes cannot be stored in a batch , the present invention enables to attain a node processing result like the result obtained when the entire tree is processed through a traversal . moreover , when attribute propagation from a node to a descendant takes place , if the timing when the propagation attribute is generated is different from that when the node of the descendant is evaluated by referencing the node of the propagation source , an appropriate node processing result can be attained because of the propagation attribute . while the present invention has been described with reference to the particular illustrative embodiments , it is not restricted by those embodiments but only by the appended claims . it is to be appreciated that those skilled in the art can change and modify the embodiments without departing from the scope and spirit of the invention . | 8 |
the simplest embodiment described herein is an integrated circuit chip that includes two power pmos load switches that are connected together on the vout side of the integrated circuit chip device while having separate input voltage sources vin1 and vin2 . each of the power pmos load switches also has a sub - circuit that allows the bulk node of the power pmos load switches to be connected to the highest voltage potential either at its source or at its drain and in this way becomes a reverse current blocking (“ rcb ”) switch . this is necessary to block any reverse current than would otherwise flow back to the vin pin when the vout voltage becomes greater than its vin voltage . the control of the system is derived from the vcc input selection block which selects the highest input voltage from vin1 or vin2 and uses that voltage to power the remaining circuits in the integrated circuit chip . the output of the vcc block in conjunction with the two external input signals sel and en form the basis of the control table shown in fig2 , which control table is derived from the state of these external signals , as is apparent . by appropriately configuring the en input pin and the sel input pin , the integrated circuit chip can be set into the auto - input detection mode or be used in the manual selection mode . keeping both the en input and the sel input at a low level will cause the integrated circuit chip to be shut down and both inputs to be disconnected from vout . also in this mode an optional pull - down resistor can be used to insure that the output voltage is completely pulled down to ground . in the automatic switching mode , the sel input is set to a logic level low voltage and the en input is set to a logic level high voltage . this allows the system to automatically select the highest input voltage from either vin1 or vin2 to be connected to the vout pin based upon the slew rate control block state , as discussed herein . if it is the users option to select the manual mode of operation , then the sel pin is set to a logic level high voltage and the en pin is used by the slew rate control block to select between connecting vin1 or vin2 to vout . in addition , the embodiments described , once the particular power signal that is selected is determined , perform skew rate control on the particular power signal that is selected , preferably as described in applications previously filed , such as , for example , apparatus and methods for slew rate controlled load switches , u . s . patent application ser . no . 14 / 469 , 258 filed aug . 26 , 2014 , which is expressly incorporated by reference herein . referring to the figures and drawings in detail , fig1 shows the overall system block diagram of the power multiplexer which includes a pair of power pmos load switches that are equal in size ( sw 1 and sw 2 ), a vcc input selection block , a slew rate control block that takes inputs from the vcc block as well as from two external inputs , sel and en in order to control the behavior of the two pmos load switches as discussed hereinafter , and the optional pull - down resister control circuit . each of the power pmos load switches has associated with it a block labeled rcb which controls the behavior of the pmos transistor &# 39 ; s bulk node in order to perform reverse current blocking . the power pmos load switches , sw 1 and sw 2 , are connected internally as a multiplexer , that is to say , there are two inputs labeled vin1 and vin2 and only one output labeled vout . the behavior of the multiplexer system is governed by the slew rate control block according to the table shown in fig2 , the slew rate control block being logic circuitry that is set based upon the state of the various inputs to create the outputs as described in the table shown in fig2 and further described herein . for the first case , input signals en and sel are both set to a logic low level . this causes both sw 1 and sw 2 to be in the open state and disconnects both vin1 and vin2 from the output pin vout . for the second case of fig2 , the en input pin is changed to a logic level high state which enables the chip into the automatic input selection mode . in this mode , the control of the voltage at the vout pin is controlled by the sel block which is connected in between the vin1 and vin2 input pins . the simplified schematic diagram of the vcc selection block is shown in fig5 . referring now to fig5 , the vcc selection block is used to determine which of the two input channels has the highest voltage potential . the block itself consists of a pair of pmos switches and a comparator circuit . the comparator measures the difference between the vin1 pin and the vin2 pin and then selects the highest voltage on those input pins to be connected to the chip &# 39 ; s vcc supply voltage . it also sends a control signal to the slew rate control block telling the slew rate control block whether to select pmos load switch sw 1 or sw 2 to be connected to vout . the operation of the automatic input selection is described in the diagram of fig4 . with the en input pin set to a logic level high and the sel input pin set to a logic level low , the vin1 and vin2 pins are allowed to power on . since vin1 rises above the uvlo threshold first , the vout pin is selected to be connected to vin1 through load switch sw 1 at time t 1 . then the vin2 voltage begins to rise . as vin2 becomes greater than vin1 the slew rate control block detects this change and switches the input voltage from vin1 to vin2 at time t 2 and the vout pin now follows the vin2 input . when the input voltage on vin2 is lowered , vout is again switched back to vin1 when the slew rate control block detects that vin1 is now a higher potential that vin2 at time t 3 . when the en input pin is brought to a logic level low voltage , then both load switches are disconnected from their respective input voltages and the voltage at the vout pin is discharged to zero volts by the pull - down resistor . since it is not desirable to have any current flowing from vin1 back into vin2 or vise - versa , the power pmos load switches are designed with reverse current blocking (“ rcb ”) circuitry . fig6 describes the rcb functioning . in fig6 the power pmos load switch is configured with a floating bulk terminal . using a voltage comparator connected across the source and drain terminals , the bulk diode is switched according to which terminal of the power pmos switch is at the highest voltage potential thereby allowing the bulk diode to block any reverse current that might be forced to flow between the source and drain terminals . both power pmos load switches sw 1 and sw 2 are connected to an rcb circuit . in a further embodiment , fig7 shows the inclusion of a uvlo function on the same integrated circuit chip that prevents the part from operating at voltages that are below the recommended operating conditions . the circuitry will operate properly as long as one of the two inputs is above the uvlo threshold level . furthermore , an additional protection feature can be added to provide thermal protection from either power path through sw 1 or sw 2 to the output pin by means of detecting the die temperature which might be an indication of an overcurrent condition at the output pin of the device . in this case , a tsd circuit on the same integrated circuit chip would be energized if the die temperature exceeds 150 ° c . and cause the control block to open up both power path switches in order to disconnect the output load from both vin1 and vin2 . the tsd circuit has a thermal hysteresis which would allow the power path switches to try to reconnect to the output should the die temperature fall below 125 ° c . in an alternate scheme shown in fig9 and 11 , an ocp circuit , on the same integrated circuit chip , is used to monitor the current of the active load switch ( either sw 1 or sw 2 or both ) and will act to cut back the current that is being delivered to the load at the output should the current exceed some predetermined limit level . fig1 shows a further embodiment using an ovp block on the same integrated circuit chip to protect the input voltages . many further embodiments are possible using various combinations of voltage protection ( ovp ) and current protection ( ocp ) schemes on either the vin1 channel or the vin2 channel or both at the same time . although described herein with reference to the preferred embodiment , one skilled in the art will readily appreciate that other applications may be substituted for those set forth herein without departing from the intended spirit and scope . various unique aspects have been described in terms of particular embodiments . other embodiments are within the scope of the following claims . for example , the steps can be performed in a different order and still achieve desirable results , and various sub - blocks described can be used in different combinations . | 7 |
the preferred embodiment will be described in reference to the linkage device functioning as a wrist and having secured to one end a workpiece gripper and being secured at the other end to a robot arm . referring to fig1 a wrist 10 at one end is connected to a three - fingered gripper 12 which is a standard device . a pneumatic line 14 , communicates with the gripper 12 . the wrist 10 is secured at its other end to the arm 15 of a robot ( not shown ). three pneumatic lines are joined to the wrist , line 16 communicates with an air bearing port ; line 18 communicates with an alignment port ; and line 20 communicates with a locking port . referring to fig2 the wrist 10 comprises a housing 22 having an outer cylindrical wall 24 and an inwardly extending support plate 26 which bisects the wrist 10 . an inner cylindrical wall 28 is concentrically aligned with the outer cylindrical wall 24 and is joined to the support plate 26 . referring to fig4 the outer cylindrical wall includes three ports , an air bearing port 30 , an alignment port 32 , and a locking port 34 . only ports 30 and 34 are shown in fig2 ; port 32 is shown in fig3 . the plate 26 is characterized by a central aperture therein through which aperture passes a tube 36 . the air bearing port 30 communicates with the tube 36 through a tap hole 38 . lateral passageways 39 are formed in the outer wall 24 and also communicate with the port 30 . the locking port 34 communicates with a passage way 40 formed in the plate 26 via a tap hole 42 . referring to fig3 the alignment port 32 communicates with a passageway 44 in the plate 26 via a tap hole 46 . in the following description , only one side of the wrist 10 will be described in detail , in that , the parts are identical in each half of the wrist . slideably received within the inner cylindrical wall 28 is a locking piston 50 . the piston 50 includes a shoulder portion 52 , the outer surface of which contacts in sliding engagement the inner surface of the inner cylindrical wall 28 . an o - ring seal 54 is received in the lower portion of the shoulder 52 . the lower portion of the shoulder 52 includes tap hole 64 , which communicates with the groove in which the o - ring 54 is secured . the piston 50 is characterized by a central aperture 56 , having a necked portion 58 . a spring 60 biases the piston 50 outwardly against a retaining ring 62 . disposed between the retaining ring 62 and the neck portion 58 of the piston 50 is an o - ring seal 97 . secured to the outer cylindrical wall 24 is a dome - shaped socket 80 . the socket includes a passageway 82 and a groove 84 . the passageway 82 is in communication with the lateral passageway 39 of the air bearing port 30 ; and the groove 84 circumscribes the inner surface of the socket 80 . a hemispherical link 90 is characterized by a dome - shaped recess 92 which contacts the piston 50 . the link 90 terminates in a flanged end 94 , which may be secured to either a gripper or to the robot arm as desired . disposed between the inner and outer cylindrical walls 24 and 28 is an alignment ring 70 . the alignment ring includes an o - ring seal 72 . formed in the base of the ring 70 is a tap hole 74 which intersects a passageway 76 . the passageway 76 communicates with the groove within which the o - ring seal 72 is received . the alignment ring 70 is adapted for fluid tight reciprocating motion between the inner and outer cylindrical walls 28 and 24 respectively . the use of pneumatic lines to pressurize a chamber or create a vacuum in a chamber , the associated solenoid valves to open and close the lines and the controls necessary to actuate the valves as desired are all well known in the art and need not be described in detail . the operation of the invention will be described in reference to the handling of a workpiece , which workpiece at a workstation will require a stamping operation by a press . the acquisition of the workpiece and the movement of the workpiece to and from the workstation is accomplished by prior art robots . the wrist 10 is secured at one end to the robot arm 15 such as a unimation inc ., model 560 puma robot . the gripper 12 is secured to the other end . the wrist functions in three modes , an air bearing mode , a locking mode and an alignment mode . in the air bearing mode , the air bearing port 30 is pressurized and the locking port 34 and the alignment port 32 are vented to ambient . in this mode , the two links 90 , as will be described , are supported on air bearings . in the locking mode , the locking port 34 is pressurized while the air bearing port is vented to ambient . in the alignment mode the alignment port 32 is pressurized , the air bearing port 30 is pressurized ; the locking port 34 is vented to ambient , this results in the links being aligned in a standard relationship . after alignment , the device may remain in the air bearing mode or placed in the locking mode as desired . the workpiece is acquired by the gripper 12 with the workpiece being clamped between the fingers of the gripper . at this time , the flanges 94 of the links 90 are in parallel relationship and the wrist 10 is in its locking mode . that is , pressurized air through pneumatic line 20 is introduced into the locking port 34 , the tap hole 42 and passageway 40 . this pressure drives the piston 50 outwardly , the piston engaging the recess 92 of the link 90 and thus locking the link 90 in a stable position . pressurized air also flows through tap hole 64 ensuring the o - ring 54 maintains a proper seal . at this time , the air bearing port and alignment port are vented to ambient . the workpiece is moved to a workstation where the workpiece is placed in a recess or the like , for a stamping operation . even if it has been properly placed in the recess , there will still occur a transmission of forces passing through the robot arm , if the wrist remains in the locking mode . accordingly , prior to the stamping operation the wrist 10 is placed in its air bearing mode . in this mode , the locking port 34 is vented to ambient and pressurized air flows through the air bearing port 30 lateral passageway 39 and into passage 82 and groove 84 in the socket 80 . the groove 84 in the socket 80 forms with the outer surface of the link 90 a passageway from which the air is dispersed forming an air bearing surface between the link 90 and the socket 80 . the pressurized air also flows through tap hole 38 , through the tube 36 , and is dispersed between the concave surface 92 of the link 90 and the outer surface of the piston 50 . this forms an air bearing surface between the piston and underside of the link 90 . in this mode , both links are adapted for relative angular movement and thus when the stamping operation is performed the wrist can absorb any vibration transmitted through the gripper to the wrist . alternatively , the fingers of the gripper could be released or relaxed further absorbing vibration forces directly along its symmetry axis . after the stamping operation , the wrist is preferably placed in the locking mode , as previously described , with the air bearing port vented to ambient and the workpiece removed from the workstation . if it is desired to re - align the wrist it is then placed in the alignment mode . the wrist is placed in the air bearing mode with the locking port vented to ambient . line 18 is pressurized and air enters the alignment port 32 shown most clearly in fig3 . the air flows through the tap hole 46 and the passageway 42 , and is discharged between the inner and outer cylindrical walls 28 and 24 respectively and the underside of the alignment ring 70 . further , as shown in fig2 air enters tap hole 74 and passageway 76 ensuring that the o - ring 72 maintains a proper seal . this mode results in the alignment rings being driven toward the bases of the links , contacting the links and moving the links to alignment with the flanges being in parallel relationship and the longitudinal axes of the links being coincident . subsequently , the locking mode is activated , the alignment port 32 vented to ambient and the locking ring retracted to a withdrawn position , as shown in fig3 right side . this withdrawal can either be by applying a vacuum to line 18 by use of a spring ( not shown ) or by simply allowing the ring to slide back when the positive pressure is removed from the alignment port 32 . the opening and closing of the solenoid valves to ensure the control of the flow of pressurized air to the various ports and the venting of ports to ambient can be accomplished in any desired fashion . that is , depending upon the workpiece being handled when and for how long the alignment mode , the air bearing and the locking modes are required will depend upon the specific task which must be performed on the workpiece . as compared to serial , cable controlled devices such as those used to position dial indicators and the like , the wrist has several important advantages such as a short moment arm which is important for robots with rotary joints as angular errors are transformed into position errors through the length of the moment arm . further , the low friction allows the device to passively accommodate forces without transmitting those forces back to the robot arm itself . lastly , rapid response is achieved which is important when the accommodation has to be made during or within a very short time frame . the use of air bearings enhances the low friction and rapid response characteristics of the wrist and results in low mass and inertia effects which is consistent with the objective of rapid accommodation . in the description of the preferred embodiment the wrist per se accomodated five ( 5 ) degrees of freedom , 2 in position and 3 in rotation . the ability to relax the gripper provided a sixth ( 6th ) degree of freedom , 1 in position , with the result that movement was completely arbitrary . the sixth degree of freedom could otherwise be accomplished by those skilled in the art . for example , the link could be adapted for telescopic motion along its longitudinal axis . | 8 |
referring now to fig1 , there is shown an exploded view of a power door opener 10 constructed in accordance with the present invention . as can be seen , the power door opener 10 is comprised of a power actuator 12 that is commercially available , for example , from burr engineering of battle creek , mich . the power actuator 12 is basically a housing 14 containing a 12 volt motor 16 and the necessary gearing and power train and an outer cylindrical tube 18 extending outwardly from the housing 14 within which there is a movable actuator shaft 20 . in the operation of the conventional power actuator 12 , the actuator shaft 20 can be moved between its closed position as shown in fig1 and an extended position ( not shown ) where the actuator shaft 20 is extended linearly outwardly from the housing 14 . typically , the actuator shaft 20 can be moved about 4 inches in its movement between the closed position and the extended position and that movement is driven in both directions by the motor 16 . in accordance with the present invention , therefore , a cylindrical fixed push plate 22 is positioned over the outer cylindrical tube 18 with the fixed push plate 22 having a distal end 24 and proximal end 26 . the proximal end 26 is affixed to the housing 14 by means of screw threads , welding or other affixation method such that the fixed push plate 22 is firmly affixed to the housing 14 in its position surrounding the outer cylindrical tube 18 . at the distal end 24 of the fixed push plate 22 , there is a fixed pry member 30 that extends radially outwardly from the fixed push plate 22 and the fixed pry member 30 tapers inwardly in the outward direction forming a relatively straight , narrow edge 32 at the outer end thereof . as shown the inward taper is formed on fixed pry member 30 on the side away from the distal end 24 of the fixed pry member 30 , however , the location of the taper may be on either side of the fixed pry member 30 or on both sides thereof . a movable push plate 34 is affixed to the outer end of the movable actuator shaft 20 by means such as a pin 36 that extends through a suitable opening 38 in the movable push plate 34 and a corresponding , aligned opening 40 in the outer end of the actuator shaft 20 , thereby securing the movably push plate 34 firmly and securely to the movable actuator shaft 20 . the movable push plate 34 has a movable pry member 42 that extends outwardly from the movable push plate 34 and , in the exemplary embodiment , the movable pry member 42 is bifurcated , having two prongs 44 with a space 46 therebetween . both of the prongs 44 taper inwardly in the outer direction and , as with the fixed pry member 30 , the taper may be on the side of the prongs 44 facing the power actuator 12 , facing away from the power actuator 12 , or on both sides of the prongs 44 . turning then to fig2 , taken along with fig1 , there is shown a perspective view of the power door opener 10 with the actuator shaft 20 in the closed position . as can be seen , the fixed pry member 30 aligns with the two prongs 44 of the movably pry member 42 since the fixed pry member 30 occupies the space 46 intermediate those prongs 44 . as such , there is formed a continuous edge by the combination and alignment of the fixed pry member 30 and the movable pry member 42 . turning then to fig3 , taken along with fig1 and 2 , there is a view of the present power door opener 10 and illustrating its use to force open a door 48 . in fig3 , the user 50 has inserted the continuous edge of the power door opener 10 into the narrow space between the door 48 and the door jamb 52 . as such , as electricity is fed to the motor 16 of the power actuator 12 , the actuator shaft 20 will move outwardly with respect to the housing 14 . the outward movement of the actuator shaft 20 will create an ever increasing space between the fixed pry member 30 and the movable pry member 42 to force the opening between the door 48 and the door jamb 52 to expand to eventually reach a linear gap where the lock or door latch will be clear of the door jamb 52 . at that point , the door 48 can be opened and access gained to the interior of the building or room . turning next to fig4 , there is shown an exploded view of an alternative exemplary embodiment of the present invention and showing the double ended power door opener 54 . with the fig4 embodiment , the power actuator 12 is basically the same as that described with respect to fig1 - 3 and the same identification numbers are with the fig4 embodiment for the same components . however , in the present embodiment the double ended power door opener 54 is designed for forcing open a door by a different method . with the fig4 embodiment , the power actuator 12 has a front side 56 and a rear side 58 . as with the fig1 embodiment the movable actuator shaft 20 extends out of the front side 56 of the power actuator 12 and there is , again , a movable push plate 34 affixed to the outer end of the actuator shaft 20 and has a movable pry member 42 . in this embodiment , however , the movable push plate 34 is reversed such that the bifurcated movably pry member 42 faces outwardly and therefore does not align with the fixed pry member 30 when the actuator shaft 20 is in the closed position . the orientation of the movable push plate 34 can be established by its affixation to the outer end of the actuator shaft 20 with pin 36 . affixed to the rear side 58 of the power actuator 12 is a long extension 60 and the long extension 60 can be affixed to the power actuator 12 by means of a pin 62 that passes through an opening 64 in the long extension 60 and also through an opening 66 formed in a connector 68 that is affixed to or a part of the power actuator 12 . as such , the long extension 60 is firmly affixed to the rear side 58 of the power actuator 12 and there is an extension push plate 70 affixed to the free end of the long extension 60 . again , the connection between the extension push plate 70 and the long extension 60 may be by means of a pin 72 passing through an opening 74 in the extension push plate 62 and a hole 76 formed in the free end of the long extension 60 . the extension push plate 70 also includes an extension pry member 78 that , again , may be bifurcated in a similar manner to the movable pry member 42 ( fig1 ). there may also be as short extension 80 that is provided so that the user can install the short extension 80 as an alternative to the long extension 60 depending on the width of the doorway that is to be distorted in forcing a door open . as can be readily seen , the short extension 80 can be installed and affixed to the power actuator 12 in the same manner as the long extension 60 and the only difference is that the overall length of the double ended power door opener 54 is different . turning then to fig5 , there is shown a perspective view of the double ended power door opener 54 of fig4 . as can be seen , the double ended power door opener 54 includes the extension push plate 70 at one end of the double ended power door opener 54 with the movable push plate 34 at the other end with a known linear distance therebetween . as such , that linear distance can be changed by activating the power actuator 12 so as to move the actuator shaft 20 to extend outwardly or retract inwardly with respect to the housing 14 . accordingly , as will become clear , the double ended power door opener 54 can be placed in a doorway between two vertical door jambs and with the actuator shaft 20 in the closed position . upon activation of the power actuator 12 , the movable push plate 34 can be extended outwardly to increases the linear distance between the extension push plate 70 and the movable push plate 34 to spread the door jamb to release the door to be forced open . that action is illustrated in fig6 , taken along with fig4 and 5 , where the double ended power door opener 54 is shown in operative position intermediate opposed door jambs 82 , 84 . as can be seen , the movable push plate 34 is fitted against the door jamb 82 while the free end of the long extension 60 is fitted against door jamb 84 . in this embodiment , a remote controller 86 is connected to the power actuator 12 so that the user can be positioned away from the doorway when the door is forced open . as such , the user can be protected by the walls that surround the door 88 and not be in the way of possible danger that may be present within the room being entered . accordingly , by activating the power actuator 12 , the door jambs 82 , 84 will be spread apart as the actuator shaft 20 moves from a closed position to an extended position , thereby freeing the lock from its connection to a door jamb and allow the user to force the door open for access to the room . while the present invention has been set forth in terms of a specific embodiment or embodiments , it will be understood that the present power door opener herein disclosed may be modified or altered by those skilled in the art to other configurations . accordingly , the invention is to be broadly construed and limited only by the scope and spirit of the claims appended hereto . | 0 |
the compounds of the present invention can be prepared synthetically . the present invention includes the synthetic processes described in the following schemes . scheme 1 illustrates the preparation of the different aldehydes used as starting materials for the synthesis of spisulosine derivatives . scheme 2 shows the preparation of spisulosine derivatives having the ( 2s , 3r ) configuration using the aldehyde derived from the corresponding l - aminoacid and grignard reagents of different lengths . scheme 3 describes the synthesis of the enantiomeric form of the final products of spisulosine starting from the corresponding d - alanine derivative . the methods for the synthesis of n - acetyl , o - methyl , 3 - halo - 3 - deoxy and o - phosphate derivatives of spisulosine are outlined in scheme 4 . scheme 5 shows the preparation of the corresponding ( 2s , 3s ) diastereoisomers of spisulosine , in which the final diamine is prepared via the azide intermediate . preparation of the diastereoisomeric form of this diamine is outlined in scheme 6 . in addition , the methods for the synthesis of o - acetyl and o - trifluoroacetyl derivatives of spisulosine are shown in scheme 6 . other spisulosines 285 and 299 derivatives are prepared following different procedures which are described in scheme 7 . 3 - keto derivatives of spisulosine and their corresponding oximes can be prepared as described in scheme 8 . the enantiomeric form of ketone 126 is prepared from the appropriate aminoalcohol as indicated in scheme 9 . the synthesis of the 1 - fluoro derivative of spisulosine starting from d - erythrosphingosine is depicted in scheme 10 . table 2 cytotoxicity of spisulosine analogs ( ic50 , molar ) solid tumors line bladder 5637 4 . 72e − 08 6 . 34e − 06 3 . 65e − 08 breast mx - 1 1 . 95e − 06 colon ht - 29 1 . 28e − 07 6 . 43e − 08 9 . 07e − 06 2 . 64e − 07 gastric hs746t 3 . 95e − 07 liver sk - hep - 1 2 . 97e − 07 nscl a549 8 . 57e − 08 3 . 43e − 08 9 . 79e − 06 1 . 01e − 05 ovary sk - ov - 3 7 . 02e − 07 pancreas panc - 1 1 . 67e − 07 7 . 22e − 07 8 . 64e − 08 pharynx fadu 2 . 49e − 07 1 . 03e − 08 8 . 12e − 08 7 . 84e − 08 prostate pc - 3 8 . 60e − 08 4 . 9e − 08 3 . 79e − 07 prostate du - 145 7 . 39e − 08 9 . 86e − 06 2 . 01e − 07 prostate lncap 4 . 44e − 08 7 . 69e − 06 7 . 15e − 08 renal 786 - o 1 . 38e − 07 scl nci - h187 1 . 63e − 07 7 . 17e − 06 na retinoblastoma y - 79 4 . 65e − 06 na na melanoma mel - 28 7 . 21e − 06 na 1 . 03e − 05 fibrosarcoma sw 694 na 6 . 49e − 06 1 . 04e − 05 1 . 01e − 05 chondrosarcoma chsa 1 . 80e − 08 1 . 58e − 06 9 . 65e − 06 osteosarcoma osa - fh 1 . 83e − 07 8 . 60e − 06 na methodology : mts . 4 - parameter curve fit w / softmax . values are molar na = not active solid tumors line bladder 5637 7 . 80e − 06 3 . 26e − 06 na 2 . 99e − 05 breast mx - 1 na 2 . 84e − 06 1 . 49e − 05 colon ht - 29 9 . 11e − 06 na na gastric hs746t na liver sk - hep - 1 na nscl a549 1 . 03e − 05 4 . 90e − 05 na na ovary sk - ov - 3 na pancreas panc - 1 1 . 86e − 07 na na na pharynx fadu 2 . 25e − 07 1 . 96e − 05 na na prostate pc - 3 1 . 02e − 05 prostate du - 145 7 . 55e − 08 na prostate lncap 6 . 35e − 06 na renal 786 - o na 1 . 62e − 07 na scl nci - h187 7 . 29e − 06 3 . 55e − 06 retinoblastoma y - 79 9 . 51e − 06 1 . 21 e − 05 melanoma mel - 28 9 . 4e − 06 na na na fibrosarcoma sw 694 7 . 57e − 06 chondrosarcoma chsa 8 . 94e − 06 na na na osteosarcoma osa - fh 8 . 52e − 06 na na 1 . 49e − 05 solid tumors line bladder 5637 na 1 . 58e − 06 1 . 45e − 06 breast mx - 1 na 1 . 72e − 06 4 . 29e − 06 colon ht - 29 na na gastric hs746t 1 . 62e − 05 liver sk - hep - 1 1 . 55e − 05 nscl a549 2 . 01e − 05 na ovary sk - ov - 3 na pancreas panc - 1 na na pharynx fadu 1 . 43e − 05 2 . 99e − 06 3 . 96e − 06 prostate pc - 3 2 . 18e − 05 prostate du - 145 4 . 95e − 08 prostate lncap na renal 786 - o na 5 . 98e − 05 3 . 30e − 06 scl nci - h187 retinoblastoma y - 79 1 . 65e − 06 melanoma mel - 28 na na 2 . 54e − 06 fibrosarcoma sw 694 chondrosarcoma chsa na na 4 . 62e − 06 osteosarcoma osa - fh na na methodology : mts . 4 - parameter curve fit w / softmax . values are molar na = not active [ 0110 ] table 3 cytotoxicity of spisulosine analogs ( ic50 , molar ) leukemias / lymphomas line all ( promyelocytic leukemia ) hl - 60 4 . 25e − 07 all ( acute lymphobalstic ) molt 3 1 . 12e − 06 7 . 61e − 06 9 . 83e − 09 cml ( chronic myelogenous ) k562 7 . 84e − 07 all ( b - cell ) ccrf - sb na leukemia ( hairy b - cell ) mo - b leukemia ( plasma cell ) arh - 77 6 . 82e − 07 lymphoma ( t cell ) h9 1 . 55e − 06 lymphoma ( cutaneous t cell ) hut 78 2 . 16e − 06 1 . 06e − 05 na 8 . 81e − 06 lymphoma mc116 8 . 82e − 06 1 . 09e − 05 9 . 58e − 06 ( undifferentiated ) lymphoma ( burkitts b cell ) ramos 2 . 14e − 06 lymphoma ( histiocytic ) u - 937 9 . 81e − 07 2 . 98e − 08 na lymphoma ( b cell ) ccrf - sb lymphoma ( b cell ) mob lymphoma ( burkitts ascites ) p3hr1 3 . 37e − 06 methodology : mts . 4 - parameter curve fit w / softmax . values are molar na = not active leukemias / lymphomas line all ( promyelocytic leukemia ) hl - 60 all ( acute lymphobalstic ) molt 3 3 . 76e − 08 2 . 61e − 05 na cml ( chronic myelogenous ) k562 0 . 001 all ( b - cell ) ccrf - sb leukemia ( hairy b - cell ) mo - b leukemia ( plasma cell ) arh - 77 lymphoma ( t cell ) h9 na na na lymphoma hut 78 9 . 15e − 06 ( cutaneous t cell ) lymphoma mc116 na na na ( undifferentiated ) lymphoma ( burkitts b cell ) ramos na na lymphoma u - 937 na na ( histiocytic ) lymphoma ( b cell ) ccrf - sb lymphoma ( b cell ) mob lymphoma ( burkitts p3hr1 ascites ) leukemias / lymphomas line all ( promyelocytic leukemia ) hl - 60 1 . 29e − 06 all ( acute lymphobalstic ) molt 3 1 . 43e − 05 5 . 81e − 07 cml ( chronic myelogenous ) k562 all ( b - cell ) ccrf - sb leukemia ( hairy b - cell ) mo - b leukemia ( plasma cell ) arh - 77 lymphoma ( t cell ) h9 2 . 59e − 06 5 . 98e − 06 lymphoma ( cutaneous t cell ) hut 78 lymphoma ( undifferentiated ) mc116 na na lymphoma ( burkitts b cell ) ramos 1 . 65e − 06 1 . 21e − 06 lymphoma ( histiocytic ) u - 937 na na lymphoma ( b cell ) ccrf - sb lymphoma ( b cell ) mob lymphoma ( burkitts ascites ) p3hr1 methodology : mts . 4 - parameter curve fit w / softmax . values are molar na = not active all solvents were reagent grade ( used in work - ups ) or hplc grade ( used as reaction and / or as purification solvent ). anhydrous solvents were used directly as supplied by the manufacturer . all other reagents were commercial compounds of the highest purity available . all amino acids and their derivatives used as starting materials were commercially available . compounds 1 and 39 were described in the international patent wo 99 / 52521 . analytical thin - layer chromatography ( tlc ) was performed on merck silica gel aluminium sheets ( 60 , f254 ) precoated with a fluorescent indicator . visualization was effected using ultraviolet light ( 254 nm ), phosphomolybdic acid ( 7 % w / v ) in 95 % ethanol . proton and carbon magnetic resonance spectra ( 1 h , 13 c - nmr ) were recorded on a varian - 300 ( 300 mhz ) fourier transform spectrometer , and chemical shifts were expressed in parts per million ( ppm ) relative to chcl 3 as an internal reference ( 7 . 26 ppm for 1 h and 77 . 0 for 13 c ). multiplicities are designated as singlet ( s ), doublet ( d ), doublet of doublets ( dd ), doublet of triplets ( dt ), triplet ( t ), quartet ( q ), quintet ( quint ), multiplet ( m ), and broad singlet ( br s ). electrospray ionization mass spectra ( esi - ms ) were obtained on a hewlett packard series 1100 msd . flash column chromatography was carried out on e . merck silica gel 60 ( 240 - 400 mesh ) using the solvent systems listed under individual experiments . illustrative examples of the synthesis of spisulosine derivatives according to the present invention are as follows : to a cold (− 78 ° c .) solution of ( cocl ) 2 ( 2m in ch 2 cl 2 , 2 . 47 ml , 4 . 94 mmol ) in ch 2 cl 2 ( 8 ml ), dmso ( 0 . 70 ml , 9 . 89 mmol ) was added dropwise . after stirring at − 78 ° c . for 15 min , a solution of ( s )- 2 -( n , n - dibenzylamino )- 1 - propanol ( 1 . 01 g , 3 . 96 mmol ) in ch 2 cl 2 ( 10 ml ) was added dropwise . the mixture was stirred at − 78 ° c . for 1 h , and then et 3 n ( 2 . 76 ml , 19 . 78 mmol ) was added . the reaction was warmed up to 0 ° c . and stirred for 15 min , followed by the addition of nh 4 cl ( 25 ml , sat . aq .). the crude was extracted with ch 2 cl 2 ( 3 × 25 ml ), washed successively with nahco 3 ( 50 ml , sat . aq .) and brine ( 50 ml ), dried over na 2 so 4 and concentrated in vacuo . aldehyde 4 was obtained as a yellow oil and used without further purification ( 928 mg , 93 % yield ). [ 0118 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ1 . 18 ( d , 3h , j = 6 . 7 hz ), 3 . 33 ( q , 1h , j = 6 . 7 hz ), 3 . 57 ( d , 2h , j = 13 . 8 hz ), 3 . 74 ( d , 2h , j = 13 . 6 hz ), 7 . 23 - 7 . 42 ( m , 10h ), 9 . 73 ( s , 1h ); [ 0119 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ6 . 8 , 54 . 9 , 62 . 8 , 127 . 3 , 128 . 4 , 128 . 8 , 139 . 0 , 204 . 5 . to a solution of ( s )- 2 - amino - 1 - butanol ( 1 . 0 ml , 10 . 58 mmol ) in meoh ( 20 ml ), bnbr ( 5 . 0 ml , 42 . 32 mmol ) and k 2 co 3 ( 5 . 85 g , 42 . 32 mmol ) were added . the mixture was stirred at 60 ° c . for 5 h , and then cooled down to room temperature and filtered , washing the solid with etoac . the filtrates were concentrated in vacuo and the residue purified by column chromatography on silica ( 100 % hexane to hexane / etoac 5 : 1 ) to obtain alcohol 5 as a white solid ( 2 . 7 g , 95 % yield ). [ 0123 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 98 ( t , 3h , j = 7 . 5 hz ), 1 . 25 - 1 . 37 ( m , 1h ), 1 . 79 - 1 . 89 ( m , 1h ), 2 . 74 - 2 . 83 ( m , 1h ), 3 . 31 ( br s , 1h ), 3 . 45 - 3 . 52 ( m , 1h ), 3 . 50 ( d , 2h , j = 13 . 1 hz ), 3 . 55 - 3 . 65 ( m , 1h ), 3 . 88 ( d , 2h , j = 13 . 3 hz ), 7 . 26 - 7 . 41 ( m , 10h ); [ 0124 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ11 . 6 , 17 . 8 , 53 . 0 , 60 . 4 , 127 . 0 , 128 . 3 , 128 . 8 , 139 . 3 . according to the method of example 1 , from alcohol 5 ( 1 . 0 g , 3 . 7 mmol ), aldehyde 6 was obtained as a yellow oil and used without further purification ( 1 . 0 g , 100 % yield ). [ 0128 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 97 ( t , 3h , j = 7 . 5 hz ), 1 . 64 - 1 . 85 ( m , 2h ), 3 . 08 ( t , 1h , j = 6 . 8 hz ), 3 . 72 ( d , 2h , j = 13 . 6 hz ), 3 . 80 ( d , 2h , j = 13 . 8 hz ), 7 . 22 - 7 . 39 ( m , 10h ), 9 . 73 ( s , 1h ). to a cold ( 0 ° c .) solution of ( s )- 2 - amino - 1 - butanol ( 2 . 0 g , 22 . 5 mmol ) in acetone / h 2 o 1 : 1 ( 50 ml ), na 2 co 3 ( 8 . 7 g , 81 . 9 mmol ) and bnococl ( 5 . 8 g , 33 . 8 mmol ) were added . after stirring at 0 ° c . for 1 h , the solid was filtered off and washed with acetone ( 2 × 30 ml ). the filtrates were concentrated in vacuo and the residue was purified by column chromatography on silica ( 100 % ch 2 cl 2 to ch 2 cl 2 / meoh 20 : 1 ) to obtain alcohol 7 as a white solid ( 2 . 14 g , 43 % yield ). according to the method of example 1 , from alcohol 7 ( 750 mg , 3 . 4 mmol ), aldehyde 8 was obtained as a yellow oil and used without further purification ( 700 mg , 94 % yield ). to a solution of l - norvaline ( 685 mg , 5 . 85 mmol ) in mecn ( 15 ml ), bnbr ( 3 . 48 ml , 29 . 24 mmol ) and k 2 co 3 ( 4 . 04 g , 29 . 24 mmol ) were added . the mixture was stirred at 60 ° c . for 9 h , and then cooled down to room temperature and filtered , washing the solid with etoac . the filtrates were concentrated in vacuo and the residue purified by column chromatography on silica ( 100 % hexane to hexane / etoac 5 : 1 ) to obtain benzyl ester 9 as a colorless oil ( 1 . 6 g , 71 % yield ). [ 0137 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 82 ( t , 3h , j = 7 . 4 hz ), 1 . 25 - 1 . 40 ( m , 1h ), 1 . 45 - 1 . 60 ( m , 1h ), 1 . 70 - 1 . 85 ( m , 2h ), 3 . 42 ( dd , 1h , j = 8 . 2 , 6 . 7 hz ), 3 . 55 ( d , 2h , j = 13 . 9 hz ), 3 . 96 ( d , 2h , j = 13 . 9 hz ), 5 . 18 ( d , 1h , j = 12 . 3 hz ), 5 . 30 ( d , 1h , j = 12 . 3 hz ), 7 . 25 - 7 . 45 ( m , 15h ); [ 0138 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ13 . 7 , 19 . 3 , 31 . 6 , 54 . 4 , 60 . 5 , 65 . 8 , 126 . 8 , 128 . 1 , 128 . 2 , 128 . 4 , 128 . 5 , 128 . 8 , 136 . 1 , 139 . 7 , 173 . 0 . to a cold ( 0 ° c .) suspension of lialh 4 ( 184 mg , 4 . 84 mmol ) in thf ( 10 ml ), a solution of ester 9 ( 375 mg , 0 . 97 mmol ) in thf ( 2 . 5 ml ) was added . the mixture was stirred at 0 ° c . for 2 h , and then quenched by dropwise addition of etoh ( 3 ml ′). na — k tartrate solution ( 10 % aq , 30 ml ) was added , and the crude was extracted with etoac ( 3 × 30 ml ), dried over na 2 so 4 , concentrated in vacuo and purified by column chromatography on silica ( hexane / etoac 5 : 1 ) to obtain alcohol 10 as a colorless oil ( 170 mg , 62 % yield ). [ 0142 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 97 ( t , 3h , j = 7 . 1 hz ), 1 . 17 - 1 . 42 ( m , 3h ), 1 . 71 - 1 . 76 ( m , 1h ), 2 . 80 - 2 . 86 ( m , 1h ), 3 . 25 ( br s , 1h ), 3 . 41 - 3 . 56 ( m , 2h ), 3 . 44 ( d , 2h , j = 13 . 3 hz ), 3 . 85 ( d , 2h , j = 13 . 3 hz ), 7 . 24 - 7 . 37 ( m , 10h ); [ 0143 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 3 , 20 . 3 , 27 . 2 , 53 . 1 , 58 . 7 , 60 . 8 , 127 . 1 , 128 . 4 , 129 . 0 , 139 . 3 . according to the method of example 1 , from alcohol 10 ( 163 mg , 0 . 58 mmol ), aldehyde 11 was obtained as a yellow oil and used without further purification ( 140 g ,. 87 % yield ). [ 0147 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 89 ( t , 3h , j = 7 . 3 hz ), 1 . 34 - 1 . 44 ( m , 2h ), 1 . 60 - 1 . 76 ( m , 2h ), 3 . 17 ( t , 1h , j = 6 . 7 hz ), 3 . 73 ( d , 2h , j = 13 . 8 hz ), 3 . 81 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 40 ( m , 10h ), 9 . 74 ( s , 1h ). according to the method of example 6 , from l - valine ( 927 mg , 7 . 91 mmol ), benzyl ester 12 was obtained as a colorless oil ( 2 . 58 g , 84 % yield ). [ 0151 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 86 ( d , 3h , j = 6 . 4 hz ), 1 . 11 ( d , 3h , j = 6 . 5 hz ), 2 . 20 - 2 . 35 ( m , 1h ), 3 . 02 ( d , 1h , j = 10 . 7 hz ), 3 . 39 ( d , 2h , j = 13 . 9 hz ), 4 . 07 ( d , 2h , j = 13 . 9 hz ), 5 . 25 ( d , 1h , j = 12 . 3 hz ), 5 . 39 ( d , 1h , j = 12 . 1 hz ), 7 . 27 - 7 . 54 ( m , 15h ); [ 0152 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ19 . 5 , 19 . 9 , 27 . 2 , 54 . 5 , 65 . 6 , 68 . 0 , 126 . 9 , 128 . 2 , 128 . 3 , 128 . 5 , 128 . 6 , 128 . 7 , 136 . 1 , 139 . 4 , 171 . 8 ; esms calcd for c 26 h 30 no 2 ( m + h ) 388 . 2 , found 388 . 2 . according to the method of example 7 , from ester 12 ( 2 . 3 g , 5 . 93 mmol ), alcohol 13 was obtained as a colorless oil ( 1 . 55 g , 92 % yield ). [ 0157 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 97 ( dd , 3h , j = 6 . 5 , 1 . 2 hz ), 1 . 17 ( dd , 3h , j = 6 . 7 , 1 . 2 hz ), 2 . 05 - 2 . 12 ( m , 1h ), 2 . 52 - 2 . 60 ( m , 1h ), 3 . 05 ( br s , 1h ), 3 . 47 ( td , 1h , j = 10 . 2 , 1 . 3 hz ), 3 . 61 ( br d , 1h , j = 10 . 1 hz ), 3 . 71 ( d , 2h , j = 13 . 3 hz ), 3 . 91 ( d , 2h , j = 13 . 3 hz ), 7 . 23 - 7 . 36 ( m , 10h ); [ 0158 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ20 . 1 , 22 . 6 , 27 . 5 , 54 . 1 , 59 . 1 , 64 . 6 , 127 . 1 , 128 . 4 , 129 . 1 , 139 . 6 ; esms calcd for c 19 h 26 no ( m + h ) 284 . 2 , found 284 . 2 . according to the method of example 1 , from alcohol 13 ( 450 mg , 1 . 59 mmol ), aldehyde 14 was obtained as a yellow oil and used without further purification ( 447 mg , 100 % yield ). [ 0163 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( d , 3h , j = 6 . 5 hz ), 1 . 08 ( d , 3h , j = 6 . 5 hz ), 2 . 25 - 2 . 32 ( m , 1h ), 2 . 72 ( dd , 1h , j = 10 . 2 , 3 . 7 hz ), 3 . 70 ( d , 2h , j = 13 . 6 hz ), 4 . 02 ( d , 2h , j = 13 . 8 hz ), 7 . 24 - 7 . 38 ( m , 10h ), 9 . 85 ( d , 1h , j = 3 . 5 hz ). according to the method of example 6 , from l - isoleucine ( 1 . 0 g , 7 . 6 mmol ), benzyl ester 15 was obtained as a colorless oil ( 2 . 4 g , 80 % yield ). [ 0167 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 71 - 0 . 79 ( m , 6h ), 1 . 09 - 1 . 21 ( m , 1h ), 1 . 82 - 2 . 01 ( m , 2h ), 3 . 02 ( d , 1h , j = 6 . 5 hz ), 3 . 23 ( d , 2h , j = 9 . 5 hz ), 3 . 89 ( d , 2h , j = 9 . 5 hz ), 5 . 15 ( d , 1h , j = 7 . 5 hz ), 5 . 24 ( d , 1h , j = 7 . 5 hz ), 7 . 11 - 7 . 46 ( m , 15h ); esms calcd for c 27 h 32 no 2 ( m + h ) 402 . 2 , found 402 . 5 . according to the method of example 7 , from ester 15 ( 0 . 50 g , 1 . 23 mmol ), alcohol 16 was obtained as a colorless oil ( 0 . 36 g , 99 % yield ). [ 0172 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 92 - 0 . 99 ( m , 6h ), 1 . 13 - 1 . 18 ( m , 1h ), 1 . 63 - 1 . 67 ( m , 1h ), 1 . 88 - 1 . 97 ( m , 1h ), 2 . 63 - 2 . 67 ( m , 1h ), 3 . 45 ( d , 2h , j = 6 . 5 hz ), 3 . 49 ( d , 2h , j = 9 . 5 hz ), 3 . 88 ( d , 2h , j = 9 . 5 hz ), 7 . 18 - 7 . 42 ( m , 10h ); [ 0173 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ11 . 4 , 15 . 8 , 28 . 2 , 32 . 7 , 53 . 9 , 58 . 7 , 62 . 7 , 127 . 0 , 128 . 3 , 129 . 0 , 139 . 7 ; esms calcd for c 20 h 28 no ( m + h ) 298 . 4 , found 298 . 4 . according to the method of example 1 , from alcohol 16 ( 479 mg , 1 . 61 mmol ), aldehyde 17 was obtained as a yellow oil and used without further purification ( 470 mg , 98 % yield ). [ 0178 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 78 - 0 . 82 ( m , 6h ), 1 . 13 - 1 . 20 ( m , 1h ), 1 . 80 - 1 . 85 ( m , 1h ), 2 . 02 - 2 . 10 ( m , 1h ), 2 . 71 ( dd , 1h , j = 7 . 8 , 3 . 5 hz ), 3 . 61 ( d , 2h , j = 11 . 8 hz ), 3 . 99 ( d , 2h , j = 11 . 8 hz ), 7 . 15 - 7 . 29 ( m , 10h ), 9 . 77 ( d , 1h , j = 2 . 0 hz ). according to the method of example 6 , from l - tyrosine ( 1 . 49 g , 8 . 22 mmol ), ester 18 was obtained as a colorless oil ( 2 . 10 g , 47 % yield ). [ 0182 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ3 . 06 ( dd , 1h , j = 14 . 0 , 8 . 1 hz ), 3 . 20 ( dd , 1h , j = 14 . 0 , 7 . 6 hz ), 3 . 65 ( d , 2h , j = 13 . 9 hz ), 3 . 79 ( t , 1h , j = 7 . 7 hz ), 4 . 04 ( d , 2h , j = 13 . 9 hz ), 5 . 15 ( s , 2h ), 5 . 22 ( d , 1h , j = 12 . 2 hz ), 5 . 33 ( d , 1h , j = 12 . 2 hz ), 6 . 94 ( d , 2h , j = 8 . 8 hz ), 7 . 03 ( d , 2h , j = 8 . 5 hz ), 7 . 26 - 7 . 57 ( m , 20h ); [ 0183 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ34 . 7 , 54 . 3 , 62 . 5 , 65 . 9 , 69 . 9 , 102 . 1 , 114 . 5 , 126 . 8 , 127 . 4 , 127 . 8 , 128 . 1 , 128 . 2 , 128 . 4 , 128 . 5 , 128 . 5 , 128 . 6 , 130 . 3 , 135 . 9 , 137 . 1 , 139 . 2 , 157 . 3 , 172 . 1 ; esms calcd for c 37 h 36 no 3 ( m + h ) 542 . 3 , found 542 . 3 . according to the method of example 7 , from ester 18 ( 1 . 90 g , 3 . 51 mmol ), alcohol 19 was obtained as a colorless oil ( 1 . 20 g , 78 % yield ). [ 0188 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ2 . 45 ( dd , 1h , j = 14 . 6 , 10 . 7 hz ), 3 . 05 - 3 . 15 ( m , 3h ), 3 . 44 ( br s , 1h ), 3 . 52 - 3 . 60 ( m , 1h ), 3 . 55 ( d , 2h , j = 13 . 3 hz ), 3 . 98 ( d , 2h , j = 13 . 3 hz ), 5 . 10 ( s , 2h ), 6 . 97 ( d , 2h , j = 8 . 6 hz ), 7 . 08 ( d , 2h , j = 8 . 4 hz ), 7 . 29 - 7 . 52 ( m , 15h ); [ 0189 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ30 . 8 , 53 . 1 , 60 . 3 , 60 . 8 , 69 . 9 , 114 . 9 , 127 . 2 , 127 . 3 , 127 . 8 , 128 . 4 , 128 . 5 , 128 . 9 , 129 . 8 , 131 . 3 , 137 . 0 , 139 . 1 , 157 . 2 ; esms calcd for c 30 h 32 no 2 ( m + h ) 438 . 2 , found 438 . 3 . according to the method of example 1 , from alcohol 19 ( 600 mg , 1 . 37 mmol ), aldehyde 20 was obtained as a yellow oil and used without further purification ( 597 mg , 100 % yield ). [ 0194 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ2 . 89 ( dd , 1h , j = 14 . 1 , 6 . 1 hz ), 3 . 09 ( dd , 1h , j = 14 . 1 , 7 . 2 hz ), 3 . 51 ( t , 1h , j = 6 . 8 hz ), 3 . 67 ( d , 2h , j = 13 . 8 hz ), 3 . 82 ( d , 2h , j = 13 . 8 hz ), 5 . 06 ( s , 2h ), 6 . 88 ( d , 2h , j = 8 . 7 hz ), 7 . 06 ( d , 2h , j = 8 . 6 hz ), 7 . 22 - 7 . 45 ( m , 15h ), 9 . 72 ( s , 1h ). according to the method of example 6 , from l - ornitine methyl ester ( 1 . 20 g , 5 . 48 mmol ), ester 21 was obtained as a colorless oil ( 2 . 18 g , 79 % yield ). [ 0198 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ1 . 50 - 1 . 60 ( m , 1h ), 1 . 75 - 1 . 90 ( m , 3h ), 2 . 41 ( t , 2h , j = 6 . 7 hz ), 3 . 36 ( t , 1h , j = 7 . 3 hz ), 3 . 55 ( d , 2h , j = 13 . 8 hz ), 3 . 63 ( d , 2h , j = 13 . 9 hz ), 3 . 65 ( d , 2h , j = 13 . 6 hz ), 3 . 84 ( s , 3h ), 4 . 02 ( d , 2h , j = 13 . 8 hz ), 7 . 29 - 7 . 45 ( m , 20h ); [ 0199 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ23 . 6 , 27 . 2 , 50 . 8 , 52 . 9 , 54 . 5 , 58 . 2 , 60 . 6 , 126 . 7 , 126 . 9 , 128 . 0 , 128 . 1 , 128 . 7 , 128 . 8 , 139 . 6 , 139 . 7 , 173 . 4 ; esms calcd for c 34 h 39 n 2 o 2 ( m + h ) 507 . 3 , found 507 . 3 . according to the method of example 7 , from ester 21 ( 1 . 75 g , 3 . 45 mmol ), alcohol 22 was obtained as a colorless oil ( 1 . 50 g , 91 % yield ). [ 0204 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ1 . 25 - 1 . 35 ( m , 1h ), 1 . 53 - 1 . 63 ( m , 2h ), 1 . 78 - 1 . 89 ( m , 1h ), 2 . 60 ( t , 2h , j = 6 . 8 hz ), 2 . 83 - 2 . 93 ( m , 1h ), 3 . 35 ( br s , 1h ), 3 . 53 ( d , 2h , j = 13 . 3 hz ), 3 . 54 - 3 . 64 ( m , 2h ), 3 . 70 ( d , 2h , j = 13 . 6 hz ), 3 . 76 ( d , 2h , j = 13 . 8 hz ), 3 . 93 ( d , 2h , j = 13 . 3 hz ), 7 . 36 - 7 . 59 ( m , 20h ); [ 0205 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ22 . 7 , 24 . 6 , 53 . 0 , 53 . 6 , 58 . 4 , 58 . 9 , 60 . 7 , 126 . 7 , 127 . 0 , 128 . 0 , 128 . 2 , 128 . 6 , 128 . 8 , 139 . 2 , 139 . 6 ; esms calcd for c 33 h 39 n 2 o ( m + h ) 479 . 3 , found 479 . 3 . according to the method of example 1 , from alcohol 22 ( 505 mg , 1 . 05 mmol ), aldehyde 23 was obtained as a yellow oil and used without further purification ( 503 mg , 100 % yield ). [ 0210 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ1 . 30 - 1 . 40 ( m , 1h ), 1 . 55 - 1 . 70 ( m , 2h ), 1 . 75 - 1 . 85 ( m , 1h ), 2 . 35 - 2 . 45 ( m , 2h ), 3 . 02 - 3 . 08 ( m , 1h ), 3 . 52 ( d , 2h , j = 13 . 6 hz ), 3 . 62 ( d , 2h , j = 13 . 6 hz ), 3 . 71 ( d , 2h , j = 13 . 8 hz ), 3 . 81 ( d , 2h , j = 13 . 8 hz ), 7 . 28 - 7 . 41 ( m , 20h ), 9 . 69 ( s , 1h ). according to the method of example 6 , from d - alanine methyl ester ( 536 mg , 3 . 84 mmol ), ester 24 was obtained as a colorless oil ( 625 mg , 57 % yield ). [ 0214 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ1 . 35 ( d , 3h , j = 7 . 1 hz ), 3 . 53 ( q , 1h , j = 7 . 0 hz ), 3 . 65 ( d , 2h , j = 13 . 8 hz ), 3 . 75 ( s , 3h ), 3 . 85 ( d , 2h , j = 13 . 8 hz ), 7 . 22 - 7 . 42 ( m , 10h ). according to the method of example 7 , from ester 24 ( 625 mg , 2 . 20 mmol ), alcohol 25 was obtained as a colorless oil ( 450 mg , 80 % yield ). [ 0218 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 98 ( d , 3h , j = 7 . 1 hz ), 2 . 95 - 3 . 05 ( m , 1h ), 3 . 13 ( br s , 1h ), 3 . 35 ( d , 2h , j = 13 . 8 hz ), 3 . 40 - 3 . 55 ( m , 2h ), 3 . 81 ( d , 2h , j = 13 . 8 hz ), 7 . 19 - 7 . 41 ( m , 10h ). according to the method of example 1 , from alcohol 25 ( 475 mg , 1 . 86 mmol ), aldehyde 26 was obtained as a yellow oil and used without farther purification ( 445 mg , 94 % yield ). [ 0222 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ1 . 18 ( t , 3h , j = 6 . 7 hz ), 3 . 33 ( q , 1h , j = 6 . 7 hz ), 3 . 57 ( d , 2h , j = 13 . 8 hz ), 3 . 74 ( d , 2h , j = 13 . 6 hz ), 7 . 23 - 7 . 42 ( m , 10h ), 9 . 73 ( s , 1h ). to a cold (− 15 ° c .) solution of n - cbz - l - alanine ( 1 . 0 g , 4 . 5 mmol ) in thf ( 15 ml ), et 3 n ( 360 mg , 4 . 5 mmol ) and i - buococl ( 610 mg , 4 . 5 mmol ) were added . after stirring at room temperature for 20 min , the solid et 3 n . hcl was filtered off and washed with thf . the filtrates were cooled to − 15 ° c . and a solution of nabh 4 ( 260 mg , 6 . 75 mmol ) in h 2 o ( 10 ml ) was added . after 1 h , the reaction was quenched with h 2 o ( 70 ml ) and the thf removed in vacuo . the residue was extracted with etoac ( 3 × 30 ml ), washed with brine ( 100 ml ), dried over mgso 4 and concentrated in vacuo to obtain alcohol 27 as a white solid ( 780 mg , 82 % yield ). [ 0225 ] 1 h nmr ( 500 mhz , cdcl 3 ) δ1 . 15 ( d , 3h , j = 6 . 8 hz ), 2 . 75 - 2 . 80 ( m , 2h ), 3 . 45 - 3 . 55 ( m , 1h ), 3 . 60 - 3 . 65 ( m , 1h ), 3 . 80 - 3 . 85 ( m , 1h ), 5 . 09 ( s , 2h ), 7 . 30 - 7 . 35 ( m , 5h ). according to the method of example 1 , from alcohol 27 ( 750 mg , 3 . 6 mmol ), aldehyde 28 was obtained as a yellow oil and used without further purification ( 680 mg , 92 % yield ). to a suspension of mg ( 155 mg , 6 . 38 mmol ) and a few crystals of i 2 in thf ( 3 . 1 ml ), an aliquot of 1 - bromoundecane ( 0 . 25 ml , 1 . 12 mmol ) was added and the mixture was stirred at 60 ° c . until the red color of the solution disappeared . then the remainder of 1 - bromoundecane ( 0 . 46 ml , 2 . 07 mmol ) was added and the reaction was stirred at room temperature for 1 h . the grignard solution formed thereof was cooled down to 0 ° c . and a solution of aldehyde 4 ( 323 . 5 mg , 1 . 28 mmol ) in thf ( 1 . 6 ml ) was added via cannula . after stirring overnight at room temperature , the reaction was quenched with hcl ( 3n , 10 ml ) extracted with etoac ( 3 × 10 ml ), washed successively with nahco 3 ( 20 ml , sat . aq .) and brine ( 20 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( 100 % hexane to 10 : 1 hexane / etoac ) to obtain a mixture of diastereoisomers . further purification by hplc on silica ( 95 : 5 to 80 : 20 hexane / mtbe ) afforded pure anti alcohol 29 as a colorless oil ( 205 mg , 39 % yield ). [ 0232 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 92 ( t , 3h , j = 6 . 9 hz ), 1 . 13 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 18h ), 1 . 65 - 1 . 80 ( m , 2h ), 1 . 87 ( br s , 1h ), 2 . 74 ( quint , 1h , j = 6 . 7 hz ), 3 . 49 ( d , 2h , j = 13 . 9 hz ), 3 . 57 - 3 . 65 ( m , 1h ), 3 . 79 ( d , 2h , j = 13 . 8 hz ), 7 . 22 - 7 . 38 ( m , 10h ); [ 0233 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 6 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 8 , 57 . 3 , 73 . 7 , 126 . 9 , 128 . 2 , 128 . 8 , 140 . 2 ; esms calcd for c 28 h 44 no ( m + h ) 410 . 3 , found 410 . 6 . to a solution of n , n - dibenzylamine 29 ( 182 mg , 0 . 44 mmol ) in meoh ( 4 . 5 ml ) at room temperature , pd ( oh ) 2 — c ( 20 % wt , 24 mg , 0 . 04 mmol ) was added . the mixture was purged with a stream of dry ar , and then h 2 . the reaction was stirred overnight under a h 2 atmosphere ( 1 atm ). the catalyst was filtered off through a 0 . 45 μm teflon filter in polypropylene housing , washing the filter with meoh ( 30 ml ) and the solvent was evaporated in vacuo . the crude was purified by column chromatography on silica ( 90 : 10 ch 2 cl 2 / meoh to 100 % meoh ) to obtain aminoalcohol 30 as a white solid ( 87 mg , 85 % yield ). [ 0237 ] 1 h nmr ( 300 mhz , cdcl 3 ) □ 0 . 87 ( t , 3h , j = 6 . 7 hz ), 1 . 03 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 18h ), 1 . 45 - 1 . 55 ( m , 2h ), 2 . 66 ( br s , 3h ), 2 . 95 - 3 . 05 ( m , 1h ), 3 . 45 - 3 . 55 ( m , 1h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 2 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 6 , 29 . 8 , 31 . 9 , 32 . 5 , 50 . 5 , 74 . 2 ; esms calcd for c 14 h 32 no ( m + h ) 230 . 2 , found 230 . 4 . according to the method of example 26 , from aldehyde 4 ( 273 mg , 1 . 08 mmol ) and 1 - bromododecane ( 671 mg , 2 . 69 mmol ), alcohol 31 was obtained as a colorless oil ( 195 mg , 43 % yield ). [ 0242 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 90 ( t , 3h , j = 6 . 9 hz ), 1 . 12 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 20h ), 1 . 65 - 1 . 75 ( m , 2h ), 1 . 82 ( br s , 1h ), 2 . 73 ( quint , 1h , j = 6 . 7 hz ), 3 . 48 ( d , 2h , j = 13 . 8 hz ), 3 . 57 - 3 . 65 ( m , 1h ), 3 . 78 ( d , 2h , j = 13 . 8 hz ), 7 . 21 - 7 . 37 ( m , 10h ); 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 6 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 8 , 57 . 3 , 73 . 7 , 126 . 9 , 128 . 2 , 128 . 8 , 140 . 2 ; esms calcd for c 29 h 46 no ( m + h ) 424 . 4 , found 424 . 7 . according to the method of example 27 , from n , n - dibenzylamine 31 ( 145 mg , 0 . 34 mmol ), aminoalcohol 32 was obtained as a white solid ( 65 mg , 78 % yield ). [ 0246 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 1 . 02 ( d , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 40 ( m , 20h ), 1 . 45 - 1 . 55 ( m , 2h ), 2 . 38 ( br s , 3h ), 2 . 93 - 3 . 03 ( m , 1h ), 3 . 42 - 3 . 52 ( m , 1h ); [ 0247 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 4 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 6 , 29 . 8 , 31 . 9 , 32 . 5 , 50 . 5 , 74 . 4 ; esms calcd for c 15 h 34 no ( m + h ) 244 . 3 , found 244 . 4 . according to the method of example 26 , from aldehyde 4 ( 332 mg , 1 . 31 mmol ) and 1 - bromotridecane ( 863 mg , 3 . 28 mmol ), alcohol 33 was obtained as a colorless oil ( 172 mg , 30 % yield ). [ 0252 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 90 ( t , 3h , j = 6 . 9 hz ), 1 . 12 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 22h ), 1 . 65 - 1 . 75 ( m , 2h ), 1 . 84 ( br s , 1h ), 2 . 73 ( quint , 1h , j = 6 . 5 hz ), 3 . 49 ( d , 2h , j = 13 . 8 hz ), 3 . 57 - 3 . 65 ( m , 1h ), 3 . 78 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 38 ( m , 10h ); [ 0253 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 8 , 57 . 3 , 73 . 6 , 126 . 8 , 128 . 2 , 128 . 7 , 140 . 2 ; esms calcd for c 30 h 48 no ( m + h ) 438 . 4 , found 438 . 7 . according to the method of example 27 , from n , n - dibenzylamine 33 ( 149 mg , 0 . 34 mmol ), aminoalcohol 34 was obtained as a white solid ( 62 mg , 71 % yield ). [ 0257 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 7 . 0 hz ), 1 . 05 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 22h ), 1 . 45 - 1 . 55 ( m , 2h ), 2 . 95 - 3 . 10 ( m , 4h ), 3 . 48 - 3 . 58 ( m , 1h ); [ 0258 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 15 . 9 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 6 , 29 . 7 , 29 . 7 , 31 . 9 , 32 . 6 , 50 . 6 , 73 . 9 ; esms calcd for c 16 h 36 no ( m + h ) 258 . 3 , found 258 . 5 . to a solution of amine 34 ( 26 mg , 0 . 10 mmol ) in dioxane ( 0 . 5 ml ), anhydrous hcl solution in dioxane ( 5 . 3m , 0 . 38 ml , 2 . 02 mmol ) was added . after stirring at room temperature for 5 h , the solvent was removed in vacuo . the resulting solid was washed with dioxane to obtain hydrochloride 35 as a white solid ( 19 mg , 64 % yield ). [ 0262 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 21 ( d , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 40 ( m , 22h ), 1 . 45 - 1 . 60 ( m , 2h ), 3 . 27 ( qd , 1h , j = 6 . 7 , 3 . 0 hz ), 3 . 65 - 3 . 73 ( m , 1h ); [ 0263 ] 13 c nmr ( 75 mhz , cd 3 od ) δ12 . 1 , 14 . 4 , 23 . 7 , 27 . 0 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 7 , 30 . 8 , 33 . 1 , 34 . 0 , 52 . 6 , 71 . 6 ; esms calcd for c 16 h 36 no ( m − cl ) 258 . 3 , found 258 . 4 . according to the method of example 26 , from aldehyde 4 ( 309 mg , 1 . 21 mmol ) and 1 - bromotetradecane ( 1 . 34 g , 4 . 84 mmol ), alcohol 36 was obtained as a colorless oil ( 270 mg , 49 % yield ). [ 0268 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 91 ( t , 3h , v 6 . 9 hz ), 1 . 12 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 24h ), 1 . 65 - 1 . 75 ( m , 2h ), 1 . 85 ( br s , 1h ), 2 . 73 ( quint , 1h , j = 7 6 . 4 hz ), 3 . 49 ( d , 2h , j = 13 . 9 hz ), 3 . 57 - 3 . 65 ( m , 1h ), 3 . 78 ( d , 2h , j = 13 . 8 hz ), 7 . 21 - 7 . 38 ( m , 10h ); [ 0269 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 4 , 54 . 8 , 57 . 3 , 73 . 6 , 126 . 9 , 128 . 2 , 128 . 8 , 140 . 2 ; esms calcd for c 31 h 50 no ( m + h ) 452 . 4 , found 452 . 5 . according to the method of example 27 , from n , n - dibenzylamine 36 ( 182 mg , 0 . 40 mmol ), aminoalcohol 37 was obtained as a white solid ( 81 mg , 74 % yield ). [ 0273 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 7 . 0 hz ), 1 . 02 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 24h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 85 ( br s , 3h ), 2 . 94 - 3 . 04 ( m , 1h ), 3 . 42 - 3 . 52 ( m , 1h ); [ 0274 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 3 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 7 , 31 . 9 , 32 . 5 , 50 . 4 , 74 . 2 ; esms calcd for c 17 h 38 no ( m + h ) 272 . 3 , found 272 . 3 . according to the method of example 32 , from aminoalcohol 37 ( 50 mg , 0 . 18 mmol ), hydrochloride 38 was obtained as a white solid ( 41 mg , 73 % yield ). [ 0278 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 6 . 8 hz ), 1 . 22 ( d , 3h , j = 6 . 8 hz ), 1 . 21 - 1 . 40 ( m , 24h ), 1 . 41 - 1 . 51 ( m , 2h ), 3 . 22 - 3 . 31 ( m , 1h ), 3 . 63 - 3 . 74 ( m , 1h ). to a solution of aminoalcohol 1 ( 63 mg , 0 . 221 mmol ) in meoh ( 1 . 1 ml ) at room temperature , l - tartaric acid ( 66 mg , 0 . 442 mmol ) was added . after stirring for 16 h , the solvent was evaporated in vacuo . the resulting solid was washed with h 2 o and dried under vacuum for 8 h to obtain tartrate 40 as a white solid ( 53 mg , 67 % yield ). [ 0281 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 21 ( d , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 40 ( m , 26h ), 1 . 40 - 1 . 55 ( m , 2h ), 3 . 26 ( qd , 1h , j = 6 . 7 , 3 . 0 hz ), 3 . 62 - 3 . 72 ( m , 1h ), 4 . 43 ( d , 2h , j = 1 . 8 hz ); [ 0282 ] 13 c nmr ( 75 mhz , cd 3 od ) δ12 . 0 , 14 . 4 , 23 . 7 , 27 . 0 , 30 . 5 , 30 . 8 , 33 . 1 , 34 . 0 , 52 . 6 , 71 . 7 , 73 . 9 ; esms calc for c 18 h 40 no ( m = chohco 2 ) 286 . 3 , found 286 . 2 . according to the method of example 32 , from aminoalcohol 1 ( 52 . 5 mg , 0 . 184 mmol ), hydrochloride 41 was obtained as a white solid ( 52 mg , 88 % yield ). [ 0286 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 21 ( d , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 40 ( m , 26h ), 1 . 40 - 1 . 55 ( m , 2h ), 3 . 26 ( qd , 1h , j = 6 . 7 , 3 . 0 hz ), 3 . 62 - 3 . 72 ( m , 1h ); [ 0287 ] 13 c nmr ( 75 mhz , cd 3 od ) δ12 . 1 , 14 . 5 , 23 . 7 , 27 . 0 , 30 . 5 , 30 . 7 , 30 . 7 , 30 . 8 , 33 . 1 , 34 . 0 , 52 . 6 , 71 . 6 ; esms calcd for c 18 h 40 no ( m − cl ) 286 . 3 , found 286 . 2 . according to the method of example 26 , from aldehyde 4 ( 294 mg , 1 . 16 mmol ) and 1 - bromohexadecane ( 1 . 42 g , 4 . 64 mmol ), alcohol 42 was obtained as a colorless oil ( 283 mg , 51 % yield ). [ 0292 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 93 ( t , 3h , j = 6 . 9 hz ), 1 . 14 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 28h ), 1 . 65 - 1 . 80 ( m , 2h ), 1 . 95 ( br s , 1h ), 2 . 75 ( quint , 1h , j = 6 . 5 hz ), 3 . 50 ( d , 2h , j = 13 . 8 hz ), 3 . 57 - 3 . 65 ( m , 1h ), 3 . 80 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 40 ( m , 10h ); [ 0293 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 7 , 57 . 2 , 73 . 6 , 126 . 8 , 128 . 2 , 128 . 7 , 140 . 1 ; esms calcd for c 33 h 54 no ( m + h ) 480 . 4 , found 480 . 5 . according to the method of example 27 , from n , n - dibenzylamine 42 ( 204 mg , 0 . 43 mmol ), aminoalcohol 2 was obtained as a white solid ( 91 mg , 72 % yield ). [ 0297 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 6 . 9 hz ), 1 . 01 ( d , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 40 ( m , 28h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 77 ( br s , 3h ), 2 . 92 - 3 . 02 ( m , 1h ), 3 . 39 - 3 . 49 ( m , 1h ); [ 0298 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 7 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 6 , 29 . 7 , 29 . 8 , 31 . 9 , 32 . 4 , 50 . 3 , 74 . 6 ; esms calcd for c 19 h 42 no ( m + h ) 300 . 3 , found 300 . 3 . according to the method of example 32 , from aminoalcohol 2 ( 530 mg , 1 . 70 mmol ), hydrochloride 43 was obtained as a white solid ( 454 mg , 76 % yield ). [ 0302 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 86 ( t , 3h , j = 6 . 8 hz ), 1 . 35 ( d , 3h , j = 6 . 8 hz ), 1 . 20 - 1 . 41 ( m , 28h ), 1 . 41 - 1 . 51 ( m , 2h ), 3 . 24 - 3 . 37 ( m , 1h ), 3 . 65 - 3 . 73 ( m , 1h ). according to the method of example 26 , from aldehyde 4 ( 410 mg , 1 . 62 mmol ) and 1 - bromoheptadecane ( 2 . 07 g , 6 . 47 mmol ), alcohol 44 was obtained as a colorless oil ( 427 mg , 53 % yield ). [ 0306 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 93 ( t , 3h , j = 6 . 9 hz ), 1 . 14 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 30h ), 1 . 65 - 1 . 80 ( m , 2h ), 1 . 94 ( br s , 1h ), 2 . 75 ( quint , 1h , j = 6 . 7 hz ), 3 . 51 ( d , 2h , j = 13 . 8 hz ), 3 . 56 - 3 . 64 ( m , 1h ), 3 . 80 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 40 ( m , 10h ); [ 0307 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 6 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 8 , 57 . 3 , 73 . 6 , 126 . 8 , 128 . 2 , 128 . 7 , 140 . 2 ; esms calcd for c 34 h 56 no ( m + h ) 494 . 4 , found 494 . 5 . according to the method of example 27 , from n , n - dibenzylamine 44 ( 294 mg , 0 . 60 mmol ), aminoalcohol 3 was obtained as a white solid ( 140 mg , 75 % yield ). [ 0311 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 6 . 7 hz ), 1 . 00 ( d , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 40 ( m , 30h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 70 ( br s , 3h ), 2 . 92 - 3 . 02 ( m , 1h ), 3 . 39 - 3 . 49 ( m , 1h ); [ 0312 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 8 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 7 , 29 . 8 , 31 . 9 , 32 . 5 , 50 . 4 , 74 . 7 ; esms calcd for c 20 h 44 no ( m + h ) 314 . 3 , found 314 . 3 . according to the method of example 32 , from aminoalcohol 3 ( 12 mg , 0 . 04 mmol ), hydrochloride 45 was obtained as a white solid ( 11 mg , 82 % yield ). 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 5 hz ), 1 . 21 ( d , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 40 ( m , 30h ), 1 . 45 - 1 . 60 ( m , 2h ), 3 . 26 ( qd , 1h , j = 6 . 9 , 3 . 0 hz ), 3 . 63 - 3 . 73 ( m , 1h ); [ 0316 ] 13 c nmr ( 75 mhz , cd 3 od ) δ12 . 1 , 14 . 4 , 23 . 7 , 27 . 8 , 30 . 5 , 30 . 6 , 30 . 8 , 33 . 1 , 34 . 0 , 52 . 6 , 71 . 7 ; esms calcd for c 20 h 44 no ( m − cl ) 314 . 3 , found 314 . 5 . according to the method of example 26 , from aldehyde 4 ( 350 mg , 1 . 38 mmol ) and 1 - bromooctadecane ( 1 . 15 g , 3 . 45 mmol ), alcohol 46 was obtained as a colorless oil ( 395 mg , 56 % yield ). [ 0321 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 91 ( t , 3h , j = 6 . 9 hz ), 1 . 14 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 32h ), 1 . 65 - 1 . 75 ( m , 2h ), 1 . 80 ( br s , 1h ), 2 . 75 ( quint , 1h , j = 6 . 7 hz ), 3 . 51 ( d , 2h , j = 13 . 9 hz ), 3 . 56 - 3 . 64 ( m , 1h ), 3 . 80 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 40 ( m , 10h ); [ 0322 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 8 , 57 . 2 , 73 . 6 , 126 . 8 , 128 . 2 , 128 . 7 , 140 . 1 ; esms calcd for c 35 h 58 no ( m + h ) 508 . 4 , found 508 . 4 . according to the method of example 27 , from n , n - dibenzylamine 46 ( 228 mg , 0 . 45 mmol ), aminoalcohol 47 was obtained as a white solid ( 125 mg , 85 % yield ). [ 0326 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j7 6 . 9 hz ), 1 . 00 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 32h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 86 ( br s , 3h ), 2 . 92 - 3 . 02 ( m , 1h ), 3 . 39 - 3 . 49 ( m , 1h ); [ 0327 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 8 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 7 , 29 . 8 , 31 . 9 , 32 . 5 , 50 . 4 , 74 . 7 ; esms calcd for c 21 h 46 no ( m + h ) 328 . 3 , found 328 . 3 . according to the method of example 32 , from aminoalcohol 47 ( 32 . 5 mg , 0 . 10 mmol ), hydrochloride 48 was obtained as a white solid ( 32 mg , 89 % yield ). [ 0331 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 6 hz ), 1 . 21 ( d , 3h , j = 6 . 9 hz ), 1 . 25 - 1 . 40 ( m , 32h ), 1 . 45 - 1 . 60 ( m , 2h ), 3 . 27 ( qd , 1h , j = 6 . 9 , 3 . 0 hz ), 3 . 65 - 3 . 73 ( m , 1h ); [ 0332 ] 13 c nmr ( 75 mhz , cd 3 od ) δ12 . 1 , 14 . 5 , 23 . 8 , 27 . 0 , 30 . 5 , 30 . 7 , 30 . 7 , 30 . 8 , 33 . 1 , 34 . 0 , 52 . 6 , 71 . 6 ; esms calcd for c 21 h 46 no ( m − cl ) 328 . 3 , found 328 . 5 . according to the method of example 26 , from aldehyde 4 ( 380 mg , 1 . 50 mmol ) and 1 - bromononadecane ( 1 . 30 g , 3 . 75 mmol ), alcohol 49 was obtained as a colorless oil ( 349 mg , 45 % yield ). [ 0337 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 91 ( t , 3h , j = 6 . 9 hz ), 1 . 14 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 34h ), 1 . 65 - 1 . 75 ( m , 2h ), 1 . 81 ( br s , 1h ), 2 . 75 ( quint , 1h , j = 6 . 7 hz ), 3 . 51 ( d , 2h , j = 13 . 9 hz ), 3 . 56 - 3 . 64 ( m , 1h ), 3 . 80 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 40 ( m , 10h ); [ 0338 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 8 , 57 . 2 , 73 . 6 , 126 . 8 , 128 . 2 , 128 . 7 , 140 . 1 ; esms calcd for c 36 h 60 no ( m + h ) 522 . 5 , found 522 . 4 . according to the method of example 27 , from n , n - dibenzylamine 49 ( 206 mg , 0 . 39 mmol ), aminoalcohol 50 was obtained as a white solid ( 100 mg , 74 % yield ). [ 0342 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 1 . 00 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 34h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 65 ( br s , 3h ), 2 . 92 - 3 . 02 ( m , 1h ), 3 . 39 - 3 . 49 ( m , 1h ); [ 0343 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 8 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 7 , 29 . 8 , 31 . 9 , 32 . 5 , 50 . 4 , 74 . 7 ; esms calcd for c 22 h 48 no ( m + h ) 342 . 4 , found 342 . 4 . according to the method of example 26 , from aldehyde 4 ( 365 mg , 1 . 44 mmol ) and 1 - bromoeicosadecane ( 1 . 30 g , 3 . 60 mmol ), alcohol 51 was obtained as a colorless oil ( 317 mg , 41 % yield ). [ 0348 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 91 ( t , 3h , j = 6 . 9 hz ), 1 . 14 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 36h ), 1 . 65 - 1 . 75 ( m , 2h ), 1 . 81 ( br s , 1h ), 2 . 75 ( quint , 1h , j = 6 . 7 hz ), 3 . 51 ( d , 2h , j = 13 . 9 hz ), 3 . 56 - 3 . 64 ( m , 1h ), 3 . 80 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 40 ( m , 10h ); [ 0349 ] 14 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 6 , 25 . 8 , 9 . 3 , 29 . 7 , 31 . 9 , 34 . 3 , 54 . 7 , 57 . 2 , 73 . 6 , 126 . 8 , 128 . 2 , 128 . 7 , 140 . 1 ; esms calcd for c 37 h 62 no ( m + h ) 536 . 5 , found 536 . 5 . according to the method of example 27 , from n , n - dibenzylamine 51 ( 191 mg , 0 . 36 mmol ), aminoalcohol 52 was obtained as a white solid ( 103 mg , 81 % yield ). [ 0353 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 1 . 00 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 36h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 65 ( br s , 3h ), 2 . 92 - 3 . 02 ( m , 1h ), 3 . 39 - 3 . 49 ( m , 1h ); [ 0354 ] 13 c nmr ( 75 mhz , cdcl 1 ) δ14 . 1 , 16 . 8 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 7 , 29 . 8 , 31 . 9 , 32 . 5 , 50 . 4 , 74 . 7 ; esms calcd for c 23 h 50 no ( m + h ) 356 . 4 , found 356 . 4 . according to the method of example 26 , from aldehyde 6 ( 660 mg , 2 . 47 mmol ) and 1 - bromotetradecane ( 1 . 71 g , 6 . 17 mmol ), alcohol 53 was obtained as a colorless oil ( 535 mg , 47 % yield ). [ 0359 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 92 ( t , 3h , j = 6 . 6 hz ), 1 . 02 ( t , 3h , j = 7 . 4 hz ), 1 . 20 - 1 . 40 ( m , 24h ), 1 . 45 - 1 . 60 ( m , 3h ), 1 . 70 - 1 . 85 ( m , 1h ), 2 . 27 ( br s , 1h ), 2 . 62 ( td , 1h , j = 7 . 0 , 4 . 2 hz ), 3 . 60 - 3 . 75 ( m , 5h ), 7 . 22 - 7 . 38 ( m , 10h ); [ 0360 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ12 . 3 , 14 . 1 , 18 . 1 , 22 . 7 , 26 . 6 , 29 . 4 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 4 , 55 . 2 , 62 . 8 , 70 . 6 , 126 . 9 , 128 . 2 , 128 . 9 , 140 . 1 ; esms calcd for c 32 h 52 no ( m + h ) 466 . 4 , found 466 . 4 . according to the method of example 27 , from n , n - dibenzylamine 53 ( 166 mg , 0 . 36 mmol ), aminoalcohol 54 was obtained as a white solid ( 100 mg , 98 % yield ). [ 0364 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 89 ( t , 3h , j = 6 . 6 hz ), 1 . 00 ( t , 3h , j = 7 . 5 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 45 - 1 . 60 ( m , 2h ), 2 . 05 ( br s , 3h ), 2 . 64 - 2 . 70 ( m , 1h ), 3 . 42 - 3 . 50 ( m , 1h ); [ 0365 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ11 . 0 , 14 . 1 , 22 . 7 , 24 . 8 , 26 . 2 , 29 . 3 , 29 . 6 , 29 . 7 , 29 . 8 , 31 . 5 , 31 . 9 , 57 . 1 , 74 . 0 ; esms calcd for c 18 h 40 no ( m + h ) 286 . 3 , found 286 . 2 . according to the method of example 32 , from aminoalcohol 54 ( 52 mg , 0 . 18 mmol ), hydrochloride 55 was obtained as a white solid ( 38 mg , 65 % yield ). [ 0369 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 04 ( t , 3h , j = 7 . 4 hz ), 1 . 25 - 1 . 50 ( m , 26h ), 1 . 55 - 1 . 80 ( m , 2h ), 3 . 04 - 3 . 12 ( m , 1h ), 3 . 70 - 3 . 80 ( m , 1h ); [ 0370 ] 13 c nmr ( 75 mhz , cd 3 od ) δ10 . 6 , 14 . 5 , 21 . 4 , 23 . 8 , 27 . 1 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 8 , 33 . 0 , 33 . 1 , 59 . 0 , 71 . 4 ; esms calcd for c 18 h 40 no ( m − cl ) 286 . 3 , found 286 . 2 . according to the method of example 26 , from aldehyde 6 ( 1 . 0 g , 3 . 7 mmol ) and 1 - bromopentadecane ( 6 . 55 g , 22 . 5 mmol ), alcohol 56 was obtained as a colorless oil ( 800 mg , 45 % yield ). [ 0374 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 6 . 8 hz ), 0 . 99 ( t , 3h , j = 7 . 4 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 40 - 1 . 55 ( m , 3h ), 1 . 70 - 1 . 80 ( m , 1h ), 2 . 56 - 2 . 62 ( m , 1h ), 3 . 60 - 3 . 75 ( m , 5h ), 7 . 26 - 7 . 46 ( m , 10h ). according to the method of example 27 , from n , n - dibenzylamine 56 ( 400 mg , 0 . 83 mmol ), aminoalcohol 57 was obtained as a white solid ( 220 mg , 88 % yield ). [ 0377 ] 1 h nmr ( 500 , mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 7 . 1 hz ), 0 . 91 ( t , 3h , j = 7 . 5 hz ), 1 . 15 - 1 . 25 ( m , 26h ), 1 . 30 - 1 . 40 ( m , 2h ), 1 . 40 - 1 . 50 ( m , 1h ), 1 . 55 - 1 . 65 ( m , 1h ), 2 . 70 - 2 . 75 ( m , 1h ), 3 . 45 - 3 . 50 ( m , 1h ); [ 0378 ] 13 c nmr ( 125 mhz , cd 3 od ) δ11 . 8 , 15 . 4 , 24 . 5 , 24 . 7 , 28 . 1 , 31 . 4 , 31 . 7 , 33 . 9 , 34 . 0 , 59 . 8 , 74 . 3 ; esms calcd for c 19 h 42 no ( m + h ) 300 . 3 , found 300 . 4 . according to the method of example 32 , from aminoalcohol 57 ( 20 mg , 0 . 07 mmol ), hydrochloride 58 was obtained as a white solid ( 6 mg , 27 % yield ). [ 0382 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 6 hz ), 1 . 04 ( t , 3h , j = 7 . 6 hz ), 1 . 25 - 1 . 50 ( m , 28h ), 1 . 55 - 1 . 80 ( m , 2h ), 3 . 04 - 3 . 12 ( m , 1h ), 3 . 70 - 3 . 80 ( m , 1h ); [ 0383 ] 13 c nmr ( 75 mhz , cd 3 od ) δ10 . 6 , 14 . 4 , 21 . 4 , 23 . 8 , 27 . 1 , 30 . 5 , 30 . 6 , 30 . 8 , 33 . 0 , 33 . 1 , 59 . 0 , 71 . 4 ; esms calcd for c 19 h 42 no ( m − cl ) 300 . 3 , found 300 . 5 . according to the method of example 26 , from aldehyde 6 ( 600 mg , 2 . 24 mmol ) and 1 - bromohexadecane ( 1 . 37 ml , 4 . 49 mmol ), alcohol 59 . was obtained as a colorless oil ( 775 mg , 70 % yield ). [ 0388 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 7 . 1 hz ), 0 . 95 ( t , 3h , j = 7 . 1 hz ), 1 . 20 - 1 . 40 ( m , 28h ), 1 . 45 - 1 . 60 ( m , 3h ), 1 . 70 - 1 . 85 ( m , 1h ), 2 . 22 ( br s , 1h ), 2 . 62 - 2 . 68 ( m , 1h ), 3 . 62 - 3 . 73 ( m , 5h ), 7 . 24 - 7 . 34 ( m , 10h ); [ 0389 ] 13 c nmr ( 75 mhz , cdcl3 ) δ12 . 3 , 14 . 1 , 18 . 1 , 22 . 6 , 26 . 6 , 29 . 3 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 4 , 55 . 1 , 62 . 7 , 70 . 5 , 126 . 9 , 128 . 2 , 128 . 9 , 140 . 1 ; esms calcd for c 34 h 56 no ( m + h ) 494 . 4 , found 494 . 5 . according to the method of example 27 , from n , n - dibenzylamine 59 ( 200 mg , 0 . 40 mmol ), aminoalcohol 60 was obtained as a white solid ( 104 mg , 83 % yield ). [ 0393 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 0 . 89 ( t , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 30h ), 1 . 45 - 1 . 53 ( m , 2h ), 2 . 55 - 3 . 20 ( m , 4h ), 3 . 50 - 3 . 61 ( m , 1h ); esms calcd for c 20 h 44 no ( m + h ) 314 . 3 , found 314 . 4 . according to the method of example 32 , from aminoalcohol 60 ( 30 . 0 mg , 0 . 17 mmol ), hydrochloride 61 was obtained as a white solid ( 20 . 4 mg , 61 % yield ). [ 0397 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 7 . 4 hz ), 1 . 04 ( t , 3h , j = 7 . 4 hz ), 1 . 25 - 1 . 50 ( m , 30h ), 1 . 55 - 1 . 80 ( m , 2h ), 3 . 04 - 3 . 12 ( m , 1h ), 3 . 70 - 3 . 80 ( m , 1h ); [ 0398 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ10 . 5 , 14 . 4 , 21 . 3 , 23 . 7 , 27 . 1 , 30 . 4 , 30 . 6 , 30 . 7 , 30 . 8 , 32 . 9 , 33 . 0 , 59 . 0 , 71 . 4 ; esms calcd for c 20 h 44 no ( m − cl ) 314 . 3 , found 314 . 5 . according to the method of example 26 , from aldehyde 6 ( 610 mg , 2 . 28 mmol ) and 1 - bromoheptadecane ( 1 . 82 g , 5 . 70 mmol ), alcohol 62 was obtained as a colorless oil ( 620 mg , 54 % yield ). [ 0403 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 86 ( t , 3h , j = 6 . 9 hz ), 0 . 94 ( t , 3h , j = 7 . 3 hz ), 1 . 20 - 1 . 40 ( m , 30h ), 1 . 45 - 1 . 55 ( m , 3h ), 1 . 70 - 1 . 85 ( m , 1h ), 2 . 24 ( br s , 1h ), 2 . 73 ( td , 1h , j = 7 . 0 , 4 . 2 hz ), 3 . 60 - 3 . 75 ( m , 5h ), 7 . 22 - 7 . 36 ( m , 10h ); [ 0404 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ12 . 3 , 14 . 1 , 18 . 1 , 22 . 7 , 26 . 7 , 29 . 4 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 4 , 55 . 2 , 62 . 8 , 70 . 6 , 126 . 9 , 128 . 3 , 128 . 9 , 140 . 1 ; esms calcd for c 35 h 58 no ( m + h ) 508 . 4 , found 508 . 5 . according to the method of example 27 , from n , n - dibenzylamine 62 ( 295 mg , 0 . 58 mmol ), aminoalcohol 63 was obtained as a white solid ( 184 mg , 97 % yield ). [ 0408 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 7 . 0 hz ), 0 . 94 ( t , 3h , j = 7 . 4 hz ), 1 . 20 - 1 . 40 ( m , 32h ), 1 . 45 - 1 . 60 ( m , 2h ), 1 . 79 ( br s , 3h ), 2 . 62 - 2 . 70 ( m , 1h ), 3 . 42 - 3 . 50 ( m , 1h ); [ 0409 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ11 . 0 , 14 . 1 , 22 . 7 , 25 . 0 , 26 . 2 , 29 . 3 , 29 . 7 , 29 . 8 , 31 . 4 , 31 . 9 , 57 . 1 , 74 . 1 ; esms calcd for c 21 h 46 no ( m + h ) 328 . 3 , found 328 . 4 . according to the method of example 32 , from aminoalcohol 63 ( 74 mg , 0 . 23 mmol ), hydrochloride 64 was obtained as a white solid ( 51 mg , 62 % yield ). [ 0413 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , * 6 . 9 hz ), 1 . 04 ( t , 3h , j = 7 . 4 hz ), 1 . 25 - 1 . 50 ( m , 32h ), 1 . 55 - 1 . 80 ( m , 2h ), 3 . 04 - 3 . 12 ( m , 1h ), 3 . 70 - 3 . 80 ( m , 1h ); [ 0414 ] 13 c nmr ( 75 mhz , cd 3 od ) δ10 . 6 , 14 . 5 , 21 . 4 , 23 . 7 , 27 . 1 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 8 , 33 . 0 , 33 . 1 , 59 . 0 , 71 . 4 ; esms calcd for c 21 h 46 no ( m − cl ) 328 . 3 , found 328 . 4 . according to the method of example 26 , from aldehyde 11 ( 123 mg , 0 . 44 mmol ) and 1 - bromopentadecane ( 318 mg , 1 . 09 mmol ), alcohol 65 was obtained as a colorless oil ( 161 mg , 75 % yield ). [ 0419 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 89 ( t , 3h , j = 6 . 9 hz ), 0 . 91 ( t , 3h , j = 7 . 0 hz ), 1 . 20 - 1 . 40 ( m , 28h ), 1 . 40 - 1 . 55 ( m , 3h ), 1 . 70 - 1 . 80 ( m , 1h ), 2 . 22 ( br s , 1h ), 2 . 65 - 2 . 72 ( m , 1h ), 3 . 60 - 3 . 75 ( m , 5h ), 7 . 21 - 7 . 35 ( m , 10h ); [ 0420 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 14 . 4 , 20 . 6 , 22 . 7 , 26 . 7 , 27 . 5 , 29 . 4 , 29 . 6 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 4 , 55 . 2 , 60 . 7 , 70 . 7 , 127 . 0 , 128 . 3 , 128 . 9 , 140 . 1 ; esms calcd for c 34 h 56 no ( m + h ) 494 . 4 , found 494 . 4 . according to the method of example 27 , from n , n - dibenzylamine 65 ( 37 mg , 0 . 075 mmol ), aminoalcohol 66 was obtained as a white solid ( 17 mg , 72 % yield ). [ 0424 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 7 hz ), 0 . 93 ( t , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 30h ), 1 . 45 - 1 . 55 ( m , 2h ), 2 . 75 - 2 . 80 ( m . 1h ), 3 . 40 - 3 . 45 ( m , 1h ); [ 0425 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 19 . 7 , 22 . 7 , 26 . 2 , 29 . 4 , 29 . 7 , 31 . 4 , 31 . 9 , 34 . 4 , 55 . 0 , 74 . 4 ; esms calcd for c 20 h 44 no ( m + h ) 314 . 3 , found 314 . 3 . according to the method of example 32 , from aminoalcohol 66 ( 9 mg , 0 . 03 mmol ), hydrochloride 67 was obtained as a white solid ( 3 mg , 30 % yield ). [ 0429 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 9 hz ), 0 . 99 ( t , 3h , j = 7 . 0 hz ), 1 . 20 - 1 . 40 ( m , 28h ), 1 . 40 - 1 . 65 ( m , 4h ), 3 . 08 - 3 . 18 ( m , 1h ), 3 . 65 - 3 . 75 ( m , 1h ); esms calcd for c 20 h 44 no ( m − cl ) 314 . 3 , found 314 . 5 . according to the method of example 26 , from aldehyde 14 ( 447 mg , 1 . 59 mmol ) and 1 - bromopentadecane ( 1 . 16 g , 4 . 0 mmol ), alcohol 68 was obtained as a colorless oil ( 340 mg , 43 % yield ). [ 0434 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 93 ( t , 3h , j = 7 . 0 hz ), 0 . 96 ( d , 3h , j = 6 . 5 hz ), 1 . 25 - 1 . 40 ( m , 29h ), 1 . 55 - 1 . 70 ( m , 2h ), 2 . 19 - 2 . 27 ( m , 1h ), 2 . 56 ( dd , 1h , j = 9 . 7 , 4 . 7 hz ), 2 . 84 ( br d , 1h ,. j = 7 . 9 hz ), 3 . 55 - 3 . 65 ( m , 1h ), 3 . 79 ( d , 2h , j = 13 . 4 hz ), 3 . 9 . 0 ( d , 2h , j = 13 . 4 hz ), 7 . 25 - 7 . 38 ( m , 10h ); [ 0435 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 20 . 8 , 22 . 7 , 23 . 2 , 27 . 1 , 28 . 2 , 29 . 3 , 29 . 6 , 29 . 6 , 31 . 9 , 33 . 2 , 56 . 3 , 67 . 2 , 70 . 3 , 127 . 2 , 128 . 4 , 129 . 1 , 139 . 9 ; esms calcd for c 34 h 56 no ( m + h ) 494 . 4 , found 494 . 4 . according to the method of example 27 , from n , n - dibenzylamine 68 ( 171 mg , 0 . 35 mmol ), aminoalcohol 69 was obtained as a white solid ( 90 mg , 83 % yield ). [ 0439 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 85 ( t , 3h , j = 7 . 0 hz ), 0 . 88 ( d , 3h , j = 6 . 7 hz ), 0 . 95 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 50 - 1 . 65 ( m , 3h ), 2 . 02 ( br s , 3h ), 2 . 41 ( dd , 1h , j = 7 . 9 , 4 . 7 hz ), 3 . 54 - 3 . 62 ( m , 1h ); [ 0440 ] 13 c nmr -( 75 mhz , cdcl 3 ) δ14 . 1 , 19 . 2 , 19 . 8 , 22 . 6 , 26 . 1 , 29 . 3 , 29 . 6 , 29 . 7 , 29 . 7 , 30 . 4 , 30 . 8 , 31 . 9 , 61 . 7 , 71 . 5 ; esms calcd for c 20 h 44 no ( m + h ) 314 . 3 , found 314 . 3 . according to the method of example 32 , from aminoalcohol 69 ( 68 . 5 mg , 0 . 22 mmol ), hydrochloride 70 was obtained as a white solid ( 55 . 5 mg , 73 % yield ). [ 0444 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 01 ( d , 3h , j = 6 . 7 hz ), 1 . 05 ( d , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 40 ( m , 26h ), 1 . 55 - 1 . 70 ( m , 2h ), 1 . 88 - 1 . 96 ( m , 1h ), 2 . 84 ( dd , 1h , j = 8 . 6 , 4 . 1 hz ), 3 . 80 - 3 . 85 ( m , 1h ); [ 0445 ] 13 c nmr ( 75 mhz , cdod 3 ) δ14 . 5 , 19 . 5 , 19 . 9 , 23 . 7 , 27 . 0 , 28 . 7 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 8 , 31 . 1 , 33 . 1 , 63 . 8 , 69 . 5 ; esms calcd for c 20 h 44 no ( m − cl ) 314 . 3 , found 314 . 4 . according to the method of example 26 , from aldehyde 17 ( 470 mg , 1 . 59 mmol ) and 1 - bromopentadecane ( 0 . 63 ml , 3 . 18 mmol ), alcohol 71 was obtained as a colorless oil ( 499 mg , 60 % yield ). [ 0450 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 85 - 0 . 90 ( m , 6h ), 0 . 98 ( d , 3h , j = 7 . 4 hz ), 1 . 25 - 1 . 40 ( m , 27h ), 1 . 55 - 1 . 60 ( m , 2h ), 1 . 86 - 1 . 97 ( mi , 2h ), 2 . 54 - 2 . 60 ( m , 2h ), 3 . 58 - 3 . 68 ( m , 1h ), 3 . 70 ( d , 2h , j = 13 . 7 hz ), 3 . 85 ( d , 2h , j = 13 . 7 hz ), 7 . 25 - 7 . 38 ( m , 10h ); [ 0451 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ11 . 3 , 14 . 1 , 16 . 1 , 22 . 6 , 26 . 8 , 28 . 1 , 29 . 3 , 29 . 5 , 29 . 6 , 31 . 8 , 33 . 4 , 34 . 2 , 56 . 1 , 65 . 5 , 70 . 3 , 127 . 1 , 128 . 3 , 129 . 1 , 138 . 9 ; esms calcd for c 35 h 58 no ( m + h ) 508 . 4 , found 508 . 8 . according to the method of example 27 , from n , n - dibenzylamine 71 ( 70 mg , 0 . 13 mmol ), aminoalcohol 72 was obtained as a white solid ( 40 mg , 89 % yield ). [ 0455 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 91 - 1 . 10 ( m , 6h ), 1 . 15 - 1 . 46 ( m , 31h ), 2 . 45 - 2 . 51 ( m , 2h ), 1 . 65 - 1 . 69 ( m , 1h ), 2 . 68 - 2 . 72 ( m , 1h ), 3 . 62 - 3 . 69 ( m , 1h ), 4 . 25 - 4 . 60 ( m , 2h ); esms calcd for c 21 h 46 no ( m + h ) 328 . 3 , found 328 . 4 . according to the method of example 32 , from aminoalcohol 72 ( 40 mg , 0 . 11 mmol ), hydrochloride 73 was obtained as a white solid ( 32 mg , 78 % yield ). [ 0459 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 0 . 95 ( t , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 31h ), 1 . 45 - 1 . 60 ( m , 2h ), 1 . 75 - 1 . 85 ( m , 1h ), 3 . 18 - 3 . 23 ( m , 1h ), 3 . 90 - 3 . 95 ( m , 1h ), 7 . 90 - 8 . 05 ( br s , 3h ); [ 0460 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ10 . 5 , 14 . 1 , 15 . 6 , 22 . 6 , 25 . 3 , 26 . 1 , 29 . 3 , 29 . 6 , 29 . 7 , 31 . 9 , 33 . 7 , 61 . 6 , 70 . 1 ; esms calcd for c 21 h 46 no ( m − cl ) 328 . 3 , found 328 . 4 . according to the method of example 26 , from aldehyde 20 ( 597 mg , 1 . 37 mmol ) and 1 - bromopentadecane ( 999 mg , 3 . 43 mmol ), alcohol 74 was obtained as a colorless oil ( 496 mg , 56 % yield ). [ 0465 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 40 ( m , 26h ), 1 . 55 - 1 . 70 ( m , 2h ), 1 . 96 ( br s , 1h ), 2 . 43 ( dd , 1h , j = 12 . 4 , 5 . 2 hz ), 2 . 95 - 3 . 07 ( m , 2h ), 3 . 65 ( d , 2h , j = 13 . 8 hz ), 3 . 65 - 3 . 75 ( m , 1h ), 3 . 78 ( d , 2h , j = 13 . 8 hz ), 5 . 09 ( s , 2h ), 6 . 92 ( d , 2h , j = 8 . 6 hz ), 7 . 07 ( d , 2h , j = 8 . 6 hz ), 7 . 20 - 7 . 49 ( m , 15h ); [ 0466 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 22 . 7 , 26 . 4 , 29 . 4 , 29 . 5 , 29 . 6 , 29 . 7 , 31 . 0 , 31 . 9 , 34 . 6 , 55 . 1 , 63 . 2 , 70 . 1 , 71 . 6 , 114 . 8 , 126 . 9 , 127 . 4 , 127 . 9 , 128 . 2 , 128 . 6 , 128 . 8 , 130 . 2 , 132 . 8 , 137 . 2 , 139 . 8 , 157 . 1 ; esms calcd for c 45 h 62 no 2 ( m + h ) 648 . 5 , found 648 . 5 . according to the method of example 27 , from n , n - dibenzylamine 74 ( 140 mg , 0 . 22 mmol ), aminoalcohol 75 was obtained as a white solid ( 80 mg , 98 % yield ). [ 0470 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( d , 3h , j = 6 . 6 hz ), 1 . 25 - 1 . 40 ( m , 26h ), 1 . 50 - 1 . 65 ( m , 21 ), 2 . 35 - 2 . 44 ( m , 1h ), 2 . 81 - 2 . 92 ( m , 2h ), 3 . 45 - 3 . 50 ( m , 1h ), 6 . 73 ( d , 2h , j = 8 . 2 hz ), 7 . 03 ( d , 2h , j = 8 . 2 hz ); [ 0471 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 5 , 23 . 7 , 27 . 2 , 30 . 5 , 30 . 8 , 30 . 8 , 33 . 1 , 33 . 4 , 38 . 3 , 58 . 7 , 74 . 8 , 116 . 4 , 130 . 9 , 131 . 2 , 157 . 1 ; esms calcd for c 24 h 44 no 2 ( m + h ) 378 . 3 , found 378 . 3 . according to the method of example 32 , from aminoalcohol 75 ( 43 mg , 0 . 11 mmol ), hydrochloride 76 was obtained as a white solid ( 10 mg , 21 % yield ). [ 0475 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 45 - 1 . 60 ( m , 2h ), 2 . 72 ( dd , 1h , j = 14 . 3 , 9 . 3 hz ), 2 . 92 ( dd , 1h , j = 14 . 3 , 5 . 4 hz ),: 3 . 39 ( ddd , 1h , j = 9 . 1 , 5 . 5 , 3 . 2 hz ), 3 . 66 - 3 . 75 ( m , 1h ), 6 . 78 ( d , 2h , j = 8 . 6 hz ), 7 . 10 ( d , 2h , j = 8 . 6 hz ); [ 0476 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 5 , 23 . 8 , 27 . 1 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 7 , 30 . 8 , 33 . 1 , 33 . 6 , 59 . 0 , 71 . 3 , 116 . 8 , 127 . 9 , 131 . 3 , 157 . 9 ; esms calcd for c 24 h 44 no 2 ( m − cl ) 378 . 3 , found 378 . 3 . according to the method of example 26 , from aldehyde 23 ( 503 mg , 1 . 05 mmol ) and 1 - bromopentadecane ( 768 ; mg , 2 . 64 mmol ), alcohol 77 was obtained as a colorless oil ( 350 mg , 48 % yield ). [ 0481 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 40 ( m , 28h ), 1 . 40 - 1 . 60 ( m , 2h ), 1 . 60 - 1 . 75 ( m , 2h ), 1 . 97 ( br s , 1h ), 2 . 43 ( t , 2h , j = 6 . 7 hz ), 2 . 56 - 2 . 62 ( m , 1h ), 3 . 57 ( s , 4h ), 3 . 61 ( d , 2h , j = 13 . 8 hz ), 3 . 65 - 3 . 75 ( m , 1h ), 3 . 67 ( d , 2h , j = 13 . 8 hz ), 7 . 20 - 7 . 40 ( m , 20h ); [ 0482 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 22 . 7 , 23 . 1 , 25 . 1 , 26 . 6 , 29 . 4 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 6 , 53 . 9 , 55 . 1 , 58 . 4 , 61 . 2 , 70 . 9 , 126 . 8 , 127 . 0 , 128 . 1 , 128 . 3 , 128 . 8 , 128 . 9 , 139 . 8 , 140 . 1 ; esms calcd for c 48 h 69 n 2 o ( m + h ) 689 . 5 , found 689 . 5 . according to the method of example 27 , from bis -( n , n - dibenzylamine ) 77 ( 105 mg , 0 . 15 mmol ), diaminoalcohol 78 was obtained as a white solid ( 45 mg , 91 % yield ). [ 0486 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 88 ( d , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 45 ( m , 28h ), 1 . 60 - 1 . 75 ( m , 4h ), 2 . 65 - 2 . 85 ( m , 3h ), 3 . 42 - 3 . 52 ( m , 1h ); [ 0487 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 4 , 23 . 7 , 26 . 9 , 27 . 2 , 28 . 8 , 30 . 5 , 30 . 8 , 33 . 1 , 33 . 4 , 41 . 1 , 56 . 9 , 74 . 6 ; esms calcd for c 20 h 45 n 2 o ( m + h ) 329 . 3 , found 329 . 3 . according to the method of example 32 , from diaminoalcohol 78 ( 40 mg , 0 . 12 mmol ) dihydrochloride 79 was obtained as a white solid ( 30 mg , 61 % yield ). [ 0491 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( d , 3h , j = 6 . 5 hz ), 1 . 25 - 1 . 40 ( m , 26h ), 1 . 45 - 1 . 60 ( m , 3h ), 1 . 70 - 1 . 95 ( m , 3h ), 2 . 98 ( t , 2h , j = 7 . 0 hz ), 3 . 20 - 3 . 25 ( m , 1h ), 3 . 72 - 3 . 80 ( m , 1h ); [ 0492 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 5 , 23 . 7 , 25 . 1 , 25 . 5 , 27 . 1 , 30 . 5 , 30 . 7 , 30 . 8 , 30 . 8 , 33 . 1 , 33 . 3 , 40 . 4 , 56 . 9 , 71 . 5 ; esms calcd for c 20 h 45 n 2 o ( m − hcl 2 ) 329 . 3 , found 329 . 4 . according to the method of example 26 , from aldehyde 26 ( 445 mg , 1 . 76 mmol ) and 1 - bromopentadecane ( 1 . 28 g , 4 . 39 mmol ), alcohol 80 was obtained as a colorless oil ( 422 mg , 52 % yield ). [ 0497 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 91 ( t , 3h , j = 6 . 9 hz ), 1 . 12 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 65 - 1 . 75 ( m , 2h ), 1 . 85 ( br s , 1h ), 2 . 73 ( quint , 1h , j = 6 . 4 hz ), 3 . 49 ( d , 2h , j = 13 . 9 hz ), 3 . 57 - 3 . 65 ( m , 1h ), 3 . 78 ( d , 2h , j = 13 . 8 hz ), 7 . 21 - 7 . 38 ( m , 10h ); [ 0498 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 6 , 14 . 1 , 22 . 7 , 25 . 9 , 29 . 3 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 4 , 54 . 8 , 57 . 3 , 73 . 6 , 126 . 9 , 128 . 2 , 128 . 8 , 140 . 2 ; esms calcd for c 32 h 52 no ( m + h ) 466 . 4 , found 466 . 4 . according to the method of example 27 , from n , n - dibenzylamine 80 ( 256 mg , 0 . 55 mmol ), aminoalcohol 81was obtained as a white solid ( 175 mg , 92 % yield ). [ 0502 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 7 . 0 hz ), 1 . 02 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 85 ( br s , 3h ), 2 . 94 - 3 . 04 ( m , 1h ), 3 . 42 - 3 . 52 ( m , 1h ); [ 0503 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 16 . 3 , 22 . 7 , 26 . 2 , 29 . 3 , 29 . 7 , 31 . 9 , 32 . 5 , 50 . 4 , 74 . 2 ; to a solution of alcohol 39 ( 48 . 5 mg . 0 . 104 mmol ) in ch 2 cl 2 ( 1 . 0 ml ) at room temperature , pyridine ( 25 μl , 0 . 313 mmol ), ac 2 o ( 29 μl , 0 . 313 mmol ) and dmap ( ca . 5 mg , cat .) were added . the reaction was stirred for 4 h , and then the solvents were evaporated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 10 : 1 ) to obtain acetate 82 as a colorless oil ( 46 mg , 87 % yield ). [ 0508 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 91 ( t , 3h , j = 6 . 8 hz ), 1 . 07 ( d , 3h , j = 6 . 6 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 40 - 1 . 50 ( m , 1h ), 1 . 75 - 1 . 85 ( m , 1h ), 2 . 02 ( s , 3h ), 2 . 81 ( quint , 1h , j = 7 . 1 hz ), 3 . 46 ( d , 2h , j = 13 . 9 hz ), 3 . 76 ( d , 2h , j = 13 . 9 hz ), 5 . 11 ( dt , 1h , j = 7 . 5 , 4 . 2 hz ), 7 . 22 - 7 . 39 ( m , 10h ); [ 0509 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 7 , 14 . 1 , 21 . 2 , 22 . 7 , 24 . 8 , 29 . 3 , 29 . 5 , 29 . 6 , 29 . 7 , 31 . 9 , 32 . 0 , 54 . 2 , 54 . 7 , 75 . 2 , 126 . 8 , 128 . 1 , 12 . 8 , 140 . 0 , 170 . 8 ; esms calcd for c 34 h 54 no 2 ( m + h ) 508 . 4 , found 508 . 5 . according to the method of example 27 , from n , n - dibenzylamine 82 ( 41 mg , 0 . 081 mmol ), acetamide 83 was obtained as a white solid ( 13 mg , 49 % yield ). [ 0513 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 89 ( t , 3h , j = 7 . 1 hz ), 1 . 09 ( d , 3h , j = 6 . 8 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 45 - 1 . 55 ( m , 2h ), 1 . 99 ( s , 3h ), 2 . 15 ( br s , 1h ), 3 . 60 - 3 . 65 ( m , 1h ), 4 . 00 ( dquint , 1h , j = 7 . 4 , 2 . 4 hz ), 5 . 84 ( br d , 1h , j = 7 . 1 hz ); [ 0514 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ13 . 9 , 14 . 1 , 22 . 7 , 23 . 5 , 26 . 0 , 29 . 4 , 29 . 6 , 29 . 7 , 31 . 9 , 33 . 6 , 49 . 5 , 74 . 2 , 82 . 4 , 170 . 0 ; esms calcd for c 20 h 41 no 2 na ( m + na ) 350 . 3 , found 350 . 3 . to a solution of alcohol 39 ( 322 mg , 0 . 69 mmol ) in dmf ( 3 . 5 ml ) at room temperature , nah ( 60 % mineral dispersion , 69 mg , 1 . 73 mmol ) and mei ( 0 . 22 ml , 3 . 46 mmol ) were added . after stirring for 16 h , the mixture was quenched with h 2 o ( 15 ml ), extracted with et 2 o ( 3 × 15 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 15 : 1 ) to obtain 84 as a colorless oil ( 110 mg , 33 % yield ). [ 0519 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 94 ( t , 3h , j = 6 . 7 hz ), 1 . 08 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 55 - 1 . 70 ( m , 2h ), 2 . 74 ( quint , 1h , j = 6 . 7 hz ), 3 . 27 ( q , 1h , j = 6 . 4 hz ), 3 . 36 ( s , 3h ), 3 . 50 ( d , 2h , j = 13 . 8 hz ), 3 . 77 ( d , 2h , j = 13 . 8 hz ), 7 . 23 - 7 . 42 ( m , 10h ); [ 0520 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 2 , 14 . 1 , 22 . 7 , 24 . 4 , 29 . 4 , 29 . 7 , 29 . 7 , 29 . 7 , 30 . 0 , 30 . 6 , 31 . 9 , 54 . 3 , 54 . 7 , 57 . 4 , 83 . 7 , 126 . 7 , 128 . 1 , 128 . 8 , 140 . 4 ; esms calcd for c 33 h 54 no ( m + h ) 480 . 4 , found 480 . 7 . according to the method of example 27 , from n , n - dibenzylamine 84 ( 54 mg , 0 . 11 mmol ), amine 85 was obtained as a white solid ( 14 mg , 42 % yield ). [ 0525 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 6 hz ), 1 . 03 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 40 - 1 . 55 ( m , 2h ); 1 . 96 ( br s , 2h ), 2 . 94 - 3 . 00 ( m , 1h ), 3 . 03 - 3 . 10 ( m , 1h ), 3 . 38 ( s , 3h ); [ 0526 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 18 . 3 , 22 . 7 , 26 . 0 , 29 . 1 , 29 . 3 , 29 . 6 , 29 . 6 , 29 . 7 , 29 . 9 , 31 . 9 , 47 . 9 , 57 . 9 , 75 . 0 , 85 . 7 ; esms calcd for c 19 h 42 no ( m + h ) 300 . 3 , found 300 . 5 . to a cold ( 0 ° c .) solution of alcohol 39 ( 24 mg , 0 . 051 mmol ) in 1 ml of pyridine , pocl 3 ( 0 . 019 ml , 0 . 206 mmol ) was added dropwise . after stirring at room temperature for 3 h , 0 . 2 ml of h 2 o were added and the solvent was evaporated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 10 : 1 ) to give chloride 86 as a colorless oil ( 14 mg , 56 % yield ). [ 0531 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 89 ( t , 3h , j = 6 . 6 hz ), 1 . 20 - 1 . 55 ( m , 30h ), 2 . 00 - 2 . 10 ( m , 1h ), 2 . 87 ( quint , 1h , j = 7 . 0 hz ), 3 . 47 ( d , 2h , j = 13 . 8 hz ), 3 . 75 ( d , 2h , j = 13 . 6 hz ), 3 . 98 ( td , 1h , j = 8 . 1 , 3 . 5 hz ), 7 . 21 - 7 . 36 ( m , 10h ); [ 0532 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ10 . 2 , 14 . 1 , 22 . 7 , 26 . 0 , 29 . 2 , 29 . 4 , 29 . 5 , 29 . 6 , 29 . 7 , 31 . 9 , 35 . 6 , 54 . 3 , 57 . 3 , 66 . 9 , 126 . 9 , 128 . 2 , 128 . 8 , 139 . 8 ; esms calcd for c 32 h 51 cln ( m + h ) 484 . 4 , found 484 . 3 . according to the method of example 27 , from n , n - dibenzylamine 86 ( 13 mg , 0 . 027 mmol ), amine 87 was obtained as a white sohd ( 3 mg , 37 % yield ). r f 0 . 10 ( etoac ); 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 6 . 6 hz ), 1 . 12 ( d , 3h , j = 6 . 6 hz ), 1 . 20 - 1 . 70 ( m , 30h ), 3 . 09 ( qd , 1h , j = 6 . 2 , 3 . 4 hz ), 3 . 90 ( td , 1h , j = 6 . 5 , 3 . 5 hz ); esms calcd for c 18 h 38 n ( m − cl ) 268 . 3 , found 268 . 2 . to a solution of alcohol 39 ( 44 mg , 0 . 095 mmol ) and cbr4 ( 47 mg , 0 . 142 mmol ) in 0 . 3 ml of pyridine , ( meo ) 3 p ( 0 . 022 ml , 0 . 189 mmol ) was added dropwise . after stirring at room temperature for 24 h , the mixture was diluted with etoac ( 10 ml ), washed successively with 5 % hcl ( 10 ml ), nahco 3 ( 10 ml , sat . aq .) and brine ( 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 10 : 1 to 2 : 1 ) to give dimethyl phosphate 88 as a colorless oil ( 20 mg , 37 % yield ) together with unreacted alcohol ( 25 mg , 57 % yield ). [ 0541 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 6 . 5 hz ), 1 . 16 ( d , 3h , j = 6 . 5 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 65 - 1 . 80 ( m , 2h ), 2 . 84 ( quint , 1h , j = 6 . 9 hz ), 3 . 40 ( d , 2h , j = 13 . 8 hz ), 3 . 69 ( dd , 3h , j = 2 . 3 , 0 . 5 hz ), 3 . 73 ( dd , 3h , j = 2 . 3 , 0 . 5 hz ), 3 . 73 ( d , 2h , j = 13 . 6 hz ), 4 . 47 ( ddd , 1h , j = 12 . 8 , 7 . 4 , 4 . 9 hz ), 7 . 20 - 7 . 34 ( m , 10h ); [ 0542 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ8 . 5 , 14 . 1 , 22 . 7 , 23 . 4 , 29 . 3 , 29 . 5 , 29 . 6 , 29 . 6 , 29 . 7 , 31 . 9 , 32 . 6 , 54 . 0 ( d ), 54 . 1 ( d ), 54 . 2 , 81 . 7 ( d ), 126 . 9 , 128 . 2 , 128 . 9 , 139 . 8 ; esms calcd for c 34 h 57 no 4 p ( m + h ) 574 . 4 , found 574 . 4 . according to the method of example 27 , from n , n - dibenzylamine 88 ( 16 mg , 0 . 028 mmol ), amine 89 was obtained as a white solid ( 6 mg , 55 % yield ). [ 0547 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 6 . 6 hz ), 1 . 08 ( d , 3h , j = 6 . 6 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 45 - 1 . 55 ( m , 1h ), 1 . 60 - 1 . 70 ( m , 1h ), 1 . 97 ( br s , 2h ), 3 . 12 - 3 . 20 ( m , 1h ), 3 . 76 ( s , 3h ), 3 . 80 ( s , 3h ), 4 . 24 - 4 . 34 ( m , 1h ); esms calcd for c 20 h 45 no 4 p ( m + h ) 394 . 3 , found 394 . 3 . according to the method of example 26 , from aldehyde 28 ( 640 mg , 3 . 1 mmol ) and 1 - bromopentadecane ( 5 . 0 g , 17 . 2 mmol ), alcohol 90 was obtained as a colorless oil ( 690 mg , 53 % yield ). [ 0551 ] 1 h nmr ( 500 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 7 . 1 hz ), 1 . 20 ( d , 3h , j = 6 . 8 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 40 - 1 . 50 ( m , 2h ), 1 . 74 ( br s , 1h ), 3 . 48 - 3 . 52 ( m , 1h ), 3 . 70 - 3 . 75 ( m , 1h ), 4 . 90 - 4 . 95 ( m , 1h ), 5 . 10 ( s , 2h ), 7 . 30 - 7 . 36 ( m , 5h ). to a solution of n - benzyloxycarbonylamine 90 ( 330 mg , 0 . 79 mmol ) in meoh ( 40 ml ) at room temperature , pd — c ( 10 % wt , 100 mg , 0 . 09 mmol ) was added . the mixture was purged with a stream of dry ar , and then h 2 . the reaction was stirred overnight under a h 2 atmosphere ( 1 atm ). the catalyst was filtered off through a 0 . 45 μm teflon filter in polypropylene housing , washing the filter with meoh ( 50 ml ) and the solvent was evaporated in vacuo . the crude was purified by column chromatography on silica ( 90 : 10 ch 2 cl 2 / meoh to 100 % meoh ) to obtain aminoalcohol 91 as a white solid ( 200 mg , 89 % yield ). [ 0554 ] 1 h nmr ( 500 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 7 . 2 hz ), 0 . 98 ( d , 3h , j = 6 . 5 hz ), 1 . 15 - 1 . 30 ( m , 26h ); 1 . 40 - 1 . 45 ( m , 2h ), 2 . 62 - 2 . 65 ( m , 1h ), 3 . 10 - 3 . 15 ( m , 1h ); [ 0555 ] 13 c nmr ( 125 mhz , cd 3 od ) δ14 . 8 , 19 . 2 , 24 . 1 , 27 . 2 , 20 . 9 , 31 . 1 , 33 . 5 , 35 . 0 , 53 . 0 , 77 . 1 ; esms calcd for c 18 h 40 no ( m + h ) 286 . 3 , found 286 . 4 . according to the method of example 26 , from aldehyde 8 ( 680 mg , 3 . 1 mmol ) and 1 - bromopentadecane ( 6 . 55 g , 22 . 5 mmol ), alcohol 92 was obtained as a colorless oil ( 800 mg , 60 % yield ). [ 0559 ] 1 h nmr ( 500 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 7 . 1 hz ), 0 . 96 ( t , 3h , j = 7 . 4 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 40 - 1 . 45 ( m , 2h ), 1 . 55 - 1 . 60 ( m , 1h ), 1 . 65 - 1 . 70 ( m , 1h ), 3 . 46 - 3 . 52 ( m , 1h ), 3 . 60 - 3 . 65 ( m , 1h ), 4 . 91 ( d , 1h , j = 9 . 3 hz ), 5 . 11 ( s , 2h ), 7 . 30 - 7 . 36 ( m , 5h ). according to the method of example 89 , from n - benzyloxycarbonylamine 92 ( 230 mg , 0 . 53 mmol ), aminoalcohol 93 was obtained as a white solid ( 140 mg , 89 % yield ). [ 0562 ] 1 h nmr ( 500 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 7 . 1 hz ), 0 . 93 ( t , 3h , j = 7 . 5 hz ), 1 . 15 - 1 . 25 ( m , 26h ), 1 . 30 - 1 . 40 ( m , 2h ), 1 . 40 - 1 . 50 ( m , 1h ), 1 . 65 - 1 . 75 ( m , 1h ), 2 . 80 - 2 . 85 ( m , 1h ), 3 . 45 - 3 . 50 ( m , 1h ); [ 0563 ] 13 c nmr ( 125 mhz , cd 3 od ) δ10 . 0 , 14 . 4 , 23 . 7 , 24 . 1 , 26 . 6 , 30 . 5 , 30 . 6 , 30 . 8 , 33 . 1 , 34 . 9 , 58 . 8 , 70 . 5 ; esms calcd for c 19 h 42 no ( m + h ) 300 . 3 , found 300 . 4 . to a solution of aminoalcohol 91 ( 46 mg , 0 .. 16 mmol ) in ch 2 cl 2 ( 1 . 6 ml ) at room temperature , boc20 ( 42 mg , 0 . 19 mmol ) was added . after stirring for 3 . 5 h , the solvent was removed in vacuo to obtain 94 as a white solid ( 62 mg , 100 % yield ). [ 0568 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 86 ( t , j = 6 . 5 hz , 3h ), 1 . 15 ( d , j = 6 . 8 hz , 3h ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 43 ( s , 9h ), 1 . 45 - 1 . 60 ( m , 2h ), 3 . 40 - 3 . 50 ( m , 1h ), 3 . 55 - 3 . 65 ( m , 1h ), 4 . 75 ( d , 1h , j = 8 . 8 hz ); [ 0569 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 18 . 3 , 22 . 7 , 25 . 6 , 27 . 4 , 28 . 4 , 29 . 3 , 29 . 6 , 29 . 6 , 29 . 7 , 31 . 9 , 34 . 2 , 50 . 5 , 74 . 9 , 156 . 2 . to a cold ( 0 ° c .) solution of alcohol 94 ( 48 mg , 0 . 12 mmol ) in ch 2 cl 2 ( 1 . 25 ml ), et 3 n ( 52 μl , 0 . 37 mmol ) and mscl ( 24 μl , 0 . 31 mmol ) were added . after stirring for 2 h , the mixture was quenched with h 2 o ( 10 ml ), extracted with ch 2 cl 2 ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude mesylate was dissolved in dmf ( 0 . 65 ml ) and nan 3 ( 40 . 5 mg , 0 . 62 mmol ) was added . the mixture was stirred at 120 c . for 3 h and then quenched with h 2 o ( 10 ml ), extracted with et 2 o ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 10 : 1 to . 5 : 1 ) to obtain azide 95 as a colorless oil ( 25 mg , 49 % yield ). [ 0573 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 6 hz ), 1 . 06 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 44 ( s , 9h ), 1 . 45 - 1 . 55 ( m , 2h ), 3 . 50 - 3 . 58 ( m , 1h ), 3 . 70 - 3 . 80 ( m , 1h ), 4 . 68 ( br d , 1h , j = 7 . 7 hz ); [ 0574 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 14 . 4 , 22 . 7 , 26 . 5 ,. 28 . 2 , 28 . 4 , 29 . 3 , 29 . 4 , 29 . 4 , 29 . 5 , 29 . 6 , 29 . 6 , 29 . 7 , 31 . 4 , 31 . 9 , 49 . 3 , 66 . 5 , 155 . 0 . to a solution of azide 95 ( 25 mg , 0 . 06 mmol ) in meoh ( 1 . 5 ml ) at room temperature , pd — c ( 10 % wt , 16 mg , 0 . 015 mmol ) was added . the mixture was purged with a stream of dry ar , and then h 2 . the reaction was stirred overnight under a h 2 atmosphere ( 1 atm ). the catalyst was filtered off through a 0 . 45 μm teflon filter in polypropylene housing , washing the filter with meoh ( 15 ml ) and the solvent was evaporated in vacuo to obtain amine 96 as a white solid ( 22 mg , 94 % yield ). r f 0 . 12 ( hexane / etoac 1 . 10 ); 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 86 ( t , 3h , j = 6 . 5 hz ), 1 . 02 ( d , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 43 ( s , 9h ), 1 . 45 - 1 . 55 ( m , 2h ), 2 . 0 . 5 ( br s , 2h ), 2 . 72 - 2 . 82 ( m , 1h ), 3 . 60 - 3 . 70 ( m , 1h ), 5 . 00 - 5 . 10 ( m , 1h ); [ 0578 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 22 . 7 , 26 . 5 , 28 . 4 , 29 . 3 , 29 . 7 , 31 . 9 , 34 . 8 , 49 . 7 , 54 . 8 , 155 . 4 ; esms calcd for c 23 h 49 n 2 o 2 ( m + h ) 385 . 4 , found 385 . 4 . to a solution of n - boc derivative 96 ( 22 mg , 0 . 057 mmol ) in dioxane ( 0 . 4 ml ), anhydrous hcl solution in dioxane ( 5 . 3m , 0 . 43 ml , 2 . 29 mmol ) was added . after stirring at room temperature for 5 h , the solvent was removed in vacuo . the resulting solid was washed with dioxane to obtain dihydrochloride 97 as a white solid ( 11 . 5 mg , 56 % yield ). [ 0582 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 45 ( m , 26h ), 1 . 42 ( d , 3h , j = 7 . 0 hz ), 1 . 65 - 1 . 80 ( m , 2h ), 3 . 42 - 3 . 48 ( m , 1h ), 3 . 58 - 3 . 66 ( m , 1h ); [ 0583 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 3 , 14 . 4 , 23 . 7 , 26 . 3 , 30 . 4 , 30 . 5 , 30 . 7 , 30 . 7 , 30 . 8 , 33 . 1 , 55 . 1 ; esms calcd for c 18 h 41 n 2 ( m − hcl 2 ) 285 . 3 , found 285 . 3 . according of the method of example 92 , from aminoalcohol 1 ( 82 . 5 mg , 0 . 30 mmol ) n - boc derivative 98 was obtained as a white solid ( 110 mg , 95 % yield ). [ 0588 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 9 hz ), 1 . 09 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 45 ( s , 9h ), 1 . 49 - 1 . 60 ( m , 2h ), 2 . 01 - 2 . 09 ( m , 1h ), 3 . 55 - 3 . 69 ( m , 3h ), 4 . 61 - 4 . 72 ( m , 1h ); [ 0589 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 14 . 2 , 22 . 6 , 26 . 0 , . 28 . 3 , 29 . 3 , 29 . 6 , 31 . 9 , 33 . 4 , 50 . 5 , 74 . 4 , 172 . 1 ; esms calcd for c 23 h 47 no 3 na ( m + na ) 408 . 4 , found 408 . 3 . to a solution of alcohol 98 ( 54 mg , 0 . 14 mmol ) in ch 2 cl 2 ( 6 . 0 ml ) at room temperature , trifluoroacetic anhydride ( 28 μl , 0 . 14 mmol ), pyridine ( 22 μl ) 0 . 42 mmol ) and dmap ( 1 . 7 mg , 0 . 01 mmol ) were added . after stirring for 1 h , the reaction was quenched with h 2 o ( 10 ml ), extracted with ch 2 cl 2 ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / acoet 9 : 1 ) to obtain trifluoroacetate 99 as a white solid ( 17 mg , 25 % yield ). [ 0594 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 6 . 5 hz ), 1 . 08 ( d , 3h , j = 6 . 5 hz ) 1 . 18 - 1 . 36 ( m , 26h ), 1 . 41 ( s , 9hi ), 1 . 52 - 1 . 61 ( m , 2h ), 3 . 87 - 3 . 92 ( m , 1h ), 4 . 39 - 4 . 44 ( m , 1h ), 4 . 98 - 5 . 21 ( m , 1h ); esms calcd for c 25 h 46 f 3 no 4 na ( m + na ) 504 . 3 , found 504 . 4 . to a solution of n - boc derivative 99 ( 17 mg , 0 . 03 mmol ) in ch 2 cl 2 ( 4 ml ) at room temperature , trifluoroacetic acid ( 1 . 0 ml ) was added . after stirring for 1 h , the solvents were removed in vacuo to obtain 100 as a white solid ( 16 mg , 94 % yield ). [ 0599 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 6 . 1 hz ), 1 . 18 - 1 . 25 ( m , 26h ), 1 . 28 ( d , 3h , j = 6 . 5hz ), 1 . 49 - 1 . 56 ( m , 1h ), 1 . 64 - 1 . 69 ( m , 1h ), 3 . 51 ( m , 1h ), 5 . 27 ( m , 1h ), 7 . 94 ( m , 1h ); [ 0600 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ12 . 1 , 21 . 4 , 22 . 7 , 25 . 9 , 26 . 2 , 26 . 3 , 26 . 4 , 26 . 6 , 27 . 4 , 28 . 9 , 49 . 7 , 79 . 0 , 101 . 3 , 111 . 4 161 . 1 ; esms calcd for c 18 h 39 no ( m − c 4 f 6 o 3 ) 286 . 5 , found 286 . 2 . according of the method of example 80 , from alcohol 98 ( 20 mg , 0 . 052 mmol ), acetate 101 was obtained as a white solid ( 18 . 5 mg , 83 % yield ). [ 0605 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 1 . 08 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 43 ( s , 9h ), 1 . 45 - 1 . 55 ( m , 2h ), 2 . 06 ( s , 3h ), 3 . 79 - 3 . 89 ( m , 1h ), 4 . 60 ( br d , 1h , j = 7 . 7 hz ), 4 . 85 ( dt , 1h , j = 7 . 2 , 4 . 9 hz ); [ 0606 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 15 . 3 , 21 . 1 , 22 . 7 , 25 . 5 , 28 . 4 , 29 . 3 , 29 . 4 , 29 . 5 , 29 . 6 , 29 . 6 , 29 . 7 , 30 . 7 , 31 . 9 , 48 . 3 , 79 . 3 , 155 . 1 , 171 . 0 ; esms calcd for c 25 h 49 no 4 na ( m + na ) 450 . 4 , found 450 . 4 . according to the method of example 95 , from n - boc derivative 101 ( 13 . 7 mg , 0 . 032 mmol ) hydrochloride 102 was obtained as a white solid ( 9 mg , 77 % yield ). [ 0610 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 6 hz ), 1 . 20 - 1 . 40 ( m , 29h ), 1 . 55 - 1 . 65 ( m , 2h ), 2 . 12 ( s , 3h ), 3 . 49 ( qd , 1h , j = 6 . 7 , 2 . 4 hz ), 5 . 07 ( ddd , 1h , j : 8 . 7 ,- 5 . 0 , 2 . 6 hz ); [ 0611 ] 13 c nmr ( 75 - mhz , cd 3 od ) δ12 . 9 , 14 . 5 , 20 . 9 , 23 . 8 , 26 . 5 , 30 . 3 , 30 . 5 , 30 . 5 , 30 . 7 , 30 . 8 , 31 . 3 , 33 . 1 , 51 . 1 , 74 . 3 , 172 . 5 ; esms calcd for c 20 h 42 no 2 ( m − cl ) 328 . 3 , found 328 . 3 . according to the method of example 93 , from alcohol 98 ( 50 mg , 0 . 13 mmol ), azide 103 was obtained as a colorless oil ( 39 mg , 73 % yield ). [ 0616 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 87 ( t , 3h , j = 6 . 8 hz ), 1 . 18 ( d , 3h , j = 6 . 8 hz ), 1 . 20 - 1 . 39 ( m , 26h ), 1 . 43 ( s , 9h ), 1 . 53 - 1 . 61 ( m , 2h ), 3 . 30 - 3 . 36 ( m , 1h ), 3 . 55 - 3 . 97 ( m , 1h ), 4 . 50 ( d , 1h , j = 9 . 2 hz ); esms calcd for c 23 h 46 n 4 o 2 na ( m + na ) 433 . 3 , found 433 . 4 . according to the method of example 94 , from azide 103 ( 15 mg , 0 . 03 mmol ), amine 104 was obtained as a colorless oil ( 13 mg , 92 % yield ). [ 0620 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 87 ( t , 3h , j = 6 . 8 hz ), 1 . 10 ( d , 3h , j = 6 . 8 hz ), 1 . 21 - 1 . 40 ( m , 26h ), 1 . 43 ( s , 9h ), 1 . 45 - 1 . 47 ( m , 2h ), 2 . 70 - 2 . 75 ( m , 1h ), 3 . 60 - 3 . 55 ( m , 1h ), 4 . 90 ( d , 1h , j = 6 . 8 hz ); esms calcd for c 23 h 49 n 2 o 2 ( m + h ) 385 . 4 , found 385 . 4 . according to the method of example 95 , from n - boc derivative 104 ( 13 mg , 0 . 03 mmol ), dihydrochloride 105 was obtained as a white solid ( 11 mg , 75 % yield ). [ 0624 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 8 hz ), 1 . 35 ( d , 3h , j = 6 . 8 hz ), 1 . 25 - 1 . 40 ( m , 26h ), 1 . 56 - 1 . 72 ( m , 2h ), 3 . 49 - 3 . 56 ( m , 1h ), 3 . 70 - 3 . 74 ( m , 1h ); [ 0625 ] 13 c nmr ( 75 mhz , cd 3 od ) δ13 . 1 , 14 . 4 , 22 . 7 , 26 . 5 , 27 . 8 , 30 . 5 , 30 . 8 , 33 . 1 , 54 . 1 ; esms calcd for c 18 h 41 n 2 ( m − hcl 2 ) 285 . 3 , found 285 . 4 . a mixture of aminoalcohol 1 ( 100 mg , 0 . 35 mmol ), formaldehyde ( 37 % w / w , aq . 142 mg , 1 . 75 mmol ), nab ( oac ) 3 h ( 370 mg , 1 . 75 mmol ) and ( ch 2 cl ) 2 ( 2 ml ) was stirred at room temperature for . 3 h . the reaction was quenched by the addition of nahco 3 ( 15 ml , sat . aq .) and extracted with etoac ( 3 × 25 ml ). the combined extracts were dried over na 2 so 4 and concentrated in vacuo to give 106 as a white solid ( 83 mg , 75 % yield ). [ 0629 ] 1 h nmr ( 500 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 7 . 1 hz ), 0 . 92 ( d , 3h , j = 6 . 7 hz ), 1 . 15 - 1 . 25 ( m , 26h ), 1 . 30 - 1 . 40 ( m , 2h ), 2 . 19 ( s , 6h ), 2 . 30 - 2 . 35 ( m , 1h ), 3 . 60 - 3 . 65 ( m , 1h ); [ 0630 ] 13 c nmr ( 125 mhz , cd 3 od ) δ8 . 7 , 14 . 9 , 24 . 2 , 27 . 7 , 30 . 9 , 31 . 2 , 33 . 5 , 36 . 8 , 42 . 2 , 65 . 0 , 73 . 3 ; esms calcd for c 20 h 44 no ( m + h ) 314 . 3 , found 314 . 4 . a mixture of aminoalcohol 1 ( 150 mg , 0 . 53 mmol ) and carbonyl diimidazole ( 94 mg , 0 . 58 mmol ) in thf ( 10 ml ) was stirred at 60 ° c . for 3 h . then , the solvent was removed in vacuo and the residue was dissolved in ch 2 cl 2 ( 40 ml ), washed successively with hcl ( 2n , 40 ml ), h 2 o ( 40 ml ) and brine ( 40 ml ), dried over na 2 so 4 and concentrated in vacuo to give oxazolidinone 107 as a white solid ( 160 mg , 98 % yield ). [ 0635 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 7 . 0 hz ), 1 . 02 ( d , 3h , j = 6 . 5 hz ), 1 . 15 - 1 . 30 ,( m , 26h ), 1 . 40 - 1 . 55 ( m , 2h ), 3 . 81 ( quint , 1h , j = 6 . 5 hz ), 4 . 44 - 4 . 52 ( m , 1h ); [ 0636 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 20 . 7 , 22 . 7 , 24 . 8 , 29 . 3 , 29 . 4 , 29 . 4 , 29 . 5 , 29 . 7 , 31 . 9 , 34 . 1 , 53 . 5 , 84 . 2 , 158 . 7 ; esms calcd for c 19 h 37 no 2 na ( m + na ) 334 . 3 , found 334 . 3 . to a cold ( 0 ° c .) solution of 107 ( 160 mg , 0 . 52 mmol ) in thf ( 20 ml ), lialh 4 ( 1m in thf , 1 . 04 ml , 1 . 04 mmol ), was added dropwise . the mixture was stirred overnight at room temperature . a further portion of lialh 4 ( 1 . 04 ml , 1 . 04 mmol ) was added and the reaction left for 2 more days . the reaction was quenched with h 2 o containing a few drops of nh 4 oh ( 20 ml ) and extracted with etoac ( 3 × 20 ml ). the combined extracts were successively washed with . h 2 o ( 30 ml ) and brine ( 30 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( 50 % to 75 % ch 2 cl 2 / hexane to 100 % ch 2 cl 2 to 10 % meoh / chcl 3 and a few drops of nh 4 oh ) to give 108 as a white solid ( 35 mg , 23 % yield ). [ 0640 ] 1 h nmr ( 500 mhz , cd 3 od ) δ0 . 80 ( t , 3h , j = 7 . 1 hz ), 0 . 92 ( d , 3h , j = 6 . 7 hz ), 1 . 15 - 1 . 25 ( m , 26h ), 1 . 30 - 1 . 45 ( m , 2h ), 2 . 19 ( s , 3h ), 2 . 50 - 2 . 55 ( m , 1h ), 3 . 55 - 3 . 60 ( m , 1h ); [ 0641 ] 13 c nmr ( 125 mhz , cd 3 od ) δ13 . 3 , 14 . 9 , 24 . 2 , 27 . 8 , 30 . 9 , 31 . 2 , 33 . 5 , 34 . 7 , 36 . 8 , 42 . 3 , 60 . 5 , 73 . 1 ; esms calcd for c 19 h 42 no ( m + h ) 300 . 3 , found 300 . 3 . to a solution of aminoalcohol 1 ( 197 mg , 0 . 69 mmol ) in thp ( 3 . 5 ml ) at room temperature , phncs ( 0 . 165 ml , 1 . 38 mmol ) was added . the reaction was stirred for 1 h , and then the solvents were evaporated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 5 : 1 to 2 : 1 ) to give phenylthiourea 109 as a white solid ( 246 mg , 85 % yield ). [ 0646 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 85 ( t , 3h , j = 6 . 7 hz ), 1 . 08 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 30 ( m , 26h ), 1 . 35 - 1 . 45 ( m , 2h ), 2 . 20 ( br s , 1h ), 3 . 72 - 3 . 82 ( m , 1h ) 4 . 45 - 4 . 60 ( m , 1h ), 6 . 58 ( d , 1h , j = 8 . 6 hz ), 7 . 18 - 7 . 38 ( m , 5h ), 8 . 39 ( br s , 1h ); [ 0647 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ12 . 9 , 14 . 0 , 22 . 6 , 25 . 8 , 29 . 2 , 29 . 4 , 29 . 5 , 29 . 5 , 29 . 6 , 31 . 8 , 33 . 7 , 54 . 5 , 73 . 5 , 124 . 4 , 126 . 6 , 129 . 9 , 136 . 4 , 179 . 0 ; esms calcd for c 25 h 43 n 2 os ( m − h ) 419 . 3 , found 419 . 2 . according to the method of example 107 , from aminoalcohol 1 ( 23 mg , 0 . 08 mmol ) and phnco ( 18 μl , 0 . 16 . mmol ), phenylurea 110 was obtained as a white solid ( 15 mg , 46 % yield ). [ 0652 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 7 hz ), 1 . 11 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 30 ( m , 26h ), 1 . 35 - 1 . 45 ( m , 2h ), 2 . 17 ( br s , 1h ), 3 . 63 - 3 . 73 ( m , 1h ) 3 . 90 - 4 . 06 ( m , 1h ), 5 . 02 ( d , 1h , j = 7 . 2 hz ), 6 . 58 ( br s , 1h ), 7 . 05 - 7 . 12 ( m , 1h ), 7 . 25 - 7 . 34 ( m , 4h ); esms calcd for c 25 h 45 n 2 o 2 ( m + h ) 405 . 3 , found 405 . 4 . according to the method of example 107 , from aminoalcohol 1 ( 27 mg , 0 . 09 mmol ) and n - bunco ( 21 μl , 0 . 19 mmol ), n - butylurea 111 was obtained as a white solid ( 13 mg , 36 % yield ). [ 0657 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 0 . 92 . ( t , 3h , j = 7 . 2 hz ), 1 . 08 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 28h ), 1 . 40 - 1 . 55 ( m , 4h ), 2 . 91 ( br s , 1h ), 3 . 14 ( q , 2h , j = 6 . 5 hz ), 3 . 61 ( br s , 1h ), 3 . 78 - 3 . 88 ( m , 1h ), 4 . 56 - 4 . 66 ( m , 2h ); esms calcd for c 23 h 49 n 2 o 2 ( m + h ) 385 . 4 , found 385 . 4 . to a solution of aminoalcohol 1 ( 40 mg , 0 . 14 mmol ) in ch 2 cl 2 ( 5 . 0 ml ) at room temperature , clso 2 me ( 11 μl , 0 . 14 mmol ) was added . after stirring for 1 h , the reaction was quenched with h 2 o ( 10 ml ), extracted with ch 2 cl 2 ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 4 : 1 ) to obtain sulfonamide 112 as a white solid ( 49 mg , 96 % yield ). [ 0662 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 85 ( t , 3h , j = 6 . 8 hz ), 1 . 19 ( t , 3h j = 6 . 8 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 47 - 1 . 53 ( m , 2h ), 1 . 86 ( d , 1h ,. j = 5 . 1 hz ), 3 . 00 ( s , 3h ), 3 . 53 ( t , 1h , j = 6 . 1 hz ), 3 . 66 - 3 . 72 ( m , 1h ), 4 . 66 ( d , 1h , j = 8 . 1 hz ); [ 0663 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ12 . 0 , 14 . 5 , 16 . 4 , 23 . 2 , 26 . 9 , 27 . 2 , 30 . 6 , 30 . 7 , 30 . 8 , 33 . 1 , 34 . 2 , 41 . 6 , 55 . 3 , 71 . 5 ; esms calcd for c 18 h 38 no ( m − so 2 me ) 286 . 2 , found 286 . 5 . according to the method of example 110 , from aminoalcohol 2 ( 25 mg , 0 . 08 mmol ), sulfonamide 113 was obtained as a white solid ( 29 mg , 94 % yield ). [ 0667 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 87 ( t , 3h , j = 6 . 4 hz ), 1 . 17 ( d , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 40 ( m , 28h ), 1 . 46 - 1 . 53 ( m , 2h ), 1 . 98 - 2 . 05 ( m , 1h ), 2 . 97 - 3 . 03 ( m , 1h ), 3 . 47 - 3 . 58 ( m , 1h ), 3 . 68 - 3 . 74 ( m , 1h ), 4 . 77 - 4 . 83 ( m , 1h ); [ 0668 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 3 , 15 . 5 , 22 . 9 , 26 . 2 , 29 . 5 , 29 . 7 , 29 . 8 , 29 . 9 , 32 . 1 , 33 . 4 , 42 . 0 , 54 . 0 , 74 . 6 ; esms calcd for c 19 h 40 no ( m − so2me ) 300 . 3 , found 300 . 3 . to a solution of aminoalcohol 1 ( 27 mg , 0 . 09 mmol ) in ch 2 cl 2 ( 5 . 0 ml ) at room temperature , trifluoroacetic anhydride ( 12 . 8 μl , 0 . 09 mmol ) was added . after stirring for 1 h , the solvents were removed in vacuo . the crude was purified by column chromatography on silica ( hexane / ch 2 cl 2 1 : 1 ) to obtain 114 ( 9 mg , 25 % yield ) r f 0 . 34 ( hexane / ch 2 cl 2 1 : 1 ) and 115 ( 11 mg , 24 % yield ) r f 0 . 52 ( hexane / ch 2 cl 2 1 : 1 ) as white solids . 114 : 1 h nmr ( 300 mhz , cd 3 od ) & amp ; 0 . 85 ( t , 3h , j = 6 . 9 hz ), 1 . 05 ( d , 3h , j = 7 . 0 hz ), 1 . 19 - 1 . 38 ( m , 26h ), 1 . 45 - 1 . 53 ( m , 2h ), 3 . 60 - 3 . 66 ( m , 1h ), 3 . 93 - 3 . 98 ( m , 1h ), 6 . 65 ( d , 1h , j = 7 . 5hz ); [ 0673 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ12 . 9 , 14 . 3 , 15 . 4 , 22 . 9 , 25 . 9 , 29 . 5 , 29 . 7 , 29 . 8 , 31 , 8 , 32 . 1 , 34 . 2 , 49 . 6 , 73 . 2 , 76 . 8 , 114 . 4 , 118 . 2 , 121 . 8 , 151 . 4 , 156 . 9 ; esms calcd for c 20 h 38 f 3 no 2 na ( m + na ) 404 . 3 , found 404 . 8 . 115 : 1 h nmr ( 300 mhz . cd 3 od ) δ0 . 89 ( t , 3h , j = 7 . 6 hz ), 1 . 20 - 1 . 39 ( m , 26h ), 2 . 46 - 2 . 55 ( m , 2h ), 4 . 01 - 4 . 43 ( m , 1h ), 4 . 95 - 5 . 24 ( m , 1h ), 6 . 00 - 6 . 34 ( m , 1h ). according to the method of example 112 , from aminoalcohol 2 ( 22 mg , 0 . 07 mmol ), 116 ( 6 mg , 22 % yield ) and 117 ( 8 mg , 23 % yield ) were obtained as white solids . 116 : 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 85 ( t , 3h , j = 6 . 8 hz ), 1 . 01 ( d , 3h , j = 6 . 8hz ), 1 . 23 - 1 . 41 ( m , 28h ), 1 . 45 - 1 . 53 ( m , 2h ), 3 . 65 - 3 . 73 ( m , 1h ), 3 . 96 - 4 . 06 ( m , 1h ), 6 . 68 - 6 . 73 ( m , 1h ). 117 : 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 88 ( t , 3h , j = 7 . 6 hz ,), 1 . 25 - 1 . 38 ( m , 26h ), 2 . 47 - 2 . 60 ( m , 2h ), 4 . 00 - 4 . 40 ( m , 1h ), 4 . 97 - 5 . 28 ( m , 1h ), 6 . 01 - 6 . 35 ( m , 1h ). to a solution of aminoalcohol 1 ( 30 mg , 0 . 10 mmol ) in ch 2 cl 2 ( 3 . 0 ml ) at room temperature , pyridine ( 58 ml , 0 . 11 mmol ) and cinnamoyl chloride ( 16 . 6 mg , 0 . 36 mmol ) were added . after stirring for 1 h , the reaction was quenched with h 2 o ( 10 ml ), extracted with ch 2 cl 2 ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 4 : 1 ) to obtain 118 as a white solid ( 32 mg , 74 % yield ). [ 0683 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 1 . 16 ( d , 3h , j = 6 . 9 hz ), 1 . 21 - 1 . 40 ( m , 26h ), 1 . 33 - 1 . 40 ( m , 2h ), 2 . 28 - 2 . 35 ( m , 1h ), 3 . 64 - 3 . 71 ( m , 1h ), 4 . 06 - 4 . 18 ( m , 1h ), 5 . 92 ( d , 1h , j = 15 . 6 hz ), 6 . 40 ( d , 1h , j = 15 . 6 hz ), 7 . 31 - 7 . 36 ( m , 3h ), 7 . 41 - 7 . 50 ( m , 2h ), 7 . 62 ( d , 1h , j = 15 . 6 hz ); [ 0684 ] 13 c nmr ( 75 mhz , cdcl3 ) δ14 . 9 , 25 . 3 , 26 . 2 , 29 . 5 , 29 . 9 , 33 . 8 , 49 . 9 , 74 . 3 , 124 . 2 , 126 . 8 , 129 . 8 , 130 . 9 , 136 . 1 , 165 . 1 ; esms calcd for c 27 h 45 no 2 na ( m + na ) 438 . 3 , found 438 . 3 . according to the method of example 114 , from aminoalcohol 1 ( 30 mg , 0 . 10 mmol ) and 3 -( trifluoromethyl )- cinnamoyl chloride ( 24 . 6 mg , 0 . 10 mmol ), amide 119 was obtained as a white solid ( 28 mg , 56 % yield ). [ 0689 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 87 ( t , 3h , j = 6 . 9 hz ), 1 . 16 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 35 - 1 . 41 ( m , 2h ), 3 . 68 - 3 . 74 ( m , 1h ), 3 . 98 - 4 . 20 ( m , 1h ), 6 . 06 ( d , 1h , j = 9 . 6 hz ), 6 . 45 ( d , j = 6 . 9 hz , 1h ), 7 . 48 - 7 . 78 ( m , 4h ); [ 0690 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 22 . 9 26 . 2 , 29 . 6 , 29 . 8 , 29 . 9 , 32 . 1 , 33 . 9 , 49 . 9 , 74 . 4 , 122 . 8 , 124 . 1 , 124 . 2 , 126 . 3 , 129 . 5 , 131 . 3 , 135 . 8 , 139 . 7 , 165 . 2 ; esms calcd for c 28 h 44 f 3 no 2 na ( m + na ) 506 . 3 , found 506 . 4 . to a solution of aminoalcohol 1 ( 30 mg , 0 . 10 mmol ) in ch 2 cl 2 ( 3 . 0 ml ) at room temperature , palmitic acid ( 28 mg , 0 . 11 mmol ), edc ( 50 . 2 mg , 0 . 26 mmol ), dipea ( 39 μl , 0 . 15 mmol ) and dmap ( 1 . 2 mg , 0 . 01 mmol ) were added . after stirring for 2 h , the reaction was quenched with h 2 o ( 10 ml ), extracted with ch 2 cl 2 ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 4 : 1 ) to obtain 120 as a white solid ( 48 mg , 87 % yield ). [ 0695 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 85 - 0 . 94 ( m , 6h ), 1 . 08 ( d , 3h , j = 7 . 1 hz ), 1 . 20 - 1 . 40 ( m , 52h ), 1 . 58 - 1 . 65 ( m , 2h ) 2 . 16 ( t , 2h , . j = 7 . 1hz ), 2 . 29 - 2 . 33 ( m , 1h ), 3 . 58 - 3 . 64 ( m , 1h ), 3 . 93 - 4 . 13 ( m , 1h ), 5 . 72 ( d , 1h , j = 7 . 1 hz ); [ 0696 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 15 . 2 , 22 . 7 , 25 . 8 , 25 . 9 , 29 . 2 , 29 . 3 , 29 . 5 , 29 . 6 , 29 . 7 , 31 . 9 , 33 . 5 , 36 . 9 , 49 . 4 , 65 . 8 , 74 . 4 , 173 . 1 ; esms calcd for c 34 h 69 no 2 na ( m + na ) 546 . 5 , found 546 . 8 . to a solution of aminoalcohol 1 ( 30 mg , 0 . 10 mmol ) in ch 2 c1 2 ( 3 . 0 ml ) at room temperature , n - boc - valine ( 23 mg , 0 . 11 mmol ), edc ( 50 . 2 mg , 0 . 26 mmol ), dipea ( 39 μl , 0 . 15 mmol ) and dmap ( 1 . 2 mg , 0 . 01 mmol ) were added . after stirring for 2 h , the reaction was quenched with h 2 o ( 10 ml ), extracted with ch 2 cl 2 ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 4 : 1 ) to obtain 121 as a white solid ( 48 mg , 87 % yield ). [ 0701 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 86 ( t , 3h , j = 6 . 9 hz ), 0 . 91 ( d , 3h , j = 6 . 9 hz ), 0 . 96 ( d , 3h , j = 6 . 9 hz ), 1 . 08 ( d , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 38 - 1 . 46 ( m , 11h ), 1 . 99 - 2 . 23 ( m , 1h ), 2 . 33 - 2 . 78 ( m , 1h ), 3 . 64 ( m , 1h ), 3 . 83 ( t , 1h , j = 6 . 3 hz ), 3 . 98 ( m , 1h ), 5 . 06 ( d , 1h , j = 6 . 8 hz ), 6 . 29 ( d , 1h , j = 7 . 8 hz ); [ 0702 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ13 . 7 , 14 . 1 , 17 . 8 , 19 . 3 , 22 . 7 ,. 26 . 0 , 28 . 3 , 29 . 3 , 29 . 5 , 29 . 7 , 30 . 6 , 31 . 9 , 33 . 5 , 49 . 6 , 60 . 4 , 73 . 8 , 157 . 4 , 171 . 3 ; esms calcd for c 28 h 57 n 2 o 4 ( m + ha ) 485 . 4 , found 485 . 7 . according to the method of example 95 , from n - boc derivative 121 ( 24 mg , 0 . 05 mmol ), hydrochloride 122 was obtained as a white solid ( 15 mg , 75 % yield ). [ 0706 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 87 ( t , 3h , j = 6 . 8 hz ), 1 . 07 - 1 . 11 ( m , 6h ), 1 . 13 ( d , 3h , j = 6 . 8 hz ), 1 . 21 - 1 . 40 ( m , 26h ), 1 . 41 - 1 . 52 ( m , 2h ), 2 . 09 - 2 . 11 ( m , 1h ), 3 . 40 - 3 . 47 ( m , 1h ), 3 . 66 - 3 . 77 ( m , 1h ), 3 . 87 - 3 . 93 ( m , 1h ); [ 0707 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ12 . 7 , 13 . 1 , 16 . 7 , 17 . 8 , 18 . 3 , 21 . 6 , 25 . 2 , 27 . 2 , 28 . 3 , 28 . 7 , 29 . 6 , 30 . 9 , 32 . 3 , 49 . 6 , 66 . 0 ,. 72 . 5 , 166 . 7 ; esms calcd for c 23 h 49 n 2 o 2 ( m − cl ) 385 . 3 , found 385 . 3 . to a solution of aminoalcohol 37 ( 82 mg , 0 . 274 mmol ) in dioxane ( 0 . 7 ml ) and h 2 o ( 0 . 4 ml ) at room temperature , naoh ( 1m , aq ., 0 . 3 ml ) was added followed by boc2o ( 66 mg , 0 . 301 mmol ). after stirring for 2 h , the reaction was diluted with etoac ( 10 ml ) and khso 4 ( 10 % aq ., 10 ml ) was added . the layers were separated and the aqueous layer extracted with etoac ( 3 × 10 ml ). the organic layers were dried over na 2 so 4 and concentrated in vacuo to obtain the crude n - boc derivative as a white solid . to a cold (− 78 ° c .) solution of ( cocl ) 2 ( 2m in ch 2 cl 2 , 0 . 22 ml , 0 . 447 mmol ) in ch 2 cl 2 ( 4 . 5 ml ), dmso ( 0 . 063 ml , 0 . 894 mmol ) was added dropwise . after stirring at − 78 ° c . for 15 min , a solution of the n - boc derivative ( 69 mg , 0 . 179 mmol ) in ch 2 cl 2 ( 2 ml ) was added dropwise . the mixture was stirred at − 78 ° c . for 1 h , and then et 3 n ( 0 . 187 ml , 1 . 34 mmol ) was added . the reaction was warmed up to 0 ° c . and stirred for 15 min , followed by the addition of nh 4 cl ( 15 ml , sat . aq .). the crude was extracted with ch 2 cl 2 ( 3 × 15 ml ), washed successively with nahco 3 ( 30 ml , sat . aq .) and brine ( 30 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 5 : 1 ) to obtain ketone 123 as a white solid ( 40 mg , 56 % yield ) together with unreacted starting material ( 30 mg ). r f 0 . 42 ( hexane / etoac 5 : 1 ); [ 0711 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 85 ( t , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 37 ( m , 25h ), 1 . 42 ( s , 9h ), 1 . 54 - 1 . 62 ( m , 2h ), 2 . 38 - 2 . 56 ( m , 2h ), 4 . 29 ( quint , 1h , j = 6 . 5 hz ), 5 . 28 ( br d , 1h , j = 5 . 2 hz ); [ 0712 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 0 , 17 . 9 , 22 . 6 , 23 . 5 , 28 . 3 , 29 . 2 , 29 . 3 , 29 . 4 , 29 . 5 , 29 . 6 , 31 . 9 , 39 . 1 , 55 . 0 , 209 . 7 ; esms calcd for c 22 h 43 no 3 na ( m + na ) 392 . 3 , found 392 . 3 . according to the method of example 95 , from ketone 123 ( 33 . 5 mg , 0 . 091 mmol ), hydrochloride 124 was obtained as a white solid ( 22 mg , 79 % yield ). [ 0716 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 9 hz ),. 1 . 20 - 1 . 35 ( m , 22h ), 1 . 51 ( d , 3h , j = 7 . 4 hz ), 1 . 55 - 1 . 65 . ( m , 2h ), 2 . 50 - 2 . 72 ( m , 2h ), 4 . 13 ( q , 1h , j = 7 . 4 hz ); [ 0717 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 4 , 15 . 7 , 23 . 7 , 24 . 3 , 30 . 1 , 30 . 5 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 8 , 33 . 1 , 39 . 2 , 55 . 8 , 207 . 4 ; esms calcd for c 17 h 36 no ( m − cl ) 270 . 3 , found 270 . 2 . according to the method of example 119 , from aminoalcohol 1 ( 53 mg , 0 . 186 mmol ), ketone 125 was obtained as a white solid ( 27 mg , 38 % yield ), together with unreacted starting alcohol ( 24 mg ). r f 0 . 42 ( hexane / etoac 5 : 1 ); [ 0721 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 37 ( m , 27h ), 1 . 43 ( s , 9h ), 1 . 54 - 1 . 62 ( m , 2h ), 2 . 38 - 2 . 56 ( m , 2h ), 4 . 30 ( quint , 1h , j = 6 . 8 hz ), 5 . 27 . ( br s , 1h ); [ 0722 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 17 . 9 , 22 . 7 , 23 . 6 , 28 . 3 , 29 . 2 , 29 . 3 , 29 . 4 , 29 . 6 , 29 . 7 , 31 . 9 , 39 . 2 , 55 . 0 , 209 . 7 ; esms calcd for c 23 h 45 no 3 na ( m + na ) 406 . 3 , found 406 . 3 . according to the method of example 95 , from ketone 125 ( 24 mg , 0 . 063 mmol ), hydrochloride 126 was obtained as a white solid ( 17 mg , 85 % yield ). [ 0726 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 35 ( m , 24h ), 1 . 51 ( d , 3h , j = 7 . 4 hz ), 1 . 55 - 1 . 65 ( m , 2h ), 2 . 50 - 2 . 72 ( m , 2h ), 4 . 13 ( q , 1h , j = 7 . 4 hz ); [ 0727 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 4 , 15 . 7 , 23 . 7 , 24 . 3 , 30 . 1 , 30 . 5 , 30 . 5 , 30 . 6 , 30 . 8 , 33 . 1 , 39 . 2 , 55 . 8 , 207 . 4 ; esms calcd for c 18 h 38 no ( m − cl ) 284 . 3 , found 284 . 3 . to a solution of ketone 126 ( 108 mg , 0 . 34 mmol ) in 2 . 5 ml of etoh , nh 2 oh . hcl ( 117 mg , 1 . 69 mmol ) and acona ( 249 mg , 3 . 04 mmol ) were added . the mixture was stirred at 80 ° c . for 8 h , and then the solvent was evaporated in vacuo . the residue was suspended in h 2 o , filtered and washed with h 2 o . the collected solid was recystallised from etoac to obtain oxime 127 as a white solid ( 70 mg , 69 % yield ). [ 0731 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 35 ( m , 27h ), 1 . 55 - 1 . 65 ( m , 2h ), 2 . 18 ( ddd , 1h , j = 12 . 9 , 10 . 1 , 6 . 0 hz ), 2 . 47 ( ddd , 1h , j = 12 . 9 , 9 . 6 , 6 . 4 hz ), 3 . 72 ( q , 1h , j = 6 . 7 hz ); [ 0732 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 5 , 18 . 3 , 23 . 7 , 24 . 0 , 26 . 6 , 26 . 7 , 30 . 4 , 30 . 5 , 30 . 7 , 30 . 8 , 31 . 0 , 33 . 1 , 50 . 2 , 158 . 0 ; esms calcd for c 18 h 39 n 2 o ( m + h ) 299 . 3 , found 299 . 3 . according to the method of example 119 , from aminoalcohol 2 ( 59 mg , 0 . 197 mmol ), ketone 128 was obtained as a white solid ( 44 mg , 56 % yield ). [ 0737 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 85 ( t , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 37 ( m , 29h ), 1 . 42 ( s , 9h ), 1 . 54 - 1 . 62 ( m , 2h ), 2 . 38 - 2 . 56 ( m , 2h ), 4 . 28 ( quint , 1h , j = 6 . 7 hz ), 5 . 29 ( br d , 1h , j = 6 . 2 hz ); [ 0738 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 0 , 17 . 8 , 22 . 6 , 23 . 5 , 28 . 3 , 29 . 2 , 29 . 3 , 29 . 4 , 29 . 5 , 29 . 6 , 31 . 9 , 39 . 1 , 55 . 0 , 209 . 7 ; esms calcd for c 24 h 47 no 3 na ( m + na ) 420 . 4 , found 420 . 2 . according to the method of example 95 , from ketone 128 ( 33 mg , 0 . 083 mmol ), hydrochloride 129 was obtained as a white solid ( 25 mg , 90 % yield ). [ 0742 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 35 ( m , 26h ), 1 . 51 ( d , 3h , j = 7 . 4 hz ), 1 . 55 - 1 . 65 ( m , 2h ), 2 . 50 - 2 . 72 ( m , 2h ), 4 . 13 ( q , 1h , j = 7 . 4 hz ); [ 0743 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 4 , 15 . 7 , 23 . 7 , 24 . 3 , 30 . 1 , 30 . 5 , 30 . 5 , 30 . 6 , 30 . 8 , 33 . 1 , 39 . 2 , 55 . 8 , 207 . 4 ; esms calcd for c 19 h 40 no ( m − cl ) 298 . 3 , found 298 . 3 . according to the method of example 119 , from aminoalcohol 3 ( 81 mg , 0 . 258 mmol ), ketone 130 was obtained as a white solid ( 75 mg , 70 % yield ). [ 0748 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 86 ( t , 3h , j = 6 . 2 hz ), . 1 . 20 - 1 . 37 ( m , 31h ), 1 . 42 ( s , 9h ), 1 . 54 - 1 . 62 ( m , 2h ), 2 . 38 - 2 . 56 ( m , 2h ), 4 . 29 ( quint , 1h , j = 6 . 5 hz ), 5 . 29 ( br d , 1h , j = 5 . 4 hz ); [ 0749 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 0 , 17 . 8 , 22 . 6 , 23 . 5 , 28 . 3 , 29 . 2 , 29 . 3 , 29 . 4 , 29 . 5 , 29 . 6 , 31 . 9 , 39 . 1 , 55 . 0 , 209 . 6 ; esms calcd for c 25 h 49 no 3 na ( m + na ) 434 . 4 , found 434 . 3 . according to the method of example 95 , from ketone 130 ( 47 mg , 0 . 114 mmol ), hydrochloride 131 was obtained as a white solid ( 30 . 5 mg , 77 % yield ). [ 0753 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 35 ( m , 28h ), 1 . 50 ( d , 3h , j = 7 . 2 hz ), 1 . 55 - 1 . 65 ( m , 2h ), 2 . 50 - 2 . 72 ( m , 2h ), 4 . 13 ( q , 1h , j = 7 . 2 hz ); [ 0754 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 4 , 15 . 7 , 23 . 7 , 24 . 3 , 30 . 1 , 30 . 5 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 8 , 33 . 1 , 39 . 2 , 55 . 8 , 207 . 4 ; esms calcd for c 20 h 42 no ( m − cl ) 312 . 3 , found 312 . 3 . according to the method of example 119 , from aminoalcohol 57 ( 82 mg , 0 . 274 mmol ), ketone 132 was obtained as a white solid ( 54 mg , 50 % yield ). [ 0759 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 86 ( t , 6h , j = 7 . 0 hz ), 1 . 20 - 1 . 35 ( m , 24h ), 1 . 43 ( s , 9h ), 1 . 55 - 1 . 65 ( m , 3h ), 1 . 84 - 1 . 96 ( m , 1h ), 2 . 38 - 2 . 56 ( m , 2h ), 4 . 28 ( q , 1h , j = 5 . 5 hz ), 5 . 24 ( br d , 1h , j = 6 . 9 hz ); [ 0760 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ9 . 2 , 14 . 0 , 22 . 6 , 23 . 5 , 24 . 8 , 28 . 3 , 29 . 2 , 29 . 3 , 29 . 4 , 29 . 6 , 29 . 6 , 31 . 9 , 39 . 8 , 60 . 1 , 209 . 4 ; esms calcd for c 24 h 47 no 3 na ( m + na ) 420 . 4 , found 420 . 3 . according to the method of example 95 , from ketone 132 ( 36 . 5 mg , 0 . 092 mmol ),. hydrochloride 133 was obtained as a white solid ( 29 mg , 95 % yield ). [ 0764 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 7 hz ), 1 . 00 ( t , 3h , j = 7 . 5 hz ), 1 . 20 - 1 . 35 ( m , 24h ), 1 . 55 - 1 . 65 ( m , 2h ), 1 . 82 - 1 . 96 ( m , 1h ), 2 . 00 - 2 . 12 ( m , 1h ), 2 . 50 - 2 . 72 ( m , 2h ), 4 . 11 ( dd , 1h , j = 7 . 2 , 4 . 5 hz ); [ 0765 ] 13 c nmr ( 75 mhz , cd 3 od ) δ9 . 3 , 14 . 5 , 23 . 8 , 23 . 9 , 24 . 3 , 30 . 1 , 30 . 5 , 30 . 5 , 30 . 6 , 30 . 7 , 30 . 8 , 33 . 1 , 39 . 8 , 61 . 0 , 207 . 1 ; esms calcd for c 19 h 40 no ( m − cl ) 298 . 3 , found 298 . 3 . according to the method of example 119 , from aminoalcohol 81 ( 53 mg , 0 . 186 mmol ), ketone 134 was obtained as a white solid ( 40 mg , 56 % yield ). [ 0770 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 4 hz ), 1 . 20 - 1 . 37 ( m , 27h ), 1 . 43 ( s , 9h ), 1 . 54 - 1 . 62 ( m , 2h ), 2 . 38 - 2 . 56 ( m , 2h ), 4 . 30 ( quint , 1h , j = 6 . 8 hz ), 5 . 27 ( br s , 1h ); [ 0771 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 17 . 9 ,. 22 . 7 , 23 . 6 , 28 . 3 , 29 . 2 , 29 . 3 , 29 . 4 , 29 . 6 , 29 . 7 , 31 . 9 , 39 . 2 , 55 . 0 , 209 . 7 ; esms calcd for c 23 h 45 no 3 na ( m + na ) 406 . 3 , found 406 . 2 . according to the method of example 95 , from ketone 134 ( 30 mg , 0 . 078 mmol ), hydrochloride 135 was obtained as a white solid ( 24 mg , 96 % yield ). [ 0775 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 89 ( t , 3h , j = 6 . 9 hz ), 1 . 20 - 1 . 35 ( m , 24h ), 1 . 51 ( d , 3h , j = 7 . 4 hz ), 1 . 55 - 1 . 65 ( m , 2h ), 2 . 50 - 2 . 72 ( m , 2h ), 4 . 13 ( q , 1h , j = 7 . 4 hz ); [ 0776 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 4 , 15 . 7 , 23 . 7 , 24 . 3 , 30 . 1 , 30 . 5 , 30 . 5 , 30 . 6 , 30 . 8 , 33 . 1 , 39 . 2 , 55 . 8 , 207 . 4 ; esms calcd for c 18 h 38 no ( m − cl ) 284 . 3 , found 284 . 2 . to a solution of d - erythro - sphingosine ( 46 mg , 0 . 153 mmol ) in ch 2 cl 2 ( 1 . 5 ml ) at room temperature , et 3 n ( 32 μl , 0 . 230 mmol ), tbdpscl ( 44 μl , 0 . 169 mmol ) and 4 - dmap ( ca . 5 mg , cat .) were added . after stirring for 4 h , the reaction was quenched with h 2 o ( 10 ml ), extracted with etoac ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 5 : 1 to 100 % etoac ) to obtain 136 as a colorless oil ( 33 mg , 40 % yield ). [ 0781 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 6 . 9 hz ), 1 . 06 ( s , 9h ), 1 . 20 - 1 . 40 ( m , 22h ), 1 . 91 ( br s , 3h ), 2 . 01 ( q , 2h , j = 6 . 5 hz ), 2 . 93 ( q , 1h , j = 5 . 5 hz ), 3 . 69 ( d , 2h , j = 4 . 5 hz ), 4 . 09 ( t , 1h , j = 6 . 1 hz ), 5 . 40 ( dd , 1h , j = 15 . 3 , 6 . 9 hz ), 5 . 73 ( dt , 1h , j = 15 . 4 , 6 . 5 hz ), 7 . 35 - 7 . 46 ( m , 6h ), 7 . 64 - 7 . 68 ( m , 4h ); [ 0782 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 19 . 2 , 22 . 7 , 26 . 8 , 29 . 2 , 29 . 2 , 29 . 3 , 29 . 5 , 29 . 6 , 29 . 7 , 31 . 9 , 32 . 3 , 56 . 3 , 66 . 2 , 74 . 6 , 127 . 7 , 128 . 9 , 129 . 8 , 133 . 1 , 134 . 1 , 135 . 5 ; esms calcd for c 34 h 56 no 2 si ( m + h ) 538 . 4 , found 538 . 4 . according to the method of example 105 , from aminoalcohol 136 ( 33 mg , 0 . 061 mmol ), oxazolidinone 137 was obtained as a colorless oil ( 32 mg , 92 % yield ). [ 0787 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 86 ( t , 3h , j = 7 . 0 hz ), 1 . 06 ( s . 9h ), 1 . 20 - 1 . 40 ( m , 22h ), 2 . 00 ( q , 2h , j = 6 . 9 hz ), 3 . 58 ( dd , 1h , j = 10 . 6 , 4 . 7 hz ), 3 . 64 ( dd , 1h , j = 10 . 6 , 6 . 7 hz ), 3 . 82 - 3 . 88 ( m , 1h ), 5 . 02 ( t , 1h , j = 8 . 1 hz ), 5 . 32 ( br s , 1h ), 5 . 51 ( dd , 1h , j = 15 . 4 , 8 . 1 hz ), 5 . 83 ( dt , 1h , j = 15 . 4 , 6 . 5 hz ), 7 . 37 - 7 . 46 ( m , 6h ), 7 . 61 - 7 . 65 ( m , 4h ); [ 0788 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 19 . 1 , 22 . 7 , 26 . 7 , 28 . 7 , 29 . 1 , 29 . 3 , 29 . 4 , 29 . 5 , 29 . 6 , 31 . 9 , 32 . 1 , 57 . 2 , 63 . 1 , 79 . 4 , 122 . 1 , 127 . 9 ,, 130 . 0 , 132 . 7 , 135 . 5 , 138 . 4 , 158 . 9 ; esms calcd for c 35 h 53 no 3 sina ( m + na ) 586 . 4 , found 586 . 5 . to a solution of 137 ( 32 mg , 0 . 057 mmol ) in thf ( 0 . 6 ml ) at room temperature , tbaf ( 1m in thf , 113 μl , 0 . 113 mmol ) was added . after stirring for 30 min , the reaction was quenched with h 2 o ( 10 ml ), extracted with etoac ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 1 : 1 to 1 : 5 ) to obtain alcohol 138 as a white solid ( 13 mg , 70 % yield ). [ 0793 ] 1 h nmr ( 300 mhz , cd 3 od ) δ0 . 90 ( t , 3h , j = 6 . 7 hz ), 1 . 25 - 1 . 50 ( m , 22h ), 2 . 12 ( q , 2h , j = 6 . 9 hz ), 3 . 51 ( dd , 1h , j = 11 . 6 , 5 . 9 hz ), 3 . 58 ( dd , 1h , j = 11 . 6 , 4 . 0 hz ), 3 . 84 ( ddd , 1h , j = 8 . 4 , 5 . 9 , 4 . 2 hz ), 5 . 10 ( t , 1h , j = 8 . 2 hz ), 5 . 67 ( dd , 1h , j = 15 . 4 , 8 . 2 hz ), 5 . 90 ( dt , 1h ,. j = 15 . 4 , 6 . 7 hz ); [ 0794 ] 13 c nmr ( 75 mhz , cd 3 od ) δ14 . 5 , 23 . 8 , 30 . 0 , 30 . 2 , 30 . 5 , 30 . 6 , 30 . 8 , 33 . 1 , 33 . 3 , 58 . 7 , 62 . 2 , 81 . 5 , 124 . 4 , 139 . 1 , 168 . 1 ; esms calcd for c 19 h 35 no 3 na ( m + na ) 348 . 3 , found 348 . 2 . to a cold (− 78 ° c .) solution of 138 ( 11 . 5 mg , 0 . 035 mmol ) in thf ( 0 . 35 ml ), dast ( 14 μl , 0 . 106 mmol ) was added . after stirring for 30 min , the mixture was warmed up to room temperature and stirred for 2 h . the reaction was quenched with nahco 3 ( 5 ml ), extracted with etoac ( 3 × 10 ml ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography , on silica ( hexane / etoac 1 : 1 ) to obtain fluoride 139 as a white solid ( 7 . 5 mg , 65 % yield ). [ 0799 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 88 ( t , 3h , j = 7 . 0 hz ), 1 . 20 - 1 . 40 ( m , 22h {), 2 . 09 ( q , 2h , j = 6 . 9 hz ), 4 . 03 - 4 . 13 ( m , 1h ), 4 . 41 ( dm , 2h , j = 46 . 5 hz ), 5 . 11 ( t , 1h , j = 7 . 9 hz ), 5 . 44 ( br s , 1h ), 5 . 48 ( dd , 1h , j = 15 . 3 , 8 . 1 hz ), 5 . 95 ( dt , 1h , j = 15 . 3 , 7 . 0 hz ); [ 0800 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 22 . 6 , 28 . 6 , 29 . 1 , 29 . 3 , 29 . 4 , 29 . 5 , 29 . 6 , 31 . 9 , 32 . 2 , 55 . 3 ( d ), 79 . 0 ( d ), 81 . 8 ( d ), 121 . 4 , 139 . 4 , 159 . 3 ; esms calcd for c 19 h 34 fno 2 na ( m + na ) 350 . 3 , found 350 . 2 . to a solution of 139 ( 46 mg , 0 . 140 mmol ) in dioxane ( 2 . 5 ml ), naoh ( 1m , 1 . 40 ml , 1 . 405 mmol ) was added . after stirring for 4 h at 100 ° c ., the reaction was quenched with h 2 o ( 10 ml ), extracted with etoac ( 3 × 10 mi ), dried over na 2 so 4 and concentrated in vacuo . the crude was purified by column chromatography on silica ( hexane / etoac 1 : 1 to 100 % etoac ) to obtain aminoalcohol 140 as a white solid ( 20 mg , 47 % yield ). [ 0805 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 2 hz ), 1 . 20 - 1 . 40 ( m , 22h ), 1 . 79 ( br s , 3h ), 2 . 05 ( q , 2h , j = 6 . 9 hz ), 3 . 03 - 3 . 13 ( m , 1h ), 4 . 05 ( t , 1h , j = 6 . 4 hz ), 4 . 40 ( ddd , 1h , j = 47 . 5 , 9 . 2 , 6 . 9 hz ), 4 . 51 ( ddd , 1h , j = 47 . 0 , 9 . 2 , 4 . 2 hz ), 5 . 44 ( dd , 1h , j = 15 . 6 , 7 . 4 hz ), 5 . 76 ( dt , 1h , j = 15 . 4 , 6 . 9 hz ); [ 0806 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 22 . 7 , 29 . 1 , 29 . 2 , 29 . 3 , 29 . 4 , 29 . 6 , 29 . 6 , 31 . 9 , 32 . 3 , 55 . 2 ( d ), 73 . 1 ( d ), 85 . 2 ( d ), 128 . 4 , 135 . 2 ; esms calcd for c 18 h 37 fno ( m + h ) 302 . 3 , found 302 . 2 . according to the method of example 89 , from olefin 140 ( 4 mg , 0 . 013 mmol ), aminoalcohol 141 was obtained as a white solid ( 1 . 8 mg , 45 % yield ). [ 0810 ] 1 h nmr ( 300 mhz , cdcl 3 ) δ0 . 87 ( t , 3h , j = 6 . 7 hz ), 1 . 20 - 1 . 40 ( m , 26h ), 1 . 50 - 1 . 60 ( m , 2h ), 1 . 87 ( br s , 3h ), . 3 . 04 - 3 . 14 ( m , 1h ), 3 . 54 - 3 . 62 ( m , 1h ), 4 . 40 ( ddd , 1h , j = 48 . 0 ,: 9 . 2 , 7 . 4 hz ), 4 . 56 ( ddd , 1h , j = 46 . 8 , 9 . 2 , 3 . 9 hz ); [ 0811 ] 13 c nmr ( 75 mhz , cdcl 3 ) δ14 . 1 , 22 . 7 , 26 . 0 , 29 . 3 , 29 . 6 , 29 . 7 , 31 . 9 , 32 . 9 , 55 . 0 ( d ), 72 . 5 ( d ), 85 . 1 ( d ); esms calcd for c 18 h 39 fno ( m + h ) 304 . 3 , found 304 . 3 . | 2 |
hereinafter , preferred embodiments of the present disclosure will be described in detail with reference to the appended drawings . note that , in this specification and the appended drawings , structural elements that have substantially the same function and structure are denoted with the same reference numerals , and repeated explanation of these structural elements is omitted . hereinafter , an embodiment of the present disclosure will be described in the following order . 1 . storage element according to embodiment 2 . configuration of storage device according to embodiment 3 . specific configuration according to embodiment 4 . experiment according to embodiment first , a storage element according to an embodiment of the present disclosure will be described . in the embodiment of the present disclosure , information is recorded by reversing the direction of magnetization of a storage layer of the storage element through the above - described spin torque magnetization reversal . the storage layer is configured by a magnetic body including a ferromagnetic layer and information is held according to a magnetization state ( the direction of magnetization ). for example , a storage element 3 has a layer configuration shown in fig3 . the storage element 3 includes at least a storage layer 17 and a magnetization fixing layer 15 as two ferromagnetic layers and includes an insulation layer 16 as an intermediate layer between the two ferromagnetic layers . the storage element 3 further includes a cap layer 18 on the storage layer 17 and includes an underlying layer 14 below the magnetization fixing layer 15 . the storage layer 17 has magnetization perpendicular to a film surface . the direction of the magnetization is changed so as to correspond to the information . the magnetization fixing layer 15 has magnetization perpendicular to a film surface serving as a reference of the information stored in the storage layer 17 . the insulation layer 16 is a non - magnetic body and is formed between the storage layer 17 and the magnetization fixing layer 15 . when spin - polarized electrons are injected in a lamination direction of the layer configuration of the storage layer 17 , the insulation layer 16 , and the magnetization fixing layer 15 , the direction of the magnetization of the storage layer 17 is changed and information is thus recorded on the storage layer 17 . electrons have two kinds of spin angular momenta . here , the electrons are defined as upward electrons and downward electrons . in the non - magnetic body , the upward and downward electrons are the same in number . in the ferromagnetic body , the upward and downward electrons are different in number . in the magnetization fixing layer 15 and the storage layer 17 , which are two ferromagnetic layers of the storage element 3 , a case in which electrons are moved from the magnetization fixing layer 15 to the storage layer 17 when the directions of magnetic moments are opposite to one another will be considered . the magnetization fixing layer 15 is a fixing magnetic layer in which the direction of a magnetic moment is fixed to ensure high coercivity . in the electrons passing through the magnetization fixing layer 15 , spin polarization occurs , that is , there is a difference in number between the upward and downward electrons . when the non - magnetic insulation layer 16 has a sufficient thickness , the electrons reach the other magnetic body , that is , the storage layer 17 , before the spin polarization of the electrons passing through the magnetization fixing layer 15 is alleviated and the electrons enter a non - polarized state ( in which the upward and downward electrons are the same in umber ) in a normal non - magnetic body . in the storage layer 17 , since the sign of the degree of spin polarization is opposite , some of the electrons are reversed , that is , the direction of the spin angular momentum is changed to lower the energy of a system . at this time , since the entire angular momenta of the system have to be conserved , the reaction equivalent to the sum of the change in the angular momenta caused by the electrons of which the direction is changed is applied to the magnetic moment of the storage layer 17 . when a current , that is , the number of electrons passing in a unit time , is small , the total number of electrons of which the direction is changed is also small . therefore , a change in the angular momentum occurring in the magnetic moment of the storage layer 17 is also small . however , when the current increases , the angular momentum can be considerably changed in a unit time . a time change of an angular momentum is a torque . when a torque is greater than a given threshold , the magnetic moment of the storage layer 17 starts a precession movement . the magnetic moment is stabilized after the magnetic moment rotates by 180 degrees by uniaxial anisotropy . that is , the magnetic moment is reversed from an opposite direction to the same direction . when a current reversely flows in a direction in which electrons are sent from the storage layer 17 to the magnetization fixing layer 15 in a state of the same direction of the magnetization , a torque is applied in a case in which the electrons are reflected from the magnetization fixing layer 15 and the spin - reversed electrons enter the storage layer 17 . then , the magnetic moment can be reversed in the opposite direction . at this time , the amount of current necessary to cause the reversal is greater compared to a case in which the magnetic moment is reversed from the opposite direction to the same direction . it is difficult to intuitively understand the reversal of the magnetic moment from the same direction to the opposite direction , but the storage layer 17 may be considered to be reversed to conserve the entire angular momenta of a system without the reversal of the magnetic moment since the magnetization fixing layer 15 is fixed . thus , “ 0 / 1 ” is recorded by causing a current corresponding to each polarity and equal to or greater than a given threshold to flow in the direction from the magnetization fixing layer 15 to the storage layer 17 or in the opposite direction . information is read using a magnetic resistive effect , as in an mram according to the related art . that is , a current flows in a direction perpendicular to a film surface , as in the recording case described above . the change phenomenon of electric resistance of an element is used depending on whether the direction of the magnetic moment of the storage layer 17 is the same as or opposite to the direction of the magnetic moment of the magnetization fixing layer 15 . a metal or insulation material may be used as the material of the insulation layer 16 formed between the magnetization fixing layer 15 and the storage layer 17 . when an insulation material is used as the material of the insulation layer 16 , a high reading signal ( resistance change ratio ) can be obtained and information can be recorded with a lower current . in this case , an element is referred to as a magnetic tunnel junction ( mtj ) element . when the direction of the magnetization of a magnetic layer is reversed through spin torque magnetization reversal , a threshold value ic of a necessary current is different depending on whether a magnetization - easy axis of the magnetic layer is in an in - plane direction or a vertical direction . the storage element according to the embodiment is a vertical magnetization type storage element . a reversal current used to reverse the direction of the magnetization of the magnetic layer is assumed to be ic_para in an in - plane magnetization type storage element according to the related art . when the magnetization is reversed from the same direction to the opposite direction ( where the same direction and the opposite direction are the directions of the magnetization of the storage layer considered using the direction of the magnetization of the magnetization fixing layer as a reference ), “ ic_para =( a · α · ms · v / g ( 0 )/ p )( hk + 2πms )” is satisfied . when the magnetization is reversed from the opposite direction to the same direction ), “ ic_para =−( a · α · ms · v / g ( π )/ p )( hk + 2πms )” is satisfied ( which is referred to as equation ( 1 )). on the other hand , a reversal current of the vertical magnetization type storage element is assumed to be ic_perp . when the magnetization is reversed from the same direction to the opposite direction , “ ic_perp =( a · α · ms · v / g ( 0 )/ p )( hk − 4πms )” is satisfied . when the magnetization is reversed from the opposite direction to the same direction , “ ic_perp =−( a · α · ms · v / g ( π )/ p )( hk − 4πms )” is satisfied ( which is referred to as equation ( 2 )). in the equations , a denotes a constant , a denotes a damping constant , ms denotes saturated magnetization , v denotes an element volume , p denotes spin polarizability , g ( 0 ) and g ( π ) denote coefficients corresponding to efficiency of a spin torque applied to a magnetic layer in the same direction and the opposite direction , respectively , and hk denotes magnetic anisotropy ( see nature materials ., 5 , 210 ( 2006 )). when the vertical magnetization type storage element ( hk − 4πms ) is compared to the in - plane magnetization type storage element ( hk + 2πms ) in the above - mentioned equations , the vertical magnetization type storage element can be understood to be suitable by a low recording current . in this embodiment , the storage element 3 is configured to include a magnetic layer ( the storage layer 17 ) in which information can be held according to a magnetization state and the magnetization fixing layer 15 in which the direction of the magnetization is fixed . to function as a storage device , written information has to be held . the value of an index δ (= kv / k b t ) of thermal stability is used as the index of the capability of holding information . here , δ is expressed by equation ( 3 ) below . in this equation , hk is an effective anisotropy field , k b is the boltzmann &# 39 ; s constant , t is temperature , ms is a saturated magnetization amount , v is the volume of the storage layer 17 , and k is anisotropic energy . the effective anisotropy field hk receives the influence of magnetic anisotropy such as shape magnetic anisotropy , induced magnetic anisotropy , or crystal magnetic anisotropy . when a single - section simultaneous rotation model is supposed , the effective anisotropy is equal to coercivity . further , when the threshold value ic is expressed in relation to above , equation ( 4 ) below is established . in this equation , e is an element charge , k b is the boltzmann &# 39 ; s constant , t is temperature , ms is a saturated magnetization amount , α is a gilbert damping constant , h bar is the flank &# 39 ; s constant , and is spin injection efficiency . when the values of hk , ms , α , and η are determined according to equation ( 3 ) and equation ( 4 ), δ and ic are proportional to the volume v of the recording layer . that is , when the volume v of the recording layer increases , δ and ic increase . conversely , when the volume v of the storage layer decreases , δ and ic decrease . this principle can be understood from the above - mentioned theoretical equation . however , in the actual storage layer , it has been found that an increasing rate of δ and ic with respect to the volume of the storage layer is changed when the volume of the storage layer is equal to or greater than a given size . according to this relation , when the volume of the storage layer is equal to or greater than the given size , only ic increases without an increase in δ in spite of the fact that the volume of the storage layer increases over the given size . this means that a ratio between δ and ic decreases when the volume of the storage layer is greater than a given size of the storage layer . therefore , it is difficult to establish an effective existence condition of the st - mram as a non - volatile memory , that is , compatibility between low - current information recording and high thermal stability of recorded information . accordingly , it is important to balance the value of the index δ of the thermal stability and the threshold value ic . in many cases , the value of the index δ of the thermal stability and the threshold value ic have a tradeoff relation . therefore , the compatibility is a task of maintaining the memory characteristics . with regard to the threshold value of the current used to change the magnetization state of the storage layer 17 , in fact , the thickness of the storage layer 17 is , for example , 2 nm . in a substantially elliptical tmr element with a planar pattern of 100 nm × 150 nm , the threshold value + ic of a positive side is equal to + 0 . 5 ma and the threshold value − ic of a negative side is equal to − 0 . 3 ma . at this time , a current density is about 3 . 5 × 10 6 a / cm 2 . these values are identical to those in equation ( 1 ). however , in a normal mram in which magnetization is reversed through a current magnetic field , a writing current of a few ma or more is necessary . accordingly , in the st - mram , the threshold value of the writing current is sufficiently small , as described above . therefore , the threshold value can be understood to be effective for reducing the power consumption of an integrated circuit . further , since a wiring line necessary in the normal mram to generate a current magnetic field is not necessary , the advantage of the degree of integration can be obtained compared to the normal mram . when the spin torque magnetization reversal is performed , information is written ( recorded ) by causing a current to flow directly to the storage element 3 . therefore , the storage device includes the storage element 3 and a selection transistor connected to each other to select the storage element 3 that writes information . in this case , the current flowing in the storage element 3 is restricted by the magnitude of the current ( the saturated current of the selection transistor ) that can flow in the selection transistor . the vertical magnetization type storage element is preferably used to reduce the recording current , as described above . further , since a vertical magnetization film can have magnetic anisotropy higher than an in - plane magnetization film , the large index δ of the above - described thermal stability is preferably maintained . examples of a magnetic material with vertical anisotropy include alloys of rare - earths and transition metals ( tbcofe and the like ), metal multilayer films ( cd / pd multilayer films and the like ), ordered alloys ( fept and the like ), and materials using interfacial anisotropy ( co / mgo and the like ) between an oxide and a magnetic metal . the alloys of rare - earths and transition metals are not desirable as the material of the st - mram . this is because vertical magnetic anisotropy is lost when the alloys are diffused and crystallized by heating . the metal multilayer films are known to be diffused by heating and thus deteriorate in the vertical magnetic anisotropy and the vertical magnetic anisotropy is expressed when face - centered cubic ( 111 ) orientation is realized . therefore , it is difficult to realize ( 001 ) orientation necessary in a high polarizability layer such as mgo or fe , cofe , cofeb , or the like adjacent to mgo . since l 10 ordered alloys are stable at high temperatures and the vertical magnetic anisotropy is expressed at the ( 001 ) orientation time , the above - mentioned problems do not occur . however , since it is necessary to arrange atoms orderly by performing heating at the sufficiently high temperature of 500 ° c . or more during manufacturing or by performing heating at the sufficiently high temperature of 500 ° c . or more after the manufacturing , there is a probability that undesirable diffusion may occur in another portion of a laminated layer such as a tunnel barrier or interface roughness may increase . however , the above - mentioned problems rarely occur for a material using interface magnetic anisotropy , that is , a material in which a co - based material or a fe - based material is laminated on mgo serving as a tunnel barrier . therefore , the material is expected as the material of the storage layer of the st - mram . in this embodiment , a material having co — fe — b as a base is used as the material of the storage layer 17 . several elements of ti , v , nb , zr , ta , hf , y , and the like may be added as non - magnetic metals to co — fe — b . further , in consideration of the saturated current value of the selection transistor , an mtj element is configured using a tunnel insulation layer that includes an insulator as the non - magnetic insulation layer 16 between the storage layer 17 and the magnetization fixing layer 15 . when the mtj element is configured using the tunnel insulation layer , a magnetoresistance ratio ( mr ratio ) can be increased compared to a case in which a grant magnetoresistive effect ( gmr ) element is configured using a non - magnetic conductive layer . therefore , the intensity of a reading signal can be increased . in particular , the magnetoresistance ratio ( mr ratio ) can be increased using magnesium oxide ( mgo ) as the material of the insulation layer 16 serving as a tunnel insulation layer . in general , a spin transfer efficiency depends on the mr ratio . the larger the mr ratio is , the more the spin transfer efficiency is improved . therefore , a magnetization reversal current density can be reduced . accordingly , by using the magnesium oxide as the material of the tunnel insulation layer and the storage layer 17 , it is possible to reduce the threshold value of the writing current through the spin torque magnetization reversal . therefore , information can be written ( recorded ) with a lower current . further , the intensity of the reading signal can be increased . thus , since the mr ratio ( tmr ratio ) can be ensured and the threshold value of the writing current can be reduced through the spin torque magnetization reversal , information can be written ( recorded ) with a lower current . further , the intensity of the reading signal can be increased . when the tunnel insulation layer is formed of a magnesium oxide ( mgo ) film , the mgo film is crystallized . therefore , crystal orientation is more preferably maintained in the 001 direction . in this embodiment , the insulation layer 16 ( the tunnel insulation layer ) formed between the storage layer 17 and the magnetization fixing layer 15 is formed of not only magnesium oxide but also various insulators such as aluminum oxide , aluminum nitride , sio 2 , bi 2 o 3 , mgf 2 , caf , srtio 2 , allao 3 , and al — n — o , a dielectric material , a semiconductor , or the like . it is necessary to control the area resistive value of the insulation layer 16 serving as the tunnel insulation layer such that the area resistive value is equal to or less than about tens of ωμm 2 in terms of obtainment of the current density necessary for reversing the direction of the magnetization of the storage layer 17 through the spin torque magnetization reversal . in the tunnel insulation layer formed of a mgo film , the thickness of the mgo film should be set 1 . 5 nm or less , so that the area resistive value is in the above - described range . in the st - mram , 0 and 1 of information are determined by relative angles of magnetization m 17 of the storage layer 17 and magnetization m 15 of the magnetization fixing layer 15 . the underlying layer 14 is formed below the magnetization fixing layer 15 and the cap layer 18 is formed on the storage layer 17 . in this embodiment , the insulation layer 16 is formed as a magnesium oxide layer to increase the magnetoresistance ratio ( mr ratio ). by increasing the mr ratio , it is possible to improve the spin injection effect and reduce the current density necessary for reversing the direction of the magnetization m 17 of the storage layer 17 . the storage device shown in fig1 and including the storage element 3 shown in fig2 has the advantage of applying a general semiconductor mos forming process when a storage device is manufactured . accordingly , the storage device according to this embodiment is applicable to a general - purpose memory . since the size of the storage layer 17 can be less than a size in which the direction of the magnetization is simultaneously changed , the power consumption can be suppressed to be as small as possible . thus , it is possible to realize the st - mram using the thermal stability of the storage element 3 as much as possible . the specific size of the storage layer 17 of the storage element 3 is preferably equal to or less than a diameter of 45 nm . thus , it is possible to realize the storage element 3 that has excellent characteristic balance while ensuring the thermal stability as the information holding capability with low power consumption . since the operation margin of the storage element 3 can be sufficiently obtained by removing an operation error , the storage element 3 can stably operate . accordingly , it is possible to realize a storage device operating stably and having high reliability . since the writing current is reduced , the power consumption can be reduced when information is written on the storage element 3 . accordingly , the entire power consumption of the storage device can be reduced . in this embodiment , a metal such as ta is used in the cap layer 18 formed to be adjacent to the storage layer 17 . an element other than co and fe may be added to the storage layer 17 according to the embodiment of the present disclosure . when a different kind of element is added , it is possible to obtain an effect of an improvement in heat resistance by diffusion prevention , an increase in the magnetoresistive effect , an increase in a dielectric strength voltage obtained with flattening , or the like . examples of the added element include b , c , n , o , f , mg , si , p , ti , v , cr , mn , ni , cu , ge , nb , mo , ru , rh , pd , ag , ta , w , ir , pt , au , zr , hf , re , os , or an alloy thereof . in the configuration of the storage layer 17 according to the embodiment of the present disclosure , another ferromagnetic layer may be directly laminated . further , a ferromagnetic layer and a soft magnetic layer may be laminated or a plurality of ferromagnetic layers may be laminated with a soft magnetic layer or a non - magnetic layer interposed therebetween . even when these magnetic layers are laminated , the advantages of the embodiment of the present disclosure can be obtained . in particular , when a plurality of ferromagnetic layers are laminated with a non - magnetic layer interposed therebetween , the strength of a mutual interaction between the ferromagnetic layers can be adjusted . therefore , it is possible to obtain the advantage of preventing the magnetization reversal current from increasing in spite of the fact that the dimension of the storage element 3 is equal to or less than a submicron . in this case , ru , os , re , ir , au , ag , cu , al , bi , si , b , c , cr , ta , pd , pt , zr , hf , w , mo , nb , or an alloy thereof can be used as the material of the non - magnetic layer . in the magnetization fixing layer 15 , the direction of the magnetization is fixed only from the ferromagnetic layer or using antiferromagnetic coupling of an antiferromagnetic layer and a ferromagnetic layer . the magnetization fixing layer 15 may include a single - layered ferromagnetic layer or may have a lamination ferri - pin structure in which a plurality of ferromagnetic layers are laminated with a non - magnetic layer interposed therebetween . as the material of the ferromagnetic layer of the magnetization fixing layer 15 having the lamination ferri - pin structure , co , cofe , cofeb , or the like can be used . as the material of the non - magnetic layer , ru , re , ir , os , or the like can be used . as the material of the antiferromagnetic layer , a femn alloy , a ptmn alloy , a ptcrmn alloy , a nimn alloy , an irmn alloy , or a magnetic body such as nio , fe 2 o 3 can be used . further , a non - magnetic element such as ag , cu , au , al , si , bi , ta , b , c , o , n , pd , pt , zr , hf , ir , w , mo , nb , or the like may be added to the magnetic body to adjust the magnetic characteristics or adjust various matter properties such as a crystal structure , a crystalline property , and substance stability . the remaining configuration other than the configuration of the storage layer 17 and the magnetization fixing layer 15 of the storage element 3 is the same as the configuration of the storage element 3 that records information through spin torque magnetization reversal according to the related art . in the configuration of the storage element 3 , the storage layer 17 may , of course , be disposed below the magnetization fixing layer 15 . in this case , the conductive oxide underlying layer undertakes the role of the conductive oxide cap layer . as described above , the storage element 3 has the lamination configuration in which the cap layer 18 , the storage layer 17 , the insulation layer 16 , the magnetization fixing layer 15 , and the underlying layer 14 are laminated from the upper layer side . however , the storage element 3 of this embodiment may have a configuration in which the storage layer 17 is laminated below the magnetization fixing layer 15 . specifically , the storage element 3 may have a configuration in which the cap layer 18 , the magnetization fixing layer 15 , the insulation layer 16 , the storage layer 17 , and the underlying layer 14 are formed sequentially from the upper layer side . next , the configuration of the storage device according to the embodiment of the present disclosure will be described . fig1 and 2 are schematic diagrams illustrating the storage device according to the embodiment . fig1 is a perspective view and fig2 is a sectional view . as shown in fig1 , the storage device according to the embodiment includes the storage element 3 configured by an st - ram capable of holding information by a magnetization state near an intersection of two kinds of addresses lines ( for example , a word line and a bit line ) perpendicular to one another . that is , a drain region 8 , a source region 7 , and a gate electrode 1 that form a selection transistor configured to select each storage device are formed in a portion isolated by element isolation layers 2 of a semiconductor base substrate 10 such as a silicon substrate . in particular , the gate electrode 1 also serves as one address line ( word line ) extending in the front and rear directions in the drawing . the drain region 8 is formed commonly in the selection transistors on the right and left of fig1 . a wiring line 9 is connected to the drain region 8 . the storage element 3 that is disposed above the source region 7 and includes the storage layer in which the direction of the magnetization is reversed through the spin torque magnetization reversal is disposed between the source region 7 and the bit line 6 extending in the right and left directions of fig1 . the storage element 3 is configured by , for example , an mtj element . as shown in fig2 , the storage element 3 includes two magnetic layers 15 and 17 . of the two - layered magnetic layers 15 and 17 , the magnetization fixing layer 15 is configured as a layer in which the direction of magnetization m 15 is fixed and the storage layer 17 is configured as a free magnetization layer in which the direction of magnetization m 17 is changed . the storage element 3 is connected to the bit line 6 and the source region 7 with upper and lower contact layers 4 interposed therebetween , respectively . thus , when a current flows in the storage element 3 in the vertical direction via two kinds of address lines 1 and 6 , the direction of the magnetization m 17 of the storage layer 17 can be reversed through the spin torque magnetization reversal . in such a storage device , it is necessary to write information using a current equal to or less than a saturated current of the selection transistor . therefore , the saturated current of the selection transistor is known to decrease with miniaturization of the storage device . accordingly , to miniaturize the storage device , it is necessary to improve the spin transfer efficiency and reduce the current flowing in the storage device 3 . further , to increase a reading signal , it is necessary to ensure a large magnetoresistance ratio . therefore , it is effective to use the above - described mtj structure , that is , the configuration of the storage element 3 in which the insulation layer is formed as the tunnel insulation layer ( tunnel barrier layer ) between the two layers of the magnetic layers 15 and 17 . when the tunnel insulation layer is used as the insulation layer , the amount of current flowing in the storage element 3 is restricted to prevent the insulation destruction of the tunnel insulation layer . that is , a current necessary for the spin torque magnetization reversal should be suppressed to ensure the reliability of overwriting of the storage element 3 . the current necessary for the spin torque magnetization reversal is also referred to as a reversal current or a recording current . since the storage device is a non - volatile memory , the storage device should stably store information written using a current . that is , it is necessary to ensure stability ( thermal stability ) against thermal fluctuation of the magnetization of the storage layer . when the thermal stability of the storage layer is not ensured , the reversed direction of the magnetization may be reversed again due to heat ( the temperature of an operation environment ) in some cases , and therefore a writing error may be caused . the storage element 3 of the storage device according to the embodiment of the present disclosure has the advantage of the scaling compared to an mram according to the related art , that is , the advantage of reducing the volume of the storage element . however , when the volume of the storage element is reduced , the thermal stability has a tendency to deteriorate under the same conditions of the other characteristics . when the st - mram has a large capacity , the volume of the storage element 3 is further reduced . therefore , to ensure the thermal stability is an important task . accordingly , the thermal stability is a very important characteristic of the storage element 3 in the st - mram . even when the volume of the storage element is reduced , the storage element should be designed to ensure the thermal stability . in the embodiment of the present disclosure , the size of the storage layer 17 of the storage element 3 is less than a size in which the direction of the magnetization is simultaneously changed . the specific size of the storage layer 17 of the storage element 3 is preferably equal to or less than a diameter of 45 nm thus , the power consumption is suppressed to be as small as possible . thus , it is possible to realize the st - mram using the thermal stability of the storage element 3 as much as possible . the writing current for the storage element 3 is reduced . since the power consumption is reduced , the entire power consumption of the storage device can be reduced . the storage device shown in fig1 and including the storage element 3 shown in fig2 has the advantage of applying a general semiconductor mos forming process when the storage device is manufactured . accordingly , the storage device according to this embodiment is applicable to a general - purpose memory . next , a specific configuration of the embodiment of the present disclosure will be described . in the configuration of the storage device , as described above with reference to fig1 , the storage element 3 capable of holding information according to a magnetization state is disposed near an intersection of two kinds of address lines 1 and 6 ( for example , a word line and a bit line ) perpendicular to each other . further , when a current flows in the storage element 3 in the vertical direction via two kinds of address lines 1 and 6 , the direction of the magnetization of the storage layer 17 can be reversed through the spin torque magnetization reversal . fig3 shows a detailed configuration of the storage element 3 . as shown in fig3 , the storage element 3 includes the magnetization fixing layer 15 below the storage layer 17 in which the direction of the magnetization m 17 is reversed through the spin torque magnetization reversal . in the st - mram , 0 and 1 of information are determined by relative angles of the magnetization m 17 of the storage layer 17 and the magnetization m 15 of the magnetization fixing layer 15 . the insulation layer 16 configured as a tunnel barrier layer ( tunnel insulation layer ) is disposed between the storage layer 17 and the magnetization fixing layer 15 , so that the mtj element is configured by the storage layer 17 and the magnetization fixing layer 15 . the underlying layer 14 is formed below the magnetization fixing layer 15 . the cap layer 18 is formed above the storage layer 17 ( that is , the side adjacent to the storage layer 17 and opposite to the insulation layer 16 ). in this embodiment , the storage layer 17 is a vertical magnetization layer formed of co — fe — b . the cap layer 18 is formed of a conductive oxide . the size of the storage layer 17 of the storage element 3 is less than a size in which the direction of the magnetization is simultaneously changed . the specific size of the storage layer 17 is preferably equal to or less than a diameter of 45 nm . in this embodiment , when the insulation layer 16 is formed of a magnesium oxide layer , the magnetoresistance ratio ( mr ratio ) can be increased . by increasing the mr ratio , it is possible to improve the spin injection effect and reduce the current density necessary to reverse the direction of the magnetization m 17 of the storage layer 17 . the storage element 3 according to this embodiment can be manufactured by continuously forming the underlying layer 14 to the cap layer 18 in a vacuum apparatus , and then forming the pattern of the storage element 3 by etching or the like . according to the above - described embodiment , since the storage layer 17 of the storage element 3 is a vertical magnetization layer , it is possible to reduce the amount of writing current necessary to reverse the direction of the magnetization m 17 of the storage layer 17 . thus , since the thermal stability can be sufficiently ensured as the information holding capability , the storage element 3 having the excellent characteristic balance can be configured . since an operation error can be presented and the operation margin of the storage element 3 can be sufficiently obtained , the storage element 3 can stably operate . that is , the storage device operating stably and having high reliability can be realized . further , since the wiring current is reduced , it is possible to reduce the power consumption when information is written on the storage element 3 . as a result , the storage device including the storage element 3 according to this embodiment can reduce the power consumption . thus , since a storage device having an excellent information holding characteristic and operating stably and reliably can be realized , the power consumption can be reduced in the storage device including the storage element 3 . further , the storage device shown in fig1 and including the storage element 3 shown in fig3 has the advantage of applying a general semiconductor mos forming process when the storage element is manufactured . accordingly , the storage device according to this embodiment is applicable to a general - purpose memory . here , samples of the storage element 3 were manufactured while changing the size of the storage layer 17 in the configuration of the storage element 3 described above with reference to fig1 to 3 , and the characteristics of the storage element 3 were inspected . in the actual storage device , as shown in fig1 , not only the storage element 3 but also a switching semiconductor circuit and the like are present . however , an examination was made on a wafer on which only the storage element 3 was formed to examine the magnetization reversal characteristic of the storage layer 17 adjacent to the cap layer 18 . a thermal oxide film with a thickness of 300 nm was formed on a silicon substrate with a thickness of 0 . 725 mm , and then the storage element 3 having the configuration shown in fig3 and 4 was formed on the thermal oxide film . specifically , the material and the thickness of each layer of the storage element 3 shown in fig3 were as follows . as shown in fig4 , the underlying layer 14 was formed as a lamination layer of a ta film with a thickness of 10 nm and a ru film with a thickness of 25 nm , the magnetization fixing layer 15 was formed as a layer including a copt film with a thickness of 2 . 0 nm , a ru film with a thickness of 0 . 8 nm , and a co — fe — b film with a thickness of 2 . 0 nm , the insulation layer 16 was formed as a magnesium oxide layer with a thickness of 0 . 9 nm , the storage layer 17 was formed as a cofeb layer ( a of fig4 ) or a cofeb / ta / cofeb layer ( b of fig4 ) with a thickness of 1 . 5 nm , and the cap layer 18 was formed as a layer including an oxide film with a thickness of 0 . 8 nm , a ta film with a thickness of 3 nm , a ru film with a thickness of 3 nm , and a ta film with a thickness of 3 nm . here , the storage element 3 shown in a of fig4 is indicated by sample 1 and the storage element 3 shown in b of fig4 is indicated by sample 2 . in the film configuration , the composition of cofeb of a ferromagnetic layer of the storage layer 17 was co at 16 %- fe at 64 %- b at 20 %. the insulation layer 16 configured by the magnesium oxide ( mgo ) film and the oxide film of the cap layer 18 were formed by an rf magnetron sputtering method and the other films were formed by a dc magnetron sputtering method . each sample was subjected to heat processing in a heat processing furnace in a magnetic field , after each layer was formed . thereafter , the cylindrical storage layers 17 with diameters of 30 nm , 40 nm , 65 nm , 75 nm , 90 nm , and 120 nm were manufactured by general electron beam lithography and a general ion milling process . the characteristics of each sample of the manufactured storage element 3 were evaluated as follows . before the measurement , a magnetic field was designed to be applied to the storage element 3 to control the values of the reversal current such that the values of the reversal current in positive and negative directions were symmetric . the voltage to be applied to the storage element 3 was set up to 1 v within a range in which the insulation layer 16 was not destructed . the saturated magnetization ms was measured through vsm measurement using a vibrating sample magnetometer . further , an anisotropy magnetic field hk was measured by applying a magnetic field in a plane - vertical direction and an in - plane direction and sweeping the magnetic field ( measurement of a reversal current value and thermal stability ). the reversal current value was measured to evaluate the writing characteristic of the storage element 3 according to this embodiment . the resistive value of the storage element 3 was then measured by causing a current with a pulse width in the range of 10 is to 100 ms to flow in the storage element 3 . further , the value of the current for which the direction of the magnetization m 17 of the storage layer 17 of the storage element 3 was reversed was calculated by changing the amount of current flowing in the storage element 3 . a value obtained by extrapolating the pulse width dependency of the value of the current at a pulse width of 1 ns was set as the value of the reversal current . the inclination of the pulse width dependency of the value of the reversal current corresponds to the index δ of the above - described thermal stability of the storage element 3 . as the value of the reversal current is changed less by the pulse width ( the inclination is small ), the thermal stability means the strong degree against heat disturbance . in consideration of a variation in the storage element 3 , twenty storage elements 3 with the same configuration were manufactured to carry out the above - described measurements , and the average values of the values of the reversal current and the indexes δ of the thermal stability were calculated . a reversal current density jc0 was calculated from the average value of the values of the reversal current obtained through the measurement and the area of the plane pattern of the storage element 3 . here , fig5 a and 5b show the size dependency of the storage layer 17 of the storage element 3 with respect to ic ( fig5 a ) and δ ( fig5 b ) obtained for sample 1 from the experiment . in fig5 a , it can be confirmed that ic increases as the size of the storage layer 17 increases , as anticipated from the equation of ic_perp . conversely , as shown in fig5 b , δ does not coincide with the relation shown in equation 3 . further , δ does not monotonically increase , even when the size of the storage element increases . to inspect the relation between δ and the size of the storage layer 17 in more detail , the saturated magnetization ms (= 760 emu / cc ) and the anisotropy magnetic field hk (= 2 koe ) were first inspected using vsm , and then δ expected from the values of the matter properties was calculated using the saturated magnetization ms , the anisotropy magnetic field hk , and equation 3 . fig6 shows a size dependency ( indicated by ▴ in the drawing ) of the storage layer 17 with respect to δ obtained from the experiment of sample 1 and a size dependency ( indicated by ♦ in the drawing ) of the storage layer 17 with respect to δ calculated based on the saturated magnetization ms and the anisotropy magnetic field hk obtained through the measurement of vsm . from fig6 , it can be understood that the calculation result and the experiment result coincide with each other up to about 40 nm which is the diameter of the storage layer 17 , but the calculation result and the experiment result are increasingly different from each other in the element size equal to or greater than 40 nm . in general , when a magnetic body is small , uniform ( simultaneous ) magnetization rotation occurs . when a magnetic body is large , uneven magnetization rotation easily occurs . the reason why the calculation result and the experiment result are different from one another is considered to be that the state of the matter property is changed when the magnetization of the storage layer 17 is reversed from the diameter of about 40 nm that is , when the size of the storage layer is equal to or less than the diameter of about 40 nm , the magnetization of the storage layer 17 is considered to be simultaneously rotated . when the size of the storage layer is greater than the diameter of about 40 nm , it is considered that the magnetization of partial portions in which rotation is easy in the storage layer 17 is initially reversed and the magnetization of the remaining portions is thus reversed due to the influence of the initial magnetization . in other words , the magnetization is considered to be unevenly rotated . when δ is regarded to be almost uniform in the storage layer 17 of which the size is equal to or greater than the diameter of 40 nm , the element size in which δ obtained by the calculation coincides with δ obtained by the experiment can be known to be 45 nm from the graph of an equation of “ y = 19697x + 17 . 634 .” this value can be considered as a value for making ic as small as possible while δ is ensured to be as large as possible . that is , the size of the storage layer 17 can be understood to be the diameter of 45 nm . the size of the storage layer can be converted to a volume of “ 1 . 5 nm × π ×( 45 / 2 ) 2 = 2390 nm 3 .” in the storage element 3 with a size equal to or less than the diameter of 45 nm , the good balance of δ and ic can be said to be maintained , as expected from the calculation result , since δ and ic are lessened . accordingly , when the storage element 3 indicated by sample 1 is formed such that the size of the storage layer 17 is equal to or less than the critical size in which the direction of the magnetization is simultaneously changed , that is , the size of the storage layer 17 is equal to or less than the diameter of 45 nm , the power consumption can be suppressed to be as small as possible . thus , it is possible to realize the st - mram using the thermal stability of the storage element 3 as much as possible . likewise , fig7 a and 7b show the size dependency of the storage layer 17 with respect to ic ( fig7 a ) and δ ( fig7 b ) obtained for sample 2 from an experiment . fig8 shows a size dependency ( indicated by ▴ in the drawing ) of the storage layer 17 with respect to δ obtained from the experiment of sample 2 and a size dependency ( indicated by ♦ in the drawing ) of the storage layer 17 with respect to δ calculated based on the saturated magnetization ms and the anisotropy magnetic field hk obtained through the measurement of vsm . in sample 2 , the saturated magnetization ms was 650 emu / cc and the anisotropy magnetic field hk was 2 . 15 koe . in sample 2 shown in fig7 a , 7b , and 8 , when the size is equal to or less than the diameter of 45 nm as in sample 1 , the power consumption can be suppressed to be as small as possible . thus , it is possible to realize the st - mram using the thermal stability of the storage element 3 as much as possible . when the storage layer 17 is formed of co — fe — b or a material in which a non - magnetic material is added to co — fe — b and the size of the storage layer 17 is equal to or less than the critical size in which the direction of the magnetization is simultaneously changed , that is , the diameter of 45 nm , as described above , the power consumption can be suppressed to be as small as possible . thus , it is possible to realize the st - mram using the thermal stability of the storage element 3 as much as possible . the embodiment has been described , but the present disclosure is not limited to the layer configuration of the storage element 3 according to the above - described embodiment . various layer configurations can be realized . for example , in the above - described embodiment , the compositions of co — fe — b of the storage layer 17 and the magnetization fixing layer 15 are the same as each other . the present disclosure is not limited to the above - described embodiment , but may be modified in various ways within the scope not departing from the gist of the present disclosure . the underlying layer 14 or the cap layer 18 may be formed of a single material or may have a lamination configuration of a plurality of materials . the magnetization fixing layer 15 may be configured by a single layer or a lamination ferri - pin structure of two layers of a ferromagnetic layer and a non - magnetic layer . further , an antiferromagnetic layer may be added to a layer with the lamination ferri - pin structure . additionally , the technology of the present disclosure may also adopt configurations as below . a storage layer that holds information according to a magnetization state of a magnetic body ; a magnetization fixing layer that has magnetization serving as a reference of the information stored in the storage layer ; and an insulation layer that is formed of a non - magnetic body disposed between the storage layer and the magnetization fixing layer , wherein the information is stored by reversing the magnetization of the storage layer using spin torque magnetization reversal occurring with a current flowing in a lamination direction of a layer configuration of the storage layer , the insulation layer , and the magnetization fixing layer , and a size of the storage layer is less than a size in which a direction of the magnetization is simultaneously changed . ( 2 ) the storage element according to ( 1 ), wherein a ferromagnetic material of the storage layer is co — fe — b . ( 3 ) the storage element according to ( 1 ), wherein a non - magnetic material is added to co — fe — b of the ferromagnetic material of the storage layer . ( 4 ) the storage element according to ( 1 ), ( 2 ), or ( 3 ), wherein the storage layer and the magnetization fixing layer have magnetization perpendicular to a film surface . ( 5 ) the storage element according to ( 1 ), ( 2 ), or ( 3 ), wherein a diameter of the storage layer is less than 45 nm . it should be understood that various changes and modifications to the presently preferred embodiments described herein will be apparent to those skilled in the art . such changes and modifications can be made without departing from the spirit and scope of the present subject matter and without diminishing its intended advantages . it is therefore intended that such changes and modifications be covered by the appended claims . | 7 |
turning to fig1 , an apparatus 100 in one example comprises one or more sensors and a processing component for measuring a movement of a body , for example an individual . the one or more sensors are strategically located on one or more joints of the individual . the one or more sensors measure movements of the one or more joints in one or more directions . the processing component translates ( e . g ., calculates , converts , infers , deduces , determines , and / or extrapolates ) the movements of the one or more joints into a general movement of the individual . the general movement represents an overall movement of the individual . the apparatus 100 includes a plurality of hardware and / or software components . a number of such components can be combined or divided in the apparatus 100 . in one example , the apparatus 100 employs at least one computer - readable signal - bearing medium . one example of a computer - readable signal - bearing medium for the apparatus 100 comprises an instance of a recordable data storage medium 201 ( fig2 ) such as one or more of a magnetic , electrical , optical , biological , and atomic data storage medium . in another example , a computer - readable signal - bearing medium for the apparatus 100 comprises a modulated carrier signal transmitted over a network comprising or coupled with the apparatus 100 , for instance , one or more of a telephone network , a local area network (“ lan ”), the internet , and a wireless network . an exemplary component of the apparatus 100 employs and / or comprises a set and / or series of computer instructions written in or implemented with any of a number of programming languages , as will be appreciated by those skilled in the art . in one example , the apparatus 100 comprises an anthropometric dead reckoning motion detector for a body . “ anthropometric ” as used herein in one example refers to measurement of the body . “ dead reckoning ” as used herein in one example refers to navigating by measuring the course and distance traveled from a known point . in one example , the body comprises an individual 102 . for example , the individual 102 comprises a person , animal , or robot . the anthropometric dead reckoning motion detector takes measurements of the individual 102 and converts the measurements to a position change starting from a known location . the apparatus 100 comprises one or more sensors , for example one or more of bi - lateral ankle sensors 104 and 106 , knee sensors 108 and 110 , hip sensors 111 and 112 , waist sensors 113 and 114 , wrist sensors 115 and 116 , elbow sensors 118 and 120 , shoulder sensors 122 and 124 , a processing component 126 , and a navigation component 128 . in one example , one or more of the sensors comprise strain sensors , as described herein . in another example , one or more of the sensors comprise rate sensors , for example , low cost rate sensors . the one or more sensors serve to measure a movement of one or more joints of the individual 102 . for example , the one or more sensors measure three dimensional motion of the one or more joints , such as the ankle , knee , hip , waist , wrist , elbow , and / or shoulder of the individual 102 . as the individual 102 traverses a path from a known starting location , the apparatus 100 serves to measure the movement of the one or more joints of the individual 102 and record the movement . subsequently , the movement of the one or more joints of the individual 102 is reconstructed to determine the path of the individual 102 . the one or more sensors are arranged bi - laterally on the individual 102 . the one or more sensors may be arranged symmetrically or asymmetrically on the individual 102 . the one or more sensors may measure other joint locations , in addition to the ankle , knee , hip , waist , wrist , elbow , and / or shoulder of the individual 102 . the one or more sensors monitoring the one more joints on the lower body of the individual 102 provide information to reconstruct a locomotion of the individual 102 . for example , the information generated by the ankle sensors 104 and 106 , knee sensors 108 and 110 , hip sensors 111 and 112 , and waist sensors 113 and 114 translate to the locomotion of the individual 102 . the information generated by the one or more sensors may also be translated to measure critical points along the path such as abrupt turns or elevation changes . the one or more sensors measure a direction and a displacement of the movement . in one example , a first sensor measures the direction of the movement and a second sensor measures the displacement of the movement . in another example , the first and second 25 sensors measure both the displacement and direction of the movement . the one or more sensors comprise strain sensors . the strain sensors detect a bending strain and / or a twisting strain due to the movement of the one or more joints of the individual 102 . for example , the ankle sensors 104 and 106 detect the bending strain and / or the twisting strain due to the movement of the ankle joint . the bending strain corresponds to , and may be translated to , the displacement ( e . g ., meters ) of the movement . the twisting strain corresponds to , and may be translated to , the direction ( e . g ., degrees ) of the movement . in one example , the one or more sensors are embedded in a suit 130 at the one or more joints of the individual 102 . the suit 130 is worn by the individual 102 . the suit 130 may be worn as outerwear , an undergarment , or incorporated into another suit . the suit 130 may be incorporated into a second suit used to monitor other information such as biological functions of the individual 102 ( e . g ., heart rate , body temperature , etc .). referring to fig1 - 2 , the processing component 126 employs one or more algorithms for translating measurements from the one or more sensors into a position change of the individual 102 . a first algorithm 202 takes as an input a bending component of the strain experienced by the one or more sensors . the first algorithm 202 translates the bending component into a displacement component of the position change . a second algorithm 204 takes as an input a twisting component of the strain experienced by the one or more sensors . the second algorithm 204 translates the twisting component into a direction component of the position change . a third algorithm 206 takes as inputs the displacement component , the direction component , and a starting location of the position change . the third algorithm 206 translates the displacement component , the direction component , and the starting location of the position change into an updated position of the individual 102 . the one or more algorithms and the one or more sensors may be calibrated to the specific motions of the individual 102 by having the individual 102 traverse a known path . the measurements by the one or more sensors generated during traversal of the known path will tune the one or more algorithms to the specific motion of the individual 102 . the first , second , and third algorithms may be combined or divided . the third algorithm 206 may additionally take inputs from a magnetic heading sensor 208 and a barometric altitude sensor 210 . the magnetic heading sensor 208 provides additional information on the direction of the movement of the individual 102 to supplement the twisting component of the strain sensors . the magnetic heading sensor 208 would use the earth &# 39 ; s magnetic field to sense the direction of the movement . a change in magnetic field measured by the magnetic heading sensor 208 would correspond to a change of direction by the individual 102 . the barometric altitude sensor 210 would measure an atmospheric pressure for altitude position changes . a change in atmospheric pressure measured by the barometric altitude sensor 210 would correspond to a change of altitude by the individual 102 . the position information generated by the magnetic heading sensor 208 and the barometric altitude sensor 210 would assist the anthropometric dead reckoning motion detector during motion of the individual 102 while the one or more joints of the individual 102 are not in motion . the third algorithm 206 would weigh and combine the position information generated by the magnetic heading sensor 208 and the barometric altitude sensor 210 with the position information generated by the first and second algorithms 202 and 204 . the navigation component 128 in one example comprises an inertial navigation system 212 (“ ins ”) and / or a global positioning system 214 (“ gps ”). the navigation component 128 provides position information of the individual 102 to supplement the position information generated by the processing component 126 . in one example , the navigation component 128 is attached to the waist of the individual 102 . for example , the navigation component 128 is integrated into a belt for the individual 102 . referring to fig4 , in another example , the navigation component 128 is located at a heel of the foot of the individual 102 . for example , the navigation component 128 is mounted into a shoe or boot worn by the individual 102 . additionally , the processing component 126 and other electronic components may be located with the navigation component 128 in the shoe worn by the individual 102 . locating the navigation component 128 in the shoe allows for zero velocity updates or zero position change updates for the navigation component 128 . for example , at a time when the foot of the individual 102 is planted or substantially stationary , the navigation component 128 may initiate the zero velocity update to correct for error or bias in measurements of the navigation component 128 . referring to fig1 - 2 , a filtering component 216 comprises an algorithm to weigh and combine the position information generated by the processing component 126 , the inertial navigation system 212 , and the global positioning system 214 . the weighing and combination of the position information is based on the respective reliabilities of the processing component 126 , the inertial navigation system 212 , and the global positioning system 214 . the algorithm processes the measurements of the processing component 126 , the inertial navigation system 212 , and the global positioning system 214 to deduce an estimate of the position of the individual 102 by using a time sequence of measurements of the system behavior , plus a statistical model that characterizes the system and measurement errors , plus initial condition information . in one example , the filtering component 216 comprises a kalman filter . in one example , the processing component 126 and the filtering component 216 are combined with the navigation component 128 , for example in the inertial navigation system 212 . the output of the filtering component 216 may be passed to one or more of a display 218 and a recording device 140 . the recording device 140 stores the position information output from the filtering component 216 . a path of the individual 102 may be reconstructed from the known starting location and the recorded position information . the path may be used to create a map of an area previously unmapped , incorrectly mapped , or update outdated maps . using dead reckoning navigation to provide information for cartography is especially useful in remote areas where the global positioning system 214 is unavailable , or in areas where the global positioning system 214 in experiencing jamming or interference . upon initialization and / or re - initialization , the inertial navigation system 212 requires a starting and / or restarting location to begin generating the position information of the individual 102 . the dead reckoning position information generated by the processing component 126 may be used as an estimate of the starting and / or restarting location for the inertial navigation system 212 . upon initialization and / or re - initialization , the global positioning system 214 would benefit from the starting and / or restarting position to lock onto satellites . the dead reckoning position information generated by the processing component 126 may be used as an estimate of the starting and / or restarting location for the global positioning system 214 . during the run times , the inertial navigation system 212 and the global positioning system 214 may provide corrections to the one or more sensors and / or the processing component 126 . therefore , the position information generated by the inertial navigation system 212 , the global positioning system 214 , and the processing component 126 would be in better agreement . due to the corrections , at a time when the inertial navigation system 212 and / or the global positioning system 214 become unavailable , the processing component 126 would be more able to alone generate an estimate of the position information . referring to fig3 , in one example the navigation component 128 comprises a signal conditioning component 302 , a signal processor 304 , and zero or more of the inertial navigation system 212 and the global positioning system 214 . the one or more sensors of the suit 130 pass information to the navigation component 128 . the signal conditioning component 302 receives the information from the one or more sensors . the signal conditioning component 302 converts the information from one or more analog signals to one or more digital signals . the one or more digital signals represent the motion of the one or more joints of the individual 102 . the one or more digital signals are multiplexed to the signal processor 304 . the signal processor 304 converts the one or more digital signals to the position information of the individual 102 . the position information of the individual 102 derived from the signal processor 304 and the global positioning system 2 14 are passed to the inertial navigation system 212 . the inertial navigation system 212 comprises an algorithm to weigh and combine the position information generated internally , and generated by the global positioning system 214 and the signal processor 304 . the steps or operations described herein are just exemplary . there may be many variations to these steps or operations without departing from the spirit of the invention . for instance , the steps may be performed in a differing order , or steps may be added , deleted , or modified . although exemplary implementations of the invention have been depicted and described in detail herein , it will be apparent to those skilled in the relevant art that various modifications , additions , substitutions , and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention . | 6 |
exemplary embodiments of the present invention will be explained in detail below with reference to the accompanying drawings . fig1 is a schematic diagram for explaining a concept of an access point 1 according to a first embodiment of the present invention . the access point 1 is connected to a directional antenna 2 and a directional antenna 3 . the access point 1 is also connected to a network by way of a router ( not shown ). the directional antenna is utilized when data is sent to and received from a wireless communication terminal device that is located within a predetermined distance in a predetermined direction . when receiving a packet from the network , the access point 1 sends the received packet only to the directional antenna 2 , but not to the directional antenna 3 . this means that the terminal device that is to receive the packet from the network has to be present in the coverage of a packet reception area 5 . when the access point 1 receives the packet from a terminal device , only the directional antenna 3 is used . this means that the terminal device that is to send the packet to the network has to be present in the coverage of a packet transmission area 4 . in other words , a terminal device that is to perform a data communication with the network has to be present in the packet communication area 6 . hence , the access point 1 according to the first embodiment limits the data communication area to a specific area , by using the directional antenna 2 specially to send the packet to a terminal device , while using the directional antenna 3 specially to receive the packet . fig2 is a functional block diagram of the access point 1 according to the first embodiment . the access point 1 is connected to the directional antenna 2 , the directional antenna 3 and a router 10 . the access point 1 includes an input / output unit 7 , a control unit 8 and a wired - lan interface 9 . the control unit 8 includes a wireless transmitting unit 8 a and a wireless receiving unit 8 b . the wireless transmitting unit 8 a receives the packet from the wired - lan interface 9 , and sends the received packet to the directional antenna 2 via the input / output unit 7 . the wireless receiving unit 8 b receives the packet from the directional antenna 3 via the input / output unit 7 , and sends the received packet to the router 10 via the wired - lan interface 9 . the wired - lan interface 9 sends the packet received from the router 10 to the control unit 8 . the wired - lan interface 9 sends the packet received from the control unit 8 to the router 10 . fig3 is a flowchart of a processing procedure for a process of the access point 1 according to the first embodiment receiving the packet from the router 10 . the wired - lan interface 9 receives the packet from the router 10 ( step s 101 ), and sends the received packet to the wireless transmitting unit 8 a ( step s 102 ). the wireless transmitting unit 8 a sends the received packet to the input / output unit 7 ( step s 103 ), and the input / output unit 7 sends the received packet to the directional antenna 2 ( step s 104 ). in such a manner , the access point 1 sends the packet to the terminal device by using the directional antenna 2 only , when receiving the packet from the router 10 . fig4 is a flowchart of a processing procedure for a process of the access point 1 according to the first embodiment receiving the packet from the terminal device . the input / output unit 7 receives the packet from the terminal device via the directional antenna 3 ( step s 201 ), and sends the received packet to the wireless receiving unit 8 b ( step s 202 ). the wireless receiving unit 8 b sends the received packet to the wired - lan interface 9 ( step s 203 ), and the wired - lan interface 9 sends the received packet to the router 10 ( step s 204 ). the access point 1 receives the packet from the terminal device by way of the directional antenna 3 only , and sends the received packet to the router 10 . as described above , the access point 1 according to the first embodiment utilizes only the directional antenna 2 when the wireless transmitting unit 8 a sends the packet received from the router 10 to the terminal device . in addition , the wireless receiving unit 8 b receives the packet from the terminal device by way of the directional antenna 3 only . it is therefore necessary for the terminal device to be positioned within the packet communication area 6 to perform the wireless data communication with the network . hence , the packet communication area can be limited to an area that the user desires by adopting the directional antenna 2 and the directional antenna 3 . this can prevent a third party from wiretapping and having an unauthorized access , and improve security in the wireless communication . fig5 is a schematic diagram for explaining a concept of an access point 11 according to a second embodiment of the present invention . the access point 11 is connected to a directional antenna 12 and a directional antenna 13 . the access point 11 is also connected to a network via a router ( not shown ). the access point 11 uses the directional antenna 12 and the directional antenna 13 alternately , when sending a packet received from the router to a terminal device . thus , the terminal device cannot receive all the packets unless it is positioned within an entire packet reception area 16 that includes the overlapping area of a packet reception area 15 for the packet from the directional antenna 12 and a packet reception area 14 for the packet from the directional antenna 13 . in other words , the data communication area can be limited to a specific area that the user desires by using the directional antenna 12 and the directional antenna 13 alternately when sending data to a predetermined terminal device . fig6 is a functional block diagram of the access point 11 according to the second embodiment . the access point 11 is connected to the directional antenna 12 , the directional antenna 13 , and a router 10 . the access point 11 includes a control unit 17 . since the rest of the structure and operation of the access point 11 is the same as the access point 1 described in the first embodiment , the same reference numerals are adopted for the same structural elements , and the explanation is omitted . the control unit 17 includes a transmission determining unit 17 a , a wireless transmitting unit 17 b , and a wireless receiving unit 17 c . the transmission determining unit 17 a determines a directional antenna to be used so that the packet received from the router 10 is sent alternately to the directional antenna 12 and the directional antenna 13 , and sends a result of the determination to the wireless transmitting unit 17 b . the wireless transmitting unit 17 b sends the packet sent from the router 10 to the directional antenna 12 or the directional antenna 13 via the input / output unit 7 , based on the result of the determination by the transmission determining unit 17 a . the wireless receiving unit 17 c receives the packet sent from the terminal device by way of the directional antenna 12 or the directional antenna 13 , and sends the received packet to the router 10 via the wired - lan interface 9 . fig7 is a flowchart of a processing procedure for a process of the access point 11 according to the second embodiment receiving the packet from the router 10 . the wired - lan interface 9 receives the packet from the router 10 ( step s 301 ), and sends the received packet to the control unit 17 ( step s 302 ). the transmission determining unit 17 a determines a directional antenna to be used so that packet is sent alternately to the directional antenna 12 and the directional antenna 13 ( step s 303 ). the wireless transmitting unit 17 b sends the packet to the directional antenna determined by the transmission determining unit 17 a ( step s 304 ). the process indicated in fig7 is repeated every time the access point 11 receives the packet . by determining a directional antenna to be used so that the packet is sent alternately to the directional antenna 12 and the directional antenna 13 at step s 303 , if the directional antenna 12 is used at a previous time when the packet is sent , the directional antenna 13 is to be used next , and if the directional antenna 13 is used at the previous time when the packet is sent , the directional antenna 12 is to be used next . as described above , the access point 11 according to the second embodiment receives the packet from the router 10 , and the transmission determining unit 17 a determines a directional antenna to be used so that the received packet will be sent alternately to the directional antenna 12 and the directional antenna 13 . the wireless transmitting unit 17 b sends the packet to the directional antenna 12 or the directional antenna 13 , based on the determination made by the transmission determining unit 17 a . in other words , the terminal device cannot perform the data communication with the network unless it is located within the entire packet reception area 16 . as a result , the data communication area can be limited to a specific area by utilizing the directional antenna 12 and the directional antenna 13 alternately , and security can be improved in the wireless communication . the packet is used as an example in the second embodiment . however , the present invention is not limited to this scheme . the structure may be such that a piece of data having a predetermined size is received , the received data is divided , and the divided data is sent alternately to the directional antenna 12 and the directional antenna 13 . fig8 is a schematic diagram for explaining a concept of an access point 20 according to a third embodiment of the present invention . the access point 20 is connected to a directional antenna 21 and a directional antenna 22 . the access point 20 is also connected to a network via a router ( not shown ). the access point 20 uses the directional antenna 21 but not the directional antenna 22 when performing a data communication relay between the router and a predetermined terminal device . only when the packet passing the access point 20 reaches a predetermined size , the antenna is switched to the directional antenna 22 , and the directional antenna 21 is deactivated . in addition , when the packet passing the access point 20 reaches the predetermined size after the antenna in use is switched to the directional antenna 22 , the antenna is switched back to the directional antenna 21 , and the directional antenna 22 is inactivated . in other words , the directional antennas are switched every time the packet that passes the access point 20 reaches the predetermined size . therefore , the terminal device can perform the data communication with the network only when it is positioned within a packet communication area 25 where a packet communication area 24 of the directional antenna 21 and a packet communication area 23 of the directional antenna 22 overlap each other . fig9 is a functional block diagram of the access point 20 according to the third embodiment . the access point 20 is connected to the directional antenna 21 , the directional antenna 22 , and a router 10 . the access point 20 includes a control unit 26 . since the rest of the structure and operation of the access point 20 is the same as the access point 1 described in the first embodiment , the same reference numerals is adopted for the same structural elements , and the explanation is omitted . the control unit 26 includes a data - size measuring unit 26 a , a wireless transmitting unit 26 b , and a wireless receiving unit 26 c . the data - size measuring unit 26 a measures a size of the packet that is sent from the router 10 to the directional antenna 21 or the directional antenna 22 and a size of packet that is sent from the terminal device to the router 10 . the data - size measuring unit 26 a sends a command to switch the directional antenna currently used each time the measured size of the packet reaches a predetermined level to the wireless transmitting unit 26 b and the wireless receiving unit 26 c . the wireless transmitting unit 26 b and the wireless receiving unit 26 c use the directional antenna 21 at the beginning when carrying out the data transmission and reception between the terminal device and the router 10 . when receiving the command from the data - size measuring unit 26 a to switch the directional antenna currently used , the wireless transmitting unit 26 b and the wireless receiving unit 26 c switch the antenna to the directional antenna 22 . in other words , the wireless transmitting unit 26 b and the wireless receiving unit 26 c use the directional antenna 22 when carrying out the data communication between the terminal device and the router 10 . fig1 is a flowchart of a processing procedure for a process of the access point 20 according to the third embodiment receiving a packet from the router 10 . the process described in fig1 is repeated while the access point 20 is in operation . for the explanation of the process described in fig1 , a case where the access point 20 currently utilizes the directional antenna 21 will be used as an example . the wired - lan interface 9 receives the packet from the router 10 ( step s 401 ), and sends the received packet to the control unit 26 ( step s 402 ). the wireless transmitting unit 26 b sends the received packet to the directional antenna 21 via the input / output unit 7 ( step s 403 ). the data - size measuring unit 26 a determines whether a total size of the received packet received from the router 10 is equal to or larger than a predetermined level ( step s 404 ). when the total size of the received packet is equal to or larger than the predetermined level ( step s 404 , yes ), the data - size measuring unit 26 a sends a command to switch the directional antenna to the wireless transmitting unit 26 b and the wireless receiving unit 26 c , and the wireless transmitting unit 26 b and the wireless receiving unit 26 c switch the directional antenna to be used for packet transmission and reception ( step s 405 ). on the other hand , when the total size of the received packet is smaller than the predetermined level ( step s 404 , no ), the process is terminated . this means that the access point 20 is configured to receive the packet from the router 10 , measure the size of the received packet , and switch the directional antenna in use whenever the measured size of the received packet is equal to or larger than the predetermined level . fig1 is a flowchart of a processing procedure for a process of the access point 20 according to the third embodiment receiving a packet from the terminal device . the process described in fig1 is repeated during the operation of the access point 20 . to explain the process indicated in fig1 , the case where the access point 20 currently uses the directional antenna 21 is taken as an example . the wireless receiving unit 26 c receives the packet sent from the terminal device via the input / output unit 7 by way of the directional antenna 21 ( step s 501 ). the wireless receiving unit 26 c sends the received packet to the router 10 via the wired - lan interface 9 ( step s 502 ), and the data - size measuring unit 26 a determines whether the total size of the packet received from the terminal device is equal to or larger than the predetermined level ( step s 503 ). when the total size of packet received from the terminal device is equal to or larger than the predetermined level ( step s 503 , yes ), the data - size measuring unit 26 a sends a command to switch the directional antenna the wireless transmitting unit 26 b and the wireless receiving unit 26 c , and the wireless transmitting unit 26 b and the wireless receiving unit 26 c switch the directional antenna to be used for packet reception ( step s 504 ). on the other hand , when the total size of the received packet is smaller than the predetermined level ( step s 503 , no ), the process is terminated . the access point 20 is configured to receive the packet from a specific terminal device , measure the size of the received packet , and switch the directional antenna currently used whenever the measured size of the packet is equal to or larger than the predetermined level . in the access point 20 according to the third embodiment , the data - size measuring unit 26 a measures the size of the packet sent from the router 10 or the terminal device , and sends the command to switch the directional antenna for transmission and reception to the wireless transmitting unit 26 b and the wireless receiving unit 26 c whenever the measured total size of the packet is equal to or larger than the predetermined level . for this reason , it is essential that the terminal device be located within the packet communication area 25 to perform the data communication with the network . hence , the data communication area can be limited to a predetermined area by alternating the directional antenna 21 and the directional antenna 22 , thereby improving security in the wireless communication . however , the present invention is not limited to this scheme , and the structure may be such that , for example , the data - size measuring unit 26 a sends the command to switch the directional antenna for transmission and reception at predetermined time intervals . fig1 is a schematic diagram for explaining a concept of an access point 30 according to a fourth embodiment of the present invention . the access point 30 is connected to a directional antenna 31 and a directional antenna 32 . the access point 30 is also connected to a network via a router ( not shown ). the access point 30 first utilizes the directional antenna 31 to register a media - access - control ( mac ) address that identifies a terminal device included in a mac - address - information collecting area 34 . the access point 30 detects the mac address that identifies a terminal device to which or from which a packet is to be sent , when performing data communication between the router and the terminal device by way of the directional antenna 32 . then , the access point 30 determines whether the same mac address as the detected mac address is registered . the access point 30 enables packet transmission and reception only when the same mac address is registered . thus , the terminal device cannot perform the data communication with the network unless it is located within a packet communication area 35 that covers the overlapping area of the mac - address - information collecting area 34 and a packet communication area 33 . fig1 is a functional block diagram of the access point 30 according to the fourth embodiment . the access point 30 is connected to the directional antenna 31 , the directional antenna 32 , and a router 10 . the access point 30 includes a control unit 36 and a storing unit 39 . since the rest of the structure and operations of the access point 30 are the same as the access point 1 described in the first embodiment , the same reference numerals are adopted for the same structural elements , and the explanation is omitted . the control unit 36 includes a mac - address processing unit 37 and a packet communicating unit 38 . the mac - address processing unit 37 includes a mac - address registering unit 37 a and a mac - address determining unit 37 b . the mac - address registering unit 37 a uses the directional antenna 31 to receive radio waves from the terminal device located in the mac - address - information collecting area 34 and to detect the mac address that identifies the terminal device . then , the mac - address registering unit 37 a registers the detected mac address and the time at which the mac address is detected on a registered - mac - address table 39 a of the storing unit 39 . the registered - mac - address table 39 a stores a serial number , the mac address , and the time at which the mac address is detected , as shown in fig1 . the mac - address registering unit 37 a deletes a registered mac address from the registered - mac - address table 39 a when a predetermined time has passed since the time at which the mac address is detected . the mac - address determining unit 37 b detects the mac address that identifies the terminal device to which or from which the packet is sent , based on the packet information sent from the router 10 or the terminal device . then , the mac - address determining unit 37 b determines whether the detected mac address is registered on the registered - mac - address table 39 a . the packet transmission is permitted only when the detected mac address is registered on the registered - mac - address table 39 a . the packet communicating unit 38 sends the received packet information to the mac - address determining unit 37 b when receiving the packet from the router 10 or the terminal device . when the mac - address determining unit 37 b permits the packet transmission , the packet communicating unit 38 sends the packet to the directional antenna 32 or the router 10 . an explanation will be given for a process where the access point 30 registers the mac address that identifies the terminal device included in the mac - address - information collecting area 34 . fig1 is a flowchart of a processing procedure for the access point 30 according to the fourth embodiment registering the mac address of the terminal device . the directional antenna 31 receives radio waves from the terminal device ( step s 601 ). the mac - address registering unit 37 a receives the radio waves via the input / output unit 7 and the packet communicating unit 38 , and detects the mac address from the received radio waves ( step s 602 ). the mac - address registering unit 37 a determines whether the detected mac address is registered on the registered - mac - address table 39 a ( step s 603 ). if the detected mac address is registered on the registered - mac - address table 39 a ( step s 603 , yes ), the time corresponding to the detected mac address is updated to the latest time at which mac address is detected ( step s 604 ). on the other hand , if the detected mac address is not registered on the registered - mac - address table 39 a ( step s 603 , no ), the detected mac address and the time at which the mac address is detected are registered onto the registered - mac - address table 39 a ( step s 606 ). fig1 is a flowchart of a processing procedure for the access point 30 according to the fourth embodiment sending a packet from the terminal device to the router 10 . the packet communicating unit 38 receives the packet by way of the directional antenna 32 ( step s 701 ), and sends packet information to the mac - address determining unit 37 b . then , the mac - address determining unit 37 b detects the mac address from the received packet information ( step s 702 ). the mac - address determining unit 37 b determines whether the detected mac address is registered on the registered - mac - address table 39 a ( step s 703 ). if the detected mac address is not registered on the registered - mac - address table 39 a ( step s 703 , no ), the mac - address determining unit 37 b sends a command to abandon the packet to the packet communicating unit 38 ( step s 704 ). on the other hand , if the detected mac address is registered ( step s 703 , yes ), the mac - address determining unit 37 b updates the time on the registered - mac - address table 39 a to the latest time at which the mac address is detected ( step s 705 ). the mac - address determining unit 37 b allows the packet communicating unit 38 to send the packet ( step s 706 ), and the packet communicating unit 38 sends the packet via the wired - lan interface 9 to the router 10 ( step s 707 ). when receiving the packet from the terminal device by way of the directional antenna 32 , the access point 30 determines whether the packet should be sent to the router 10 , based on the registered - mac - address table 39 a and the mac address that identifies the terminal device from which the packet is sent . in other words , the mac - address determining unit 37 b permits the packet transmission only when the mac address that identifies the sender terminal device is registered on the registered - mac - address table 39 a . fig1 is a flowchart of a processing procedure for the access point 30 according to the fourth embodiment sending a packet from the router 10 to the terminal device . the packet communicating unit 38 receives the packet from the router 10 via the wired - lan interface 9 ( step s 801 ). the packet communicating unit 38 sends the packet information to the mac - address determining unit 37 b . the mac - address determining unit 37 b detects the mac address of the sender from the packet information ( step s 802 ), and determines whether the detected mac address is registered on the registered - mac - address table 39 a ( step s 803 ). if the detected mac address is not registered on the registered - mac - address table 39 a ( step s 803 , no ), the mac - address determining unit 37 b sends a command to abandon the packet to the packet communicating unit 38 ( step s 804 ). on the other hand , if the detected mac address is registered on the registered - mac - address table 39 a ( step s 803 , yes ), the mac - address determining unit 37 b updates the time on the registered - mac - address table 39 a to the latest time at which the mac address is detected ( step s 805 ). then , the mac - address determining unit 37 b allows the packet communicating unit 38 to send the packet ( step s 806 ), and the packet communicating unit 38 sends the packet via the input / output unit 7 to the directional antenna 32 ( step s 807 ). when receiving the packet from the router 10 , the access point 30 determines whether the packet should be sent to the directional antenna 32 , based on the registered - mac - address table 39 a and the mac address that identifies the terminal device to which the packet is sent . in other words , the mac - address determining unit 37 b permits the packet transmission only when the mac address that identifies the destination terminal device is registered on the registered - mac - address table 39 a . fig1 is a flowchart of a processing procedure for a mac - address registering unit 37 a updating the registered - mac - address table 39 a . the mac - address registering unit 37 a detects the mac address and the time at which the mac address is detected from the registered - mac - address table 39 a ( step s 901 ), and determines whether a predetermined time has passed since the time at which the mac address is detected ( step s 902 ). if the predetermined time has passed since the time ( step s 902 , yes ), the mac - address registering unit 37 a deletes the detected mac address ( step s 903 ), and checks whether all the times and mac addresses have been detected ( step s 904 ). on the other hand , if the predetermined time has not passed since the time ( step s 902 , no ), the mac - address registering unit 37 a equally checks whether all the times and mac addresses have been detected ( step s 904 ). if all the mac addresses and times have not yet been detected ( step s 904 , no ), the process proceeds to step s 901 , otherwise ( step s 904 , yes ), the process is terminated . as described above , in the access point 30 according to the fourth embodiment , the mac - address registering unit 37 a registers in advance the mac address that identifies the terminal device located in the mac - address - information collecting area 34 , by way of the directional antenna 31 . the mac - address determining unit 37 b determines whether the mac address that identifies the destination terminal device to which the packet that are sent from the router 10 or the sender terminal device from which the packet is sent is registered on the registered - mac - address table 39 a , and allows the packet communicating unit 38 to send or receive the packet only when the registration is completed . in other words , the terminal device needs to be located in the packet communication area 35 where the mac - address - information collecting area 34 and the packet communication area 33 overlap each other , to have the data communication with the network . the user can limit the data communication area of the terminal device by adopting the directional antenna 31 and the directional antenna 32 , thereby improve security in the wireless communication . although the directional antenna 31 is utilized to receive the mac address that identifies the terminal device while the directional antenna 32 is utilized to send the packet to and receive the packet from the terminal device according to the fourth embodiment , the structure may be designed such that the directional antenna 31 is utilized for the packet transmission and reception with the terminal device while the directional antenna 32 is utilized for reception of the mac address that identifies the terminal device . fig1 is a schematic diagram for explaining a concept of an access point 40 according to a fifth embodiment of the present invention . the access point 40 is connected to a directional antenna 41 , a directional antenna 42 , and a nondirectional antenna 43 . the packet transmission and reception is enabled in a predetermined area and in a 360 - degree field in a lateral direction by incorporating the nondirectional antenna 43 to the structure . the access point 40 is also connected to a network via a router ( not shown ). the access point 40 receives radio waves in advance from a terminal device located in a mac - address - information collecting area 44 by way of the directional antenna 41 and the directional antenna 42 , detects the mac address that identifies the terminal device from the received radio waves , and registers the detected mac address . when receiving the packet sent from the router or the terminal device , the access point 40 detects the mac address of the terminal device from which or to which the packet is sent , and permits the packet transmission and reception with the terminal device by way of the nondirectional antenna 43 only when the detected mac address is not registered . thus , the terminal device can achieve the data communication with the network only when the terminal device is located within a packet communication area 45 that does not overlap with the mac - address - information collecting area 44 . fig2 is a functional block diagram of the access point 40 according to the fifth embodiment . the access point 40 is connected to the directional antenna 41 , the directional antenna 42 , the nondirectional antenna 43 , and a router 10 . the access point 40 includes a control unit 46 . since the rest of the structure and operations of the access point 40 is the same as the access point 30 described according to the fourth embodiment , the same reference numerals are assigned to the same structural elements , and the explanation is omitted . the control unit 46 includes a mac - address processing unit 47 and a packet communicating unit 48 . the mac - address processing unit 47 includes a mac - address registering unit 47 a and a mac - address determining unit 47 b . the mac - address registering unit 47 a receives radio waves from the terminal device included in the mac - address - information collecting area 44 by way of the directional antenna 41 and the directional antenna 42 , and detects the mac address that identifies the terminal device . then , the mac - address registering unit 47 a registers the detected mac address and the time at which the mac address is detected on the registered - mac - address table 39 a of the storing unit 39 . the mac - address determining unit 47 b detects the mac address that identifies the terminal device from which or to which the packet is sent , from the packet information sent from the router 10 or the terminal device . then , the mac - address determining unit 47 b determines whether the detected mac address is registered on the registered - mac - address table 39 a , and permits the packet transmission and reception by way of the nondirectional antenna 43 only when the detected mac address is not registered on the registered - mac - address table 39 a . when receiving the packet from the router 10 or the terminal device , the packet communicating unit 48 sends the received packet information to the mac - address determining unit 47 b . the packet communicating unit 48 then sends the packet to the nondirectional antenna 43 or the router 10 when the mac - address determining unit 47 b permits the packet transmission and reception . as described above , in the access point 40 according to the fifth embodiment , the mac - address registering unit 47 a registers in advance the mac address that identifies the terminal device located in the mac - address - information collecting area 44 by way of the directional antenna 41 and the directional antenna 42 . the mac - address determining unit 47 b determines whether the same mac address as the mac address of the destination terminal device to which the packet is sent or the sender terminal device from which the packet is sent is registered on the registered - mac - address table 39 a . the mac - address determining unit 47 b permits the packet transmission and reception only when the detected mac address is not registered on the registered - mac - address table 39 a , and the packet communicating unit 48 sends and receives the packet by way of the nondirectional antenna 43 . in other words , the terminal device needs to be included in the packet communication area 45 that does not overlap with the mac - address - information collecting area 44 . thus , the user can limit the data communication area of the terminal device by adopting the directional antenna 41 , the directional antenna 42 , and the nondirectional antenna 43 , and improve security in the wireless communication . as explained above , according to the present invention , the terminal device can perform the wireless communication with the wired - network only in the overlapping area of the transmission enabled area and reception enabled area , while the wireless communication with the wired - network is not permitted in an area other than the overlapping area . therefore , the present invention has an advantage that the wirelessly communication area can be limited to a predetermined area , and that security can be improved in the wireless communication . although the invention has been described with respect to a specific embodiment for a complete and clear disclosure , the appended claims are not to be thus limited but are to be construed as embodying all modifications and alternative constructions that may occur to one skilled in the art that fairly fall within the basic teaching herein set forth . | 7 |
the following examples describe in detail the preparation of intermediates and their conversion to the desired final product of this invention . to a solution of 43 . 0 g . ( 1 . 0 mole ) of ethyleneimine and 60 . 0 g . ( 0 . 5 mole ) of styrene oxide is added 3 drops of water and 0 . 2 g . of potassium hydroxide . the mixture is heated at reflux for 11 / 2 hours . distillation of the excess ethyleneimine from the crude product gives 55 . 6 g . ( 68 %) of the crystalline product . recrystallization gives pure dl - α - phenyl - 1 - aziridineethanol with melting point 74 °- 76 ° c . one half of the crude product from the reaction of 1 . 0 mole of ethyleneimine with 0 . 50 mole of styrene oxide ( example 1 ) is reacted with thiocyanic acid without purification . a warm mixture of 26 . 7 g . ( 0 . 275 mole ) of potassium thiocyanate in 250 ml . of ethanol is treated with 53 g . of a methanolic solution of hydrogen chloride ( 0 . 25 mole ). the precipitated potassium chloride is filtered , and washed with ethanol to provide the thiocyanic acid solution . to the stirred solution of thiocyanic acid is added a solution of the crude dl - α - phenyl - 1 - aziridineethanol in 250 ml . of ethanol at a rate sufficient to keep the reaction temperature at 30 °- 35 ° c . after the aziridine addition is complete , 72 g . of a methanolic solution of hydrogen chloride ( 0 . 35 mole ) is added and the solution stirred for 1 . 5 hours at room temperature . an additional 0 . 05 mole of hydrogen chloride in 10 g . of ethanol is added , and the reaction heated at 35 °- 40 ° c . for 0 . 5 hour . it is then allowed to proceed at room temperature for 2 . 5 days . the mixture is concentrated under reduced pressure to about 100 ml ., filtered , washed with ethanol and dried to give 27 . 1 g . of white crystals , melting point 198 °- 200 ° c . the yield is 42 % ( based on styrene oxide ) or 71 % ( based on dl - α - phenyl - 1 - aziridineethanol ). a laboratory pressure bottle is charged with 75 ml . of concentrated hydrochloric acid ( 22 ° be &# 39 ;), cooled to 0 °- 5 ° c . and 52 g . of 95 % sulfuric acid ( 0 . 5 mole ) is added thereto . an amount of 49 . 1 g . of real dl - 3 -( β - hydroxyphenethyl )- 2 - iminothiazolidine hydrochloride , compound iii , ( 0 . 19 mole ) plus 23 . 4 g . of sodium chloride ( 0 . 4 mole ) is added at 0 °- 5 ° c . the pressure bottle is closed and the contents heated at 45 °- 47 ° c . for 22 hours . the reaction mixture is then cooled and added to a mixture of 188 ml . of water , 27 ml . of n - butanol and 38 ml . of toluene . the mixture is agitated at 15 °- 20 ° c . and 50 % sodium hydroxide solution is added thereto dropwise to adjust the ph to 6 . the mixture is then heated to 50 °- 55 ° c ., 39 . 4 g . ( 0 . 285 mole ) of anhydrous potassium carbonate is added quickly and the mixture is stirred at 50 °- 55 ° c . for 2 hours . at the end of this time , an additional 50 ml . of toluene is added thereto , the water layer is separated and the organic layer is clarified . the clarified organic layer is treated with a solution of isopropanolic hydrogen chloride below 40 ° c . to the point where congo red test paper changes from red to blue . the solution is then cooled to 10 ° c ., filtered and the filter cake is washed with 100 ml . of ambient temperature isopropanol . the product is then dried at 80 ° c . to obtain 45 . 2 g . of dl tetramisole hydrochloride , compound vii , which represents a 98 . 9 % overall yield based on the starting compound iii . the product contained 0 . 15 % by weight of styryl impurity viii . the procedure of example 3 is followed except that 1 . 0 mole of sulfuric acid is added per mole of sodium chloride present in the starting compound iii . the overall yield based on real starting compound iii is 93 . 7 % of theory . the product contains 0 . 15 % by weight of styryl impurity . this example illustrates that a lower yield is obtained in the absence of sulfuric acid even when the chlorination reaction is prolonged . a laboratory pressure bottle is charged with 75 . 0 g . of material which contains 15 . 5 g . of sodium chloride and 49 . 2 g . of real dl 3 -( β - hydroxyphenethyl )- 2 - iminothiazolidine hydrochloride , and 116 ml . of 36 % hydrochloric acid ( 22 ° be &# 39 ;) and the mixture is heated at 45 °- 47 ° c . for 70 hours . at the end of this time , the reaction mixture is cooled and worked up in the same manner as in example 3 . the yield of dl 6 - phenyl - 2 , 3 , 5 , 6 - tetrahydroimidazo [ 2 , 1 - b ] thiazole hydrochloride based on starting material charged is 80 % of theory . to a 500 ml . flask is added 91 . 8 g . ( 78 ml ; 0 . 93 mole ) of 37 % aqueous hydrochloric acid , and 79 . 0 g . ( 0 . 2 mole ) of dl - 3 -( β - hydroxyphenethyl )- 2 - iminothiazolidine iii , as the p - toluene - sulfonate salt . the flask vents are sealed , and 55 . 8 g . of 97 % sulfuric acid ( 30 . 5 ml ; 0 . 57 mole ) is added to the reaction mixture over a period of one hour while stirring and maintaining a temperature of 30 °- 32 ° c . with external cooling . after the addition of the sulfuric acid is completed , the reaction mixture is heated and held at 40 °- 46 ° c . for 20 hours . samples of the crude reaction mixture are taken after 2 , 4 , and 20 hours , respectively . the samples , after diluting with water , adjusting the ph to 3 with ammonium hydroxide and then diluting with methanol , are spotted on thin layer plates ( silica gel f - 254 ) and developed in a 50 : 50 : 1 . 5 acetone : toluene : ammonium hydroxide solvent system . the developed plates clearly show that the major product in all three samples is dl - 3 -( β - chlorophenethyl )- 2 - iminothiazolidine - p - toluenesulfonate , iv . essentially no dl tetramisole , vi , and very little unreacted dl - 3 -( β - hydroxyphenethyl )- 2 - iminothiazolidine , iii , is present . a small portion of the reaction mixture is diluted with water , and the product is filtered . the isolated material on recrystallization from ethanol is identical to an authentic sample of dl -( β - chlorophenethyl )- 2 - iminothiazolidine - p - toluenesulfonate , iv , by infrared analysis and melting point ( 200 °- 201 ° c .). the main portion of the reaction mixture containing the chlorinated compound , iv , ( 0 . 195 moles as iii ), is added to a 2 - liter flask containing 750 ml . of water and 250 ml . of toluene . while stirring , 50 % sodium hydroxide is added at 55 °- 60 ° c . until the ph is stabilized at 9 - 9 . 5 ; a total of 118 ml . of 50 % sodium hydroxide is required . the toluene phase is separated from the aqueous phase , clarified by filtration , and dl tetramisole hydrochloride is precipitated by the addition thereto of isopropanolic hydrogen chloride until a blue color is obtained with congo red indicator paper . on cooling to 10 ° c ., the dl tetramisole hydrochloride is separated by filtration and washed with isopropanol . after air drying , a total of 42 . 7 g . ( 91 % yield ) of dl tetramisole hydrochloride is obtained which melts at 258 °- 262 ° c . the product contains less than 0 . 2 % by weight of the styryl impurity , viii . a laboratory pressure bottle is charged with 92 ml . of 37 % hydrochloric acid , cooled to 0 °- 5 ° c ., and a mixture consisting of 79 . 0 g . ( 0 . 2 mole ) of dl - 3 -( β - hydroxyphenethyl )- 2 - iminothiazolidine - p - toluene sulfonate and 40 . 4 g . ( 0 . 69 mole ) of sodium chloride is added . the mixture is cooled to 0 °- 5 ° c ., and 89 . 2 g . of 97 % sulfuric acid ( 0 . 875 mole ) is added . the pressure bottle is closed , and the contents heated at 50 ° c . for 20 hours . the reaction mixture is cooled and added to a mixture of 200 ml . water and 250 ml . of toluene . the mixture is agitated at 20 °- 30 ° c . and 50 % sodium hydroxide solution is added thereto dropwise to adjust the ph to 6 . the mixture is heated to 50 °- 55 ° c ., 40 . 0 g . of anhydrous potassium carbonate is added quickly , and the mixture is stirred at 50 °- 55 ° c . for 2 hours . at the end of this time , an additional 100 ml . of water is added , the lower aqueous layer separated , and the organic layer clarified . the clarified organic layer is treated with a solution of isopropanolic hydrogen chloride below 40 ° c . to the point where congo red test paper changes from red to blue . the reaction mixture is then cooled to 10 ° c ., the precipitate is separated by filtration , and filter cake washed with 100 ml . of ambient temperature isopropanol . the product is air dried to constant weight to obtain 44 . 4 g . ( 92 . 5 % yield ) of dl tetramisole hydrochloride , compound vii . the product contains less than 0 . 1 % of the styryl impurity , viii . a sample of dl - 3 -( β - hydroxyphenethyl )- 2 - iminothiazolidine - p - toluenesulfonate ( 7 . 9 g ., 0 . 019 mole ), concentrated hydrochloric acid ( 37 % aqueous ; 10 ml ., 0 . 09 mole ) and sodium chloride ( 4 . 0 g .) are mixed in a pressure vessel and cooled to 0 ° c . to 5 ° c . concentrated sulfuric acid ( 96 %; 5 ml ., 0 . 057 mole ) is added to the mixture in a closed system over 1 hour at 0 ° c . to 5 ° c . the reaction mixture is heated in 15 minutes to 45 ° c . to 50 ° c . and held at 48 ° c . for 5 hours . it is then cooled down and stirred overnight in a closed system . the pressure is then released and the reaction mixture poured on an ice / water mixture . the precipitate formed is collected by filtration , washed and dried to afford 7 . 9 g . white solid ( 95 . 8 % yield ). infrared analysis shows the sample to be identical to an authentic sample of dl - 3 -( β - chlorophenethyl )- 2 - iminothiazolidine p - toluenesulfonate . a sample recrystallized from methanol has a m . p . of 198 ° to 200 ° c . no dl tetramisole is found in the reaction mixture by thin layer chromatography . a mixture of dl - 3 -( β - chlorophenethyl )- 2 - iminothiazolidine - p - toluenesulfonate ( 2 . 0 g ., 0 . 0048 mole ), water ( 25 ml .) and toluene ( 25 ml .) is stirred , cooled to 0 ° c . and sodium hydroxide ( 50 % aqueous ) added slowly at 0 ° c . until the ph of the reaction mixture stabilizes at 9 . the toluene layer is separated , clarified and a mixture of 2 - propanol / hydrochloric acid added to the point where congo red test paper changes from red to blue . the mixture is heated to reflux , cooled and filtered . the crystalline solid obtained is air dried to afford dl tetramisole hydrochloride ( 1 . 1 g ., 96 . 5 % yield ). infrared analysis shows the sample to be identical to an authentic sample of dl tetramisole hydrochloride . | 2 |
while the present invention is susceptible of embodiment in various forms , there is shown in the drawings and will hereinafter be described a presently preferred , albeit not limiting , embodiment with the understanding that the present disclosure is to be considered an exemplification of the present invention and is not intended to limit the invention to the specific embodiments illustrated . referring to fig1 a - 2b , a removable seat cover 10 in accordance with the instant invention , is shown . the seat cover 10 may be made of any material , or combinations of materials , known to one of skill in the art , including but not limited to moisture impermeable materials , absorbent materials , wicking materials , waterproof materials , hydrophobic , non - absorbing materials , or rubberized backing materials . the seat cover 10 may be made of flexible material to allow the user to store the seat cover 10 in a folded or rolled - up state . the removable seat cover 10 contains an elongated material having a first front surface 12 and a second back surface 14 . the seat cover 10 is defined by a top side 16 , a bottom side 18 , and opposing sides 20 and 22 . the distance between the top side 16 and the bottom side 18 defines the length of the seat cover 10 , which can be made in various lengths to accommodate the object it covers or is intended to cover . the distance between opposing sides 20 and 22 defines the width of the seat cover 10 and can be varied depending upon the width of the object it covers or is intended to cover . the shape of the seat cover can vary as well , thereby allowing for the seat cover 10 to be adaptable to a variety of sitting or lying surfaces . the seat cover 10 may include a plurality of pockets which effectively divide the seat cover 10 into a plurality of defined areas . for example , a first pocket 24 defines an upper portion 26 , see fig2 a . the upper portion 26 is generally placed upon the upper end of a seat , typically at or near where the head and / or the shoulder of the user rests . the first pocket 24 has an open end and a closed end to define an inner cavity adapted to receive and support objects . the first pocket 24 is preferably sealed by a sealing member , such as a zipper 28 . while each of the figures illustrates the cover using a zipper 28 , other means , or combinations thereof , of closing a pocket , such as but not limited to , use of fabric loop and fasteners , such as velcro , buttons , snaps , stitching , or the like , may be used as well . the pocket may be formed as a hidden pocket or may extend outwardly like a pouch . referring back to fig1 a , a second pocket 30 defines a lower portion 32 of the seat cover 10 . the lower portion is generally placed at the bottom end of the object to be covered , typically where a user &# 39 ; s feet and legs rest . the second pocket area 30 is closed by use of the zipper 28 . the distance between the upper portion 26 and the lower portion 32 is the main body portion 34 . the main body portion 34 may contain curved areas 36 and 38 which are designed to provide coverage of the areas of a seat where the backrest meets the seating area . in order to provide additional storage , the seat cover 10 may optionally include one or more additional pockets 39 enclosed by a zipper 28 . while the additional pocket 39 is illustrated on surface 14 , such pocket may be positioned on either surface 12 or 14 and placed along any part of the surface . referring to fig1 b , two opposing pockets 39 are positioned along the upper portion 26 . the two opposing pockets 39 are sized and shaped to hold personal belongings such as money , credit cards , identification , a portable media player which is capable of storing and playing digital media ( audio , video , and the like ), such as an apple ipod , or other electronic devices such as cell phones , cameras , or tablet computers . in a preferred embodiment , the second pocket 30 positioned on the first surface 12 is aligned in a substantially parallel manner and adjacently connected to the pocket 39 positioned on the second surface 14 , thereby forming a dual pocket assembly 41 , see fig2 b . fig3 illustrates an alternative embodiment of the seat cover 10 in which the upper portion 26 contains a pocket which is sealed by stitching 40 . in the lower corner of the upper portion 26 is a valve 42 , such as a boston valve or an oral inflation valve commonly used in blow - up beach balls , for easy inflation and deflation . fig4 is a partial view of 4 - 4 of fig3 , illustrating the valve 42 attached to a portion of surface 12 . the valve 42 contains a main body 44 with sealing cap 46 . the valve 42 is preferably a one - way valve . inflation of the upper portion , therefore , may be commenced by squeezing main body 44 while simultaneously exhaling air within opening 48 . as the air is blown in , the upper portion 26 expands , forming an air cushioned area for placing a portion of a user &# 39 ; s body , such as the head , thereupon . once the desired amount of inflation has been reached , cap 46 is secured to opening 48 . fig5 illustrates the seat cover 10 having a fully inflated upper portion 26 . referring back to fig3 , the lower portion 32 contains one or more independent compartments , illustrated herein as cylindrical pockets 50 and 52 . the cylindrical pockets , which may be formed by continuous side walls 49 or 51 , are constructed and arranged to hold various items , particularly liquid drinks or beverages , such as soda or beer cans 53 , water bottles , or the like which can be inserted through opening 55 . the cylindrical pockets , as well as any other pocket constructed and arranged to hold beverages is referred to generally as the beverage container holding pocket . each of the ends of cylindrical pockets 50 and 52 may optionally contain partial enclosures 56 such as velcro strips , see fig5 , or full enclosures ( not illustrated ) to provide the capability to partially or completely seal the ends and prevent items stored within from falling out during transportation . to maintain the beverage at a certain temperature , the cylindrical pockets 50 and 52 may be made of or lined with insulating material , such as neoprene , insulating foam liner , insulating foam rubber liner , vinyl , vinyl - plastic , or other insulating materials known to one of skill in the art . additionally , the cylindrical pockets 50 and 52 may be made of a waterproof material to allow the pockets to be filled with ice . referring to fig6 , an alternative embodiment of the seat cover 10 is illustrated . the first pocket 24 positioned on upper portion 26 is sized and shaped to receive a pillow 58 . placed within a beverage container holding pocket 59 is a beverage holding device , or support tray 60 . the beverage container holding pocket 59 is preferably attached to or integrally formed within the lower portion 32 of the front surface 12 , the bottom end of the back surface 14 , or combinations thereof , and has an open end and a closed end to define an inner cavity adapted to receive and support at least one beverage container . the beverage holding device 60 contains a plurality of individual beverage holding cavities 62 which are sized and shaped to accommodate beverages of different sizes and shapes , i . e . cans , bottles , pouches , and is designed to maintain the beverage holders in an upright position through , for example use of loops , a rack , clips , or other securing devices known to one of skill in the art . the beverage holding device may be secured within or to the pocket by any means known to one of skill in the art , such as stitching or use of fastening chemicals . to maintain the beverage at a certain temperature , the beverage container holding pocket may be made of or lined with insulating material , such as neoprene , insulating foam liner , insulating foam rubber liner , vinyl , vinyl - plastic , or other insulating materials known to one of skill in the art . additionally , the beverage container holding pocket 59 may be made of a waterproof material to allow the pockets to be filled with ice . once secured therein , the beverage container holding pocket 59 effectively forms a beverage cooler , thereby eliminating the need for a large and bulky traditional style cooler . referring to fig7 and 8 , seat cover 10 is illustrated in use . for example , fig7 illustrates a typical car seat arrangement having two seats 63 and 64 separated by a console 66 . car seat 63 is illustrated without seat cover 10 and includes a head rest portion 68 , a backrest portion 70 , a seat portion 72 , and a leg rest portion 74 . seat 64 is illustrated with seat cover 10 . the upper portion 26 is placed over the head rest 68 by placing the head rest 68 within the first pocket 24 . the upper portion 26 , therefore , allows for attachment to the back and / or head rest of the seat , functioning to keep the seat cover 10 in place while making it easy to install and remove . the main body portion 34 of the seat cover 10 is draped along the backrest portion 70 and seat portion 72 . the curved portions 36 and 38 are positioned along the area where the backrest portion 70 and the seat portion 72 meet in order to provide complete coverage . the lower portion 32 is draped over the leg rest portion 74 , thereby ensuring seat 64 is covered by seat cover 10 . fig8 illustrates seat cover 10 placed on a lounge chair 76 . the seat cover 10 illustrated in fig8 may be the same seat cover as illustrated in fig7 . in such a case , the user simply removes the seat cover 10 from the car seat 64 and places it onto lounge chair 76 . as illustrated , the upper portion 26 has an inflated head rest portion , either through the use of air or through the use of an inserted pillow , positioned at the top portion 78 of the lounge chair 76 . the main body portion 34 is draped along the body portion 80 of the lounge chair 76 . the lower portion 32 is placed at the bottom portion 82 of the lounge chair 76 . while not illustrated , the lower portion may contain either the cylindrical portions 50 and 52 or the beverage holding device 60 , thus providing a cooler which stores beverages while the user is lying down on the lounge chair 76 . while the seat cover 10 is shown covering a seat or lounge , the seat cover 10 can be applied to other surfaces , such as but not limited to grass , the beach , cement , or pavement . referring to fig9 , the seat cover 10 is shown placed over a sand filled environment 84 , such as the beach . all patents and publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains . all patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference . it is to be understood that while a certain form of the invention is illustrated , it is not to be limited to the specific form or arrangement herein described and shown . it will be apparent to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what is shown and described in the specification and any drawings / figures included herein . one skilled in the art will readily appreciate that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned , as well as those inherent therein . the embodiments , methods , procedures and techniques described herein are presently representative of the preferred embodiments , are intended to be exemplary and are not intended as limitations on the scope . changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention and are defined by the scope of the appended claims . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to such specific embodiments . indeed , various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art are intended to be within the scope of the following claims . | 1 |
fig1 portrays an exemplary substrate or structure to which adhesive films are commonly applied . structures of this sort may occur , for example , in truck bodies , especially van and semi - trailer bodies , wherein overlapping panels 12 and 14 are aluminum side panels and member 16 is a vertical frame member inside the van body . the structure is held together by rivet 10 , having head 11 , which protrudes above the exterior surface of panel 12 . referring to fig2 , film 20 comprises a backing and a pressure activated adhesive layer , wherein the adhesive layer is adjacent to surface 23 of panel 12 . in one embodiment , film 20 comprises a thermoplastic backing , which is durable at room temperature but soft and conformable at elevated temperatures . it has been found that commonly used thermoplastic film materials , such as plasticized polyvinyl chloride , polyolefin polymers and copolymers , and a variety of polyesters , exhibit a range of suitable temperatures above their softening points at which the method of the present invention can be used . it will be understood that some film materials having softening points at or below room temperature may be suitable for some applications of the present invention without the heating step . additionally , multilayer films , such as those comprising an overlaminate , as well as single layer films , have been found useful in the present invention . also , since many pressure activated adhesives exhibit thermoplastic properties , conformance of the adhesive layer to the surface can also be improved by embodiments of the present invention in which heat is applied as part of the conforming process . suitable adhesive films are commercially available from 3m company , and are commonly called marking films . examples include 3m ™ scotchcal ™ marking film , available from 3m company , st . paul , minn ., and thermoformable 3m ™ scotchlite ™ reflective sheeting , also available from 3m company . it is an advantage of the present invention that film materials which might not have been previously suitable as adhesive laminating films can now be used , due to greater latitude in heating which is made possible by the reduced mechanical contact occurring during the conforming process . film 20 is applied by , for example , hand lamination , over surface 23 and rivet head 11 . as a result , detached region 24 is formed by a detached section 21 of film 20 which is held away from panel 12 by rivet head 11 , a phenomenon referred to as tenting . similarly , if film 20 is laminated over a depression , a phenomenon called bridging occurs , wherein film 20 covers the depression without conforming to it . while film tenting and bridging may or may not have significant effects on the appearance of the laminated film , they can have a detrimental effect on the long - term durability of the film . for example , if weathering or other adverse conditions cause embrittlement or cracking of film 20 , the unsupported section 21 may tear or be removed entirely , while damage to the attached portion of film 20 may be much less visible due to the fact that it is supported and held in place by surface 23 . while the present invention is useful for conforming relatively small detached sections of film to a surface the methods of the present invention are not so limited . it has been found that larger detached sections of film can be conformed to a surface by the method of the present invention using easily learned techniques . in one embodiment , wherein film 20 is thermoplastic , detached sections near the periphery of the detached region are first heat softened and aspirated , followed by repeated application of heat and aspiration to the remaining detached region . the volume of the detached region becomes progressively smaller , until the entire detached film section has been conformed and adhered to the surface . an alternative technique which has been found useful for conforming large detached sections of film is to insert the aspirator probe into the film in the detached region , without applying vacuum , then start the vacuum , and finally heat portions of the film adjacent the detached region , beginning in the areas farthest from the aspirator probe , while maintaining aspiration . in the case of film which is highly conformable at room temperature , heating may not be necessary to produce acceptable conformance . referring to fig3 , an apparatus for carrying out an embodiment of the method of the present invention is portrayed schematically . the apparatus includes heat source 30 and aspirator probe 32 . heat source 30 may be , for example , a source of heated air which is blown at detached film section 21 , a radiant heat source , or any other heat source capable of heating detached film section 21 to a suitable temperature without scorching , burning , or otherwise damaging the film . energy for heat source 30 may be from an electrical source , from combustion of a fuel , or from any other suitable source . it is preferred that detached film section 21 be heated to a temperature above its softening point , and preferably to a temperature where most , and preferably all , residual stresses are relieved , but not so hot that the film 20 loses its integrity , becomes scorched , or is otherwise damaged . referring again to fig3 , aspirator probe 32 comprises a contact portion 34 and a connector portion 36 . contact portion 34 may be , for example , a metal tube or hollow needle having end 33 with an opening , wherein the end 33 is squarely cut off in a plane perpendicular to the central cylindrical axis of the tube . it has been found that metal tubes having outer and inner diameters similar to 10 to 22 gauge hypodermic syringe needles are particularly suitable . tubing of this sort is available from aldrich scientific , 1001 west saint paul avenue , milwaukee , wi 53233 . as specified by aldrich , hypodermic tubing of the 10 gauge size has an inside diameter of about 2 . 7 millimeters and an outside diameter of about 3 . 4 millimeters . hypodermic tubing of the 20 gauge size has an inside diameter of about 0 . 58 millimeters and an outside diameter of about 0 . 90 millimeters . the optimal gauge depends on several factors , including the heat source type and temperature , film type , film thickness , the amount of detached film , and vacuum level and airflow characteristics of the vacuum source . it has been found that 15 – 20 gauge tubing is preferred for typical graphic marking films applied over rivets . smaller diameter tubes tend to reduce the flow rate of the probe . reduced flow rates can , in some cases , have a detrimental effect on the net pressure differential achievable in pressing film section 21 against rivet head 11 and surface 23 . reduced flow rates may also reduce the speed at which conformance of film section 21 against rivet head 11 and panel 12 is achieved . larger diameter tubes , on the other hand , tend to produce larger apertures in the film 20 , which may have a detrimental effect on appearance . it has been found that the particular material used to make the tubes is not critical , though metal tubes , particularly tubes made of stainless steel hypodermic needle tubing , have the advantage of durability . it will be appreciated that while cylindrical tubing has been found suitable , other cross - sectional shapes may also be used , and may in some instances offer advantages , which would cause them to be preferred . moreover , while cylindrical tubes of constant cross section have the advantage of simplicity , it may be useful in some instances to use tubes of varying or adjustable cross sectional dimension . for example , a short tube of small diameter which contacts the film might then expand or be replaced by a larger diameter tube for enhanced airflow and less risk of clogging . also , different probe tip configurations may be appropriate for different applications . for example , probe tips , which are squarely cut in a plane perpendicular to the axis of the tube to produce a flat tip , have been found suitable for applications wherein the film is heated prior to aspiration . on the other hand , in cases wherein the probe is inserted through the film prior to heating , as might be done when aspirating very large detached regions or wherein no heating is being used , a probe with a beveled , serrated , or similar configuration that is better capable of cutting the film might be more useful . it is contemplated that assortments of probes of different configurations may be provided and that probes will be easily removed and installed , so that the user can select the most appropriate probe for any particular task and , if necessary , try a variety of probe tips before deciding on the one which is most suitable . referring to fig4 , aspiration of entrapped air from detached region 24 is initiated by contacting aspirator probe 32 onto detached film section 21 , and continuing to urge it against the film section 21 , to form indentation 40 . in one embodiment of the present invention , this downward urging is performed after heat softening of film section 21 . at some point in the process , the level of heat softening and the downward force on probe 32 reach levels sufficient to produce penetration of film section 21 , thereby forming aperture 50 , as portrayed in fig5 . in one embodiment , this penetration is produced simply by exerting sufficient probe force against sufficiently heat softened film section 21 , while in an alternative embodiment , a predetermined probe force is first exerted and maintained , prior to heat softening , and the film section 21 is then heated until sufficient softening occurs to allow penetration of the probe through the film section 21 and consequent formation of aperture 50 . in yet another embodiment , the probe tip is able to penetrate the film section 21 without heat , and the film is conformed to the surface with or without heating , as needed , depending on the properties of the film 20 being used . the inventors do not wish to be bound by any particular theory as to the exact mechanism of probe penetration through the heat softened film , and in fact observation of the penetration phenomenon under various conditions suggests that more than one mode of penetration may occur . in some instances , it appears that penetration may be aided by heat - softened film section being drawn into the probe by the vacuum applied to the probe . in other cases , the probe may mechanically cut at least a portion of the film section prior to penetration . likewise , the exact nature of the seal between contact portion 34 of probe 32 and film section 21 is not known . moreover , it is not known whether a significant amount of sealing occurs , or , if it does occur , the time duration of any such sealing . it appears , however , that there is sufficient restriction of flow between contact portion 34 and aperture 50 to allow sufficient net flow of air out of region 24 into probe 32 to produce a air pressure reduction in detached region 24 which is below ambient or atmospheric pressure . this pressure reduction is effective in collapsing the detached region 24 and producing surface conformance as portrayed in fig6 . in some instances , it appears that an aperture can be made in film section 21 with a first instrument , and that the vacuum probe can then be brought into proximity with the aperture , without actually entering the aperture , to produce sufficient air pressure reduction within detached region 24 to produce conformance . the present invention is not limited to any particular hydrodynamic model for the process of reducing air pressure within a detached region . referring to fig7 , after conformance has been achieved , probe 32 is retracted , leaving aperture 50 , which can , by suitable choice of the size of contact portion 34 , is preferably sufficiently small to be essentially inconspicuous . the term vacuum source may include any device , including any volume or enclosure that preferably provides a reduced air pressure therein which is capable of generating a flow of air sufficient to produce an effective level of vacuum in the detached region 24 when aspirated by an aspirator probe connected to the vacuum source . vacuum sources may be continuous or intermittent . examples of continuous vacuum sources include piston type vacuum pumps , rotary vane type vacuum pumps , turbine type vacuum apparatus such as those used in vacuum cleaners , hydrodynamic flow generating devices such as venturi devices , and other continuous airflow apparatus which produce reduced air pressures while generating an effective level of airflow . examples of intermittent vacuum sources include spring actuated or manually actuated pistons and diaphragms , elastic bulbs , as well as other devices which produce reduced pressure by an expansion of an enclosed volume . vacuum tanks and other enclosed volumes from which a quantity or air has been removed can also function as vacuum sources . vacuum sources can also include combinations of the above devices and apparatus . as used herein , the term vacuum valve will mean any valve interposed between an aspirator probe and a vacuum source . vacuum valves may be used to control the application of vacuum to the aspirator probe . in one embodiment of the present invention , aspirator probe 32 is provided as a handheld device . more particularly , probe 32 is provided as a handheld probe preferably having approximately the size , shape , and general configuration of a writing instrument such as a pencil or pen , so as to take advantage of the dexterity already developed by many people in using devices of this configuration . in embodiments wherein heat is used , heating of the film can be provided by an electrically powered heat gun . since heat guns of this sort are commercially available with air temperature sensing instrumentation and air temperature controlling systems , it has been found that operators can develop a high level of skill in producing an effective heating and aspirating sequence to achieve conformance of film section 21 around rivets and other surface irregularities without significant damage to the film 20 . it is an advantage of the present invention that since there is little mechanical contact between the heated film section 21 and the aspirator probe 32 , except at the point of penetration , it may be possible , in some cases , to heat the film section 21 to a higher temperature during the conforming process , without causing the sort of damage that might occur , for example , if brushes , pads , or other like devices were to contact the film 20 in its heat softened state . this additional freedom eases the operator &# 39 ; s task and may allow improved conformance due to greater softening of the film 20 . in an alternative embodiment , probe 32 can be positioned and urged against detached film section 21 by use of a mechanical holding and moving means , as portrayed schematically in fig8 . probe 32 is positioned in the horizontal direction , relative to , for example , rivet head 11 , by probe holder 80 , represented schematically in sectional side view , which rests on film 20 and is slidable thereon to position probe 32 in the horizontal direction . fig8 portrays fixture 80 prior to positioning , being moved in a direction along the arrow designated by the numeral 81 for final positioning prior to aspiration . fig9 portrays probe 32 in position for aspirating detached film section 21 prior to contacting the film 20 . it is preferred that probe holder 80 be configured so as not to contact any portion of film 20 which is in a heat softened state , as this may produce mechanical damage to the film surface . probe holder 80 may include locating means such as notches or other features , which engage specific mechanical features of the substrate to which film 20 is being laminated , for the purpose of locating holder 80 relative to the rivet 10 or other feature to which detached film section 21 is being conformed . for example , holder 80 may comprise one or more notches which receive other rivets in areas where film 20 is unheated , so as to be positively located relative to rivet 10 . additionally , some or all of holder 80 may be made of a transparent material to enable better viewing of the area proximate to detached region 24 . heat source 30 is portrayed only schematically , and may take many forms , such as a hand held heat gun or a heating device incorporated into probe holder 80 . optionally , the heat source may be connected with the probe as a single , handheld unit . as an additional option , the hand held unit may include a self - contained vacuum source such as a vacuum pump . fig1 portrays aspirator probe 32 in contact with detached film 21 , just prior to penetration of film 21 and beginning of aspiration . the probe 32 is moved in the direction of the arrow 91 in order to penetrate the film . vertical motion and urging of probe 32 against detached film 21 may be produced and controlled by any suitable means , not shown . such urging means include manual actuation , fluid or vacuum operated actuators , mechanical linkages , electromechanical devices such as motors and solenoids , as well as springs and other resilient mechanical components . referring to fig1 , in an alternative embodiment , an array 142 of aspirator probes 32 may be provided . in this embodiment , array 142 may also include array 140 of heating elements 146 . it will be understood that while heating elements 146 are shown as separate elements , they may optionally be all part of a single heat source . for example , they could be nozzles in a single manifold carrying heated air . heat source 140 may be a source of heated forced air , radiant heat , or other suitable heat source . in one embodiment , portrayed in fig1 , probes 32 are preferably independently movable and resiliently mounted so that when array 142 is lowered onto detached film section 21 , each of probes 32 contacts detached film section 21 with a suitable force , without either causing or preventing other probes from also contacting film section 21 . referring to fig1 , one or more of probes 32 may penetrate film 21 . probes which contact the film in areas which are not detached will not penetrate , while those contacting detached areas may be expected to penetrate , as portrayed at penetration point 164 . in the following examples , conformance of thermoplastic adhesive films to test plates was visually evaluated for degree of conformance , avoidance of air entrapment , absence of wrinkles , and other damage to the film , which may have occurred during the conforming process . in the case of conformance of film over surface protrusions , a useful measure of conformance is lifting distance d , which is the distance from the point of detachment on a protrusion to the point at which the detached film section contacts the surface to which it is being adhered . in the case of complete conformance with no tenting , the film is attached completely up to the edge of the protrusion ( such as the edge of a rivet head ), resulting in a lifting distance of 0 . referring to fig1 , detached film section 21 is portrayed as having outer detachment boundary 171 and inner detachment boundary 173 , wherein film 20 is attached to surface 23 outside of boundary 171 and attached to rivet head 11 inside of boundary 173 , but detached in region 172 , which is inside boundary 171 and outside of boundary 173 . lifting distance d is measured at several sample points , producing distances d 1 , d 2 , d 3 , and d 4 , for example . average lifting distance d may then be reported as the average of measurements d 1 – d 4 . since the effects of film detachment are primarily visual , the location of boundaries 171 and 173 are determined visually , and sufficiently precise measurements can usually be made with a millimeter scale . alternatively , a typical location may be selected for taking a single measurement , d , based upon the overall visual effect of the tenting . this process , referred to as visual averaging , has been found in many cases to give a fair portrayal of the level of conformance to the film to the surface in the areas around rivets . another defect arising from incomplete film attachment is air entrapment , which occurs as bubbled or wrinkled film at points near , but not adjacent to , protrusions . wrinkles may be the result of air entrapment or of film deformation , which leaves an excess amount of film in a particular location . air entrapment may not be permanent . if the amount of entrapped air is sufficiently small , the air may dissipate over time , thereby allowing film in the affected area to adhere uniformly to the substrate without the appearance of visual defects from the entrapped air . various processes of conforming thermoplastic adhesive film to surfaces can produce film damage . such damage usually takes the form of surface abrasions , scratches , tears , or puncture holes due to tools being applied to the heat softened film to press it into place . additionally , scorching , wrinkling , or damage due to overheating the film or to other mishaps can also occur . in the following examples , damage of these types will be reported as defects when visible . it is an advantage of the present invention that abrasion , scratching , and other surface damage caused by mechanical contact is reduced , since the film is pressed into conformance with the surface to which it is being adhered by means of air pressure differentials rather than by mechanical contact . the present invention may produce , in some instances , visible holes from penetration of the aspirator probe . the diameter of these holes is reported in millimeters ( mm ). the following examples were produced by selecting various thermoplastic adhesive films , commercially available from 3m company , st . paul , minn ., and laminating them to painted aluminum test plates having dimensions of 10 . 2 × 30 . 4 centimeters , into which four test rivets had been inserted at a spacing of 7 . 7 centimeters , with the rivet nearest the end of the panel being at a distance of 3 . 5 centimeters from the end of the plate . the rivet spacing was chosen to place the rivets sufficiently far apart to avoid interaction between them during the laminating process . the test plates were painted with a standard white vehicle paint of the type commonly used on semi - trailers . the rivets were of a type commonly used in the fabrication of aluminum semi - trailer bodies , having a rivet head diameter of 12 millimeters , and a rivet head height of about 1 . 5 millimeters . the rivets were tightly pressed into the test panels so that the heads were seated firmly against the painted surface . descriptions of the films used in the following examples are given in table 1 . in table 1 , the first column gives the use of each film and the type of adhesive used for that film . in column 1 , protective overlaminates are transparent films , which are laminated over graphic films , usually after imaging but before application to a surface , to provide protection for images on the graphic film . graphic films are films , which are capable of receiving a graphic image by such imaging means as ink jet printing , electrostatic printing , thermal transfer printing , or other graphic imaging techniques . changeable graphic films are those having a reduced level of adhesion , so as to allow them to be removed without the use of special equipment such as heat guns or other removal equipment . films having comply ™ performance are films in which the topography of the adhesive surface includes channels for the egress of air or other fluids . adhesive surfaces having topographies of this sort are disclosed in u . s . pat . no . 6 , 197 , 397 b1 . controltac ™ adhesive systems comprise adhesive layers having isolated protrusions , either tacky or non - tacky , on the adhesive surface . these protrusions limit initial adhesion so as to allow repositioning on a substrate prior to forming a pressure - activated bond . adhesive systems of this type are disclosed in u . s . pat . no . 5 , 296 , 277 and u . s . pat . no . 5 , 362 , 516 . referring to fig2 , the film samples were laminated to the rivet head side of the test plates using a 3m pa - 1 squeegee type applicator , available from 3m company , taking care to avoid wrinkling , but allowing smooth tenting of film 20 to occur over rivet head 11 , to form detached film portion 21 . referring to fig1 , a typical distance d for the tented film was in the range of 8 – 10 millimeters after this initial application . several samples of each film were laminated to different test plates for testing under various conditions of aspirator probe diameter and heating conditions . unless noted otherwise , flat - tipped , stainless steel , syringe tubing was used as aspirator probes . the vacuum source for the aspirator probes was a rotary vane vacuum pump manufactured by gast mfg ., inc ., a unit of idex corp . of benton harbor , mich . comparative examples were also run using traditional application tools such as 3m rivet brush applicator rba - 3 , 3m mpp - 1 multipin punch , disclosed in u . s . pat . no . 6 , 311 , 399 , and 3m rivet finishing pad cmp - 1 , all commercially available from 3m company . heating of laminated film samples was performed using a heavy - duty heat gun , available from mcmaster - carr , atlanta , ga ., and designated as mcmaster - carr catalog number 3433k21 . unless otherwise noted , an air temperature setting of 427 ° c . ( 800 ° f .) was used . samples were placed on a laboratory workbench during heating and aspiration . the detached film section around each rivet was heated with the heat gun , using a predetermined air temperature setting , holding the heat gun at a distance of approximately 2 – 7 centimeters from the film surface , for about 0 . 5 – 4 . 0 seconds , or until softening of the film became visible . it was found that different types of films and different thicknesses of films required different amounts of heating , but that skill in judging a sufficient amount of heating could easily be learned . once the film had softened , the aspirator probe , which was connected to a vacuum pump , was applied to each of the tented regions at a location near the edge of the rivet head , while simultaneously removing the heat gun . after the aspirator probe had penetrated the film and conformance had been achieved , the probe was removed . conformance of the detached film sections against the test panel was typically so rapid that a snapping sound was generated as the film became adhered to the test panel surface . the heating and aspiration process was then repeated for the remaining three rivets on each test panel . the riveted areas were then conditioned at 66 ° c . ( 150 ° f .) for 7 days . each rivet on each sample was then tested for quality of conformance , as measured by detached film distance d , and absence of damage or other defects . comparative examples were prepared using the 3m multipin punch , mpp - 1 in combination with either the 3m rivet brush applicator , rba - 3 , or the 3m rivet finishing pad , cmp - 1 . in both cases , several small holes (˜ 0 . 2 mm in diameter ) were created in the detached film section around the rivet by striking the film with the mpp - 1 . the film was then heated with a heat gun set at the desired air temperature in a similar manner as in the table 2 examples . next , the appropriate finishing tool was forced against the detached film section . a circular brushing motion was used with the rba - 3 , whereas one downward stroke was used with cmp - 1 . results for examples 1 – 27 are shown in table 2 and results for comparative examples c1 – c16 are shown in table 3 . the average lifting distance , d , and the ranges of visible whole sizes for each test panel are reported . descriptions of the film materials used in the examples reported in tables 2 and 3 are given in table 1 . in table 2 , the tubing used was stainless steel hypodermic tubing obtained from aldrich scientific . in table 2 , the visible hole size in column 6 refers to the apertures produced by the aspirator probes , while in table 3 , the visible hole size refers to holes produced by the 3m mpp - 1 multipin punch used prior to heating the detached sections or holes created when pressing the detached sections down with the rba - 3 brush or the cmp - 1 rivet finishing pad . referring to table 2 , examples 1 – 9 demonstrate the that lifting distances d of less than 2 . 0 mm can be achieved with a changeable adhesive , as is used on 3m ™ scotchcal ™ 3500c marking film . moreover , as demonstrated by examples 4 – 6 and examples 7 – 9 , lifting distances of less than 2 . 0 mm can , with suitable choice of probe diameter , also be achieved when an overlaminate is present . historically , it has been noted that good conformance , as measured by lifting distance d , has been more difficult to achieve when changeable adhesives are used , due to the lower adhesion of such adhesives . likewise , it has been found that films having an overlaminate are more difficult to conform to irregular surfaces , due to their increased thickness , which results in increased stiffness . referring to table 3 , comparative examples c1 and c2 demonstrate that , even without an overlaminate , the use of a brush to conform 3m ™ scotchcal ™ 3500c marking film to a rivet head does not achieve a lifting distance in the range of 2 . 0 mm , while the use of pad or brush for this purpose produces significant surface damage and wrinkling . comparative examples c3 – c6 further demonstrate that when overlaminates are present , lifting distances in the range of 2 . 0 mm are not achieved using the brush or the pad , and that significant surface damage and wrinkling can occur . referring again to table 2 , examples 10 – 12 demonstrate the method of the present invention in conforming 3m ™ scotchcal ™ 3540c marking film to rivet heads . the adhesive layer of 3540c marking film has a surface topography of the type disclosed in u . s . pat . no . 6 , 197 , 397 , to allow egress of trapped air . as shown in table 2 , probe diameters can be chosen to achieve lifting distances d of less than 2 . 0 mm with relatively little surface damage . comparative examples c7 and c8 , however , show significant surface damage when either the brush or the pad are used . referring again to table 2 , examples 13 – 16 demonstrate that with suitable choice of probe diameter , the present invention can be used to achieve lifting distances of 1 . 0 mm or less with a thinner vinyl backing , namely one having a thickness of 0 . 05 mm ( 2 mils ), even with 3m ™ scotchcal ™ 180 - 10 marking film , wherein the adhesive layer does not have a surface topography incorporating air egress channels . it was noted that when using 180 - 10 film , there was a noticeable amount of trapped air in the areas around each rivet , and it was speculated that this was due to the absence of air egress channels in the adhesive layer . referring to table 3 , comparative examples c9 and c10 , using 3m ™ scotchcal ™ 180 - 10 marking film , show somewhat greater lifting distances d than those produced by the present invention in examples 13 – 16 . examples 17 – 20 illustrate that when air egress channels are added to the adhesive layer , as is done in 3m ™ scotchcal ™ 180 - 10c marking film , the amount of trapped air is reduced , and , with suitable choice of probe diameter , lifting distance d can be reduced to below 1 . 0 mm . comparative examples c11 and c12 show comparable to somewhat larger lifting distances for this film , with a type of wrinkling not seen in samples produced in examples 17 – 20 . examples 21 – 24 demonstrate the use of a backing having a thickness of 0 . 05 mm ( 2 mils ) with a vinyl overlaminate having a backing thickness of 0 . 05 mm ( 2 mils ), resulting in a film having a total backing thickness of approximately 0 . 1 mm ( 4 mils ). as shown by example 24 , with suitable choice of probe diameter , a lifting distance d of 0 . 5 mm can be achieved , whereas , as shown in table 3 , comparative examples c13 and c14 , both the brush and pad were unable to achieve lifting distances below 2 . 0 mm . moreover , example 24 , which produced the lowest value of d , also did not produce any noticeable film damage . examples 25 – 29 demonstrate that a variety of different types of tubing can be used as aspirator probes , and that the tubes need not be circular in cross section , nor do they need to be made of metal . a heat gun setting of 260 ° c . ( 500 ° f .) was used in these examples . a non - circular probe was made by flattening a 13 gauge stainless steel hypodermic syringe needle with a pliers to form an oblong cross section at the end of the tube . this flattened tube was then successfully used to aspirate detached film regions near several rivets . a 13 gauge syringe needle with a sharp beveled tip of the type used in hypodermic medical applications was used to aspirate several detached regions near rivet heads . while the aspiration and conformance of the film to the area around the rivet head was successful , the needle tended to scratch the film if not used with extreme care . it was also found that because of the beveled tip and the resulting elongated aperture at the end of the probe , the probe had to be inserted a greater distance into the detached region to achieve aspiration . a nonmetallic probe , in the form of a glass eyedropper tube having an inside diameter of about 1 . 5 mm and an outside diameter of about 2 . 5 mm was connected to a vacuum source via a vacuum line and used successfully to aspirate detached regions around several rivet heads . a nonmetallic probe , in the form of a plastic tube from a laboratory squirt bottle having an inside diameter of about 0 . 8 mm was successfully used to aspirate detached regions around several rivet heads . the plastic tube showed a tendency to clog after several aspirations , and also suffered heat damage , which may have contributed to the clogging . a nonmetallic probe , in the form of a length of flexible vacuum hose , was used to aspirate detached regions around several rivet heads . while the detached regions were successfully aspirated , there was a tendency for portions of the film to be sucked into the hose , and holes in the film having a diameter on the order of 3 mm were sometimes produced . examples 30 and 31 demonstrate that the order in which the steps of heating , probe insertion , and application of vacuum are performed can have a significant effect on the level of conformance achieved . a 13 gauge square tipped stainless steel tube was inserted into a detached region of laminated film prior to application of heat or vacuum . the probe was connected , via a flexible vacuum hose , to a closed vacuum valve , which was in turn connected to a vacuum source . the detached region of the film was then heat softened , after which the vacuum valve was opened , so as to apply vacuum to the detached region . good conformance was achieved . a detached section of laminated film was first heat softened using a heat gun , after which a 13 gauge square tipped stainless steel needle , connected , via a flexible vacuum hose , to a closed vacuum valve , which was in turn connected to a vacuum source , was inserted into the detached region . the vacuum valve was then opened and the detached region aspirated . limited conformance was achieved , due , at least in part , to the difficulty of achieving an adequate flow restriction or seal between the probe and the film . it was speculated that insertion of the probe into heated film , without the simultaneous application of vacuum , may have had a detrimental effect on the flow restriction or seal that could be achieved . a sheet of 3m ™ scotchlite ™ plus flexible reflective sheeting series 680 reflective sheeting , commercially available from 3m company , st . paul , minn ., having dimensions of about 10 centimeters by 30 centimeters , was laminated to a test panel of the type used in examples 1 – 24 , using the same lamination procedure . a detached section over a rivet was heated with the heat gun used in examples 1 – 24 , but using a heat setting of 399 ° c . ( 750 ° f .) for a time of 1 – 3 seconds . a flat tipped 13 gauge needle attached via a vacuum hose to a vacuum pump was placed against the detached film section near a rivet edge and urged against the rivet base . the reflective sheeting rapidly collapsed around the rivet head to produce good conformance . the process was repeated for the remaining rivet heads on that test panel and on a second test panel . after conditioning the samples for 18 hours at room temperature , the average lifting distance d was 1 . 6 mm for the first panel and 0 . 8 mm for the second . the average sizes of the holes left by the aspirator probes were 0 . 7 mm for the first panel and 1 . 0 mm for the second panel . no film damage was observed . this was considered to be a significant achievement , since 3m ™ scotchlite ™ reflective sheeting , having typical thicknesses in the range of 0 . 18 – 0 . 20 mm , is thicker than typical marking films , and is made up of a layer of glass beads held in place by a binder layer , along with other support material . test panels were prepared as in examples 7 – 9 , using 3m ™ scotchcal ™ 3500c marking film with 3m ™ scotchcal ™ 8910 vinyl overlaminate laminated thereon . a shell and tip of a pentel 0 . 5 mm p215 mechanical pencil was used as an aspirator probe . the shell and tip were connected to a vacuum hose which was in turn connected to a to a vacuum pump . removal of detached regions and conformance around rivet heads proceeded rapidly , and the probe was found easy to maneuver around rivets , due to its familiar shape . the average value for lifting distance d after aging of the conformed film for 18 hours at room temperature was 0 . 7 mm , and the average size of the hole left in the film after aspiration was 0 . 8 mm . no film damage was observed . two test panels were prepared as in examples 7 – 9 , using 3m ™ scotchcal ™ 3500c marking film with 3m ™ scotchcal ™ 8910 vinyl overlaminate laminated thereon . a “ goot ”™ tp - 100 desoldering gun , produced by taiyo electric ind . co . ltd ., japan , and commercially available from radio shack retail stores , was used as the aspirator device . a flat tipped , 18 gauge stainless steel tube having a length of 1 centimeter was attached to the end of the desoldering gun and used as the aspirator probe . the tp - 100 desoldering gun contains a vacuum source in the form a diaphragm . detached sections of film around rivet heads on the prepared samples were heated using the same heat gun used in examples 7 – 9 , with an air temperature setting of 399 ° c . ( 750 ° f . ), and the desoldering gun was used as an aspirator probe to aspirate the detached regions around the rivet heads on the two test panels . after aspiration , the panels were aged at room temperature for 18 hours and the lifting distances were measured . the average lifting distances were 0 . 9 mm for the first test panel and 0 . 25 mm for the second panel . the average whole sizes produced by the 18 gauge aspirator probe were 1 . 5 mm or the first panel and 1 . 0 mm for the second . no film damage was observed for panel 1 , and small wrinkles were observed around three of the four rivets on panel 2 . it was found that the diaphragm vacuum device in the desoldering gun produced adequate vacuum , thereby demonstrating that the vacuum source and aspirator probe can be integrated into a single , handheld device . a 4 centimeter by 12 centimeter sheet of 3m ™ scotchcal ™ 180 - 10 marking film was applied to a flat , painted , aluminum sheet in a manner which left detached regions having areas in the range of 4 – 100 square millimeters trapped between the film and the painted sheet . each detached film section was heated using a heat gun setting of 399 ° c . ( 750 ° f .). the detached regions were aspirated with a flat tipped 18 gauge aspirator probe connected to a vacuum pump . at each detached region , the aspirator probe formed an aperture in the film , the trapped air was quickly aspirated away , and the film conformed to the surface . the only visible indication of the aspiration was the presence of small marks having diameters of about 0 . 1 – 1 . 0 mm in diameter , corresponding to the points of contact of the needle with the film . a test panel was prepared by laminating a 4 centimeter × 12 centimeter sheet of 3m ™ scotchcal ™ 3500c marking film onto an aluminum sheet having 3 circular indentations such that the film bridged the indentations . each indentation was about 6 mm deep and about 28 mm in diameter . the film section bridging each of the indentations was heated using a heat gun air temperature setting of 399 ° c . ( 750 ° f .) and aspirated with an 18 gauge stainless steel probe connected to a vacuum source by slowly moving the probe into contact with the detached section . as each detached region was aspirated , the probe was moved toward the indentation to follow the film section as it conformed to the indentation , so as to maintain communication between the detached region and the probe . in each case , the film section was successfully conformed to the indentation . the complete disclosures of the patents , patent documents , and publications cited herein are incorporated by reference in their entirety as if each were individually incorporated . various modifications and alterations to this invention will become apparent to those skilled in the art without departing from the scope and spirit of this invention . it should be understood that this invention is not intended to be unduly limited by the illustrative embodiments and examples set forth herein and that such examples and embodiments are presented by way of example only with the scope of the invention intended to be limited only by the claims set forth herein as follows . | 1 |
fig1 is a drawing demonstrating a prior art credit card in diagram form , having a strip of magnetic material 2 which is embedded in a plastic substrate 1 which magnetic strip carries a pattern of magnetization which is a magnetic representation of information or patterns relating to the credit card . fig1 shown in graphical form the top and front edge view of the magnetic strip with a representation of the magnetic flux recorded therein . fig2 shows a diagram of the preferred embodiment of the present invention , dubbed a multi - card by the inventor , having a plastic substrate 3 , on which is suitably mounted a programmable magnetic strip 4 , an lcd display 5 , a solar cell power source 6 , including an electricity storage cell ( not shown ), an infrared emitter 7 , and infrared sensor 8 , and a key pad 9 consisting of 14 operator actuated switches . it will be appreciated that these switches may be capacitive type touch sensitive sensors or other types . it will be understood that the programmable magnetic strip 4 may also be of a type which may sense magnetic information or patterns , and thus may be used as an input or output device . programmable magnetic strip 4 is preferred to be operated to approximate , duplicate or replicate a magnetic pattern matching the particular need of the operator in response to the operator &# 39 ; s commands or inputs to the card as will be described in more detail below . in operation , the multi - card has stored in it several sets of data corresponding to account related information or patterns for different credit cards , identification cards and the like . power for the operation of the device is provided by a solar cell , which power is stored in a storage battery . the battery is preferred to be replaceable with a charged battery for those applications where the solar cell does not receive enough light to operate the multi - card , however it is preferred that devices which make use of the multi - card provide sufficient illumination to the solar cell to power the device . to operate the multi - card , the operator simply presses a given key , which may be a touch sensitive pad , which causes multi - card to activate and the display 5 to display which account is associated with that key . if the operator forgets which key is associated with a wanted account , he may simply operate all keys in sequence until the correct account is selected . it will be understood that it is also possible to provide only one key , with a different account called up for each press . when each account is called , the magnetic data for that account is loaded into the magnetic strip 4 , causing the magnetic strip to simulate the magnetic strip on the prior art type card by emulating , approximating , replicating or duplicating the magnetic pattern , depending on the accuracy required by the device reading the pattern . the control of the accuracy provided may be provided by the operator , or may be automatic in response to feedback ( or lack thereof ) by the device using the card . in this fashion , the multi - card may then be placed into a card reader or other device which reads the magnetic pattern from the magnetic strip to allow the holder access to the account , services or features associated with the stored data or pattern . it will be recognized by one of ordinary skill in the art from the teachings herein that the invention allows access to numerous accounts , services , features , etc . with just one card , thereby eliminating the need to carry , store or retain numerous cards . other features may be combined with the invention as well , or as the case may be the invention may be combined with other functions , examples including personal reminder and memory capability , calculator and clock or even telephone and television functions . other sequences of operation of the invention may be utilized as well . for example , the key pad may be used to enter a convenient select designator , for example a bc representing bank card or a pbc indicating personal bank card , or any other convenient select designator . the select designator will then cause the account identifier to be displayed on 5 and the proper pattern loaded into 4 . in addition , the loading of pattern into 4 may be caused to occur only when another command is generated by the operator , or only upon or after insertion of the card in a device which uses it . these operations are considered to be novel features of the invention . it will be understood by one of ordinary skill in the art that elements 3 and 5 – 9 are well known and commonly found and utilized in the industry and may be controlled by a microprocessor with their application and use in the preferred embodiment of the invention being within the capability of one of ordinary skill in the art . fig7 shows an top and side views of an alternate mechanical embodiment similar to fig2 . the mechanical embodiment of fig7 has the advantage of allowing a larger space for the electronics while maintaining a thin cross section in the “ card ” area , thus allowing easier fabrication . fig3 shows a diagram of the multi - card and a supporting console which may be used to store information or patterns in the multi - card or recover information or patterns from the multi - card , or another card . a control circuit 11 , which is preferred to be a microprocessor such as an intel 80c31 or which may have internal rom , ram and nonvolatile ram as is known in the industry , is utilized to control and operate the various elements of the multi - card . as an example the intel 80c31 series microcontroller is well suited to the control task . when the 80c31 is coupled with a nonvolatile ram such as the xicor x2444 available from xicor , inc . 1511 buckeye drive , milpitas , calif ., a keypad such as can be easily constructed with the itt schadow ksa 1m211 switch available from itt schadow inc . 8081 wallace rd ., eden prairie , minn ., and an lcd display such as the optrex dmc20261ny - ly - b , available from 44160 plymouth oaks blvd ., plymouth , mich ., the invention components may be readily constructed . a 16 keypad matrix in 4 × 4 form ( not all 16 need be used ) is preferably configured on the 8 p 1 port connections , the lcd is preferably configured on the p 0 data port under write control as addressed by the p 2 data port and controlled by the / wr control . the input / output interface 14 is preferably provided via the txd / rxd serial ports ( alternate functions provided on the p 3 port ), and the nonvolatile ram is preferably configured directly to the / int 0 , / int 1 and t 0 pins of the p 3 port . the - program instructions to run the processor are preferably stored in an eprom having data pins coupled to the p 0 port and addressed by - the p 2 port under / rd read control as is commonly known in the industry . intel provides a wealth of information on configuring , programming and operating this and many other processors , which information is available from intel corporation , 3065 bowers ave ., santa clara , calif . the programmable magnetic strip 10 is preferred to contain multiple inductive coils to generate magnetic fields in response to current flowing therein , as will be described in more detail below . the connection of the processor of 11 , be it an 80c31 or other type may be made directly via matrixing of the two connections of the individual coils in 10 , for example as is commonly done to write ( and read from ) core type magnetic memory in the computer industry . alternately , a large serial shift register array may be loaded with serial binary data under control of 11 with the array &# 39 ; s output being enabled to a low impedance state from a high impedance state after loading . the binary data may thus cause the many parallel outputs , each of which is coupled to a coil , to source electrons into the coil , or sink electrons from the coil , providing that the other end of each coil is connected to a voltage source which is midway between the output &# 39 ; s high and low logic level states . to achieve control over the current flow through the coils , multiple serial shift registers may be utilized , with several outputs being coupled to each coil through resistors or other current controlling circuits , the pattern of data in the several outputs controlling the current flow . several variations of the suggested elements of the preferred embodiment may be utilized as will be convenient to implement particular embodiments of the invention which may be configured to specific needs and applications , as will be apparent to one of ordinary skill in the art from the teachings herein . the substrate 3 may be of any material on or to which the other elements may be suitably secured or attached , examples including the preferred pvc plastic , ceramic , metal and others display 5 which is used to provide messages to the user of the device may be of any electro optical type such as lcd , led , crt , incandescent , fluorescent , flip dot , etc . or may be of electro mechanical type such as beeper , buzzer , vibrator , etc ., or may be eliminated in applications where it is not desired to convey messages to the user , or where messages are conveyed via other means . such other means for example include via the device which reads the magnetic strip 4 . power source 6 may be any well known power source , such as solar cell , battery , electric generator operating to convert motion to electricity , fuel cell , electromagnetic or electric field receiver , piezoelectric generator , etc . or any combination thereof . emitter 7 may be the preferred infrared led , antenna , coil , transducer , or any other device capable of conveying information or patterns from the invention to outside devices , and receiver 8 is preferred to be a photo transistor but may also be any such apparatus or device capable of receiving information or patterns from outside devices to be used by the invention . either or both of the emitter and receiver may be eliminated if the capability provided is not desired , or is otherwise provided for . for example , the sensing capability of 10 or the input capability of 13 may be utilized to provide the receiver 8 function and the display may be utilized to provide the emitter function . touch sensitive key pad 9 may be capacitive , heat sensing , optical or mechanical switches , etc . or any device capable of receiving and coupling operator input to the invention . the operator interface 13 and its key pad 9 may also be eliminated if no operator interface is desired . the control circuit operates with the programmable magnetic strip 10 , examples include those corresponding to 4 of fig2 , to create a predetermined magnetic pattern which may be read by compatible reading devices , and may also operate in conjunction with 10 to sense magnetic patterns . control circuit 11 also drives the lcd display 12 , examples including associated with 5 of fig2 , to display messages to the operator and as signified by the dotted arrow on the control circuit 11 may also operate interactively with 12 . control circuit 14 operates interactively with the input / output interface 14 , examples including those associated with 7 and 8 of fig2 , to communicate with the console . control circuit 11 also operates interactively with operator interface 13 , examples including those corresponding to 9 of fig2 , to allow operator input to the control circuit . also shown in fig3 is a power source 15 , examples including those associated with 6 of fig2 , and which provides power for the operation of the multi - card . in the preferred embodiment , 15 includes a replaceable nickel cadmium battery and solar cell allowing the battery to be replaced and / or recharged . it is of course possible to use either replaceable or rechargeable power sources . fig3 includes a console comprised of programming circuitry 16 and card reader 17 . in operation , the card reader may be operated to read information or patterns from a particular data storage medium , examples including the magnetic strip on a credit card . the information or patterns may be read as the actual data represented in any of its various forms , or may be read simply as the representation . with respect to reading a magnetic stripe , the reader may simply read the magnetic pattern without concern as to the data represented thereby , or may decode the magnetic pattern into the encoded ( that is represented ) data , or may decode the data to the unencoded ( that is unprotected by security scrambling and the like ) data as is convenient . in the preferred embodiment , the magnetic pattern is simply sensed at a high resolution by moving the magnetic strip over a magnetic sensor and generating a binary representation of the polarity of the magnetic field in response thereto . the resulting binary pattern corresponds to the magnetic polarity field , in the preferred embodiment at 0 . 001 inch increments , giving a linear “ snapshot ” of the magnetic pattern . the binary representation is then coupled to the programming circuitry 16 ( via 14 ) where an account identifier is associated therewith to later be displayed on the display 12 when the wanted corresponding magnetic pattern is recalled from the memory in the control circuit 11 . while called an account identifier , there is no need that the pattern correspond in any way to an account , and may well correspond to anything . the account identifier may be thought up by the operator , may be chosen by the operator from a list or other source , or may be assigned without operator intervention , for example preprogrammed in the card which is read or in the control circuit 11 . the input of the account identifier may be via 13 or 16 as is desired . it is however preferred that the operator may have some choice in the matter in order that an account identifier which is either convenient to or associated by the operator is used , and thus it is preferred that 16 contain a keyboard with which the operator may type in his desired identifier , and the desired key , key sequence or location associated therewith . it is also preferred to associate a select designator with the binary representation , in order to allow the operator to utilize the select designator to call up a particular magnetic pattern . the select designator may be thought up by the operator , may be chosen by the operator from a list or other source , or may be assigned without operator intervention , for example preprogrammed in the card which is read or preprogrammed in the control circuit 11 at the time of manufacture or other time . in operation , it is preferred that there be more than one method for the operator to call up a wanted pattern . one preferred way is for the operator to enter the select designator . this causes the account identifier to be displayed in 12 . alternatively , the operator may scroll through all the possible sets of data , viewing each account identifier as it appears until the desired one is called up , or may key in a more detailed pattern , to call up the desired account . the magnetic pattern ( or data represented thereby in some form ) is then caused to be stored in the memory of 11 in a form which allows it to be associated with the identifier , and preferably also with some known input terminal or sequence of terminals of 9 . in the preferred embodiment , the operator chooses an available key of 9 ( for example the upper right ) or other select designator , provides an account identifier , ( for example bank card ) and the operator choices and data are stored in 11 in a fashion which associates them all . it is preferred that the data be stored in nonvolatile memory in order that it will be retained in the event that the power storage device of 15 is fully discharged or the control circuit is turned off , for example to save power . it is preferred that by utilizing the foregoing programming procedure , the operator stores the magnetic pattern , account identifier and desired associated select designator in 11 . upon subsequent entry of the associated select designator , the control circuit 11 recalls the associated data corresponding to the magnetic pattern and the account identifier from memory . the account identifier is loaded in the display 12 to remind the operator what the data is associated with , and the magnetic pattern is caused to be replicated in 10 from the stored data . the replicated magnetic pattern in 10 may then be utilized to operate a card reading device to provide the operator access to the account , services , features or other conveniences associated therewith , and hence associated with the card which was read by 17 . it is of course desired to provide the capability of storing several such sets of associated data , identifier and key in the memory of 11 , and it is further desirable to provide for the association of multiple select identifiers with a given set of data . by way of example , in this fashion , a set of data for generating a magnetic pattern for a company issued bank card may be called up by use of any of the select identifiers cc , or cocard or company card , etc . and another set of data for a personal bank card may be called up by use of any of the select identifiers pc , pbc , etc . fig4 shows a diagram of the details of the magnetic strip 10 and control circuit 11 , including individual electromagnet coils , one of which is shown as 21 and having electric circuit connections 22 and 23 , and magnetic flux conducting material 20 . it will be recognized that by passing an electric current through a given coil that a magnetic flux will be created across the associated gap in the magnetic flux conducting material 20 above the coil , such as is represented by 24 . furthermore , the flux for each coil will be largely contained in the gap corresponding to that coil by the magnetic flux conducting material . the polarity of the flux may of course be changed by changing the direction of current flow through the coil , and the intensity of the magnetic flux may be varied by varying the electric current through the coil . in this fashion , the original magnetic pattern which was read by reader 17 may be approximated , duplicated or replicated as required . while it may be desirable to cause the control circuit 11 to have the ability to vary the accuracy with which it stores the magnetic data or programs the magnetic strip , it will be recognized that this is not a requirement , and 11 may simply operate to a single given accuracy . it may also be noted that the material used for 20 may be of a type having a large magnetic memory or hysteresis so that once a magnetic pattern is generated in the material , the electric current through the coils may be turned off or reduced and the magnetic field will remain . techniques which are used to write and read magnetic core type memory , as well as the materials used therefore , will be applicable to the generation of magnetic patterns for 10 , and the technology used in the core industry may be easily adapted to be used in fabricating 10 . it will also be recognized that other methods of creating magnetic patterns may be utilized as well , such as various chemical , thermal and optical methods which may be utilized to create magnetic flux patterns , or to alter existing flux patterns . fig5 shows a sectional diagram a — a of elements 20 – 23 of fig4 and the preferred method of construction thereof . this method of construction is readily implemented with either photographic lithography and lamination techniques or with chemical vapor etching and deposition as are commonly utilized to fabricate miniature electronic circuits . other construction methods may be utilized as well . element 18 is a substrate material , examples including plastic or ceramic , on which the magnetic coils 21 may be built a conductive layer 19 is formed on the substrate in a predetermined pattern to make up the bottom half of the coils 21 . this layer may be created by depositing or printing a continuous metallic film and then etching away all but the desired conductive paths , or by photographically printing the conductive paths . next , the magnetic material 20 is formed on top of the bottom conductive paths . preferable the magnetic material is an electrically non - conductive or low conductive material , but if it is conductive , an insulating layer may first be deposited to prevent it from shorting out the top and bottom conductive paths . after the magnetic material is formed the top electrically conductive layer is formed thereover using the same process as for the bottom , thus completing the coils 21 . finally , conductive wires or circuits 22 and 23 are bonded to the coils for connection to 11 , and the entire magnetic strip is provided with an environmentally insulating covering if desired to shield from moisture , corrosion , etc . by utilization of this method , it will be seen that very low manufacturing cost and small size may be obtained . it will also be understood that the linear array of coils is given by way of example with respect to the preferred embodiment and may be arranged in other than a linear fashion , for example in circular or three dimensional patterns . it will also be understood that the magnetic coils may be replaced with leds to create emitted light patterns , or by lcd elements to create reflected or transmitted light patterns , or by any other type of energy radiator , absorber or deflector in order that the invention may be practiced with virtually any sort of emitted , absorbed or deflected pattern . it will be recognized that while the coils may be utilized to generated a magnetic pattern , they may also be utilized to sense a magnetic pattern . while some motion is required to generate an electric current in the coils , this motion may be supplied by the user . in addition , magneto restrictive materials may also be adopted to allow sensing of magnetic patterns without motion . one of ordinary skill in the art will be able to construct such a device and practice the invention from the teachings of the preferred embodiment given herein without undue experimentation or further invention . it will also be recognized that it will be possible to have magnetic strip 10 sense the magnetic pattern on another magnetic strip directly , removing the need for card reader 17 . it would also be possible to incorporate the programming circuitry 16 in the control circuit 11 , thus completely eliminating the need for the console of fig3 . once the console is eliminated , the input / output interface 14 may also be eliminated . one skilled in the art will also recognize that an inexpensive version of the invention may be constructed of simply a programmable magnetic strip 10 which can both read and simulate a magnetic pattern , a control circuit 11 , an elementary operator interface 13 and a power source 15 . alternatively , instead of a magnetic strip 10 capable of reading , several preprogrammed magnetic patterns may be programmed in control circuit 11 upon manufacture , either by storage of the magnetic patterns , storage of data which may create the magnetic patterns or storage of an algorithm or method by which the magnetic pattern may be created in 10 under control of 11 . in such a system , only elements 11 and 10 are absolutely required since it would be possible for 11 receive commands from the reading device via 10 , or to simply try all stored patterns in 10 upon excitation or connection of the power , source 15 . while the preferred embodiment of the invention has been given by way of example with respect to credit cards having magnetic strips , it will be recognized that the invention may very well be adapted for use with other methods of storage and storage medium . examples include , simulating two or more dimension patterns . optical devices which record data on film in two or more dimensions may be replaced by liquid crystal or other optical displays which simulate the patterns recorded on the film . holographic recordings may also be simulated by lcd or other optical displays . mechanical devices may be replaced by electromechanical devices in which mechanical dimensions are adjusted via solenoids , motors , piezoelectric cells or the like . keys are an excellent example of a device which may be replaced by a battery of such adjustable devices . in fig6 for example , the device of fig3 may be utilized in conjunction with micro machines in order to create an adjustable key in which the operator selects an identifier corresponding to the particular lock which the wishes to unlock . the device uses electromagnetically driven micromotors and worm screws to adjust the serrated edge on the key to fit the lock . a sectional view of the device is shown in which a standard key blank 25 is machined to couple to a bank of micro motors or solenoids 26 , each of which is connected via a worm screw to a flexible shaft or wire which extends to the serrated edge of the key . by way of example , micromotor 27 is coupled to flexible shaft 28 which passes through a hollow portion of the key blank 25 to the serrated edge where it protrudes through the blank at 29 . individual channels may be micromachined for the flexible shafts , or the shafts may simply be sized to fill the slot in the key blank , or bundled together to prevent lateral displacement which would affect the protrusion distance from the edge of the key blank at 29 . the micromotor 27 , via the screw , adjusts the position of the end of 28 to thereby control the length of protrusion of the other end at 29 , thus adjusting the depth of the serration at that point . all of the micromotors in the bank 26 are coupled to the control circuit 11 of fig3 by a suitable coupling . in this fashion , the key may be adjusted to fit different locks as desired by the operator . in this example , card reader 17 may be replaced with a key reader in order that the serration pattern of precut keys may be read into 11 and stored , along with account identifiers , select designators , etc . as previously described . in view of continuing development of micro machines on silicon wafers by use of semiconductor fabrication techniques , it is envisioned that it will be possible to manufacture both electro mechanical components such as solenoids and the corresponding electrical control circuitry all on the same semiconductor substrate . in this fashion , it would be possible to manufacture the invention of fig6 , including the necessary control circuitry of fig3 entirely with existing semiconductor fabrication technology . it would also be convenient to replace the electronic storage of different patterns with a mechanical or other storage of patterns , for example with respect to the key of fig6 on a rotating cam shaft , shown as 27 of the inset , which would be rotated to adjust the height of spring loaded pins on the key , the springs holding the pins against the cams . while the configuration of the inset would require a fairly wide key , the camshaft could also be located entirely within the handle of the key and be coupled to the spring loaded pins via flexible shafts or wires 28 as with the micromotor actuator 26 . the account identifiers or select identifiers can be engraved directly on the end of the shaft . it will be understood that the flexible shafts may be arranged in other than a linear fashion , for example in circular or three dimensional patterns . the invention described herein by way of explanation of the preferred embodiment may be practiced with numerous changes in the arrangement , structure and combination of the individual elements , as well as with substitution of equivalent functions and circuits for the elements in order to optimize the invention for a particular application , all without departing from the scope and spirit of the invention as hereinafter claimed . | 6 |
the method of operation of the control valve 1 which is shown is substantially consistent with the method of operation of the control valves which are shown and described in gb 2 181 803 a and in de 33 43 172 c2 . the method of operation is not part of the present invention and is therefore also not described in detail , but the contents of gb 2 181 803 a and de 33 43 172 c2 are made the subject matter of the disclosure here in their entirety . the control valve 1 has a housing consisting of a housing upper part 2 and a housing lower part 3 which are joined together in a sealed manner with a sealing ring 29 positioned in between . a plunger piston 4 is inserted centrally into a pressure plate 5 substantially without play , preferably with a press fit , and is guided axially displaceably with a sliding fit in a cylindrical guide 2 a in the housing upper part 2 by means of a hollow - cylindrical projection 5 a which is formed radially on the outside of the pressure plate 5 , and is secured against falling out of the housing upper part 2 by a securing ring 7 which is arranged in a circumferential groove 6 in the housing upper part 2 . the housing upper part 2 is sealed to the outside by means of a folding bellows 8 . an elastomer spring element 9 of frustoconical configuration is arranged between the pressure plate 5 and a first valve piston 10 . the elastomer spring element 9 is supported with its larger diameter region 9 d radially inside the hollow - cylindrical projection 5 a on the pressure plate 5 and with its smaller diameter region 9 c on the first valve piston 10 . the elastomer spring element 9 is moulded integrally on the first valve piston 10 outside its frustoconical region and engages around and engages over the first valve piston 10 there . in this connecting region , a radially outwardly directed sealing lip 9 a is formed on the composite component consisting of elastomer spring element 9 and first valve piston 10 . furthermore , the first valve piston 10 is provided with an undercut annular groove 10 a on its side which faces the pressure plate 5 , into which annular groove 10 a an annular axial protrusion 9 b of the elastomer spring element 9 engages . as a result of this construction , the first valve piston 10 can be arranged in the housing upper part 2 with abundant radial play , without impairing the sealing action by way of the sealing lip 9 a . in order to form the said composite component , the elastomer spring element 9 is preferably moulded onto the valve piston 10 in a mould which receives the first valve piston 10 . in order to ensure secure adhesion of the elastomer spring element 9 on the first valve piston 10 , those surface regions of the first valve piston 10 which come into contact with the elastomer spring element 9 during moulding are coated with an adhesion promoter . the frustoconical region of the elastomer spring element 9 is preferably composed of an elastomer with a greater shore hardness than that region , on which the sealing lip 9 a is formed , it being possible for the elastomer spring element 9 to be moulded onto the first valve piston 10 by way of a two - component injection - moulding method . the first valve piston 10 has a hollow - cylindrical axial projection 12 which points away from the pressure plate 5 and ends at an annular sealing seat 13 . the plunger piston 4 is first of all guided with a cylindrical region 4 c with a sliding fit in a first cylindrical bore 10 b in the first valve piston 10 , and is then guided by means of a first cylindrical projection 4 a of the plunger piston 4 in a second cylindrical bore 10 c which is formed in a circumferential , head - shaped radial protrusion 11 on the first valve piston 10 . a securing ring 19 which is arranged in a groove of the first cylindrical projection 4 a of the plunger piston 4 holds the arrangement comprising the plunger piston 4 , the pressure plate 5 , the elastomer spring element 9 and the first valve piston 10 together as a structural unit which can be pre - assembled , with a predefined prestress which is applied by the elastomer spring element 9 . the first valve piston 10 interacts in a known manner by way of its annular sealing seat 13 on its hollow - cylindrical projection 12 with a first annular plate valve 14 . the first annular plate valve 14 has a radial sealing face 15 which for its part interacts in a known manner with a first non - displaceable sealing seat 16 in the housing upper part 2 . the first annular plate valve 14 is guided with a hollow - cylindrical projection 14 a radially inside a second valve piston 30 , such that it can be displaced axially over a small travel , and is sealed with respect to the second valve piston 30 by means of a sealing ring 31 . the first annular plate valve 14 is surrounded by a first pressure space 17 which is fed compressed air from a compressed - air source in a manner which is known but not shown . the first annular plate valve 14 is pierced , as a result of which a venting passage is formed . a back - pressure spring 20 is supported axially on the housing upper part 2 and on the underside , remote from the pressure plate , of the first valve piston 10 and ensures that the arrangement comprising the plunger piston 4 , the pressure plate 5 , the elastomer spring element 9 and the first valve piston 10 bears axially against the upper securing ring 7 when the plunger piston 4 is not actuated . a compression spring 21 which is arranged in the first pressure space 17 is supported axially at one end on the first annular plate valve 14 and at the other end on a lip seal 24 which is arranged in the housing upper part 2 and is secured axially against falling out by a securing ring 25 . the said securing ring 25 is arranged in a groove in the housing upper part 2 . a brake pressure space 22 for a first brake circuit ( not shown ) is formed between the first valve piston 10 and the first non - displaceable sealing seat 16 , in which brake pressure space 22 a modulated brake pressure is built up by the interaction of the plunger piston 4 with the first valve piston 10 and the first annular plate valve 14 . a supporting element 23 is arranged axially displaceably on the first cylindrical projection 4 a of the plunger piston 4 and bears against the underside of the head - shaped radial protrusion 11 of the first valve piston 10 under the axial application of force of a compression spring 26 . the said compression spring 26 is supported with its other end on a supporting disc 27 which bears against a step between the first cylindrical projection 4 a and a second cylindrical projection 4 b of smaller diameter of the plunger piston 4 . the supporting disc 27 is fixed on the said step by means of a securing ring 28 . the supporting disc 27 comprises a number of perforations 27 a or perforated holes to facilitate exhaust air flow during brake release . the second valve piston 30 is guided axially in the housing lower part 3 such that it is sealed via two o - sealing rings 32 , 33 , and interacts by way of an annular sealing seat 34 with a second annular plate valve 37 . a radial sealing face 38 of the second annular plate valve 37 interacts in a known way both with the annular sealing seat 34 on the second valve piston 30 and with a second , non - displaceable sealing seat 35 on a hollow - cylindrical projection 36 of the housing lower part 3 , which hollow - cylindrical projection 36 protrudes axially to the inside with its free end . the said hollow - cylindrical projection 36 of the housing lower part 3 is surrounded radially on the outside by an annular brake pressure space 39 which is connected to a second brake circuit ( not shown ), in order to feed a modulated brake pressure to the said second brake circuit . a second pressure space 17 a which is fed compressed air from a compressed - air source in a manner which is not shown is formed between a hollow - cylindrical projection 37 a of the second annular plate valve 37 and the hollow - cylindrical projection 36 of the housing lower part 3 . the said second pressure space 17 a can be flow - connected in a manner which is not shown to the first pressure space 17 in the region of the first annular plate valve 14 . a compression spring 40 is arranged in the second pressure space 17 a , which compression spring 40 is supported at one end on the second annular plate valve 37 and at the other end on a lip seal 41 which for its part is secured by a supporting ring 42 . the supporting ring 42 is secured against falling out by a securing ring 43 and is connected via radially inwardly protruding radial spokes 42 a to a hollow - cylindrical guide 42 b which serves to guide the second cylindrical projection 4 b of the plunger piston 4 , with the result that the said plunger piston 4 is guided over a great length firstly by means of the pressure plate 5 , 5 a in the housing upper part 2 and by means of the hollow - cylindrical guide 42 b in the housing lower part 3 . it can be seen that , as a result of the guidance of the plunger piston 4 in the housing upper part 2 by means of the hollow - cylindrical projection 5 a of the pressure plate 5 and by means of the second cylindrical projection 4 b in the cylindrical guide 42 b in the housing lower part 3 , all transverse forces and tilting moments are guided directly into the housing upper part 2 and the housing lower part 3 and are kept away from the first valve piston 10 . the first valve piston 10 is guided securely on the plunger piston 4 and on its first cylindrical projection 4 a , with the result that no excessive loading of the sealing lip 9 a on the first valve piston 10 and a resulting reduction in the sealing action occur . the control valve 1 is ventilated in a known way by the venting passage and a venting cap 44 on the housing lower part 3 when the brake pressure in the brake pressure spaces 22 and 39 is reduced or neutralized completely by retraction of the plunger piston 4 . the control valve 1 according to the invention is of very compact construction and , with regard to the sealing action of the first valve piston 10 by way of the sealing lip 9 a , is insusceptible to tilting moments and transverse forces which act on the plunger piston 4 . when the plunger piston 4 is actuated , the first valve piston 10 moves down due to combined force transfer of rubber spring stiffness . when first valve piston 10 moves down the supporting element 23 forces the second valve piston 30 to move down , as the supporting element 23 is in contact with first valve piston 10 . before the first valve piston 10 will open the first annular plate valve 14 , the second valve piston 30 comes into contact with second annular plate valve 37 , that means , the reaction force of the compression spring 26 acts against the compression spring 40 , what facilitates easy opening of the second annular plate valve 37 . on further actuation of the plunger piston 4 , the first valve piston 10 moves down and opens first annular plate valve 14 , resulting in a connection of the air supply to the delivery port . as the supporting element 23 is already in contact with the first valve piston 10 , delivery air from top circuit just moves down to the second valve piston 30 and opens second annular plate valve 37 without any additional pressure build up in top circuit . this arrangement is conventionally termed as a delta p reduction arrangement . it helps in delivering approximately the same delivery pressure in both top and bottom circuit without much time lag . all the features which are mentioned in the above description of the figures , in the claims and in the introduction of the description can be used both individually and in any desired combination with one another . the invention is therefore not restricted to the described and claimed combinations of features , but rather all combinations of features are to be considered to be disclosed . 9 c smaller diameter region of the elastomer spring element 9 d larger diameter region of the elastomer spring element 10 b first cylindrical bore in the first valve piston 10 c second cylindrical bore in the first valve piston 13 annular sealing seat on the hollow - cylindrical projection 12 of the first valve piston 14 a hollow - cylindrical projection on the first annular plate valve 14 15 radial sealing face on the first annular plate valve 14 16 first non - displaceable sealing seat in the housing upper part 2 34 annular sealing seat on the second valve piston 30 35 second non - displaceable sealing seat in the housing lower part 3 37 a hollow - cylindrical projection of the second annular plate valve 37 38 radial sealing face on the second annular plate valve 37 | 1 |
according to one embodiment of the invention , an ldmos device having a low on - resistance whilst exhibiting a high breakdown voltage is provided . a method of fabricating such an ldmos device in accordance with one embodiment of the present invention will now be discussed with reference to fig1 . for the purposes of describing the embodiment of fig1 , it is assumed that the substrate is a p - type substrate , and the ssr well profile is to be formed in an n - type well region . however , it will be appreciated by those skilled in that art that the dopant types of the various regions can be changed so as to produce p - type devices instead of n - type devices , and vice versa . hence , in an alternative embodiment , the substrate may be an n - type substrate and the ssr well profile may be formed within a p - type well region . considering now fig1 , at step 10 a photoresist is formed on the p - type substrate to define an area in which a p - type well region ( p well ) is to be formed . in particular , the area for the p well formation is defined by the gap in the photoresist . then , at step 20 , a p well region is formed in the substrate by implanting a particular element in the portion of the substrate not covered by the photo resist . in the particular example illustrated in fig1 , boron is used as the element implanted to form the p well , but it will appreciated by those skilled in the art that other elements could be used . at step 30 , the photoresist is then removed and a new layer of photoresist is then deposited in order to define an area for formation of an n - type well region ( n well ). again , the area for the well is defined by a gap in the photoresist . thereafter , at step 40 , the n well region is formed in the p - type substrate by implanting a suitable element into the portion of the substrate not covered by the photoresist . in the particular example illustrated in fig1 , phosphorus is used as the element implanted at step 40 , but it will be appreciated that other elements , for example other elements in group vi of the periodic table , could be used . thereafter , with the photoresist still in place , a second implantation step 50 is performed in order to implant a heavier element into the n well region , with the depth of implantation being controlled so as to produce an ssr well profile . in the particular example illustrated in fig1 , the heavier element may take the form of antimony . the depth of implantation can be controlled in a variety of ways , for example by controlling the implantation energy applied at step 50 . then , at step 60 , the photoresist is removed . at this point , the p - type substrate has both a p - type well and an n - type well formed therein , in one embodiment these two wells being adjacent each other . at step 70 , a number of field oxide ( fox ) regions are formed at desired locations on the surface of the substrate . more particularly , as will be discussed later for example with reference to fig2 d , a central fox region 162 is formed in the n - well region , which in the finished device will partly underlie a portion of the gate ( this portion of the gate being referred to as the field plate ), this relatively thick fox region serving to increase the breakdown voltage of the device by reducing electric field crowding at the gate edge . further , two additional fox regions 160 , 164 are formed , one at each side of the ldmos device , which serve to isolate the device from other devices . each of the fox regions will typically be grown using a thermal oxidation process . at step 80 , an insulating gate oxide layer is formed adjacent to the central fox region . the gate oxide layer may be formed using thermal oxidation or chemical vapour deposition ( cvd ), but thermal oxidation has been found to produce a better quality gate oxide layer . whilst the formation of the gate oxide is shown as taking place after the formation of the fox regions , it will be appreciated that in some embodiments the gate oxide can be formed at the same time as the fox regions , or indeed can be formed prior to formation of the fox regions . at step 90 , a polysilicon gate layer is formed over the gate oxide and at least part of the adjacent fox region . the gate layer can be formed using any one of a number of known techniques in the art . for example , a doped polysilicon gate layer may be formed using a thermal or cvd process . then lithography is typically applied and finally an etching process is applied , for example an anisotropic etching to pattern the gate . finally , at step 95 , n + and p + regions are formed in the exposed surface of the substrate ( i . e . those portions not covered by the fox regions or by the polysilicon gate and gate oxide layers ). in particular , an n + doped region may be formed within the n − type well in order to form a drain region , and a second n + doped region can be formed in the p well in order to form a source region . in addition , with regard to the n + region formed in the p well , an adjacent p + pickup region may be provided to reduce resistivity . the various regions formed at step 95 may be produced through conventional masking steps by selective doping of the substrate in the required regions . the selective doping process may be performed with any conventional method , such as diffusion and ion implantation . fig2 a to 2 f are cross - sectional diagrams illustrating the production of an ldmos device using the earlier - described method of fig1 . fig2 a shows the formation of a first photoresist 105 on the substrate 100 and the subsequent step of employing an implantation process 107 to form a p - type well 110 ( see steps 10 and 20 of fig1 ). fig2 b shows the subsequent formation of a second photoresist 115 overlying the p - type well 110 , followed by the subsequent implantation process 130 in order to form an n - type well 120 adjacent to the p - type well 110 ( see steps 30 and 40 of fig1 ). fig2 c then illustrates the use of a second implantation process 140 using the same photoresist 115 as a mask , in order to produce a modified n - type well 125 having an ssr well profile . in particular , the implantation process 140 uses a heavier element than that implanted in the earlier implantation process 130 in order to produce a doping concentration profile 150 that changes with depth through the n - type well . in particular , as shown in fig2 c , in the example ssr doping profile illustrated therein , the doping profile within the n - well is 3e16 atom / cm3 except for in a particular central region where the doping concentration increases to 3e17 atom / cm3 due to the implantation of the heavier element into that central region . the exact depth of implantation of this heavier second element can be controlled , for example by controlling the implantation energy , in order to produce the desired ssr well profile for a particular implementation . the process illustrated schematically by fig2 c is equivalent to that discussed with reference to step 50 of fig1 . fig2 d then illustrates the formation of three fox regions 160 , 162 and 164 within the surface of the substrate ( see step 70 of fig1 ). the fox regions 160 and 164 serve to isolate the ldmos device from adjacent devices , whilst the fox region 162 is used to provide a relatively thick insulating portion to underlie part of the gate . fig2 e illustrates the formation of a gate oxide layer 175 adjacent to the fox region 162 , whereafter a polysilicon gate layer 170 is formed over the gate oxide 175 and part of the fox region 162 ( see steps 80 and 90 of fig1 ). fig2 f then illustrates the formation of an n + drain region 180 and n + source region 185 with adjacent p + pickup region 190 , within the substrate . fig2 f hence illustrates the final form of the ldmos device , in which a drain terminal would be attached at region 180 , a gate terminal would be attached to the polysilicon layer 170 , and a source terminal would be attached to the source region 185 . the n - type well region 120 , with its associated ssr doping profile , provides a light surface doping to enable a higher breakdown voltage to be obtained within the ldmos device , and heavier sub - surface doping to decrease the on - resistance . the terminal acting to sustain high voltage will be formed within the ssr well . hence , in the example of fig2 f , the drain region 180 is formed within the n - type well . however , alternatively , the source region could be formed within the n - type well , and the drain region could be formed within the p - type well , if the source terminal were to act to sustain high voltage . fig3 illustrates an ldmos device in accordance with an alternative embodiment of the present invention , in which the ldmos device has a symmetric structure , such that both the source and drain regions are placed within respective n - type well regions , both of which are formed with an ssr doping profile . in particular , as shown in fig3 , a p - type substrate 200 has a p - type well 210 formed therein , and then on each side of the p - type well 210 n - type well regions 220 , 225 are formed . each n - type well region 220 , 225 is formed with an ssr doping profile , for example by using the two - stage implantation process discussed earlier with reference to steps 40 and 50 of fig1 . fox regions 260 , 264 correspond to fox regions 160 , 164 of the earlier described fig2 a to 2 f , but now instead of a single central fox region , two central fox regions 262 , 263 are formed , one within each n - type well region 220 , 225 , respectively . an insulating gate oxide layer 275 extends between the two central fox regions 262 , 263 , and a polysilicon gate layer 270 is then formed overlying that gate oxide layer and partly overlying each fox region 262 , 263 . n + regions 280 , 285 are then formed in the exposed substrate of the two n - type well regions 220 , 225 to form drain and source regions , respectively . in such a symmetric embodiment as illustrated in fig3 , both the source and drain terminals are then capable of sustaining high voltage operation . in accordance with the above described embodiments of the present invention , it will be appreciated that such embodiments enable the production of an ldmos device with an increased saturation current ( idsat ) due to the heavy sub - surface doping concentration in the ssr well region , whilst retaining high breakdown voltage characteristics due to the light surface doping concentration in the ssr well region . the formation of the ssr doping profile within the n well region can be performed without significantly increasing the complexity of the manufacturing process , and it has been found that the ssr concentration profile is retained even though some thermal processes are applied afterwards , for example to form the fox regions . in one particular embodiment , the ssr well is formed by implantation of a heavy dopant to produce a desired doping profile that is not unduly disturbed by the following thermal budget . such an ldmos device has application in a wide variety of types of integrated circuit . in particular , such ldmos devices are usefully employed in integrated circuits requiring the sustaining of a high breakdown voltage , for example as is required in an lcd driver . although particular embodiments of the invention have been described herein , it will be apparent that the invention is not limited thereto , and that many modifications and additions may be made within the scope of the invention . for example , various combinations of the features of the following dependent claims could be made with the features of the independent claims without departing from the scope of the present invention . | 7 |
the present invention relates to a method and system for specifying , assigning , and maintaining user - defined metadata in a network - based metadata management system . the following description is presented to enable one of ordinary skill in the art to make and use the invention and is provided in the context of a patent application and its requirements . various modifications to the preferred embodiments and the generic principles and features described herein will be readily apparent to those skilled in the art . thus , the present invention is not intended to be limited to the embodiments shown but is to be accorded the widest scope consistent with the principles and features described herein . the present invention provides a metadata management system that allows users of to specify custom metadata , assign the custom metadata to images , and manage the metadata . the present invention provides an online library of metadata vocabularies from which users may create custom vocabularies using a form - driven interface without needing to understand the underlying semantics and syntax of the schema language . in a preferred embodiment the vocabularies are specified using the rdf schema definition language specified by the w3c . ( see www . w3 . org / rdf / for details of rdf and rdf schema languages .) although rdf is expected to become the standard for specification and exchange of metadata on the web , any schema language with similar capabilities will work with this system . [ 0017 ] fig1 is a block diagram illustrating an online metadata management system in accordance with a preferred embodiment of the present invention . according to the present invention , the system 10 includes a metadata management website 12 that includes a server 14 , and multiple client computers 16 . in a preferred embodiment , the server 14 can be accessed at a specific uniform resource locator ( url ) address on the internet or other network , and users 18 interact with the photosharing site 12 through a standard web browser 19 . in a preferred embodiment , the metadata management system 10 is used in conjunction with a photosharing site and client computers 16 typically store the digital images 20 of a particular user 18 . the digital images 20 are stored as image files that include image data . each image also has metadata 22 associated with it that describe and categorize the image . the metadata 22 may be associated with the images 20 by the user 18 or automatically by the server 14 as described below . according to the present invention , the metadata management site 12 allows users 18 to create , manage , and reuse metadata vocabularies and schema languages without requiring that the users 18 know the details of the metadata schema or exchange syntax . the present invention will be described in terms of a preferred embodiment where the targets to which the metadata is applied are digital images 20 , although the metadata 22 may be applied to any type of digital resource . the user 18 may upload the images 20 and the associated metadata 22 to the server 14 for storage . in the alternative embodiment of the present invention , the client computers 16 maintain storage of the actual image data and only the metadata 22 for each image are uploaded to the server 14 . in operation , users 18 of the client computers 16 register themselves with the server 14 to become members of the service so that they can specify , assign , and manage custom metadata . once a member of the service , users 18 can search the server 14 for and reuse custom metadata defined by other users 18 . in a preferred embodiment , the server 14 includes a web server application 50 , a metadata vocabulary library 52 , and a user and group account database 54 . the metadata vocabulary library 52 is for storage and management of metadata schemas 84 or vocabularies . the vocabulary library 52 stores both custom metadata vocabularies 84 created by the users 18 , as well as actual metadata values associated with specific images 22 and uploaded from client computers 16 . in a preferred embodiment , the vocabulary library 52 includes a universal schema , shared schemas , and private schemas , which in a preferred embodiment are defined using rdf and xml . all images 20 in the system 10 are required to have associated with them metadata 22 specified by the universal schema . each schema or vocabulary 84 specifies the metadata properties in that vocabulary and specifies constraints that must be enforced in order to comply with the vocabulary . the present invention allows users 18 and groups to define their own schemas , which may include the universal schema and may borrow from other vocabularies 84 . according to the present invention , the web server application 50 includes a form - driven user interface 66 that provides users 18 with an easy and intuitive way to define custom metadata vocabularies 84 without specifying the syntax for knowing the underlying schema language . for example , the homepage for the photosharing site 12 may display a web page having the following links : “ create a new metadata vocabulary ” and “ search for a metadata vocabulary .” if the user clicks on the link to “ create new metadata vocabulary ”, then one or more web pages may be displayed with a field for entering the title of the new metadata vocabulary , multiple fields for entering properties for the vocabulary , and fields for entering constraints on the values for each property . assume , for example , that the same a user has taken photos of national parks and wishes to use the photosharing site 12 to create a custom metadata vocabulary for “ national parks ”. possible properties the user could define for this new metadata vocabulary include the name of the park , its location ( i . e . state and country ), the names of objects in the picture , the category ( e . g ., wildlife , landscape , structure , etc ). a possible constraint is that the country must be chosen from a list specified in the vocabulary schema , and the state must be chosen from a list which depends on the value of the country . it should be noted that the rdf schema language is not as complete as it could be with respect to specifying constraints . there are good reasons for this as identified by the w3c ( see the rdf working group home page ). therefore , according a further aspect of the present invention , the user 18 is provided with the option of associating a vocabulary validator 24 with a newly defined metadata vocabulary 84 in the case were stronger constraints are needed . according to the present invention , the vocabulary validator 24 is a software program that runs on either the server or the client computers 16 that uses a plugin interface provided by the web application 50 . for example , the plugin interface could define an interface compatible with java &# 39 ; s enterprise java beans , or use a remote method invocation technology such as rmi or iiop which makes the location of the validator unknown to the web application invoking it . the web application 50 passes the metadata corresponding to the custom metadata vocabulary to the vocabulary validator 24 after it has ensured the constraints specified using the rdf schema have been enforced for further constrain enforcement . this process is described in more detail later . the web application 50 provides metadata library management support that allows users with the appropriate permissions to not only add new metadata vocabularies 84 to the library 52 , but also to enter search terms in the user interface 66 to find existing metadata vocabularies 84 and properties . the user 18 may then add one or more existing metadata vocabularies 84 to the user &# 39 ; s custom metadata vocabulary , or only select particular properties from the existing metadata vocabularies 84 to add to the user &# 39 ; s custom metadata vocabulary . when user has completed the task of entering and / or selecting properties and constraints for the custom metadata vocabulary 84 , the newly created metadata vocabulary is stored in the metadata vocabulary library 52 . the user account database 54 stores user account and corresponding contact information and preferences of each registered user 18 . according to the present invention , groups and users may specify their own metadata 22 vocabularies and may share these vocabularies with other users and groups . users and group administrators may specify one or more vocabularies , which must be supported for images associated with the user and group accounts , respectively . the server 14 and client computers 16 enforce these metadata requirements . groups of users 18 may also share common policies , which may include permission settings , user interface options , required and optional metadata vocabularies 84 , subscriptions lists , and event / notification policies . in a preferred embodiment access control lists are maintained to control and restrict access . in alternate embodiment , role based permissions as supported by the java authentication and activation services may be supported . the user account database 54 allows mandatory vocabularies 84 to be associated with certain target resources . for example , a particular user 18 may want all of his individual photographs to have a certain set of metadata always supplied . his / her account would be configured to indicate the assignment of metadata supporting the relevant metadata vocabulary 84 is required before the image 20 may be stored on the system 10 . an example of required metadata , might be a vocabulary 84 for data about the owner of the account ( e . g name , address , etc ). multiple vocabularies 84 may be required for any given target types . digital still images 20 need not be the only type of target resources . examples of other types of image files for which required vocabularies may be specified include multiple image files , such as timelapse images , burst images , panarama images , etc . non - image target resources may also be supported , such as sound files , movies , and text documents . the present invention applies to any resource that could conceivably have metadata associated with it . [ 0032 ] fig2 is a flow chart illustrating the process of allowing users of the metadata management system to manage the metadata library 52 . once the user logs - in , the web application 50 displays one or more web pages that allows the user 18 to perform the following high - level functions . one management function is to allow the user to create vocabularies 84 to be added to the library 52 in step 106 ( described further in fig3 ). the second management function is to allow the user 18 to add references to metadata vocabularies existing elsewhere on the web to the library 52 in step 110 so they may be found by the search facilities provided by the web application 50 . to add a reference to a metadata vocabulary existing external to the metadata library 52 , user 18 enters the name and uri for the metadata vocabulary in one of the user interface forms in step 112 , and clicks a link or button to create a new entry in the metadata library 52 in step 114 . see www . w3 . org / rdf / for details of how a vocabulary can reference elements of another vocabulary in order to borrow from it . the third management function is to allow the user 18 to set access permissions for the metadata vocabularies 84 in the metadata library 52 in step 118 . this is accomplished by selecting one or more metadata vocabularies 84 from the vocabulary library 52 in step 120 and setting the user permissions of the selected metadata vocabularies 84 in step 116 . [ 0035 ] fig3 is a flow chart illustrating the process of adding a new metadata vocabulary 84 to the metadata library 52 . in response to the user 18 choosing to create a metadata vocabulary 84 in step 106 of fig2 the web application 50 gives the user 18 a choice to reuse properties from an existing vocabulary in step 206 or create a new property in step 214 . the user 18 may create new properties to be contained in the vocabulary by entering the property name and specifying the constraints , if any , for the possible values the property may contain in step 216 and 218 . for each new property the user 18 creates , the web application 50 prompts the user 18 for the name of the property and allows the user 18 to select from a list of property types string , list , boolean , numeric , etc . the choices are limited to what the underlying specification language supports . depending on the type , the web application 50 may prompt the user 18 to provide additional constraints , such as the list of possible values for a list type or a range for a numeric range . if the user 18 chooses to reuse an existing vocabulary 84 , then a search facilities is presented in step 208 that allows the user 18 to locate existing vocabularies 84 based on user supplied criteria , such as the vocabulary identifier ( i . e ., its uri ), the vocabulary &# 39 ; s name , the name ( s ) of properties contained in the vocabulary , the owner of the vocabulary , or the intended target types of a vocabulary . that is , the library 52 supports metadata about the metadata vocabularies 84 . the search facility makes the vocabularies 84 easily browsable . the system 10 may at the option of the user 18 extend its search to include other metadata libraries ( aka registries ) as more of these libraries appear on the web . after the user enters search terms and finds existing vocabularies , the user 18 may select one or more properties from these vocabularies 84 in step 210 to add to the metadata vocabulary 84 being created . the user may optionally add additional constraints to the borrowed property ( as allowed by rdf ) in step 212 . as an example of reusing properties from an existing vocabulary and searching , consider a user who wants to create a metadata vocabulary 84 for describing pictures of his pets . he may begin by borrowing properties from the well - known dublin core metadata vocabulary , such as title , subject , and description . he would do this by locating the dublin core vocabulary using the search facility . in the search facility , he can enter the id of the dublin core ( i . e ., its uri ) or enter the names of one or more properties in the dublin core such as “ subject ”. once the dublin core vocabulary is located and selected , the web application 50 would display the properties available from the vocabulary allowing the user to select which elements to borrow . the user 18 may repeat this borrowing process from other vocabularies 84 . as the user 18 borrows properties , the web application 50 allows the user to specify additional constraints . for example , the “ subject ” property in the dublin core is a string ( typically a string of keywords ). the user 18 could select to restrict the string to one or more of a series of words from a list he specifies . when subsequently applying his custom metadata to images of his pets , the web application 50 would display the list of pet names for the user to select from . as an additional option , the user 18 may supply a validator 24 to enforce contraints beyond those supported by the specification language . the validator 24 is a software program that supports a plugin api provided by the metadata library 52 . the validator 24 is called when metadata associated with the vocabulary is created or changed , but after the constraints enforced by the specification language have been verified . the processes of reusing existing vocabularies 84 and creating new properties may be repeated as needed until the user 18 is satisfied with the new metadata vocabulary 84 in step 202 . when the new metadata vocabulary 84 is complete , the metadata vocabulary 84 is named and saved in the metadata library 52 in step 204 . [ 0042 ] fig4 is a flow chart illustrating the process of assigning required metadata from the vocabulary library to a target resource . when the web application 50 receives a target resource to be added to the photosharing site 12 from the user 18 , the web application 50 checks the user &# 39 ; s account and the relevant group accounts that the user is a member of and retrieves the required vocabularies 84 specified for the type of target resource in step 302 . as stated above , any resource type may be supported , including images , sound files , movies , text files , and so on ). because the metadata vocabularies 84 often borrow properties from one another , the web application 50 merges the required metadata vocabularies 84 retrieved from the library 52 in step 304 before prompting the user to enter values for the properties . the merging process performs two primary functions . first , it removes duplicate properties ( that result from the borrowing of properties among vocabularies 84 ). second , because the same property may have different sets of constraints specified by different vocabularies 84 , the web application 50 ensures that policy for conflicting constraints is enforced . in a preferred embodiment , the most restrictive constraints are applied . in an alternate embodiment , the web application 50 may allow the user to enter values that meet either constraint . a third possibility for constraint policy is to always choose the constraints in one particular vocabulary 84 over another . for example , two required vocabularies 84 may both borrow the property “ subject ” from the dublin core . each of these vocabularies 84 may have specified additional constraints on what the value of “ subject ” may be . after merging vocabularies 84 , the web application 50 builds the user interface by generating forms for metadata assignment in step 306 through which the user may enter values for the assigned metadata . in a preferred embodiment , the interface is a series of one or more forms displayed in the web browser 19 . in a preferred embodiment , xslt is used to transform the rdf schema specification into xhtml forms for display in the user &# 39 ; s web browser 19 . the user 18 is then allowed to navigate through the form ( s ) entering data in step 308 . the forms may display additional comments provided by the vocabularies 84 to aid the user 18 in entering the data values . as the user moves to an input field for a given property , the web application 50 uses the constraints defined for the property to determine the correct form element to use for data input for any given property ( a test field , a selection list , a choice list , and so on ). as the user 18 enters values for the metadata , the web application 50 validates the metadata values based on the vocabulary constraints and optionally supplied vocabulary validator 24 ( s ) in step 310 . when the data is valid and the user 18 is finished entering metadata values , the web application 50 associates the metadata with the target resource and saves in step 312 . [ 0046 ] fig5 illustrates the process of allowing the user 18 to associate optional metadata with a target resource that already exists in the management site 12 . in other words , this process allows the user 18 to add metadata for the target resource that was not otherwise required for that resource type . in a preferred embodiment , the user 18 may add metadata to any target to which he / she has access . the user 18 first searches and / or browses for metadata vocabularies 84 as needed to add the desired metadata to the target in step 402 . the user 18 then selects vocabularies 84 to use in step 404 . note : if the user 18 can &# 39 ; t find the needed properties in existing vocabularies 84 the user 18 can create a new one , as described with reference to fig3 . after the user has selected vocabularies to use , the process proceeds as described with reference to fig4 : merging the vocabularies ( step 406 ), generating forms for metadata assignment ( step 408 ), displaying the forms and accepting user input ( step 410 ), and validating the metadata values based on the vocabulary constraints and optional vocabulary validator 24 s ( step 412 ). the user 18 may continue by searching for more vocabularies to add to the target resource in step 402 . when user 18 is done in step 414 , the metadata is associated with the target resource and saved in step 416 . as an example of adding optional metadata to images consider the following example . assume that the user 18 has added an image of a family with mountains in the background to the system 10 . assume further that the user 18 has defined a private schema that includes the universal schema , borrows from a shared schema defined for family metadata , and has added additional metadata for the user &# 39 ; s 18 private use . another user 18 may discover the image , perhaps through a search using fields in the universal schema . seeing the mountains in the picture and being an avid fan of nature photography this user creates nature metadata to associate with image using a shared schema defined for nature photographs . the user then uploads this metadata for the image to the server 14 . other users constructing searches built using one or more of these vocabularies ( universal , family , user &# 39 ; s private extensions , and nature ) will be able to find image if the search criteria match . according to the present invention , the photosharing system allows users to create custom metadata and to make the custom metadata available for other users in the system to use . the schema definitions are not limited by the system 10 . further , the system allows the users to add and reuse the metadata stored in the system without requiring users to know underlying details regarding the schema language and syntax . a method and system for specifying , assigning , and maintaining user defined metadata in a network - based metadata management system has been disclosed . the present invention has been described in accordance with the embodiments shown , and one of ordinary skill in the art will readily recognize that there could be variations to the embodiments , and any variations would be within the spirit and scope of the present invention . accordingly , many modifications may be made by one of ordinary skill in the art without departing from the spirit and scope of the appended claims . | 8 |
the embodiments of the optical connector of the present invention will be described with reference to the accompanying drawings . note that the same reference numerals denote the same parts throughout the drawings , and a repetitive description will be avoided . fig1 is a perspective view showing a ferrule and an optical fiber which are applied to the optical connector according to the present invention . the ferrule 1 shown in fig1 is made of a resin ( or zirconia or glass ) in the form of an almost rectangular parallelepiped , and is utilized as a part of the optical connector ( for example , a mt connector ). moreover , the ferrule 1 is incorporated and utilized as a part of another connector or the like in some cases . as shown in fig1 to 3 , a hollow portion 50 for optical fiber protrusion having a width a ( 3 mm ), a height b ( 1 . 5 mm ) and a depth d ( 0 . 03 mm ) is formed on the center of a front end face 1 a of the ferrule 1 . the hollow portion 50 has a rectangular opening window 50 a . four optical fiber positioning holes 4 are formed on a front part in the ferrule 4 . each of the optical fiber positioning holes 4 serves to perform positioning by inserting four ( four - core ) optical fibers 3 exposed from the tip of a ribbon - shaped optical fiber 2 ( which will be hereinafter referred to as a “ optical fiber ribbon ”) respectively and has a diameter of 126 μm to 127 μm for the optical fiber 3 having a diameter of 125 μm . each optical fiber positioning hole 4 is extended from a bottom face 50 b of the hollow portion 50 rectilinearly in parallel , and the front end opening of the optical fiber positioning hole 4 is formed as an optical fiber protrusion port 5 . accordingly , the four optical fiber protrusion ports 5 are aligned on the bottom face 50 b of the hollow portion 50 . an optical fiber inlet 6 for introducing the optical fiber 3 from the outside is provided in the rear portion of the ferrule 1 . furthermore , an adhesive filling hollow portion 7 for accommodating an adhesive r is provided between the optical fiber inlet 6 and the optical fiber positioning hole 4 , and an adhesive filling window 8 forming a rectangular opening into which the adhesive is poured is formed on the top of the adhesive filling hollow portion 7 . four optical fiber alignment grooves 9 extended along the overall length are formed on a bottom face 7 a of the adhesive filling hollow portion 7 . each optical fiber alignment groove 9 is positioned on the extension of each optical fiber positioning hole 4 , and is extended between the optical fiber positioning hole 4 and the optical fiber inlet 6 . furthermore , each optical fiber alignment groove 9 is formed to have a c - shaped section and is extended to have the same diameter as the diameter of the optical fiber positioning hole 4 ( see fig1 ). a guide pin inserting hole 10 for inserting a guide pin ( not shown ) is formed on both sides of the hollow portion 50 over the front end face 1 a of the ferrule 1 . the optical fiber 3 inserted from the optical fiber inlet 6 of the ferrule 1 is provided in the optical fiber positioning hole 4 along the optical fiber alignment groove 9 . in this case , while a tip face 3 a of the optical fiber 3 is protruded from the optical fiber protrusion port 5 , it is led in with a retreat amount s of approximately 5 μm to 10 μm with respect to the front end face 1 a of the ferrule 1 and is drawn in the hollow portion 50 . in consideration thereof , it is preferable that the depth of the hollow portion 50 should be set to 20 μm or more . moreover , when the adhesive r is filled in the adhesive filling hollow portion 7 , the optical fiber 3 can be fixed to the optical fiber alignment groove 9 through the adhesive r . this implements the firmer fixation of the optical fiber 3 to the ferrule 1 . in this case , since a difference between the diameters of the optical fiber 3 and the optical fiber positioning hole 4 is very small , the adhesive r rarely flows from a rear end 4 a side of the optical fiber positioning hole 4 . an optical connector c having such a structure does not depend on the shape of the tip face 3 a of the optical fiber 3 and is readily applicable to the mt ( mechanically transferable ) connector which can perform high - speed switching for a cats ( cable transfer system ) or the like . more specifically , it is not necessary to enhance the cutting precision or polishing precision of the tip face 3 a of the optical fiber 3 and a time required for a work of attaching the optical fiber 3 to the ferrule 1 can be shortened greatly . moreover , since the tip face 3 a of the optical fiber 3 is not protruded from the front end face 1 a of the ferrule 1 , an operator does not touch the tip end face 3 a of the optical fiber 3 carelessly during handling . furthermore , a step of precisely polishing the front end face 1 a of the ferrule 1 is not required at the final stage of fixing the optical fiber 3 to the ferrule 1 . consequently , the time required for working can be shortened greatly . in addition , it is possible to prevent the tip face 3 a of the optical fiber 3 from being chipped during polishing . a retreat amount ( withdrawal amount ) s of the optical fiber 3 is set such that the tip face 3 a of the optical fiber 3 is not protruded from the front end face 1 a of the ferrule 1 even if a temperature is changed in consideration of a coefficient of linear expansion of a member forming the optical connector c . by inserting a boot 11 made of rubber which is fitted in the optical fiber 3 into the optical fiber inlet 6 of the ferrule 1 , the optical fiber 2 can be prevented from being bent . an example of a method for assembling the optical connector c having such a structure will be described below . in order to carry out this method , an optical fiber press member 20 made of a resin in the form of an almost rectangular parallelepiped is prepared as shown in fig4 . the front face of the optical fiber press member 20 is provided with a flat ferrule connecting face 20 a to abut on the front end face 1 a of the ferrule 1 . the ferrule connecting face 20 a is provided with a positioning protrusive portion 21 having the shape of a square pole to be inserted in the hollow portion 50 of the ferrule 1 , and the positioning protrusive portion 21 is formed to have such a size to be fitted in the hollow portion 50 . the tip of the positioning protrusive portion 21 is provided with a flat rectangular optical fiber press face 21 a . the optical fiber press face 21 a is protruded from the ferrule connecting face 20 a by approximately 5 to 10 μm . this corresponds to an amount in which the tip face 3 a of the optical fiber 3 can retreat from the front end face 1 a of the ferrule 1 . moreover , a guide pin inserting hole 22 corresponding to each guide pin inserting hole 10 of the ferrule 1 is provided . the optical fiber press member 20 having such a structure is prepared before the work . as shown in fig5 first of all , the optical fiber 2 is inserted into the boot 11 made of rubber , and a covering portion f having a predetermined length is removed from the tip portion of the optical fiber 2 by a heating type remover or the like , and a covering waste is wiped off with alcohol or the like with the four optical fibers 3 exposed . after the optical fibers 3 are cut to have a predetermined length by means of a cleaver or the like such that they are aligned , the tip face 3 a of the optical fiber 3 is subjected to an edge removing treatment by the discharging work as shown in fig6 . this is intended for preventing the end face from being chipped by the contact of the optical fiber 3 with the ferrule 1 when the optical fiber 3 is to be inserted into the ferrule 1 and for rapidly carrying out the inserting work . for the same edge treatment , the tip face 3 a of the optical fiber 3 may be mechanically treated by a polishing rotor 23 or a manual work as shown in fig7 . as shown in fig8 next , a grease - like silicon based refractive index matching material k is applied onto the front end face 1 a of the ferrule 1 such that it enters the hollow portion 50 of the front end face 1 a of the ferrule 1 . then , the exposed end side of the guide pin p is inserted in the guide pin inserting hole 10 of the ferrule 1 ( see fig1 ) with the guide pin p inserted in the guide pin inserting hole 22 of the optical fiber press member 20 . with the positioning protrusive portion 21 of the optical fiber press member 20 entering the hollow portion 50 of the ferrule 1 by the induction of the guide pin p , the ferrule connecting face 20 a of the optical fiber press member 20 is pressed against the front end face 1 a of the ferrule 1 . as a result , the optical fiber press face 21 a enters the hollow portion 50 by approximately 5 to 10 μm with the index matching material k entering the hollow portion 50 ( see fig1 ). in order to maintain this state , the ferrule 1 and the optical fiber press member 20 may be interposed and fixed on both sides by means of a clip which is not shown . as shown in fig9 then , the optical fibers 3 are inserted from the optical fiber inlet 6 of the ferrule 1 . thus , the optical fibers 3 are inserted in the optical fiber positioning holes 4 , respectively . as shown in fig1 , the optical fiber 2 is advanced to such an extent that the tip face 3 a of the optical fiber 3 abuts on the optical fiber press face 21 a of the positioning protrusive portion 21 . as a result , the tip face 3 a of the optical fiber 3 retreats to be led in by approximately 5 to 10 μm ( corresponding to the amount of protrusion of the positioning protrusive portion 21 ) with respect to the front end face 1 a of the ferrule 1 , and is drawn in the hollow portion 50 . furthermore , the hollow portion 50 is filled with the silicon based refractive index matching material k , and the tip face 3 a of the optical fiber 3 is completely drawn in the index matching material k . furthermore , a misalignment of approximately several μm is generated on the tip face 3 a of the optical fiber 3 during cutting . therefore , it is necessary to align the tip faces 3 a in order to eliminate an optical connection loss caused by the misalignment . as shown in fig1 , therefore , the ferrule 1 and the optical fiber positioning member 20 are fixed onto a base plate 24 and the covering portion f of the optical fiber 2 is held by means of a fiber holder 25 which can be slid over the base plate 24 in a longitudinal direction . in this state , pressure is applied forward to give such an alignment load that the tip faces 3 a of all the optical fibers 3 abut on the optical fiber press face 21 a of the positioning protrusive portion 21 ( such a load as to give 0 . 2 kgf ( about 1 . 96 n ), for example , to the four optical fibers 3 forward ). consequently , the tip face 3 a of the optical fiber 3 is forcibly aligned as shown in fig1 . in this case , it is necessary to absorb an amount of the optical fiber 3 to be compressed . as shown in fig1 , therefore , it is preferable that the optical fiber alignment groove 9 should have a c - shaped section and a slit - shaped opening 9 a having a smaller width than the diameter of the optical fiber 3 should be formed over the optical fiber alignment groove 9 . by providing such an opening 9 a , the optical fiber 3 can be prevented from jumping out so that the adhesive r can flow into the optical fiber alignment groove 9 . as shown in fig1 , then , the adhesive filling hollow portion 7 of the ferrule 1 is filled with an epoxy based thermosetting type adhesive r . in this state , the ferrule 1 is properly heated by a heater which is not shown so that the adhesive r is cured . at the final step , the ferrule 1 and the optical fiber 3 slightly change their dimensions by expansion and contraction ( particularly , the ferrule 1 made of a resin is greatly expanded and contracted ). however , the tip face 3 a of the optical fiber 3 is previously led in . therefore , the tip face 3 a of the optical fiber 3 is not protruded from the front end face 1 a of the ferrule 1 . as shown in fig1 , the optical fiber press member 20 is removed from the ferrule 1 . consequently , the work for assembling the optical fiber 2 into the ferrule 1 is completed with the tip face 3 a of the optical fiber 3 aligned reliably ( see fig1 ). the refractive index matching material k in the hollow portion 50 is cleaned and removed after the assembling work if necessary . moreover , the expansion and contraction of the ferrule 1 and the optical fiber 3 can be prevented by using a ultraviolet curing adhesive or a room temperature curing adhesive for the adhesive r . in the case in which refuse or the like sticks to the tip face 3 a of the optical fiber 3 protruded in the hollow portion 50 , it is preferable that the tip portion of the optical fiber 3 should be cleaned by inserting and turning a cleaning member such as an applicator in the hollow portion 50 . thus , the hollow portion 50 also serves to easily clean the tip face 3 a of the optical fiber 3 . next , another optical connector c 1 according to the present invention will be described . the components , which are identical or similar to those of the optical connector c , have the same reference numerals . as shown in fig1 , a ferrule 30 to be applied to the optical connector c 1 is provided with a housing 32 for a fiber press fixing member for accommodating a block - shaped fiber press fixing member 31 , and the top of the housing 32 is formed as a rectangular opening 33 for inserting the fiber press fixing member 31 therein . four optical fiber alignment grooves 34 extended over the whole length are formed on the bottom face of the housing 32 . when the fiber press fixing member 31 is inserted from the opening 33 , the four optical fibers 3 in the optical fiber alignment groove 34 can be pressed downward at one time by a lower face 31 a of the fiber press fixing member 31 ( see fig1 ). the optical connector c 1 has a spring member 35 for energizing the fiber press fixing member 31 inserted into the housing 32 . the spring member 35 is constituted as a clamp member having a u - shaped section which is extended from the upper face of the ferrule 30 to the lower face thereof . the fiber press fixing member 31 is elastically held in the housing 32 by means of the clamp member 35 . accordingly , each optical fiber 3 in each optical fiber alignment groove 34 can be firmly fixed to the ferrule 30 with a predetermined fixed load by utilizing the clamp member 35 . the material of the clamp member 35 is phosphorus bronze or stainless steel which has been subjected to cold working . consequently , the clamp member 35 can have strong spring force and high durability . thus , long - term reliability of clamp force can be ensured . moreover , the clamp member 35 is formed to have a u - shape by an upper plate - shaped piece 35 a , a lower plate - shaped piece 35 b and an intermediate piece for coupling them ( which is not shown ), thereby generating proper clamp force by the upper piece 35 a of the clamp member 35 . furthermore , the optical connector c 1 has a block - shaped covering portion press fixing member 39 for fixing a covering portion f of a optical fiber ribbon 2 to the ferrule 30 in addition to the fiber press fixing member 31 for fixing the optical fiber 3 to the ferrule 30 . an optical fiber guide hole 40 extended rearward from the optical fiber alignment groove 34 is provided in the ferrule 30 , and a covering portion inserting member 36 is positioned therebehind . the covering portion inserting member 36 has at least such a width as to accommodate the covering portion f of the optical fiber ribbon 2 . a housing 37 for the covering portion press fixing member is formed as a notch on the rear end of the ferrule 30 in parallel with the housing 32 for the fiber press fixing member . the covering portion press fixing member 39 can be provided in the housing 37 . moreover , the optical connector c 1 has a spring member 38 for energizing the covering portion press fixing member 39 in the housing 37 . the spring member 38 is constituted as a clamp member having a u - shaped section which is extended from the upper face of the ferrule 30 to the lower face thereof . the covering portion press fixing member 39 is elastically held in the housing 37 by means of the clamp member 38 . in the same manner as the optical connector c , a hollow portion 50 for optical fiber protrusion is provided on the center of a front end face 30 a of the ferrule 30 and the tip face 3 a of the optical fiber 3 is not protruded from the front end face 30 a of the ferrule 30 but is drawn in the hollow portion 50 . an optical connector according to a further embodiment of the present invention will be described below . as shown in fig1 , tip faces 3 a of four optical fibers 3 may not be aligned but be provided in a hollow portion 50 . more specifically , in the case in which the tip face 3 a of each optical fiber 3 is drawn in the hollow portion 50 , the amount of the optical fiber 3 protruded from an optical fiber protrusion port 5 may be uneven . the reason is that independent optical connection is carried out in the respective optical fibers 3 . in other words , when four optical fibers 28 a provided on a ferrule 28 of another optical connector 27 are to be optically connected to the optical fiber 3 of a ferrule 1 , the optical fiber 3 performs independent optical connection to the optical fiber 28 a . by drawing the tip face 3 a of the optical fiber 3 in the hollow portion 50 of the ferrule 1 , the following advantages can further be obtained . more specifically , it is possible to roughly cut the tip portion of the optical fiber 3 in a slight misalignment state with an alignment error of several μm even if the tip face 3 a of the optical fiber 3 is not cut to be aligned with high precision at the previous step of inserting the optical fiber 3 into the ferrule 1 . as a result , the cutting work can be carried out rapidly . in this case , even if the tip face of the optical fiber 3 is obliquely cut , the connection is affected with difficulty . moreover , also after the optical fiber 3 in the misalignment state of the end face is incorporated in the ferrule 1 , it is not necessary to align and cut the tip portion of the optical fiber 3 again . consequently , the work of assembling the optical fiber 3 can be carried out very rapidly . furthermore , a change in the amount of protrusion of the optical fiber 3 caused by a coefficient of thermal expansion can also be permitted . when the tip face 3 a of the optical fiber 3 is rounded by a discharging work at the previous step of inserting the optical fiber 3 into the ferrule 1 , the optical fiber 3 can easily be inserted into an optical fiber positioning hole 4 and so is the ferrule 30 . the optical connector according to the present invention is not restricted to various embodiments described above . for example , a hollow portion 61 having a slit - shaped opening window 61 a may be provided on the center of a front end face 60 a of a ferrule 60 in an optical connector c 2 as shown in fig1 . in this case , it is easy to greatly move a cleaning member such as an applicator along the hollow portion 61 . the opening window 61 a may be formed slenderly in the transverse direction to include a guide pin inserting hole 10 on both sides over the front end face 60 a of the ferrule 60 . as a matter of course , the coverage of the optical connector described above includes multi - fiber optical connectors of other types and single core optical connectors of sc and mu types in addition to an optical connector of an mt type . as shown in fig2 , for example , a hollow portion 71 having a slit - shaped opening window 71 a may be provided on the center of a front end face 70 a of a cylindrical ferrule 70 in a single core optical connector c 3 . in this case , an optical fiber 72 having a single core is utilized and a tip face 73 a of an optical fiber 73 is drawn in the hollow portion 71 . from the invention thus described , it will be obvious that the invention may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended for inclusion within the scope of the following claims . | 6 |
an at least partially automated mechanical transmission system intended for vehicular use is schematically illustrated in fig1 . the automated transmission system 10 includes a fuel - controlled engine 12 ( such as a well - known diesel engine or the like ), a multiple - speed , change - gear transmission 14 , and a non - positive coupling 16 ( such as a friction master clutch ) drivingly interposed between the engine and the input shaft 18 of the transmission . engine 12 is preferably a heavy - duty vehicle diesel engine having a governed maximum speed of about 2100 to 2200 rpm . the transmission 14 may be of the compound type comprising a main transmission section connected in series with a splitter - and / or range - type auxiliary section . transmissions of this type , especially as used with heavy - duty vehicles , typically have 6 , 8 , 9 , 10 , 12 , 13 , 16 or 18 forward speeds . examples of such transmissions may be seen by reference to u . s . pat . nos . 5 , 390 , 561 and 5 , 737 , 978 , the disclosures of which are incorporated herein by reference . a transmission output shaft 20 extends outwardly from the transmission 14 and is drivingly connected with the vehicle drive axles 22 , usually by means of a prop shaft 24 . the illustrated master friction clutch 16 includes a driving portion 16a connected to the engine crankshaft / flywheel and a driven portion 16b coupled to the transmission input shaft 18 and adapted to frictionally engage the driving portion 16a . an upshift brake 26 ( also known as an input shaft brake or inertia brake ) may be used for selectively decelerating the rotational speed of the input shaft 18 for more rapid upshifting , as is well known . input shaft or upshift brakes are known in the prior art , as may be seen by reference to u . s . pat . nos . 5 , 655 , 407 and 5 , 713 , 445 . a microprocessor - based electronic control unit ( or ecu ) 28 is provided for receiving input signals 30 and for processing same in accordance with predetermined logic rules to issue command output signals 32 to various system actuators and the like . microprocessor - based controllers of this type are well known , and an example thereof may be seen by reference to u . s . pat . no . 4 , 595 , 986 . system 10 includes a rotational speed sensor 34 for sensing rotational speed of the engine and providing an output signal ( es ) indicative thereof , a rotational speed sensor 36 for sensing the rotational speed of the input shaft 16 and providing an output signal ( is ) indicative thereof , and a rotational speed sensor 38 for sensing the rotational speed of the output shaft 20 and providing an output signal ( os ) indicative thereof . a sensor 40 may be provided for sensing the displacement of the throttle pedal and providing an output signal ( thl ) indicative thereof . a shift control console 42 may be provided for allowing the operator to select an operating mode of the transmission system and for providing an output signal ( gr t ) indicative thereof . as is known , if the clutch is engaged , the rotational speed of the engine may be determined from the speed of the input shaft and / or the speed of the output shaft and the engaged transmission ratio ( es = is = os * gr ). system 10 also may include sensors 44 and 46 for sensing operation of the vehicle foot brake ( also called service brakes ) and engine brakes , respectively , and for providing signals fb and eb , respectively , indicative thereof . the master clutch 16 may be controlled by a clutch pedal 48 or by a clutch actuator 50 responding to output signals from the ecu 28 . alternatively , an actuator responsive to control output signals may be provided , which may be overridden by operation of the manual clutch pedal . in the preferred embodiment , the clutch is manually controlled and used only to launch the vehicle ( see u . s . pat . nos . 4 , 850 , 236 ; 5 , 272 , 939 and 5 , 425 , 689 ). the transmission 14 may include a transmission actuator 52 , which responds to output signals from the ecu 28 and / or which sends input signals to the ecu 28 indicative of the selected position thereof . shift mechanisms of this type , often of the so - called x - y shifter type , are known in the prior art , as may be seen by reference to u . s . pat . nos . 5 , 305 , 240 and 5 , 219 , 391 . actuator 52 may shift the main and / or auxiliary section of transmission 14 . the engaged or disengaged condition of clutch 16 may be sensed by a sensor or determined by comparing the signals es and is indicative to the engine and input shaft rotational speeds . fueling of the engine is preferably controlled by an electronic engine controller 54 , which accepts command signals from and / or provides input signals to the ecu 28 . preferably , the engine controller 54 will communicate with an industry standard data link dl which conforms to well - known industry protocols such as sae j1922 , sae 1939 and / or iso 11898 . the ecu 28 may be incorporated within the engine controller 54 . as is known , for automated shifting , the ecu 28 must determine when upshifts and downshifts are required and if a single or skip shift is desirable ( see u . s . pat . nos . 4 , 361 , 060 ; 4 , 576 , 065 ; 4 , 916 , 979 and 4 , 947 , 331 ). fig2 is a graphical representation of shift point profiles utilized to determine when shift commands should be issued by the ecu 28 to the shift actuator 52 . solid line 60 is the default upshift profile , while solid line 62 is the default downshift profile . as is known , if the vehicle is operating to the right of upshift profile 60 , an upshift of transmission 14 should be commanded , while if the vehicle is operating to the left of downshift profile 62 , a downshift should be commanded . if the vehicle is operating in between profiles 60 and 62 , no shifting of the transmission is then required . shift profile 62 is a graphical representation of the engine speeds ( es d / s ) at various levels of throttle position , at which a downshift from a currently engaged gear ratio ( gr ) into a lower ratio ( gr - n , n = 1 , 2 , 3 ) is indicated . in the prior art ( see dashed line 64 ), it is known that the downshift engine speed increases with increased throttle position ( i . e ., increased driver demand for engine speed and torque ). in the present invention , there is a step increase in the value of es d / s above a predetermined throttle displacement value 66 selected at about 80 % to 100 % displacement . briefly , if thl & lt ; 80 %- 100 %, a coast downshifting condition is assumed to exist while above this value , a power downshifting condition is assumed to exist . as is known , all or portions of shift profiles 60 and 62 are subject to movement under various operating conditions . according to the control of the present invention , if a downshift from a currently engaged ratio ( gr ) is required ( i . e ., if at current throttle displacement engine speed ( es ) is less than the downshift engine speed ( es d / s ) on shift point profile 62 ), a sequence is initiated for identifying the desirable downshift target ratio ( gr target ), if any . the control , in sequence , will evaluate multiple skip , then single skip and then single downshifts for desirability and command a downshift to the first potential target ratio deemed desirable . two reference engine speed values are established or set , ( i ) a desirable maximum engine speed ( es des ), has a default value of about 1600 to 1700 rpm for a vehicular heavy - duty diesel engine governed to about 2200 rpm , which is selected to be a speed which will not cause a sensation of engine flaring at completion of a downshift , and ( ii ) a maximum downshift engine speed ( es max ), about 2000 to 2150 rpm , selected to be slightly below ( about 50 to 150 rpm below ) the governed speed ( es gov ) of the engine . multiple skip downshifts , then single skip downshifts , and then single downshifts are then evaluated , in sequence , and a downshift initiated from the currently engaged ratio into the first evaluated target downshift ratio deemed desirable . ( 1 ) a big skip downshift from the currently engaged ratio gr into gr - 3 is evaluated by estimating the expected engine speed es gr - 3 at completion of a downshift to gr - 3 and comparing that speed to the desirable maximum engine speed es des . expected engine speeds in a target ratio are estimated / determined as a function of current vehicle speed ( os ), the expected acceleration / deceleration of the vehicle ( dos / dt ), the expected acceleration of the engine ( des / dt ) and the time expected for completion of a downshift . if es gr - 3 is less than the maximum desirable engine speed ( es gr - 3 & lt ; es des ), the downshift to gr - 3 is desirable and will be initiated . if not , ( 2 ) then a single skip downshift into gr - 2 is evaluated by estimating the expected engine speed ( es gr - 2 ) at completion of a downshift to gr - 2 and comparing that estimated speed to the desirable maximum engine speed ( es des ). if es gr - 2 is less than the desirable maximum engine speed ( es gr - 2 & lt ; es des ) then the downshift to gr - 2 is desirable and will be initiated . if not , ( 3 ) then a single downshift into gr - 1 is evaluated by estimating the expected engine speed es gr - 1 at completion of a downshift into gr - 1 and comparing that estimated speed to the maximum downshift engine speed ( es max ). if es gr - 1 is less than the maximum downshift engine speed ( es gr - 1 & lt ; es max ), then a single downshift from the currently engaged ratio ( gr ) into gr - 1 is desirable and will be commanded . if not , to provide for enhanced performance when performance is requested by the operator ( such as , for example , when throttle pedal displacement position is above a reference value ( usually about 85 - 90 %)), the desirable maximum engine speed ( es des ) used to evaluate possible skip downshifts is increased by a performance offset ( if thl & gt ; ref , then es des = es des - default + offset ). for a typical diesel engine having a rated speed of about 2100 rpm , the offset is equal to about 50 - 150 rpm . increasing the desirable maximum engine speed ( es des ) used to evaluate skip downshifts will result in the selection of more performance - oriented gear ratios . alternatively , the value of es des used to evaluate skip downshifts could be increased incrementally or continuously from the default value thereof as throttle position ( thl ) exceeds the performance reference value . the control of the present invention is shown in flow chart format in fig3 a and 3b . although only skip shifts of two ratio steps are illustrated , the present invention also is applicable to skip shifts of three or more ratios . the time and / or rate of engine acceleration ( des / dt ) used to determine an estimated engine speed after a downshift ( es gr - n ) may be empirically determined constants or may be calculated or learned values . to complete a downshift from gr to gr - n , the engine speed must be modulated to a zero driveline torque value ( see u . s . pat . no . 4 , 850 , 236 ), the transmission must be shifted into neutral , the engine must be accelerated to a substantially synchronous speed for the new ratio ( es gr - n ≈ os expected * gr target ), and then the transmission must be shifted from neutral into the appropriate ratio . accordingly , it may be seen that an improved control system / method for controlling downshifting in an at least partially automated mechanical transmission system in a vehicle is provided . although the present invention has been described with a certain degree of particularity , it is understood that the description of the preferred embodiment is by way of example only and that numerous changes to form and detail are possible without departing from the spirit and scope of the invention as hereinafter claimed . | 8 |
in order to carry out the method of preparing a ( bi , pb ) srcacuo - 2223 superconducting wire according to the present invention , first prepared is a starting precursor powder with its oxygen content adjusted to the value of the final 2223 phase . the oxygen content of the final 2223 phase can be determined experimentally by chemical analysis . the 2223 phase can be formed by sintering at a temperature and the corresponding oxygen partial pressure normally used in constant pressure sintering condition . then the 2223 phase is quenched from the sintering condition and the oxygen content is measured . as the 2223 phase can be formed in a range of temperatures and oxygen partial pressures , the oxygen content also has its range of values . the value chosen will affect the sintering conditions . an advantage of the 2223 phase over other high temperature superconductors is that its superconducting transition temperature is not very sensitive to the oxygen content . for example , a yba 2 cu 3 o x sample quenched from the sintering temperature will have a low oxygen content and it is not superconducting . an oxygen annealing is necessary to obtain superconductivity in the quenched yba 2 cu 3 o x sample . however , a quenched 2223 phase from a normal sintering condition has nearly the same superconducting transition temperature as the value for a slowly cooled sample . a first powder which contains a 2212 phase with a pb content close to the value of the final ( bi , pb ) srcacuo - 2223 composition is prepared . depending on the composition and processing conditions , certain non - superconducting phases may also be present in the powder . the calcination temperature and oxygen partial pressure are chosen so that the desired 2212 composition is within the solubility limit of pb . a second powder is prepared which contains a 2212 phase with a pb content less than 10 % of the value of the final ( bi , pb ) srcacuo - 2223 composition . the remaining pb content is in the nonsuperconducting phases . the amount of pb in the 2212 phase and the amount of pbo phase can be used to adjust the oxygen content . both powders are quenched from the calcination temperature to maintain a low oxygen content . then , appropriate amount of the first powder is mixed with the second powder to give the volume fraction of 20 % to 30 % to the fully doped 2212 phase . additional nonsuperconducting oxide phases may be added to obtain the final cation composition and oxygen content . the powder is pulverized , into a particle size less than 5 μm , preferably less than 2 μm , with a ball mill , a micromill , an attriter , or the like , preferably in a glove - box filled with dry nitrogen or argon to avoid pick - up of moisture . to prepare a superconducting composite wire , the precursor powder is then filled into a metal sheath . the metal sheath thus filled with the precursor powder is subjected to deformation processing such as swaging , drawing , extrusion , and rolling . the deformation process reduces the size of the composite to form a single filament wire . for a multifilamentary wire , the composite wire of single filament is cut into many sections and bundled together into another metal sheath , and the deformation process is repeated . to develop texture in the precursor 2212 phase , a rolling deformation with a total deformation ratio of about 70 % is applied to produce a tape - like composite wire . to use metals other than a silver - based material in the outer sheath and silver in the inner sheath , a suitable material such as nickel alloy can be used . the sintering atmosphere will be the atmosphere suitable for the sheath material . the sheath must be effectively sealed so that no oxygen loss of the superconducting oxide will occur . a diffusion barrier can be used between the outer sheath material and inner sheath of silver to avoid possible harmful reactions . diffusion barriers have been widely used in the preparation of nb 3 sn superconducting wires and in semiconductor industry . for example , metals with very low solubility of the sheath materials can be used to reduce interdiffusion of sheath materials , and oxides with low diffusivity of oxygen can be used to reduce oxygen diffusion . such data are readily available in reference books on phase diagrams and diffusivity . to further reduce the amount of silver , a non - silver metal is used in the sheath in the preparation stage of the single filament wire . a buffer layer is used between the sheath material and the superconducting oxide . the design of the composite can also take into considerations of requirements for a . c . loss . then the composite wire is heat treated to form the ( bi , pb ) srcacuo - 2223 phase . the sintering atmosphere is chosen according to the outer sheath material and extra pressure may be applied in case of bubbling in the tape . the optimum sintering temperature is related to the cation composition and oxygen content chosen . to the best knowledge of the applicant , most phase diagram studies are conducted under constant pressure condition , normally in air or in 8 - 10 % oxygen at ambient pressure . this is no surprise since the prior art sintering is performed under a constant pressure condition . the sintering condition for the fixed oxygen content in the present case is best represented by a constant volume condition neglecting the small change caused by thermal expansion . the phase relation under this condition can be either calculated from the constant pressure data plus some thermodynamic parameters by commercial phase diagram software such as calphad , or determined experimentally . generally speaking , a sintering temperature around the value for the measurement of the oxygen content of the 2223 phase can be used . slight oxidation at the interface of the sheath material may occur but the sintering condition is very different from the constant pressure conditions used in the prior art where oxygen exchange can occur between the 2223 phase and the sintering atmosphere . if a second or third heat treatment should be applied , a deformation of about 10 % is applied to increase the density and texture before the heat treatment . the present invention will be further illustrated by the following examples . this example will show how to balance the oxygen content of the precursor powder . the oxygen content range of the final 2223 phase can be determined experimentally by chemical analysis . the major source of oxygen release is caused by the valence change of pb + 4 in ( sr , ca ) 2 pbo 4 to pb + 2 in the superconducting phases . therefore , partial or complete replacing of ( sr , ca ) 2 pbo 4 by pbo can be used to decrease the oxygen content of the precursor powder . bi 2 o 3 , pbo , srco 3 , caco 3 and cuo are mixed to get the cation ratio of bi , pb , sr , ca and cu of 1 . 75 : 0 . 35 : 1 . 90 : 2 . 05 : 3 . 05 . the mixture is thoroughly ground to a particle size of less than 5 μm . the mixture is pressed into pellets and calcined twice with intermediate grinding at 750 ° c . and 800 ° c . respectively for 8 - 12 hours in co 2 - free flowing air . then the material is ground again and calcined at 800 ° c . in 1 % oxygen ( balance nitrogen or argon ) for about 8 hours and then quenched to room temperature to obtain the first powder . bi 2 o 3 , pbo , srco 3 , caco 3 and cuo are mixed to get the cation ratio of bi , pb , sr , ca and cu of 1 . 75 : 0 . 04 : 1 . 90 : 2 . 05 : 3 . 05 . the mixture is calcined in the same way as above . the amount of pb in this powder can be adjusted to change the oxygen content of the final precursor powder . pbo is then added to make the second powder with a composition ratio of bi , pb , sr , ca and cu of 1 . 75 : 0 . 35 : 1 . 90 : 2 . 05 : 3 . 05 . then the first powder is mixed with the second powder in a weight ratio of about 3 : 7 . the mixture is pulverized to obtain a precursor powder with a particle size less than 5 μm and preferably less than 2 μm . this example will show the use of metals other than silver as part of the sheath material . now the sintering condition is changed from the normal constant oxygen partial pressure environment to a fixed oxygen content environment . therefore , it is necessary to start with the right oxygen content . the precursor powder prepared in example 1 will be used . the precursor powder is filled into a silver or silver alloy tube of 25 mm outer diameter and 22 mm in inner diameter , which in turn is swaged into 12 mm in diameter , drawn into 4 . 0 mm in diameter . the single filament wire is cut into 19 sections of equal length . the single filament sections are packed into a nickel or nickel alloy tube of 25 mm in outer diameter and 22 mm in inner diameter , and the tube is then pumped to vacuum and sealed by welding . the composite is swaged into 12 mm in diameter , drawn into 1 mm in diameter , and then rolled into 0 . 20 mm in thickness . the tape - like 19 - filamentary wire is heat treated in an inert atmosphere at about 825 ° c . twice for about 5 h and 50 h respectively with intermediate rolling of 10 % reduction , and then slowly cooled to room temperature . as the cost of nickel is significantly lower than that of silver , the overall material cost will be cut by about 30 - 40 %. other embodiments of the invention will be apparent to those skilled in the art from a consideration of this specification or practice of the invention disclosed herein . it is intended that the specification and examples shall be interpreted as illustrative and not in a limiting sense , with the true scope and spirit of the invention being indicated by the following claims | 8 |
a schema modeler for generating an efficient database schema will now be described . in the following exemplary description numerous specific details are set forth in order to provide a more thorough understanding of embodiments of the invention . it will be apparent , however , to an artisan of ordinary skill that the present invention may be practiced without incorporating all aspects of the specific details described herein . in other instances , specific features , quantities , or measurements well known to those of ordinary skill in the art have not been described in detail so as not to obscure the invention . readers should note that although examples of the invention are set forth herein , the claims , and the full scope of any equivalents , are what define the metes and bounds of the invention . the brief summary of the invention provides information concerning field types that are utilized in one or more embodiments of the invention . for further information , see the patents and patent applications incorporated by reference in that section . readers should note that one or more embodiments of the invention are used in various contexts and provide users with a way to conform a set of input data to a target schema . the target schema can vary but in at least one embodiment of the invention conforms to the requirements of sap &# 39 ; s master data management ( mdm ) software solution . in modeling an mdm schema there are specific requirements that are mdm specific . for example , an mdm schema must typically have a main table , can make use of qualifiers , have multi - lingual values and / or have other mdm specific constraints . fig1 is an architectural view of an embodiment of the invention . various components of this and other embodiments of the invention may be incorporated in a schema modeler computer program product for generating an efficient database schema comprising computer readable instruction code executing in a tangible memory medium of a computer and configured to perform functions described herein . external data source 110 may be utilized to import external schema and associated data . alternatively , embodiments of the invention may be utilized to create a schema manually , without importing any other schema or data . xml layer 120 is utilized to interface to external data source 110 via xml . although xml is shown in this figure it will be understood to one skilled in the art that any type of language or method of exchanging information without the use of xml is in keeping with the spirit of the invention . in one or more embodiments extensible mark language schema definition ( xsd ) is utilized to provide data type information for the exported schema . xml layer 120 may include xml metadata and data as shown in the leftmost and rightmost blocks in xml layer 120 . the components that make up embodiments of the invention are shown as data modeler workbench 100 . data modeler workbench is also referred to as schema modeler herein . the apparatus includes “ sample data generator ” for generating sample data for use in manual schema definition projects or when importing schemas where data extraction is difficult or not possible . “ metadata importer ” is utilized to read in xml based schemas such as xsd formatted schemas . “ metadata transformer ” takes the output of “ metadata importer ” and transforms the imported schema into a format used by the apparatus . conversely , “ manual schema definition ” is utilized when creating a new schema where no external data source schema exists . regardless of the method utilized to obtain a schema , “ structural semantics checker ” is utilized to ensure that all structural and semantic rules are enforced in any target schema . specifically , structural compatibility and semantic compatibility is checked with at least one rule wherein the check includes inspection of data integrity due to nested structure denormalization , inspection of lookup tables that can hold an unlimited number of records , inspection of taxonomy defined on a non - main table and inspection of the existence of one main table . any other structural or semantic test may be utilized in embodiments of the invention . “ data profiler ” is utilized to conduct data profiling to validate a schema against sample data derived from external data source 110 that includes checks for semantics , structural inconsistencies , table and field conflicts and data integrity correctness . “ schema visualizer ” is utilized to display list view and / or entity relationship diagrams or any other type of schema viewing component capable of depicting a schema either via text or graphics or via any other media . database layer 130 includes “ db ” ( the database ), and “ create schema ” block that may be implemented as computer code to create a schema compatible with a desired database “ db ”. database layer 130 also includes “ server ” and an “ export schema ” block that may also be implemented as computer code to export a desired database schema . in this manner , the schema generated using schema modeler 100 may be read back in and modified as desired . fig2 is a view of a menu embedded into a spreadsheet program for accessing a command for creating a schema template . “ create schema template ” command 201 may be utilized to create a new template for manual input of a desired schema . although the figure depicts the command as an add - on to an existing spreadsheet program , any method of exercising the functionality of the schema modeler 100 shown in fig1 is in keeping with the spirit of the invention . fig3 is a view of the spreadsheet program utilized in the manual creation of a “ customers ” table . in this figure , the “ field type ” for a given field is shown as a selectable pull - down list 301 that includes sql and extend types utilized by embodiments of the invention . for example , the field type “ lookup [ flat ] ( mv )” signifies a field type that is a lookup table type that is “ flat ” and that allows “ mv ” ( multi - values ) to be entered into a single field . any of the custom fields shown below as well as any standard sql field type may be suggested by an embodiment of the invention for a target schema . for example , if there are a series of fields that are sparsely populated and have similar text substrings , e . g ., “ qty 1 - 10 ”, “ qty 5 - 25 ”, etc ., then the apparatus may suggest that a qualified table be utilized to efficiently hold the sparse data . the following custom ( non - standard sql ) types may be utilized in one or more embodiments of the invention : fig4 is a view of an operation on the “ customers ” table , namely to extend the table across defined fields by dragging the mouse . embodiments of the invention may take advantage of any computer program into which the embodiment is embedded . for example in this figure , the embodiment is configured to accept drag operations that apply a “ table name ” to multiple rows of the display , in this case to multiple fields in a table . specifically , table name rows 301 are set to a table name of “ customers ”. fig5 is a view of an operation that generates standardized field codes for the defined fields in the table . field codes that are standardized for a given target database may be generated using command 501 . any other operation used for generating schemas may also be incorporated into the menus of embodiments of the invention . fig6 shows a view of xsd - based schema imported data 601 , imported from an external database . in this figure , column a shows the table name , column b shows the standardized field code , column c shows the field name , column d shows the cardinality of the relation and column e shows the xsd data type of the exported schema . the exported schema may be read in via “ metadata importer ” ( see fig1 ). fig7 shows a combined view of imported xsd - based schema 701 and target schema template 702 . the schema read in via “ metadata importer ” may be shown for example on the left side of a list display . the target schema may be shown on the right side which includes the desired or suggested field types , field parameters , flags that signify if the field is to be a qualifier , multi - lingual or calculation type field . any other method of showing the imported schema versus the target schema is in keeping with the spirit of the invention including but not limited to a dual entity relationship diagram or an entity relationship diagram that shows modifications in a different color for example . the fields are correlated and altered as per profiled or observed data to take advantage of sparse values for example . fig8 is a view of build schema operation menu 801 that is used to perform structure and semantic checks and generate a schema . structural and semantic checks are performed on or before the “ build ” button on the menu is selected . see the description of fig1 for a description of the checks performed . menu 801 further allows for the specification of the target server , repository , username , password and port in which to connect . furthermore , the specific database parameters utilized are specified as shown in the lower portion of the menu . one or more embodiments of the invention generate or build schemas that utilize a “ main table ”. the “ main table ” allows for certain special relations to be assigned to the table , for example a family based on a taxonomy in the table in the case of a product main table . fig9 is a view of an embodiment of an entity relationship diagram viewer component . any change to this diagram is automatically updated in the list view as shown in fig7 for example . the entity relationship diagram may utilize custom field types as listed in table 1 or table 2 above . in addition , the suggestion of a particular field type may be made by embodiments of the apparatus when the type of data or relationship of data in different fields is determined either programmatically or via querying the user . fig1 is a view of import schema command 1001 . any other method of importing or accepting an import instruction from a user is in keeping with the spirit of the invention . the result of this command is shown as the underlying data in fig6 and 9 . fig1 is a flowchart that illustrates the manual schema generation process . processing starts at 1101 . a field is displayed at 1102 , the field may be input manually as in this figure , or imported ( see fig1 ). the field type associated with the field is displayed at 1103 . the display may include a list view display and entity relationship diagram display or any other type of display . a field type selection is performed at 1104 . the field type may be standard sql or a custom type ( see tables 1 and 2 ). in the case of visual modes of operation , e . g ., non - batch modes , the field type selection is displayed at 1105 . any other displays that are displaying the information , e . g ., the combination of an entity relationship diagram or list view , then the other views are updated with the selection at 1106 . the field types and relationships are checked for structural and semantic compatibility with the rules that are defined for the given target schema at 1107 . ( see fig1 for a list of the types of structural and semantic checks performed ). in addition , step 1107 may utilize the “ sample data generator ” as shown in fig1 to perform checks for semantics , structural inconsistencies , table and field conflicts and data integrity correctness by building sample test data to fit the target schema . the apparatus may create validation code at 1108 if so desired by the user , based on relations and limit values for example that are input by the user to allow entry of only acceptable values as desired . processing ends at 1109 . fig1 is a flowchart that illustrates the import schema generation process . processing starts at 1101 . a field is displayed at 1102 , the field may be input manually as in this figure , or imported ( see fig1 ). the field type associated with the field is displayed at 1103 . the display may include a list view display and entity relationship diagram display or any other type of display . a field type selection is performed at 1104 . the field type may be standard sql or a custom type ( see tables 1 and 2 ). in the case of visual modes of operation , e . g ., non - batch modes , the field type selection is displayed at 1105 . any other displays that are displaying the information , e . g ., the combination of an entity relationship diagram or list view , then the other views are updated with the selection at 1106 . data profiling is performed at 1201 to check for semantic problems , structural inconsistencies , table and field conflicts and data integrity correctness . the apparatus presents suggested field types based on data that populate the database at 1202 . by optimizing the schema for the actual data that will be associated with the schema , the most efficient schema for the data is thus created . if data patterns change over time , then the schema may be altered and optimized based on observed data at any time . the field types and relationships are checked for structural and semantic compatibility with the rules that are defined for the given target schema at 1107 . ( see fig1 for a list of the types of structural and semantic checks performed ). the apparatus may create validation code at 1108 if so desired by the user , based on relations and limit values for example that are input by the user to allow entry of only acceptable values as desired . processing ends at 1109 . while the invention herein disclosed has been described by means of specific embodiments and applications thereof , numerous modifications and variations could be made thereto by those skilled in the art without departing from the scope of the invention set forth in the claims . | 6 |
in order to create a particularly high degree of flexibility in the course of the production of prills , working takes place with differing die plates , depending on various throughputs , which each comprise a different number and / or distribution of through bores . in this way an automatic adaptation to the load is achieved . at the same time it is possible that , through the choice of the suitable die plate , load ranges from 0 . 5 to 8 t of bisphenol melt per hour are possible without departing from an initial pressure of the die plate within a previously defined range from , preferably , 0 . 1 to 0 . 3 bar . in further development of the invention , slide rails that have a length of at least twice the die - plate length , preferably four times the die - plate length , are provided for the guidance of the die plates . with a view to improving the exchange operation , the slide rails consist , at least on their surface , of a copper bronze , preferably a cusn 8 alloy . this alloy is reliably resistant to bisphenol vapours . a further development of the invention provides that the slide rails and / or the die plates exhibit a polished surface on their contact region . here a depth of roughness of 0 . 8 μm has proved particularly expedient . by way of drive mechanism for displacing the die plate , according to a further teaching of the invention at least one displacement cylinder is provided . preferred is the use of a single - piston system in which the displacement cylinder is capable of being pressurised pneumatically . the constructional effort in the case of a single displacement cylinder engaging centrally is distinctly lower than that of two or more pistons operating in parallel , by reason of the problems of synchronisation . finally , with a view to sealing the die plate on the opening in the top of the prilling tower , a contact cylinder is provided which is preferably capable of being pressurised hydraulically . with such a contact cylinder the die plate that is active in the given case is pressed onto the opening in the top of the prilling tower with a pressure of preferably 200 bar . sealing of the die plate is effected on the product side via an o - ring seal , made of viton b for example , and on the gas side towards the prilling head by metallic means . the invention is elucidated in more detail below on the basis of preferred embodiments , with reference to drawing fig1 and 3 . the device according to the invention for exchanging a die plate 1 of a prilling tower is shown in fig1 the die plate 1 comprising a die 2 consisting of concentrically arranged bores ( only represented schematically ), which in the operating position of the die plate 1 is located centrally above the opening , which is not represented , of a prilling tower 3 which is only indicated schematically . now , in accordance with the invention , several die plates 1 are provided which are capable of being brought in linear manner along a guide into an operating position or an exchange position by means of a suitable drive mechanism . to this end , slide rails 4 are provided as a guide , which in the embodiment example represented have approximately 2½ times the length of a die plate 1 . as already stated , the slide rails 4 exhibit a surface made of copper bronze , preferably a cusn 8 alloy . with a view to further facilitating the linear displacement of the die plates 1 , the slide rails 4 and / or the die plates 1 are provided , at least in their contact region , with a polished surface which preferably amounts to a depth of roughness of 0 . 8 μm . by way of drive mechanism for displacing the die plates 1 , use is made of a pneumatically operable displacement cylinder 5 which is arranged in such a way that it is arranged parallel to the slide rails 4 and engages the die plates 1 centrally . with a view to tilt - free guidance of the die plates 1 , the slide rails 4 are preferably provided with a substantially u - shaped profile . now in fig2 a preferred die - exchanging device is represented in which the length of the slide rails 4 amounts to approximately four times the die - plate length . this is particularly preferred for automated operation , since in this way four different positions arise . a cleaned die plate i is firstly brought into position iv ( reserve position ) and from there is brought by means of the displacement cylinder 5 , from position a thereof , into position iii ( preheating position ) by the displacement cylinder moving into position b . now , after the displacement cylinder has again moved into position a , a new die plate 1 can be inserted which then , again with the aid of the displacement cylinder 5 , is brought from the reserve position iv into the preheating position iii . in the process the die plate which has been provided for operation and which in the meantime has been preheated moves from position iii into position ii ( operating position ). in the operating position the die plate is pressed in sealing manner , by a contact cylinder 6 which is only indicated , into the opening of the prilling tower 3 , which is likewise only indicated . with a view to renewed exchange of the die plate , the latter is brought , as previously described , from position ii into position i ( removal position ) after the pressure of the contact cylinder 6 has been removed . with a view to cleaning , the contaminated die plate 1 can be removed from position i and , after cleaning has taken place , can be transferred again into the reserve position iv . the entire exchange operation is elucidated in more detail below on the basis of an example which is represented in fig3 : in normal operation of the prilling tower 3 the valves 7 and 8 are switched in such a way that the bisphenol melt is conveyed to the prilling tower 3 in temperature - controlled and quantity - controlled manner by means of a melt pump 9 . in this connection the flushings with nitrogen to the die plate 1 , that is to say the valve 8 , and the recirculation to the melt container 10 , that is to say the valve 7 , are shut off . the die plate 1 , which is only represented schematically , is hydraulically sealed by a contact cylinder , which is not represented here , and by a pressure of 200 bar , on the product side via an o - ring seal made of viton b and on the gas side towards the prilling tower 3 by metallic means . the pneumatic displacement cylinder 5 ( cf . fig2 ) is in position a . three die plates are inserted in the device , one in position ii ( operating position ), one in position iii ( preheating position ) and one in position iv ( reserve position ). the “ ejection space ” for the die plate to be exchanged ( that is to say , position i ) is free . by way of preparation for the exchange of dies , the valve 7 is switched in such a way that the bisphenol melt is rerouted from the prilling tower 3 to the melt container 10 . the valve 8 is switched , it closes the path of the melt and simultaneously opens the supply of nitrogen to the prilling tower 3 in order to initiate the n 2 flushing . in order that the pipeline between valves 7 and 8 can drain clean , an adjustable timing element is provided for the purpose of switching the valve 8 . by switching the valve 8 over , the n 2 flushing operation is concluded and the n 2 circuit ventilator is switched off . the pressure in the prilling tower 3 is reduced to a p { umlaut over ( 0 )} of less than 4 mbar by relaxation downstream of the circuit filter . the actual die - exchange operation is initiated by relieving the load on the hydraulic contact cylinder 6 . as soon as the hydraulic pressure has been reduced , the pneumatic displacement cylinder 5 moves from position a into position b and in the process displaces all three die plates 1 . in this process the die plate that was previously in operation moves to the free ejection space ( from ii to i ), the preheated die plate 1 moves into the operating position ( from iii to ii ) and the reserve plate moves into the preheating zone ( from iv to iii ). as soon as the displacement cylinder 5 has reached position b , the hydraulic contact cylinder 6 is again placed under pressure , so that imperviousness in the region of the die plate 1 is guaranteed . subsequently the displacement cylinder moves again into its initial position a . with a view to resuming the operation of the prilling tower , the operating pressure is set to about 50 mbar as a result of a feed of nitrogen n 2 . subsequently the nitrogen circuit ventilator is switched in and the hydraulic contact cylinder 6 is pressurised . in the process the pressure of the contact cylinder 6 unlocks the valve 7 which has to be switched over for the purpose of resuming the operation of the prilling tower 3 . after the operating speed of the ventilator has been attained , the supply of melt to the prilling tower 3 is enabled by switching the valve 7 . prilling of the bisphenol melt now takes place automatically , corresponding to the predetermined quantity and the selected die plate 1 , in a range from 500 to 8 , 000 kg / h . with a view to cleaning the die plates 1 , the latter are cleaned after operation in an ultrasound bath in dilute caustic - soda solution ( 6 . 5 % naoh ) at ambient temperatures for about 30 min . after this , the die plates 1 are vigorously rinsed with fully de - ionized water and are dried prior to re - use . | 2 |
an embodiment of the invention is described in detail with reference to the drawings . referring to fig1 this embodiment comprises a system composed of a host a 100 and a disk system a 101 , and a server system or computer system composed of a host b 200 and a disk system b 201 being installed at a spot being geographically or physically remote from that system . the disk system a 101 is composed of a controller a 110 and a disk a 111 . the controller a 110 has a data controller a 120 , a host controller a 121 , a disk controller 122 , a cache a 123 and a remote controller a 124 connected to one another through one bus , and is provided with a write activity detector 125 connected to the host controller a 121 . hereupon , the data controller a 120 program - controls the cache a 123 , the host controller a 121 , the disk controller a 122 and the remote controller a 124 according to a specified control program so as to control the data flow between them at proper timing . and the host controller a 121 is in charge of response of a command and data between the host controller a 121 and the host a 100 . the host a 100 and the host controller a 121 are ordinarily connected to each other through a data bus and an address bus , and they may use a parallel bus such as a pci ( peripheral component interconnect ) bus , an isa ( industrial standard architecture ) bus or the like , or a serial bus such as rs - 232c , rs - 422a , usb ( univeral serial bus ), an ieee1394 bus or the like . the disk controller a 122 performs a process to write data into the disk a 111 when the data to be written into the disk a 11 exist in the cache a 123 . the cache 123 stores cache information in it , and each time it has received a data read instruction from the host a 100 through the host controller a 121 , it is utilized to judge whether or not there are data to be read out in the cache by comparing data required by the host a 100 and identification information of the data stored in the cache with each other data . and the cache 123 is also utilized to temporarily store data to be written in case that the controller a 110 has performed a data write instruction from the host a 100 through the host controller a 121 . the remote controller a 124 transfers data to the remote controller b 224 when the data to be transferred to the remote controller b 224 exist in the cache a 123 and , after the data transfer has ended , receives a data reception response signal from the remote controller b 224 of the remote site . the write activity detector 125 monitors the activity of a command received by the host controller a 121 , and when it recognizes that the activity has become larger than the range of an activity estimated in an operation mode at that point of time , it issues a signal to change over the mode to a mode making it possible to perform a data processing at a higher speed through the host controller a 121 . the composition and operation of each component inside the disk system b 201 are equal to those inside the disk system a 101 from which the write activity detector 125 is removed . ( operation of this embodiment ) next , operation of this embodiment is described in detail with reference to fig1 to 4 . first , basic three copy modes of a method for copying data to be stored into the disk system a 101 into the disk system b 201 in this embodiment are described with reference to fig2 to 4 . fig2 is a conceptual diagram for explaining a copy method called a synchronous mode . in fig2 the flow of data is shown in steps a 1 to a 4 . in this case , the disk system b 201 in fig1 is called a remote site , and it is attempted to store the same data as data to be stored into the disk a 111 into the disk system b 201 of the remote site . a copy in this case may be stored either into the cache b 223 or into the disk b 211 , and in this embodiment either will do . first , the host a 100 issues a command for a data write operation to the controller a 110 ( step a 1 ). the controller a 110 takes in and stores the data write command and its data together into the disk a 111 , and sends them to the controller b 210 of the remote site for copying them ( step a 2 ). the controller b 210 receives all the data and then returns a reception response to the controller a 110 ( step a 3 ). the controller a 110 receives this reception response and then sends a write command completion notice to the host a 100 ( step a 4 ). in this synchronous mode since a command completion notice is sent to the host after a data reception response from the remote site , the longest processing time is required from the viewpoint of the host a 101 . however , since data are sent to the remote site and a reception response is received and then a completion response is sent to the host a 100 , this mode is the best in reliability of data . fig3 is a conceptual diagram for explaining a copy method called a semi - synchronous mode . in fig3 the flow of data is shown in steps b 1 to b 4 . in this case , the disk system b 201 is called a remote site . first , the host a 100 issues a command for a data write operation to the controller a 110 ( step b 1 ). immediately after the controller a 110 receives all the data contained in the command , it sends a write command completion notice to the host a 100 ( step b 2 ). after this , the controller a 110 stores the data into the disk a 111 and sends the data to the controller b 210 of the remote site for copying the data ( step b 3 ). the controller b 210 receives all the data and then returns a reception response to the controller a 110 ( step b 4 ). in this semi - synchronous mode , since a command completion response is sent to the host a 100 before a data reception response comes from the remote site , the processing speed for the host a 100 is made faster by a processing time for processing data transfer and reception response between the sites than the synchronous mode . however , a new next command from the host a 100 cannot be received until the step b 4 ends . that is to say , since the host a 100 can start another operation by receiving a write command completion notice ( step b 2 ), this mode is made faster thanks to this , but the next command cannot be sent to the controller a 110 until step b 4 ends . and from the viewpoint of the reliability of data , there is the possibility of losing data of one i / o operation between steps b 2 and b 4 . fig4 shows a copy method called an adaptive copy mode . in fig4 the flow of data is shown in steps c 1 to c 5 . in this case , the disk system b 201 is called a remote site . first , the host a 100 issues a command for a data write operation to the controller a 110 ( step c 1 ). after the controller a 110 has received all the data contained in the command , it sends a write command completion notice to the host a 100 ( step c 2 ). the controller a 110 registers this data at the queue of the cache in the controller a 110 ( step c 3 ). if the next command is issued , so long as there is a free space in the queue , steps c 1 to c 3 are repeated . in case that there is no free space in the queue , even if a command is issued the controller a 110 does not receive this command . after this , at proper timing the controller stores the data registered at the queue into the disk a 111 and sends the data to the controller b 210 of the remote site ( step c 4 ). the controller 210 receives and stores the data into - the cache b 223 or the disk b 211 , and then returns a reception response to the controller a 110 ( step c 5 ). in this adaptive copy mode , since a command completion response is sent to the host a regardless of data transfer with the remote site so long as there is a free space in the queue , commands issued one after another by the host a 100 are received and therefore the response is made faster than the semi - synchronous mode . from the viewpoint of the reliability of data , however , there is the possibility of losing data of i / o operations registered at the queue . next , the data mirroring method and operation of the present invention are described with reference to fig1 . a command issued from the host a 100 is received by the host controller a 121 and its data are first stored into the cache a 123 . a write operation to the disk system a itself is performed by the disk controller a 122 from the cache a 123 to the disk a 111 . separately from and in parallel with this operation , for the purpose of copy , data are sent by the remote controller a 124 from the cache a 123 to the remote controller b 224 of the disk system b 201 . the remote controller b 224 stores the received data into the cache b 223 and then immediately or after it has finished a write operation to the disk b 211 through the disk controller b 222 , the remote controller b 224 returns a reception completion response to the remote controller a 124 . by doing this , a copy of the data stored in the disk system a 101 is made also in the disk system b 201 . handling of a reception notice to be returned to the remote controller a 124 or data stored in the cache a 123 is controlled by the data controller a 120 so as to perform a process according to a specified copy mode . a write command from the host a 100 is received by the host controller a 121 and similarly a completion response to it is sent from the host controller a 121 to the host a 100 . a state of reception response to the write command is monitored by the write activity detector 125 . the write activity detector 125 checks always the number of commands or the quantity of information received and responded per unit time and the queuing state of commands wating for being processed , namely , the number of commands or the information quantity of data waiting for being processed . and the write activity detector 125 compares with each other the sum of weighted values , for example , the sum of values obtained by multiplying the number of commands fitting in an access range or the information quantity of data to be processed by the commands by a correlation coefficient determined by the access range for each command on which a reception response or a queuing process has been performed and the range of the applicable sum in case of using a copy mode at that point of time which has been determined in advance . when the sum is within the range of the said applicable sum in case of using a data copy mode at that point of time , the write activity detector 125 keeps the data copy mode as it is , but when the sum becomes larger than the upper limit of the said applicable sum , the write activity detector 125 recognizes that the performance may be influenced and issues an instruction to change over the mode to a mode making it possible to display a better performance through the host controller a 121 to the data controller a 120 . the reason for such weighting is that an access range where there are data required by a command includes an access range where accesses are concentrated and the lowering of performance is liable to occur and an access range where accesses are not concentrated so much and the lowering of performance is not liable to occur , and an influence upon the performance is more exactly reflected by setting a higher correlation coefficient at the access range where accesses are concentrated . on the contrary , if the influence comes not to exist , the mode is changed over to a mode in which the reliability is considered to be more important . by doing so , it is possible to keep the write performance of the system at a high level regardless of a state of command access from the host a 100 . the above - mentioned embodiment has been described on the assumption that the host b side is a remote site in relation to the host a , but it is a matter of course that the host a side can be handled as a remote site in relation to the host b side . in this case an activity detector is provided on the host controller b 221 and the number of commands or the quantity of data from the host b 200 is detected at the host controller b 221 . an effect of the present invention is that since it is possible to monitor the command activity of commands from a host and change over a copy mode to another copy mode making it possible to perform a more high - speed process according to the increase of a load without manually performing a copy mode change , it is possible to keep the write performance of a system at a high level at a necessary timing and regardless of a state of command access from the host . while this invention has been described with reference to illustrative embodiments , this description is not intended to be construed in a limiting sense . various modifications of the illustrative embodiments , as well as other embodiments of the invention , will be apparent to persons skilled in the art upon reference to this description . it is , therefore , contemplated that the appended claims will cover any such modifications or embodiments as fall within the true scope of the invention . | 6 |
it has been determined that the smarting and tearing effect associated with peeling onions is caused by propanethial - s - oxide (‘ pso ”) and related compounds naturally occurring in onions . ( see “ propanethial - s - oxide ”, chemical abstracts registry # 3215729 - 2 ). the compounds are quite volatile , vaporizing at room temperature . these compounds , the most significant of which is propanethial - s - oxide , and other compounds having similar chemical and physical properties , viz ., lachrymatory activity and volatility , can be diluted and utilized to stimulate tearing to combat pathogenic and benign dry eye conditions . the method of moisturizing the eye contemplated by the invention consists of the fundamental step of introducing into the eye , in vapor , gaseous or otherwise microscopic form , a lachrymatory compound ( s ) naturally occurring in onions . for the purposes of this specification the term microscopic is defined to encompass misting , vaporous or gaseous methods of introducing lachrymatory agents into the eye . the lachrymatory compounds may be appropriately diluted to a concentration that is suitable to the individual using it . the concentration must be determined empirically as the strength of the compounds in onions varies widely with the variety of onion used , growing conditions , etc . the desideratum is a concentration which produces sufficient tearing without undue burning or smarting of the eye . the preferred composition comprises an amount of pso and related compounds to produce tears after a short exposure time . the purity of the compounds will have a direct effect on the production of tears . it is preferred to use pure pso and related compounds , although the pso and related compounds maybe diluted to promote the volatility of the pso . common pharmaceuticals adjuvants may also be added to the compositions to produce the desired composition . said common pharmaceutical adjuvants can be found in remingtons pharmaceutical sciences , fifth edition , by mack publishing company , which publication is herein specifically incorporated by reference . the desired composition may be any that is known to those skilled in the art and can be based on , for example , an aerosol composition employing a propellant , or a volatile composition using volatility enhancers , such as , for instance , ethyl alcohol . a device for introducing the lachrymatory agent will now be described with reference to the drawings and , first , to fig1 to 4 showing a container 10 having an opening 12 at its upper end . a cap assembly 14 includes a mounting band 16 tightly encircling opening 12 and a captive closure member 18 secured to the band by a hinge 20 consisting of a strip of flexible plastic or other material . closure member 18 is of the type often referred to as a “ snap - cap ” and is closed by means of downward finger pressure applied on its top surface , preferably at a point diametrically opposite hinge 20 . in this condition , the cap closes opening 12 . a radially projecting tab 22 on cap 18 facilitates opening the container which is accomplished by upward pressure on the tab . thus opening can be accomplished with a single finger , usually the thumb , by pushing tab 22 upwardly ; when in the open position , shown in fig4 the cap is held captive by hinge 20 . container 10 has a generally ovate cross - section as appears in fig3 lending itself to a comfortable fit in the user &# 39 ; s palm and permitting easy removal and replacement of the cap . container 10 is filled to the desired level with the lachrymatory agent ; preferably the agent is absorbed in a matrix of suitable absorbent material such as cotton shown at 24 in fig1 . whether or not a matrix is used , it is preferred that a wick 26 be disposed in the container extending from a point at or near its bottom 28 and extending to opening 12 , terminating flush with the face of the opening . to moisturize the eye , the user simply positions the opening of the container close to his eye , opening the cap before or after doing so . ( there is no need to tilt the head back .) the vapor from the container enters the eye and almost immediately stimulates tear production by the lachrymatory glands . after a few moments , i . e ., when the desired effect is obtained , the process is repeated with the other eye . then the cap is replaced and the container restored to purse or pocket . an alternative form of the moisturizer is shown in fig5 wherein the cap assembly 14 ′ is modified as compared to fig1 - 4 by the substitution of a spring hinge 20 ′ for hinge 20 . spring hinge 20 ′ resiliently biases cap 18 toward its open position and a latch is provided diametrically opposite the hinge . when engaged , the latch maintains the cap in closed position against the bias effect of the spring . a latch release button 32 , when pressed , causes the cap to snap open ; it is closed by applying downward pressure on the top surface of the cap in the same manner as the previously described embodiment . the use of the fig5 moisturizer is entirely analogous to and will be readily apparent from the above - described use of the device in fig1 - 4 . fig6 and 7 show further embodiments of the invention each including a preferably soft plastic cup - shaped member 34 and 34 ′, respectively , mounted on a container 10 . members 34 , 34 ′ are configured and dimensioned to fit over the eye and are , in use , selectively placed in flow communication with the interior of the container so as to guide and confine vapor issuing there from to the ocular region . the fig6 embodiment is a non - aerosol , pump - type dispenser which ejects a measured quantity of the contents of the container 10 each time the member 34 is depressed as by finger pressure on the flat 35 provided thereon for the purpose . fig7 illustrates an aerosol - type unit in which the contents of container 10 are under pressure and a metered quantity ejected into member 341 when a valve actuation button 36 is pressed . it will be understood that the construction and operation of the pump and aerosol dispensing devices per se are well known . however the substance issuing from the device is not an aerosol or spray but a vapor . the use of the devices shown in fig6 and 7 is completely analogous to that of the fig1 - 4 embodiment of the invention already described except , of course , that the cup - shaped member 34 , 34 ′ is placed over the eye before dispensing the lachymatory vapor . the use of a kit comprising means for dispensing lachrymatory agent and the lachrymatory agent itself is also within the scope of this invention . a preferred kit would use an apparatus for dispensing said lachrymatory agent as described above containing a lasting supply of lachrymatory agent . such kit would be packaged in a shrink wrapped package or a hard plastic protection pack . the packaging material used in the kit can be any material known to those skilled in the art . such materials can include cardboard , plastic and any combination of the two , for example . from the foregoing description of exemplary embodiments , it will be seen that the objects of the invention are achieved , enabling moisturization of the eyes discretely and effectively , using a single hand , without tilting the head or possibility of misapplication of liquid drops . the scope of this invention is intended to include all such modifications that would be obvious to one of ordinary skill in the art . | 8 |
the surface treatment agents for medical devices of the present invention contain a copolymer of a hydrophilic functional group - containing monomer and an epoxy group - containing monomer . by chemically fixing such a copolymer to the surface of a medical device such as a catheter , it is possible to give it not only lubricity but also resistance to lubricity reduction ( i . e ., lubricant durability ). in the present invention , the constituent hydrophilic functional group - containing monomer of the copolymer is not particularly limited , and any monomers with various hydrophilic groups can be used . the hydrophilic functional group - containing monomer may suitably be a deliquescent monomer , i . e ., a monomer having properties of spontaneously absorbing moisture ( water vapor ) from the air and forming an aqueous solution . the hydrophilic functional group of the hydrophilic functional group - containing monomer is preferably a polyoxyalkylene group , a metal salt - containing hydrophilic group , a halogen salt - containing hydrophilic group , a zwitterionic group or the like in view of lubricity and its durability . suitable examples of the polyoxyalkylene group - containing monomer include compounds represented by the following formula ( i ): wherein ao groups are the same as or different from one another and each represent an oxyalkylene unit ; r 11 represents a hydrogen atom or a methyl group ; p represents an integer of 1 to 50 ; and r 12 represents a hydrogen atom or a c1 to c20 alkyl group . the number of carbon atoms in each oxyalkylene unit ( ao ) is preferably 2 to 4 ( e . g ., oxyethylene unit , oxypropylene unit , oxytetramethylene unit ). when different oxyalkylene units are present , they may be attached in blocks , randomly , or in an alternating fashion . examples of c1 to c20 alkyl groups for r 12 include linear or branched groups such as methyl , ethyl , and propyl groups . specific examples of the polyoxyalkylene group - containing monomer include methoxypolyethylene glycol mono ( meth ) acrylate , polyethylene glycol mono ( meth ) acrylate , methoxypolypropylene glycol mono ( meth ) acrylate , polypropylene glycol mono ( meth ) acrylate , ethylene glycol - propylene glycol ( meth ) acrylate , and poly ( ethylene glycol - propylene glycol ) mono ( meth ) acrylate . suitable examples of the metal salt - containing hydrophilic group - containing monomer include monomers containing an alkali metal salt - containing hydrophilic group or an alkaline earth metal salt - containing hydrophilic group ( alkali metal salt - containing monomers and alkaline earth metal salt - containing monomers ). examples of alkali metal salt - containing monomers include alkali metal salts of acrylic acid such as sodium acrylate and potassium acrylate ; alkali metal salts of methacrylic acid such as sodium methacrylate and potassium methacrylate ; alkali metal salts of itaconic acid such as sodium itaconate and potassium itaconate ; alkali metal salts of 3 - vinylpropionic acid such as sodium 3 - vinylpropionate and potassium 3 - vinylpropionate ; alkali metal salts of vinylsulfonic acid such as sodium vinylsulfonate and potassium vinylsulfonate ; alkali metal salts of 2 - sulfoethyl ( meth ) acrylate such as sodium 2 - sulfoethyl ( meth ) acrylate and potassium 2 - sulfoethyl ( meth ) acrylate ; alkali metal salts of 3 - sulfopropyl ( meth ) acrylate such as sodium 3 - sulfopropyl ( meth ) acrylate and potassium 3 - sulfopropyl ( meth ) acrylate ; alkali metal salts of 2 - acrylamide - 2 - methylpropanesulfonic acid such as sodium 2 - acrylamide - 2 - methylpropanesulfonate and potassium 2 - acrylamide - 2 - methylpropanesulfonate ; and alkali metal salts of styrenesulfonic acid such as sodium styrenesulfonate and potassium styrenesulfonate . examples of alkaline earth metal salt - containing monomers include alkaline earth metal salt - containing monomers that correspond to the aforementioned alkali metal salt - containing monomers . in particular , alkali metal salts of ( meth ) acrylic acid are preferred , and potassium 3 - sulfopropyl methacrylate is particularly preferred . suitable examples of the halogen salt - containing hydrophilic group - containing monomer include monomers containing a chlorine salt - or bromine salt - containing hydrophilic group ( chlorine salt - containing monomers and bromine salt - containing monomers ). in particular , preferred are compounds represented by the following formula ( ii ) and the like : wherein a represents an oxygen atom or nh ; b represents a c1 to c4 alkylene group ; r 21 represents a hydrogen atom or a methyl group ; r 22 , r 23 and r 24 are the same as or different from one another and each represent a c1 to c4 alkyl group ; and x − represents a halogen ion . a is preferably an oxygen atom . examples of b include linear or branched alkylene groups such as methylene , ethylene , and propylene groups . methylene and ethylene groups are preferred among these . examples of r 22 to r 24 include linear or branched alkyl groups such as methyl , ethyl , and propyl groups . methyl and ethyl groups are preferred among these . examples of x ( halogen atom ) include fluorine , chlorine , and bromine . chlorine is preferred among these . examples of halogen salt - containing hydrophilic group - containing monomers represented by the formula ( ii ) include 2 -( methacryloyloxy ) ethyl trimethylammonium chloride ( 2 -( methacryloyloxy ) ethyl trimethylaminium chloride ), 2 -( acryloyloxy ) ethyl trimethylammonium chloride ( 2 -( acryloyloxy ) ethyl trimethylaminium chloride ), 2 -( methacryloyloxy ) ethyl dimethylethylammonium chloride ( 2 -( methacryloyloxy ) ethyl dimethylethylaminium chloride ), and 2 -( acryloyloxy ) ethyl dimethylethylammonium chloride ( 2 -( acryloyloxy ) ethyl dimethylethylaminium chloride ). examples of the zwitterionic group - containing monomer ( zwitterionic group - containing compound : compound bearing a center of permanent positive charge and a center of negative charge ) include various zwitterionic monomers such as carboxybetaines , sulfobetaines , and phosphobetaines . other examples include compounds represented by formula ( iii ) below , and in particular compounds represented by formula ( iv ) below are suitable . in the formula , r 31 represents — h or — ch 3 ; x represents — o —, nh — or n + —; m represents an integer of 1 or greater ; and y represents a zwitterionic group or a halogen group ( e . g . cl − , br − , f − ). in the formula ( iii ), r 31 is preferably — ch 3 , x is preferably — o —, and m is preferably an integer of 1 to 10 . in the zwitterionic group designated by y , the cation may be a quaternary ammonium cation such as tetraalkylammonium , and the anion may be a carboxylate , sulfonate , phosphate or the like anion . in the formula , r 31 represents — h or — ch 3 ; p and q each represent an integer of 1 or greater ; and y 1 and y 2 are ionic functional groups with opposite charges . in the formula ( iv ), p is preferably an integer of 2 or greater , and more preferably an integer of 2 to 10 ; and q is preferably an integer of 1 to 10 , and more preferably an integer of 2 to 4 . moreover , preferred r 31 is the same as described above . y 1 and y 2 are as described for the cation and anion above . typical suitable examples of the zwitterionic monomer include compounds represented by the following formulae ( iv - 1 ) to ( iv - 4 ): wherein r 31 represents a hydrogen atom or a methyl group ; and p and q each represent an integer of 1 to 10 , wherein r 31 represents a hydrogen atom or a methyl group ; and p and q each represent an integer of 1 to 10 , wherein r 31 represents a hydrogen atom or a methyl group ; r 32 represents a c1 to c6 hydrocarbon group ; and p and q each represent an integer of 1 to 10 , wherein r 31 represents a hydrogen atom or a methyl group ; r 33 , r 34 and r 35 are the same as or different from one another and each represent a c1 or c2 hydrocarbon group ; and p and q each represent an integer of 1 to 10 . examples of compounds represented by the formula ( iv - 1 ) include dimethyl ( 3 - sulfopropyl )( 2 -( meth ) acryloyloxyethyl )- ammonium betaine . examples of compounds represented by the formula ( iv - 2 ) include dimethyl ( 2 - carboxyethyl )-( 2 -( meth ) acryloyloxyethyl ) ammonium betaine . examples of compounds represented by the formula ( iv - 3 ) include dimethyl ( 3 - methoxyphosphopropyl )( 2 -( meth ) acryloyloxyethyl )- ammonium betaine . examples of compounds represented by the formula ( iv - 4 ) include 2 -( meth ) acryloyloxyethyl phosphorylcholine . other zwitterionic monomers include 2 -( meth ) acryloyloxyethyl carboxybetaine and 2 -( meth ) acryloyloxyethyl sulfobetaine . the hydrophilic functional group - containing monomer may also be a quaternary ammonium salt monomer represented by the following formula : wherein a represents an oxygen atom or nh ; b and d are the same as or different from each other and each represent a c1 to c4 alkylene group ; r 41 represents a hydrogen atom or a methyl group ; and r 42 and r 43 are the same as or different from each other and each represent a c1 to c4 alkyl group . a is preferably an oxygen atom . examples of b and d include linear or branched alkylene groups such as methylene , ethylene , and propylene groups . methylene and ethylene groups are preferred among these . examples of r 42 and r 43 include those described above for r 22 to r 24 . examples of the quaternary ammonium salt monomer include [ 2 -( methacryloyloxy ) ethyl ] dimethyl -( 3 - sulfopropyl ) ammonium hydroxide . the hydrophilic functional group - containing monomers may be used alone or in combinations of two or more . the constituent epoxy group - containing monomer of the copolymer in the present invention may be , for example , an epoxy group - containing polymerizable vinyl monomer containing an epoxy group and a polymerizable carbon - carbon double bond in the molecule . examples of the epoxy group - containing polymerizable vinyl monomer include epoxy group - containing ( meth ) acrylic acid ester monomers and epoxy group - containing ether monomers . examples of epoxy group - containing ( meth ) acrylic acid ester monomers include epoxy group - containing ( meth ) acrylic acid esters , specifically glycidyl ( meth ) acrylate , hydroxybutyl acrylate glycidyl ether and 2 - methyloxiranylmethyl ( meth ) acrylate . examples of epoxy group - containing ether monomers include epoxy group - containing linear , branched or cyclic aliphatic ether monomers such as vinyl glycidyl ether , allyl glycidyl ether , isopropenyl glycidyl ether , and 4 - vinylcyclohexyl glycidyl ether ; and epoxy group - containing aromatic ether monomers such as 3 - vinylbenzyl glycidyl ether and 4 - vinylbenzyl glycidyl ether . in view of lubricity and its durability , epoxy group - containing ( meth ) acrylic acid ester monomers are preferred among these , and glycidyl ( meth ) acrylate is particularly preferred . the epoxy group - containing monomers may be used alone or in combinations of two or more . the copolymer of a hydrophilic functional group - containing monomer and an epoxy group - containing monomer can be produced by known radical polymerization processes . the copolymerization may be carried out by any process , such as , for example , known photo - or thermally - induced radical polymerization processes . specifically , a photopolymerization initiator , a hydrophilic functional group - containing monomer and an epoxy group - containing monomer may be charged in liquid form or in the form of a solution into a transparent vessel made of glass , pet , polycarbonate or the like , followed by irradiation with uv light to allow radical polymerization ( photo - radical polymerization ) to proceed , whereby the copolymer can be prepared . the radical - polymerizable monomers ( in liquid form ) or solution thereof may contain a known polymerization inhibitor such as 4 - methylphenol . examples of polymerization initiators include carbonyl compounds , organic sulfur compounds such as tetraethylthiuram disulfide , persulfides , peroxides , redox compounds , azo compounds , diazo compounds , halogen compounds , and photoreducing dyes . among these , carbonyl compounds , peroxides , and azo compounds are preferred . preferred among carbonyl compounds serving as initiators for photo - induced radical polymerization are benzophenone and derivatives thereof ( benzophenone compounds ). for example , suitable are benzophenone compounds represented by the following formula : wherein r 1 to r 5 and r 1 ′ to r 5 ′ are the same as or different from one another and each represent a hydrogen atom , an alkyl group , a halogen ( fluorine , chlorine , bromine , iodine ), a hydroxyl group , a primary , secondary , or tertiary amino group , a mercapto group , or a hydrocarbon group that may contain an oxygen , nitrogen , or sulfur atom , and any two adjacent groups of r 1 to r 5 and r 1 ′ to r 5 ′ may be joined to each other to form a ring together with the carbon atoms to which they are attached . specific examples of the benzophenone compound include benzophenone , xanthone , 9 - fluorenone , 2 , 4 - dichlorobenzophenone , methyl o - benzoylbenzoate , 4 , 4 ′- bis ( dimethylamino ) benzophenone , and 4 , 4 ′- bis ( diethylamino ) benzophenone . particularly preferred among these are benzophenone , xanthone , and 9 - fluorenone because these compounds allow polymer brushes to be formed well . the initiator for photo - induced radical polymerization may also suitably be a thioxanthone compound because it provides a high polymerization rate and can easily be adsorbed on and / or reacted with rubber or the like . for example , suitable are compounds represented by the following formula : wherein r 6 to r 9 and r 6 ′ to r 9 ′ are the same as or different from one another and each represent a hydrogen atom , a halogen atom , or an alkyl , cyclic alkyl , aryl , alkenyl , alkoxy , or aryloxy group . examples of thioxanthone compounds represented by the above formula include thioxanthone , 2 - isopropylthioxanthone , 4 - isopropylthioxanthone , 2 , 3 - diethylthioxanthone , 2 , 4 - diethylthioxanthone , 2 , 4 - dichlorothioxanthone , 2 - methoxythioxanthone , 1 - chloro - 4 - propoxythioxanthone , 2 - cyclohexylthioxanthone , 4 - cyclohexylthioxanthone , 2 - vinylthioxanthone , 2 , 4 - divinylthioxanthone , 2 , 4 - diphenylthioxanthone , 2 - butenyl - 4 - phenylthioxanthone , and 2 - p - octyloxyphenyl - 4 - ethylthioxanthone . preferred among these are those which are substituted at one or two , especially two , of r 6 to r 9 and r 6 ′ to r 9 ′ with alkyl groups . more preferred is 2 , 4 - diethylthioxanthone . light irradiation allows radical polymerization of the monomers to proceed . here , ultraviolet light sources with an emission wavelength mainly in the ultraviolet region , such as high - pressure mercury lamps , metal halide lamps , and led lamps , can be suitably used . the light dose may be appropriately chosen in view of polymerization time and uniform progress of the reaction . moreover , in order to prevent inhibition of polymerization due to active gas such as oxygen in the reaction vessel and the reaction tube , oxygen is preferably removed from the reaction vessel , the reaction tube and the reaction solution during or before the light irradiation . to this end , appropriate operations may be performed . for example , an inert gas such as nitrogen gas or argon gas is inserted into the reaction vessel , the reaction tube and the reaction solution to discharge active gas such as oxygen from the reaction system and replace the atmosphere in the reaction system with the inert gas . moreover , in order to prevent inhibition of the reaction due to oxygen or the like , for example , a measure may appropriately be taken in which an ultraviolet light source is placed such that no air layer ( oxygen content : 15 % or higher ) exists between the reaction vessel made of glass , plastics or the like and the reaction solution or the modification target . the ultraviolet wavelength suitably ranges from 300 to 400 nm . such a wavelength allows a polymer to be formed well . examples of light sources that can be used include high - pressure mercury lamps , leds with a center wavelength of 365 nm , and leds with a center wavelength of 375 nm . more preferred is irradiation with led light having a wavelength of 355 to 380 nm . in particular , leds or the like having a center wavelength of 365 nm , which is close to the excitation wavelength ( 366 nm ) of benzophenone , are preferred in view of efficiency . light with a wavelength of 300 nm or longer is preferred , with light having a wavelength of 355 nm or longer being more preferred . light having a wavelength of longer than 400 nm , however , is less likely to activate the photopolymerization initiator , with the result that the polymerization reaction is not allowed to easily proceed . thus , light having a wavelength of 400 nm or shorter is preferred . although led light is suitable in that it is in a narrow wavelength range and does not include light with other wavelengths than the center wavelength , a mercury lamp or the like can also achieve similar effects to led light by using a filter to block light having a wavelength of shorter than 300 nm . preferred among initiators for thermally - induced radical polymerization are peroxides and azo compounds . “ peroxide ” refers to those containing a — o — o — group , and examples include peroxyesters , peroxyketals , dialkyl peroxides , diacyl peroxides , and peroxycarbonates . in particular , organic peroxides such as benzoyl peroxide ( bpo ) and lauroyl peroxide ( lpo ) are preferred . “ azo compound ” refers to those containing a — n ═ n — group , and examples include 2 , 2 ′- azobis ( 4 - methoxy - 2 , 4 - dimethylvaleronitrile ), 2 , 2 ′- azobis ( 2 , 4 - dimethylvaleronitrile ), 2 , 2 ′- azobis ( isobutyronitrile ) ( aibn ), 2 , 2 ′- azobis ( 2 - methylbutyronitrile ), 1 , 1 ′- azobis ( cyclohexane - l - carbonitrile ), 1 -[( 1 - cyano - 1 - methylethyl ) azo ] formamide , 2 , 2 ′- azobis [ 2 -( 2 - imidazolin - 2 - yl ) propane ] dihydrochloride , 2 , 2 ′- azobis [ 2 -( 2 - imidazolin - 2 - yl ) propane ] disulfate dihydrate , 2 , 2 ′- azobis [ 2 -( 2 - imidazolin - 2 - yl ) propane ], 2 , 2 ′- azobis ( 2 - amidinopropane ) dihydrochloride , and 2 , 2 ′- azobis [ n -( 2 - carboxyethyl )- 2 - methylpropionamidine ] n - hydrate . among these , azobisisobutyronitrile ( aibn ) and the like are preferred . in addition to the copolymer prepared , for example , as described above , the surface treatment agents for medical devices of the present invention may contain additional components such as a solvent in amounts that do not impair the effects . examples of objects ( medical devices ) to be treated with the surface treatment agents for medical devices include thermoplastic elastomers such as nylon , polyester , and polyurethane , and dynamically crosslinked thermoplastic elastomers prepared from these elastomers . examples of nylon include nylon 6 , nylon 66 , nylon 11 , and nylon 12 . moreover , the dynamically crosslinked thermoplastic elastomer is preferably obtained by dynamically crosslinking a halogenated butyl rubber in a thermoplastic elastomer . in this case , the thermoplastic elastomer is preferably nylon , polyurethane , or the like . medical devices of the present invention can be prepared by treating the surface of a medical device with the surface treatment agent described above , and examples include those obtained by at least partially treating the outer surface and / or inner surface of a medical device with the surface treatment agent . the treatment with the surface treatment agent may be carried out by any method that allows the surface treatment agent to make contact with the surface of a medical device , and examples include a method in which the treatment agent is fixed to the surface of a medical device by coating , spraying , immersion or the like . in particular , for fixing on the surface , the surface treatment is preferably carried out with the aid of heat and / or an acid . the treatment with heat maybe carried out , for example , at 80 ° c . to 130 ° c . for 10 minutes to 10 hours . the treatment with an acid may be carried out using an inorganic or organic acid or the like appropriately chosen for fixing and the like . the treatment is preferably applied to an area that requires lubricity , and the treatment may be applied to the entire surface . particularly preferred examples of medical devices of the present invention are catheters , and the present invention gives them not only lubricity but also lubricant durability . the present invention is more specifically described with reference to examples below . the present invention is , however , not limited to these examples . to a solution mixture of 5 ml of water and 4 ml of ethanol were added 0 . 65 g of an 80 % aqueous solution of trimethyl - 2 - methacryloyloxyethyl ammonium chloride ( an 80 % aqueous solution of 2 -( methacryloyloxy ) ethyl trimethylammonium chloride ) and 0 . 36 g of glycidyl methacrylate . to this was added 1 ml of a solution of benzophenone in methanol ( 2 mg / 10 ml methanol ), and the mixture was put in a 20 - ml vial . the vial was covered with a lid and purged with a flow of ar gas . then , polymerization was carried out with stirring by irradiation from a 365 nm uv - led ( 5 mw / cm 2 ) ( irradiation time : 6 hours ). the surface of a tube made of nylon 12 was coated with the resulting polymer and held at 100 ° c . for 5 hours to fix the polymer . thus , a surface - treated tube was prepared . to a solution mixture of 5 ml of water and 4 ml of ethanol were added 0 . 91 g of an 80 % aqueous solution of trimethyl - 2 - methacryloyloxyethyl ammonium chloride and 0 . 21 g of glycidyl methacrylate . to this was added 1 ml of a solution of benzophenone in methanol ( 2 mg / 10 ml methanol ), and the mixture was put in a 20 - ml vial . the vial was covered with a lid and purged with a flow of ar gas . then , polymerization was carried out with stirring by irradiation from a 365 nm uv - led ( 5 mw / cm 2 ) ( irradiation time : 3 hours ). the surface of a tube made of nylon 12 was coated with the resulting polymer and held at 100 ° c . for 5 hours to fix the polymer . thus , a surface - treated tube was prepared . to a solution mixture of 5 ml of water and 4 ml of ethanol was added 0 . 91 g of an 80 % aqueous solution of trimethyl - 2 - methacryloyloxyethyl ammonium chloride . to this was added 1 ml of a solution of benzophenone in methanol ( 2 mg / 10 ml methanol ), and the mixture was put in a 20 - ml vial . the vial was covered with a lid and purged with a flow of ar gas . then , polymerization was carried out with stirring by irradiation from a 365 nm uv - led ( 5 mw / cm 2 ) ( irradiation time : 2 . 5 hours ). thereafter , 0 . 21 g of glycidyl methacrylate dissolved in 1 . 5 ml of water and 1 ml of ethanol was added , and the resulting mixture was further subjected to irradiation from a uv - led ( 5 mw / cm 2 ) for 1 hour . the surface of a tube made of nylon 12 was coated with the resulting polymer and held at 100 ° c . for 5 hours to fix the polymer . thus , a surface - treated tube was prepared . to a solution mixture of 5 ml of water and 4 ml of ethanol were added 0 . 62 g of potassium 3 -( methacryloyloxy ) propanesulfonate ( potassium 3 - sulfopropyl methacrylate ) and 0 . 36 g of glycidyl methacrylate . to this was added 1 ml of a solution of benzophenone in methanol ( 2 mg / 10 ml methanol ), and the mixture was put in a 20 - ml vial . the vial was covered with a lid and purged with a flow of ar gas . then , polymerization was carried out with stirring by irradiation from a 365 nm uv - led ( 5 mw / cm 2 ) ( irradiation time : 3 hours ). the surface of a tube made of nylon 12 was coated with the resulting polymer and held at 100 ° c . for 5 hours to fix the polymer . thus , a surface - treated tube was prepared . to a solution mixture of 5 ml of water and 4 ml of ethanol were added 0 . 71 g of [ 2 -( methacryloyloxy ) ethyl ] dimethyl -( 3 - sulfopropyl ) ammonium hydroxide and 0 . 36 g of glycidyl methacrylate . to this was added 1 ml of a solution of benzophenone in methanol ( 2 mg / 10 ml methanol ), and the mixture was put in a 20 - ml vial . the vial was covered with a lid and purged with a flow of ar gas . then , polymerization was carried out with stirring by irradiation from a 365 nm uv - led ( 5 mw / cm 2 ) ( irradiation time : 3 hours ). the surface of a tube made of nylon 12 was coated with the resulting polymer and held at 100 ° c . for 5 hours to fix the polymer . thus , a surface - treated tube was prepared . an amount of 5 . 8 g of trimethyl - 2 - methacryloyloxyethyl ammonium chloride and 1 . 07 g of glycidyl methacrylate were dissolved in 25 ml of ethanol . to this was added 0 . 05 g of aibn , and the mixture was put in a 20 - ml vial . the vial was covered with a lid and purged with a flow of ar gas . then , the vial was placed in a water bath at 60 ° c ., and polymerization was carried out for 4 hours with stirring . the surface of a tube made of nylon 12 was coated with the resulting polymer and held at 100 ° c . for 5 hours to fix the polymer . thus , a surface - treated tube was prepared . an amount of 5 . 8 g of trimethyl - 2 - methacryloyloxyethyl ammonium chloride and 1 . 07 g of glycidyl methacrylate were dissolved in 25 ml of ethanol . to this was added 0 . 07 g of benzoyl peroxide ( bpo ), and the mixture was put in a 20 - ml vial . the vial was covered with a lid and purged with a flow of ar gas . then , the vial was placed in a water bath at 60 ° c ., and polymerization was carried out for 4 hours with stirring . the surface of a tube made of nylon 12 was coated with the resulting polymer and held at 100 ° c . for 5 hours to fix the polymer . thus , a surface - treated tube was prepared . a tube made of nylon 12 was used as it was . used was a tube made of nylon 12 , the surface of which was coated with a 5 % solution of methyl vinyl ether - maleic anhydride ( gantrez - an 16 , produced by ips ) in methanol . it should be noted that nylon 12 is a material often used in vascular catheters , and methyl vinyl ether - maleic anhydride is a typical lubricant to provide the surface with lubricity . the surface - treated tubes prepared in the examples and comparative examples were evaluated as follows . water was applied to the surface of each tube , and the sliding properties of the surface were then subjectively evaluated by touching with a human finger . the subjective evaluation was carried out by ten persons according to the following rating scale of 1 - 5 : a rating of 5 corresponds to a tube with good sliding properties and a rating of 1 corresponds to a tube with so poor sliding properties that the finger never slides on the surface . the average rating was calculated . after water was applied to the surface of each tube , the tube was held between fingers and moved by sliding on the fingers . this cycle was repeated 100 times . then , the subjective evaluation was again carried out by ten persons according to the rating scale for lubricity , and the average rating and the rate of decrease from the initial lubricity were calculated . table 1 shows that the nylon surfaces in the examples each had high lubricity , good durability , and quite a low rate of decrease in lubricity . in contrast , comparative example 1 had quite poor lubricity ; comparative example 2 , in which a commonly used product was used , had moderately high initial lubricity , but had low durability and quite a high rate of decrease in lubricity . these results demonstrated that by using a surface treatment agent containing a copolymer of a hydrophilic functional group - containing monomer and an epoxy group - containing monomer and fixing the polymer on the surface of a catheter or the like , it is possible to simultaneously give it sufficient lubricity and lubricant durability . | 0 |
the particulars shown herein are by way of example and for purposes of illustrative discussion of the embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the present invention . in this regard , no attempt is made to show structural details of the present invention in more detail than is necessary for the fundamental understanding of the present invention , the description taken with the drawings making apparent to those skilled in the art how the several forms of the present invention may be embodied in practice . the device illustrated in fig1 and 2 include a housing 1 with a measuring surface 2 intended to abut against a front face 3 of brake disk 4 during the measurement . further , stops 5 , 6 are provided on housing 1 to extend transversally , in particular , perpendicularly , to measuring surface 2 . stops 5 , 6 are arranged to radially abut housing 1 against an outer edge 7 of brake disk 4 , i . e ., they are used to radially align housing 1 with respect to brake disk 4 . stops 5 , 6 are designed as projections that extend over measuring surface 2 . advantageously , exactly two such projections are employed in order to ensure a defined radial abutment on brake disk 4 . the device further includes a display 8 , advantageously arranged on a side of housing 1 that is opposite to measuring surface 2 so that it can be seen by the user . when the device is abutting correctly against brake disk 4 , a side 9 of housing 1 is arranged to face the axle of brake disk 4 . further , side 9 includes a light source 11 , which can include , e . g ., a semiconductor laser having a light beam is extended in a direction perpendicular to front face 3 to form a planar light field 12 . planar light field 12 can serve as a positioning help because light source 11 and stops 5 , 6 should preferably be mutually aligned so that , when the device correctly abuts against brake disk 4 , a strip of light 13 is created on front face 3 . the user can use strip of light 13 for azimuthally aligning the device in a defined manner with respect to one or more marks 14 arranged on brake disk 4 . this solution requires no additional mechanical marker and is suited for all disk sizes . for better identification , light source 11 may be modulated in brightness . the user can place housing 1 against brake disk 4 in the manner shown in fig2 , where the projections 5 , 6 align the device radially and measuring surface 2 provides an axial alignment . to move the device to the correct azimuthal angle position , the user moves it along the circumference of brake disk 4 . to simplify this motion , projections 5 , 6 can be formed by rollers , e . g ., rotatable cylinders , which roll along outer edge 7 of brake disk 4 . as has been mentioned , the measurement is carried out by one or more coils . fig3 shows an advantageous coil arrangement with several coils 15 . in this embodiment , coils 15 are arranged side by side in a row , such that their centers lie along an arcuate curve 16 , in particular a segment of a circle . the center of a circular coil is understood to be the axis that the coil is wound around . coils 15 form an arcuate measuring area 18 , as it is shown in dashed lines in fig4 . measuring area 18 lies within a ring 19 between two concentric circle lines 20 , 21 . radial width d of the ring ( i . e ., the distance between circle lines 20 , 21 ) is smaller than 2 cm . length l of measuring area 18 measured tangentially along the ring is at least 8 cm . inner radius r of ring 19 lies between 10 and 15 cm . with a measuring area 18 of this type , a substantial region of a conventional brake disk can be reached , without metallic parts of the attachment or edge regions of the brake disk falling within measuring area 18 . instead of a single row of coils 15 , it is also possible to use at least two rows of coils 15 . this is illustrated in fig7 , where the two rows of coils 15 are arranged on two parallel , arcuate curves 16 ′, 16 ″, in particular , on two segments of concentric circles . advantageously , each two neighboring coils 15 arranged on different curves are poled anti - parallel , as it is shown by the signs + and − in fig7 . in this manner , the field of one coil is deflected into the respective neighboring coil , so that it extends through a substantial volume of brake disk 4 without extending very deeply into brake disk 4 . this allows preventing the field from exiting through the opposite side of brake disk 4 , where it might be affected by metal parts . in principle , also in the embodiment of fig3 and 4 , each two neighboring coils can be poled anti - parallel . however , it has also been found that the use of anti - parallel poled coils in an arrangement with two rows of coils according to fig7 is particularly advantageous . the term “ poled anti - parallel ” as used in the embodiments is to be understood to mean that the fields generated by the two coils are anti - parallel to each other . this can be achieved , e . g ., by winding the two coils in opposite winding directions and by sending currents of equal phases through them , or by winding the two coils in the same winding direction and by sending oppositely phased currents through them . the coils 15 shown in fig3 may be advantageously arranged on a common carrier plate 25 , which simplifies their mounting and mutual alignment . advantageously , they are designed as concentric conducting leads on carrier 25 , implemented as a multi - layer printed circuit . in the embodiment shown in fig3 , carrier plate 25 lies against a wall section 26 of housing 1 that forms measuring surface 2 . advantageously , carrier plate 25 is laminated to wall section 26 . alternatively , carrier plate 25 can form the outer wall of housing 1 and therefore measuring surface 2 itself . both these embodiments allow positioning of coils 15 close to and in very well defined spatial relation relative to the surface of brake disk 4 . in particular , the distance between coils 15 and the sample does not vary when the force pressing the one against the other changes . this is important because a variation of the distance by only a few tenths of a millimeter can lead to very large signal variations . coils 15 have a diameter that corresponds approximately to the half thickness of the sample such that their field extends sufficiently deep into the brake disk 4 without a substantial part of the field exiting from the opposite side of brake disk 4 . in order to fulfill these requirements for typical brake disks , an advantageous diameter of coils 15 is in a range between 10 - 15 mm . if the coils are non - rotationally symmetric , this is the diameter tangential to the brake disk if the measuring device is applied in its measuring position against brake disk 4 . a review of fig5 shows that the selected geometry satisfies the requirements . the wiggly line shows the position dependence of the signal when measuring with a single coil whose diameter corresponds approximately to the disk thickness . a part of the modulation is caused by the venting channels — overlaid and non - periodic are variations due to the natural inhomogeneity of the composite . the smoothed curve is created when sampling with the device described here . the vertical axis shows the measuring value , in linear units , the horizontal axis the angle or azimuthal position of the device along the outer edge of the brake disk 4 . fig6 shows a possible embodiment of the coil circuit . accordingly , a driver 30 is provided , which controls the operation of coils 15 and generates a magnetic field in measuring area 18 via coils 15 . an electronic switch 31 is attributed to or associated with each coil , i . e ., coils 15 can , by closing switches 31 , be connected , parallel to each other and to the supply voltage from a voltage source 32 . this parallel configuration allows using a voltage source 32 with low voltage and without voltage converter , such as a simple battery . when switches 31 are interrupted , coils 15 are disconnected from the voltage supply and an inductive voltage is generated over each coil due to the eddy currents in brake disk 4 . these inductive voltages are added computatively or electrically by driver 30 . in this manner , a comparatively strong signal is generated even if only a low supply voltage is used . advantageously , as shown in fig1 , the device has an interface 39 for exchanging data with external equipment , e . g ., in order to generate a protocol of the measurements that have been carried out . further , one or more buttons 40 can be arranged on the device for storing and / or marking a current measuring value . in principle , it is also possible to equip the device with a single coil only , which has an arcuate cross section . however , as such a coil has a high inductance , it needs more power and is slower in operation . in addition , its field reaches deeply , which gives rise to a risk that components arranged behind the brake disk may be included in the measurement . for these reason , it is advantageous to use several coils , and in particular more than three coils . it is noted that the foregoing examples have been provided merely for the purpose of explanation and are in no way to be construed as limiting of the present invention . while the present invention has been described with reference to an exemplary embodiment , it is understood that the words which have been used herein are words of description and illustration , rather than words of limitation . changes may be made , within the purview of the appended claims , as presently stated and as amended , without departing from the scope and spirit of the present invention in its aspects . although the present invention has been described herein with reference to particular means , materials and embodiments , the present invention is not intended to be limited to the particulars disclosed herein ; rather , the present invention extends to all functionally equivalent structures , methods and uses , such as are within the scope of the appended claims . | 5 |
fig7 is a block diagram showing an embodiment of a control circuit used in an optical information processing apparatus according to the present invention . the apparatus of the present invention is substantially the same as that described with reference to fig1 to 6 except for this circuit . a servo sensor 18 , a preamplifier 43 , and an arithmetic unit 44 are connected as shown in fig7 . the arithmetic unit 44 is connected to a digital signal processing circuit 48 via an input switching circuit 62 and an a / d ( analog - to - digital ) converter 63 . the arithmetic unit 44 is also connected to a track counter 64 . the output of the track counter 64 is connected to the digital signal processing circuit 48 . a lens position sensor 34 is connected to the input switching circuit 62 via a preamplifier 45 . the output of a home position sensor 65 is connected to the digital signal processing circuit 48 . a cpu ( central processing unit ) 66 is bidirectionally connected to the digital signal processing circuit 48 and an external interface 67 . a spindle motor 42 for rotating a disk is connected to the digital signal processing circuit 48 via a motor driver 68 . two rf sensors 19 and 20 are connected to an rf signal processing circuit 69 via preamplifiers 52 and 53 . one output of the rf signal processing circuit 69 is connected to the input switching circuit 62 via a detector 70 , and the other input thereof is connected to the digital signal processing circuit 48 . a memory 71 for storing various data is connected to the digital signal processing circuit 48 . the digital signal processing circuit 48 is connected to a laser diode 1 , a focus coil ( af coil ) 23 , a tracking coil ( at coil ) 22 , and a linear motor coil 38 through a d / a ( digital - to - analog ) converter 72 and an output switching circuit 73 , four sample & amp ; hold ( s / h ) circuits 74 , 75 , 76 , and 77 , and then drivers 78 , 49 , 50 , and 51 . a monitor photodiode 79 for monitoring light emitted from the laser diode is connected to the input switching circuit 62 via a preamplifier 80 . a temperature sensor 81 for detecting a temperature in the apparatus is connected to the input switching circuit 62 . the basic operation of the circuit shown in fig7 will be described below . a light beam incident on the servo sensor 18 is converted into a voltage signal by the preamplifier 43 . thereafter , a focus error signal , a tracking error signal , and a focus / tracking sum signal are calculated by the arithmetic unit 44 based on the voltage signal . one of these signals is selected by the input switching circuit 62 , and the selected signal is converted into a digital signal by the a / d converter 63 . the digital signal is input to the digital signal processing circuit 48 . the digital signal processing circuit 48 outputs a digital control value to the d / a converter 72 to control the at and af coils so that tracking and focus error levels become zero . an analog control signal output from the d / a converter 72 is selected by the output switching circuit 73 , and is then held by the s / h circuits 75 and 76 . thereafter , the held signals are output to the drivers 49 and 50 . the drivers 49 and 50 respectively drive the af and at coils 23 and 22 . in order to read / write a magnetooptical signal , a laser beam must be radiated on a disk . the digital signal processing circuit 48 outputs a laser beam control value to the d / a converter 72 . the analog - converted signal is selected by the output switching circuit 73 , and is then input to the laser driver 78 via the s / h circuit 74 . the laser driver controls the laser diode 1 so that a light amount necessary for read / write access can be obtained . the monitor photodiode 79 for monitoring light emitted from the laser diode is attached to the laser diode , and the output from the photodiode 79 is input to the input switching circuit 62 via the preamplifier 80 . since the light amount is monitored by the monitor photodiode 79 , the digital signal processing circuit 48 can accurately control a laser output light amount . a signal line directly connected from the digital signal processing circuit 48 to the laser driver 78 is a high - speed laser on / off signal line used in a write mode . the lens position ( lp ) sensor 34 comprises a 2 - split photodiode , and is irradiated with light emitted from an lp sensor light - emitting diode ( led ) 30 . an output from the photodiode is changed upon a change in object lens position . this output is amplified by the preamplifier 45 , and the amplified signal is input to the input switching circuit 62 . the signal is then input to the digital signal processing circuit 48 via the a / d converter 63 . an output from a home position sensor 65 for detecting that an actuator is moved to a home position on an outer periphery side is input to the digital signal processing circuit 48 . the cpu 66 for managing the overall sequence operation according to the present invention is connected to the digital signal processing circuit 48 to control the operation of the circuit 48 . the cpu 66 is also connected to the external interface 67 to manage data exchange with an external device . the memory 71 stores various data supplied from the digital signal processing circuit 48 or the cpu 66 via the circuit 48 . rotation of the spindle motor 42 is controlled by the motor driver 68 . the start and stop operations of the spindle motor 42 are controlled by the cpu 66 via the digital signal processing circuit 48 . the linear motor coil 38 is driven through the driver 51 in response to a speed command from the digital signal processing circuit 48 . when the linear motor is started , the tracking error signal from the arithmetic unit 44 appears as a track crossing signal . the number of tracking signals during movement of the linear motor is counted by the track counter 64 to detect a moving track count . the digital signal processing circuit 48 calculates a target moving speed , and the like on the basis of a target track count and a present track count . the two rf sensors 19 and 20 convert a magnetooptical signal and a preformat signal into electrical signals . these signals are amplified by the preamplifiers 52 and 53 , and the amplified signals are then subjected to difference detection , in - phase detection , and peak detection processing operations in the rf signal processing circuit 69 . the output from the rf signal processing circuit 69 is processed , as digital data , by the cpu 66 via the digital signal processing circuit 48 , and the processed signal is output , as digital information , to the external device via the external interface 67 . on the other hand , the envelope of the signal subjected to the rf signal processing is detected by the detector 70 as an analog signal , and the signal is then input as a signal indicating a magnitude level to the digital signal processing circuit 48 via the input switching circuit 62 and the a / d converter 63 . this signal is used to judge the magnitude of the rf signal level and to detect whether or not focus and tracking operations are normally executed . fig8 shows an automatic control sequence of the servo system in the apparatus of the present invention . first , the object lens is positioned at the center of a light beam from the semiconductor laser , and only the af servo is operated . then , an offset value of a tracking error signal is measured and corrected ( step 1 ). the offsets to be corrected at this time include an alignment error upon adjustment of , e . g ., the servo sensor , a position shift after adjustment , warp of a disk , and the like . next , the object lens position sensor is calibrated , and a tracking error signal offset when the object lens is shifted from the center of the light beam is corrected ( step 2 ). these two operations can be performed at the same time but may be performed independently . the object lens position sensor output is calibrated based on an absolute object lens position from the center of light beam which is detected by counting the number of tracks of the disk . thus , linearity of the object lens position sensor is corrected . correction of the tracking error signal offset executed when the object lens is shifted from the center of the light beam is performed to correct linearity between the object lens position and the offset value of the tracking error signal , which occurs due to the causes described in step 1 . at the same time , a variation in offset caused by a variation in , e . g ., depth of the guide groove of the disk is corrected . a focus error signal offset is then corrected ( step 3 ). this step may be executed before step 2 . the af and at servo operations are performed and an offset value is determined to maximize reproduction amplitudes of preformat signals ( e . g ., sector marks , address signals , and the like ) of the disk . thus , an af offset caused by an alignment error upon adjustment of , e . g ., the servo sensor , variations in thickness and refractive index of a disk substrate , a variation in guide groove of the disk , and the like can be corrected . then , an af gain is adjusted ( step 4 ). the af and at servo operations are performed to add a proper focus disturbance from the digital processing circuit , and a response thereto is measured , thereby adjusting the gain to a predetermined value . initial and aging variations of the actuator , variations in disk , and the like can be corrected at the same time . an at gain is adjusted in the same manner as in step 4 ( step 5 ). a linear motor gain is adjusted ( step 6 ). the af and at servo operations are performed on a predetermined track to add a proper disturbance from the digital signal processing circuit to the linear motor , and a response from the linear motor is measured using the object lens position sensor calibrated in step 2 . initial and aging variations of the linear motor can be corrected . finally , laser power monitor linearity is corrected based on the monitor photodiode incorporated in the semiconductor laser ( step 7 ). since the magnetooptical disk apparatus uses a laser power by changing it to have a difference of about 10 times between a data reproduction mode and data erase and write modes , the monitor linearity is impaired by light reflected by the disk . thus , the poor linearity can be corrected by the output from the servo sensor . thus , a recording / reproduction operation with an optimal laser power can be performed . the correction methods in respective steps will be described in detail below . method of correcting tracking error signal offset at object lens reference position ( on optical axis ) in order to prevent already recorded data from being erased during correction , the carriage is moved to its home position . the home position sensor 65 comprising , e . g ., a photointerrupter , and a mechanical switch shown in fig7 can detect whether or not the carriage is moved to the home position . the object lens is then moved to the central position of a light beam from the semiconductor laser ( to be referred to as a lens reference position hereinafter ). as a method of attaining this operation , when a focus actuator is moved downward to a lowermost point , a mechanical pin may be engaged at a central point . alternatively , the output from the preamplifier 45 of the lp sensor 34 is adjusted in advance to have a predetermined value at the lens reference position in the manufacture , and the lens position may be electrically moved so that the lp sensor output has the predetermined value . in this state , a focusing operation is performed to set the lens at a substantially focal point . then , a tracking error signal upon track crossing is generated by the following methods . in one method , the linear motor coil 38 is energized while the lens is fixed in position at the reference position to vibrate the linear motor . when the linear motor is sinusoidally vibrated , the object lens is vibrated to cross the tracks , and a tracking error signal (( s 2 + s 3 )-( s 1 + s 4 )) can be obtained from the arithmetic unit 44 . in the second method , the object lens is slightly vibrated in the tracking direction at the reference position while the linear motor stands still at the home position . in this manner , the tracking error signal including an offset can be obtained near the lens reference position . as shown in fig9 the tracking error signal has an offset component . this signal is a tracking signal output from the arithmetic unit 44 , and is a / d - converted based on a sampling pulse shown in fig9 via the input switching circuit 62 . thus , the digital signal is input to the digital signal processing circuit 48 . the digital signal processing circuit 48 obtains peak and bottom values from the digital tracking signal , and then obtains an intermediate point of these values , thereby recognizing this point as an offset value . in order to more accurately obtain the peak and bottom values , the tracking error signal is preferably sampled several times . the offset value obtained in this manner is stored in the memory 71 . in a tracking operation after correction , the obtained tracking offset value is subtracted from the digital tracking error signal before offset correction , which is obtained from the arithmetic unit 44 via the a / d converter 63 to generate an offset - corrected tracking error signal after offset correction . then , tracking loop is controlled using the offset - corrected tracking error value . the outputs of the lens position sensor 34 have characteristics so that the two sensor outputs s lp1 and s lp2 change in opposite directions with respect to an object lens position shift , as shown in fig1 . basically , the following arithmetic operation is performed to remove an in - phase fluctuation such as a temperature fluctuation of the sensor output , thus detecting the object lens position : however , since the outputs s lp1 and s lp2 are not linearly changed with respect to the object lens position , the relationship between the sensor outputs and the object lens position must be detected by the following methods . the object lens position is set at the center of a light beam from the semiconductor laser , focus servo and tracking servo are set in in - focus and on - track states , and a disk is then rotated . since the disk suffers from an eccentricity , the tracking actuator fluctuates in the tracking direction to follow the eccentricity , and the two outputs s lp1 and s lp2 of the lens position sensor 34 vary accordingly . as shown in fig1 , the fluctuating outputs s lp1 and s lp2 are sampled in response to a rotation synchronous sampling pulse which is synchronized with rotation of the disk , and the sampled outputs are converted into digital signals by the a / d converter 63 . thus , eccentricity data during one revolution are stored in the memory 71 via the digital signal processing circuit 48 . these data are used to remove an eccentricity component during sampling of the object lens position data ( to be described below ). a tracking servo loop is then opened to jump the tracking actuator by an object lens moving range ( e . g ., ± 250 microns =± 170 tracks ). during this operation , data of the relationship between the outputs s lp1 and s lp2 of the lens position sensor and the object lens position displacement are sampled . while the object lens position is moved from a - 170th track position to a + 170th track position , the outputs lp1 and lp2 are sampled at every eleventh tracks , and are a / d - converted . the outputs s lp1 and s lp2 fluctuate under the influence of the eccentricity , as shown in fig1 . thus , data obtained by subtracting the eccentricity component from the sampled data by utilizing the above - mentioned eccentricity data to remove the eccentricity are stored in the memory 71 . in the first method , the object lens position is continuously moved from the - 170th track position to the + 170th track position , and data are sampled during movement . in this method , however , the object lens position is jumped by several tens of tracks , and the tracking loop is closed to sample data . the same operation as in the first method is executed until the object lens position is brought to the optical central position to enable the tracking loop . in the second method , however , no eccentricity data are sampled . in this method , the object lens position outputs s lp1 and s lp2 are loaded during one or a plurality of revolutions of the disk , and average values of the outputs s lp1 and s lp2 are obtained by the digital signal processing circuit 48 , thus obtaining the object lens position output from which an eccentricity component is removed . as shown in fig1 , a track jump operation is executed by the predetermined number of tracks , and the tracking loop is closed at the object lens position after movement . during one or several revolutions of the disk , the object lens position outputs are loaded , and their average values are obtained , thereby obtaining the object lens position output at that point . in this manner , the track jump operation , data sampling , and average value calculations are repeated , and object lens position output values free from an eccentricity component over the entire object lens moving range are stored in the memory 71 . in the first or second method , data sampling is performed while the object lens position is continuously moved or the track jump operation is performed . in this method , data sampling is performed by tracing . the object lens position is jumped inwardly by 170 tracks and the tracking loop is closed . since the spiral grooves are formed in the disk from its inner periphery toward the outer periphery , the object lens position traces from the inner periphery toward the outer periphery in this state . the object lens position outputs are sampled in every revolution during tracing . in this manner , since data sampling is performed in every revolution , no eccentricity component is caught , and data sampling free from an eccentricity component can be automatically performed . when data sampling of the relationship between the object lens position and the lp sensor output is completed by any one of the first to third methods and the sampled data are actually used , the object lens position must be obtained from the object lens position outputs . in one method , a conversion table may be allocated in the memory 71 . in this case , however , a numerical arithmetic method using a digital signal processor ( dsp ) or the like which can perform high - speed arithmetic operations will be described below . where x is the normalized object lens position output , and a , b , c , d , and e are constants . that is , we have : ## equ1 ## where g and k are constants . g is selected so that the range of x corresponds to ± 1 . 0 when the values of the s lp1 and s lp2 are substituted . a , b , c , d , and e can be determined based on the values of s lp1 and s lp2 by the law of least squares so that a position error is minimized . k is used to correct a difference between output levels of s lp1 and s lp2 . when adjustment is performed in advance to yield s lp1 = s lp2 when the object lens is located at the lens reference position , k = 1 can be set . in this embodiment , the lp sensor detects the position of the object lens in a track crossing direction . however , the present invention is applicable to a case wherein this sensor detects the position of the object lens in an optical axis direction . correct tracking error signal offset when object lens is shifted from reference position since the tracking error offset value and the object lens position displacement have a linear relationship to some extent , it is possible to correct the tracking offset using this relationship . in this case , offset correction is executed in the digital signal processing circuit . however , a method of more strictly correcting an offset will be described hereinafter . when data of the relationship between the object lens position and the lp sensor output are sampled , a tracking signal obtained when the object lens is shifted from the reference position in the radial direction is simultaneously observed , and the relationship between the object lens position and the tracking error offset amount is obtained . as shown in fig1 , a signal generated upon crossing of tracks is mixed in the tracking error signal . the peak and bottom values of the tracking error signal are read , and their central value is calculated as the tracking error signal . this value may be stored in the memory 71 as a conversion table or an approximation equation described in correction of the lens position sensor may be obtained to numerically calculate the central value using a digital signal processor ( dsp ) or the like which can perform high - speed arithmetic operations . the tracking error signal in this case is in a considerably higher frequency range than an eccentricity component . therefore , a sampling pulse must have a high frequency enough to sufficiently catch peak and bottom values of the tracking error signal . for example , when only an eccentricity component is sampled , the sampling frequency can be about 500 hz about 10 times the frequency ( 50 hz ) of the eccentricity component . however , in order to read a signal generated upon crossing of tracks , a sampling pulse having a frequency of about 10 khz which is 10 times that ( about 1 khz ) of the tracking error signal upon crossing of tracks is required . in the first method of correcting a focus error signal offset , an offset value is determined to maximize a reproduction amplitude of a preformat signal ( e . g ., a sector mask or an address signal ) on a disk . the af and at servo operations are performed , and an amplitude value of a signal in a preformat area obtained when an offset is forcibly added to the focus error signal is monitored . this operation will be described below with reference to fig1 . in fig1 , an af offset amount is plotted along the abscissa , and an amplitude value of a signal is plotted along the ordinate . assume that the amplitude of the preformat signal obtained when a predetermined positive offset amount is added ( point p 3 in fig1 ) to an initial af offset position ( point p 1 in fig1 ) as the center is a value indicated by x in fig1 a , and the amplitude obtained when a negative offset amount is added ( point p 2 in fig1 ) is a value indicated by y in fig1 b . the two amplitudes x and y are stored in the memory , and are compared with each other . in this case , since x & gt ; y , a maximum point of the preformat signal amplitude value , i . e ., a just focus point is present on the positive side from the present position . in fig1 , assume that a point defined by adding a predetermined positive offset value to the point p 3 is set to be a new central point . furthermore , the amplitude value of the preformat signal at a point p 5 defined by adding a predetermined positive offset value to the point p 4 is stored in the memory , and is compared with the stored value of the amplitude of the preformat signal at the point p 3 . since the amplitude value at the point p 5 is larger than that at the point p 3 , it is determined that the just focus point is present on the further positive side . in this manner , this operation is repeated to search that the just focus point is present between the points p 4 and p 6 . the predetermined offset amount is set to be 1 / 2 that of the initial value to narrow a search range . the same operation is repeated to have the intermediate point p 5 between the points p 4 and p 6 to converge an offset amount to the just focus point . this operation is continued until a difference from the preformat signal amplitude to be compared becomes zero . the obtained focus offset amount is stored , and is kept applied to the focus error signal . note that a differentiated signal of the preformat signal using a differential circuit ( not shown ) is preferably used to improve a detection sensitivity of the just focus point . as another method of detecting an amplitude value of the preformat signal , the following methods are known . ( a ) in this method , photocurrents from the rf sensors 19 and 20 are amplified by the preamplifiers 52 and 53 , outputs from these amplifiers are directly monitored , and a peak value at that time is held to detect a dc component . ( b ) in this method , the outputs from the rf sensor preamplifiers 52 and 53 are differentiated by a differential circuit ( not shown ) to detect a peak value of a signal . a p -- p value of the differentiated signal is monitored to detect the amplitude value . ( c ) in this method , the differentiated signal output is half - wave rectified or full - wave rectified and this peak value is monitored to detect the amplitude value . ( d ) in this method , a filter for extracting a certain range where a fluctuation of the af offset amount considerably appears in a fluctuation of the amplitude value is used , and the output from this filter is monitored . these amplitude value data are a / d - converted and fetched , and are then processed in the digital signal processing circuit 48 . in the second method , magnetooptical signal data in a data area of the disk is directly fetched , and its amplitude value can be monitored . the sequence of this method is the same as that of the first method . a signal for changing an offset amount , as shown in fig1 b , is added to the focus error signal , and the differentiated magnetooptical signal output from a differential circuit , as shown in fig1 a , may be monitored . in this case , a voltage value of an af offset application signal at a position where the amplitude value of the magnetooptical signal is maximized is read ( corresponding to a point p in fig1 b ), and this value is always applied to the focus error signal , thus setting a just focus state . the first method of auto focus gain control will be described below with reference to fig1 . fig1 is a pseudo block diagram of a processing sequence in the digital signal processing circuit 48 . the af and at servo operations are performed to set the object lens at the reference position , and one track is followed or a track tracking state is set . in fig1 , the focus error value ( an offset has been removed in the above - mentioned process ), and a sum signal value are digital data after a / d conversion , and an output value and an estimated value are all digital data . a disturbance value which has the same frequency as a 0 - db crossing frequency of the auto focus loop gain and does not cause an error is given . the amplitude of the disturbance value is given by an increase / decrease in data in the digital signal processing circuit , and its period is also given by ( 1 / crossing frequency ). amplitude data at a node b after application of the disturbance value is compared with amplitude data before application at a node a by a divider 90 . when b & lt ; a or b & gt ; a , a value k in a multiplier 91 is adjusted to yield a = b , thereby adjusting a gain . the second method can be executed even when the digital signal processing circuit 48 is limited to a gate array in fig1 . an amplitude value b after application of a disturbance from an oscillator 82 is compared with an amplitude value a output from the gate array , and gain control is performed to yield a = b . in this case , c after the output switching circuit 73 may be used in place of b . read values of a and b have different phases and cannot be read at the same timing . therefore , one period of a disturbance is sampled to detect amplitude values a and b , and a comparator 84 for comparing these values , and a gain setting circuit 85 for causing the gate array to control the gain are separately arranged . gain control may also be performed by applying a disturbance to a signal output from the a / d converter 63 at the input side of the gate array , and comparing the applied amplitude value and an amplitude value after the input switching circuit 62 . auto tracking gain control is performed in the same manner as in auto focus gain control . linear motor gain control is performed as follows . as shown in fig1 , a disturbance having the same frequency as a 0 - db crossing frequency in the linear motor loop gain is applied to the linear motor control 38 , and a displacement of the linear motor is detected on the basis of the output from the lp sensor . a servo operation is performed so that the linear motor is fixed at home position . the focus and tracking servo operations are then performed so that the object lens is located at the reference position . the digital signal processing circuit 48 generates a digital disturbance signal , and applies the disturbance to the linear motor coil via the d / a converter 72 , and the like . the linear motor is vibrated by the disturbance . however , since the tracking servo operation is performed , the object lens is vibrated in the radial direction of the disk in correspondence with the movement of the linear motor to maintain tracking . therefore , the lp sensor also generates an output synchronous with the vibration . since the linear motor open loop gain is constant except for a mechanical sensitivity of the linear motor , an arithmetic gain can be set so that the displacement of the linear motor has a predetermined value ( 0 db at the 0 - db crossing frequency ) when a predetermined disturbance amplitude is applied . the digital signal processing circuit 48 reads the output value from the lp sensor , and sets the linear motor servo loop gain so that the read amplitude value has a predetermined value . in this method , a disturbance is generated by the oscillator 82 arranged outside the digital signal processing circuit 48 , as shown in fig1 . like in the first method , focus , tracking , linear motor servo operations are performed at the home position . the object lens position is the reference position . in addition , a disturbance frequency is the 0 - db crossing frequency . in this method , the output disturbance signal is fetched by an a / d converter 86 , its amplitude is detected by an amplitude value detector 92 , and the detected value is estimated by the digital signal processing circuit 48 . the displacement of the linear motor is detected based on the lp sensor output like in the first method . the digital signal processing circuit 48 determines an arithmetic gain so that the displacement of the linear motor has a predetermined value ( 0 db at the 0 - db crossing frequency ) when a predetermined disturbance amplitude is applied . since this method employs an analog oscillator , an oscillation waveform need not be generated by the digital signal processing circuit . therefore , a software load can be reduced , and a high frequency can be easily generated . in this method , the object lens is fixed in reference position , and the tracking servo loop is opened . a disturbance is applied to the linear motor to vibrate it , so that the object lens is vibrated in the radial direction of the disk . the number of tracking error signals upon crossing of tracks is counted to detect a displacement amount of the linear motor . the focus and linear motor servo operations are performed at the home position , and the disturbance frequency is the 0 - db crossing frequency like in the first method . in this case , when an eccentricity component is counted , a detected displacement amount suffers from an error . therefore , it is necessary to count only an eccentricity component beforehand without application of a disturbance , and to subtract the eccentricity component from a count value applied with the disturbance . although this method often causes an error of a maximum of about one track , no problem is posed as long as a large displacement amount is set . according to the present invention , a laser power is controlled by detecting an output signal from the monitor photodiode 79 . however , with only this operation , since a monitor output is influenced by light reflected by the disk , a power of the laser beam radiated on the disk cannot be controlled with perfect precision . according to the present invention , linearity is corrected using light reflected by the disk . light reflected by the disk is received by the servo sensor 18 to be subjected to current - voltage conversion . thereafter , the output signal is converted to a sum signal ( s 1 + s 2 + s 3 + s 4 ) by the arithmetic unit 44 . the sum signal is then a / d - converted , and the digital signal is input to the digital signal processing circuit 48 . on the other hand , the output from the monitor photodiode 79 is input to the digital signal processing circuit 48 via the preamplifier 80 and the a / d converter 63 . as shown in fig2 , the digital signal processing circuit 48 controls the laser driver 78 to emit a laser beam of 10 mw having relatively good monitor linearity . at this time , if the sum signal is 10 v , the laser output can be given by ( sum signal / 1 , 000 ( w )). data representing the relationship with the monitor output can be sampled while decreasing the laser output so that the sum signal output is decreased by , e . g ., every 0 . 1 v . thus , the monitor output can be corrected based on the sum signal output . correction data is stored in the memory 71 , and the monitor output is corrected based on this data to control the laser power , thus allowing precise laser radiation . fig2 shows an algorithm for embodying a servo system automatic gain control method according to the present invention . the automatic gain control of the present invention can be performed every time a magnetooptical disk is loaded and the magnetooptical disk apparatus is started or every time the temperature sensor arranged in the apparatus exhibits a change in temperature exceeding a predetermined value in use and a position shift of the optical parts described above is feared . when the automatic gain control is performed every time a new magnetooptical disk is loaded , an alignment error upon adjustment of , e . g ., the servo sensor or a position shift after adjustment can be easily corrected . in addition , a variation in at offset occurring when the object lens is shifted in the radial direction due to a variation in guide groove of the disk , and variations in af and at gains can be corrected . at the same time , an af offset caused by variations in thickness and refractive index of a disk substrate , an at offset caused by warp of the disk substrate , and the like can also be corrected . when automatic control is performed every time the temperature sensor exhibits a change in temperature exceeding a predetermined value , a position shift of optical parts caused by the change in temperature , a position shift of a light spot on the servo sensor caused by a change in wavelength of the semiconductor laser , and the like can be corrected . for example , in the magnetooptical disk apparatus shown in fig1 assuming that a beam shaping ratio of the beam shaping prism 3 is set to be 2 and glass is bk7 , a deflection angle of a light beam is about 3 sec per change in wavelength by 1 nm . if the focal length of the focusing lens 15 is assumed to be 40 mm , a light spot shift on the servo sensor is about 0 . 6 micron per change in wavelength by 1 nm . since the wavelength of the semiconductor laser is changed by 0 . 3 nm per change in temperature by 1 ° c ., a change in temperature of 30 ° c . causes a light spot shift of about 6 microns , and this influences tracking servo precision . however , if automatic gain control is performed every time a change in temperature reaches 5 ° c ., a position shift can be converged to a value which poses no problem . thus , the beam shaping prism need not comprise an expensive achromatic prism as a combination of a plurality of kinds of glass . the automatic gain control for a servo system has been described . the present invention is not limited to the focus error detection method , the tracking error detection method , and the object lens position detection method described in the above embodiment . focus and tracking errors may be detected by independent detectors . in the above embodiment , light reflected by a medium is detected . however , when a medium is of a light transmission type , the transmission light may be detected to calibrate a control means . | 6 |
fig1 a - 1d are schematic sectional views of mos transistors in a multi - voltage level semiconductor device according to an embodiment of the present invention . in fig1 a , a mos transistor for a low - voltage circuit is shown on the left - hand side , and a mos for a high - voltage circuit is shown on the right - hand side . for example , a field oxide film 2 is formed onto the surface of a silicon substrate 1 , to define or demarcate active regions . gate oxide films 3 are then formed onto the surface of the active regions . here the thickness of the gate oxide film 3 gradually decreases from the edges 3 b towards the centre 3 a of the film , with respect to the direction in which current flows through the mos transistor . polycrystalline silicon electrodes 4 a , and 4 b are formed onto the gate oxide films 3 . the polycrystalline silicon electrode 4 a for a low - voltage circuit is doped with a higher concentration of impurity than the polycrystalline silicon electrode 4 b for the high - voltage circuit . for example , the impurity concentration in polycrystalline silicon electrode 4 a is of the order of 10 20 cm − 3 , whereas the impurity concentration in polycrystalline silicon electrode 4 b is approximately 1 × 10 18 cm − 3 - 5 × 10 19 cm − 3 . side wall spacers made from silicon oxide are formed at the edge regions of the gate electrodes 4 a , and 4 b . regions ( ldds ) doped shallowly at a low concentration with an impurity of the same conductivity type as the gate electrode are formed below the side wall spacers of gate 4 a of the low - voltage circuit mos transistor , and source and drain regions 5 a , and 6 a ( n + ) doped deeply at a high concentration with the impurity are formed on the opposite sides of the ldds to the gate electrode . on the other hand , in the high - voltage circuit mos transistor , source and drain regions 5 b , 6 b doped shallowly at low concentration with impurity of the same conductivity type as the gate electrode are formed below the gate side wall spacers and adjacently thereto , on opposite sides to the gate electrode . the impurity concentration in the source and drain regions 5 b , and 6 b is similar to the impurity concentration in the gate electrode of the high - voltage circuit mos transistor , namely , approximately 10 18 cm − 3 - 5 × 10 19 cm − 3 . hereinbelow , either one or both of the source regions 5 a , and 5 b may be referred to as “ source region 5 ”. similarly , either one or both of the drain regions 6 a , 6 b may be referred to as “ drain region 6 ”. furthermore , the collective term “ source / drain ” may also be used to refer to both sources and drains . the gate oxide films 3 in low - voltage circuit mos transistors and high - voltage circuit mos transistors have equal thickness in the central regions thereof . channel regions 7 are defined or demarcated below the gate electrodes 4 between the source / drain regions 5 , 6 . fig1 b shows the state of the transistors when voltages are applied to the gate electrode and source / drain regions . the source region 5 is connected to earth potential ( 0v ), and the drain region 6 is connected to the power supply voltage ( v d1 , v d2 ). a gate voltage v g1 , v g2 which varies depending on whether the transistor is in an on state or an off state , is supplied to the gate electrode 4 . here , in a low - voltage circuit , voltages v g1 and v d1 in the on state are the low - voltage level power supply voltage , and in a high - voltage circuit , voltages v g2 and v d2 in the on state are the high - voltage circuit power supply voltage . in the mos transistor for use in low - voltage circuits , as shown on the left - hand side , when power supply voltage v g1 is applied to the gate electrode 4 a , an inversion layer 8 a is induced in the channel 7 a . the voltage between the source region 5 a and inversion layer 8 a , and the gate electrode 4 a is received by the gate oxide film 3 a . the gate oxide film 3 a is selected such that it matches the low - voltage circuit power supply voltage . in the high - voltage circuit mos transistor , when the power supply voltage v g2 is applied to the gate electrode 4 b , an inversion layer 8 b is induced in the channel region 7 b , and a depletion layer dp is created on the channel side of the gate electrode 4 b , which is doped at a low impurity concentration . since the depletion layer dp functions effectively as an insulating layer , the electric field applied to the gate insulating film below the gate electrode 4 b is reduced . on the other hand , in the off state of the high - voltage transistor , the gate electrode is not depleted because the source region 5 b and the gate electrode 4 b are connected to earth potential . also in this case a high voltage is applied to the gate oxide when the drain region 6 b is connected to the power supply voltage . since the gate oxide film 3 is formed more thickly at its edges than in its central region , the electric field applied to the edge region of the gate oxide film is reduced . by forming the gate oxide film 3 more thickly at its edges than in its central region and generating a depletion layer dp within the gate electrode 4 b , the breakdown voltage of the insulated gate structure in a high - voltage circuit mos transistor can be raised , even if the gate oxide film 3 itself has the same thickness as the gate oxide film 3 in a low - voltage circuit component . fig1 c shows an enlarged portion of a source region 5 b and a gate electrode 4 b in a high - voltage circuit mos transistor . if the gate electrode 4 b is at the same potential as the source region 5 b , then the whole gate electrode 4 b , which is made of silicon , will function as a gate electrode . when a power supply voltage is applied to the gate electrode 4 b , an inverse bias acts between the source region 5 b , channel region 7 b and gate electrode 4 b , thereby creating a depletion layer dp . the gate electrode 4 b effectively develops a boundary , as marked by the dotted line , and the effective position of the gate electrode 4 b in the lowermost portion thereof moves from x to y . in this way , when a high voltage is applied to the gate electrode of a high - voltage circuit mos transistor , the electric field applied to the gate oxide film is reduced by the depletion layer created in the gate electrode , and therefore breakdown voltage is improved . moreover , since the gate oxide film is formed more thickly at its edges than in its central region , the thickness of the gate insulating film in the edge regions of the gate electrode , where a high electric field is applied , is increased . furthermore , concentration of the electric field is eased by the fact that the electric field between the gate oxide film 3 and the gate electrode 4 b forms a smooth convex curve toward the source region 5 b . fig1 d shows an enlarged sectional view of a portion of a source region 5 a and gate electrode 4 a in a low - voltage mos transistor . an insulating side wall spacer 9 is formed on the side wall of the gate electrode 4 a . the source region 5 a is constituted by an extended section ( ldd region ) 10 of low impurity concentration , which partially overlaps with the gate electrode 4 a in the plane of the substrate , and a source region 11 of high impurity concentration , which is aligned in position with the edge of the insulating spacer 9 . the high - impurity - concentration source region 11 lowers the effective resistance of the source region as a whole . since the gate electrode 4 a is doped with impurity at a high concentration , no depletion layer is created . by selecting an optimum thickness of the gate oxide film 3 for the low - voltage mos transistor , a high - performance low - voltage mos transistor can be formed . in both of the transistors described above , a gate oxide film which is thicker at its edges in the vicinity of the source / drain regions than in its central portion can be formed by gate electrode patterning followed by thermal oxidation . fig2 shows simulation results for the form of an oxide film formed on the surface of a gate electrode , by gate electrode patterning followed by thermal oxidation . a gate oxide film 3 approximately 9 nm thick is formed on the surface of a silicon substrate 1 , and a polycrystalline silicon gate electrode 4 approximately 300 nm thick is then formed onto this . after patterning the polycrystalline silicon gate electrode 4 by lithography and etching , thermal oxidation was carried out for 60 minutes at 950 ° c . in an o 2 atmosphere , and an oxide film ox approximately 30 nm thick was grown onto the surface of the silicon substrate 1 . in this process , the oxide film ox penetrates below the edge regions of the gate electrode , thereby the shape of the edge regions of the gate electrode 4 is smoothed or rounded , and furthermore , the thickness of the gate oxide film 3 is increased in these regions . by subsequently performing ion implantation using the gate electrode 4 and the oxide film formed on the surface thereof as a mask , a source / drain region 5 is formed which overlaps partially with the gate electrode 4 . the distance from the surface of the oxide film on the side wall of the gate electrode 4 to the end of the source / drain region 5 is 50 nm , and the distance from the side wall of the gate electrode 4 to the end of the source / drain region 5 is approximately 30 nm . the portion of the gate oxide film having increased thickness penetrates more deeply towards the centre of the gate electrode than the end of the source / drain region 5 . in this way , by performing thermal oxidation after patterning of polycrystalline silicon gate electrodes , it is possible to make the gate oxide film 3 thicker at its edges than in its central region , and to round the corners at the edges of the gate electrode 4 . in the case shown in fig2 the gate oxide film is approximately 40 nm thick at the edges of the gate electrode , which is more than four times the 9 nm thickness of the gate oxide film in the central region thereof . desirably the thickness at the edges should be at least two times , or preferably , three times as thick , or more as that at the central region . fig3 a and 3b show approximate compositional examples of a multi - voltage level semiconductor device . in fig3 a , a low - voltage circuit ck 1 and a high - voltage circuit ck 2 are formed in an integrated semiconductor chip ic . the low - voltage circuit ck 1 is , for example , a digital circuit , and the high - voltage circuit ck 2 is an analogue circuit . a voltage level converting circuit ck 3 is placed between the low - voltage circuit ck 1 and the high - voltage circuit ck 2 . input pads ip 1 , ip 2 , power supply pads pp 1 , pp 2 , and output pads op 1 , op 2 are positioned at the edges of the ic . the pads ip 1 , pp 1 , op 1 are pads for the low - voltage circuit ck 1 and the pads ip 2 , pp 2 , op 2 are pads for the high - voltage circuit ck 2 . fig3 b shows a further compositional example of a multi - voltage level semiconductor device . a high - voltage circuit ck 2 is placed around a low - voltage circuit ck 1 separated by a voltage level converting circuit ck 3 . the high - voltage circuit ck 2 may be an output circuit , for example . high - voltage level pads ip 2 , pp 2 , op 2 are placed in the edge portion of the chip . low - voltage level pads may be placed in another edge portion or in a central portion . fig4 a - 4l show schematic sectional views of a semiconductor substrate for illustrating manufacturing steps for a multi - voltage level semiconductor device according to an embodiment of the present invention . the region on the left - hand side of the drawings is for low - voltage circuit use and the region on the right - hand side is for high - voltage circuit use . as shown in fig4 a , n - type wells 111 , 114 and p - type wells 112 , 113 are formed on the surface region of a p - type silicon substrate 11 . a field oxide film 12 approximately 400 nm thick is formed onto the surface of the silicon substrate by a commonly known locos ( local oxidation of silicon ) technique , thereby dermarcating or defining active regions . a gate oxide film 13 approximately 9 nm thick is formed onto the surface of the active regions by dry thermal oxidation , for example . this gate oxide film approximately 9 nm thick is the optimum gate oxide film for driving at low voltages . in fig4 a , the n - type well 111 and p - type well 112 on the left - hand side provide a region for forming low - voltage circuit mos transistors , and the n - type well 114 and p - type well 113 on the right - hand side provide a region for forming high - voltage circuit mos transistors . the gate oxide film 13 having a uniform thickness is formed jointly on the n - type well 111 and p - type well 112 for the low - voltage circuit and the n - type well 114 and p - type well 113 for the high - voltage circuit by a single manufacturing step , so it is not necessary to fabricate gate oxide films of different thickness separately . as shown in fig4 b , a polycrystalline silicon film 14 approximately 200 nm thick , for example , is formed by low - pressure cvd ( lpcvd ) onto the substrate surface on which the gate oxide film 13 was fabricated . as shown in fig4 c , a resist pattern 21 for patterning gate electrodes is formed on the surface of the polycrystalline silicon film 14 , and the polycrystalline silicon film 14 is etched using the resist pattern 21 as an etching mask . in this way , each gate electrode 14 a is formed on the active region . thereupon , the resist pattern 21 is removed . as shown in fig4 d , the silicon substrate 11 on which a gate electrode 14 a has been formed by patterning is then subjected to dry thermal oxidation for 60 minutes at 950 ° c . in an o 2 atmosphere , thereby growing an oxide film 13 a approximately 30 nm thick on the surface of the silicon substrate 11 . the silicon oxide film grows more thickly on the surface of the polycrystalline silicon gate electrode 14 a than on the surface of the silicon substrate . here , by conducting thermal oxidation of the silicon surface , the thermal oxidation will progress below the gate electrode 14 a from the edges of the gate electrode towards the central region thereof , as illustrated in fig2 and a silicon oxide film 13 a will be formed which gradually decreases in thickness from the edge regions of the gate electrode 14 a towards the central region thereof . in addition to growing the silicon oxide film , it is also possible to round or smooth the corners at the lower edges of the polycrystalline silicon gate electrode 14 a . the growth of oxide film below the gate electrode in this way may be thought to be similar or analogous in some sense to the growth of “ bird &# 39 ; s beak ” in locos . such resultant configurations of the oxide film under the gate electrode are common to low - voltage circuit mos transistors and high - voltage circuit mos transistors . as shown in fig4 e , a resist pattern 22 is formed to cover the n - type wells 111 , 114 and exposes the p - type wells 112 , 113 , and ion implantation of n - type impurity ions , such as p + ions or as + ions , is performed . for example , ion implantation of an n - type impurity is conducted to a dose of 2 × 10 13 - 2 × 10 15 cm − 2 at an acceleration energy of 20 - 80 kev . the polycrystalline silicon gate electrode 14 a formed by this ion implantation is doped with n - type impurity at approximately 1 × 10 16 - 5 × 10 19 cm − 3 . regions doped with n - type impurity are formed in the p - type wells 112 , 113 on either side of the gate electrode 14 a . the distance from the surface of silicon oxide film on the side wall of the gate electrode 14 a to the edge of the region doped with n - type impurity is approximately 50 nm . in other words , the n - type impurity - doped region has an overlapping area where it extends below the gate electrode 14 a . thereupon , the resist pattern 22 is removed . as shown in fig4 f , a resist pattern 23 is formed to cover the p - type wells 112 , 113 and expose the n - type wells 111 , 114 . using this resist pattern 23 as a mask , ion implantation of a p - type impurity , such as b + or bf 2 + ions , is performed . the implantation dose of p - type impurity is similar to the n - type impurity dose of 2 × 10 13 - 2 × 10 15 cm − 2 , as illustrated in fig4 e . as shown in fig4 g , a silicon oxide film 19 approximately 200 nm thick is then deposited on the substrate surface by cvd . the silicon oxide films 19 , 13 a are then etched by reactive ion etching using chf 3 / o 2 / ar as the etching gas , to leave side wall spacers 19 a on the side walls of the gate electrode 14 a , and to expose the surface of the silicon substrate . by means of the processes described above , a p - type region 15 which is shallowly doped at low impurity concentration is formed on either side of the gate electrode of the n - type well 111 , an n - type region 16 which is doped shallowly at low impurity concentration is formed on either side of the gate electrode of the p - type well 112 , an n - type region 17 which is doped shallowly at low impurity concentration is formed on either side of the gate electrode of the p - type well 113 , and a p - type region 18 which is doped shallowly at low impurity concentration is formed on either side of the gate electrode of the n - type well 114 . these shallow low - impurity concentration ( lightly doped ) regions 15 - 18 form “ ldd regions ”. as shown in fig4 h , then a resist pattern 24 covering the high - voltage circuit p - type well 113 and the n - type wells 111 , 114 is formed to expose the p - type well 112 . using this resist pattern as a mask , ion implantation of p + or as + n - type impurity is carried out . for example , ion implantation is carried out at a dose of 2 × 10 15 cm − 2 and acceleration energy of 40 kev , to form a high - concentration source / drain region having an n - type impurity concentration of approximately 1 × 10 20 cm − 3 . the gate electrode 14 a over the p - type well 112 is similarly doped at high concentration . thereupon , the resist pattern 24 is removed . as shown in fig4 i , a high - impurity - concentration source / drain region 16 a is formed on either side of the gate electrode 14 a of the p - type well 12 by means of the ion implantation process illustrated in fig4 h . thereupon , a resist pattern 25 covering the p - type well 112 , and the high - voltage circuit p - type well 113 and n - type well 114 is formed to expose the n - type well 111 . using this resist pattern 25 as a mask , the n - type well 111 is implanted with ions of b + or bf 2 + p - type impurity . for example , ion implantation is conducted at a dose of 2 × 10 15 cm − 2 , thereby forming source / drain regions having a p - type impurity concentration of approximately 1 × 10 20 cm − 3 . the gate electrode 14 a on the n - type well 111 is also doped similarly at high concentration . since the whole of the high - voltage circuit region is covered with resist when this high concentration of impurity is implanted , the source / drain regions 17 , 18 and the gate electrodes are kept at low concentration . fig4 j shows a high - impurity - concentration source / drain region 15 a formed in this way . thereupon , the resist pattern 25 is removed . after removing the resist pattern , the substrate is annealed for 10 seconds at a temperature of approximately 1000 ° c ., for example , by rapid thermal annealing ( rta ), thereby activating the implanted impurity ions . after activation , on the high - voltage circuit region on the right - hand side of the figure , source / drain regions 17 , 18 approximately 200 nm deep are formed on either side of the gate electrode , source / drain regions 15 a approximately 200 - 300 nm deep are formed in the n - type well 111 , and source / drain regions 16 a approximately 300 - 400 nm deep are formed in the p - type well 112 . as shown in fig4 k , a ti film 30 approximately 50 nm thick is then deposited on the surface of the substrate by sputtering , for example . thereupon , the substrate is annealed for approximately 30 seconds at about 650 ° c ., thereby causing the ti film 30 , which is a refractory metal with a high melting point , to react with the underlying si to form a ti silicide layer . after this primary silicide reaction , the unreacted ti film is removed by washing out . after removing the unreacted ti film , the substrate is further annealed for approximately 0 . 1 seconds at around 950 ° c . to complete a secondary silicide reaction . in this way , silicide electrode layers 31 are formed on the source / drain regions of the mos transistor and silicide electrode layers 32 are formed on the gate electrodes 14 a , as shown in fig4 l . in the low - voltage circuit shown on the left - hand side of the figures , mos transistors are formed having a gate oxide film which is thicker at its edges than at its centre . the gate electrode and source / drain regions are doped with an impurity at high concentration . in the high - voltage circuit shown on the right - hand side of the figures , the gate oxide film is formed to be thicker at its edges than at its centre , and the gate electrode is doped with a low concentration of impurity . therefore , when an reverse - bias voltage is applied to the gate electrode , a depletion layer is created in the lower portion of the gate electrode . the mos transistor for use in a high - voltage circuit only comprises source / drain regions which are doped shallowly with a low concentration of impurity , but since silicide electrodes are formed on the surface thereof , this does not present any operational problems . in the present embodiment , the gate oxide film is made thicker at the edge regions of the gate electrode than at the centre thereof , and the impurity concentration in the gate electrode of the high - voltage circuit mos transistor is reduced . therefore , a depletion layer is created when a reverse bias is applied to the gate electrode of the high - voltage circuit mos transistor . in cooperation with varying the thickness of the gate insulating film , the breakdown voltage of the insulated gate structure is improved . the present invention has been described with reference to the preferred embodiments , but the present invention is not limited thereto . for example , the possibility of various modifications , improvements , combinations , and the like , will be self - evident to those skilled in the art . | 7 |
the contents of u . s . patent application ser . no . 13 / 457 , 815 , filed apr . 27 , 2012 , entitled “ down and / or up force adjustment system ” and u . s . patent application ser . no . 13 / 457 , 577 , filed apr . 27 , 2012 , entitled “ remote adjustment of a row unit of an agricultural device ” are both incorporated herein by reference . soil and seed characteristics are important when planting a crop and may have a direct impact on the efficiency of the planting process and ultimately on the crop yield . some of such soil characteristics include , but are not limited to , soil temperature , soil moisture , soil type , soil nutrients , etc . soil temperature directly impacts germination of the seeds planted in the soil . if the soil temperature is not at a sufficient level , the seeds will not germinate . in addition , the soil must be at an appropriate temperature for a sufficient period of time in order for the seeds to germinate . regarding soil moisture , seeds need to be enveloped within soil having an adequate moisture content in order for germination to occur . soil moisture content may vary at different soil depths and placement of the seeds into optimum soil moisture conditions will promote optimum and uniform growth of the plants resulting from the seeds and ultimately maximize crop yield . as indicated above , seed characteristics may also be important in the planting process . seed characteristics such as , for example , seed spacing , seed location within the furrow , seed temperature , and a variety of other seed characteristics may be important to the planting process . information relating to soil and seed characteristics may be gathered , stored , and analyzed for future planting processes . such historical information may be used by farmers in future to potentially realize higher crop yields . with reference to fig1 , an exemplary system 20 for determining soil and seed characteristics and analyzing the same is illustrated . the system 20 is capable of determining a wide variety of soil and seed characteristics and analyzing the soil and seed characteristics to optimize crop yield . in some exemplary embodiments , the system 20 is capable of determining and analyzing soil temperatures . in other exemplary embodiments , the system 20 is capable of determining and analyzing soil moistures . in further exemplary embodiments , the system 20 is capable of determining the presence and location of seeds in the soil and analyzing the same . in still further embodiments , the system 20 is capable of determining and analyzing more than one soil and / or seed characteristic . for example , the system 20 may determine and analyze soil temperature and soil moisture . it should be understood that the system 20 is capable of determining and analyzing any number and any combination of soil and seed characteristics and still be within the intended spirit and scope of the present invention . with continued reference to fig1 , the exemplary system 20 includes a tractor 24 and an agricultural device 28 used for the planting process . the agricultural device 28 may be a wide variety of different agricultural devices used for the planting process and all of such planting devices are intended to be within the spirit and scope of the present invention . in the illustrated exemplary embodiment , the agricultural device is a planter 28 including a plurality of row units 32 , each of which is capable of opening the soil by creating a furrow 36 ( see fig2 and 3 ), planting seeds 40 ( see fig2 ) in the furrow 36 , and covering the planted seeds 40 with soil by closing the furrow 36 . the tractor 24 couples to the planter 28 and is adapted to pull the planter 28 through a field to plant a crop . in the illustrated exemplary embodiment , the tractor 24 includes a processing unit 44 , a user interface 48 , memory 52 , a pneumatic source 56 , an electrical power source 60 , and a global positioning system ( gps ) 64 . the tractor 24 is capable of including other mechanical and electrical components and all of such components are intended to be within the intended spirit and scope of the present invention . the processing unit 44 performs the necessary processing to achieve the desired functionality of the system 20 ( described in more detail below ) and communicates with the input devices , output devices , memory , the tractor and the agricultural device ( e . g ., the planter ) as necessary to achieve such desired functionality . the user interface 48 is an exemplary output device that may include audio and video capabilities to enable a user to hear and see information . the tractor electrical power source 60 may provide the components of the tractor 24 requiring electrical power with sufficient electrical power to enable operation of the electrical components . similarly , the tractor pneumatic source 56 may provide the components of the tractor 24 requiring pneumatics with sufficient pneumatics to enable operation of the pneumatic components . the gps 64 may be a conventional gps system and may communicate with the processing unit 44 to achieve desired functionality of the system 20 ( described in more detail below ). with continued reference to fig1 , the planter 28 includes a plurality of row units 32 , an electrical power source 68 , and a pneumatic source 72 . the planter 28 may include any number of row units 32 , which is exemplified in fig1 by the annotations : row unit # 1 ; row unit # 2 ; . . . ; row unit # n . the row units 32 may be substantially the same in construction and functionality . in some exemplary embodiments , the planter electrical power source 68 may provide the components of the planter 28 requiring electrical power with sufficient electrical power to enable operation of the electrical components . similarly , in some exemplary embodiments , the planter pneumatic source 72 may provide the components of the planter 28 requiring pneumatics with sufficient pneumatics to enable operation of the pneumatic components . in the illustrated exemplary embodiment , each row unit 32 includes a row unit sensor 76 . in other exemplary embodiments , each row unit 32 may include any number of row unit sensors 76 ( see fig5 ). returning to the illustrated embodiment , the sensors 76 are capable of sensing a wide variety of soil and seed characteristics such as , for example , soil temperature , soil moisture , seed presence , seed temperature , etc . in some exemplary embodiments , the sensors 76 on the various row units 32 may sense the same characteristic . in other exemplary embodiments , the sensors 76 on the various row units 32 may sense different characteristics . the sensors 76 may require electrical power to operate and such electrical power may originate from a variety of different sources . in some exemplary embodiments , the sensors 76 may be electrically powered by the planter electrical power source 68 . in other exemplary embodiments , the sensors 76 may be electrically powered by the tractor electrical power source 60 . the above described electrical power sources 60 , 68 may be a wide variety of types of electrical power sources and all of such various electrical power sources are intended to be within the intended spirit and scope of the present invention . for example , an electrical power source may comprise any one of the following : an alternator coupled with a hydraulic motor ; an alternator coupled mechanically to an engine of the tractor ; an alternator coupled with a ground drive ; an alternator coupled with an electric motor ; a battery pack ; or any other appropriate electrical source . while the system 20 is utilized during the planting process , dust , dirt , and other debris may become airborne due to the turbulence created by the tractor 24 and planter 28 . if debris accumulates on the sensors 76 , the efficacy of the sensors 76 may deteriorate . the system 20 may include a protective member 80 ( see fig3 ) coupled to each sensor 76 to inhibit accumulation of debris on the sensors 76 . the protective member 80 may include an air inlet 84 through which pressurized air enters the protective member 80 . the pressurized air blows past the sensor 76 to dislodge any accumulated debris and to inhibit debris from settling on the sensor 76 . the pressurized air exits the protective member 80 through an open bottom end 88 of the protective member 80 . blowing of pressurized air out through the open bottom end 88 inhibits debris from rising up into the protective member 80 and accessing the sensor 76 . in some exemplary embodiments , the air may be pressurized at about 5 pounds per square inch ( psi ). in other exemplary embodiments , the air may be pressurized within a range of about 0 . 5 psi to about 250 psi . the pressurized air may originate from a variety of different sources . in some exemplary embodiments , the pressurized air may originate from the planter pneumatic source 72 . in other exemplary embodiments , the pressurized air may originate from the tractor pneumatic source 56 . referring now to fig2 , an exemplary row unit 32 and an exemplary sensor 76 of the system 20 are illustrated . the exemplary illustrated embodiments of the row unit 32 and the sensor 76 are not intended to be limiting . the system 20 may include other embodiments of row units 32 and sensors 76 and all of such embodiments are intended to be within the spirit and scope of the present invention . in the illustrated exemplary embodiment , the exemplary row unit is a planter row unit 32 , which is capable of planting seeds 40 in the soil . for simplicity , only one planter row unit 32 is illustrated and described herein . however , it should be understood that the exemplary planter 28 is capable of having any number of planter row units 32 and such numerous row units 32 may be similarly configured and have similar functionality to the illustrated and described exemplary planter row unit 32 . with continued reference to fig2 , the illustrated exemplary planter row unit 32 may be coupled to a frame or toolbar ( not shown ) of a tractor 24 by a coupling 92 . the row unit 32 may include a frame 96 coupled to the coupling 92 , a furrow opener or pair of flat circular disc blades 100 ( only one shown ) coupled to the frame 96 to open a seed trench or furrow 36 in the soil , a pair of depth gauge wheels 104 ( only one shown behind the disc blade 100 ) coupled to the frame 96 and located adjacent to and slightly to a rear of the blades 100 , a seed meter ( not shown ) which “ singulates ” seed 40 from a seed hopper ( not shown ) and deposits the seed 40 , via a seed tube 108 , into the furrow 36 formed by the twin disc opener blades 100 , and a pair of spaced apart closing wheels ( not shown ) coupled to the frame 96 and positioned to follow after the planted seed 40 for breaking down the furrow side walls on either side of the furrow 36 and covering the seed 40 , closing the furrow 40 , and firming the soil over the covered seed 40 . the gauge wheels 104 determine , at least in part , the depth of the furrow 36 formed by the opener blades 100 . the sensor 76 may be coupled to the row unit 32 in any manner and at any location . for example , the sensor 76 may be fastened , welded , adhered , bonded , unitarily formed with , or any other manner of coupling , to the row unit 32 . additionally , the sensor 76 may be coupled to a variety of different components of the row unit 32 such as , for example , the frame 96 , the seed tube 108 , or any other portion of the row unit 32 . further , the sensor 76 may be coupled to the row unit 32 at a variety of different locations such as , for example , a location following the seed tube 108 , a location preceding the seed tube 108 , a location spaced relatively high above the soil , a location spaced relatively close to the soil , a location between the opening blades 100 and the closing wheels , or any other location relative to the row unit 32 . further yet , the sensor 76 may be directed in a variety of different directions . for example , the sensor 76 may be directed straight downward , angled forward , angled rearward , or any other of a large variety of orientations . in some exemplary embodiments , the type of characteristic being sensed by the sensor 76 may determine the manner in which the sensor 76 is coupled , the component to which the sensor 76 is coupled , the location of the sensor 76 relative to the row unit 32 , and the sensor direction . in the illustrated exemplary embodiment , the sensor 76 is coupled to the frame 96 at a location between the opening blades 100 and the closing wheels , and is directed straight downward toward the soil . with this configuration , the sensor 76 is directed downward into a bottom of the open furrow 36 where the seeds 40 are at rest . referring now to fig3 , the exemplary sensor 76 shown in fig2 is shown with an exemplary protective member 80 , exemplary electrical wires 112 , and exemplary pneumatic piping 116 . the exemplary illustrated embodiments of the protective member 80 , electrical wiring 112 , and pneumatic piping 116 are not intended to be limiting . the system 20 may include other embodiments of protective members , electrical wiring , and pneumatic piping and all of such embodiments are intended to be within the spirit and scope of the present invention . in the illustrated exemplary embodiment , the protective member 80 has a hollow tube shape with an open top end 120 and an open bottom end 88 . a bottom of the sensor 76 is positioned within and secured to the open top end 120 of the protective member 80 and the open bottom end 88 is aligned with the sensor 76 and directed downward toward the soil such that the protective member 80 does not impede the sensing capabilities of the sensor 76 . the protective member 80 of the illustrated exemplary embodiment extends downward from the sensor 76 to a position disposed just above the soil . positioning the open bottom end 88 relatively close to the soil promotes accurate readings by the sensor 76 by limiting the field of view or measured zone of the sensor 76 . in this manner , soil or other distractions outside of the sensor &# 39 ; s field of view do not bias the sensor readings . alternatively , the protective member 80 may extend downward from the sensor 76 to a position closer to or further from the soil . the protective member 80 may also have a variety of different cross - sectional shapes , which may be defined along a plane perpendicular to a longitudinal extent of the protective member 80 . for example , the protective member 80 may have a circular , triangular , square , rectangular , or any other polygonal , arcuately perimetered , or combination of straight and arcuately perimetered shape . in the illustrated exemplary embodiment , the pressurized air inlet 84 is located near a top of the protective member 80 and near the bottom end of the sensor 76 . with this configuration of the pressurized air inlet 84 , pressurized air , upon entering the protective member 80 , immediately blows across the bottom of the sensor 76 and then downward toward the open bottom end 88 of the protective member 80 where the pressurized air exits the protective member 80 . the pressurized air may dislodge debris that may have accumulated on the bottom end of the sensor 76 and exits the open bottom end 88 of the protective member 80 at a sufficient pressure to inhibit debris from entering the bottom end 88 of the protective member 80 and accessing the sensor 76 . in other exemplary embodiments , the pressurized air inlet 84 may be defined in the protective member 80 at any other location . depending on the electrical power source relied upon to provide electrical power to the sensors 76 , the electrical wiring 112 will have one end coupled to the sensor 76 and the other end coupled to the desired electrical power source ( e . g ., the planter electrical power source 68 or the tractor electrical power source 60 ). similarly , depending on the pneumatic source relied upon to provide pressurized air to the inlet 84 of the protective member 80 , the pneumatic piping 116 will have one end coupled to the protective member 80 and the other end coupled to the desired pneumatic source ( e . g ., the planter pneumatic source 72 or the tractor pneumatic source 56 ). the following description includes several exemplary operations of the system 20 . these exemplary operations are provided to assist with understanding of the system 20 of the present invention and are not intended to be limiting . the system 20 of the present invention is capable of operating in a wide variety of other manners and all of such operations are intended to be within the spirit and scope of the present invention . in some exemplary embodiments , the system 20 is capable of determining the temperature of the soil . in such exemplary embodiments , the sensor 76 may be any type of sensor capable of sensing the temperature of the soil . exemplary temperature sensors may include , but are not limited to , infrared sensors , laser sensors , thermal imagers , etc . it may be desirable to know the temperature of the soil at the time of planting in order to ensure the soil temperature is at the appropriate level to facilitate germination of the seeds 40 . it may also be desirable to associate the soil temperature readings with a gps position so temperature effects on crop yield may be analyzed following harvest to aid in planting decisions for the following seasons . in such exemplary embodiments , the processing unit 44 communicates with the row unit sensors 76 and instructs each sensor 76 to take a soil temperature reading . the soil temperature readings taken by the sensors 76 are communicated to the processing unit 44 . the processing unit 44 may also assign a gps position , using the gps 64 , to each soil temperature reading and store the data pairs of soil temperature and gps position in the memory 52 for later retrieval and analysis . additionally , the processing unit 44 may communicate the soil temperature readings and the gps positions to the user interface 48 where such information will be displayed for the user to view . in some exemplary embodiments , only the soil temperatures may be displayed on the user interface 48 . the user may or may not alter planting operations based on the information displayed on the user interface 48 . in some exemplary embodiments , the system 20 is capable of determining the moisture content of the soil . it may be desirable to know the moisture content of the soil at the time of planting in order to ensure planting of the seeds 40 at a depth having optimum soil moisture content ( or at least the best available soil moisture content ), which will maximize crop yield . in such exemplary embodiments , the sensor 76 may be any type of sensor capable of sensing the required characteristics used to determine the moisture content of the soil . in one exemplary embodiment , a temperature sensor may be used to sense the temperature of the soil and the processing unit 44 may apply necessary algorithms to convert the soil temperature reading to moisture content of the soil . exemplary temperature sensors may include , but are not limited to , infrared sensors , laser sensors , infrared imaging devices , etc . alternative types of sensors may be used to determine the moisture content of the soil such as , for example , contact thermocouple thermometers , electrical conductivity sensors , etc . it may be desirable to associate the soil moisture content readings with a gps position so moisture effects on crop yield may be analyzed following harvest to aid in planting decisions for the following seasons . in exemplary embodiments where temperature sensors are utilized , the processing unit 44 communicates with the row unit sensors 76 and instructs each sensor 76 to take a soil temperature reading . the soil temperature readings taken by the sensors 76 are communicated to the processing unit 44 and the processing unit 44 may apply an algorithm to convert the soil temperature readings to soil moisture content readings . the processing unit 44 may also assign a gps position , using the gps 64 , to each soil moisture content reading and store the data pairs of soil moisture content and gps position in the memory 52 for later retrieval and analysis . additionally , the processing unit 44 may communicate the soil moisture content readings and the gps positions to the user interface 48 where such information will be displayed for the user to view . in some exemplary embodiments , only the soil moisture content may be displayed on the user interface 48 . the user may or may not alter planting operations based on the information displayed on the user interface 48 . in some exemplary embodiments , the system 20 is capable of determining the presence and location of seeds 40 in the furrow 36 . it may be desirable to determine the presence and location of the seeds 40 in the furrow 36 at the time of planting in order to ensure proper spacing between seeds 40 , proper positioning of seeds 40 within the furrow 36 , whether or not a seed 40 was deposited in the furrow 36 by the planter row unit 32 when it was intended to be deposited , and if adjacent or double seeds were deposited in a single location , etc . in such exemplary embodiments , the sensor 76 may be any type of sensor capable of sensing the required characteristics used to determine the presence and location of the seeds 40 in the furrow 36 . in one exemplary embodiment , a temperature sensor may be used to sense a temperature differential between the seeds 40 and the soil . exemplary temperature sensors may include , but are not limited to , infrared sensors , laser sensors , thermal imaging devices , etc . alternative types of sensors may be used to determine the presence and location of seeds 40 within a furrow 36 such as , for example , visible wavelength imaging sensors , ultrasonic sensors , capacitive sensors , photoelectric sensors , luminescence sensors , contrast sensors , video cameras , color sensors ( identify a difference in color between the soil and the seed ), laser distance sensors ( measures distance to bottom of furrow and measured distance changes when a seed moves under the sensor ), etc . it may be desirable to associate the location of each seed 40 with a gps position so seed performance may be analyzed following harvest to aid in planting decisions for the following seasons . in exemplary embodiments where temperature sensors are utilized to detect the presence and location of seeds 40 within a furrow 36 , the processing unit 44 communicates with the row unit sensors 76 and instructs each sensor 76 to take one or more temperature reading ( s ). if the temperature reading experiences a temperature differential , a seed 40 may be present in the measured zone and have a different temperature than the surrounding soil . if the temperature reading does not have a temperature differential and instead has a single or constant temperature reading , then a seed 40 may not be present in the measured zone and the sensor 76 may be merely measuring the temperature of the soil . alternatively , the sensors 76 may be continuously measuring temperatures of the soil , which will have a first temperature or a temperature within a first range . as the sensor 76 passes over a seed 40 , the seed 40 may have a second temperature different than the temperature of the soil and the sensor 76 will measure this second temperature . when the sensor measures a second temperature different than the soil temperature , the system 20 detects the presence of a seed 40 . the seed and soil temperature readings taken by the sensors 76 are communicated to the processing unit 44 , the processing unit 44 may assign a gps position , using the gps 64 , to each seed 40 detected by the sensors 76 , and the data pairs of detected seeds and seed gps locations are stored in the memory 52 for later retrieval and analysis . additionally , the processing unit 44 may communicate the seed detection , seed spacing , seed location within the furrow , etc ., to the user interface 48 where such information will be displayed for the user to view . any quantity and any combination of information may be displayed on the user interface 48 for viewing by the user . the user may or may not alter planting operations based on the information displayed on the user interface 48 . in some exemplary embodiments , a natural temperature differential may exist between the seed temperature and the soil temperature and such natural temperature differential may be sufficient for detection by the sensors 76 . in other exemplary embodiments , a natural temperature differential may not exist between the seed temperature and the soil temperature , or a natural temperature differential between the seed temperature and the soil temperature may not be sufficient for detection by the sensors 76 . in such exemplary embodiments , it may be desirable to heat or cool one or both of the seeds 40 and / or the soil in order to create a sufficient temperature differential that may be detected by the sensors 76 . in exemplary embodiments where seeds 40 are heated , the seeds 40 may be heated by a heater at a bottom of a central seed tank or a meter housing or , if the planter includes individual seed hoppers , the seeds 40 may be heated by a heater at a bottom of seed hoppers . in such exemplary embodiments , one or more sensors 76 may be positioned to take a temperature reading of the seeds at or near a bottom of a central seed tank or meter housing , or at or near a bottom of the seed hoppers . referring now to fig4 , another exemplary system 20 a for determining soil and seed characteristics and analyzing the same is illustrated . the components of the system 20 a illustrated in fig4 that are similar to components of the system 20 illustrated in fig1 - 3 are identified with the same reference number and an “ a ”. the system 20 a illustrated in fig4 has many similarities to the system 20 illustrated in fig1 - 3 . at least one difference between system 20 a illustrated in fig4 and system 20 illustrated in fig1 - 3 is that the agricultural device or planter 28 a includes the processing unit 44 a , the memory 52 a , and the gps 64 a rather than the tractor 24 a , which is the case in system 20 . with the processing unit 44 a included in the planter 28 a , the planter electrical power source 68 a may provide electrical power to the processing unit 44 a . even with this difference , the system 20 a is capable of performing all the same functionality as the system 20 illustrated in fig1 - 3 . it should be understood that the processing unit , the memory , the gps , and any other components of the systems may be included on either the tractor or the planter and in any combination , and be within the intended spirit and scope of the present invention . for example , the planter may include the processing unit and memory and the tractor may include the gps . also , for example , the tractor may include the processing unit and the memory and the planter may include the gps . with reference to fig5 , another exemplary operation of the system 20 will be described . in this exemplary operation , each row unit 32 includes multiple sensors 76 , with one sensor 76 ′ directed toward a top , uncut surface of the soil and a second sensor 76 ″ directed toward a bottom of the cut furrow . the first sensor 76 ′ senses a temperature of the surface of the soil and the second sensor 76 ″ senses a temperature at the bottom of the furrow . the processing unit 44 receives these temperatures and determines if a temperature differential exists between the surface of the soil and the bottom of the furrow . the processing unit 44 may use this temperature differential to determine the moisture of the soil and system operation may be adjusted ( e . g ., adjust cutting depth ) based on this determination . it should be understood that the system 20 may include sensors 76 in locations other than on the row units 32 . for example , one or more sensors may be coupled to the planter 28 and one or more sensors may be coupled to the tractor 24 . in addition , the system 20 may include sensors 76 on the row units and include one or more sensors on the planter 28 and / or the tractor 24 . in one exemplary embodiment , one sensor 76 may be coupled to each row unit 32 and one sensor may be coupled to the planter 28 or the tractor 24 . the sensors 76 coupled to the row units 32 may be directed downward toward the bottom of the furrow to sense a furrow temperature and the sensor coupled to the planter 28 or tractor 24 may be directed toward a surface of the uncut soil to sense a soil surface temperature . the processing unit 44 receives the temperature readings from the sensors , determines a temperature differential ( if one exists ), and determines soil moistures at each row unit 32 . operation of the system 20 may be adjusted based on the soil moistures . the foregoing description has been presented for purposes of illustration and description , and is not intended to be exhaustive or to limit the invention to the precise form disclosed . the descriptions were selected to explain the principles of the invention and their practical application to enable others skilled in the art to utilize the invention in various embodiments and various modifications as are suited to the particular use contemplated . although particular constructions of the present invention have been shown and described , other alternative constructions will be apparent to those skilled in the art and are within the intended scope of the present invention . | 0 |
fig1 is a receiver panel unit 18 for the wireless safety control system . the receiver panel unit includes a multi - tap hook up terminal 20 for connecting a 120 - volt ac power source or a 12 - volt dc power source . all of the relays connected to the panel operate on 12 - volt dc . thus , a 120 - volt ac to 12 - volt dc transformer 22 is installed in each switch or panel to convert power provided at 120 - volt ac to 12 - volt dc so that the user can hook up to either power source without further action . the above features and others make the safety shut - off system herein one that may be packaged and marketed for others to install . a time delay off relay 24 is connected to the 12 - volt dc source and a switch 26 is provided to initiate contact with the relay 24 . the signal received by a receiver 28 causes the time delay relay 24 to latch an internal solid state latching relay in the made position which causes the pump unit 34 to become and remain activated . upon latching , the time delay relay 24 starts timing off at an adjustable rate . one - hundred seconds would be a suitable time delay for the relay 24 to time off if a signal is not received by the time delay relay start switch 26 . when a subsequent signal is received from a transmitter 30 by the switch 26 , the relay 24 resets and begins timing again for one - hundred seconds . the one - hundred second time delay permits the system to miss receiving three consecutive signals from the transmitter 30 before the relay 24 will safety - off . the delay process and requirement for the system to miss three consecutive signals before latching off creates a very reliable safety system that does not incur false safety - off occurrences . the preferred embodiment of the invention uses a solid state device 24 that includes a latching relay and a time delay relay in one unit 24 . the solid state time delay relay 24 operates on 12 volts dc and provides a reliable and cost - effective relay . the time delay relay 24 receives its input from an output relay 32 on the radio frequency receiver 28 that receives a signal from the remote transmitter 30 . the receiver panel unit 18 further includes terminals 46 and 48 that connect to a starter of a pump unit 34 for automatic operation of the pump unit 34 or shut down circuitry of a diesel pump unit 34 . should the receiver 28 not receive a signal from the transmitter 30 in the one - hundred seconds allotted by the time delay relay 24 , the receiver panel 18 will provide an output and trigger the shut down of the pump unit 34 . typically , an irrigation system will include an irrigation control panel 36 located on the pivot system tower near the pivot axis of the pivot system . as shown , the irrigation control panel 36 has a safety circuit 38 with terminals 50 and 52 located on the irrigation control panel 36 . in the present invention , a transmitter switch panel 16 is connected to the irrigation control panel circuitry 36 and is powered by a 120 - volt ac current that is converted to 12 - volt dc . the transmitter switch panel 16 includes a repeat cycle solid state timer 42 , labeled rc 1 in fig3 that operates on the 12 - volt dc current and repeats its clock cycle at an interval of time . in the preferred embodiment , the repeat cycle timer 42 provides an on input cycle for two seconds and then times for a thirty second delay before it sends another two second on input cycle signal . these time delays may be set according to the desired application settings . the inventor has found that setting the time delay for fifteen seconds rather than thirty may cause transmitter 30 to overheat because of the transmission frequency . as long as the transmitter switch panel 16 is receiving power from the irrigation system control panel 36 , the on input signal will be generated periodically by the timer 42 and will be carried by the transmitter switch panel circuitry 16 to triggering relay contacts 44 on the transmitter 30 that is connected to the timer 42 . the transmitter triggering contacts 44 are set to the normally open position . thus , when the on input signal is received by the transmitter 30 , the transmitter contacts 44 close and send a latching signal to the receiver 28 . fig4 and 5 represent a variation of the wireless safety control system of the present invention . the system depicted in fig4 and 5 provide additional improvements to the basic control system unit shown in fig1 and 3 . in particular , the design illustrated in fig4 and 5 provides safeguards against false activation signals and isolates the wireless safety system controls from the existing controls on the irrigation system . the transmitter panel 54 of the irrigation safety control system shown in fig4 includes a three position switch 56 . when the switch is turned left to a start position 58 , the circuit causes the transmitter 60 to transmit a signal at a first channel selection , channel a , by closing the relay 62 , labeled ch - a , on the circuit . in the preferred embodiment of the invention , channel a is set as channel one on the transmitter 60 and receiver 72 . the receiver panel circuitry 70 of fig5 is configured such that a signal on channel a must be received for further operation . the switch 56 may be spring loaded when turned to the left start position 58 so that the switch 56 will automatically return to a middle or off position 64 when released . transmitting the signal on the first channel , channel a , to the receiver 72 latches a twenty ( 20 ) second time delay off relay 74 , labeled td 1 , located in the receiver panel 70 as shown in fig5 . this gives the user twenty ( 20 ) seconds to turn the three position switch 56 to the right to a third position , which is the run position 66 . the time delay of the time delay off relay 74 may be changed according to the users desired specifications . when the switch 56 is turned to the run position 66 a repeat cycle relay 68 , labeled rc 1 in fig4 is activated on the transmitter panel 54 causing the auxiliary contacts 75 to close . the repeat cycle relay 68 causes the transmitter 60 to transmit a signal at a second channel selection , channel b , by closing the channel b transmitter contacts 76 , labeled as ch - b , on the transmitter panel circuit 54 of fig4 . in the preferred embodiment of the invention , channel b is set as channel four on the transmitter 60 and receiver 72 . the channel b signal is activated by the repeat cycle relay 68 for two ( 2 ) seconds every thirty ( 30 ) seconds . the channel b signal cycle is repeated until the irrigation safety control system is turned off or until the safety circuit 38 on the irrigation system pivot control box is kicked out . as shown in fig5 when the receiver 72 receives a channel a signal and contacts 96 are closed , the internal switch 94 of time delay off relay 74 is activated and gives the user twenty seconds to turn the switch 56 to the run position 66 and cause the channel b signal to be transmitted to the receiver 72 . during the twenty seconds that the time delay off relay 74 is energized and latched , the contacts 78 of the time delay relay 74 will be closed . if the channel b signal is not received by the receiver 72 , the receiver panel 70 will not provide activation of the irrigation pump unit 34 . however , if the channel b signal is received by the receiver 72 , then the channel b contacts 100 are closed and an internal switch 98 is activated and latches a one - hundred second time delay off relay 80 , labeled as td 2 . the time delay of the second time delay off relay 80 may be varied according to the users desired settings and the timing of the repeat cycle relay 68 that causes the transmitter 60 to send a signal to the receiver 72 . latching the time delay relay 80 activates the control relay 82 , labeled as co 1 , and closes the contacts 102 . as the time delay off relay 80 is timing off for one - hundred seconds , the transmitter 60 is sending channel b signals to the receiver 72 every thirty ( 30 ) seconds as regulated by the repeat cycle relay 68 . every time the receiver 72 receives the channel b signal time delay off relay 80 resets at one - hundred seconds and begins timing off again . time delay off relay 74 will time out at the end of 20 seconds , but time delay relay 80 will stay energized because relay 82 is latching the time delay off relay 80 at contacts 90 . therefore , the receiver 72 will continue to operate until channel b signals are no longer received . the receiver 72 may miss a two signals before the time delay off relay 80 will time out and cause the system shut off . while energized , the relay 82 holds closed a remotely mounted control relay 84 , labeled as co 2 , through isolated contacts 86 on the control relay 82 . dry contacts 88 on the control relay 84 are used to operate the pump unit 34 . when channel b signals stop , the time delay off relay 80 will time out and relays 82 and 84 will de - energize causing the isolated contacts 86 and contacts 88 on the control relays 82 and 84 to open and cause the pumping unit 34 to stop . in the embodiment disclosed , the receiver 28 is the model xr - 1 receiver and receiver 72 is the model xr - 4 receiver . both preferred receivers are manufactured by linear corporation . the companion transmitters 30 or 60 are the models xt - 1 and xt - 4 , respectively , also manufactured by linear corporation . the xr - 1 and xr - 4 receivers are known for use in various applications where the receiver receives a signal and performs an operation , but is unique in its present application for an irrigation safety control system that is reliable and uses repetitive latching circuitry . the receiver 28 or 72 is used for the present irrigation safety control system because it provides a means for receiving a digital signal from a companion transmitter 30 or 60 over a distance of two to five miles . further , the transmitters and receivers described may operate without being within the line of sight of each other . the receiver units include two 8 - position switches used to set the units &# 39 ; system codes . more than 65 , 536 codes are possible for the unit . the code set in the receiver is matched to the code of the companion transmitter . these codes may be preset to match the location as not to interfere with other like safety control systems that are nearby . these codes can be easily changed if there is any conflict . the xt - 1 and xt - 4 transmitters are extended range fm frequency transmitters that send a 10 watts , 27 . 255 mhz , digital encoded , fsk modulated , signal to a companion receiver . the transmitters include switches to set one of more than 65 , 536 codes to coincide with the code set on the receiver described previously . the component transmitting panels 16 and 54 and receiver panels 18 and 70 of the present invention are enclosed in weatherproof enclosures . back plates of aluminum or similar heat conductive material may be provided , especially for the transmitter panel 16 or 54 , to act as a heat sink to help cool the panels . usually the safety system of the present invention will consist of one transmitter panel 16 or 54 , which is located at the irrigation system location ( i . e ., the pivot system tower ), and one receiver panel 18 or 70 , which is located at the pump unit 34 location . antennas are provided at each location for transmitting and receiving signals generated by the system . the safety system is expandable to accommodate combinations of multiple pivot systems or pump units , according to the farmer &# 39 ; s needs . the safety system can include additional receivers assigned complementary tasks such as activating an alarm in the farmer &# 39 ; s home , if it is within range of the transmitter , should the pump units shut down . from the preceding description of the preferred embodiment of this invention , it will be apparent to those skilled in the art that modifications or alterations may be made therein within the scope and spirit of the invention . | 6 |
a semiconductor package assembly is provided that includes a semiconductor die and a conductive clip and provides an assembly suitable for high - power applications . clip bonding is used in a number of semiconductor package assemblies , including , for example , surface mount packages , power packages and bridge rectifier packages . in one embodiment , the assembly process generally includes forming a first joint between a die pad on which the semiconductor die is mounted and forming a second joint between the semiconductor die and a conductive member of the clip . a third joint is formed between the conductive member and a lead terminal , which collectively form the clip . the surface of the conductive member and / or the surface of the lead terminal that form the third joint have grooves formed therein enhance the strength of the joint and reduce clip movement during the subsequent solder reflow process . the following description provides specific details for a thorough understanding of embodiments of a semiconductor assembly semiconductor assembly formation process . however , one skilled in the art will understand that the assembly and process described herein may be practiced without these details . in other instances , well - known structures and functions have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments described herein . one example of a semiconductor chip package 100 is schematically shown in the cross - sectional view of fig1 . as shown , a die or chip 110 is located on a die pad 115 of a lead frame 120 . by way of example the die 110 may be a two terminal device such as a diode , a transient voltage suppressor or an led . the die 110 is soldered to the surface of the die pad 115 using solder 140 so as to establish electrical contact between the die pad 115 and an electrode on a lower surface of the die 110 . likewise , the die 110 is soldered to the surface of an end of a conductive member 125 proximal to the die 110 using solder 145 . the solder 145 establishes electrical contact between the conductive member 125 and an electrode on the upper surface of the die 110 . the electrodes of the die 110 are formed from exposed regions of metal or other electrically conductive material that are in electrical contact with corresponding semiconductor device structures within the die 110 . the die pad 115 and conductive member 125 may be formed from any suitable electrically conductive material such as copper ( cu ), aluminum ( al ), nickel , titanium ( ti ), or alloys based on these metals . an end of the conductive member 125 distal to the die 110 has a contact surface 130 that is in electrical contact with an upper surface 155 of a lead terminal 135 . solder 150 is used to establish contact between contact surface 130 and the upper surface 155 of the lead terminal 135 . the conductive member 125 and the lead terminal 135 form a conductive clip . a packaging enclosure 170 is formed around the components of the semiconductor device . in particular , the die 110 , die pad 115 , conductive member 125 , solder 140 , 145 and 150 and portions of the lead frame 120 and lead terminal 135 are encapsulated or encased in an epoxy or other suitable compound as appropriate to the device . during the package assembly process , the clip is formed by placing solder on both the upper surface of the die 110 and the upper surface of the lead terminal 135 . the conductive member 115 is placed over the solder and acts like a bridge between the die 110 and lead terminal 135 . after being properly positioned , the assembly is heated in a furnace to cause the solder to reflow , which secures the conductive member 125 in place after cooling . one problem that sometimes arises during the assembly process is that the position of the conductive member 125 shifts after reflow from the designated position in which it is placed . this problem is illustrated with reference to fig2 a and 2 b . fig2 a shows a plan view of the chip subassembly before the conductive member is put in place . as shown , solder paste 180 has been applied to both the upper surface of the die 110 and the upper surface of the lead terminal 135 . fig2 b shows the chip subassembly after the conductive member 125 has been put in place and the solder has undergone reflow . in this case the conductive member 125 has shifted in the x - direction ( i . e ., the direction along the line connecting points a and b shown in fig1 ) by a distance d from its position before reflow . clip shifting as described above can cause a variety of quality problems which may result in a deterioration in device performance , including possibly device failure . for example , problems such as device shorting or high current leakage may arise . without being bound to theory , clip shifting is likely caused by an imbalance in joint strength between the joints that are formed at points a and b in fig1 . in particular , the proximal joint at point a is formed by the conductive member 125 , the solder 145 and the die 110 and , assuming the conductive member 125 is formed from copper , is composed of a copper layer , a solder layer and the chip metal ( e . g ., au ). on the other hand , the distal joint at point b is formed by the conductive member 125 , solder and the lead terminal 135 and , assuming the lead terminal 135 is also formed from copper , is composed of a copper layer , a solder layer and a copper layer . the different materials of which the two joints are formed lead to different joint strengths . in conventional chip assembly processes , clip shifting is sometimes controlled by adjusting the processing conditions . for example , the volume of the solder paste that is used and the soldering reflow temperature profile are adjusted so that chip shifting is reduced . among other problems , however , these techniques may be subject to inconsistencies over time that lead to structural differences from package to package . instead of adjusting the processing conditions , the process described herein employs grooves that are formed in the surface of the conductive member 125 and / or the lead terminal 135 where the distal joint is formed . the grooves may have any of a variety of different profiles and may be , for instance , v - shaped or u - shaped . additionally , the grooves may be patterned in different ways and may form , by way of example , a pattern of parallel lines , a grid of horizontal and vertical lines , a rhomboid pattern containing parallel lines , irregular or nonperiodic patterns , and so on . such grooves can effectively control the shift of the clip frame so that the conductive member 125 remains in the position in which it is placed . similar to fig2 a , fig3 shows a plan view of the chip subassembly before the conductive member is put in place . in this case , grooves 165 , which define a pattern of parallel lines , are formed in the surface of the lead terminal 135 which forms the distal joint b . fig4 shows another plan view of the chip subassembly before the conductive member is put in place where the grooves 165 define a grid pattern . the reduction in clip shifting that can be achieved using grooves as described above has been demonstrated in various package assembly applications . for example , in one process in which a number of semiconductor chip packages were formed , the shift in the conductive member that occurred between the time it was placed on the die and the time after reflow without the use of a grooved surface was found to range between about 2 . 52 mil and 7 . 81 mil . however , when a pattern of parallel grooves were formed in the surface of the conductive member , the shift was reduced to between about − 1 . 19 mil and 4 . 21 mil . likewise , when a grid pattern of grooves was employed , the shift was reduced to between about − 1 . 41 mil and 3 . 30 mil . fig5 is a flowchart showing one example of a method for forming a semiconductor package assembly having a clip for providing an electrical connection . the assembly process includes forming the lead frame and forming the clip structure , which includes forming grooves in the surface of the lead terminal that is to be electrically and mechanically connected to a conductive member , which is in turn electrically and mechanically connected to an electrode on a semiconductor die . at block 405 solder is applied to one or more portions of the die pad 115 of the lead frame 120 . a first surface of a semiconductor die 110 is mounted on the solder surface at block 410 . the first surface may be a bottom surface of the die , but is not so limited in other embodiments . the bottom surface may be either of an anode or cathode of the die as appropriate to the device . next at block 415 solder is applied to a second surface of the die 110 . the second surface may be a top surface of the die , but is not so limited in other embodiments . the top surface may be either of an anode or cathode of the die as appropriate to the device . in addition , at block 420 solder is applied to the grooved top surface of the lead terminal 135 . the conductive member 125 is mounted on the solder surfaces on the die 110 and the lead terminal 135 . the conductive member 125 may be properly positioned or aligned on the die and the lead terminal using any suitable means . the resulting assembly is heated to cause the solder to undergo reflow at block 425 . while the semiconductor assembly process described above uses solder to join the die to the other components of the device , alternative embodiments may use other conductive adhesive compounds to join the die to the other components of the device as appropriate to the device . finally , at block 430 a packaging enclosure is formed around the components of the semiconductor device . forming the enclosure includes encapsulating or encasing the conductive die 110 , the die pad 115 , the conductive member 125 and the portion of the lead terminal 135 that includes distal joint b in an epoxy or other suitable compound as appropriate to the device and using processes as appropriate to the device . it will be understood that spatially relative terms , such as “ above ,” “ upper ,” “ beneath ,” “ below ,” “ lower ,” and the like , may be used herein for ease of description to describe one element or feature &# 39 ; s relationship to another element ( s ) or feature ( s ) as illustrated in the figures . it will be understood that the spatially relative terms are intended to encompass different orientations of the device in use or operation in addition to the orientation depicted in the figures . for example , if the device in the figures is turned over , elements described as “ below ” or “ beneath ” other elements or features would then be oriented “ above ” the other elements or features . thus , the exemplary term “ above ” may encompass both an above and below orientation . | 7 |
with reference to the drawings , in particular to fig1 - 4 thereof , the present invention , denoted by reference number 10 , known as a portable expandable barbecue grill will be described . as seen in the figures , the present invention is a grill apparatus 10 designed and configured to adjust in length so as to provide for an increase or decrease in cooking surface . in addition , the present invention can be altered in height so as to accommodate any size person , or alternatively , to provide for a device that can easily be towed via vehicle or stored at any location . to provide for such a configuration , the present invention comprises a present invention comprises a support frame 12 that maintains a housing 14 . the support frame and housing each include an inner member 16 a , 18 a , respectively , and an outer member 16 b , 18 b respectively . the inner member 16 a of the frame being slideably mounted within the outer member 16 b of the frame . the inner member of the housing 18 a being slideably mounted within the outer member of the housing 18 b . as such , the outer member 16 b of the support frame 12 includes a horizontal support arm 20 . this support arm 20 includes an outer end and an inner end . secured to the outer ends is a pair of vertical legs 22 a . slideably mounted to the inner end of the support arm 20 is the inner frame member 16 a . to receive the inner frame member 16 a , the support arm 20 includes a groove 24 that forms a sleeve . the outer support arm 20 includes an opening , which forms a sleeve for receiving and maintaining a support arm of the inner frame . this outer support arm 20 is secured exteriorly to the outer housing 18 b . an inner support arm 26 includes an outer end and an inner end . the inner end is received within the groove 24 and as such provides for the inner support arm 26 to be slideably mounted within the groove 24 . located at the outer end of the inner support arm 26 is an attaching member 28 . this member receives the outer end of the inner housing 18 a so as to provide for the outer end of the inner housing to be secured to the inner support arm 26 via the attaching member 28 . also secured to this attaching member 28 is a second set of vertical legs 22 b . though not illustrated , a handle can be attached to this attaching member for enabling the user to grab the handle and pull or push the inner support arm 26 out or in the groove of the outer support arm 20 . accordingly , as the user pulls out the attaching member , the inner support bar slides out of the groove . since the attaching member is attached to the inner housing , the inner housing is inherently slid out or m as well . thus rendering an extended or non - extended grill . a locking device , as illustrated but not labeled , can be located on the frame . this locking device is conventional and will ensure that the inner frame member will be secured to the outer frame member when in a desired position . as seen in the various drawings , fig1 - 4 , the inner member 18 a and outer member 18 b of the housing 14 each include a lower section 30 and 32 , respectively and an upper section 34 and 36 , respectively . the lower section 30 and 32 maintains the heating element , such as lava rocks for gas grills or coals for charcoal grills . the lower section will be designed so as to accommodate the preferred heating system . the lower section 30 of the inner member 18 a , and / or the lower section 32 of the outer member 18 b include an access means 38 for allowing access to the interior for permitting maintenance to occur as necessary . hindgedly secured to lower section 30 and 32 is the upper section 34 and 36 . this upper section 34 and 36 act as the lid and as such each includes a handle 40 for lifting the lid and apertures 42 for ventilation . this aperture can include a pivotally or hingedly located cover for enabling the user to decide the need and the amount for ventilation . it is noted that the handle located on the inner housing is sized such that the housing can slid freely within the outer housing and be non - obtrusive . a thermostat 44 or the like can also be located on each lid for displaying the temperature within the housing . a shelf 46 or the like can be exteriorly attached to the housing 14 of the inner housing , outer housing or a combination thereof . to enable the slideable connection of the housing 14 , the inner member 18 a is substantially the same shape , but smaller in size to allow for inner member 18 a to slide freely into the outer member 18 b . a locking device 48 can be attached to provide for the inner member to be in a locked and secured position once the desired length is met . this locking member 48 can be any conventional locking device . this locking device can be located on the lid , on any surface of the housing or a combination thereof this will provide for a locking device that can be located at any location that will enable adequate locking capabilities . removably secured the lower section 30 and 32 , respectively , of the inner and outer housings 18 a and 18 b , respectively is a grate 50 . the grate comprises an inner grate member 52 a and an outer grate member 52 b , wherein the inner grate is slideably secured to the outer grate member . as seen in the drawings the outer grate 52 b is secured to the lower section of the outer housing via conventional means such as by hooks , groove or the like . this grate 52 b includes a plurality of parallel disposed hollow sleeves 54 . perpendicular crossbars 56 can be secured to the hollow sleeves for additional support . slideably located within each sleeve 54 is a rod 58 . each rod includes an inner end and an outer end . the inner is received within the sleeve . the outer end is secured to a perpendicularly disposed cross bar 60 . this cross bar 60 is removably secured to the inner housing via conventional means , such as by hooks or the like . optionally , the front most and back most rod can be secured to the side of the housing . this will ensure the securement of the grate . accordingly , as the inner frame is pulled outward , the housing is inherently adjusted horizontally , causing the rods to be removed from the hollow sleeves . once at the desired length is located , the housing and / or frame are locked into position , and the sleeves and rods form the cooking surface . thus providing for the sleeves and rods to form the grate . a handle can be secured to the inner and outer portions of the grate . this handle is illustrated but not labeled . as seen in the drawings , the handle is secured to the outer grate and is slideable mounted to the inner grate . to provide for a slideably connection , conventional means is utilized . in this embodiment , as shown , the handle on the inner grate includes an aperture . this aperture receives a rod of the inner grate . the rod slides within this aperture and thus enables the handle to accommodate any length grate . two handles can be located thereon to provide for a handle to be located near the front of the grill and a second handle to be located in the rear of the grill . this arrangement will ensure adequate removal of the grate . for enhancing the present invention , the legs can include lockable wheels , illustrated , but not labeled . the wheels can be enlarged to provide for the grilled to be transported across a variety of terrain , easily and effortlessly . in addition the legs can be adjusted and / or removably from the support bars . this provides for a grill that can be utilized by any cook , regardless of their size or stored for easy transportation . the legs can be adjusted via any conventional means , but preferably , and as illustrated , the legs can be adjusted via the system as shown in the figures . as seen , the support 20 and attaching member 28 include a receiving member 62 for each leg . the receiving member will lock the upper end of the leg via the use of a butter fly nut 64 . the upper portion of each leg 66 is secured to the receiving member 62 . this upper portion 66 is designed and configured to slideably receive the lower portion of the leg 68 . in order to achieve the desired height , the lower portion of the leg 68 is slid within the upper portion 66 . once the desired height is achieved , the lower portion is locked into place via a butterfly pin or the like , as shown . while the invention has been particularly shown and described with reference to an embodiment thereof , it will be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention . | 0 |
reference will now be made in detail to the embodiments of the present general inventive concept , examples of which are illustrated in the accompanying drawings , wherein like reference numerals refer to the like elements throughout . the embodiments are described below in order to explain the present general inventive concept by referring to the figures . fig1 is a perspective view illustrating a paper feeding cassette having a release unit according to an embodiment of the present general inventive concept . fig2 is a perspective view illustrating the release unit of the paper feeding cassette of fig1 . fig5 is a cross - sectional view illustrating the operation of feeding a sheet of paper from the paper feeding cassette of fig1 . referring to fig1 , 2 , and 5 , a paper feeding cassette 100 may include a cassette main body 110 , a paper stacking plate 111 , a lift unit 120 , and a release unit 130 . the paper stacking plate 111 can be installed in the cassette main body 110 to rotate in upward and downward directions , and sheets of paper s are stacked on the paper stacking plate 111 . the lift unit 120 can be placed under the paper stacking plate 111 and causes the sheets of paper s stacked on the paper stacking plate 111 to contact a pickup roller 200 or to separate from the pickup roller 200 by ascending or descending the paper stacking plate 111 , respectively . the release unit 130 applies a physical force to the lift unit 120 to compulsively descend the paper stacking plate 111 and to remove a force applied to the pickup roller when the sheets of paper s stacked on the paper stacking plate 111 are excessively pressed toward the pickup roller by a force generated by the lift unit 120 . one side of the paper stacking plate 111 can be installed in the cassette main body 110 to rotate in upward and downward directions by a pivot 112 ( fig5 ), and the sheets of paper s can be stacked on the paper stacking plate 111 . the paper stacking plate 111 can descend toward a cassette bottom 115 by its weight with the sheets of paper s stacked thereon . the lift unit 120 may include a rotating pivot 121 , a lift lever 123 , a protrusion 128 , and a connection portion 127 . the rotating pivot 121 can be supported by the cassette main body 110 to rotate and can have a plurality of protruding pins 122 opposite to each other at one side . one side of the lift lever 123 can be fixed on the rotating pivot 121 , and the other side thereof can contact the paper stacking plate 111 . the lift lever 123 can be rotated together with the rotating pivot 121 to cause the paper stacking plate 111 to ascend or descend . the protrusion 128 can be installed to be slid in a direction of a driving pivot 125 of a driving motor 124 installed in a main body of a printer ( not shown ), be elastically biased in a direction of the rotating pivot 121 by a spring 126 , and contact a release portion 1313 that will be described later . the connection portion 127 can have a plurality of cutting parts 129 into which the pins 122 can be inserted to be attached thereto or detached therefrom . the connection portion 127 is not limited to the above description , and various modifications of the connection portion 127 may be possible so that the connection portion 127 can connect or disconnect a power of the driving motor 124 to or from the rotating pivot 121 . the release unit 130 may include a release lever 131 , an opening lever 133 , and a connection lever 132 . the release lever 131 can be supported by a cassette rear plate 114 to rotate and disconnect the connection portion 127 from the rotating pivot 121 . the opening lever 133 can be supported by a cassette front plate 113 to rotate . the connection lever 132 connects the opening lever 133 to the release lever 131 and allows the release lever 131 to pivot when the opening lever 133 is pivoted . the release lever 131 may include a body 1311 , rotating portions 1312 , the release portion 1313 , and an interlocking portion 1314 . the rotating portions 1312 can protrude from both sides of the body 1311 to support the body 1311 and to rotate on the cassette rear plate 114 of the cassette main body 110 . the release portion 1313 surrounds the connection portion 127 and contacts the protrusion 128 to force the connection portion 127 of the lift unit 120 to disconnect from the rotating pivot 121 . the interlocking portion 1314 is connected to the connection lever 132 and interlocks with the connection lever 132 . the release lever 131 may be installed at an external side of the cassette main body 110 to rotate on the cassette rear plate 114 . the opening lever 133 may include a pressing portion 1331 , a main frame 1332 , support portions 1333 , an elastic portion 1334 , and a connection portion 1335 . the main frame 1332 can include the pressing portion 1331 to which a force can be applied . the support portions 1333 can protrude from both sides of the main frame 1332 to support the main frame 1332 and to rotate on the cassette front plate 113 of the cassette main body 110 . the elastic portion 1334 can surround each of the support portions 1333 . one end of the elastic portion 1334 can be fixed at a stopping portion 1336 installed in the main frame 1332 , and the other end thereof can be fixed at the cassette front plate 113 . the elastic portion 1334 applies an elastic force to the main frame 1332 . a connection portion 1335 connects the main frame 1332 to the connection lever 132 . when a user pulls the opening lever 133 by hand , a force is applied to the pressing portion 1331 , and the opening lever 133 is rotated around the supporting portion 1333 . when a force applied to the opening lever 133 is removed , the opening lever 133 is returned to its original location by the elastic portion 1334 . the connection lever 132 may include a through hole 1321 and an interference portion 1322 . the through hole 1321 can be formed at one end of the connection lever 132 so that the connection portion 1335 of the opening lever 133 is inserted into the through hole 1321 and the opening lever 133 is connected to the connection lever 132 . the interference portion 1322 can be formed at another end of the connection lever 132 in contact with the interlocking portion 1314 of the release lever 131 to interfere with the release lever 131 . the connection lever 132 may be installed in the cassette bottom 115 to slide in a direction of an arrow a ( see fig1 ). the interference portion 1322 may be installed outside of the cassette main body 110 and contact the interlocking portion 1314 to rotate the release lever 131 . referring to fig1 , a first sensor 220 to sense whether the paper feeding cassette 110 is inserted into a main body ( not shown ), and a second sensor 210 to sense whether the sheets of paper s stacked on the paper stacking plate 111 are in contact with the pickup roller 200 , may be installed in the cassette rear plate 114 or the main body of the printer ( not shown ). the operation of the release unit 130 having the above described structure will be described in more detail while referring to fig1 - 5 . fig3 and 4 are plan views illustrating the operation of the release unit 130 of the paper feeding cassette of fig1 . referring to fig1 , 2 , 3 , and 5 , when the paper feeding cassette 110 is inserted into the main body of the printer ( not shown ), the protruding pins 122 of the rotating pivot 121 are inserted into the cutting parts 129 and engage with the cutting parts 129 . when the driving motor 124 is rotated , a rotating force is applied to the rotating pivot 121 by the connection portion 127 , and the rotating pivot 121 is rotated . then , the lift lever 123 lifts the paper stacking plate 111 , and the sheets of paper s contact the pickup roller 200 . when the driving motor 124 is not properly controlled and the lift lever 123 excessively pushes the paper stacking plate 111 toward the pickup roller 200 , it is difficult to pickup the sheets of paper s using the pickup roller 200 , and it is difficult to detach the paper feeding cassette 100 from the main body of the printer ( not shown ). in this case , as shown in fig1 and 4 , when the user pulls the opening lever 133 toward the cassette front plate 113 , the connection lever 132 is slid in a direction of the arrow a ( see fig1 ), and the interference portion 1322 pulls the interlocking portion 1314 . thus , the release lever 131 is rotated around the rotating portions 1312 , and the release portion 1313 pushes the protrusion 128 toward the driving motor 124 . then , the connection portion 127 is slid toward the driving motor 124 in a direction of the driving pivot 125 , and the protruding pins 122 are detached from the cutting parts 129 so that the connection portion 127 and the rotating pivot 121 are separated from each other . when the rotating pivot 121 is separated from the connection portion 127 , the paper stacking plate 111 is rotated toward the cassette bottom 115 by a weight of its load . thus , the sheets of paper s are separated from the pickup roller 200 . as a result , the paper feeding cassette 100 may be easily detached from the main body of the printer ( not shown ). when the user removes force from the opening lever 133 , the connection portion 127 is returned to its original location by an elastic force of the spring 126 , and the release lever 131 is returned to its original location . the opening lever 133 is returned to its original location by the elastic force of the elastic portion 1334 . fig6 is a perspective view illustrating a paper feeding cassette having a release unit according to another embodiment of the present general inventive concept . fig7 is a perspective view illustrating the release unit of the paper feeding cassette of fig6 . fig8 and 9 are plan views illustrating the operation of the release unit according of the paper feeding cassette of fig6 . referring to fig6 through 9 , in a paper feeding cassette 300 of fig6 , the paper stacking plate 111 and the lift unit 120 are the same as those of the paper feeding cassette 100 of fig1 . the only difference between the paper feeding cassette 110 of fig1 and the paper feeding cassette 300 of fig6 is in a connection lever 332 and a release lever 331 of a release unit 330 . the same reference numerals as those of fig1 through 4 represent the same elements having the same functions , and thus detailed descriptions thereof will be omitted . the release lever 331 may include a body 3311 , rotating portions 3312 , a release portion 3313 , and an interlocking portion 3314 . the rotating portions 3312 may protrude from both sides of the body 3311 to support the body 3311 and to rotate on the cassette rear plate 114 of the cassette main body 110 . the release portion 3313 surrounds the connection portion 127 and contacts the protrusion 128 to force the connection portion 127 of the lift unit 120 to disconnect from the rotating pivot 121 . the interlocking portion 3314 can be connected to the connection lever 332 and can interlock with the connection lever 332 . the release lever 331 may be installed at an external side of the cassette main body 110 to rotate on the cassette rear plate 114 . the connection lever 332 may include through holes 3321 formed at both sides the connection lever 332 so that the connection portion 1335 of the opening lever 133 and the interlocking portion 3314 of the release lever 331 can be inserted into the respective through holes 3321 to connect the opening lever 133 to the release lever 331 . when the user pulls the opening lever 133 toward the cassette front plate 113 , the connection lever 332 is slid in a direction of an arrow b and pulls the interlocking portion 3314 . thus , the release lever 331 is rotated around the rotating portions 3312 , and the release portion 3313 pushes the protrusion 128 toward the driving motor 124 . then , the connection portion 127 is slid toward the driving motor 124 in a direction of the driving pivot 125 ( see fig8 ), and the protruding pins 122 are detached from the cutting parts 129 so that the connection portion 127 and the rotating pivot 121 are separated from each other . as described above , the paper feeding cassettes according to the various embodiments of the present general inventive concept have the following effects . first , when sheets of paper are stacked on a paper feeding plate and any of the sheets of paper is excessively pressed by a pickup roller during a printing operation , the paper feeding cassette can be detached from a main body without damage or deformation of any parts thereof . second , when the paper feeding cassette is detached from the main body , the paper stacking plate falls first such that the sheets of paper are prevented from being twisted by the pickup roller . although a few embodiments of the present general inventive concept have been shown and described , it will be appreciated by those skilled in the art that changes may be made in these embodiments without departing from the principles and spirit of the general inventive concept , the scope of which is defined in the appended claims and their equivalents . | 1 |
fig1 and 2 show a cylindrical drill shaft 11 that , at the front part thereof , is provided with two insert seatings 12 and 13 placed on both sides of the center line cl of the drill . axial recesses or channels formed for the chip release are designated 14 and 15 . the two insert seatings 12 , 13 are centrally hole provided for receipt of locking screws ( not shown ) for locking of cutting inserts in the seatings . each insert seating comprises a tangential support surface 16 , an axial support surface 17 as well as a radial support surface 18 . the support surfaces are arranged with additional gaps 19 in order to house a plurality of the corners of the cutting insert . the tangential support surfaces 16 are substantially parallel to radial planes through the centre line cl . each axial support surface 17 is broken so that it forms a substantially v - shaped profile , the tip of which is directed axially rearwards towards the fastening part of the shaft . a surface 20 in the centre seating 12 , which surface is opposite the radial support surface 18 , has no supporting function of the cutting insert but only aims to prevent wedging of chips between the shaft and the centre cutting insert . the section transition between the radial support surface 18 and the tangential support surface 16 is designated 21 . at said section transition 21 , the maximal stress concentration in the insert pocket arises upon full engagement with a workpiece . therefore , here it is desirable to be able to improve fatigue strength and as far as possible reduce the risk of crack initiation and propagation . according to exemplary embodiments disclosed herein , a surprisingly improved fatigue strength of materials in the tool body is obtained by submitting the material to a surface hardening and a surface treatment following thereafter , which can build in compressive stresses into the surface at the same time as the risk of crack initiation and crack propagation can be significantly reduced , on one hand in and adjacent to the insert seatings , and on the other hand at portions axially behind the insert seatings of the tool holder body . the surface hardening means that the material is submitted to a method that gives compressive stresses in the surface , e . g ., by nitrocarburizing . other methods for giving the corresponding compressive stresses may , for instance , be used , such as nitriding or ion nitriding in the way that has been described by way of introduction . the subsequent surface treatment has the purpose of modifying / machining or removing parts of or the entire phase - transition layer . this is done in order to remove initiated cracks and pores in the phase - transition layer , which are formed during the surface hardening and simultaneously build in additional compressive stresses . according to an exemplary method , said surface treatment is made in the form of shot peening , which means that a number of small balls are bombarded against the surface of materials that are to be treated . according to an alternative exemplary method , the surface treatment may be made in the form of a micro blasting , which means that the surface of the material is bombarded with small particles in such a way that a part of the material is removed . by the micro blasting , a certain plastic deformation of the holder body is achieved , whereby the compression residual stresses are increased . simultaneously , parts of or the entire phase - transition layer developed previously by the first treatment are modified / machined or removed . in the micro blasting , for instance , small balls of suitable steel material were used . the structural picture shown in fig3 shows the effect of the surface hardening . the surface zone obtained by the surface hardening comprises an outer phase - transition layer , which extends approximately 3 to 10 μm under the surface . inside this phase - transition layer , a zone has been formed having a decreasing quantity of precipitates , which zone extends to approximately 100 to 200 μm under the surface . thereby , the surface hardening has been obtained to a depth where the hardness has dropped to the same hardness value as of the base material in the tool body . the duration of the surface hardening in this first step is a time such that compressive stresses amount to a considerably higher value than the original base material . in fig3 , also the hardness profile according to the above has been illustrated more closely . in fig4 to 5 , the difference of a surface of a cutting seat before and after the disclosed exemplary treatment is shown . fig4 shows the surface of a cutting seat before the treatment and fig5 shows the surface of a cutting seat after the treatment . as is seen from this , substantially all scratches and crack initiations are gone in fig5 , which of course improves the fatigue strength . a test bar of a steel material of type ss2242 has been produced and then surface treated according to the embodiments disclosed herein . subsequently , the test bar has been subjected to a fatigue test . the result of the test is seen in fig6 , which shows the number of load cycles as a function of the applied force . in fig6 , a test bar that has been treated according to embodiments disclosed herein has been designated a ; a test bar that only has been subjected to shot peening is designated b ; a test bar that solely has been surface hardened by means of nitrocarburizing to a depth of 0 . 14 mm is designated c ; and d is an entirely untreated test bar , i . e ., a commonly hardened tool material . as is clearly seen from this , an improved strength has been obtained by a treatment first comprising nitrocarburizing followed by micro blasting / shot peening , which confirms that in this way a surprisingly synergistic improvement is achieved beyond what has been found reason to expect in the form of the sum of each one of the same treatments . after a surface hardening , for relevant tool cutting data , which is approximately 2700 n in fig6 , an increase of the fatigue service life is normally obtained by approximately 20 % by virtue of provided compressive stresses . after shot peening alone , the fatigue service life increases by approximately 100 %, by virtue of provided compressive stresses as well as a surface showing fewer crack initiations . if the material first is submitted to a surface hardening according to the above followed by a surface treatment by , e . g ., shot peening , an increase of the fatigue service life by approximately 500 % is , however , surprisingly obtained by virtue of major provision of compressive stresses and by parts of or the entire phase - transition layer having been modified / worked so that microcracks and pores in the layer have been removed . thus , the surface receives a more even geometry without cracks and scratches . the difference between a surface - treated and a not surface - treated tool is seen in fig4 and 5 . the surface treatment , preferably micro blasting / shot peening , gives a contribution of the surface tensions to a level being higher than after the surface hardening alone . by the surface hardening , followed by a separate surface treatment , the possibility is given to manufacture the product in a softer state , which no longer needs to be particularly good from a wear point of view , since the only purpose thereof is to hold the nitrocarburizing layer . this results in the fact that the same desired high level of precision can now be obtained that previously only could be attained by machining in a hardened state , in machining in this softer material . no subsequent hardening giving great deformations is needed . now , it is enough with the basic material having sufficient bearing strength . this means , in turn , that mill cutting a finished product in , e . g ., 33 hrc instead of 45 hrc is possible , which makes a great difference from a workability point of view . nitrocarburizing and shot peening give a very small deformation to the product . another risk of tool breakdown , usually is that the material in a tool handle , at the portions that are located a distance axially behind the insert seatings , may be subjected to too unfavorable bending and torsion stresses , which may lead to breakage . it has turned out that also against this type of crack initiations and risk of breakage , a clearly improved material strength has been attained by the disclosed surface treatment . the described embodiments of the present invention are intended to be illustrative rather than restrictive , and are not intended to represent every possible embodiment of the present invention . various modifications can be made to the disclosed embodiments without departing from the spirit or scope of the invention as set forth in the following claims , both literally and in equivalents recognized in law . | 8 |
fig1 is a block diagram of an embodiment of the present invention , fig2 a is a cross - sectional view schematically showing the structure of an ultrasonic wave motor , and fig2 b is a perspective view of a vibration member composed of a piezoelectric member and a resilient member . at first the structure of the ultrasonic wave motor will be explained with reference to fig2 a and 2b . a vibration member 83 is composed of a resilient member 81 and a piezoelectric member 82 adhered on a face thereof . a rotor 85 is maintained in pressure contact , across a slider 84 , on the other face of the piezoelectric member 82 , and the slider 84 and rotor 85 constitute a rotating member 86 . the piezoelectric member 82 is provided , on the surface thereof as shown in fig2 b , with four electrodes 82a , 82b , 82c , 82d , of which the electrodes 82a and 82b receive ac voltages with a mutual phase difference of π / 2 , while the electrode 82c is grounded . the electrode 82d is used for obtaining a monitor signal . the structure and function of these components will not be explained further , as they are already known , for example in the u . s . pat . no . 4 , 510 , 411 . such ultrasonic wave motor has frequency - speed characteristics as shown by a solid line c1 or a broken line c2 in fig3 . thus , when the driving frequency is higher than the resonance frequency f m , the speed increases as the driving frequency decreases . on the other hand , when the driving frequency is lower than the resonance frequency f m , the speed decreases as the driving frequency decreases . in general , the speed control is considered possible between a maximum frequency f h and a minimum frequency f l which are higher than the resonance frequency f m . the lower limit frequency f l of the oscillation band of the voltage - controlled oscillator 4 shown in fig1 is so selected as to satisfy a condition f l & gt ; f m even when the resonance frequency f m varies for example by change in the load , fluctuation in the ambient conditions or change in the pressure . the maximum frequency f h corresponds to the lowest speed of the ultrasonic wave motor , and is so selected as to provide a speed sufficiently lower than the desired speed . also the minimum frequency f l corresponds to the highest speed of the ultrasonic wave motor , and is so selected as to be higher than the resonance frequency even in the presence of a fluctuation in the load in the course of rotation of the ultrasonic wave motor at the desired speed . the solid line c1 shows the frequency - speed characteristics of the ultrasonic wave motor 8 under a certain ambient condition ( hereinafter called 1st driving condition ), and the broken line c2 indicates the characteristics under a different ambient condition ( hereinafter called 2nd driving condition ). in the present embodiment , as shown in fig4 a shaft 85a extending from the rotor 85 is coupled with a rotary encoder 9 through gears 87 , 88 , so that the rotary encoder 9 generates pulses of a frequency proportional to the speed of the rotor 85 . now referring to fig1 there are shown a reference pulse oscillator 1 for generating reference pulses of a frequency corresponding to a speed n1 to be explained later ; a phase comparator 2 for comparing the phase of the output pulses from the encoder 9 with that of the reference pulses and generating a signal corresponding to the phase difference therebetween ; an integrator 3 , called a loop filter , for integrating the output signal of the phase comparator 2 ; a voltage - controlled oscillator ( vco ) 4 for generating pulses of a frequency corresponding to the output voltage of integrator 3 ; a frequency - dividing phase - shifting circuit 5 for dividing the frequency of pulses from the vco 4 and generating signals of a mutual phase difference of π / 2 ; known power amplifiers 6a , 6b for amplifying the output signals of the frequency - dividing phase - shifting circuit 5 for supply of ac to the electrodes 82a , 82b of the piezoelectric member 82 of the ultrasonic wave motor 8 ; and switches 7 for controlling the input signals to the ultrasonic wave motor 8 , thereby switching the rotating direction thereof , or stopping the motor in the open state . the details of the phase comparator 2 and the integrator 3 are shown in fig5 . the phase comparator 2 is composed of jk - flip - flops 21a , 21b respectively receiving pulses from the encoder 9 and the reference pulse oscillator 1 ; a nand gate 22 ; nor gates 23 , 24 ; inverters 25 - 27 ; and mosfet &# 39 ; s 28a , 28b , and provides a complementary output . it is of a known structure called phase - frequency comparator , and will not therefore be explained further . the integrator 3 is composed of a resistor 31 and a capacitor 32 , constituting a lag filter . now the functions of the phase comparator 2 and the integrator 3 will be explained with reference to fig6 . in fig6 ( a ) shows the reference pulses from the reference pulse oscillator 1 , ( b ) output signal of the encoder 9 , ( c ) output signal of the phase comparator 2 , and ( d ) output signal of the loop filter 3 . when the phase of the encoder output pulses is delayed from that of the reference pulses as shown in the section i , the mosfet 28b is turned on from the upshift of the reference pulse to that of the encoder output pulse , namely for a period corresponding to the delay in phase as shown in ( c ), whereby the output of the phase comparator 2 becomes zero . at the upshift of the encoder output pulse , the mosfet &# 39 ; s 28a , 28b are turned off , whereby the output of the phase comparator 2 assumes a high - impedance state as indicated by a chain line in ( c ). as shown in ( d ), the output of the loop filter 3 descends after the mosfet 28b is turned on , but is retained when the output of the phase comparator 2 assumes the high impedance state by the turning - off of the mosfet 28b . in the section ii , the reference pulses and the encoder output pulses are of a same phase , whereby the mosfet &# 39 ; s 28a , 28b are maintained off , and the output of the loop filter 3 remains constant as shown in ( d ). in the section iii , the reference pulses are delayed in phase with respect to the encoder output pulses , whereby the mosfet 28a is turned on from the upshift of the encoder output pulse to the downshift of the reference pulse , and the phase comparator 2 releases a voltage vcc as shown in ( c ). consequently the output voltage of the loop filter 3 increases . in the section iv , the frequency of the encoder output pulses is lower than that of the reference pulses , whereby the output of the loop filter 3 decreases . in the section v , the frequency of the encoder output pulses is higher than that of the reference pulses , whereby the output of the loop filter 3 increases . thus the output of the loop filter 3 decreases when the reference pulses are advanced in phase or are of a higher frequency compared with the encoder output pulses , and vice versa . also the output does not change if the reference pulses and the encoder output pulses are of a same phase and a same frequency . fig7 shows the relationship between the input voltage and the output frequency of the vco 4 , wherein the input voltage is the output voltage of the loop filter 3 . a frequency 4 × f l is released in response to the minimum output voltage of 0 v from the loop filter 3 , and a frequency 4 × f h is released in response to the maximum output voltage vcc from the loop filter 3 . the frequency - dividing phase - shifting circuit 5 is composed , as shown in fig8 of two d - flip - flops 51 , 52 , and the set output terminal q of the flip - flop 51 is connected to the data input terminal d of the flip - flop 52 , while the inverted set output terminal q is connected to the data input terminal d of the flip - flop 51 . consequently , as shown in fig9 circuit 5 divides the output frequency of the vco 4 by 4 and generates signals having a mutual phase difference of π / 2 . in the following there will be explained the function of the driving device for an ultrasonic wave motor of the present invention . let us consider a state in which the ultrasonic wave motor 8 is driven with a speed n1 by the application of an ac voltage of a driving frequency f1 to the piezoelectric member of the motor under the 1st driving condition represented by the curve c1 in fig3 . if the driving condition changes to the 2nd one , the speed of the motor 8 changes to n2 defined by the curve c2 . the present invention is to effect pll speed control in such case , thereby maintaining the ultrasonic wave motor 8 at the speed n1 even after the change from the 1st to the 2nd driving condition . if the ultrasonic wave motor 8 and the encoder 9 rotate with a 1 : 1 speed ratio , the frequency of the encoder output pulses at the speed n1 of the motor 8 can be represented by : ## equ1 ## wherein fe is the number of output pulses of the encoder 9 per turn thereof . thus the frequency of the reference pulses of the reference pulse oscillator 1 is selected at a value determined by ( 1 ). when the switches 7 is in a neutral position shown in fig1 and the ultrasonic wave motor 8 are stopped , the frequency of the output pulses of the encoder 9 is 0 hz . in this state the phase comparator 2 receives the reference pulses , and the output voltage of the loop filter 3 decreases with time to reach 0 v after a predetermined time . consequently the output of the vco 4 becomes equal to 4 × f l as shown in fig7 . when the switches 7 are closed in either direction , the set output terminals q of the flip - flops 51 , 52 of the frequency - dividing phase - shifting circuit 5 release signals , as shown by ( b ) and ( c ) in fig9 having a frequency equal to one fourth that of the input signal from the vco 4 and having a mutual phase difference of π / 2 . consequently the ultrasonic wave motor 8 receives the ac voltage of a frequency f l and starts rotation toward the maximum revolution . in the course of gradual increase of speed of the motor 8 , while the speed is lower than n1 , the frequency of the encoder output pulses is lower than that of the reference pulses , whereby the phase comparator 2 decreases the output voltage of the loop filter 3 as explained above . consequently the output voltage of the loop filter 3 becomes approximately zero , whereby the output frequency of the vco 4 becomes equal to 4 × f l to apply the ac voltage of a frequency f l , corresponding to the maximum speed , to the ultrasonic wave motor 8 . thus the speed of the motor 8 increases with time . when the speed exceeds n1 , the frequency of the encoder output pulses becomes higher than that of the reference pulses , whereby the phase comparator 2 increases the output voltage of the loop filter 3 as explained above . consequently the output frequency of the vco 4 increases to elevate the driving frequency , thereby reducing the speed of the ultrasonic wave motor 8 . repetition of the above - explained cycles brings the driving frequency to f 1 providing the target speed n1 . the rate of convergence to that frequency can be suitably regulated by the time constant of the loop filter . then , if the driving condition varies from the 1st to the 2nd one due to a fluctuation in the load or in the pressure , the frequency - speed characteristics of the ultrasonic wave motor 8 changes from c1 to c2 shown in fig3 whereby the speed at the driving frequency f 1 increases toward n2 (& gt ; n1 ). consequently the frequency of the encoder output pulses becomes larger than that of the reference pulses , whereby the phase comparator 2 elevates the output voltage of the loop filter 3 . as the result the output frequency of the vco 4 increases , and the driving frequency varies toward the maximum frequency f h . through this operation the speed of the motor 8 is lowered , and the driving frequency converges to f 2 providing the speed n1 . as explained in the foregoing , the pll speed control circuit of the present invention maintains the speed of the ultrasonic wave motor 8 at a constant value , regardless of the change for example in the ambient condition or in the pressure . in the above - explained embodiment , the reference pulse oscillator means is formed by the reference pulse oscillator 1 , phase difference signal generating means by the phase comparator 2 , integrating means by the loop filter 3 , pulse generating means by the vco 4 , and ac voltage signal forming means by the frequency - dividing phase - shifting circuit 5 and power amplifiers 6a , 6b . the loop filter 3 is composed of a lag filter in the foregoing explanation , but it may also be composed of a lag lead filter or an active filter . also the phase comparator may be composed of a bi - directional shift register instead of jk - flip - flops . also the encoder may be of any type or structure as long as it is capable of generating pulses corresponding to the speed of the moving member . the vco 4 employed in the above - explained embodiment is so designed to generate pulse signals of a frequency 4 × f l or 4 × f h respectively in response to the input voltage of 0 v or vcc . if the vco itself does not have such characteristics , there may be obtained oscillation with a range from 4 × f l to 4 × f h by a voltage - controlled oscillator circuit explained in the following . ( 1 ) fig1 illustrates an embodiment of the voltage - controlled oscillator circuit capable of defining the upper and lower limits of the oscillation frequency by controlling the output voltage of the loop filter 3 , wherein a voltage - controlled oscillator circuit ( pulse generating means ) 400a is composed of a vco 401 and a peripheral circuit for limiting the oscillation frequency thereof . the vco 401 itself generates pulses of a frequency lower than 4 × f l in response to an input voltage of 0 v , and pulses of a frequency higher than 4 × f h in response to an input voltage vcc . a high frequency discriminator 402 releases a high - level signal when the output frequency of the vco 401 is higher than 4 × f h , or a low - level signal when the output frequency is equal to or lower than 4 × f h . a low frequency discriminator 403 releases a high - level signal or a low - level signal respectively when the output of the vco 401 is of a lower frequency than 4 × f l , or equal to or higher than 4 × f l . an analog switch 404 is closed when the output of the vco 401 is within a frequency range of 4 × f l to 4 × f h or otherwise opened , according to the output signals of the high - frequency discriminator 402 and of the low - frequency discriminator 403 . there are also shown a known voltage follower 405 , an or gate 406 for forming the logic sum of the output signals of the frequency discriminators 402 , 403 for supply to the control terminal of the analog switch 404 , an inverter 407 for inverting the output of the low - frequency discriminator 403 , a low - pass filter 408 composed of a resistor r1 and a capacitor c and having a time constant sufficiently smaller than that of the loop filter 3 , a transistor 409 to be turned on by the output signal of the low - frequency discriminator 403 through the inverter 407 when the vco 401 releases a frequency lower than 4 × f l , a transistor 410 to be turned on by the output signal of the high - frequency discriminator 402 when the vco 401 releases a frequency higher than 4 × f h , and resistors r2 - r5 . in the following there will be explained the function of the voltage - controlled oscillator circuit 400a , consisting of the vco 401 and the peripheral circuits . when the vco 401 oscillates within the frequency range of 4 × f l to 4 × f h in the course of operation of the ultrasonic wave motor 8 , the analog switch 404 is closed and the transistors 409 , 410 are both turned off . thus the integrated signal from the loop filter 3 , transmitted through the voltage follower 405 , is supplied to the vco 401 through the low - pass filter 408 , whereby the vco 401 releases pulses of a frequency corresponding to the input voltage . if the oscillation frequency of the vco 401 becomes higher than 4 × f h due to the increase of the output voltage of the loop filter 3 in this state , the high - frequency discriminator 402 releases a high - level output to open the analog switch 404 , thereby intercepting the output signal of the voltage follower 405 and turning on the transistor 410 . since the transistor 409 is turned off , the capacitor c is discharged through the resistor r5 , thereby reducing the input voltage to the vco 401 and reducing the oscillation frequency thereof . when the output frequency of the vco 401 becomes lower than 4 × f h , the output of the high - frequency discriminator 402 is inverted to the low level state thereby closing the analog switch 404 and turning off the transistor 410 . thus the capacitor c is charged , through the resistor r1 , by the output voltage of the voltage follower 405 . in response the oscillation frequency of the vco 401 starts to elevate again , and , when it exceeds 4 × f h again , it is controlled to 4 × f h or below as explained above . on the other hand , if the oscillation frequency of the vco 401 is lower than 4 × f l due to the low output voltage of the loop filter 3 , the low - frequency discriminator 403 releases a high - level output to open the analog switch 404 and to turn on the transistor 409 . since the transistor 410 is turned off , the capacitor c is charged through the resistor r3 , thereby elevating the input voltage to the vco 401 and increasing the oscillation frequency thereof . when the oscillation frequency becomes equal to or higher than 4 × f l , the output of the low - frequency discriminator 403 is shifted to the low level state , thereby closing the analog switch 404 and turning off the transistor 409 . thus the capacitor c is charged by the output voltage of the voltage follower 405 , whereby the input voltage of the the vco 401 continues to rise , and the oscillation frequency thereof is maintained at 4 × f l or higher . the voltage - controlled oscillation circuit 400a including the peripheral circuit explained above is thus capable of maintaining the oscillation frequency within a range from 4 × f l to 4 × f h , even utilizing a vco of which the oscillation frequency range does not match the above - mentioned range . ( 2 ) in the above - explained embodiment shown in fig1 , if the switch 7 is closed simultaneously with the activation of the driving circuit for the ultrasonic wave motor 8 , the oscillation frequency of the vco 401 at the starting of the motor is 4 × f l , so that the motor 8 is started with the frequency corresponding to the maximum speed and is gradually controlled to the target speed . on the other hand , for starting the motor with the minimum speed , there can be employed a voltage - controlled oscillator circuit 400b shown in fig1 , in which the same components as those in fig1 are represented by the same numbers . in the following there will principally be explained the differences from the foregoing embodiment . a switch 411 is linked with the switches 7 shown in fig1 and is in a neutral position when the ultrasonic wave motor 8 is stopped . a multiplexer 412 selects the output of the inverter 407 or that of the high - frequency discriminator 402 , for supply to the base of the transistor 409 . when switch 411 is in the neutral position , a high - level signal is supplied through a resistor r6 to the control terminal of said multiplexer 412 , which in response selects the output of the high - frequency discriminator 402 . on the other hand , when the switch 411 is closed , a low - level signal is supplied to the control terminal of the multiplexer 412 , which in response selects the output signal of the inverter 407 . a 3 - input or gate 413 receives the outputs of the switch 411 and the high - and low - frequency discriminators 402 , 403 , and sends the output to the control terminal of the analog switch 404 . when the ultrasonic wave motor 8 is stopped by the open state of the switches 7 , a high - level signal from the switch 411 is supplied , through the or gate 413 , to the control terminal of the analog switch 404 , which is in response maintained open . in response to said high - level signal , the multiplexer 412 selects the high - frequency discriminator 402 . in this state , if the oscillation frequency of the vco 401 is higher than 4 × f h , the high - frequency discriminator 402 releases a high - level signal to turn off the transistor 409 and turn on the transistor 410 . thus the capacitor c is discharged through the resistor r5 , whereby the input voltage of the vco 401 decreases and the oscillation frequency thereof also decreases . when it becomes equal to or lower than 4 × f h , the output of the high - frequency discriminator 402 is shifted to the low - level state to turn off the transistor 410 and to turn on the transistor 409 , whereby the capacitor c is charged through the resistor r3 . thus the input voltage to the vco 401 is elevated and the oscillation frequency thereof increases . when it again exceeds 4 × f h , the output of the frequency discriminator 402 is inverted and the oscillation frequency decreases . by the repetition of the above - explained functions , the vco 401 oscillates at 4 × f h when the ultrasonic wave motor 8 is stopped . when the switches 7 are closed in either direction in this state , the signal from the switch 411 to the multiplexer 412 is shifted to the low level , whereby the multiplexer 412 selects the output of the low - frequency discriminator 403 supplied through the inverter 407 . also since the input from the switch 411 to the 3 - input or gate 413 is shifted to the low level , an operation similar to that explained in relation to fig1 is conducted when either one of the outputs of the frequency discriminators 402 , 403 is shifted to the high - level state . thus the oscillation frequency of the vco 401 is controlled to a value corresponding to a predetermined speed , within a frequency range of 4 × f l to 4 × f h . ( 1 ) fig1 is an embodiment of the voltage - controlled oscillator circuit 400c for controlling the input voltage of the loop filter 3 , corresponding to fig1 . in fig1 , the same components as those in fig1 are represented by the same numbers . the circuit 400c is formed by inserting the components of the circuit shown in fig1 , except for the voltage follower 405 and the low - pass filter 408 , in the input side of the loop filter 3 as shown in fig1 . when the oscillation frequency of the vco 401 exceeds 4 × f h , the analog switch 404 is opened and the transistor 410 is turned on , whereby a capacitor 32 is discharged through the resistor r5 . thus the input voltage to the vco 401 is lowered to reduce the oscillation frequency thereof . when the oscillation frequency becomes equal to or lower than 4 × f h , the analog switch 404 is closed and the transistor 410 is turned off , whereby the capacitor 32 is charged by the output voltage of the phase comparator 2 to elevate the input voltage to the vco 401 again , thereby increasing the oscillation frequency thereof . by repetition of the above - explained operations , the oscillation frequency of the vco 401 is controlled to 4 × f h . when the vco 401 oscillates at a frequency equal to or lower than 4 × f l , the components are similar controlled by the output signal of the low - frequency discriminator 403 , whereby the oscillation frequency of the vco 401 is controlled to 4 × f l . ( 2 ) fig1 shows another embodiment corresponding to fig1 , wherein the same components as those in fig1 are represented by the same numbers , and different points only will be explained in the following . the voltage - controlled oscillator circuit 400d is formed by inserting the components shown in fig1 , except for the voltage follower 405 and the low - pass filter 408 , into the input side of the loop filter 3 , as shown in fig1 . when the switches 7 are off , the switch 411 releases a high - level signal whereby the analog switch 404 is opened and the multiplexer 412 selects the high - frequency discriminator 402 . if the output of the frequency discriminator 402 is at the low level state , the transistor 409 is turned on while the transistor 410 is turned off . consequently the capacitor 32 of the loop filter 3 is charged through the resistor r3 , thus elevating the input voltage to the vco 401 . when the oscillation frequency thereof exceeds 4 × f h , the transistor 409 is turned off while the transistor 410 is turned on to discharge the capacitor 32 through the resistor r5 , thereby reducing the input voltage to the vco 401 . when the oscillation frequency becomes equal to or less than 4 × f h , the capacitor 32 is charged again to elevate the input voltage of the vco 401 , thereby increasing the oscillation frequency thereof . by the repetition of such operations , the oscillation frequency of the vco 401 is controlled to 4 × f h when the ultrasonic wave motor 8 is stopped and , when the switches 7 are closed , the motor 8 is started with the minimum speed . the present invention is naturally applicable to the linear ultrasonic wave motor . as explained in the foregoing , the present invention controls the ultrasonic wave motor with a phase - locked loop speed control circuit , to obtain a predetermined speed in stable manner even in the presence of fluctuation in the ambient condition or in the pressure . | 7 |
a first embodiment of the present invention will be described with reference to the drawings . fig1 is an external oblique perspective view of a system 1 according to the present invention which can be used as a percent body fat measuring system for a pregnant woman and also a health care system for a pregnant woman . the system 1 roughly comprises a measuring section 2 , a display / print section 3 , and a support 4 which is fixed to a base plate for the measuring section 2 which is not shown and to the display / print section 3 . the measuring section 2 has the same constitution as that of a known body fat measuring device . the section 2 has a body weight measuring sensor therein and can measure a body weight of a patient when the patient stands on a top surface of the measuring section 2 . in addition , on the top surface of the measuring section 2 , electric current supplying electrodes 5 a and 6 a and voltage measuring electrodes 5 b and 6 b are provided so as to measure a bioelectrical impedance between feet . meanwhile , the display / print section 3 , as shown in fig1 , comprises an operating section 7 , a display section 8 for displaying input data and results of measurements , and a print section 9 for printing results of measurements . the operating section 7 in fig2 comprises a power switch 10 , a tare weight setting key 11 for setting a weight of clothing of a patient , a key 12 for setting a date and time , a group of keys 13 for setting a gender and a body type , and a numeric keypad 14 for entering data and the like . fig3 is an electric block diagram of the system 1 for a pregnant woman . the system 1 has a control section 15 which has a microcomputer therein . to the control section 15 , the switch and keys in the operating section 7 in fig2 as well as the display section 8 and the print section 9 are connected . as for the measuring section 2 , the electric current supplying electrodes 5 a and 6 a are connected to the control circuit 15 via a constant current generating circuit 16 , the voltage measuring electrodes 5 b and 6 b are connected to the control circuit 15 via a voltage measuring circuit 17 , and the body weight measuring sensor is also connected to the control circuit 15 . in addition , a memory 18 for storing data as well as a clock circuit 19 for generating date and time data such as the gestational weeks is also connected to the control circuit 15 . next , operations of the system 1 for a pregnant woman according to the present invention will be described with reference to a flowchart shown in fig4 . first of all , when the power switch 10 is pressed to be on , the control circuit 15 initializes the microcomputer , the memory 18 and the like in step s 1 . then , in step s 2 , the system 1 determines whether a date and time is already set . if it is already set , the system 1 proceeds to step s 4 . if it is not set yet , it is set in step s 3 . a detailed description of the setting of the date and time will be omitted since it is carried out in the same manner as in a commonly used device . in step s 4 , a message “ enter a weight of your clothing or a tare weight using the numeric keypad 14 . press the tare weight setting key 11 when you are done .” is displayed on the display section 8 . then , if an patient enters “ 1 . 0 kg ” by use of the numeric keypad 14 and presses the tare weight setting key 11 , the action is determined to be “ yes ” in step s 5 , and the system 1 proceeds to step s 6 where the tare weight is stored in the memory 18 . if the tare weight setting key 11 is not pressed in step s 5 , the system 1 returns to step s 4 so as to display the message urging the patient to enter the tare weight again . then , in step s 7 , a message urging the patient to press a key which matches the patient among the keys 13 for setting a gender and a body type is displayed on the display section 8 . for example , when the patient is a standard male , the patient presses a “ standard ” key in a box marked as “ male ” in fig2 . then , the input is detected in step s 8 , and the system 1 proceeds to step s 9 where data corresponding to the pressed key is stored in the memory 18 . until the key is pressed , the system 1 keeps returning to step s 7 from step s 8 and urging the patient to press the key . similarly , an age of the patient is entered and stored in the memory 18 in steps s 10 to s 12 , and a height of the patient is entered and stored in the memory 18 in steps s 13 to s 15 . then , in step s 16 , it is determined which key has been pressed in step s 8 . in this case , since the patient is a standard male , the key - pressing action is determined to be “ no ”, and the system 1 proceeds to step s 17 . in step s 17 , the system 1 starts to carry out a measurement after confirming that the patient is standing on the measuring section 2 with his toes in contact with the electric current supplying electrodes 5 a and 6 a and his heels in contact with the voltage measuring electrodes 5 b and 6 b . to determine a body weight , an output from the body weight sensor is taken into the control unit 15 , and the body weight is calculated in step s 18 . meanwhile , to determine impedance , a constant current is passed between the electrodes 5 a and 6 a from the constant current circuit 16 , a voltage between the electrodes 5 b and 6 b is measured by the voltage measuring circuit 17 , and the impedance is calculated based on a relationship between the electric current and the voltage in step s 18 . in step s 18 , the tare weight is subtracted from the measured body weight so as to determine the body weight of the patient , a percent body fat is calculated from the impedance , the body weight is multiplied by the percent body fat so as to determine a total body fat , the total body fat is subtracted from the body weight so as to determine a fat - free body weight , the fat - free body weight is multiplied by 73 . 2 %, which is an average percent body water , so as to determine a total body water , and bmi ( body mass index ) is calculated from the height and the body weight . then , the results of the calculations are not only displayed on the display section 8 but also printed out from the print section 9 in step s 19 . fig5 shows an example of the results of the calculations displayed on the display section 8 and the printout . in addition to a measuring date and time , personal data including the input gender , body type , age and height and the results of the measurements and calculations carried out in steps s 17 and s 18 are displayed and printed out . after displaying and printing out these data , the system 1 returns to step s 4 and waits for another data entry . if a “ maternity ” key is pressed in step s 8 , the key - pressing action is determined to be “ yes ”, and the system 1 proceeds to step s 20 . in step s 20 , a message “ enter your expected date of confinement .” is displayed on the display section 8 . until the date is entered by means of the numeric keypad in step s 21 , steps s 20 and s 21 are repeatedly carried out . when the expected date is entered , the input is determined to be “ yes ” in step s 21 , and the gestational weeks is calculated from the expected date of confinement and the data obtained on the measuring date in step s 22 and stored in the memory 18 in step s 23 . in a case where the “ maternity ” key has been pressed , processes to be performed in step s 17 are the same as those in a case where a key other than the “ maternity ” key is pressed . as for data calculations performed in step s 18 , the following calculations are performed in addition to the calculations described above . based on graphs ( whose data are stored in the memory 18 ) shown in fig6 , a fetal body weight , a weight of an amniotic fluid and a placental weight are read from a specific gestational weeks , and they are subtracted from the measured body weight excluding the tare weight so as to determine a body weight excluding the weight of the fetal part , and based on the body weight , a percent body fat , a total body fat , a fat - free body weight , a total body water , a total body water / total body fat ( tbw / fat ) ratio are calculated ( please note that the total body water / total body fat is utilized only when the system 1 is used as the health care system ). then , the results of the calculations are displayed on the display section 8 and printed out in the print section 9 in step s 19 . an example of the display section and the printout , as shown in fig7 , comprises the gestational weeks , a pre - correction body weight ( excluding a tare weight ) before a weight of a fetal part is subtracted therefrom , a post - correction body weight excluding the weight of the fetal part , a fetal body weight , a weight of an amniotic fluid , a weight of a placenta , a total body water / total body fat ratio and pre - correction bmi determined from the body weight ( excluding the tare weight ) before the weight of the fetal part is subtracted therefrom and a height in addition to the data in the example of fig5 ( please note that the total body water / total body fat is utilized only when the system 1 is used as the health care system ). the reason that the pre - correction bmi is calculated and displayed or printed out is to provide the data to an obstetrician - gynecologist who patient a condition of a growing fetus based on the pre - correction bmi value . similarly , for the purpose of data provision , bmi of the patient when she is not pregnant and an amount of increase in body weight determined by subtracting a body weight of the patient when she is not pregnant from the measured pre - correction body weight may be printed or displayed in addition to the example of the printout shown in fig7 or the data displayed on the display 8 . upon completion of the display and the printout in step s 19 , the system 1 returns to step s 4 and waits for another data entry . in the above data display in the maternity mode , the percent body fat is displayed only in numeric values . meanwhile , it has heretofore been found that a relationship between the gestational weeks and an appropriate percent body fat is such that in the case of a pregnant woman with a normal figure to be described later , the appropriate percent body fat increases in an early stage of pregnancy and slightly decreases in a late stage of pregnancy as shown in fig8 . therefore , if data of the graph is stored in the memory 18 and it is determined according to the gestational weeks whether the percent body fat is too low , appropriate or too high after calculation of the percent body fat in step s 18 and some advice based on the determination is displayed or printed , the pregnant woman can find means for improving her physical condition with ease . further , in the above data display in the maternity mode , the percent body fat has been determined to be too low , appropriate or too high and advice has been made based on the relationship shown in fig8 between the gestational weeks and the percent body fat . similarly , a total body fat may be determined to be too low , appropriate or too high and appropriate advice may be made based on a relationship between the gestational weeks and the total body fat . in this case , an appropriate range varies as shown in fig1 , 11 and 12 according to whether the subject &# 39 ; s body type when she is not pregnant is slim ( bmi is lower than 18 ), normal ( bmi is 18 to 24 ) or obese ( bmi is higher than 24 ). in these figures , a middle graph indicates median values of an appropriate total body fat , an upper graph indicates upper limits of the appropriate total body fat , and a lower graph indicates lower limits of the appropriate total body fat . therefore , the patient &# 39 ; s bmi in non - pregnant state is entered at some point from step s 7 to step s 15 in fig4 , and when a total body fat value which exceeds the upper graph is measured , advice such as “ your current total body fat is too high . menus of desirable meals are as follows .” is displayed on the display section 8 or printed out in the print section 9 . in addition to the determinations of the percent body fat and the total body fat indicated by fig8 , 10 , 11 and 12 , the patient &# 39 ; s bmi when she is not pregnant is entered at some point from step s 7 to step s 15 in fig4 , an amount of increase in body fat is calculated in step s 18 in fig4 for each group of weeks after conception for each body type based on the bmi of the subject when she is not pregnant as shown in fig1 , and when an amount of increase in the body fat of the patient in a certain week after conception exceeds a corresponding value in the table shown in fig1 , some advice can be displayed on the display section 8 or printed out in the print section 9 . in this case , because the pregnant woman is obese and her total body fat must decrease after the 28 th week after conception , advice urging the patient to decrease her total body fat is displayed and / or printed out if the total body fat does not decrease . further , the total body water / total body fat ratio shows onset ( s ) of edema or / and toxemia of pregnancy of the pregnant woman at the time of measurement . as shown in fig1 , a total body water ( indicated as “ tbw ” in the figure ) of a pregnant woman ( excluding a fetal part ) with a normal body type tends to slightly increase as the gestational weeks increases , and a total body fat ( indicated as “ fat ” in the figure ) of the pregnant woman tends to slightly increase as the gestational weeks increases but decrease to some degree in a late stage of pregnancy . however , once the pregnant woman develops edema or toxemia of pregnancy , the total body water sharply increases while the total body fat decreases . as a result of examining this tendency meticulously , it has been found that when a pregnant woman of normal body type develops edema or toxemia of pregnancy , a bioelectrical impedance becomes lower than an appropriate range as shown in fig1 . thereby , a total body water and a total body fat which are calculated based on the bioelectrical impedance change . further , it has also been found that a value ( tbw / fat ) obtained by dividing the total body water by the total body fat based on the bioelectrical impedance , as shown in fig1 , appears as a change in the body of the pregnant woman of normal body type and deviates from an appropriate range at least two weeks before a doctor examines the woman and finds the change . hence , the appropriate range of the total body water / total body fat is determined according to the gestational weeks , a range above the appropriate range is defined as a range ( above upper limits of the appropriate range or a range between the appropriate range and a graph a ) in which edema develops , a range above the graph a is defined as a range in which toxemia of pregnancy develops , and these ranges are stored in the memory 18 . then , the result of the calculation performed in step s 18 is compared with these ranges so as to display and print out whether edema or toxemia of pregnancy develops in step s 19 . the display and printout can be carried out at least two weeks earlier than the examination of the pregnant woman . therefore , the pregnant woman can be subjected to proper treatment before onset of edema or toxemia of pregnancy . for example , as shown in fig1 , when the result of the calculation exceeds an upper limit of the appropriate range , a message such as “ there is a possibility that you will have edema . you should be careful about an excessive intake of water and keep an intake of salt at 7 to 8 grams or lower . keep your feet high when you sleep .” is displayed on the display section 8 or printed out in the print section 9 . similarly , when the result of the calculation exceeds the graph a , a message such as “ there is a possibility that you may develop toxemia of pregnancy . you should consult a doctor .” is displayed or printed out . in addition , as measurement is made every day , the result of the calculation may exceed the above appropriate range or graph a temporarily . in that case , a message such as “ a faint sign of onset of edema is seen . please take measurements every day .” is displayed or printed out . the appropriate range shown in fig1 varies according to a body type of the pregnant woman when she is not pregnant . thus , to define the appropriate range for each possible body type of the pregnant woman when she is not pregnant , i . e ., “ slim ” with a body mass index ( bmi ) of lower than 18 , “ normal ” with a bmi of not lower than 18 and lower than 24 and “ obese ” with a bmi of not lower than 24 , lines as shown in fig1 may be defined as center lines of the appropriate ranges , and the appropriate ranges each may range a standard deviation of the corresponding center line ± σ . these appropriate ranges can be changed accordingly according to levels of determinations of edema and toxemia of pregnancy . further , in an early stage of pregnancy , morning sickness is apt to occur and a bioelectrical impedance is not stable . in addition , edema often appears from the 28 th week after conception . hence , as shown in fig1 , using a total body water / total body fat ( indicated as “ tbw / fat ” in fig1 ) value in the 20 th week after conception as a reference , onset of edema or toxemia of pregnancy may be determined based on a rate of change from the reference value . the above reference value is not limited to the value in the 20 th week after conception , and use of a value in a week in which the bioelectrical impedance is stable leads to accurate determinations of onsets of edema and toxemia of pregnancy . in this case as well , a result of calculation may go too far in a positive direction or exceed a graph b temporarily . in that case , a message such as “ a faint sign of onset of edema is seen . please take measurements every day .” is displayed or printed out . furthermore , to further improve accuracy , by use of the result of the determination of the total body water / total body fat based on fig1 and the result of the determination of the rate of change based on fig1 , the physical condition of the pregnant woman is determined based on a matrix shown in fig1 in which “ 0 ” indicates “ no edema is found . your physical condition is normal .”, “ 1 ” indicates “ edema (+): please be careful about onset of edema . you should review your life style and dietary life .”, “ 2 ” indicates “ edema (++): edema is seen . please be careful about toxemia of pregnancy .”, “ 3 ” indicates “ edema (+++): edema is clearly seen . onset of toxemia of pregnancy is suspected .” and “ 4 ” indicates “ edema (++++): edema is being worsened . onset of toxemia of pregnancy is strongly suspected .” one of these messages is displayed on the display section 8 or printed out in the print section 9 according to the determined physical condition of the pregnant woman . the determination in this case is such that when the physical condition of the pregnant woman is indicated by the same cell in the matrix over a number of successive days , a message corresponding to the cell is displayed or printed , and even if her physical condition is indicated by a different cell temporarily , a message corresponding to the last cell is displayed or printed out . next , a second embodiment of the present invention in a case where , in particular , the system 1 is used as the health care system will be described . a constitution and electric block diagram of the second embodiment are the same as those shown in fig1 and 3 of the first embodiment . a flowchart shown in fig9 of the second embodiment is the same as that shown in fig4 except that steps s 24 , s 25 and s 26 are newly added after step s 23 . in the present embodiment , unlike the first embodiment in which a fetal body weight which constitutes a weight of a fetal part in conjunction with a weight of an amniotic fluid and a weight of a placenta is estimated according to the gestational weeks in fig6 and input automatically , a fetal body weight value estimated by ultrasonotomography is manually input by use of the numeric keypad in step s 25 , stored in the memory 18 , and then used in computations performed in step s 18 . otherwise , the second embodiment is the same as the first embodiment . in the present invention , a weight of a fetal part comprising a fetal body weight , a weight of an amniotic fluid and a weight of a placenta according to the gestational weeks is stored in the memory , and computations are performed based on the stored data . however , these data may be entered in numerics by use of the numeric keypad each time measurement is made . further , a body weight before a weight of a fetal part is subtracted therefrom and the weight of the fetal part can also be entered by use of the numeric keypad . in that case , the present invention can also be applied to a hand type body fat measuring device or card - type body fat measuring device incorporating no weighing machine . in addition , in the above embodiment , the results of the computations are displayed and printed out . however , they can be expressed as graphs as shown in fig1 and 18 together with past data read from the memory 18 . further , in the above embodiment , a total body weight and a total body fat are computed by use of a corrected body weight excluding a weight of a fetal part . the computations are not limited to use of the corrected body weight , and it has also been found that results of computations performed by using a measured body weight as it is show similar tendencies . therefore , the computations may be preformed by use of the pre - correction body weight . next , a second embodiment of the present invention in a case where , in particular , the system 1 is used as the percent body fat measuring system will be described . a constitution and electric block diagram of the second embodiment are the same as those shown in fig1 and 3 of the first embodiment . a flowchart shown in fig9 of the second embodiment is the same as that shown in fig4 except that steps s 24 , s 25 and s 26 are newly added after step s 23 . in the present embodiment , unlike the first embodiment in which a fetal body weight which constitutes a weight of a fetal part in conjunction with a weight of an amniotic fluid and a weight of a placenta is estimated according to the gestational weeks in fig6 and input automatically , a fetal body weight value estimated by ultrasonotomography is manually input by use of the numeric keypad in step s 25 , stored in the memory 18 , and then used in computations performed in step s 18 . illustrative examples of a method of determining a fetal body weight by the ultrasonotomography include an osaka university method using three parameters measured by ultrasound , i . e ., a biparietal diameter of a fetal head , an area of a fetal trunk and a length of a fetal thigh bone and a tokyo university method using a circumference of a fetal trunk and an occipitofrontal diameter thereof . in this case , a weight of an amniotic fluid and a weight of a placenta are entered automatically based on a corresponding gestational weeks in fig6 . to determine a percent body fat or a total body fat in the present second embodiment , they can be determined in the same manner as in the first embodiment by use of graphs obtained by substituting the gestational weeks on horizontal axes in fig8 , 10 and 12 of the first embodiment with fetal body weights estimated by the ultrasonotomography . otherwise , the second embodiment is the same as the first embodiment . further , it is also possible to determine a fetal body weight by the ultrasonotomography and determine a weight of an amniotic fluid and a weight of a placenta from the fetal body weight . in addition , when the weight of the amniotic fluid is also determined by the known ultrasonotomography , a weight of an amniotic fluid of a pregnant woman suffering from hydramnios or oligoamnios can be determined accurately . next , a third embodiment of the present invention in a case where , in particular , the system 1 is used as the percent body fat measuring system will be described . the present inventors have paid attention to a fact that a length of uterine fundus ( length of an anterior abdominal wall from an upper edge of pubic symphysis to uterine fundus ) increases as the gestational weeks increases and have found that a fetal body weight , a weight of an amniotic fluid and a weight of a placenta have certain relationships with the length of uterine fundus as shown in fig2 . in the third embodiment , a length of uterine fundus is entered after step s 23 in fig4 of the first embodiment , and a weight of a fetal part ( total of a fetal body weight , a weight of an amniotic fluid and a weight of a placenta ) is computed based on fig2 in performing the computations in step s 18 so as to determine a percent body fat , a total body fat , a fat - free body weight and a total body water as in the case of the first embodiment . to determine a percent body fat or a total body fat in the present third embodiment , they can be determined in the same manner as in the first embodiment by use of graphs obtained by substituting the gestational weeks on horizontal axes in fig8 , 10 and 12 of the first embodiment with lengths of uterine fundus . otherwise , the third embodiment is the same as the first embodiment . further , it has been found that a weight of an amniotic fluid and a weight of a placenta have relationships shown in fig2 with a fetal body weight . therefore , in the third embodiment , it is also possible to determine only a fetal body weight from a length of uterine fundus by use of fig1 and determine a weight of an amniotic fluid and a weight of a placenta from the determined fetal body weight by use of fig1 so as to determine a weight of a fetal part which is a total of these weights . further , in the third embodiment , it is also possible to determine only a fetal body weight from a length of uterine fundus by use of fig1 and determine a weight of an amniotic fluid and a weight of a placenta from the gestational weeks by use of fig6 so as to determine a weight of a fetal part which is a total of these weights . in the present invention , a weight of a fetal part comprising a fetal body weight , a weight of an amniotic fluid and a weight of a placenta according to the gestational weeks is stored in the memory , and computations are performed based on the stored data . however , these data may be entered in numerics by use of the numeric keypad each time measurement is made . further , a body weight before a weight of a fetal part is subtracted therefrom and the weight of the fetal part can also be entered by use of the numeric keypad . in that case , the present invention can also be applied to a manual adipometer or card - type adipometer incorporating no weighing machine . in addition , in the above embodiments , the results of the computations are displayed and printed out . however , the results of the computations can be expressed as graphs as shown in fig8 , 10 , 11 and 12 together with past data read from the memory 18 so as to show changes in the past . in the above embodiments , a weight of a fetal part is determined from the gestational weeks , ultrasonotomography or a length of uterine fundus so as to determine a percent body fat and a total body fat . examining results by these methods , they can be expressed as shown in fig2 . these results are examined on an assumption that a total body fat immediately after birth ( indicated as “ after birth ”) is nearly the same as that in a late stage of pregnancy . according to the assumption , a total body fat when the gestational weeks ( indicated as “ number of weeks ”) is used is somewhat smaller than the measurement result after birth , a total body fat when ultrasonotomography ( indicated as “ ultrasound ”) is used is almost the same as the measurement result after birth , and a total body fat when a length of uterine fundus is used is slightly larger than the measurement result after birth . thereby , it is understood that any two of the gestational weeks , the ultrasonotomography and the length of uterine fundus , e . g ., a combination of the gestational weeks and the ultrasonotomography , a combination of the gestational weeks and the length of uterine fundus and a combination of the length of uterine fundus and the ultrasonotomography , or all three of them can be used in combination so as to determine a weight of a fetal part . when any two or three of these are used in combination , accuracy further improves and errors in fetal part weight measurement caused by variations in growth of a fetus ascribable to constitution and physical condition of a pregnant woman can be decreased . the present invention is a system for measuring a percent body fat or total body fat of a pregnant woman by a bioelectrical impedance method , which comprises first input means , second input means and computation means , wherein personal data of a subject such as a height and a body weight is input into the first input means , a weight of a fetal part is input into the second input means , and the computation means computes a percent body fat or total body fat by subtracting the body weight input into the second input means from the body weight input into the first input means . thereby , a pregnant woman can measure her percent body fat or total body fat with ease . further , the present invention is a system for measuring a percent body fat or total body fat of a pregnant woman by a bioelectrical impedance method , which comprises first input means , second input means , computation means and determination means , wherein personal data of a subject such as a height and a body weight is input into the first input means , a weight of a fetal part is input into the second input means , the computation means computes a percent body fat or total body fat by subtracting the body weight input into the second input means from the body weight input into the first input means , and the determination means determines the percent body fat or total body fat based on the gestational weeks , ultrasonotomography or a length of uterine fundus . thereby , a pregnant woman can measure her percent body fat or total body fat with ease and also determine the percent body fat or total body fat based on the gestational weeks , ultrasonotomography or a length of uterine fundus . also , the present invention is a health care system for a pregnant woman , which comprises input means , computation means , reference setting means , comparison means and determination means , wherein personal data of a pregnant woman such as a height and a body weight is input into the input means , the computation means computes a total body water and a total body fat by a bioelectrical impedance method , the reference setting means has reference values corresponding to a specific week after conception , the comparison means compares the results of the computations performed by the computation means with the reference values , and the determination means determines a physical condition of the pregnant woman based on the results of the comparisons made by the comparison means . thereby , health care administration including treatments for avoiding onsets of edema and toxemia of pregnancy of a pregnant woman can be performed objectively and quantitatively . further , the present invention is a health care system for a pregnant woman , which comprises input means , computation means , reference setting means , comparison means and determination means , wherein personal data of a pregnant woman such as a height and a body weight is input into the input means , the computation means computes a ratio of a total body water to a total body fat by a bioelectrical impedance method , the reference setting means has a reference ratio value corresponding to a specific week after conception , the comparison means compares a rate of change from the ratio computed by the computation means with the reference ratio value , and the determination means determines a physical condition of the pregnant woman based on the result of the comparison made by the comparison means . thereby , health care administration including treatments for avoiding onsets of edema and toxemia of pregnancy of a pregnant woman can be performed objectively and quantitatively . further , the present invention displays advice about health of a pregnant woman . therefore , it is useful and convenient for pregnant women . in addition , the present invention computes a total body water and a total body fat based on a bioelectrical impedance between feet of a pregnant woman and can detect onset of edema or toxemia of pregnancy in its early stage by measuring lower limbs where edema is apt to appear . furthermore , the present invention uses , as a reference ratio value , a ratio value in a week after conception in which a bioelectrical impedance of a pregnant woman is stable . therefore , accurate determination can be made . | 0 |
referring now to the drawings , fig1 is a diagram illustrating the concepts of the method and apparatus of the present invention . in particular , fig1 shows a portion of a detection and location system 10 which includes an array of magnetic sensors 11 that is coupled to processing apparatus ( not shown in fig1 ). the array of circular locations represent magnetic response locations 12 that are defined relative to the array of magnetic sensors 11 . as will be more fully described below , the magnetic response locations 12 have precomputed magnetic responses associated therewith which represent the magnetic field that would result if a magnetic dipole were present within each particular magnetic response location 12 at a plurality of different orientations . also shown in fig1 is a particular magnetic response location 12a in which is located a magnetic dipole 13 , represented by the submarine . also a plurality of arrows representing magnetic vectors 14 are shown extending from each sensor of the array of magnetic sensors 11 toward the particular magnetic response location 12a in which the magnetic dipole 13 is located . each sensors reading contributes a set of vectors indicative of the location of the magnetic dipole 13 , thereby forming a sensed signature that is processed using the concepts of the present invention as described below . referring to fig2 it shows a block diagram illustrating the processing steps utilized in the method and apparatus of the present invention . in particular , fig2 shows the processing steps performed within the processing apparatus of the present invention . as shown in fig2 in a first processing step 31 , data from the array of sensors 11 is processed using a linear model to predict each sensor &# 39 ; s value using the other sensors . in addition , in a second processing step 32 , the data is time averaged to perform a long term integration thereof which operates as a low pass filter on the data . this data is used to adjust the values of the data computed in the first processing step 31 . furthermore , in a third processing step 33 , the predicted data , as modified by the time averaged data , is subtracted from the measured data and the resultant data is expanded in terms of anderson &# 39 ; s functions in step 34 . prior to operational use of the present invention , and as is indicated in process step 35 , stored data is generated in terms of the anderson functions which comprise magnetic responses associated with each of the magnetic response locations 12 that represent the magnetic field that would result if a magnetic dipole were present within each particular magnetic response location 12 . the precomputed data generated in step 35 is then correlated with the resultant data generated in step 34 in processing step 36 . this correlation comprises a dot product of the two sets of data , and the correlation produces sharply increased dot product values when the two data values are substantially the same , while producing relatively low values when the data is only moderately different . a maximum , or peak , correlated value is selected in processing step 37 . a threshold is selected in step 38 , say for example , 50 % of the peak correlated value , and correlated and normalized signals above the threshold are displayed by interpolating the relative positions ( locations ) of the magnetic response location and displaying them on a monitor , for example , as is illustrated in steps 39 and 40 . referring now to fig3 it again illustrates the processing performed using the method and apparatus of the present invention in more detail and utilizing alternative terminology . specifically , the data is temporally filtered in step 41 . this is accomplished by the low pass filtering discussed with reference to fig2 . spatially coherent fluctuations are removed in step 42 . this is also accomplished by the low pass filtering discussed with reference to fig2 . then spatial matched filtering is employed to determine the existence of magnetic dipoles in the detection region of the array of sensors 12 . this is accomplished by the correlation step 36 discussed with reference to fig2 . next the matched filtered data is processed using a square law detection scheme in step 44 , and then this data is smoothed in step 45 . the smoothed data is then thresholded and magnetic dipoles located in the data are localized in step 46 . this corresponds to the threshold and interpolation steps 38 , 39 discussed with reference to fig2 . finally , the position of the detected magnetic dipoles are displayed for viewing by the user of the system 10 . referring to fig4 a - 4d , they show the formation of precomputed data from which magnetic dipoles are detected and localized using the method and apparatus of the present invention . fig4 a shows the field shape and dipole orientation associated with a particular magnetic dipole , shown as a submarine . fig4 b shows the precomputed dipole orientations for each magnetic response location identified in fig1 . in fig4 b , the dipole orientations are computed at every 45 degrees , and four orientations are shown . fig4 c illustrates the computation of contributions of each sensor of the array of sensors to each magnetic response location . the contributions are identified by the arrows pointing towards the submarine . fig4 d illustrates the matching of precomputed dipoles generated in fig4 b with the computed dipole generated from fig4 c . in particular , a match occurs when the precomputed and computed dipole orientations are aligned . fig5 a and 5b illustrate magnetic signature signals for two different dipole orientations , and in particular for output signals derived from two dimensional vector sensors ( x , y ). the output signatures shown in fig5 a and 5b are clearly different for the two dipole orientations , and are thus discernable by using the techniques employed by the present invention . fig6 is a diagram illustrating an embodiment of the dipole moment detector and localizer system 10 in accordance with the present invention used to test the principles of the present invention . the complete system 10 comprises processing apparatus that includes a macintosh ii computer 45 incorporating a sensor interface 46 . a printer 47 and disk storage apparatus 48 is coupled to the computer 45 and are provided to permit storage and output of the data generated by the system 10 . a test dipole comprising an electromagnet 50 that is coupled to an adjustable power source 49 is used as a target that is detectable by the array of sensors 11 . the output of the array of sensors 11 is coupled by way of the sensor interface 46 to the computer 45 which has two separate computer programs operating therein . the first is a data acquisition program which accepts the sensor data and converts the data into signals that are processable by a second program that implements the processing steps outlined above with reference to fig2 and 3 . the computer 45 includes a monitor on which is displayed the localized output of the program and shows the location of the electromagnet 50 as it is moved past the array of sensors 11 . in summary , the present invention employs a method that uses the array of magnetic sensors 11 to detect the presence of the dipole 13 within the field of the array . the method is based on the use of a set of functions proposed by anderson in the late 1940 &# 39 ; s in a paper entitled &# 34 ; magnetic airborne detection frequency responses &# 34 ;, nadc technical report , naval air development center , johnsville , pa ., 1949 . however the aspects of the present invention are different from the anderson approach in at least five ways . first , the present invention is different from anderson &# 39 ; s original application in that it is based on the measurement of the magnetic field on a set of spatially distributed sensors rather than measurements on a single sensor over a period of time . second , the present invention uses the functions proposed by anderson , hereafter called &# 34 ; anderson functions &# 34 ; in a different way from other applications of these functions . this is because the inner product used for the expansion of the magnetic field in terms of these functions uses an arbitrary kernel function which is optimized for the particular application . third , the present processing method results in a set of responses ( outputs ), one for each hypothesized location of a dipole 13 relative to the array of sensors 11 and for each hypothesized orientation of the dipole . only if the one of these responses is significantly different from zero , in comparison to the naturally occurring variations in the magnetic field surrounding the array of sensors 11 , will a detection of the dipole 13 be declared . the present processing method uses interpolation of the responses to obtain a greater accuracy of location and dipole orientation . fourth , the present method reduces the naturally occurring variations in the magnetic field by exploiting their high degree of spatial correlation . this is accomplished by first determining and then subtracting the long term mean of the magnetic field from each of the sensor &# 39 ; s measurements , then with a long term estimate of the cross - covariance of the sensors &# 39 ; outputs , in the absence of a dipole of interest , each sensor &# 39 ; s output is estimated from the measurements on the other sensors using standard statistical estimation techniques , and this estimate is subtracted from the measurement at each time a new measurement is made . as used herein , a long term is meant to denote any time duration which is large compared to the time durations over which variations of the magnetic field due to the dipole 13 are expected to occur . fifth , the technique is applicable whether the magnetic field measurements are measurements of each of the vector components of the field at each sensor &# 39 ; s location or whether they are measurements of the magnitude of the magnetic field at each such location . the difference in the two kinds of measurements is that a different set of anderson functions and a possibly different kernel function is used , and the detection - localization performance is different . reference is made to fig7 which illustrates a geometric arrangement representing a line of array of sensors along the x - axis with a particular search location defined with respect to parameters y 1 and theta that is useful in explaining the mathematics associated with processing performed in accordance with the present invention . fig6 is used herein to help describe the mathematics associated with processing performed by the present invention . if x ij is used to denote the measurement of the field ( vector or magnitude ) on sensor i at time j , then the measurement with the estimated mean subtracted y ik at time k is given by ## equ1 ## where n is the number of measurements over which the mean is estimated . the result of reducing the variations of the natural background magnetic field is for sensor i at time k ## equ2 ## these resulting measurements are expanded in terms of a set of anderson functions which are derivable by expanding the field due to a dipole with respect to the geometrical situation shown in fig7 . here we have assumed that the sensors are distributed along a line in the x direction . a similar development is possible for any other spatial distribution , with the case of a distribution along a rectangular grid being of particular interest . the line array of sensors is used here for simplicity of illustration of the principles . the field due to a dipole is given by ## equ3 ## with a similar expansion for the z component if it is available . in this expression the lower case a vector is a unit magnitude vector in the direction of the dipole &# 39 ; s location . m is the unit magnitude vector oriented with the dipole , m is the magnitude of the magnetic dipole moment , r is the distance to the dipole and y 1 is the perpendicular offset from the line of the sensor array to the dipole . the gamma symbol is defined to be the tangent function of the angle theta shown in fig1 . for this case the anderson functions are chosen to be ## equ4 ## for the case where the measurements are not made of the individual magnetic field components but rather of the magnitude of field ( so - called total field case ), the expansion we perform is of the magnitude - squared field ## equ5 ## where now the anderson functions are chosen to be ## equ6 ## in neither case are the anderson functions a complete orthonormal set ( cons ) of functions with respect to the lebesque measure of gamma or theta . for this reason we have chosen to generalize the definition of the inner product usually applied to anderson function applications . we define the inner product with respect to a general kernel function k . note that the integral is with respect to theta . it can be expressed in terms of an integral with respect to gamma by a change of variables . we have found that the output of our processing method depends usefully on the selection of a best kernel function k . because the selected anderson functions are not orthogonal in general relative to the selected kernel function , the expansion coefficients of a function in terms of the anderson functions are expressed in terms of integrals over the adjoint functions defined by ## equ7 ## where r - 1 is the inverse of the inner product matrix defined above . the expansion of an arbitrary field in terms of the anderson functions is given by ## equ8 ## we now have expressions in terms of generalized anderson functions for what the magnetic field of a dipole would be on a set of magnetic sensors if the dipole were located at ( x , y 1 ) with a particular orientation , phi . we also have a method of expanding the actual measurements in terms of these same anderson functions . what we do next is form the products of the expected expansion coefficients ( for a dipole located at a selected set of locations with a selected set of orientations ) with the measured expansion coefficients ( which are denoted by a subscript s ) ## equ9 ## because of the cauchy - schwarz inequality we can expect to find that this product is maximum when the two sets of expansion coefficients are equal except for a scale factor . in order to eliminate the strong dependence of the expected coefficients on the perpendicular offset distance y 1 , the present processing procedure first sets the sum of squares of these coefficients for a particular location and orientation to one by dividing by the square - root of the sum of squares . the following is a description that illustrates the generality of the magnetic detection and localization technique of the present invention . the method and the example describing the magnetic detection and localization technique of the present invention are based on a particular application of the principles disclosed ; namely it has used a particular method of generating the response function , j , also known as and described as the correlation . for the correlation , it uses a particular formulation of an inner product , in which the measured and the computed magnetic responses are each expanded in terms of anderson functions . this is indeed the preferred way of implementing the calculation of the response functions for the various chosen locations near the array of magnetic sensors , but we want to emphasize here that the present invention covers the more general concept . the basic process used in generating the responses at the various chosen locations relative to the array is the following . form an estimate of the magnetic field on the array of magnetometers , if there were a magnetic dipole located at each of the various selected locations ( these estimates are called the calculated values for the array magnetic fields ). take measurements of the magnetic field at each of the field sensors ( magnetometers ) at the time we wish to detect and localize a possibly existent magnetic dipole within the field . we remove as much of the spatial and temporal variations caused by the naturally occurring background as is possible using the temporal and spatial smoothing techniques disclosed herein . correlate the measured values with each of the calculated values for the array magnetometers , where by the term correlate we mean the multiplication of the calculated array of values with the array of measurements and summing the results over the array of sensors ( the values of these correlations for each selected location off of the array of sensors , expressed as a function of the actual dipole location is what is called the response function j for that selected location ). if one of the correlations resulting has a significantly larger value than the others and if it is greater than some predetermined threshold , a detection is declared for the location off of the array corresponding to the calculated values which resulted in the larger value of the correlation . the anderson function approach is the best way we have yet found for calculating the correlations ( which can be calculated in various ways ) and thus the best way of calculating the response functions . thus we do claim to have found an efficient way of performing the correlation , but the magnetic detection and localization technique disclosed is more general ; it works with any implementation of the correlation . expansion in terms of nonorthogonal functions : the anderson functions as selected are not orthogonal since ## equ10 ## define g , and define a set of adjoint functions by ## equ11 ## therefore to find the coefficients of h k in the expansion of an arbitrary function multiply by the adjoint h k and integrate . for example , let a be given by : we can define an inner product and thus a hilbert space by ## equ12 ## temporal gain results from matching the signal and noise bandwidths ( eckart filtering may be used ). spatial coherence gain removes fluctuations common to the sensors . spatial matching gain arises from matching the spatial filter to the field of a dipole via anderson functions . post detection gain ( track before detect gain ) allows the use of a lower recognition differential ( false alarms are controlled by requiring a viable or realistic track ). fig8 illustrates a typical operational scenario utilizing the present invention . fig8 shows a typical shore line including a harbor 65 having a shallow water shelf 60 located adjacent the harbor 65 , and a deep water area 62 distal from the harbor 65 . a plurality of submarines 13a , 13b , 13c are located in deep water , above the shallow water shelf , and at the harbor site . a control station 66 is located within the various areas adjacent the harbor 65 and includes a radar 68 that is adapted to detect and locate surface going vessels . an array of magnetic sensors 11 are disposed under the water at the base the shallow water shelf 60 and are positioned such that the sensor spacing gives full field coverage , although it is not specifically shown as such in fig8 . the array of sensors 11 may comprise passive acoustic , high frequency active acoustic or passive magnetic sensor . the array of sensors 11 are coupled to the control station 66 by way of cabling 69 and telemetry using conventional techniques well known in the sonar art . the multisensor data correlation techniques described above are implemented at the control station 66 to process the magnetic or acoustic sensor data . the system of fig8 is employed to discriminate subsurface vessels from surface vessels . the system of fig8 provides for shallow water subsurface vessel detection , harbor protection and friendly vessel delouse , particularly for slow moving undersea vessels such as the submarines 13 , and the like . fig9 is a block diagram again illustrating the detection and location apparatus 10 of the present invention . in fig9 magnetic sensor measurements are received from the array of sensors 11 and are processed such that estimates of each sensor &# 39 ; s response based on all of the other sensor &# 39 ; s data are determined , as is shown by estimate processing means 70 . in order to accomplish this , an estimate is formed based on all sensors in the array of sensors 11 as shown by sensor estimation processing means 71 . the output of the sensor estimation processing means 71 is utilized to form an estimate of sensor fluctuation cross correlation matrix , as is shown by sensor fluctuation cross correlation means 72 . the output of the sensor estimation processing means 71 and the sensor fluctuation cross correlation means 72 is employed to form the estimate of each sensor response . the estimate of each sensor response are subtracted from the original magnetic sensor measurements , as is shown by the subtraction means 73 . a large output signal is expected from the subtraction means 73 only if some anomaly occurs different from the historical statistics formed by computing the above estimated . the signal output from the subtraction means 73 is then expanded in terms of anderson functions as is illustrated in expansion means 74 . precomputed anderson functions for each of the preformed response regions that are stored in storage means 75 are correlated in correlation means 76 . this amounts to a spatial match filtering of the output signals using the precomputed anderson function data . the signal output comprising the spatially match filtered signals provided by the correlation means 76 which has a maximum correlation is selected in selection means 77 . a threshold is set in thresholding means 78 and any signals above the threshold have their position determined by position interpolation means 79 and are classified and localized by localization means 80 and displayed on a monitor 81 , for example . the output of the localization processing performed by the localization means 80 amounts to an amplitude versus time information that is indicative of the anomalies present in the magnetic field sensed by the array of sensors 11 . typically , target data is hidden in background noise . when processing acoustic sensor data , signal conditioning hydrophone sensor data with no integration time and then acoustically processing the hydrophone sensor data by performing lone term integration as described above , a time versus frequency graph is produced wherein target data is highlighted by the long term integration process . furthermore , when processing magnetometer data signal conditioned with no integration time , and then processing this data using the processing detailed in fig9 the time versus amplitude graph is indicative of the anomalies present in the magnetic field sensed by the array of sensors 11 . utilizing the above - described system and methodology , and processing data at a fixed site , provides for a system that has no geographical surprises , and reduced false alarms . the long term integration approach of the present invention is supported by the fixed position of the array of sensors 11 and the substantially nonmoving nature of the fixed site . the noise reduction aspects of the present invention is employed since knowledge may be generated about the geographical location , noise correlation which may be produced across all sensors in the array of sensors 11 , and long term surveillance is compatible with the long term data integration aspects of the present invention . in addition , the system of the present invention is difficult to countermeasure . the permanent dipole moment of a suspected target may reduced through degaussing techniques , but the induced moment caused by the target movement through the earth &# 39 ; s magnetic field cannot be minimized . also , target size creates a large anomaly relative to the earth &# 39 ; s magnetic field , which is detectable using the present invention . fig1 shows a more detailed version of the system 10 of the present invention , specifically for a vector sensor system whose sensors provide x , y and z sensor output measurements or signals . in fig1 , the array of sensors 11 , comprising sensor 1 through sensor n , are individually coupled to axis alignment computation means 90 and low pass filtering means 91 to coherent spatial noise filtering means 92 . the low pass filtering means 90 that corresponds to the portion of fig9 comprising estimate processing means 70 , sensor estimation processing means 71 , and sensor fluctuation cross correlation means 72 , 73 . the coherent spatial noise filtering means 92 corresponds to the expansion means 74 , the storage means 75 which stores the precomputed anderson function values , and the correlation means 76 in fig9 . the outputs of the coherent spatial noise filtering means 92 , comprising sets of vector component signals ( x1 , y1 , z1 , . . . xn , yn , zn ), are coupled to the dipole moment detector and localizer processing means 93 . the dipole moment detector and localizer processing means 93 corresponds to that portion of the system of fig9 comprising steps 74 and 75 relating to the computation of the anderson function expressions , the correlation step 76 , and the maximum correlation selection step 77 . the dipole moment detector and localizer processing means 93 comprises a plurality of dip orientation match filters adapted to receive each of the component signals from the individual sensors of the array of sensors 11 , which are coupled to a plurality of low pass filtering means 95 for false alarm reduction and then to selection means 96 which is adapted to select the maximum correlated value . the output of the each of the selection means 96 of the dipole moment detector and localizer processing means 93 is then individually coupled through square law detection means 97 , low pass filtering means 98 , and threshold and localization processing means 78 to the display 81 . thus there has been described new and improved dipole moment detectors and methods that provide for detection , localization and orientation of dipoles such as submarines and ocean going vessels , and the like . it is to be understood that the above - described embodiment is merely illustrative of some of the many specific embodiments which represent applications of the principles of the present invention . clearly , numerous and other arrangements can be readily devised by those skilled in the art without departing from the scope of the invention . | 6 |
according to various exemplary embodiments , systems and methods are provided to automatically collect usage and performance data for each tenant in a multi - tenant database system environment . turning now to fig1 , an exemplary multi - tenant application system 100 suitably includes a server 102 that dynamically creates virtual applications 128 a - b based upon data 132 from a common database 130 that is shared between multiple tenants . the server 102 may be referred to as , for example , an origin application server . data and services generated by the virtual applications 128 a - b are provided via network 145 to any number of client devices 140 a - b , as desired . each virtual application 128 a - b is suitably generated at run - time using a common platform 110 that securely provides access to data 132 in database 130 for each of the various tenants subscribing to system 100 . the multi - tenant application system 100 may also include any number of content delivery networks (“ cdns ”) 160 a - b , as desired . the cdns 160 a - b may contain a copy of at least some of the data 132 which may be accessible via the network 145 as described in further detail below . the multi - tenant application system 100 may also employ any number of proxy servers 170 a - b which may be used to direct traffic between the server 102 and the cdns 160 a - b . a “ tenant ” generally refers to a group of users that shares access to common data within database 130 . tenants may represent customers , customer departments , business or legal organizations , and / or any other entities that maintain data for particular sets of users within system 100 . although multiple tenants may share access to a common server 102 and database 130 , the particular data and services provided from server 102 to each tenant can be securely isolated from those provided to other tenants , as described more fully below . the multi - tenant architecture therefore allows different sets of users to share functionality without necessarily sharing each other &# 39 ; s data 132 . database 130 is any sort of repository or other data storage system capable of storing and managing data 132 associated with any number of tenants . database 130 may be implemented using any type of conventional database server hardware . in various embodiments , database 130 shares processing hardware 104 with server 102 . in other embodiments , database 130 is implemented using separate physical and / or virtual database server hardware that communicates with server 102 to perform the various functions described herein . server 102 is implemented using one or more actual and / or virtual computing systems that collectively provide a dynamic application platform 110 for generating virtual applications 128 a - b . server 102 operates with any sort of conventional computing hardware 104 , such as any processor 105 , memory 106 , input / output features 107 and the like . processor 105 may be implemented using one or more of microprocessors , microcontrollers , processing cores and / or other computing resources spread across any number of distributed or integrated systems , including any number of “ cloud - based ” or other virtual systems . memory 106 represents any non - transitory short or long term storage capable of storing programming instructions for execution on processor 105 , including any sort of random access memory ( ram ), read only memory ( rom ), flash memory , magnetic or optical mass storage , and / or the like . input / output features 107 represent conventional interfaces to networks ( e . g ., to network 145 , or any other local area , wide area or other network ), mass storage , display devices , data entry devices and / or the like . in a typical embodiment , application platform 110 gains access to processing resources , communications interfaces and other features of hardware 104 using any sort of conventional or proprietary operating system 108 . as noted above , server 102 may be implemented using a cluster of actual and / or virtual servers operating in conjunction with each other , typically in association with conventional network communications , cluster management , load balancing and other features as appropriate . when the data and services generated by the virtual applications 128 a - b are provided via network 145 to the any number of client devices 140 a - b a log of each event is stored in log 150 . as discussed above , some of the data 132 stored in the database 130 may also be stored in any number of cdns 160 a - b . cdns are usually deployed in multiple locations , often over multiple backbones . these cdns 160 a - b cooperate with each other , the server 102 and any proxy servers 17 a - b to satisfy requests for content by end users of client devices 140 a - b , transparently moving content to optimize the delivery process . optimization can take the form of reducing bandwidth costs , improving end - user performance ( reducing page load times and improving user experience ), or increasing global availability of content . similar to the log 150 in server 102 , the cdns 160 a - b each have a log 162 a - b storing a log of each event . each proxy server 172 a - b may also have a log for storing events . the logs ( log 150 , 162 a - b and 172 a - b ) may record when an action occurs . for example , an entry may be added to a logs whenever a page is viewed or bandwidth is used on the respective server . the logs may also increment a counter associated with a page whenever the page is viewed . a tier may also be associated with each action by the respective server . the tier associated with the page view will often depend upon the content on the page . any number of tiers can be associated with the page views . the logs may also store a bandwidth consumed by each page view and and / or a request time associated with each page request . in another embodiment , the logs 150 , 162 a - b and 172 a - b may store a request time , the time the respective server within the multi - tenant application system 100 takes to serve a customer request . the server 102 collects performance data from logs 150 , 162 a - b and / or 172 a - b and aggregates the data into a single database as described in further detail below . in another embodiment , a separate billing server ( not illustrated ) may collect the performance data from server 102 , the cdns 160 a - b and any proxy servers 170 a - b . in one embodiment , for example , the proxy servers 170 a - b may be reverse proxy servers . fig2 illustrates another exemplary multi - tenant application system 200 in accordance with an embodiment . the multi - tenant application system 200 includes client devices 140 a - b , network 145 , cdns 160 a - b and proxy servers 170 a - b similar to those described above . the multi - tenant application system 200 further includes a server 102 that dynamically creates virtual applications 128 a - b based upon data 132 from a common database 130 that is shared between multiple tenants . data and services generated by the virtual applications 128 a - b are provided via network 145 to any number of client devices 140 a - b , as desired . each virtual application 128 a - b is suitably generated at run - time using a common platform 110 that securely provides access to data 132 in database 130 for each of the various tenants subscribing to system 100 . data 132 may be organized and formatted in any manner to support multi - tenant application platform 110 . in various embodiments , data 132 is suitably organized into a relatively small number of large data tables to maintain a semi - amorphous “ heap ”- type format . data 132 can then be organized as needed for a particular virtual application 128 a - b . in various embodiments , conventional data relationships are established using any number of pivot tables 234 that establish indexing , uniqueness , relationships between entities , and / or other aspects of conventional database organization as desired . further data manipulation and report formatting is generally performed at run - time using a variety of meta - data constructs . metadata within a universal data directory ( udd ) 236 , for example , can be used to describe any number of forms , reports , workflows , user access privileges , business logic and other constructs that are common to multiple tenants . tenant - specific formatting , functions and other constructs may be maintained as tenant - specific metadata 238 a - b for each tenant , as desired . rather than forcing data 132 into an inflexible global structure that is common to all tenants and applications , then , database 130 is organized to be relatively amorphous , with tables 234 and metadata 236 - 238 providing additional structure on an as - needed basis . to that end , application platform 110 suitably uses tables 234 and / or metadata 236 , 238 to generate “ virtual ” components of applications 128 a - b to logically obtain , process , and present the relatively amorphous data 132 from database 130 . application platform 110 is any sort of software application or other data processing engine that generates virtual applications 128 a - b that provide data and / or services to client devices 140 a - b . virtual applications 128 a - b are typically generated at run - time in response to queries received from client devices 140 a - b . in the example illustrated in fig2 , application platform 110 includes a bulk data processing engine 212 , a query generator 214 , a search engine 216 that provides text indexing and other search functionality , and a runtime application generator 220 . each of these features may be implemented as a separate process or other module , and many equivalent embodiments could include different and / or additional features , components or other modules as desired . runtime application generator 220 dynamically builds and executes virtual applications 128 a - b in response to specific requests received from client devices 140 a - b . virtual applications 128 a - b created by tenants are typically constructed in accordance with tenant - specific metadata 238 , which describes the particular tables , reports , interfaces and / or other features of the particular application . in various embodiments , each virtual application 128 a - b generates dynamic web content that can be served to a browser or other client program 142 a - b associated with client device 140 a - b , as appropriate . application generator 220 suitably interacts with query generator 214 to efficiently obtain multi - tenant data 132 from database 130 as needed . in a typical embodiment , query generator 214 considers the identity of the user requesting a particular function , and then builds and executes queries to database 130 using system - wide metadata 236 , tenant specific metadata 238 , pivot tables 234 and / or any other available resources . query generator 214 in this example therefore maintains security of the multi - tenant database 130 by ensuring that queries are consistent with access privileges granted to the user that initiated the request . data processing engine 212 performs bulk processing operations on data 132 such as uploads or downloads , updates , online transaction processing and / or the like . in many embodiments , less urgent bulk processing of data 132 can be scheduled to occur as processing resources become available , thereby giving priority to more urgent data processing by query generator 214 , search engine 216 , virtual applications 128 a - b and / or the like . again , the various components , modules and inter - relationships of other application platforms 120 may vary from the particular examples described herein . in operation , then , developers use application platform 110 to create data - driven virtual applications 128 a - b for the tenants that they support . such applications 128 a - b may make use of interface features such as tenant - specific screens 224 , universal screens 222 or the like . any number of tenant - specific and / or universal objects 226 may also be available for integration into tenant - developed applications 128 a - b . data 132 associated with each application 128 a - b is provided to database 130 , as appropriate , and stored until requested , along with metadata 138 that describes the particular features ( e . g ., reports , tables , functions , etc .) of tenant - specific application 128 a - b until needed . data and services provided by server 102 can be retrieved using any sort of personal computer , mobile telephone , tablet or other network - enabled client device 140 on network 145 . typically , the user operates a conventional browser or other client program 242 to contact server 102 via network 145 using , for example , the hypertext transport protocol ( http ) or the like . the user typically authenticates his or her identity to the server 102 to obtain a session identification (“ sessionld ”) that identifies the user in subsequent communications with server 102 . when the identified user requests access to a virtual application 128 a - b , application generator 220 suitably creates the application at run time based upon metadata 236 and 238 , as appropriate . query generator 214 suitably obtains the requested data 132 from database 130 as needed to populate the tables , reports or other features of virtual application 128 a - b . as noted above , the virtual application 128 a - b may contain java , activex or other content that can be presented using conventional client software 142 a - b running on client device 140 a - b ; other embodiments may simply provide dynamic web or other content that can be presented and viewed by the user , as desired . whenever a request is received by a server connected to the multi - tenant application system 200 ( i . e ., server 102 , cnd 160 a - b , proxy server 170 a - b , etc ), the respective server creates a log entry in a respective log . the servers within the multi - tenant application system 200 may log page views , bandwidth usage , request time and any other usage or performance data as needed . fig3 illustrates a method 300 for collecting performance data in accordance with an embodiment . the server 102 obtains the page views from each log ( e . g . logs 150 , 162 a - b , 172 , etc .). ( step 310 ). the server 102 may obtain the page views at any time and at any frequency . in one embodiment , for example , the server 102 may obtain the page views at a predetermined time each day . the server 102 may obtain the page views once per day , multiple times per day , once per week , multiple times per week , once per month and / or multiple times each month . the server 102 may then obtain the bandwidth values stored in each log ( e . g . logs 150 , 162 a - b , 172 , etc .). ( step 320 ). the server 102 may obtain the bandwidth values simultaneously with the pages views or at a separate time ( before or after ). the bandwidth values may be obtained at the same frequency as the page views or at a different frequency . in one embodiment , for example , the bandwidth values may be obtained one hour after the server 102 obtains the page views . the server 102 may obtain the page views and bandwidth values for any predetermined period of time . in one embodiment , for example , the frequency at which the page views and bandwidth values are obtained may differ from the period of time the page views and bandwidth values are obtained . for example , in one embodiment the server 102 may obtain page view and bandwidth values once a day , each time obtaining the data , for example , for the past two days or three days . by obtaining the same data multiple times over different days , the server 102 may verify that the data is correct and that there have been no changes , as discussed in further detail below . if the server 102 fails to obtain the data from any one of the servers ( cdns , proxy servers , etc ) at steps 310 or 320 , the server 102 can try to re - obtain the data . ( steps 312 and 322 ). the server 102 may try to re - obtain the data immediately after the failed attempt , or at a subsequent time . in one embodiment , if the server 102 fails to obtain data from one of the cdns , for example , the server 102 may increase the amount of data captured on a subsequent obtain . for example , if the server 102 failed in an attempt to obtain the past two days values for page views , the server 102 in the subsequent obtain may attempt to obtain the past three days values for page views . if the logs are recording events which the server 102 is uninterested in , the server 102 may filter the page views and bandwidth data obtained from the logs . ( step 330 ). for example , for billing purposes the server 102 may not be interested in static content ( e . g ., images , javascript , css files ) or ajax requests . in another embodiment , for example , the server 102 may also filter out test data . if the server is monitoring performance , other types of page views may be filtered . furthermore , the filtering may be done on a tenant - by - tenant fashion . for example , certain events may be filtered for one tenant based upon filtering settings associated with that tenant , but the event may not be filtered for another tenant . the filtering can be performed by any known manner . for example , in one embodiment the server 102 may perform the filtering by analyzing a uniform resource locator (“ url ”) associated with each page view and bandwidth value . in another embodiment only the page views may be filtered . the server 102 may , for example , parse a url associated with a page view to determine a type associated with the page view . the server 102 , at step 330 , may also associate a tier with each page view based upon the type associated with each page view . in one embodiment , for example , a page which is associated with media content my have a higher tier than a page which is associated with plain text . the tiers , for example , may be billed at different rates , or may be used to partition the data into different performance categories . in another embodiment an identification code identifying a content type may be stored with each entry in the logs ( e . g . logs 150 , 162 a - b , 172 , etc .). the server may obtain the identification code and filter the obtained information based upon the identification code . in yet another embodiment the server 102 may only obtain logged events with a predefined set of identification codes . the server 102 may then determine which tenant is associated with each entry in the logs . ( step 340 ). in one embodiment , for example , the server 102 may determine which tenant is associated with each log entry by parsing a url associated with the log entry . in one embodiment , for example , the server 102 may aggregate all of the page view data and bandwidth value data into a single database , while tagging each of the entries to indicate which tenant the entry belongs to . in another embodiment , for example , the server may generate a separate database for each tenant including all of the page views and bandwidth values related to the tenant . in yet another embodiment , the server may generate both an aggregate database with all of the data and an individual database for each tenant with all of the data relating to the tenant . as discussed above , the same data may be obtained multiple times depending by the frequency at which the data is obtained and the length of time over which the data is obtained . if the data for an entry in the aggregate and / or individual databases has been previously obtained , the server 102 at step 340 may also compare the previously obtained data to the currently stored data . in one embodiment , for example , if the new data differs from the previously stored data , the server 102 overwrites the old data entry with the new data entry . in another embodiment , the data from each obtain may be saved for later analysis . for example , if the data is being used to generate a bill for a tenant based upon the usage of the multi - tenant system 100 ( e . g ., based upon the number of page views and / or bandwidth usage ), all of the accumulated data may be saved and then analyzed prior to a bill generation . one benefit , for example , of obtaining the same data multiple times is that each server which is logging the data may have a different logging system , a logging system may be temporarily backed up , or a logging system may lag being in page view aggregations . accordingly , by obtaining the same data multiple times , a more accurate set of performance data for each tenant on the multiple servers may be created . the server 102 may then store the aggregate and / or individual databases in a memory . ( step 350 ). the aggregate and / or individual databases may be stored in memory 106 , in database 130 or in any other memory in communication with the server 102 . in one embodiment , for example , the aggregate and / or individual databases may be accessible by each tenant such that the tenant can view its own performance data or usage data . in another embodiment , once the data is collected , the data may be exposable to another tenant that runs a billing system . as discussed above , the page view data and bandwidth value data may be used to generate a usage bill for each tenant in the multi - tenant system 100 . the collected data may be used , for example , for tiered billing . in one embodiment , for example , the billing system may associate one price with bandwidth usage and another price for page views . generally speaking , the various functions and features of method 300 may be carried out with any sort of hardware , software and / or firmware logic that is stored and / or executed on any platform . some or all of method 300 may be carried out , for example , by logic executing within system 100 in fig1 . for example , various functions shown in fig3 may be implemented using software or firmware logic that is stored in memory 106 and executed by processor 105 as part of application platform 110 . the particular hardware , software and / or firmware logic that implements any of the various functions shown in fig3 , however , may vary from context to context , implementation to implementation , and embodiment to embodiment in accordance with the various features , structures and environments set forth herein . the particular means used to implement each of the various functions shown in fig3 , then , could be any sort of processing structures that are capable of executing software and / or firmware logic in any format , and / or any sort of application - specific or general purpose hardware , including any sort of discrete and / or integrated circuitry . the term “ exemplary ” is used herein to represent one example , instance or illustration that may have any number of alternates . any implementation described herein as “ exemplary ” should not necessarily be construed as preferred or advantageous over other implementations . although several exemplary embodiments have been presented in the foregoing description , it should be appreciated that a vast number of alternate but equivalent variations exist , and the examples presented herein are not intended to limit the scope , applicability , or configuration of the invention in any way . to the contrary , various changes may be made in the function and arrangement of the various features described herein without departing from the scope of the claims and their legal equivalents . | 7 |
as a precursor to the present invention it is proposed to arrange a ball ramp on the output side of the cvt and design the ramp angle so that it provides the correct clamping for high gear operation . in practice , it was found that this will cause over - clamping as the cvt moves to lower gears . this over clamping necessitates that the cvt is designed much heavier than a cvt with an input ramp . the over clamping in high gear caused by an input ramp affects the efficiency and life but does not necessitate a heavier design and for this reason can used in toroidal devices . a particular type of engine enhancement system called variable volume supercharger ( vvs ) is being applied to internal combustion engines as a way of downsizing their swept volume but retaining a large engine performance . in this application , a toroidal cvt is coupled to a turbine so that when the engine is running at low rpm and the driver calls for acceleration the cvt moves from a low gear to a high gear and speeds up the turbine creating boost pressure at low rpm allowing for rapid acceleration response . the cvt then backs away from high gear as the engine speed increases to avoid over revving the turbine . known designs to date all use an input based clamping force generating ramp . this mechanism can benefit from the use of an output based ramp system because although the output ramp “ over clamps ” in low gear the torque in low gear is typically very low and the over clamping never necessitates the deliberate over engineering that would be necessary in a typical cvt transmission . however , if the cvt is used in a turbo compounder where exhaust gas energy is returned to the engine crankshaft ( once the engine is running at a high speed ) the torque is high enough to make this state the critical state when determining the component sizes . the result being a situation where the cvt in low gear is both over clamped and over stressed . fig8 depicts a section through a variable volume supercharger in which a pulley 38 drives a shaft 14 that is splined to a driving toroidal disc 4 that is clamped over rollers 16 onto a driven disc 3 . the pulley diameter is typically arranged to run at around double the engine speed . a ball ramp with a captured ball 1 is built into the driven disc 3 and a ramp structure 5 that drives an output disc 12 connected to an output shaft 13 . the output shaft 13 drives the planet carrier of a traction drive epicyclic step - up gear set 42 that increases the speed of the shaft 43 that is connected to the turbine 40 located inside a turbine housing 39 by a typical ratio of between 10 : 1 and 13 : 1 . a thrust bearing 11 is held against the back of the driven disc 3 and the shaft 14 that acts as the clamping force restraint mechanism . in this arrangement the turbine is designed to deliver compressed air to the intake manifold of an internal combustion engine . the sump 41 is designed to collect the traction fluid in which these devices operate . the rollers 16 and associated carriages can be rotated by the circular rack gear 45 driven by the worm 46 so as to change the relative speeds of the driven and driving discs 3 , 4 . the worm gear is in turn driven via a pinion gear connected to a shaft driven by an electric motor 44 . the section is drawn in the ratio where the driving disc 4 is speeding up the driven disc 3 and in turn the turbine 40 by a combined speed increase of around 30 : 1 . when the rollers 16 are rotated back to low gear position the speed increase is typically 6 : 1 . the pressure of the air is dependent on the speed of the turbine and generally is very low at speeds below 60 , 000 rpm rising to 1 - 2 bar at speeds of 120 , 000 rpm . this means that when in low gear there is very little torque passing through the system and the clamping force generated by the ball ramp arrangement 1 is well below what it develops when in high gear . when in high gear the ramp arrangement 1 develops the clamping force required to ensure that no slip occurs between the discs 3 , 4 and rollers 16 . a similar situation exists when applied to a kinetic energy recovery system ( kers ) where energy is stored in a high speed flywheel and torque flows in both directions in and out of the flywheel . any simple mechanical clamping system either placed on the input or output side will result in both over clamping and over stressing in some ratios . it is also important to understand that because the clamping force created by either an input or output ramp is parallel to the discs &# 39 ; axis of rotation the actual “ normal ” force needed at the contact point to resist this is always greater in any position other than the central position . there is a “ wedging ” affect because of the curvature in the toroidal disc so that the actual normal force is equal to the axial force ( created by the ramp ) times the inverse of the cos of the angle by which the roller has been rotated . fig4 shows the relationships of the required normal forces ( at constant torque ) to produce a constant relationship between the normal force and the traction force ( constant traction coefficient or “ perfect clamping ”) and the force created by an input or output based ramp . it can be seen that the input based ramp creates over - clamping in high gear ( between b and c ) while the output based ramp over - clamps in low gear ( between a and b ). fig5 shows a similar relationship for a vvs mechanism operating at an engine speed of 2 , 000 rpm . it can be seen that when the cvt is in low gear the turbine is running at such a low speed that very little torque is required to be inputted to the cvt . as the ratio is changed and the turbine is sped up a greater and greater amount of torque is required to be inputted with the greatest torque level reached when the cvt is in high gear . if an input based ramp is being used to control the clamping force it will create a normal force on the rollers that is much more than is necessary and in designing with this type of arrangement the rollers will need to be made larger than necessary to carry this force . the physical size of the cvt will become bigger than necessary . it can be seen that although the output based ramp creates a normal force that is greater than necessary when the cvt is in a low gear that this force is always much less than the maximum required normal force and has no effect on the design of the cvt in terms of component sizing . fig6 shows the same vvs mechanism with the engine operating at 4 , 000 rpm . it is now necessary to restrict the upper level ratio of the cvt to around 1 . 5 : 1 so that the turbine does not over speed . it can be seen that the use of an output based ramp continues to keep the normal forces higher than necessary but the output based ramp remains at or below the maximum required normal force . fig7 shows it at an engine speed of 6 , 000 rpm where the cvt ratio must be restricted to below 1 : 1 to prevent the turbine over speeding . again the output based ramp delivers close to the correct normal force at the 1 : 1 ratio and is in fact identical to it in this design . the output based ramp does over clamp the cvt more than the input ramp at this speed but again never clamps more than the maximum ( ever ) required normal force . the cross section illustrated is of a double roller full toroidal variator or dftv using a single cavity . a driven disc 104 is rotated by a clamping roller that is trapped inside the input ramps 102 . one of these ramps is formed in the driven disc 104 and one is formed in the ramp support structure 106 . the ramp support structure 106 is driven by torque fingers 108 connected to a finger support plate 113 which is driven by an input shaft 109 . preload springs 115 are loaded between the input ramp support structure 106 and the finger support plate 113 . the fingers 108 can move axially inside apertures in the input ramp support structure 106 running on low friction rollers . a clamping shaft 114 bears up on the back of the preload springs 115 and passes through the discs 103 , 104 to the other side of the variator to be held onto a thrust bearing 111 by a nut 118 . the thrust bearing 111 on the output side bears up against an output ramp support structure 105 which has a ramp 101 formed in its face matching a similar ramp in the driving disc 103 inside which is another trapped clamping roller . the trapped clamping rollers are ideally ball bearings , as shown . the driven disc 104 and the driving disc 103 clamp over rollers 116 providing the necessary axial force in operation to create the normal forces that are large enough but not excessively large to carry the tangential rolling contact forces . the roller trapped within ramp 101 is driven by the driving disc 103 which drives the output ramp support structure 105 which drives torque fingers 107 which are connected to an output drive plate 112 which drives an output shaft 110 . it can be seen that when the variator is in a high gear position the torque generated at the input side is greater than that generated at the output side . the input ramp 102 is capable then of overcoming the force generated at the output and it rolls the trapped rollers along the input ramps 102 until the output ramp 101 is closed . this action can be seen in fig1 . position a corresponds with the section shown in fig9 ( high gear but carrying low torque ). the force generated in the output ramp 101 is overcome by the force being generated by the input ramp 102 and the output ramp 101 is “ closed ” with the roller on the input side reaching a stop where it can no longer exert any greater force . the clamping force is now being generated by the output ramp 101 . this particular state is one in which the input torque is great enough to overcome the preload springs 115 but not enough to cause large axial deflections in the variator itself . consequently , the roller trapped within output ramp 101 is located towards the centre of the output ramps 101 . if the input torque is increased , deflections allow the trapped roller to roll a considerable distance along the output ramp 101 and so the ramps must be long enough to accommodate this axial deflection . in this case , the design is for a typical road car transmission where the forward torques are much larger than the reverse ( engine braking torque ) so the input ramp 102 on the reversed torque side can be much smaller . position b corresponds with the variator being in low gear ( see fig1 ) where the output ramp 101 generates a higher clamping force than the input side ramp 102 and the trapped rollers shuttle to the other side with the ramp structures themselves moving a small distance x ( see fig1 ) and moving the clamping shaft 114 axially to the left . in diagram b of fig1 the system is carrying low torque so the input ramp roller remains near the centre of the input ramp 102 . in diagram c , the system is operating under high torque that will create deflections that allow the trapped input roller to move along the input ramp 102 . the trapped roller on the output ramp 101 has moved all the way to the end - stop where it can no longer clamp to any greater degree than the input ramp roller 102 . it can be seen by now looking at the graphs in fig4 to 7 that the object of maintaining a degree of clamping that is sufficient to avoid slip , but not a great deal too much , is achieved . the “ clamping shaft ” 114 with thrust bearing 111 attached can move axially a small distance if the force being generated at one of the ramps 101 , 102 is greater than the other . the ramps 101 , 102 themselves are built into the back of the input and output toroidal discs 103 , 104 and the input ramp structure 106 and the output ramp structure 105 plates . they are formed in the shape of a flat “ v ” which terminates in a stop that prevents the trapped rollers from rolling any further along the slot when it reaches the end of the ramp . fig1 shows typical sections through these ramps with the trapped clamping rollers in the positions they adopt for various configurations . fig1 shows a plan view and section of these ramps as they relate to the input and output ramps . the ramp angle for these ramps is set up to deliver the required clamping for either ramp that will be sufficient to ensure that the traction coefficient is always kept low enough to guarantee no gross slip . in this design the ramp angle of the output ramp a is 2 . 28 ° and the input ramp b 5 . 2 °. the section through the output ramp a shows the driving disc 103 and the output ramp structure 105 with the input ramp made up of driven disc 104 and input ramp structure 106 . each ramp has a forward torque section 119 and a reverse torque section 120 . the relative size of 19 and 20 being related to the relative intensity of the maximum forward and reverse torques . in this case the ramps are designed for a conventional transmission application where the forward torques ( acceleration ) are always much greater than the reverse torques ( engine braking ) and so one side of the ramp is longer to accommodate the greater overall deflections that occur in the forward torque state . in a mechanism , such as a kinetic energy recovery system where forward and reverse torques would be more or less the same , the ramps would need to be equal lengths . it can be seen that when one ramp is generating the greatest force the trapped ball roller will roll up the ramp to the end stop and the actual clamping force will become the lower of the two forces . in this way a very good compromise normal force is applied to the rollers 116 with little over clamping regardless of what ratio the cvt is in . this can be seen in the earlier described fig4 . fig1 shows the same cvt as in fig9 after it has moved to low gear with the clamping force being generated by the input ramp 102 . the clamping shaft 114 has moved to the left under the influence of the higher clamping force being generated on the output ramp 101 . the trapped roller ball on the output ramp 101 is now hard up against the respective ramp end stop with the other trapped roller ball on the input ramp 102 being free to move and generate the input ramp clamping force . diagram d in fig1 represents the roller ramp positions when operating under zero torque . both trapped rollers have moved to the bottom of the ramps under the influence of the preload springs 115 . the rollers roll through this position during a torque reversal when , for an instant , there is no torque . as soon as torque is generated the rollers will roll up both ramps 101 , 102 and establish equilibrium when the clamping force from both ramps 101 , 102 is equal . the ramps 101 , 102 can also be designed with a curved slope so that the clamping balance is established when each trapped roller is resting on a section of the ramp that allows the torque to establish equal clamping forces . a curved ramp can be used to create exactly the correct clamping force with a small degree of excessive clamping that exists with the ramp using a constant slope and a stop eliminated . it is also possible to create a hybrid of curve and stop that makes the arrangement less sensitive to deflection induced hysteresis in a way that can reduce over clamping to an even greater extent . fig1 shows the double ramp system applied to a double cavity dftv . it can be seen that in this case the clamping shaft 214 also carries torque to a second cavity and it is necessary for the shaft 214 and the entire second cavity arrangement to move axially during a ramp “ change over ”. the change over occurs at or near the 1 : 1 ratio point . because there is no torque reaction in the torque reaction plates when at the 1 : 1 position , very little torque is passing the torque tube as the transition occurs . fig1 a represents the section of the variator when in high gear positions with the output ramp 201 providing the clamping force and the input ramp trapped roller 202 on the stops . fig1 b shows the same variator in low gear with the output ramp 201 on the ramp stop and the input ramp 202 providing the clamping force . there are two driving or input discs 204 and 204 a and two driving or output discs 203 and 203 a that form two toroidal cavities , enclosing the rollers 216 . in this double roller design the rollers 216 are supported on yokes 231 which are connected by a swivel joint ( not shown ) to a trunnion 230 . the trunnions 230 are fitted with circular rack gears 228 in the second cavity and 229 in the first cavity which are driven by a worm gear 237 located in the first cavity and another 226 located in the second cavity . the worm gear 226 , 237 is driven by a pinion gear 236 connected to a shaft ( not shown ) driven by an electro mechanical actuator . the trunnions 230 in the first cavity c are supported on a pair of torque reaction plates 227 and the trunnions 230 in the second cavity d are supported on a similar pair of plates 233 . these plates 227 , 233 carry the torque reactions from the trunnions 230 which , in the 1 : 1 ratio , are zero in a double roller design . one of these torque reaction plates in both cavities is provided with a torque reaction tube 224 and 225 that transfer torque from the second cavity to the first cavity through torque fingers 222 , which include rollers on the first cavity tube that roll in an aperture built into the second cavity tube . an oil gallery sliding tube flows oil to flow from one torque reaction plate to the other which provides lubrication to the rollers . the entire assembly of second cavity d discs , reaction plates , trunnions , yokes , gears and rollers can slide axially along the clamping shaft 214 . the worm gears are provided with a castellated sliding connection 223 that allows them to slide axially while maintaining the same rotational position relative to the circular rack gears . when input torque is provided to the input shaft 209 all of this torque is transferred via the input torque fingers 208 via the input torque disc 213 to apertures in the input ramp structure 206 . approximately 50 % of this torque is transferred to the second cavity d via a splined connection 235 between the shaft 214 and the ramp structure 206 . the other 50 % is transferred to the first cavity input ( driven ) disc 204 by the interaction of the rollers and ramps 202 such interaction also producing a clamping force that acts through the rollers 216 to the first cavity output ( driving ) disc 203 . the first cavity output disc 203 drives the trapped roller 201 located in the output ramp structure 205 while providing a clamping force that reacts on the second cavity output disc 203 a which clamps on the rollers 216 in the second cavity which bear up against the second cavity input disc 204 a . the clamping force is transferred along the shaft 214 to counteract the force being generated in the first cavity by the trapped rollers on the input ramp 202 . the output ramp structure 205 outputs torque via the torque fingers 207 to the output bell housing 234 which is connected to the output shaft 210 . the output ramp support structure 205 is connected or even part of the second cavity output disc 203 a and the 50 % torque that arrives from the second cavity passes to it for collection by the output torque fingers 207 . it is important to understand that the first and second cavity will share the torque equally between themselves because small slips occur at all of the rolling contacts . the size of these slips is related to the amount of torque being passed and if one cavity is carrying more than 50 % of the torque it will slip more and in consequence lose the ability to carry more than 50 % of the torque . the system can now respond to different input torques and different ratio positions as before with the clamping forces being created by half the input torque and generally being half the size of the clamping forces in a single cavity variator using this method of clamping . as the variator passes through the 1 : 1 position where the clamping force created at the input ramp 202 and output ramps 201 are equal the mechanism inside the second cavity will move the distance x in fig1 b which swaps the ramps creating the clamping maintaining optimized clamping . it can be seen that the shaft 214 could be arranged to extend through the output shaft 210 allowing for collection of the two shaft speeds and torques for incorporation in an ivt mechanism that uses an epicyclic gear to achieve additional benefits . the illustrated embodiments are of a double roller full toroidal variator however it is clear that the method described in this invention could be used in other forms of toroidal variator including the single roller full toroidal variator , the single roller half toroidal variator and variators using other forms of control method including torque control . it can also be seen that the double ramp arrangement could be used as a servo system using lower forces and much smaller ramps and ball rollers or sliding ramps to create a hydraulic pressure designed to provide the full clamping force . in such a system the ramps could be physically remote from each other using only the hydraulic fluid to connect them . it will be understood by someone skilled in the art of traction based cvts , including but not limited to toroidal , planetary , belt and chain types , that the use of a double ramp could be used in many ways to control clamping forces so as to improve efficiency , power density or life of the mechanism . | 5 |
the present invention will be described in connection with a printing environment having one or more printing machines operated by a network of servers and workstations . it is contemplated , however , that this invention may be applied to a wide range of printing applications and systems , in which the benefits of this invention will accrue . accordingly , it is to be understood that this description of the present invention is presented by way of example only , and that this description is not to limit the true scope of the invention as claimed . fig1 illustrates a portion of a typical print shop environment into which the present invention is implemented . the overall print shop environment in which the portion of fig1 resides can be quite varied , depending upon the facility and its function ( e . g ., commercial service bureau , or corporate print shop ). an example of a full service commercial high volume print shop configuration into which the portion illustrated in fig1 can be implemented is described in u . s . pat . no . 6 , 407 , 820 b1 , commonly assigned herewith and incorporated herein by this reference . this u . s . pat . no . 6 , 407 , 820 b1 also describes an exemplary workflow into which the present invention can be readily implemented , to which the following description will refer by way of example . referring to fig1 , printing system 101 has an image - forming machine 100 having one or more remote workstations 120 having graphic user interfaces ( gui ) 110 . the workstation gui is provided digital graphic signals from a computer or the like having an input device such as a keyboard , mouse or the like for entering commands . loaded on the computer 114 are software applications . one such application implements a document or image - viewing functionality and provides a plug - in interface to another software application implementing an image - forming management functionality in the image - forming machine 100 . many functionalities , such as proofing , editing , drafting , and comparing may be provided by the such software applications . other or additional software applications may be used to implement a functionality . while particular configurations and arrangements are shown , other configurations and arrangements may be used including those with other and additional components . the image - forming machine 100 may be an electrophotographic device such as one of the digimaster ® digital printers manufactured by heidelberg digital l . l . c . located in rochester , n . y . the image - forming machine 100 also may be another electrophotographic machine , a photocopy machine , a printing device , or the like . the image - forming machine 100 has a computer 118 , a feeder 102 , a marking engine 104 , a finisher 106 , and a printer use interface 108 which may be separate or integrated components . the printer user interface 108 may be a display unit with push buttons , mouse or keyboard ( not shown ) or other activation means for inputting control parameters to the image - forming machine 100 . the feeder 102 provides receivers , or printing or copying sheets to the printing engine 104 . the sheets may be one or a combination of paper , transparencies , and other medium . the sheets may be configured with pre - punched holes , tabs , and the like . the marking engine may include a photoconductor ( not shown ), one or more chargers ( not shown ), an exposure machine ( not shown ), a toning station ( not shown ), and a fuser station ( not shown ). in operation , the photoconductor is selectively charged and optically exposed to form an electrostatic latent image on the surface . toner is deposited onto the photoconductor surface . the toner is charged , thus adhering to the photoconductor surface in areas corresponding to the electrostatic latent image . the toner image is transferred onto the sheet . in the fuser station , the sheet is heated causing the toner to fix or adhere to the paper or other medium . the sheet exits the marking engine 104 and enters the finisher 106 , which may discharge the sheets as is or may perform one or more finishing operations such as stapling , folding , and inserting an inserted sheet and be deposited one or more stacking trays 112 . the location of one or more tray 112 may be in other places than that shown . the sheets 113 will most likely have provided thereon an image which is or was at one time displayed on remote gui 110 and / or the local marking engine gui 108 . the gui 110 may be a separate component such as a dedicated desktop or other personal computer operatively connected to a printer computer 118 of the image - forming machine 100 . the gui 110 also may be integrated with the printer user interface 108 or other components of the image - forming machine 100 . the printer computer 118 is operatively connected to a logic control unit ( not shown ) in the image - forming machine 100 . operatively connected includes transmission or communication means such as electrical , radio , network , and the like . the gui and the logic control unit also may be integrated into the same component . the logic control unit is connected to control the feeder 102 , the marking engine 104 , the finisher 106 , and the printer user interface 108 . the gui 110 comprises a display screen ( not shown ) and an interfacing means such as a touch screen ( not shown ), a keyboard ( not shown ), a mouse ( not shown ), a track ball ( not shown ), or a combination thereof . the gui 110 also may include tear - off menus , floating buttons , dialog boxes , alternate keyboard command and mouse shortcuts , and other alternative physical input devices . the gui 110 provides visual interaction with the image - forming machine 100 using one or more applications that implement one or more functionalities such as a document or image viewing / editing / creation functionality and an image - forming management functionality which may be implemented via a plug - in architecture . a plug - in architecture allows enhancements and updates to be incorporated in a simpler and more efficient manner and without requiring recompilation of the program codes that implement the functionalities . using a plug - in architecture only requires you to recompile the plug - in that provides the desired functionality and not the core application . however , other architectures may be used as is known in the art . document or image viewing functionality provides a centralized viewing window for viewing electronic images of the original documents in a print job . for example , adobe acrobat ® software application , manufactured by adobe ® systems , inc . located in san jose , calif ., may implement the document or image viewing functionality on the image - forming machine 100 . other document or image viewing software applications may be used . image - forming management functionality integrates various software applications that implement , control , or manage the image - forming machine 100 . the image management functionality visually represents objects ( documents , tickets , other entities , operations , and the like ) with icons , tree structures , and pull - down menus . a user may interact with the image management functionality using various interaction means such as the touch screen , the mouse , the track ball , and the keyboard . such interaction with the visual representations results in manipulation of the underlying objects . while the image - forming management functionality may have an object - oriented appearance , the implementation of the functionality may be by an object oriented programming language or a non - object oriented programming language . in one aspect , the image - forming management functionality is implemented by an imagesmart ® document mastering smartboard ™ software application used with digimaster ® digital printers manufactured by heidelberg digital l . l . c . located in rochester , n . y . other image - forming management software applications may be used . various computer stations may be networked with multiple printing output devices ( printers ) 100 . these computer stations include one or more job preparation stations , one or more network servers , and at least one print server . additional workstations , for example so - called “ storefront ” workstations for use by print customers in the context of a commercial print shop or service bureau , may be optionally included in the environment . these systems may be interconnected over a conventional ethernet network . of course , other network arrangements and technologies , including both local area network and wide area networks of various configurations , and combinations thereof , can alternatively be used as the network backbone . sometimes when printing a document , it is important that the front and back sides are perfectly aligned ( e . g . book publishing ), it is very hard to adjust the alignment without any other tools . in some cases it may be possible to use existing page content ( e . g . page numbers or headers or footers ), but most documents do not have page content that is always at the same location . referring to fig2 , a typical printed sheet 113 will contain an image having text and / or graphical information that represent the desired document after printing which was displayed on a gui before printing using a viewing functionality software application . referring to fig3 , a grid may be added to , superimposed on or overlayed on the desired document image by the heretofore mentioned software application in order to facilitate proper alignment of the desired image to the printed sheet , and / or alignment of the text and graphical information within the image . in order to verify or check proper alignment of the image on the printed sheet , the software application provides for the grid to be printed on the printed sheet along with the desired image . once a proofer or editor is satisfied the image is aligned properly on the printed sheet , the software application may remove the grid and the sheet may be printed so that only the desired image is on the printed sheet . referring to fig4 , multiple grids may be added to , superimposed on or overlayed on the desired document image by the heretofore mentioned image viewing software application in order to facilitate proper alignment of the desired image to the printed sheet , and / or alignment of the text and graphical information within the image . in order to verify or check proper alignment of the image on the printed sheet , the software application provides for the grid to be printed on the printed sheet along with the desired image . once a proofer or editor is satisfied the image elements are aligned properly on the printed sheet , the software application may remove the grid and the sheet may be printed so that only the desired image is on the printed sheet . the software application may be implemented as an adobe acrobat ® plug - in . the plug - in interface allows to provide additional functionality to a user of adobe acrobat ® and preferably is indistinguishable from core acrobat ® functionality . the alignment grid is particularly useful when the user works with a document that requires accurate front / back alignment , or requires adjustments of trim positions . referring now to fig5 , the user may access the grid functionality via two menu items on adobe acrobat &# 39 ; s menu bar : “ add grid ” and “ remove grid ”. when the “ add grid ” menu item is selected , a dialog window may be displayed that allows the user to specify the grid properties . the “ spacing ” input field allows to specify the distance between the grid lines . one or more input fields for horizontal and vertical line spacing may be specified . the “ unit of measure ” selection provides the unit in which the line spacing was specified . it may default to the unit selection of adobe acrobat ®. the “ color ” user interface element may display a color picker to specify the grid color . when adding the grid lines , acrobat ® may store additional information with the new page content , so that it can be identified as one group of elements at a later time . when the “ ok ” button is selected , the specified grid may be added to one or more page in the document . when a grid is added to a page that already contains a grid , the original grid may be removed before the new grid is added or both grids may remain . the grid may be aligned to different locations on the page , such as either the lower left corner , the center of the page , the lower right corner , the upper left corner or the upper right corner . the grid may also be rotated so that it can be used to measure the skew angle of scanned images . it may also provide the capability to select different alignment configurations for odd and even pages . after the grid is added to the document , the user can print the document the same way it would be printed without the grid . by adding the grid to the page content , one can make sure that the document is processed the same way as without the grid . the printer &# 39 ; s internal test pattern generator may inject the test pattern page images close to the point where the images get transferred to the physical page ( usually in the buffer that holds the images that are ready for printing ). the software application forces the grid pattern to be processed by all stages of the ripping process . for example , any image shift that is applied in the pdf interpreter , or the postscript interpreter will also be applied to the printed document . this shift would not be applied to test images created in the printer . if the printed output shows a misalignment ( such as between the front and back sides of the printed pages ), the user can adjust the alignment of one or both sides by shifting one or both images by the amount indicated by the test print . once alignment is acceptable , the grid can be removed from the document again by selecting the “ remove grid ” menu item . this function will go through the document pages and check for the group of elements that makes up the grid on the page . if this group of elements is identified , it will be removed from the page content . by doing this , the original page content will be restored again . the grid may be used for the following applications : establish and verify front / back alignment ; fine trim adjustment for the booklet maker ( useful for oversized covers that are sent to the booklet maker ); alignment for inline perfect binder and three knife trimmer ; verify alignment of micr characters to micr standard ; verify alignment of bar code placement ; verify shift operation ; align text that is placed with the text tool ; create graph paper ; demonstrate machine quality and consistency ; and , align machine for custom paper sizes . while the present invention has been described according to its preferred embodiments , it is of course contemplated that modifications of , and alternatives to , these embodiments , such modifications and alternatives obtaining the advantages and benefits of this invention , will be apparent to those of ordinary skill in the art having reference to this specification and its drawings . it is contemplated that such modifications and alternatives are within the scope of this invention as subsequently claimed herein . | 6 |
the present invention is directed to ( a ) a gem setting for enhancing the appearance of a gem , ( b ) an article of jewelry incorporating the setting , ( c ) a kit for use in making the gem setting , and ( d ) a method for assembling the gem setting . the setting of this invention enhances the appearance of the gem . with reference to the figures , the setting 10 comprises a gem 12 , a diadem 20 , a base 22 , and a plurality of complementary gemstones 24 securely retained between the diadem 20 and the base 22 to enhance the appearance of the gem 12 . the gem 12 has a pavilion 25 , a crown 26 , and a girdle 27 . each complementary gemstone 24 has a pavilion 28 , a crown 29 , and a girdle 30 , as well as an upper edge 32 and a lower edge 34 . the diadem 20 comprises an annular collar 36 having an upper surface 38 and a lower surface 40 . the collar 36 has a central conical - shaped hole or cavity 42 therethrough . a plurality of prongs 46 for retaining the gem 12 project upwardly from the upper surface 38 of the collar 36 . the gem 12 is retained by the prongs 46 with its crown 26 exposed and with its pavilion 25 extending through the cavity 42 so that a portion of the pavilion 25 is exposed so that light enters it . the collar 36 has a first recess 52 in its lower surface 40 for retaining the upper edges 32 of the complementary gemstones 24 . the diadem 20 also comprises a plurality of arms or appendages 56 depending downwardly from the lower surface 40 of the collar 36 . the downwardly depending arms 56 terminate in a shaft 58 having a main body 60 for receiving the base 22 . the shaft 58 aligns the base 22 with the diadem 20 . a gap 61 is formed between adjacent arms 56 to allow light to pass between the adjacent arms 56 into the pavilion 25 of the central gem 12 . the shaft 58 has a jewelry mounting extension 62 for mounting the setting 10 on an article of jewelry 64 . the jewelry mounting extension 62 has a smaller diameter than the diameter of the main body 60 of the shaft 58 . the base 22 has an annular - shaped body 66 having a central opening 68 . a second recess 70 for retaining the lower edges 34 of the complementary gemstones 24 is located in a top surface 72 of the base 22 . the second recess 70 surrounds the second central opening 68 of the base 22 . the setting 10 can be provided as a kit comprising the diadem 20 and the base 22 where the purchaser supplies the gem 12 and / or the gemstones 24 . before the base 22 is secured to the diadem 20 , the base 22 is capable of being axially moved with respect to the shaft 58 to accommodate different length complementary gemstones 24 . thus different length complementary gemstones 24 are capable of being mounted and retained between the first recess 52 in the diadem 20 and the second recess 70 in the base 22 . however , for any given setting , preferably all the complementary gemstones 24 have substantially the same length . when the complementary gemstones 24 are mounted in the setting 10 , inwardly facing faces 74 of the complementary gemstones 24 are proximate to and exposed to at least a portion of the pavilion 25 of the gem 12 . light passing inwardly through the mounted complementary gemstones 24 is refracted and at least a portion of the refracted light enters the pavilion 25 of the gem 12 . for certain gems , e . g ., diamonds , the passage of the refracted light into the pavilion 25 of the gem 12 can greatly enhance the appearance of the gem 12 . preferably the prongs 46 hold the center gem 12 so that at least a portion of the pavilion 25 protrudes through diadem 20 to the space between the arms 56 . by having the pavilion 25 protrude through the first transverse opening 50 , the pavilion 25 is placed in close proximity to the inwardly facing faces 74 of the complementary gemstones 24 . the close proximity of the inwardly facing faces 74 to the pavilion 25 is believed to further enhance the appearance of certain gems 12 . to avoid obstructing passage of light into the pavilion 25 , it is preferred that the pavilion 25 not touch the surface 41 of the conical cavity 42 or the arms 56 . similarly , to avoid obstructing light that passes through the complementary gemstones 24 , it is preferred that the complementary gemstones 24 be mounted without substantially touching the arms 56 or the shaft 58 of the diadem 20 . furthermore , in order that most of the light entering the pavilion 25 of the gem 12 be refracted light , it is preferred that the complementary gemstones 24 be contiguously mounted . an exemplary first recess 52 in the lower surface 40 of the collar 36 comprises a first groove 78 in the lower surface 40 of the collar 36 formed by a first intersection 80 of two surfaces 82 and 84 the first intersection 80 has a first acute angle =. similarly , an exemplary second recess 70 in the top surface 72 of the base 22 comprises a second groove 90 in the top surface 72 of the base 22 . the second groove 90 is formed by a second intersection 92 of two surfaces 94 and 96 the second intersection 92 has a second acute angle β . exemplary gems 12 and complementary gemstones 24 are diamonds , rubies , emeralds , sapphires , zircon , and glass . typical shapes of the gem 12 are round , marque , square , pear , emerald cut and princess shapes . typical shapes for the complementary gemstones 24 include baguette , tapered baguette , square , and round shapes . exemplary center gem 12 sizes range from about half carat to larger . exemplary complementary gemstones 24 have a length that ranges from about 3 mm and up . in order to securely retain the complementary gemstones 24 between the first and second recesses 52 and 70 , respectively , it is preferred that the length of each complementary gemstone 24 be substantially the same to at least about a thousandth of an inch . in order to achieve this degree of exactness , it is preferred to use a device for measuring the lengths of the complementary gemstones 24 that is capable of accurately measuring the length of the complementary gemstones 24 to at least about one thousandth of an inch . with respect to fig4 and 5 , the gem setting 10 is incorporated into a ring 101 comprising a band 102 for displaying the setting 10 . when incorporated into the ring 101 , the jewelry mounting extension 62 of the shaft 58 matingly fits in an opening 104 in a mounting surface 106 of the band 102 . the overall appearance of the complementary gemstones 24 can be changed by varying the configuration of the first recess 52 in the lower surface 48 of the collar 36 , the second recess 70 in the top surface 72 of the base 22 , and the length and shape of the complementary gemstones 24 . for example , when the complementary gemstones 24 have substantially the same length , a tapered baguette shape , and are contiguously mounted between the first recess 52 having a first diameter and the second recess 70 having a second diameter , the first diameter being greater than the second diameter , the complementary gemstones 24 have a beautiful truncated , conical contour 108 . as shown in fig6 and 7 , the setting can be assembled with the aid of a die 114 the die 114 has a mating female half 116 that mates with a male half 118 . the female half 116 has first mating surfaces 120 having female alignment parts 122 , a first inner surface 124 , a first top end 126 and a first bottom end 128 . the male half 118 of the die 114 has second mating surfaces 130 , corresponding male alignment parts 132 , a second inner surface 134 , a second top end 136 , and a second bottom end 138 . a piece 140 of a two - sided adhesive tape is placed between the first top end 126 and first bottom end 128 of the female half 116 . a second piece 142 of the two - sided adhesive tape is placed between the second top end 136 and the second bottom end 138 of the male half 118 of the die 114 . the complementary gemstones 24 are placed over each piece 140 and 142 of the two - sided adhesive in a manner so that the upper edge 32 and lower edge 34 of each complementary gemstone 24 extend beyond an upper edge 144 and a lower edge 146 , respectively , of both pieces 140 and 142 of the two - sided adhesive . typically , a sufficient number of complementary gemstones 24 are employed so that the complementary gemstones 24 positioned in each half 116 and 118 of the die 114 are contiguous and are substantially flush with each first intersection 148 between the first mating surfaces 120 and the first inner surface 124 and each second intersection 149 between the second mating surfaces 130 and the second inner surface 134 . generally , between four to seven , and typically five or six , complementary gemstones 24 are placed in each half 116 and 118 of the die 114 . the female half 116 and male half 118 of the die 114 are then assembled together . the diadem 20 is inserted into the assembled die 114 so that the upper edges 32 of the complementary gemstones 24 are capable of contacting the first recess 52 in the lower surface 40 of the collar 36 . the base 22 is also inserted into the die 114 so that the lower edges 34 of the complementary gemstones 24 are capable of contacting the second recess 70 in the top surface 72 of the base 22 . at least a portion of the shaft 58 is inserted into the second central opening 68 in the base 22 . the thickness of the two - sided adhesive preferably is slightly wider than the width of a lower rim 150 of the diadem 20 and a top rim 152 of the base 22 . this relationship provides sufficient room for the lower rim 150 of the diadem 20 and the upper rim 152 of the base 22 to readily slide between the inner surfaces 124 and 134 of the die 114 and each outer facing surface 154 of the complementary gemstones 24 . the diadem 20 and the base 22 are then subjected to axial pressure so that the base 22 slides along the shaft 58 until the upper edges 32 of the complementary gems 24 touch the first recess 52 and the lower edges 34 of the complementary gemstones 24 touch the second recess 70 to securely retain the complementary gemstones 24 in the setting 10 . once the base 22 is in its final position , jewelry solder 156 is used to immobilize the base 22 on the shaft 58 . the diadem 20 , the base 22 , and the ring 101 preferably are made from precious metals . exemplary precious metals include gold and silver . the gem setting 10 of the instant invention has a rich , majestic appearance . the crowns 28 of the complementary gemstones 24 are retained between the base 22 and the diadem 20 and enhance the appearance of the gem by imparting the impression that the gem 12 is supported by a luxurious gem - like pillar . in addition to being mounted in a very complementary environment , the passage of light inwardly through the complementary gemstones 24 and into the pavilion 25 of the gem 12 enhances the appearance and beauty of certain gems . although the present invention has been described in considerable detail with references to certain preferred version thereof , other versions are possible . for example , the diadem and base can be made from non - precious metals . in addition , other exemplary shapes of the base , the diadem , and their recesses for holding the complementary gemstones include rectangular , pentagonal , hexagonal , and octagonal shapes . furthermore , earrings can also be used to display the setting of the instant invention . therefore , the spirit and scope of the appended claims should not necessarily be limited to the descriptions of the preferred versions contained herein . | 0 |
referring to fig1 of the drawing ; illustrated is a stringed musical instrument 1 a . the particular instrument shown is a guitar ; however the invention is equally applicable to other stringed instruments such as , but not limited to : the mandolin , banjo , bass , ukulele , and / or the bowed family of instruments . instrument 1 a is seen as including : a headstock 1 with tuning pegs or tuners 2 , a neck 7 with fingerboard or fretboard 3 having frets 4 and a body 5 , with saddle assemblies 20 secured to the top of a bridge 8 . with the body 5 , one or more strings 6 are stretched from the headstock 1 over the neck 7 and fretboard 3 and over a portion of the top of the body 5 to contact points on the bridge saddle 10 . the invention is concerned with adjustment of the height of the strings 6 , individually , and relative to the neck 7 , its fretboard 3 , and body 5 , ( commonly referred to as the string &# 39 ; s “ action ”) while maintaining full contact to the instruments body 5 . fig2 illustrates the primary subject of the invention , the saddle 10 , and the saddle housing 9 , in turn making up a saddle assembly 20 . fig3 - 11 demonstrate embodiments of how the new invention here within works . fig1 and 11 show a side cross section enlargement view of the saddle invention . in this example ; to use the saddle height adjustment feature , one would first install a string 6 by threading it through a hole 5 a in the instrument body 5 , passing the string through a hole in the bridge plate 13 a , then onto the string groove 10 a found in the saddle 10 , then connect the string to the instrument &# 39 ; s tuner 2 . then to make individual string action height adjustments one would loosen the locking set screw 12 , fig3 and 6 , and then turn the height adjustment screw 11 , fig3 and 4 , to raise the leading edge of the string groove 10 a up or down , which in turn raises or lowers the string 6 . once the desired string action height is achieved , and to complete the adjustment , the saddle 10 is locked into place by turning the locking set screw 12 , mounted in the saddle housing 9 , into the saddle centering notch 10 b found on the saddle 10 as seen in fig3 , 6 , and 8 . fig7 shows a left side view 10 l , of the saddle 10 , which includes a serpentine shaped recess lever portion 10 c . it is desired to have the saddle 10 fit into the saddle housing 9 snugly , but with enough clearance to allow the saddle 10 to rotate in the saddle housing 9 . fig8 also shows a saddle centering notch 10 b cut into the saddle 10 , which when engaged with the saddle locking set screw 12 , fig6 , prevents the saddle 10 from shifting sided - to - side , or from rotating in the saddle housing 9 . fig1 shows a side view cross section of the height adjustment screw 11 turned outward , and the end of the screw 11 is engaged with the recess lever 10 c . in this position the leading edge of the string groove 10 a holds the string 6 in its lowest action height setting . conversely , fig1 shows the height adjustment screw 11 turned inward , pushing on the recess lever 10 c , which in turn allows encapsulated saddle 10 to rotate in the saddle housing 9 upward , therefore moving the leading edge of the string groove 10 a , and the string 6 upward in unison . the string height adjustment range is shown as item 16 , found in fig1 . as demonstrated in fig1 and 11 , it is important to note that throughout the entire string height adjustment range 16 ; as the saddle 10 rotates in saddle housing 9 , the string 6 always makes contact with the saddle 10 , which in turn makes full contact with the saddle housing 9 , which in turn makes full contact with the bridge plate 13 , which is mounted directly to the instrument &# 39 ; s body 5 . this method insures the utmost positive string vibration transfer to the instrument &# 39 ; s body 5 and insures utmost sonic sustain with improved tonal response of the vibrating string 6 . it may be desirable to have the saddle assembly 20 , fig1 and 11 , equipped with a fine adjustment intonation screw 14 , which can be affixed to a bridge plate 13 , and can thread into the saddle housing 9 . when the intonation screw 14 is turned , the saddle assembly 20 moves parallel with the strings 6 , therefore desirably changing the string 6 scale length . fig1 and 13 show an alternate exposed at 17 string 6 design whereas the top of the saddle 10 , and saddle housing 9 has minimal material removed to expose at 17 the string 6 at the point of the leading edge of the saddle 10 , for facilitating what is commonly called “ palm muting ” ( the exposed strings allow the playing musician to rest the palm of the hand directly on the strings near the bridge and mute , or dampen sustain of the strings ) playing techniques . note that though material is removed from the top of the saddle 10 and the top of the saddle housing 9 ; overall integrity , adjustment , and sonic character the invention remain fully intact . fig1 and 15 illustrate an alternate two stud bridge 18 embodiment which incorporates the newly disclosed invention . included are two threaded mounting studs 19 , which pass through recesses in the bridge plate 13 and securely attach to the instrument &# 39 ; s body 5 . the saddle assemblies 20 sit securely atop of the bridge plate 13 , and may utilize intonation adjustment screws 14 , and for added stability , saddle assembly 20 locking screws 21 . as it is desirable to employ a direct string - to - body coupling method , fig1 also illustrates the use of a connecting plate 22 , which can be affixed to the bottom of the bridge plate 13 , through various methods . in this embodiment , the connection plate 22 is affixed to the bridge plate 13 via two fasteners 23 . fig1 reveals the two stud bridge 18 , affixed to the instrument &# 39 ; s body 5 with strings 6 installed . fig1 further reveals the string - to - body direct coupling method in which the vibrating string 6 rests in the string groove 10 a located in the saddle 10 , which in turn ; the solid portion at the bottom of the saddle 10 makes contact with the solid portion in the bottom of the saddle housing 9 , which in turn makes firm contact with the bridge plate 13 , which in turn makes contact with the connecting plate 22 , which contacts the instrument &# 39 ; s body 5 . fig1 also illustrates the two stud bridge 18 firmly attached to the instrument &# 39 ; s body 5 via the threaded mounting studs 19 . to further convey the significance of the new invention , fig1 - 18 show a side by side comparison of a typical , industry standard saddle assembly 24 , compared to the new full contact saddle assembly 20 as disclosed in the invention herein . note how the industry standard saddle assembly 24 , found in fig1 , employs small screws 25 to adjust the string action height . this method creates undesired air gaps 26 between the vibrating string 6 , the bridge plate 13 , and the instrument &# 39 ; s body 5 . the only means of positive string vibration transference to the instrument &# 39 ; s body 5 is through minimal contact points 27 found at the bottom of the set screws 25 . in contrast to fig1 , fig1 illustrates the invention herein , which demonstrates the incorporation of a solid and stable mass 27 between the vibrating string 6 and the body 5 of the instrument . to improve musical sustain and tonality , it is most desirable to have a solid and stable , yet fully adjustable mass 27 between the vibrating string 6 and the body of the instrument 5 . fig1 and 20 reveal an alternate design to the disclosed invention presented herein , in which the saddle 10 can include two or more string grooves 10 a , for receiving more than one string 6 . the saddle housing 9 can be altered in length to accommodate a saddle 10 of varying lengths , which is determined by the number of strings to be positioned in the saddle 10 . as in the aforementioned single string saddle assembly 20 , the height adjustment screw 11 , and the locking set screw 12 , perform in the same manner as does the intonation screw 14 , and the saddle assembly locking screw 21 . fig1 and 20 also reveal that full contact between the vibrating strings 6 , and the instruments body 5 is maintained regardless of the saddle assembly 20 length , or how many strings 6 can be simultaneously adjusted for string action height 16 . fig2 - 23 illustrate another design feature in accordance with the teachings of the present invention , wherein the housing 9 holds a rotatable pin 28 which has a threaded hole and therefore can be the recipient of the intonation adjustment screw 14 . this design allows the intonation adjustment screw 14 to move up or down freely and locate with the intonation screw hole 29 found on bridge plate 13 . this feature is desirable because the intonation screw hole 29 positions often fluctuate in height due to variables in the manufacturing process of the bridge plate 13 . fig2 and 23 further illustrate the above by detailing a side by side comparison . fig2 shows the intonation adjustment screw 14 engaged with the intonation screw hole 29 which is in a nominal high position 30 . in contrast , fig2 shows the intonation adjustment screw 14 engaged with the intonation screw hole 29 which is in a nominal low position 31 . | 6 |
hereinafter , practical application of a medical tissue extraction instrument according to the present invention will be described in detail . fig2 is a view illustrating a configuration of the medical tissue extraction instrument according to the present invention . as illustrated , the medical tissue extraction instrument includes a fine needle 13 , suction tubes 23 and 25 , a tissue collector 33 , and a tissue extraction controller 40 . the fine needle 13 takes the form of a metal tube to be inserted into a tissue extraction region of a patient . one end of the fine needle 13 is inserted into the body of the patient and the other end of the fine needle 13 is connected to the first suction tube 23 . the first suction tube 23 connected to the fine needle 13 serves as a movement tube of biological tissue extracted via the fine needle 13 . changing the air pressure of the suction tube 23 may control whether or not the fine needle 13 begins to extract tissue . the extracted biological tissue is moved into the tissue collector 33 through the first suction tube 23 . the tissue collector 33 provides a space for receiving the extracted biological tissue . preferably , the tissue collector 33 is externally provided with scales or other graduations to aid in easy recognition of the quantity of the extracted biological tissue . in an embodiment of the present invention , the tissue collector 33 is provided at the top thereof with connection holes for connection of the first suction tube 23 and the second suction tube 25 . preferably , the first and second suction tubes 23 and 25 are tightly inserted into the connection holes with rubber packing members 35 interposed therebetween , so as to prevent leakage of the extracted biological tissue or the interior air of the suction tubes 23 and 25 . in addition , the tissue collector 33 is further preferably provided at the top thereof with an opening / closing lid 37 to help the operator to easily inspect the tissue received in the tissue collector 33 . the second suction tube 25 is connected at one end thereof to the top of the tissue collector 33 and at the other end thereof to the tissue extraction controller 40 . the tissue extraction controller 40 serves to control the pressure of the second suction tube 25 . preferably , according to the present invention , the tissue extraction controller 40 is externally provided with a suction adjustor to adjust pressure applied to the interior of the suction tube 25 . the suction adjustor according to the present invention includes a pressure adjustor 41 and a suction period adjustor 43 . the pressure adjustor 41 serves to adjust the pressure inside the suction tubes 23 and 25 . the suction period adjustor 43 serves to adjust a suction period of tissue extracted into the first suction tube 23 . when the suction period adjustor 43 is used , furthermore , it is possible to set a generation period of pressure applied to the interior of the suction tubes 23 and 25 , which enables automatic extraction of tissue at regular intervals . the tissue extraction controller 40 according to the present invention includes a suction pressure generator 60 in the form of a footboard . the suction pressure generator 60 includes upper pressure boards 61 and 63 by which the operator generates suction pressure . that is , the suction operation of the suction tubes 23 and 25 is controlled by controlling force applied to the pressure boards 61 and 63 . the pressure boards 61 and 63 may include two or more pressure boards . in the embodiment of the present invention , the pressure boards 61 and 63 may be a continuous suction pressure board 61 and a discontinuous suction pressure board 63 . the continuous suction pressure board 61 serves to allow the suction tubes 23 and 25 to perform successive suction operations . the discontinuous suction pressure board 63 serves to allow the suction tubes 23 and 25 to perform intermittent suction operations . fig3 is a view illustrating an operation using the medical tissue extraction instrument according to the present invention . during operation , as illustrated , the operator or the inspector attempts to insert the fine needle 13 into a tissue extraction region of the patient &# 39 ; s body using one hand while gripping an ultrasonic transducer 50 in the other hand . in this case , the interior pressures of the suction tubes 23 and 25 are adjusted based on the suction pressure and the suction period set by the pressure adjustor 41 and the suction period adjustor 43 of the tissue extraction controller 40 . through the suction operation of the suction tubes 23 and 25 , the biological tissue extracted via the fine needle 13 is moved into the tissue collector 33 through the first suction tube 23 . in this case , the operator or the inspector may control the suction operation by selectively pushing any one of the continuous suction pressure board 61 and the discontinuous suction pressure board 63 of the suction pressure generator 60 . for example , if the continuous suction pressure board 61 is pushed , the suction operation may be performed successively and periodically based on the suction period set by the suction period adjustor 43 . on the other hand , the operator may control the suction operation as occasion demands by selectively pushing the discontinuous suction pressure board 63 . as is apparent from the above description , the present invention provides a medical tissue extraction instrument according to the present invention , which allows an operator ( or an inspector ) to control a suction operation thereof without any need for assistance . accordingly , the operator is capable of accurately aiming a fine needle at a tissue extraction region of the patient &# 39 ; s body and stably performing tissue extraction . although the preferred embodiment of the present invention has been disclosed for illustrative purposes , those skilled in the art will appreciate that various modifications , additions and substitutions are possible , without departing from the scope and spirit of the invention as disclosed in the accompanying claims . | 0 |
at the outset , an exploration of the physical principles involved in the present invention will be made to assist in an understanding of the present invention . it has been shown in an article by born , geophysics , vol . 6 , no . 2 , p . 132 , april , 1941 , that the frequency - amplitude characteristics of cylindrical bars fashioned from rocks can be measured in the laboratory . the bar can be said to act as a damped resonant system and the amplitude frequency resonance curve might typically appear as illustrated in fig1 . frequencies f 2 and f 1 are frequencies whose amplitude values are 1 /√ 2 of the resonant frequency f r . the frequency shift between frequencies f 2 and f 1 manifests the bandwidth bw of the resonant system . another commonly used quantity , q , or sharpness of resonance , is expressed by : which for longitudinal resonance may also be related to the attenuation of young &# 39 ; s modulus waves by ## equ1 ## amplitudes a x of a longitudinally traveling wave measured one wavelength apart , x , in a bar are related to : where it is seen that as a function of time , a constant designation according to the present invention as an alpha constant , 2 ( πf 2 - πf 1 ) is manifested by the bandwidth of the signal . it has also been shown that if all appropriate bar constants are changed to bulk values , then the identical alpha constant applies to plane compressional and shear waves in bulk media . for lumped constant systems , the amplitude of a decaying oscillation is expressed as : it is to be noted that for the lumped constant system , the alpha constant is also 2 ( πf 2 - πf 1 ) and is also a function of bandwidth . with the present invention , it has been found that if seismic data are processed so that seismic traces are modeled as having an impulsive source and being a collection of damped oscillations emanating from resonating bars in the earth , wherein the signature of said oscillations contain bandwidth information , such data may be analyzed for alpha values which are useful in exploration for hydrocarbons and for other geophysical analysis . in the method of determining alpha values , the starting point is digital seismic data , which has been recorded broad - band . the data preferably has also been processed using conventional techniques so that it has been corrected for gain , spherical spreading and geometry , and so that the data is noise free ( i . e ., multiples , reverberations , bubble bounce signals , etc . are removed ). because seismic data contain a multitude of overlapping events , only in rare instances may true alpha values be directly observed . however , it is possible to closely estimate these values by transforming the seismic data into the frequency domain . the estimated alpha values are then computed in the sequence set forth below . in fig2 a seismic trace t is shown . a hanning window hw , of pre - determined length is applied to a portion of data at the beginning of trace t . the length of the hanning window is determined by observing the typical length of events on the trace ( usually about 100 ms ). the hanning window is applied to the data to obtain an estimate of the frequency - amplitude spectrum . because of the overlapping nature of seismic events the hanning function is best suited to produce a spectrum which appears to have come from a single event . it should be understood that other types of window functions or operators may be used , if desired . the fourier transform of the hanned data is then determined . fig1 illustrates an example of the general appearance of a fourier transform spectrum so obtained . in this spectrum are certain characteristics which describe the true alpha , or α values which would be observed in the time domain if the seismic events were not overlapping in time . the half - power values , f 1 and f 2 , in the spectrum are then determined . the resonant or dominant frequency f r is determined . should any one of these values be unavailable , the relation exists and the unknown may be obtained . the alpha value , α , is obtained from the equation : the α value so found is then stored as an amplitude on magnetic tape and represents the α value estimate of the hanned data window . the above process is repeated by moving the hanning window down the seismic trace at a specified increment , and an alpha trace having all positive values is thus obtained . as an example of the potential inherent in the process of obtaining alpha values from seismic data , traces from an area where gas accumulations are present were processed . in fig3 a conventional amplitude section and in fig4 a section displaying alpha values are illustrated and so labelled . alpha processing started at 0 . 5 sec .. also displayed in the alpha section is a sonic log which was obtained at the location labelled x on both sections . the sonic log was used to verify the validity of values . where low sonic readings are noted ( low velocity ), high α values are expected , and vice - versa . if the alpha section in fig4 is viewed end - on , &# 34 ; hard &# 34 ; ( limes , sands ) streaks in the layers , of low α values , and &# 34 ; soft &# 34 ; ( shale ) streaks in the layers of high ( dark ) α values are readily apparent . several geologic horizons identified from cuttings and cores are noted next to their respective sonic readings . shown in fig4 are : of particular interest in fig4 is the horizon ( e ). the limestone portion just below 1 . 46 sec . contains several porous zones with gas tests , including one at the shale - lime interface at 1 . 46 sec .. the estimated extent of the porous zones on either side of the well location can be drawn on the alpha section as so indicated by observing the anomalously high α values inside the lime layer . the top of this layer is noted on both sections by the triangles on either side of each section near 1 . 5 sec . the only sign that gas might be present on the seismic section in fig3 is the dim - out observed on record 31 near 1 . 5 sec .. there is no gas - indicative response , known as a &# 34 ; bright - spot &# 34 ;, associated with the gas test . however , the extent of a porous gas - tested zone is relatively easy to outline on the alpha section . if for instance it is known that a layered stringer of lime exists , yet some anomalous alpha values are noted inside the layer , it may be assumed that one is observing a change of porosity . the sum of all the alpha values is related to a gain function which might be suited for gain compensation . it is envisioned that alpha - porosity tables ( or charts ) might be computed for the different earth materials . the same could be applied to density , etc . also , there is a rather good inverse correlation between alpha values and velocity , and a relation may be mathematically formulated to tie these quantities together . in a special purpose digital computer or calculator c of the present invention ( fig5 ), input digital data in the form of seismic traces which have been recorded broadband and subjected to preliminary processing of the type set forth above , and amplitude normalization in the conventional manner , are read in through a digital switch 10 into a main memory unit 12 . a cycle control unit 14 ( fig5 and 8 ) controls the read - in of data into the memory 12 and the operation of the remaining circuits of the calculator c . the digital switch 10 and the remaining digital switches of the calculator c are conventional circuits , such as and gates , which permit data present at one input to pass therethrough when a control signal is received from the cycle control unit 14 . as will be set forth in detail below , data bits of a length corresponding to the specified time window and transferred from the main memory unit 12 through a switch 16 to a process memory unit 18 . the data bits in memory unit 18 are input data for a processing cycle and are multiplied by a hanning function , subjected to fourier transformation to obtain the frequency - amplitude spectrum , and the spectrum so obtained is analyzed to obtain the peak frequency f r and half - power frequencies f 1 and f 2 . from the half - power frequencies , the bandwidth f 2 - f 1 is obtained , which when multiplied by a factor of π yields the α value for the data window . the cycle control unit 14 provides timing signals to the remaining circuit components of the calculator c to route the data therethrough for each processing cycle . a first portion of the input digital data , corresponding in length to a desired time window is transferred from the main memory unit 12 through the switch 16 to the process memory unit 18 in response to signals from the cycle control unit 14 . the digital data in the memory unit 18 is further transferred through switches 20 and 22 as a first input to a digital multiplier 24 . a hanning function generator 26 , a commercially available sine / cosine wave function generator , which generates an output signal in accordance with the hanning function : ## equ2 ## receives an input signal representing the expected resonant frequency f c of the data window from a suitable digital input device . the hanning function formed in the generator 26 based on the input signal representing the expected resonant frequency f c is transferred through digital switches 28 and 30 to the digital multiplier 24 . the multiplier 24 multiplies the digital data from memory unit 18 by the hanning function from generator 26 to form a signal a t . the resulting signal a t from such multiplication is then stored in a storage buffer or register 32 and subsequently transferred into the memory unit 18 through the switch 16 . after the input data window has been multiplied by the hanning function in multiplier 24 to form the signal a t and returned through switch 16 to memory 18 , the calculator c performs a fourier transformation of the signal a t to obtain a function a f 2 of the following form : ## equ3 ## step 1 . sine product formed . during the first step of the fourier transformation , the data signal a t is furnished to the multiplier 24 through the switches 20 and 22 . the sine function , sin2πt / t c , is formed in a sine wave function generator 34 , a conventional digital sine wave function generator . the sine function from the generator 34 is provided through switches 28 and 30 as a second input to the multiplier 24 , which multiplies the signal a t by the sine function . the product formed in the multiplier 24 is then provided to an adder circuit 36 , and the output of adder 36 stored in a buffer 38 . the contents of the buffer 38 are provided as a second input to adder circuit 36 through a switch 40 to sum the products formed in multiplier 24 . step 2 . cosine product formed . during the second step of the fourier transformation , the data signal a t is furnished to multiplier circuit 24 through switches 20 and 22 . the cosine function , cos2πt / t c , is formed in a cosine wave function generator 42 , which is a conventional digital cosine wave function generator . the cosine function from the generator 42 is provided through switches 28 and 30 as a second input to multiplier 24 , which multiplies the signal a t by the cosine function . the product formed in the multiplier 24 is then provided to an adder circuit 44 , and the output of adder 44 is stored in a buffer 46 . the contents of buffer 46 are also provided as an input to the adder circuit 44 to sum the products formed in multiplier 24 . step 3 . squaring the result of step 1 . during the third step of fourier transformation , the sum of products of the signal a t and the sine function , stored in the buffer 38 , is returned through switches 22 and 30 to both inputs of the multplier 24 , which thereby squares such product function . the squared result is transferred to one input of the adder 36 , while the other input of the adder 36 receives a zero value input signal through the switch 40 in response to a control signal from cycle controller 14 . addition of this zero value to the squared output product function of multiplier 24 and adder 36 results in the squared product function being stored in buffer 38 . step 4 . summing to obtain a f 2 . during the final step of fourier transformation , the sum of products of the signal a t and the cosine function , stored in the buffer 46 , is returned to both inputs of the multiplier 24 through the switches 22 and 30 , squaring such cosine product function . the squared result from the multiplier 24 is transferred to one input of the adder 36 , while the contents of buffer 38 , representing the squared sine product function are transferred to the input of adder 36 through the switch 40 in response to a signal from controller 14 . the output of adder 36 thus represents the fourier transformation function a f 2 , which is transferred into the buffer 38 . a comparison and control circuit 50 of the circuit c ( fig5 through 7 ) which operates during the fourier transformation compares the amplitude functions a f 2 from the buffer 38 beginning with the expected center frequency f c and for successively incremented frequency values to detect both the resonant or peak frequency f r and the half - power frequencies f 1 and f 2 . as a labelling convention in the comparison and control circuit 50 and the cycle control unit , the flip - flops therein are of the type known as &# 34 ; d &# 34 ; flip - flops and will be called indicators . each of such flip - flops has a d input , a clock input ck , a preset input p and a clear input cl , as well as a q output and a q output . when a logic &# 34 ; 0 &# 34 ; to logic &# 34 ; 1 &# 34 ; level change appears at the clock input ck and the d input is logic &# 34 ; 1 &# 34 ;, the flip - flop will set to a &# 34 ; 1 &# 34 ; logic level at the q output and to a logic &# 34 ; 0 &# 34 ; level at the q output . when &# 34 ; 0 &# 34 ; to &# 34 ; 1 &# 34 ; logic level change appears and the d input is &# 34 ; 0 &# 34 ;, the q output goes to the &# 34 ; 1 &# 34 ; level while the q output goes to the &# 34 ; 0 &# 34 ; level . the presence of a logic &# 34 ; 1 &# 34 ; at the p input forces the q output to a logic &# 34 ; 1 &# 34 ; and the q output to a logic &# 34 ; 0 &# 34 ; regardless of the d and ck inputs . conversely , the presence of a logic &# 34 ; 1 &# 34 ; at the cl input forces the q to a logic &# 34 ; 1 &# 34 ; and the q output to a logic &# 34 ; 0 &# 34 ;. it should be understood , however , that other types of digital logic registers or flip - flops may be used , if desired . as a connector convention , due to the numerous connections of timing signals with other components of the calculator c as well as between the various circuit components of the circuit 50 , individual conductors performing these connecting functions are not shown in the drawings in order to maintain clarity in the drawings . rather , the output of a circuit component is given an identifying label and inputs of other circuits receiving such a signal are given like identifying labels . for example , in the comparison and control circuit 50 , a fourier transform indicator 52 ( fig6 ) receives an input signal from an indicator 162 of the cycle control unit 14 at a ck input , driving the q output thereof to logic &# 34 ; 1 &# 34 ;. the output from the indicator 52 is provided over a conductor labelled clear through an or gate 54 to a p terminal of an up / down indicator register 56 , driving a q or &# 34 ; up &# 34 ; output to a logic &# 34 ; 1 &# 34 ; and a down output q to logic &# 34 ; 0 &# 34 ;. the clear output signal from indicator 52 is also provided to a t counter 58 ( fig7 ) and a p counter 60 , resetting the counts therein to zero . the clear signal from the indicator 52 is also provided to the cl input terminals of a down half - power indicator 62 ( fig6 ), a half power cycle indicator 64 and an up half - power indicator 108 driving the q outputs thereof to logic &# 34 ; 0 &# 34 ;. the clear signal from the indicator 52 is also provided through an or gate 66 to a peak cycle indicator 68 at a cl input thereof , driving the q output , labelled peak , to a logic &# 34 ; 0 &# 34 ;. also , the clear output from indicator 52 is provided through an or gate 70 to a disregard indicator 72 . in this manner , upon receipt of a signal from the cycle control unit 14 in the comparison and control unit 50 , the timing counters 58 and 60 are reset to zero , the up / down indicator 56 is reset to indicate that counting should be in the upward direction ; the peak cycle indicator detector is set to zero where it will remain until the peak frequency is found ; the up half - power and the down half - power indicator are set to zero since such will not be the first comparison cycles to be performed ; the disregard indicator is set to zero so that comparison results will not be disregarded ; and the half - power cycle indicator 64 is set to zero since the first operation of the comparison circuit 50 is to determine the peak frequency f r . the timing cycle counter circuit or t counter 58 ( fig7 ) is a digital counter forming output count signals t 0 through t 9 at designated output terminals thereof , forming ten equal time intervals t 0 through t 9 . the t 9 output of the counter 58 is provided to the p counter circuit 60 which is a large capacity digital counter , for example 256 counts or larger , forming output count signals p 0 through p k , indicating the number of processing cycles of the calculator c , each composed of ten equal time intervals t 0 through t 9 . during the period when the counter 60 is providing p 0 as an output signal , an up / down counter 78 ( fig7 ) is set to zero at the cl input through an or gate 80 ,. the counter 78 counts upwardly in response to a logic &# 34 ; 1 &# 34 ; signal at a count control input terminal 78a from the up / down indicator 56 ( fig6 ). for each cycle thereafter , the counter 78 increments the count upwardly on receipt of the timing control signal t 0 from the counter 58 at a ck input . the output of counter 78 , representing the number of increments to the input frequency f c is also provided to function generators 34 and 42 ( fig5 ) as will be set forth . during the cycle p 0 storage registers 82 , 84 and indicator 68 through or gate 66 ( fig6 ) are cleared as well . concurrently during the cycle p 0 , the value a f 2 is computed in the calculator c and stored in the buffer 38 ( fig5 ) in the manner set forth above . during the first time interval t 0 of cycle p 1 , and for cycles thereafter the counter 78 is advanced by one ( fig7 ). also , the buffer register 85 is energized to receive the contents a f 2 from the first cycle p 0 for the expected frequency a f . sbsb . c from buffer 38 . during the time interval t 3 of the cycle p 1 and for cycles thereafter , register 84 is energized at a load input terminal by an and gate 86 , reading the value a f 2 in buffer 85 into the register 84 as well . a comparator 88 compares the amplitude of the contents of register 82 and 84 at this time . since the register 82 was cleared during the first cycle p 0 and has received no further data , the signal presented at an input terminal 88a is less than the signal present at input terminal 88b to the comparator 88 and the comparator 88 forms an output signal with a logic &# 34 ; 1 &# 34 ; level at an output terminal 88c indicating that the contents of register 82 are less greater than the contents of register 84 . at the time interval t 7 of cycle p 1 and for cycles thereafter , the register 82 is energized through an and gate 90 transferring the contents from the register 85 into the register 82 for the next comparison cycle . during the time interval t 0 of the third cycle p 2 , the counter 78 is incremented again by one and the register 85 receives the contents a 2 fc + 1 from the buffer 38 . during the time interval t 3 , the register 84 is loaded with the contents of the register 85 , and the contents of registers 82 and 84 are compared in the comparator 88 . two situations can exist as a result of the comparison in the comparator 88 : case one , where the contents of register 82 are less than the contents of register 84 , and case two , where the contents of register 84 equal or exceed the contents of register 82 . case one will be discussed first , with case two set forth thereafter . if the comparison results during time cycle p 2 indicate that the contents of register 82 are less than the contents of register 84 , the amplitude function a f . spsb . c + 1 2 exceed the previous amplitude function a 2 f . spsb . c for the expected resonant frequency f c . accordingly , for each further cycle p i , during t 0 , the counter 78 is incremented by one , and the contents a 2 of buffer 38 for the new frequency f c + i are transferred into the register 85 during the time interval t 0 . further , the newly incremented contents of counter 78 are summed with the input frequency f c in an adder 79 and provided to function generators 34 and 42 . during the time interval t 3 , register 84 is loaded with the contents of the register 85 , and a comparison made in the comparator 88 . finally , during the time interval t 7 , the register 82 is loaded with the contents of the register 85 for the next succeeding comparison cycle . at some time interval p n for a particular frequency f c + n - 1 , the comparator 88 determines that the content of the register 82 equals or exceeds the content of the register 84 . during such cycle , the comparator 88 at the time interval t 5 energizes the peak indicator flip - flop 68 through an and gate 90 . at this time , a peak frequency register 92 ( fig7 ) is energized to load therein the contents of an adder 93 . adder 93 sums the contents of the adder 79 with a plus or minus one from a switch 95 . the switch 95 is controlled through a control input 95a by the up / down indicator 56 to provide minus one for up and plus one for down . the adder 79 sums the count output from the counter 78 with the designated input frequency f c selected by the operator and provided thereto in the manner that such signal is provided to the hanning function generator 26 as set forth above . the contents of adder 93 thus represent the sum of the designated input frequency f c and the number n - 1 of increments required to reach the frequency f r where the peak amplitude function a f . sbsb . r 2 was detected in the comparator and control circuit 50 . finally , the disregard indicator 72 ( fig6 ) is enabled at its clock input through or gate 102 so that the next comparison cycle will be disregarded by exhibiting and gate 86 . this disregard signal is provided at the time the peak is detected , since it is known that the next subsequent comparison will be meaningless and should be disregarded . during the time interval t 7 of cycle p n when the peak amplitude function is detected , an and gate 104 ( fig7 ) is energized by the peak indicator 68 , resetting the counter 78 to zero through the or gate 80 . since the peak amplitude function a 2 f . sbsb . r has been detected , it is now necessary to search for the half - power frequencies f 1 and f 2 in comparator and control circuit 50 . accordingly , the amplitude function a 2 . sub . f . sbsb . r stored in register 82 is divided in half . this function is performed by the presence of the peak signal from indcator 68 at a shift input terminal s of register 82 and the presence of the timing signal t 7 at the clock input terminal through and gate 90 . during time interval t 8 , the half - power cycle indicator 64 is energized at the ck input thereof by the simultaneous presence of the peak indicator signal and the time interval t 8 at inputs of an and gate 106 . at this time , the q output of the indicator 64 is driven to a &# 34 ; 1 &# 34 ; level , clearing the peak indicator 68 through the or gate 66 . the half - power cycle indicator controls switch 98 ( fig7 ). for &# 34 ; 0 &# 34 ; output from the half power indicator switch 98 will transfer f c to adder 79 . for logic &# 34 ; 1 &# 34 ; output from the half power indicator switch 98 will transfer f r from register 92 to adder 79 . during the next cycle p n + 1 after detection of the frequency having the peak amplitude in the spectrum , during the time cyle t 0 , the counter 78 is advanced by a count of one , and during the time interval t 4 , the disregard indicator 72 is set to zero through the or gate 70 . during the second cycle p n + 2 after detection of the peak amplitude , during the time interval t 0 the counter 78 is advanced by one , and during the time cycle t 3 the register 84 is loaded with the contents of the register 85 . the comparison is then performed in the comparator 88 which compares the amplitude function a 2 f . sbsb . r with the halved value of the peak amplitude function a 2 fr / 2 stored in register 82 . succeeding operating cycles p n + i continue with the counter 78 being advanced one during the time interval t 0 , the register 84 loaded with the contents of register 85 and comparison taking place in comparator 88 during the time interval t 3 until the comparator 88 indicates that the contents of register 84 equal or exceed the contents of register 82 . during the cycle p n + m when this occurs , an up one - half power indicator 108 is energized at the clock input terminal through an and gate 110 , provided that the indicator 56 indicates than an up count is being performed , the proper output is received from the comparator 88 , and the disregard indicator is disabled , and time interval t 6 . again , since the next comparison cycle is meaningless , the disregard indicator 72 is now energized by the output of the indicator 108 through the or gate 102 . at that time , indicator 126 is energized from indicator 108 through or gate 128 . during the time interval t 7 , the output of the indicator 108 energizes and upper half - power register 112 through an and gate 114 , causing the contents of the adder 93 ( fig7 ) to be transferred and stored in the buffer 112 . the output from the adder 93 stored in the buffer 112 represents the upper half frequency count f 2 obtained from the adder 79 after the contents of adder 93 are decreased by - 1 by an input from switch 95 in the manner set forth above . during the time interval t 8 of the cycle p n + m , the indicator 56 is energized through an or gate 120 and an and gate 122 from the indicator 108 , causing the indicator 56 to now indicate &# 34 ; 0 &# 34 ; at the q output and &# 34 ; 1 &# 34 ; at the q output . further at t 8 , indicator 126 is set to &# 34 ; 1 &# 34 ; at its q side causing the 1 / 2 power up / down indicator 124 ( fig7 ) to be energized . energization of the indicator 124 causes the counter 78 to be reset to zero through the or gate 80 . during the next succeeding time interval t 9 , the indicator 124 is reset to zero at its clear input by the timing signal t 9 . during the next operating cycle p n + m + 1 , the counter 78 is advanced by a - 1 , since the indicator 56 now indicates that a down count is being made . accordingly for the time interval t 0 for each succeeding cycle , the counter 78 is advanced by - 1 . during the time inteval t 4 of cycle p n + m + 1 , the disregard indicator 72 is again reset through the or gate 70 . during the cycle p n + m + 2 , the counter 78 is again advanced by - 1 , and the register 85 loaded with the contents from the buffer 38 . during the time interval t 3 , the register 84 is loaded with the contents of the register 85 and a comparison performed in the comparator 88 . the operating cycles continue until a time operating cycle p n + m + j when the comparator 88 indicates that the contents of the register 82 equal or exceed the contents of the register 84 during the time interval t 3 . during the time interval t 6 of this cycle , the down one - half power indicator 62 ( fig6 ) is energized through an and gate 130 , thereby energizing the disregard indicator 72 through the or gate 102 . during the time interval t 7 of the cycle when the lower half power frequency f 1 has been found , as evidenced by the output from the comparator 88 , a buffer 132 is energized by an and gate 134 , causing the contents of the adder 93 ( fig7 ), representing the lower half power frequency f 1 , to be stored in the buffer 132 . the contents of the buffers 112 and 132 are provided as inputs to an adder 136 which subtracts the lower half power frequency f 1 from the upper half power frequency f 2 . during the next time interval t 8 , a buffer 138 is energized through and gates 140 and 142 , causing the output of adder 136 which when multiplied by a scaling constant is the value of alpha , α , to be stored in the buffer 138 . additionally , the indicator 124 ( fig7 ) is energized through indicator 126 and or gate 128 , and the counter 78 thereby reset to zero through the or gate 80 . during the time interval t 9 , the indicator 52 is cleared through an and gate 144 , and gate 142 and or gate 145 , indicating that an alpha value has been determined for the particular data window . at this time , the cycle controller unit 14 receives an output signal from the indicator 52 in a manner to be set forth and causes the contents of the register 138 in the comparator and control circuit 50 to be transferred to the main memory 12 through the switch 10 . another data window is then called from the main memory 12 and transferred to the processing memory unit 18 for application of the hanning function thereto and the preceding cycle set forth above again takes place for each succeeding data window . the second operating condition is case two , where operations through the third cycle p 2 , time interval t 3 , take place in a like manner to case one . however , in case two , the output of the comparator 88 at this time interval indicates that the contents of register 82 equal or exceed the contents of register 84 , indicating that the frequency spectrum must be scanned for decreasing rather than increasing frequency values to detect the peak frequency f r , and accordingly that frequency incrementing operations need to be reversed . accordingly , during the next time interval t 4 of the cycle p 2 , a wrong way indicator 146 ( fig6 ) is energized through an and gate 148 , causing the indicator 56 to be set through the or gate 120 to indicate a down count , and energizing the disregard indicator 72 . during the time interval t 8 of the cycle p 2 , the counter 78 ( fig7 ) is reset to zero through or gate 80 , indicator 124 , indicator 126 and or gate 128 . during the next operating cycle p 3 , the counter 78 is advanced by - 1 , due to the count direction input from indicator 56 , and the register 85 loaded with the contents of the buffer 38 . during the time interval t 4 , the disregard indicator 72 is cleared . during the time interval t 9 of the cycle p 3 the wrong way indicator 146 is cleared through an and gate 150 . during the next operating cycle p 4 , the counter 78 is advanced by - 1 , and the contents of buffer 38 transferred into the buffer 85 . during the time interval t 3 of this operating cycle , the contents of buffer 85 are stored in register 84 , and a comparison performed in the comparator 88 between the contents of register 82 and 84 . so long as the contents of register 82 are less than the contents of register 84 , during the time interval t 7 , the contents of register 85 are transferred into register 82 , and another operating cycle performed for the frequency advanced again by - 1 by the counter 78 . comparison operations in this manner scanning downwardly in the frequency spectrum continue until a time p n , when the comparator 88 indicates during the time interval t 3 that the contents of register 82 equal or exceed the contents of register 84 , indicating that the peak frequency f r has been detected . at this time , the peak indicator 68 is energized through the gate 90 , the register 92 ( fig7 ) is caused to load the contents of the adder 93 therein and the disregard indicator 72 energized . during the time interval t 7 , the counter 78 is set to zero , and the contents of register 82 divided in half by being shifted one bit to the right in the manner set forth above . during the next time interval t 8 , the half - power cycle indicator 64 is set to one through the and gate 106 . after the peak frequency f r has been found in the comparator and control circuit 50 during the case two operations , location of the half - power frequencies f 1 and f 2 is then performed in a like manner to processing steps of case one set forth above , however , the down half - power frequency is detected first . once the down half - power frequency is detected , time interval t 8 will set indicator 56 to up direction through or gate 54 and and gate 55 . the up half - power frequency will now be searched for . in the cycle controller 14 ( fig8 and 8a ), a start switch 150 ( fig8 ) is depressed by an operator to begin processing operations of the calculator c . a preset machine monostable multivibrator , or one - shot , 152 forms a logic &# 34 ; 1 &# 34 ; output pulse of suitable duration , for example , 100 msec ., in response to depression of the switch 150 . the pulse from the one - shot 152 clears a main memory indicator 154 through an or gate 156 , a memory 1 indicator 158 through an or gate 160 , and a hanning cycle indicator 162 through an or gate 164 , as well as other components of control unit 14 to be set forth as indicated as inputs thereof . after the expiration of the one hundred msec . pulse from the one - shot circuit 152 , the main memory indicator 154 q output is set to &# 34 ; 1 &# 34 ; by the q output from one - shot 152 , indicating that the calculator c is operating in the main memory cycle , transferring data into the main memory 12 through the switch 10 . a calculator chip 166 receives input signals representing the expected resonant frequency , f c , in a like manner to hanning function generator 26 in the manner set forth above , and forms an output signal representing the value 3000 / f c , representing the time length of the hanning window function , which is stored in a register 168 in response to a &# 34 ; 1 &# 34 ; output from the main memory indicator 154 . a start indicator 176 is also set to &# 34 ; 1 &# 34 ; by a logic &# 34 ; 1 &# 34 ; from the q output of main memory indicator 154 . the calculator c is now ready for receipt of external data from a suitable digital memory . incoming data are provided to a decoder circuit 177 ( fig8 a ) and a decoder circuit 178 in the cycle controller 14 , as well as the switch 10 during read - in to the memory 12 . the decoder circuit 177 detects a code in the incoming data signal indicating start of data in such signals and activates an and gate 180 so that clock or synchronization pulses in each data word of the incoming signal are counted in a counter 182 , which thus counts the number of data words in the incoming data . the incoming clock pulses in the data through and gate 180 are also provided to a suitable time delay circuit 183 which compensates for processing delays , and therefrom to switch 10 to cause the incoming data to be read through the switch 10 to the main memory 12 . the clock pulses from gate 180 are also provided through or gate 200 to counter 186 . counter 186 counts up and provides address locations for the incoming data in the main memory 12 . a decoder 184 ( fig8 a ) compares the output count of the counter 182 with a digital number stored therein , representing the storage capacity of the memory 12 and sends a full main memory signal to or gate 156 ( fig8 ) and also a full main memory signal to disable and gate 180 . decoder circuit 178 ( fig8 a ) detects a code in the incoming data signal indicating end of data in such signals and sends an end of data signal to or gate 156 ( fig8 ) and also an end of data signal to disable and gate 180 . accordingly , when either the memory unit 12 is filled with data , or all input data but less than the storage capacity of unit 12 have been stored or gate 156 ( fig8 ) will set the main memory indicator 154 to logic &# 34 ; 0 &# 34 ; and also disable counter 182 through an and gate 180 . a counter 186 is reset at this time through a oneshot 188 and an or gate 190 in response to transition of the main memory indicator 154 output to logic &# 34 ; 0 &# 34 ;. an and gate 192 ( fig8 ) at the output of the start indicator 176 is driven to a &# 34 ; 1 &# 34 ; and an and gate 194 , connected to the output of the gate 192 and to the q output of the fourier transform indicator 52 in the cycle control of 50 ( fig6 ) is then energized since the fourier transform cycle has not yet begun . and gate 194 thus drives memory 1 indicator 158 to &# 34 ; 1 &# 34 ;, indicating that transfer of a time window of data from the memory unit 12 to the process memory unit 18 is to take place . the counter 172 ( fig8 ) is advanced by one through the gates 173 and 174 ( fig8 a ), and such count is provided as an address indicator signal to the processing memory unit 18 and the function generator 26 . the counter 186 is advanced by 1 through an and gate 198 and an or gate 200 by clock pulses from the clock 175 , and the count contents of the counter 186 are provided as a main memory address signal to the main memory unit 12 . counting and addressing continues in this manner until the contents of the counter 172 ( fig8 ) equal the number stored in the register 168 indicating the length of the hanning window , as detected by the comparator 170 . at this time , a reset counter one - shot 204 ( fig8 ) is energized by the comparator 170 , forming an output pulse which clears counter 172 of its contents and resets the counter 172 to zero . the output signal from the comparator 170 is also provided at this time to an and gate 206 to clear the memory 1 indicator 158 through the or gate 160 , thereby energizing the hanning cycle indicator 162 . the counter 186 is then cleared and a counter 208 ( fig8 a ), whose contents thus indicate the number of data windows to which the hanning function has been applied , is advanced by one . a &# 34 ; 0 &# 34 ; output of the q side of the hanning cycle indicator 162 at the start of the hanning cycle also removes the signal which has been provided to clear an indicator 210 ( fig8 a ) and thus removes the blocking of clock pulses from clock 175 through indicator 210 through the or gate 173 present prior to the hanning cycle . after removal of the clearing signal to indicator 210 at the start of the hanning cycle , each clock pulse from clock 175 is routed by indicator 210 and by the q output through or gate 173 to advance counter 172 and addresses memory 18 . the q output loads memory 18 . the counter 172 continues to advance for each cycle of the hanning cycle , providing address signals to the process memory unit 18 and the hanning function generator 26 until the comparator 170 detects that a data sample of equal length to the hanning window has been multiplied by the hanning function from generator 26 . at this time , the counter 172 is reset by the oneshot 204 , and the hanning cycle indicator 162 is reset through an and gate 212 and the or gate 164 , indicating completion of the hanning cycle . the q output of the hanning cycle indicator 164 is connected to the clock input of the fourier transform indicator register 52 in the comparison and control unit 50 ( fig6 ) and a reset of the hanning cycle indicator 162 cause the indicator 52 to be activated , indicating start of the first cycle , p 0 of the comparison and control unit 50 , the operation of which is set forth above . output of the indicator 52 is also provided at a load input of the counter 186 ( fig8 a ), causing the contents of the counter 208 , representing the number of hanning cycles , to be transferred into the counter 186 for comparison with the contents of the counter 182 , representing the number of data words in the data to be processed . the output of the register 52 during the first cycle p 0 is also provided through an or gate 214 ( fig8 ) to energize a step 1 cycle indicator register 216 , indicating the first step of the fourier transform cycle , multiplication and addition in the multiplier 24 and adder 38 of the hanned data in memory 18 by the sine function from the generator 34 , is to be performed . the counter 172 is advanced by one through the or gate 173 and an and gate 218 ( fig8 a ) for each word during step 1 of the fourier transform cycle , and the output of counter 172 provided as an address signal to memory 18 and function generator 34 . advancing the contents of counter 172 ( fig8 ) with clock pulses in this manner continues until the comparator 170 detects that each data word has been multiplied , at which time the one - shot 204 resets counter 172 clearing the step 1 indicator 216 through an and gate 220 and an or gate 222 , energizing a step 2 cycle indicator 224 . the indicator 224 when energized indicates that the second step of the fourier transform cycle , multiplication of the hanned data window in memory 18 by the cosine function from the generator 42 , is to be performed . the counter 172 is advanced by one through the or gate 173 and an and gate 230 for each multiplication operation in the step 2 of the fourier transform cycle and the output of counter 172 provided as an address signal to memory 18 and function generator 42 . advancing the contents of counter 172 in this manner continues until comparator 170 again detects that each data word have been multiplied , at which time counter 172 is reset through one - shot 204 and step 2 indicator 224 is reset through the gates 226 and 228 , energizing a step 3 indicator 232 . step 3 indicator 232 , when energized , indicates that the third step of the fourier transform cycle , multiplication of the contents of the buffer 38 by itself through switches 22 and 30 in the multiplier 24 is to take place . the output of step 3 indicator 232 indicator energizes these circuits of the calculator c during the third step of the fourier transform cycle . a clock pulse from and gate 219 and or gate 173 loads buffer 38 with the result of step 3 . the same clock pulse resets step 3 indicator through and gate 236 and or gate 234 . the transition of step 3 indicator to its q side will energize step 4 indicator 238 . step 4 indicates that the fourth step of the fourier transformation cycle , squaring the contents of the buffer 46 in the multiplier 24 , summing the squared products so formed with the contents of the buffer 38 in adder 36 and storing it in buffer 38 is to be performed . the output of step 4 indicator 238 energizes these circuits of the calculator c during the fourth step of the fourier transform cycle . a clock pulse from and gate 221 and or gate 173 loads buffer 38 with the result of step 4 . by the same clock pulse , indicator 238 is reset through an and gate 240 and an or gate 242 , indicating completion of the fourth step of the fourier transform cycle . at the end of the first cycle p 0 of the comparison and control unit 50 , the p counter 60 is advanced one count through a synchronization control circuit 244 ( fig7 ) whose function is to co - ordinate operating cycles of the cycle controller 14 and comparator and control unit 50 . an indicator 246 is set to a logic &# 34 ; 1 &# 34 ; by the t counter 58 at the end of time interval t 9 of each operating cycle p of the control unit 50 , as indicated by an inverted t 9 signal from an inverter 247 , and an indicator 248 is set to a logic &# 34 ; 1 &# 34 ; by the output of step 4 indicator 238 ( fig8 ) at the end of the fourth step of the cycle controller 14 . an and gate 250 is connected to the outputs of indicators 246 and 248 to prevent advancing the p counter 58 until both the present fourier transform function a f . sbsb . i 2 for the next comparison cycle has been obtained under control of cycle controller 14 , and the present ocmparison cycle in unit 50 has been performed . when both operations are performed the q output of indicators 246 and 248 , will enable and gate 250 to form an advance p count pulse to advance the p counter 58 to begin a new comparison cycle in the unit 50 , to clear indicators 246 and 248 and to serve as a clock pulse to step 1 indicator 216 ( fig8 ) through or gate 214 , beginning the first step of the next fourier transform cycle under control of cycle controller 14 . for each operating cycle p i , the step 1 indicator 216 is enabled through the or gate 214 by the advance p counter signal , and a new fourier transform cycle for the newly incremented frequency value provided to generators 34 and 42 from adder 79 in control unit 50 is performed . the amplitude function a f . sbsb . i 2 so obtained is then transferred in the next cycle p i + 1 to the buffer 85 ( fig6 ) in unit 50 , where such function is compared and processed until the peak frequency f r and the half - power frequencies f 1 and f 2 determined in the unit 50 , in the manner set forth above . at such time , as has been set forth above , the indicator 52 is cleared , providing a signal to the and gate 194 , again energizing the memory 1 indicator 158 , beginning the transfer of another data word , of length corresponding to the hanning function , from the memory unit 12 through the switch 16 to the memory unit 18 . the cycle control unit 14 continues to control operation of the calculator c for each data window stored in the main memory 12 , advancing the counter 208 ( fig8 a ) during the hanning cycle and transferring such count to counter 186 during the beginning of each fourier transform cycle p in comparison unit 50 until a comparator 252 determines that the contents of the counter 186 , representing the number of data windows processed plus the width of one hanning function , equals the contents of counter 182 or number of words in the main memory , indicating that all the data has been processed . at this time , the comparator 252 forms an output signal clearing the start indicator 176 ( fig8 ) through an and gate 254 , and providing a logic &# 34 ; 1 &# 34 ; from indicator 176 to an end indicator 256 . on completion of the comparison cycle in comparison unit 50 , the q output of indicator 52 in the comparison control unit 50 is energized , transferring the signal from indicator 176 to provide an output signal indicating that the data have been processed and are available for transfer through a suitable buffer 258 ( fig5 ) to a conventional display apparatus 260 for formation of a display of the type shown in fig4 . the foregoing disclosure and description of the invention are illustrative and explanatory thereof , and various changes in the size , shape , materials , components , circuit elements , wiring connections and contacts as well as in the details of the illustrated circuitry and construction may be made without departing from the spirit of the invention . | 6 |
fig1 shows a learning system 114 that includes a training portion 120 and an operating portion 122 . the training portion 120 includes an incremental supervised learner 106 connected with a state representation storage 108 and a predictor storage 110 . the operating portion 122 includes an applier 112 and the prediction storage 110 . the state representation storage 108 and the predictor storage 110 can be implemented using any appropriate combination of alterable , volatile or non - volatile memory or non - alterable , or fixed memory . the alterable memory , whether volatile or non - volatile , can be implemented using any one or more of static or dynamic ram , a floppy disk and disk drive , a writeable or rewriteable optical disk and disk drive , a hard drive , flash memory or the like . prior to operation , the incremental supervised learner 106 of training portion 120 is first initialized with a hypothetical learning task which initially encodes state representation reflecting that no training instances have yet been received into the state representation storage 108 . once initialized , the incremental supervised learner 106 receives training instances 102 as inputs . the training instances 102 are made up of feature vectors and target values . a feature vector is a collection of feature values , which can be numeric , boolean etc ., such that corresponding feature values in different instances encode similar information about the instance . for example , a feature value might be the number of times a particular word occurs in a document , and the feature vector for the document the set of feature values for each of a set of words . the use of feature vectors to represent instances is well known in the art . feature vectors are discussed in machine learning , by tom . m . mitchell , mcgraw - hill , 1997 which is incorporated by reference in its entirety . the feature vectors represent what is known about the training instance 102 while the target value represents the desired output if the feature vector were used as input to an appropriate predictor . each training instance may reflect new learning tasks or the refinement of existing learning tasks . for each training instance 102 that reflects new learning tasks the state representation 108 of the hypothetical learning task is copied to form the initial state representation of each new learning task . the incremental supervised learner 106 can also produce a predictor which is then produced for each new learning task or refine a predictor for each learning task based on the learning task state representation and the current training instance . after the incremental supervised learner 106 updates all learning tasks state representations , the incremental supervised learner 106 updates the hypothetical learning task state representation is updated with the training instance as a default or negative example . the hypothetical learning task state representation is always updated to reflect each new training instance as a default or negative example . during operation of the systems , the application of the predictors generated during learning is accomplished by the applier 112 of the operating portion 122 which accepts as input feature vectors 104 and predictors from the predictor storage 110 and applies the predictors to produce a prediction 116 as to the appropriate categorization or classification to be given the input feature vectors 104 . fig3 is an exemplary embodiment of the state representation storage 108 of the learning system 114 after n - number of training instances have been received . for example , fields 312 - 320 show exemplary state representation of the hypothetical learning task , field 312 as well as learning task 1 through learning task m . it will be apparent that any number of learning tasks could be used in the invention without departing from the spirit and cope of the present invention . the state representation depicted in fig3 is exemplary and not limiting and any type of state representation storage may be used to practice the present invention . fig3 , col . 312 illustrates the state representation storage 108 of the hypothetical learning task of the incremental supervised learner 106 after n - number of consecutive training instances . the learning task state representation for learning task 1 after n - number of training instances have been received by the incremental supervised learner is illustrated in col . 314 . the learning task 2 state representation for learning task 2 after n - number of training instances have been received by the incremental supervised learner is shown in col . 316 . the learning task 3 state representation for learning task 3 after n - number of training instances have been received by the incremental supervised learner is shown in col . 318 . the learning task state representation of learning task ( m ) after n - number training instances is shown in col . 320 . after the incremental supervised learner , hypothetical learning task has been initialized as illustrated by row entry 322 showing no training instances seen by the hypothetical learning task , the first training instance is received as shown at row 324 . when the incremental supervised learner receives training instance example 1 , it generates learning task 1 which is added to the list of active learning tasks . each learning task 314 - 320 on the active list of learning tasks is then analyzed with respect to the training instance . first a determination is made whether the training instance is the first training instance for the learning task if the training instance is the first instance for this learning task then the learning task is a new learning task . a new learning task state representation is created by copying the hypothetical learning task state representation for use as the initial state representation for the new learning task . for example , the state representation for the hypothetical learning task as shown by col . 312 through row entry 324 , is copied and used to initialize the new learning task state representation . predictors are then produced for the new learning task based on the learning task state representation and the current training instance . the new learning task state representation is then updated based on the existing learning task state representation and the current instance . if no more learning tasks remain then the hypothetical learning task state representation is updated with the training instance as a negative example as shown by col . 312 , row 324 . it should be noted that predictors 110 are not produced for the hypothetical learning task . row entry 326 shows a second training instance presented as input to the incremental supervised learner . this training instance reflects a positive example of refinement to learning task 1 , as well as generating new learning task 2 as indicated by row 326 , cols . 314 and 316 . if the training instance was not the first training instance for the task , then predictors are produced for the learning task based on the learning task state representation and the current instance . the learning task state representation is then updated based on the existing learning task state representation and the current training instance as shown by row entry 326 illustrating the update to learning task 1 state representation as a result of the training instance example 2 . since the training instance was also a first training instance for learning task 2 , an initial state representation is created by copying the hypothetical learning task state representation as shown in rows 324 - 326 , col . 316 . in row 328 training instance example 3 is shown . this training instance adds learning task 3 to the list of learning tasks . then it is determined that training instance 3 does not reflect a positive training example for learning task 1 as indicated at row 328 , col . 314 . the training instance does reflect a positive training example for learning task 2 as indicated by row 328 , col . 316 . thus , a predictor 110 is produced based on the existing state representation , as shown in row 324 - 326 , col . 316 and the training instance . similarly , training instance example 3 reflects a positive training example for newly created learning task 3 . since the training instance example 3 is the first instance for newly created learning task 3 , a new state representation for learning task 3 is created by copying the current hypothetical learning task state representation , as shown in rows 324 - 326 , col . 312 , to initialize the state representations for learning task 3 as shown by rows 324 - 326 , col . 318 . predictors are then produced based on the state representations for learning task 3 and the current training instance . it should therefore be apparent that each training instance may serve to update more than one learning task . in row 334 , training instance example ( n ) is received . this training instance reflects the refinement of learning task 1 as well as the creation of new learning task m . for learning task 1 , predictors 110 are produced based on the existing state representation reflected by col . 314 , rows 324 - 332 and the new training instance example n . for learning task m , a new state representation is initialized with the state representation from the hypothetical learning task as represented by rows 324 - 332 , col . 312 . a predictor 110 for learning task m is then created based on the state representation task m and the current training instance example n . this state representation is depicted in rows 324 - 332 of col . 320 . a new state representation for learning task ( m ) as represented by rows 324 - 334 , col . 320 , and training instance example ( n ). at this point there are no further learning tasks to be updated . the state representation 312 for the hypothetical learning task is then updated with the training instance example ( n ) serving as a negative example as indicated by rows 324 - 334 , col . 312 . fig2 is a flowchart illustrating an exemplary process of the present invention . the incremental supervised learner uses a hypothetical learning task which maintains a corresponding state representation to encode all training instances as negative training examples . this hypothetical task state representation is used by the incremental supervised learner to efficiently accumulate and transfer knowledge about training instances already encountered to each new learning task . the incremental supervised learner starts at step 200 , the state representation for the hypothetical learning task encodes all training instances as negative examples . the process starts at step 200 , control is transferred to step 205 where a state representation of the hypothetical learning task is created that reflects that no training instances have been seen by the incremental supervised learner . control is passed to step 210 where an empty list of training tasks are created and control passes to step 215 where the training instance is received . control then proceeds to step 220 where all the learning tasks that have a non - default target value for this training instance are added to the list of learning tasks . control is then transferred to step 225 where the first learning task in the list of learning tasks is retrieved . control is then transferred to decision point step 230 . at step 230 a determination is made as to whether the current training instance is the first training instance associated with this learning task . if this training instance is not the first training instance for the current learning task , control is transferred to step 240 . otherwise , if this training instance is the first training instance for the current learning task , then control is transferred to step 235 where the hypothetical learning task state representation is copied to form the initial state representation for the new learning task . control is then transferred to step 240 . in step 240 , predictors are produced for the learning task based on the state representation for the learning task and the current training instance . control is transferred to step 245 . in step 245 , a new state representation for the learning task is produced based on the state representation for the learning task and the current training instance . control is then transferred to decision point step 250 . in step 250 , a determination is made whether any more learning tasks remain . if more learning tasks remain to be processed , control then returns to step 225 and the process is repeated for each remaining learning task . if no further learning tasks remain to be processed , then control proceeds to step 255 . at step 255 , the hypothetical learning task state representation is updated treating the current training instance as having a default target value for the hypothetical learning task . control is then transferred to step 260 . in step 260 , a determination is made whether any training instances remain to be processed . if further instances exist , control is then transferred to step 215 and the process repeats for each remaining training instance . if no further training instances remain , control is then transferred to step 270 where the process ends . as shown in fig1 , the method of this invention is preferably implemented on a programmed general purpose computer . however , the invention can also be implemented on a special purpose computer ; a programmed processor or micro controller and peripheral integrated circuit elements ; an application specific integrated circuit ( asic ), or other integrated circuit ; a digital signal processor , a hardwired electronic or logic circuit , such as a discrete element circuit ; a programmable logic device , such as a pld , pla , fpga or pal , or the like . in general , any device capable of implementing a finite state machine that is in turn capable of implementing the flowchart shown in fig2 , can be used to practice the invention described above . while the invention has been described in the conjunction with the specific embodiments thereof , it is evident that many alternatives , modifications , and variations will be apparent to those skilled in the art accordingly , preferred embodiments of the invention as set forth herein are intended to be illustrative , not limiting . various changes may be made without departing from the spirit and scope of the invention as described in the following claims . | 6 |
the most versatile , conventional method for producing 2 - sheet spf / db parts and the cores for 4 or more sheet spf / db parts has been the stopoff technique , whereby a boron nitride or an yttria mixture is applied using silkscreening to the areas of the pack where bonding is unwanted . the stopoff pattern can be flexible to allow many different shapes of “ dot core ,” “ truss core ,” and other configurations of multi - sheet spf / db . in the stopoff method , however , the silkscreening process is difficult to control . process repeatability is a major issue . the method of the present invention is useful to make any of these prior art configurations . the resistance welding method of the prior art is not as flexible as the stopoff method for producing cores . for resistance welding , a straight line weld or only a slightly curved weld line can be produced — thereby limiting the designer in terms of the complexity of the design . “ dot core ”, for example , cannot be made using the resistance welding approach . laser welding is also limited when compared to the stopoff method , since the process creates distortion of the material due to the high melting / welding temperatures . the compression diffusion bonding system of the present invention is substantially as flexible as the stopoff method in terms of the complexity of spf / db panel that it can produce . virtually any core geometry can be cut into the cres templates . circular bonds will be used for “ dot core .” linear bonds with skips will be used for 2 - sheet compression bonded / formed “ stiffened panels .” many other variations are possible . as shown in fig3 a two - sheet pack 30 includes an upper sheet 10 , such as ti - 6al - 4v alloy , a lower sheet 12 of the same material , and an edge weld 14 ( or equivalent , fluid - tight seal ) to create a cavity between the sheets . the pack 30 is positioned between opposing die surfaces 16 and 18 in a superplastic forming press . the die surfaces are pressed together and the pack is heated to the superplastic forming range of he sheets . forming gas is introduced to the cavity or cavities 42 between the sheets through a suitable forming gas inlets ( 54 , fig5 ) to form the pack into the complementary die configuration of the finished part here a fully formed hat section , while diffusion bonds 44 are formed in the areas where the sheets 10 and 12 are in intimate contact between the precision machined surfaces of the die . my improvement to the compression db method through use of a cres template 52 is shown in various alternative embodiments in fig5 - 8 . a cres template 52 is located on one side ( fig5 ) or both sides ( fig6 ) of the pack . the template is a grid pattern ( fig9 ) and corresponds to the patterning made to the cres dies in the conventional process , but with greater flexibility in die configuration and reduced costs for manufacture . different part configurations can be made simply by changing templates rather than by changing dies . fig7 and 8 show the use of the cres template 52 in conjunction with a titanium spacer 56 . the spacer nulls deformations between the facing surfaces of the dies 58 and 60 that otherwise might lead to the disbonds mcdonnell douglas experienced . the spacer 56 softens at the forming temperature and fills any twists , bends , or valleys that might develop in the cres dies 58 and 60 . the templates also permit conversion of the diffusion bonding process to one capitalizing on efficient induction heating , thereby greatly reducing energy consuption . the diffusion bonding temperature can be easily controlled in an induction heating operation by selecting a suitable “ smart ” alloy with the appropriate curie temperature in the range from 1550 ″- 1750 ° f . for diffusion bonding of titanium or titanium alloys . the curie temparature , of course , would be lower for diffusion bonding other materials at lower temperatures . “ smart ” susceptors and suitable alloys are described in greater detail in u . s . patent application ser . no . 08 / 469 , 604 , which i incorporate by reference . the dies 58 and 60 are mounted on platens of the spf press . only the bottom platen is shown in fig5 - 8 for simplicity of illustration . a typical spf press is described in the patents already discussed or in u . s . pat . nos . 5 , 467 , 626 which i incorporate by reference . the platens 63 in a conventional resistance heating press supply the necessary heat and pressure for the forming as shown schematically with arrow 65 . forming gas inlets 54 for the spf workpiece in which diffusion bonds will be formed prior to expansion allow pressurized argon gas 67 or another suitable inert gas to inflate the cavity 42 ( fig4 ) to achieve the desired bonding and subsequent forming . i manage the gas supplied to the press using a gas management system generally of the type described in u . s . pat . no . 5 , 419 , 170 , which i incorporate by reference . i could also use boeing &# 39 ; s induction heating press as described in u . s . pat . no . 5 , 530 , 227 , for example . an induction heating press uses an oscillating magnetic field to induce eddy currents in the susceptor , which in this case would primarily be the template or templates . for induction heating , the dies generally would be ceramic and would inculde an embedded induction coil . the templates might be faced with another susceptor sheet to envelope the part pack . otherwise , the magnetic field would probably inductively heat the pack sheets at the same time they heated the templates . forming after bonding might be done in a separate operation , but the overall efficiency in time and energy savings still might favor the induction heating operation . a typical cres template 52 is shown in plan view in fig9 . the template is of window pane or gasket arrangement having narrow bands of cres metal to define regions for the diffusion bond lines in the pack and large open areas . while shown with rectangular openings and straight sides , the template can be cut in a wide variety of patterns as appropriate for the manufactured parts . the template is easy to manufacture at relatively low cost even from cres alloys . it generally is about 0 . 5 - 37 . 5 mm thick ( typically 1 - 10 mm ). it is cut with a 800 - 3000 w , co 2 or yag laser at any suitable draft angle or made in any other suitable way . the template 52 transfers pressure from the platens to the diffusion bond lines , and , in fact , intensifies the pressure to about 300 - 1200 psi by reducing the area through which the hydraulic ram force of the press acts . using the template allows the simpler facial configurations for the press dies since the template replaces the grid pattern conventionally used . if two templates are used ( fig6 ), i can create complicated forming and bonding patternsin the product . if the templates are identical in plan view ( fig1 ) so that the bands overlap in all locations , the matching bands of the templates create the 300 - 1200 psi pressure needed to form rapidly a diffusion bond between the sheets 10 and 12 in the area of overlap . i can reduce the diffusion bonding time from the three hours that the conventional process requires to one hour or less with resulting savings in energy consumption and labor . if , however , the bands of the templates do not register , the templates will not create pressure sufficient to form a diffusion bond . there , the bands will define expanded product configuration much like a feature milled into a die surface . the displaced bands will create unique pillowing patterns upset typically 5 - 15 % of the titanium sheet metal thickness as the inflating pressure 67 forms the sheets . while the dies in fig5 - 8 , 10 and 12 are shown with flat surfaces , generally these dies will have forming cavities 75 like those shown in fig4 . the two - sheet pack in fig4 is formed into a hat section stiffened panel . in my preferred embodiment , i use the template 52 to make a core 100 ( fig1 ) for a multisheet product such as the core of a turbine fan blade . the core 100 is sandwiched between face sheets 102 and 104 , which might be sheetstock metal matrix composites ( mmc &# 39 ; s ) or a mmc - sheetstock laminate . typical multisheet spf parts and cores that are the subject of the present invention are described , for example , in u . s . pat . nos . 5 , 330 , 092 and 5 , 534 , 354 , which i incorporate by reference . the core 100 from the initial diffusion bonding operation just decribed typically is aligned with sandwiching facing sheets 102 and 104 . the new part pack is welded 106 around the periphery of the facing sheets or otherwise sealed to form a 4 - sheet pack analogous to the 2 - sheet pack shown in fig3 . this 4 - sheet pack is loaded to an spf press and is bonded , expanded , and formed to the desired final configuration shown , for example , in fig1 . during this second forming operation , forming gas pressure is supplied , as appropriate , to cavities 108 or 110 between the core 100 and face sheets 102 and 104 or within the core itself , respectively . the face sheets bond to the core and the internal truss walls are completed around each diffusion bond 115 that i formed in the core during the initial bonding operation . the product is a multisheet part of high quality and with disbonds . a single sheet of material can be formed over itself , flattened to create a single bendline at the nose , and bonded in a region of intimate contact between overlapping surfaces to form a teardrop product useful as a control surface , leading edge , or rotor blade . if i us two templates , each cut into the same grid pattern , with templates of different thickness , the formed and bonded packs have a different depth , and the formed cells ( i . e . the “ pillowing ”) will be different in shape . if i use templates , each with a different grid pattern , such that some common surfaces are shared , the resulting part has cavities of different size , shape , draft angle and other configurations . the formed and bonded cells can be made to different shapes . a metal sheet ( generally titanium ) can be used as a spacer or gasket ( fig7 or 8 ) between the template and the flat block to null any out - of - flat discontinuities or distortions between the pack and the die surfaces . in effect , the spacer is a disposable metal sheet that functions much like a gasket to correct for nonplanar tools ( which is a common problem ) by filling valleys in the die surfaces . peaks are accommodated with the openings in the template . accordingly , the template is generally thicker than the spacer . of course , multiple templates might be stacked on one or both sides of the part pack to obtain desired product configuration . in operation , all tool elements are suitably coated or treated to allow disassembly of the dies , spacers , and templates . that is , suitable release agents might be used at the interfaces between these tools . i can also use precision matched dies that are curved or even have compound contour instead of the flat dies that i have elected to show in the drawings . the dies can be metal , carbon , ceramic , or any other suitable material . the templates might include the curvature to simply manufacture of the dies . that is , while i have illustrated that the templates have planar faces , i could fabricate matching curved faces into the templates to form waves into the part pack when the pack is loaded to the press . templates of this type , however , typically would be thicker . i might prefer to use a stack up of template elements in such case to reduce total cost . if a metal matrix composite ( mmc ) material , such a silicon carbide fiber reinforced titanium , is placed in a multisheet pack for the second forming operation , the entire stack - up can be spf / db processed to form the core into intimate contact with the mmc and to bond facing metal sheets to the mmc to form a single mmcreinforced , multisheet , spf / db panel . the process also lends itself to the use of spf / db metal sheets that have been preferentially chemically milled prior to processing to attain a particular pad - up or required thickness in the finished part with localized thickening . the template should remain strong ( about 15 ksi ) at the diffusion bonding temeratures for titanium in the range of about 1550 - 1750 ° f ., be resistant to creep , be resistant to oxidation , and be inert with the workpiece . i prefer a metal alloy that i can readily laser cut , such as inconel 625 , inconel 718 , cres 304 , cres 321 , steel ( especially nickel alloys ), titanium alloys , or other high temeprature , high strength materials . i could use a ceramic facing on the template as a gasket or backing between the metal of the template and the die surface . while i have described preferred embodiments , those skilled in the art will readily recognize alternatives , variations , and modifications which might be made without departing from the inventive concept . therefore , interpret the claims liberally with the support of the full range of equivalents known to those of ordinary skill based upon this description . the examples illustrate the invention and are not intended to limit it . accordingly , define the invention with the claims and limit the claims only as necessary in view of the pertinent prior art . | 1 |
the present invention satisfies the need for a way to control the interchange of digital information that allows control over security and access to the information , and which prevents unauthorized copying of copyright - protected content . in the detailed description that follows , like element numerals are used to describe like elements illustrated in one or more of the figures . various terms are used throughout the detailed description , including the following : appliance . electronic devices , systems , networks , and the like with the minimum capacity to acquire digital information , transmit the information , and acquire location information . these electronic devices will often include a processing capability to execute program instructions and a memory capacity for short term and long term data storage . associating location identity . the method of marking digital information with a location identity attribute . digital information . digital information is information that is represented in digital format . examples of information that can be represented digitally include text , data , software , music , video , graphics , etc . enforcing location identity . the method of providing or denying access to digital information through its associated location identity attribute . geocode . a unique coding of a location on earth usually associated with a coordinate system . some geocodes identify a point location , such as when a place is identified by its latitude and longitude . other geocodes may identify a region such as a zip code . geolock . an enforced association between digital information and a geographic area defined by a location identity attribute . geolocked information . digital information that has been associated with a location identity attribute , and that can only be accessed within an area defined by the location identity attribute . location . any geographic place . it may be , but is not limited to , a precise point location , an area or region location , a point location included within a proximate area , or combinations of places on earth . location can also include height ( or altitude ) to identify position above or below the surface of the earth , or time to identify position in a temporal dimension . location identity . a precise coding of a location . it can be used , but is not limited to , an attribute of information to precisely define the location at which the information is to be accessed . location identity may be a coding of a point location , a region , a region with an associated point location , a corridor ( i . e ., center line with length on either side of the center line ), or by any other precise identification of a location in space and time . location variance . the minimum resolution at which a geocode of a location may fail to exactly distinguish it from adjacent locations . for example , if a military grid reference system is used with two characters of precision , then any location is precise to within only ten kilometers . playback location . a location at which playback of digital information will be allowed . the foregoing definitions are not intended to limit the scope of the present invention , but rather are intended to clarify terms that are used in describing the present invention . it should be appreciated that the defined terms may also have other meanings to persons having ordinary skill in the art . these and other terms are used in the detailed description below . referring now to fig1 , a schematic illustration of the present invention depicts access to digital information determined by location identity . location identity refers to an attribute of information that precisely determines the geographic area or region in which the information is accessible . two geographic areas denoted by a and b are shown on a map 101 within the continental united states . information 130 is represented in digital format , and has an associated location identity attribute 131 which precisely defines the geographic area a as the region in which the digital information can be accessed . if an appliance 112 is located within the geographic region a , then the digital information 130 will be accessible by the appliance . conversely , if an appliance 122 is located within the geographic region b ( or anywhere else besides geographic region a ), then the digital information 130 will not be accessible . location identity thus represents an attribute of digital information that determines the precise geographic region within which the information can be accessed . digital information that have location identity are termed “ geolocked ” and systems that enforce location identity geolock the associated digital information to the geographic region defined by the location identity attribute . fig2 depicts a location identity attribute 140 as comprising two items of information : a location value 142 , and a proximity value 143 . the location value 142 corresponds to the unique position of a particular place . many different coordinate systems , such as latitude and longitude , have been developed that provide unique numerical identification of any location . for the purposes of this invention , any coordinate system that uniquely identifies a place can be used for the location value 142 of the location identity attribute 140 . the proximity value 143 corresponds to the extent of a zone or area that encompasses the location . the location identity attribute 140 may comprise a point location or an exact location if the proximity value 143 is set to zero , null , empty , etc ., or some other value indicating that the area referred to by the location identity attribute is a unique point location . it should be appreciated that the proximity value 143 is different from location variance . the proximity value 143 refers to a representation of an area or region , whereas location variance is the minimum resolution at which a geocode or a location may fail to exactly distinguish it from an adjacent location . fig3 depicts the location value 142 in greater detail . as noted above , there are numerous different coordinate systems in common use that provide a set of numbers that uniquely identify every location within the coordinate system . in the present invention , the location value 142 is defined in terms of a unique location designation or geocode as shown at 142 a . latitude 144 and longitude 145 using a conventional coordinate system may then further define the geocode . other known systems , such as the earth centered , earth fixed cartesian coordinate system , universal transverse mercator ( utm ), military grid reference system ( mgrs ), world geographic reference system ( georef ) etc ., could also be advantageously utilized . in addition to latitude 144 and longitude 145 , the location value could further include an altitude 146 as shown at 142 b , which corresponds to the height of the location above sea level . alternatively , the location value could further include a time value 147 that may be defined in terms of a date and / or time range . this allows the definition of location identity to consider both geographic and / or temporal access to information . any geographic region or area that contains the location value 142 of the location identity can serve as the proximity value 143 for the location identity attribute 140 . the proximity value 143 may comprise a rectangular region defined by two adjacent longitude lines ( providing horizontal edges ) and two adjacent latitude lines ( providing vertical edges ). alternatively , the proximity value 143 may comprise a circular region represented by a single number defining the radius around the location . the circular region can be further defined as an elliptical area either centered at the location , or a circular or elliptical area that contains the location but not necessarily as the centroid . in another alternative , the proximity value 143 may comprise an irregular closed polygon , or a corridor . in yet another alternative , the proximity value 143 may correspond to a known geographic region , such as the country of brazil . other types of known geographic regions that can define the proximity value 143 can include postal zip codes , states , counties , incorporated cities , etc . in accordance with the invention , whenever digital information is saved , stored , or copied , a location identity attribute 140 is associated with the digital information so that subsequent access of the digital information is limited to the geographic area specified by the location identity attribute 140 . fig4 illustrates a general method for associating digital information with the location identity attribute 140 that precisely defines the region in which access or playback of the digital information will be allowed . it should be appreciated that this method is analogous to the setting of a file attribute , such as a read - only attribute , for a computer file when the file is saved . the method would be performed by a system or device having a data processing capability and memory sufficient to generate , handle or process digital information for communication or distribution to another party , such as a personal computer , server , personal digital assistant ( pda ), laptop , workstation , network , and the like . software or embedded firmware instructions operating on the system or device would cause the method to be performed . more particularly , the method starts at step 200 with a command to save or store digital information with a location identity attribute . at step 202 , a location value 142 for the digital information is retrieved and stored for later use . the location value 142 is not necessarily the geographical location at which the method is invoked on the appliance , but rather corresponds to the location identity attribute ( described above ) for an appliance at which access to the digital information will be allowed . at step 204 , a proximity value 143 of the location identity attribute of the appliance is retrieved and stored for later use . various methods for generating the location and proximity values 142 , 143 will be described in greater detail below . in addition to such methods , the location and proximity values 142 , 143 may also be pre - stored and retrieved from memory , or the end user may be queried to provide the information . at step 206 , the retrieved location and proximity values 142 , 143 are used to generate the location identity attribute 140 . then , at step 210 , the digital information 216 is associated with the location identity attribute 140 to provide geolocked digital information 218 . attempts to access geolocked information through a read or copy operation performed by a playback appliance will be denied unless the appliance confirms a valid location identity . this is performed by evaluating the associated location identity of the digital information against the location of the playback appliance to determine whether there is a match . fig5 shows a general method for enforcing access to digital information by location identity . logically , this method is analogous to the way that operating systems currently enforce a read - only attribute on files , i . e ., allowing the user to access the file for reading , but denying access for writing . the method would be performed by a system or device having a data processing capability and memory sufficient to enable receipt of digital information communicated or distributed by another party , such as a personal computer , server , router , personal digital assistant ( pda ), workstation , network , laptop , and the like . software or embedded firmware instructions operating on the system or device would cause the method to be performed . particularly , the method starts at step 220 with a command to access the digital information . at step 222 , the geolocked digital information 218 is accessed to read and store the associated location identity attribute 140 . it should be appreciated that only the location identity portion of the geolocked information is accessed , and not the digital information itself . the location identity 140 of the geolocked information is stored for further use in the method . at step 224 , the method determines the location of the appliance accessing the digital information . as will be described below , there are numerous possible ways to determine the appliance location 160 . the appliance location 160 is stored for further use in the method . at step 226 , the method determines whether the location of the appliance is consistent with the region defined by the location identity 140 . if the appliance location 160 is consistent with the location identity 140 , then access to the geolocked digital information 218 is allowed at step 228 . conversely , if the appliance location 160 is not consistent with the location identity 140 , then access is denied at step 230 . fig6 a – 6d illustrate a plurality of exemplary methods to determine the playback location of the appliance that seeks access to the geolocked digital information . these methods would be performed by a system as part of the process of enforcing location identity with digital information , as described above with respect to fig4 . it should be appreciated that other methods for determining the playback location of the appliance could also be advantageously utilized . fig6 a shows an address decoding method 240 in which a geocode is resolved from the street address for the appliance that will receive the geolocked digital information . at step 242 , the address for the appliance is retrieved . the address information may be recalled from memory based on a previous communication with the appliance in which the address was obtained . alternatively , the appliance may prompt to provide the address information as an initial part of an information transaction . once the address information is retrieved , the address information is decoded to derive a specific geocode at step 244 . this step may utilize a commercially available software program that can generate a coordinate specific geocode from an address , such as the mapmarker ocx component version 4 . 2 from the mapinfo corporation located in troy , n . y . if it is desired to include a time element with the location identity attribute , then at step 246 the current time would be retrieved from the appliance , such as by reading the time from the appliance system clock . it should be appreciated that this step 246 is optional , and in many applications a time element would not be required . lastly , at step 248 , the geocode and time are converted to a format usable as the location value 142 for the location identity attribute 140 . fig6 b shows an appliance license method 250 in which the location value is derived from a license stored on the appliance . a license pack is a familiar feature of many systems and is generally used to validate access to application programs . license packs are digital files that contain information regarding the user / licensee . while not unbreakable , they are organized and encrypted in a way that makes them a reliable way of validating the user . in this embodiment of the invention , the license pack would include a coordinate specific geocode identifying the location of the appliance . at step 252 , the license pack stored on the appliance is accessed and retrieved . then , a geocode is recovered from the license at step 254 . if it is desired to include a time element with the location identity attribute , then at step 256 the current time would be retrieved from the appliance , such as by reading the time from the appliance system clock . it should be appreciated that this step 256 is optional , and in many applications a time element would not be required . lastly , at step 258 , the geocode and time are converted to a format usable as the location value 142 for the location identity attribute 140 . fig6 c shows a gps data recovery method 260 in which the location value is recovered from a gps receiver embedded in the appliance . as known in the art , the global positioning system ( gps ) is a satellite - based radio - navigation system developed and operated by the u . s . department of defense . gps permits land , sea , and airborne users to determine their three - dimensional position , velocity , and time , twenty - four hours a day in all weather , anywhere in the world . the gps system provides civilian users with an accuracy of less than one hundred meters , while military users have an even greater degree of accuracy . the gps position information is based on a system of coordinates called the world geodetic system 1984 ( wgs 84 ), and is similar to the latitude and longitude coordinate system . the commercial availability of gps receivers is increasingly common , and in this embodiment it is anticipated that the appliance include an embedded gps receiver . for example , gps receivers are available as pcmcia cards such as the navcard made by the rockwell corporation or the gpscard from trimble navigation , and the novalel corporation makes a gps receiver for a general purpose ibm pc . at step 262 , the gps receiver embedded in the appliance is accessed . a geocode is recovered from the embedded gps receiver at step 264 . optionally , a time value may also be recovered from the gps receiver . lastly , at step 266 , the geocode and optional time value are converted to a format usable as the location value 142 for the location identity attribute 140 . fig6 d shows a triangulation data recovery method 270 to determine the location of the appliance . as known in the art , triangulation is a method often employed by satellites , cellular phones , navigational systems , and other radio signal operators to provide accurate position information . the loran - c system is an example of a commercially available navigation system that provides location information by triangulating rf signals from a plurality of fixed position rf transmitters . at step 272 , the system will determine the direction to the appliance by accessing a rf signal communicated by the appliance . a geocode is calculated from the rf signal using a triangulation algorithm at step 274 . lastly , at step 276 , the geocode is converted to a format usable as the location value 142 for the location identity attribute 140 . if a time element is needed in the location identity attribute 140 , then the current time would be read from the appliance system clock in the same manner as described above . in accordance with an embodiment of the invention , the digital information is encrypted before transfer to an appliance and the location identity attribute 140 is used to generate a location identity based key used to encrypt the digital information . the layer of encryption added to the digital information enforces the limitation on access defined by the location identity attribute 140 . fig7 illustrates an encryption method for associating digital information with the location identity attribute 140 . the method starts at step 300 with a command to save or store digital information with a location identity attribute . at step 302 , a location value 142 for the digital information is retrieved and stored for later use . at step 304 , a proximity value 143 of the location identity attribute of the appliance is retrieved and stored for later use . at step 306 , the location and proximity values 142 , 143 are used to generate an area parameter 190 that defines a shape of the geographic region defined by the location and proximity values , but which does not identify the location . the area parameter 190 may correspond to the proximity value 143 . the location and proximity values 143 are used to generate a cryptographic location identity key 170 at step 308 . then , at step 310 , the digital information 312 in cleartext form is deterministically combined with the location identity key 170 by an encryption algorithm to provide encrypted geolocked digital information 314 in ciphertext form . this way , the cleartext would be encrypted based on the location identity key 170 , such that the location identity attribute is cryptographically integrated with the digital information . the area parameter 190 would also be attached to the geoplocked digital information 314 in cleartext form . it should be appreciated that other methods of generating the area parameter 190 may be utilized , as long as the area parameter alone is insufficient to generate the location identity key , but only when combined with the location of the appliance produces the location identity key . attempts to access the encrypted geolocked information through a read or copy operation performed by a playback appliance will be denied unless the appliance enforces the location identity . fig8 shows a method for enforcing access to digital information by cryptographic location identity . the method starts at step 320 with a command to access the digital information . at step 322 , the encrypted geolocked digital information 314 is accessed to recover the area parameter 190 . it should be appreciated that at this point only the area parameter 190 is accessed , but not the encrypted geolocked information . at step 324 , the method determines the location of the appliance accessing the digital information , such as using one of the methods described above . the appliance location 160 is stored for further use in the method . the method proceeds to step 328 in which the appliance location 160 is combined with the area parameter 190 to generate a cryptographic location identity key 170 . it should be appreciated that the cryptographic location identity key 170 generated in step 328 will match the cryptographic location identity key generated previously in step 308 ( see above ) only if the appliance location 160 is within the region defined by the location identity attribute . the cryptographic location identity key 170 is then used in an encryption algorithm in step 330 to decrypt the geolocked digital information 314 and produce the cleartext digital information 312 . it is noted that this method is not dependent upon any particular type of encryption algorithm and could be adapted for use with any known encryption method , including secret key encryption and public key encryption . in another embodiment of the invention , the location identity attribute 140 is associated with a file containing digital information by an application or operating system of an appliance so that subsequent access of the digital information by the application or operating system is limited to the geographic area specified by the location identity attribute 140 . unlike the embodiment of fig4 ( described above ) which was directed primarily to the communication of digital information between parties , this embodiment is most applicable to the management of data files by an application program or operating system executing on an individual appliance or a network of appliances . particularly , this method is directed to the inclusion of a location identity attribute with a file ( e . g ., in the file header ) which is used by an application program such as a word processing program , e - mail client or database manager to determine access to the file . it should be appreciated that an operating system could incorporate the present method into drivers that control basic system file operations , including save , store , copy , delete , and read commands . this is analogous to the way file attributes , such as read / write attributes , are handled in unix , windows and vax / dcl operating systems . fig9 illustrates a file method for associating digital information with the location identity attribute 140 that precisely defines the region in which access of a digital information file by an application or operating system will be allowed . the method starts at step 400 with a command to save or store a file containing digital information with a location identity attribute . this command may be performed as part of the ordinary operation of an application or operating system . at step 402 , a location value 142 for the digital information is retrieved and stored for later use . at step 404 , a proximity value 143 of the location identity attribute of the appliance is retrieved and stored for later use . as described above , various methods for generating the location and proximity values 142 , 143 may be utilized . at step 406 , the retrieved location and proximity values 142 , 143 are used to generate the location identity attribute 140 . then , at step 408 , the digital information 416 is integrated with the location identity attribute 140 to provide geolocked digital information 418 . there are many ways in which to integrate the digital information 416 with the associated location identity attribute 140 . for digital information 416 stored as a file , the location identity can be formatted and appended to the front of the digital information file , such as in a header . alternatively , the location identity attribute 140 can be saved in an associated directory file . in either case , an application or operating system attempting to access the digital information file will enforce location identity by determining whether the location identity attribute 140 allows access to the geolocked digital information . attempts to access geolocked information through a read or copy operation performed by an application or operating system executing on the appliance will be denied unless the appliance complies with the location identity . fig1 shows a file method for enforcing access to geolocked digital information by location identity . the method starts at step 420 with a command to access the geolocked digital information . at step 422 , the geolocked digital information 218 is accessed to recover the associated location identity attribute 140 . it should be appreciated that only the location identity portion of the geolocked information is accessed , and not the digital information itself . at step 424 , the method determines the location of the appliance accessing the digital information . as described above , there are numerous possible ways to determine the appliance location 160 . the appliance location 160 is stored for further use in the method . at step 426 , the method determines whether the location of the appliance is consistent with the region defined by the location identity 140 . if the appliance location 160 is consistent with the location identity 140 , then the application or operating system can access the geolocked digital information 218 at step 428 . conversely , if the appliance location 160 is not consistent with the location identity 140 , then access is denied at step 430 . since access to the geolocked digital information can only be achieved through an application or through the operating system , the application or operating system will be able to robustly enforce access to the geolocked digital information . in yet another embodiment of the invention , the method for associating digital information with the location identity attribute 140 can be implemented in a hardware controller for an appliance . every hardware device for an appliance ( e . g ., hard disk , dvd / cd - rom , floppy disk , video display , etc . ), has a corresponding hardware controller that performs a limited set of functions with the device in response to specific commands from a software operating system . as in the preceding embodiments , digital information is saved in association with a corresponding location identity attribute . any attempt to read the digital information through a device level command will be carried out by the device hardware controller with respect to the location of the playback appliance and the location identity stored on the device . specifically , the hardware controller may be adapted to execute some or all aspects of the aforementioned methods , including steps 202 – 210 of the general method described above with respect to fig4 , and steps 222 – 230 of the general method described above with respect to fig5 . for example , a hard disk controller for a personal computer may be coded to implement the foregoing method such that every digital information file that is stored in the hard disk has a location identity attribute stored therewith or as part of a file directory . the device hardware controller may further include an integrated gps receiver that can provide the device hardware controller with location and temporal information . as before , attempts to access the stored file will be blocked by the hardware controller unless the appliance location matches the location identity attribute . similarly , a video controller may be coded to block display of a file unless the appliance location matches the location identity attribute . there are numerous applications and data formats in which the location identity attribute can be used to control access to digital information . a user can receive geolocked digital information in electronic form using any conventional method , including via telephone line , fiber optic , cable television , satellite broadcast , wireless or other media . a user may also physically receive custom generated geolocked digital information from a store or vendor in the form of magnetic or other encoded media , e . g ., cd - rom , diskette , videocassette or tape . similarly , geolocked digital information can be communicated over a network including wide area networks such as the internet , local networks such as intranets , dial - up access between a personal and server computers , as an attachment to e - mail , or through a digital cell phone or other wireless device . geolocked digital information can be stored on diskette , cd - rom , tape , fixed or removable hard disk , dvd / cd - roms , flash memory / disks , eeproms , etc . the types of digital information that can be protected in this matter can include music files ( e . g ., mp3 ), software , literary works , commercial transaction files , text files , video / graphics , paging messages , cell phone conversation and commerce , and digital film , to name a few . in an exemplary application of the present invention , the location identity attribute may be used to combat the problem of piracy and unauthorized use and copying of digital film . a customer would rent or buy digital video media ( e . g ., dvd ) in a manner analogous to that when renting or purchasing film at a commercial video rental store . the location identity attribute is utilized at the time of purchase of the digital video media . specifically , the location identity attribute corresponding to the customer &# 39 ; s home address would be physically stored on a re - writable portion of the digital video media . the dvd player in the customer &# 39 ; s home will be coded to enforce the location identity attribute in order to limit the playback of the digital video media to the particular geographic region and time period . even if the media is copied , lost or stolen , it can only be viewed within its playback region and time span , and thus serves as a robust solution to the problems associated with unauthorized use of digital media . in another exemplary application , a customer orders digital film or audio through a vendor &# 39 ; s catalog . the catalog may be hardcopy or internet - based , and the order may be placed via postal mail , telephone , facsimile transmission or internet - based transaction . by whatever method the order is placed , the customer &# 39 ; s order indicates the playback location . when the order is filled by the vendor , the location identity attribute associated with the customer is determined and used to generate an encryption key which is then used to encrypt the digital information file for the media . the purchased media is then custom encrypted for the order , copied to a format such as dvd or cd - rom , and packaged with a viewer that is also customized for the location identity attribute . even if the entire contents of the purchased media are copied , the viewer and media , customized with the location identity attribute , prevent viewing except in the allowable region . in this exemplary application , the use of location identity and customized encryption and viewers provides a robust solution to the problem of piracy and unauthorized use and copying of digital media . in another exemplary application of the invention , location identity is used to “ narrowcast ” information over public networks . narrowcasting refers to the transmission of information to a limited audience ( in contrast with broadcasting whereby information is transmitted to a large audience ). many types of information are useable only within a location context , e . g ., local weather , traffic information , movie schedules , store information , etc . applications that use such location - dependent information may be referred to as location - based applications . location identity provides a way to use a broadcast type protocol to send information over a network that is identified by the location for which it is pertinent , e . g ., local area for weather , store location for sale and advertising information , etc . using the location of the client appliance , the client applications can utilize the location identity attached to the information to screen information selectively based on their current location . it can also provide a way to establish a unique location - based shared cryptographic key to maintain secure confidential communications for geographically limited narrowcast applications . in another exemplary application of the present invention , location identity is used to enhance confidentiality and security for wireless network connectivity . wireless networking is coming of age with the advent of networking equipment and protocols such as the “ bluetooth ” technology that allows wireless portable or workstations to connect to a network . “ bluetooth ” is an open standard for short - range transmission of digital voice and data between mobile devices ( e . g ., laptops , pdas , cellular telephones ) and desktop devices that supports point - to - point and multipoint applications . since every wireless appliance communicating over the network will have a unique location , location identity can be utilized to establish a unique shared cryptographic key that can be used to maintain secure confidential communications for wireless devices connecting over a public network . in still another exemplary application of the present invention , location identity is used to enhance confidentiality and security for users of web applications . internet “ cookies ” provide a way to allow web applications to maintain state between separate web pages , and are widely implemented by allowing the server to set and store name / value pairs on the user &# 39 ; s computer . a server delivers a cookie to the user computer containing a unique state identifier that is established and shared by the client and server . allowing the server to set and store information on a user &# 39 ; s computer , however , has raised confidentiality and security concerns . the present invention provides a new way to enhance confidentiality and security by allowing the client application to generate the unique state identifier , which can be shared with the server , and used to maintain state for a web - based application . in each of the foregoing embodiments and exemplary applications , there are at least four logical boundaries that exist between the application program that accesses geolocked digital information and the peripheral and network environment in which these applications operate . these boundaries include : ( 1 ) the data acquisition / appliance boundary ; ( 2 ) the storage / appliance boundary ; ( 3 ) the user interface / appliance boundary ; and ( 4 ) the appliance / acquiring location boundary . the data acquisition / appliance boundary refers to the enforcement of location identity at the point of acquisition of digital information by an appliance , e . g ., the appliance that cannot acquire the digital information from another source unless the location identity attribute is satisfied . the storage / appliance boundary refers to the enforcement of location identity at the point of storage of digital information by an appliance , e . g ., the appliance cannot recall a stored file from memory unless the location identity attribute is satisfied . the user interface / appliance boundary refers to the enforcement of location identity at the point of presenting the information to the user , e . g ., the user cannot view the digital information on the monitor of the appliance unless the location identity attribute is satisfied . the appliance / acquiring location boundary refers to the limitations upon access to geolocked data by validating the appliance location , e . g ., the user cannot view , store , retrieve or otherwise utilize the digital information in any manner unless the appliance location is acquired using an embedded gps receiver . it should be appreciated that the relative security provided by any particular implementation of the present invention is related to the boundary at which access control is enforced . having thus described a preferred embodiment of a system and method for using location identity to control access to digital information , it should be apparent to those skilled in the art that certain advantages of the invention have been achieved . it should also be appreciated that various modifications , adaptations , and alternative embodiments thereof may be made within the scope and spirit of the present invention . the invention is further defined by the following claims . | 6 |
the present invention embodied in a foldable portable telephone is now described with reference to the drawings . as shown in fig1 , a foldable portable telephone of the present invention has an operation housing 1 and a display housing 2 that are openably and closably coupled to each other via a hinge mechanism 3 . the operation housing 1 includes a battery pack 4 , and has a plurality of operation buttons ( not shown ) arranged on the facing surface to the display housing 2 . the display housing 2 has a main display ( not shown ) arranged on the facing surface to the operation housing 1 , and has a sub display 20 arranged on the back face of the display housing 2 . as shown in fig2 , the foldable portable telephone of the present invention includes a cabinet body 14 of the operation housing 1 that includes a battery chamber r and two side plate portions 11 , 11 projecting from both ends of the battery chamber r . the cabinet body 14 has an antenna substrate 53 and a high frequency substrate 52 that are arranged on opposite sides across the battery chamber r . the antenna substrate 53 and the high frequency substrate 52 are electrically connected to each other by a coaxial cable 7 . the coaxial cable centrally includes a wire exposed portion 7 a for grounding . a support plate 6 made of stainless steel and centrally having an opening 61 is placed in the battery chamber r . two first coupling pieces 62 , 62 and two second coupling pieces 63 , 63 project from both ends of the support plate 6 . the two first coupling pieces 62 , 62 are coupled to the high frequency substrate 52 , and the two second coupling pieces 63 , 63 are coupled to the antenna substrate 53 . the support plate 6 supports the antenna substrate 53 and the high frequency substrate 52 via the first coupling pieces 62 , 62 and the second coupling pieces 63 , 63 . the coaxial cable 7 is placed between the support plate 6 and the bottom of the battery chamber r . the support plate 6 is electrically connected to the wire exposed portion 7 a of the coaxial cable 7 to thereby connect the antenna substrate 53 and the high frequency substrate 52 to a ground potential via the support plate 6 . further , heat dissipation effect on the high frequency substrate 52 is given by the support plate 6 being coupled to the high frequency substrate 52 via the first coupling pieces 62 , 62 . the antenna substrate 53 is covered with an antenna substrate cover 13 . the high frequency substrate 52 is covered with a high frequency substrate cover 12 . two tongues 15 , 15 project from an end of the high frequency substrate cover 12 . the two tongues 15 , 15 cover both ends of the hinge mechanism 3 . the battery pack 4 is detachably received via the support plate 6 in the battery chamber r of the cabinet body 14 . two nail pieces 17 , 17 project from an end of the battery lid 41 , and are inserted into two connection holes ( not shown ) provided on an end face of the high frequency substrate cover 12 that faces the battery chamber r . the antenna substrate cover 13 has a lock mechanism 16 for locking the battery pack 4 . the lock mechanism 16 detachably locks the battery pack 4 . as shown in fig3 , the battery pack 4 includes a battery 42 and a battery lid 41 joined to the battery 42 by ultrasonic welding . the battery 42 includes a battery body 43 and a battery case 44 storing the battery body 43 . the battery lid 41 has a main plate portion 45 ultrasonically welded to the battery 42 and two side plate portions 46 , 46 connected to both ends of the main plate portion 45 . the two nail pieces 17 , 17 to be inserted into the two connection holes of the high frequency substrate cover 12 project from an end of the main plate portion 45 . the battery pack 4 will be expanded in the thickness direction by using the battery pack 4 received in the battery chamber r of the cabinet body 14 under high temperature and high humidity environments . in the case of the conventional portable telephone 100 , as shown in fig5 , the expansion of the battery pack 103 causes the battery pack 103 to press the support plate 111 covering the inside of the battery chamber r of the cabinet body 101 , causing the reaction force thereof to raise the battery pack 103 outward from the battery chamber r . this results in each gap g being defined between the side plate portions 115 , 115 of the battery lid 109 and the side plate portions 110 , 110 of the cabinet body 101 . in contrast , in the case of the portable telephone of the present invention , as shown in fig4 , the opening 61 accommodates the expanded portion of the expanded battery pack 4 to thereby mitigate the force pressing the bottom face of the battery chamber r . this results in reducing the reaction force from the support plate 6 and the battery chamber r , preventing the battery pack 4 from being raised outward from the battery chamber r . this results in preventing a gap g from being defined between the side plate portions 46 , 46 of the battery lid 41 and the side plate portions 11 , 11 of the cabinet body 14 . the size of the opening 61 is determined in view of the strength of the material of the support plate 6 , and may be at least within a range in which the support plate 6 can maintain mechanical strength to support the antenna substrate 53 and the high frequency substrate 52 . the present invention is not limited to the foregoing embodiment in construction but can be modified variously without departing from the spirit of the invention as set forth in the appended claims . although the present invention embodied in a foldable portable telephone is described in the above described embodiment , the present invention is not limited to this but can be carried out in small electronic devices such as phss ( personal handyphone systems ), laptop personal computers or the like . | 7 |
latchup is defined as the triggering of a parasitic structure which then acts as a short circuit creating a low impedence path between the power supply rails and an electrical component . fig1 is a plan view of a gate array according to embodiments of the present invention . in fig1 , formed in a substrate 100 is a gate array 105 . gate array 105 is surrounded by shallow trench isolation ( sti ) 110 ( heavy lines ). gate array 105 includes a pfet gate array 115 and an nfet gate array 120 . it should be understood that a “ gate array ” includes at least one pfet device , and one nfet device , whereas a “ pfet gate array ” includes one or more pfet devices , and whereas a “ nfet gate array ” includes at least one or more nfet devices , where spatially the pfet device or gate array and the nfet device or gate array are in proximate to each other . pfet gate array 115 includes an n - well 125 , source drains 130 formed in the n - well and an n - well contact 135 to the n - well . nfet gate array 120 includes a p - well 140 , source drains 145 formed in the p - well and a p - well contact 150 to the p - well . an array of gate electrodes 155 is common to both pfet gate array 115 and nfet gate array 120 . when substrate 100 is p - type , p - well contact 150 is also a substrate contact . it should be noted that n - well contact 135 and p - well contact 150 on located on opposing sides of gate array 105 to allow compact layout of gate electrodes 155 . an electrically conductive through via 160 contacts p - well 140 and sti 110 ( see fig3 and description infra ). alternatively , a first array of gates may be positioned over n - well 125 and a second array of gates , not physically attached to the first array of gates , may be positioned over p - well 140 , instead of common gates 155 . fig2 is a cross - section through line 2 - 2 of fig1 . in fig2 , source / drains 145 are separated by channel regions of p - well 140 under gate electrodes 155 and gate dielectric 165 intervenes between the gate electrodes 155 and these channel regions . a top surface of sti 110 is coplanar with a top surface 170 of substrate 100 . p - well 140 abuts a bottom surface 185 of sti 110 . formed on a bottom surface 175 of substrate 100 is an optional electrically conductive layer 180 . the structure of pfet array 115 is similar with p - well 140 being replaced with n - well 125 ( see fig1 ) and source / drains 145 being replaced with source / drains 130 ( see fig1 ). fig3 is a cross - section through line 3 - 3 of fig1 . in fig3 , through via 160 extends from bottom surface 180 , through substrate 100 , through p - well 140 to abut a bottom surface 185 of the region of sti 110 between pfet gate array 115 and nfet gate array 120 . either an electrically conductive contact , which may be ohmic ( e . g ., having resistance of about 1 ohm or less ) or a schottky diode is formed at the interface of through vias 160 and p - well 140 . conductive layer 180 provides a low - resistance contact to through via 160 . through via 160 prevents latchup by preventing formation of a parasitic lateral pnpn device comprising source / drains 130 and 145 ( see fig1 and 2 ) p - well 140 and n - well 125 . through via 160 eliminates the regenerative feedback between the pnp and npn portions of the pnpn device through substrate 100 . in fig3 , through via 160 does not touch n - well 125 . in one example , through via 160 comprises doped polysilicon , one or more refractory metals examples of which include tungsten , titanium and tantalum , or combinations thereof . in one example , conductive layer 180 comprises doped polysilicon , aluminum , platinum , nickel , cobalt , a metal silicide , one or more refractory metals examples of which include tungsten , titanium and tantalum , or combinations thereof . it should be understood , that substrate 100 may be p or n - type and through via 160 may formed through n - well 125 instead of p - well 140 ( see fig3 ). thus , the embodiments of the present invention provide more robust latchup preventive structures and methods for preventing latchup for gate arrays in integrated circuit chips . the description of the embodiments of the present invention is given above for the understanding of the present invention . it will be understood that the invention is not limited to the particular embodiments described herein , but is capable of various modifications , rearrangements and substitutions as will now become apparent to those skilled in the art without departing from the scope of the invention . therefore , it is intended that the following claims cover all such modifications and changes as fall within the true spirit and scope of the invention . | 7 |
noble gases comprise a group of elements consisting of helium , neon , argon , krypton , xenon and radon , which show essentially no chemical reactivity under regular conditions , e . g . room temperature even in a mixture with chlorine gas . theoretically speaking all noble gases can be used for mixing with chlorine for the microorganism control . in reality , the suitability of each noble gas is determined by its density , availability and cost as shown in table 1 . in order to make a mixture that is physically stable during storage and use , a noble gas is required that has a comparable density to chlorine . if the noble gas is too light , then it will create a blanket close to the ceiling in a closed system , preventing chlorine access to the ceiling . likewise , if the noble gas is too heavy , then the floor will be shielded from chlorine . the cost of the noble gas is another important factor when this mixture is to be commercialized . from table 1 , it can easily be appreciated that argon is the best candidate , with neon in the second place and less preferable . argon and chlorine are the preferred mixture . argon and chlorine gases can be stored in separate commercial containers of appropriate material , e . g . steel tanks , equipped with calibrated dials on their release valves . when the agent is to be applied , the mixture can be generated by passing the gases from the high - pressure containers through their respective pressure regulator into a mixer . a representative design of the mixer can be a y - shaped tube . one side is the two arms , each of which connects to one gas supply and the other side is one stem , which directs the mixed gases into the air for dispensing purpose . a representative size of the y - shaped tube is 0 . 5 inch long for each of the two arms , and 1 inch long for the stem and the size can be increased or decreased according to need or convenience . the mixer can be made of any material that has sufficient strength and chemical resistance to corrosion from chlorine . a few of the exemplar materials are monel , which is a mixture of copper and nickel , nickel itself , or stainless steel . a preferred material is teflon ( dupont ). teflon material possesses outstanding chemical resistance to chlorine and is lightweight compared to metal or metal alloys . a suitable device , e . g . a baffle , can be installed in the stem to promote efficient mixing . the amount of chlorine gas and the ratio of argon to chlorine can be varied according to need . for example , to clean a room 20 ft long , by 20 ft wide , by 10 ft high using the gas mixture of the invention , 20 cubic feet of chlorine , 400 cubic feet of argon , which accounts for a ratio of argon : chlorine at 20 : 1 ( or 5 % chlorine ) can be utilized . even levels of 1 - 3 % of chlorine can work very effectively . if virus on an exposed surface is the target , as little as 0 . 1 to 0 . 2 % of chlorine could be enough . however , it is possible to increase the level of chlorine so that the chlorine is present in an amount of up to 25 % of the total mixture of chlorine and argon , especially in cases of emergency situations . the mixture chlorine and argon (“ chloragon ”) can be sprayed into the site of the microorganisms , such as bacteria , virus , spores and even where termites or mice are the problem or where black mold is present . the fact that it is in a gas form makes it possible to quickly and deeply penetrate even the smallest cracks and crevices of the enclosed area and particularly where the organism may linger to recontaminate later if the conventional method or physical removal are used . the fact that chlorine is denser than air ( about 0 . 0012 g / cm 3 at 1 atmosphere , and 20 ° c .) helps keep chlorine in the crevices and on top of the floor for a longer period of time for higher efficiency . it is to be noted that the space needs to be enclosed and maintained closed for the duration of the treatment in order to maintain the concentration of chlorine substantially constant and avoid its diffusion into the atmosphere , whereby the organisms or microorganisms contained in the closed space can be destroyed . therefore , the doors , windows and other openings need to be closed or taped shut , and the ventilation system also shut off during the application period . the length of the period can be varied depending on the target , the chlorine concentration , the volume of the mixture released , etc . in order to kill a virus exposed on a surface with chloragon , one or two hours should be enough in most cases . while if the target is a spore former , such as anthrax , one or two days may be necessary . it may be necessary to install an alarm or detection system to detect malfunction in the chlorine - argon systems and for determining chlorine residuals . due to the toxic effect of chlorine at relatively high concentration in the air , any person , pets , plants or other living organisms should be kept from the room or building before the site is fumigated with the chloragon gas mixture and thorough ventilation is necessary afterwards before the inhabitants return . in typical conditions , one or two hours should be sufficient for ventilation . a fan can be used to expedite the ventilation since neither argon nor chlorine is flammable by electrical sparking . chlorine is a very reactive element and undergoes reaction with a wide variety of other elements and compounds . it reacts directly with most metals and many chemicals , with the exception of nitrogen , oxygen , air and carbon . chloragon should not be applied during humid days , because the moisture can react with chlorine and produce highly corrosive hcl acid . argon is a noble gas , which is obtained from air , is so - called inert and does not react with air , hcll , hno 3 , naoh , etc . the norwalk and norwalk - like viruses , anthrax , legionellae , sars virus and mold have to be attacked quickly , considering the acuteness and severity of the illnesses associated with the microorganisms in issue , and the rapid onset and communication of these illnesses . the use of the chloragon gas compositions has the advantage that it can penetrate into the empty spaces and crevices so that the microorganisms can be eliminated completely . after the decontamination by chloragon and before the site is reoccupied by inhabitants , the residual chlorine has to be completely removed through efficient ventilation , and the ventilation can be expedited by opening doors and / or windows , using fans or other exhaust means . | 0 |
dna sequences for several membrane proteins are listed in the embl database , in most cases , they do not have introns . with the help of primers , the required dna can be produced via pcr from genomic dna or via rt - pcr from mrna . this dna is then cloned into an expression vector , which was constructed for the expression of a fusion protein . the tag part protein can be e . g . an histidine tail ( his ), as described in the art , e . g . in sambrook , j . and russell d . w . ( 2001 ), “ molecular cloning — a laboratory manual ”, cold spring harbor laboratory press , new york , which is herewith incorporated by reference . vectors for the expression of sphingosin 1 phosphate receptor ( gpr3 ) and of cannabinoid receptor 1 ( cb1 ) as histidine - tagged glutathione - s - transferase ( gst ) fusion proteins were produced . the expression vectors were transformed into a cell line which expressed the fusion proteins . the proteins are , in this procedure , not incorporated into the membrane , but exist at least partly aggregated in form of inclusion bodies in cytoplasm and are , thus , not correctly folded . the cdnas of above mentioned membrane proteins were each , in - frame , inserted into the vector pgex2a - c - his . this vector contains downstream of the tac - promotor the sequence encoding glutathione - s - transferase and a subsequent thrombin cleavage site , followed by a polylinker sequence and , finally , six histidine codons and a stop codon . the vectors were transformed into e . coli strains derived from strain k12 , e . g . bl21 or blr . the protein expression was induced by adding iptg , and the cells were harvested after further three hours . after lysozyme treatment and homogenization by sonification , the membranes and inclusion bodies were separated from the soluble proteins by centrifugation . for each membrane protein 50 ml of inclusion bodies were centrifuged for 10 min , at 4 ° c . at maximum speed . each pellet was resuspended in 450 ml of the following buffer : 25 mm tris / hcl ph 8 . 5 , 250 mm nacl , 1 mm dtt , and put on ice for 15 min . subsequently , each ice cold sample was subjected to sonification for 3 min at 50 % “ duty cycle ” and 80 % power in a bandelin sonoplus microsonicator using a rosette cell . it has to be ensured that the sample will be kept cool . afterwards 50 ml of following first detergent and lipid containing buffer solution was added to each sample : 10 % l - lauroyl - sarcosine ( ls ) in tbs ph 8 . 5 containing 0 . 1 mg / ml brain polar lipid extract ( aranti polar lipids inc ., alabaster , usa ; cat . no . 14110 ). the membrane protein was herewith solubilized . to each sample 12 . 500 u thrombin was added , in order to cleave the gst fusion part . each sample was slowly stirred overnight at 20 ° c . afterwards , the membrane protein was solubilized . the sample was centrifuged for 20 min at ≧ 20 . 000 g at 4 ° c . 25 ml of ninta column material equillibrated in 50 mm hepes / naoh ph 7 . 5 , 250 mm nacl and 1 % ls was added to 500 ml of solubilized membrane protein , e . g . of gpr3 or cb1 . the sample was incubated for 30 to 60 min , afterwards the column material comprising the immobilized membrane protein was transferred either into an empty column or an xk26 / 30 column ( amersham , buckinghamshire , uk ). the following steps were performed at 4 ° c ., i . e . all buffers used were stored on ice . the column was washed with 10 column volumes ( cv ) of 50 mm hepes / naoh ph 7 . 5 , 250 mm nacl , 0 . 1 mg / ml brain polar liquid extract , 1 mm gsh , 1 mm gssg , 1 % ls ; followed by washing with 10 cv of 50 mm hepes / naoh ph 7 . 5 , 250 mm nacl , 1 % fos - choline - 14 ( c14 , n - tetradecylphosphocholine ; second detergent ). elution was performed using 3 cv of elution buffer , i . e . 50 mm hepes / naoh ph 7 . 5 , 500 mm nacl , 300 mm imidazole ( ph 7 . 0 ), 0 . 1 % c14 . therefor the column was incubated with the incubation buffer for 15 min at room temperature . subsequently , fractions of 8 ml each were eluted . aliquots of solubilized membrane protein , flow through , wash and elution fractions were separated by sds page followed by coomassie blue staining in order to examine purity and yield . the first three elution fractions were pooled . a typical yield is about 22 mg of protein , i . e . of gpr3 or cb1 , concentrated at 1 . 45 mg / ml . the solution was concentrated to 10 to 15 mg / ml using an amicon ultra 15 ml 30 kd ultrafiltration concentrator . a superdex 200 10 / 300 gl column ( amersham biosciences , buckinghamshire , uk ) was equillibrated using 1 . 5 cv of 20 mm hepes / naoh ph 7 . 0 , 200 mm nacl , 0 . 1 % c14 . 8 times 100 μl of concentrated protein solution , i . e . about 0 . 8 mg , were added to the column . elution was performed using 1 . 5 cv of above mentioned elution buffer . fractions of 200 μl each were collected . the fractions were analyzed by means uv absorption at 280 nm and sds page followed by coomassie blue staining . alternatively , a superdex 200 26 / 60 prep grade column was used . in this case , approximately 50 mg of protein were added to the column . fractions of 5 ml each were collected . monomeric fractions were pooled . the pooled sample was concentrated to 10 mg / ml using an amicon ultra 10 ml 30 kda device . a typical yield is 3 mg protein . in order to confirm whether the sample is purified , i . e . consisting exclusively of monomeric membrane protein , 10 μl of concentrated protein solution was subjected to an analytic gel filtration using a superdex 200 10 / 300 gl column , 20 mm hepes / naoh ph 7 . 0 , 200 mm nacl , 0 . 1 % c14 . alternatively , the second detergent c14 was changed for a third detergent by performing the following procedure : a superdex 200 10 / 300 gl column was equilibrated using 1 . 5 cv of 20 mm hepes / naoh ph 7 . 0 , 200 mm nacl , and third detergent ( e . g . 0 . 01 % fos - choline - 16 , or 0 . 01 % tetradecylmaltoside ). 1 mg protein of each sample was subjected to a size exclusion filtration as described before . the monomeric fractions were pooled , the solution was concentrated to 10 mg / ml using an amicon ultra 15 ml 30 kda device . a superdex 200 26 / 60 prep grade column was equilibrated using 1 . 5 cv of 20 mm hepes / naob ph 7 . 0 , 200 mm nacl , 0 . 1 % c14 . 5 ml of concentrated protein solution , i . e . about 50 mg , were applied to the column , elution was performed using 1 . 2 cv of above mentioned elution buffer . fractions of 5 ml each were collected . monomeric fractions were pooled . the pooled sample was concentrated to 10 mg / ml using a millipore ultra 100 kda . the pooled sample was checked via a superdex 200 hr 10 / 30 column using 20 mm hepes / naoh ph 7 . 0 , 200 mm nacl , 0 . 1 % c14 . alternatively , a superdex 200 10 / 300 gl column was used . in this case , approximately 1 - 2 mg of protein were applied in a volume of 100 μl to the column . fractions of 0 . 2 ml each were collected . monomeric fractions were pooled . the pooled sample was concentrated to 10 mg / ml using an amicon ultra 15 ml 100 kda device . a typical yield is 5 - 15 mg protein . in order to confirm whether the sample is homogenous , i . e . consisting exclusively of monomeric membrane protein , 10 μl of concentrated protein solution was subjected to an analytic gel filtration using a superdex 200 10 / 300 gl column with 20 mm hepes / naoh ph 7 . 0 , 200 mm nacl , 0 . 1 % c14 as running buffer . alternatively , the second detergent c14 was exchanged for a third detergent by performing the following procedure : a superdex 200 26 / 60 prep grade column was equilibrated using 1 . 5 cv of 20 mm hepes / naoh , ph 7 . 0 , 200 mm nacl , and a third detergent ( e . g . 0 . 01 % fos - choline - 16 , 0 . 01 % tetradecylmaltoside , or 0 . 1 % lauryldimethylamine n - oxide ( ldao )). 1 mg protein was subjected to a size exclusion filtration as described before . the monomeric fractions were pooled , the solution was concentrated to 10 mg / ml using an amicon ultra 15 ml 100 kda device . the crystallization was performed according to “ sitting drop ” vapour diffusion technique . therefor a crystalquick 288 plate with circular wells ( greiner , germany ) was used . the reservoir solution was 0 . 1 m tris / hcl , ph 8 . 5 ; 24 % polyethyleneglycol ( peg ) 4000 . each drop was consisting of 200 nl protein solution of example 5 , and of 200 nl reservoir solution . the screening for crystals was performed according to standard screening procedures , e . g . sparse matrix sampling technology . corresponding commercialized screens can be found at hampton research inc ., aliso viejo , usa ( http :// www . hamptonresearch . com / hrproducts / xtalscreens . html ; http :// www . hamptonresearch . com /). crystals have been developed after 10 days as shown in fig1 . the crystallisation was performed using the “ sitting drop ” vapour diffusion technique . the screening for crystals was conducted using commercially available sparse matrix screens . corresponding screens can be found at hampton research inc ., aliso viejo , usa ( http :// www . hamptonresarch . com / hrproducts / xtalscreens . html ; http ;// www . hamptonresearch - com /). the reservoir solution was 0 . 1 m hepes / naoh , ph 7 . 0 , 40 % polyethyleneglycol monomethylether ( pegmme ). each drop was consisting of 100 - 200 nl protein solution of example 5 , and of 100 - 200 nl reservoir solution . crystals grew after 10 - 14 days at 18 ° c . as shown in fig2 . | 2 |
referring now the drawings , wherein like reference numerals designate identical or corresponding parts throughout the several views , and more particularly to fig2 thereof , in fig2 the shift control system for the keyboard includes a central processing unit ( cpu ) 11 , a keyboard controller 12 and a scan type keyboard 13 . the keyboard controller 12 is a programmable interface device designed to interface the keyboard 13 and the cpu 11 . the keyboard controller 12 includes a scanning counter to count the number of the keys . the key matrix of the keyboard 13 includes at least one shift key in addition to plural character keys . the scan lines 14 provide scanning signals to the encoder 21 via the register 17 . the return lines 15 provide raw key data to the encoder 22 via the register 18 . the control line 16 provides a control signal to the register 20 from the cpu 11 . the outputs of the encoders 21 and 22 are coupled to the comparator 23 and the keyboard controller 12 through the register 19 . the comparator 23 has another input from the register 20 . the cpu 11 writes the matrix code identifying the matrix position of the shift key into the register 20 . the comparator 23 compares the return data with the matrix code of the shift key to determine if the shift key has just been operated . in fig3 another embodiment of the invention is shown in block diagram form . the difference between the embodiments of fig2 and fig3 is that in the fig2 embodiment there is one shift key , however , in the embodiment in fig3 there are plural shift keys . in correspondence with the increase of the number of shift keys , there are provided respective registers 20 1 - 20 n and comparators 23 1 - 23 n . the outputs of the comparators are applied as inputs to the or gate 33 . the register 31 is a status register provided to indicated the status of the each shift keys . the output of the or gate 33 is supplied to the register 32 along with the outputs of the register 19 which instantly latches the outputs of the encoders 21 and 22 . thus , register 32 stores not only the contents latched in the register 19 but also stores an output of the or gate 33 , such that if one of the shift keys has been operated the most significant bit of the register 32 is &# 34 ; 1 &# 34 ;. referring to fig2 the operation of the invention will be explained as follows . the cpu 11 preliminarily writes the matrix code of the shift key designated by the programs into the register 20 . the writing of the shift key matrix code is controlled by the control signal 16 and defines the position of the shift key in the key matrix . the keyboard controller 12 begins to scan the key matrix 13 . if there are any keys pushed down , the return lines 15 transfer the signals . the return signals are stored in the register 18 and are coded by the encoder 22 . while the codes of the return lines are being made , the scan lines 14 are stored in the register 17 and are coded by the encoder 21 . the outputs of both encoders 21 and 22 are stored in the register 19 . therefore it is possible to determine whether or nor the shift key is depressed by comparing the contents of the register 19 with that of the register 20 , because the matrix code of the shift key was preliminarily stored in the register 20 as aforementioned . the keyboard controller 12 transmits the keycodes including the status of the shift key to the cpu . the keyboard controller controls the registers 17 , 18 and 19 and the comparator 23 by the control timing signals 24 . in the case of plural shift keys as shown in fig3 the register 31 is provided to indicate the status of the shift keys , that is , which shift key is depressed . in this embodiment the bit corresponding to a respective depressed shift key is set to &# 34 ; 1 &# 34 ;. the register 31 must have a number of bits equal to the number of shift keys . the register 32 stores the keycodes and is designed such that if one of the shift keys is operated the most significant bit becomes &# 34 ; 1 &# 34 ;. the keyboard controller 12 operates to make its most significant output bit &# 34 ; 1 &# 34 ;. if the most significant bit of the register 32 is &# 34 ; 1 &# 34 ;, the keyboard controller sends the data of register 32 to the cpu and then also sends the contents of the register 31 to the cpu 11 . however , if the most significant bit of the register 32 is &# 34 ; 0 &# 34 ; indicating no shift key is depressed , the keyboard controller does not send the register 31 data to the cpu since no shift key is depressed . if the cpu 11 receives the data of register 32 in which the most significant bit is &# 34 ; 1 &# 34 ; from the keyboard controller 12 , the cpu 11 only generates the keycodes after receiving the corresponding shift status data . if the cpu 11 receives the data of register 37 in which the most significant bit is &# 34 ; 0 &# 34 ;, the cpu 11 generates the keycodes immediately , concluding that no shift key is depressed . in this embodiment although the operation of any of the shift keys is indicated by the most significant bit of the register 32 , others of the bits can be used for this purpose , for example , the least significant bit or another intermediate bit . further , it is a simple design task to employ negative logic in the control operations . these alternatives can be accommodated under control of the cpu . referring to fig4 the coding of the encoders 21 and 22 is nextly explained . in fig4 operations of the key matrix are shown when the key identified by the symbol 0 is depressed . in the example prior to scanning each of the scan lines 14 ( 0 - 11 ) and the return lines 15 ( 0 - 7 ) are &# 34 ; 1 &# 34 ;. if the scan line 4 becomes &# 34 ; 0 &# 34 ;, the return lines 3 becomes &# 34 ; 0 &# 34 ; at the depressed key . the encoders 21 and 22 read the number 4 ( 0100 ) of the scan lines 14 and the number 3 ( 011 ) of the return lines 15 and make their respective coding . in the embodiment although the register 19 has eight bits for the convenience of the keyboard controller 12 , the number of bits can be selected based on user convenience . namely in the embodiment although the number of scan lines is sixteen and there are eight return lines , if more lines are needed , the additional lines can be accommodated by increasing the number of bits of the register 19 . in fig5 the keyboard controller employ a single chip microprocessor 41 . operation of this embodiment is nextly explained referring to the flow chart of the firmware operations shown in fig6 . in comparison with the embodiments in fig2 and fig3 the keyboard controller itself compares the shift codes with the scanned codes , whereby the hardware is simplified . when the cpu is initiallized by being provided a source program , it sends the matrix codes of the shift key preliminarily determined by the source program to the microprocessor 41 . the microprocessor 41 stores the data in its memory . when the microprocessor 41 scans the key matrix and finds a depressed key , the microprocessor 41 compares the codes of the depressed key with the matrix codes of the shift key stored in memory . if the microprocessor 41 detects a comparison coincidence , the processor 41 turns on a shift bit in the status area of the memory and scans the depressed key . if plural shift keys are depressed , the microprocessor 41 turns on the corresponding shift bits of the status area allocated in the memory to the shift keys . then as shown in fig3 the microprocessor reads the data other than the shift keys and makes the most significant bit of the data sent to the cpu &# 34 ; 1 &# 34 ;, and after this operation the microprocessor sends this data to the cpu 11 and then also sends the contents of the shift status area to the cpu . the cpu 11 generates the corresponding keycodes based on the two sets of data . however , if a shift key is not pushed down . the microprocessor makes the most significant bit of the data sent to the cpu &# 34 ; 0 &# 34 ; and then sends this data to the cpu without any data from the status area . the cpu 11 can then determine whether or not a shift key is depressed and can thereby ascertain proper keycodes . if only shift keys are depressed , the microprocessor 41 does not send the key data . in the embodiment described although the keyboard controller makes the most significant bit of the matrix code &# 34 ; 1 &# 34 ; when the shift key is depressed and sends them to the cpu 11 with the shift status data , there is a possible alternative technique in which the microprocessor initially notifies the cpu which shift key is depressed and thereafter sends only the matrix codes . in this case a keyboard controller is necessary in order to send the data to the cpu 11 when the shift key is released . referring to fig7 the processing of the embodiment in fig5 is nextly described in more detail . in fig7 the shift keys sfk 2 and sfk 5 and keys key 1 and key 2 of the key matrix 13 are shown depressed . the memory of the microprocessor 41 , shown schematically encircled by a dashed line , provides a buffer 51 for transmission and a buffer 52 for the shift key status as shown in the memory map . the microprocessor 41 scans the key matrix 13 and confirms the four keys depressed . the microprocessor compares the scanned key matrix codes with the shift key matrix code data preliminarily sent from the cpu to detect a shift key depression and to set the particular bit of the buffer 52 indicative of the shift key status . in this case the processor sets the bits corresponding to sf 2 and sf 5 . the processor stores the key matrix codes key 1 and key 2 in the buffer 51 for transmission without the shift matrix codes . when the processor confirms that at least one bit of the buffer 52 storing the shift key status is set , it sets the most significant bit of the matrix codes stored in the buffer 51 for transmission . then the processor 41 transmits these data to the cpu 11 with the transmission states shown in the fig8 . the keycodes key 1 and key 2 are coded as explained in fig4 . in fig8 the microprocessor 41 transmits the matrix codes of the key 1 first with the most significant bit set to indicate shift key depression and then sends the shift status . the microprocessor 41 then notifies the cpu of the matrix codes and the shift status of the other depressed keys in successive operations . if it is desired to change the location of the shift keys in the key matrix , it is not necessary to change the physical location of the shift keys but only to change the shift key matrix codes in the cpu , because according to the invention , the cpu preliminarily notifies the kbc of the matrix codes of the shift keys . obviously , numerous modifications and variations of the present invention are possible in light of the above teachings . it is therefore to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described herein . | 7 |
“ aerodynamic diameter ” of a given particle refers to the diameter of a spherical droplet with a density of 1 g / ml ( the density of water ) that has the same settling velocity as the given particle . “ aerosol ” refers to a suspension of solid or liquid particles in a gas . “ aerosol drug mass density ” refers to the mass of lidocaine , verapamil , diltiazem , isometheptene , or lisuride per unit volume of aerosol . “ aerosol mass density ” refers to the mass of particulate matter per unit volume of aerosol . “ aerosol particle density ” refers to the number of particles per unit volume of aerosol . “ amorphous particle ” refers to a particle that does not contain more than 50 percent by weight of a crystalline form . preferably , the particle does not contain more than 25 percent by weight of a crystalline form . more preferably , the particle does not contain more than 10 percent by weight of a crystalline form . “ condensation aerosol ” refers to an aerosol formed by vaporization of a substance followed by condensation of the substance into an aerosol . “ diltiazem degradation product ” refers to a compound resulting from a chemical modification of diltiazem . the modification , for example , can be the result of a thermally or photochemically induced reaction . such reactions include , without limitation , oxidation and hydrolysis . “ inhalable aerosol drug mass density ” refers to the aerosol drug mass density produced by an inhalation device and delivered into a typical patient tidal volume . “ inhalable aerosol mass density ” refers to the aerosol mass density produced by an inhalation device and delivered into a typical patient tidal volume . “ inhalable aerosol particle density ” refers to the aerosol particle density of particles of size between 100 nm and 5 microns produced by an inhalation device and delivered into a typical patient tidal volume . “ isometheptene degradation product ” refers to a compound resulting from a chemical modification of isometheptene . the modification , for example , can be the result of a thermally or photochemically induced reaction . such reactions include , without limitation , oxidation and hydrolysis . “ lidocaine degradation product ” refers to a compound resulting from a chemical modification of lidocaine . the modification , for example , can be the result of a thermally or photochemically induced reaction . such reactions include , without limitation , oxidation and hydrolysis . an example of a degradation product is 2 , 6 - dimethylaniline ( c 8 h 11 n ). “ lisuride degradation product ” refers to a compound resulting from a chemical modification of lisuride . the modification , for example , can be the result of a thermally or photochemically induced reaction . such reactions include , without limitation , oxidation and hydrolysis . “ mass median aerodynamic diameter ” or “ mmad ” of an aerosol refers to the aerodynamic diameter for which half the particulate mass of the aerosol is contributed by particles with an aerodynamic diameter larger than the mmad and half by particles with an aerodynamic diameter smaller than the mmad . “ rate of aerosol formation ” refers to the mass of aerosolized particulate matter produced by an inhalation device per unit time . “ rate of inhalable aerosol particle formation ” refers to the number of particles of size between 100 nm and 5 microns produced by an inhalation device per unit time . “ rate of drug aerosol formation ” refers to the mass of aerosolized lidocaine , verapamil , diltiazem , isometheptene , or lisuride produced by an inhalation device per unit time . “ settling velocity ” refers to the terminal velocity of an aerosol particle undergoing gravitational settling in air . “ typical patient tidal volume ” refers to 1 l for an adult patient and 15 ml / kg for a pediatric patient . “ vapor ” refers to a gas , and “ vapor phase ” refers to a gas phase . the term “ thermal vapor ” refers to a vapor phase , aerosol , or mixture of aerosol - vapor phases , formed preferably by heating . “ verapamil degradation product ” refers to a compound resulting from a chemical modification of verapamil . the modification , for example , can be the result of a thermally or photochemically induced reaction . such reactions include , without limitation , oxidation and hydrolysis . any suitable method is used to form the aerosols of the present invention . a preferred method , however , involves heating a composition comprising lidocaine , verapamil , diltiazem , isometheptene , or lisuride to form a vapor , followed by cooling of the vapor such that it condenses to provide a lidocaine , verapamil , diltiazem , isometheptene , or lisuride comprising aerosol ( condensation aerosol ). the composition is heated in one of four forms : as pure active compound ( i . e ., pure lidocaine , verapamil , diltiazem , isometheptene , or lisuride ); as a mixture of active compound and a pharmaceutically acceptable excipient ; as a salt form of the pure active compound ; and , as a mixture of active compound salt form and a pharmaceutically acceptable excipient . salt forms of lidocaine , verapamil , diltiazem , isometheptene , or lisuride are either commercially available or are obtained from the corresponding free base using well known methods in the art . a variety of pharmaceutically acceptable salts are suitable for aerosolization . such salts include , without limitation , the following : hydrochloric acid , hydrobromic acid , acetic acid , maleic acid , formic acid , and fumaric acid salts . pharmaceutically acceptable excipients may be volatile or nonvolatile . volatile excipients , when heated , are concurrently volatilized , aerosolized and inhaled with lidocaine , verapamil , diltiazem , isometheptene , or lisuride . classes of such excipients are known in the art and include , without limitation , gaseous , supercritical fluid , liquid and solid solvents . the following is a list of exemplary carriers within the classes : water ; terpenes , such as menthol ; alcohols , such as ethanol , propylene glycol , glycerol and other similar alcohols ; dimethylformamide ; dimethylacetamide ; wax ; supercritical carbon dioxide ; dry ice ; and mixtures thereof . solid supports on which the composition is heated are of a variety of shapes . examples of such shapes include , without limitation , cylinders of less than 1 . 0 mm in diameter , boxes of less than 1 . 0 mm thickness and virtually any shape permeated by small ( e . g ., less than 1 . 0 mm - sized ) pores . preferably , solid supports provide a large surface to volume ratio ( e . g ., greater than 100 per meter ) and a large surface to mass ratio ( e . g ., greater than 1 cm 2 per gram ). a solid support of one shape can also be transformed into another shape with different properties . for example , a flat sheet of 0 . 25 mm thickness has a surface to volume ratio of approximately 8 , 000 per meter . rolling the sheet into a hollow cylinder of 1 cm diameter produces a support that retains the high surface to mass ratio of the original sheet but has a lower surface to volume ratio ( about 400 per meter ). a number of different materials are used to construct the solid supports . classes of such materials include , without limitation , metals , inorganic materials , carbonaceous materials and polymers . the following are examples of the material classes : aluminum , silver , gold , stainless steel , copper and tungsten ; silica , glass , silicon and alumina ; graphite , porous carbons , carbon yarns and carbon felts ; polytetrafluoroethylene and polyethylene glycol . combinations of materials and coated variants of materials are used as well . where aluminum is used as a solid support , aluminum foil is a suitable material . examples of silica , alumina and silicon based materials include amphorous silica s - 5631 ( sigma , st . louis , mo . ), bcr171 ( an alumina of defined surface area greater than 2 m 2 / g from aldrich , st . louis , mo .) and a silicon wafer as used in the semiconductor industry . carbon yarns and felts are available from american kynol , inc ., new york , n . y . chromatography resins such as octadecycl silane chemically bonded to porous silica are exemplary coated variants of silica . the heating of the lidocaine , verapamil , diltiazem , isometheptene , or lisuride compositions is performed using any suitable method . examples of methods by which heat can be generated include the following : passage of current through an electrical resistance element ; absorption of electromagnetic radiation , such as microwave or laser light ; and , exothermic chemical reactions , such as exothermic solvation , hydration of pyrophoric materials and oxidation of combustible materials . lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosols of the present invention are delivered to a mammal using an inhalation device . where the aerosolis a condensation aerosol , the device has at least three elements : an element for heating a lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing composition to form a vapor ; an element allowing the vapor to cool , thereby providing a condensation aerosol ; and , an element permitting the mammal to inhale the aerosol . various suitable heating methods are described above . the element that allows cooling is , in it simplest form , an inert passageway linking the heating means to the inhalation means . the element permitting inhalation is an aerosol exit portal that forms a connection between the cooling element and the mammal &# 39 ; s respiratory system . one device used to deliver the lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosol is described in reference to fig1 . delivery device 100 has a proximal end 102 and a distal end 104 , a heating module 106 , a power source 108 , and a mouthpiece 110 . a lidocaine , verapamil , diltiazem , isometheptene , or lisuride composition is deposited on a surface 112 of heating module 106 . upon activation of a user activated switch 114 , power source 108 initiates heating of heating module 106 ( e . g , through ignition of combustible fuel or passage of current through a resistive heating element ). the lidocaine , verapamil , diltiazem , isometheptene , or lisuride composition volatilizes due to the heating of heating module 106 and condenses to form a condensation aerosol prior to reaching the mouthpiece 110 at the proximal end of the device 102 . air flow traveling from the device distal end 104 to the mouthpiece 110 carries the condensation aerosol to the mouthpiece 110 , where it is inhaled by the mammal . devices , if desired , contain a variety of components to facilitate the delivery of lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosols . for instance , the device may include any component known in the art to control the timing of drug aerosolization relative to inhalation ( e . g ., breath - actuation ), to provide feedback to patients on the rate and / or volume of inhalation , to prevent excessive use ( i . e ., “ lock - out ” feature ), to prevent use by unauthorized individuals , and / or to record dosing histories . lidocaine , verapamil , diltiazem , isometheptene , or lisuride are given at strengths of 30 mg , 40 mg , 30 mg , 65 mg , and 0 . 2 mg respectively for the treatment of migraine headaches . as aerosols , 10 mg to 50 mg of lidocaine , 10 mg to 60 mg of verapamil , 10 mg to 50 mg of diltiazem , 5 mg to 200 mg of isometheptene , and 0 . 05 mg to 0 . 4 mg lisuride are generally provided for the same indication . a typical dosage of a lidocaine , verapamil , diltiazem , isometheptene , or lisuride aerosol is either administered as a single inhalation or as a series of inhalations taken within an hour or less ( dosage equals sum of inhaled amounts ). where the drug is administered as a series of inhalations , a different amount may be delivered in each inhalation . the dosage amount of lidocaine , verapamil , diltiazem , isometheptene , or lisuride in aerosol form is generally no greater than twice the standard dose of the drug given orally . one can determine the appropriate dose of lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosols to treat a particular condition using methods such as animal experiments and a dose - finding ( phase i / ii ) clinical trial . one animal experiment involves measuring plasma concentrations of drug in an animal after its exposure to the aerosol . mammals such as dogs or primates are typically used in such studies , since their respiratory systems are similar to that of a human . initial dose levels for testing in humans is generally less than or equal to the dose in the mammal model that resulted in plasma drug levels associated with a therapeutic effect in humans . dose escalation in humans is then performed , until either an optimal therapeutic response is obtained or a dose - limiting toxicity is encountered . purity of a lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosol is determined using a number of methods , examples of which are described in sekine et al ., journal of forensic science 32 : 1271 – 1280 ( 1987 ) and martin et al ., journal of analytic toxicology 13 : 158 – 162 ( 1989 ). one method involves forming the aerosol in a device through which a gas flow ( e . g ., air flow ) is maintained , generally at a rate between 0 . 4 and 60 l / min . the gas flow carries the aerosol into one or more traps . after isolation from the trap , the aerosol is subjected to an analytical technique , such as gas or liquid chromatography , that permits a determination of composition purity . a variety of different traps are used for aerosol collection . the following list contains examples of such traps : filters ; glass wool ; impingers ; solvent traps , such as dry ice - cooled ethanol , methanol , acetone and dichloromethane traps at various ph values ; syringes that sample the aerosol ; empty , low - pressure ( e . g ., vacuum ) containers into which the aerosol is drawn ; and , empty containers that fully surround and enclose the aerosol generating device . where a solid such as glass wool is used , it is typically extracted with a solvent such as ethanol . the solvent extract is subjected to analysis rather than the solid ( i . e ., glass wool ) itself . where a syringe or container is used , the container is similarly extracted with a solvent . the gas or liquid chromatograph discussed above contains a detection system ( i . e ., detector ). such detection systems are well known in the art and include , for example , flame ionization , photon absorption and mass spectrometry detectors . an advantage of a mass spectrometry detector is that it can be used to determine the structure of lidocaine , verapamil , diltiazem , isometheptene , or lisuride degradation products . particle size distribution of a lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosol is determined using any suitable method in the art ( e . g ., cascade impaction ). an andersen eight stage non - viable cascade impactor ( andersen instruments , smyrna , ga .) linked to a furnace tube by a mock throat ( usp throat , andersen instruments , smyrna , ga .) is one system used for cascade impaction studies . inhalable aerosol mass density is determined , for example , by delivering a drug - containing aerosol into a confined chamber via an inhalation device and measuring the mass collected in the chamber . typically , the aerosol is drawn into the chamber by having a pressure gradient between the device and the chamber , wherein the chamber is at lower pressure than the device . the volume of the chamber should approximate the tidal volume of an inhaling patient . inhalable aerosol drug mass density is determined , for example , by delivering a drug - containing aerosol into a confined chamber via an inhalation device and measuring the amount of active drug compound collected in the chamber . typically , the aerosol is drawn into the chamber by having a pressure gradient between the device and the chamber , wherein the chamber is at lower pressure than the device . the volume of the chamber should approximate the tidal volume of an inhaling patient . the amount of active drug compound collected in the chamber is determined by extracting the chamber , conducting chromatographic analysis of the extract and comparing the results of the chromatographic analysis to those of a standard containing known amounts of drug . inhalable aerosol particle density is determined , for example , by delivering aerosol phase drug into a confined chamber via an inhalation device and measuring the number of particles of given size collected in the chamber . the number of particles of a given size may be directly measured based on the light - scattering properties of the particles . alternatively , the number of particles of a given size is determined by measuring the mass of particles within the given size range and calculating the number of particles based on the mass as follows : total number of particles = sum ( from size range 1 to size range n ) of number of particles in each size range . number of particles in a given size range = mass in the size range / mass of a typical particle in the size range . mass of a typical particle in a given size range = π * d 3 * φ / 6 , where d is a typical particle diameter in the size range ( generally , the mean boundary mmads defining the size range ) in microns , φ is the particle density ( in g / ml ) and mass is given in units of picograms ( g − 12 ). rate of inhalable aerosol particle formation is determined , for example , by delivering aerosol phase drug into a confined chamber via an inhalation device . the delivery is for a set period of time ( e . g ., 3 s ), and the number of particles of a given size collected in the chamber is determined as outlined above . the rate of particle formation is equal to the number of 100 nm to 5 micron particles collected divided by the duration of the collection time . rate of aerosol formation is determined , for example , by delivering aerosol phase drug into a confined chamber via an inhalation device . the delivery is for a set period of time ( e . g ., 3 s ), and the mass of particulate matter collected is determined by weighing the confined chamber before and after the delivery of the particulate matter . the rate of aerosol formation is equal to the increase in mass in the chamber divided by the duration of the collection time . alternatively , where a change in mass of the delivery device or component thereof can only occur through release of the aerosol phase particulate matter , the mass of particulate matter may be equated with the mass lost from the device or component during the delivery of the aerosol . in this case , the rate of aerosol formation is equal to the decrease in mass of the device or component during the delivery event divided by the duration of the delivery event . rate of drug aerosol formation is determined , for example , by delivering a lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosol into a confined chamber via an inhalation device over a set period of time ( e . g ., 3 s ). where the aerosol is pure lidocaine , verapamil , diltiazem , isometheptene , or lisuride , the amount of drug collected in the chamber is measured as described above . the rate of drug aerosol formation is equal to the amount of lidocaine , verapamil , diltiazem , isometheptene , or lisuride collected in the chamber divided by the duration of the collection time . where the lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosol comprises a pharmaceutically acceptable excipient , multiplying the rate of aerosol formation by the percentage of lidocaine , verapamil , diltiazem , isometheptene , or lisuride in the aerosol provides the rate of drug aerosol formation . the lidocaine , verapamil , diltiazem , isometheptene , or lisuride containing aerosols of the present invention are typically used for the treatment of migraine headaches . the following examples are meant to illustrate , rather than limit , the present invention . lidocaine , verapamil hydrochloride , diltiazem hydrochloride , and lisuride are commercially available from sigma ( www . sigma - aldrich . com ). the preparation of isometheptene is described in u . s . pat . nos . 2 , 230 , 753 and 2 , 230 , 754 . approximately 1 g of salt ( e . g ., mono hydrochloride ) is dissolved in deionized water (˜ 30 ml ). three equivalents of sodium hydroxide ( 1 n naoh aq ) is added dropwise to the solution , and the ph is checked to ensure it is basic . the aqueous solution is extracted four times with dichloromethane (˜ 50 ml ), and the extracts are combined , dried ( na 2 so 4 ) and filtered . the filtered organic solution is concentrated using a rotary evaporator to provide the desired free base . if necessary , purification of the free base is performed using standard methods such as chromatography or recrystallization . a solution of drug in approximately 120 μl dichloromethane is coated on a 3 . 5 cm × 7 . 5 cm piece of aluminum foil ( precleaned with acetone ). the dichloromethane is allowed to evaporate . the coated foil is wrapped around a 300 watt halogen tube ( feit electric company , pico rivera , calif . ), which is inserted into a glass tube sealed at one end with a rubber stopper . running 90 v of alternating current ( driven by line power controlled by a variac ) through the bulb for 5 s or 3 . 5 s affords thermal vapor ( including aerosol ), which is collected on the glass tube walls . reverse - phase hplc analysis with detection by absorption of 225 nm light is used to determine the purity of the aerosol . ( when desired , the system is flushed through with argon prior to volatilization .) to obtain higher purity aerosols , one can coat a lesser amount of drug , yielding a thinner film to heat . a linear decrease in film thickness is associated with a linear decrease in impurities . the following aerosols were obtained using this procedure : lidocaine aerosol ( 7 . 3 mg , 99 . 5 % purity ); verapamil aerosol ( 1 . 41 mg , 96 . 2 % purity ); diltiazem aerosol ( 1 . 91 mg , 97 . 1 % purity ); and , lisuride aerosol ( 0 . 2 mg , 100 % purity ). a solution of 12 . 2 mg lidocaine in 100 μl dichloromethane was spread out in a thin layer on the central portion of a 3 . 5 cm × 7 cm sheet of aluminum foil . the dichloromethane was allowed to evaporate . assuming a drug density of about 1 g / cc , the calculated thickness of the lidocaine thin layer on the 24 . 5 cm 2 aluminum solid support , after solvent evaporation , is about 5 . 0 microns . the aluminum foil was wrapped around a 300 watt halogen tube , which was inserted into a t - shaped glass tube . both of the openings of the tube were sealed with parafilm , which was punctured with fifteen needles for air flow . the third opening was connected to a 1 liter , 3 - neck glass flask . the glass flask was further connected to a large piston capable of drawing 1 . 1 liters of air through the flask . alternating current was run through the halogen bulb by application of 90 v using a variac connected to 110 v line power . within 1 s , an aerosol appeared and was drawn into the 1 l flask by use of the piston , with collection of the aerosol terminated after 6 s . the aerosol was analyzed by connecting the 1 l flask to an eight - stage andersen non - viable cascade impactor . results are shown in table 1 . mmad of the collected aerosol was 2 . 4 microns with a geometric standard deviation of 2 . 1 . also shown in table 1 is the number of particles collected on the various stages of the cascade impactor , given by the mass collected on the stage divided by the mass of a typical particle trapped on that stage . the mass of a single particle of diameter d is given by the volume of the particle , πd 3 / 6 , multiplied by the density of the drug ( taken to be 1 g / cm 3 ). the inhalable aerosol particle density is the sum of the numbers of particles collected on impactor stages 3 to 8 divided by the collection volume of 1 l , giving an inhalable aerosol particle density of 4 . 2 × 10 6 particles / ml . the rate of inhalable aerosol particle formation is the sum of the numbers of particles collected on impactor stages 3 through 8 divided by the formation time of 6 s , giving a rate of inhalable aerosol particle formation of 7 . 0 × 10 8 particles / second . table 1 : determination of the characteristics of a lidocaine condensation aerosol by cascade impaction using an andersen 8 - stage non - viable cascade impactor run at 1 cubic foot per minute airflow . a solution of 10 . 4 mg lidocaine in 100 μl dichloromethane was spread out in a thin layer on the central portion of a 3 . 5 cm × 7 cm sheet of aluminum foil . the dichloromethane was allowed to evaporate . assuming a drug density of about 1 g / cc , the calculated thickness of the lidocaine thin layer on the 24 . 5 cm 2 aluminum solid support , after solvent evaporation , is about 4 . 2 microns . the aluminum foil was wrapped around a 300 watt halogen tube , which was inserted into a t - shaped glass tube . both of the openings of the tube were sealed with parafilm , which was punctured with fifteen needles for air flow . the third opening was connected to a 1 liter , 3 - neck glass flask . the glass flask was further connected to a large piston capable of drawing 1 . 1 liters of air through the flask . alternating current was run through the halogen bulb by application of 90 v using a variac connected to 110 v line power . within seconds , an aerosol appeared and was drawn into the 1 l flask by use of the piston , with formation of the aerosol terminated after 6 s . the aerosol was allowed to sediment onto the walls of the 1 l flask for approximately 30 minutes . the flask was then extracted with acetonitrile and the extract analyzed by hplc with detection by light absorption at 225 nm . comparison with standards containing known amounts of lidocaine revealed that 3 . 1 mg of & gt ; 99 % pure lidocaine had been collected in the flask , resulting in an aerosol drug mass density of 3 . 1 mg / l . the aluminum foil upon which the lidocaine had previously been coated was weighed following the experiment . of the 10 . 4 mg originally coated on the aluminum , 10 . 2 mg of the material was found to have aerosolized in the 6 s time period , implying a rate of drug aerosol formation of 1 . 7 mg / s . | 0 |
the present invention discloses an amphiphilic copolymer pdms - modified p ( hema - maa ), which is synthesized via chemically bonding 2 - hydroxyethyl methacrylate ( hema ), methacrylic acid ( maa ), and poly ( dimethylsiloxane ), bis ( 3 - aminopropyl ) terminated ( pdms ) in an aqueous solution , which is also called the p ( hema - maa )- pdms amphiphilic copolymer thereinafter . the pdms - modified p ( hema - maa ) amphiphilic copolymer can completely dissolve in alcohol solvents to facilitate the succeeding fabrication . the amphiphilic copolymer of the present invention has adjustable hydrophilicity and superior biocompatibility and thus can apply to fouling prevention and drug delivery . the pdms - modified p ( hema - maa ) amphiphilic copolymer of the present invention simultaneously contains compounds respectively expressed by structural formula i and structural formula ii : and wherein m is an arbitrary integer of 1 ˜ 10 , n is an arbitrary integer of 1 ˜ 40 , x is an arbitrary integer of 1 ˜ 10 , y is an arbitrary integer of 1 ˜ 10 , and o is an arbitrary integer of 1 ˜ 10 . refer to fig1 for the crosslinking state of the amphiphilic copolymer . the amphiphilic copolymer simultaneously contains hydrophilic terminals and hydrophobic terminals . the hydrophilic terminals are provided by hema and maa , which respectively contribute a hydroxyl group and a carboxylic acid group as the hydrophilic functional groups . ultraviolet ray is used to induce the radical copolymerization reaction of hema and maa . the hydrophobic terminals is contributed by the poly ( dimethylsiloxane ), bis ( 3 - aminopropyl ) terminated . the dimethylsiloxane of the pdms derivative is very hydrophobic and provides superior oxygen permeability for the amphiphilic copolymer of the present invention . the amphiphilic copolymer of the present invention can dissolve in a polar solvent , such as ethanol , propanol , isopropyl alcohol , polyethylene glycol , polypropylene glycol , methyl sulfoxide , or the mixture of some of the abovementioned solvents . the amphiphilic copolymer has a molecular weight of 3500 - 30000 and can self - assemble into spherical nanoparticles having a diameter of 30 - 40 nm . the amphiphilic copolymer can be fabricated into a transparent film or a nanoparticle to transport drugs in the succeeding fabrication process . below is described the method for fabricating the pdms - modified p ( hema - maa ) amphiphilic copolymer . firstly , dissolve hema and maa by a weight ratio of from 100 : 10 to 100 : 100 in deionized water to form a first solution , wherein the weight ratio of hema plus maa to deionized water is from 1 : 100 to 10 : 100 . next , add a photo initiator to the first solution , such as 2 - hydroxy - 2 - methyl propiophenone ( darocur 1173 ), to form a second solution , and agitate the second solution uniformly . next , illuminate the second solution with ultraviolet ray to polymerize the compounds in the second solution to form a third solution , which is a white - colored solution containing copolymers . next , add an activating reagent and an alcohol solvent to the third solution to form a fourth solution , and agitate the fourth solution uniformly to form a mixture solution . next , slowly drip a pre - mixed dms solution to the mixture solution to form a fifth solution , wherein the pre - mixed dms solution is a solution of dimethylsiloxane and an alcohol solvent . next , add a catalyst , such as edc ( 1 - ethyl - 3 -( 3 - dimethylaminopropyl )), to the fifth solution to form a sixth solution , and agitate the sixth solution uniformly to accelerate the reaction . let the reaction proceed for one day to form a solution of the pdms - modified p ( hema - maa ) amphiphilic copolymer of the present invention . after the solution of the pdms - modified p ( hema - maa ) amphiphilic copolymer is done , the amphiphilic copolymer solution can be further dialyzed to form powered amphiphilic copolymer with a dialysate , such as isopropyl alcohol , propanol or ethanol . the powered amphiphilic copolymer can be re - dissolved in a polar solvent , such as ethanol , propanol , isopropyl alcohol , polyethylene glycol , polypropylene glycol , methyl sulfoxide , or a mixture of some of the abovementioned solvents for the succeeding application . besides , the powered amphiphilic copolymer can also dissolve in water and self - assemble to form spherical nanoparticles having a diameter of 30 - 40 nm . in the present invention , the copolymer ( hema + maa ) is covalently bonded with dms ( dimethylsiloxane ) by a ratio of from 100 : 1 to 100 : 40 . the abovementioned alcohols or alcohol solvents include ethanol , propanol , isopropyl alcohol , polyethylene glycol , polypropylene glycol , and the mixtures of some of the abovementioned solvents . the pdms - modified p ( hema - maa ) amphiphilic copolymer and the method for fabricating the same have been described above . below , embodiments and experiments are used to further demonstrate the present invention . below is described the detailed process for fabricating the pdms - modified p ( hema - maa ) amphiphilic copolymer , i . e . the p ( hema - maa )- pdms amphiphilic copolymer , of the present invention . firstly , mix 1 ml of hema and 1 ml of maa uniformly to form solution 1 . next , add 98 ml of deionized water and 40 μl of water - soluble photo initiator ( darocur 1173 ) into solution 1 to form solution 2 . next , agitate solution 2 for 10 minutes , and use ultraviolet ray to polymerize the components in solution 2 during agitation to form solution 3 , which is a white - colored solution containing a dissoluble polymer of hema and maa , called dp ( hema - maa ) thereinafter . next , add 50 ml of isopropyl alcohol , propanol , or ethanol to solution 3 , and agitate them uniformly to form a transparent solution . next , add several drops of activating reagent ( nhs ) to the transparent solution to form solution 4 , and agitate solution 4 uniformly to form a mixture solution . next , slowly drip 400 μl of pmds solution to the mixture solution to form solution 5 , and add several drips of catalyst ( edc ) to solution 5 to form solution 6 , and agitate solution 6 for 24 hours at an ambient temperature to facilitate reaction . next , add isopropyl alcohol , propanol , or ethanol to the resultant solution , and dialyze the resultant solution for 72 hours . next , dry the product of dialysis at an oven . next , crush the dried product into a pale - yellow powder of the p ( hema - maa )- pdms amphiphilic copolymer , which is also called hmpms thereinafter . refer to fig2 the results of using the fourier - transform infrared ( ft - ir ) absorption spectrometry to analyze dp ( hema - maa ), pdms , and hmpms . the absorption peak at 2964 cm − 1 , which is observed in the transmittance ir curve of dp ( hema - maa ), is generated by the stretching vibration of oh of cooh of dp ( hema - maa ). after dp ( hema - maa ) is modified by pdms , the absorption by oh stretching vibration is attenuated . the absorption peaks at 1590 cm − 1 and 3735 − 1 are respectively generated by the bending vibration and stretching vibration of nh 2 of unmodified pdms . the two nh 2 absorption peaks of unmodified pdms disappear after modification . it indicates that the functional group cooh of dp ( hema - maa ) reacts with nh 2 of pdms . the absorption peak at 1110 cm − 1 is generated by the stretching vibration of si — o — si . the absorption peak at 1547 cm − 1 is generated by the stretching vibration of the amide bond of hmpms . the amphiphilic copolymer of the present invention can uniformly dissolve in solvents such as ipa , propanol , and ethanol . in a mixed solvent of ipa and h 2 o by a ratio of 1 : 2 , the amphiphilic copolymer would self - assemble to form spherical nanoparticles having a diameter of 30 - 40 nm , as shown in the sem ( scanning electron microscopy ) image of fig3 . refer to fig4 for a tem ( transmission electron microscopy ) image of the nanoparticle formed by the self - assembly of the amphiphilic copolymer in a mixed solvent of ipa and h 2 o by a ratio of 1 : 2 . laminate crystalline phases of silicon dioxide are observed in the tem image . it is presumed that the amphiphilic copolymer is likely to self - assemble in a hydrophilic - lipophilic environment . it is also observed in the tem image that the crystalline phases of silicon dioxide are in form of laminates arranged neatly and each having a thickness of 3 nm . the generation of the silicon - dioxide phases may be attributed to that the hydrophilic - lipophilic environment exerts different force fields on the hydrophilic terminals and hydrophobic terminals of the amphiphilic copolymer and that the hydrophilic action force causes the molecules of the hydrophobicity - biased amphiphilic copolymer to self - organize into an ordered arrangement . refer to fig5 for an x - ray diffraction spectrum of the amphiphilic copolymer of the present invention . the peaks respectively appear at about 13 degrees and about 30 degrees of 2theda are exactly the characteristics of crystalline silicon dioxide . the amphiphilic copolymer of the present invention can also dissolve in ipa . based on the abovementioned feature , the fabrication of the light - and heat - sensitive oil - soluble drug vitamin a is used to exemplify the application of the present invention below . the fabrication process of vitamin a carried by the amphiphilic copolymer of the present invention includes the following steps : ( 1 ) dissolving vitamin a in ipa ; ( 2 ) dissolving the amphiphilic copolymer in ipa to form an ipa solution containing 10 % the amphiphilic copolymer ; and ( 3 ) mixing the solutions fabricated in steps ( 1 ) and ( 2 ) uniformly , spraying the resultant solution on contact lenses available in the market , and drying the contact lenses . experiments are undertaken to observe the effects of pdms concentrations on the release rates of vitamin a to 2 . 5 % tween20 , wherein the solutions of vitamin a and the amphiphilic copolymers , which are respectively modified by different concentrations of pdms , are sprayed on commercial contact lenses . refer to fig6 for the experimental results . it can be observed in fig6 : the higher the pdms concentration , the less the swelling of molecular structure , and the lower the drug release rate . experiments are also undertaken to verify the biocompatibility of the amphiphilic copolymer of the present invention , wherein bce ( bovine cornea endothelial from bcrc ( bioresource collection and research cente , bcrc no . 60044 ) and hs68 ( human foreskin fibroblast from bcrc , bcrc no . 60038 ) are used in the cytotoxicity tests . refer to fig7 and fig8 for the results of the cytotoxicity tests . the test results prove the superior biocompatibility of the amphiphilic copolymer of the present invention . in the case that the amphiphilic copolymers modified by different concentrations of pdms are coated on commercial contact lenses , the biocompatibility of the amphiphilic copolymers is obviously increased for bce . in the case that hs68 is cultured together with the amphiphilic copolymers , the cell viability is still over 90 % two days later . in conclusion , the present invention uses a simple process to join pdms and the hydrophilic p ( hema - maa ) copolymer to form a pdms - modified p ( hema - maa ) amphiphilic copolymer , which dissolves in alcohols containing less than three carbon atoms and has higher hydrophilicity than the traditional silicone hydrogel . the amphiphilic copolymer of the present invention features surface hydrophobicity and dissolves in polar solvents . therefore , the copolymer of the present invention has high workability and can apply to various hydrophobically - modified anti - fouling coating materials . further , the amphiphilic copolymer of the present invention can also apply to various fields of biomedicine because of its high workability , high hydrophobicity , high oxygen permeability and super biocompatibility . the embodiments described above are only to exemplify the present invention to enable the persons skilled in the art to understand , make and use the present invention . however , these embodiments are not intended to limit the scope of the present invention . any equivalent modification or variation according to the spirit of the present invention is to be also included within the scope of the present invention . | 2 |
the present invention is directed to a system for generating a motion control profile for advance motion control of a high performance servo axis , for use , for example , in chip placement systems for placing components on printed circuit boards , such as the omniplace b ™ manufactured by universal instrument corporation of binghamton , n . y . the system in accordance with the present invention is shown in fig1 and generally designated 10 . throughout the figures , like numerals are used to represent like elements . advanced motion control system 10 includes a controller 12 having multi - axis outputs 15 and multi - axis inputs 17 , and a servo amplifier 14 which drives a motor 32 which , in turn , drives a load 34 . a velocity feedback loop 25 is provided from motor 32 via a tachometer 30 . a position feedback loop 35 is provided from load 34 via a position feedback device 36 . controller 12 comprises a multi - axis motion control processor 16 , a digital to analog converter 20 and a feedback signal converter 18 . digital to analog converter 20 and feedback signal converter 18 communicate with multi - axis motion control processor 16 via high speed buss 22 . feedback signal converter 18 inputs multi - axis inputs 17 and position feedback loop 35 . digital to analog converter 20 outputs multi - axis outputs 15 and position error signal 19 . servo amplifier 14 comprises a first comparator 24 for determining velocity error , a second comparator 26 for determining current error , and a power amp 28 . the first comparator 24 compares position error signal 19 the velocity feedback loop 25 and outputs a velocity error signal 21 reflective of the comparison . velocity error signal 21 is compared with current feedback loop 25 by the second comparator 26 which in turn outputs a current error signal 23 . the output of power amp 28 is used to drive the motor 32 . fig2 is a functional block diagram of the software embodiment illustrated in fig1 . the plant 64 represents the device to be driven or controlled . the input of the plant 64 is controlled by profile / target zone switch 63 having two possible positions . when the switch 63 is in a first position 63a , the plant 64 is in communication with a profile circuit 41 . when in a second position 63b , the plant 64 is in communication with a target zone circuit 43 . the switch 63 is controlled by profile / target zone switch control 40 . profile circuit 41 includes a motion profile position generator 38 which communicates with the profile / target zone switch control 40 . velocity reference output 55 is applied to a feedforward gain generator 60 and reference position output 55a is applied to a comparator 56 . the comparator 56 compares the position reference output 55a and a position feedback signal 35 , described previously with reference to fig1 and produces a position error output 57 which is applied to a first proportional gain generator 58 . outputs from the first proportional gain generator 58 and the feedforward gain generator 60 are applied to a first summation device 62 . the output of the first summation device is applied to position 63a of profile / target zone switch 63 . the target zone circuit 43 includes a target zone position generator 42 which communicates with profile / target zone switch control 40 and which produces an output which is applied to a deadband adjuster 44 . the deadband adjuster 44 correspondingly outputs an adjusted target position signal 45 which is applied to a fourth comparator 46 along with the position feedback signal 35 . the output of the fourth comparator 46 , position error signal 47 , is applied to second proportional gain generator 48 and to integration time constant error generator 50 . the outputs of generator 48 and generator 50 are applied to a second summation device 52 , and the corresponding output is applied to error limit adjust 54 . error limit adjust 54 produces an output , target position error signal 53 , which is applied to position 63b of profile / target zone switch 63 . the profile circuit 41 provides the digital motion reference for point to point movement . the known input parameters are acceleration / deceleration rate , total distance movement , and maximum velocity . the software profile generator first precalculates the maximum velocity achieved based on the total point to point distance and programmed acceleration rate . if the total distance is greater than the distance to accelerate to constant velocity and decelerate from constant velocity then the motion profile is trapezoidal . if the peak velocity is found to be less than the constant velocity for the total move distance then the motion profile is triangular . the s - curve is derived from the trapezoid or triangle profile . when the peak velocity obtained is less than the constant velocity and the profile type selected is trapezoidal the software performs a compensation reduction based on a percentage of the peak velocity . the compensation transforms a triangular profile into a trapezoidal profile . the tuning parameter that controls the magnitude of peak velocity reduction is called tip compensation . this reduces the &# 34 ; jerk &# 34 ; forces produced when acceleration changes to deceleration at the peak velocity or tip of the velocity - time profile . all of the above precalculation computations , as summarized in fig3 and shown in detail in fig6 -- 10 , occur before motion starts the precalculated variables are then initialized to start the beginning of &# 34 ; real time &# 34 ; motion . since optimum servo system performance requires a control rate of one millisecond or less the processor code instruction timing becomes very critical if servicing multiple axis . the profile generator algorithm is based on simple addition , subtraction , and binary shift instructions therefore minimizing the time for instruction execution . the real time interrupt is shown in fig1 . as mentioned above , the motion control system of the present invention utilizes either of two preferred motion profiles , a trapezoid or s - curve velocity time profile . the precalculation permits selection of either the trapezoid or the s - curve velocity - time profile before any point to point move . the trapezoid profile real time calculations are summarized in fig5 and shown in detail in fig1 , 15 and 18 . during each one millisecond time interval the acceleration increment is added to the previous velocity sum . the distance is calculated by adding the velocity sum to the previous distance sum . when velocity equals or exceeds preprogram constant velocity or tip compensated velocity the profile generator equations at each one millisecond time interval change to : during deceleration at each one millisecond time interval the profile generator equations are : the s - curve profile real time calculations are summarized in fig4 and shown in detail in fig1 , 13 and 15 - 17 . during each one millisecond time interval the acceleration increment is added to the previous acceleration sum for one - half the acceleration time . during the second half of acceleration time the acceleration increment is subtracted from the previous acceleration sum . the acceleration sum is added to the previous velocity sum . the distance is calculated by adding the velocity sum to the previous distance sum . ## equ1 ## when velocity equals or exceeds preprogram constant velocity the profile generator equations at each one millisecond time interval change to : during each one millisecond time interval the acceleration increment is added to the previous acceleration sum for one - half the acceleration time . during the second half of the acceleration time the acceleration increment is subtracted from the previous acceleration sum . the acceleration sum is subtracted from the previous velocity sum . the distance is calculated by adding the velocity sum to the previous distance sum . ## equ2 ## after the profile generator completes the total distance commanded the software signals the changes required to switch into the target zone mode , as shown in fig1 . the interconnect zone illustrated in this figure provides a continuous velocity between the end of the reference profile and the target zone . if the magnitude of the position follow error is greater than the target zone gain limit , the system continues to control the loop from the main profile ( which has finished and therefore the reference remains the target position ). when the magnitude of the velocity error is equal to or less than the target zone gain limit , the system then switches to the target zone control loop . in this way , the system eases into the target zone control loop without creating jerk forces . at one millisecond intervals the processor does a complete position feedback calculation . the first calculation computes the position difference between the profile reference position and the actual encoder feedback position . this value is called the position following error . the position error calculation subroutine is shown in fig2 . the position following error is multiplied by a programmable proportional gain parameter , scaled and sent out to the servo amplifier as a position error signal . this is in effect until the axis reaches the target zone . when the axis reaches the target zone then position error is accumulated ( integrated ), as shown in fig2 and 21 . this allows the software to compensate for static disturbances that would otherwise keep the position error from becoming zero when the axis has stopped moving . such static disturbances include friction , springs , windup , and gravitational forces . the gain is determined by the target zone proportional gain parameter and the integration time constant parameter . the torque is then range limited by the target zone gain limit parameter and sent out to the servo amplifier . in addition the deadband window parameter determines the lock on target zone . if the deadband window is set to zero then the axis will lock on target within + or - one half an encoder count . the software is also capable of providing velocity feedforward compensation . this is accomplished in software by precomputing the reference command velocity and adding this quantity , scaled by the feedforward gain parameter to the position error signal . this will reduce the intrinsic following error or lagging position error . each of the gain terms mentioned above has a unique influence on the closed - loop dynamics of the system . by adjusting the various parameters it is easy to tailor the system dynamics to meet specific needs . the programmable control gains influence the closed - loop dynamics in the following way : ## str1 ## tuning parameters allow a wide range of adjustments to satisfy all requirements of servo system performance . the velocity parameter determines the maximum slew velocity the axis travels toward its target position . the axis travels at this constant velocity until it must begin to decelerate in order to stop near the target position . this parameter is in effect outside the target zone . this parameter determines the acceleration rate at which the axis begins its move toward the target position . the axis accelerates at this constant rate until it reaches the slew velocity or it must begin deceleration to stop near the target position . deceleration is equal to the acceleration rate . this parameter is in effect outside the target zone . this proportional gain parameter determines the amount of gain applied to the position error signal . adjustment of this parameter controls the smoothness or stiffness of the actual servo motor motion profile . this parameter is in effect outside the target zone . the feed forward gain parameter determines the amount of precomputed reference command velocity added to the position error . adjustment of this parameter controls the amount of lag in the actual position versus the reference generator profile position this parameter aids adjustment of the control loop if the mechanical system does not allow sufficient proportional gain amounts due to instabilities and compliance . this parameter is in effect outside the target zone . the tip compensation parameter determines the amount of peak velocity removed when the motion profile is triangular . this reduces the &# 34 ; jerk &# 34 ; force produced when acceleration changes to deceleration at the midpoint of the incremental move . this parameter is in effect outside the target zone . the target zone gain parameter determines the amount of proportional gain applied to the position error signal . the target zone mode is latched when the profile generator command has completed the trajectory and remains latched until a new destination is commanded . this parameter is in effect only when the system enters the target zone . the integration time constant determines the speed of applied signal gain added to the proportion gain whenever the position error is not equal to the target window . the integration signal gain is fixed at 2 . 5 millivolts . this parameter is only in effect when the system enters the target zone . the target zone gain limit parameter determines the maximum amount of gain applied by proportional gain and integration gain . this &# 34 ; clamps &# 34 ; the error signal preventing instability if a large error exists or an error exists for a large amount of time . this parameter is only in effect when the system enters the target zone . this value defines a distance in encoder error counts which extends in both directions from the target position . when the axis is within this distance of target position the system is considered to be &# 34 ; in - position &# 34 ; and settled . the proportional gain value is equal to zero and the integration gain value is held constant to the value of applied gain needed to enter the dead band window . the goal of every closed - loop servo system is to position to the greatest accuracy possible utilizing the full resolution of the encoder feedback system . in some systems mechanical backlash is present between the encoder feedback location and the servo motor drive shaft . this is a conditionally unstable system and the target dead band window has to be adjusted to a value greater than the mechanical backlash angle thus preventing oscillation around the target zone . this parameter determines the maximum allowable position error allowed outside the target zone . when the axis is in motion the actual position is compared with the reference profile generator position at one millisecond intervals . if the magnitude of the position error exceeds the preprogram position following error parameter the axis executes an error shut down forcing the servo motor to a complete stop with full electrical braking power . this parameter is in effect outside the target zone . fig2 - 26 show the software code for a preferred position profile generator model algorithm in quick basic ™. of course , any suitable program could be used . the foregoing is for illustrative purposes only . modifications can be made within the scope of the invention as defined by the appended claims . | 6 |
fig1 illustrates use of photo - luminescent safety covers of the present invention on a wall - mounted tub / shower rail 10 , a tub - mounted grab bar 12 , and a pair of raised toilet seat arm - rests 14 . this way , a visitor to the bathroom facility at night is provided with a source of illumination without having to turn on a wall or ceiling mounted light , or other electrically operated light fixture . by providing photo - luminescent material at the location of grab bars , hand rails or arm rests , improved safety is also provided by visually highlighting these pieces of safety equipment to those who require the assistance of such equipment . turning to fig2 , a suitable cover 20 for use on grab bars and hand rails and illustrated . the cover 20 is the form of a longitudinally split length of tubing 22 to which photo - luminescent material has been applied , or within which photo - luminescent material has been incorporated during manufacturer . the primary material of the tubing , to which the photo - luminescent material is added , is a resiliently flexible material , for example rubber , acrylic , or silicone . the natural default shape of the tubing is arcuate along its length . a central longitudinal axis 24 around which the wall of the tubing extends is thus curved in its travel from one end 22 a of the tubing to the other opposing end 22 b . a longitudinal split 26 is provided in the tubing and runs fully from one end 22 a to the other 22 b , and forms the only break or discontinuity in the otherwise continuous circumferential span of the tubing around its central longitudinal axis a . both the radius and diameter of the hollow interior of the tubing is less than the wall thickness of the tubing in the illustrated embodiment to make the tubing easily flexible to a user , and the wall thickness is uniform throughout to give similar pliability throughout the cross - section . the tubing has resilient character in both its circumference and length , whereby the longitudinal resiliency will bias the length of the tubing into an arcuate shape like that of fig2 , and the circumferential resiliency will bias the cross - sectional wall shape of the tubing ( as seen in planes lying normal to the longitudinal axis 24 , such as the viewing plane of fig2 a ) into a closed condition spanning fully around the axis 24 . as shown in fig3 , the two free edges 22 c , 22 d of the tubing wall &# 39 ; s substantially full circumferential span about the axis 24 can be pried apart by pulling them away from one another against the resilient force that normally abuts them together into closed contact . applicant has found that commercially available silicone tubing , when longitudinally cut to form the described longitudinal split , provides these resilient characteristics , and so specialized tubing manufacture techniques are not necessarily required , and therefore are not described herein . likewise , flexible plastic tubing of other non - foam plastic compositions are expected to be able to provide equivalent functionality . liquid impermeable materials may be preferable to avoid penetration by water or soap in bath / shower applications to avoid trapping of same between the cover the underlying equipment , and prevent interference with frictional contact between the cover and the underlying equipment . fig3 illustrates installation of the cover 20 on a straight grab bar or hand rail of circular cross - section , for example like the wall - mounted tub / shower rail 10 of fig1 . the two free edges 22 c , 22 d of the tubing wall are manually pulled apart using digits of the installer &# 39 ; s opposing hands , as schematically shown by arrows 28 that represent a prying force that is sufficient to overcome the circumferential resiliency force of the split tubing . the free edges 22 , 22 d are pulled far enough apart from one another so that the width of the longitudinal slot 26 measured between them increases to an amount greater than the diameter of the hand rail 10 . at this point , the pried - open longitudinal slot is lowered down over the top of the hand rail 10 , thereby inserting the topside of the hand rail 10 into the interior space of the split tubing . the cover is forced downwardly until the free edges 22 c , 22 d have reached downwardly past the horizontal diameter of the hand rail 10 , and the area 30 of the tube &# 39 ; s interior surface lying opposite to the longitudinal slit 26 rests atop the hand rail 10 . at this point , release of the pried - apart free edges 22 c , 22 d allows them to resiliently move back toward another at the underside of the rail 10 . provided that the hand rail diameter 10 doesn &# 39 ; t exceed the default diameter of the tubing &# 39 ; s closed condition , the free edges 22 c , 22 d will return into contact with one another , thereby completing a full - circumference enclosure of the split tubing around the entirely of the hand rail . while the forgoing process describes forcing the cover downwardly onto the hand rail from the topside thereof , the same installation process can be performed in other directions , for example forcing it upwardly onto the hand rail from below , or laterally onto the hand rail from the side thereof . the flexibility of the tubing allows the normally arcuate tubing to conform to the linear shape of the hand rail or grab bar by repetition of this prey - push - release action at sequential points moving along the length of the tubing . the normal curvature of the tubing also allows better kink - free conformation of the tubing with equipment of non - linear shape , such as the generally inverted u - shape or inverted v - shape of the illustrated tub - mounted grab bar 12 . even if the diameter of the hand rail 10 is greater than the normal diameter of the split - tubing , the cover 22 will still provide a self - gripping action on the hand rail 10 , so long as the tubing is large enough so that the longitudinal slot can be enlarged to a width exceeding the hand rail diameter so that the two free edges can still effectively hook partially around the hand rail without closing entirely therearound . installation of the tubing on a shower / tub hand rail , grab bar , toilet seat arm rest , bedrail , etc . provides a more resilient surface for the user to grasp , thereby improving the grip of the rail , bar , or armrest . if the primary material of the tubing is transparent or translucent , then dispersing of a photo - luminescent material into the primary material during manufacture of the tubing will cause the tubing to emit light in a darkened bathroom or other unlit environment once the photo - luminescent material has been suitably charged by another light source ( e . g . sunlight exposure through a window during the daylight , ambient light through an open doorway , charging with a bathroom light fixture before the user goes to sleep , etc .). other means of carrying photo - luminescent material on the tube may be employed , for example by attachment of a sheet - style photo - luminescent product to the exterior surface of the tubing . applicant found that a commercially available glow in the dark vinyl sheet called lunagel glow sheet by lunabrite light technology of mountain lakes , n . j . ( http :// www . lunabrite . com ) was easily attached to split tubing by way of heat transfer , and provided suitable results . alternatively , photo - luminescent material may be provided on the split tubing by other means . illumination sources other than photo - luminescent material may alternatively be employed to provide the split tubing with its illumination functionality , but photo - luminescent material may be advantageous in order to avoid the need for battery - powered or mains - powered electrical lighting components . fig5 illustrates how the split tubing may also be installed over a peripheral edge of an object or fixture other than a hand rail or grab bar . the drawing shows the cover 20 installed on a peripheral edge of a countertop , for example of a bathroom vanity . the installation process is similar to that described above for a hand rail . the free edges of the cover are pried apart by a distance exceeding the width of the countertop edge ( i . e . the ‘ thickness ’ or ‘ height ’ dimension of the countertop at its exposed peripheral edge ), and then the closed - end of the tubing &# 39 ; s split cross - section lying opposite to the longitudinal split 26 is pushed toward the countertop edge with the two free edges 26 c , 26 d residing above and below the countertop . the cover 20 is automatically retained in place on the countertop edge by a self - gripping action achieved by the circumferentially resilient action that forces the free edges 22 c , 22 d toward one another , as this forces the interior surface of the tubing ( i . e . at the corners 32 a , 32 b where the inside surface of the tubing meets the free edges 22 c , 22 d ) into frictional contact against the topside and underside of the countertop . such an installation of a photo - illuminescent cover on a countertop edge , table edge , or other furniture edge can be used to provide night - time illumination of bathrooms or other areas without requiring activation of an electrical light source . a self - gripping split - tube illumination device like that described above may be slipped on and frictionally engaged to a bath - side floor mat 32 or toilet - embracing floor mat 34 , like those shown in fig1 . however , fig6 illustrates another possible solution for an illuminating floor mat that may similarly be used to improve night - time visibility in a bathroom or other area while avoiding activation of a ceiling or wall mounted light or other electrical lamp . fig6 a illustrates a floor mat showing use of a tubular , elongated photo - luminescent body 36 of the type shown in fig1 b of u . s . pat . no . 7 , 771 , 070 of lunabrite inc ., hereafter referred to as the lunabrite patent , and the entirety of which is incorporated herein . although fig6 a illustrates only one perimeter edge of a floor mat , it will be appreciated that such a longitudinal photo - luminescent element may be provided at each and every perimeter edge of a floor mat , as illustrated schematically in fig1 . the photo - luminescent body 36 features a photo - luminescent core 36 a surrounded by a sheath 36 b , and having a selvedge or flange 36 c coupled to the sheath and extending laterally therefrom to a position reaching inwardly from the perimeter edge 38 of the mat at the underside thereof . the flange 36 c is sewn , adhered , fused or otherwise affixed to the mat from the underside thereof in order to attach the photo - luminescent body 36 to the mat in a position residing outwardly beyond the perimeter edge thereof so as not to be visually concealed beneath the mat . fig6 illustrates a similar configuration , but uses a photo - luminescent body 36 ′ of different cross - sectional shape , particularly replacing the circular sheath of fig6 a with a semi - circular sheath positioned flat - side down so as to provide a lower - profile lighting solution at the edge of the mat . the floor mat may use a photo - luminescent member other than the particular construction described in the incorporated lunabrite patent . for example , a coupling flange on an elongated illumination member may be used to sew , adhere or otherwise affix it to the mat , regardless of whether the illumination member uses the particular core and sheath configurations described and illustrated in the incorporated lunabrite patent . for example , glow - in - the - dark rope or tubing is commercially available from a number of existing suppliers , and could be modified to include a suitable attachment flange . an illumination member may similarly be sewn or otherwise attached to an exterior of a toilet lid cover at the perimeter thereof , where it externally wraps under the perimeter edge of the toilet seat and connects to the underlying elasticized rim at the open bottom of the toilet seat cover . the disclosed embodiments of the invention include a non - slip , safety cover formed of soft rubber , acrylic , silicone , or any other resiliently flexible material that can incorporate photo luminescent materials dispersed within and incorporated into the material in a manner providing visually detectable illumination when charged . the disclosed covers are suitable for attachment to all manner of existing bathroom safety items including shower handrails , bathroom grab bars , tub rails and toilet armrests , as well as medical institution grab bars , handrails , and beds . as well , the glow - in - the - dark safety covers would be applicable for assisted mobility devices such as canes , walkers , rollators , and wheelchairs . the covers are slit down the middle to allow their placement over bathroom safety items and assistive mobility devices . in some embodiments , the covers may be capable of recharging in 5 - 30 minutes from ambient light , sunlight , or powered light bulb , and provide subsequent glowing action for 8 or more hours until recharged . these performance specifications are provided as examples only , and are not intended to limit the scope of the present invention . as mentioned above , conventional grab bars can be slippery when wet , potentially leading to injuries . the covers disclosed herein help prevent accidents from hands slipping off of the grab bar and can be placed over existing grab bars / handrails . the glow - in - the - dark component can provide lighting sufficient to see objects in the bathroom without the need to turn on a light and incur visual problems ( e . g ., bright light splits rhodopsin , making it difficult for eyes to detect light properly ), including lowering the chemicals serotonin and melatonin , and disrupting the circadian rhythm . the covers make it easier to locate / pinpoint the toilet , grab bars , edge of the bathtub , etc ., when walking to the bathroom at night , and may be especially helpful for people with poor vision who can &# 39 ; t quite make out the shape of the toilet in the dark . the covers also offer a practical solution for those who don &# 39 ; t want to turn on the light and awaken their spouse . another potential target market is for consumers who don &# 39 ; t want to “ waste electricity ” by turning on the light , whether for financial or environmental reasons . older hands can attach the covers without difficulty , by just slipping the flexible , waterproof covers over any suitable bathroom safety product or other object . the glow - in - the - dark material will absorb indoor light during the day , and provide an intense locator glow , for example in green or other colors , all night long . the glow - in - the - dark items disclosed herein may also contain antimicrobial agents to prevent the growth of bacteria . since various modifications can be made in my invention as herein above described , and many apparently widely different embodiments of same made within the spirit and scope of the claims without department from such spirit and scope , it is intended that all matter contained in the accompanying specification shall be interpreted as illustrative only and not in a limiting sense . | 4 |
referring now to the drawings , and particularly to fig1 thereof , there is shown a medicine container 20 having a dosage reminder cap 22 installed thereon . the dosage reminder cap 22 comprises a hexagon shaped base 24 and a window disk 26 . the dosage reminder cap 22 threadedly engages the top of the container 20 until it rests upon a lip 28 around the container 20 . the lip 28 has a detent 30 and a tab 31 on one side thereof providing a child safety feature . referring to fig2 , there is shown an enlarged , exploded view of the embodiment shown in fig1 . the dosage reminder cap 22 fastens onto the container 20 by engaging a threaded neck 32 of the container 20 . a notch 34 formed in the base 24 engages the detent 30 and locks the dosage reminder cap 22 in place . in order to unscrew and remove the dosage reminder cap 22 , the tab 31 is pressed down enabling the base 24 to disengage the detent 30 . the base 24 is thereafter pressed down and turned in a counterclockwise direction at the same time . the hegaxon shaped base 24 comprises a cavity 36 in the top center thereof which is sized to accommodate the window disk 26 recessed therein . printed within the cavity 36 are two concentric text rows 38 and 40 . the outer row 38 has each of the seven days of the week spaced at equal intervals therearound . the inside row 40 comprises sets of sequential numbers located below , concentric with and aligned with each day of the week displayed in the outer row 38 , each set of numbers beginning with the number 1 . in the center of the cavity 36 is an opening 42 for accommodating a pin 44 protruding from the bottom of the window disk 26 . the pin 44 snaps into the opening 42 thereby securing the window disk 26 to the base 24 and providing the axis about which the window disk 26 turns . the window disk 26 has a t - shaped window 50 cut out of one edge thereof . the window 50 displays one day of the week from the outer row 38 and one number from the inner row 40 . below the window 50 is indicator text 52 to assist the patient or person dispensing the medicine . the text 52 comprises the words “ last dose taken .” alternative texts are “ next dose due ”, “ next dose to be taken ”, or other alternative phrases having similar meanings . the window disk 26 rotates counterclockwise and stops when the desired day and dose number are displayed through the window 50 . a series of notches 54 are formed in the face of the cavity 36 , such that there is one notch 54 for each corresponding dose number of the inner row 40 . the notches 54 engage a triangular wedge 56 protruding from the bottom of the window disk 26 thereby locking the window disk 26 in place when the desired day and dose number are displayed through the window 50 . to change the day and dose number displayed , a person dispensing the medicine turns the window disk 26 by pressing down in the disk with a thumb or other finger . referring now to fig3 , there is shown the engagement of the wedge 56 and the notches 54 . the wedge 56 and the notches 54 have the shape of an isosceles triangle . the isosceles triangle shape allows the wedge 56 to continue forward to the next notch 54 while preventing the wedge 56 from going back to the previous notch 54 . referring now to fig4 , there is shown a view of the bottom of the window disk 26 illustrating the location of the pin 44 and the wedge 56 . referring now to fig5 , the dosage reminder cap 22 is shown secured in engagement with the container 20 . the inner surface of the base 24 is threaded to engage corresponding threads 58 of the neck 32 of the container . fig6 and 7 illustrate a dosage reminder cap 60 comprising a second embodiment of the invention . many of the component parts of the dosage reminder cap 60 are substantially identical in construction and function to component parts of the dosage reminder cap 22 illustrated in fig1 through 5 and described hereinabove in conjunction therewith . such identical component parts are designated in fig6 and 7 with the same reference numerals utilized above in the description of the dosage reminder cap 22 , but are differentiated therefrom by means of a prime (′) designation . the dosage reminder cap 60 differs from the dosage reminder cap 22 in that the dosage reminder cap 60 employs an alternative closure and child safety mechanism for engagement with the container 20 ′. the base 24 ′ of the dosage reminder cap 60 comprises two locking tabs 62 on opposite sides for engagement with a lip 63 of the container 20 ′. a circular inner surface 64 of the base 24 ′ secures over the neck 32 ′ of the container 20 ′. as shown in fig7 , to remove the dosage reminder cap 60 from the container 20 ′ pressure is applied to two pressure points 68 equidistant between the tabs 62 on opposite sides of the base 24 ′. as pressure is applied to the pressure points 68 , the tabs 62 are forced outwardly thereby disengaging the tabs 62 from the lip 63 allowing the dosage reminder cap 60 to removed from the container 20 ′. although preferred embodiments of the invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the embodiments disclosed , but is capable of numerous rearrangements , modifications , and substitutions of parts and elements without departing from the spirit of the invention . | 1 |
the present invention is directed to motor vehicle air ride suspension assemblies , and more particularly , to an air ride suspension assemblies or kits for converting an original equipment leaf spring suspension arrangement supporting a solid rear axle of the motor vehicle to one supported by an air ride suspension assembly . the ensuing description provides exemplary embodiment ( s ) only , and is not intended to limit the scope , applicability or configuration of the disclosure . rather , the ensuing description of the exemplary embodiment ( s ) will provide those skilled in the art with an enabling description for implementing an exemplary embodiment . it being understood that various changes may be made in the function and arrangement of elements without departing from the spirit and scope as set forth in the appended claims . within the ensuing description an air ride suspension system ( arss ) intended for secondary market installation / sales ( smis ) is described and depicted with respect to exemplary embodiments of the invention . with respect to fig1 to 4 and the design of the upper support arm the design depicted represents one for a ford f - 250 although it would be evident to one skilled in the art that the principles described are applicable to other trucks , suvs , and vehicles through adjustment in the design / dimensions . referring to fig1 there are depicted first and second upper support arms 100 a and 100 b for smis arss for the f - 250 truck according to an embodiment of the invention wherein first upper support arm 100 a is mounted to the left hand side ( lhs ) of the f - 250 and second upper support arm 100 b is mounted to the right hand side ( rhs ) of the f - 250 . each of the first and second upper support arm variant 100 a and 100 b comprises : high strength steel ( hss ) tube 108 ; first leaf spring mount 102 ; support plates 103 ; first blanking plate 104 ; mounting bracket 105 ; stop housing 106 and stop housing bushing 107 ( not depicted for clarity on second upper support arm variant 100 b but depicted on first upper support arm 100 a ); first mount 109 ; second mount 110 which is attached to third mount 111 ; second blanking plate 112 ; and second leaf spring mount 113 . as noted , each of the depicted first and second upper support arm variants 100 a and 100 b respectively with appropriate dimensions l 1 to l 8 are intended to smis arss to an f - 250 . the dimensions l 1 to l 8 as well as those of elements including , but not limited to , second and third mounts 110 and 111 respectively , first and second leaf spring mounts 102 and 113 respectively , first mount 109 and plate 115 . fig2 to 4 depict individually these multiple elements added to the hss tube 108 forming the primary element within first and second upper support arm variants 100 a and 100 b respectively . the hss tube 108 is 78 inches long and cross - section 3 × 2 × ¼ inch . these other elements being : first leaf spring mount 102 of ⅞ inch diameter circular pipe with ⅛ inch wall and length 3½ inches ; support plates 103 of thickness ¼ inch and 3 × 3 inch ; first blanking plate 104 of thickness ¼ inch and 3 × 1⅝ inch ; mounting bracket 105 of thickness 5 / 16 inch and 3 × 1½ inch which is profiled by bending ; stop housing 106 of 2¾ inch diameter circular pipe with ¼ inch wall and length 3½ inches and stop housing bushing 107 of diameter 4 inches and thickness ⅛ inch with inner diameter of 2¼ inches ; first mount 109 comprising l - shaped 1½ × 1½ × 3 / 16 inches and length 3½ inches ; second mount 110 of plate ⅜ × 2½ inch and length 8½ inches which is attached to third mount 111 of plate ¼ × 12 inch and length 9 inches , wherein both are profiled and bent to shape ; second blanking plate 112 ¼ × 1 inch and length 3 inches ; and second leaf spring mount 113 of 1⅛ inch diameter circular pipe with 3 / 16 inch wall and length 3½ inches ; fitting 114 plate ⅜ × 1½ inch and length 6 inches which is profiled and bent to shape ; plate 115 of dimensions ⅜ × 4 inch and length 10 inches which is profiled and bent to shape ; supports 116 which are ½ inch diameter rods of length 8¼ inches . now referring to fig5 and 6 , there are depicted axle mounting brackets for a smis air ride suspension system ( arss ) according to an embodiment of the invention . in fig5 , the lower axle mounting bracket 200 is depicted in first to third views 200 a to 200 c respectively for the side elevation , front elevation and rear elevation . as evident , lower axle mounting bracket 200 comprises recess 210 which mates to the lower portion of the circular rear axle . fig6 depicts first and second axle mounting brackets 300 and 400 respectively for the left and right hand sides of the truck . first axle mounting bracket 300 is depicted in first side elevation 300 a , front elevation 300 b , second side elevation 300 c , and rear elevation 300 d . second axle mounting bracket 400 is depicted in first side elevation 400 a , front elevation 400 b , second side elevation 400 c , and rear elevation 400 d . as depicted , each comprises a central plate to which are attached a first mounting “ u ” element and an angled bracket . each of the angled brackets has attached an angled second “ u ” element with mounting holes of axis relative to the mounting bracket . now referring to fig7 , there are depicted sway bar 500 and lower axle support bar 600 for a smis arss according to an embodiment of the invention . as depicted , sway bar 500 is presented in first to third views 500 a to 500 c representing plan , front , and end elevations respectively . lower axle support bar 600 is depicted in plan view 600 a and front view 600 b respectively . referring to fig8 , there are depicted upper adjustable axle support bar 700 and sway bar adjustment bar 800 for a smis arss according to an embodiment of the invention . upper adjustable axle support bar 700 is depicted in top elevation 700 a , front elevation 700 b , and bottom elevation 700 c as comprising first and second mounting elements 710 and 720 with clamping regions 730 and 740 respectively as mounted to central rod 750 . sway bar adjustment bar 800 is depicted in first and second views 800 a and 800 b representing plan and front elevations respectively . as depicted , the sway adjustment bar 800 comprises a mounting element 830 , rod 820 , and threaded rod portion 810 . referring to fig9 , there is depicted a flow 900 depicting a sequence of steps 905 to 945 for the removal of an oem leaf - spring suspension for the subsequent installation of an smis asrss according to an embodiment of the invention . as depicted , once the installer has identified and purchased the correct smis arss kit for the vehicle being modified , then they : first step 905 wherein the installer measures the ride height of the vehicle and the pinion angle ; second step 910 comprising removal of spare tire for easy install if located in a position impacting access to the rear axle ; third step 915 with lift the rear of the vehicle off the ground and securing it ; fourth step 920 with removal of both rear tires ; fifth step 925 with removal of the u - bolts holding the leaf springs in position ; sixth step 930 wherein the leaf springs are removed from both sides of the vehicle ; seventh step 935 wherein the oem shock absorbers are removed ; eighth step 940 wherein , for a ford and potentially other oem vehicles / brands , helper spring brackets are removed ; and ninth step 945 wherein the rear leaf spring shackles are removed from the leaf springs and are attached to the rear of each upper support arm . optionally , any oem installed sway bar is removed during this dismantling of the oem installed rear leaf spring assemblies . now referring to fig1 , there is depicted a flow 1000 depicting the initial sequence of installing through steps 1010 to 1070 a smis asrss according to an embodiment of the invention . from process flow 900 the flow 1000 proceeds to first step 1010 wherein the installer installs the first and second upper support arms 100 a and 100 b to the vehicle on the left and right hand sides of the vehicle . if the installer is installing a smis arss according to the design presented by the inventors within u . s . pat . no . 8 , 870 , 203 entitled “ vehicle leaf spring to air - ride suspension conversion assembly ” ( referred to as “ autoflex ”) then the flow 1000 proceeds via first flow 1300 , second step 1020 associated with flow 1300 in fig1 , third and fourth steps 1040 and 1050 respectively , and fifth step 1060 associated with flow 1400 in fig1 before proceeding to flow 1100 in fig1 . if the installer is installing a smis arss according to an embodiment of the invention ( referred to as “ ultra ”) then the flow 1000 proceeds via sixth step 1030 associated with flow 1600 in fig1 , third and fourth steps 1040 and 1050 respectively , and seventh step 1070 associated with flow 1700 in fig1 before proceeding to flow 1100 in fig1 . third step 1040 relates to installation of the sway bar 500 together with sway adjustment bar 800 which is left loose at this point and fourth step 1050 relates to the installation of the new shock absorbers onto the vehicle . from flow 1000 the process proceeds to flow 1100 in fig1 depicting the sequence of steps for the addition of the air compressor / pump and air tank for an smis arss which are common to both the autoflex smis arss according to u . s . pat . no . 8 , 870 , 023 by the inventors and the ultra smis arss according to embodiments of the invention . as depicted , flow 1100 comprises first to eighth steps 1105 to 1140 wherein the installer : first step 1105 wherein the installer installs a leveling valve bracket to front side of spare tire rack facing to the front of the vehicle ( leveling valve bracket not depicted within fig1 to 8 ); second step 1110 comprising installing an adjustable link tab to the axle housing ; third step 1115 wherein leveling valve and adjustable link are bolted for adjustment later ; fourth step 1120 with installation of the air tank brackets on chassis on the passenger side ; fifth step 1125 with installation of the air tank with its two ports facing rear ; sixth step 1130 wherein installation of the air compressor bracket to frame is made , this being close to air tank ; seventh step 1135 wherein the air compressor is installed ; and eighth step 1140 wherein the wiring harness is run from compressor to front of vehicle on the driver &# 39 ; s side and the wiring connected to the vehicle &# 39 ; s electrical system . now referring to fig1 , there is depicted a flow 1200 for the remainder of the installation sequence for an smis arss wherein flow 1200 follows from flow 1100 in fig1 . as depicted , the installer performs first and second steps 1210 and 1220 before progressing . within first step 1210 the installer runs the air lines from the air tank to the left and right hand airbags whilst in second step 1220 the installer adjusts the sway bar 700 , measures from the vehicle frame to hub face on either side and tightens via sway adjustment bar 800 . if the installer is installing a smis arss according to the design presented by the inventors within u . s . pat . no . 8 , 870 , 203 entitled “ vehicle leaf spring to air - ride suspension conversion assembly ” ( referred to as “ autoflex ”) then the flow 1200 proceeds via third and fourth steps 1230 and 1240 respectively , first flow 1280 associated with flow 1500 in fig1 , and fifth to seventh steps 1250 to 1270 respectively . if the installer is installing a smis arss according to an embodiment of the invention ( referred to as “ ultra ”) then the flow 1200 proceeds via second flow 1290 associated with flow 1800 in fig1 , and steps third to seventh steps 1230 to 1270 respectively . in each instance the installation is complete . third step 1230 wherein the installer installs the rear wheels ; fourth step 1240 wherein the installer sets the ride height , measures the vehicle , and sets via the adjustable link ; fifth step 1250 wherein the installer checks for leaks on the air system ; sixth step 1260 wherein the rear wheels are torqued to factory specifications ; and seventh step 1270 wherein the spare wheel is re - installed into its original place in the frame under the rear of the vehicle . referring to fig1 to 15 , there are depicted flows 1300 to 1500 representing the sequences of steps associated with these flows within fig1 and 12 for an smis air ride suspensions according to u . s . pat . no . 8 , 870 , 203 by the inventors . referring to fig1 , flow 1300 comprises first to fourth steps 1310 to 1340 wherein : first and second steps 1310 and 1320 wherein the installer installs trailing arms to each of the first and second upper support arms 100 a and 100 b respectively ; third step 1330 wherein the installer installs bolts into the pivot to the axle ; fourth step 1340 wherein each trailing arm is tightened to the axle through the bolts . now referring to flow 1400 in fig1 , this comprises first to third steps 1410 to 1430 comprising : first step 1410 wherein the fittings are installed to the air bladders ; second and third steps 1420 and 1430 respectively wherein the two airbags are installed on the trailing arm ledge such that they are disposed between the ledge of the trailing arm and the bottom of the upper support arm . the upper bracket 1425 between the airbags on the left and right sides and the first and second upper support arms 100 a and 100 b respectively in the smis arss kit for the autoflex approach may be bolted to first and second upper support arms 100 a and 100 b respectively allowing a common design of upper support arm to be employed in both autoflex and ultra configurations . referring to flow 1500 in fig1 , this comprises step 1510 wherein the bolts on the trailing arms are torqued to the specification of the autoflex specifications . now referring to fig1 to 18 , there are depicted flows 1600 to 1800 representing the sequences of steps associated with these flows within fig1 and 12 for an smis air ride suspensions according to an embodiment of the invention . referring to fig1 , flow 1600 comprises first to fifth steps 1610 to 1650 wherein : first and second steps 1610 and 1620 wherein the installer mounts on the lower side of the rear axle on both left and right sides a lower axle mounting bracket 200 and on the upper side of the rear axle on the left and right sides the respective one of the first and second upper axle mounting brackets 300 and 400 respectively ; third step 1630 wherein an installed lower axle mounting bracket 200 and upper axle mounting bracket ( 300 / 400 ) are depicted with the upper support arm ( 100 a / 100 b ) above ; fourth step 1640 wherein an upper adjustable axle support bar 700 is depicted installed between the upper support arm ( 100 a / 100 b ) and upper axle mounting bracket ( 300 / 400 ) wherein the first and second mounting elements 710 and 720 have not been clamped using clamping regions 730 and 740 to the central rod 750 allowing the setting of the smis arss once installed ; and fifth step 1650 wherein a lower axle support bar 600 is depicted installed between the upper support arm ( 100 a / 100 b ) and lower axle mounting bracket ( 200 ). now referring to fig1 , there are depicted first to third steps 1710 to 1730 comprising : first step 1710 wherein the installer installs limiters comprising a rising limiter and falling limiter for raising / dropping of the axle relative to the vehicle body wherein the rising limiter comprises a hollow pillow which is inserted into the ring 106 on the upper support arm and is retained by interference fit and the falling limiter comprises a resilient member between the upper support arm and the upper axle mounting bracket ( optionally the falling limiter may be attached between the upper support arm and the lower axle mounting bracket ); second step 1720 wherein the installer installs an air bladder on each side of the vehicle between the upper axle mounting brackets ( 300 / 400 ) on the rear axle on either side and the first and second upper arms 100 a and 100 b respectively ; and third step 1730 wherein replacement shock absorbers are attached on either side of the vehicle wherein the sway bar 500 may be shaped to go around the shock absorbers depending upon the mechanical configuration of the vehicle . now referring to fig1 , there is depicted first step 1810 wherein the upper adjustable axle support bars 700 on either side of the vehicle are set such that the first and second mounting elements 710 and 720 are spaced equally on either side of the vehicle to a predetermined spacing and clamped to the central rod 750 via clamping regions 730 and 740 . accordingly , once the mechanical installation is completed through flow 1800 prior to installation of the tyres in step 1230 in flow 1200 and completion of the smis arss installation , the assembled arss according to an embodiment of the invention is depicted in first and second images 1910 and 1920 using first and second upper support arms 100 a and 100 b respectively on the right and left sides of the vehicle , in this case a f - 250 truck . accordingly , the interconnection between the upper support arms 100 a and 100 b and the upper and lower axle mounting brackets 200 and 300 / 400 respectively via upper adjustable axle support bars 700 and fixed lower axle support bar 600 can be clearly seen . equally , sway bar 500 can be seen in first image 1910 running from the upper axle mounting bracket 300 / 400 to the other side of the truck under the chassis . in each of the first and second images 1900 a and 1900 b , respectively , the air bladder on either side is also clearly evident between the upper support arms 100 a and 100 b and the upper axle mounting brackets 300 / 400 together with their air interconnections and air pressure indicator in second image 1920 ( not described during installation for ease ). accordingly , it would be evident that the smis arss described in respect of an embodiment of the invention provides for the after sale retrofitting of an air ride suspension system to a vehicle having an oem installed leaf spring suspension system . whilst the dimensions and relative positions of elements may change according to the specific vehicle being retrofitted with the arss the overall assembly comprises the same elements and their relative positions / associations such as described and depicted within the specification supra . further , it would be evident to one skilled in the art that the arss as described and depicted differs from the smis arss described within u . s . pat . no . 8 , 870 , 203 also by the inventors . it would be evident to one skilled in the art that the arss as described comprising air bladders disposed on either side of the chassis to the rear axle , the compressor and air tank form part of an air control system associated with the arss . the air bladders rely upon an air source , such as the compressor , which draws power from a source such as the motor vehicle itself , i . e . via the battery and / or a generator coupled to the engine . the connection between power supply and compressor is made through a regulator which in conjunction with a sensor determines whether air pressure should be maintained or increased . the sensor within an embodiment of the invention may be a levelling valve that can serve to increase or decrease the pressure in the air bladders as needed . if a decrease in air pressure is required , the levelling valve , can provide air bladders with the means to exhaust air by putting the bladders in fluid communication with the outside environment , thus allowing the bladders to vent . the exhausting of air can be continued until the desired bed level is reached and the levelling valve closes . between compressor and the air bladders , is an air tank that can be kept under pressure so that the inflation of the air bladders can be performed quicker than would be possible if they were directly connected to air compressor . when using air tank , flow from the tank can be run through the sensor to the dump valve ( which can be implemented as a three way ball valve ). in such a configuration , the levelling valve has three states , an inflation state , a maintenance state and a deflation state . the choice of states is controlled by the ride height as determined by levelling valve . the use of a single air passage to each of the air bladders ( through both levelling valve and dump valve , for both inflation and deflation , results in an easier to install system . dump valve can be used to provide the user with the ability to control the ride height of the vehicle bed , or to control the air pressure in tank when the system is powered down . whilst a single air bladder is depicted disposed between the upper axle mounting bracket and upper support arm it would be evident that multiple air bladders may be deployed within the same footprint or that with appropriate modification to the upper axle mounting brackets that multiple air bladders may be employed with a larger footprint . in operation , a sensor determines whether the bed is at the desired level ( ride height ). the bed can be at the level , in which case , no changes to the air pressure in the air bladders is needed ; it can be too high , in which case the air bladders need to be deflated ; or it can be too low in which case the air bladders will need to be inflated . when sensor determines the applicable state it selects between its three states . in a first state , a seal is effectively maintained , so that the air pressure in the bladders is maintained . in a second state , the bladders are put into fluid communication with the air tank , which is at a higher pressure than the bladders . the air in the system will seek to find equilibrium , and thus will flow to the air bladders , inflating them in the process . when the desired level has been reached , the sensor will seal access to the bladders . in the third state , the air bladders are put into fluid communication with a lower pressure environment , which can be done by opening a valve to the open atmosphere . once again , the air in the system will seek equilibrium , which in this case will empty the air bladders . in such a system the regulator provides power to the compressor from the power source based on the air pressure in the tank . dump valve can be used to provide manual control of the pressure in various components of the system . in standard operation , dump valve allows the air tank to be in fluid communication with the air bladders , a communication controlled by sensor . however , when in a powered off state , the user may want to lower the bed of the vehicle which is achieved by venting the air bladders to the atmosphere . in such a case , dump valve can be used to empty the bladders . in some embodiments , dump valve can also be used to vent pressurized air stored in tank if so desired . additional control elements including check valves , shut off valves and couplers to allow the pressure in the air tank to be released can be provided . the use of these systems will be well understood by those skilled in the art . it would be evident that other types of sensors can be employed as sensor . in the illustrated embodiments , a levelling valve is employed to allow for the creation of a simple pneumatic control system . this valve can be preset so that there is a desired level at which the bed of the trailer is to be maintained . when the bed of the trailer is not at this level , air pressure in the bladders is increased or decreased accordingly . optionally , an air gauge can be employed to measure the pressure in the suspension system , which is directly related to the pressure in bladders . because the weight of the bed in any given installation is constant , when the bed is level the pressure of the suspension system is directly proportional to the weight of the load carried by the vehicle . thus an air gauge can also be employed to provide a rudimentary load scale on the vehicle . though described above as using a mechanical control system regulated by a levelling valve , the system of the present invention can be controlled through the use of an electronic control system that can be responsive to a number of different inputs , such as the height differential between the upper support arm and the upper axle mounting , the angle between the upper support arm and the trailing arms upper or lower axle mounting , a direct measure of the ride height , or a manual input such as one set through external controller interface . those skilled in the art will appreciate that the implementation of such a system does not depart from the scope of the present invention . specific details are given in the above description to provide a thorough understanding of the embodiments . however , it is understood that the embodiments may be practiced without these specific details . for example , circuits may be shown in block diagrams in order not to obscure the embodiments in unnecessary detail . in other instances , well - known circuits , processes , algorithms , structures , and techniques may be shown without unnecessary detail in order to avoid obscuring the embodiments . the foregoing disclosure of the exemplary embodiments of the present invention has been presented for purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise forms disclosed . many variations and modifications of the embodiments described herein will be apparent to one of ordinary skill in the art in light of the above disclosure . the scope of the invention is to be defined only by the claims appended hereto , and by their equivalents . further , in describing representative embodiments of the present invention , the specification may have presented the method and / or process of the present invention as a particular sequence of steps . however , to the extent that the method or process does not rely on the particular order of steps set forth herein , the method or process should not be limited to the particular sequence of steps described . as one of ordinary skill in the art would appreciate , other sequences of steps may be possible . therefore , the particular order of the steps set forth in the specification should not be construed as limitations on the claims . in addition , the claims directed to the method and / or process of the present invention should not be limited to the performance of their steps in the order written , and one skilled in the art can readily appreciate that the sequences may be varied and still remain within the spirit and scope of the present invention . | 1 |
referring to fig1 an airborne emission sensing device 30 is placed in proximity to the weld site of a welding tool 20 . in this embodiment , the sensing device is placed between three and six feet from the weld site 20 . the tool in this embodiment is a conventional laser welding tool , used to attach two metal plates 22 by means of a high energy , visible light beam 24 . however , the application of this invention to other welding tools is contemplated by the inventors . the beam 24 , when energized , is a continuous , multi - mode beam , directed at multiple points around the desired weld location . the plates 22 are clamped together and are placed in a perpendicular arrangement with respect to the beam 24 . each individual beam is tuned so that its visible light comes to focus at the point where the two plates make contact with each other 26 . when the plates 22 are in place , the tool 20 is energized and an enable signal is immediately transmitted along a conductor 28 attached between the welding tool 20 and an input port 48 of a signal processing and storage system 36 . this signal is set to logic ` 1 ` when the welding tool 20 is welding the plates and is otherwise reset to logic ` 0 `. the subsequent heating and bonding of the metal plates creates airborne emissions which have been found to characterize the integrity of the bonding process . in this embodiment , a simple audio microphone 30 is used to measure emissions in the 0 - 20 khz range . in other embodiments , the sensor can be any device capable of sensing emissions in an applicable frequency band of interest . the microphone 30 has a continuous analog output which is connected to an amplifier 32 , the output of which is connected to an analog to digital converter 34 . the digital output of the converter 34 is connected to the signal processing and storage system 36 which samples the digital data at a predetermined sampling rate , and stores the resultant discrete digital data in random access memory 38 . at predetermined time intervals , the stored data is transformed to the frequency domain using standard fast fourier transform techniques . in this embodiment , a dedicated burr brown zpb - 3211 single chip digital signal processor 40 is used solely to make this transformation , with which a 512 entry data block may be transformed in less than 20 milliseconds . next , the frequency data is communicated to an averaging block 42 which averages the frequency data , to provide an average frequency value for the process . that value is transmitted to a comparator 44 , where it is compared to a predetermined threshold value which has been stored in the read only memory 46 of the signal processing and storage system 36 . the weld is diagnosed as faulty if the average frequency value exceeds the predetermined value . upon diagnosing a weld as bad , a message is sent through an output port 48 to an operator interface 50 , advising the operator of the fault . the system operator may then attempt to cure the fault by repositioning the parts with respect to the weld beam , reclamping the parts , or adjusting the focal point of the beam . the weld process , or a part thereof , is then repeated with the fault detection invention again checking the integrity of the weld . if the fault is determined to be incurable , the operator may remove the parts from the weld zone and discard them or attempt an off - line manual repair . the central processor in the processing system takes the form of a standard digital computer , such as a motorola 68030 32 - bit , single - chip microcomputer . the computations used to carry out the principles of this invention are performed by this processor , with the exception of the transformation of the data to the frequency domain , which is carried out by the burr brown digital signal processor 40 , as discussed . the principles of this invention are implemented in the form of an operating program stored in the read only memory 46 of the central processor . referring to fig2 when power is first applied to the system , the control program is entered at step 98 , and proceeds to step 100 where the controller provides for system initialization . for example , at this step data constants are transferred from rom locations to ram locations and counters , pointers and flags are initialized . after the initialization step the controller proceeds to step 102 , where the system starts a routine to periodically monitor the weld enable signal , which is set to logic ` 1 ` when a weld is in progress and is otherwise reset to logic ` 0 `. the controller then proceeds to a background loop at step 104 which is continuously repeated . this loop may include system diagnostic and maintenance routines . the loop also includes a routine to monitor the weld enable signal shown at step 106 , such that the fault detection algorithm incorporating the principles of this invention will be executed at step 108 whenever this routine senses that a new weld has begun . this fault detection algorithm is illustrated in fig3 and is entered at step 120 . generally , the algorithm senses and stores radiation from a weld during the weld process into data blocks of predetermined size . in this embodiment , the blocks contain 512 data points . when a block is full , the data contained therein is transformed to the frequency domain and is then averaged yielding one scalar average frequency value for that block . this is continued for the duration of the welding process . when the weld is complete , each scalar value is compared to a predetermined value to determine the integrity of the weld . specifically , at the start of the weld , the algorithm proceeds to step 122 , where temporary variables used in the present execution of the algorithm are initialized . next , at step 124 , the controller reads the output of the analog to digital ( a / d ) converter and stores the digital value as the kth entry in the 512 entry data block . the controller then , at step 126 , checks to see if the block is full . if the block is not full , the controller reads the weld enable line at step 128 . if this line is at digital ` 1 ` such that the welding process is still in progress , the controller increments the storage pointer k at step 130 for storage of the next entry in the block . the controller then delays for a predetermined amount of time at step 132 before repeating the process starting at step 124 . in the preferred embodiment , the delay is set up so that new data is read from the a / d converter every fifty microseconds . if either the 512 entry data block is full at step 126 or the weld enable line is at digital ` 0 ` at step 28 signifying the completion of the present weld , the controller executes steps 134 through 158 to analyze the emissions from the weld . specifically , at step 134 , the data in the block , whether the block is full or not , is transformed to the frequency domain using standard fast fourier transform techniques . the frequency data is then averaged at step 136 to arrive at one scalar value f j which is the average frequency for the jth block of data , according to the following equation ## equ1 ## where freq ( i ) is the frequency of the ith entry in memory , and x ( i ) is the magnitude of the ith frequency component . next , the weld enable line is read at step 138 . if it is set to a logic ` 1 `, signifying that the weld is still in progress , the pointer for storing the average frequency data j is incremented at step 140 , the pointer for storing data in the data block k is reset for the next block at step 142 , and the controller returns to the delay block 132 to delay before starting to fill the next 512 entry block . alternatively , if the weld enable line is reset to logic ` 0 ` at step 138 , signifying completion of the weld , the controller executes steps 144 through 158 to analyze the stored series of average frequency points . starting with step 144 , the controller resets the index i to point at the start of the sequence of average frequency data values . next , at step 146 , the controller compares the ith average frequency point to a predetermined threshold value k 1 . experimentation has shown that the creation of a faulty weld produces emissions with substantially higher average frequency than the creation of a &# 34 ; fault - free &# 34 ; weld . k 1 is determined through experimentation where , for given materials and a given welding system , the average frequency is measured from known faulty and known fault - free welds . a region exists between the measured average frequency values of these two types of welds , and k 1 is determined as the midpoint of that region . returning to step 146 , if the average frequency value f i exceeds the threshold value k 1 , an excursion counter is incremented at step 148 . otherwise , the controller goes back and examines the next average frequency point via steps 150 and 152 . this process continues until the controller determines at step 152 that it has compared all of the frequency points to k 1 . the fraction of faulty frequency points to overall frequency points is then compared at step 154 to a cutoff fraction , k 2 . k 2 is derived as a function of the desired quality of the weld and of the predicted error in the frequency measurements . imperfections may exist in any weld but may not significantly impact the integrity of the bond between the welded parts . additionally , substantial inaccuracies often exist in the data acquisition and analysis steps of this algorithm . k 2 is the tolerance means by which a certain degree of weld imperfection and data gathering error is tolerated without diagnosing a weld as faulty . returning to fig3 if , at step 154 , the fraction of frequency excursions exceeds k 2 , a signal is sent to the system operator at step 156 to identify the weld as defective . the operator may then , at his discretion , attempt any conventional cure , or may discard the parts , depending in the severity and curability of the defect . the controller then , at step 158 , returns to the background routine which will continuously repeat until the weld enable line is again set to a logic ` 1 `, indicating the start of the next weld . if the fraction of frequency excursions does not exceed the cutoff value , the controller directly returns to the background routine at step 158 . this algorithm , starting again at step 120 , will continue to repeat while the fault detection controller is operating . the entire algorithm is executed for a given weld in less than one second , such that no interruption or delay is introduced into the automatic weld process . the foregoing description of a preferred embodiment for the purpose of explaining the principles of this invention is not to be considered as limiting or restricting the invention since many modifications may be made by the exercise of skill in the art without departing from the scope if the invention . | 6 |
as shown in fig1 , a water / steam system 1 according at least one preferred non - limiting embodiment comprises a high and / or intermediate pressure section 2 of a heat recovery steam generator ( hrsg ) 4 and a steam turbine section 5 . the hrsg 4 provides a flue gas stream path 6 . the flue gas stream path 6 extends from a hot end 7 to a cold end 8 of the hrsg 4 . a flue gas inlet stream 9 i enters the hrsg 4 at the hot end 7 . a flue gas outlet stream 90 exits the hrsg 4 at the cold end 8 . after entering the hrsg 4 at the hot end 7 , the flue gas stream 9 is guided along the flue gas stream path 6 through the high / intermediate pressure section 2 . the high / intermediate pressure section 2 is equipped with high and / or intermediate pressure economisers , evaporators and / or super - heaters operating at respective high and / or intermediate pressure levels as known from hrsgs in order to generate steam for high and / or intermediate pressure steam turbines ( not shown ). when exiting the high / intermediate pressure section 2 , the flue gas stream 9 is guided through the low pressure section 3 along the flue gas stream path 6 . the low pressure section 3 comprises a low pressure subsection 10 and a sub low pressure subsection 11 . the low pressure subsection 10 is arranged upstream of the sub low pressure subsection 11 along the stream path 6 , although the low pressure subsection 10 and the sub low pressure subsection 11 may interleave with each other which will become evident from the detailed description of the low pressure subsection 10 and the sub low pressure subsection 11 in the following . the low pressure subsection 10 comprises a first low pressure economiser 12 , a low pressure evaporator 13 , and a low pressure super - heater 14 . the first low pressure economiser 12 is arranged downstream of the low pressure evaporator 13 which is again arranged downstream of the low pressure super - heater 14 along the flue gas stream path 6 . additionally , the low pressure subsection 10 comprises a second low pressure economiser 22 arranged downstream of the low pressure subsection 11 in the flue gas stream path 6 . by the arrangement of the second low pressure economiser 22 downstream of the sub low pressure subsection 11 , the low pressure subsection 10 and the sub low pressure subsection 11 may be regarded as interleaving with each other . furthermore , a low pressure steam drum 15 is provided in the low pressure subsection 10 . the low pressure steam drum 15 is connected on its waterside 15 a to the first low pressure economiser 12 and the low pressure evaporator 13 through the respective low pressure water lines 16 . a steam side 15 b of the low pressure steam drum 15 is connected to the low pressure evaporator 13 and the low pressure super - heater 14 via respective low pressure steam lines 17 . on the waterside 15 a , both the low pressure water line 16 and a bypass line 18 yield into a low pressure main water input 19 of the low pressure sub section 10 , in particular the low pressure steam drum 15 thereof . via the bypass line 18 , both the first and the second economiser 12 , 22 may be bypassed . on the steam side 15 b , a low pressure super - heater steam output 20 of the low pressure subsection 10 , in particular the low pressure super - heater 14 thereof , is connected to the steam turbine section 5 in order to provide steam to the steam turbine section 5 at a low pressure level p 10 . furthermore , feed water can enter the first low pressure economiser 12 directly through a first low pressure economiser water input line 21 connected to the input of the first low pressure economiser 12 . the sub low pressure subsection 11 comprises a sub low pressure evaporator 23 , and a sub low pressure super - heater 24 . water pre - heated in the second low pressure economiser 22 may be used in the sub low pressure subsection 11 as well as in the high / intermediate pressure section 2 . therefore , the second low pressure economiser 22 may be regarded as being part both of the low pressure subsection 10 and the sub low pressure subsection 11 . from another point of view , the first and second low pressure economizers 12 , 22 may be regarded as a single economizer which is split by the sub low pressure evaporator 23 according to the embodiments described herein . hence , this is another example for how the low pressure subsection 10 and the sub low pressure subsection 11 interleave with each other . the second low pressure economiser 22 is arranged downstream of the sub low pressure evaporator 23 which is again arranged downstream of the first low pressure economizer 12 and the sub low pressure super - heater 24 along the flue gas stream path 6 . hence , the low pressure subsection 10 and the sub low pressure subsection 11 also interleave with each other in that the first low pressure economizer 12 is arranged between the low pressure super - heater 24 and the sub low pressure evaporator 23 along the flue gas stream path 6 . furthermore , a sub low pressure steam drum 25 is provided . the sub low pressure steam drum 25 is connected on its waterside 25 a to the second low pressure economiser 22 and the sub low pressure evaporator 23 through the respective sub low pressure water lines 26 . a steam side 25 b of the sub low pressure steam drum 25 is connected to the low pressure evaporator 23 and the sub low pressure super - heater 24 via respective sub low pressure steam lines 27 . on the waterside 25 a , a recirculation lines 28 enable to recirculate water / condensate from the low pressure water line 16 and the first low pressure economiser water input line 21 . the low pressure water line 16 may be regarded as a hot source line as it carries water from the first low pressure economizer 12 to the low pressure steam drum 15 on a higher temperature level than the water in the first low pressure economizer input line 21 . therefore , the first low pressure economizer input line 21 may be regarded as a cold source line . furthermore , the low pressure section 3 comprises a sub low pressure main water input 29 of the low pressure sub section 11 , in particular the sub low pressure steam drum 25 thereof . on the steam side 25 b , a sub low pressure steam super - heater output 30 of the sub low pressure subsection 11 , in particular the sub low pressure super - heater 24 thereof , is connected to the steam turbine section 5 in order to provide steam to the steam turbine section 5 at a sub low pressure level p 11 . furthermore , feed water can enter the second low pressure economiser 22 directly through a water / condensate input line 31 connected to the input of the second low pressure economiser 22 . via the water / condensate input line 31 , water / condensate maybe provided to the entire hrsg 4 from a water / condensate source 32 , such as a cooling facility like a water cooling tower or alike . the water / condensate source 32 is connected to the entire low pressure section 3 of the hrsg 4 via a water / condensate input 33 of the low pressure section 3 . the water / condensate input 33 is split into the sub low pressure bypass line 18 and the second low pressure economiser water input line 31 . the steam turbine section 5 comprises high / intermediate pressure steam turbines 50 a , 50 b and a low pressure steam turbine 51 which are all arranged on a shaft 52 mechanically connected to an electricity generator ( not shown ). in a known manner , the high pressure steam turbine 50 a is supplied with steam from the high / intermediate pressure section 2 . exhaust steam from the high pressure steam turbine 50 a is used in the intermediate pressure steam turbine 50 b ( more specifically , the exhaust steam generally goes to an hrsg to be reheated , merges with incoming intermediate pressure steam and then goes to the intermediate pressure steam turbine ). the low pressure super - heater steam output 20 of the hrsg 4 and an exhaust steam line 53 connected to an exhaust steam output of the intermediate pressure steam turbine 50 b both lead into a main input 54 of the low pressure steam turbine 51 . the sub low pressure super - heater steam output 30 of the hrsg 4 is connected to intermediate ports 55 a , 55 b of the low pressure steam turbine 51 , in particular to a first intermediate port 55 a and a second intermediate port 55 b of the low pressure steam turbine 51 . the low pressure steam turbine 51 is in general a double - flow steam turbine and in general comprises a first flow path and a second flow path 51 a , 51 b ( left and right flow path ) which are arranged mirror - symmetrically to each other . each of the flow paths 51 a , 51 b may comprise three intermediate ports for example , associated to different pressure levels of the low pressure steam turbine 51 . these low pressure levels may again comprise a high , an intermediate , and a low pressure level in the low and a sub low pressure level range . the first and second intermediate ports 55 a , 55 b are associated to a high and an intermediate pressure level of the low pressure steam turbine 51 . in the alternative , the first and second intermediate ports 55 a , 55 b may be associated to that same pressure level of the low pressure turbine , e . g . the intermediate pressure level of the low pressure range . bleed ports of the low pressure steam turbine 51 may be used as the intermediate ports 55 a , 55 b . hence , the sub low pressure steam may be used at different sub low pressure levels p 11 in order to drive the low pressure steam turbine 51 . in operation , low pressure water / condensate enters the heat recovery steam generator 4 through the water input 33 from the water / condensate source 32 at a temperature between approx . 20 ° c . to 50 ° c . depending on the respective conditions . in the sub low pressure steam drum 25 , temperatures of around 115 ° c . may prevail . low pressure levels p 10 and the low pressure super - heater steam output line 20 commonly vary in a range from 4 to 8 bar . based on this range , sub low pressure levels p 11 in the sub low pressure super - heater output line 30 are below 4 bar to vacuum . for example , such a sub low pressure level p 11 may range between 0 . 8 and 1 bar . at a low pressure level p 11 of 0 . 9 bar , the respective steam would be superheated by 15 k . the mass flow of steam through the sub low pressure super - heater steam output line 30 would be up to approximately 4 % of the mass flow of the steam flowing through the main input 54 of the low pressure steam turbine 51 . the sub low pressure subsection 11 may be at least partly switched off in time periods with extraordinarily low ambient temperatures around the ccpp and / or very low loads of the ccpp , i . e . that electricity consumption demanded to be covered by the ccpp is far lower than the power the ccpp is designed to provide at full load . in this way , heat available in the hrsg 7 can be shifted to the economisers 12 , 22 , so that water / condensate provided to the low pressure section 10 and the high / intermediate pressure section 2 can be sufficiently pre - heated . | 8 |
a separator sheet handling assembly 10 embodying the invention is illustrated in fig1 and 2 . the illustrated separator sheet handling assembly 10 includes a lift assembly 20 , feed assembly 30 , alignment assembly 40 , test assembly 50 , first storage assembly 60 and second storage assembly 70 . during operation of the separator sheet handling assembly 10 , a pallet 12 having a stack of separator sheets 14 thereon is supplied into the lift assembly 20 . the lift assembly 20 moves the pallet 12 upward until the feed assembly 30 grasps a separator sheet 16 positioned on lop of the stack of separator sheets 14 . the feed assembly 30 transports the separator sheet 16 into the alignment assembly 40 . as the separator sheet 16 passes through the alignment assembly 40 , the separator sheet 16 is maneuvered to a predetermined location for delivery to the test assembly 50 . the test assembly 50 is adapted to test the separator sheet 16 in order to determine if the separator sheet 16 is clean and free from holes , tears or any other damage . the separator sheet 16 is preferably tested ( and analyzed ) as it is transported through the test assembly 50 , although the movement of the separator sheet 16 might have to either be slowed , or stopped altogether , depending on types of tests that are performed . depending on the condition of the separator sheet 16 , it is either transported into the first storage assembly 60 or transported over the first storage assembly 60 into the second storage assembly 70 . it should be noted that additional storage assemblies could be added if the test assembly 50 has the capacity to analyze additional characteristics on the separator sheet 16 . as an example , clean and undamaged separator sheets 16 would be transported to the first storage assembly 60 , dirty but undamaged sheets would be transported into the second storage assembly 70 and damaged sheets would be transported into a third storage assembly ( not shown ). in the assembly illustrated in fig1 and 2 , the lift assembly 20 is adapted to receive a pallet 12 that is inserted by a lift truck or other pallet handling device including , but not limited to , a conveyor 21 . although any conventional lift could be employed without departing from the scope of present invention , the lift assembly 20 is shown as a scissors lift which is powered by a hydraulic cylinder that indexes the pallet 12 upward at designated intervals so that the feed assembly 30 removes the separator sheets 16 one at a time from the top of the stack of separator sheets 14 . positioned above the lift assembly 20 is a top frame remover assembly 17 ( shown in fig1 only ). the top frame remover assembly 17 includes a gripper assembly 18 ( shown in the raised position ) that is lowered as needed to grab a top frame 19 positioned on top of the stack of separator sheets 14 . the gripper assembly 18 is suspended from , and travels along , horizontal rails 15 . during operation of the separator sheet handling assembly 10 , the gripper assembly 18 is positioned above the lift assembly 20 until a top frame 19 is detected on top of the stack of separator sheets 14 . operation of the sheet feed assembly 30 is suspended and the gripper assembly 18 lowers until it engages the top frame 19 and grabs it with pneumatically powered grippers ( not shown ). the gripper assembly 18 then returns to the raised position and moves along guide rails 15 until it is over a frame collection bin 13 where the top frame 19 is released by the grippers to fall into the frame collection bin 13 . as shown in fig2 , the top frame collection bin 13 is positioned beside lift assembly 20 but it should be understood that it can be positioned in any available position that is adjacent to the lift assembly 20 . the lift assembly 20 also includes an air chamber 25 positioned near the top of the stack of separator sheets 14 . the air chamber 25 moves air through the lift assembly 20 to facilitate removing only the top separator sheet 16 instead of multiple sheets . the sheets in the stack of separator sheets 14 often tend to adhere to the top sheet due to moisture , dirt and / or static among other reasons . in a preferred form of the invention , the lift assembly 20 includes squaring fences ( not shown ). the squaring fences organize the stack of separator sheets 14 into a neat pile before the uppermost sheet is removed by the feed assembly 30 . the squaring fences can be any configuration commonly known in the art and may continuously , or periodically , square the stack of separator sheets 14 as the lift assembly 20 indexes the pallet upward toward the feed assembly 30 . the feed assembly 30 is shown in detail in fig3 - 5 . the feed assembly 30 is adapted for horizontal movement relative to the lift assembly 20 and the alignment assembly 40 . horizontal motion is translated to a portion 78 of the feed assembly 30 by a drive 80 . the drive 80 maneuvers a chain 79 in an endless pattern as indicated by arrow a in fig4 . a bracket 81 is connected to a section of the chain 79 such that the bracket 81 moves along the path of the chain 79 . the bracket 81 is pivotally connected to one end 82 of a support arm 83 such that maneuvering the bracket 81 causes movement of the support arm 83 . an opposite end 84 of the support arm 83 is pivotally connected to a bracket 85 ( see fig3 ) that is connected to a laterally extending support structure 86 of the feed assembly 30 . the pivotal connection between the ends 82 , 84 of the support arm 83 and the respective brackets 81 , 85 causes the nonlinear motion of the support arm 83 to be translated to horizontal linear motion of the laterally extending support structure 86 . a pair of support rods 87 a , 87 b extend longitudinally from opposite sides of the laterally extending support structure 86 . the support rods 87 a , 87 b are supported for horizontal movement by bearings 32 positioned on opposite sides of the separator sheet handling assembly 10 . the feed assembly 30 is maneuvered vertically by pneumatic cylinders 34 positioned on opposite sides of the separator sheet handling assembly 10 . the feed assembly 30 includes vacuum fittings 36 that engage the top surface of the separator sheet 16 . a preferred form and arrangement of the vacuum fittings 36 are disclosed in pct / us97 / 07520 , which is incorporated herein by reference . during operation of the separator sheet handling assembly 10 , the feed assembly 30 moves backward and downward to grasp the separator sheet 16 positioned on the top of the stack of separator sheets 14 . once the vacuum fittings 36 engage the top surface of the separator sheet 16 , the feed assembly 30 moves upward and forward to position the separator sheet 16 between rotating drive rollers 37 , 38 . drive roller 38 drives a first plurality of endless belts 41 and drive roller 37 drives a second plurality of endless belts 39 . the first and second plurality of belts 39 , 41 contact the upper and lower surface of the separator sheet 16 and deliver the separator sheet 16 into the alignment assembly 40 . the feed assembly 30 includes a pair of brackets 89 a , 89 b that are pivotally connected to support members 90 a , 90 b that are part of separator sheet handling assembly 10 . this pivoted connected allows the feed assembly 30 to be rotated ( i . e ., raised up ) by activating pneumatic cylinders 34 that are positioned on opposite sides of the feed assembly 30 . the ability to raise the feed assembly 30 in this manner permits easy inspection and / or maintenance of the area between the first and second plurality of belts 39 , 41 , especially when a separator sheet 16 becomes jammed in the feed assembly 30 . the separator sheet 16 is carried through the alignment assembly 40 by the first plurality of belts 41 which are positioned across the width of the separator sheet handling assembly 10 . as the separator sheet 16 travels through the alignment assembly 40 , the separator sheet 16 is maneuvered by guides 42 into a predetermined position . the separator sheet 16 needs to be maneuvered into this predetermined position so that the separator sheet 16 is properly positioned as it enters the test assembly 50 . the plurality of belts 41 also transports the separator sheet 16 through the test assembly 50 . the test assembly 50 uses conventional monitoring devices in order to collect data regarding certain characteristics of each separator sheet 16 . in a preferred form , the test assembly 50 includes a light emitting system 51 that projects light upward toward the separator sheet 16 as the separator sheet 16 passes through the test assembly 40 . the test assembly 50 further includes a sensor 52 that checks to see if any light passes through the separator sheet due to tears or holes in the separator sheet 16 . the test assembly 50 could also perform other tests on the separator sheet 16 that are commonly known in the art , including , but not limited to , checking for load tags and surface contamination ( e . g ., oil or syrup spots , and footprints ). the collected data is supplied to a computer ( not shown ) or some other decisionmaking entity . the computer then instructs the separator sheet handling assembly 10 to direct the separator sheet 16 into either the first storage assembly 60 or the second storage assembly 70 . the delivery of the separator sheet 16 into either the first storage assembly 60 or the second storage assembly 70 is illustrated in fig6 and 7 . depending on the characteristics of the separator sheet 16 , the computer sends out a signal that directs an actuator 61 to either expand or contract . the actuator 61 is connected to a directing guide 62 that moves up and down as the actuator 61 expands and contracts . in the assembly illustrated in fig6 , the actuator 61 is contracted such that the directing guide 62 is in a lowered position . when the directing guide 62 is in the lowered position , the separator sheet 16 passes over the directing guide 62 and moves from the plurality of laterally spaced belts 41 onto a separate set of laterally spaced belts 65 that transport the separator sheet 16 to the second storage assembly 70 . if the computer directs the actuator 61 to expand , the directing guide 62 moves into a raised position ( see phantom lines in fig6 ) such that the separator sheet 16 enters the directing guide 62 between an upper bracket 63 and a lower bracket 64 . the separator sheet 16 continues through the directing guide 62 into the first storage assembly 60 . the first storage assembly 60 includes a lifting frame 69 that is capable of supporting a pallet 66 in a predetermined location . the separator sheet 16 enters the first storage assembly 60 and is positioned on top of a pile 67 of previously sorted separator sheets by guides 68 . the lifting frame 69 is maneuvered up and down using chains 100 that are driven by sprockets positioned on opposite sides of a support structure 105 . as the separator sheets 16 continue to stack up on the pallet 66 , the lifting frame 69 is indexed downwardly until a desired number of separator sheets 16 have been stacked on to the pallet 66 . the full pallet 66 may be directed from the first storage assembly 60 via a conveyor ( not shown ). the situation illustrated in fig7 occurs when the actuator 61 is retracted and the separator sheet 16 is transported over the directing guide 62 onto the plurality of laterally spaced belts 65 . the plurality of belts 65 transport the separator sheet 16 between an upper bracket 74 and a lower bracket 75 on a receiving guide 71 . the separator sheet 16 passes through the receiving guide 71 and is directed onto a pile of separator sheets 76 by guides 77 . the second storage assembly 70 includes a lifting frame 72 that is adapted to support a pallet 73 . chains 101 move the lifting frame 72 up and down . sprockets positioned on opposite sides of a support structure 106 support the chains 101 . the lifting frame 72 indexes downwardly as the separator sheets 16 are stacked onto the pallet 73 . once the pallet 73 is stacked full of separator sheets , the pallet 73 can either be removed directly or transported via a conveyor ( not shown ) to another location . the receiving guide 71 is different from the directing guide 62 in that the receiving guide 71 is not adjustable . as stated previously , the separate sheet handling assembly 10 can include additional storage assemblies ( not shown ). it should be apparent that the separator sheets need to be directed into one of the storage assemblies . the separator sheets will be directed into the storage assembly located on the end of the separator sheet handling assembly 10 if the separator sheet 16 has not been previously directed into another storage assembly . therefore , a nonadjustable receiving guide 71 should be located before the final storage assembly . in one form of the invention , the storage assemblies 60 , 70 each include squaring fences ( not shown ). the squaring fences organize the stack of separator sheets 14 into a neat pile as the sheets 16 are inserted into the respective storage assemblies 60 , 70 . the squaring fences can be any configuration commonly known in the art and may continuously or periodically square the stacks of separator sheets as the respective lifting frames 69 , 72 index the pallets 66 , 73 downward . in another embodiment of present invention the second storage assembly 70 does not include a lifting frame 72 . instead , the second storage assembly is located adjacent to the frame of separator sheet handling assembly 10 such that sheets 16 which are not delivered to the first storage assembly 60 are delivered off of an end 99 of the separator sheet handling assembly 20 into a receptacle ( e . g ., a trash bin ). various features of the invention are set forth in the following claims . | 1 |
to overcome the ravaging effect of the glare from reflection of various luminances , it was found that a lens when suitably treated and formed could be worn by the observer so as to substantially block the form of visual noise produced by the spectral light and other environmental luminances . this invention is also concerned with the radiation that emanates from the interior of the cathode ray tube or other vdt that forms after images . it is primarily to the multiple effect of the environment upon the surface of the vdt and other objects , such as the source document viewed by an observer , or any other source of luminance , that this invention is directed . filters , if provided in front of the vdt , would not in any way reduce the effect of the reflections from the environment , and hence , would do nothing to alleviate the eye strain and fatigue from the environmental luminances that these reflections would produce . the lens material is preferably in the form of a plastic body of a clear light transmitting material in which the plastic may be made of conventional light transmitting plastic lens blanks composed of materials such as cellulose acetate ( ca ), cellulose acetate butyrate ( cab ) and allyl diglycol carbonate ( adc ). other materials such as clear acrylic compositions could be useful although the dyeing of these lenses is more difficult . the adc lens may be vacuum formed by &# 34 ; sagging &# 34 ; or formed by molding . it has been found that the sagged adc lens is more economical and easier to impregnate . it has been found that the shape of the lens should be convex outwardly as it faces the vdt screen and preferably have an internal concave surface as the lens faces the eye of the observer . the purpose of the convex surface of the lens is to deflect angled stray radiation that may not be on a direct line between the eye of the observer and the screen , thus such stray angled radiation would be deflected off to the side and not enter the eye . in order to achieve this deflection of the stray radiation , it is preferable that the outer or front surface of the lens have a + 1 -+ 8 diopter curvature and preferably + 4 -+ 6 diopter curvature . the components of the visual noise that have been found to cause the eye strain and fatigue include the ultraviolet light having a wave length generally between 250 and 400 nm and portions of the visible spectrum generally between the 500 and 600 nm range that includes the wavelengths of the green and yellow radiation . significant improvement in reduction of eye strain comes from removal of all , or substantially all , of the ultraviolet light radiation , preferably 97 - 100 %. in any event , at least 85 - 100 % should be absorbed . there are several ultraviolet absorbers or blockers known but the one that is found to be particularly useful is sold under the trademark &# 34 ; uvinul - d 50 &# 34 ; which is a 2 , 2 &# 39 ;, 4 , 4 &# 39 ; tetrahydroxybenzophenone and sold by basf of parsippany , new jersey . of course , any other ultraviolet absorber such as the following benzophenones : 2 ,- 4 dihydroxy -; 2 - hydroxy - 4 methoxy -; 2 , 2 &# 39 ;- dihydroxy - 4 - 4 &# 39 ;- dimethoxy -; 2 - hydroxy - 4 - methoxy . . . - 5 - sulfonic acid ; and disodium 2 - 2 &# 39 ; dihydroxy - 4 - 4 &# 39 ;- dimethoxy 5 - 5 &# 39 ; disulfo -, can be used as well as ethyl - 2 - cyano - 3 , 3 - diphenyl acrylate , 2 - ethylhexyl - 2 - cyano - 3 , 3 - diphenyl acrylates for the acrylic plastic bodies . the ca or cab lens body may be coated or impregnated with the ultraviolet blocker simply by dipping the lens in an aqueous bath of the slightly soluble ultraviolet blocker at a bath temperature of 130 °- 250 ° f ., and preferably 140 °- 160 ° f . for ca or cab lenses and more preferably about 130 ° for a ca and cab lens for a time broadly between 1 second and 20 minutes and more particularly between 1 and 250 seconds , or 1 - 30 seconds with about 15 seconds most preferable for the ca or cab lens and 10 - 20 minutes for the adc lens . when the lens is removed it will have an impregnation of the ultraviolet absorber sufficient to block substantially all of the ultraviolet radiation that would otherwise have been transmitted . if a sagged allyl diglycol carbonate ( adc ) lens is used , the bath temperature should be from 190 °- 250 ° f ., preferably about 210 ° f . for a time between 0 . 5 and 10 minutes preferably about 1 - 2 minutes , if the adc lens is molded the times may be at least 10 times longer than for the impregnation of the sagged lens blank . it is particularly desirable to utilize a dye having either or both a red dye component and a blue dye component that will be able to sustain ( a ) the eye sensitivity to the green color in a crt display with green indicia and ( b ) to sustain the eye sensitivity to the yellow color in a crt display with yellow indicia respectively . when both dyes are present , a rose dye results which is capable of sustaining both the green color and yellow color sensitivity and can be used interchangeably with the different crts . it has been found that there is a loss in green sensitivity in the eye of the observer that continues to occur upon continuous viewing of the green indicia on the crt screen . use of the rose dye , or at least the red component , for instance , reduces the intensity of the green and therefore diminishes the rate of consumption of the green sensitive chemical component of rhodopsin , the chemical in the retina that senses all colors . there is a different , but comparable , visual chemical component of rhodopsin for the wave length of the yellow color , which upon continuous viewing bleaches the chemical component of rhodopsin , that would transmit this color to the retina , and therefore , through the optic nerve to the brain . when the intensity of the incident green or yellow radiation , is lowered , the respective chemical compound of rhodopsin sensitive to that color radiation is not used up to the same extent as if the eye had been viewing these colors in their original intensity . thus the eye would be able to see the green color or the yellow color , for instance , longer and easier without any eye strain than if no rose dye filter , or appropriate red or blue dye component , would be used . this new rose or component colored filter thus prevents reverse after images that in the case of green indicia on the crt would be red and would be a cause for eye strain . when the crt includes the amber or yellow phosphor to produce a yellow indicia , a blue dye or a blue component of the rose dye , as identified above , acts to attenuate the effect of the incident amber or yellow radiation in the same manner as described above with the green wavelength . the eye is thus able to continue to view the yellow color without the reverse after image that in the case of a yellow phosphor would be a blue after image . the plastic lens body may be coated or impregnated with the rose dye or the blue or red component forming the rose dye , either independently , or at the same time . the red dye component utilized is composed of the following : ______________________________________ colour indexdye colour index no . vol . 2 pg . no . ______________________________________88 . 0 % wt c . i . disperse red 137 2624eastman brilliantfast red 2b - glf6 . 6 % wt c . i . disperse red 88 2604eastman polyesterred b , 150 % 5 . 4 % wt c . i . disperse yellow 99 2525eastman polyesteryellow 6gt______________________________________ the red dye as described above is a typical example of an appropriate red dye . however , there are many other dyes that would be suitable , for instance , any of the disperse red dyes as outlined in the colour index would be suitable . the foregoing identification of the composition of the red component dye is a particular example of dye that is believed to provide the most suitable results but in fact any one of the long list of disperse red dyes would be useful . this red dye is mixed with water , and preferably distilled water , to form a bath having a composition in a range from , in the broadest aspects , 3 : 1 to 20 : 1 or more desirably 6 : 1 to 8 : 1 water to dye ratio with 6 : 1 being preferable . the bath is preferably at a temperature of about 190 °, but may range in temperature from 180 °- 200 ° f ., or more broadly 150 °- 210 ° f . the bath or dip dwell time for a sagged adc lens is about 15 seconds to a broader range of 2 - 150 seconds , or 10 - 25 seconds and in its broadest aspects about 1 second to 20 minutes . times within the ranges given are for the ca and cab or acetate lenses and for the adc or carbonate lens disclosed . the acetate lenses are found to be more easily impregnated and therefore lower dwell times are suitable while the carbonate lens is more difficult to impregnate and requires the longer times . for the blue component dye to be used with the red dye to form the rose dye or independently to block a portion of the yellow radiation emanating from the crt utilizing yellow phosphors it has been found that the typical blue dye that would be useful is any one of the polyester blue dyes produced by eastman kodak and , in fact , any one of the disperse blue dyes in the colour index would be suitable . a particular blue dye composition found to be useful in this invention is the following : ______________________________________ colour indexdye colour index no . vol . 2 pg . no . ______________________________________92 . 3 % wt eastman c . i . disperse blue 27 2675polyesterblue glf , 150 % 6 . 2 % wt eastman c . i . disperse blue 77 2691polyesterblue blf1 . 5 % wt eastman c . i . disperse yellow 88 2519polyester yellow6g - lsw______________________________________ it has been found that should the blue dye be combined with the red dye to form the rose dye the chronology of the application of the dye to the lens is not critical . the weight concentration of the dye in water is optimally 6 : 1 water to dye ratio but may be 6 : 1 to 8 : 1 and or broadly 3 : 1 to 20 : 1 water to dye . the bath is preferably heated to a temperature of about 190 °, but may range in temperature from 180 °- 200 ° f . or more broadly 150 °- 210 ° f . and the bath or dip dwell time for a sagged adc lens is about 15 seconds to a broader range of 2 - 150 seconds , or 10 - 15 seconds and in its broadest aspects about 1 second to 20 minutes . times within the ranges given for the acetate lenses and for the carbonate lens disclosed . the acetate lenses , as has previously been stated , are easier to impregnate . to impregnate the plastic lens body with the grey neutral density dye , the following grey neutral density dye is preferred : ______________________________________ colour indexdye colour index no . vol . 2 pg . no . ______________________________________79 . 5 % wt ekpolyester blackobl48 . 3 % ek polyester c . i . disperse blue 77 2691blue blf39 . 2 % novilene c . i . disperse violet 28 2649violet rl12 . 5 % ek dk . c . i . disperse orange 37 2549orange rl , 150 % 13 . 17 wt ek c . i . disperse blue 77 2691polyester blueblf7 . 14 % wt ek c . i . disperse orange 37 2549polyester dk . orange rl , 150 %. 19 % wt ek c . i . disperse yellow 86 2518polyester yellow2r______________________________________ the grey neutral density dye as described above is a medium density grey dye and is a typical example of an appropriate grey neutral density dye . however there are many other dyes that would be suitable . for instance , any of the combination of disperse dyes that would be able to produce a black dye would be suitable . the particular identification of the composition of the grey neutral density dye as given above is merely a typical dye to achieve the medium density grey . the grey neutral density dye is mixed with water , and preferably distilled water , to form a bath having a composition in the range from , in its broadest aspects , 3 : 1 to 20 : 1 , or more desirably , 6 : 1 to 8 : 1 water to dye weight ratio with 6 : 1 being preferable . the bath is preferably a temperature of about 190 ° f ., but may range in temperature from 180 °- 200 ° f ., or more broadly 150 °- 210 ° f ., and the bath or dip dwell time for a sagged adc lens is about 15 seconds to a broader range of 2 to 150 seconds , or 10 to 25 seconds , and in its broadest aspects , about 1 second to 20 minutes . times within the ranges given are for the acetate lenses and for the carbonate lens disclosed . as previously stated the acetate lenses are found to be more easily impregnated with the grey neutral density dye . it is an optional feature of the present invention to include a flesh colored dye of the following composition : ______________________________________ colour indexdye colour index no . vol . 2 pg . no . ______________________________________35 . 7 % wt ek c . i . disperse red 137 2624brilliant fast red2b - glf33 . 8 % wt ek c . i . disperse blue 77 2691polyester blueblf30 . 5 % wt ek c . i . disperse yellow 99 2525polyester yellow6gt______________________________________ the flesh colored dye as described above is a typical example of an appropriate flesh colored dye . there are , however , many dyes that would be suitable . for instance , any of the combinations of disperse red , disperse blue and disperse yellow that would provide a flesh colored dye would be suitable . the flesh colored dye is preferably mixed with distilled water to form a bath having a composition in the range from , in its broadest aspects , 3 : 1 to 20 : 1 , or more desirably , 6 : 1 to 8 : 1 water to dye weight ratio with 6 : 1 being preferable . the bath is preferably a temperature of about 190 ° f ., but may range in temperature from 180 °- 200 ° f ., or more broadly , 150 °- 210 ° f ., and the bath or dip dwell time for a sagged adc lens is about 15 seconds to a broader range of 2 to 150 seconds , or 10 to 25 seconds , and in its broadest aspects , about 1 second to 20 minutes . times within the ranges given are for the acetate lenses and for the carbonate lens disclosed . it is an optional feature of the present invention that the lens so treated with the foregoing dyes may be subjected to a conventional vapor deposition of sio 2 or quartz . the antireflection coating on the lens is used to reduce both specular and diffuse reflections and is a desirable , but not critical , element of the present invention . the lens composed as described has the unique capability of being used with a video display terminal and a crt with either green or yellow character indicia without the observer experiencing the eye strain that would normally accompany viewing such screen whether the discomfort is due to visual noise related to glare , reflections or after images . when the observer dons a lens of the type described the ultraviolet radiation is blocked from at least 97 %- 100 % of the incident ultraviolet radiation but at least 85 % of the ultraviolet will be absorbed . the use of the colored filter that absorbs 10 %- 40 % of the visible light incident upon the lens which is in the 500 - 600 nm wavelength range reduces the visual noise by essentially eliminating the after images that would be formed due to green light derived from a green character indicia crt or yellow light emitted from a crt having yellow phosphors that produce yellow character indicia . both of these wavelengths can be absorbed in the amount of 10 %- 40 % through the use of a rose dye . however if either the green wavelength or the yellow wavelength is alone considered to be of concern then the colored filter may be limited to a red component or the green character indicia while a blue component of the dye would be sufficient to reduce the radiation from a yellow character indicia crt . use of both dyes simultaneously in the lens simply allows the lens to be used interchangeably with different crts . the lens having the grey density filter impregnated into the plastic body reduces the transmission of the white light incident upon the lens and thus passing to the eye by 20 %- 30 %. a flesh colored dye when added to the filter does provide the capability of toning the transmitted light to a more pleasing tone . however the use of a flesh colored dye is found to be optional . the total of the reductions of the visible light transmitted through the lens to the eye of the observer should be no more than 40 % and preferably between about 20 % and 40 %. due to the + 1 to + 8 diopter curvature of the lens and preferably a + 3 to + 5 diopter curvature , the lens is capable of diverting or deflecting stray radiation that would otherwise enter the eye . the entire lens is preferably coated with an antireflective coating of sio 2 or quartz to further minimize any specular or diffuse reflections entering the eye after incidence upon the lens . a specific example of the present invention is as follows : a lens blank that has been sagged or vacuum formed into the shape of a lens having approximately a + 4 diopter curvature is made from the plastic allyl diglycol carbonate . the lens is first impregnated with an ultraviolet absorber known under the trademark uvinul - d 50 which is a 2 , 2 &# 39 ;, 4 , 4 &# 39 ; tetrahydroxybenzophenone sold by basf . this benzophenone is formed into an aqueous bath having a ratio of about 6 : 1 distilled water to the benzophenone . the bath is heated to approximately 210 ° f . and the lens is dipped into the bath for a dwell time of about 90 seconds . it is removed and washed in distilled water and prepared for the next bath . a rose dye composed of a red dye with a composition of 88 . 0 % wt eastman brilliant fast red 2b - glf , 6 . 6 % wt eastman polyester red b , 150 %, 5 . 4 % wt eastman polyester yellow 6gt , and a blue dye of the following composition -- 92 . 3 % wt eastman polyester blue glf , 150 %, 6 . 2 % wt eastman polyester blue blf , 1 . 5 % wt eastman polyester yellow 6g - lsw -- are mixed together in an aqueous bath at a concentration of about 6 : 1 distilled water to dye . the bath is heated to about 190 ° f . and the lens is dipped into the bath for a dwell time of about 15 seconds and removed and rinsed with distilled water . the lens is then prepared for the dye treatment with the neutral density grey dye having the following composition : 79 . 5 % wt ek polyester black obl , 48 . 3 % ek polyester blue blf , 39 . 2 % novilene violet rl , 12 . 5 % ek dk . orange rl , 150 %, 13 . 17 % wt ek polyester blue blf , 7 . 14 % wt ek polyester dk . orange rl , 150 %, 0 . 19 % wt ek polyester yellow 2r . the dye bath is prepared at a concentration of 6 : 1 by weight distilled water to dye and then the bath is heated to a temperature of about 190 ° f . the lens is permitted to be dipped into the bath so prepared for a dwell time of approximately 15 seconds and removed and rinsed with distilled water . an optional flesh colored dye of the following composition is then used to treat the lens . 35 . 7 % wt ek brilliant fast red 2b - glf , 33 . 8 % wt ek polyester blue blf , 30 . 5 % wt ek polyester yellow 6gt . the dye is prepared at the same 6 : 1 distilled water to dye weight ratio and the bath heated to 190 ° f . and the lens dipped into the bath for a dwell time of about 15 seconds . the lens is removed and rinsed and dried . thereafter , it is optional but found to be desirable the lens is subjected to a conventional vacuum deposition of sio 2 or quartz in order to provide an antireflective coating . the lens so treated is now able to be formed into either a conventional clip - on type lens or could be inserted into a common conventional eye glass frame for use by the viewer . | 6 |
turning to fig1 a , a lift fan 100 in one example comprises a plurality of fan blades 10 mounted in a housing 12 . in a preferred embodiment , housing 12 is made from magnesium or aircraft strength aluminum , although any suitable material could be used . housing 12 includes front mounts 14 which allow lift fan 100 to be mounted in an aircraft by means of clamps , not shown . rear mount 16 allows lift fan 100 to be attached to the aircraft using a pin ( not shown ) inserted along line 18 . although specific front and rear mounts have been shown , one of ordinary skill in the art would readily understand that alternative mounting arrangements could be used . housing 12 includes an inlet 20 for receiving high velocity air from an engine of the aircraft . in an embodiment , this air can be compressed air or bleed air . after air passes through the housing it is expelled through outlet 22 . air exiting outlet 22 can be directed either back to inlet 20 or expelled to ambient air . fan blades 10 are mounted to a center hub 24 , shown in more detail below . each fan blade 10 includes an curved support 26 ( shown in fig1 b ) close to but not at the outer end of fan blade 10 . an extension 28 of each fan blade 10 extends beyond curved support 26 as shown in more detail below . fig1 b shows an enlarged view of a portion of lift fan 100 of fig1 a . fan blade 10 includes curved support sections 26 which interconnect to form an annular ring within housing 12 . extension 28 of fan blade 10 is located in housing 12 such that air from inlet 20 pushes against extension 28 so as to cause lift fan 100 to rotate . fig2 a shows a top view of housing 12 . similarly to fig1 a , housing 12 includes inlet 20 and outlet 22 , as well as front mounts 14 and rear mount 16 . in addition , fig2 a shows center cap paddock 40 which is attached to the outer portion of housing 14 by arms 42 . a cross section view of housing 12 along line a - a in fig2 a is shown in fig2 b . center cap paddock 40 includes a bolt hole 44 and pressed precision bearing 46 . center hub 24 ( fig3 c ) is bolted to the inner side of center cap paddock 40 next to spacer 52 . in an embodiment , spacer 52 is made of polytetrafluoroethylene but any similar material could be used . housing 12 features a channel 48 around it &# 39 ; s inner circumference into which blade tips 28 of fig1 b extend . electromagnet 50 is mounted in housing 12 to provide centering and braking of fan blade 10 . fig3 a shows a top view of a center hub 24 of fig1 a . mounting hole 54 will align with bolt hole 44 of fig2 b . fig3 b shows a bottom view of center hub 24 . a plurality of slots 62 receive fan blades 10 of fig1 a - 1b . fig3 c shows a cross sectional side view of center hub 24 . in an embodiment , bolt 66 extends through center cap paddock 40 ( fig2 b ), center hub 24 and plate 68 and is secured with nut 70 . alternative methods of securing center hub 24 and plate 68 to center cap paddock 40 could be used as understood by one of ordinary skill in the art . fig3 d shows a bottom view of plate 68 of fig3 c . fig4 shows a cross sectional top view of fan blade 10 of fig1 a - 1b . fan blade 10 is connected to curved support 26 and blade tip 28 . each end of curved support 26 ends in opposing tabs that interlock . each tab 80 cooperates with tab 82 of an adjoining fan blade 10 to form a complete ring when all the fan blades are installed . fan blade 10 is terminates in inner end 86 , which is inserted into slots 62 of center hub 24 as shown in fig3 b . magnetic material 84 cooperates with an electromagnet 52 of housing 12 ( shown in fig2 b and 5a ). although shown as a series of separate magnets , magnetic material 84 could also be made of a solid ring of magnetic material . fig5 a shows a cross sectional side view of the housing of fig1 a . housing 12 encloses an electromagnet 50 , which is separated from housing 12 by an spacing 90 . in an alternative embodiment , spacing 90 is an non - magnetic material such as rubber or polytetrafluoroethylene ( ptfe ). it is necessary to separate and also insulate fan blade 10 from the environment and its corrosive properties . blade tip 28 and curved support 26 ride inside electromagnet 50 . in operation electromagnet 50 is controlled through wiring 60 and cooperates with magnetic material 84 to provide braking of the lift fan . it also provides centering and stabilization of the fan in the housing 12 . the use of an electromagnet allows the polarity of the magnet to be changed . giving electromagnet 50 an opposite polarity as magnetic material 84 results in a braking operation . the same polarity provides stability . an alternative embodiment is shown in fig5 b . in this embodiment , the housing does not include an electromagnet . instead housing 12 includes material 92 , for example , ptfe . this ensures that fan blade 10 rides smoothly in housing 12 . fig6 a shows a side of fan blade 10 and blade tip 28 . fig6 b shows a sectional view of blade 10 along line b - b of fig6 a . arced support 26 ends in tabs 80 and 82 as shown in fig4 . blade 10 includes a curvature typical of fan blades . the exact curve of the fan blade would vary along its length as would be understood by one of ordinary skill in the art . if used and unless otherwise stated , the terms “ upper ,” “ lower ,” “ front ,” “ back ,” “ over ,” “ under ,” and similar such terms are not to be construed as limiting the invention to a particular orientation . instead , these terms are used only on a relative basis . an illustrative description of operation of the apparatus 100 is presented , for explanatory purposes . the steps or operations described herein are just for example . there may be many variations to these steps or operations without departing from the spirit of the invention . for instance , the steps may be performed in a differing order , or steps may be added , deleted , or modified . although example implementations of the invention have been depicted and described in detail herein , it will be apparent to those skilled in the relevant art that various modifications , additions , substitutions , and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the following claims . | 1 |
the invention is particularly well suited for implementation in a network environment , where reservation communications occur instantaneously . one possible implementation is depicted in fig1 . the reservation system 100 comprises an advance resource reservation system 110 communicating over a network 120 ( which can be the internet , a corporate intranet , etc .) with potential resource users 130 . resource users 130 are occasionally referred to herein as “ potential ” because at the time of submission of an advance reservation request , use of the resource attempting to be reserved has not occurred and is thus “ potential ”. the advance resource reservation system is coupled to the network 120 by a bi - directional network interface 112 allowing two - way communication between the advance resource reservation system and potential resource users 130 . the advance resource reservation system 110 further comprises at least one computer memory 114 and at least one computer processor 116 coupled to the at least one memory 114 and network interface 116 . the at least one memory 114 is operable to store one or more computer programs capable of performing methods operating in accordance with the present invention when executed by the computer processor 116 . an advantageous aspect of the present invention is that resource users 130 specify multiple ways in which a resource provider may satisfy their need for a resource . this aspect is advantageous because resource users 130 often are frustrated by the “ all or nothing ” advance resource reservation systems of the prior art . for example , a first resource user may require that a small percentage of her advance reservation request be met immediately ; but may be indifferent about whether the remaining portion is met now , or at a later time . a second resource user may be relatively indifferent about when a need for a resource is met , but may have varying needs for amounts of the resource . for example , the second resource user may absolutely require that 75 % of his need for a resource be met , but may place less importance on whether the remaining 25 % is met . “ all or nothing ” advance reservation systems do not take into account these details and frequently misallocate resources . a typical misallocation occurs in systems where the second resource user described above is bidding for a resource . the second resource user places more value on the first 75 % of his need and is relatively indifferent about the remaining 25 %. thus , if a third resource user appears that would value the remaining 25 % of the resource more highly than the second resource user , the remaining 25 % should be allocated to the third resource user . if the advance resource reservation system is an “ all or nothing ” system , and the second resource user &# 39 ; s bid is higher than the third resource user &# 39 ; s bid , this fact will be ignored and a misallocation will occur . in methods and apparatus of the present invention , this limitation of the prior art is overcome by providing potential resource users with the opportunity to specify their advance reservation requests with higher granularity . advance reservation requests that may be submitted in embodiments of the present invention are depicted in fig2 . the advance reservation requests 210 , 220 are presented by potential resource users seeking resource reservations in embodiments of the invention . as is apparent , the advance reservation requests 210 , 220 specify various reservation fulfillment requirements such as , for example , a resource type sought ( in the case , a cpu ); a resource amount sought ; the operating system used ; resource delivery initiation ; and resource delivery duration . as is also apparent in each of the advance reservation requests 210 , 220 depicted in fig2 at least one of the reservation fulfillment requirements is specified in terms of multiple options indicating various ways the needs of the potential resource user may be fulfilled by the resource provider . further , each of the multiple options has an associated business value assigned by the potential resource user . for example , advance reservation request 210 specifies multiple options with respect to the reservation fulfillment requirement corresponding to the start time of resource delivery . each of the multiple options has an associated business value assigned by the potential resource user that issued the advance reservation request 210 . likewise , advance reservation request 220 also specifies a reservation fulfillment requirement in terms of multiple options . in the case of advance reservation request 220 , a business value is assigned to each of a combination of reservation fulfillment requirements . for example , advance reservation request 220 assigns a business value of 5 to a resource fulfillment requirement option comprised of a resource amount of 5 ; duration of resource use of 2 hours ; and a start time of before 7 pm . steps performed in methods operating in accordance with the present invention are conceptually depicted in fig3 . a resource provider 300 has six available central processing units (“ cpus ”). suppose resource user 1 has two acceptable resource choices as shown by reference character 310 — five cpus with a business value equal to seven or four cpus with a business value equal to five . the resource manager calculates that a net business value of 8 could be achieved if one cpu is removed from resource user 1 and allocated to resource user 2 instead . resource user 1 is accordingly adjusted to its second choice of four cpus ( business value equal to five ). the resulting total business value is eight ( five plus three ), which is greater than what was previously achieved , which was seven . this process occurs without a re - negotiation between the resource provider and the resource user , saving time and processing spent in costly negotiation cycles . moreover , resource wastage was avoided and the business value was increased by altering existing reservations . with fixed advances reservations , user 2 would not have been accommodated leading to one wasted cpu and lower total business value . fig4 illustrates the process of how an incoming advanced reservation request is mapped to resources . the resource manager first checks if the request can be accommodated . if not , at 400 , then it checks to see if existing reservations can be modified to accommodate the new request . for this step , it uses the resource alternatives provided by the other users , when the earlier requests were made . it also checks to see if the resulting business value obtained from the new configuration is greater than before . if a better configuration is not found , then the provider can suggest a list of alternative resources that can be accommodated , and the user can start another negotiation process based on this suggested list of alternatives 430 . this is called hint - or suggestion - driven negotiations . if a better configuration is found , the new request is accommodated at 410 , and at step 420 ( a ) the earlier requests are modified and the user is informed about the change or ( b ) the respective users are informed about their now invalid reservations and a new negotiation cycle between that user and the provider is started . in embodiments of the invention , flexible reservations are specified by the interaction of a resource user or “ job submitter ” with an agreement management service . in a preferred embodiment reservations are stored in the form of an xml document conforming to the ws - agreement specification , extended with an expression language . the core reservation specification process consists of the following main steps ( some of which are shown in fig5 ): preparation of the reservation ; transmittal of the desired reservation to the agreement management service ( step 510 ); evaluation of the reservation by the service ; transmittal of possible alternative reservations from the agreement manager service to the user ( step 540 ); re - submittal of modified request by the potential resource user ( step 550 ); storage of accepted reservations by the service ( step 560 ); transmittal of a confirmation from the agreement management service to the submitter ( step 570 ); and transmission of modification / cancellation notices to other resource users ( step 580 ). business value objective functions can be used to assist in the evaluation of the relative “ goodness ” or “ business value ” when allocating resources to jobs . for instance , business value might be expressed as a function of resource attribute capabilities modified by coefficient functions that provide a means to normalize between jobs . in a preferred embodiment , an expression language is provided that enables users to convey the functions they wish performed as part of the business value calculation associated with a job request or class of job requests . the core of the expression language is a set of arithmetic , relational , and conditional directives , conveyed as xml elements . the conditional directive & lt ; not & gt ; has a single operand which may be the result of prior expressions . it returns a value of 1 if the condition is true and a value of 0 if the condition is false . arithmetic and relational directives each have 2 operands . the operands may be a ) constants , b ) resource attribute values , or c ) results of prior expressions . relational directives will return a value of 1 if the relationship is true and a value if 0 if the relationship is false . resource attribute values are extracted at run time and reflect the current state of managed resource attribute instances , for example : available memory on computer system x . resource attribute values are referenced within expressions by an xml element as follows : & lt ; resourceattribute name =” rname / aname .”/& gt ; where rname is a well - known name for a resource and aname is a well - known name for the attribute of a resource . external document variables may be referenced by standard qualified naming conventions , i . e . establishing an association of a prefix with a namespace , such as : xmlns : jsdl = http :// www . ibm . com / scheduling / 2005 / 07 / abc and then referring to a document element , using an xpath - like notation . for example : “& lt ; abc : scheduling / priority & gt ;” refers to the value of the child element “ priority ” associated with current instance of an “ abc : scheduling ” element . if ( operatingsystem / osmajorversion = 5 & amp ;& amp ; operatingsystem / osminorversion = 2 ) then businessvalue = 2 ; else if ( operatingsystem / osmajorversion = 5 & amp ;& amp ; operatingsystem / osminorversion != 2 ) then businessvalue = 1 ; else if ( operatingsystem / osmajorversion != 5 & amp ;& amp ; operatingsystem / osminorversion == 2 ) then businessvalue = 1 ; else businessvalue = 0 ; an example of an expression xml instance embedded within a ws - agreement instance is provided in appendix b . the following steps are performed in the runtime component as depicted in fig6 . at step 610 , advance reservation requests are received into the reservation queue . then at step 620 , advance reservation requests that are candidates for a particular time slot are obtained . next at step 630 , available resources that meet the minimum job requirements are identified . then , at step 640 , the business value of potential resource allocations to jobs is evaluated . next , at step 650 , resource allocation directives are prepared based on the comparison of the relative realizable business value between all job and resource possibilities ( resource matching optimization ). then at step 660 backfilling is performed and shared use of resources is identified . next , at step 670 , the allocation is executed . finally , at step 680 starvation avoidance method is implemented . note that step 650 may be implemented using any of a variety of means , such as a genetic algorithms or heuristics . a particular algorithm may be selected by specifying dynamically loadable modules during system configuration . the resource matching problem is essentially a variation of a binary knapsack problem in which the set of candidate items is two dimensional , i . e . a number of alternative items ( job / resource pairs ) exist . as such , it is an “ np - complete ” problem , or in other words , to arrive at a truly optimal solution all variations must be explored . exploring every possible alternative does not scale well and so the preferred embodiment describes the use of a heuristic since this appears to be fairly efficient and reasonably effective . a scheduling domain may contain | r | resources , for which | j | jobs compete at any given time . a valuation expression e i is associated with each job j i . each job j i might execute on any of a number of qualified resources r ( r ⊂ r ). each job and qualified resource pair belongs to a set of allocation alternatives a where a ⊂{ j i ∩ r }. each allocation alternative a x is assigned a value , v = ƒ ( e i , a x ). an evaluated allocation alternative may be expressed as a i =( α =( r k ) k = 1 ,| a |, v a = e i ). the task is to find the selection of unique alternatives , ∃! a ( δ i = 1 if ∃! a x selected , 0 if not ) that meet the job requirements and attempt to meet the goal described below . the goal when allocating unique alternatives is to maximize ( or at least improve ) aggregate business value when allocating job alternatives to resources where the following constraints apply : ∑ r ∈ ( a s ) δ s ≤ 1 ∀ r , in a preferred implementation , job requests are associated with a job duration parameter . availability time slots are associated with resources and are tracked and managed by the resource manager . reservation constraints are mapped to time slots to determine the universe of requests to evaluate at any one point in time . the steps depicted in fig6 will now be described in greater detail . in a preferred embodiment , job reservation requests may be stored in a repository , keyed by earliest desired execution time and retrieved periodically by the runtime environment and added to a queue of outstanding requests . alternatively the agreement manager , or a surrogate , may post reservation requests to the runtime environment , and the runtime environment may subsequently add them to a queue of outstanding requests . on a periodic basis the runtime environment , or reservation management function , obtains outstanding reservation requests and adds them to an evaluation queue . a resource manager tracks the state of all resources that may be allocated across the entire system . in a preferred embodiment it keeps this state information in a database and keeps a subset of this information in a memory cache to speed access to commonly used information . resources have capabilities as well as capacities . a capability is a specific attribute such as “ operating system ”, “ processor ”, or “ memory ”. a capacity is a quantity of an attribute . not all attributes have quantities . an example of a capability is “ z - series 990 ”. another example of a capability is “ linux ”. an example of a capacity is “ amount of freephysicalmemory ”. when a job reservation request enters the runtime environment , the reservation manager asks the resource manager to find the set of resources that might meet the strict capabilities specified by the reservation request . an alternative a x is created for each valid job request / candidate resource pair . the business value expression associated with each a x ( obtained from the job request ) is evaluated in light of state of valid candidate resource state . job id : 1 , bv : 5 , resource name = cs1 resource : 1 job id : 1 , bv : 2 , resource name = cs5 resource : 5 job id : 2 , bv : 7 , resource name = cs1 resource : 1 job id : 2 , bv : 4 , resource name = cs3 resource : 3 job id : 3 , bv : 6 , resource name = cs2 resource : 2 job id : 3 , bv : 1 , resource name = cs4 resource : 4 job id : 4 , bv : 6 , resource name = cs3 resource : 3 job id : 4 , bv : 2 , resource name = cs5 resource : 5 job id : 5 , bv : 7 , resource name = cs2 resource : 2 job id : 5 , bv : 7 , resource name = cs3 resource : 3 job id : 5 , bv : 7 , resource name = cs4 resource : 4 alternatives a are sorted in descending order of value v , grouped by job id . job id : 2 , bv : 7 , resource name = cs1 resource : 1 job id : 2 , bv : 4 , resource name = cs3 resource : 3 job id : 2 , bv : 4 , resource name = cs3 resource : 3 job id : 5 , bv : 7 , resource name = cs2 resource : 2 job id : 5 , bv : 7 , resource name = cs3 resource : 3 job id : 5 , bv : 7 , resource name = cs4 resource : 4 job id : 3 , bv : 6 , resource name = cs2 resource : 2 job id : 3 , bv : 5 , resource name = cs3 resource : 3 job id : 3 , bv : 1 , resource name = cs4 resource : 4 job id : 4 , bv : 6 , resource name = cs3 resource : 3 job id : 4 , bv : 2 , resource name = cs5 resource : 5 job id : 1 , bv : 5 , resource name = cs1 resource : 1 job id : 1 , bv : 2 , resource name = cs5 resource : 5 then for each j the highest value a is selected where the resource r is unassigned and this a x is kept in a pre - allocation list pl . each lower value a associated with the current j is stored in an alternative list al . if an unassigned r cannot be found for a j x , all the unrealized alternatives for that job are stored in a “ bumped ” list bl . at the end of this step pl will contain a primitive greedy solution to the allocation problem , al will contain a list of the alternatives for each of the greedily allocated job requests and bl will contain a list of job requests that cannot obtain resources . then the overall business value that can be realized by allocating based on pl is stored : s1 ≡ σ i = 1 n plδ i v i . job id : 2 , bv : 7 , resource name = cs1 resource : 1 job id : 5 , bv : 7 , resource name = cs2 resource : 2 job id : 3 , bv : 5 , resource name = cs3 resource : 3 job id : 4 , bv : 2 , resource name = cs5 resource : 5 while i & lt ; size of ( bl ) and while not all j have been assigned resources the first pre - allocated item pl k in pl that uses the resource r required by bl i is found . next it is determined if there is an entry al x that is an alternative to the pl k entry . if there are no alternatives , and if bl i has a value greater than the pl k item , then pl k is copied into a list of removed jobs , remove pl k , and bl i inserted into pl . if there is an alternative al x and the sum of al x v + bl i v & gt ; pl k v then pl k is removed , bl i is copied into pl , al x is copied into bl , and al x is removed . once this loop is completed , sum the values of the items contained in the pl : job id : 2 , bv : 7 , resource name = cs1 resource : 1 job id : 4 , bv : 6 , resource name = cs3 resource : 3 job id : 3 , bv : 6 , resource name = cs2 resource : 2 job id : 5 , bv : 7 , resource name = cs4 resource : 4 job id : 1 , bv : 2 , resource name = cs5 resource : 5 the method chooses to allocate job / resource pairs from either pl from step 3 or plβ from step 2 , based on which list provides the greater value : allocation list = max ( s1 , s2 ). after the optimization heuristic makes its recommendations some job requests may remain unfulfilled . the alternatives for these residual job requests are sorted by business value . the residual alternatives are examined to determine whether they make use of either 1 ) unallocated fractions of resources , or 2 ) resources that have available “ whitespace ”, i . e . resources that have been allocated for future use but are currently available for some limited and known period . if the residual requests can either use the residual resource capacity or can fit into available “ whitespace ” then they may also be allocated . once an alternative for a job request is allocated any remaining alternatives derived from the same job request are purged from the list of residual alternatives . any job requests that still remain unfilled at the end of step 4 are placed back into queue j so that they may be processed in a subsequent scheduling cycle . starvation avoidance is achieved by gradually incrementing the business value of job requests that were deferred and re - queued by previous iterations of the run - time steps . additional methods operating in accordance with the present invention will now be described with reference to fig7 - 9 . fig7 depicts a method that is generally applicable in an advance resource reservation system like that depicted in fig1 for managing allocation of a resource . at step 710 , the advance resource reservation system receives requests for a resource submitted by a plurality of potential resource users , wherein each advance reservation request specifies at least one reservation fulfillment requirement that comprises multiple options indicating various ways in which a resource provider may meet the needs of a particular potential resource user issuing the advance reservation request , and where a business value is assigned to each of the multiple options . next , at step 720 , the advance resource reservation system analyzes each advance reservation request to determine if a reservation can be granted for at least one of the multiple reservation fulfillment requirement options . in various embodiments of the invention , the business values may be assigned to the reservation fulfillment requirement options by the potential resource users or by the resource provider . for example , the business values assigned to each of the multiple reservation fulfillment requirement options may be selected by a potential resource user prior to a time when an advance reservation request containing the multiple reservation fulfillment requirement options is submitted to the advance resource reservation system . alternatively , the business value assigned to each of the multiple reservation fulfillment requirement options may be selected by the resource provider after an advance reservation request containing the multiple reservation fulfillment requirement options is received by the resource provider . this may be done by the resource provider in accordance with a business value schedule already agreed to by the potential resource user in order to reduce the size of the communication necessary to request a reservation . it may also be done when the business values are dependent on variables known better to the resource provider . further , the reservation fulfillment requirement comprised of multiple options may correspond to two or more discrete options or to a continuous range wherein any value within the range corresponds to a distinct option . in addition , different business values can be assigned to each discrete option in the first case , or to portions of the range in the second case . in the second case , business values can be related to portions of the range by a mathematical equation or other formalism . additional steps may be performed under the aegis of analyzing each advance reservation request to determine if a reservation can be granted for at least one of the multiple reservation fulfillment requirement options . for example , in one step , it may be determined for a particular advance reservation request that a reservation will not be granted for any of the multiple reservation fulfillment requirement options ; and in another step a particular potential resource user that issued the particular advance reservation request will be informed that none of the multiple reservation fulfillment requirement options will result in a reservation . in another example , in one step it may determined for a particular advance reservation request that a reservation will be granted for at least one of the multiple reservation fulfillment requirement options ; and in another step a particular potential resource user that issued the particular advance reservation request will be informed that a reservation will be granted for at least one of the multiple reservation fulfillment requirement options . in another variant of the method depicted in fig7 , the advance reservation request received from a particular potential resource user may specify a time by which the particular potential resource user requires an indication whether the particular potential resource user will receive a resource reservation . in situations where it is determined that a particular potential resource user who has specified a time by which a reservation decision is needed will be granted a reservation , an additional step of issuing a reservation to the particular potential resource user is performed . the reservation is issued at or before the time specified in the advance reservation request . in further variants of the method depicted in fig7 , analyzing each advance reservation request to determine if a reservation can be granted for at least one of the multiple reservation fulfillment requirement options is performed starting with a pre - allocation step as depicted in fig8 . “ pre - allocation ” means setting aside a portion or more of the resource available for use at a later time by one of the potential resource users submitting advance reservation requests . it does not mean actually providing the resource to the potential resource user at the time of the pre - allocation . dependence on the desired resource delivery times specified in the advance reservation requests . the pre - allocation may be done at a time that would accommodate a just - in - time delivery criterion . in the method depicted in fig8 , many criteria may be adopted for pre - allocating the resource among the plurality of potential resource users on the basis of business values specified with respect to particular reservation fulfillment requirement options . one such criterion would maximize collective business values across a population of potential resource users in the resource pre - allocation . additional steps to formalize the granting of a reservation may be performed at or after step 830 . for example , a reservation may be issued as soon as the resource pre - allocation is completed . alternatively , the reservation may be withheld until a time specified by the potential resource user . regarding the details of the reservation , the reservation may be granted for one or more of the reservation fulfillment requirement options specified in an advance reservation request , and may further specify the time when the resource will be provided to a particular potential resource user . for further allocation operations , a reservation or reservation component will be assigned the business value associated with the reservation fulfillment requirement option that resulted in the granting of the reservation or reservation component . in embodiments of the invention concerned with activities after a reservation has been granted , the decision to grant the reservation may be revisited to ensure that the resource continues to be provided to resource users who assign the highest business value to the resource . steps accomplishing this advantageous aspect of the invention are depicted in fig9 . at step 910 , the advance resource reservation system continues to receive advance reservation requests after the resource pre - allocation . then at step 920 , at or prior to the time when the resource will be provided to the particular potential resource user holding the reservation , business values associated with reservation fulfillment requirement options specified in advance reservation requests received after the resource pre - allocation are examined . next , at step 930 , it is determined whether any of the advance reservation requests received after the resource pre - allocation specify a reservation fulfillment requirement option having a higher business value than that associated with the reservation held by a particular potential resource user . if so , at step 940 , the resource is re - allocated in accordance with the higher business value specified in the advance reservation request received after the resource pre - allocation . re - allocating the resource in step 940 results in a resource re - allocation . as a result of the resource re - allocation additional steps may be performed . for example , the resource re - allocation may result in cancellation of the reservation held by a particular potential resource user . in such situations one step is performed to cancel the reservation held by the particular potential resource user ; and in another step the particular potential resource user is informed of the reservation cancellation . in other situations where a reservation has multiple components associated with multiple reservation fulfillment requirement options having differing associated business values , one or more of the components may be cancelled and one or more of the components may survive the re - allocation and hence remain as valid . this aspect of the present invention is particularly advantageous because it insures that whenever possible , an advance reservation request specifying a higher business value will be granted the resource over an advance reservation request ( which may have matured into a reservation ) specifying a lower business value . in further embodiments of the invention , the cancellation of a reservation may result in the performance of additional steps . in certain of these embodiments , the additional steps may trigger a penalty provision which is imposed on the resource provider canceling the reservation . in other embodiments , the cancellation of a reservation may trigger a new round of negotiations for a reservation . in such embodiments additional steps may be performed . one step would comprise presenting the particular potential resource user whose reservation was cancelled with an opportunity to submit a new advance reservation request and another step would comprise providing the potential resource user whose reservation was cancelled with at least one suggested business value which , if adopted by the potential resource user in a new advance reservation request , would result in the issuance of a new reservation to the particular potential resource user . following these steps , further steps would be performed . one further step would comprise receiving from the potential resource user whose reservation was cancelled a new advance reservation request , wherein the new advance reservation request specifies at least one reservation fulfillment requirement option having a new business value that is at least as great as the suggested business value ; another step would comprise analyzing the new advance reservation request to identify the new business value ; and yet another step would comprise re - allocating the resource among the plurality of potential resource users on the basis of business values specified by each of the plurality of potential resource users with respect to particular reservation fulfillment options , including the new business value specified by the particular potential resource user whose reservation was cancelled , wherein the re - allocation results in a new resource re - allocation . in another step a reservation would be issued to the particular potential resource user whose reservation was cancelled . in situations following the steps described with respect to fig7 where a particular potential resource user is informed that none of the reservation fulfillment requirement options specified in an advance reservation request submitted by the particular potential resource user will result in a reservation , similar hint - driven steps may be performed . in one such step , the potential resource user who submitted an advance reservation request containing multiple reservation fulfillment requirement options , wherein it was determined that none of the multiple reservation fulfillment requirement options would result in a reservation , would be presented with an opportunity to submit a new advance reservation request ; and in another step during the opportunity to submit a new advance reservation request , the potential resource user would be provided with at least one suggested business value which , if adopted by the potential resource user in a new advance reservation request , would result in the issuance of reservation . another advantageous aspect of the invention accommodates mandatory reservations . in certain situations , a resource user and a resource provider may desire to operate in a system that both honors a certain number of mandatory reservations and allocates remaining reservations on the basis of maximizing business values among a population of resource users . this method is a variant of the method depicted in fig8 and operates in the following manner when it is known that an advance reservation request specifies a mandatory reservation fulfillment requirement that must be met by a resource provider . prior to step 810 of pre - allocating the resource , the advance resource reservation system identifies the particular advance reservation request specifying a mandatory reservation fulfillment requirement and the particular potential resource user who presented the advance reservation request containing the mandatory reservation fulfillment requirement . then , the advance resource reservation system performs another step prior to step 810 , wherein a portion of the resource corresponding to the amount specified in the mandatory reservation fulfillment requirement is allocated to the particular potential resource user who presented the advance reservation request containing the mandatory reservation fulfillment requirement . then step 810 is performed wherein the resource remaining is pre - allocated with a view to maximizing collective business value across a population of resource users . another advantage of the present invention is that a starvation avoidance allocation method can be implemented to make sure that at least some of the resource is allocated to those potential resource users who habitually specify lower business values in their advance reservation requests . the starvation avoidance allocation method would be implemented after multiple resource pre - allocation and resource provision cycles where the resource is actually provided to potential resource users . in a first step of the starvation avoidance method , potential resource users who over a course of a plurality of resource pre - allocation and resource provision cycles have been provided less than a pre - determined minimum amount of the resource would be identified . then in a next step , during at least one following resource pre - allocation and resource provision cycle , a portion of the resource available for pre - allocation would be set aside for those potential resource users who over a course of a plurality of resource pre - allocation and resource provision cycles have been provided less than a pre - determined minimum amount of the resource . then , in a further step the portion of the resource available to those potential resource users who have been provided less than a pre - determined minimum amount of the resource would be pre - allocated on the basis of business values specified by each of the plurality of potential resource users in their advance reservation requests with respect to particular reservation fulfillment requirement options , wherein the pre - allocation results in a starvation avoidance resource pre - allocation . next , binding resource reservations would be issued to those potential resource users accommodated under the starvation avoidance resource pre - allocation . one of ordinary skill in the art will understand that the methods depicted and described herein can be embodied in a tangible machine - readable memory medium . a computer program fixed in a machine readable memory medium and embodying a method or methods of the present invention perform steps of the method or methods when executed by a digital processing apparatus coupled to the machine - readable memory medium . tangible machine - readable memory media include , but are not limited to , hard drives , cd - or dvd - rom , flash memory storage devices or in a ram memory of a computer system . thus it is seen that the foregoing description has provided by way of exemplary and non - limiting examples a gull and informative description of the best method and apparatus presently contemplated by the inventors for implementing a multi - user advance reservation system where reservations are specified in terms of multiple options , and where each option has an associated business value . one skilled in the art will appreciate that the various embodiments described herein can be practiced individually ; in combination with one or more other embodiments described herein ; or in combination with advance reservation systems differing from those described herein . further , one skilled in the art will appreciate that the present invention can be practiced by other than the described embodiments ; that these described embodiments are presented for the purposes of illustration and not of limitation ; and that the present invention is therefore limited only by the claims which follow . pseudo - code : bv = (( freememory / 1 million ) * 80 ) + 8 ) | 6 |
fig2 ( a )- 2 ( e ) are schematic drawings showing each of the manufacturing steps of a leadless package structure in accordance with an embodiment of the present invention . first , a metal sheet 11 covered by an adhesive tape 12 is provided , wherein the metal sheet 11 can be made of copper , aluminum , cu — al alloy , aluminum alloy or a combination of the above materials . as shown in fig2 ( b ), by a stamping process , a plurality of concaves 132 are formed on the upper surface of the metal sheet 11 , and therefore a plurality of convexes 131 are formed on the lower surface between the metal sheet 11 and the adhesive tape 12 . by a photolithography process , the metal sheet 11 is turned into a plurality of connected die pads 14 and a plurality of separated pins 13 , wherein the pins 13 are formed in the plurality of openings 141 of the die pad 14 , as shown in fig2 ( c ). and the combination of one of the die pads 14 and its surrounding pins 13 is considered as a package unit 181 of the leadframe 18 . as shown in fig2 ( d ), each die 15 is further mounted on the die fixing area 142 ( as shown in fig3 ) at the center of each die pad 14 . a plurality of lead wires 17 connect each die 15 to the pins 13 surrounding it by wire bonding . preferably , the lead wires 17 are connected to the portions of the s pins 13 excluding the concave parts 132 . to protect the die 15 and the lead wires 17 from external forces and the environmental influence , each die 15 , each package unit 181 and the plurality of lead wires 17 are covered with a molding material 16 , as shown in fig2 ( d ). after the molding material 16 hardens , the adhesive tape 12 can be removed , and the leadless package unit 20 is cut along the edges of the package units 181 by a dicing process so that the package units 181 are separated from each other , as shown in fig2 ( e ). fig3 shows the top view of a leadless package unit in accordance with the present invention . the die 15 is mounted on the die fixing area 142 in the center of the die pad 14 , and the plurality of leads 17 are placed on the plurality of openings 141 surrounding the die pad 14 . unlike the qfn package 80 in fig1 , the die pad 14 of the present invention extends to the four edges of the leadless package unit 20 . except the openings 141 , the whole area of the die pad 14 can dissipate heat . besides , since the area of the die pad 811 of the conventional qfn package 80 is approximately the same as that of the die fixing area 142 in fig3 , the heat dissipation efficiency of these two packages are remarkably different due to the different sizes of the areas of the die pads 14 . furthermore , the four sides of each pin 13 of the present invention are fixed and protected by the molding material 16 , so the package is not easily damaged by external forces . fig4 shows the top view of a lead frame employed by a leadless package in accordance with the present invention . to meet the requirements of mass production , the plurality of package units 181 of the lead frame 18 can be arranged in m rows by n columns matrix . for example , the package units 181 in fig4 are arranged in two rows by n columns matrix . instead of such arrangement , there can also be more rows to increase the unit per hour ( uph ) of the molding process . the convex parts 131 of pins 13 on the leadless package unit 20 increase the area in contact with the solders , and therefore enhance the solderability of the leadless package unit 20 in the surface mounting process . the concave parts 132 of pins 13 increase the area in contact with the molding material 16 , and therefore reduce the probability of the molding material getting delaminated from the pins 13 , which in turn improves the manufacturing yield . as shown in fig5 ( a ), a plurality of concave parts 132 ′ are first formed on one surface of the metal sheet 11 , and accordingly a plurality of convex parts 131 ′ are formed on the other surface of the metal sheet 11 . afterward , the plurality of concave parts 132 ′ and the adhesive tape are adhered together , as shown in fig5 ( b ). then , the same steps in fig2 ( c ) to 2 ( e ) are implemented to complete most of the manufacturing processes . preferably , the lead wires 17 are connected to the parts of the pins 13 excluding the concave parts 132 . finally , the leadless package unit 20 ′ is cut along edges of the package units 181 by a dicing process so that the package units 181 are separated from each other , as shown in fig5 ( c ). the concave parts 132 ′ of pins 13 of the leadless package unit 20 increase the area in contact with the solders , and therefore enhance the solderability of the leadless package unit 20 in the surface mounting process . the convex parts 131 ′ of pins 13 increase the area in contact with the molding material 16 , and therefore reduce the probability of the molding material getting delaminated from the pins 13 . the above - described embodiments of the present invention are intended to be illustrative only . numerous alternative embodiments may be devised by those skilled in the art without departing from the scope of the following claims . | 7 |
preferred embodiment of a servo adjustment method and an apparatus therefor according to the present invention will now be described with reference to the attached drawings . fig1 is a block diagram showing the configuration of a servo control unit for controlling servomotors which feed a table of nc machine tool , for carrying our the servo adjustment method according to the invention . the control unit adopts the semi - closed loop system . in fig1 reference numeral denotes a servomotor for driving a feed shaft 11 assigned to the x - axis , and reference numeral 12 denotes servomotor for driving a feed shaft 13 assigned to the y - axis . the servomotors 10 , 12 for the y - axis and the y - axis for respectively feeding a table 14 and a saddle 15 are controlled in a two - axis control mode simultaneously , to drive the table 14 for a circular interpolation feed motion . an analyzing unit 16 converts nc program p into command data . then a distributing unit 17 gives a position instruction signal corresponding to a specified radius r of a circular arc and a feed speed f to a motor control circuit 18 for controlling the x - axis servomotor 10 and a motor control circuit 20 for controlling the y - axis servomotor 12 respectively . the servomotors 10 , 12 , are provided with position transducers 21 , 22 each comprised of a encoder . position feedback signals provided by these position transducers 21 , 22 , are respectively compared with x - axis position instruction signal and y - axis position instruction signal . further , the motor control circuits 18 , 20 control the servomotors 10 , 12 so as to follow the instructed position . outputs from the position transducers 21 , 22 are synthesized by a biaxial signal synthesizer 24 , and its output is delivered to a display unit 26 comprised of crt , etc . accordingly , the display 26 displays a locus of angular positions of the servomotors 10 , 12 , which can be free from the actual influence of an power transmission mechanism , a driving mechanism and the mass of a workpiece . the composite signal provided by the biaxial signal synthesizer 24 is introduced also to servomechanism adjusting units 28 and 29 . the servomechanism adjusting units 28 and 29 use the functions of a processor included in a nc unit , and execute a procedure expressed by a flow chart shown in fig4 to set automatically servo parameters , such as positionloop gain and speedloop gain , of a feedback control system to optimum values . fig2 is a block diagram showing the motor control circuit 18 of the x - axis of fig1 in more detailed manner . in this case , the motor control circuit 20 of the y - axis is similarly constituted ( not shown ). a position control loop such that the deviation between a position feedback signal from the position transducer 22 and a position instruction signal reduced to 0 is constituted as the outer loop . a loop of the inside thereof is a velocity control loop , and the position feedback signal is differentiated by a differentiator 31 so that it is converted into a velocity feed back signal . thereafter , the velocity feed back signal is compared with an output of a position control unit 32 . a integrator 34 as a compensating element is on the innermost of the velocity control loop . a output of the integrator 34 is added to a input signal for the velocity control unit 33 . an output of the velocity control unit 22 is amplified by an amplified by an amplifier 34 as a torque signal which is given to servomotor 10 . a servo control error evaluating unit 36 calculates the deviation from an instructed position on the basis of an actual position provided by the two - axis signal synthesizing unit 24 and a position instruction signal , and quantitatively evaluates the variation of the deviation as servo control error . an oscillation decision unit 39 decides whether or not the feedback control system is caused to oscillate on the basis of the servo control error provided by the servo control error evaluating unit 36 . a parameter setting unit 37 adjusts the set values of servo control parameters to appropriate values on the basis of a decision made by the oscillation decision unit 39 . in this embodiment , servo control parameters are positionloop gain , speedloop gain , the crossover frequency of an integration element and such . the servomechanism adjusting method will be described in detail in connection with a flow chart of a speedloop gain adjusting procedure shown in fig4 for adjusting speedloop gain as a servo control parameter . referring to fig4 an initialization process is executed in steps s10 to s14 . the speedloop gain is set to an initial value in step s10 . it is undesirable to set the speedloop gain to a large initial value because oscillation of the feedback control system may occur after the beginning of the procedure in a case where the initial value of the speedloop gain is excessively large . therefore , the initial value of the speedloop gain is relatively small . a nc program is executed to control the table 14 for a circular interpolation feed motion along a circular path of a predetermined radius r at a feed rate f in step s11 . the angular positions of the servomotors 10 and 12 are detected by the position transducers 21 and 22 during the circular interpolation feed motion , and the output signals of the position transducers 21 and 22 are synthesized by the two axis signal synthesizing unit 24 . in step s12 , based on the output signal of the two axis signal synthesizing unit 24 , a locus of the table 14 driven for the circular interpolation feed motion , is displayed on the display 26 , and the accuracy of the circular interpolation feed motion is measured . fig3 is an example of the locus of the table 14 driven for the circular interpolated motion . in fig3 εi ± x and εi ± y are quadrant protrusions that occur when the table 14 moves from one quadrant into an adjacent quadrant . these quadrant protrusions are omitted from error evaluation basis , and the rest of the deviations εi from instructed positions are used as basis for servo control error evaluation . as shown in fig5 ( a ), an actually measured wave of deviations εi includes a low - frequency component and a high - frequency component . since the low - frequency component does not contribute to the error evaluation , the low - frequency component is removed by filtering to obtain only the high frequency component as shown in fig5 ( b ). a servo control error is determined from the wave form of the high frequency component . the servo control error is evaluated by the servo control error evaluating unit 36 in step s13 . the servo control error evaluating unit 36 calculates the mean value of the absolute values of displacements because the displacement and amplitude of deviation i vary according to positions , and evaluates the mean value as a servo control error e0 in the initial state . a maximum displacement or a mean amplitude may be used as a servo control error . in step s14 , the oscillation decision unit 39 examines the feedback control system to check whether or not the oscillation occurs in the feedback control system . the oscillation decision unit 39 decides that the feedback control unit is oscillating if , for example , the servo control error e0 is greater than a predetermined reference value . if it is decided that the feedback control system is oscillating , the speedloop gain is initialized again . fig6 ( a ) shows a locus of the table 14 driven for the circular interpolated motion when the speedloop gain is initialized . the movement of the table 14 is stable but the response of the table 14 is not satisfactory and the table 14 deviates greatly from instructed positions when the speedloop gain is relatively low . in the case where the feedback control system is not oscillating , the parameter setting unit 37 increases the value of the speedloop gain in step s15 . the increased speedloop gain is determined , for example , by a square approximation method or by increasing the initial value of the speedloop gain by a predetermined increment of 5 or 10 . after the speedloop gain has been set to an increased set value , the circular interpolation feed motion is resumed under the initial conditions in step s16 . the locus of the movement is displayed on the display 26 , and the accuracy of the circular interpolated motion is measured in step s17 in the manner similar to the foregoing step s12 , and the servo control error ei is evaluated in step s18 . in step s19 , the servo control error ei is compared with the servo control error ei - 1 evaluated in the preceding control cycle using the uncorrected speedloop gain . if the servo control error ei is greater than a value obtained by multiplying the servo control error ei - 1 evaluated in the preceding control cycle by a coefficient , such as two , the oscillation decision unit 39 decides that the feedback control system is oscillating as shown in fig6 ( c ). the value of the coefficient is determined properly according to the characteristics of the control system . if the feedback control system is not oscillating ( if the response to the query in step s19 is negative ), steps s15 to s19 are repeated to further increase the speedloop gain . the deviation decreases as the value of the speedloop gain is increased and thereby the response characteristic is improved . if the speedloop gain is increased beyond an appropriate value , an oscillation as shown in fig6 ( c ) is generated . when it is decided in step s19 that the feedback control system is oscillating , the speedloop gain is set to the value set in the preceding control cycle executed before the oscillation occurred . then the feedback control system functions in an improved response characteristic to move the table 14 along a locus having the least deviation as shown in fig6 ( b ). although the speedloop gain setting procedure has been described , other parameters , such as the crossover frequency c of the speedloop gain , the positionloop gain , and the crossover frequency a of the integrator 34 , can be set to optimum values which improve servo rigidity by like procedures . since the feed speed of a practical machine tool varies in a certain range , several optimum values for the parameters may be determined for feed speeds in the range of a normal feed speed to a maximum feed speed , and the parameters may be set to the minimum values to secure the stable operation of the feedback control system . although the foregoing servomechanism adjusting method is of a semi closed loop control system , the servomechanism adjusting method may be of a hybrid control system or a full closed loop control system . although the invention has been described in its preferred embodiments with a certain degree of particularity , obviously many changes and variations are possible therein . it is therefore to be understood that the present invention may be practiced otherwise than as specifically described herein without departing from the scope and spirit thereof . | 6 |
throughout this description , the preferred embodiment and examples illustrated should be considered as exemplars , rather than as limitations on the present invention . as used herein , the term “ invention ,” “ device ,” “ present invention ,” or “ present device ” refers to any one of the embodiments of the invention described herein , and any equivalents . furthermore , reference to various feature ( s ) of the “ invention ,” “ device ,” “ present invention ,” or “ present device ” throughout this document does not mean that all claimed embodiments must include the referenced feature ( s ). it is also understood that when an element or feature is referred to as being “ on ” or “ adjacent ” to another element or feature , it can be directly on or adjacent the other element or feature or intervening elements or features may also be present . it is also understood that when an element is referred to as being “ connected ” or “ coupled ” to another element , it can be directly connected or coupled to the other element or intervening elements may be present . in contrast , when an element is referred to as being “ directly connected ” or “ directly coupled ” to another element , there are no intervening elements present . relative terms such as “ outer ”, “ above ”, “ lower ”, “ below ”, “ horizontal ,” “ vertical ” and similar terms , may be used herein to describe a relationship of one feature to another . it is understood that these terms are intended to encompass different orientations in addition to the orientation depicted in the figures . although the terms first , second , etc . may be used herein to describe various elements or components , these elements or components should not be limited by these terms . these terms are only used to distinguish one element or component from another element or component . thus , a first element or component discussed below could be termed a second element or component without departing from the teachings of the present invention . as used herein , the term “ and / or ” includes any and all combinations of one or more of the associated list items . the terminology used herein is for describing particular embodiments only and is not intended to be limiting of the invention . as used herein , the singular forms “ a ,” “ an ,” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ,” “ comprising ,” when used herein , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . embodiments of the invention are described herein with reference to different views and illustrations that are schematic illustrations of idealized embodiments of the invention . as such , variations from the shapes of the illustrations as a result , for example , of manufacturing techniques and / or tolerances are expected . embodiments of the invention should not be construed as limited to the particular shapes of the regions illustrated herein but are to include deviations in shapes that result , for example , from manufacturing . fig1 shows a closure device 100 comprising at least one connecting structure 102 ( one shown ). closure device 100 can further comprise one or more base structures , for example , a first base portion 104 and a second base portion 106 , as shown in fig1 . closure device 100 is shown configured with a container 108 ( in this case a bag ). the opening 110 of container 108 can be at least partially covered by connecting structure 102 and can be held shut by closure device 100 , as opening 110 is between a first portion 112 of connecting structure 102 and a second portion 114 of connecting structure 102 , such that container 108 is held closed . as shown in fig1 , the connecting structure 102 can be configured to connect said first base portion 104 and said second base portion 104 . each of first portion 112 and second portion 114 can be connected to container 108 in one or more of the following ways : 1 ) connected to different sides of container 108 , such that opening 110 is held at least partially shut ( for example opposing sides of container 108 as shown ); 2 ) directly connected to different sides of container 108 , such that opening 110 is held at least partially shut , for example , in embodiments where closure device 100 does not comprise a base structure ; 3 ) connected to one or more base structures , which are in turn connected to different sides of container 108 , such that opening 110 is held at least partially shut ; 4 ) connected to container 108 at different sides , such that first portion 112 and second portion 114 are held in place and / or connected to the sides of the container by one or more base structures , such that opening 110 is held at least partially shut ( for example , by being sandwiched between a base structure and a side of the container ); and / or 5 ) any connection configuration that is known in the art . closure device 100 , including connecting structure 102 and base structures 104 , 106 can be made from any suitable material that could provide enough support to allow closure device 100 to hold container 108 closed . some example materials include , but are not limited to : paper , resin , rubber , vinyl , polyurethane , poly vinyl chloride ( pvc ), polystyrene foam , polymers / copolymer substances , acrylic substances , plastic , leather , metal , glass , fiberglass , wood , cloth or a combination thereof . the closure device 100 can be formed by any suitable method known in the art , for example , paper folding , molding , injection molding , stamping and extrusion . if the material chosen for closure device 100 is sturdy enough and the connection to container 108 is freely removable without causing significant damage to container 108 and / or closure device 100 , then closure device 100 can be reusable . in some embodiments , closure device 100 comprises one or more materials that can be easily destroyed by intentional manual manipulation , for example , paper which one can rip or tear . in these embodiments , closure device 100 can transform a common conventional container , such as a bag , into a wrapped gift , wherein one can destroy a portion of connecting structure 102 to allow access to a gift contained within the container 108 . while connecting structure 102 and base structures 104 , 106 are shown in fig1 as being roughly linear / rectangular and trapezoidal respectively , it is understood that these features can comprise any known shape , including any regular or irregular polygon . further novel shapes , for example , in the gift bag embodiments are discussed further below in regard to fig4 . one or more portions of connecting structure 102 and / or one or more portions of base structures 104 , 106 can be connected to container 108 in a variety of ways by various connection element including , but not limited to : suction cups , hooks , gripping mechanisms , hook and loop connections ( such as velcro ®), male / female connections , adhesives , tapes and any connection configuration known in the art . fig2 shows one such example of one connection configuration . fig2 shows a closure device 200 , similar to closure device 100 , comprising a connecting structure 202 , a first base structure 204 and a second base structure 206 . both first base structure 204 and second base structure 206 are angled in fig2 , such that the sides that are to be facing the container to be closed are exposed to view . first and second base structures 204 , 206 are shown comprising first and second adhesive structures 208 , 210 respectively , which are configured to connect to a portion of a container that is to be closed . in the embodiment shown , adhesive structures 208 , 210 comprise separate adhesive pads connected to base structures 204 , 206 which are coated with an adhesive material , such that they can stick to a portion of a container , as discussed above with reference to fig1 . in some embodiments , a film 211 covers the adhesive surface of one or more of the adhesive structures 208 , 210 , which blocks access to the adhesive surface and can be removed by , for example , peeling the film off to expose the adhesive surface when closure device 200 is ready to use . closure device 200 can be manufactured and distributed as a single attached unit or in multiple parts as separate components , for example , as three separate parts ( e . g . a connecting structure , a first base structure and a second base structure ) or two separate parts ( e . g . a connecting structure connected to a first base structure and a separate second base structure , as shown in fig2 ). one advantage of manufacturing closure device 200 as multiple structures is that the length and looseness of connecting structure 202 can be more precisely controlled . for example , the effective length of the connecting structure 202 can be shortened when closure device 200 is used on a container . in some embodiments , the above - mentioned shortening of the effective length of connecting structure 202 can be accomplished by connecting first base structure 204 to one side of a container , wrapping a desired length of connecting structure 202 over the opening of the container , and then pinning a portion of connecting structure 202 to the opposing side of the container utilizing second base structure 206 . depending on how long or short one wants connecting structure 202 to effectively be , one can connect second base structure 206 to a variable portion of the length of connecting structure 202 on the side of a container opposing the side of the container to which first base structure 204 is connected . in some embodiments , one of more of base structures 204 , 206 can comprise a holding portion 212 , which can be used to better contain any excess length of connecting structure 202 . examples of such holding structures include small folds , recesses , handles or spools that can store excess length . in some embodiments , wherein connecting structure 202 is made of a flexible material , such as paper , the excess length can be easily handled by simply folding or bending connecting structure 202 prior to using base structure 206 to connect connecting structure 202 to the opposing side of the container . the above mentioned adjustable length feature is shown in more detail in fig3 , which shows a closure device 300 , similar to closure device 200 discussed in fig2 above . closure device 300 comprises a connecting structure 302 , a first base structure 304 and a second base structure 306 . like in fig2 , first base structure 304 and the connecting structure 302 are connected , while second base structure 306 is a separate structure . second base structure 306 pins connecting structure 302 to the side 308 of container 310 , which opposes the side 312 to which first base structure 304 is connected . the location along the length of connecting structure 302 , which second base structure 306 pins to opposing side 308 results in connecting structure 302 having a fairly long - length and slack state of looseness . this allows for a wider opening 314 for container 310 . this is useful if container 310 is larger or is containing a larger number of items within it . to adjust the length of connecting structure 302 such that the container 310 is more tightly closed and more closely resembles container 108 in fig1 , one would simply connect second base structure 306 to a higher point 316 on connecting structure 302 and pin connecting structure 302 to opposing side 308 at the higher point 316 . the additional length of connecting structure 302 that is below higher point 316 could be folded , bent , obscured by base structure 306 , or stored in a holding portion as discussed above . fig4 shows a closure device 400 , similar to the closure devices 100 , 200 , 300 already discussed herein with reference to fig1 - 3 . closure device 400 differs in that it comprises a first base structure 402 and a second base structure 404 , which comprise festive shapes . this is particularly useful in embodiments wherein closure device 400 is utilized as a gift bag . for example , the base structures 402 , 404 could be shaped like birthday cakes for a birthday gift bag , buckets of golf balls for a retirement party or sheriff &# 39 ; s badges for a policeman &# 39 ; s anniversary . any number of festive shapes can be implemented for any number of occasions . in some embodiments , the base structures 402 , 404 , which can include festive shapes , can hide or mask all or some of a portion of the container , for example , the side to which the base structure 402 , 404 is connected . in these embodiments , the overall look or appearance of a container , for example , a common brown bag , can be concealed to appear to be a gift bag , for example , by having the shape , size or dimensions of the base structures 420 , 404 match or otherwise correspond to the dimensions of the side of the bag to which the base structures 402 , 404 are connected . in this way , closure devices incorporating features of the present invention can simultaneously at least partially close a container and at least partially conceal a container &# 39 ; s appearance . in some embodiments , the base structures 402 , 404 are configured to conceal a substantial portion of the sides of the container to which they are connected . although the present invention has been described in detail with reference to certain preferred configurations thereof , other versions are possible . embodiments of the present invention can comprise any combination of compatible features shown in the various figures , and these embodiments should not be limited to those expressly illustrated and discussed . therefore , the spirit and scope of the invention should not be limited to the versions described above . the foregoing is intended to cover all modifications and alternative constructions falling within the spirit and scope of the invention . | 1 |
the description and operation of the invention will be best initiated with reference to fig1 and which illustrates a perspective view of the adjustable mount lighting fixture 11 of the present invention and illustrates a housing 13 of a rectangular shape and having a rear enclosure 15 ( shown with an under arrow ), a first side 17 , a second side 21 ( shown with a hooked arrow ) oppositely disposed from first side 17 , both first and second sides 17 and 21 generally perpendicular to and contiguous with rear enclosure 15 . housing 13 further has a first end 23 , and a second end 25 oppositely disposed from first end 23 , first and second ends 23 and 25 generally perpendicular to and contiguous with first and second sides 17 and 21 and rear enclosure 15 and forming a partially enclosed rectangle with a front opening 26 . the body members above may be formed from sheet metal by folding , welding , and the like . first side 17 of housing 13 has a first planar portion 27 extending from rear enclosure 15 to a first edge 31 of housing 13 , and a second planar portion 33 extending from first edge 31 of housing 13 in a direction perpendicular to first planar portion 27 and generally toward second side 21 and terminating adjacent front opening 26 . similarly , second side 21 of housing 13 has a first planar portion 37 extending from rear enclosure 15 to a second edge 41 of housing 13 , and a second planar portion 43 extending from second edge 41 of housing 13 in a direction perpendicular to first planar portion 37 and generally toward first side 17 and terminating adjacent front opening 26 . first end 23 of housing 13 has a first planar portion 47 ( shown with a hooking lead line ) extending from rear enclosure 15 to a third edge 51 of housing 13 , and a second planar portion 53 extending from third edge 51 of housing 13 in a direction perpendicular to first planar portion 47 and generally toward second end 25 , and having an aperture 57 therethrough . second planar portion 53 terminates adjacent front opening 26 . similarly , second end 25 of housing 13 has a first planar portion 61 extending from rear enclosure 15 to a fourth edge 63 of housing 13 , and a second planar portion 65 extending from fourth edge 63 of housing 13 in a direction perpendicular to first planar portion 61 and generally toward first end 23 , and having an aperture 71 therethrough . second planar portion 65 terminates adjacent front opening 26 . first planar portion 27 of first side 17 has a first slot 81 therethrough situated near first end 23 of housing 13 , and a second slot 83 therethrough situated near the second end 25 of housing 13 . both first and second slots 81 and 83 extend between rear enclosure 15 and front opening 26 in a direction normal to the plane containing the rear enclosure 15 and to the plane of the front opening 26 . first slot 81 of first side 17 is shown adjacent a first adjustable bracket 85 , and second slot 83 of first side 17 is shown adjacent a second adjustable bracket 87 . first and second adjustable brackets 85 and 87 are illustrated as attached to housing 13 at slots 81 and 83 of first side 17 with bolts 89 and nuts ( not yet illustrated ). slots 81 are preferably about one to two inches long and extend to about a half an inch from the front face of the fixture 11 . each of first and second adjustable brackets 85 and 87 has a first planar portion 91 with a pair of apertures 93 therethrough , and a second planar portion 95 with a pair of elongate apertures 97 therethrough , and which together form an edge 99 therebetween first and second planar portions 91 and 95 such that first and second planar portions 91 and 95 are perpendicular to with respect to one another . each of first planar portions 91 of adjustable brackets 85 and 87 is situated adjacent first and second slots 81 and 83 , respectively , of first side 17 of housing 13 and parallel to the plane occupied by first side 17 of housing 13 with edge 99 perpendicular to and projected forward of corresponding slot 81 or 83 . first planar portion 91 extends away from edge 99 toward rear enclosure 15 in a direction parallel with first side 17 , and second planar portion 95 extends away from edge 99 and perpendicularly away from first side 17 of housing 13 . similarly , the first planar portion 37 of the second side 21 has a first slot 101 ( not illustrated in fig1 ) therethrough situated near first end 23 of housing 13 , and a second slot 103 ( not illustrated in fig1 ) therethrough situated near the second end 25 of housing 13 . both first and second slots 101 and 103 extend between rear enclosure 15 and front opening 26 in a direction normal to that plane containing the rear enclosure 15 and to the plane of the front opening 26 . first slot 101 of second side 21 is shown adjacent a third adjustable bracket 105 , and second slot 103 of second side 21 is shown adjacent a fourth adjustable bracket 107 . first and second adjustable brackets 105 and 107 are illustrated as attached to housing 13 at slots 101 and 103 of second side 21 with bolts 89 and nuts ( not yet illustrated ). each of third and fourth adjustable brackets 105 and 107 has a physical configuration identical to that described for first and second adjustable brackets 85 and 87 , and are situated with respect to corresponding slots 101 and 103 of the second side 21 of housing 13 exactly as adjustable brackets 85 and 87 have been described as being situated with respect to slots 81 and 83 . bolts 89 extend through the pairs of apertures 93 of each of adjustable brackets 85 , 87 , 105 , 107 , and simultaneously gag through each of the corresponding slots 81 , 83 , 101 and 103 , before interconnecting with their respective nuts . this configuration allows translation of the bolts 89 within the slots 81 , 83 , 101 , and 103 and consequently for selective positioning of the adjustable brackets 85 , 87 , 105 , 107 with respect to the housing 13 to achieve a target position of the housing 13 with respect to an anchoring structure ( not yet illustrated ) and thus the overall position of the adjustable mount lighting fixture 11 with respect to surrounding structures . illustrated in phantom in fig1 is a pair of fluorescent light tubes 111 located just within the front opening 26 of the housing 13 and shown supported at their ends with supports , and shown as they would be if the adjustable mount lighting fixture 11 was fully operational . in lieu of tubes 111 , a series of bulbs can be used . also illustrated in fig1 as exploded away from the housing 13 of the adjustable mount lighting fixture 11 is a face plate 113 and screws 114 for attaching face plate 113 to housing 13 for enclosing the front opening 26 of housing 13 . face plate 113 has an interior surface 115 directed toward the housing 13 , and an exterior surface 117 directed away from the housing 13 . the face plate 113 may be made of acrylic in a variety of patterns and textures , or may be constructed of glass or other similar medium through which light may be at least partially transmitted . the face plate 113 has a first aperture 121 and a second aperture 123 through which screws 114 may be inserted and subsequently threaded into apertures 57 and 71 , respectively , of the second planar portions 53 and 65 of each of first and second ends 23 and 25 of the housing 13 for securing the face plate 113 to the housing 13 . finally , fig1 illustrates sections of a mirror or wall 125 on either side of the adjustable mount lighting fixture 11 having an exterior surface 127 that faces in the same direction as the exterior surface 117 of the face plate 113 . note that the dashed lines shown as bisecting the housing 13 , the pair of fluorescent light tubes 111 , and the face plate 113 in fig1 illustrate that the adjustable mount lighting fixture 11 may vary in height . additionally , the mirror or wall 125 is illustrated as fragmented in order to convey that it may also be of any height . fig2 illustrates a section of the first side 17 of housing 13 of fig1 as broken away and includes first slot 81 therethrough first side 17 of housing 13 and first adjustable bracket 85 adjacent and attached to housing 13 through first slot 81 . fig2 illustrates first and second planar portions 91 and 95 of adjustable bracket 85 , both features of which , it should be noted , are common to all adjustable brackets 85 , 87 , 105 , and 107 . the overall shape of the pair of elongate apertures 97 of the second planar portion 95 of adjustable bracket 85 is also more easily realized with reference to fig2 . further illustrated in fig2 is a pair of bolts 89 extending through the pair of apertures 93 of the first planar portion 91 of the adjustable bracket 85 , through first slot 81 of first side 17 , and interconnected with a pair of nuts 133 . note that although this configuration is described with respect to a single slot 81 and corresponding adjustable bracket 85 , the described configuration applies to each of the four slots 81 , 83 , 101 , 103 and their corresponding adjustable brackets 85 , 87 , 105 , and 107 . when the nuts 133 are loosened , the bolts 89 become moveable within and translatable along slot 81 , and thus the adjustable bracket 85 becomes slidable and fixable in a variety of positions along slot 81 . all adjustable brackets 85 , 87 , 105 , and 107 , may be positioned so that once the housing 13 is fastened to an anchoring structure ( not illustrated in fig2 ), a flush fit or other such customized fit of the face plate 113 of the adjustable mount lighting fixture 11 with respect to the adjacent wall or mirror 125 may be achieved . the position may be further adjusted with respect to the additional dimension present by attaching the face plate 113 to the housing 13 . once the adjustable bracket 85 has been positioned as necessary to achieve the desired fit , nuts 133 may be tightened in order to fixably secure the adjustable bracket 85 to the housing 13 . another customized fit of the adjustable mount lighting fixture 11 may be achieved by positioning the adjustable brackets 85 , 87 , 105 , and 107 so that the exterior surface 117 of the face plate 113 projects just forward of , but still parallel with , the plane of the exterior surface 127 of the adjacent mirror or wall 125 when the face plate 113 is attached to the housing 13 . likewise , the adjustable brackets 85 , 87 , 105 , and 107 may be positioned so that the exterior surface 117 of the face plate 113 is recessed with respect to the exterior surface 127 of the adjacent mirror or wall 125 . the ability to selectively locate the adjustable brackets 85 , 87 , 105 , and 107 with respect to the housing 13 allows a user a choice of customized applications with regard to the fit of the exterior surface 117 of the face plate 113 with respect to the exterior surface 127 of the adjacent mirror or wall 125 . the pair of elongate apertures 97 on the second planar portion 95 of each of adjustable brackets 85 , 87 , 105 , and 107 also allow for lateral adjustment of the housing 13 prior to fastening the housing 13 to an anchoring structure . fig3 is a view of the adjustable mount lighting fixture 11 as in fig1 with the face plate 113 attached to housing 13 with screws 114 and with exterior surface 117 of the face plate 113 exposed . also illustrated in fig3 are the two adjustable brackets 85 and 87 adjacent first side 17 of housing 13 , and the two adjustable brackets 105 and 107 adjacent second side 21 of housing 13 . the pairs of elongate apertures 97 , second planar portions 95 , and edges 99 of all adjustable brackets 85 , 87 , 105 , and 107 , can be seen in fig3 . furthermore , the first planar portions 91 of adjustable brackets 85 and 87 are also visible . first and second ends 23 and 25 of the housing 13 are also included in fig3 . as in fig1 the dashed lines of fig3 indicate that the adjustable mount lighting fixture 11 may be of any height . fig4 is a side view of the adjustable mount lighting fixture 11 , the view of the opposite side of the adjustable mount lighting fixture 11 being identical . fig4 illustrates the first side 17 of housing 13 with face plate 113 attached to housing 13 and adjustable brackets 85 and 87 attached to first planar portion 27 of first side 17 of the housing 13 with bolts 89 . first and second planar portions 91 and 95 of each of adjustable brackets 85 and 87 may also be seen in fig4 . fig5 is an end view of the adjustable mount lighting fixture 11 , the view of opposite end of the adjustable mount lighting fixture 11 being identical . fig5 illustrates first end 23 of housing 13 , and illustrates adjustable bracket 85 attached to first side 17 of housing 13 , and adjustable bracket 105 attached to second side 21 of housing 13 with bolts 89 . face 37 plate 113 is illustrated as attached to housing 13 . fig6 is a rear view of the adjustable mount lighting fixture 11 which illustrates the rear enclosure 15 , two adjustable brackets 85 and 87 attached to first side 17 of housing 13 , and two adjustable brackets 105 and 107 attached to second side 21 of housing 13 with bolts 89 . first planar portions 91 of all adjustable brackets 85 , 87 , 105 , and 107 are visible with pairs of elongate apertures 97 , and a partial view of the second planar portions 95 are also visible in this figure . fig7 is a plan frontal view of the adjustable mount lighting fixture 11 which illustrates two adjustable brackets 85 and 87 adjacent first side 17 of housing 13 , and two adjustable brackets 105 and 107 adjacent second side 21 of housing 13 . the second planar portions 95 of each of the adjustable brackets 85 , 87 , 105 , and 107 with pairs of elongate apertures 97 may be seen in this figure . fig8 is a cross - sectional end perspective of the first end 23 of the housing 13 of the adjustable mount lighting fixture 11 as fastened to an anchoring structure 135 within a wall 137 and illustrates two of the adjustable brackets 85 and 105 . fig8 illustrates the pair of fluorescent light tubes 111 ( in phantom ) within the front opening 26 of housing 13 as they would be positioned if the adjustable mount lighting fixture 11 were fully operational . both first and second planar portions 91 and 95 of the two adjustable brackets 85 and 105 may be seen in fig8 . the two adjustable brackets 85 and 105 are shown as secured to the housing 13 along through the two of the slots 81 and 101 ( not illustrated in this figure ), respectively with bolts 89 and nuts 133 . the adjustable mount lighting fixture 11 of fig8 is illustrated with face plate 113 attached with screws 114 , the exterior surface 117 of which is situated flush relative to the adjacent mirror or wall 125 . note that although structure 137 has been defined as a wall in this illustration , structure 125 continues to be defined as either a mirror or a wall , and if a wall would simply be an extension of wall 137 in the form or sheetrock or some other similar finishing material , for example . the housing 13 of the adjustable mount lighting fixture 11 is attached to anchoring structure 135 by wood screws 141 . each pair of wood screws 141 is shown extending through a corresponding pair of elongate apertures 97 in the second planar portion 95 of each of the two adjustable brackets 85 and 105 , or 87 and 107 . in this illustration , the housing 13 of the adjustable mount lighting fixture 11 is mounted so that the exterior surface 117 of the face plate 113 is coplanar with the exterior surface 127 of the adjacent mirror or wall 125 . while the present invention has been described in terms of an adjustable mount lighting fixture , the principles contained herein are applicable to other types of custom lighting systems . although the invention has been derived with reference to particular illustrative embodiments thereof , many changes and modifications of the invention may become apparent to those skilled in the art without departing from the spirit and scope of the invention . therefore , included within the patent warranted hereon are all such changes and modifications as may reasonably and properly be included within the scope of this contribution to the art . | 5 |
the novel compounds of this invention are best realized in the following structural formula : ## str1 ## wherein : ## str2 ## wherein one of r r &# 39 ; and r &# 34 ; is trichlorovinyl and the other two of r , r &# 39 ; and r &# 34 ; are selected from hydrogen , halogen , cyano , trifluoromethyl , loweralkanoyl , nitro , loweralkyl , loweralkoxy , carboxy , carbalkoxy , trifluoromethoxy , acetamido , loweralkylthio , loweralkylsulfinyl , loweralkylsulfonyl , trichlorovinyl , trifluoromethylthio , trifluoromethylsulfinyl , or trifluoromethylsulfonyl ; r 2 is amino , mono or diloweralkyl amino , acetamido , acetimido , ureido , formamido , formimido or guanidino ; and the preferred novel compounds of the instant invention are realized in the above structural formula when one of r , r &# 39 ; and r &# 34 ; is trichlorovinyl and the other two of r , r &# 39 ; and r &# 34 ; are selected from hydrogen , halogen , cyano , trifluoromethyl , trichlorovinyl or methyl ; further preferred compounds of this invention are realized where r is trichlorovinyl , r &# 39 ; is hydrogen and r &# 34 ; is selected from halogen , cyano , trifluoromethyl or methyl . the most preferred compounds of this invention are realized when r is trichlorovinyl and r &# 39 ; is hydrogen and r &# 34 ; is halogen or trifluoromethyl . a further aspect of this invention involves the use of the above novel compounds , and other structurally related compounds in novel compositions and methods for the treatment of coccidiosis . the novel compositions and methods of this invention , which include the above novel compounds , are best realized in the following structural formula : ## str3 ## wherein : r 1 is phenyl , phenyl loweralkyl , substituted phenyl or substituted phenyl loweralkyl wherein the substituents are 1 to 5 of halogen , cyano , trifluoromethyl , loweralkanoyl , nitro , loweralkyl , loweralkoxy , carboxy , carbalkoxy , trifluoromethoxy , acetamido , loweralkylthio , loweralkylsulfinyl , loweralkylsulfonyl , trichlorovinyl , trifluoromethylthio , trifluoromethylsulfinyl , or trifluoromethylsulfonyl ; r 1 may also be phenacyl , pyridyl , pyridylmethyl , naphthyl , naphthylmethyl , quinolyl or quinolylmethyl ; and the preferred compounds forming the active ingredient in the novel compositions and methods of the instant invention are realized in the foregoing structural formula wherein : r 1 is mono - di - or tri - substituted phenyl or mono - di - or tri - substituted benzyl wherein the substituents are halogen , cyano , trifluoromethyl , trichlorovinyl or methyl ; the most preferred compounds of the instant novel compositions and methods of the instant invention are realized in the foregoing structural formula wherein r 1 is di - or tri - substituted phenyl or di - or tri - substituted benzyl , and wherein the substituents are in the meta or para positions and are chloro , cyano , methyl , trifluoromethyl , or trichlorovinyl ; examples of preferred compounds of the novel compositions and methods of this invention are , in addition to the specific compounds named above : in the instant invention the term &# 34 ; loweralkyl &# 34 ; is intended to include those alkyl groups containing from 1 to 3 carbon atoms . exemplary of such groups are methyl , ethyl , propyl and isopropyl . the term &# 34 ; loweralkoxy &# 34 ; is intended to include those alkoxy groups containing from 1 to 3 carbon atoms . exemplary of such qroups are methoxy , ethoxy , propoxy , and isopropoxy . the term &# 34 ; loweralkanoyl &# 34 ; is intended to include those alkanoyl groups containing 1 to 3 carbon atoms exemplified by formyl , acetyl , and propionyl . the compounds of the instant invention may be prepared by any one of several processes . the most general process is outlined in the following reaction scheme . reaction scheme i : ## str4 ## wherein an r 3 - methylene substituted nitrile is allowed to react with an r 1 substituted azide in the presence of a base to provide the desired 5 - amino - 1 - substituted - 1 , 2 , 3 - triazole . the reaction is carried out in solvents such as aromatic hydrocarbons , lower alkanols , dimethylformamide , dimethylsulfoxide or hexamethylphosphoric triamide . the base may be any alkali metal or alkaline earth hydroxide , alkoxide or hydride such as sodium ethoxide , potassium t - butoxide , magnesium ethoxide , sodium hydroxide or sodium hydride , chosen to be compatible with the reaction solvent . generally the reaction is conducted at from - 40 ° c . to 100 ° c . and is complete in from 15 minutes to 48 hours . the product of the reaction is isolated by techniques known to those skilled in the art . reaction scheme ii ## str5 ## wherein x is a halogen , preferably chlorine or bromine . in the foregoing reaction a 1 - unsubstituted but otherwise appropriately substituted 1 , 2 , 3 - triazole is reacted with a halogen substituted r 1 group in the presence of a base to prepare the desired 1 - substituted 1 , 2 , 3 - triazole . the reaction is carried out in a solvent which may be any polar aprotic organic solvent such as dimethylformamide , dimethylsulfoxide , acetonitrile , dioxane , and the like in the presence of a base . the base may be any non - nucleophilic organic or inorganic base . suitable inorganic bases are alkali metal bases , such as sodium and potassium carbonates , phosphates , bicarbonates and hydroxides , or sodium hydride , chosen for compatibility with the reaction solvent . suitable organic bases are tertiary amines such as trialkyl substituted amines . the reaction rate varies greatly with the nature of the proposed substituent at the r 1 position , the base being used in the reaction and the solvent . very reactive substituent and base combinations may be complete in as little as ten minutes and at the other extreme the reaction may take as long as two weeks . most reactions are however complete in from 1 to 100 hours . the reaction is carried out at a temperature of from room temperature to 100 ° c . or to the reflux temperature of the solvent system being used . the products of the reaction are isolated using techniques known to those skilled in the art . the novel compounds of this invention are orally administered to poultry for the control and prevention of coccidiosis . any number of conventional methods are suitable for administering the coccidiostats of this invention to poultry , as for example , they may be given in the poultry feed . the actual quantity of the coccidiostats administered to the poultry in accordance with this invention will vary over a wide range and be adjusted to individual needs , depending upon species of the coccidia involved and severity of the infection . the limiting criteria are that the minimum amount is sufficient to control coccidiosis and the maximum amount is such that the coccidiostat does not cause any undesirable effects . a feed typically contains from about 0 . 001 to about 0 . 2 percent , preferably from about 0 . 003 to about 0 . 1 percent , by weight of one of the coccidiostats of this invention . the optimum levels will naturally vary with the specific compound utilized and species of eimeria involved , and can be readily determined by one skilled in the art . levels of the 5 - amino and substituted amino 1 , 2 , 3 - triazoles of this invention , in poultry feed of from about 0 . 003 percent to about 0 . 1 percent by weight of the diet are especially useful in controlling the pathology associated with e . tenella . as well as the intestinal dwelling species . depending on the compound employed , levels as low as 0 . 001 percent possess the novel effects of reducing the number of oocysts passed in the droppings of infected chickens . the quantity or concentration of a novel coccidiostat of this invention in any admixture in which it is administered to the poultry will , of course , vary in accordance with the type of admixture utilized . of the various methods of administering the coccidiostats of this invention to poultry , they are most conveniently administered as a component of a feed composition . the novel coccidiostats may be readily dispersed by mechanically mixing the same in finely ground form with the poultry feedstuff , or with an intermediate formulation ( premix ) that is subsequently blended with other components to prepare the final poultry feedstuff that is fed to the poultry . typical components of poultry feedstuffs include molasses , fermentation residues , corn meal , ground and rolled oats , wheat shorts and middlings , alfalfa , clover and meat scraps , together with mineral supplements such as bone meal and calcium carbonate and vitamins . the following non - limiting examples will serve to further illustrate the instant invention . a stirred mixture of 3 , 4 - dichlorobenzyl chloride ( 12 . 6 g , 64 . 5 mmol ) and sodium azide ( 7 . 0 g , 0 . 11 mole ) in absolute ethanol ( 70 ml ) was refluxed for 4 . 75 hours , cooled and filtered to provide a solution of 3 , 4 - dichlorobenzyl azide . separately , 2 - cyanoacetamide ( 5 . 5 g , 65 mmol ) was added to a 35 ° c . solution of sodium ( 1 . 5 g , 65 mmol ) in absolute ethanol ( 125 ml ), and to the resulting suspension was added the above azide solution dropwise over 10 minutes . the combined mixtures were refluxed for 1 hour , kept 16 hours at ambient temperature and 1 hour at 5 ° c ., and filtered . the crude product was dried under vacuum , dissolved in boiling ethanol ( 290 ml ), filtered hot , and cooled to 0 ° c . the solid was collected by filtration and dried under vacuum to provide 12 . 4 g ( 67 %) of 1 -( 3 , 4 - dichlorobenzyl )- 5 - amino - 1 , 2 , 3 - triazole - 4 - carboxamide , m . p 221 °- 222 ° c . a stirred , ambient temperature solution of 5 - amino - 1 , 2 , 3 - triazole - 4 - carboxamide ( 635 mg , 5 . 00 mmole ) in dry dimethylformamide ( 20 ml ) is treated in one portion with sodium hydride ( 240 mg of a 50 % dispersion in mineral oil , 120 mg nah , 5 . 0 mmol ). after 15 min 3 , 4 - dichlorobenzyl chloride ( 0 . 977 g , 5 . 00 mmol ) is added . the mixture is stirred 1 hour , poured into water ( 20 ml ), acidified to ph 6 with glacial acetic acid , and filtered . the solid is washed with water , dried , and chromatographed to provide 5 - amino - 1 -( 3 , 4 - dichlorobenzyl )- 1 , 2 , 3 - triazole - 4 - carboxamide . a stirred mixture of 4 - methylbenzyl bromide ( 1 . 3 g , 7 . 0 mmol ) and sodium azide ( 754 mg , 11 . 6 mmol ) in ethanol ( 8 ml ) was refluxed under a nitrogen atmosphere for 3 hours , cooled to ambient temperature , and filtered . separately , 2 - cyanoacetamide ( 588 mg , 7 . 0 mmol ) was added to a stirred , refluxing solution of sodium ( 167 mg , 7 . 2 mmol ) in ethanol ( 15 ml ), followed by dropwise addition of the above azide solution over 20 min . the resulting slurry was refluxed 1 hour , cooled to ambient temperature , and refrigerated . the precipitate was collected by filtration , washed with ethanol , and dried under vacuum to provide 1 . 12 g ( 69 %) of 1 -( 4 - methylbenzyl )- 5 - amino - 1 , 2 , 3 - triazole - 4 - carboxamide , m . p . 223 °- 225 ° c . a mixture of 2 - chloro - 5 - methylbenzonitrile ( 10 . 6 g , 69 . 9 mmol ), n - bromosuccinimide ( 12 . 2 g , 68 . 5 mmol ), and dibenzoyl peroxide ( 349 mg , 1 . 44 mmol ) in benzene ( 350 ml ) was refluxed 1 . 5 hours , cooled , and evaporated to dryness under vacuum . the residue was suspended in 7 : 3 ( v / v ) hexane - dichloromethane , filtered , and evaporated . the crude product was chromatographed on silica gel ( 650 g ) eluted with 7 : 3 ( v / v ) hexane - dichloromethane to provide 4 . 8 g ( 30 %) 4 - chloro - 3 - cyanobenzyl bromide , m . p . 55 °- 58 ° c . a stirred mixture of 4 - chloro - 3 - cyanobenzyl bromide ( 3 . 0 g , 13 mmol ) and sodium azide ( 1 . 26 g , 19 . 4 mmol ) was refluxed 5 hours in absolute ethanol ( 30 ml ). the mixture was kept 18 hours at ambient temperature , filtered , and the filtrate was evaporated under vacuum . the residue was triturated with diethyl ether , filtered , and evaporated to provide 2 . 45 g ( 98 %) liquid 4 - chloro - 3 - cyanobenzyl azide ; i . r . ( neat ): 2240 , 2100 cm 1 . a stirred suspension of 2 - cyanoacetamide ( 790 mg , 9 . 40 mmol ) in absolute ethanol ( 40 ml ) was treated with sodium methoxide ( 495 mg , 9 . 16 mmol ) and refluxed 10 minutes . the mixture was cooled slightly , a solution of 4 - chloro - 3 - cyanobenzyl azide ( 1 . 35 g , 7 . 01 mmol ) in absolute ethanol ( 10 ml ) was added in one portion , and the mixture was refluxed 2 . 5 hours . the mixture was filtered hot , the solid was washed with absolute ethanol , and the combined filtrate and wash were evaporated to dryness under vacuum . the residue was triturated with diethyl ether , filtered , and washed twice with diethyl ether . the solid was recrystallized from methanol ( 6 ml ) and dried at 65 ° c . under vacuum to provide 635 mg ( 24 %) 5 - amino - 1 -( 4 - chloro - 3 - cyanobenzyl )- 1 , 2 , 3 - triazole - 4 - carboxamide , m . p . 172 °- 175 ° c . a mixture of 5 - amino - 1 -( 3 , 4 - dichlorobenzyl )- 1 , 2 , 3 - triazole - 4 - carboxamide ( 2 . 86 g , 10 . 0 mmol ), methyl iodide ( 1 . 42 g , 10 . 0 mmol ), and potassium carbonate ( 1 . 38 g , 10 . 0 mmol ) in n , n - dimethylformamide ( 20 ml ) is stirred 48 hours a ambient temperature , poured into water ( 150 ml ), and filtered . chromatography provides 1 -( 3 , 4 - dichlorobenzyl )- 5 - methylamino - 1 , 2 , 3 - triazole - 4 - carboxamide . a stirred suspension of 2 - cyanoacetamide ( 790 mg , 9 . 4 mmol ) in absolute ethanol ( 40 ml ) was treated with sodium methoxide ( 495 mg , 9 . 2 mmol ) and refluxed 10 minutes . the mixture was cooled lightly , a solution of 4 - chloro - 3 - cyanobenzyl azide ( 1 . 35 g , 7 . 0 mmol ) in absolute ethanol was added , and the mixture was refluxed 2 . 5 hours . the mixture was filtered hot and the filtrate evaporated under vacuum . the residue was triturated with diethyl ether , filtered , and washed twice with diethyl ether . the solid was crystallized from refluxing methanol , filtered , washed twice with methanol and once with diethyl ether , and dried at 65 ° c . under vacuum to provide 635 mg ( 33 %) 5 - amino - 1 -( 4 - chloro - 3 - cyanobenzyl )- 1 , 2 , 3 - triazole - 4 - carboxamide , m . p . 172 °- 175 ° c . a stirred , ambient temperature solution of 5 - amino - 1 , 2 , 3 - triazole - 4 - carboxamide ( 630 mg , 5 . 0 mmol ) in dry n , n - dimethylformamide ( 20 ml ) was treated with sodium hydride ( 250 mg of a 50 % dispersion in mineral oil , 125 mg nah , 5 . 2 mmol ). the resulting suspension was stirred 10 min ., 4 - cyano - 3 , 5 - dichlorobenzyl chloride ( 1 . 1 g , 5 . 0 mmol ) was added , and the mixture was stirred 2 hours . the reaction was quenched by pouring into ice and water ( 80 ml ). the suspension was filtered and washed three times with water . the solid was suspended in 19 : 1 ( v / v ) dichloromethane - methanol and filtered to provide 364 mg ( 23 %) 5 - amino - 1 -( 4 - cyano - 3 , 5 - dichlorobenzyl )- 1 , 2 , 3 - triazole - 4 - carboxamide . recrystallization from ethanol provided material of m . p . 238 °- 239 5 ° c . a solution of 5 - chloro - m - xylene ( 59 . 3 g ) and dibenzoyl peroxide ( 5 . 0 g ) in 1 . 13 l of benzene was heated at reflux . n - bromosuccinimide ( 82 . 2 g ) was added in portions over 15 minutes . heating was continued for an additional 20 minutes until a negative potassium iodide reaction was observed . the reaction mixture was cooled , evaporated and then titurated with hexane ( 500 ml ). the precipitated succinimide was removed by filtration and washed with additional hexane . concentration afforded 101 g of crude 3 - chloro - 5 - methylbenzyl bromide . a solution of crude 3 - chloro - 5 - methylbenzyl bromide ( 49 . 68 g ) in 300 ml of glacial acetic acid containing 48 . 54 g of koac was heated at reflux for 3 hours . the mixture was concentrated and then partitioned between water ( 600 ml ) and ether ( 500 ml ). after repeated extractions with ether , the combined organic layers were washed with saturated nahco 3 solution ( 300 ml ) and water ( 300 ml ). after treatment with mgso 4 , the ethereal solution was concentrated to give an oil , 41 . 5 g . the crude acetate was dissolved in 200 ml of methanol and treated slowly with a methanolic koh solution ( 33 . 4 g in 100 ml ). the reaction mixture was stirred for 35 minutes at room temperature . the reaction mixture was neutralized with acetic acid and concentrated under reduced pressure . the residue was partitioned between water ( 300 ml ) and ether ( 200 ml ). concentration afforded 27 . 9 g of crude product which was purified by silica gel chromatography ( eluant 95 : 5 ch 2 cl 2 / et 2 o ) to give 15 . 6 g of 3 - chloro - 5 - methylbenzyl alcohol , m . p . 32 °- 34 . 5 ° c . to a cold solution (- 60 ° c .) of oxalyl chloride ( 14 . 88 ml ) in 300 ml of ch 2 cl 2 , dimethylsulfoxide ( 25 . 16 ml ) in 75 ml of ch 2 cl 2 was added followed by the addition of 3 - chloro - 5 - methylbenzyl alcohol ( 23 g ) in 100 ml of ch 2 cl 2 . to this cold mixture , triethylamine ( 103 ml ) was slowly added ( exothermic ) over 20 minutes . the reaction mixture was then permitted to warm to room temperature over 1 . 5 hours . the mixture was then added to 1 l of water and the layers separated . the ch 2 cl 2 layer was repeatedly washed with water and then dried with mgso 4 . concentration afforded 25 . 4 g of an oil which was chromatographed on silica gel . elution with 60 : 40 hexane : ch 2 cl 2 gave 20 . 01 g of pure 3 - chloro - 5 - methylbenzaldehyde . a cold solution (- 10 ° c .) of 3 - chloro - 5 - methylbenzaldehyde ( 19 . 5 g ) and chloroform ( 15 . 6 ml ) in 76 ml of dmf was treated dropwise with a 5m methanolic koh solution ( 17 . 16 ml ). the reaction mixture was stirred for 2 hours at - 10 ° c . and then poured into a cold mixture of 170 ml of 1n hcl and 170 ml of ch 2 cl 2 with vigorous stirring the layers were separated and the aqueous phase further extracted with ch 2 cl 2 ( 2 × 200 ml ). the combined organic layers were washed with water ( 3 × 100 ml ) and then dried over mgso 4 . concentration produced 38 . 17 g of a crude oil . purification by silica gel chromatography with 50 : 50 hexane : ch 2 cl 2 as eluant gave 32 . 3 g of pure trichloromethyl carbinol . to a suspension of pcl 3 ( 13 . 75 g ) in 275 ml of ch 2 cl 2 , a solution of ( 3 - chloro - 5 - methylphenyl )-( trichloromethyl )- carbinol ( 17 . 87 g ) in 125 ml of ch 2 cl 2 was added dropwise . the reaction mixture was stirred for 30 minutes prior to the addition of an additional 8 g of pcl 5 . the reaction mixture was stirred for a total of 3 hours at ambient temperature prior to aqueous work - up which afforded 19 . 35 g of pentachloro product . a solution of the pentachloro adduct ( 3 . 62 g ) in 26 ml of methanol was added dropwise to a solution of naoh ( 554 mg ) in methanol ( 17 ml ) over 15 minutes . the reaction mixture was stirred at room temperature for an additional 15 hours at which point hcl was added to adjust the ph of the mixture to about 3 . the solution was concentrated and then partitioned between water and ether . repeated extractions with ether afforded 3 . 36 g of oil upon evaporation . this material was chromatographed on silica gel ( hexane as eluant ) to give 2 . 93 g of 3 - chloro - 5 -( trichlorovinyl ) toluene . a solution of 3 - chloro - 5 -( trichlorovinyl ) toluene ( 7 . 56 g ) and dibenzoyl peroxide ( 0 . 5 g ) in 250 ml of benzene was heated at reflux . n - bromosuccinimide ( 6 . 04 g ) was added in portions and the reaction mixture stirred at reflux for 3 hours . the mixture was then evaporated and the residue titurated with hexane ( 200 ml ). the precipitated succinimide was removed by filtration and washed with hexane ( 2 × 25 ml ). the hexane was concentrated and the residual oil ( 10 . 1 g ) chromatographed on silica with petroleum ether as eluant . the column afforded 1 . 39 g of starting toluene , 1 . 18 g of dibromide , and 6 . 57 g of the desired benzyl bromide . a solution of 3 - chloro - 5 -( trichlorovinyl ) benzyl bromide ( 3 . 57 g ) and sodium azide ( 813 mg ) in 50 ml of ethanol was heated at reflux for 30 minutes . the reaction was then concentrated and the residue chromatographed on silica gel with petroleum ether as eluant to afford 2 . 24 g of pure 3 - chloro - 5 -( trichlorovinyl ) benzyl azide . a solution of cyanoacetamide ( 412 mg ) in dimethyl formamide ( dmf ) ( 10 ml ) and hexane ( 2 ml ) was treated with nah ( 50 % dispersion , 470 mg ) at ambient temperatures for 25 minutes . the solution was then filtered through celite and rinsed with dmf ( 2 × 2 ml ). the filtrate was then cooled to 0 ° c . to this cold solution a solution of 3 - chloro - 5 -( trichlorovinyl ) benzyl azide ( 980 mg ) in 18 ml of dmf was added dropwise over 10 minutes the resulting mixture was stirred for 45 minutes at 0 ° c . and then poured into 50 ml of water containing 5 ml of glacial acetic acid . the precipitate was collected and washed repeatedly with water and with hexane . the solid was recrystallized from ethanol ( 11 ml ) to give 345 mg of pure product , m . p . 191 °- 193 . 5 ° c . a solution of 5 - amino - 1 , 2 , 3 - triazole - 4 - carboxamide ( 386 mg ) in 12 ml of dry dimethylformamide ( dmf ) was treated with sodium hydride ( 50 % dispersion in mineral oil , 154 mg ). the reaction mixture was stirred at ambient temperature for 20 minutes at which point a solution of 3 - chloro - 5 -( trichlorovinyl ) benzyl bromide ( 1 . 01 g ) in 6 ml of dmf was added dropwise . the resulting mixture was stirred for 1 hour at room temperature and then poured into 50 ml of water . acetic acid was added to adjust the ph to 6 . 0 . the aqueous mixture was then extracted with methylene chloride ( 2 × 75 ml ). the organic layers were back - washed with water , dried with anhydrous magnesium sulfate and then concentrated under vacuum . the residue was chromatographed on silica gel ( 97 : 3 methylene chloride : methanol ) to give : 4 - amino - 1 -[ 3 - chloro - 5 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 5 - carboxamide ( 497 mg ) and 5 - amino - 1 -[ 3 - chloro - 5 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide ( 346 mg ). a cold (- 10 ° c .) solution of 2 - chloro - 5 - methylbenzaldehyde ( 20 . 8 g ) and chloroform ( 16 . 6 ml ) in 81 ml of dimethylformamide ( dmf ) is treated dropwise with a methanolic koh solution ( 6 . 08 g in 18 . 3 ml ). the reaction mixture is stirred for 2 hours at - 10 ° c . and then poured into a mixture of 1n hcl ( 185 ml ) and 185 ml of ch 2 cl 2 . the layers are separated and the aqueous layer further extracted with ch 2 cl 2 ( 2 × 75 ml ). the combined organic layers were washed with water ( 3 ×), dried with anhydrous magnesium sulfate and concentrated under reduced pressure . the residue ( 40 g ) was chromatographed on silica with 1 : 1 hexane / ch 2 cl 2 to give 24 . 49 g of trichloromethyl carbinol . to a suspension of pcl 5 ( 12 . 4 g ) in 250 ml of ch 2 cl 2 , a solution of the trichloromethyl carbinol ( 24 . 49 g ) in 100 ml of ch 2 cl 2 was added dropwise . the reaction mixture was stirred for 15 minutes at which point an additional 7 . 5 g of pcl 3 was added . the reaction mixture was stirred for an additional hour at room temperature and then carefully poured into 500 ml of ice - water . the layers were separated and the organic layer was washed with water , saturated nahco 3 solution , and water again . evaporation afforded 25 g of an oil which was chromatographed on silica ( petroleum ether ) to give 18 . 6 g of the pentachloride adduct . this pentachloride adduct ( 17 . 6 g ) was added to a solution of 3 . 1 g of naoh in 150 ml of methanol and the resulting mixture stirred for 16 . 5 hours at room temperature . the reaction mixture was neutralized with hcl ( ph 6 ) and then concentrated under reduced pressure . the residue was partitioned between ether ( 400 ml ) and water ( 100 ml ). the layers were separated and the organic layer further washed with water and then dried with anhydrous magnesium sulfate . concentration gave an oil which was distilled at 93 °- 95 °/ 3 mm to give pure 4 - chloro - 3 -( trichlorovinyl ) toluene , 14 . 0 g . a solution of 4 - chloro - 3 -( trichlorovinyl ) toluene ( 13 . 77 g ) and dibenzoyl peroxide ( 1 . 0 g ) in 500 ml of benzene was heated at reflux . n - bromosuccinimide ( 11 . 6 g ) was added in portions and the resulting mixture stirred at reflux for 1 . 5 hours ( negative ki test ). the reaction mixture was concentrated under reduced pressure . the residue was partially dissolved in 300 ml of petroleum ether and the insoluble succinimide removed by filtration . the filtrate was concentrated to give 17 . 9 g of the benzyl bromide . a solution of 5 - amino - 1 , 2 , 3 - triazole - 4 - carboxamide ( 1 . 65 g ) in 50 ml of dry dimethylformamide ( dmf ) was treated with sodium hydride ( 50 % in mineral oil , 658 mg ) and heated to 40 ° c . for 20 minutes . to this mixture a solution of 4 - chloro - 3 ( trichlorovinyl ) benzyl bromide ( 4 . 4 g ) in 10 ml of dmf was added and heating was continued at 40 ° c . for 1 hour . the reaction mixture was slowly added to 250 ml of water and the ph of the resulting solution adjusted with acetic acid to neutrality . the aqueous mixture was extracted with methylene chloride . the organic layers were then back - washed with water ( 4 ×&# 39 ; s ), dried with magnesium sulfate and concentrated . the residue was chromatographed on silica gel ( 97 : 3 ch 2 cl 2 : ch 3 oh ) to give : 4 - amino - 1 [ 4 - chloro - 3 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 5 - carboxamide ( 963 mg ) and 5 - amino - 1 -[ 4 - chloro - 3 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide ( 650 mg ), m . p . 174 °- 175 ° c . a solution of 5 - nitro - m - xylene ( 100 g ) and dibenzyl peroxide ( 5 . 0 g ) in 1 . 35 l of benzene was heated at reflux . in portions n - bromosuccinimide ( 128 g ) is added over 15 minutes . the reaction mixture is heated for an additional hour at which point the mixture gave a negative ki test . the reaction mixture was evaporated and the residue treated with 1 l of hexane . the precipitated succinimide was removed by filtration . the filtrate was concentrated to give 174 g of a yellowish oil . the crude benzylic bromide was dissolved in acetic acid ( 450 ml ) to which was added 100 g of potassium acetate . the resulting solution was heated at reflux for 1 hour and then concentrated . the residue was partitioned between water ( 1 l ) and ether ( 2 × 500 ml ). the layers were separated and the combined organic layers were washed with saturated nahco 3 and brine . concentration afforded 142 . 7 g of crude benzylic acetate . the crude benzylic acetate product was dissolved in 250 ml of methanol and treated with 75 ml of a 5n methanolic koh solution . after 30 minutes the reaction mixture was neutralized with acetic acid and concentrated . the residue was partitioned between water ( 500 ml ) and ether ( 500 ml ). the ethereal layer was washed with brine , dried with magnesium sulfate , and concentrated to give 131 . 5 g . the crude product was chromatographed on silica gel with methylene chloride to give 60 . 69 g of 3 - methyl - 5 - nitrobenzyl alcohol , m . p . 56 . 8 °- 57 . 9 ° c .. to a cold (- 60 ° c .) solution of oxalyl chloride ( 7 . 08 ml ) in 177 ml of ch 2 cl 2 , dimethylsulfoxide ( 12 ml ) in 35 ml of ch 2 cl 2 added slowly followed by the addition of 3 - methyl - 5 - nitro benzaldehyde ( 11 . 84 g ) in 50 ml of ch 2 cl 2 . to this cold mixture , triethylamine ( 50 ml ) was slowly added . the reaction mixture was then permitted to come to room temperature over the next hour . the reaction mixture was poured into 500 ml of water and the layers separated . the organic layer was repeatedly washed with water and dried over anhydrous magnesium sulfate concentration afforded an oil ( 12 . 1 g ) which was used in the next reaction without further purification . a cold solution (- 10 ° c .) of 3 - methyl - 5nitrobenzaldehyde ( 60 . 6 g ) and chloroform ( 45 . 4 ml ) in 220 ml of dimethylformamide ( dmf ) was treated dropwise with a 5n methanolic solution of koh ( 49 . 73 ml ). the reaction mixture was stirred at - 10 ° c . for 2 hours and then poured into a cold mixture of ch 2 cl 2 ( 500 ml ) and 1n hcl ( 500 ml ) with vigorous stirring . the layer were then separated . the aqueous layer was further extracted with ch 2 cl 2 ( 1 × 500 ml ). the combined organic layers were repeatedly washed with water , dried over magnesium sulfate and concentrated under reduced pressure . the residue was chromatographed on silica gel ( 80 : 20 ch 2 cl 2 : hexane ) to give 73 g of the trichloromethyl carbinol derivative . to a suspension of pcl 5 ( 28 . 8 g ) in 700 ml of ch 2 cl 2 , a solution of 59 . 47 g of the trichloromethyl carbinol derivative in 300 ml of ch 2 cl 2 was added dropwise . after stirring the reaction mixture for 15 minutes , an additional 14 . 5 g of pcl 5 was added and the reaction mixture stirred overnight . the mixture was then poured slowly into 2 l of ice / water and the layers separated . the organic layer was washed with saturated nahco 3 , water and then dried over magnesium sulfate . concentration gave 61 . 52 g of the tetrachloro derivative . a solution of 61 . 0 g of this tetrachloro derivative in 420 ml of methanol was added dropwise to a solution of naoh ( 10 . 96 g ) in 463 ml of methanol . the reaction mixture was stirred overnight at room temperature . the ph of the mixture was then adjusted to near 6 with glacial acetic acid . the reaction mixture was concentrated and the resulting residue partitioned between ether ( 800 ml ) and water ( 500 ml ). the layers were separated and the aqueous layer further extracted with 500 ml of ether . the combined organic layers were washed with water ( 3 × 300 ml ) and then dried over magnesium sulfate . concentration afforded 53 . 23 g of 3 -( trichlorovinyl )- 5 - nitrotoluene . to a warm solution of 3 -( trichlorovinyl )- 5 - nitrotoluene ( 10 . 95 g ) in 150 ml of ethanol , an aqueous solution of ammonium sulfide ( 30 ml of a commercial 4 - 52 % aqueous solution diluted to 90 ml with water ) was added in one portion . the resulting heterogeneous solution was heated in a 100 ° c . oil bath for 30 minutes . the hot reaction mixture was filtered and the precipitate thoroughly washed with ethanol . the filtrate was diluted with 1 . 2 l of brine and then extracted with methylene chloride ( 2 × 400 ml ). the combined organic layers were washed with brine and dried over anhydrous magnesium sulfate . concentration afforded 9 . 36 g of an oil . 3 - methyl - 5 -( trichlorovinyl ) aniline ( 9 . 9 g ) was mixed with 32 ml of concentrated hcl and 75 ml of water . the resulting suspension was cooled to - 10 ° c . and a solution of sodium nitrite ( 3 . 5 g in 7 ml h 2 o ) was added dropwise . the reaction mixture was stirred at - 10 ° c . for 10 minutes and then at 0 ° c . for 30 minutes . the cold (- 10 ° c .) solution was filtered and the filtrate treated with 10 ml of a 60 % solution of hpf 6 . the mixture was shaken ( 0 ° c .) for 20 minutes and then filtered . the collected salt was washed with cold water repeatedly and dried in a vacuum oven at room temperature over p 2 o 5 to give 11 . 30 g of the desired hexafluorophosphate salt . to a suspension of cubr2 ( 14 . 1 g ) in dimethylsulfoxide ( dmso ), a solution of 3 - methyl - 5 -( trichlorovinyl ) benzenediazonium hexafluorophosphate ( 11 . 3 g ) in 35 ml of lmso was added . the reaction mixture was stirred at 25 ° c . for 15 minutes and then at 35 ° c . for 10 minutes . the reaction mixture was cooled ( 0 ° c .) and then diluted with 500 ml of ice water . the aqueous solution was extracted with ether ( 3 × 150 ml ). the combined ethereal layers were washed with brine ( 2 × 100 ml ), dried with magnesium sulfate and concentrated to give 7 77 g of an oil . chromatography on silica gel ( hexane ) afforded 6 . 88 g of pure product . a solution of 3 - bromo - 5 -( trichlorovinyl ) toluene ( 1 . 76 g ) and 100 mg of dibenzoyl peroxide in 100 ml of benzene was heated at reflux . n - bromosuccinimide ( 1 . 3 g ) was added in portions and the reaction mixture stirred at reflux for 5 . 5 hours . the reaction mixture was concentrated and the residue triturated with 100 ml of hexane . the precipitated succinimide was collected by filtration and thoroughly washed with hexane the filtrate was concentrated under reduced pressure to give 2 . 2 g of a crude mixture containing the desired benzyl bromide . a solution of crude 3 - bromo - 5 -( trichlorovinyl ) benzyl bromide ( 2 . 2 g ) and sodium azide ( 760 mg ) in 30 ml of ethanol was heated at reflux for 1 hour . the reaction solution was concentrated under reduced pressure and the residue triturated with 100 ml of hexane . the mixture was filtered and the filtrate chromatographed on silica ( hexane ) to give 1 . 1 g of pure azide to a hot ( 60 ° c .) solution of cyanoacetamide ( 546 mg ) in 20 ml of ethanol , 6 . 47 ml of a methanolic solution of naoh ( 1n ) was added and the resulting mixture was stirred at 60 ° c . for 20 minutes . a solution of 3 - bromo - 5 -( trichlorovinyl ) benzyl azide ( 1 . 02 g ) in 10 ml of ethanol was added and the reaction mixture heated at 60 ° c . for two hours . the ph of the solution was adjusted to ˜ 6 with acetic acid and then concentrated to a small volume . dilution with 50 ml of water afforded a precipitate which was washed thoroughly with water . the precipitate was recrystallized from 8 ml of ethanol to give 466 mg of pure product , m . p . 175 °- 177 ° c .. a cold (- 10 ° c .) solution of 2 , 5 - dimethylbenzaldehyde ( 44 . 25 g ) and chloroform ( 150 . 2 g ) in 531 ml of dimethylformamide ( dmf ) was treated dropwise with a methanolic koh solution ( 39 . 7 g of koh in 119 ml of methanol ). the reaction mixture was stirred for 2 hours at - 8 ° c . at which point the reaction mixture was poured onto a cold mixture of 450 ml of benzene and 450 ml of a 1n hcl solution , the reaction mixture permitted to come to room temperature . the layers were then separated and the organic layer was further washed with water . concentration under reduced pressure afforded 90 . 98 g of crude trichlorovinyl carbinol . to a suspension of pcl 3 ( 75 g ) in 1 . 5 l of ch 2 cl 2 , a solution of the crude trichlorovinyl carbinol ( 90 . 98 g ) in 400 ml of ch 2 cl 2 was added dropwise . the reaction mixture was stirred for 30 minutes at which point additional pcl 5 ( 45 g ) was added . the reaction mixture was stirred for 3 hours and then subjected to aqueous work - up which afforded 88 . 8 g of crude tetrachloro derivative . a solution of this tetrachloro adduct ( 83 . 8 g ) in 375 ml of methanol was added dropwise to a solution of naoh ( 14 . 8 g ) in methanol ( 750 ml ). the resulting solution was stirred at ambient temperature for 29 hours . the reaction mixture was concentrated and then partitioned between ether and water . the ethereal fraction was dried with anhydrous magnesium sulfate , evaporated and chromatographed on silica gel . elution with hexane gave 41 . 5 g of pure 2 -( trichlorovinyl )- p - xylene . to a hot solution of 2 -( trichlorovinyl )- p - xylene ( 25 . 4 g ) and dibenzoyl peroxide ( 3 . 2 g ) in 1000 ml of benzene , n - bromosuccinimide ( 20 . 79 g ) was added in portions . the resulting mixture was heated at reflux for 15 minutes at which point no n - bromosuccinimide was evident . the reaction solution was evaporated and the residual oil suspended in 90 : 10 petroleum ether : methylene chloride ( 250 ml ). the precipitated succinimide was collected by filtration and thoroughly washed with the above solvent system . the filtrate was concentrated and then chromatographed on silica gel . elution with 90 : 10 petroleum ether : methylene chloride gave 20 . 9 g of a mixture containing 4 - methyl - 3 -( trichlorovinyl ) benzyl bromide and 4 - methyl - 2 -( trichlorovinyl ) benzyl bromide . a solution of the crude mixture of benzyl bromides [ 4 - methyl - 3 -( trichlorovinyl ) benzyl bromide and 4 - methyl - 2 -( trichlorovinyl ) benzyl bromide , 29 . 32 g ] in 700 ml of dry tetrahydrofuran was treated with 33 . 92 g of tetra - n - butyl ammonium acetate and stirred at room temperature for 1 hour . the reaction mixture was concentrated under reduced pressure and the residual oil triturated with 400 ml of hexane . the precipitate was removed by filtration and thoroughly washed with hexane ( 2 × 200 ml ). concentration gave 28 . 2 g of a yellow oil which was dissolved in 266 ml of methanol and treated dropwise with an aqueous 1n koh solution ( 55 ml ). the reaction mixture was stirred at ambient temperature for 30 minutes and then partially concentrated . the concentrate was then extracted with ether ( 1000 ml ). the ethereal layer was back - washed with brine ( 2 × 200 ml ), dried with anhydrous magnesium sulfate , and concentrated in vacuum to give 28 . 2 g of an oil . chromatography on silica ( 90 : 10 methylene chloride : ether ) gave 8 . 92 g of 4 - methyl - 2 -( trichlorovinyl ) benzyl alcohol and 10 . 67 g of the desired 4 - methyl - 3 -( trichlorovinyl ) benzyl alcohol . a solution of 4 - methyl - 3 -( trichlorovinyl ) benzyl alcohol ( 2 . 06 g ) and triphenylphosphine ( 2 . 58 g ) in 100 ml of carbon tetrachloride was heated at reflux for 48 hours . the reaction mixture was concentrated under reduced pressure and the residue dissolved in ch 2 cl 2 ( 200 ml ). this organic solution was shaken with 30 % h 2 o 2 ( 10 ml ) and then diluted with water ( 100 ml ) and the layers separated . the organic layer was further washed with water , dried with anhydrous magnesium sulfate and concentrated to give 4 . 37 g of crude product . chromatography on silica ( 1 : 1 hexane : methylene chloride ) gave 1 . 81 g of 4 - methyl -( trichlorovinyl ) benzyl chloride . a solution of 4 - methyl - 3 -( trichlorovinyl ) benzyl chloride ( 1 . 81 g ) and sodium azide ( 650 mg ) in 20 ml of ethanol was heated at reflux for 5 hours . the reaction mixture was concentrated and then chromatographed on silica gel . elution with 1 : 1 hexane : methylene chloride afforded 1 . 65 g of pure azide . to a hot ( 60 ° c .) solution of cyanoacetamide ( 1 . 09 g ) in 30 ml of ethanol , 13 ml of a methanolic solution of naoh ( 1n ) was added and the resulting mixture was stirred at 60 ° c . for 20 minutes . at this point a solution of 4 - methyl - 3 -( trichlorovinyl ) benzyl azide ( 1 . 65 g ) in 10 ml of ethanol was added and the reaction mixture stirred at 60 ° c . for an additional two hours . the precipitate was removed by filtration and rinsed with ethanol and ether . the filtrate was diluted with water ( 200 ml ) and the resulting precipitate collected ( 1 . 56 g ). the crude product was chromatographed on silica with 95 : 5 methylene chloride : methanol to give 889 mg of 5 - amino - 1 -[ 4 - methyl - 3 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide , m . p . 196 °- 197 ° c .. to a refluxing solution of 5 -( trichloro - vinyl )- m - xylene ( 32 . 28 g ) and dibenzoyl peroxide ( 3 . 43 g ) in 1300 ml of benzene , n - bromosuccinimide ( 30 . 21 g ) was added in portions . the resulting mixture was heated at reflux for 30 minutes at which point no n - bromosuccinimide was evident . the reaction mixture was concentrated under reduced pressure and the residue triturated with 250 ml of hexane . the precipitated succinimide was collected by filtration and thoroughly washed with hexane . the filtrate was concentrated and the residue chromatographed on silica ( petroleum ether ) to give 26 . 2 g of the desired benzyl bromide . a solution of 3 - methyl - 5 -( trichlorovinyl ) benzyl bromide ( 3 . 14 g ) and sodium azide ( 1 . 0 g ) in 25 ml of ethanol was heated at reflux for 2 hours . the reaction mixture was concentrated under reduced pressure and the resulting oil triturated with 50 ml of hexane . the mixture was filtered and the filtrate concentrated to give 2 . 64 g of azide . to a hot ( 60 ° c .) solution of cyanoacetamide ( 1 . 8 g ) in 57 ml of ethanol , 21 . 3 ml of a 1n methanolic solution of naoh was added and the resulting mixture stirred for 20 minutes . a solution of 3 - methyl - 5 -( trichlorovinyl ) benzyl azide ( 2 . 64 g ) in 20 ml of ethanol was added and the reaction mixture stirred at 60 ° c . for an additional two hours . the ph of the solution was adjusted to 6 with acetic acid . the solution was diluted with water ( 300 ml ) and the resulting precipitate collected and rinsed thoroughly with water . the solid was then chromatographed on silica gel ( 97 : 3 ) ch 2 cl 2 : ch 3 oh ) to give 980 mg of pure triazole . a suspension of potassium acetate ( 4 . 4 g ) and 3 - methyl - 5 -( trichlorovinyl ) benzyl bromide ( 7 . 2 g ) in 50 ml of glacial acetic acid was heated at reflux for two hours . the reaction mixture was concentrated and the residue partitioned between ether ( 150 ml ) and water ( 150 ml ). the layers were separated and the aqueous phase further extracted with ether . the combined ethereal layers were washed with saturated nahco 3 and water and then dried with anhydrous magnesium sulfate . concentration afforded the crude acetate which was dissolved in 50 ml of methanol and treated with 4 . 5 g of koh . the resulting mixture was stirred at room temperature for 45 minutes . the ph of the solution was adjusted to @ 6 with acetic acid . the reaction mixture was then concentrated and the residue partitioned between ether ( 150 ml ) and water ( 150 ml ). the layers were separated and the ethereal layer concentrated to give 6 . 5 g of an oil which was chromatographed on silica gel ( 80 : 10 : 10 hexane : methylene chloride : ethyl acetate ) to give 5 . 8 g of pure alcohol , m . p . 63 °- 65 . 5 ° c . to a cold (- 60 ° c .) solution of oxalyl chloride ( 3 . 17 ml ) in 65 ml of dry methylene chloride ( ch 2 cl 2 ), dimethyl sulfoxide ( dmso ) ( 5 . 37 ml ) in 16 ml of ch 2 cl 2 was added followed by the addition of 7 . 86 g of 3 - methyl - 5 -( trichlorovinyl ) benzyl alcohol in 16 ml of ch 2 cl 2 , to this cold mixture , triethylamine ( 22 ml ) was slowly added . the reaction mixture was permitted to warm to room temperature over 1 . 5 hours . the reaction mixture was then added to 200 ml of water and the layers separated . the organic layer was repeatedly washed with water and then dried with magnesium sulfate . concentration afforded 8 . 16 g of an oil which was chromatographed on silica gel ( 60 : 40 hexane : ch 2 cl 2 ) to give 7 . 82 g of pure aldehyde , m . p . 42 °- 43 ° c .. a cold solution (- 10 ° c .) of 3 - methyl - 5 -( trichlorovinyl ) benzaldehyde ( 7 . 72 g ) and chloroform ( 3 . 8 ml ) in 18 . 5 ml of dimethylformamide ( dmf ) was treated dropwise with a 5n methanolic solution of koh ( 4 . 19 ml ). the mixture was stirred at - 10 ° c . for 2 hours and then poured into a cold mixture of 42 ml of 1n hcl and 42 ml of ch 2 cl 2 with vigorous stirring . the layers were separated and the aqueous layer further extracted with ch 2 cl 2 . the combined organic layers were washed with water and then dried with mgso 4 . concentration afforded 15 . 9 g of a yellow oil which was chromatographed on silica gel ( 70 : 30 ch 2 cl 2 : hexane ) to give 10 . 7 g of pure trichloromethyl carbinol . a solution of this trichloromethyl carbinol ( 10 . 7 g ) in 50 ml of ch 2 cl 2 was added dropwise to a suspension of pcl 5 ( 4 . 0 g ) in 65 ml of ch 2 cl 2 . the reaction mixture was stirred for 30 minutes at which point an additional 2 . 4 g of pcl 5 was added . the mixture was stirred at room temperature for 2 hours and then poured carefully into 250 ml of ice - water . the layers were separated and the aqueous layer further extracted with ch 2 cl 2 . the combined organic layers were washed with water , saturated nahco 3 and brine . the organic solution was dried with mgso 4 and concentrated to give 11 . 0 g of product . this material was dissolved 30 ml of methanol and treated with a solution of naoh ( 1 . 7 g ) in 70 ml of methanol . the reaction mixture was stirred at room temperature for 16 hours and then the ph adjusted to 6 with acetic acid . the mixture was concentrated under reduced pressure and the residue partitioned between ether ( 200 ml ) and water ( 200 ml ). the layers were separated and the aqueous phase further extracted with ether . the combined ethereal layers were washed with water and then dried with mgso 4 . concentration afforded 9 . 63 g of 3 , 5 - di ( trichlorovinyl ) toluene , m . p . 41 . 4 °- 44 . 6 ° c . a solution of 3 , 5 - di ( trichlorovinyl ) toluene ( 6 . 0 g ) and dibenzoyl peroxide ( 200 mg ) in 150 ml of benzene was heated at reflux . n - bromosuccinimide ( 3 . 6 g ) was added in portions and the reaction mixture stirred at reflux for 3 hours . the mixture was evaporated and the residue triturated with 200 ml of hexane . the precipitated succinimide was collected and the filtrate concentrated to five 7 . 9 g of crude benzyl bromide . a solution of crude 3 , 5 - di ( trichlorovinyl ) benzyl bromide ( 7 . 9 g ) and sodium azide ( 1 . 9 g ) in 200 ml of ethanol was heated at reflux for 1 . 5 hours . the reaction mixture was concentrated and the residue partitioned between 100 ml of ether and 100 ml of water . the layers were separated and the aqueous phase further extracted with ether . the ethereal layers were washed with water , dried with mgso 4 , and concentrated to give 7 . 03 g of an oil . this material was chromatographed on silica gel ( hexane then 90 : 10 hexane : ch 2 cl 2 to give 3 . 52 g of pure azide . to a hot ( 60 ° c .) solution of cyanoacetamide ( 0 . 692 g ) in 25 ml of ethanol , 8 . 2 ml of a 1n methanolic solution of naoh was added and the resulting mixture stirred for 20 minutes . 3 , 5 - di ( trichlorovinyl ) benzyl azide ( 1 . 5 g ) was added in one portion and the resulting mixture stirred at 60 ° c . for 1 hour . the ph of the mixture was adjusted to 6 with acetic acid . the reaction mixture was then concentrated to a reduced volume and diluted with 100 ml of water . the aqueous mixture was extracted with ch 2 cl 2 ( 3 × 100 ml ). the combined organic layers were washed with water , dried with mgso 4 and concentrated to give 1 . 5 g of crude product . this material was chromatographed on silica gel ( 95 : 5 ch 2 cl 2 : ch 3 oh ) to give 890 mg of a solid . recrystallization from 5 ml of ethanol provided pure triazole , m . p . 167 °- 169 ° c .. a mechanically stirred mixture of 3 - methyl - 5 -( trichlorovinyl ) benzenediazonium hexafluorophosphate ( 10 g ) and sea sand ( 90 g ) are immersed in an oil bath at 160 °- 165 ° c . the mixture is stirred for 10 minutes at this elevated temperature and then permitted to cool . the reaction mixture is triturated in 300 ml of ether and filtered . the filtrate is washed with aqueous sodium bicarbonate and water . the ether solution is dried with mgso 4 and concentrated under reduced pressure . the residue is chromatographed on silica gel ( hexane ) to yield 3 - fluoro - 5 -( trichlorovinyl )) toluene . to a solution of 3 - fluoro - 5 -( trichlorovinyl ) toluene ( 2 . 39 g ) and dibenzoyl peroxide ( 0 . 2 g ) in 60 ml of benzene at reflux , n - bromosuccinimide ( 2 . 21 g ) is added in portions . the mixture is heated at reflux until the solution gives a negative reaction with potassium iodide . the reaction mixture is concentrated and the residue triturated with 100 ml of hexane . the precipitated succinimide is collected by filtration and the filtrate concentrated and then chromatographed on silica gel ( hexane ) to give the desired benzyl bromide . a solution of 3 - fluoro - 5 -( trichlorovinyl ) benzyl bromide ( 3 . 18 g ) and sodium azide ( 0 . 975 g ) in 25 ml of ethanol is heated at reflux for 2 hours . the reaction mixture is concentrated and the residue triturated with 50 ml of hexane . the mixture is filtered and the filtrate concentrated to give the desired azide . to a hot ( 60 ° c .) solution of cyanoacetamide ( 3 . 0 g ) in 120 ml of ethanol , 42 . 6 ml of a 1n methanolic solution of naoh is added . the resulting mixture is stirred for 20 minutes . a solution of 3 - fluoro - 5 -( trichlorovinyl ) benzyl azide ( 5 . 2 g ) in 40 ml of ethanol is added and the reaction mixture stirred at 60 ° c . for an additional hour . the mixture is cooled and then treated with acetic acid to adjust the ph to 6 . the solution is then concentrated under vacuum to a small volume and diluted with water . the precipitate is collected by filtration and thoroughly washed with water . the solid is then chromatographed on silica gel ( 97 : 3 ch 2 cl 2 : ch 3 oh ) to yield pure triazole . a cold (- 10 ° c .) solution of 2 - chloro - 4 - methylbenzaldehyde ( 15 . 96 g ) and chloroform ( 18 . 6 g ) in 62 ml of dimethylformamide ( dmf ) was treated dropwise with a methanolic solution of koh ( 4 . 66 g in 14 ml ). the reaction mixture was stirred at - 10 ° c . for two hours and then poured into a cold mixture of 1n hcl ( 140 ml ) and ch 2 cl 2 ( 140 ml ) with vigorous stirring . the layers were separated and the aqueous layer further extracted with ch 2 cl 2 . the combined organic layers were washed with water , dried with mgso 4 , and concentrated to give 15 . 1 g . chromatography 12 . 88 g of trichloromethyl carbinol product . to a suspension of pcl 5 ( 6 . 52 g ) in 150 ml of ch 2 cl 2 , a solution of the trichloromethyl carbinol ( 12 . 88 g ) in 75 ml of ch 2 cl 2 was added dropwise . the reaction mixture was stirred for 30 minutes and then an additional 4 . 0 g of pcl 5 was added . the reaction mixture was stirred for 3 hours and then carefully subjected to aqueous work - up to give 13 . 11 g of crude product . chromatography on silica gel ( petroleum ether ) provided 11 . 7 g of pure pentachloro derivative . a solution of this pentachloro derivative ( 11 . 68 g ) in 50 ml of methanol was added dropwise to a solution of naoh ( 2 . 06 g ) in methanol ( 100 ml ). the reaction mixture was stirred at room temperature for 18 hours at which point the ph of the solution was adjusted to 6 with hcl . the reaction mixture was concentrated and then partitioned between ether ( 400 ml ) and water ( 200 ml ). the ethereal layer was dried with mgso 4 and concentrated to give 10 . 1 g of 3 - chloro - 4 -( trichlorovinyl ) toluene . to a solution of 3 - chloro - 4 -( trichlorovinyl ) toluene ( 10 . 1 g ) and dibenzoyl peroxide ( 726 mg ) in 360 ml of benzene at reflux , n - bromosuccinimide ( 8 . 42 g ) was added in portions . the mixture was heated at reflux for 2 hours at which point the mixture gave a negative ki response . the reaction mixture was concentrated and the residue triturated with 300 ml of petroleum ether . the mixture was filtered and the filtrate concentrated in vacuo to give 14 . 77 g of crude benzyl bromide . a solution of 5 - amino - 1 , 2 , 3 - triazole - 4 - carboxamide ( 1 . 65 g ) in 50 ml of dimethylformamide ( dmf ) was treated with nah ( 50 % in mineral oil , 658 mg ) and stirred at room temperature for 20 minutes . to this mixture a solution of 3 - chloro - 4 -( trichlorovinyl ) benzyl bromide ( 5 . 7 g ) in 10 ml of dmf was added and the resulting reaction mixture stirred for 1 hour . the mixture was carefully poured into 500 ml of water and the ph of the resulting solution adjusted to 6 with acetic acid . the mixture was then extracted with ch 2 cl 2 ( 2 × 400 ml ). the organic layers were dried and concentrated . the resulting residue was chromatographed on silica gel ( 97 : 3 ch 2 cl 2 : ch 3 oh ) to give : 4 - amino - 1 -[ 3 - chloro - 4 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 5carboxamide ( 2 . 28 g ) and 5 - amino - 1 -[ 3 - chloro - 4 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide ( 1 . 2 g ). this latter material was recrystallized from ethanol to give pure triazole , m . p . 185 °- 186 . 5 ° c .. from the reaction of m - tolualdehyde ( 18 . 52 g ) and chloroform ( 27 . 88 ml ) in dimethylformamide ( 93 ml ) with koh ( 7 . 0 g ) in methanol ( 21 ml ) as in example 29 , 39 . 4 g of crude trichloromethyl carbinol was obtained . a suspension of pcl 5 ( 21 . 2 g ) in 500 ml of ch 2 cl 2 was treated with the crude trichloromethyl carbinol as in example 29 . after 15 minutes at room temperature , an additional portion of pcl 5 ( 12 . 91 g ) was added . appropriate work - up yielded 39 . 2 g of crude tetrachloro derivative . a solution of this tetrachloro derivative ( 39 . 2 g ) in methanol was slowly added to a solution of naoh ( 7 . 66 g ) in methanol ( 370 ml ) and stirred at room temperature for 24 hours . the reaction mixture was acidified to ph 6 with acetic acid and partially evaporated in vacuo . the oily residue was partitioned between ether ( 250 ml ) and water ( 200 ml ). the aqueous layer was further extracted with ether ( 200 ml ). the combined extracts were washed with water and dried over mgso 4 . concentration afforded the crude product which was purified by chromatography on silica gel ( petroleum ether ) to give 26 . 47 g of 3 -( trichlorovinyl ) toluene . from the reaction of 3 -( trichlorovinyl ) toluene ( 4 . 35 g ), dibenzoyl peroxide ( 0 . 363 g ), and n - bromosuccinimide ( 4 . 21 g ) in 180 ml of benzene as in example 30 , 6 . 56 g of crude benzyl bromide was obtained . the reaction of this crude benzyl bromide ( 6 . 56 g ) and sodium azide ( 1 . 92 g ) in ethanol ( 90 ml ) as in example 33 gave 5 . 48 g of crude benzyl azide . chromatography on silica gel yielded 3 . 29 g of pure 3 -( trichlorovinyl ) benzyl azide . from the reaction of cyanoacetamide ( 1 . 84 g ), 3 -( trichlorovinyl ) benzyl azide ( 2 . 59 g ) and 1n methanolic naoh ( 22 . 2 ml ) in ethanol ( 60 ml ) as in example 34 , 2 . 03 g of crude triazole was obtained . after recrystallization from isopropanol , 1 . 35 g of pure 5 - amino - 1 -[ 3 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide , m . p . 186 °- 188 ° c .., was obtained . from the reaction of p - tolualdehyde ( 18 . 52 g ) and chloroform ( 27 . 88 g ) in dimethylformamide ( 93 ml ) with koh ( 7 . 0 g ) in methanol ( 21 ml ) as in example 29 , 39 . 4 g of crude trichloromethyl carbinol was obtained . a suspension of pcl 5 ( 21 . 2 g ) in 500 ml of ch 2 cl 2 was treated with a solution of the crude carbinol ( 39 . 4 g ) in 120 ml of ch 2 cl 2 as in example 29 . after 15 minutes at room temperature an additional portion of pcl 5 ( 12 . 91 g ) was added . the same reaction conditions and work - up as in example 29 yielded 41 . 7 g of crude tetrachloro derivative . a solution of the tetrachloro adduct in methanol ( 100 ml ) was slowly added to a solution of sodium hydroxide ( 7 . 66 g ) in methanol ( 370 ml ) and stirred at room temperature for 18 hours . the reaction mixture was acidified to ph 6 with acetic acid and partially evaporated in vacuo . the oily residue was partitioned between ether ( 250 ml ) and water ( 200 ml ). the aqueous layer was further extracted with an additional 200 ml of ether . the combined extracts were washed with water , dried with mgso 4 , and concentrated to yield the crude product . purification on silica gel ( petroleum ether ) yielded 14 . 69 g of pure 4 -( trichlorovinyl ) toluene . from the reaction of 4 -( trichlorovinyl ) toluene ( 4 . 35 g ), dibenzoyl peroxide ( 0 . 363 g ), and n - bromosuccinimide ( 4 . 21 g ) in 180 ml of benzene at reflux as in example 30 , 6 . 7 g of crude benzyl bromide was obtained . the reaction of this crude benzyl bromide ( 6 . 7 g ) and sodium azide ( 1 . 92 g ) in ethanol ( 90 ml ) at reflux as in example 33 yielded 5 . 7 g of crude benzyl azide . chromatography on silica gel afforded 3 . 98 g of pure 4 -( trichlorovinyl ) benzyl azide . from the reaction of cyanoacetamide ( 1 . 84 g ), 4 -( trichlorovinyl ) benzyl azide ( 2 . 59 g ), and 1n naoh ( 22 . 2 ml ) in ethanol ( 60 ml ) as in example 34 , 2 . 00 g of crude triazole was obtained . recrystallization from isopropanol gave 0 . 867 g of pure 5 - amino - 1 -[ 4 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide , m . p . 200 °- 203 ° c .. 2 , 6 - dichloro - 4 - methylaniline ( 30 . 4 g ) was converted to 2 , 6 - dichloro - 4 - methylbenzaldehyde ( 6 . 54 g ) according to the general procedure of jolad and rajagopal ( organic synthesis , collected volume i . pp 139 - 141 ). this aldehyde ( 2 . 44 g ) was reacted with chloroform ( 2 . 40 g ) and methanolic koh ( 610 mg in 1 . 8 ml ) in dimethylformamide ( 8 ml ) according to the procedure described in example 29 to give 3 . 5 g of crude trichloromethyl carbinol . a suspension of pcl 5 ( 2 . 80 g ) in 60 ml of ch 2 cl 2 was treated with a solution of the crude trichloromethyl carbinol ( 3 . 5 g ) in 20 ml of ch 2 cl 2 as in example 29 . after 15 minutes at room temperature , an additional 1 . 6 g of pcl 5 was added . appropriate reaction times and work - up as in example 29 afforded 2 . 8 g of hexachloro product . a solution of this material ( 2 . 8 g ) in 15 ml of methanol is added dropwise to a solution of naoh ( 0 . 5 g ) in 25 ml of methanol as in example 29 . the reaction mixture is stirred at room temperature for 15 hours at which point the ph of the solution is adjusted to 6 with hydrochloric acid . the reaction mixture is concentrated and partitioned between ether and water . the ethereal layer is dried and concentrated . the residue is chromatographed on silica gel to give pure 3 , 5 - dichloro - 4 -( trichlorovinyl ) toluene . from the reaction of 3 , 5 - dichloro - 4 -( trichlorovinyl ) toluene ( 2 . 15 g ), dibenzoyl peroxide ( 0 . 33 g ), and n - bromosuccinimide ( 2 . 05 g ) in 85 ml of benzene at reflux as in example 30 , 3 , 5 - dichloro - 4 -( trichlorovinyl ) benzyl bromide is obtained . this material ( 2 . 7 g ) and sodium azide ( 0 . 8 g ) in ethanol ( 25 ml ) is heated for 2 hours . the crude product is chromatographed on silica gel to give pure 3 , 5 - dichloro - 4 -( trichlorovinyl ) benzyl azide . from the reaction of cyanoacetamide ( 0 . 92 g ), 3 , 5 - dichloro - 4 -( trichlorovinyl ) benzyl azide ( 1 . 25 g ), and 1n methanolic naoh ( 11 . 1 ml ) in ethanol ( 30 ml ) as in example 34 , crude triazole is obtained . this material is chromatographed on silica gel to give pure 5 - amino - 1 -[ 3 , 5 - dichloro - 4 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide . a solution of 5 - iodo - m - xylene ( 2 . 3 g ) in dimethylformamide ( dmf )( 30 ml ) and copper bronze ( 0 . 65 g ) in a stainless steel tube is cooled and treated with trifluoromethyliodide ( 15 g ). the tube is sealed and heated at 130 °- 140 ° c . in a rocking autoclave for 6 hours . after cooling and venting , the reaction mixture is diluted with water and extracted with n - hexane ( 2 × 200 ml ). the combined hexane extracts are washed with aqueous nahco 3 and water . after drying over mgso 4 , the solvent is removed under reduced pressure . the residue is subjected to chromatography over silica gel to yield purified 5 -( trifluoromethyl )- m - xylene . a solution of 5 - trifluoromethyl - m - xylene ( 3 . 4 g ) and dibenzoyl peroxide ( 0 . 25 g ) in 100 ml of benzene at reflux is treated with n - bromosuccinimide ( 4 . 4 g ) in portions . the mixture is heated until a negative potassium iodide test is obtained . the reaction mixture is cooled and concentrated in vacuo . the residue is triturated with n - hexane and the solids are removed by filtration . the filtrate is evaporated to give the oily crude benzyl bromide . the crude benzyl bromide ( 5 . 3 g ) is dissolved in acetic acid ( 50 ml ) and treated with potassium acetate ( 2 . 9 g ). the mixture is heated at reflux for 2 hours . the solvent is removed and the residue extracted with ether . the ether extracts are washed with aqueous nahco 3 and water . after drying with mgso 4 , the ethereal solution is evaporated to yield the crude benzyl acetate which is then hydrolyzed to the benzyl alcohol with methanolic koh as in example 10 . the crude product is then chromatographed on silica gel to give 3 - trifluoromethyl - 5 - methylbenzyl alcohol . a solution fo oxalyl chloride ( 2 . 8 ml ) in 20 ml of ch 2 cl 2 is treated with a solution of dimethyl sulfoxide ( dmso )( 5 . 0 ml ) in 15 ml of ch 2 cl 2 at - 60 ° c . as in example 11 . to this mixture is added the 3 - trifluoromethyl - 5 - methylbenzyl alcohol ( 5 . 4 g ) in ch 2 cl 2 ( 20 ml ) followed by 20 ml of triethlyamine . appropriate reaction conditions and work - up as in example 11 afforded 3 - trifluoromethyl - 5 - methylbenzaldehyde . the reaction of 3 - trifluoromethyl - 5 - methylbenzaldehyde ( 5 . 8 g ) and chloroform ( 3 . 8 ml ) in dmf ( 20 ml ) with 5n methanolic koh ( 4 . 19 ml ) as in example 29 yields the crude trichloromethyl carbinol . this material as a solution in ch 2 cl 2 ( 50 ml ) is added to a stirred suspension of pcl 5 ( 4 . 0 g ) in 65 ml of ch 2 cl 2 at room temperature . after 15 minutes an additional portion of pcl 5 ( 2 . 4 g ) is added . the reaction condition and work - up is the same as in example 29 . this crude tetrachloro derivative is dissolved in 50 ml of methanol and treated with a solution of naoh ( 2 . 2 g ) in methanol ( 30 ml ). the reaction mixture is stirred for 16 hours and then treated with acetic acid to adjust the ph of the mixture to 6 . the reaction mixture is concentrated and the residue partitioned between ether and water . the layers are separated and the aqueous phase repeatedly extracted with ether . the combined organic layers are washed with brine , dried with mgso 4 , and concentrated under reduced pressure . the crude product is chromatographed on silica gel to yield pure 3 - trifluoromethyl - 5 - trichlorovinyltoluene . a solution of 3 - trifluoromethyl - 5 - trichlorovinyltoluene ( 2 . 89 g ) and dibenzoyl peroxide ( 0 . 2 g ) in benzene ( 40 ml ) at reflux is treated with n - bromosuccinimide ( 2 . 21 g ) as in example 30 . the hexane soluble portion affords the crude benzyl bromide ( 3 . 67 g ) which when heated with sodium azide ( 0 . 975 g ) in ethanol ( 30 ml ) at reflux for 2 hours as in example 33 provides the desired benzyl azide . from the reaction of 3 - trifluoromethyl - 5 - trichlorovinylbenzyl azide ( 1 . 07 g ) and cyanoacetamide ( 0 . 616 g ) in 20 ml of ethanol with 1n methanolic naoh ( 7 . 4 ml ) as in example 34 , one obtains the crude triazole derivative . chromatography on silica gel ( 97 : 3 ch 2 cl 2 : ch 3 oh ) provides purified 5 - amino - 1 -[ 3 -( trifluoromethyl )- 5 -( trichlorovinyl ) benzyl ]- 1 , 2 , 3 - triazole - 4 - carboxamide . | 2 |
as shown in fig1 through 13 , the drawings show that the irrigation oriented valve system comprises a main body 1 , water inlet conduit 11 , manifold 4 , water outlet conduit 5 , multiple water chambers 41 , multiple solenoid switches 3 and multiple manual switches 2 , wherein the main body 1 is a basic outer casing of a valve , the main body 1 is disposed with multiple pores for use in connection with water inlet conduit 11 , manifold 4 , water outlet conduit 5 , the water inlet conduit 11 , manifold 4 , water outlet conduit 5 and water chamber 41 are formed into a single structure and disposed inside the main body 1 . in the present embodiment of the current invention , the valve is disposed with more than one valve , where the valve has a manual switch 2 and a solenoid switch 3 . fig1 shows a frontal view of the manual switch 2 , an end of the main body 1 is disposed with a water inlet conduit 11 , the manifold 4 extends into a first water outlet opening 411 and further into a water chamber 41 , which is further connected to a second water outlet 412 and then introduced into a third water passage 44 , a third water outlet opening 51 and a water conduit ( not shown in figs .). the third water outlet opening 51 extends away from the main body 1 , the frontal face of the main body 1 is disposed with a manual valve switch 2 having a rotating lever 21 , the rotating lever 21 is a controller for an operable valve 22 . in one embodiment of the present invention , there is an instruction label showing on one surface of the rotating lever 21 that the surface of the main body 1 is labeled with symbols a , b , c , where a represents automatic mode ( auto ), indicating that the solenoid switch 3 is turned to an automatic mode , b represents on - state ( on ), indicating that the manual switch 2 is turned on , c represents off - state ( off ), indicating that the manual switch 2 is engaged in forcing the solenoid valve to exit a water discharge mode ; and third water outlet openings 51 are installed on corresponding ends of each valve . as shown in fig2 to 10 , the water inlet conduit 11 is disposed on one end of the main body 1 , the manifold 4 stems from a part of the water inlet conduit 11 and extends to form into a number of bifurcating water conduits . inside each manifold 4 there is disposed with a manual switch 2 and a solenoid switch 3 , the manual switch 2 is disposed on a corresponding position relative to the solenoid switch . more specifically , the manual switch 2 communicates with one end of the third water passage 44 of the solenoid switch 3 . with regard to the manifold 4 , each manifold houses a water chamber 41 , an inside of the water chamber is disposed with a valve , the valve comprises interchangeably corresponding manual switch 2 and solenoid switch 3 , the solenoid switch 3 comprises : a connecting pipe 31 , a valve stem 32 , a seat 33 , an electromagnetic coil 34 and a magnet 35 , the water outlet conduit 5 is disposed on its inside two stabilizers 52 , which are designed to provide a means for arranging the two default grooved sections 441 c of the water leakage prevention device 441 to service a rail track function . the water leakage prevention device 441 has a first port 441 a and a second port 441 b and two grooved sections 441 c . the first port 441 a appears as a pipe opening , the first port 441 a faces toward the second water outlet opening 412 , and a third gasket is inserted on the first port 441 a , so as to offer an equipment for sealing for resolving dripping of the second water outlet opening 412 . as shown in fig3 , the inner diameter and width of the third gasket 442 substantially matches the outer diameter and width of the first port 441 a , and is inserted onto the first port 441 a and has a surface protruding away from the first port 441 a , the third gasket 442 is made of a soft plastic material . the connecting pipe 31 is disposed on one end of the water chamber 41 , and an inside of the connecting pipe 31 has a partitioning wall 311 to separate the space into a front space and a back space , a magnet 35 is disposed in the back space , a movable valve stem 32 is disposed inside the front space . the distal end of the valve stem is a valve plug having a conical shape , which can work to seal or open the seat 33 by way of mechanical displacement . the seat 33 is located at an engaging place between the outlet opening of the connecting pipe 31 and the first water passage 42 , the connecting pipe 31 has an electromagnetic coil wrung around the outside of the connecting pipe . the electromagnetic coil 34 is connected to the electrical circuit and provides for circuit conversion to turn on and off the conductive state of the electromagnetic coil 34 so as to change the polarity of the valve between positive or negative . polarity of one end of the valve stem 32 is negative and another end of the valve stem 32 is positive , transition of state between each is obtained by way of electromagnetic coil 34 , so as to separate the valve stem 32 and the magnet 35 , or attract valve stem 32 and the magnet 35 together . the vale 33 is placed at an engaging place between a connecting pipe 31 and a first water passage 42 , or the valve stem 32 is attracted to the valve stem 32 to open the first water passage 42 . the magnet 35 is disposed at one end of the connecting pipe 31 and is separated through a partitioning wall 311 and fixed at a specific location , and is electrically connected to an electromagnetic coil 34 . the valve stem 32 installed inside the connecting pipe is disposed on another surface of the partitioning wall 311 . the valve stem 32 is free to move in an axial direction inside the connecting pipe 31 , an end of the valve stem 32 is a valve plug , which can push against the valve 33 to provide a means for sealing the first water passage 42 or exit the valve 33 to provide a means for opening the first water passage 42 . when the electromagnetic valve closes the first water passage 42 , an electrically turned - on electromagnetic coil 34 would produce a magnetic polarity opposite to the magnetic polarity of one end of the valve stem 32 , which will make the valve stem 32 to detach from the magnet 35 , and instantly become subject to a reverse movement , making the vale stem 32 to closely push against the valve 33 and therefore close the first water passage 42 . furthermore , when the electromagnetic coil 34 is electrically turned - on to produce a magnetic polarity attractive to an end of the valve stem 32 , making the valve stem 32 attracted to the magnet 35 , the valve stem 32 is dislodged from the valve 33 , leaving the valve 33 to an open sate to allow water flow at the first water passage 42 for directing the water flow to go into the third water passage 44 . as shown in fig2 and 4 , the manual switch 2 comprises a rotating lever 21 and valve 22 , the rotating valve 21 is a means for controlling the axial rotation of the valve 22 . the rotation of the valve 22 is deemed as an option for opening or closing the first water passage 42 and second water passage 43 . the rotating lever 21 comprise a driver 211 , a base disc 213 , a shaft 214 , a positioning device 6 and a first gasket 23 . the driver 211 provides a torsional functionality of the rotating lever 21 , which is disposed on an outer surface of the main body 1 , which extends from an inside of the main body to expand into a base disc 213 . the base disc 213 is disposed with positioning hole 212 , the positioning hole 213 is used as a wedge to push against the positioning device 6 when the driver 211 turns . the shaft 214 is disposed on another end of the rotating lever 21 , and extends to stick outward to connect with the valve 22 . the first gasket 23 is inserted into onto the grooved section of the outer diameter of the shaft 214 , so as to prevent water leakage from the water chamber 41 . the first gasket 23 is made from a soft plastic material . the valve 22 is a cylindrical valve and has a valve port 222 , a valve plane 221 , a closed portion 223 , a second gasket 224 and a valve blocking portion 225 . the valve port 222 provides a way for the water to flow from the first water passage 42 to the second water outlet opening 412 , and offers use for water discharge when the solenoid switch 3 is turned on . the valve plane 221 serves to direct water flowing from the manifold 4 to go into the second water outlet opening 412 via the second water passage 43 . the closed portion 223 serves to seal the first water outlet opening 411 so as to force close the on - state of the solenoid valve . the second gasket 224 is inserted onto grooved section of outer diameter of a cylindrical valve 22 such that water flow from the water inlet opening 226 of the second water passage 43 , through valve port , to the second water outlet opening , can be prevented . the second gasket 224 is made by a soft plastic material . the valve blocking portion 225 is disposed at the valve 22 facing one end of the first water passage 42 , or opens the first water passage 42 when the valve 33 is detached from the valve blocking portion 225 . the positioning device 6 is disposed at an inside surface opposite to the base disc 213 of the rotating lever 21 . an inside of a pre - established assembly space 45 disposed on the outer surface of the water chamber 41 comprises an expansion portion 61 and a shrinkage portion 62 , which are installed with a spring inside the assembly space 45 . one end of the spring 7 is inserted onto the shrinkage portion 62 and pushes against the expansion portion 61 , another end of the spring 7 is disposed inside the assembly space 45 . the shrinkage portion 62 is placed in the inner storage space of the spring 7 , the expansion portion 61 substantially pushes against the outer wall of the spring , making the expansion portion 61 to protrude away from the exterior surface of the spring 7 &# 39 ; s storage space , such that a distal end of the expansion portion 61 can always make the rotating lever 21 to hanker into a secured spot when the positioning hole 212 of the bas disc 213 is set into a desired location , when the every time the rotating lever 21 is turned . fig5 to 7 show views of the valve operating in an automatic mode . when the rotating lever 21 is dialed to the automatic symbol a ( auto ), the valve port 22 of the valve will turn to face the second water outlet opening 412 , the second water passage 43 is sealed . the first water outlet opening 411 is opened and communicates with the first water passage 42 , and this is where the water of the water passage flows from . the objective to achieve automatic water turn - on by use of solenoid valve and water close - off by use of manual switch is such that when the solenoid valve is turned on , water discharging from the first water passage 42 can flow into the water inlet opening 226 through the valve 22 , and into the third water passage 44 through the valve port 222 . furthermore , when the solenoid switch 3 presents a shut - down condition for the first water passage 42 , the valve stem 32 will seal the seat 33 with the valve plug . a wall of the corresponding seat 33 works to push against the valve blocking portion 225 of the valve 22 . this is essentially to mean that water discharge from the first water passage 42 and the second water passage 43 are sealed off at the same time . the purpose of this is to contribute to automatic water shut - down by use of solenoid switch . fig8 and 10 show examples highlighting the instruction labels pointing to the symbol c ( off ), the closed portion 223 of the valve 22 pushes against the first water outlet opening 411 and the second water outlet opening 412 in order to prevent the water from the first water passage 42 and the second water passage 43 from leaking . even if the solenoid switch 3 appears to be in an on - state , water discharge from the first water passage 42 and the second water passage 43 will be sealed by the valve port of the valve 22 . the purpose of this is contributive to enabling manual force shut - down of water . as shown in fig1 to 13 , examples are shown for situations where the rotating lever 21 points to the symbol b ( on ). in this condition , the valve plane 221 of the valve 22 is turned to the second water outlet opening 412 . the design here is configured in such a way that even if the second water outlet opening 412 is opened and can communicate with the second water passage 43 , and this is where the water of the water passage flows from . when the first water passage 42 of the solenoid switch is closed , the water discharge from the second water passage 43 can flow into the second water outlet opening 412 , and the water discharge from the third water passage 44 can flow into the third water outlet opening 51 . this is designed to allow for force opening for water by use of manual switch . the invention has been described herein by illustration of a preferred exemplary embodiment . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense . further , it will be apparent to those skilled in the art that other embodiments having equivalent modification and change are possible within the scope of the invention . | 5 |
the elements illustrated in the figures interoperate as explained in more detail below . before setting forth the detailed explanation , however , it is noted that all of the discussion below , regardless of the particular implementation being described , is exemplary in nature , rather than limiting . referring to fig1 , an exemplary craftwork accessory 100 is shown . the accessory 100 may include a base portion 110 , one or more elevated side portions 120 a , 120 b and 120 c , and cover portion 130 . the side portions 120 a - c may define a workspace 112 on the base portion 110 that may be used to place the item to be stamped or otherwise adorned . in some embodiments , such as the embodiment shown in fig1 , the accessory 100 may include three elevated side portions 120 a - c . in other embodiments , more or less elevated side portions may be provided . the cover portion 130 may be moveably attached to the base portion 110 . alternatively , or additionally , the cover portion 130 may be attached to one or more side portions 120 a - c and / or the base portion 110 . in the illustrated embodiment , the cover portion 130 is attached to the base portion 110 by a hinge assembly 140 . other mechanisms for moveably attaching the cover portion 130 to other components of the accessory 100 may also be used . these may include , for example , brass hinges , piano hinges , non - hinge assemblies , and the like . in one embodiment , the overall footprint of the accessory 100 is about 8 ″ by about 10 ″. in other embodiments , the width of the footprint of the accessory 100 may be between about 5 ″ and about 15 ″ and the length of the footprint of the accessory 100 may be between about 6 ″ and about 16 ″. these sizes typically allow the accessory 100 to be compatible with most common cardstock and the like while maintaining portability of the accessory 100 . other sizes may also be used . alternatively , or additionally , the accessory 100 may be sold in various sizes , such as extra small , small , medium , large , and extra - large and / or in various colors . in some embodiments , different colors may be used for different components of the accessory . the components of assembly 100 may be made of any suitable material , for example , rigid or semi - rigid materials such as acrylic , metal , tempered glass , cardboard and the like may be used . the components may be made of the same material , or different components may be made using different materials or combinations of materials . the assembly 100 as a whole may be made of a unified construction , subsets of components made of a unified construction , or each component may be separately constructed . an exemplary base portion 110 of an exemplary craftwork accessory 100 is shown in fig2 . the base portion 110 may be made of any suitable rigid or semi - rigid material , such as acrylic or the like . the base portion 110 may be translucent or opaque , clear or colored . the base portion 110 may define some or all of the footprint of the accessory item 100 . for example , the base portion 110 may have a width of about 8 ″, a length of about 10 ″, and a thickness of about 3 / 32 ″. other sizes may also be used . the base portion 110 may include indicia 114 ( fig8 a ) to facilitate of an item on the workspace 112 of the base portion 110 . the indicia 114 may include , for example , grid lines , ruler markings , and the like . the indicia 114 may be printed or laser etched onto either an upper or lower surface of the base portion 110 itself . alternatively , or additionally , additional components including indicia 114 may be placed under or atop the base portions 110 , such as a piece of grid paper , to facilitate alignment of the item on the workspace . optionally , the bottom of the base portion 110 may be made of a material having a suitable coefficient of friction to impede movement or slippage of the accessory 100 during normal use ( also referred to herein as a “ non - slip ” surface ). alternatively or additionally , such a material may be attached to or applied to the bottom or the top of the base portion 110 . optionally , the accessory may include a fastening mechanism for securing the item to the work space . in one embodiment , the base portion 110 may include metal or other ferromagnetic material 118 ( fig5 ) for cooperating with a magnet 119 ( fig8 b ) placed on top of the item to secure the item on the workspace 112 . alternatively , or additionally , the ferromagnetic material 118 may be disposed above or below some or all of the workspace 112 . other mechanism may also be used to fasten the item to the workspace 112 . for example , a top surface of the workspace 112 may have a coefficient of friction that impedes movement of an item placed thereon . fig3 a - b show exemplary side portions 120 a - c of an exemplary craftwork tool . in fig3 a , a top view of an exemplary side portions 120 a - c are shown . the side portions 120 a - c may be made up of a single piece or multiple pieces . the side portions 120 a - c may be disposed to the top of the base portion 110 . alternatively , or additionally , one or more of the side pieces may be attached to another part of the base portion 110 , such as a side of the base portion 110 . in one embodiment , the side portions may be attached to the top of the base portion 110 and have a thickness of at least about one - eighth inch so as to define a workspace 112 that is about one - eight inch deep . other thicknesses may be used , such as one - quarter inch , one - third inch , one - half inch and the like . in some embodiments , one or more spacers 113 ( fig6 ) may be provided with the accessory to reduce the depth of the workspace 112 relative to the elevated side portions 120 a - c . spacer 113 may be , for example , a foam pad . the spacer 113 may have a thickness proportional to the depth of the workspace 112 , such as a thickness corresponding to one - half or one - quarter the depth of the workspace 112 . any other ratio may also be used . each side portion 120 a - c may be the same thickness and / or width , or each side portion 120 a - c may vary in thickness and / or width . for example , each side portion 120 a - c may be about three - quarters inches wide . the width of the side portions 120 a - c may vary with the overall footprint of the accessory 100 . in some embodiments , the width of a side portion 120 a - c may be between about five percent and about twelve percent of the length or width of the overall footprint of the accessory 100 . the side portions 120 a - c may span some or all of the length of a side of the accessory 100 , and each side piece 120 a - c may span a different length of its corresponding side . in some embodiments , the side portions 120 a - c may span at least one - fifth of the length of the side of the accessory 100 . in other embodiments , the side portions 120 a - c may span at least one fourth , one - third , or one - half of the length of a corresponding side of the accessory 100 . other lengths may also be used . the inner part of the side portions 120 a - c may abut the upper surface of base portion 110 , or one or more of the side portions 120 a - c may include a recessed portion 124 that provides a gap between the upper surface of the base portion and a surface of side portion 120 a - c . an example of this is shown in fig3 b . the recessed portion 124 may allow a user of the accessory 100 additional alignment options , such as when creating a border on the item . optionally , the side portions 120 a - c are dimension to allow for the inclusion of indicia 122 for facilitating alignment of the item and / or stamp or other embellishment items . in some embodiments , indicia 122 may be disposed in one - eighth inch increments along one or all of the side portions 120 a - c . other increments , such as numbers , gridlines and the like , also may be provided and different indicia may be placed on different side portions or within the same side portion . the indicia may be laser etched or printed to the side portion , or may be on a sticker , decal or the like affixed to one or more of the side portions 120 a - c . combinations of techniques and / or indicia may also be used . in addition , any of the techniques for providing any indicia on any of the components of the accessory 100 may be used to provide indicia on any of the other components . fig4 shows a cover portion 130 of an exemplary craftwork tool . the cover portion 130 may be dimensioned similarly to the base portion 110 , or may be dimensioned differently . in one embodiment , the cover may be about 8 ″ wide by about 10 ″ long . other sizes , such as sizes appropriate for an accessory 100 having an overall footprint in the ranges discussed above , may also be used . the cover may be made of any suitable rigid or semi - rigid material , such as acrylic or the like . preferably , the cover is translucent so as to allow a user of the accessory 100 to see the workspace even if the cover is closed . in other embodiments , the cover may be opaque . preferably , the cover includes indicia 132 for facilitating alignment of the item and / or stamp . for example , indicia 132 may include one - quarter inch gridlines , one - eighth inch , and the like . the indicia 132 may be , for example , printed or etched onto the cover 132 . other methods of placing indicia 132 on the cover 130 may also be used . in some embodiments , the cover portion 130 does not include any indicia 132 . fig5 shows a cross - sectional view of an exemplary craftwork tool . as illustrated , the accessory 100 includes a base portion 110 , side portions 120 a - b , and a cover portion 130 attached to the base portion 110 by a hinge assembly 140 . in addition , a piece of ferromagnetic material 118 is provided under the base portion 110 . the ferromagnetic material 118 may be secured in position by a non - slip surface 116 , which may be attached to the base . alternatively , both the ferromagnetic material 118 and the non - slip surface 116 may be attached to the base portion 110 independently . fig6 shows a cross sectional view of another exemplary craftwork tool . similar to the embodiment shown in fig5 , the accessory 100 includes a base portion 110 , side portions 120 a - b , and a cover portion 130 attached to the base portion 110 by a hinge assembly 140 . in the embodiment shown in fig6 , a piece of ferromagnetic material 118 is provided in a recessed portion of the base portion 110 . additionally , an element 115 having indicia for alignment is also provided in the recessed portion of the base portion 110 so as to be visible by a user looking down on the workspace 112 . element 115 may be , for example , a piece of grid paper or the like . a removable spacer 113 is also provided in the workspace 112 to reduce the depth of the workspace 112 . fig7 shows a flow chart of an exemplary method of operation of an exemplary craftwork tool and fig8 a - g shows a series of depictions of an exemplary craftwork tool while performing the steps shown in fig7 . initially , a user opens the cover portion 130 of the accessory 100 at step 710 ( as shown in fig8 a ). the user then aligns the item in the workspace 112 and optionally secures the item in place at step 720 ( as shown in fig8 b ). in the illustrated embodiment , the item is secured in place by placing a magnet 119 on top of the item . next , the user aligns the stamp on top of the item in a desired position at step 730 ( as shown in fig8 c ). in the illustrated embodiment , the user places a “ happy birthday ” stamp on the item . at step 740 , the user closes the cover portion 130 and presses down to secure the stamp to the cover portion 130 ( as shown in fig8 d ). the user then opens the cover portion 130 and inks the stamp at step 750 ( as shown in fig8 e ). once the stamp is inked , the user may close the cover portion 130 and press down to impress the image on the item at step 760 ( as shown in fig8 f ). as a result , the item is left with an impression of the stamped image as shown in fig8 g . as should be apparent to one in the art , if a clean impression is not made on the first attempt , the user may reapply ink and / or repress the stamp as necessary . additionally , because both the item and the stamp are secured in their portions , the user may re - ink the stamp with various colors and apply the new impression to the enhance or otherwise alter the image on the item , or create multiple copies of the same item be aligning a new item in the same position and restamping . additionally , the top of the cover may be used in a similar manner to stamp items that are not placed in workspace 112 , such as oversized items . referring to the embodiment shown in fig8 a - g a user can ( 1 ) place an item to the right of the accessory 100 , ( 2 ) align a stamp on the item , ( 3 ) open the cover 130 and secure the stamp to the cover 130 , ( 4 ) close the cover 130 and ink the stamp and ( 5 ) open the cover 130 to stamp the item . other methods of operation may also be apparent to one of ordinary skill . thus , the accessories 100 described herein provide solutions that offer a portable and easy - to - use tool for creating high - quality stamp impressions for a wide variety of uses . while various embodiments of the invention have been described , it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible within the scope of the invention . accordingly , the invention is not to be restricted except in light of the attached claims and their equivalents . | 1 |
fig1 of the drawing illustrates a sewing machine with fragments of two mechanisms shown thereon , the needle positioning and the work feeding mechanism , which can contribute to changes in the relative coordinates of successive needle penetrations . as shown in phantom lines in fig1 the sewing machine casing 10 includes a bed 11 , a standard 12 rising from the bed 11 and a bracket arm 13 overhanging the bed 11 . the driving mechanism of the sewing machine includes an arm shaft 14 and a bed shaft 15 interconnected by a timing belt ( not shown ) in the standard 12 , the timing belt being driven by the main drive motor ( also not shown ) of the sewing machine . a needle 16 carried for endwise reciprocation by a needle bar 17 is mounted for lateral jogging movement in a gate 18 in the bracket arm 13 . any conventional connections ( not shown ) may be used between the arm shaft 14 and the needle bar 17 for imparting needle reciprocation . a drive link 19 pivoted at 20 to the gate 18 serves to impart lateral jogging movement to the needle 16 . the drive link 19 is connected to a linear actuator 20a which controls the position of the link 19 and hence the lateral position of the needle 16 . also illustrated in fig1 is a fragment of a work feeding mechanism including a feed dog 21 carried by a feed bar 22 . in fig1 a mechanism is illustrated for imparting work transporting movement to the feed dog 21 including a feed drive shaft 23 driven by gears 24 from the bed shaft 15 , a cam 25 on the feed drive shaft 23 , a pitman 26 embracing the cam 25 and connected to reciprocate a slide block 27 in a slotted feed regulating guideway 28 . a link 29 pivotally connects the pitman 26 with the feed bar 22 so that depending upon the inclination of the guideway 28 , the magnitude and direction of the feed stroke of the feed dog 21 will be determined . the inclination of the guideway 28 is controlled by a linear actuator 30 , connected to a link 31 . the link 31 is pivoted at 32 to a rock arm 33 carried on a rock shaft 34 secured to the guideway 28 . movement of the linear actuator 30 controls the position of the link 31 and the inclination of the guideway 27 . also shown in fig1 is a printed circuit board 40 which illustratively has mounted thereon memory means for storing stitch pattern information and control circuitry for operating the linear actuators 20a 30 in accordance with the stored information . the circuitry on the board 40 will not be described in any greater detail than is necessary for an understanding of the principles of this invention and such explanation will be given in conjunction with a description of the block diagram of fig5 . if additional information is desired , the reader is referred to the above - referenced u . s . pat . no . 3 , 872 , 808 . in accordance with the principles of this invention , a transparent display window 45 is provided in the front face of the sewing machine arm 13 . behind the window 45 and within the arm 13 is a graphic pattern display element 46 mounted on a cylindrical member 47 . the cylindrical member 47 is mounted on the shaft 48 of a stepping motor 49 in a conventional manner and is adapted to be rotated therewith . the stepping motor 49 is conventionally mounted ( by means not shown ) within the arm 13 . suspended within the cylindrical member 47 is a source of light , illustratively a miniature incandescent lamp 50 . a shaft position sensor and encoder 51 is coupled to the shaft 48 . the cylindrical element 47 is transparent to allow light from the light source 50 to pass therethrough . the display element 46 is a transparent graphic pattern display having a plurality of substantially equal size stitch pattern image areas thereon . each of the image areas is a graphical representation of one of the patterns which may be formed by utilizing the information stored within the memory means on the circuit board 40 . illustratively , there are 24 patterns which may be produced in accordance with the information stored in the memory means . therefore , the display element 46 has 24 image areas , each occupying 15 ° out of the total 360 ° of circumference of the cylindrical member 47 . accordingly , the stepping motor 49 is chosen to be a 15 ° per step stepping motor , preferrably of the permanent magnet type which is of low cost . besides being of low cost , another advantage of utilizing a permanent magnet stepping motor is that it maintains its position when power is reduced or removed . as shown in fig4 the display window 45 is chosen to be of sufficient dimension that three of the image areas on the display element 46 are visible therethrough . in accordance with the principles of this invention , three operator controllable actuators 52 , 53 and 54 are provided . illustratively , these actuators are push button switches . a preferred method of operating the sewing machine 10 in order to select a desired pattern is for the operator to push the actuator 53 . this causes , in a manner to be described in detail hereinafter , the stepping motor 49 to advance the cylindrical member 47 three steps so that three different image ares are visible through the display window 45 . the operator continues pushing the actuator 53 until the desired pattern is visible . if the desired pattern is the center pattern of the three visible patterns , no further action is required by the operator . if the desired pattern is the leftmost visible pattern , the operator pushes the actuator 52 . this causes the stepping motor 49 to move one step in the &# 34 ; left &# 34 ; direction so that the prior leftmost pattern becomes the center pattern viewed through the display window 45 . likewise , if the desired pattern is the rightmost pattern of the three patterns which are visible through the display window 45 , the operator then pushes the right actuator 54 to cause the stepping motor 49 to move in the &# 34 ; right &# 34 ; direction to center the prior rightmost pattern . the angular position of the stepping motor shaft 48 , as sensed by the shaft position sensor 51 , is designed to correspond to the center pattern which is visible through the display window 45 . referring now to fig5 depicted therein is a block schematic diagram of illustrative control circuitry for the pattern selection and display arrangement according to this invention . as shown in fig5 the shaft 48 of the stepping motor 49 is coupled to the shaft position encoder 51 . the encoder 51 is of conventional design and provides over the output leads 55 a five bit digital code indicative of the angular position of the shaft 48 . there are 24 angular positions which the shaft 48 can assume , each of these positions corresponding to one of the sewing machine stitch patterns . the five bit code over the leads 55 is an input to the address memory circuit 56 . the address memory circuit 56 corresponds to the address memory 91 shown in fig2 of the above - referenced u . s . pat . no . 3 , 872 , 808 . as disclosed in that patent , the output of the address memory 56 is a code word representing the pattern selected , the bight and feed information for forming the pattern then being retrieved from the memory unit . thus , the angular position of the shaft 48 is sensed to uniquely determine the selected pattern . in order to control the stepping motor 49 to display , and hence select , the desired pattern , a stepping motor drive control circuit 57 is provided . the stepping motor drive control circuit 57 is of conventional design and responds to pulses on its &# 34 ; right &# 34 ; input lead 58 to cause the stepping motor 49 to rotate in a first direction and it also responds to pulses on its &# 34 ; left &# 34 ; input lead 59 to cause the stepping motor 49 to rotate in a second direction . for each pulse over one of the input leads 58 and 59 , the stepping motor 49 is caused to move a single , illustratively 15 °, step in the respective direction . to provide input signals to the stepping motor drive control circuit 57 , the push button 53 , designated the advance button , is connected to provide a ground signal to a three pulse generator 60 when pushed . the three pulse generator 60 is of conventional design and responds to a ground level signal on its input lead 61 to provide three pulses on its output lead 62 . the lead 62 is coupled to one input of or gate 63 whose output is the lead 58 . therefore , when the advance button 53 is pushed , three pulses appear at the &# 34 ; right &# 34 ; input to the stepping motor drive control circuit 57 so as to cause the stepping motor 49 to advance three steps . this occurs each time the advance button 53 is pushed so that an operator can quickly scan all the possible pattern images , in groups of three , until a desired pattern image is visible through the display window 45 . at this time , if the desired pattern image is in the center , no further action is necessary on the part of the operator , other than to begin sewing , because the five bit shaft position encoder 51 provides signals to address memory circuit 56 indicative of the centermost pattern , which is the desired one . however , if the desired pattern is on the right side of the display window 45 , the operator pushes the right button 54 which applies a ground signal to the lead 64 . this ground signal on the lead 64 is an input to one - shot circuit 65 , of conventional design , which applies a single pulse to the lead 66 . the lead 66 is an input to the or gate 63 . thus , when the right button 54 is pushed , a single pulse appears at the &# 34 ; right &# 34 ; input 58 of the stepping motor drive control circuitry 57 to cause the stepping motor 49 to advance one step bringing the prior rightmost pattern image within the display window 45 to the center position thereof . this causes the output of the five bit shaft position encoder 51 to change and provide the proper new pattern information signals to the address memory circuit 56 . similarly , if the desired pattern image is in the leftmost position of the display window 45 , the operator pushes the left button 52 to apply a ground signal to one - shot circuit 67 over the lead 68 . the one - shot circuit 67 responds to provide a signal pulse to the &# 34 ; left &# 34 ; input of the stepping motor drive control circuit 57 over the lead 59 . this causes the stepping motor 49 to move one step in the second direction so as to bring the prior leftmost pattern image into the center position of the display window 45 . again , this changes the pattern information transmitted to the address memory circuit 56 by the five bit shaft position encoder 51 . accordingly , there has been described a stitch pattern selection and display arrangement for use in a sewing machine having stitch pattern data stored in an addressable memory . it is understood that the above - described arrangement is merely illustrative of the application of the principles of this invention . for example , the display window could only have room to display a single pattern image , in which case only a single actuator would be provided and the stepping motor would only be advanced a single step at a time . also , the centermost position is only one possible position for the desired pattern image , it being contemplated that other positions within the window may be chosen while still remaining within the scope of this invention . for instance , the leftmost position may be chosen as the position for the desired pattern image , in which case only an advance button and a right button would be necessary . alternatively , the display arrangement could react to pattern selection from an external source to control the stepping motor so as to display the selected pattern through the window . numerous other arrangements may be devised by those skilled in the art without departing from the spirit and scope of this invention , as defined by the appended claims . | 6 |
at least one of a nitrate , a sulfate or a hydrochloride of two or three valanced metal ions is added to a polyvinylpyrrolidone in the ratio of 0 . 01 to 10 % and then well stirred with the appropriate amount of an ammonia water at the normal temperature , so that a ph 7 to ph 10 is obtained , thereby producing a metal hydroxide . as the two or three valanced metal ions , there are zn + 2 , al + 3 , ba + 2 , cd + 2 , mg + 2 and the like . the polyvinylpyrrolidone as described above is deposited on the inner surface of a conventional face plate . a mask for black matrix is placed thereon , exposed to the light and then developed by warm water of about 20 ° to 50 ° c . thereby forming photo sensitive material stripes . on the remaining space formed therebetween is deposited a graphite solution and then the stripes are etched by using a hydrogen peroxide water , a dilute sulfuric acid solution or sulfamic acid solution as the etching solution . since this etching solution has a property of oxidizing and decomposing organic compounds , it can oxidize and decompose the organic compounds in the photo sensitive material stripe thereby forming the predetermined black matrix stripes . at that time the solution is rapidly reacted with the metal hydroxide described previously and dissolved , so that the polyvinylpyrrolidone has a good straight line property thereby forming the straight crossing black matrix patterns when being developed . the usual time required for etching is about 30 to 60 sec . described below ar examples of the present invention in connection with the preferred embodiments . 1000 ml of 10 weight percentage aqueous polyvinylpyrrolidone solution with 100 ml aqueous soln . of 0 . 5 g zinc sulfate solution is stirred for 10 min . thereafter , an ammonia water is added so that the mixture is maintained at ph 7 . 1 g of photo sensitive agent das ( diazonium salt ) is added to this mixed solution . and then this mixed solution is deposited on an inner surface of a face plate , exposed to the light , and developed . a graphite solution is deposited thereon and then dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . 1000 ml of 10 weight percentage aqueous polyvinylpyrrolidone solution with 100 ml aqueous soln . of 1 . 5 g zinc sulfate is stirred for 10 min . thereafter , ammonia water is added so that the mixture is maintained at ph 8 . 1 g of photo sensitive agent das is added to this mixed solution . and then this mixed solution is deposited on an inner surface of a face plate , exposed to the light , and developed . a graphite solution is deposited thereon and then dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . 1000 ml of 10 weight percentage aqueous polyvinylpyrrolidone solution with 100 ml aqueous soln . of 1 g aluminum nitrate is stirred for 10 min . thereafter , an ammonia water is added so that the mixture is maintained at ph 9 . 1 g of photo sensitive agent das is added to this mixed solution . and then this mixed solution is deposited on an inner surface of a face plate , exposed to the light , and developed . a graphite solution is deposited thereon and then dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . 1000 ml of 10 weight percentage aqueous polyvinylpyrrolidone solution with 100 ml aqueous soln . of 1 . 5 g zinc nitrate and 0 . 5 g zinc sulfate is stirred for 10 min . thereafter , an ammonia water is added so that the mixture is maintained at ph 7 . 5 . 1 g of photo sensitive agent das is added to this mixed solution . and then this mixed solution is deposited on an inner surface of a face plate , exposed to the light , and developed . a graphite solution is deposited thereon and then dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . 1000 ml of 10 weight percentage aqueous polyvinylpyrrolidone solution with 100 ml aqueous soln . of 2 g barium sulfate is stirred for 10 min . thereafter , an ammonia water is added so that the mixture is maintained at ph 9 . 1 g of photo sensitive agent das is added to this mixed solution . and then this mixed solution is deposited on an inner surface of a face plate , exposed to the light , and developed . a graphite solution is deposited thereon and then dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . 1000 ml of 10 weight percentage aqueous polyvinylpyrrolidone solution with 100 ml aqueous soln . of 1 . 2 g cadmium nitrate is stirred for 10 min . thereafter , an ammonia water is added so that the mixture is maintained at ph 8 . 5 . 1 g of photo sensitive agent das is added to this mixed solution . and then this mixed solution is deposited on an inner surface of a face plate , exposed to the light , and developed . a graphite solution is deposited thereon and then dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . 1000 ml of 10 weight percentage aqueous polyvinylpyrrolidone solution with 100 ml aqueous soln . of 3 g magnesium chloride is stirred for 10 min . thereafter , an ammonia water is added so that the mixture is maintained at ph 9 . 1 g of photo sensitive agent das is added to this mixed solution . and then this mixed solution is deposited on an inner surface of a face plate , exposed to the light , and developed . a graphite solution is deposited thereon and then dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . 10 weight percentage aqueous polyvinylpyrrolidone solution with 1 g of das is sufficiently stirred and then deposited on the inner surface of a face plate , exposed to the light and developed . a graphite solution is deposited and dried . thereafter , it is etched by 10 weight percentage of sulfamic acid solution for 30 sec and then washed down by a pure water thereby obtaining the black matrix on a phosphor layer of a color cathode ray tube . the microphotographs of the black matrix prepared according to the example 1 and the comparative example 1 above show hat while that of the example 1 ( fig1 a ) has excellent straight line property , that of the comparative example 1 ( fig1 b ) has poor straight line property . as described above , the present invention improves the quality of polyvinylpyrrolidone photo sensitive material as a metal hydroxide , so that the conventional etching solution can well dissolve a photo sensitive part thereof thereby obtaining the good straight line property when being developed and a good black matrix pattern . | 6 |
the apparatus 10 , of this invention comprises two components ; a spring lift roller assembly hereinafter designated slra , 12 , used in conjunction with a pair of opposed spaced spring lift lid rollers , 13 , hereinafter designated sllr . two apparatuses are required for the movement and opening of a lid of a mobile or other tank . one apparatus is mounted on each end of such a tank which are generally of a rectangular horizontal cross section . tanks , of a mobile nature , for which the opening of lids is desired , utilizing the apparatus of this invention are depicted in whole or in part in such figures as 15 , 17 and 19 and are noted as designator 76 . typically these tanks 76 are rectangular , and have two sides 78 and two ends 88 , a bottom , not seen , a moveable lid 84 , seen in fig1 , 18 and 19 , and often 4 wheels or rollers 96 , one per corner , for movement . see also fig1 . the apparatus of this invention is used in pairs , to relocate the lid 84 of a tank such that access can be gained to the interior of the tank or container 76 for further addition to the contents therein . ( it should be noted that while the contents are loaded through the top they are dumped through the tailgate at the rear of the tank . the actual time sequence and pattern of movement is shown in fig1 , and discussion thereon is set forth infra . reference is made to fig1 wherein the first component 12 , the slra is seen disposed at one end of a channel like dual track system 80 connected to lid 84 . lid 84 is seen to be in a general horizontal disposition , overhanging the side wall of the tank . one sllr 13 , can be seen but the second opposed one is hidden from view in this figure . note the presence of the handgrip 86 on the side edge of the lid 84 for use by a workman . hinges 90 disposed beneath the track , ie . interposed between the track and the tank allow the tailgate to hinge for quick unloading of the contents of the tank . the discussion now moves to the slra 12 seen in front elevation in fig2 and seen in front and rear elevation in fig3 and 4 , and in rear perspective in fig5 and top perspective in fig7 . the slra 12 main element is the elongated main roller plate 14 , which has three integrated sections of the same thickness but different lengths . the sections are 14 a , the upper ; 14 b , the middle and 14 c the lower section . reference is made particularly to fig3 and 4 . section 14 a , is a racetrack shape section of the longest dimension , and which has a slot 52 therein . section 14 b is a solid plate of slightly less extension and which has therein part of a vertical central slot , 60 for the receipt and passage of the vertically spaced mounting bearing bolts 38 , each of which bolts has a bearing 43 thereon , ( see fig8 ) and which bolts are seen best in fig5 and 6 . these bearings though not seen permit unencumbered vertical movement of the main bearing plate 14 between the spacer plate 22 and the inner roller track plate 30 . the third section is a vertically directed central section 14 c , fig3 and 4 . this third section is integral to the second section and contains the lower part of the rounded end vertical slot 60 . the upper end of the rounded end vertical slot 60 can be seen in fig8 . the third section 14 c of the main roller plate 14 , has a preferably arcuate lower end . a pair of bearing plates , the outer bearing plate 16 and the inner bearing plate 20 are spaced horizontally from each other by a bearing , 18 per fig4 and each of said bearing plates is disposed on the exterior opposite face of the slra 14 . the spacer plate 22 as seen also in fig8 includes a lower central bore and an upper cradle recess in which are disposed the bearing carrying bearing bolts 38 . a threaded shaft 40 passes through aligned unnumbered throughbores in each roller plate , per fig3 . a pair of nuts 44 , per fig4 are mounted on the threaded shaft 40 at two locations , one each abutting the external face of one of the two bearing plates . sleeve 42 overlays the interior end of the threaded shaft 40 to protect the threads . reference is now made to fig5 wherein it is seen that the upper section 14 a , includes a central inwardly directed pointer 56 that is disposed in the upper part of the oval element and directed into slot 52 . element 14 a also has a concave notch 54 therein vertically spaced from the pointer in the lower part of the oval element . the two bearing plates 16 , 20 are configured differently . the outer bearing plate 16 is generally rectangular , and has an aperture 16 a spaced up slightly from its lower end for the receipt of the threaded shaft 40 as per fig2 and 4 . the inner bearing plate 20 is of the same general dimension , has an aperture 20 a , aligned with aperture 16 a for the shaft 40 , but it has chamfered upper corners , and an inwardly directed top flange 20 f mounted normal to the plane of the plate , disposed toward the outer flange plate . this flange , 20 f , best seen in fig7 serves as a spacer member . as can be seen in various figures , the shaft 40 passes through both plates , and the plates can rotate independently on the shaft . the inner plate also includes a concave recess 20 d , which matches the curvature of section 30 h of the inner roller track plate 30 , to permit the bearing 18 , not seen in fig6 to rest in the notch 54 with plate 20 in position disposed above section 30 h . see fig1 for a depiction of the bearing at rest . disposed between the two plates is a roller bearing 18 , seen in fig3 and 5 ( in cutaway ). this roller bearing 18 , also rides on the threaded shaft 40 within the slot 52 , of section 14 a and is of a cross section slightly smaller than that of the slot 52 . as seen in fig2 and 8 , outer spacer plate 22 , which is a generally rectangular vertically disposed plate , includes a pair of vertically aligned bores 22 a , through which pass a pair of bolts 38 , seen best in fig7 each of which bolts are retained by two washers , 48 and a pair of nuts 26 . bolts 38 which each carry a bearing are connected to permit the lowermost section of the sllr , 14 c &# 39 ; s vertical slot 60 , to move relative to the fixed bearings carried by bearing bolts 38 , as per fig2 and 7 upon the urging of the adjacent coil springs . the discussion now turns to fig5 wherein the inner side of the slra 12 is seen . the bolt heads of bolts 38 are seen to pass through suitable apertures in the inner roller plate 30 . the plate 30 is a generally rectangular plate with the longer dimension being in a lateral disposition . the two lower corners are preferably radiused , and the plate 30 includes an upstanding hemi - spherical upper segment 30 h , in the same vertical plane as the balance of the unit , through which one of the bolts 38 for retention of main roller plate 14 passes . the inner roller track plate 30 also includes a pair of spaced bores , not seen , through which pass axle bolts 50 to be retained by nuts 26 without washers . see fig2 , and 9 . note from fig2 and 4 , among others , the feet 24 which are mounted at the lower edge of the inner roller track plate 30 , and directed away from the plate and inwardly toward each other as well . note particularly fig2 . each foot 24 includes a vertical bore 28 for the mounting of a coil spring 58 . each spring 58 is placed upon an inverted l shaft 62 , which shaft is simply disposed within the bore 28 at its lower end , while the upper end of the shaft is welded to the roller plate 14 . see the detailed close - up view of fig1 , as well as fig2 among others for these elements . as noted in fig5 a pair of laterally spaced v - groove casters 34 having aligned grooves 36 are mounted on spaced axle bolts 50 , which bolts are disposed through the outer roller track plate 32 and the inner such plate 30 , which pair retains these casters 34 in place . the outer roller track plate , is a flat horizontally disposed plate with radiused ends for cosmetic purposes . see also fig3 and 6 . reference is made to fig7 the bottom plan view , where the spacer washers 46 and 48 , also mounted on the axle bolts 50 , are seen separating the v - groove casters from the two roller track plates on the opposite sides of the casters . the axle bolts 50 , per fig2 and 8 pass through the inner roller track plate 30 per fig7 and are retained by double nuts 26 . the reader &# 39 ; s attention is now directed to the second component of this invention , the spring lift lid roller or sllr , 13 , which component is employed in mirror image facing pairs on each end wall of the lid 84 . thus four of these sllrs are employed with two of the slras for movement and rotation of lid 84 . while seen in fig1 and 2 , specific reference is made to the close - up views of them in fig1 and 13 . thus each sllr 13 , includes an angularly disposed , folded arched elongated u - shaped sheet metal plate 19 having a pair of upper aligned apertures 39 u , and a pair of lower aligned ones 39 l at each respective terminus of the arch . through the upper aperture passes a mount bolt 29 . this bolt 29 passes through the lid outwardly and is terminated by a lock washer , 31 and nut 35 used in combination . this same combination of a washer and nut but designated 41 and 35 respectively are on the exterior end of the lower bolt 33 which retains the roller 37 . see fig1 . a generally right angle triangular flange 19 f is integrally formed with and extends from the interior arm of the u - shaped plate 19 . the 90 ° angle thereof is adjacent to the interior terminus of the u - shaped plate &# 39 ; s “ u ”. a small spacer segment 19 ff extends normally to the flange 19 f and is directed inwardly toward the lid . an aperture 43 at the distal end of flange 19 f is for the attachment of coil spring 17 as per fig1 and 13 . a roller 37 , is carried by a lower bolt 33 , which bolt passes through a lower pair of aligned bores , 39 l , which are also in said u - shaped plate , 19 but distant from the u - end . the threaded end of this bolt 33 carries a nut 35 and a spacer washer 41 . an upstanding teardrop metal segment 15 is welded or otherwise attached to the sidewall of the lid 84 s , per fig1 . on this segment 15 , an eyebolt 27 is attached , directed toward the u - shaped plate 19 &# 39 ; s arch . the coil spring 17 , is attached at one end to the eyebolt 27 and at its other end to the flange 19 f &# 39 ; s aperture 43 . prior to a discussion on how the 2 sllrs 13 , on each side wall 84 s and the slra 12 cooperate to relocate and tilt the lid 84 of the container 76 , the discussion will first relate to the disposition of the sllrs and the slra . thus reference to fig1 shows that each sllr is mounted to one end of the sidewall 84 s of the lid 84 . thus for any one tank there are 4 sllrs , two on the opposite extremes of each of the two sidewalls 84 of the lid , with each pair being mounted in a mirror image relationship . a review of fig1 shows one sllr 13 , depicted positioned relative to an slra , 12 . as to mounting , a track 80 seen in fig1 and 2 , as well as in fig8 , 10 and 11 , serves as the receiver for the slra . the track 80 is a c - shaped channel disposed on the top of each of the sidewalls of the tank end 88 , and it is welded into place such as at weld sites 100 , ( fig8 ) to the container &# 39 ; s end 88 , upper edge , along the length thereof . the c - channel includes an upper surface 80 a , a middle surface , 80 b normal to both the upper and lower surfaces , and a lower surface , 80 c , spaced from and parallel to the upper surface 80 a . the track 80 is closed off by track ends 80 e welded upright to the channel 88 as is seen in fig8 . attached as by welding , braising or some other suitable means to the interior side of the lower surface 80 c , is an inverted v - extrusion 82 , that runs the length of the channel and is designated the lower track . the upper track of similar material designated 83 is the upper track of the dual track system . these extrusions are best seen in fig1 and 10 . it is this inverted v 82 , that fits into the v - groove caster 34 &# 39 ; s v - groove 36 . again reference is made to fig1 . the v - groove casters 36 are disposed between the two inner and outer roller plates 32 and 34 of the slra as has been noted with respect to fig7 . thus it is understood that the slra 12 , rides via its casters on the v - extrusion between the two track ends 80 e of the channel . the sleeved end 42 of the threaded shaft 40 seen in various figures , is disposed into a central tubular portion 94 of a triangular plate 92 which plate is mounted at the midpoint of the side 84 s of the lid 84 . see fig1 . this is the connection between the slra 12 , and the lid 84 for the lateral movement of the lid in conjunction with the moving of the sllrs 13 ; and then for the ultimate pivoting of the lid 84 when the slra reaches the end of the track 80 as per the disposition as depicted in fig8 . the threaded shaft 40 connection to the slra passes through the two bearing plates 14 , 16 as per fig8 and 9 to retain the roller bearing that rides in the racetrack slot as previously discussed . a contrast of fig1 and 8 shows the positioning of the slra at opposite extremes of the track 80 , while fig9 and 11 shows the lid 84 pivoted . reference to the figures also reveals that the component 13 rides on the exterior surface of the upper channel member 80 a of the track 80 . now that the components and the connections thereof have been set out the discussion moves to the opening , movement and ultimate tilting of the lid . a stylized time lapse drawing — without the intervening travel between the sides of the container — illustrates the lid &# 39 ; s rotary action in its entirety , transpiring at both the left and right sides position of the container in fig1 . of course rotation only transpires at one end at any one time . the reader &# 39 ; s attention is turned to fig2 and 8 , not for the specific location of the lid 84 , but to specifically note the presence of the vertical slot 60 . note further from fig2 how the bearing plate 16 has its lower end below the racetrack slot , as the roller bearing 18 — seen via the cutaway of fig5 is disposed within the notch 54 . note also how the lid 84 is in close proximity to the container &# 39 ; s walls upper edges , i . e ., closed . reference is now again made to fig5 wherein the slot 60 is not visible . there is no visibility because , when the lid is in position as for travel or prior to movement , the lid 84 is sealed to the edge of the container and so retained by at least one web tightener . in fig1 , such a conventional web tightener 98 is seen mounted to the end wall of the container . a nylon webbing section 102 , passes through a swivel latch 100 which webbing when tight holds the lid to the container . at least one such web tightener is found on each end of the container . when the webbing section 102 is tightened down , the two big coil springs , 58 seen best in fig1 , as well as in fig8 and 9 , are compressed and the slot 60 can be seen . but when the webbing 102 is released , the coil springs relax , and force the roller bearing out of the notch 54 , into the elongated slot , such that the vertical slot 60 can no longer be seen , because the pins 38 per fig5 have moved upwardly in the vertical slot 60 . restated , in the at rest position , the pins 38 are toward the bottom of the vertical slot 60 and the slot is visible , while the coil springs 58 are under compression . but when the coil springs relax , the pins 38 rise , and the slot 60 becomes no longer visible . see fig1 and 15 among others . in fig1 , the slra 12 is seen to have moved from its exact center position , slightly to the right . note how both sllr &# 39 ; s 13 &# 39 ; s rollers 37 are still riding along the upper member , 80 a . see also fig1 which is a zoomed in view . note the disposition of the roller bearing 18 situated between the plates 16 and 20 , in that the three elements are at the far right of the racetrack slot 52 . in fig1 , a view at a point in time a few seconds later than the view of fig1 , one notes that the lid 84 overhangs the container 76 and that only one of the sllr rollers 37 is still riding on the top surface of the upper member of the c - channel ; namely , 80 a , while one roller 37 is hanging in mid - air . but the v - casters have not as yet hit the track end 80 e . fig8 would be the next point in time if the lid had been moving leftwardly rather than rightwardly as has been noted . however the action that transpires is the same , as if the lid had been moving rightwardly , given the understanding of fig1 which shows that the action to the sides of the container is the same . the casters impact the end 80 e , and one spring 26 hangs out beyond the container . the connection to the lid via threaded shaft 40 between the plates 16 , 20 now overhangs the side of the container . gravity comes into play , and so we note how one end of the lid 84 dips down and the other end dips up . reference is again made to fig1 . the tilting of the lid continues downwardly as can be seen in fig9 and fig1 , until the lid assumes a generally vertical position with one end sticking up in the air . the lid is disposed beyond the edge of the container , so that the vertical positioning is readily achievable . an end view , showing the lid 84 absolutely upright on the right side of the container is depicted in fig1 . note the same relative positioning of the other elements . one spring 26 is shown rightwardly beyond the container . such positioning is also noted from fig1 wherein the viewer &# 39 ; s vantage point is from on the side of the container with the lid having moved sidewardly and being in the air , as opposed to the viewer being on the end of the container , as in fig1 . returning momentarily to fig1 wherein two of the trio of hinges 90 are seen . these are present only at one end of the tank and are attached to the underside of the track carrying the lid . these hinges are fixed relative to the track , but move with the bottom opening door to permit the unloading of the tank as when hoisted front end up as is known in the art . thus dumping of the contents of the tank , without having to use shovels , vessels or other implements — depending on nature of the contents — to remove the stored material can easily be accomplished . on the opposite side , suitable spacers — not seen — may be present instead of the hinges , 90 in order to have uniform spacing of the lid and track from the tank &# 39 ; s upper edge , ie . to keep the lid level . other means to achieve a level lid are also known . fig2 is present to help emphasize the fact that the invention of this application is used in pairs , at both ends of the apparatus . thus fig2 is seen to be the head end of a tank employing the instant invention . note the distinct absence of a pivoting door used for disposal of tank contents upon lifting of the tank onto a real or virtual incline . of course the track is resent on the forward end and is the same as the track described with respect to the rear end of the tank . it is seen that we have disclosed a tank lid retention and removal apparatus that unseals the lid from a mobile tank when the web tighteners are released . when our apparatus is employed , movement of the lid does not drag across the container top edges , but rather the lid rolls across the top edge of the container until such time as more than half of the lid is extended beyond the tank , either side of the tank . at that time , gravity takes over and the lid rotates about the mounting axis to a vertical position for material placement therein . the slra is returned toward the center after the dipped end of the lid is manually raised , to help the lid return to a horizontal disposition , which action is followed by manual urging of the lid horizontally toward the interior of the tank . once the lid is aligned with the edges of the tank the web tightener and its web can be redeployed . during the movement just described the slra will move from the edge 80 e inwardly toward the middle of the track 80 . first one of and then the second of the sllr &# 39 ; s rollers will roll along the top wall exterior surface 80 a of the channel forming the track . note again that entry into the tank is had through the lid of this invention , but disposal of the tank &# 39 ; s contents takes place through the gate or door built into the rear of the tank . when full , the tank can be manually evacuated , or be subject of machine assisted evacuation , — vacuum hose — as may be desired . the hinged door is again lowered , sealed and the covered tank is again ready for use . it is seen that one person can readily and quickly move the lid from these mobile tanks , a feat that can not be accomplished using prior art lid attachment means , which are usually just a pair or more of hinges . the operation of the invention described above is applicable whether one employs the slra 12 described supra , which is less preferred , or that component is replaced by the more preferred slra 112 to be discussed infra . in the discussion to follow , parts which are the same as part previously described will retain the earlier used number designations . however , where a part is similar to a previously discussed part in function but not in appearance the two digit reference number will not be retained , instead 100 is added to the designator . where the part is the same as is employed in the less preferred embodiment earlier discussed , its original numeric designator is retained . the slra 112 seen in fig2 is an alternative improved embodiment to the one previously discussed . this slra 112 has a main element which also is an elongated main roller plate , designated 114 , and which has three integrated sections of the same thickness but different lengths . the sections are 114 a , the upper ; 114 b , the middle and 114 c the lower section . reference is made particularly to fig2 and 21 . section 114 a , is a modified racetrack shape section of the longest dimension , and it has a boomerang shaped slot 152 therein . contrast this shape of the preferred embodiment to the racetrack shape of section 14 a earlier discussed and the slot found therein . while referred to as a boomerang , the slot 152 is a lazy v - shaped slot , with the inclination of each “ arm ’ of the slot being within the range of 7 to 10 degrees above the horizontal . section 114 b is a solid plate of slightly less extension and which has therein part of a vertical central slot , 60 for the receipt and passage of the vertically spaced mounting bearing bolts 38 , each of which bolts has a bearing 139 thereon , and which are seen best in fig2 . these bearings , 139 permit unencumbered vertical movement of the main bearing plate 14 between the spacer plate 22 and the inner roller track plate 30 . the third section is a vertically directed central section 114 c , in fig2 . this third section 114 c is integral to the second section and contains the lower part of the rounded end vertical slot 60 and is itself preferably arcuate at the bottom . the upper area of the rounded end vertical slot 60 can also be seen in fig2 . a pair of bearing plates , the outer bearing plate 16 and the inner bearing plate 20 are spaced horizontally from each other by a bearing , 18 per fig2 , and each of said bearing plates is disposed on the exterior opposite face of the slra 114 . the spacer plate 22 as seen also in fig2 , includes a lower central bore and an upper cradle recess in which are disposed the bearing 43 carried by bearing bolts 38 . a threaded shaft 40 passes through aligned throughbores in each roller plate , in the manner per fig4 and is secured by a pair of nuts 44 , as shown for this embodiment in fig2 , one each abutting the external face of one of the two bearing plates , 16 and 20 . sleeve 42 overlays the interior end of the threaded shaft 40 to protect the threads . this sleeved end is connected to triangular plate 92 , preferably by insertion into a tubular receiver attached to said triangular plate , and acts in the same manner as the sleeved end 42 discussed supra with respect to the discussion pertaining to fig1 for the connection to the lid . in all other respects the slra designated 112 is the same as component 12 . thus , for example , the coil spring mounts 62 are still welded on at the top and inserted into apertures in the respective foot to carry a coil spring 58 , to permit the springs 58 to act in a manner to dampen the vertical lift of the plate 114 . the slra 112 just described in detail with the boomerang slot 152 is the preferred version of the component . the primary reason is that it is easier to manufacture , thus achieving a cost savings during manufacture . also by having the lower surface of the slot angled downwardly as shown , gravity aids in the central disposition of the bearing 18 ; and the removal from the less preferred depression opposite the pointer is also more difficult to achieve effort - wise , than is a mere angled travel based upon the boomerang angled geometry of the slot 152 of the more preferred embodiment . fig2 is included herein to help the reader comprehend the fact that the invention is utilized at both ends of the tank . all of the views showing the tank have been of the rear end , 77 ( see fig1 ) where the trap or hinged door is placed . here at the forward end 101 of the tank , there is no hinged door present , rather only a hitch or other similar means 103 to enable the tank or container 76 to be relocated . it should be pointed out to the reader that tanks of this nature are loaded through the top , but are emptied through the hinged door shown to be in the rear of the tank . indeed , while the tank depicted in the drawings here has a bottom opening rear door , many manufacturers choose to have the “ trap door ’, be side opening . the hinge location dictates the mode of opening . top hinged means bottom opening . of course appropriate seals are employed to retain the contents . however time need not be spent on the details of the unloading door , since the unloading door forms no part of the instant invention . typically a roll - off hoist can be utilized to raise the mobile tank &# 39 ; s front end into the air for dumping . truck mounted roll - off hoists are available in the marketplace from various manufacturers , including the assignee of this application . since certain changes may be made in the above described apparatuses without departing from the scope of the invention herein involved , it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense . | 1 |
in the embodiment presented on fig1 , the drilling tool 1 is configured as a two - edged spiral drill . the drilling tool depicted on fig1 can be functionally divided into a clamping shaft 2 for clamping the drilling tool 1 in a tool holder ( not shown ), e . g ., a jaw chuck , and a cutting element 3 contiguous with the clamping shaft 2 . the cutting element 3 has two flutes 4 that run helically around the tool axis , and each are distinguished by a flute surface with a concavely curved cross section , as well as a cutting element tip 5 provided with a point thinning . in the drilling tool 1 shown on fig1 , the cutting element 3 consists of a base body , which in the area of the noses 6 ( see fig2 ) is fitted with a respective plate - like cutting insert 7 . the cutting inserts 7 are each situated in a frontally and circumferentially open receiving pocket 8 worked into the area of the nose 6 of the corresponding flute . as a result , the cutting inserts 7 each help to form the main and secondary cutting edges 9 , 10 in the area of the nose 6 . the plate - like cutting inserts 7 are made out of a highly wear resistant material , e . g ., polycrystalline diamond ( pkd ), cubic boron nitride ( cbn ), cvd diamond , cermet or the like . according to the invention , the two flutes 4 in the drilling tool shown on fig1 are each ground into the chip - forming zone adjacent to the main cutting edge 9 , in particular in such a way that the cut - in encompasses the flute front , i . e ., the cutting face , and the back segments of the web 11 leading in the rotational direction . the cut - in 12 can be relatively easily actuated by means of a suitable form grinding wheel dipped into the respective flute 4 from the side and then guided in the direction of the cutting element tip 5 , and enlarges the cross section of the flute 4 in the area of the chip - forming zone . as a result , the chip formed at the main cutting edge 9 has available to it in the area of the chip - forming zone a chip space with an enlarged cross section , in which the chips can be discharged in the direction of the clamping shaft 2 . in addition , the cut - in 12 yields a surface area that encompasses the flute front and back segment , and has a more strongly curved cross section than the cross section of the flute 4 outside the cut - in 12 . fig4 presents a schematic view of the cut - in 12 in the flute 4 . the dot - dashed line denotes the cross section of the flute 4 without or in a section that has been cut into . as evident , the cut - in 12 increases the cross section of the flute 4 . in addition , a chip guiding stage 16 is formed via the cut - in 12 with a more strongly curved cross section . as a consequence , the chip in the area of the cut - in 12 becomes more strongly curved than in the area of the flute 4 outside the cut - in 12 . the stronger chip curvature helps cause the chip to break up relatively early , so that short chip fragments are present at the outlet of the cut - in 12 or chip - forming zone , which then can be smoothly discharged via the area of the flute 4 contiguous with the cut - in 12 . as evident from fig2 , the cut is introduced into the flutes 4 in particular in such a way that the cut - in 12 extends only over a relatively short axial length of the cutting element 3 . for example , the axial length over which the cut - in 12 extends measures 0 . 5 to 1 . 5 times the tool diameter . as a result , the core cross section of the drilling tool can be retained over an essentially axial length despite the cut - ins 12 in the flutes 4 , making it possible to ensure a long tool service life . in the drilling tool 1 depicted on fig1 , a respective plane surface 12 a is formed by the cut - in 12 in the respective flute 4 , which basically exhibits a flute surface with a concavely curved cross section . one of the plane surfaces 12 a is denoted by hatched lines on fig3 . the plane surfaces 12 a are each aligned at a defined angle relative to the tool axis 13 , which is preferably less than or equal to the front rake angle or twist angle of the flute 4 . even though the plane surfaces 12 in the drilling tool 1 shown on fig1 do not extend all the way to the respective plate - like cutting insert 7 , the plane surfaces 12 a still make it possible to adjust or approximate the level of the flute front surface to the level of the surface of the chip surface formed in the cutting insert 7 , at least in the area of the chip - forming zone . this makes a flute cross section enlarged by the cut - in 12 available to the chips formed at the main cutting edges 9 . the cut - in 12 extending frontally beyond the cutting element tip 5 corrects the position and progression of the main cutting edge 9 in such a way that the main cutting edges 9 formed by the cutting inserts 7 and tool base body in the drilling tool shown on fig1 each lie essentially in an axial plane of the drilling tool 1 . in the drilling tool 1 according to the invention , the cut - ins 12 each lie radially inside the nose 6 between the main and secondary cutting edge 9 , 10 . in addition , the cut - ins 12 run in front of the respective secondary cutting edge 8 , which in the drilling tool 1 shown on fig1 is formed by the cutting inserts 7 and the tool base body . as evident from fig2 , the drilling tool 1 depicted on fig1 has a two - edged point geometry with a point symmetrical edge arrangement and point thinned chisel edge 14 . a point geometry with point thinned chisel edge is known in the art . however , the drilling tool 1 according to the invention combines the known advantages arising from the chisel edge point thinning 15 with the aforementioned advantages of the cut - in 12 of the chip - forming zone . as a consequence , the cut - ins 12 according to the invention represent additional structural measures independent of the chisel edge point thinning 15 that positively impact chip discharge in the area of the chip - forming zone . in order to lengthen the tool service life or prevent any chinking of the edges 17 that form between the point thinning 12 and adjacent main free surface 16 of the respective web 11 leading in the rotational direction , these edges 17 are preferably removed or abraded . in order to improve the discharge of chips or chip fragments , the drilling tool 1 depicted on fig1 is also provided in a known manner with an internal coolant / lubricant supply system with outlet openings 18 that open frontally . in partially a perspective view , fig4 to 9 show modified cutting element tip segments of a drilling tool fitted with cutting inserts 7 . while the cut - in 12 is respectively designed in such a way in the drilling tool 1 shown on fig1 to 3 as to not encompass the receiving pocket of the cutting insert 7 , the cut - in 12 can also be expanded up until the area of the receiving pocket 8 for the cutting insert 7 as viewed in a radial direction . fig5 shows an example of a cutting element tip 5 modified in such a way . in this case in particular , the receiving pocket 8 is configured in such a way that the cutting insert 7 as viewed in the rotational direction of the drilling tool 1 is either situated flush with the plane surface 12 a formed by the cut - in , or has a defined , slight excess length relative to the plane surface 12 a formed by the cut - in . in the modification shown on fig6 , the cut - in 12 is concentrated more on the back segment than the flute front . fig7 presents a modification in which the cut - in 12 extends over a large surface of the flute front and back segment in the chip - forming zone . in this modification , the chisel edge point thinning 15 extends from the cutting element tip up to the outer circumference of the drilling tool 1 . not visible in the perspective view is the main free surface , which lies in front of the surface of the point thinning 15 viewed in the rotational direction . the edge 17 formed between the point thinning surface and the no longer visible main free surface is removed in the area of the outlet opening 18 of the interior coolant / lubricant supply system and the cutting element tip 14 . fig8 presents a modification in which the cut - in 12 is concentrated on a transitional area between the flute front and back segment . clearly evident here is the chisel edge point thinning 15 and main free surface 16 . in the modification shown on fig9 , the cut - in 12 is clearly discernible as a plane surface that encompasses the nose 6 , which incorporates the receiving pocket 8 for the cutting insert 7 . the cut - in 12 forms a chip guiding stage 19 at the transition to the flute 4 . as an alternative to the drilling tools described above , for example , the drilling tool according to the invention can exhibit a one - piece design and consist of a suitable material , e . g ., solid carbide . in this case , the flutes can be cut in so that the cut - ins significantly define the noses , and hence the main and secondary cutting edges . as an alternative to the two - edged drilling tool described above , the drilling tool according to the invention can exhibit a single - edged design , or exhibit more than two edges . as an alternative to the helically fluted drilling tools described , above , the flutes can also be straight . in addition , let it be noted that , according to the invention , the features of the drilling tools described above can be combined with each other as desired within the bounds of the technically realizable , as well as within the scope of the claims . | 8 |
herebelow , the best embodiment for carrying out the present invention will be described in detail with reference to the drawings . firstly , external structures of a digital camera 10 relating to the first exemplary embodiment will be described with reference to fig1 . as is shown in fig1 , a lens 12 , for focusing a subject image , and a viewfinder ( an ovf , or optical viewfinder ) 58 , which is used for determining the composition of a subject to be photographed , are provided at the front face of the digital camera 10 . a release button (“ shutter ”) 56 a , which is pressed for operation by a photographer when photography is to be executed , and a power switch 56 b are provided at an upper face of the digital camera 10 . the release button 56 a relating to the present exemplary embodiment is constituted to be capable of detecting two stages of pressing operation : a state of being pressed down to an intermediate position ( herebelow referred to as a half - pressed state ) and a state of being pressed down beyond the intermediate position to a final lowermost position ( below referred to as a full - pressed state ). at the digital camera 10 relating to the present exemplary embodiment , when the release button 56 a is put into the half - pressed state , an ae ( automatic exposure ) function operates and exposure conditions ( a shutter speed and an aperture state ) are specified , and then an af ( auto focus ) function operates to control focusing . thereafter , when the release button 56 a is further put into the full - pressed state , exposure ( photography ) is carried out . an eyepiece portion of the aforementioned viewfinder 58 , a liquid crystal display ( below referred to as an lcd ) 30 , a mode switch 56 c , a cross - cursor button 56 d and a zoom control 56 e are provided at a rear face of the digital camera 10 . the lcd 30 is for displaying subject images represented by digital image data obtained by photography , and various menu screens , messages and the like . the mode switch 56 c is operated by sliding to set one of a photography mode , which is a mode for carrying out photography , and a replay mode , which is a mode for displaying ( replaying ) at the lcd 30 subject images represented by digital image data which has been obtained by photography . the cross - cursor button 56 d is structured to include four arrow keys representing four directions of movement - up , down , left and right — in a display region of the lcd 30 . the zoom control 56 e is operated when zooming ( magnification or reduction ) of the subject image is to be carried out at a time of photography . the cross - cursor button 56 d is structured to include a total of five keys , the four arrow keys representing the four directions of movement up , down , left and right in the display region of the lcd 30 , and a select key disposed at a central portion of the four arrow keys . the zoom control 56 e is structured by a telephoto switch , corresponding to the position of the ‘ t ’ in fig1 , which is operated when the subject image is to be magnified , and a wide angle switch , corresponding to the position of the ‘ w ’ in fig1 , which is operated when the subject image is to be reduced . next , structure of an electronic system of the digital camera 10 relating to the present exemplary embodiment will be described with reference to fig2 . as shown in fig2 , the digital camera 10 is structured to include a cpu ( central processing unit ) 32 , a first memory 38 and a second memory 40 . the cpu 32 administers overall operations of the digital camera 10 . the first memory 38 is used as a work memory at times of execution of various processes by the cpu 32 , and the like . the second memory 40 principally stores the digital image data obtained by photography . the cpu 32 , the first memory 38 and the second memory 40 are respectively connected to one another through a bus . the digital camera 10 is further structured to include a media controller 42 , which is for enabling access by the digital camera 10 to a removable recording medium 42 a in the body of the digital camera 10 . the media controller 42 is also connected to the bus . thus , from the cpu 32 , access to the first memory 38 and the second memory 40 , and access to the recording medium 42 a via the media controller 42 , can be respectively implemented . the first memory 38 may be constituted by , for example , an sdram ( synchronized dynamic random access memory ) and the second memory 40 may be constituted by , for example , a vram ( video ram ), respectively . as is also shown in fig2 , an optical unit 13 , a ccd ( charge coupled device ) 14 and a timing generator 48 are provided in the digital camera 10 . the optical unit 13 is structured to include the aforementioned lens 12 . the ccd 14 is disposed to rearward on the optical axis of the lens 12 . the timing generator 48 principally generates timing signals for driving the ccd 14 and provides the timing signals to the ccd 14 . an input terminal of the timing generator 48 is connected to the cpu 32 and an output terminal of the timing generator 48 is connected to the ccd 14 . driving of the ccd 14 is controlled by the cpu 32 via the timing generator 48 . the lens 12 included in the optical unit 13 relating to the present exemplary embodiment includes a plurality of lenses , and is constituted to serve as a zoom lens capable of altering the focusing distance ( altering magnification ). a lens driving mechanism is provided that is structured to include a zoom motor , a focus adjustment motor and an aperture driving motor . output terminals of motor driving portions 50 a , 50 b and 50 c are connected to a zoom motor 13 a , a focus adjustment motor 13 b and an aperture driving motor 13 c , respectively . the input terminals of the motor driving portions 50 a , 50 b and 50 c are each connected to the cpu 32 . the zoom motor 13 a , focus adjustment motor 13 b and aperture driving motor 13 c are respectively driven by driving signals provided from the respective motor driving portions 50 under the control of the cpu 32 . when an optical zoom magnification is to be altered , the cpu 32 controls to drive the zoom motor 13 a and the focusing distance of the lens 12 included in the optical unit 13 is altered . the digital camera 10 is yet further structured to include a correlated doubled sampling circuit ( below referred to as a cdsamp ) 16 and an analog / digital converter ( below referred to as an adc ) 18 , which converts inputted analog signals into digital data . an input terminal of the cdsamp 16 is connected to an output terminal of the ccd 14 , and an output terminal of the cdsamp 16 is connected to an input terminal of the adc 18 . at the cdsamp 16 , with a view to moderating noise and the like included in output signals from the ccd 14 , processing is carried out to obtain accurate image data by taking differences between feed - through component levels and image signal component levels which are included in the output signals of individual pixels , which are solid state imaging elements . operation portions 56 , including the aforementioned release button 56 a , power switch 56 b , mode switch 56 c , cross - cursor button 56 d and zoom control 56 e , are connected to the cpu 32 . thus , the cpu 32 can continuously identify operational states of the respective operation portions 56 . the digital camera 10 is structured to include an image input controller 20 , an image signal processing circuit 22 , a compression / expansion processing circuit 24 and a display control circuit 28 . the image input controller 20 incorporates a line buffer with a predetermined capacity and performs control to directly store inputted digital image data in a predetermined region of the second memory 40 . the image signal processing circuit 22 carries out various kinds of image processing on the digital image data . the compression / expansion processing circuit 24 performs compression processing on the digital image data into a predetermined compression format , and performs expansion processing on digital image data that has been compressed . the display control circuit 28 supplies , to the lcd 30 , signals for displaying images represented by digital image data and menu screens and the like at the lcd 30 . here , an output terminal of the adc 18 is connected to an input terminal of the image input controller 20 . the digital camera 10 is still further structured to include an af detection circuit 34 , which detects a physical quantity required for operating the aforementioned af function , and an ae / awb detection circuit 36 , which detects physical quantities required for operating the aforementioned ae function and an awb ( automatic white balance ) function . as the physical quantity detected by the af detection circuit 34 , an af evaluation value which represents a high frequency component of luminance ( a contrast value ) in an af region of an image obtained by imaging by the ccd 14 is detected . as the physical quantities detected by the ae / awb detection circuit 36 , luminance information and color difference information which represent brightness of an image obtained through the ccd 14 are detected . that is , in the present exemplary embodiment , a “ ttl ” ( through the lens ) system is used as the above - mentioned af function . the ttl system sets the position of a focusing lens by controlling driving of the focus adjustment motor 13 b via the motor driving portion 50 a , on the basis of the af evaluation value detected by the af detection circuit 34 , so as to maximize contrast in the image obtained by imaging by the ccd 14 . the above - mentioned image input controller 20 , image signal processing circuit 22 , compression / expansion processing circuit 24 , display control circuit 28 , af detection circuit 34 and ae / awb detection circuit 36 are respectively connected to one another through the above - mentioned bus that is connected to the cpu 32 and the like . thus , the cpu 32 can implement control of operations of each of the image input controller 20 , the image signal processing circuit 22 , the compression / expansion processing circuit 24 and the display control circuit 28 , and of acquisition of the physical quantities detected by the af detection circuit 34 and the ae / awb detection circuit 36 . now , in the digital camera 10 relating to the present exemplary embodiment , if the af evaluation value at which the image contrast is maximized falls below a predetermined threshold value th , then the zoom ratio is lowered . fig3 a shows an example of a change in af evaluation value when image contrast is maximized when the zoom ratio is altered . as is shown in fig3 a , the higher the zoom ratio , the more difficult it is to raise the contrast of the image , and the smaller the af evaluation value tends to be . note that the trend shown in fig3 a is an example ; changes are not limited to being linear as shown in fig3 a , and will differ in accordance with compositions , shapes and the like of subject images . fig3 b shows magnitudes of viewing angles when the zoom ratio is altered . the viewing angles represent angles of incident light . the larger the viewing angle , the more subjects are included in an imaging region , while the smaller the viewing angle , the fewer subjects are included in the imaging region . fig4 a to fig4 c show respective images obtained when the same subject image is photographed with different zoom ratios . fig4 a and fig4 b show cases in which the subject image is photographed with high zoom ratios , and fig4 c shows a case in which the subject image is photographed with a low zoom ratio . when the zoom ratio is low , as shown in fig4 c , many subject images are imaged , whereas when the zoom ratio is high , as shown in fig4 a , the imaging region is narrower , the af evaluation value of a subject image is lower , and there is a tendency for subject images to not be expressed clearly . furthermore , if the target of photography is misplaced when the zoom ratio is high , due to the effects of hand shake or the like , then there is a tendency for it to be unclear what is being pictured , as is shown in fig4 b . that is , as shown in fig4 a and fig4 b , when the af evaluation value is lower than the threshold value th shown in fig3 a , then , as shown by the broken line arrow in fig3 b , the zoom ratio is lowered and the viewing angle is increased , and a range of visible subject images is widened . next , operation of the digital camera 10 relating to the present exemplary embodiment will be described . as overall operations of the digital camera 10 at a time of photography , firstly , imaging is carried out by the ccd 14 through the optical unit 13 , and signals representing a subject image are sequentially outputted from the ccd 14 . hence , the signals outputted from the ccd 14 are sequentially inputted into the cdsamp 16 and subjected to correlated double sampling processing , and then inputted into the adc 18 . the adc 18 converts signals of r ( red ), g ( green ) and b ( blue ) inputted from the cdsamp 16 into respective 12 - bit r , g and b signals ( i . e ., digital image data ), and outputs the same to the image input controller 20 . the image input controller 20 collects the digital image data sequentially inputted thereto from the adc 18 in the line buffer incorporated therein , and temporarily stores the digital image data in the predetermined region of the second memory 40 . the digital image data stored in the predetermined region of the second memory 40 is read out by the image signal processing circuit 22 under the control of the cpu 32 , and is subjected to white balance adjustment , in which digital gain is applied in accordance with the physical quantities detected by the ae / awb detection circuit 36 . in addition , gamma processing and sharpness processing are applied and 8 - bit digital image data is generated . further , yc signal processing is applied to generate luminance signals y and chroma signals cr and cb ( below referred to as yc signals ). the yc signals are stored at a region of the second memory 40 different from the above - mentioned predetermined region . herein , the lcd 30 is constituted to be employable as a viewfinder ( an evf , which is an electronic viewfinder ), displaying a moving image obtained by continuous imaging by the ccd 14 ( a through - image ). when the lcd 30 is employed as a viewfinder in this manner , the yc signals that are generated are outputted to the lcd 30 via the display control circuit 28 . hence , the through - image is displayed at the lcd 30 . now , when the release button 56 a is put into the half - pressed state by a user , as mentioned earlier , the ae function operates and sets exposure conditions , and then the af function operates and performs focusing control . thereafter , if the user continues on to the full - pressed state , the yc signals that are stored in the second memory 40 at this time are compressed into the predetermined compression format by the compression / expansion processing circuit 24 , and are then recorded to the recording medium 42 a as an image file . fig5 is a flowchart showing a flow of a photography processing program that is executed by the cpu 32 of the digital camera 10 when a photography mode has been set in accordance with a sliding position of the mode switch 56 c . herebelow , photography processing relating to the present exemplary embodiment will be described with reference to fig5 . first , in step 100 , display of the through - image is commenced . then , in step 102 , it is determined whether or not an operation signal representing operation of the zoom control 56 e has been inputted . if this determination is positive , the processing advances to step 104 . in step 104 , the zoom lens is moved in accordance with an operation direction and operation amount of the zoom control 56 e , after which the processing advances to step 106 . on the other hand , if the determination in step 102 is negative , the processing advances to step 106 without executing the processing of step 104 . in step 106 , it is determined whether or not an operation signal representing the release button 56 a being put into the half - pressed state has been inputted . if this determination is positive , the processing advances to step 108 and the focusing lens position is fixed , after which the processing advances to step 110 . in step 110 , it is determined whether or not the af evaluation value detected by the af detection circuit 34 is at or below the pre - specified threshold th . if this determination is negative , the processing advances to step 118 , and it is determined whether or not the release button 56 a has been put into the full - pressed state . if the determination in step 118 is positive , the processing advances to step 122 , and photography is implemented by image information provided via the ccd 14 being stored in the recording medium 42 a as still image information . then , the processing advances to step 124 . if the determination of step 118 is negative , the processing advances to step 120 , and it is determined whether or not the half - pressed state of the release button 56 a has been released . if the determination of step 120 is negative , the processing advances to step 116 . if the determination of step 120 is positive , the processing returns to step 102 . meanwhile , if the determination of step 110 is positive , it is judged that the zoom ratio is excessively high ( fig4 a ) or the target to be photographed has been misplaced due to hand shake ( fig4 b ), and the processing advances to step 112 . in step 112 , it is determined whether or not the position of the zoom lens is a position at which the viewing angle is maximized ( a state in which the subject image is minimally reduced ; i . e ., the wide - angle end ). if this determination is negative , the processing advances to step 114 and the zoom lens is moved toward the low magnification end , after which the processing advances to step 116 . if the determination in step 112 is positive , it is judged that the zoom ratio is not excessively increased and that hand shake is not a factor at this zoom ratio , and the processing advances to step 118 . in step 116 , the af evaluation value detected by the af detection circuit 34 in the current state is acquired , after which the processing returns to step 110 . in step 124 , it is determined whether or not photography is to end . if this determination is negative , the processing returns to step 102 again . if switching into a replay mode has been instructed by operation of the mode switch 56 c or cutting off of the power supply has been instructed by operation of the power switch 56 b , the determination of step 124 is positive and the processing advances to step 126 . in step 126 , through - image display ends , after which the present photography processing ends . as described above , in the digital camera 10 relating to this first exemplary embodiment , if the af evaluation value when the contrast of the image is maximized is at or below the predetermined threshold th in the state in which the focusing lens position is fixed by the af control , the zoom ratio is lowered . thus , a determination of composition by a photographer when altering a magnification ratio of a subject image and performing photography may be assisted . in this first exemplary embodiment , when the zoom ratio is changed in accordance with the af evaluation value , a message to that effect , or an icon or the like , may be displayed at the lcd 30 . for the first exemplary embodiment , a mode has been described in which the zoom ratio is lowered if the af evaluation value when the image contrast is maximized falls to or below the predetermined threshold value th . for the second exemplary embodiment , a mode will be described in which the zoom ratio is lowered if a comparison value , which is calculated on the basis of af evaluation values that correspond to a predetermined interval between images acquired via the ccd 14 , is at or below a predetermined threshold value . the structure of a digital camera relating to this second exemplary embodiment is similar to the structure of the digital camera 10 described in the first exemplary embodiment ( see fig1 and fig2 ), and only the details of the photography processing differ . herebelow therefore , the same reference numerals are assigned to the same structures and descriptions thereof are not given . details of the photography processing are described with reference to the drawings . fig6 a and fig6 b are a flowchart showing a flow of a photography processing program that is executed by the cpu 32 of the digital camera 10 when the photography mode has been set in accordance with the sliding position of the mode switch 56 c . herebelow , the photography processing relating to the second exemplary embodiment will be described with reference to fig6 a and fig6 b . first , in step 200 , display of the through - image is commenced . then , in step 202 , it is determined whether or not an operation signal representing operation of the zoom control 56 e has been inputted . if this determination is positive , the processing advances to step 204 . in step 204 , the zoom lens is moved in accordance with an operation direction and operation amount of the zoom control 56 e , after which the processing advances to step 206 . on the other hand , if the determination in step 202 is negative , the processing advances to step 206 without executing the processing of step 204 . in step 206 , it is determined whether or not an operation signal representing the release button 56 a being put into the half - pressed state has been inputted . if this determination is positive , the processing advances to step 208 and the focusing lens position is fixed , after which the processing advances to step 209 . in step 209 , an acquired af evaluation value is stored , after which the processing advances to step 210 . in step 210 , it is determined whether or not af evaluation values corresponding to a predetermined interval have been stored . if this determination is positive , the processing advances to step 211 . in step 211 , a difference between the af evaluation value that was acquired and stored the predetermined interval before and the af evaluation value that was most recently acquired and stored is calculated to serve as a comparison value , after which the processing advances to step 212 . in step 212 , it is determined whether or not the calculated comparison value is at or above a pre - specified threshold value ( here , the threshold value is positive ). if this determination is negative , the processing advances to step 218 , and it is determined whether or not the release button 56 a has been put into the full - pressed state . if the determination in step 218 is positive , the processing advances to step 222 , and photography is implemented by image information provided via the ccd 14 being stored in the recording medium 42 a as still image information . then , the processing advances to step 224 . thus , in this second exemplary embodiment , the difference between the af evaluation value acquired and stored the predetermined interval before and the af evaluation value acquired and stored immediately before is calculated to serve as the comparison value , and it is judged that the af evaluation value is falling significantly if this comparison value is at or above the pre - specified threshold value ( the threshold value being positive ). if the determination of step 218 is negative , the processing advances to step 220 , and it is determined whether or not the half - pressed state of the release button 56 a has been released . if the determination of step 220 is negative , the processing advances to step 216 . if the determination of step 220 is positive , the processing returns to step 202 . meanwhile , if the determination of step 212 is positive , it is judged that the target to be photographed has been misplaced due to hand shake ( fig4 b ), and the processing advances to step 213 . in step 213 , it is determined whether or not the position of the zoom lens is the position at which the viewing angle is maximized ( the state in which the subject image is minimally reduced ; i . e ., the wide angle end ). if this determination is negative , the processing advances to step 214 and the zoom lens is moved toward the low magnification end , after which the processing advances to step 216 . if the determination in step 213 is positive , it is judged that hand shake is not a factor at this zoom ratio , and the processing advances to step 218 . here , when the zoom lens is moved toward the low magnification end , a movement amount may be so as to move the zoom lens toward the wide angle end by a fixed amount , or so as to move the zoom lens to a predetermined position . in step 216 , the af evaluation value detected by the af detection circuit 34 in this state is acquired , after which the processing returns to step 209 . in step 224 , it is determined whether or not photography is to end . if this determination is negative , the processing returns to step 202 again . if switching into the replay mode has been instructed by operation of the mode switch 56 c or cutting off of the power supply has been instructed by operation of the power switch 56 b , the determination of step 224 is positive and the processing advances to step 226 . in step 226 , the through - image display ends , after which the present photography processing ends . as described above , in the digital camera 10 relating to this second exemplary embodiment , the zoom ratio is lowered if , in the state in which the focusing lens position is fixed by the focusing control , the comparison value calculated on the basis of the af evaluation values corresponding to the predetermined interval between images acquired via the ccd 14 is at or below the predetermined threshold . thus , a determination of composition by a photographer when altering a magnification ratio of a subject image and performing photography may be assisted . here , a difference between an average value of af evaluation values corresponding to the predetermined interval and the af evaluation value acquired and stored most recently may be employed as the comparison value . further , as shown in fig7 , when the zoom ratio is to be changed by the zoom lens being moved toward the low magnification end , an amount of the change in the zoom ratio may vary in a stepwise manner with respect to the comparison value . the zoom ratio change amount that corresponds to a comparison value may be determined using a pre - specified table , a function , plural thresholds or the like . that is , as shown in fig8 a to fig8 e , the comparison value in a case of going from the state shown in fig8 a to the state shown in fig8 b is smaller than a comparison value in a case of going from the state shown in fig8 a to the state shown in fig8 d . therefore , in the case of going from fig8 a to fig8 b , there is a high likelihood of the target of photography not being greatly displaced , or of the target of photography being displaced but a subject image included in the photography region being identifiable . therefore , as shown in fig8 c , even if the zoom ratio is changed a little , a user can easily re - adjust the viewing angle . in contrast , in the case of going from fig8 a to fig8 d , there is a high likelihood of the target of photography being greatly displaced or of it being difficult to identify a subject included in the photography region because the af evaluation value is too low . therefore , as shown in fig8 e , the zoom ratio is greatly changed to facilitate identification of the subject image by the user . in this second exemplary embodiment , when the zoom ratio is changed in accordance with the comparison value , a message to that effect , or an icon or the like , may be displayed at the lcd 30 . for the first exemplary embodiment and the second exemplary embodiment , modes have been described in which the zoom ratio is lowered in accordance with af evaluation values at which image contrast is maximized . for the third exemplary embodiment , a mode will be described in which , in accordance with change amounts of af evaluation values of division regions , a display of advice that shows a direction to a subject image to a user is implemented . the structure of a digital camera relating to this third exemplary embodiment is similar to the structure of the digital camera 10 described in the first exemplary embodiment ( see fig1 and fig2 ), and only the details of the photography processing differ . herebelow therefore , the same reference numerals are assigned to the same structures and descriptions thereof are not given . details of the photography processing are described with reference to the drawings . fig9 a and fig9 b are a flowchart showing a flow of a photography processing program that is executed by the cpu 32 of the digital camera 10 when the photography mode has been set in accordance with the sliding position of the mode switch 56 c . herebelow , the photography processing relating to the third exemplary embodiment will be described with reference to fig9 a and fig9 b . first , in step 300 , display of the through - image is commenced . then , in step 302 , it is determined whether or not an operation signal representing operation of the zoom control 56 e has been inputted . if this determination is positive , the processing advances to step 304 . in step 304 , the zoom lens is moved in accordance with an operation direction and operation amount of the zoom control 56 e , after which the processing advances to step 306 . on the other hand , if the determination in step 302 is negative , the processing advances to step 306 without executing the processing of step 304 . in step 306 , it is determined whether or not an operation signal representing the release button 56 a being put into the half - pressed state has been inputted . if this determination is positive , the processing advances to step 307 and the focusing lens position is fixed , after which the processing advances to step 308 . in step 308 , division regions that are used by the af function are stored to serve as positions of focusing subjects , after which the processing advances to step 309 . as is shown in fig1 a to fig1 c , in the present exemplary embodiment , positions and numbers of the division regions that are used by the af function and the ae function are linked in relation with the size of a focusing subject included in the photography region . that is , as shown in fig1 a , when the zoom ratio is low , positions of the division regions used by the af function and the ae function are set to positions of the focusing subject , and the number of division regions is set to 4 in accordance with the size of the focusing subject . then , as the zoom ratio is increased , as shown in fig1 b and fig1 c , the size of the subject included in the photography region increases , and accordingly the positions of the division regions that are used by the af function and the ae function are set to positions of the focusing subject and the number of division regions increases in accordance with the size of the focusing subject . in step 309 , af evaluation values of the regions stored as positions of the focusing subject are respectively stored , after which the processing advances to step 310 . in step 310 , it is determined whether or not af evaluation values that correspond to a predetermined interval have been stored . if this determination is positive , the processing advances to step 311 . in step 311 , differences between the af evaluation values that were acquired and stored the predetermined interval before and the af evaluation values that were most recently acquired and stored are calculated to serve as comparison values , after which the processing advances to step 312 . in step 312 , it is determined whether or not any of the calculated comparison values is at or above a pre - specified threshold value ( here , the threshold value is positive ). if this determination is negative , the processing advances to step 318 , and it is determined whether or not the release button 56 a has been put into the full - pressed state . if the determination in step 318 is positive , the processing advances to step 322 , and photography is implemented by image information provided via the ccd 14 being stored in the recording medium 42 a as still image information . then , the processing advances to step 324 . thus , in this third exemplary embodiment , the differences between the af evaluation values acquired and stored the predetermined interval before and the af evaluation values acquired and stored immediately before are calculated to serve as the comparison values , and it is judged that an af evaluation value is falling significantly if the comparison value thereof is at or above the pre - specified threshold value ( the threshold value being positive ). if the determination of step 318 is negative , the processing advances to step 320 , and it is determined whether or not the half - pressed state of the release button 56 a has been released . if the determination of step 320 is negative , the processing advances to step 321 . if the determination of step 320 is positive , the processing returns to step 302 . meanwhile , if the determination of step 312 is positive , it is judged that the target to be photographed has been misplaced due to hand shake ( fig4 b ), and the processing advances to step 314 . in step 314 , display of advice recommending that the lens be turned to the direction opposite from the region at which the difference in the af evaluation value is largest is performed , after which the processing advances to step 318 . if the image obtained via the ccd 14 goes from the state shown in fig1 c to the stage shown in fig1 d , the region at which the difference in the af evaluation value is largest is the division region that appears as solid white in fig1 d . in the example shown in fig1 d , an arrow indicating the opposite direction from the region at which the difference in the af evaluation value is largest is employed as the advice display . in step 321 , the af evaluation values of the division regions detected by the af detection circuit 34 in this state are acquired , after which the processing returns to step 309 . in step 324 , it is determined whether or not photography is to end . if this determination is negative , the processing returns to step 302 again . if switching into the replay mode has been instructed by operation of the mode switch 56 c or cutting off of the power supply has been instructed by operation of the power switch 56 b , the determination of step 324 is positive and the processing advances to step 326 . in step 326 , the through - image display ends , after which the present photography processing ends . as described above , in the digital camera 10 relating to this third exemplary embodiment , an af evaluation value of the image acquired via the ccd 14 is calculated for each of plural division regions , and advice display showing the direction of a subject to the user is performed on the basis of amounts of change of the af evaluation values of the division regions . thus , a determination of composition by a photographer when altering a magnification ratio of a subject image and performing photography may be assisted . note that the constitution of the digital camera 10 described in the above exemplary embodiments ( see fig1 and fig2 ) and the flows of photography processing ( see fig5 , fig6 a and fig6 b , fig9 a and fig9 b ) are examples ; suitable modifications are applicable within a scope not departing from the spirit of the present invention . | 7 |
both the enzymes of the invention can be produced by culturing the respective microorganisms on a source of carbon and nitrogen . any conventional sources can be used , but it is preferred to grow the rhodococcus h1 on a carbon source comprising heroin and the p . putida m10 on a carbon source comprising heroin or morphine . the rhodococcus h1 grows on glucose as carbon source but the amce activity of the cells is lower than when it is grown on heroin . the mdh is produced constitutively and therefore the p . putida m10 can be cultured on glucose to produce a highly active preparation of mdh . for both microorganisms cultivation is preferably aerobic . any usual temperature , e . g . within the 20 ° to 40 ° c . range , preferably 25 ° to 35 ° c ., can be used . to obtain the enzyme the cells can be disrupted in any conventional way . preferably a cell - free extract is made . the enzyme is then recovered from the cells or extract . instead of the precise starting organism deposited , a mutant thereof , e . g . derived by gamma - ray irradiation or use of a chemical mutant , induction by culture on another medium etc . or a transconjugant thereof with another bacterium or an artificially produced variant can be used . the enzyme or some modification thereof can also be made by recombinant dna technology using methods well recognised in that art . these may entail producing the enzyme in another host organism . the enzymes of the present invention are useful primarily in the detection of heroin . the preferred method involves use of both enzymes together , the amce to degrade the heroin to morphine and the mdh to oxidise the morphine , the latter reaction requiring a cofactor . alternatively , the amce can be used on its own . also the mdh - cofactor system can be used on its own for detection of morphine . the invention is particularly applicable to the detection of grains of powdered heroin or morphine ( free base or any of their salts ). samples containing the drug can be collected from luggage , cargo or about the person by blowing air over the affected area , collecting the air and concentrating the particles contained in it . a suitable apparatus is shown schematically in fig6 . in order to remove drug particles 1 which have become electrostatically held to plastic surfaces in the luggage 2 , the air can first be passed through a neutraliser unit 3 which generates positively and negatively charged ions . these can be generated in any conventional way , e . g . by a 210 po radioactive source ( not shown ). the ionised air is then sent under pressure through a conduit 4 into the luggage 2 . the drug particles held on the plastic surfaces within the luggage are thereby electrically neutralised . air is exhausted from the luggage by gentle suction through conduit 5 , entraining the drug particles 1 . these drug particles in the withdrawn air are focussed and concentrated . this can be done by conferring a negative charge on the particles with the aid of an air ioniser 6 and collecting them on an earthed electrode , 7 of a biosensor . instead of the ioniser 6 and electrode 7 , the particles could be collected on an ultrafine sieve , or within a porous plug of , say , cotton wool , depending on the intended method of detection . the invention is also applicable to the detection of heroin or morphine in biological fluids , especially in urine and blood . heroin is hydrolysed in vivo to morphine and therefore use of the mdh is appropriate for such detection . the hydrolysis of heroin by the amce must take place in an aqueous medium . the enzyme or the sample or both should be in an aqueous medium immediately before contact . the aqueous medium is used to solubilise the heroin ( as acid addition salt ) and to allow enzyme activity . for detection of solid particles it is often convenient to introduce the enzyme into a humectant composition . thus , for example where a biosensor is used for the detection of solid particles , the sampling surface of the biosensor is pre - coated with the enzyme ( s ) in a humectant composition . similarly where a test strip is used , the strip support is coated with a humectant composition containing the enzyme . a humectant is desirable in order to prevent the enzyme from dehydration caused by the air flow from the sample apparatus . the method of detection may depend on conductance , e . g . to detect acetate ions liberated from the hydrolysis of heroin . in that event , the humectant should be one which provides a stable initial level of conductance ( blank reading ) to be attained , which is not badly affected by changes in relative humidity in the surrounding atmosphere which might occur during sampling . it should thus allow the biosensor to be used in the variety of climatic conditions encountered in different countries . for the conductimetric method , a simple , inexpensive humectant such as glycerol with sodium chloride , suitably buffered , is adequate . preferably the buffer is imidazole . the composition desirably contains ( by weight ) from 70 to 90 % glycerol , 2 to 3 % sodium chloride and 17 to 7 % of aqueous imidazole of concentration appropriate to the ph required , e . g . 2 millimolar for ph 7 . 5 . particularly preferred is a composition comprising ( by weight ), about 10 % of 2 mm aqueous imidazole , about 87 . 5 % glycerol and about 2 . 5 % sodium chloride . for other detection procedures , other humectants and buffers can be used . thus , in an amperometric method , 50 mm glycine / sodium hydroxide , ph 10 can be substituted for imidazole . alternatively , polyvinyl pyrrolidone , buffer and sodium chloride can be used . the principle of operation of a conductimetric biosensor involves the application of an electric field across a pair of electrodes in an electrolyte . the electric field can be generated by application of a sinusoidal voltage wave form across the electrodes in order to minimise or eliminate undesirable faradaic processes , double - layer charging and concentration polarisation at the surface of the electrode . in order to detect accurately the small conductance generated by acetate ions it is necessary to introduce comparator circuitry . preferably an owen type bridge circuit as described in example 5 is used . of course , the acetate ions do not have to be detected conductimetrically . more preferably , the morphine liberated by the hydrolysis is detected . especially , both enzymes are employed and the heroin is then detected amperometrically . amperometric detection depends on using the oxidation of morphine to morphinone via the concomitant reduction of the cofactor , especially nadp + to nadph , electrochemically to transfer electrons to an electrode and thereafter to an external electrical circuit . one method of transfer is via a mediator , as illustrated in fig4 of the drawings . many mediators are well known for this general type of reaction in which the cofactor for the enzyme is re - oxidised and most of these are operable in the present instance . examples are hexacyanoferrate ions , phenazine methosulphate or ethosulphate , ferrocene / diaphorase or 4 - methylquinone . any of the usual electrochemical cell arrangements for the transfer of electrons from a chemical reaction to an electrode can be used . the cofactor can be nadp + or any operable analogue thereof such as 3 - acetylpyridine adp . nad + and nicotinamide hypoxanthine diphosphate have not been found to be operable under conditions tried to date . a preferred composition for use in detecting heroin therefore comprises ( 1 ) the amce , ( 2 ) mdh and ( 3 ) a cofactor for the mdh , especially nadp + . optionally , depending on the method of detection , the composition can also include a humectant or a mediator . although in the two - enzyme method , the best heroin - degrading acetyl carboxylesterase is believed to be that of the invention , it is possible in principle to use other such acetyl carboxylesterases . clearly such an acetyl carboxyesterase is present in the pseudomonas putida strain &# 34 ; m10 &# 34 ; since this bacterium is able to produce morphine from heroin , but its activity appears to be low . the invention includes specifically an amperometric biosensor comprising a working electrode , a reference electrode and a counter - electrode in contact with an electrolyte containing the mdh , a cofactor therefor and ( usually ) a mediator . where the current is small , the counter - electrode can also serve as the reference electrode . it also includes a conductimetric biosensor comprising a pair of electrodes in contact with an electrolyte containing the amce . the electrodes of the biosensor and the external circuitry are those appropriate to conductimetric or amperometric detection of current , as the case may be . the mdh reaction is also detectable spectrophotometrically in various ways . according to one aspect , the oxidation of morphine is used to drive a redox reaction in which a colour change or a change in uv absorption occurs . thus , the cofactor itself can be used to detect the reaction by observing the reduction of nadp + to nadph , particularly as an increase in absorbance at about 340 nm . alternatively , the redox reaction of the cofactor can be used to drive a redox reaction or a &# 34 ; system &# 34 ; comprising more than one such reaction , in which a colour change takes place . for example , using phenazine methosulphate as a mediator , nitroblue tetrazolium can be reduced to a formazan , giving a blue - purple colour . instead of nitroblue tetrazolium , triphenyl tetrazolium chloride , iodonitro tetrazolium chloride , neotetrazolium chloride or 2 , 6 - dichlorophenolindophenol could be used . in other sensors of the invention an optical transducer ( e . g . an optical fibre ) or a thermal transducer ( e . g . a thermistor ), or a potentiometric or piezoelectric transducer is put into a working relationship with the enzyme . the following examples illustrate the invention . &# 34 ; sephadex &# 34 ;, &# 34 ; sephacel &# 34 ; and &# 34 ; mimetic &# 34 ; are registered trade marks in many countries . preparation of an acetylmorphine carboxylesterase ( amce ) from the bacterial strain &# 34 ; rhodococcus h1 &# 34 ; the organism rhodococcus h1 was isolated from cambridge garden soil by enrichment with heroin as the sole carbon source . cultures of rhodococcus h1 were grown in 250 ml ehrlenmeyer flasks containing 50 ml . of defined minimal medium consisting of ( nh4 ) 2 so 4 ( 0 . 5 g . ), k 2 pho 4 ( 2 . 0 g . ), kh 2 pho 4 ( 0 . 2 g .) and mg so 4 ( 0 . 05 g .) per liter containing trace elements as described by j . a . barnet and m . ingram , journal of applied bacteriology , 18 , 131 - 148 ( 1955 ), supplemented with 5 mm glucose and 5 mm heroin . ( note : the bacteria will give lower yields of biomass but a higher specific activity of amce when grown solely on 10 mm heroin ). after 48 hours of growth at 30 ° c . in a shaking incubator ( 180 rev / min ), the contents of the flask were poured aseptically into a 2 liter ehrlenmeyer flask containing 750 ml of the same medium . the cultures were incubated for 48 h . for bulk preparation of bacteria , the contents of a 2 liter flask were used as inoculum for a 10 liter culture vessel , containing 9 . 25 liters of sterile medium . the bulk cultures were incubated at 30 ° c ., with forced aeration for 48 h or until 80 - 85 % of the carbon source had been utilised . cell - free extracts were prepared by resuspending cell paste at a concentration of 0 . 5 g / ml in buffer a ( 50 mm potassium phosphate buffer mixture , ph 7 . 0 , 1 mm dithiothreitol ). the cell suspension was kept chilled in a crushed ice bath and sonicated for periods of 15 seconds . in a soniprep 150 mse ultrasonic disintegrator at an amplitude of 10 μm , peak to peak , for a total sonication time of 3 min . the bacterial extracts were centrifuged at 30 , 000g for 15 min in a sorval rc - 5c centrifuge , using an 8 × 50 rotor at 4 ° c . to remove the unbroken cells and debris . 3 - acetyl - and 6 - acetylmorphine were prepared from morphine and heroin , respectively according to the methods of l . e . welsh , j . org . chem . 19 , 1409 - 1415 ( 1954 ) and c . i . wright , j . pharmacol . exp . therap . 71 . 164 - 168 ( 1941 ) respectively . other chemicals are commercially available or readily preparable by known methods . esterase activity was assayed by two spectrophotometric methods . in the first assay , phenyl acetate was used as the substrate . the reaction was maintained at 30 ° c . and the formation of phenol monitored by uv absorbance at 275 nm . the reaction mixture contained , in a total volume of 2 ml , 50 mm tris - hcl buffer mixture , ph 7 . 5 , 4 mm phenyl acetate and enzyme . the second spectrophotometric method to monitor esterase activity used the ph indicator dye bromocresol purple , since enzymic hydrolysis of diacetylmorphine rapidly lowered the ph of a poorly buffered assay mixture . bromocresol purple ( 0 . 1 g ) was dissolved in 16ml of 0 . 01n naoh solution and made up to 250 ml with distilled water . the change in absorbance at 588 nm was measured as the rate of reaction . the reaction mixture contained in a total volume of 1 ml ; 2 mm imadazole buffer , ph 7 . 0 , 2 mm diacetylmorphine , 10 μl bromocresol purple solution and enzyme . a third enzyme assay depended upon the separation of diacetylmorphine , 6 - acetylmorphine and morphine by hplc . the solvent system was that described by j . g . umans , journal of chromatography 233 , 213 - 225 ( 1982 ). the reaction mixture contained 1 mm heroin and enzyme in 2 ml of 50 mm tris - hcl buffer mixture , ph 7 . 5 . from the assay mixture , incubated at 30 ° c ., in a shaking water bath , 200 μl aliquots were removed at intervals and the reaction stopped by the addition of 5 μl of concentrated acetic acid and the protein precipitate removed by centrifugation in a microfuge , before samples ( 50 μl ) of the supernatant were analysed by hplc . the unit of enzyme activity is defined as the amount of enzyme necessary to hydrolyse 1 μmol of phenyl acetate into phenol in 1 min . protein in extracts used in enzyme assays was measured by the method of m . m . bradford , analytical biochemistry 72 , 243 - 254 ( 1976 ). crude extracts was prepared from 19 g ( wet weight ) of frozen diacetylmorphine - grown cells that were thawed at 4 ° c . before extraction . cells were resuspended in buffer a . the cell suspension was kept chilled in a crushed ice bath and sonicated for periods of 15 s in a soniprep mse ultrasonic disintegrator at a amplitude of 10 μm peak to peak for a total sonication time of 3 min . the bacterial extracts were centrifuged at 30 , 000g for 15 min in a sorval rc - 5c centrifuge , using an 8 × 50 rotor at 4 ° c . to remove the unbroken cells and debris . a neutralised 10 % ( w / v ) streptomycin sulphate solution was added dropwise with constant stirring to 33 ml of crude extract until 0 . 1 ml of streptomycin sulphate had been added per 1 ml of cell extract . after stirring at 4 ° c . for 5 min , the nucleic acid percipitate was removed by centrifugation . the streptomycin - treated preparation was applied to a deae - sephacel column ( 2 . 5 × 30 cm ) that had previously been equilibrated with buffer a . after adsorption on to the column , the sample was washed extensively with buffer containing 0 . 1m nacl until no further absorbance at 280 nm was detected in the eluant thus purifying it from much contaminating protein . the amce was eluted with 400 ml of buffer a in a linear gradient running from 0 . 1m - 1 . 0m nacl . fractions of 8 ml were collected at a flow rate of 18 ml / h . the enzyme eluted at approximately 0 . 25m nacl . the course of the chromatography is shown in fig1 in which the esterase activity is denoted by open circles and the protein content by filled circles . the peak of esterase activity occurred at fractions 50 - 56 within a relatively small protein content peak . fractions from the ion - exchange column containing the highest esterase activity were combined and concentrated to 5 ml by ultrafiltration . the concentrate was then applied to a sephadex g - 150 column ( 1 . 5 × 75 cm ) that had previously been equilibrated with buffer b ( 50 mm mops , ph 7 . 5 ). the flow rate was maintained at 10 ml / h and fractions of 6 ml were collected . the course of the chromatography is shown in fig2 in which the esterase activity is denoted by open circles and protein content by solid circles . the peak of esterase activity occurred at fractions 14 - 19 , within a second , broad protein content peak . fractions from the sephadex g - 150 column containing the highest esterase activity were loaded on to the mono q hr 5 / 5 column ( pharmacia ). the column had previously been equilibrated with buffer b . the column was washed with buffer b until no further absorbance at 280 nm was detected , then the enzyme was eluted with 20 ml of buffer b in a linear gradient running from 0 - 1m nacl . fractions of 1 ml were collected at a flow rate of 1 ml / min . page was performed by the method of u . k . laemmli , nature 227 , 680 - 682 ( 1970 ) on a 1 mm thickness vertical slab gel ( bio - rad ), containing 11 % ( w / w ) acrylamide in the resolving gel . protein was detected by staining the gel for 3 h with coomassie brilliant blue r250 dissolved in a solvent system consisting of methanol - water - acetic acid ( 4 : 5 : 1 by vol ). gels were diffusion - destained by repeatedly washing them in the above solvent mixture , and allowing the stain to diffuse out in solution in the solvent . growth of the isolate rhodococcus h1 with heroin as the sole carbon source produced an amce of specific activity ( expressed in units / mg protein ), some 15 - fold greater than that observed with growth on glucose . the enzyme was highly purified to electrophoretic homogeneity ( over 200 fold in terms of specific activity ), by the procedure described . steps 1 - 3 achieved an approximately 15 - fold purification , step 4 ( the mono - q chromatography ) a further 18 - fold . the enzyme was homogeneous when subject to page . the amce has a broad ph optimum range from 7 . 0 to 9 . 5 in tris - hcl buffer , using phenyl acetate substrate . this plateau - like ph activity relationship ensures that the amce can be used at a high ph , e . g . of 9 . 5 to 10 , which is a particular advantage in the combined use of amce and mdh . potassium phosphate buffer appears to have an inhibitory effect on esterase activity . the enzyme ( 60 μg ) was incubated at 40 ° c . in 50 mm potassium phosphate buffer , ph 7 . 0 and its activity plotted against time . from the graph it was deduced that it had a half - life of 14 min at 40 ° c . a comparison of amce activities with 3 - acetyl - and 6 - acetylmorphine was examined with each compound at a concentration of 1 . 0 mm in a reaction mixture containing 3 ml potassium phosphate buffer , ph 7 . 5 and purified enzyme ( 5u ). the reaction mixture was incubated in a shaking water bath at 30 ° c . and 200 μl samples were removed at intervals and the reaction stopped by the addition of 5 μl of concentrated acetic acid . the samples were then centrifuged to remove any precipitated protein . aliquots of 50 μl were analysed by hplc . the acetyl esterase rapidly hydrolysed 3 - acetylmorphine to morphine . 6 - acetylmorphine was also a substrate for the amce , but the rate of hydrolysis was much slower than that for the 3 - acetyl analogue . thus , the time taken to reduce the substrate concentration by 20 % was 2 minutes for 3 - acetylmorphine and 4 hours for 6 - acetylmorphine . the molecular weight of the native enzyme was determined by the method of andrews , biochem . j . 91 , 222 - 233 ( 1964 ) from measurements on a column of sephacryl s - 200 ( 1 . 5 × 75 cm ) calibrated with marker proteins . after the column was equilibrated with 20 mm tris - hcl , ph 7 . 5 , a solution containing purified enzyme was applied to the bed surface and eluted with equilibration buffer at a flow of 4 ml / h , collecting 1 . 5 ml fractions . the elution volume of the amce corresponded to a molecular weight of 200 , 000 . the starting microorganism , m10 was isolated from industrial waste liquor by enrichment with heroin . for reference purposes , other pseudomonas bacteria were studied . these were : p . putida atcc 17464 , p . testosteroni atcc 17454 and p . fluorescens , ncimb 9815 , and p . aeruginosa strain k atcc 25102 , kindly supplied by judith greenwood , department of biochemistry , university of cambridge , england . cultures of p . putida m10 were grown and cell - free extracts were prepared as for rhodococcus h1 in example 1 . 3 - acetyl - and 6 - acetylmorphine were prepared from morphine and heroin respectively , according to the methods of l . e . welsh , j . org . chem . 19 , 1409 - 1415 ( 1954 ) and c . i . wright , j . pharmacol . exp . therap . 71 , 164 - 168 ( 1941 ) respectively . other chemicals are commercially available . the resolution and identification of 3 - acetyl -, 6 - acetylmorphine , morphine , heroin , codeine and codeinone was determined by hplc analysis at 218 mm , on waters 450 system linked to an waters 740 data module . the 25 cm length column contained 5μ spherisorb - ods ( c - 18 ) reverse - phase packing . the solvent system was that described by j . g . umans , journal of chromatography 233 , 213 - 225 ( 1982 ). mdh was measured by ultra - violet spectroscopy by following the reduction of nadp + at 340 mm in 50 mm glycine - naoh buffer , ph 10 , containing 2 mm morphine or codeine , 2 mm nadp + and enzyme in a final volume of 1 ml . the unit of enzyme activity is defined as the amount of enzyme necessary to reduce 1 μmol of nadp + per minute . protein in extracts used in enzyme assays was measured by the method of m . m . bradford analytical biochemistry 72 , 248 - 254 ( 1976 ). 2 . deae - sephacel ion exchange chromatography : as in example 1 . the course of this chromatography is shown in fig3 of the drawings in which the open circles denote protein and the filled in circles represent mdh activity in units / ml . enzyme activity was eluted at 0 . 37m nacl on the linear salt gradient . 3 . sephacryl s - 300 gel filtration : as for the sephadex g - 150 filtration in example 1 . fractions 28 - 60 contained protein , peaks being obtained at around fractions 32 and 42 . fractions 35 - 55 showed mdh activity , with a peak at around fraction 44 . all the pseudomonads screened possessed the ability to grow at the expense of heroin ; however , only p . putida m10 degraded morphine and codeine when they were supplied as the sole carbon source . furthermore , during the metabolism of these compounds , the medium became progressively darker . heroin metabolism by washed cells of p . putida m10 grown at the expense of heroin was tested directly by measuring the disappearance of substrates from incubation mixtures by hplc . cells grown on heroin readily metabolised morphine , codeine and ethylmorphine . thebaine , however , was not degraded at all . no degradation of the morphine alkaloids was detected when p . putida m10 was grown at the expense of glucose . by hplc analysis and reference to authentic standard compounds , both the acetyl ester groups of heroin were shown to be hydrolysed by whole washed cells of p . putida m10 grown at the expense of heroin . further experiments with cell extracts showed that an esterase enzyme hydrolysed heroin to 6 - acetylmorphine , then catalysed further hydrolysis to morphine . no traces of 3 - acetylmorphine were found to accumulate . when cell free extract was replaced in the reaction mixture by boiled cell extract , only slow hydrolysis of heroin to 6 - acetylmorphine occurred . each strain of pseudomonad was screened for acetyl carboxy esterase activity after growth with heroin . in each case , growth with the alkaloid substrate led to enhanced esterase activities compared with those found in extracts of glucose - grown cells . crude extracts from cells of p . putida m10 grown with diacetylmorphine as the growth substrate , did not show any activity against either morphine or codeine , even when high concentrations of crude extract protein were used . the extracts showed an absolute requirement for nadp + ; nad + was shown not to be a substrate . activity was not observed when crude extract was replaced with boiled extract in the reaction mixture . the mdh was found to be purified 100 fold ( in terms of its specific activity in units / mg protein ) by anion exchange chromatography on deae - sephacel followed by gel filtration chromatography on sephacryl s - 300 ( fig3 ). although the enzyme was not found to be electrophoretically homogeneous , morphinone was not further degraded , thus indicating that the other enzymes of the morphine degradation pathway had been removed . the effect of ph on enzyme activity over the ph range 7 to 11 showed an optimum activity towards morphine at ph 10 in glycine - naoh buffer mixture . the specific activity was reduced at ph values above 10 . 5 . the more highly purified material prepared in example 4 showed optimum activity at ph 9 . 5 . p . putida m10 and the reference pseudomonads were screened for nadp + - dependent mdh activity . the cells were grown on ( a ) heroin ( 10 mm ), ( b ) morphine ( 5 mm ), supplemented with glucose ( 5 mm ) or ( c ) glucose ( 10 mm ) each &# 34 ; m10 &# 34 ; showed mdh activities of 0 . 65 , 0 . 02 and 0 . 39 respectively , whereas all the other pseudomonads showed nil mdh activity in all cases . in order to resolve the degradation product of morphine or codeine metabolism by p . putida m10 , the alkaloid ( 100 μmol ) in 50 ml 25 mm glycine - naoh buffer , ph 10 . 0 was incubated for 3 h at 30 ° c . with highly purified enzyme ( 4u ). at intervals during the incubation , 300 μl aliquots were removed from the reaction mixture and the reaction stopped by the addition 5 μl of concentrated acetic acid . the samples were then centrifuged to pellet any precipitated protein and 50 μl of supernatant was analysed by hplc . the enzymic degradation product of codeine was identified as codeinone by reference to authentic standard compounds . in order to confirm the identity of this compound the reaction mixture was made alkaline by the addition of concentrated naoh and then extracted with 3 × 100 ml vol . of ethyl acetate . the ethyl acetate extract was dried over anhydrous mgso 4 and the solvent evaporated in vacuo to leave a small oily residue . the oil was then dissolved in a small volume of chloroform and resolved by t . l . c . on silica plates with solvent a [ chloroform : methanol , 80 : 20 by vol ] and solvent 8 [ ethyl acetate : methanol : water : ammonia , 85 : 10 : 3 : 1 by vol ]. codeine and codeinone were used as standards to assist in the identification of the reaction products . the reaction product readily resolved into two components , with r f values of 0 . 41 and 0 . 48 in solvent a and 0 . 24 and 0 . 27 in solvent b . the compound with r f values 0 . 48 and 0 . 27 was identical with the r f value of authentic codeinone . the second compound with r f values 0 . 41 and 0 . 24 corresponds to unconverted codeine . the compound corresponding to codeinone was purified by preparative tlc on silica plates ( 1000 μm , whatman ) in solvent a . the codeinone band was scraped from the plate and eluted with methanol . the methanol was removed by rotary evaporation at a temperature below 40 ° c . the residue was then dissolved in chloroform and the infrared spectra examined . the infra - red spectrum of the reaction product measured in chloroform exhibited an intense absorption band at 1685 cm - 1 due to a carbonyl group , which is consistent with the spectrum of authentic codeinone . when codeine was replaced by morphine in the reaction mixture , the isolated product had r f values of 0 . 32 and 0 . 12 in solvents a and b , respectively . the proton nuclear magnetic resonance spectrum of the compound in cdcl 3 was also consistent with the structure of morphinone . its principal features ( relative to trimethylsilane ) were as follows . a pair of doublets at 6 . 6δ were assigned to the aromatic ab system of the two protons on c - 1 and c - 2 . a singlet at 4 . 7δ was assigned to the proton on c - 5 . a carbonyl group on the c - 6 produces a marked change in the chemical shift of the hydrogen atoms bonded to the relevant carbon atoms ( c - 7 and c - 8 ). this explains the overlapping of the multiplet at 6 . 6δ due to the proton at c - 8 , with the pair of doublets of the aromatic ab system . the signal at 6 . 12δ was assigned to the proton on c - 7 . no steroid dehydrogenase activity was detected when morphine was replaced in the standard assay with either testosterone or androsterone . no steroid dehydrogenase activity was detected when nad + replaced nadp + in the reaction mixture . the β - hydroxysteroid dehydrogenase from pseudomonas testosteroni is the only previously described oxidoreductase enzyme to have activity against morphine , liras et al ., applied microbiology 30 , 262 - 266 . ( 1975 ). unfortunately , this enzyme is disadvantageous for use in an amperometric sensor , because of its very low activity against morphine or its analogues , as indicated by the large quantities of enzyme ( over 80 u / ml ) required to transform codeine to codeinone . clearly , the morphine dehydrogenase of p . putida m10 differs from the steroid dehydrogenase of p . testosteroni . example 2 was repeated , but the mdh was further purified ( beyond the stages 1 to 3 shown in example 2 ) and further tested . fractions from the mono q column containing the highest mdh activity were combined and concentrated to 5 ml by ultrafiltration . the concentrate was then applied to an sephacryl s - 300 column ( 1 . 5 × 75 cm ) that had previously been equilibrated with buffer b ( 50 mm mops , ph 7 . 5 ). the flow rate was maintained at 10 ml / h and fractions of 1 . 5 ml were collected . an activity stain was developed for detecting active mdh in non - denaturing polyacrylamide gels . the electrophoresed gel was incubated at room temperature in 20 ml of solution containing : 50 mm glycine - naoh buffer , ph 10 , 2 mm nadp , 0 . 5 mm dithiothreitol , 9 mg nitroblue tetrazolium , 0 . 1 mg phenazine methosulphate and 2 mm morphine or codeine . in crude extracts from cells of p . putida m10 grown with either heroin or glucose as the sole carbon source , mdh was present at a specific activity of 0 . 018 unit ( mg . protein ) - 1 . it was purified 233 fold as shown in table 1 below : table 1__________________________________________________________________________purification of the mdh from p . putida m10 total total specificpurification volume activity protein activity purificationstep ( ml ) ( units ) ( mg ) ( units . mg . sup .- 1 ) factor__________________________________________________________________________crude extract 67 14 819 0 . 017 1streptomycin 70 13 . 3 806 0 . 016 1sulphatedeae - 60 11 . 2 30 0 . 373 22sephacelgel filtration 31 . 5 8 . 9 5 . 1 1 . 745 46sephacryl s - 300fplc 20 7 . 03 1 . 5 4 . 700 274mono qgel filtration 5 0 . 4 0 . 1 4 . 000 233sephacryl s - 300__________________________________________________________________________ the mono q chromatography step produced 4 main protein peaks , the 4th peak coincident with a single peak of mdh activity . however , when the active fractions around this peak were subjected to page the enzyme was found not to be homogeneous . the active fractions were , therefore , concentrated to 2 ml and reapplied to the sephacryl s - 300 gel filtration column . the pooled active fractions from this final step were & gt ; 90 % pure , which produced a distinct main protein band when analysed by page , which coincided with a single band when either morphine or codeine were used as substrates for activity stains . the relative molecular mass of the native enzyme was determined by the previously mentioned method of andrews from measurements on a column of sephacryl s - 200 ( 1 . 5 × 75 cm ) calibrated with marker proteins . after the column was equilibrated with 50 mm potassium phosphate buffer , ph 7 . 0 , a solution containing purified enzyme was applied to the bed surface and eluted with equilibration buffer at a flow of 4 ml / h , collecting 1 . 5 ml fractions . the elution volume of the mdh corresponded to a relative molecular mass of 32 , 000 . the ability of various morphine alkaloids to serve as substrates was investigated by replacing morphine with each of the following analogues in turn : codeine , pholcodeine , morphine glucuronide , ethylmorphine , 6 - acetylmorphine , heroin , thebaine , dihydrocodeine , oxycodone and codeinone . ethanol was also tested as a substrate . each was added at a concentration of 2 mm to a reaction mixture containing 50 mm glycine - naoh buffer , ph 10 , 5 μg of purified mdh and 2 mm nadp in a final volume of 1 ml and at 30 ° c . morphine gave a specific activity of 0 . 002 μmol / min ./ mg . protein . codeine had an activity of 1 . 7 times and ethyl morphine 1 . 2 times that of morphine . all other substrates were completely inactive . using the more highly purified enzyme of example 4 , slightly different results were obtained . ethanol was also tested using a concentration of mdh twenty times higher , again with a negative result . the formulae of the alkaloid substrates tested are shown below . ## str2 ## in the reverse direction , the purified enzyme catalysed the oxidation of nadph when codeinone was the alkaloid substrate . purified mdh ( 48 μg ) was incubated at 50 ° c . in 50 mm potassium phosphate buffer , ph 7 . 0 . activity , determined as in example 2 , was plotted against time and it was thus determined that the mdh had a half - life of 6 . 5 min at 50 ° c . the mdh was purified to near electrophoretic homogeneity . apart from morphine , only two of a wide range of analogues acted as substrates namely codeine and ethylmorphine . in this state of purity the enzyme did not show any activity towards dihydrocodeine , which differs from codeine by the absence of the double bond on the cyclohexyl ring . the enzyme showed no activity towards 6 - acetylmorphine , where the hydroxyl group is on the aromatic c - 3 carbon . furthermore , with oxycodone which has a hydroxyl group at c - 14 there was also no activity . inactivity towards pholcodeine and morphine glucuronide might be due to the steric hindrance by the alkyl group at c - 3 , preventing the binding of the alkaloid at the active centre of the enzyme . furthermore , the enzyme was found to be highly specific in that it does not oxidise ethanol , a property important for use in narcotics biosensor . ( ethanol could be present from broken bottles of perfume or drink or in body fluids ) bulk cultures of p . putida m10 ( 400 liters ) were grown on the defined minimal medium of example 1 , supplemented with 10 mm glucose . cells were harvested and stored at - 80 ° c . the following procedures were performed at 4 ° c . and all centrifugations were run at 30 , 000 g for 20 min . the &# 34 ; mimetic &# 34 ; columns were supplied by affinity chromatography ltd ., freeport , ballasalla , isle of man , british isles . crude extract was prepared from 40 g ( wet weight ) of frozen glucose - grown cells . the cells were resuspended in buffer a ( 50 mm potassium phosphate - naoh , ph 7 . 0 , containing 1 mm dithiothreitol ) at a concentration of 0 . 5 g ( wet weight )/ ml and were disrupted by 3 min ultrasonication in a soniprep mse ultrasonic disintegrator at an amplitude of 10 μm . the sonicated cell suspension was centrifuged to remove the cell debris . the cell - free extract was applied to a mimetic orange 3 a6xl column ( 2 . 5 × 5 . 0 cm ) that had previously been equilibrated with buffer c ( 20 mm potassium phosphate , ph 7 . 0 , containing 1 mm dithiothreitol ). after adsorption , the column was washed extensively with buffer c containing 0 . 25m kcl until no further absorbance at 280 nm was evident in the eluate ( approx . 500 ml ), then the morphine dehydrogenase was eluted batchwise with 400 ml of buffer c , containing 0 . 8m kcl . fractions ( 10 . 2 ml ) were collected at a flow rate of 108 ml / h . this step separated the mdh from non - specific nadph oxidases and removed most of the contaminating proteins . pooled fractions ( 54 - 61 ) from the mimetic orange 3 affinity chromatography step containing the highest morphine dehydrogenase activity were dialysed overnight against 2 liters of buffer c . the dialysed sample was applied to a mimetic red 2 a6xl column ( 1 . 0 × 3 . 0 cm ) that had previously been equilibrated with buffer c . after adsorption on to the affinity matrix , the column was washed with buffer c until no absorbance at 280 nm due to protein could be detected in the eluate whence the enzyme was eluted batchwise with 0 . 1m kcl at a flow rate of 72 ml / h . a single peak at 280 nm was associated with all the mdh activity . the active fractions of the eluate ( 20 - 25 ) were pooled and concentrated in an amicon ultrafiltration cell fitted with a ym10 membrane . sds page gave a single protein band after staining with 0 . 1 % w / v coomassie blue r - 250 . non - denaturing page also gave a single band stained with coomassie blue r - 250 , which coincided with mdh activity , as determined by staining in a manner similar to that of example 3 . yields of mdh activity were improved by adding dithiothreitol to the equilibration and elution buffers . the purification method of this example was judged more satisfactory than those of examples 2 and 3 . the purification factor in terms of enzyme specific activity was 1216 times that of the crude extract . accordingly some re - determinations of properties of the mdh and determinations of further properties were undertaken . the relative molecular mass of the enzyme was re - determined by the above - cited method of andrews on columns of sephacryl s - 300 calibrated with marker proteins . after the column had been equilibrated with buffer a , a solution containing purified enzyme ( 3u ) was applied to the bed surface of the column and eluted with equilibration buffer at a flow rate of 8 ml / h , collecting 1 ml fractions . catalase ( m r 240 , 000 ), alcohol dehydrogenase ( m r 150 , 000 ) hexokinase ( m r 110 , 000 ), bovine serum albumin ( m r 66 , 000 ) and myoglobin ( m r 17 , 000 ) were used as standards . it was determined to be 32 , 000 ± 1000 as calculated from three independent determinations . when the mdh was subjected to sds / page calibrated with standard proteins , a single distinct band with an m r of 32 , 000 ± 1000 was obtained , thus indicating that mdh is monomeric . flat bed isoelectric focusing of the mdh was performed on an lkb multiphor apparatus using ph 3 . 5 - 9 . 5 ampholine pag plates . a constant voltage ( 750 v ) was applied for 5 h and the gel was maintained at 4 ° c . protein was detected by staining the gel for 10 min at 60 ° c . with coomassie blue r - 250 dissolved in ethanol / water / acetic acid ( 0 . 25 : 0 . 67 : 0 . 08 , by vol ). gels were diffusion - destained by repeated washing in the above solvent mixture . a single isoelectric point of 4 . 2 was obtained . mdh activity was measured by following the reduction of nadp + at 340 nm in glycine - naoh buffer containing 3 mm morphine , 3 mm nadp + and enzyme in a final volume of 1 ml , over the ph range 7 . 0 - 10 . 5 . in the reverse direction the reaction was measured in mops buffer , 0 . 5 mm nadph , 1 mm codeinone and enzyme in a total volume of 1 ml , over the ph range 6 . 0 - 8 . 5 . the unit of enzyme activity is defined as the amount of enzyme necessary to reduce 1 μmol of nadp + or to oxidise 1 μmol of nadph per min at 30 ° c . the ph optima were about 9 . 5 and 6 . 5 respectively . automated n - terminal sequence analysis was performed on an applied biosystems 470a sequencer . results are given in the sequence listing at the end of the description , immediately before the claims . morphine dehydrogenase was very unstable when stored at 4 ° c . although there was only slow loss of activity on prolonged storage ( approx . 10 % loss of activity over - two months ) at - 80 ° c . in buffer c . the thermal inactivation results of example 3 were confirmed . initial rates of oxidation of morphine and codeine were determined spectrophotometrically using reaction mixtures with all the components at the concentration of the standard assay ( 3 . 0 mm nadp + ), except for the alkaloid substrates which were varied within the range 0 . 15 - 2 . 0 mm for morphine , 0 . 015 - 0 . 5 mm for codeine and 0 . 5 - 10 mm for dihydrocodeine . double reciprocal and eadie - hofstee plots were linear throughout this range , and regression analysis of the data gave apparent k m values of 0 . 50 mm , 0 . 04 mm and 2 . 91 mm for morphine , codeine and dihydrocodeine , respectively . dehydrogenase activity was tested using 0 . 35 μg of purified enzyme with the alkaloid substrates at a final concentration of 3 mm , as described for ph optima , and at ph 9 . 5 . alcohol substrates were at a final concentration of 50 mm , whilst d , l - mandelic acid , testosterone and androsterone were at a final concentration of 10 mm . activities are relative to that determined with 3 mm morphine ( 0 . 0252 μmol nadph / min = 100 %). codeine had 120 % activity , dihydrocodeine 7 . 1 % and each of the following had zero activity : 6 - acetylmorphine , cyclohexanol , benzyl alcohol , butan - 2 - ol , propan - 2 - ol , ethanol , propanol , testosterone , androsterone and d , l - mandelic acid . inhibition of mdh by thiol - blocking reagents , chelating agents and heavy metals the purified mdh was incubated with the indicated reagents ( a ) for 10 min at room temperature and ( b ) for 16 h at 4 ° c . and then 10 min at 30 ° c . before enzyme activity was determined by the addition of 3 mm nadp + to the reaction mixture . the absolute activity , using 0 . 35 μg of enzyme , was 67 u / mg of protein (= 100 %). table 2 below shows the results . table 2______________________________________effect of various reagents on mdh activity ( a ) relative ( b ) relativeaddition to the activity activityassay mixture conc . ( mm ) (%) (%) ______________________________________none -- 100 16cuso . sub . 4 0 . 1 34 5p - hydroxymercuri - 0 . 01 0 . sup .+ 0 . sup .+ benzoate ( a thiol - blocking reagent ) n - ethylmaleimide 0 . 05 100 -- 1 . 0 58 23 * iodoacetate 0 . 1 61 1 . 0 58 10 . 0 54 30 * edta 0 . 5 104 188 - hydroxyquinoline 0 . 05 1001 , 10 - phenanthroline 0 . 05 76 0 . 5 61 142 , 2 &# 39 ;- dipyridyl 0 . 05 75 0 . 5 67 9dithiothreitol 1 . 0 97 64mercaptoethanol 1 . 0 100 73______________________________________ . sup .+ after incubation with 3 mm dithiothreitol for 10 min ( a ) 45 % and ( b ) 23 % of the activity was recovered . * after inbucation with 3 mm dithiothreitol no further activity was recovered . these data differentiate mdh even more clearly from most bacterial alcohol and aldehyde dehydrogenases which are insensitive to inhibition by metal chelating agents . the results suggest that a metal ion and thiol groups might be present at the active site . pharmaceutical grade heroin hydrochloride was supplied by macfarlan smith ltd ., ( edinburgh , scotland ). the amce was prepared as in example 1 . all solutions were prepared in deionised water that had been purified with a super q system ( millipore , uk ). microelectronic conductance devices were fabricated as described by l . d . watson et al ., biosensors 3 , 101 - 115 ( 1987 / 88 ). these electrodes bear a gold upper layer silicon wafer supports of varying composition and finish . the owen bridge type circuitry used requires two pairs of well matched microconductimetric devices , wire bonded onto the same flat ceramic base support and is generally similar to that disclosed by l . d . watson et al ., supra ; see also uk patent specification 2204408a ( the plessey company plc ). to monitor the reaction of the amce with heroin hydrochloride , two 5 μl aliquots of enzyme solution in imidazole buffer ( 2 mm ; ph 7 . 5 ) were placed on each of the reference and sample electrode pairs . heroin hydrochloride powder ( typically 2 - 3 grains ) was dusted from a paintbrush tip onto the sample pair of electrodes to simulate pick - up of heroin . a control reaction , in the absence of amce , was carried out with 5 μl aliquots of imidazole - hcl buffer ( 2 mm ; ph 7 . 5 ) on each of the reference and sample electrode pairs , followed by addition of powdered heroin hydrochloride ( typically 2 - 3 grains ) to the sample electrode . the conductimetric microelectrodes , described in this section have been highly sensitive in the detection of powdered heroin hydrochloride . addition of the powdered heroin hydrochloride to the sample cell produced a small increase in conductance measurement due to the hcl salt , but a much larger conductance increase due to amce degradation of the heroin to produce conducting acetate ions . in practice , the amce will be incorporated in a humectant composition as described in example 6 . acrylamide stock solution ( a ) was prepared according to methods given by bio - rad ( richmond , calif ., u . s . a . ), as follows , acrylamide ( 87 . 6 g ) and n &# 39 ; n &# 39 ;- bismethyleneacrylamide ( 2 . 4 g ) were dissolved in water in a total volume of 300 ml , filtered and stored at 4 ° c . in the dark . ( 1 ) acrylamide stock solution a , ( 2 ) freshly prepared ammonium persulphate solution ( 10 % w / v ), ( 3 ) electrophoretically pure temed and ( 4 ) buffered amce from example 1 ( 10 u / ml with 1 mg / ml total protein after deae - sephacel chromatography in potassium phosphate buffer , 50 mm ; ph 7 . 0 ) were mixed in the respective proportions of 200 : 10 : 5 : 1790 by vol . 10 μl of the mixture were spin - coated on to the microconductimetric electrode surface and left to gel ( 5 - 6 mins ). this humectant composition has a highly stable conductance ( in the absence of the dry sample ) at 30 ° c . and its conductance is relatively little perturbed by a change in atmospheric humidity . microconductimetric devices were spin coated with an amce / humectant mixture and stabilised by leaving them in the open atmosphere . after dusting prepared devices with heroin hydrochloride , the conductance increased rapidly and then levelled off to a constant value . heroin hydrochloride was therefore , readily solubilised by the humectant and the consequential increase in conductance recorded was due firstly to , addition of charged species -- chloride anions , protons and the quaternary ammonium cartons or secondly , as a result of amce activity , rapid hydrolysis of the acetyl ester groups of heroin . morphine dehydrogenase ( mdh ) was isolated from pseudomonas putida m10 , partially purified by deae - sephacel anion exchange chromatography as described in example 2 . using the method of b . f . y . yon - hin and c . r . lowe , anal . chem . 59 , 2111 - 2115 ( 1987 ) the working electrode was prepared as strips ( 0 . 5 cm × 6 cm ), cut from a porous nickel sheet ( 40 % porosity , 0 . 25 mm . thick , inco europe ltd .) and glued with an epoxy adhesive onto a ceramic base support . all the nickel surface was insulated with epoxy resin except for two areas required for external electrical contact and for a working surface area ( 0 . 5 cm × 0 . 5 cm ). silver / silver chloride ( ag / agcl ) reference electrodes were available from clark electromedical instruments ( reading , barks , uk ). hexacyanoferrate mediator , surface immobilised to porous nickel electrodes , was prepared as follows . the electrodes were pretreated by first sonicating in acetone in an ultrasonic bath and subsequently drying . they were poised at a fixed potential of - 1 . 0 v ( vs ag / agcl ) for 15 min ; the electrodes were cycled between - 0 . 1 v and + 0 . 4 v until a constant background profile was observed . the hexacyanoferrate films were electrochemically grown on these electrodes from an aqueous solution containing approximately 5 mm sodium ferricyanide by sweeping continuously between - 0 . 1 v and + 1 . 0 v at a sweep rate of 70 mv / sec . the modified electrodes were thoroughly rinsed in distilled water . a cyclic voltammogram was thus obtained during the deposition process . all solutions were prepared in deionised water that had been purified with a super q system ( millipore , uk ). steady - state current measurements were performed with the hexacyanoferrate - modified porous nickel electrode in buffer solutions ( sodium phosphate ( 0 . 01m ; ph 8 ) containing sodium perchlorate ( 0 . 1m ) ( 3 ml ) containing nadp + ( 2 mm ) and mdh . the electrode was poised at + 0 . 2 v ( vs ag / agcl ). once a background current was obtained , an aliquot of morphine hcl ( 2 mm ; 300 μl ) was added . after the mixture was stirred briefly , the current in quiescent solution was recorded . the steady - state current measurements recorded for morphine / mdh reaction with a nickel / hexacyanoferrate working electrode , are shown in fig6 . 5 . following the addition of buffered solutions of morphine ( 1 or 2 mm ), there is a rapid current increase which peaks and reduces to a steady - state value , for each drug concentration . it is contemplated that by using a two - working electrode system it will be possible to distinguish between any current response due to morphine addition as an hcl salt and any oxidation current response due to the dehydrogenase reaction . initial rates of oxidation of heroin were detected spectrophotometrically by measuring the production of nadph , which absorbs at 340 nm , using reaction mixtures containing a final volume of 1 ml , 50 mm glycine - naoh buffer mixture ( ph 10 ), 2 mm nadp , 0 . 6 mg of partially purified amce , 2 . 8 μg of purified mdh and heroin which was varied within the range 0 . 25 to 1 . 5 mm . the effect of heroin concentration on the coupled enzyme assay is shown in table 3 below . table 3______________________________________heroin concentration activity ( mm ) ( u × 10 . sup . 3 ) ______________________________________1 . 5 0 . 71 . 0 0 . 60 . 75 0 . 20 . 5 0 . 080 . 25 0 . 03______________________________________ activity ( u ) = μmol . nadph / min . a colorimetric assay for the detection of heroin has also been developed , incorporating the coupled assay of example 8 . the reaction mixture contained all the components at the standard concentration ( above ) and heroin at 1 . 5 mm . additionally , the mixture contained 0 . 45 mg nitroblue tetrazolium and 5 ng phenazine methosulphate . the transfer of electrons from nadph to nitroblue tetrazolium ( nbt ) by phenazine methosulphate reduces nbt to the insoluble formazan , giving a blue - purple colour . this assay is very specific for heroin and very rapid , the colour developing within 30 seconds . ______________________________________sequence listing______________________________________sequence id no : 1sequence type : amino acidsequence length : 25 amino acidsfragment type : n - terminaloriginal source : pseudomonas putida &# 34 ; m10 &# 34 ; deposited as a patent deposit as ncimb 40119experimental source : same as original sourceproperties : dehydrogenase enzyme with high specificity for morphineala gly lys ser pro leu ile asn leu asn asn gly val lys met1 5 10 15pro ala leu gly leu gly val phe ala ala20 25______________________________________ __________________________________________________________________________sequence listing ( 1 ) general information :( iii ) number of sequences : 1 ( 2 ) information for seq id no : 1 :( i ) sequence characteristics :( a ) length : 25 amino acids ( b ) type : amino acid ( d ) topology : linear ( ii ) molecule type : protein ( iii ) hypothetical : no ( v ) fragment type : n - terminal ( vi ) original source : ( a ) organism : pseudomonas putida ( b ) strain : m10 ( xi ) sequence description : seq id no : 1 : alaglylysserproleuileasnleuasnasnglyvallysmetpro151015alaleug lyleuglyvalphealaala2025 | 2 |
the present invention uses a smart card in combination with an authentication infrastructure to provide a software licensing system designed to control the distribution of a software package . smart cards provide a convenient yet secure way of transporting and storing sensitive information used in the authentication infrastructure . the software is freely distributed and copied , but software use is controlled by selling authorized , irreproducible smart cards , and authenticating the smart card before being able to use the software . one type of authentication infrastructure is public key infrastructure ( pki ), and it will be used to illustrate the principles of the invention . pki lays the foundation for a well - established system of authentication and authorization . combining the capabilities of smart cards and pki produces a new scheme of licensing that provides the level of security and flexibility that is unrealizable in pure software licensing . pki will be described further , as will smart card technology , followed by the ways in which these elements are combined . pki is a system of issuing and servicing authentication and authorization applications using public key cryptographic technologies . pki involves the following basic elements : public and private keys and key pairs , a one - way hash message digest , digital signatures , digital certificates , and certificate authorities . “ keys ” are issued in public / private pairs . what is encrypted with one key ( public or private ) can only be decrypted with the other key ( private or public ). this type of encryption , called “ public key cryptography ,” uses “ asymmetric ” keys , as compared to “ secure key cryptography ” which uses the same key to encrypt and decrypt (“ symmetric ” key ). a “ one - way hash message digest ” is generated when a hash algorithm takes a large chunk of data and compresses it into a digest of the original data . a preferred hash algorithm is substantially collision - free , which means that it is robust enough that there is only an infinitesimal theoretical probability of collision , i . e ., that another chunk of data happens to produce the same digest . a “ digital signature ” is a message digest encrypted using the private key of a public key pair in which the public key is known and trusted . the successful decryption of the message digest using the known and trusted public key ascertains the integrity and authenticity of a message . a “ digital certificate ” is a standard data format for associating between the organizational identity of an individual or network resource and its public key . a digital certificate is usually signed digitally by a trusted “ certificate authority ” ( ca ), which provides the infrastructure to ensure the authenticity of the issued certificates . a “ certificate authority ” is a trusted authority responsible for creating and certifying identities bound to the public key by signing the digital certificate with its private key , and by providing pervasive and trusted access to its own public key , in the form the of a “ root certificate .” a “ smart card ” is a credit - card sized plastic card containing an integrated circuit chip . the chip may come in one of two forms , contact and contactless , and the chip may contain memory only , memory with security logic , or memory with a cpu . the smart card of the present invention is preferably the latter . electronic properties and transmission characteristics of smart cards are defined by the iso 7816 standard series . smart cards have mainly been used to store and retrieve data as well as to run applications , and the possibilities are continuously expanding . with security intrinsically built in , the smart card offers protection of its content and renders itself tamper - resistant . due to its attractive security capabilities , smart card technology has been deployed extensively for financial transactions , cable tv subscriptions , phone cards , online securities , etc . many standards exist for smart cards and their development tools , some of which are fundamental and can be used in all applications ; and others of which are proprietary and are tied to particular vendors . as an illustrative example , one of the major smart card standards is “ java card ,” which is simply a regular smart card that allows java technology to run on it . by specifying the java application environment to numerous cooperating smart card manufacturers , and providing a set of application programming interfaces ( apis ) and tools for programming in such an environment , java card allows developers to create applications that will run on any java card technology - enabled smart cards across a range of vendors , thus benefiting from the inherent advantages of the java language itself . moreover , java card technology has a built - in framework to work with card vendors on cryptography algorithms and pki functionalities that are essential to licensing using smart cards . the smart card licensing scheme of the present invention includes three main entities shown in fig1 : the software vendor 10 ( i . e ., licensor ), the software ( or software package ) 20 ( i . e ., licensed product ), and a smart card 30 ( i . e ., license ). licensing requires successful and secure exchanges of information among the three entities at appropriate times . as fig1 indicates , the present invention involves vendor 10 issuing both software 20 and smart card 30 and interactions between software 20 and smart card 30 involving activation of software 20 , operation of software 20 , and addition and transfer of software options from the card to the software . the software is freely distributed and can be freely obtained , e . g ., through cd - roms or downloads from a website . the software alone does not provide fully functional service options , and thus cannot be used by itself . the presence of a legitimate smart card 30 issued by software vendor 10 is necessary to unlock the software &# 39 ; s functionality . when a user purchases a software license , he or she specifies the service options ( allowed software functionality ) desired , which are then placed on the smart card . the type and number of options from which to choose may vary based on the type of software . one option that may be included on software of any kind is the number of machines on which the software may operate ( herein called “ client support ”). on software designed for assisting with a user &# 39 ; s data storage needs , the illustrative example used herein , the software options may include mirroring , replication , and / or time marking ( i . e ., creating periodic , scheduled , point - in - time copies of data volumes ). once these service options are specified , software vendor 10 issues smart card 30 containing licensing material for those options . prior to issuing smart card 30 , software vendor 10 performs several tasks , generally as illustrated in fig2 . first , vendor 10 safely stores the vendor &# 39 ; s digital certificate and private key , as shown in 205 . the vendor &# 39 ; s digital certificate may be issued by a higher - level certificate authority ( ca ) or it may be a “ root ” certificate , which is issued and certified by vendor 10 itself rather than another ca . next , the vendor generates a public / private key pair 210 and stores it on smart card 30 . this key pair 210 is unique to each smart card 30 . the keys are randomly generated and securely exported to each card along with an associated smart card certificate 220 for the public / private key pair . smart card certificate 220 includes the card &# 39 ; s public key . digital certificates such as smart card certificate 220 can be generated using any of a number of existing apis . for example , the protocol openssl ( see www . openssl . org ) includes a command line tool to generate digital certificates . vendor 10 digitally signs certificate 220 by ( 1 ) performing a one - way hash function on certificate 220 to generate digest 230 and ( 2 ) encrypting digest 230 using the vendor &# 39 ; s private key to generate encrypted digest 240 , which is also loaded onto smart card 30 . this digital signature ensures that certificate 220 is indeed from software vendor 10 , while the hash function helps verify the integrity of that certificate &# 39 ; s content . examples of popular hash functions that may be used are md - 5 (“ message digest 5 ”), created by rsa laboratories , and sha - 1 (“ secure hash algorithm ”), developed by the u . s . national institute of standards and technology ( nist ). next , vendor 10 populates smart card 30 with a copy 250 of the vendor &# 39 ; s digital certificate ( which includes the vendor &# 39 ; s public key ), which will be used to validate the correct public key of vendor 10 when needed . if certificate 250 is a root certificate ( i . e ., no ca has signed it ), vendor 10 may create many resources for verifying the certificate by , for example , distributing a copy of certificate 250 in each smart card 30 issued , publishing certificate 250 on the vendor &# 39 ; s corporate website and possibly other authoritative websites , maintaining another copy of certificate 250 inside the software , and providing phone support for verification , in order to prevent someone from attempting to issue a phony certificate . the certificate is the same for every smart card for a specified software package 20 . however , the certificate may differ from one software package to another . next , vendor 10 populates smart card 30 with a list of symbols 260 that the software will interpret to determine the licensed service options for this card . finally , a cluster of binary software modules (“ binaries ”) 270 , sections of code extracted from the software , is placed on smart card 30 . these sections of code are missing from the actual software package 20 . smart card 30 is then shipped along with a card acceptance device ( e . g ., a card reader ), and is ready to interact with the licensed software 20 loaded onto a user &# 39 ; s machine . after smart card 30 is issued with the items described above , the software must be activated by authenticating the smart card . once the user launches software 20 , the software first checks whether there is a smart card to read from . after software 20 confirms a card &# 39 ; s presence , the activation stage begins , as illustrated in fig3 a . the first step is for software 20 to extract smart card certificate 220 and validate it . using vendor 10 &# 39 ; s public key from vendor certificate 250 , software 20 decrypts encrypted digest 240 ( which had been encrypted with the vendor &# 39 ; s private key ) to generate digest 330 . if the decryption works , then vendor 10 is indeed the author . next , software 20 performs a one - way hash on smart card certificate 220 itself using the same hash algorithm as was used in issuing the certificate , and generates another digest 230 . the software then compares the two digests 230 and 330 . if they match , the software can trust that the content of smart card certificate 220 has not been tampered with since the time vendor 10 digitally signed it . the authenticated certificate 220 then tells software 20 what the card &# 39 ; s public key is . as illustrated in fig3 b , given this information , the software then confirms that smart card 30 is the correct card associated with the public key by sending smart card 30 a challenge — something encrypted using the card &# 39 ; s public key — and waiting for a satisfying response . if smart card 30 correctly decrypts the challenge using its securely stored private key and responds back , it has passed the test . at this point , software 20 believes smart card 30 to be legitimate and uses it to determine which software options should be activated . as mentioned earlier , the smart card contains a list of symbols 260 , with each symbol representing one service option of the software . the list is now retrieved by software 20 and is interpreted , making the licensed options ready for use . fig4 illustrates a sample option list 400 . integers are used as symbols to facilitate explaining the operation of software 20 , but any kind of symbol may be used so long as the software is able to interpret it . in addition , simply interpreting option list 400 does not allow software 20 to provide the full functions of those options . one more piece of data is retrieved from smart card 30 — the cluster of code binaries 270 that is missing from the software . these binaries must be retrieved by software 20 at appropriate times for the software to operate normally . this imposes another obstacle to someone who tries to bypass the smart card licensing . once activated , software 20 allows full access to its specified options . smart card 30 is expected to remain in the card reader while the software operates . software 20 looks for the card periodically to ensure that it is indeed still in place . this periodic check is important because it prevents unauthorized users from using one smart card to run multiple copies of the software simultaneously . failure to do so defeats the purpose of licensing . in one illustrative variation , software 20 may be programmed to temporarily tolerate a missing smart card 30 ( such as when the card is accidentally removed from the reader ) and issue warnings to the user . only after such warnings are repeatedly ignored does software 20 take action to cease operation . software vendor 10 issues each smart card 30 specifying a defined set of licensed options 260 . in the illustrative embodiment ( see fig4 ), smart card 30 includes base software functionality , replication , and time marking for five clients ( client support = 5 ). however , there may come a time when the user desires to have more or different options from those that are included with the smart card . such an instance requires an option transfer to take place . this is done by issuing a new smart card 500 having an option list 560 that indicates the newly requested options as the only options licensed . smart card 500 does not need to know what options the original card 30 has . as far as card 500 is concerned , all other options are not licensed . option transfer can occur between any two smart cards issued by the same vendor 10 . the categories of information stored inside one smart card are exactly the same as another . consequently , any one of the cards can be used as a “ master card ” that activates and keeps the software running . options from several cards can all be consolidated into one “ master card ” if desired . the actual transfer process begins by reading the intended destination smart card 30 . software 20 authenticates card 30 ( as described with respect to fig3 a and 3b ), retrieves its smart card certificate 220 , and stores certificate 220 in a separate , temporary location 510 ( see fig5 a ) on the computer running the software . next , software 20 prompts the user to place source smart card 500 in the card reader and the software authenticates card 500 as was done in fig3 a and 3b . fig5 b shows a source smart card 500 having licensed options “ mirroring ” and “ client support = 10 .” software 20 lets the user choose the actual options desired to be transferred , and then informs source card 500 of the selections made , passing along the destination card &# 39 ; s certificate 220 . source card 500 now prepares to export those options . to ensure a destination card issued only by vendor 10 can import the options , source card 500 first authenticates received smart card certificate 220 . then source card 500 puts data representing the selected options 560 into a selected options package 530 ( see fig5 c ), encrypts selected options package 530 using the destination card &# 39 ; s public key , and timestamps the package , producing encrypted package 540 . only the smart card containing the destination card &# 39 ; s public key will be able to decrypt and use the options ( using the destination card &# 39 ; s private key ). then , source card 500 digitally signs encrypted package 540 using a hash function and source card 500 &# 39 ; s private key , producing encrypted digest 550 . both encrypted package 540 and encrypted digest 550 are transmitted to software 20 along with source card certificate 520 ( containing the source card &# 39 ; s public key ). as soon as options are exported , they are removed from source smart card 500 so that the same option cannot be transferred more than once . fig5 d shows the resulting state of source card 500 after these steps , assuming the user has selected “ mirroring ” and “ client support = 5 ” to transfer . source smart card 500 is updated ( mirroring = 1 − 1 = 0 and client support = 10 − 5 = 5 ) and then put away . software 20 authenticates destination card 30 again , and transfers encrypted package 540 and source card certificate 520 onto it . destination card 30 first makes sure encrypted package 540 comes from a smart card issued by vendor 10 by verifying the source card certificate 520 using the vendor &# 39 ; s root certificate stored inside each card , and then authenticates encrypted package 540 using encrypted digest 550 . once encrypted package 540 is authenticated , destination card 30 decrypts the package using the destination card &# 39 ; s private key and accepts the new options . this completes the transfer process . fig5 e shows the status of smart card 30 , including mirroring = 0 + 1 = 1 and client support = 5 + 5 = 10 . when transfer is complete , software 20 erases from memory 510 the data that was temporarily stored there . in order to prevent clever users from finding out how this transfer scheme works and copying the option package before software 20 has a chance to erase it ( thereby repeatedly downloading the same card using its correct private key , e . g ., to increase the client support count or the capacity supported ), the present invention uses the timestamp previously placed on package 540 . after importing the information from source card 500 , destination smart card 30 records the timestamp and knows not to again import a package having the same timestamp . the destination card memory retains the recorded timestamps , but the memory is limited , so if a user transfers options often , the destination card memory may fill up . in that case , the user can export the entire contents of the card to temporary software memory and then re - import the contents onto another smart card issued by vendor 10 . cards whose memory for storing timestamps is used up may be discarded or returned to the vendor . the above licensing system can be used with standalone computers or with networked or enterprise systems . however , use with networked or enterprise systems contemplates each networked computer having a smart card reader . in the event that each networked computer does not have a smart card reader , an alternate embodiment is described below . networked system 600 may include any number of networked computers 610 ( five of which , 610 - a , 610 - b , 610 - c , 610 - d , 610 - e , are shown in fig6 ) connected to each other via network 640 . network 640 may be , for example , a local area network ( lan ), a wide area network ( wan ), a metropolitan area network ( man ), or an internetwork of computers , such as the internet . the alternate licensing scheme may be implemented using only one smart card reader 660 attached to one of the networked computers , here computer 610 - e . this computer includes software , here called “ console program ” 650 , that can be used to distribute the licenses to different machines running the licensed software program . console program 650 can securely license options inside a smart card to each networked computer 610 . a software package 21 , which is slightly modified from software package 20 for use with this licensing scheme , includes an additional mechanism to internally generate a pair of asymmetric keys along with the corresponding certificate at the time software package 21 is loaded on each networked computer . the certificate contains the name of the networked computer to identify the keys with that machine . console program 650 acts as a middleman during transactions between the smart card and software 21 installed on each computer 610 . each smart card is initialized and issued the same way as described in the previous embodiment . thus , authenticating smart cards to verify that they are issued from vendor 10 is performed using the method described under “ activation of the software .” to perform authentication , console program 650 includes a copy of vendor 10 &# 39 ; s certificate securely stored for reference . just as in the previous embodiment , a network or system administrator is issued one or more smart cards containing the licensed materials paid for . these smart cards can be purchased directly from vendor 10 or from a reseller . when a card is inserted into card reader 660 , console program 650 authenticates the card and displays all the available license options . console program 650 also finds all computers in network 640 that desire to use software 21 . the system administrator chooses which license options to distribute to which computer 610 . once an appropriate computer is selected and options are assigned to it by the system administrator through the console program &# 39 ; s interface , the activation process for that computer begins . first , console program 650 asks computer 610 to provide a copy of the certificate the computer generated when software package 21 was first installed on the computer . console program 650 passes this certificate to the smart card along with the selections made by the system administrator . because in this embodiment licensing options are actually being exported , there must be a way for the options to be securely transferred back to the card when needed . therefore , the options package contains not only the licensing options , but also a ready - made return package that allows the card to restore its options . to produce the return package , the card encrypts the selected licensing options using its own public key so that no other card will be able to use the return package . a unique stamp is then added to the encrypted options , and the result is digitally signed using the card &# 39 ; s private key . such a stamp can be a timestamp as described earlier , or it can be any stamp that can be uniquely generated each time . the signature ensures that when the card later receives the return package , it will know that the package was not altered in any way . next , the card encrypts the selected licensing options again , this time using the passed - in certificate &# 39 ; s public key , and attaches the same unique stamp to it . the result is the export package that the target computer will be able to decrypt and use . lastly , the return package and the export package are combined and signed together using the card &# 39 ; s private key , and the result is sent back to console program 650 along with the card &# 39 ; s certificate . the unique stamp for this package is recorded inside the card , in a recording area different from the stamp history list for transfers between cards , described in the previous embodiment . this recording area exists only in this alternate embodiment . console program 650 subsequently passes everything to the networked computer . the options exported are then deducted from the smart card . when computer 610 receives the package , software 21 first verifies the signature on the smart card &# 39 ; s certificate against the vendor &# 39 ; s certificate to make sure this package comes from a valid smart card from vendor 10 . then the software verifies the card &# 39 ; s signature on the package and tries to decrypt the package using the internal private key generated by software 21 . before decryption , software 21 makes sure the computer it is running on matches the computer name on its own certificate . software 21 checks the timestamp to make sure that it did not already receive this package ( the software maintains a list of timestamps for packages it already received and is using ). software 21 decrypts the export package , accepts the licensing options , and activates them accordingly . the entire package including the return package is stored securely in computer 610 &# 39 ; s memory for necessary checks and operations in the future ( as described below ). periodically , the activated software 21 performs a reaffirmation with the smart card , a step that is taken because of security issues related to software deactivation , described below . reaffirmation involves console program 650 asking software 21 operating on a networked computer for a copy of its option package , the computer passing it to the smart card , and having the card check whether the random number stamp inside the package is stored in the card as one of the distributed packages . if so , then this computer is indeed licensed by this card . otherwise , this computer either never received a licensed package from this card or is using a license package that has already been retracted . this alternate embodiment introduces a feature that is not needed in the previous embodiment . in the previous embodiment , a computer is activated when the valid smart card is inserted into its attached smart card reader , and the smart card must remain in the card reader for the computer to remain activated . when the smart card is removed from the card reader , the software 20 is automatically deactivated . the options inside such a smart card do not change except when transferring options . in the alternate embodiment , however , activating the software on a networked computer 610 requires actual deduction of options from a smart card . the deducted options are physically transferred to the designated computer &# 39 ; s memory where they remain . the receiving computer &# 39 ; s licensed options are thus sustained once activated . there is no automatic deactivation . this process works so long as the system administrator does not ever want to use these options on a different networked computer or change the options for this computer . once a system administrator chooses to reallocate options within a networked computer or among networked computers , the options need to be taken from the current computer and redistributed accordingly . the current computer will then end up being deactivated unless some purchased options are again allocated to it . to retract an option package , console program 650 tells the target networked computer to submit its package and destroy any remains of it in the system . to make sure that the receiving card is not some random smart card , however , the same card that initially issued the option package to the networked computer should be used . the target computer , the computer whose option package is being retracted , first generates a random number and sends it to the card as a challenge . the card digitally signs the number and returns the result . the target computer checks the signature against the card &# 39 ; s certificate that was received along with the option package , and only agrees to give up the package when verification succeeds . the package submitted by the networked computer does not need to be the entire package it received , but only the return package inside . when the smart card receives the package , it first verifies its own signature on the package . then , it looks at the unique stamp . if the stamp matches any of the recorded stamps for distributed packages , then this return package is acceptable and the card decrypts the licensing options using its private key and restores them onto its array of options . the recorded stamp for this package is then removed from the list of timestamps the software maintains . the present invention is not limited to the illustrative example of storage software licensing — the problems faced in software product licensing are experienced by any software vendor , especially major enterprise software vendors . the options and capabilities available may be tailored to the specific type of software being licensed . vendors can generate their own certificates and public / private key pairs . the present invention is also not limited to the illustrative example of public key cryptography as an authentication infrastructure . other authentication infrastructures may be used , so long as they authenticate a user &# 39 ; s smart card . thus , biometric identification of a user may be used . biometric identification uses physiological characteristics and behavioral traits for the automatic identification , or identity verification , of persons . in general , biometric identification requires sensors to convert a physical characteristic or behavior of a person into a signal that can be stored , or compared to previously stored signals , using a computer . some examples of biometric identification include identifying a user by a fingerprint , a thumb print , an iris scan , a retinal scan , facial recognition , and dna . additional advantages and modifications will readily occur to those skilled in the art . therefore , the present invention in its broader aspects is not limited to the specific embodiments , details , and representative devices shown and described herein . accordingly , various changes , substitutions , and alterations may be made to such embodiments without departing from the spirit or scope of the general inventive concept as defined by the appended claims . | 7 |
referring now in greater detail to the drawings , in which like numerals represent like components throughout the several views , fig1 is a partially cut - away , rear perspective view of an automotive vehicle 30 , in accordance with a first preferred embodiment of the present invention . the vehicle 30 includes a front 32 , a rear 34 , a right side 36 , and a left side 38 . the vehicle 30 further includes a conventional frame 40 which is generally covered by a conventional body 42 . wheels 48a - d are connected to the frame 40 in a conventional manner . wheel 48d , which is not seen , is situated on the left side 38 toward the front 32 of the vehicle 30 . portions of the body 42 are cut - away at the rear 34 to expose a drive train 46 which includes a motor 44 . in accordance with the first preferred embodiment of the present invention , the drive train 46 , or more particularly the motor 44 , is central to the inventive aspects of present invention . as discussed in greater detail below , the motor 44 preferably turns the wheels 48a , b by virtue of the fact that an output shaft 51 ( fig7 and 8 ) of the motor 44 turns an output gear 55 . as is also further discussed below , a motor housing 53 portion of the motor 44 inventively pivots and is linked to sub - components such as , but not limited to , an air spoiler 50 and suspension arms 52a , b such that the sub - components pivot in response to the pivoting of the motor housing 53 . a spoiler linkage assembly 86 links the motor housing 53 to the air spoiler 50 . the air spoiler 50 is shown partially cut - away if fig1 . a suspension linkage assembly 76 links the suspension arms 52a , b to the motor housing 53 . the suspension arms 52a , b extend laterally from the frame 40 to support the wheels 48a , b respectively . fig2 is another partially cut - away , rear perspective view of the automotive vehicle 30 , in accordance with the first preferred embodiment , wherein the front 32 ( fig1 ) of the vehicle 30 , rear portions of the body 42 , and a portion of the air spoiler 50 are cut - away . as discussed above , the motor 44 includes the outer motor housing 53 and the output shaft 51 ( fig7 and 8 ) to which the output gear 55 is attached . in accordance with the preferred embodiment of the present invention , the motor 44 is preferably a direct - current type of electric motor , whereby the output shaft 51 is an armature shaft ( see fig1 for an exemplary armature shaft 176 ). in accordance with alternate embodiments of the present invention , the motor 44 is , for example and not limitation , acceptably a gasoline engine , diesel engine , alternating - current electric motor , or the like . opposite ends of the motor housing 53 are pivotally mounted to the frame 40 by a pair of motor mounts 54a , b . the motor mounts 54a , b include mounting plates 56a , b , respectively , that are rigidly connected to the frame 40 . the motor mounts 54a , b further include bearing plates 58a , b , respectively , that are rigidly connected to the mounting plates 56a , b , respectively . as discussed in greater detail below , the bearing plates 58a , b cooperate with the opposite ends of the motor housing 53 to pivotally mount the motor housing 53 to the frame 40 . the mounting plates 56a , b are interconnected by interconnection members 60 , 62 , as discussed in greater detail below . the drive train 46 further includes a conventional transmission assembly 63 that is disposed between the mounting plates 56a , b . the transmission assembly 63 is just forward of the motor 44 and is partially hidden behind the mounting plate 56a in fig1 and 2 . also included in the drive train 46 is a drive gear 64 that is extended from the transmission assembly 63 and meshes with the output gear 55 . the drive train 46 further includes axles 66a , b that extend from opposite sides of the transmission assembly 63 to the wheels 48a , b , respectively . rotation of the output gear 55 causes rotation of the drive gear 64 , which , in conjunction with the transmission assembly 63 , causes the axles 66a , b to rotate the wheels 48a , b , respectively , in a conventional manner . the wheels 48a , b are connected to the frame in a conventional manner by suspension arms 52a , b , respectively . each suspension arm 52a , b includes elongated members 68 , 70 that span between a wheel 48 and the frame 40 , and an web 72 extending between the elongated members 68 , 70 . one end of each suspension arm 52a , b is pivotally connected to the frame 40 by a bushing assembly 74 ( only one of which is seen in the figures herewith ) in a conventional manner . the opposite end of the suspension arms 52a , b is connected to one of the wheels 48a , b , respectively , in a conventional manner . in accordance with the preferred embodiment of the present invention , the pivoting of the suspension arms 52a , b relative to the frame 40 is at least partially controlled and dampened by shock absorber and spring assemblies ( not shown ) in a conventional manner , as should be understood by those reasonably skilled in the art . as mentioned previously , in accordance with the first preferred embodiment of the present invention , the motor housing 53 pivots with respect to the frame 40 . the pivoting motion of the motor housing 53 is transferred by way of the suspension linkage assembly 76 to the suspension arms 52a , b , as discussed in greater detail below . the suspension linkage 76 assembly includes a link block 78 connected to the motor housing 53 and a traction assembly 80 connected to the link block 78 . in accordance with the first preferred embodiment of the present invention , the traction assembly 80 is in the form of a traction bar 82 having opposite bar ends 84a , b which selectively apply force to the suspension arms 52a , b , respectively . the traction bar 82 is generally planar and rigid . as also mentioned previously , the pivoting motion of the motor housing 53 is additionally transferred by way of the spoiler linkage assembly 86 to a wing 88 portion of the air spoiler 50 . referring additionally to fig3 which is an isolated rear view of the air spoiler 50 in accordance with the first preferred embodiment , the wing 88 of the air spoiler 50 includes a front edge 90 and a rear edge 92 . pivot posts 94a , b depend from the underside of the wing 88 proximate to opposite ends of the wing 88 . support posts 96a , b extend upward from the vehicle 30 to the wing 88 . the lower ends of the support posts 96a , b are preferably rigidly connected to the vehicle 30 . an elongated pivot rod 98 is connected at opposite ends thereof to the pivot posts 94a , b and extends through apertures defined through the upper ends of the support posts 96a , b in a manner that allows for the pivoting of the wing 88 relative to the support posts 96a , b . an upper link member 100 depends from the bottom of the wing 88 forward of the pivot rod 98 . referring back to fig2 the spoiler linkage assembly 86 includes a lower link member 102 protruding upward from the link block 78 . the spoiler linkage assembly 86 further includes a connecting rod 104 having opposite ends which are pivotally connected to the upper link member 100 and the lower link member 102 , respectively . fig4 is a right side elevational view of one of the mounting plates 56a , b ( fig2 ), the side opposite being a mirror image . in accordance with the first preferred embodiment of the present invention , each of the mounting plates 56a , b is generally identical . each mounting plate 56a , b is generally planar and thin , and defines connection holes 106 , 108 , 110 , 112 , 113 , a connection slot 114 , and a port 116 therethrough . further , each mounting plate 56a , b defines a recess 118 that is oriented generally toward the rear 34 ( fig1 ) of the vehicle 30 ( fig1 and 2 ), while the connection hole 110 is oriented generally toward the front 32 ( fig1 ) of the vehicle 30 . additionally , each mounting plate 56a , b defines a trailing edge 119 . referring to both fig2 and 4 , mounting plate 56a is oriented toward the right side 36 ( fig2 ) of the vehicle 30 . the left side of the mounting plate 56a abuts the right side of the transmission assembly 63 ( fig2 ). a plurality of threaded rods ( not shown ) extend from the right side of the transmission assembly 63 , and one of the plurality of threaded rods extends into each of the connection holes 112 , 110 , 108 to stabilize the mounting plate 56a with respect to the transmission assembly 63 . the terminuses of the threaded rods that extend into the connection holes 112 , 110 are preferably flush with the right side surface of the mounting plate 56a so as not to interfere with the rotation of the drive gear 64 ( fig2 ). the terminus of the threaded rod that extends into the connection hole 108 actually extends from the right side of the mounting plate 56a , and a nut ( not shown ) is threaded onto that exposed terminus to rigidly secure the mounting plate 56a to the transmission assembly 63 . additionally , a horizontally extending rod ( not shown ) has a fist end connected at the connection hole 113 of mounting plate 56a and an opposite second end connected at the connection hole 113 of mounting plate 56b . a bolt 115 and associated washer that connects that horizontally extending rod ( not shown ) to the connection hole 113 of the mounting plate 56a is seen in fig6 . a similar bolt ( not shown ) is associated with the connection hole 113 of the mounting plate 56b . regarding the mounting plate 56b , the right ends of the interconnection members 60 , 62 ( fig2 ) are connected the left side of the transmission assembly 63 ( fig2 ). the left ends of the interconnection members 60 , 62 abut the right side of the mounting plate 56b . a threaded rod ( not shown ) protrudes from the left end of the interconnection member 60 and passes through the connection hole 110 of the mounting plate 56b where it is in receipt of a nut ( not shown ) such that the mounting plate 56b is rigidly connected to the transmission assembly 63 . the left end of the interconnection member 62 is similarly connected to the connection hole 112 of the mounting plate 56b by way of a threaded rod and nut ( neither of which is shown ) such that the mounting plate 56b is further rigidly connected to the transmission assembly 63 . an additional interconnection member ( not shown ) is similarly connected between the left side of the transmission assembly 63 and connection hole 108 of the mounting plate 56b . fig5 is a right side elevational view of one of the bearing plates 58a , b ( fig2 ), the side opposite being a mirror image . in accordance with the first preferred embodiment of the present invention , each of the bearing plates 58a , b is generally identical . each of the bearing plates 58a , b is generally planar and thin . each of the bearing plates 58a , b defines connection holes 120 , 122 , and a rotation hole 124 therethrough . the bearing plates 58a , b each include a bearing surface 126 that encircles and defines the rotation hole 124 . referring additionally to fig6 which is an isolated , cut - away , right side , elevational view of the rear 34 of the vehicle 30 , in accordance with the first preferred embodiment of the present invention , the right side of the bearing plate 58a abuts the left side of the mounting plate 56a . the connection holes 120 , 122 of the bearing plate 58a align with the connection slot 114 ( fig4 ) and connection hole 106 ( fig4 ), respectively , of the mounting plate 56a . bolts 128 , 130 , with associated washers , rigidly connect the bearing plate 58a to the mounting plate 56a such that the rotation hole 124 defined through the bearing plate 58a is aligned with the recess 118 defined through the mounting plate 56a . the head of the bolt 128 abuts a washer that abuts the right side of the mounting plate 56a , and the threaded rod of the bolt 128 extends through the connection slot 114 ( fig4 ) of the mounting plate 56a and threads into the connection hole 120 in the bearing plate 58a . the connection slot 114 accommodates selective manual forward and rearward adjustment of the motor 44 , which adjustment assures proper meshing of the output gear 55 and the drive gear 64 . the threaded rod of the bolt 128 preferably does not extend from the left side of the bearing plate 58a . the bolt 130 similarly connects the bearing plate 58a to the mounting plate 56a by way of the connection hole 106 ( fig4 ) of mounting plate 56a and the connection hole 122 of the bearing plate 58a . the bearing plate 58b is similarly rigidly connected to the right side of the mounting plate 56b by way of a pair of bolts ( not shown ) interacting with the connection holes 120 , 122 of the bearing plate 58b and the connection slot 114 and the connection hole 106 of the mounting plate 56b . fig7 is an isolated , rear perspective view of the motor 44 with the link block 78 exploded therefrom , in accordance with the first preferred embodiment of the present invention . the motor housing 53 defines two connection holes 132 , 134 , and the link block 78 defines two connection passages 136 , 138 therethrough . the threaded rods of bolts 140 , 142 extend through the connection passages 136 , 138 , respectively , and thread into the connection holes 132 , 134 , respectively to rigidly secure the link block 78 to the motor housing 53 . the lower link member 102 ( fig2 and 9 ) fits into a bore 146 in the top of the link block 78 , and the top of the traction bar 82 ( fig2 and 9 ) is rigidly affixed to the bottom of the link block 78 . the motor 44 includes a right end 148 and a left end 150 . the output shaft 51 ( e . g . an armature shaft in accordance with the first preferred embodiment ) protrudes from the motor housing 53 at the right end 150 . the output gear 55 fits over the terminus of the output shaft 51 and is secured thereto by a set screw ( not shown ). a pair of electrical wires 152 , 154 are connected to the left end 150 of the motor 44 and extend to a battery assembly ( not shown ) that selectively and controllably supplies electricity to the motor 44 . the supply of electricity causes the output shaft 51 , and thereby the output gear 55 , to rotate about the engine axis 156 . an annular cylinder in the form of a journal , which is a journal sleeve 158a in accordance with the first preferred embodiment , protrudes from the motor housing 53 at the right end 148 . similarly , an annular cylinder in the form of a journal , which is a journal sleeve 158b in accordance with the first preferred embodiment , protrudes from the motor housing 53 at the left end 150 . fig8 is an isolated , top plan view of the motor 44 . electrical leads 162 , 164 extend from the left end 150 and receive the electrical wires 152 , 154 ( fig7 ), respectively . the journal sleeve 158a includes an annular peripheral surface 166a and an annular , radially extending lip 168a . in accordance with the first preferred embodiment of the present invention , the peripheral surface 166a of journal sleeve 158a resides within the rotation hole 124 ( fig5 ) of the bearing plate 58a ( fig2 and 9 ) such that the peripheral surface 166a and the lip 168a of the journal sleeve 158a slidingly cooperate with the bearing surface 126 ( fig5 ) and the left side surface , respectively , of the bearing plate 58a . similarly , the journal sleeve 158b includes an annular peripheral surface 166b and an annular , radially extending lip 168b . the peripheral surface 166b of the journal sleeve 158b resides within the rotation hole 124 ( fig5 ) of the bearing plate 58b ( fig2 ) such that the peripheral surface 166b and the lip 168b of the journal sleeve 158b slidingly cooperate with the bearing surface 126 ( fig5 ) and the right side surface , respectively , of the bearing plate 58b . the interaction of the journal sleeves 158a , b with the bearing plates 58a , b ( fig2 ), respectively , allow for the selective pivoting of the housing 53 about the motor axis 156 . that is , the journal sleeves 158a , b are capable of slidingly and pivotally interacting with the bearing plates 58a , b , respectively . in accordance with the first preferred embodiment of the present invention , the vehicle 30 operates as follows . referring back to fig2 when the motor 44 operates , the output shaft 51 ( fig7 and 8 ) turns in a counterclockwise direction ( when viewed from the right side 36 ) such that the remainder of the drive train 46 causes the wheels 48a , b to turn so as to propel the vehicle 30 forward . a reactionary force is developed during motor 44 acceleration that seeks to cause the motor housing 53 to turn in a clockwise direction ( when viewed from the right side 36 ). due to the fact that the motor housing 53 is pivotally mounted at the opposite ends thereof , as discussed above , the motor housing 53 tends to pivot clockwise ( when viewed from the right side 36 ) during motor acceleration in response to the aforementioned acceleration related reactionary force . reactionary forces also exist during times of motor 44 deceleration that tend to pivot the motor housing 53 counterclockwise ( when viewed from the right side 36 ). referring to fig7 in accordance with the first preferred embodiment of the present invention , the motor housing 53 pivots through an angle &# 34 ; a &# 34 ; about the motor axis 156 . this pivoting occurs while the motor housing 53 is mounted , in the manner discussed above , to the motor mounts 54a , b ( fig2 ) due to the aforementioned reactionary forces . in accordance with the first preferred embodiment of the present invention , the angle &# 34 ; a &# 34 ; is approximately 40 degrees , while in other embodiments of the present invention the angle &# 34 ; a &# 34 ; is greater than and less than 40 degrees . more specifically , and with reference to fig2 and 6 , in accordance with the first preferred embodiment of the present invention , during times of motor 44 acceleration , the motor housing 53 tends to pivot clockwise ( when viewed from the right side 36 ) such that the suspension linkage assembly 76 causes the traction bar 82 to pivot clockwise ( when viewed from the right side 36 ) such that the bar ends 84a , b thereof contact and force the suspension arms 52a , b , respectively , downward in a manner that tends to increase wheel 48 traction ; as is represented by arrow &# 34 ; a &# 34 ; in fig6 . in accordance with the first preferred embodiment of the present invention , the downward force is generated even if the tires 48a , b do not have traction with respect to the surface they are intended to be contacting . additionally , during times of motor 44 acceleration , the clockwise pivoting of the motor housing 53 causes the spoiler linkage assembly 86 to pivot the wing 88 counterclockwise ( when viewed from the right side 36 ) such that the wing 88 tends to be generally horizontal during periods of acceleration to minimize wind resistance . the degree to which the wing 88 is capable of pivoting counterclockwise is limited by the distance to which the traction bar 82 is capable of pivoting the suspension arms 52a , b downward . in other words , the suspension arms 52a , b function as stops that the define the maximum distance to which the motor housing 53 is capable of rotating in the clockwise direction . in accordance with the first preferred embodiment of the present invention , clockwise rotation of the motor housing 53 is preferably limited solely by the suspension arms 52a , b . fig9 is an isolated , cut - away , right side , elevational view of portions of the rear 34 of the vehicle 30 , in accordance with the first preferred embodiment of the present invention . as discussed above , and with reference to both fig2 and 9 , during times of motor 44 deceleration , the motor housing 53 tends to pivot counterclockwise ( when viewed from the right side 36 ). in response to this counterclockwise pivoting , the suspension linkage assembly 76 causes the traction bar 82 to pivot counterclockwise ( when viewed from the right side 36 ) such that the bar ends 84a , b thereof tend to move away from the suspension arms 52a , b , respectively , as is indicated by arrow &# 34 ; b &# 34 ; in fig9 . also , as the traction bar 82 pivots counterclockwise , the underside of the traction bar 82 eventually abuts the trailing edges 119 ( fig4 ) of the mounting plates 56a , b , whereby the counterclockwise rotation of the motor housing 53 is limited . in accordance with the first preferred embodiment of the present invention , counterclockwise rotation of the motor housing 53 is preferably limited solely by the abutment of the underside of the traction bar 82 with the trailing edges 119 . additionally , during times of motor 44 deceleration , the counterclockwise pivoting of the motor housing 53 causes the spoiler linkage assembly 86 to pivot the wing 88 clockwise ( when viewed from the right side 36 ) such that the wing 88 tends toward a more vertical configuration during motor 44 deceleration , whereby the wing 88 tends to slow the vehicle 30 . the wing 88 is preferably pivoted clockwise such that the front edge 90 of the wing 88 is lower than the rear edge 92 . thus , as the vehicle 30 travels forward , air impinges upon the upper surface of the wing 88 such that the rear 34 of the vehicle 30 is forced downward in a manner that increases tire 48a , b traction . in accordance with the first preferred embodiment of the present invention , the automotive vehicle 30 is acceptably , but not limited to , a reduced scale , radio controlled , electric car . the fact that the vehicle 30 is , in accordance with the first preferred embodiment , a reduced scale and radio controlled vehicle 30 is significant in that humans are preferably not transported therein . when humans are transported in a vehicle , the humans can typically sense the performance characteristics of the vehicle and adjust sub - components of the vehicle accordingly to maintain vehicle stability and predictability . as mentioned just above , in accordance with the first preferred embodiment of the present invention the vehicle 30 is a reduced scale vehicle ; therefore , humans are preferably not transported in the vehicle 30 . thus , it is important that the vehicle 30 of the first preferred embodiment operates in a manner such that the vehicle 30 is automatically stable and predictable as a result of the inventive aspects of the present invention , as discussed in greater detail below . the scale of the vehicle 30 is preferably approximately 1 / 10 or 1 / 12 of that of a vehicle that transports humans . an acceptable example of a reduced scale , radio controlled , electric car , which is capable of being modified to function as the automotive vehicle 30 of the first preferred embodiment , is an rc10 graphite car which is available from associated electrics , inc . of costa mesa , calif . the mounting plates 56a , b ( fig2 , 6 , and 9 ) are acceptably constructed from a generally rigid material such as , but not limited to aluminum or graphite . the bearing plates 58a , b ( fig2 , 6 , and 9 ) are also acceptably constructed from a generally rigid material such as , but not limited to , aluminum or graphite . additionally , the journal sleeves 158a , b ( fig7 , 11 , and 12 ) are acceptably constructed from a generally rigid material such as , but not limited to aluminum . as mentioned previously , in accordance with the first preferred embodiment the motor 44 is acceptably a direct - current type electric motor . an acceptable example of an electric motor is an extech motor available from trinity of linden , n . j . fig1 is a perspective , exploded view of an acceptable motor 44 &# 39 ; prior to being modified such that it includes journal sleeves 158a , b ( fig7 , 11 , and 12 ). the motor 44 &# 39 ; includes a motor housing 53 &# 39 ; into which the connection holes 132 , 134 ( fig7 ) are bored . the motor 44 &# 39 ; further includes bearing housings 174a , b ( bearing housing 174b is not seen ) that protrude from opposite ends of the motor 44 &# 39 ;. the opposite ends of the armature shaft 176 extend into and through the bearing housings 174a , b , and the bearing housings 174a , b are constructed and arranged to provide for the pivoting of the armature shaft 176 with respect to the motor housing 53 . while the bearing housing 174a is clearly seen , the bearing housing 174b is obscured within excess material 178 at one end of the motor 44 &# 39 ;. in accordance with the first preferred embodiment of the present invention , the excess material 178 is at least partially cut - away to expose the bearing housing 174b . then , the journal sleeves 158a , b are press - fit over the bearing housings 174a , b , respectively . fig1 and 12 are isolated right side 36 ( fig1 ) and rear 34 ( fig1 ) views , respectively the journal sleeve 158a , which is generally representative of journal sleeve 158a ( fig7 and 8 ). the journal sleeve 158a defines an aperture 182 therethrough that is occupied by the bearing housing 174a ( fig1 ) subsequent to the press fitting of the journal sleeve 158a over the bearing housing 174a . the journal sleeve 158a includes the annular peripheral surface 166a and the annular lip 168a . in accordance with an alternate embodiment of the present invention , the journal sleeves , 158a , b are not employed . rather , the bearing housings 174a , b ( fig1 ) are smoothed , for example by &# 34 ; turning them &# 34 ; on a lathe , and the resulting exterior annular surface of the bearing housings 174a , b are employed as journals with respect to the bearing plates 58a , b ( fig2 , 6 , and 9 ). fig1 and 14 are rear and top views , respectively , of isolated and cut - away portions of the rear 34 &# 39 ; of an automotive vehicle 30 &# 39 ;, in accordance with a second preferred embodiment of the present invention . with the exception of that which is noted , the automotive vehicle 30 &# 39 ; of the second preferred embodiment is generally identical to the automotive vehicle 30 ( fig1 and 2 ) of the first preferred embodiment . the automotive vehicle 30 &# 39 ; of the second preferred embodiment includes a suspension linkage assembly 74 &# 39 ; that includes a bar member 180 having a bushing 182 extending through a hole ( not seen ) defined through the bar member 180 . a bolt 184 extends through the bushing 182 and threads into the connection hole 134 ( fig7 ) defined in the motor housing 53 &# 34 ; of the motor 44 &# 34 ; such that the bar member 180 is capable of pivoting about the elongated axis of the bolt 184 . the bar member 180 defines another hole 186 therethrough . in accordance with alternate embodiments of the present invention , a supplemental bolt ( not shown ) is capable of being extended through the hole 186 and threaded into the connection hole 132 ( fig7 ) of the motor housing 53 &# 34 ; to selectively preclude rotation of the bar member 180 about the bolt 184 . pivot pins 186a , b extend through holes defined through the bar member 180 proximate to the opposite ends thereof the pivot pins 186a , b are capable of pivoting about their elongated axes relative to the bar member 180 . rods 188a , b extend between the pivot pins 186a , b , respectively , and the suspension arms 52 &# 39 ; a , b . the portions of the pivot pins 186a , b that depend from the bar member 180 defined holes therethrough . ends of the rods 188a , b extend through the holes in the pivot pins 186a , b , respectively . linkage plates 190a , b are attached to the suspension arms 52 &# 39 ; a , b , respectively . the linkage plates 188a , b define apertures 191a , b , respectively , therethrough . the apertures 191a , b are in receipt of the ends of the rods 188a , b , respectively , which are distant from the pivot pins 186a , b . the suspension linkage assembly 74 &# 39 ; functions to transfer rotation of the motor housing 53 &# 34 ; to the suspension arms 52 &# 39 ; a , b in a manner similar to that in which the linkage assembly 74 ( fig2 ) of the first preferred embodiment functions . however , it is thought that the pivoting of the bar member 180 with respect to the motor housing 53 &# 34 ; might enhance the performance of the vehicle 30 by maintaining the independence of the suspension arms 52 &# 39 ; a , b . further , performance characteristics are capable of being varied by decreasing the effective size of the apertures 191a , b defined through the linkage plates 190a , b . the effective size of the apertures 191a , b is capable of being varied , for example , by partially occluding the apertures 191a , b with bolts or the like . additionally , in accordance with the second preferred embodiment of the present invention , the linkage plates 190a , b are capable of being manually repositioned along the length of the suspension arms 52 &# 39 ; a , b , and this will vary the performance characteristics of the vehicle 30 &# 39 ;. for example , and not limitation , the linkage plates 190a , b are shown variously positioned in fig1 - 17 , which are rear views of isolated and cut - away portions of the rear 34 &# 39 ; of the automotive vehicle 30 &# 39 ;, in accordance with the second preferred embodiment of the present invention . referring back to fig1 and 14 , the aforementioned pivoting of the pivot pins 186a , b accommodates for the various positioning of the linkage plates 190a , b ( see fig1 - 17 for example ). the linkage plates 190a , b function to limit the degree to which the motor housing 53 &# 34 ; is capable of rotating about the motor axis by virtue of the fact that the travel of the ends of the rods 188a , b within the apertures 191a , b is limited by the linkage plates 190a , b . thus , in accordance with the second preferred embodiment of the present invention , the mounting plates 56a , b ( fig2 , 6 , and 9 ) of the first preferred embodiment are preferably replaced with modified mounting plates 56 &# 39 ; a , b ( fig1 ) that do not include trailing edges 119 ( fig4 ) for abutting the suspension linkage assembly 74 &# 39 ; in a manner that limits rotation of the motor housing 53 &# 39 ;&# 34 ;. additionally , the horizontally extending rod of the first preferred embodiment that extends between the connection holes 113 ( fig4 ) of the mounting plates 56a , b ( fig2 , 6 , and 9 ), respectively , is not included in the second preferred embodiment of the present invention . fig1 is a right side elevational view of one of the modified mounting plates 56 &# 39 ; a , b , the side opposite being a mirror image , in accordance with the second preferred embodiment of the present invention . the modified mounting plates 56a , b are preferably generally identical . referring back to fig1 and 14 , the automotive vehicle 30 &# 39 ; of the second preferred embodiment , as well as the automotive vehicle 30 ( fig1 and 2 ) of the first preferred embodiment , preferably include conventional elongated turnbuckle assemblies 192a , b that are capable of being manipulated to adjust the &# 34 ; tow - in &# 34 ; of the wheels 48a , b ( fig1 and 2 ). further , in accordance with the second preferred embodiment of the present invention the connection rod 140 ( fig2 and 3 ) is connected to the bar member 180 . fig1 is an isolated , perspective , partially exploded view of a motor 44 &# 39 ;&# 34 ;, in accordance with a first alternate embodiment of the present invention . the motor housing 53 &# 39 ;&# 34 ; defines an annular channel 194 on the interior surface thereof the output shaft 51 &# 39 ;&# 34 ; inserts through a central hole in a first bearing plate 196 which is inserted into the cavity 198 defined by the motor housing such that the periphery of the bearing plate 196 is proximate to the channel 194 . similarly , the output shaft 51 &# 39 ;&# 34 ; inserts through a central hole in a second bearing plate 200 which is inserted into the cavity 198 after the first bearing plate 196 is inserted . at least one of the central holes in the bearing plates 196 , 200 is preferably equipped with a bearing assembly ( not shown ) which promotes the rotation of the output shaft 51 &# 39 ;&# 34 ; with respect to the bearing plates 196 , 200 . an annular groove 202 is defined at the periphery of the first bearing plate 196 , and the annular groove 202 generally faces the second bearing plate 200 . similarly , an annular groove 204 is defined at the periphery of the second bearing plate 200 , and the annular groove 204 generally faces the first bearing plate 196 . a plurality of balls 206 are inserted between the bearing plates 196 , 200 , and the bearing plates 196 , 200 are forced toward each other , for example by attaching and tightening a bolt ( not shown ) therebetween . as a result , the balls 206 are forced to occupy the annular channel 194 and annular grooves 202 , 204 such that the motor housing 53 &# 39 ; is capable of pivoting about the motor axis 156 &# 39 ;&# 34 ; relative to the bearing plates 196 , 200 . referring additionally to fig2 in accordance with the first alternate embodiment of the present invention , the vehicle 30 is slightly modified to allow for the incorporation of the motor 44 &# 39 ;&# 34 ; thereinto . the motor mount 54b ( which includes mounting plate 56b and bearing plate 58b , as discussed above ) and the interconnection members 60 , 62 ( plus the additional interconnection member and the other horizontally extending rod ( associated with connection holes 113 ( fig4 )) that are not shown , but which were discussed above ) are not employed . similarly , the bearing plate 58a of motor mount 54a is not employed . in accordance with the first alternate embodiment of the present invention , the second bearing plate 200 is directly and rigidly connected to the mounting plate 56a . such mounting is acceptably facilitated , for example , by bolting the second bearing plate 200 to the mounting plate 56a by way of the connection hole 106 ( fig4 ) and connection slot 114 ( fig4 ) of the mounting plate 56a and an appropriate pair of the connection holes 208a - b defined in the second bearing plate 200 . once the motor 44 &# 34 ; is so attached , it functions and interacts with various components of the automotive vehicle 30 in a manner similar to that discussed above , as should be understood by those reasonably skilled in the art upon fully reading and understanding this disclosure . fig2 is a side view of a boat 210 in accordance with a second alternate embodiment of the present invention . fig2 is a schematic , cut - away , top view of the boat 210 , in accordance with the second alternate embodiment of the present invention . the boat 210 includes a frame in the form of a hull 212 having a front 214 and a rear 216 . with reference to fig2 , journals 158 &# 34 ;&# 34 ; a , b at opposite ends of the motor 44 &# 34 ;&# 34 ; cooperate with motor mounts 54 &# 34 ;&# 34 ; a , b such that the motor housing 53 &# 34 ;&# 34 ; pivots about the motor axis 156 &# 34 ;&# 34 ; in response to reactionary forces , as discussed above . a rod 218 is connected between the motor housing 53 &# 34 ;&# 34 ; and an arm 220 of a pivot plate 222 . the pivot plate 222 is mounted to a pivot pin 224 such that , under the influence of the rod 218 , the pivot plate 222 pivots about the pivot pin 224 in response to rotation of the motor housing 53 &# 34 ;&# 34 ; such that a second arm 226 of the pivot plate 222 is moved . with reference additionally to fig2 , a rod 228 is connected between the arm 226 and a wing 88 &# 39 ; in a manner that causes the wing 88 &# 39 ; to pivot relative to a support post 96 &# 39 ; and the hull 212 in response the pivoting of the motor housing 53 &# 34 ;&# 34 ;. a rod 230 extends between the arm 226 of the pivot plate 222 and a first arm of a second pivot plate 232 which pivots about a pivot pin 234 . a rod 236 is pivotally connected between a second arm of the second pivot plate 232 and a trim adjusting sub - component that is , in accordance with the second alternate embodiment , in the form of a trim plate 238 . the trim plate 238 is pivotally connected at a forward edge 240 thereof to the hull 212 . the output shaft 51 &# 34 ;&# 34 ; of the motor 44 &# 34 ;&# 34 ; is linked to and drives a propeller 240 that functions to propel the boat 210 . as the motor 44 &# 34 ;&# 34 ; accelerates , the motor housing 53 &# 34 ;&# 34 ; rotates in a first direction about the motor axis 156 &# 34 ;&# 34 ;, and the rods 218 , 228 , 230 , 236 and pivot plates 222 , 232 , transfer the motion of the motor housing 53 &# 34 ;&# 34 ; to the wing 88 &# 39 ; and trim plate 238 such that the wing 88 &# 39 ; and trim plate 238 pivot and achieve a generally horizontal configuration ( as is depicted in fig2 ). alternatively , as the motor 44 &# 34 ;&# 34 ; decelerates , the motor housing 53 &# 34 ;&# 34 ; rotates in a second direction about the motor axis 156 &# 34 ;&# 34 ;, and the rods 218 , 228 , 230 , 236 and pivot plates 222 , 232 , transfer the motion of the motor housing 53 &# 34 ;&# 34 ; to the wing 88 &# 39 ; and trim plate 238 such that the wing 88 &# 39 ; and trim plate 238 pivot toward a more vertical configuration . fig2 is schematic , isolated , top view of a motor 44 &# 34 ;&# 34 ;&# 34 ; cooperating with motor mounts 54 &# 39 ;&# 34 ;&# 34 ; a , b , in accordance with a third alternate embodiment of the present invention . in accordance with the third alternate embodiment , the motor 44 &# 39 ;&# 34 ;&# 34 ; is situated in a vehicle in a manner generally similar to that described above . the motor housing 53 &# 39 ;&# 34 ;&# 34 ; of the motor 44 &# 39 ;&# 34 ;&# 34 ; pivots about the motor axis 156 &# 39 ;&# 34 ;&# 34 ; in a manner similar to that described above , except to a greater degree . a sub - component in the form of a coil spring 242 functions to allow the motor housing 53 &# 39 ;&# 34 ;&# 34 ; to pivot through a plurality of revolutions about the motor axis 156 &# 39 ;&# 34 ;&# 34 ; when the motor 44 &# 39 ;&# 34 ;&# 34 ; accelerates ( while the output shaft 51 &# 39 ;&# 34 ;&# 34 ; also pivots through a plurality of revolutions about the motor axis 156 &# 39 ;&# 34 ;&# 34 ; and relative to the motor housing 53 &# 39 ;&# 34 ;&# 34 ;). the coil spring 242 also functions to limit the rotation of the motor housing 53 &# 39 ;&# 34 ;&# 34 ; as the coil spring 242 becomes compressed . referring also to fig2 , which is an isolated side view of the coil spring 242 in accordance with the third alternate embodiment , the coil spring 242 spirals about the motor axis 156 &# 39 ;&# 34 ;&# 34 ; and includes an inner end 244 that is connected to the motor housing 53 &# 39 ;&# 34 ;&# 34 ; proximate to the journal sleeve 158a &# 39 ;&# 34 ;&# 34 ;. the coil spring 242 additionally includes a hooked end 246 that grips a peg 248 extending from the motor mount 54 &# 39 ;&# 34 ;&# 34 ; a . the assembly of the third alternate embodiment seeks to smooth out changes in the motive force supplied by the output shaft 51 &# 39 ;&# 34 ;&# 34 ;. while certain of the preferred and alternate embodiments of the present invention have been disclosed herein , other embodiments of the apparatus and methods of the present invention will suggest themselves to persons skilled in the art in view of this disclosure . therefore , it will be understood that variations and modifications can be effected within the spirit and scope of the invention and that the scope of the present invention should only be limited by the claims below . additionally , while it is intended that the scope of the present invention also include various alternate embodiments , it should be understood that each of the embodiments disclosed herein , including the preferred embodiments , include features and characteristics which are considered independently inventive . accordingly , the disclosure of variations and alterations expressed in alternate embodiments is intended only to reflect on the breadth of the scope of the present invention without suggesting that any of the specific features and characteristics of the preferred embodiment are in any way obvious or unimportant . | 0 |
the present invention enables extending the mirror assembly 16 out beyond its standard 150 degrees of horizontal field of view by fixing a set of vacuum wing extension structure boxes 30 at the extremities of the original mirror cell base support structure . this present invention solves the technical problems that needed to be resolved and overcome . as depicted in fig1 , 2 and 3 a , a standard collimated display system 20 of an aircraft simulator 10 mounted to a movable platform 11 is depicted . with display system 20 , an image is projected onto a translucent back projection screen 23 from which it is reflected to the observer ( in this case , a pilot and co - pilot , the positions of which are indicated by arrowheads 12 and 14 in fig3 a ) by a large radius spherical section mirror assembly 16 . the radius of the spherical section mirror is commonly approximately 10 feet , although the radius is not critical . with few exceptions , such mirrors are almost exclusively manufactured using a soft plastic reflective film , commonly reflective mylar ™ film 17 . fig1 depicts a general layout of typical wide angled display system 20 of an aircraft simulator 10 showing location of collimating mirror film 17 , projectors 22 that form an intermediate image , sharply focused on the surface of the back projection screen 23 . it is this image that is “ reflected ” onto the mylar ™ film 17 of the large mirror assembly 16 to be seen by the pilot 12 and co - pilot 14 . the use of the mylar ™ film 17 in this capacity was first used by rediffusion in the early days . to make this mirror assembly 16 , the mylar ™ film 17 is laid over the edge of a mirror cell support 18 and secured in place on the edge 19 . this “ edge ” 19 is referred to as the forming edge of the mirror cell support 18 . this forming edge 19 runs along the top and bottom of the mirror cell support 18 and down both sides in the shape of a sector of a circle and provides the frame over which the mylar ™ film 17 is secured . the shape and size of this forming edge 19 are critical to determining the shape of the completed mirror assembly 16 . distortions caused by unequal stresses are generally introduced into the mylar ™ material at this stage in the process , when the mylar ™ film 17 is laid over the hard surface of the forming edge 19 . this phenomenon is considered by most display vendors to be inevitable . extreme cases of this distortion can produce displays with a ‘ hall of mirrors ’ type effect more commonly seen at the fair ground ! when secured in place on the forming edge 19 , the mylar ™ is then subjected to a constant vacuum applied to the air - tight space 21 between the mylar ™ mirror film 17 and the mirror cell support 18 in order to ‘ suck ’ the mylar ™ film 17 back into its final shape of a portion of a sphere . when sucked into its final spherical shape , the mirror film 17 will be maintained about 2 inches from the surface of the mirror cell support 18 . the spherical shape of the film 17 is maintained by controlling the volume of air in the chamber with a positional sensor and control valve ( not shown ). observers ( such as the pilot and co - pilot ) viewing the projected image from projectors 22 onto the convex surface of the projection screen 23 reflected through the spherical collimating mirror see the resultant image close to optical infinity . it is this collimating effect that provides the “ depth ” to the viewed image required for adequate training of commercial pilots . the alternative to mylar ™ film 17 for the mirror assembly 16 was very heavy , expensive and fragile glass mirrors . the main issue with the glass mirrors is that that they made the simulator too heavy for the available motion systems of the time and correspondingly expensive to manufacture . since that time every one of the visual system vendors has come to adopt the mylar ™ mirror approach to providing large mirror display systems . fig2 depicts a conceptual arrangement of a typical wide angled display system 20 . this ‘ wide ’ display approach was subsequently adopted by all the major visual display system vendors and is now the industry norm . this adoption of the rediffusion wide can be seen by the fact that a continuous field of view for pilot is now a pre - requisite for federal aviation administration ( faa ) certification of training devices . fig3 a and 8a depict an existing mirror assembly 16 and fig3 b and 8b depict a modified mirror with extensions 18 ′ in accordance with an embodiment of the invention . in order to install the extensions of this embodiment , the first step in the update process is to the remove the mirror cell assembly 16 from the simulator . this process entails the removal of the bracing bars 31 used on both sides of the mirror assembly 16 to attach it to the simulator and provide stiffening and structural support . fig3 a 8 a depicts the original mirror assembly 16 and fig3 b and 8b depicts the mirror assembly 16 with the extension structure 18 ′ attached , to extend the mirror assembly 16 to 180 degrees . after this modification , the bracing bars 31 shown in fig3 a and 8a are discarded as they will no longer be used . once the mirror assembly 16 is removed from the simulator and placed on the floor the existing mylar ™ film 17 is removed from the cell 18 . the existing end bars 31 are removed from the left and right hand vertical edges of the mirror cell assembly 16 . these end bars attach to the existing forming edge 19 of the mirror cell . fig4 depicts a left hand edge 19 of an existing mirror cell assembly 16 . at this stage we are left with a hard structure that is the curved mirror cell assembly 16 . around the edge of this mirror cell is a fixed forming edge 19 . as depicted in fig3 b and 8b , the new segments 18 ′ are then mounted on the left and right hand edges of the mirror assembly 16 and permanently fixed to the existing cell 16 using pre - drilled holes ( not shown ) in the mirror mounting plate . fig5 depicts mirror segments 18 ′ for the left hand side of the mirror cell support 18 . this drawing is similar to fig4 , but is reversed for the right hand side . fig6 a - b , 7 , 8 a - b and 9 show the left hand segment of the extensions 18 ′ of one embodiment of the invention . in order to maintain the correct shape of the mirror film 17 , the segments 18 ′ have stiffening plates 33 mounted horizontally inside the segments . these plates 33 are permanently secured and form an integral stress and load bearing part of the segments 18 ′. in order for a vacuum to be applied equally inside the entire mirror cell assembly 16 ( including segments 18 ′) when the mylar ™ film 17 is applied , holes are drilled through the mounting plates 32 and into the existing mirror cell assembly 16 . these holes are left open to allow the free flow of air and allow vacuum to be applied in the extended segments , in the space 21 between the film 17 and the cell 16 . great care is important in the location of these holes in order that the structural integrity of the segment is not compromised . extra stiffening beams can be applied directly to the mounting plate 32 in order to ensure that shape and strength of the structure is maintained . a mounting frame with a supporting leg 33 is added to the base of each segment 18 ′ to provide further support when the segment 18 ′ is mounted to the existing mirror cell assembly 16 . when both sides of the mirror cell assembly 16 have been upgraded and fitted with the extension segments 18 ′, the mirror is re - skinned with replacement mylar ™ film 17 and is then replaced on the simulator 10 . the original mirror cell assembly 16 will need to be extensively modified to allow the fitting of the additional segments 18 ′. this modification will entail the removal of the end pieces currently fitted to the 150 degree mirror cells 16 . a new terminating assembly will be fitted to these mirror cells that will allow for a clean and uniformly accurate mating surface upon which the extension vacuum box segments 18 ′ will be attached . due to the fact that segments 18 ′ have been added to the mirror cell assembly 16 it is evident that the existing bracing bars 31 are no longer useable due to the existing mounting plates being moved . furthermore , the new geometry of the mirror precludes direct access to the existing mounting locations . for this reason , in one embodiment of the present invention , the existing bracing bars 31 and structure are replaced with a new ‘ d ’ plate 35 , as depicted in fig9 . this d plate is fitted to the end of extension segments 18 ′ of the extended mirror cell on one side and the other ( flat side of the d is mounted directly to the simulator ). the metal d plate can include an inspection port 37 that provides not only structural rigidity but also prevents light leaking into the mirror cell itself . a further benefit is that contamination of the mirror surface can be prevented . adjustable frames can also be provided on the segments 18 ′ to provide for a continuous and accurate forming edge 19 ′ on the new extension segments 18 ′. the segments 18 ′ and hardware used in the present invention needs to be held solidly and accurately in place for many years to come when fitted to the simulator with a full motion system that will stress the structure for many years to come . in one embodiment , a method of mounting the segments to the existing 150 degree mirror cell will use threaded inserts and bonding material between the new segments 18 ′ and the edge of the original mirror cell assembly 16 in order to provide rigidity and some amount of damping for when the mirror is subjected to vibrations and continued motion of the moving platform 11 when fitted to the full flight simulator 10 . much investigation has taken place to determine the optimum solution for this upgrade . in one embodiment , the extension segments 18 ′ are manufactured from a glass fiber composite material . however , dependent upon required application and existing mirror structure it may be decided to use metal vacuum boxes . careful alignment of the mirror forming edge 19 ′ and the exterior curvature are critical considerations to be accounted for and checked at this time in order to ensure a uniform shape to the mirror surface and a clean curvature to the external surface . the external surface finish of the existing mirror cell assembly 16 is typically a bubble / stipple effect that is painted white . in the present invention , the vacuum box extensions 19 ′ can match this surface finish in both texture and colour for the exterior of the extension segments 18 ′ to ensure a uniform smooth exterior finish across the entire mirror cell assembly . in summary , the unique nature of this approach can be viewed against the current industry standard of disposing of the standard 150 degree mirrors and fitting new hardware to existing trainers . in the past few years a number of existing 150 degree mirror cells have been destroyed as there appeared no industry option available . the present invention is unique in concept and application . the present inventors have reviewed each issue that has arisen and have developed a solution to each . in another embodiment of the invention , the extension boxes 18 ′ can be used temporarily as reskin tooling to be temporarily attached to these extension vacuum boxes 18 ′. in this case , the extension boxes 18 ′ are used only during the reskinning procedure and are removed when the reskinning is complete , prior to placing the simulator 10 back into service . this is discussed in more detail below . every mylar ™ mirror manufacturer uses some type of tooling to assist in the application of the mirror skin 17 to the mirror cell assembly 16 to assist in achieving a mirror surface with the minimum of distortion at both ends of the mirror . the tooling can be either removable or built into the mirror cell assembly 16 . the tooling is usually referred to as skinning boxes , wings , tensioning devices or other tooling . in some cases a combination of designs is used . there are different approaches to achieve the same goal , which is to stretch the skin over the mirror cell as uniformly as possible . in reskinning , a problem which needs to be overcome is that at each end of the mirror cell the skin needs to be stretched from its vertical “ cord ” position across the mirror cell to its radial position at each end of the mirror cell so the vacuum can be applied using a method that will introduce the minimum of stress and distortion . in the prior art , the technique is to hold the skin using a mechanical device ( tensioning tool ) that then pulls / pushes the mirror skin back against the mirror cell prior to fixing he mirror into position and applying the vacuum . the present inventors have found , however , that a better method for reskinning the mirror cell assembly 16 is to temporarily extend the mirror cell assembly 16 using a structure ( wings / skinning boxes ) that supports the skin and then to initially attach the mylar ™ film 17 to the forming edge of these temporary skinning boxes . the aim of the tooling is to temporarily extend the true field of the mirror beyond the final field of view setting . in this method , the present inventors first temporarily extend the horizontal field of view of the mirror by a total of 30 degrees ( 15 degrees either side ) beyond its final field of view , although more or less can be used to good effect . this is done by attaching temporary 15 degree extensions 18 ′ to either side of the mirror cell . then , the soft mylar ™ mirror material is securely located in place on the forming edges 19 ′ of the extensions 18 ′, as previously described . when the mylar ™ skin is vacuumed back into position , while attached to the forming edges 19 ′ of the extensions 18 ′, any distortion is transferred from the mirror cell into the section of the mirror that is in the vicinity of the attachment edges 19 ′ of these extensions 18 ′. then , the mirror skin ( mylar ™) 17 is cut and the re - skin tooling used to extend the mirror is removed . the resulting mirror assembly 16 is once again returned to its original degree field of view and attached to the original forming edges 19 . this leaves a more stress - free and distortion - free edge of the mylar ™ film 17 at the original forming edge 19 once the extensions are removed . with the mirror cell assembly 16 extended in this way , the present inventors were better able to monitor and adjust mirror tensioning and therefore provide improved symmetry and accuracy of display . the foregoing reskin tooling and technique can also be employed in combination with the embodiment of the invention described above , where the extensions are permanently attached to extend the horizontal field of view of an existing spherical mirror from 150 to 180 degrees . in this case , two sets of extension boxes 18 ′ can also be used ; one permanent to extend the field of view and one temporary , to minimize distortion during the reskinning process . in this case , the first set of extension boxes is attached to extend the original 150 degree field of view to 180 degrees . this first set of these extension boxes 18 ′ will remain in place permanently . then , in order to minimize distortion of the mirrors 18 during the mirror reskinning process , a second set of extensions is temporarily attached to temporarily extend the mirror cell assembly 16 , with its extensions 18 ′ still further , for purposes of facilitating attaching the mylar ™ during the reskinning process . however , this second set of extensions 18 ′ will be removed prior to completion of the reskinning process . to use this method in the method of the present invention , a first set of extensions 18 ′ is installed onto the existing forming edges 19 , typically adding 15 degrees to each side , which will increase the field of view from 150 degrees to 180 degrees . these first extensions 18 ′ are structurally reinforced and supported as they will become a permanent part of the structure , as previously described . then , a second set of 15 degree skinning boxes 18 ′ is attached to the first set . thus , there can initially be 30 degrees of extension added to each side of the mirror cell assembly 16 . then , the mylar ™ film 17 is attached to the edges of the skinning boxes ( i . e ., the second set of extensions ) and the mylar ™ film 17 vacuumed into place to remove or minimize any distortion or stress on the mylar ™ in the vicinity of the forming edge 19 ′ of the first extension . the mylar ™ film 17 is then permanently attached to the forming edges 19 ′ of the first set of extensions 18 ′, which are left in place permanently during subsequent use of the simulator 10 . the temporary skinning extension boxes 18 ′, which were used to minimize stress and distortion in the mylar ™ mirror film 17 at the forming edges 19 ′ of the first extensions , are then removed , leaving the mylar ™ mirror film 17 attached to the edges 19 ′ of the extensions 18 ′ of the mirror cell assembly 16 . if permanent extensions 18 ′ have been added , this will be to the edge of the permanent first set of extensions 19 ′, thus adding 15 degrees of horizontal field of view on either side . the result is a spherical mirror assembly 16 with an enlarged field of view and relatively free of uneven stress and distortion at the forming edge of the first extensions . | 6 |
referring to fig1 - 8 , a preferred apparatus 20 of the invention preferably includes a housing having a removable cover 30 and a frame 24 . cover 30 desirably has a modern styled highly finished look and is attachable to frame 24 by frictional engagement and is preferably completely removable to facilitate access to the interior of apparatus 20 . it will be understood and appreciated , however , that cover 30 can likewise be connected to frame 24 by other similarly effective means such as hinges , for example , provided that access to the interior of apparatus 20 can still be achieved . cover 30 can also snap on or screw on and , if desired , a lock ( not shown ) can also be provided to control access to the interior of the housing . cover 30 includes front , top and bottom wall sections 22 , 24 , 28 , respectively . extending from or through bottom 28 of cover 30 is an outlet port 34 for use in discharging aqueous bacterial slurries produced in apparatus 20 . either or both of cover 30 and frame 24 are preferably made of a suitable metal or plastic , although frame 24 , if made of plastic , should be made of durable plastic that is resistant to fading , cracking , creep or other structural failure when used over prolonged periods . frame 24 of apparatus 20 preferably includes mounting plate 65 having apertures 32 ( fig5 and 7 ) for insertion of mounting screws or other conventional fasteners ( not shown ) for mounting frame 24 and apparatus 20 to a support structure such as , for example , a wall . frame 24 desirably further comprises upper support plate 66 and lower support plate 64 , each of which is either made integrally with or connected to mounting plate 65 and bracket members 62 , 63 , respectively , that are preferably disposed at each side of the respective base plates and also project forwardly from mounting plate 65 . upper support plate 66 desirably includes aperture 68 for receiving a drive shaft for feeder unit 70 , described in greater detail below , and apertures 69 for use in installing circulating jets 116 , 118 as described below in relation to fig1 - 18 . top bracket 46 is provided for use in releasably attaching cover 22 ( fig1 ) to frame 24 if desired . referring to fig1 , 17 and 18 , mounting plate 65 and upper and lower support plates 66 , 64 facilitate attachment of , and provide mounting sites for , microprocessor 49 , battery 42 or , alternatively , an alternating current power adapter ( not shown ), water flow lines 110 , 112 , 114 , liquid flow control system 48 , feeder unit 70 , feeder drive assembly 50 and mixing tank 56 . mixing tank 56 preferably has top flanges that slide into engagement with a cooperating flange of upper support plate 66 . lower support plate 64 comprising drain port 34 desirably mates with an effluent outlet lip on the bottom side of mixing tank 56 . referring to fig9 - 11 , mixing tank 56 can be made of a disposable and recyclable material , and preferably comprises a top flange 130 defining a substantially circular top opening , a substantially cylindrical upper wall section 124 , a frusto - conical lower sidewall section 126 , and bottom 128 having a centrally disposed drain port 57 . overflow drain tube 120 , preferably comprising inlet scuppers 122 , is provided for use in harvesting the aqueous bacterial slurry produced in the invention . the liquid capacity of mixing tank 56 , which is determined by the height of overflow drain tube 120 , is desirably about 750 ml in a preferred embodiment of the invention , but can vary according to other design parameters and the intended application for a particular apparatus . bacteria slurry periodically overflow via gravity at preset timed intervals triggered by additions of cold water to the mixing tank . the liquid capacity of the mixing tank can also vary depending on the specific design of a particular apparatus intended for a particular end use application . referring to fig1 - 15 , particulate matter feeder unit 70 preferably comprises inverted feed canister 44 having a solid end wall 47 and an opposed open end surrounded by threads 45 . the volume of feed canister 44 is preferably sufficient to contain enough particulate feed material to last through a targeted number of operational cycles during a desired service interval . feed canister 44 is preferably designed so that threads 45 are cooperatively engageable with threads 53 of feeder base and lid assembly 52 . pellet dam 78 and rotatable feeder cup 74 are preferably disposed inside feeder base and lid assembly 52 prior to attachment of feed canister 74 to feeder base and lid assembly 52 . when constructed in this or a similarly effective configuration , feed canister 44 can be shipped preloaded with the particulate starter material , pellet dam 78 and rotatable feeder cup 74 in place and oriented so that feeder base and lid assembly 52 is attached and ready for insertion into feeder drive base 72 of feeder drive assembly 50 at the time of use . following use for predetermined service intervals , the entire feeder unit can be disposed of for subsequent recycling , and a new feeder unit can be installed . if desired , mixing tank 56 can likewise be disposed of and another installed together with the feeder unit . feeder base and lid assembly 52 preferably further comprises side wall 148 having circumferentially spaced keyways 152 that receive keys 78 a ( shown as 140 in fig1 ) of pellet dam 78 to prevent pellet dam from rotating relative to feeder base and lid assembly 52 . referring to fig1 , pellet dam 78 preferably further comprises a raised , wedge - shaped section 138 comprising surface enhancements 142 intended to help prevent the particulate feed material flowing downwardly out of feed canister 44 ( fig1 ) from bridging or jamming prior to flowing further downward by gravity flow through opening 80 inside bottom rim 144 of pellet dam 78 and through feed chamber 76 of rotatable feeder cup 74 ( fig1 ), downwardly projecting discharge port 54 of feeder base and lid assembly 52 ( fig1 ), and aperture 160 of feeder drive base 72 into mixing tank 56 ( fig1 ). feed chamber 76 of rotatable feeder cup 74 has no top or bottom , but is disposed over a solid surface of bottom 154 of feeder base and lid assembly 52 at the time it receives particulate feed material flowing downwardly through opening 80 in pellet dam 78 . as rotatable feeder cup 74 rotates between pellet dam 78 and bottom 154 of feeder base and lid assembly 52 , feed chamber 76 sweeps under opening 80 and receives particulate feed sufficient to substantially fill the cup , then rotates over aperture 68 ( fig1 ) in projecting discharge port 54 in bottom 154 of feeder base and lid assembly 52 to discharge the particulate feed into mixing tank 56 the preferred rectangular shape of downwardly projecting discharge port 54 of feeder base and lid assembly 52 ( fig1 ) desirably releasably engages aperture 160 in bottom 158 of feeder drive base 72 and prevents feeder base and lid assembly 52 from rotating relative to feeder drive base 72 . drive shaft 96 is preferably square and cooperatively sized to fit snugly inside aperture 79 of rotatable feeder cup 74 to insure that rotatable feeder cup 74 rotates with drive shaft 96 . conversely , apertures 86 of feeder drive base 72 and aperture 146 in bottom 154 of feeder base and lid assembly 52 are desirably large enough to permit drive shaft 96 to rotate freely inside them . ribs 150 in outside wall 148 of feeder lid and base assembly 52 are sized and configured to cooperatively engage ribs 162 inside wall 156 of feeder drive base 72 to snugly hold feed canister 44 in place during use of apparatus 20 ( fig1 ). referring to fig1 and 15 - 18 , feeder drive assembly 50 preferably further comprises gear assembly 90 , 92 , 94 driven by shaft 84 of small direct current motor 82 that is mounted through aperture 88 in bottom 158 of feeder drive base 72 . this is preferably a center axle multiple gear drive with an offset motor . rotatable feeder cup 74 preferably comprises a substantially cylindrical disk having a centrally disposed aperture 79 adapted to receive drive shaft 96 ( fig1 ) extending upwardly through coaxially aligned apertures 86 and 146 in feeder drive base 72 . when motor 82 powered by battery 42 is actuated by a signal received from microprocessor 49 , gear assembly 90 , 92 , 94 causes drive shaft 96 to rotate , thereby causing rotatable feeder cup 74 to rotate and feed particulate starter material into mixing tank 65 . battery 42 , which is most preferably a rechargeable battery pack and / or a 110v a / c to d / c converter , supplies power to liquid flow control unit 48 , die motor 82 for gear for feeder drive assembly 50 , and microprocessor 49 . liquid flow control unit 48 desirably comprises at least one solenoid valve , and microprocessor 49 controls the cold tap water inlet solenoid cycles at designated times , thereby facilitating dissolution and mixing of the solid product in the initial operational cycle , and for mixing addition of dissolved oxygen and final dispensing of vegetative bacteria to the desired application near and at the end of the operational cycle . microprocessor 49 also actuates motor 82 of feeder drive assembly 50 to cause feeder unit 70 to discharge particulate feed material into the water contained in mixing tank 56 . an example of microprocessor pre - set times for addition of the particulate starter material comprising bacterial and nutrient components and for water injection according to a preferred 24 - hour operational cycle are as follows : beginning of cycle @ 0 hours ,≧ run cold tap water for 5 min . after this cycle , feeder unit 70 activates and discharges a predetermined weight or volume of particulate feed material to the water in the growth vessel . mix and aerate cycle # 1 @ 6 hours — run cold tap water for 3 seconds . mix and aerate cycle # 2 @ 12 hours — run cold tap water for 3 seconds . mix and aerate cycle # 3 @ 16 hours — run cold tap water for 3 seconds . mix and aerate cycle # 4 @ 19 hours — run cold tap water for 3 seconds . mix and aerate cycle # 5 @ 22 hours — run cold tap water for 3 seconds it should be understood that these water injection times can vary based on requirements for specific bacteria , ambient temperatures or other conditions affecting dissolved oxygen requirements . flow control system 48 , which comprises at least one solenoid valve , controls the mix / aeration cycle as well as the ‘ run tap water for 5 minutes ’ beginning of cycle which results in the dispensing of the live vegetative bacteria into the desired application . this ‘ run tap water for 5 minutes ’ cycle also replenishes the growth vessel with clean cold tap water just prior to the addition of the solid biological product initiating the preferred 24 - hour operational cycle . zero jet water inlets 116 , 118 mounted to or received through apertures in upper support plate 66 are preferably positioned diametrically opposite and equidistant from the geometric center of mixing tank 56 , with liquid overflow tube 120 positioned at the center of that circle . water inlets 116 , 118 are positioned a minimum of 1 inch above the highest anticipated liquid level inside mixing tank 56 to comply with plumbing code regulations requiring a one - inch air gap and are preferably directed perpendicular to the intersecting horizontal diameter line on which they are positioned to induce a ‘ spinning ’ water movement which is conducive to mixing and aerating of the resulting solution / mixture . it should be understood that the number or size of jets , and the corresponding positional relations can vary provided that the objectives of enhanced dissolution , mixing and aeration are achieved so as to promote bacterial growth . the vegetative bacteria contained in the aqueous bacterial slurry thus formed is then directed to application injection sites , e . g ., floor drain , waste pit , grease trap , grease interceptor , process waste streams , municipal . waste streams , and the like . feeder driver base 72 , rotating feeder cup 74 , pellet dam 78 and mixing tank 56 are all disposable and recyclable components that can be replaced whenever it is necessary during normal interval maintenance to minimize cleaning . although particulate matter feeder unit 70 as disclosed herein is a preferred feeder unit for apparatus 20 of the invention , it should be appreciated by those of skill in the art upon reading this disclosure that feeders incorporating structural elements that are equivalent to those disclosed herein likewise have applicability to many other devices and systems in which a controllable gravitational feeder for particulate solids is desired for other applications . accordingly , the design and use of a feeder unit similar to feeder unit 70 disclosed herein for purposes other than for growing and harvesting aqueous slurries of bacterial is also contemplated to constitute part of the subject invention in the absence of prior art disclosing same . other modifications and improvements to the system and apparatus disclosed herein will likewise become apparent to those of ordinary skill in the art upon reading this disclosure and it is intended that the scope of the invention be limited only by the broadest interpretation of the appended claims to which the inventors are legally entitled . | 6 |
fig1 illustrates a first preferred embodiment of a radial piston pump according to the present invention . a rotor 10 is rotatably mounted by bearings 12 , 14 in a pump housing 16 . the outer race 17 of bearing 14 is prevented from moving axially to the right as shown in fig1 by a shoulder 18 formed in the pump housing 16 . the outer race 19 of bearing 12 is prevented from moving axially to the left as seen in fig1 by a shoulder 20 formed on the inner surface of an end quill 22 . the inner races 21 , 23 of the bearings 12 , 14 are prevented from moving towards one another by counterweights 25 mounted on the rotor 10 on either side of the cam surface 27 . counterweights 25 also serve to counter the dynamic imbalance caused by the offset or eccentricity of cam surface 27 . the radially outer surface 24 of end quill 22 is threaded and engageable with a similarly threaded inner surface 26 of the pump housing 16 . the pre - load on bearings 12 , 14 thus may be adjusted simply by rotating end quill 22 to compress or decompress the bearings 12 , 14 . a suitable lock nut 28 or the like is provided to hold end quill 22 in the desired position . a simple cover 29 then preferably is positioned over the end quill 22 to protect it and reduce the likelihood of tampering with the bearing pre - load . pump housing 16 also is provided with an inlet passage 30 , an outlet passage 32 and a plurality of radial valve / piston cartridge receiving bores 34 spaced circumferentially thereabout ( for convenience of illustration , only one such bore 34 is illustrated ). inlet passage 30 and outlet passage 32 are connected to each bore 34 by annular grooves 36 , 38 extending around the bore 34 . a first preferred embodiment of a valve / piston cartridge 40 according to the present invention is positioned in each bore 34 and is best seen in fig2 . a hollow , substantially cylindrical liner 42 is positioned in bore 34 , and preferably is formed of a wear - resistant material , e . g ., high - grade steel . with the liners 42 formed of such a material , the pump housing 16 can be formed of a lower grade material , e . g ., nodular iron . radial movement of the liner 42 inward ( downward in fig2 ) is prevented by a shoulder 44 formed in the bore 34 . the liner 42 has at least one ( and preferably a plurality ) of inlet bores 46 hydraulically connecting inlet groove 36 to the inside of the liner 42 . the inner surface of the liner 42 preferably also is provided with an annular inlet groove 48 interconnecting the inlet bores 46 . the liner 42 is prevented from moving radially outward ( upward in fig2 ) by an end cap 50 which presses against a shoulder 52 formed on the liner 42 . the circumferentially outer surface 54 of the end cap 50 is threaded for engagement with a similar threaded surface 56 at the top end of bore 34 . at least one outlet bore 58 is provided in the end cap 50 to hydraulically connect the inside of the end cap 50 with the outlet groove 38 . the inner diameter 60 of the end cap 50 is somewhat larger than the outer diameter 62 of the liner 42 in the region surrounded by the end cap 50 . the outer diameter 62 of the liner 42 may be somewhat smaller in this region than elsewhere to aid in this . similarly , the end 64 of the liner 42 stops short of the underside 66 of the end cap 50 . the result of these relative spacings is to provide a hydraulic connection between the inside of the liner 42 and the outlet bore 58 . a cup - shaped piston 68 is slidably positioned inside the radially inward end of the liner 42 . similarly , hollow inlet sleeve 70 is slidably positioned inside the liner 42 radially outward from the piston 68 . the space 72 between the liner 42 , end cap 50 , piston 68 and inlet valve sleeve 70 acts as the piston chamber of the pump , as will be described below . a spring spider 73 extends from the base of the cup of the piston 68 to a position above the inlet valve sleeve 70 , where it holds a lightweight inlet valve spring 74 which presses inlet valve sleeve 70 towards piston 68 . a considerably stronger main spring 76 is positioned within the spider 73 and extends between the top cap 50 and the base of the cup of the piston 68 to bias the piston 68 towards the cam surface 27 of the rotor 10 . roller bearings 80 and a piston race 82 are provided between the cam surface 27 and the base of the piston 68 . rings 78 preferably are provided on either side of the cam surface 27 to hold the roller bearings 80 and piston race 82 in axial alignment with the cam surface 27 . the base 84 of the inlet valve sleeve 70 is angled slightly so as always to have a hydraulic connection with fluid in the inlet groove 48 . the other end 85 of the inlet valve sleeve 70 is exposed to the pressure in the piston chamber 72 . finally , outlet groove 38 is connected to outlet passage 32 via a check valve 86 of any suitable type which will allow flow from the outlet groove 38 to the outlet passage 32 , but not vice versa . to minimize pressure rippling in the outlet passage 32 , the check valve 86 should open as easily as reasonably possible , and is shown here as a disk valve . in operation , as the piston 68 follows the cam surface 27 radially inward from the position illustrated in fig2 it creates a low pressure condition in the piston chamber 72 . this closes outlet check valve 86 , preventing flow of high pressure fluid from outlet passage 32 into the piston chamber 72 . pressure in the liner inlet groove 48 will match whatever pressure is in the inlet passage 30 , typically atmospheric pressure . this inlet pressure will be higher than the low pressure in the piston chamber 72 and will force inlet valve sleeve 70 upwards away from piston 68 . fluid therefore will flow from the inlet passage 30 into the piston chamber 72 . when the piston 68 subsequently is forced radially outward by the cam surface 27 , the pressure differences will be reversed , so that the inlet valve sleeve 70 will again engage the upper surface of the piston 68 , shutting off the connection between the piston chamber 72 and the inlet passage 30 . this increased pressure in the piston chamber 72 will open check valve 86 , allowing the fluid in the piston chamber 72 to be forced out into the higher pressure outlet passage 32 . note that the outer diameter of the piston 68 is greater than the outer diameter of the inlet valve sleeve 70 . the outer diameter of the inlet valve sleeve 70 is the effective pumping diameter of the piston 68 . in contrast , the larger outer diameter of the piston 68 is the surface that engages the piston race 82 . this difference reduces the stress at the piston / piston - race interface , reducing the likelihood of a face - to - race failure . fig3 and 4 depict an alternative embodiment of a valve / piston cartridge according to the present invention which contains both the inlet and outlet valves . for convenience , elements which perform substantially the same function as in the first preferred embodiment have been labeled with the same number and a &# 34 ; prime &# 34 ; (&# 39 ;), e . g ., pump housing 16 &# 39 ;, inlet passage 30 &# 39 ;, outlet passage 32 &# 39 ;, although their precise positions may vary from those illustrated in connection with the first preferred embodiment . these elements serve the same functions as those described in connection with the first preferred embodiment and will not be described in further detail here . as with the first preferred embodiment , the second preferred embodiment has a liner 90 positioned in each radial bore 34 &# 39 ;. inlet groove 92 in the outer circumference of liner 90 serves much the same function as inlet groove 36 provided in the bore 34 of the first preferred embodiment , namely , to ensure distribution of fluid from the inlet passage 30 &# 39 ; around to the various inlet bores 46 &# 39 ;. in contrast to the first preferred embodiment , in this embodiment the end cap 50 &# 39 ; sealingly engages the radially outward end ( upper end in fig3 ) of the liner 90 . outlet bores 94 then are provided in the liner 90 to connect the piston chamber 72 &# 39 ; with the outlet passage 32 &# 39 ;. the actual valving operation is provided by two nearly circular flexible members 98 , 100 , preferably formed of spring steel or the like . the inlet flexible member 98 is provided on the piston chamber 72 &# 39 ; side of inlet bores 46 &# 39 ;, while the outlet flexible member 100 is provided on the outside of outlet bores 94 . both flexible members 98 , 100 preferably are prestressed to bias them to sealingly close the bores 46 &# 39 ;, 94 . the walls of the bore 34 &# 39 ; can serve to limit outward movement of the flexible member 100 , and an annular extension 102 can be provided on the end cap 50 &# 39 ; to limit inward motion of the flexible member 98 . this annular ring 102 also can serve to help stabilize the position of the main spring 76 &# 39 ;. flexible members 98 , 100 can be held positively in position , e . g ., by positioning an end between two components , as illustrated with member 98 positioned between the bottom of end cap 50 &# 39 ; and the top of liner 90 . alternatively , as illustrated with flexible member 100 , they can simply be sized such that even if they move to one end or the other of the cavity in which they are located , they still will completely close their respective passages . the flexible members can be held circumferentially by any suitable means , e . g ., a tang and slot arrangement or a dimple to engage the bores 46 &# 39 ;, 94 . finally , the inner surface of the cylinder liner 90 is provided with at least one dimmple 104 , best seen in fig4 to provide a connection between piston chamber 72 &# 39 ; and outlet bores 94 even when piston 68 &# 39 ; is positioned fully within the liner 34 &# 39 ;. in operation , as the piston 68 &# 39 ; follows the cam surface 27 &# 39 ; radially inwards ( downward in fig3 ), it creates a low pressure situation in piston chamber 72 &# 39 ;. the higher ( atmospheric ) pressure in inlet passage 30 &# 39 ; forces the flexible member 98 away from inlet passages 46 &# 39 ;, allowing fluid to fill the piston chamber 72 &# 39 ;. meanwhile , the still higher pressure in outlet passage 32 &# 39 ; forces flexible member 100 against liner 34 &# 39 ;, sealing off outlet bores 94 . when the piston 68 &# 39 ; subsequently is forced radially outward ( upward in fig3 ) by the cam surface 27 &# 39 ;, a high pressure situation is created in piston chamber 72 &# 39 ;. this forces flexible member 98 against cylinder liner 34 &# 39 ;, closing off inlet bores 46 &# 39 ;. this pressure also forces flexible member 100 away from cylinder liner 34 &# 39 ;, opening bores 94 and allowing the fluid in the piston chamber 72 &# 39 ; to be forced out into the outlet passage 32 &# 39 ;. as will be readily apparent , the above described preferred embodiments of the present invention provide a pump structure which is considerably easier to assemble and properly adjust than those previously known , thereby minimizing manufacturing costs . repair also is easier since a single valve / piston cartridge , or even just a cartridge liner , can be easily be replaced upon failure . while the invention has been described in conjunction with certain specific embodiments , it is to be understood that many alternatives , modifications and variations will be apparent to those skilled in the art in light of the aforegoing description . for example , the first preferred embodiment could easily be modified to have the outlet valve rather than the inlet valve in the cartridge simply by eliminating or reversing the angling of the base 84 of the valve sleeve 70 and by reversing the direction in which check valve 86 operates . similarly , the positions of the inlet and outlet valves in the second preferred embodiment can easily be reversed by reversing which flexible member 98 , 100 is inside liner 90 and which is outside . one flexible member 98 , 100 could even be eliminated and an external check valve such as check valve 86 substituted nstead . accordingly , this invention is intended to embrace all such alternatives , modifications and variations which fall within the spirit and scope of the appended claims . | 5 |
the invention is based on the finding that , in a brazing material , for example a clad or filler layer , containing a high si content , mn can play a significant role in improving the corrosion performance of the resolidified brazing material in a brazed product . the term “ substantially free ” means having no significant amount of that component purposely added to the alloy composition , e . g . at a level of & lt ; 0 . 005 % and more preferably absent , it being understood that trace amounts of incidental elements and / or impurities may find their way into a desired end product . particularly it is preferred that the mn / fe ratio in weight percent is at least 1 , preferably at least 2 weight percent . it is also believed to be desirable to select the amount of mn such that , in an intermetallic phase in the resolidified brazing material containing mn and fe , the ratio of mn / fe in weight percent is at least 0 . 4 , preferably at least 0 . 5 , more preferably at least 0 . 7 weight percent . all percent compositions given in this specification are weight percents unless otherwise indicated . the invention further provides a product suitable for brazing , having a base ( core ) of aluminium or aluminium alloy and a clad layer on said base having a lower melting point than said base , wherein the clad layer is aluminium alloy brazing material of the invention as described above . the invention further provides a brazed assembly comprising at least two members joined by an aluminium alloy brazing material of the invention as set out above . typically this brazing material is in the form of a clad layer on one of the members or a fillet joining the two members . in the aluminium alloy brazing material of the invention , the amount of si is selected in a conventional manner , to provide the desired brazing properties of the alloy . the amount of fe depends primarily on the origin of the alloy material . the amount of mn is in the range 0 . 2 to 1 . 5 %, because below 0 . 2 % the effect of improved corrosion resistance is not found . preferably the amount of mn is at least 0 . 3 %, and more preferably at least 0 . 4 %, to provide improved corrosion resistance . with a view to the properties of the alloy , the amount of mn should be not more than 1 . 5 %, preferably not more than 1 . 0 %. the preferred maximum is 0 . 8 %, since above this level the improved corrosion resistance may be less . the amount of mg is chosen in accordance with the intended type of brazing of the particular product . for cab brazing , a relatively low level of mg may be present , e . g . up to 0 . 4 %. for vacuum brazing , a higher level , up to 2 . 0 % preferably not more than 1 %, is suitable . zn is an impurity element which can be tolerated to a level of up to 1 %, and is preferably not more than 0 . 5 %. the brazing material comprises optionally a wetting agent as alloying element in a range of up to 1 wt . %, and preferably up to 0 . 8 wt . % in order to improve the wettability of the brazing material during the brazing process , in particular during vacuum brazing or controlled atmosphere brazing ( cab ) in the absence of a brazing flux material . preferably the wetting agent is selected from the group consisting of lead , bismuth , antimony , tin , silver , thallium , indium , and any mixture thereof . the balance of the composition is aluminium and inevitable impurities , and preferably maximum impurities in total preferably 0 . 20 wt %, with no element more than 0 . 05 wt %. preferred embodiments of this aluminium alloy are also substantially sodium - free and beryllium - free . for the purposes of study , seven alloys suitable for the use as brazing filler materials ( clad or fillet ) were cast , having the compositions given in table 1 . alloys 1 , 2 and 3 are comparative , and have an increasing amount of fe without mn . alloys 4 , 5 , 6 and 7 have an increasing amount of mn , with constant fe . dsc ( differential scanning calometry , also known as differential scanning calorimetry ) was used to determine the melting temperature ( onset of melting ) of the alloys , since the effect of mn on the melting point was not known . the melting points show that the melting temperature will not affect the brazing properties of these alloys . these filler alloys were used to form fillets in a brazed structure , shown in fig1 , in which the sheet 1 and the angular coupon 2 are aa3003 aluminium alloy . the brazing alloy forms the fillet 3 . in each sample about 85 mg filler alloy was used , and the samples were brazed using 2 g / m 2 flux . corrosion tests were performed on both the filler alloys as cast , and on the brazed fillets . polished samples were exposed to a nacl solution ( 3 %, twice for 90 minutes ) light microscopy pictures were taken before and after corrision the same location . corrosion was qualitatively established from the visible local attack around second phase particles . for the alloys as cast , it was found that the corrosion performance deteriorates with increasing fe content , for alloys 1 , 2 and 3 . on the other hand , the corrosion attack clearly decreased with increasing mn content in the alloys 4 , 5 and 7 . the corrosion performance of alloy 6 was similar to that of alloy 5 . similarly , using light microscopy images , corrosion was inspected for the fillets of the brazed product shown in fig1 . corrosion after 90 and 180 minutes exposure in 3 % nacl was studied . while there was not much difference between the corrosion attack on alloys 1 and 2 , there was much more corrosion for alloy 3 . all four of alloys 4 , 5 , 6 and 7 showed improved corrosion resistance , compared with the fillet of alloy 2 . the optimum effect was achieved for alloys 5 and 6 , with alloy 7 showing a less good performance than alloys 5 and 6 . from these results , improved corrosion resistance is expected for the brazing material of the invention , when used as a clad layer as a member on an aluminium or aluminium alloy base ( core ) in a construction subjected to brazing , with resolidification of the material of the clad layer . the brazing material of the invention can be applied for example to constructions such as heat exchangers . having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made without departing from the spirit or scope of the invention as herein described . | 1 |
description will be made below on an embodiment of a steering column apparatus according to the present invention . fig1 is a side view of a steering column apparatus according to the first embodiment of the present invention , and fig2 a is an enlarged cross - sectional view taken along a - a line in fig1 , provided that a steering shaft 13 is omitted in fig1 . the steering column 1 is attached to a vehicle body - side strength member 7 through a fixed upper bracket 3 formed of a steel plate by press - forming to serve as a vehicle body - side bracket and a pivot bracket 5 formed of alluminium alloy by die casting , so as to support an upper steering shaft ( hereinafter simply called the steering shaft ) 13 to be rotatable through bearings 9 , 11 . the upper bracket 3 has integrally a pair of body - side mounting portions 3 a , 3 b having the width in the length direction of the steering shaft , and being extended symmetrically in a direction perpendicular to an extending direction of the steering shaft , that is , the right - and - left direction in fig2 a , so as to be secured to the body - side strength member 7 by the use of fixing members ( not shown ) such as bolts , and a pair of side plate portions 3 c , 3 d which are bent substantially at right angles at the inner ends of body - side mounting portions 3 a , 3 b of the upper bracket 3 to be extended in vertical directions respectively . while a steering wheel ( not shown ) is attached to an upper end of the steering shaft 13 , a lower steering shaft is coupled to a lower end of the steering shaft 13 through a universal joint , which leads to a rack and pinion mechanism of a steering mechanism . tilt adjusting holes 15 a , 15 b are formed on the side wall portions 3 c , 3 d of the upper bracket 3 . the steering column 1 is comprised of an upper column 21 formed of a steel pipe by hydroforming and a lower column 23 of a steel pipe fitted in the upper column 21 to be slidable . the upper column 21 is generally in the form of a cylinder , but is formed with a pair of right and left pressed and expanding portions 25 , 27 in fig2 a to be pressed and sandwiched by the side plate portions 3 c , 3 d at the positions corresponding to these side plate portions 3 c , 3 d of the upper bracket 3 and a distance unit 29 whose bottom 28 is expanded and connect the expanding portions 25 , 27 at the lower end . on flat surface portions 51 , 53 of the expanding portions 25 , 27 , there are formed elongated holes 37 , 37 respectively extending in the axial direction , corresponding to elongated holes 15 a , 15 b formed on the side plate portions 3 c , 3 d of the upper bracket 3 . an adjusting bolt 31 is inserted through the elongated holes 15 a , 15 b and the elongated holes 37 , 37 , and the distance unit 29 is pressed and fixed with a predetermined clamping force to the fixed upper bracket 3 by the adjusting nut 33 , as described later . the adjusting nut 33 and an adjusting lever 35 are interposed between a nut 31 a thread - engaged with the adjusting bolt 31 and secured thereto and one of the side plate portions 3 d of the upper bracket 3 . the adjusting nut 33 and the adjusting lever 35 are in a mutually integrated rotational relationship since a substantially conical projection of the adjusting nut 33 is fitted in a substantially conical recess of the adjusting lever 35 . in addition , a thread portion of the adjusting bolt 31 is thread - engaged with a thread portion of the adjusting bolt 33 . a surface contacting with the side plate portion 3 c of a head portion 31 b of the adjusting bolt 31 has a cross - section in a substantially rectangular form , and is fitted in the elongated hole 15 a formed on the side plate portion 3 c of the upper bracket 3 to permit no rotation of the adjusting bolt 31 . the adjusting lever 35 is thus manually rotated to clamp the flat surface portions 51 , 53 of the distance unit 29 by the side plate portions 3 c , 3 d or to release this clamping . such a clamping or releasing operation as described above may be performed by a known cam mechanism , instead of the adjusting nut 33 . the elongated holes 37 , 37 formed on the flat surface portions 51 , 53 of the column expanded portions 25 , 27 and extended in parallel to the column shaft are used for adjusting the telescopic position of the steering column . on the other hand , the pivot bracket 5 a has a pair of body mounting portions 5 a which are extended horizontally , as shown in fig2 b , and are secured to the body - side strength member 7 by bolts , or the like . a pair of vertical plate portions 5 b , 5 c which are extended in parallel in a vertical direction from the body mounting portions 5 a are formed on the pivot bracket 5 . a column - side lower bracket 41 secured to a lower part of the lower column 23 integrally comprises flat plate portions 41 b , 41 c which are extended in the up - and - down direction , corresponding to the vertical plate portions 5 b , 5 c of the pivot bracket 5 and which are respectively in pressure contact therewith . the vertical plate portions 5 b , 5 c and the flat plate portions 41 b , 41 c of the column - side lower bracket are respectively formed with round holes arrayed in the horizontal direction , and the bolt 43 is inserted through these round holes to clamp those plate portions with the nut 45 . in the present embodiment , the column - side lower bracket 41 is formed by press - forming separately from the lower column 23 , and is fixed to the lower column 23 by welding . however , the column - side lower bracket 41 may be integrally formed by expanding the lower column 23 by hydro - bulging or the like , in the same manner as the distance unit described above . a cut - away portion 47 in a substantially u shape is formed on the pivot bracket 5 to be open forward , and the pivot bolt 43 is inserted in the rear end side of the cut - away portion 47 . the steering column 1 is arranged to be rockable as a whole around the pivot bolt 43 . the driver can adjust a vertical position of the steering wheel ( in the up - and - down direction in fig1 ) within a range in which the adjusting bolt 31 is moved in the tilt adjusting elongated holes 15 a , 15 b by operating the adjusting lever 35 . moreover , the upper column 21 is slidable with respect to the lower column 23 , so that the driver can adjust the front and back positions of the steering wheel ( in the right - and - left direction in fig1 ) within a range in which the adjusting bolt 31 is moved in the elongated holes 37 for telescopic adjustment by operating the adjusting lever 35 . on the upper column 21 of the present embodiment , the pressed and expanding portions 25 , 27 are formed with the flat surface portions 51 , 53 which are brought into contact with the inner surfaces of the vertical side plate portions 3 c , 3 d of the fixed upper bracket 3 , and three beads 55 , 57 are formed , respectively , on an upper part and a lower part of the distance unit 29 . fig3 is a perspective view of this arrangement , while fig4 shows a lateral view thereof . each of the beads 55 , 57 is formed at least along the length of the elongated hole 37 so as to couple the pressed portions 25 , 27 together , thereby reinforcing the upper column . the number of such beads may be increased to meet a desired strength . a mode of an operation of the present embodiment will be described in the following . when the position of the steering wheel becomes inappropriate because of a change of drivers , or the like , with the steering column apparatus of the first embodiment , first the driver rotates the adjusting lever 35 clockwise to loosen the adjusting nut 33 with respect to the adjusting bolt 31 . then , the axial force of the adjusting bolt 31 which has worked on the distance unit 29 of the upper column 21 through the upper bracket 3 is extinguished so that the steering column 1 is allowed to rock in a predetermined amount which is determined by the elongated holes 15 a , 15 b around the pivot bolt 43 and , at the same time , the upper column 21 is also allowed to slide in a predetermined amount which is determined by the elongated holes 37 , 37 with respect to the lower column 23 . with this operation , the driver can tiltingly or telescopically move the steering column 1 to adjust the steering wheel to a desired position . upon completion of the positional adjustment of the steering wheel , the driver rotates the adjusting lever 35 counter - clockwise to clamp the adjusting nut 33 with respect to the adjusting bolt 31 . then , a predetermined axial force is generated in the adjusting bolt 31 so that the inner surfaces of the fixed upper bracket 3 are brought into pressure contact with the pressed flat surface portions 51 , 53 of the distance unit 29 . as a result , the upper column 21 ( that is , the steering wheel ) is fixed at a desired position with respect to the upper bracket 3 . on this occasion , since the beads 55 , 57 for coupling the pressed and expanding portions 25 , 27 are provided in an upper part and a lower part of the distance unit 29 in the present embodiment , the rigidity of the distance unit 29 is conspicuously high , compared with that of the prior art described above . with this structure , the upper column 21 can be supported by the fixed upper bracket 3 without fail , and a vibration of the steering shaft 13 and that of the steering wheel in running can be suppressed . in addition , an unintentional movement of the upper column 21 and the like at collision of the car is difficult to occur . if an excessive axial force is generated in the adjusting bolt 31 when the adjusting lever 35 is clamped by a strong clamping force , elastic or plastic deformation of the distance unit 29 is difficult to occur so that a stable clamping is feasible for a long time . fig5 is a perspective view of an upper column according to the second embodiment , and fig6 is a perspective view of the upper column according to the third embodiment . each of these embodiments employs a structure substantially the same as that of the first embodiment . however , in the second embodiment three grooves 61 depressed in the column are formed on the distance unit 29 , instead of the beads . on the other hand , a wide r - shaped band type convex portion 63 is provided on the distance unit 29 in the third embodiment . these grooves 61 and the convex portion 63 are formed at least along the length of the elongated hole 37 , in the similar manner as in the first embodiment , so as to connect the pressed and expanding portions 25 , 27 and a mode of operation thereof is also the same as that in the first embodiment . embodiments of the present invention are not limited to those described above . for example , the size and the shape of a cross section of the convex portion or the concave portion for connecting the pressed and expanding portions , and the number or the pitch of these portions can be properly determined in accordance with designing reasons , or the like . these convex and concave portions may be provided on the upper side , on the lower side , or on the bottom of the pressed and expanding portions . the convex and concave portions may be properly combined with each other . the shape of a cross section of the bead may be substantially triangular , rectangular , or r - shaped . the material for the steering column may be steel pipe or alluminium . the steering column may be plastically processed by explosive bulging , rubber bulging , or press - forming , instead of hydroforming . in the embodiments described above , the present invention is applied to a steering column apparatus of a telescopic type . however , the present invention may be applied to a steering column apparatus which is provided only with a tilting mechanism or only with a telescopic mechanism . the described steering column comprises the upper column and the lower column which are separately formed . however , the upper column and the lower column may be integrally formed . also , not only the distance unit , but also the lower bracket may be formed integrally . specific structures of the steering apparatus and the material , the shape , and the like , of each of the constituent parts thereof can be properly changed within the scope and spirit of the present invention . as described above , according to the steering column apparatus of the present invention , the rigidity of the whole column distance unit which is pressed and supported by the body - side bracket is improved and is difficult to be deflected even if a great clamping force is applied onto the pressed portion , the steering column can be supported by the body - side bracket without fail , a vibration of the steering shaft or that of the steering wheel in running can be suppressed , and an unintentional movement of the steering column or the like at a collision of the car scarcely occur . | 1 |
the following description is merely exemplary in nature and is not intended to limit the present disclosure , application , or uses . for purposes of clarity , the same reference numbers will be used in the drawings to identify similar elements . as used herein , the term “ module ” refers to an application specific integrated circuit ( asic ), an electronic circuit , a processor ( shared , dedicated , or group ) and memory that execute one or more software or firmware programs , a combinational logic circuit , or other suitable components that provide the described functionality . referring to fig1 , a vehicle 10 may include an engine assembly 12 and a control module 14 . engine assembly 12 may include an engine 16 , an intake system 18 , an exhaust system 20 , and a fuel system 22 . intake system 18 may be in communication with engine 16 and may include an intake manifold 24 , a throttle 26 , and an electronic throttle control ( etc ) 28 . etc 28 may actuate throttle 26 to control an air flow into engine 16 . exhaust system 20 may be in communication with engine 16 and may include an exhaust manifold 30 and a catalyst 32 , such as a catalytic converter . fuel system 22 may provide fuel to engine 16 . exhaust gas created by combustion of the air - fuel mixture may exit engine 16 through exhaust system 20 . control module 14 may be in communication with fuel system 22 , etc 28 , an intake air temperature ( iat ) sensor 33 , a mass air flow ( maf ) sensor 34 , a barometric pressure ( p baro ) sensor 35 , a manifold absolute pressure ( map ) sensor 36 , an engine speed sensor 38 , and an oxygen sensor 40 . iat sensor 33 may provide a signal to control module 14 indicative of an air temperature within intake system 18 . maf sensor 34 may be located upstream of intake manifold 24 and throttle 26 and may provide a signal to control module 14 indicative of an engine air flow rate ( efr maf ) past maf sensor 34 and into engine 16 . map sensor 36 may be located downstream of maf sensor 34 , generally between throttle 26 and engine 16 and may provide a signal to control module 14 indicative of map within intake manifold 24 . engine speed sensor 38 may provide a signal to control module 14 indicative of the operating speed of engine 16 . p baro sensor 35 may provide a signal to control module 14 indicative of barometric pressure . oxygen sensor 40 may be located between exhaust manifold 30 and catalyst 32 , generally at an inlet of catalyst 32 , and may provide a signal to control module 14 indicative of an oxygen level of exhaust gas exiting engine 16 . referring to fig2 , control module 14 may include an air flow measurement module 42 , an air flow calculation module 44 , a fuel control module 46 , an exhaust gas evaluation module 48 , an air leak determination module 50 , and an air leak control module 52 . air flow measurement module 42 may receive the air flow measurement signal from maf sensor 34 . air flow measurement module 42 may be in communication with fuel control module 46 and air leak determination module 50 may provide the engine air flow rate ( efr maf ) based on the measurement from maf sensor 34 thereto . air flow calculation module 44 may receive the map measurement signal from map sensor 36 . air flow calculation module 44 may additionally be in communication with engine speed sensor 38 and may receive the engine speed signal . air flow calculation module 44 may determine a calculated engine air flow rate ( efr map ) into engine 16 based on the map measurement provided by map sensor 36 and the engine speed provided by engine speed sensor 38 . more specifically , efr map may be determined by the function shown below : where rpm is engine speed , map is manifold absolute pressure , nocyl is number of cylinders , disp is engine displacement , ve is volumetric efficiency ( which is a function of rpm and map ), bcorr is a barometric correction for ve ( which is a function of p baro and rpm ), r is the gas constant for air ( 287 m 2 /( s 2 *° k )), and tm is manifold air charge temperature . air flow calculation module 44 may be in communication with fuel control module 46 and air leak determination module 50 and may provide efr map thereto . fuel control module 46 may be in communication with fuel system 22 and may determine an amount of fuel needed to meet a desired air - fuel ratio . fuel control module 46 may receive efr maf from air flow measurement module 42 and efr map from air flow calculation module 44 . fuel control module 46 may additionally be in communication with air leak determination module 50 and air leak control module 52 . exhaust gas evaluation module 48 may be in communication with oxygen sensor 40 and may determine a concentration of oxygen in exhaust gas from engine 16 . exhaust gas evaluation module 48 may be in communication with air leak determination module 50 and may provide the determined oxygen concentration thereto . air leak determination module 50 may determine whether an air leak is present in intake system 18 based on inputs from air flow measurement module 42 , air flow calculation module 44 , fuel control module 46 , and exhaust gas evaluation module 48 . air leak determination module 50 may compare efr maf and efr map to predetermined limits limit low and limit high . limit low and limit high may be lower and upper calibrated limits for air flow into engine 16 , and may be defined as the functions shown below : air leak control module 52 may be in communication with air leak determination module 50 and may determine remedial actions when an air leak is detected at air leak determination module 50 . air leak control module 52 may additionally be in communication with fuel control module 46 and may adjust fuel supplied to engine 16 when an air leak is detected , as discussed below . with reference to fig3 , control logic 100 generally illustrates an air leak detection and management system for an air leak in intake system 18 . control logic 100 may begin at block 102 where applicable active diagnostic faults are evaluated . if an active diagnostic fault is present , control logic 100 returns to block 102 . applicable active faults may include faults that will prevent diagnostic systems from making a correct or robust detection . applicable active faults may include a maf sensor fault and a map sensor fault . it is understood that other fault signals may additionally be considered . if no applicable active faults are detected , control logic 100 may proceed to block 104 where engine idle conditions are evaluated . vehicle speed and throttle position may be used to make sure that engine 16 is operating at idle . more specifically , a vehicle speed of approximately 0 miles per hour and a closed throttle position may correspond to the idle condition . if idle conditions are met , control logic 100 may proceed to block 106 . otherwise , control logic 100 may return to block 102 . block 106 may evaluate efr maf from maf sensor 34 . if efr maf is less than a first predetermined air flow limit , control logic 100 may proceed to block 108 . in the present example the first predetermined air flow limit may include limit low . otherwise , control logic 100 may return to block 102 . block 108 may determine efr map , as discussed above . control logic 100 may then proceed to block 110 where efr map is evaluated relative to second and third air flow limits . in the present example , the second air flow limit may include limit low and the third air flow limit may include limit high . therefore , the second air flow limit may be equal to the first air flow limit . if efr map is between limit low and limit high , control logic 100 may proceed to block 112 . otherwise , control logic 100 may return to block 102 . block 112 may evaluate an exhaust oxygen level . if the exhaust oxygen level is greater than a predetermined upper limit ( limit o2 ), control logic 100 may proceed to block 114 . limit o2 may generally correspond to an oxygen level associated with efr maf for a generally stoichiometric air - fuel ratio . when an air leak is present downstream of maf sensor 34 , the amount of fuel provided to engine 16 to maintain a commanded air - fuel ratio may be less than the amount actually needed for the commanded air - fuel ratio due to a greater amount of air entering engine 16 than measured by maf sensor 34 . more specifically , the greater amount of air may result in a lean air - fuel ratio ( greater than 14 . 7 - to - 1 ) when the commanded air fuel ratio is stoichiometric , resulting in a greater exhaust oxygen level than would be present from a generally stoichiometric air - fuel ratio . block 114 may evaluate exhaust oxygen levels relative to the commanded air - fuel ratio from fuel control module 46 . the commanded air - fuel ratio may include a stoichiometric air - fuel ratio ( 14 . 7 - to - 1 ) or a rich air - fuel ratio ( less than 14 . 7 - to - 1 ). more specifically , block 114 may generally determine whether the high oxygen level in the exhaust gas is due to the commanded air - fuel ratio . the evaluation at block 114 may include a comparison between an expected exhaust gas oxygen level associated with the commanded air - fuel ratio and the measured exhaust oxygen level . if the oxygen level corresponds to the commanded air - fuel ratio , control logic 100 may return to block 102 . otherwise , control logic 100 may proceed to block 116 . for example , if the commanded air - fuel ratio is rich ( less than 14 . 7 - to - 1 ), a relatively low oxygen level would be expected in the exhaust gas . therefore , the high oxygen level would generally indicate an air leak . however , if the commanded air - fuel ratio is lean , the high exhaust oxygen level may be due to the commanded air - fuel ratio and not an air leak . block 116 may generally indicate an air leak in intake system 18 . control logic 100 may then proceed to block 118 where remedial actions may be initiated . remedial actions may include controlling fuel supplied to engine 16 based on efr map rather than efr maf . control logic 100 may then terminate . | 5 |
fig1 shows a layer system 1 according to the invention . the layer system 1 comprises a metallic substrate 4 which , in particular for components at high temperatures , consists of a nickel - or cobalt - based superalloy ( fig2 ). directly on the substrate 4 , there is preferably a metallic bonding layer 7 in particular of the nicocralx type , which preferably consists of an aluminum oxide layer is preferably formed already on this metallic bonding layer 7 before further ceramic layers are applied , or such an aluminum oxide layer ( tgo ) is formed during operation . there is generally an inner ceramic layer 10 , preferably a fully or partially stabilized zirconium oxide layer , on the metallic bonding layer 7 or on the aluminum oxide layer ( not shown ) or on the substrate 4 . yttrium - stabilized zirconium oxide is preferably used , with 6 wt %- 8 wt % of yttrium preferably being employed . calcium oxide , cerium oxide and / or hafnium oxide may likewise be used to stabilize zirconium oxide . the zirconium oxide is preferably applied as a plasma - sprayed layer , although it may also preferably be applied as a columnar structure by means of electron beam deposition ( ebpvd ). an outer ceramic layer 13 which consists mainly of a pyrochlore phase , i . e . it comprises at least 80 wt % of the pyrochlore phase that consists of either gd 2 hf 2 o 7 or gd 2 zr 2 o 7 , is applied on the stabilized zirconium oxide layer 10 . preferably 100 wt % of the outer layer 13 consists of one of the two pyrochlore phases . amorphous phases , pure gdo 2 , pure zro 2 or pure hfo 2 , mixed phases of gdo 2 and zro 2 or hfo 2 , which do not comprise the pyrochlore phase , are in this case undesirable and should be minimized . the layer thickness of the inner layer 10 is preferably between 10 % and 50 % of the total layer thickness of the inner layer 10 plus the outer layer 13 . the inner ceramic layer 10 preferably has a thickness of from 40 μm to 60 μm , in particular 50 μm ± 10 % the total layer thickness of the inner layer 10 plus the outer layer 13 is preferably 300 μm or preferably 400 μm . the maximum total layer thickness is advantageously 800 μm or preferably at most 600 μm . the layer thickness of the inner layer 10 is preferably between 10 % and 40 % or between 10 % and 30 % of the total layer thickness . it is likewise advantageous for the layer thickness of the inner layer 10 to comprise from 10 % to 20 % of the total layer thickness . it is likewise preferable for the layer thickness of the inner layer 10 to be between 20 % and 50 % or between 20 % and 40 % of the total layer thickness . advantageous results are likewise achieved if the contribution of the inner layer 10 to the total layer thickness is between 20 % and 30 %. the layer thickness of the inner layer 10 is preferably from 30 % to 50 % of the total layer thickness . it is likewise advantageous for the layer thickness of the inner layer 10 to comprise from 30 % to 40 % of the total layer thickness . it is likewise preferable for the layer thickness of the inner layer 10 to be between 40 % and 50 % of the total layer thickness . although the pyrochlore phase has better thermal insulation properties than the zro 2 layer , the zro 2 layer may be configured to be just as thick as the pyrochlore phase . fig3 shows a perspective view of a rotor blade 120 or guide vane 130 of a turbomachine , which extends along a longitudinal axis 121 . the turbomachine may be a gas turbine of an aircraft or of a power plant for electricity generation , a steam turbine or a compressor . the blade 120 , 130 comprises , successively along the longitudinal axis 121 , a fastening zone 400 , a blade platform 403 adjacent thereto as well as a blade surface 406 . as a guide vane 130 , the vane 130 may have a further platform ( not shown ) at its vane tip 415 . a blade root 183 which is used to fasten the rotor blades 120 , 130 on a shaft or a disk ( not shown ) is formed in the fastening zone 400 . the blade root 183 is configured , for example , as a hammerhead . other configurations as a firtree or dovetail root are possible . the blade 120 , 130 comprises a leading edge 409 and a trailing edge 412 for a medium which flows past the blade surface 406 . in conventional blades 120 , 130 , for example solid metallic materials , in particular superalloys , are used in all regions 400 , 403 , 406 of the blade 120 , 130 . such superalloys are known for example from ep 1 204 776 b1 , ep 1 306 454 , ep 1 319 729 a1 , wo 99 / 67435 or wo 00 / 44949 ; with respect to the chemical composition of the alloy , these documents are part of the disclosure . the blades 120 , 130 may in this case be manufactured by a casting method , also by means of directional solidification , by a forging method , by a machining method or combinations thereof . workpieces with a monocrystalline structure or structures are used as components for machines which are exposed to heavy mechanical , thermal and / or chemical loads during operation . such monocrystalline workpieces are manufactured , for example , by directional solidification from the melts . these are casting methods in which the liquid metal alloy is solidified to form a monocrystalline structure , i . e . to form the monocrystalline workpiece , or is directionally solidified . dendritic crystals are in this case aligned along the heat flux and form either a rod crystalline grain structure ( columnar , i . e . grains which extend over the entire length of the workpiece and in this case , according to general terminology usage , are referred to as directionally solidified ) or a monocrystalline structure , i . e . the entire workpiece consists of a single crystal . it is necessary to avoid the transition to globulitic ( polycrystalline ) solidification in these methods , since nondirectional growth will necessarily form transverse and longitudinal grain boundaries which negate the beneficial properties of the directionally solidified or monocrystalline component . when directionally solidified structures are referred to in general , this is intended to mean both single crystals which have no grain boundaries or at most small - angle grain boundaries , and also rod crystal structures which , although they do have grain boundaries extending in the longitudinal direction , do not have any transverse grain boundaries . these latter crystalline structures are also referred to as directionally solidified structures . such methods are known from u . s . pat . no . 6 , 024 , 792 and ep 0 892 090 a1 ; these documents are part of the disclosure . the blades 120 , 130 may likewise have coatings against corrosion or oxidation , for example ( mcralx ; m is at least one element from the group ion ( fe ), cobalt ( co ), nickel ( ni ), x is an active element and stands for yttrium ( y ) and / or silicon and / or at least one rare earth element , or hafnium ( hf )). such alloys are known from ep 0 486 489 b1 , ep 0 786 017 b1 , ep 0 412 397 b1 or ep 1 306 454 a1 which , with respect to the chemical composition of the alloy , are intended to be part of this disclosure . on the mcralx layer , there may furthermore be a ceramic thermal insulation layer 13 according to the invention . rod - shaped grains are produced in the thermal insulation layer by suitable coating methods , for example electron beam deposition ( eb - pvd ). refurbishment means that components 120 , 130 may need to have protective layers taken off ( for example by sandblasting ) after their use . then the corrosion and / or oxidation layers or products are removed . optionally , cracks in the component 120 , 130 are also repaired . the component 120 , 130 is then recoated and the component 120 , 130 is used again . the blade 120 , 130 may be designed to be a hollow or solid . if the blade 120 , 130 is intended to be cooled , it will be hollow and optionally also comprise film cooling holes 418 ( indicated by dashes ). fig4 shows a combustion chamber 110 of a gas turbine 100 ( fig5 ). the combustion chamber 110 is designed for example as a so - called ring combustion chamber in which a multiplicity of burners 107 , which produce flames 156 and are arranged in the circumferential direction around a rotation axis 102 , open into a common combustion chamber space 154 . to this end , the combustion chamber 110 as a whole is designed as an annular structure which is positioned around the rotation axis 102 . in order to achieve a comparatively high efficiency , the combustion chamber 110 is designed for a relatively high temperature of the working medium m , i . e . about 1000 ° c . to 1600 ° c . in order to permit a comparatively long operating time even under these operating parameters which are unfavorable for the materials , the combustion chamber wall 153 is provided with an inner lining formed by heat shield elements 155 on its side facing the working medium m . each heat shield element 155 made of an alloy is equipped with a particularly heat - resistant protective layer ( mcralx layer and / or ceramic coating ) on the working medium side , or is made of refractory material ( solid ceramic blocks ). these protective layers may be similar to the turbine blades , i . e . for example mcralx means : m is at least one element from the group ion ( fe ), cobalt ( co ), nickel ( ni ), x is an active element and stands for yttrium ( y ) and / or silicon and / or at least one rare earth element , or hafnium ( hf ). such alloys are known from ep 0 486 489 b1 , ep 0 786 017 b1 , ep 0 412 397 b1 or ep 1 306 454 a1 which , with respect to the chemical composition of the alloy , are intended to be part of this disclosure . refurbishment means that heat shield elements 155 may need to have protective layers taken off ( for example by sandblasting ) after their use . the corrosion and / or oxidation layers or products are then removed . optionally , cracks in the heat shield element 155 are also repaired . the heat shield elements 155 are then recoated and the heat shield elements 155 are used again . owing to the high temperatures inside the combustion chamber 110 , a cooling system may also be provided for the heat shield elements 155 or for their retaining elements . the heat shield elements 155 are then hollow , for example , and optionally also have film cooling holes ( not shown ) opening into the combustion chamber space 154 . fig5 shows a gas turbine 100 by way of example in a partial longitudinal section . the gas turbine 100 internally comprises a rotor 103 , which will also be referred to as the turbine rotor , mounted so as to rotate about a rotation axis 102 and having a shaft 101 . successively along the rotor 103 , there are an intake manifold 104 , a compressor 105 , an e . g . toroidal combustion chamber 110 , in particular a ring combustion chamber , having a plurality of burners 107 arranged coaxially , a turbine 108 and the exhaust manifold 109 . the ring combustion chamber 110 communicates with an e . g . annular hot gas channel 111 . there , for example , four successively connected turbine stages 112 form the turbine 108 . each turbine stage 112 is formed for example by two blade rings . as seen in the flow direction of a working medium 113 , a guide vane row 115 is followed in the hot gas channel 111 by a row 125 formed by rotor blades 120 . the guide vanes 130 are fastened on an inner housing 138 of a stator 143 while the rotor blades 120 of a row 125 are fastened on the rotor 103 , for example by means of a turbine disk 133 . coupled to the rotor 103 , there is a generator or a work engine ( not shown ). during operation of the gas turbine 100 , air 135 is taken in and compressed by the compressor 105 through the intake manifold 104 . the compressed air provided at the turbine - side end of the compressor 105 is delivered to the burners 107 and mixed there with a fuel . the mixture is then burnt to form the working medium 113 in the combustion chamber 110 . from there , the working medium 113 flows along the hot gas channel 111 past the guide vanes 130 and the rotor blades 120 . at the rotor blades 120 , the working medium 113 expands by imparting momentum , so that the rotor blades 120 drive the rotor 103 and the work engine coupled to it . during operation of the gas turbine 100 , the components exposed to the hot working medium 113 experience thermal loads . apart from the heat shield elements lining the ring combustion chamber 110 , the guide vanes 130 and rotor blades 120 of the first turbine stage 112 , as seen in the flow direction of the working medium 113 , are heated the most . in order to withstand the temperatures prevailing there , they may be cooled by means of a coolant . substrates of the components may likewise comprise a directional structure , i . e . they are monocrystalline ( sx structure ) or comprise only longitudinally directed grains ( ds structure ). iron -, nickel - or cobalt - based superalloys are for example used as material for the components , in particular for the turbine blades 120 , 130 and components of the combustion chamber 110 . such superalloys are known for example from ep 1 204 776 b1 , ep 1 306 454 , ep 1 319 729 a1 , wo 99 / 67435 or wo 00 / 44949 ; with respect to the chemical composition of the alloy , these documents are part of the disclosure . the guide vanes 130 comprise a guide vane root ( not shown here ) facing the inner housing 138 of the turbine 108 , and a guide vane head lying opposite the guide vane root . the guide vane head faces the rotor 103 and is fixed on a fastening ring 140 of the stator 143 . | 8 |
with reference to the above figures , the reference numeral 1 designates the ski boot comprising a shell 2 provided with a first flap 3 and with a second flap 4 which mutually overlap in normal use while skiing by means of adapted levers , not shown in the figure . as shown in fig2 a tab 6 is formed on the lateral edge 5 of the first flap 3 and is folded toward the inside of the shell in the direction of the second flap 4 . the tab 6 forms , when inactive , an acute angle with the internal lateral surface 7 of the first flap 3 . when the first and second flaps overlap , once the necessary levers have been secured , the tab 6 can be partially or fully accommodated within an adapted seat 8 formed longitudinally with respect to the second flap 4 . the use of the invention is thus as follows : when the first and second flaps overlap , during sports practice , the tab 6 improves the seal between the first flap and the second flap by virtue of its deformability . if the skier stops skiing and loosens the levers to walk , the unavoidable mutual separation of the lateral edges of the first and second flaps is compensated by the tab 6 , which still interacts with the second flap and forms a sealing region again by virtue of its elastic deformation . it has thus been observed that the invention has achieved the intended aim and objects , since a ski boot with overlapping flaps has been obtained in which tightness between said flaps is ensured both during sports practice and while walking . the ski boot according to the invention is naturally susceptible to numerous modifications and variations , all of which are within the scope of the same inventive concept . thus , for example , a shell 102 is illustrated which has a first flap 103 and a second flap 104 that can mutually overlap . an elastically deformable tab 106 protrudes toward the overlying first flap 103 at the lateral edge 105 of the second flap 104 . said tab 106 forms an acute angle with the outer lateral surface 109 of the second flap 104 , and its outward edge interacts with the inner lateral surface 107 of the first flap 102 . this second solution also allows to maintain excellent tightness while walking . fig4 illustrates a shell 202 comprising a first flap 203 and a second flap 204 that mutually overlap . a tab 206 protrudes toward the first flap 203 at the lateral edge 205 of the second flap 204 and forms an obtuse angle with the outer lateral surface 209 of the second flap 204 . the outward edge of the tab 206 instead interacts with the inner lateral surface 207 of the first flap 203 . in this condition , too , the tab 206 is elastically deformable , in that its free edge tends to maintain contact with the inner lateral surface 207 of the first flap 203 . fig5 and 6 illustrate a ski boot 301 wherein flaps 303 and 304 are not made integral with the shell but rather associated therewith by means of rivets 333 . the first flap 303 has a tab 306 formed at the edge 305 and , similarly to the embodiment illustrated in fig1 and 2 , the tab 306 can be arranged in an adapted seat 308 provided at the second flap 304 . fig7 illustrates a shell similar to the embodiment illustrated in fig3 wherein , however , the flaps 403 and 404 are riveted to the shell by means of rivets 433 . fig8 illustrates a shell 502 having a first flap 503 and a second flap 504 associated therewith by means of rivets 533 . the first flap 503 has a tab 506 which is adapted to be arranged in a seat 508 provided at the second flap 504 , similarly to the embodiments illustrated in fig2 and 6 . in this case however the tab 506 is not provided at the edge of the flap but rather at a distance therefrom . fig9 illustrates a shell 602 having a first flap 603 and a second flap 604 . flap 604 has a tab 606 projecting outward and provided at a distance from the edge 605 of the second flap 604 . fig1 illustrate a detail of a shell having a first flap 703 and a second flap 704 . the first flap 703 has an outward projecting tab 706 adapted to engage the second flap 704 in a manner similar to that of the embodiment shown in fig3 for example . a border member 707 , made of rubber for example , is provided at the edge 705 of the second flap 704 to improve the sealing action . with regard to the above described embodiments , the shells each have an inside for accommodating a user &# 39 ; s foot . the internal surfaces and external surfaces of each of the flaps face respectively towards and away from the inside of the respective shell . as it may be appreciated from the foregoing description , in each embodiment the elastically deformable tab is connected to one of the overlapping flaps in the various manners as described , in such a manner that the tab is folded with respect to such one flap to form a fold line between the tab and the one flap , and such that the tab has an extension which forms a first angle with respect to an extension of the one flap when the flaps are relatively mutually spaced in an open position . in the embodiments as seen in fig1 - 3 and 5 - 10 , the first angle formed between the extension of the tab and the extension of the flap to which the tab is connected is an acute angle , while in the embodiment seen in fig4 such first angle is an obtuse angle . moreover , the extensions of the tab and of the flap to which the tab is connected intersect , in the open position , at the fold line between the tab and the flap and the first angle formed between such extensions in the open position has a vertex which lies essentially on the fold line . as it may be further appreciated from the foregoing description , the elastically deformable tab in each embodiment is elastically deformable such that when the first and second flaps are relatively mutually closed in a closed position the tab assumes a bent position relative to a position the tab assumed in the open position by being bent along the fold line so as to form a second angle between an extension of the flap to which the tab is connected and an extension of the tab in the closed position , and such that the extensions of the tab and of the flap to which the tab is connected in the closed position intersect at said fold line and the second angle is formed between the extensions in the closed position with a vertex of such second angle lying essentially on the fold line . in each of the embodiments , the above described second angle is different than above described first angle . in the embodiments as seen in fig1 - 3 and 5 - 10 , the first angle in the open position is greater than the second angle in the closed position , while in the embodiment seen in fig4 the first angle in the open position is less than the second angle in the closed position . as it may be further appreciated from the foregoing description of the various embodiments of the invention , the elastically deformable tab in each embodiment is connected to one flap at the above described fold line while the tab is unconnected to the other one of the overlapping flaps in the sense that it is not rigidly connected to such other flap but rather it is capable of freely sliding with respect to such other flap as the flaps are mutually relatively moved between the above described open and closed positions . in particular , in each embodiment , the free outward edge of the tab arranged distally from the fold line interacts or makes contact , in the open position of the flaps , at a contact line of an appropriate surface of the other flap to which the tab is unconnected . this interaction or contact maintains excellent sealing even when the flaps are in their open position , as described previously . however , as the flaps are mutually relatively moved from the open position into the closed position , the tab bends along the fold line resulting in the transformation of the angle formed by the extensions of the tab and of the flap to which the tab is connected , and the free outward edge of the tab is displaced with respect to the contact line as described above in the open position such that the free outward edge is arranged in a new position relative to the respective surface of the flap to which the tab is unconnected . the tab in its bent configuration in the closed position also provides an excellent sealing as described previously . it is apparent that the tab in each of the described embodiments has such a rigidity sufficient so that the free outward edge is kept in essential contact with the contact line of the appropriate surface of the flap to which the tab is unconnected in the open position of the flaps , in order to maintain the described sealing even when the flaps are in their open position . the materials and the dimensions constituting the individual components of the ski boot may naturally be the most pertinent according to the specific requirements . | 0 |
illustrated in fig1 is a perspective schematic diagram of a power plug of a first embodiment of the present invention . as shown in the drawing , the power plug 1 comprises a terminal base 10 having two conductive terminals 100 and a ground terminal 101 ; an electric wire 11 having core wires connected to the conductive terminals 100 and the ground terminal 101 , respectively ; a cover 12 integrally connected to the terminal base 10 by a plurality of first screws 102 ; and a ground mechanism 13 for connecting the first screws 102 to the ground terminal 101 , allowing the first screws 102 to be grounded . fig2 illustrates a perspective dissection diagram of a terminal base with a ground mechanism in the power plug of the first embodiment of the invention ; fig3 illustrates a cross - sectional view of a terminal base with a ground mechanism in the power plug of the first embodiment of the invention . referring to fig1 and 3 , the ground mechanism 13 includes a first conductive member 130 such as a copper plate for connecting the first screws 102 to the ground terminal 101 . one end of the copper plate 130 is associated with the ground terminal 101 , and the other end thereof extends to screw holes 1020 for allowing the first screws 102 to penetrate therethrough . this makes the first screws 102 come into contact with the copper plate 130 when being screwed into the screw holes 1020 . furthermore , two of the first screws 102 are provided in the power plug 1 . the first conductive member 130 is an approximately m - shaped copper plate , wherein a central portion of the copper plate 130 is connected to the ground terminal 101 , and two ends thereof respectively extend to two screw holes 1020 where the first screws 102 can penetrate therethrough , so as to allow the first screws 102 to respectively screwed into the screw holes 1020 and come into contact with the copper plate 130 . moreover , the conductive terminals 100 and the ground terminal 101 of the terminal base 10 are in the form of a female power plug . fig4 illustrates a cross - sectional view of an upper part of a cover in the power plug of the first embodiment of the invention . referring to fig2 and 4 , the power plug 1 further comprises : a wire fixing mechanism 14 installed in the cover 12 , and two second screws 15 . the wire fixing mechanism 14 includes a press board 140 positioned at where the electric wire 11 passes thereby , and a clamping member 141 underneath the press board 140 . the two second screws 15 penetrate through the cover 12 and are screwed at two ends of the press board 140 , respectively . by screwing tight the second screws 15 , the press board 140 can be moved toward an inner wall of the cover 12 , allowing the electric wire 11 to be fixed and abut against the inner wall of the cover 12 , and to be firmly clamped by the clamping member 141 . besides the above first conductive member 130 for allowing the first screws 102 to be grounded , the ground mechanism 13 further includes a second conductive member 131 for interconnecting the two second screws 15 ; and a third conductive member 132 for connecting the first screws 102 to the second conductive member 131 , allowing the second screws 15 to be grounded via the second conductive member 131 and the first screws 102 . the second conductive member 131 is a copper plate , two ends of which copper plate 131 respectively extend to second screw holes 150 for allowing the two second screws 15 to penetrate therethrough . this makes the second screws 15 comes into contact with the copper plate 131 when being screwed into the second screw holes 150 . a central portion of the second conductive member 131 is exposed to one of the first screw holes 1020 used for screwing the first screws 102 therein . the third conductive member 132 is a metallic spring installed in the first screw hole 1020 . when one of the first screws 102 is screwed into the first screw hole 1020 , the metallic spring 132 is pressed , making one end thereof abut against the first screw 102 , and the other end of the metallic spring 132 adjoin the central portion of the second conductive member 131 . fig5 is a perspective dissection diagram showing another example of a terminal base with a ground mechanism in the power plug of the first embodiment of the invention . as shown in the drawing , besides the above - mentioned female power plug , the conductive terminals 100 and the ground terminal 101 of the terminal base 10 can also be in the form of a male power plug . fig6 , 8 and 9 are respectively a top view , a side view , a front view and a back view of a power plug of a second embodiment of the invention ; fig1 is a perspective structural diagram showing an unassembled power plug of the second embodiment of the invention . referring to fig6 to 10 , the power plug 2 of this embodiment comprises : a terminal base 20 having two conductive terminals 200 and a ground terminal 201 ; an electric wire 21 having core wires connected to the conductive terminals 200 and the ground terminal 201 , respectively ; two covers 22 integrally connected to the terminal base 20 , which two covers 22 are capable of being coupled to each other by means of screws 24 , so as to enclose the conductive terminals 200 and the ground terminal 201 therein ; and a ground mechanism 23 for connecting the screws 24 to the ground terminal 201 , so as to ground the screws 24 . furthermore , the ground mechanism 23 includes a conductive member 230 for interconnecting the first screws 24 and the ground terminal 201 . this conductive member 230 is a copper plate attached to an inner wall of one of the covers 22 , wherein one end of the copper plate 230 extends toward the ground terminal 201 , and is pressed to abut against the ground terminal 201 when the two covers 32 are engaged with each other , and the other end of the copper plate 230 extends to screw holes 240 for allowing the screws 24 to penetrate therethrough , whereby the screws 24 are made to come into contact with the copper plate 230 when being screwed into the screw holes 240 . in particular , two of the screws 24 are adopted in this embodiment , and alternatively , the conductive member 230 can be an approximately t - shaped copper plate provided on the inner wall of one of the covers 22 . the vertical end of the t - shaped copper plate 230 extends toward the ground terminal 201 , and is pressed to abut against the ground terminal 201 when the two covers 32 are engaged with each other ; the other two ends of the copper plate 230 extend to the screw holes 240 , allowing the two screws 24 to come into contact with the copper plate 230 when being respectively screwed into the screw holes 240 . illustrated in fig1 and 12 are respectively a top view and a cross - sectional view of a power plug of a third embodiment of the invention . referring to fig1 and 12 , the power plug 3 comprises : a terminal base 30 having a conductive terminal 300 ; an electric wire 31 having core wires connected to the conductive terminal 300 and a ground terminal 330 , respectively ; a cover 32 integrally connected to the terminal base 30 by means of screws 320 ; a ground wire 33 having one end thereof connected to the ground terminal 330 inside the terminal base 30 and the cover 32 ; and a ground mechanism 34 for connecting the screws 320 to the ground terminal 330 of the ground wire 33 , so as to ground the screws 320 . the power plug of the invention is characterized in the provision of a ground mechanism , which can solve a problem of electron ionization occurring in a conventional power plug as previously described , and further allow timbre quality of audio equipment to be effectively improved , whereby sounds generated from the audio equipment are clarified , especially for low bands to be more stable and sound . moreover , in the use of the power plug of the invention , metal - induced interference with power or current passing through inside of the power plug and electric wires can be eliminated , allowing high quality of the clear original sounds to reappear . in conclusion , the invention evidently provides positive and affirmative improvements in elevating and raising sound quality generated by the audio equipment . the invention has been described using exemplary preferred embodiments . however , it is to be understood that the scope of the invention is not limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications and similar arrangements . the scope of the claims , therefore , should be accorded the broadest interpretation so as to encompass all such modifications and similar arrangements . | 7 |
exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings . in the drawings , the thicknesses of layers or regions are exaggerated for illustrative purposes . fig4 is a cross - sectional view schematically illustrating the structure of a fusing device of an electrophotograhpic image forming apparatus according to an embodiment of the present invention , and fig5 is a longitudinal cross - sectional view of the fusing device of fig4 . a fusing device 100 includes a pressing roller 130 which is rotated in a direction of an arrow c , and a heating unit 120 which is installed to be opposite to the pressing roller 130 and fuses the toner image 111 onto the sheet of paper 110 passing between the pressing roller 130 and the heating unit 120 at a fusing nip n formed between the heating unit 120 and the pressing roller 130 . the heating unit 120 includes a fixing portion having both ends fixed and a heating element therein , and a fusing film 121 which is slid on the surface of the fixing portion . the fusing film 121 can comprise polyimide having a thickness of 50 - 1000 μm , and a teflon coating ( not shown ) which is a toner protective layer , can be formed on a surface contacting the toner image 111 . the fixing portion includes a conductive member 122 and an induction heating part . the conductive member 122 includes a linear part 122 a formed on one side thereof in an area corresponding to the fusing nip n and a cylindrical area having a hollow structure . the induction heating part heats the conductive member 122 by induction . the induction heating part includes a core 123 which perforates a hollow of the conductive member 122 , a coil 125 which is wound in an outer circumference of the core 123 and inductively heats the conductive member 122 , and an ac voltage source ( not shown ) which applies a predetermined ac voltage to both ends of the coil 125 . the conductive member 122 comprises conductive metal , such as a carbon steel pipe , a stainless alloy pipe , an aluminum pipe , or iron . a coating layer 122 c which reduces a frictional force against the fusing film 121 , can be formed at a circumference of the conductive member 122 . the coating layer 122 c comprises fluoric resin , such as polytetrafluoroethylene ( ptfe ), tetrafluoroethylene - perfluoroalkylvinylether copolymer ( pfa ), or tetrafluoroethylene - hexafluoropropylene copolymer ( fep ), or silicon resin to a thickness of about 0 . 1 mm . the core 123 forms a closed magnetic circuit . the coil 125 is wound on a portion of the circumference of the core 123 inside a hollow section 122 b of the heating unit 120 , several hundreds or thousands of times , and an insulating layer 124 , for example , mica sheet is wound between the core 123 and the coil 125 . the insulating layer 124 prevents electrical connection between the core 123 and the coil 125 . when an ac voltage is applied from an ac voltage source ( not shown ) to the coil 125 , magnetic flux by which an inductive current is generated along a circumferential direction of the conductive member 122 , is produced . the core 123 can comprise an iron core used in a conventional transformer and has high magnetic permeability . the conductive member 122 is heated by the inductive current . the fusing film 121 is rotated in a direction of an arrow d . the fusing film 121 can be driven and rotated by the pressing roller 130 due to a frictional force between the pressing roller 130 and the fusing film 121 rather than by an additional driving unit . the pressing roller 130 includes an elastic roller 131 which contacts the fusing film 121 and forms the fusing nip n , and a shaft 132 which supports the elastic roller 131 at the center of the elastic roller 131 and is rotated by a driving unit ( not shown ). the shaft 132 is elastically biased toward the opposite heating unit 120 using a spring member 133 . the elastic roller 131 can be formed of heat - resistant silicon rubber . due to rotation of the elastic roller 131 , the fusing film 121 is driven and rotated on the circumference of the conductive member 122 . a thermistor 127 which measures a temperature of the fusing nip n , is installed above the linear portion 122 a of the fusing nip n . the temperature of the fusing nip n is determined by the number of turns of the coil 125 and frequency and voltage from the ac voltage source . meanwhile , a thickness t 1 of an area corresponding to the fusing nip n of the conductive member 122 is different from a thickness t 2 of another area of the conductive member 122 . when an ac of several tens to hundreds of hz is applied from the ac voltage source to the coil 125 , an ac magnetic field is formed in an axial direction around the core 123 and the coil 125 , and an inductive current flows in a circumferential direction of the conductive member 122 . in this case , a skin depth at which the current is generated can be given by equation 1 . here , δ is a skin depth , ω is an angular frequency , μ is magnetic permeability , and σ is an electrical conductive constant . when a thickness ( t 1 of fig4 ) of the fusing nip n of the conductive member 122 is smaller than the skip depth δ , a significant amount of an inductive current flowing in the circumferential direction is generated at the fusing nip n rather than in another area of the conductive member 122 . the current flowing in the circumferential direction flows to a small cross section of the fusing nip n . since resistance at the fusing nip n increases in inverse proportion to the cross section and joule &# 39 ; s heat at the fusing nip n is in proportion to the resistance , the thickness t 1 of the fusing nip n is adjusted so that the temperature of the fusing nip n can be locally increased . when an ac having frequency of several tens or hundreds of hz is used , the skin depth is 2 - 20 mm . thus , the thickness of the fusing nip n is less than the skip depth , and the thicknesses of other areas are greater than the skin depth so that stiffness of the heating unit 120 is maintained . meanwhile , the thickness ti of the fusing nip n can be gradually reduced from the center toward both ends . the thickness of the conductive member 122 at the both ends of the fusing nip n is reduced so that heat loss at the both ends is compensated for and the temperature in the lengthwise direction of a fusing nip area is maintained at a constant level . an operation of the fusing device having the above structure will be described with reference to the accompanying drawings . first , when an ac having a frequency of several tens or hundreds of hz is applied from an ac voltage source ( not shown ) to the coil 125 , ac magnetic flux is generated in the core 123 wound by the coil 125 . due to the magnetic flux , an inductive current is generated in a circumferential direction of the conductive member 122 which is an adjacent conductor , and joule &# 39 ; s heat is generated by the inductive current . in this case , the thickness of the conductive member 122 of the fusing nip n is less than a skin depth and the fusing nip n having a thickness smaller than the thickness t 2 of other areas is locally and further heated and is rapidly heated to a temperature appropriate for a fusing operation , for example , 150 - 200 ° c . in addition , since the thickness of both ends of the fusing nip n is smaller than the thickness of the center of the fusing nip n , both ends of a heating unit 120 is further heated , and the temperature at both ends of the heating unit 120 is prevented from being lowered . when a sheet of paper 110 on which toner 111 which has not yet been fused is fed into the fusing device maintained at a predetermined fusing temperature , the sheet of paper 110 enters between the heating unit 120 and a pressing roller 130 , the unfused toner 111 is heated at the fusing nip n and is melted , pressed by the pressing roller 130 , and is fused onto the sheet of paper 110 . a surface temperature of the fusing nip n of the conductive member 122 can be adjusted using a thermistor 127 by controlling the ac voltage and the frequency applied to the coil 125 . according to another embodiment of the present invention , the thickness of the conductive member 122 of the fusing nip n is maintained at a constant level , and the width of the conductive member 122 is gradually increased from the center toward both ends so that heat loss at both ends of the fusing device can be compensated for . according to another embodiment of the present invention , the number of turns of the coil 125 is gradually increased from the center toward both ends so that the temperature at both ends of the fusing device can be prevented from being lowered . as described above , in the fusing device of the image forming apparatus according to an embodiment of the present invention , the thickness of a conductive member at a fusing nip is less than a skin depth and is locally heated such that heat loss in other areas can be reduced . in addition , the thickness and width of a conductive layer in an area corresponding to the fusing nip are adjusted to compensate for heat loss at both ends of the fusing device such that temperatures in a lengthwise direction of the fusing device are maintained at a constant level and an image quality is improved . while this invention has been particularly shown and described with reference to certain embodiments thereof , it should be understood by those skilled in the art that various changes in form and details can be made therein without departing from the spirit and scope of the invention as defined by the appended claims . | 6 |
fig1 is a schematic drawing of a dental handset constructed according the principles of the present invention . the handset , generally denoted by numeral 10 , is designed to accommodate one or two tools , such as dental instruments 20 . handset 10 comprises an ergonomically designed elongated body comprising gripping zones 30 on one or two ends thereof , and elevated portions 40 facing each of said gripping zones . each elevated portion 40 is designed to accommodate the ridge between the thumb and the forefinger when the user is applying the opposite - side tool , as depicted in fig4 . fig2 is a side - view of the handset 10 , viewed with only one inserted instrument , depicting the tapered shape of gripping zones 30 . the angle created between the two tangents t 1 and t 2 to the gripping zone 30 , prevents the hand from slipping backwards while force is being applied to the tool . fig3 is a front - view of the handset 10 , depicting tool - insertion area 50 and the three finger - rests 45 , designed to accommodate the thumb , the forefinger and the index respectively , as depicted in fig5 . the triangular profile created by the three finger - rests 45 may be isosceles or equilateral , having concave or convex side , depending on the application . the four resting zones — finger rests 45 and elevated portion 40 — have the effect of dividing the stress between them when force is applied to the tool . in a preferred embodiment of the present invention , handset 10 may be constructed of a rigid plastic material , with finger rests 45 made of an elastomer having a high friction coefficient and a low shore value . alternatively , handset 10 maybe constructed entirely from rigid plastic material . in this case , friction - enhancing patterns such as bulges may be added to the finger rests 45 to avoid slippage of the fingers . the materials should be resistant to disinfecting products . handset 10 may be rotationally asymmetry or symmetric , when rotated around its longitudinal axis or around its center . the tools to be held by the handset of the present invention , such as tooth - cleaning instruments , may be removably inserted into the one or two tool - insertion areas 50 in any manner known in the art , such as snapping , screwing , etc . alternatively , non - replaceable instruments may be created by molding the handset of the present invention around the original one or two tools . fig6 depicts another embodiment of the present invention , in which a pivot axis 55 connects the two opposite tips of handset 10 , to enable relative rotation between them . the relative rotation enables using the rotated tool at different angles , without the need to change the gripping position of the handset . in an additional embodiment of the present invention , as depicted in fig7 , a saddle - like component 60 is attached to handset 10 at the middle thereof . saddle 60 is designed to be “ worn ” around the ridge of the human palm , connecting the thumb and the forefinger , as depicted in fig8 and 9 . saddle 60 comprises an outer bent plastic surface 65 , cushioned from within with soft , elastic material 70 ( fig1 ) for easy adaptation to various hand shapes and sizes and having a suitable friction coefficient so as to attach to the hand without applying undue pressure . the cushioned part 70 is preferably produced of thermoplastic elastomers such as eva , engulfing air - cushions or gel filling . the cushioned part 70 may alternatively be made entirely of gel , such as silicone , or of a sponge material such as for example foamed pe . the two opposite parts of the handset 10 are preferably not aligned horizontally , but rather define an angle between them , to create an optimal working angle , as may be seen in fig8 and 9 . when working , the entire stresses on the hand are transferred to the saddle - mounted area , where they are “ spread ” over a larger and massive area with good support , to absorb the tension . this creates an effective counter - mass to facilitate the operation . another advantage of the “ saddle configuration is that it enables minimal relative movement between the hand , wrist and arm . the main muscles used are those of the arm , thus avoiding / minimizing movements and stresses on the muscles of the fingers and palm . in a preferred embodiment of the present invention , the “ saddle ” 60 is rotatably connected to the body of handset 10 , using any manner known in the art 80 , to allow a 360 ° rotation of the handset above the saddle . in a preferred embodiment the connection 80 is implemented by a spiral thread that enables elevation of the handset while rotating , to overcome obstacles such as the hand bones . the rotation is designed to facilitate tool change while maintaining the same hand position . additionally , an intermediate stage may be defined , wherein the handset is rotated to a position in which the hand is free to perform other operations without the need to lay the tool down . a retaining arrangement , such as a snap , preferably holds the handset in the intermediate stage . in a preferred embodiment , the saddle may be detached from the handset , thus facilitating the choice of materials for the saddle , as e . g . disinfection may be done without the saddle . the saddle 60 of the present invention may also be used with “ standard ” tools , not having the tapered ends , to reduce the pressure applied to the fingers , as shown in fig8 and 9 . it is appreciated that certain features of the invention , which are , for clarity , described in the context of separate embodiments , may also be provided in combination in a single embodiment . conversely , various features of the invention , which are , for brevity , described in the context of a single embodiment , may also be provided separately or in any suitable subcombination . unless otherwise defined , all technical and scientific terms used herein have the same meanings as are commonly understood by one of ordinary skill in the art to which this invention belongs . although methods similar or equivalent to those described herein can be used in the practice or testing of the present invention , suitable methods are described herein . it will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove . rather the scope of the present invention is defined by the appended claims and includes both combinations and subcombinations of the various features described hereinabove as well as variations and modifications thereof , which would occur to persons skilled in the art upon reading the foregoing description . | 0 |
a first embodiment of the present invention will be explained using fig1 and 5 . a gas dynamic pressure bearing system 9 shown in fig1 includes a stationary part 1 and a rotary part 2 . the radial bearing 3 and the thrust bearing 4 rotatably supports the rotary part 2 such that the rotary part 2 can rotate with respect to the stationary part 1 . the stationary part 1 comprises a shaft 14 and two thrust plates 15 separated away from each other in an axial direction of the shaft 14 . a surface of each the thrust plate 15 radially spreads , constituting a flat surface of the stationary part , and a thrust bearing surface 13 is formed thereon . the shaft 14 comprises an inner shaft 14 a and an outer shaft 14 b which is fitted over the inner shaft 14 a . by mounting the outer shaft 14 b , the shaft is formed with a columnar enlarged portion . an outer peripheral surface of the enlarged portion is a radial bearing surface 11 . a lower surface of the thrust plate 15 is the thrust bearing surface 13 . the rotary part 2 includes a sleeve 24 and a hub 62 which is fitted over the sleeve 24 . the sleeve 24 is a hollow cylindrical shape having a hole which penetrates the sleeve 24 in an axial direction thereof . an inner peripheral surface of the sleeve 24 is a radial bearing surface 21 . an axial end surface of the sleeve spreads in its radial direction , constituting a flat surface of the rotary part , and a thrust bearing surface 23 is formed thereon . the radial bearing surface 11 of the stationary part 1 and the radial bearing surface 21 of the sleeve are opposed to each other through a micro - gap . the micro - gap is filled with gas . on the radial bearing surface on the side of the stationary part , radial dynamic - pressure - generating groove rows are formed . in each row , a plurality of dynamic - pressure - generating grooves is arranged on the bearing surface in a circumferential direction . in the case of the structure shown in fig1 two radial dynamic - pressure - generating groove rows 32 and 32 are formed apart in the axial direction . each groove row constitutes the radial bearing , and two radial bearings support the rotary part 2 . the thrust bearing surface 13 of the stationary part 1 and the thrust bearing surface 23 of the rotary part 2 are opposed to each other through a micro - gap ( fig2 ). the micro - gap is filled with gas . on the thrust bearing surface 13 of the stationary part 1 , a thrust dynamic - pressure - generating groove row 42 is formed . in the groove row , a plurality of dynamic - pressure - generating grooves is arranged on the bearing surface in the circumferential direction , thereby constituting the thrust bearing . in fig2 inclination of double lines 32 b or 42 b to bearing surface beside means that the dynamic - pressure - generating groove row generate a gas pressure difference on the bearing surface , and the gas pressure is increased at the separated end of the double line from the bearing surface comparing to the near end . that is , in fig2 the thrust dynamic - pressure - generating groove row 42 functions to increase the pressure of gas toward a annular micro - gap portion 102 between a gap of the radial bearing and a gap of the thrust bearing . similarly , the radial dynamic - pressure - generating groove row 32 ( not shown in fig2 ) functions to increase the pressure toward the annular micro - gap portion 102 . here , the gap of the radial bearing and the gap of the thrust bearing are connected to each other over the entire periphery of the bearing , and the annular micro - gap portion 102 is also annularly formed . gas filled in the micro - gaps can flow through the annular micro - gap portion . at the time of rated rotation , the radial dynamic - pressure - generating groove row generates higher pressure difference than that generated by the thrust dynamic - pressure - generating groove row . so the gas filled in the micro - gap of the bearing tends to move toward the thrust bearing from the radial bearing . however , if this trend remains as it is , gas is lost from a region sandwiched between the two radial dynamic - pressure - generating groove rows 32 and 32 , and there is an adverse possibility that the gas dynamic pressure bearing system operates abnormally . therefore , the rotary part is formed with a communication passage 53 . that is , the radial bearing supplies , through the communication passage 53 , the gas deficiency on its side where the pressure of the bearing gap is lowered . at the time of rated rotation , gas which was lost from a space between the radial dynamic - pressure - generating groove rows is supplemented by gas flowing through the communication passages 53 b , 53 c and 53 a . this communication passage 53 is connected , through a peripheral space , to a side of the thrust bearing where a pressure of the bearing gap is lowered . when the bearing system starts rotating and stops rotating , a pressure difference which is generated by the thrust dynamic - pressure - generating groove row 42 becomes relatively higher than that generated by the radial dynamic - pressure - generating groove row 32 . therefore , the airflow passing through the communication passage 53 reversed . dust generated when the bearing surface comes into direct contact is mainly generated on the side of the thrust bearing . if the particle enters the radial bearing , the bearing surface is damaged and affected seriously . this is because that the micro - gap between the bearing surfaces of the radial bearing is smaller than that of the thrust bearing . at the time of rated rotation , the gas in the bearing flows from the radial bearing to the thrust bearing , and a centrifugal force is also applied . therefore , the possibility that the particle generated in the thrust bearing enters the radial bearing is small . when the bearing system starts rotating and stops rotating , since gas may flow from the thrust bearing to the radial bearing in some cases , it is necessary to catch the particles and to reduce the invasion of particles to the radial bearing . the particle catching hole 100 is provided for this purpose . fig5 is a plan view of the thrust plate 15 . fig5 shows the thrust dynamic - pressure - generating groove row 42 and the particle catching holes 100 formed by extending their grooves . in fig5 however , the particle catching hole 100 is a groove and is not a hole . since the thrust plate 15 is mounted on an end surface of the outer shaft 14 b in the axial direction thereof , the opening of the groove structure 100 in fig5 is closed by the outer shaft end surface and becomes the particle catching hole 100 . since each the particle catching hole 100 opens adjacent an end 101 of the thrust dynamic - pressure - generating groove , particles in the thrust bearing is efficiently introduced into the hole and caught . since the bearing on the side of the stationary part 1 is always formed with the particle catching hole , a centrifugal force caused by rotation is not applied to the caught particles , and the returning of particles into the bearing is very rare . according to the gas dynamic pressure bearing system shown in fig1 particles in the thrust bearing is effectively prevented from entering the radial bearing , lifetime of the bearing system is increased and the reliability is enhanced . since the particles are trapped , the possibility that the particles are discharged outside of the bearing system is reduced . a modification of the first embodiment will be explained using fig3 and 6 . in fig3 the particle catching hole is formed in an end of the outer shaft 14 b instead of the thrust plate 15 . fig6 is a plan view of the particle catching hole . in this example also , the particle catching hole 100 b is a groove before the thrust plate 15 is mounted on the outer shaft end . an opening of the groove is closed with the thrust plate 15 , and the opening becomes the particle catching hole 100 b . according to the structure shown in fig3 the end 101 b of the thrust dynamic - pressure - generating groove row 42 is slightly extended toward the outer shaft 14 b , and partially superposed with the particle catching hole 100 b . with this configuration , particles in the thrust dynamic - pressure - generating groove are efficiently introduced into the particle catching hole . among the dynamic - pressure - generating grooves which constitute the thrust dynamic - pressure - generating groove row 42 , if only the dynamic - pressure - generating groove which is superposed with the particle catching hole 100 b is extended , this effect can be obtained . it is not always necessary to extend the end of the dynamic - pressure - generating groove 42 , and the end may not be superposed with the particle catching hole 100 b as shown in fig4 . only if the opening of the particle catching hole and the end 101 c of the thrust dynamic - pressure - generating groove row are opposed to each other , the effect for catching particles can be obtained . among the dynamic - pressure - generating grooves which constitute the thrust dynamic - pressure - generating groove row 42 , if only the dynamic - pressure - generating groove which is superposed with the particle catching hole 100 c is opposed to the opening of the particle catching hole 100 b , this effect can be obtained . a second embodiment of the invention will be explained using fig7 . [ 0051 ] fig7 is a sectional view of a spindle motor 64 having a gas dynamic pressure bearing system 9 of the invention . the gas dynamic pressure bearing system 9 includes radial dynamic - pressure - generating groove rows 32 and 32 , and two radial bearings which are separated from each other in an extension direction of the shaft . the gas dynamic pressure bearing system 9 also includes thrust dynamic - pressure - generating groove rows 42 and 42 provided on two opposed thrust plates , and includes two thrust bearings which generate supporting forces in opposite directions . the double lines shown on the sleeve have the same meaning as those shown in fig2 . the dynamic - pressure - generating groove on the thrust bearing increases a pressure of air which lubricates the bearing surface toward the radial bearing . the dynamic - pressure - generating groove on the radial bearing increases a pressure of air which lubricates the bearing surface toward the thrust bearing . a difference in pressure of air between the two radial bearings and air outside the thrust bearing generated by effect of the thrust and radial dynamic - pressure - generating grooves is overcome by providing the communication passage 53 . one end 53 a of the communication passage 53 is opened between the two radial bearings , and this point is the same as that of the gas dynamic pressure bearing shown in fig1 . on the other hand , the other ends 53 b , 53 b of the communication passage 53 are opened at upper and lower sides of the thrust plate . the communication passage 53 is formed in an inner shaft . this configuration facilitates the working of the communication passage . this is because that since the inner shaft 14 a has no portion that comes into direct slide , the communication passage can be made of normal metal material . on the other hand , the bearing surfaces of the outer shaft , the thrust plate and the sleeve must be made of ceramic having excellent wear resistance and high hardness . according to the structure of the communication passage shown in fig7 since the centrifugal force is applied to particles generated in the thrust bearing , it is rare that a particles reaches the opening 53 b of the communication passage . it is rare that the inside of the communication passage is contaminated by particles . when a force is applied to the particles in the thrust bearing toward the radial bearing , the particles are caught by the particle catching holes which are continuously provided in the dynamic - pressure - generating groove 42 , and the particles are prevented from entering the radial bearing . in the spindle motor 64 having the gas dynamic pressure bearing system , a recording disk 932 is placed on a hub 62 fitted over the sleeve 24 . the shaft 14 is fixed to a base 63 , and a stator 60 is mounted on the base . rotor magnets 61 are arranged annularly on a lower portion of the hub 62 . magnetic poles of the magnets are opposed to the stator . according to the spindle motor having the above - described structure , particles generated in the bearing are not discharged out from the bearing , and will soon be caught by the particles catching hole 100 . therefore , the reliability as a bearing system is high and the spindle motor does not discharge particles . thus , this spindle motor is especially suitable for a hard disk drive which is required to rotate at high speed . a third embodiment of the invention is shown in fig8 . [ 0059 ] fig8 shows a data storage disk drive 910 having a spindle motor of this invention . in a housing 911 of the data storage disk drive 910 , a recording disk 932 is mounted on the spindle motor 9 , and a magnetic head 916 supported by a swing arm 915 is opposed to a surface of the disk 932 at a small distance ( micro - gap ). when a particle enters the micro - gap , the particle injures the recording disk surface and the magnetic head , and reading and writing errors of information are caused . therefore , particles should not exist in the housing 911 . when the spindle motor of the invention is used for the data storage disk drive , since it is difficult to discharge particles into the housing 911 , the spindle motor can rotate at high speed , and the reliability of the data storage disk drive can be secured . a fourth embodiment of the invention is shown in fig9 . [ 0063 ] fig9 shows a polygon scanner 940 having a spindle motor 64 of the invention . in the spindle motor 64 , a polygon mirror 960 is mounted on a hub 62 , and the spindle motor rotates at high speed . the spindle motor 64 and the mirror 960 are accommodated in a housing 950 , and the spindle motor 64 and the mirror 960 reflect light entering from a beam - permeable slit 952 of a side surface of a cover 950 . the slit 952 is covered with a clear glass cover 953 . the spindle motor 64 includes the gas dynamic pressure bearing system 9 of the invention , and the spindle motor has high bearing rigidity but has few troubles caused by generation of particles in the bearing system . the particle catching hole 100 is provided continuously with the thrust dynamic - pressure - generating groove row 42 and particles are trapped in the groove row . therefore , particles enter the radial bearing surface and the bearing surface is not damaged . the present invention is not limited to the above - explained embodiments . for example , although the dynamic - pressure - generating groove is illustrated on only one surface constituting the dynamic pressure gas bearing system in the drawings , the groove may be provided on the other surface which constitutes the dynamic pressure gas bearing system or may be provided on both the surfaces . shapes of the dynamic - pressure - generating grooves are illustrated in the drawings corresponding to respective embodiments , but other shapes may be employed , and the same effect of the invention can be obtained . as shown in fig2 and 7 , each the dynamic - pressure - generating groove enhances a pressure of air which lubricates the bearing in a direction specified in the specification . although air is used as the gas which lubricates the bearing , gas other than air may be used only if the gas is noncorrosive gas . although the number of particle catching holes illustrated in fig5 and 6 is four , the number is not limited to four . the number of the holes may be the same as the number of grooves in the thrust dynamic - pressure - generating groove row , or two particle catching holes may be formed for an opening of one thrust dynamic - pressure - generating groove . even if the number of particle catching holes exceeds four , this does not depart from the scope of the invention . the term “ gap ” in this specification will be explained . the gap in the specification means a gap between bearing surfaces in a state in which a gas dynamic pressure bearing system or a spindle motor rotates , a supporting force is generated by a thrust bearing and a radial bearing , and the bearing surfaces maintain the non - contact state . therefore , when a product is checked when it is stopped , a gap can not be seen between the thrust bearing surfaces in some cases . even in such a case , the bearing system has play so that a shaft body or a sleeve can float . because this play exists , the bearing can rotate , and the gap is held between the bearing surfaces in a state where a sufficient supporting force is generated . even when no gap can be visually seen when the bearing stopped , if the bearing is seen at the molecular level , the bearing surfaces are in contact at extremely small portions . from this viewpoint , it can be considered that the gap spreads over substantially the entire regions of the opposed surfaces of the bearing . | 5 |
the practice of the embodiments described herein employs , unless otherwise indicated , conventional molecular biological techniques within the skill of the art . such techniques are well known to the skilled worker , and are explained fully in the literature . see , e . g ., ausubel , et al ., ed ., current protocols in molecular biology , john wiley & amp ; sons , inc ., ny , n . y . ( 1987 - 2008 ), including all supplements ; sambrook , et al ., molecular cloning : a laboratory manual , 2nd edition , cold spring harbor , n . y . ( 1989 ). unless defined otherwise , all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art . the specification also provides definitions of terms to help interpret the disclosure and claims of this application . in the event a definition is not consistent with definitions elsewhere , the definition set forth in this application will control . as used herein , the term “ cells ” can refer to prokaryotic or eukaryotic cells . in one embodiment , the term “ cells ” can refer to microorganisms such as bacteria including , but not limited to gram positive bacteria , gram negative bacteria , acid - fast bacteria and the like . in certain embodiments , the “ cells ” to be tested may be collected using swab sampling of surfaces . in other embodiments , the “ cells ” can refer to pathogenic organisms . as used herein , gram positive bacteria include , but are not limited to , actinomedurae , actinomyces israelii , bacillus anthracis , bacillus cereus , clostridium botulinum , clostridium difficile , clostridium perfringens , clostridium tetani , corynebacterium , enterococcus faecalis , listeria monocytogenes , nocardia , propionibacterium acnes , staphylococcus aureus , staphylococcus epiderm , streptococcus mutans , streptococcus pneumoniae and the like . as used herein , gram negative bacteria including , but are not limited to , afipia fielis , bacteriodes , bartonella bacilliformis , bortadella pertussis , borrelia burgdorferi , borrelia recurrentis , brucella , calymmatobacterium granulomatis , campylobacter , escherichia coli , francisella tularensis , gardnerella vaginalis , haemophilius aegyptius , haemophilius ducreyi , haemophilius influenziae , heliobacter pylori , legionella pneumophila , leptospira interrogans , neisseria meningitidia , porphyromonas gingivalis , providencia sturti , pseudomonas aeruginosa , salmonella enteridis , salmonella typhi , serratia marcescens , shigella boydii , streptobacillus moniliformis , streptococcus pyogenes , treponema pallidum , vibrio cholerae , yersinia enterocolitica , yersinia pestis and the like . as used herein , acid - fast bacteria include , but are not limited to , myobacterium avium , myobacterium leprae , myobacterium tuberculosis and the like . in other embodiments , the “ cells ” can refer to other bacteria not falling into the other three categories including , but are not limited to , bartonella henselae , chlamydia psittaci , chlamydia trachomatis , coxiella burnetii , mycoplasma pneumoniae , rickettsia akari , rickettsia prowazekii , rickettsia rickettsii , rickettsia tsutsugamushi , rickettsia typhi , ureaplasma urealyticum , diplococcus pneumoniae , ehrlichia chafensis , enterococcus faecium , meningococci and the like . in yet other embodiment , the term “ cells ” can refer to fungi including , but are not limited to , aspergilli , candidae , candida albicans , coccidioides immitis , cryptococci , and combinations thereof . in another embodiment , the term “ cells ” can refer to parasitic microbes including , but are not limited to , balantidium coli , cryptosporidium parvum , cyclospora cayatanensis , encephalitozoa , entamoeba histolytica , enterocytozoon bieneusi , giardia lamblia , leishmaniae , plasmodii , toxoplasma gondii , trypanosomae , trapezoidal amoeba and the like . in another embodiment , the term “ cells ” can refer to parasites including worms ( e . g ., helminthes ), particularly parasitic worms including , but not limited to , nematoda ( roundworms , e . g ., whipworms , hookworms , pinworms , ascarids , filarids and the like ), cestoda ( e . g ., tapeworms ) and the like . as used herein , “ zwitterionic detergent ” refers to detergents exhibiting zwitterionic character ( e . g ., does not possess a net charge , lacks conductivity and electrophoretic mobility , does not bind ion - exchange resins , breaks protein - protein interactions ), including , but not limited to , chaps , chapso and betaine derivatives , e . g . preferably sulfobetaines sold under the brand names zwittergent ® ( calbiochem , san diego , calif .) and anzergent ® anatrace , inc . ; maumee , ohio ). examplary zwitterionic detergents for use in practicing the invention include those sold under the brand names zwittergent ® and anzergent ® having the chemical names of : n - tetradecyl - n , n - dimethyl - 3 - ammonio - 1 - propanesulfonate , n - octyl - n , n - dimethyl - 3 - amraonio - 1 - propanesulfonate , n - decyl - n , n - dimethyl - 3 - ammonio - 1 - propanesulfonate , and n - dodecyl - n , n - dimethyl - 3 - ammonio - 1 - propanesulfonate . exemplary detergents of the present invention can be purchased under the brand names , for example , of : anzergent 3 - 14 , analytical grade ; anzergent 3 - 8 , analytical grade ; anzergent 3 - 10 , analytical grade ; anzergent 3 - 12 , analytical grade , respectively or zwittergent 3 - 8 , zwittergent 3 - 10 , zwittergent 3 - 12 and zwittergent 3 - 14 , chaps , chapso , apolo and apol2 . in one embodiment , the zwitterionic detergent is chaps ( cas number : 75621 - 03 - 3 ; available from sigma - aldrich product no . c3023 - 1g ), an abbreviation for 3 -[( 3 - cholamidopropyl ) dimethylammonio ]- 1 - propanesulfonate ( described in further detail in u . s . pat . no . 4 , 372 , 888 ) having the structure : in a further embodiment , chaps is present at a concentration of about 0 . 125 % to about 2 % weight / volume ( w / v ) of the total composition . in a further embodiment , chaps is present at a concentration of about 0 . 25 % to about 1 % w / v of the total composition . in yet another embodiment , chaps is present at a concentration of about 0 . 4 % to about 0 . 7 % w / v of the total composition . in another embodiment , the zwitterionic detergent is chapso ( cas number : 82473 - 24 - 3 ; available from fluka , product number 26675 ), an abbreviation for 3 -[( 3 - cholamidopropyl ) dimethylammonio ]- 2 - hydroxy - 1 - propanesulfonate and having the structure : in a further embodiment , chapso is present at a concentration of about 0 . 125 % to about 2 % w / v of the total composition . in a further embodiment , chapso is present at a concentration of about 0 . 25 % to about 1 % w / v of the total composition . in yet another embodiment , chapso is present at a concentration of about 0 . 4 % to about 0 . 7 % w / v of the total composition . as used herein , the term “ buffer ” refers to a composition that can effectively maintain the ph value between 6 and 9 , with a pk a at 25 ° c . of about 6 to about 9 . the buffer described herein is generally a physiologically compatible buffer that is compatible with the function of enzyme activities and enables biological macromolecules to retain their normal physiological and biochemical functions . examples of buffers include , but are not limited to , hepes (( 4 -( 2 - hydroxyethyl )- 1 - piperazineethanesulfonic acid ), mops ( 3 -( n - morpholino )- propanesulfonic acid ), n - tris ( hydroxymethyl ) methylglycine acid ( tricine ), tris ( hydroxymethyl ) methylamine acid ( tris ), piperazine - n , n ′- bis ( 2 - ethanesulfonic acid ) ( pipes ) and acetate or phosphate containing buffers ( k 2 hpo 4 , kh 2 po 4 , na 2 hpo 4 , nah 2 po 4 ) and the like . the term “ azide ” as used herein is represented by the formula — n 3 . in one embodiment , the azide is sodium azide nan 3 ( cas number 26628 - 22 - 8 ; available from sigma - aldrich product number : s2002 - 25g ) that acts as a general bacterioside . the term “ protease ,” as used herein , is an enzyme that hydrolyses peptide bonds ( has protease activity ). proteases are also called , e . g ., peptidases , proteinases , peptide hydrolases , or proteolytic enzymes . the proteases for use according to the invention can be of the endo - type that act internally in polypeptide chains ( endopeptidases ). in one embodiment , the protease can be the serine protease , proteinase k ( ec 3 . 4 . 21 . 64 ; available from roche applied sciences , recombinant proteinase k 50 u / ml ( from pichia pastoris ) cat . no . 03 115 887 001 ). proteinase k is used to digest protein and remove contamination from preparations of nucleic acid . addition of proteinase k to nucleic acid preparations rapidly inactivates nucleases that might otherwise degrade the dna or rna during purification . it is highly - suited to this application since the enzyme is active in the presence of chemicals that denature proteins and it can be inactivated at temperatures of about 95 ° c . for about 10 minutes . in one embodiment , lysis of gram positive and gram negative bacteria , such as listeria , salmonella , and e . coli requires the lysis reagent include proteinase k ( 1 mg / ml ). protein in the cell lysate is digested by proteinase k for 15 minutes at 55 ° c . followed by inactivation of the proteinase k at 95 ° c . for 10 minutes . after cooling , the substantially protein free lysate is compatible with high efficiency pcr amplification . in addition to or in lieu of proteinase k , the lysis reagent can comprise a serine protease such as trypsin , chymotrypsin , elastase , subtilisin , streptogrisin , thermitase , aqualysin , plasmin , cucumisin , or carboxypeptidase a , d , c , or y . in addition to a serine protease , the lysis solution can comprise a cysteine protease such as papain , calpain , or clostripain ; an acid protease such as pepsin , chymosin , or cathepsin ; or a metalloprotease such as pronase , thermolysin , collagenase , dispase , an aminopeptidase or carboxypeptidase a , b , e / h , m , t , or u . proteinase k is stable over a wide ph range ( ph 4 . 0 - 10 . 0 ) and is stable in buffers with zwitterionic detergents . the term “ lysate ” as used herein , refers to a liquid phase with lysed cell debris and nucleic acids . as used herein , the term “ substantially protein free ” refers to a lysate where most proteins are inactivated by proteolytic cleavage by a protease . protease may include proteinase k . addition of proteinase k during cell lysis rapidly inactivates nucleases that might otherwise degrade the target nucelic acids . the “ substantially protein free ” lysate may be or may not be subjected to a treatment to remove inactivated proteins . as used herein , the phrase “ does not inhibit said amplifying polymerase and rnase h enzymatic activities ” means the presence of the lysis reagent decreases the amplifying polymerase and rnase h enzymatic activities by 0 % or by less than about 1 % or by less than about 2 % or by less than about 5 % or by less than about 10 % or by less than about 25 % as compared to the amplifying polymerase and rnase h enzymatic activities in the absence of the lysis reagent . as used herein , the term “ nucleic acid ” refers to an oligonucleotide or polynucleotide , wherein said oligonucleotide or polynucleotide may be modified or may comprise modified bases . oligonucleotides are single - stranded polymers of nucleotides comprising from 2 to 60 nucleotides . polynucleotides are polymers of nucleotides comprising two or more nucleotides . polynucleotides may be either double - stranded dnas , including annealed oligonucleotides wherein the second strand is an oligonucleotide with the reverse complement sequence of the first oligonucleotide , single - stranded nucleic acid polymers comprising deoxythymidine , single - stranded rnas , double stranded rnas or rna / dna heteroduplexes . nucleic acids include , but are not limited to , genomic dna , cdna , hnrna , snrna , mrna , rrna , trna , fragmented nucleic acid , nucleic acid obtained from subcellular organelles such as mitochondria or chloroplasts , and nucleic acid obtained from microorganisms or dna or rna viruses that may be present on or in a biological sample . nucleic acids may be composed of a single type of sugar moiety , e . g ., as in the case of rna and dna , or mixtures of different sugar moieties , e . g ., as in the case of rna / dna chimeras . as used herein , the term “ label ” or “ detectable label ” can refer to any chemical moiety attached to a nucleotide , nucleotide polymer , or nucleic acid binding factor , wherein the attachment may be covalent or non - covalent . preferably , the label is detectable and renders said nucleotide or nucleotide polymer detectable to the practitioner of the invention . detectable labels include luminescent molecules , chemiluminescent molecules , fluorochromes , fluorescent quenching agents , colored molecules , radioisotopes or scintillants . detectable labels also include any useful linker molecule ( such as biotin , avidin , streptavidin , hrp ( horseradish peroxidase ), protein a , protein g , antibodies or fragments thereof , grb2 , polyhistidine , ni 2 + , flag tags , myc tags ), heavy metals , enzymes ( examples include alkaline phosphatase , peroxidase and luciferase ), electron donors / acceptors , acridinium esters , dyes and calorimetric substrates . it is also envisioned that a change in mass may be considered a detectable label , as is the case of surface plasmon resonance detection . the skilled artisan would readily recognize useful detectable labels that are not mentioned above , which may be employed in the operation of the present invention . solely , for illustrative purposes , the method of using the lysis reagent for nucleic acid template preparation is disclosed below in the context of catacleave pcr or rt - pcr detection of the bacterial pathogen , salmonella . catacleave pcr will be explained hereinafter . as used herein , the term “ target ” nucleic acid sequence refers to a nucleic acid sequence or structure to be detected or characterized . exemplary target nucleic acid sequences include , but are not limited to , genomic dna or genomic rna . in one embodiment , a “ target ” nucleic acid sequence can serve as a template for amplification in a pcr reaction or reverse transcription pcr reaction . in one embodiment , the “ target ” nucleic acid sequence can refer to a nucleic acid sequence present in the nucleic acid of an organism or a sequence complementary thereto , which is not present in the nucleic acids of other species . in one embodiment , a salmonella nucleic acid sequence targeted for dna amplification is first selected from salmonella nucleic sequences known in the art . as used herein , the term “ salmonella target sequence ” refers to a dna or rna sequence comprising the nucleic acid sequence of a bacterium of the genus salmonella . it includes but is not limited to , species s . enterica and s . bongori that include , but are not limited to , the subspecies : enterica ( i ), salamae ( ii ), arizonae ( iiia ), diarizonae ( iiib ), houtenae ( iv ), and indica ( vi ). exemplary serogroups and serovars of the subspecies salmonella enterica can be found in the u . s . pat . no . 7 , 659 , 381 , which is incorporated herein by reference in its entirety . exemplary salmonella nucleic acid sequences that may be targeted for amplification according to the present invention are taught by the following publications : liu w q et al ., “ salmonella paratyphi c : genetic divergence from salmonella choleraesuis and pathogenic convergence with salmonella typhi ”, plos one , 2009 ; 4 ( 2 ): e4510 ; thomson n r et al ., “ comparative genome analysis of salmonella enteritidis pt4 and salmonella gallinarum 287 / 91 provides insights into evolutionary and host adaptation pathways ,” genome res , october 2008 ; 18 ( 10 ): 1624 - 37 ; encheva v et al ., “ proteome analysis of serovars typhimurium and pullorum of salmonella enterica subspecies i .”, bmc microbiol , jul . 18 , 2005 ; 5 : 42 ; mcclelland m et al ., “ comparison of genome degradation in paratyphi a and typhi , human - restricted serovars of salmonella enterica that cause typhoid ”, nat genet , december 2004 ; 36 ( 12 ): 1268 - 74 ; chiu c h et al ., “ salmonella enterica serotype choleraesuis : epidemiology , pathogenesis , clinical disease , and treatment ,” clin microbiol rev , april 2004 ; 17 ( 2 ): 311 - 22 ; deng w et al ., “ comparative genomics of salmonella enterica serovar typhi strains ty2 and ct18 ,” j bacteriol , april 2003 ; 185 ( 7 ): 2330 - 7 ; parkhill j et al ., “ complete genome sequence of a multiple drug resistant salmonella enterica serovar typhi ct18 .”, nature , oct . 25 , 2001 ; 413 ( 6858 ): 848 - 52 ; mcclelland m et al ., “ complete genome sequence of salmonella enterica serovar typhimurium lt2 ,” nature , oct . 25 , 2001 ; 413 ( 6858 ): 852 - 6 , of which contents are incorporated herein by reference . an exemplary nucleotide sequence of the complete 4857432 by genome of salmonella enterica subsp . enterica serovar typhimurium str . lt2 is available under genbank accession no . nc — 003197 . in one embodiment , the amplification probe , having the sequence of seq id no : 3 , anneals to the target salmonella inva nucleic acid sequence . in another embodiment , the target nucleic acid sequence is a region found within the salmonella - specific inva gene nucleic acid sequence having the following dna sequence : as used herein , the term “ primer ” or “ amplification primer ” refers to an oligonucleotide that acts as a point of initiation of dna synthesis in a pcr reaction . a primer is usually about 15 to about 35 nucleotides in length and hybridizes to a region complementary to the target sequence . oligonucleotides may be synthesized and prepared by any suitable methods ( such as chemical synthesis ), which are known in the art . oligonucleotides may also be conveniently obtained through commercial sources . a person of ordinary skill in the art would easily optimize and identify primers . a number of computer programs ( e . g ., primer - express ) are readily available to design optimal primer / probe sets . it will be apparent to one of ordinary skill in the art that the primers and probes based on the nucleic acid information provided ( or publicly available with accession numbers ) can be prepared accordingly . in one embodiment , the pair of amplification primers ( i . e ., forward primer and reverse primer ) can be the pair of primers of seq id nos : 1 and 2 . a “ primer dimer ” is a potential by - product in pcr that consists of primer molecules that have partially hybridized to each other because of strings of complementary bases in the primers . as a result , the dna polymerase amplifies the primer dimer , leading to competition for pcr reagents , thus potentially inhibiting amplification of the dna sequence targeted for pcr amplification . in real - time pcr , primer dimers may interfere with accurate quantification by reducing sensitivity . primer sequences for the detection of salmonella are screened for the formation of primer - dimer . pcr reactions are performed using pairs of forward and reverse primers in the presence of sybr green i . the fluorescence emission intensity of this dye increases when it becomes intercalated into duplex dna and therefore can serve as a non - specific probe in nucleic acid amplification reactions . the reactions are performed in a suitable reaction buffer described containing 800 nm of forward and reverse primer , thermostable dna polymerase , and sybr green i . the resulting increase in sybr green i fluorescence emission can be detected in real - time using a suitable instrument , such as the applied biosystems 7500 fast real - time pcr system or the biorad cfx96 real - time pcr thermocycler . primer - dimer formation leads to a characteristic sigmoidal shaped emission profile similar to that seen in the presence of primer - specific template dna . the terms “ annealing ” and “ hybridization ” are used interchangeably and mean the base - pairing interaction of one nucleic acid with another nucleic acid that results in formation of a duplex , triplex , or other higher - ordered structure . in certain embodiments , the primary interaction is base specific , e . g ., a / t and g / c , by watson / crick and hoogsteen - type hydrogen bonding . in certain embodiments , base - stacking and hydrophobic interactions may also contribute to duplex stability . as used herein , the term “ substantially complementary ” refers to two nucleic acid strands that are sufficiently complimentary in sequence to anneal and form a stable duplex . the complementarity does not need to be perfect ; there may be any number of base pair mismatches , for example , between the two nucleic acids . however , if the number of mismatches is so great that no hybridization can occur under even the least stringent hybridization conditions , the sequence is not a substantially complementary sequence . when two sequences are referred to as “ substantially complementary ” herein , it means that the sequences are sufficiently complementary to each other to hybridize under the selected reaction conditions such as stringent hybridization condition . the relationship of nucleic acid complementarity and stringency of hybridization sufficient to achieve specificity is well known in the art . two substantially complementary strands can be , for example , perfectly complementary or can contain from 1 to many mismatches so long as the hybridization conditions are sufficient to allow , for example discrimination between a pairing sequence and a non - pairing sequence . accordingly , “ substantially complementary ” sequences can refer to sequences with base - pair complementarity of 100 , 95 , 90 , 80 , 75 , 70 , 60 , 50 percent or less , or any number in between , in a double - stranded region . a person of skill in the art will know how to design pcr primers flanking a salmonella genomic sequence of interest . synthesized oligos are typically between 20 and 26 base pairs in length with a melting temperature , t m of around 55 degrees . an exemplary protocol for detecting a target salmonella sequence may include the steps of providing a food sample or surface wipe , mixing the sample or wipe with a growth medium and incubating to increase the number or population of salmonella (“ enrichment ”), disintegrating salmonella cells (“ lysis ”), and subjecting the obtained lysate to amplification and detection of target salmonella sequence . food samples may include , but are not limited to , fish such as salmon , dairy products such as milk , and eggs , poultry , fruit juices , meats such as ground pork , pork , ground beef , or beef , vegetables such as spinach or alfalfa sprouts , or processed nuts such as peanut butter . the limit of detection ( lod ) for food contaminants is described in terms of the number of colony forming units ( cfu ) that can be detected in either 25 grams of solid or 25 ml of liquid food or on a surface of defined area . by definition , a colony - forming unit is a measure of viable bacterial numbers . unlike indirect microscopic counts where all cells , dead and living , are counted , cfu measures viable cells . one cfu ( usually one bacterial cell ) will grow to form a single colony on an agar plate under permissive conditions . the united states food testing inspection service defines the minimum lod as 1 cfu / 25 grams of solid food or 25 ml of liquid food or 1 cfu / surface area . in practice , it is impossible to reproducibly inoculate a food sample or surface with a single cfu and insure that the bacterium survives the enrichment process . this problem is overcome by inoculating the sample at either one or several target levels and analyzing the results using a statistical estimate of the contamination called the most probable number ( mpn ). as an example , a salmonella culture can be grown to a specific cell density by measuring the absorbance in a spectrophotometer . ten - fold serial dilutions of the target are plated on agar media and the numbers of viable bacteria are counted . this data is used to construct a standard curve that relates cfu / volume plated to cell density . for the mpn to be meaningful , test samples at several inoculum levels are analyzed . after enrichment and extraction a small volume of sample is removed for real - time analysis . the ultimate goal is to achieve a fractional recovery of between 25 % and 75 % ( i . e . between 25 % and 75 % of the samples test positive in the assay using reverse transcriptase - pcr employing a catacleave probe , which will be explained below ). the reason for choosing these fractional recovery percentages is that they convert to mpn values of between 0 . 3 cfu and 1 . 375 cfu for 25 gram samples of solid food , 25 ml samples of liquid food , or a defined area for surfaces . these mpn values are chosen because they bracket the required lod of 1 cfu / sample . with practice , it is possible to estimate the volume of diluted inoculum ( based on the standard curve ) to achieve these fractional recoveries . the reagent for lysing cells can comprise a buffer with a ph of about 6 to about 9 , a zwitterionic detergent at a concentration of about 0 . 125 % to about 2 %, and an azide at a concentration of about 0 . 3 to about 2 . 5 mg / ml . for the lysis of gram negative bacteria , such as salmonella or e . coli , the lysis reagent may optionally include a protease such as proteinase k . proteases such as proteinase k are however required for the preparation of pcr template nucleic acid from gram positive bacteria . in one embodiment , the 1 × lysis reagent is prepared that contains 12 . 5 mm tris acetate or tris - hcl or hepes ( 4 -( 2 - hydroxyethyl )- 1 - piperazineethanesulfonic acid ) ( ph = 7 - 8 ), 0 . 25 % ( w / v ) chaps , 0 . 3125 mg / ml sodium azide . 45 μl 1 × lysis agent is then added to 5 μl enrichment sample and incubated at 55 ° c . for 15 minutes . for the lysis of gram negative bacteria , proteinase k to 1 mg / ml may be added to the lysis reagent . after incubation at 55 ° c . for 15 minutes , the proteinase k is inactivated at 95 ° c . for 10 minutes to produce a substantially protein free lysate that is compatible with high efficiency pcr or reverse transcription pcr analysis . once the primers are selected and the cell free lysate containing the target nucleic acid is prepared ( see examples ), nucleic acid amplification can be accomplished by a variety of methods , including the polymerase chain reaction ( pcr ), nucleic acid sequence based amplification ( nasba ), ligase chain reaction ( lcr ), and rolling circle amplification ( rca ). the polymerase chain reaction ( pcr ) is the method most commonly used to amplify specific target dna sequences . “ polymerase chain reaction ,” or “ pcr ,” generally refers to a method for amplification of a desired nucleotide sequence in vitro . the procedure is described in detail in u . s . pat . nos . 4 , 683 , 202 , 4 , 683 , 195 , 4 , 800 , 159 , and 4 , 965 , 188 , the contents of which are hereby incorporated herein in their entirety . generally , the pcr process consists of introducing a molar excess of two or more extendable oligonucleotide primers to a reaction mixture comprising the desired target sequence ( s ), where the primers are complementary to opposite strands of the double stranded target sequence . the reaction mixture is subjected to a program of thermal cycling in the presence of a dna polymerase , resulting in the amplification of the desired target sequence flanked by the dna primers . in one aspect , salmonella - specific primers which can be used in the embodiments may have a dna sequence of seq id nos . : 1 - 2 . a probe which can be used in the embodiments of the instant application ( sometimes referred to as a “ catacleave probe ”) may have the following sequences : 5 ′-/ fam / cgatcagrgrararatcaaccag / iabfq ) ( seq id no : 3 ) to be used with the primer pair of seq id nos : 1 and 2 ( wherein , lowercase “ r ” denotes rna bases ( i . e . rg is riboguanosine ). as used herein , the term “ pcr fragment ” or “ amplicon ” refers to a polynucleotide molecule ( or collectively the plurality of molecules ) produced following the amplification of a particular target nucleic acid . an pcr fragment is typically , but not exclusively , a dna pcr fragment . an pcr fragment can be single - stranded or double - stranded , or in a mixture thereof in any concentration ratio . a pcr fragment can be about 100 to about 500 nucleotides or more in length . an amplification “ buffer ” is a compound added to an amplification reaction which modifies the stability , activity , and / or longevity of one or more components of the amplification reaction by regulating the amplification reaction . the buffering agents of the invention are compatible with pcr amplification and rnase h cleavage activity . examples of buffers include , but are not limited to , hepes ( 4 -( 2 - hydroxyethyl )- 1 - piperazineethanesulfonic acid ), mops ( 3 -( n - morpholino )- propanesulfonic acid ), and acetate or phosphate containing buffers and the like . in addition , pcr buffers may generally contain up to about 70 mm kcl and about 1 . 5 mm or higher mgcl 2 , to about 50 - 200 μm each of datp , dctp , dgtp and dttp . the buffers of the invention may contain additives to optimize efficient reverse transcriptase - pcr or pcr reactions . an additive is a compound added to a composition which modifies the stability , activity , and / or longevity of one or more components of the composition . in certain embodiments , the composition is an amplification reaction composition . in certain embodiments , an additive inactivates contaminant enzymes , stabilizes protein folding , and / or decreases aggregation . exemplary additives that may be included in an amplification reaction include , but are not limited to , betaine , formamide , kcl , cacl 2 , mgoac , mgcl 2 , nacl , nh 4 oac , nai , na ( co 3 ) 2 , licl , mnoac , nmp , trehalose , demiethylsulfoxide (“ dmso ”), glycerol , ethylene glycol , dithiothreitol (“ dtt ”), pyrophosphatase ( including , but not limited to thermoplasma acidophilum inorganic pyrophosphatase (“ tap ”)), bovine serum albumin (“ bsa ”), propylene glycol , glycinamide , ches , percoll , aurintricarboxylic acid , tween 20 , tween 21 , tween 40 , tween 60 , tween 85 , brij 30 , np - 40 , triton x - 100 , chaps , chapso , mackernium , ldao ( n - dodecyl - n , n - dimethylamine - n - oxide ), zwittergent 3 - 10 , xwittergent 3 - 14 , xwittergent sb 3 - 16 , empigen , ndsb - 20 , t4g32 , e . coli ssb , reca , nicking endonucleases , 7 - deazag , dutp , anionic detergents , cationic detergents , non - ionic detergents , zwittergent , sterol , osmolytes , cations , and any other chemical , protein , or cofactor that may alter the efficiency of amplification . in certain embodiments , two or more additives are included in an amplification reaction . additives may be optionally added to improve selectivity of primer annealing provided the additives do not interfere with the activity of rnase h . as used herein , an “ amplifying polymerase activity ” or “ amplifying activity ” refers to the enzymatic activity associated with nucleic acid amplification such as the activity associated with thermostable dna polymerases . as used herein , the term “ thermostable ,” as applied to an enzyme , refers to an enzyme that retains its biological activity at elevated temperatures ( e . g ., at 55 ° c . or higher ), or retains its biological activity following repeated cycles of heating and cooling . thermostable polynucleotide polymerases find particular use in pcr amplification reactions . as used herein , a “ thermostable polymerase ” is an enzyme that is relatively stable to heat and eliminates the need to add enzyme prior to each pcr cycle . non - limiting examples of thermostable polymerases may include polymerases isolated from the thermophilic bacteria thermus aquaticus ( taq polymerase ), thermus thermophilus ( tth polymerase ), thermococcus litoralis ( tli or vent polymerase ), pyrococcus furiosus ( pfu or deepvent polymerase ), pyrococcus woosii ( pwo polymerase ) and other pyrococcus species , bacillus stearothermophilus ( bst polymerase ), sulfolobus acidocaldarius ( sac polymerase ), thermoplasma acidophilum ( tac polymerase ), thermus rubber ( tru polymerase ), thermus brockianus ( dynazyme polymerase ), thermotoga neapolitana ( tne polymerase ), thermotoga maritime ( tma ) and other species of the thermotoga genus ( tsp polymerase ), and methanobacterium thermoautotrophicum ( mth polymerase ). the pcr reaction may contain more than one thermostable polymerase enzyme with complementary properties leading to more efficient amplification of target sequences . for example , a nucleotide polymerase with high processivity ( the ability to copy large nucleotide segments ) may be complemented with another nucleotide polymerase with proofreading capabilities ( the ability to correct mistakes during elongation of target nucleic acid sequence ), thus creating a pcr reaction that can copy a long target sequence with high fidelity . the thermostable polymerase may be used in its wild type form . alternatively , the polymerase may be modified to contain a fragment of the enzyme or to contain a mutation that provides beneficial properties to facilitate the pcr reaction . in one embodiment , the thermostable polymerase may be taq polymerase . many variants of taq polymerase with enhanced properties are known and include amplitaq , amplitaq stoffel fragment , supertaq , supertaq plus , la taq , lapro taq , and ex taq . reverse transcriptase — pcr amplification of a salmonella rna target nucleic acid sequence one of the most widely used techniques to study gene expression exploits first - strand cdna for mrna sequence ( s ) as template for amplification by the pcr . this method , often referred to as rt - pcr or reverse transcriptase - pcr , exploits the high sensitivity and specificity of the pcr process and is widely used for detection and quantification of rna . as used herein , “ reverse transcriptase activity ” refers to the activity associated with rna - dependent dna polymerases that catalyze the synthesis of a complementary dna strand or cdna from a single stranded rna template . the reverse transcriptase - pcr procedure , carried out as either an end - point or real - time assay , involves two separate molecular syntheses : ( i ) the synthesis of cdna from an rna template ; and ( ii ) the replication of the newly synthesized cdna through pcr amplification . to attempt to address the technical problems often associated with reverse transcriptase - pcr , a number of protocols have been developed taking into account the three basic steps of the procedure : ( a ) the denaturation of rna and the hybridization of reverse primer ; ( b ) the synthesis of cdna ; and ( c ) pcr amplification . in the so called “ uncoupled ” reverse transcriptase - pcr procedure ( e . g ., two step reverse transcriptase - pcr ), reverse transcription is performed as an independent step using the optimal buffer condition for reverse transcriptase activity . following cdna synthesis , the reaction is diluted to decrease mgcl 2 , and deoxyribonucleoside triphosphate ( dntp ) concentrations to conditions optimal for taq dna polymerase activity , and pcr is carried out according to standard conditions ( see u . s . pat . nos . 4 , 683 , 195 and 4 , 683 , 202 ). by contrast , “ coupled ” reverse transcriptase pcr methods use a common buffer for reverse transcriptase and taq dna polymerase activities . in one version , the annealing of reverse primer is a separate step preceding the addition of enzymes , which are then added to the single reaction vessel . in another version , the reverse transcriptase activity is a component of the thermostable tth dna polymerase . annealing and cdna synthesis are performed in the presence of mn 2 + then pcr is carried out in the presence of mg 2 + after the removal of mn 2 + by a chelating agent . finally , the “ continuous ” method ( e . g ., one step reverse transcriptase - pcr ) integrates the three reverse transcriptase - pcr steps into a single continuous reaction that avoids the opening of the reaction tube for component or enzyme addition . continuous reverse transcriptase - pcr has been described as a single enzyme system using the reverse transcriptase activity of thermostable taq dna polymerase and tth polymerase and as a two enzyme system using amv reverse transcriptase and taq dna polymerase wherein the initial 65 ° c . an rna denaturation step can be omitted . the first step in real - time reverse - transcription pcr is to generate the complementary dna strand using one of the template specific dna primers . in traditional pcr reactions this product is denatured , the second template specific primer binds to the cdna , and is extended to form duplex dna . this product is amplified in subsequent rounds of temperature cycling . to maintain the highest sensitivity it is important that the rna not be degraded prior to synthesis of cdna . the presence of rnase h in the reaction buffer will cause unwanted degradation of the rna : dna hybrid formed in the first step of the process because it can serve as a substrate for the enzyme . there are two major methods to combat this issue . one is to physically separate the rnase h from the rest of the reverse - transcription reaction using a barrier such as wax that will melt during the initial high temperature dna denaturation step . a second method is to modify the rnase h such that it is inactive at the reverse - transcription temperature , typically 45 - 55 ° c . several methods are known in the art , including reaction of rnase h with an antibody , or reversible chemical modification . for example , a hot start rnase h activity as used herein can be an rnase h with a reversible chemical modification produced after reaction of the rnase h with cis - aconitic anhydride under alkaline conditions . when the modified enzyme is used in a reaction with a tris based buffer and the temperature is raised to 95 ° c . the ph of the solution drops and rnase h activity is restored . this method allows for the inclusion of rnase h in the reaction mixture prior to the initiation of reverse transcription . additional examples of rnase h enzymes and hot start rnase h enzymes that can be employed in the invention are described in u . s . patent application no . 2009 / 0325169 to walder et al . one step reverse transcriptase - pcr provides several advantages over uncoupled reverse transcriptase - pcr . one step reverse transcriptase - pcr requires less handling of the reaction mixture reagents and nucleic acid products than uncoupled reverse transcriptase - pcr ( e . g ., opening of the reaction tube for component or enzyme addition in between the two reaction steps ), and is therefore less labor intensive , reducing the required number of person hours . one step reverse transcriptase - pcr also requires less sample , and reduces the risk of contamination . the sensitivity and specificity of one - step reverse transcriptase - pcr has proven well suited for studying expression levels of one to several genes in a given sample or the detection of pathogen rna . typically , this procedure has been limited to use of gene - specific primers to initiate cdna synthesis . the ability to measure the kinetics of a pcr reaction by real - time detection in combination with these reverse transcriptase - pcr techniques has enabled accurate and precise determination of rna copy number with high sensitivity . this has become possible by detecting the reverse transcriptase - pcr product through fluorescence monitoring and measurement of pcr product during the amplification process by fluorescent dual - labeled hybridization probe technologies , such as the 5 ′ fluorogenic nuclease assay (“ taq - man ”) or endonuclease assay (“ catacleave ”), discussed below . real - time pcr of a salmonella target nucleic acid sequence using a catacleave probe post - amplification amplicon detection has been developed to monitor amplification during the pcr process . these methods typically employ fluorescently labeled probes that bind to the newly synthesized dna or dyes whose fluorescence emission is increased when intercalated into double stranded dna . the probes are generally designed so that donor emission is quenched in the absence of target by fluorescence resonance energy transfer ( fret ) between two chromophores . the donor chromophore , in its excited state , may transfer energy to an acceptor chromophore when the pair is in close proximity . this transfer is always non - radiative and occurs through dipole - dipole coupling . any process that sufficiently increases the distance between the chromophores will decrease fret efficiency such that the donor chromophore emission can be detected radiatively . common donor chromophores include fam , tamra , vic , joe , cy3 , cy5 , and texas red . acceptor chromophores are chosen so that their excitation spectra overlap with the emission spectrum of the donor . an example of such a pair is fam - tamra . there are also non fluorescent acceptors that will quench a wide range of donors . other examples of appropriate donor - acceptor fret pairs will be known to those skilled in the art . common examples of fret probes that can be used for real - time detection of pcr include molecular beacons , taqman probes ( e . g ., u . s . pat . nos . 5 , 210 , 015 and 5 , 487 , 972 ), and catacleave probes ( e . g ., u . s . pat . no . 5 , 763 , 181 ). the molecular beacon is a single stranded oligonucleotide designed so that in the unbound state the probe forms a secondary structure where the donor and acceptor chromophores are in close proximity and donor emission is reduced . at the proper reaction temperature , the beacon unfolds and specifically binds to the amplicon . once unfolded the distance between the donor and acceptor chromophores increases such that fret is reversed and donor emission can be monitored using specialized instrumentation . taqman and catacleave technologies differ from the molecular beacon in that the fret probes employed are cleaved such that the donor and acceptor chromophores become sufficiently separated to reverse fret . taqman technology employs a single stranded oligonucleotide probe that is labeled at the 5 ′ end with a donor chromophore and at the 3 ′ end with an acceptor chromophore . the dna polymerase used for amplification must contain a 5 ′→ 3 ′ exonuclease activity . the taqman probe binds to one strand of the amplicon at the same time that the primer binds . as the dna polymerase extends the primer the polymerase will eventually encounter the bound taqman probe . at this time the exonuclease activity of the polymerase will sequentially degrade the taqman probe starting at the 5 ′ end . as the probe is digested the mononucleotides comprising the probe are released into the reaction buffer . the donor diffuses away from the acceptor and fret is reversed . emission from the donor is monitored to identify probe cleavage . because of the way taqman works a specific amplicon can be detected only once for every cycle of pcr . extension of the primer through the taqman target site generates a double stranded product that prevents further binding of taqman probes until the amplicon is denatured in the next pcr cycle . u . s . pat . no . 5 , 763 , 181 , the content of which is incorporated herein by reference , describes another real - time detection method ( referred to as “ catacleave ”). catacleave technology differs from taqman in that cleavage of the probe is accomplished by a second enzyme that does not have polymerase activity . the catacleave probe has a sequence within the molecule which is a target of an endonuclease , such as , for example a restriction enzyme or rnase . in one example , the catacleave probe has a chimeric structure where the 5 ′ and 3 ′ ends of the probe are constructed of dna and the cleavage site contains rna . the dna sequence portions of the probe are labeled with a fret pair either at the ends or internally . the pcr reaction includes an rnase h enzyme that will specifically cleave the rna sequence portion of a rna - dna duplex . after cleavage , the two halves of the probe dissociate from the target amplicon at the reaction temperature and diffuse into the reaction buffer . as the donor and acceptors separate fret is reversed in the same way as the taqman probe and donor emission can be monitored . cleavage and dissociation regenerates a site for further catacleave binding . in this way it is possible for a single amplicon to serve as a target or multiple rounds of probe cleavage until the primer is extended through the catacleave probe binding site . the term “ probe ” as used herein refers to a polynucleotide that comprises a specific portion designed to hybridize in a sequence - specific manner with a complementary region of a specific nucleic acid sequence , e . g ., a target nucleic acid sequence . in one embodiment , the oligonucleotide probe is in the range of 15 - 60 nucleotides in length . more preferably , the oligonucleotide probe is in the range of 18 - 30 nucleotides in length . the precise sequence and length of an oligonucleotide probe of the invention depends in part on the nature of the target polynucleotide to which it binds . the binding location and length may be varied to achieve appropriate annealing and melting properties for a particular embodiment . guidance for making such design choices can be found in many of the references describing taq - man assays or catacleave , described in u . s . pat . nos . 5 , 763 , 181 , 6 , 787 , 304 , and 7 , 112 , 422 , the contents of which contents are incorporated herein by reference in their entirety . as used herein , the term “ label ” or “ detectable label ” may refer to any label which can be detected by optical or chemical means . for example , in one embodiment , the label or detectable label of a catacleave probe may comprise a fluorochrome compound that is attached to the probe by covalent or non - covalent means . as used herein , the term “ fluorochrome ” refers to a fluorescent compound that emits light upon excitation by light of a shorter wavelength than the light that is emitted . the term “ fluorescent donor ” or “ fluorescence donor ” refers to a fluorochrome that emits light that is measured in the assays described in the present invention . more specifically , a fluorescent donor provides light that is absorbed by a fluorescence acceptor . the term “ fluorescent acceptor ” or “ fluorescence acceptor ” refers to either a second fluorochrome or a quenching molecule that absorbs energy emitted from the fluorescence donor . the second fluorochrome absorbs the energy that is emitted from the fluorescence donor and emits light of longer wavelength than the light emitted by the fluorescence donor . the quenching molecule absorbs energy emitted by the fluorescence donor . any luminescent molecule , preferably a fluorochrome and / or fluorescent quencher may be used in the practice of this invention , including , for example , alexa fluor 350 , alexa fluor 430 , alexa fluor 488 , alexa fluor 532 , alexa fluor 546 , alexa fluor 568 , alexa fluor 594 , alexa fluor 633 , alexa fluor 647 , alexa fluor 660 , alexa fluor 680 , 7 - diethylaminocoumarin - 3 - carboxylic acid , fluorescein , oregon green 488 , oregon green 514 , tetramethylrhodamine , rhodamine x , texas red dye , qsy 7 , qsy33 , dabcyl , bodipy fl , bodipy 630 / 650 , bodipy 6501665 , bodipy tmr - x , bodipy tr - x , dialkylaminocoumarin , cy5 . 5 , cy5 , cy3 . 5 , cy3 , dtpa ( eu3 +)- amca and ttha ( eu3 + ) amca . in one embodiment , the 3 ′ terminal nucleotide of the oligonucleotide probe is blocked or rendered incapable of extension by a nucleic acid polymerase . such blocking is conveniently carried out by the attachment of a reporter or quencher molecule to the terminal 3 ′ position of the probe . in one embodiment , reporter molecules are fluorescent organic dyes derivatized for attachment to the terminal 3 ′ or terminal 5 ′ ends of the probe via a linking moiety . preferably , quencher molecules are also organic dyes , which may or may not be fluorescent , depending on the embodiment of the invention . for example , in a preferred embodiment of the invention , the quencher molecule is non - fluorescent . generally whether the quencher molecule is fluorescent or simply releases the transferred energy from the reporter by non - radiative decay , the absorption band of the quencher should substantially overlap the fluorescent emission band of the reporter molecule . non - fluorescent quencher molecules that absorb energy from excited reporter molecules , but which do not release the energy radiatively , are referred to in the application as chromogenic molecules . exemplary reporter - quencher pairs may be selected from xanthene dyes , including fluoresceins , and rhodamine dyes . many suitable forms of these compounds are widely available commercially with substituents on their phenyl moieties which can be used as the site for bonding or as the bonding functionality for attachment to an oligonucleotide . another group of fluorescent compounds are the naphthylamines , having an amino group in the alpha or beta position . included among such naphthylamino compounds are 1 - dimethylaminonaphthyl - 5 - sulfonate , 1 - anilino - 8 - naphthalene sulfonate and 2 - p - touidinyl6 - naphthalene sulfonate . other dyes include 3 - phenyl - 7 - isocyanatocoumarin , acridines , such as 9 - isothiocyanatoacridine and acridine orange ; n -( p -( 2 - benzoxazolyl ) phenyl ) maleimide ; benzoxadiazoles , stilbenes , pyrenes , and the like . in one embodiment , reporter and quencher molecules are selected from fluorescein and non - fluorescent quencher dyes . there are many linking moieties and methodologies for attaching reporter or quencher molecules to the 5 ′ or 3 ′ termini of oligonucleotides , as exemplified by the following references : eckstein , editor , oligonucleotides and analogues : a practical approach ( irl press , oxford , 1991 ); zuckerman et al ., nucleic acids research , 15 : 5305 - 5321 ( 1987 ) ( 3 ′ thiol group on oligonucleotide ); sharma et al ., nucleic acids research , 19 : 3019 ( 1991 ) ( 3 ′ sulfhydryl ); giusti et al ., pcr methods and applications , 2 : 223 - 227 ( 1993 ) and fung et al ., u . s . pat . no . 4 , 757 , 141 ( 5 ′ phosphoamino group via aminolink . ii available from applied biosystems , foster city , calif .) stabinsky , u . s . pat . no . 4 , 739 , 044 ( 3 ′ aminoalkylphosphoryl group ); agrawal et al ., tetrahedron letters , 31 : 1543 - 1546 ( 1990 ) ( attachment via phosphoramidate linkages ); sproat et al ., nucleic acids research , 15 : 4837 ( 1987 ) ( 5 ′ mercapto group ); nelson et al ., nucleic acids research , 17 : 7187 - 7194 ( 1989 ) ( 3 ′ amino group ); and the like . rhodamine and non - fluorescent quencher dyes are also conveniently attached to the 3 ′ end of an oligonucleotide at the beginning of solid phase synthesis , e . g ., woo et al ., u . s . pat . no . 5 , 231 , 191 ; and hobbs , jr ., u . s . pat . no . 4 , 997 , 928 . attachment of a salmonella - specific catacleave probe to a solid support in one embodiment of the invention , the oligonucleotide probe can be attached to a solid support . different probes may be attached to the solid support and may be used to simultaneously detect different target sequences in a sample . reporter molecules having different fluorescence wavelengths can be used on the different probes , thus enabling hybridization to the different probes to be separately detected . examples of preferred types of solid supports for immobilization of the oligonucleotide probe include polystyrene , avidin coated polystyrene beads cellulose , nylon , acrylamide gel and activated dextran , controlled pore glass ( cpg ), glass plates and highly cross - linked polystyrene . these solid supports are preferred for hybridization and diagnostic studies because of their chemical stability , ease of functionalization and well defined surface area . solid supports such as controlled pore glass ( 500 å , 1000 å ) and non - swelling high cross - linked polystyrene ( 1000 å ) are particularly preferred in view of their compatibility with oligonucleotide synthesis . the oligonucleotide probe may be attached to the solid support in a variety of manners . for example , the probe may be attached to the solid support by attachment of the 3 ′ or 5 ′ terminal nucleotide of the probe to the solid support . however , the probe may be attached to the solid support by a linker which serves to distance the probe from the solid support . the linker is most preferably at least 30 atoms in length , more preferably at least 50 atoms in length . hybridization of a probe immobilized to a solid support generally requires that the probe be separated from the solid support by at least 30 atoms , more - preferably at least 50 atoms . in order to achieve this separation , the linker generally includes a spacer positioned between the linker and the 3 ′ nucleoside . for oligonucleotide synthesis , the linker arm is usually attached to the 3 ′- oh of the 3 ′ nucleoside by an ester linkage which can be cleaved with basic reagents to free the oligonucleotide from the solid support . a wide variety of linkers are known in the art which may be used to attach the oligonucleotide probe to the solid support . the linker may be formed of any compound which does not significantly interfere with the hybridization of the target sequence to the probe attached to the solid support . the linker may be formed of a homopolymeric oligonucleotide which can be readily added on to the linker by automated synthesis . alternatively , polymers such as functionalized polyethylene glycol can be used as the linker . such polymers are preferred over homopolymeric oligonucleotides because they do not significantly interfere with the hybridization of probe to the target oligonucleotide . polyethylene glycol is particularly preferred because it is commercially available , soluble in both organic and aqueous media , easy to functionalize , and is completely stable under oligonucleotide synthesis and post - synthesis conditions . the linkages between the solid support , the linker and the probe are preferably not cleaved during removal of base protecting groups under basic conditions at high temperature . examples of preferred linkages include carbamate and amide linkages . immobilization of a probe is well known in the art and one skilled in the art may determine the immobilization conditions . according to one embodiment of the method , the hybridization probe is immobilized on a solid support . the oligonucleotide probe is contacted with a sample of nucleic acids under conditions favorable for hybridization . the fluorescence signal of the reporter molecule is measured before and after being contacted with the sample . since the reporter molecule on the probe exhibits a greater fluorescence signal when hybridized to a target sequence , an increase in the fluorescence signal after the probe is contacted with the sample indicates the hybridization of the probe to target sequences in the sample . in an unhybridized state , the fluorescent label is quenched by the quencher . on hybridization to the target , the fluorescent label is separated from the quencher resulting in fluorescence . immobilization of the hybridization probe to the solid support also enables the target sequence hybridized to the probe to be readily isolated from the sample . in later steps , the isolated target sequence may be separated from the solid support and processed ( e . g ., purified , amplified ) according to methods well known in the art depending on the particular needs of the researcher . real - time detection of salmonella target nucleic acid sequences using a catacleave probe the labeled oligonucleotide probe may be used as a probe for the real - time detection of salmonella target nucleic acid sequence in a sample . a catacleave oligonucleotide probe is first synthesized with dna and rna sequences that are complimentary to sequences found within a pcr amplicon comprising a selected salmonella target sequence . in one embodiment , the probe is labeled with a fret pair , for example , a fluorescein molecule at one end of the probe and a non - fluorescent quencher molecule at the other end . hence , upon hybridization of the probe with the pcr amplicon , a rna : dna heteroduplex forms that can be cleaved by an rnase h activity . rnase h hydrolyzes rna in rna - dna hybrids . this enzyme was first identified in calf thymus but has subsequently been described in a variety of organisms . rnase h activity appears to be ubiquitous in eukaryotes and bacteria . although rnase hs constitute a family of proteins of varying molecular weight and nucleolytic activity , substrate requirements appear to be similar for the various isotypes . for example , most rnase h &# 39 ; s studied to date function as endonucleases and requiring divalent cations ( e . g ., mg 2 + , mn 2 + ) to produce cleavage products with 5 ′ phosphate and 3 ′ hydroxyl termini . rnase hi from e . coli is the best - characterized member of the rnase h family . in addition to rnase hi , a second e . coli rnase h , rnase hii has been cloned and characterized ( itaya , m ., proc . natl . acad . sci . usa , 1990 , 87 , 8587 - 8591 ). it is comprised of 213 amino acids while rnase hi is 155 amino acids long . e . coli rnase him displays only 17 % homology with e . coli rnase hi . an rnase h cloned from s . typhimurium differed from e . coli rnase hi in only 11 positions and was 155 amino acids in length ( itaya , m . and kondo k ., nucleic acids res ., 1991 , 19 , 4443 - 4449 ). proteins that display rnase h activity have also been cloned and purified from a number of viruses , other bacteria and yeast ( wintersberger , u . pharmac . ther ., 1990 , 48 , 259 - 280 ). in many cases , proteins with rnase h activity appear to be fusion proteins in which rnase h is fused to the amino or carboxy end of another enzyme , often a dna or rna polymerase . the rnase h domain has been consistently found to be highly homologous to e . coli rnase hi , but because the other domains vary substantially , the molecular weights and other characteristics of the fusion proteins vary widely . in higher eukaryotes two classes of rnase h have been defined based on differences in molecular weight , effects of divalent cations , sensitivity to sulfhydryl agents and immunological cross - reactivity ( busen et al ., eur . j . biochem ., 1977 , 74 , 203 - 208 ). rnase hi enzymes are reported to have molecular weights in the 68 - 90 kda range , be activated by either mn 2 + or mg 2 + and be insensitive to sulfhydryl agents . in contrast , rnase h ii enzymes have been reported to have molecular weights ranging from 31 - 45 kda , to require mg 2 + to be highly sensitive to sulfhydryl agents and to be inhibited by mn 2 + ( busen , w ., and hausen , p ., eur . j . biochem ., 1975 , 52 , 179 - 190 ; kane , c . m ., biochemistry , 1988 , 27 , 3187 - 3196 ; busen , w ., j . biol . chem ., 1982 , 257 , 7106 - 7108 .). an enzyme with rnase hii characteristics has been purified to near homogeneity from human placenta ( frank et al ., nucleic acids res ., 1994 , 22 , 5247 - 5254 ). this protein is reported to have a molecular weight of approximately 33 kda and be active in a ph range of 6 . 5 - 10 , with a ph optimum of 8 . 5 - 9 . the enzyme is reported to require mg 2 + and be inhibited by mn 2 + and n - ethyl maleimide . the products of cleavage reactions have 3 ′ hydroxyl and 5 ′ phosphate termini . according to an embodiment , real - time nucleic acid amplification is performed on a target polynucleotide in the presence of a thermostable nucleic acid polymerase , an rnase h activity , a pair of pcr amplification primers capable of hybridizing to the salmonella target polynucleotide , and the labeled catacleave oligonucleotide probe . during the real - time pcr reaction , cleavage of the probe by rnase h leads to the separation of the fluorescent donor from the fluorescent quencher and results in the real - time increase in fluorescence of the probe corresponding to the real - time detection of salmonella target dna sequences in the sample . in certain embodiments , the real - time nucleic acid amplification permits the real - time detection of a single target dna molecule in less than about 40 pcr amplification cycles . the disclosure herein also provides for a kit format which comprises a package unit having one or more reagents for the real - time detection of salmonella target nucleic acid sequences in a sample . the kit may also contain one or more of the following items : buffers , instructions , and positive or negative controls . kits may include containers of reagents mixed together in suitable proportions for performing the methods described herein . reagent containers preferably contain reagents in unit quantities that obviate measuring steps when performing the subject methods . the kit may contain a lysis reagent comprising a buffer with a ph of about 6 to about 9 , a zwitterionic detergent at a concentration of about 0 . 125 % to about 2 %, and an azide at a concentration of about 0 . 3 to about 2 . 5 mg / ml . for the lysis of gram positive bacteria , the kit may include a protease , for example , 100 mg of lyophilized proteinase k and an aliquot of a buffer solution for the reconstitution of the proteinase k solution . in one embodiment , the 1 × lysis reagent contains 12 . 5 mm tris acetate ( ph 8 . 0 ) or tris - hcl ( ph 8 . 0 ) or hepes ( ph = 7 . 8 ), 0 . 25 % ( w / v ) chaps , and 0 . 3125 mg / ml sodium azide . kits may also contain reagents for real - time pcr including , but not limited to , a thermostable polymerase , thermostable rnase h , primers selected to amplify a samonella nucleic acid target sequence and a labeled catacleave oligonucleotide probe that anneals to the real - time pcr product and allow for the detection of salmonella target nucleic acid sequences according to the methodology described herein . kits may comprise reagents for the detection of two or more salmonella target nucleic acid sequences . kit reagents may also include reagents for rt - pcr analysis where applicable . in certain embodiments , the amplification primer pair has the sequence of seq id nos 1 and 2 . in other embodiments , the catacleave oligonucleotide probe has the sequence of seq id no : 3 . the present invention will now be illustrated by the following examples , which are not to be considered limiting in any way . 5 μl of ground beef enrichment ( spiked with salmonella ) are diluted into 42 . 5 μl of lysis buffer containing 2 . 5 μl proteinase k ( 20 . 1 mg / ml ). the samples are incubated at 55 ° c . for 15 minutes and then heated to 95 ° c . for 10 minutes prior to cooling . 2 μl of lysate is then added to each pcr - catacleave reaction . real - time detection of the gram negative pathogen salmonella inva gene sequences in the presence of different lysis reagents 1 . cz1 : 1 % chaps , 1 mg / ml sodium azide , 20 mm hepes - koh ( ph 8 ) 2 . cz2 : 2 % chaps , 1 mg / ml sodium azide , 20 mm hepes - koh ( ph 8 ) 3 . cz3 : 0 . 5 % chaps , 1 mg / ml sodium azide , 20 mm hepes - koh ( ph 8 ) 4 . cz4 : 1 % chaps , 0 . 5 mg / ml sodium azide , 20 mm hepes - koh ( ph 8 ) 5 . cz5 : 1 % chaps , 2 . 5 mg / ml sodium azide 20 mm hepes - koh ( ph 8 ) 6 . cz6 : 1 % chaps , 1 mg / ml sodium azide , 20 mm hepes - koh ( ph 8 ) 7 . cz7 : 1 % chaps , 1 mg / ml sodium azide , 100 mm hepes - koh ( ph 8 ) 8 . 0 . 125 tz ( 1 × tz : 2 % triton - x , 5 mg / ml sodium azide , 0 . 2 m tris ph = 8 ) each reaction mix contained amplification buffer ( 32 mm hepes (( 4 -( 2 - hydroxyethyl )- 1 - piperazineethanesulfonic acid )- koh , ph 7 . 8 , 100 mm potassium acetate , 4 mm magnesium acetate , 0 . 11 % bovine serum albumin , 1 % dimethylsulfoxide ), 800 nm salmonella - forward primer ( seq id no . 1 ), 800 nm salmonella - reverse primer ( seq id no . 2 ), 200 nm salmonella catacleave probe ( seq id no . 3 ), dutp / ntp mix ( 80 μm dgtp , dctp , datp and 160 μm dutp ), 2 . 5 units thermus aquaticus dna polymerase , 1 unit pyrococcus furiosis rnase hii , and 0 . 1 unit uracil - n - glycosylase and lysate . the salmonella forward and reverse primers amplify a 180 base pair fragment contained within the salmonella invasion gene ( inva ). salmonella - forward primer : ( seq id no : 1 ) 5 ′- tcgtcattccattacctacc salmonella - reverse primer : ( seq id no : 2 ) 5 ′- tactgatcgataatgccagacgaa salmonella catacleave probe : ( seq id no : 3 ) 5 ′-/ fam / cgatcagrgrararatcaaccag / iabfq ), abbreviations : fam : 6 - carboxyfluorescein ; iabhq : iowa black hole quencher for short wavelength emission from integrated dna technologies ( coralville , iowa ). the reaction were run on a roche lightcycler 480 using the following cycling protocol : 37 ° c . for 10 minutes ; 95 ° c . for 10 minutes ; then 50 cycles of amplification ; 95 ° c . for 15 seconds , 60 ° c . for 20 seconds . the raw data from the catacleave - pcr reactions are depicted as an output graph in fig3 a . the data show cz5 with a composition of cz5 : 1 % chaps , 2 . 5 mg / ml sodium azide 20 mm hepes - koh ( ph 8 ) was the best lysate reagent for salmonella . real - time detection of the gram positive pathogen listeria inva gene sequences in the presence of different lysis reagents 1 ) control catacleave pcr in the presence of different concentrations of lysis reagent a control catacleave pcr was first tested on purified target dna resuspended in following lysis reagent concentrations : 1 × zac , 0 . 5 × zac , 0 . 25 × zac , 0 . 125 × zac and 0 . 125 × tz lysis reagent . ( 1 × zac contains 100 mm tris - acetate ( ph 8 . 0 ), 1 % ( w / v ) chaps , 2 . 5 mg / ml sodium azide ) five microliters of ground beef enrichment ( spiked with listeria ) was first added to 42 . 5 μl of lysis agent and 2 . 5 μl proteinase k ( 20 mg / ml ) and incubated at 55 ° c . for 15 minutes . after inactivation at 95 ° c . for 10 minutes , 2 μl of the lysate was added to each reaction mix containing 1 × ican amplification buffer ( 32 mm hepes - koh , ph 7 . 8 ; 4 mm magnesium acetate ; 1 % dmso ; and , 0 . 11 % bsa ), 400 nm lmonc3 - forward primer ( seq id no . 5 ), 400 nm lmonc3 - reverse primer ( seq id no . 6 ), 200 nm catacleave probe ( seq id no . 7 ), dutp / ntp mix ( 80 μm dgtp , dctp , datp and 160 μm dutp ), 2 . 5 units thermus aquaticus dna polymerase , 1 unit pyrococcus furiosis rnase hii , and 0 . 1 unit uracil - n - glycosylase ( ung ). the reactions were run on a roche lightcycler 480 using the following cycling protocol : 37 ° c . for 10 minutes ; 95 ° c . for 10 minutes ; then 50 cycles of amplification ; 95 ° c . for 15 seconds , 60 ° c . for 20 seconds . fam emission was monitored during the 60 ° c . step . the raw data from the catacleave - pcr reactions are depicted as an output graph in fig3 b . the results show that the lysis reagent does not inhibit the pcr catacleave reaction . 2 ) catacleave pcr in the presence of different concentrations of lysis reagent 5 μl of ground beef enrichment ( spiked with listeria ) were diluted into 42 . 5 μl of lysis agent containing 2 . 5 μl proteinase k ( 20 . 1 mg / ml ). the samples are incubated at 55 ° c . for 15 minutes and then heated to 95 ° c . for 10 minutes and then cooled . 17 . 7 μl of lysate was then added to each reaction mix containing amplification buffer 1 × ican buffer , 400 nm lmonc3 - forward primer ( seq id no . 5 ), 400 nm lmonc3 - reverse primer ( seq id no . 6 ), 200 nm catacleave probe ( seq id no . 7 ), dutp / ntp mix ( 80 μm dgtp , dctp , datp and 160 μm dutp ), 2 . 5 units thermus aquaticus dna polymerase , 1 unit pyrococcus furiosis rnase hii , and 0 . 1 unit uracil - n - glycosylase ( ung ). component μl / 25 μl rxn 10x ican buffer 2 . 5 forward primer 1 reverse primer ( 20 1 1 fermentas dn / utp 1 taq polymerase ( 5 0 . 5 0 . 1 rnaseh ii 0 . 2 lysate 17 . 7 the reactions were run on a roche lightcycler 480 using the following cycling protocol : 37 ° c . for 10 minutes , 95 ° c . for 10 minutes , then 50 cycles of amplification , 95 ° c . for 15 seconds , 60 ° c . for 20 seconds . fam emission was monitored during the 60 ° c . step . the raw data from the catacleave - pcr reactions are depicted as an output graph in fig4 . the lysis reagent 0 . 125 × zac is shown to be optimal for the combined lysis and pcr catacleave assay for the detection of the inva listeria gene . the results also show that the 0 . 125 × zac lysis reagent is superior to 0 . 125 × tz lysis agent ( a . abolmaaty , c . vu , j . oliver and r . e . levin . 2000 . microbio . 101 : 181 - 189 ). an overnight culture of l . monocytogenes cells were diluted and lysed in 0 . 125 × zac with 1 mg / ml proteinase k , and 2 μl of the resulting lysate was added to each reaction mix containing 1 × ican amplification buffer , 400 nm lmonc3 - forward primer ( seq id no . 5 ), 400 nm lmonc3 - reverse primer ( seq id no . 6 ), 200 nm catacleave probe ( seq id no . 7 ), dutp / ntp mix ( 80 μm dgtp , dctp , datp and 160 μm dutp ), 2 . 5 units thermus aquaticus dna polymerase , 1 unit pyrococcus furiosis rnase hii , and 0 . 1 unit uracil - n - glycosylase ( ung ). the raw data from the catacleave - pcr reactions are depicted as an output graph in fig5 . the results shown in fig5 demonstrate that the assay was able to detect 1 cfu , or one genomic copy of l . monocytogenes . any patent , patent application , publication , or other disclosure material identified in the specification is hereby incorporated by reference herein in its entirety . any material , or portion thereof , that is said to be incorporated by reference herein , but which conflicts with existing definitions , statements , or other disclosure material set forth herein is only incorporated to the extent that no conflict arises between that incorporated material and the present disclosure material . | 8 |
the method of the invention allows for the production of diamonds doped with relatively large dopant atoms such as aluminium , arsenic , antimony and phosphorus which atoms are capable of providing the diamond with optical or electrical properties when situated in lattice positions in the crystal lattice of the diamond . the dopant atoms are introduced at total ion doses which are considerably lower than those illustrated and described in the above - mentioned european patent publications . the actual total ion dose used will vary according to the size of the dopant atom , the energy used and the area of the damaged region . such total dose will , however , be such that it will create less damage than would be created when carbon atoms are implanted to a density of 2 . 5 × 10 18 / cm 3 . the effect of this is to introduce less strain into the diamond lattice , yet allow for efficient and effective activation of the dopant atom on subsequent annealing . activaton of the implanted dopant atom is achieved by causing the dopant atoms to move into a substitutional or lattice position in the crystal lattice of the diamond . dopant atoms move by diffusing into a vacancy or a vacancy diffusing to the dopant atom . the driving force for this is the annealing . the annealing is preferably rapid annealing as described , for example , in european patent publication no . 0 573 312 . the annealing is rapid in the sense that the annealing temperature is reached in a short space of time . how rapid the annealing temperature is reached will be dependent on factors such as the annealing temperature selected and the thickness of the damaged layer or region . preferably the annealing is such that at the temperature selected , the temperature will be reached before the average time it takes for a self interstitial to move out of the damaged layer . generally the annealing temperature will be reached in less than 20 seconds and typically less than 1 second . the rapid annealing will generally not exceed 30 minutes . it has been found that activation is preferably achieved by first rapidly annealing at a temperature of less than 1200 ° c . followed by a second rapid anneal at a temperature of at least 1200 ° c . the invention has particular application to the doping of diamond with arsenic , antimony and phosphorus each of which , when electronically activated , can create good qualify n - type conducting layers . phosphorus is preferred since it has electrons just below the conduction band which makes it an excellent dopant atom for creating n - type conduction . for such atoms , and by way of example , it can be stated that the desired dopant atom density in the diamond may be achieved at total ion doses which are equivalent to a carbon ion dose of less than 5 × 10 13 over a range of energies up to 150 kev giving an implanted width of about 0 . 2 microns . generally , the total ion dose will not be less than 5 × 10 10 on this basis . the implantation of dopant atoms takes place at a low temperature in the manner described in the above european patent publications . this generally means that the temperature of implantation will be less than 0 ° c . and typically at the temperature of liquid nitrogen or lower . it is possible to create n - type layers , e . g . by implanting phosphorus atoms or ions , and p - type layers , e . g . implanting boron atoms or ions . it is thus possible to create a p - n junction by creating the two types of layers in a substrate . such p - n junctions may be used in various applications such as diodes , triodes , photovoltaic cells and transistors . the electrical properties of three type iia diamonds implanted with c + , b + and p + ions were compared such that in each the total amount and distribution of the implanted damage was the same . owing to the large mass of the p + ion and the limited capacity in the energy of the ion implanter used it was not possible to implant the phosphorus to the same depths as the c + and b + ion . accordingly , the damage distribution was obtained by implanting c + ions to the depths the p + could not reach . the doses used for the three implantations are shown in table 1 . thus , although the c + and b + ions were spread over the whole implantation - damaged layer of width 0 . 25 microns , the p + ions were only present to an average depth of ≈ 0 . 12 microns ( in an equivalent damaged layer ). diamonds iia ( b ), iia ( c ), and iia ( p ) were implanted with the ions and doses given in table 1 while maintaining them at liquid nitrogen temperature . afterwards , each one was rapidly heated from this low temperature to 500 ° c ., i . e . the temperature was reached in less than 20 seconds , and held at this temperature for 30 minutes . this was followed by two further rapid heatings from room temperature to 1200 ° c . ( for 10 minutes ) and to 1600 ° c . ( for 2 minutes ). the temperatures were again reached in less than 20 seconds . afterwards the diamonds were cleaned by boiling them in acids . to effect ohmic contacts on diamond iia ( c ), the contact areas were overdoped with boron . for the other two diamonds , silver foils were placed on the contact areas before clamping them for resistance measurements . because very high resistances were anticipated , all the measurements were made using a potential of 50 v . table 1__________________________________________________________________________energies , ions and doses used for the three diamonds . diamond iia ( b ) diamond iia ( c ) diamond iia ( p ) boron carbon phosphorusion : b . sup .⊥ ion : c . sup .⊥ ions : p . sup .⊥ and c . sup .⊥ energy dose energy dose energy dose ( kev ) ( cm . sup .- 2 ) ( kev ) ( cm . sup .- 2 ) ion ( kev ) ( cm . sup .- 2 ) __________________________________________________________________________130 2 . 25 × 10 . sup . 11 170 1 . 876 × 10 . sup . 11 c . sup .• 170 1 . 876 × 10 . sup . 11110 7 . 50 × 10 . sup . 10 140 6 . 280 × 10 . sup . 10 c . sup .• 140 6 . 280 × 10 . sup . 10100 3 . 75 × 10 . sup . 10 128 3 . 120 × 10 . sup . 10 c . sup .• 128 3 . 120 × 10 . sup . 1090 3 . 75 × 10 . sup . 10 116 3 . 120 × 10 . sup . 10 c . sup .• 116 3 . 120 × 10 . sup . 1080 3 . 75 × 10 . sup . 10 103 3 . 120 × 10 . sup . 10 c . sup .⊥ 103 3 . 120 × 10 . sup . 1070 3 . 75 × 10 . sup . 10 90 3 . 120 × 10 . sup . 10 c . sup .+ 90 3 . 120 × 10 . sup . 1060 3 . 75 × 10 . sup . 10 77 3 . 120 × 10 . sup . 10 p . sup .⊥ 165 8 . 875 × 10 . sup . 950 3 . 75 × 10 . sup . 10 64 3 . 120 × 10 . sup . 10 p . sup .⊥ 140 8 . 875 × 10 . sup . 940 3 . 75 × 10 . sup . 10 51 3 . 120 × 10 . sup . 10 p . sup .⊥ 113 8 . 875 × 10 . sup . 930 3 . 75 × 10 . sup . 10 37 3 . 120 × 10 . sup . 10 p . sup .⊥ 84 8 . 875 × 10 . sup . 9totals : b . sup .⊥ = 6 × 10 . sup . 11 cm . sup .- 2 c . sup .+ = 5 × 10 . sup . 11 cm . sup .- 2 p . sup .• = 3 . 55 × 10 . sup . 10 cm . sup .- 2__________________________________________________________________________ the results , as a function of inverse temperature , are compared in fig1 : 1 . diamond iia ( c ) only conducted at high temperatures with an activation energy of ≈ 2 . 2 ev , which is typical for a type iia diamond in its virgin state . thus , the residual damage introduced by the carbon - ion treatment did not lead to a noticable increase in the conductivity . 2 . as expected , the boron - doped diamond showed a lower resistance caused by p - type conduction ( as checked with a hot probe ). however , the activation energy is ≈ 1 . 2 ev and not 0 . 37 ev as expected for p - type diamond . it is known that in cold implantation - rapid annealing , boron - doped diamond there are donors at ≈ 1 . 2 to 1 . 5 ev above the valence band which compensate the acceptors . it would thus seem that in the present case the donor density is slightly more , or near to that of the acceptors . this will move the fermi level towards the donor position , thus increasing the activation energy . it is interesting to note that this layer is optically very active . after being exposed to light the resistance is much lower at room temperature than shown in fig1 . and increased slowly over a long time when keeping the diamond in the dark . this increase can be accelerated by heating the diamond . the curve in fig1 was measured after the resistance had settled down . 3 . it will be noted that the p + cold implantation - rapid annealing treated diamond [ iia ( p )] behaved different to diamonds iia ( c ) and iia ( b ). even though its contacts were non - linear ( non - ohmic ), it conducted better at low temperatures , changed resistance at a lower rate , and showed hysteresis between the heating and cooling measurement cycles . comparing this result to that of diamond iia ( c ), which contained the same residual damage , means that the conduction measured in diamond iia ( p ) could only have been caused by the presence of the phosphorus . corresponding results had not been found when using high ion dose phosphorus implantations . | 2 |
the present invention relates to a method and a molding system generally for replacing articles in structures having an outermost surface , and , more specifically , for replacing doors and windows in stucco buildings . referring to fig2 through 4 , using a conventional measuring device ( not shown ), measure the exterior cross - section of the existing article or existing window 20 , thus establishing a height h1 and a width w1 . next , measure the cross - section of the replacement article or window 30 to establish a height h2 and a width w2 . with these measurements completed , a determination can be made as to the margin m1 , m2 of stucco to be removed about the existing periphery p1 of the existing window 20 . this is accomplished by determining the difference δ h between the heights h2 and h1 as well as the difference δ w between the widths w2 and w1 and dividing these differences δ h , δ w by a factor of two , thus producing values which correspond to the margin m1 of stucco 1 / 2δ h to be removed along both the top and bottom edges of the existing window 20 as well as the margin m2 of stucco 1 / 2δ w to be removed along both the left and right sides of the existing window 20 . mark the stucco surface s about the periphery p1 of the existing window 20 . this may be performed in a conventional manner , such as inscribing tick marks t and popping a chalk line l along the tick marks t . hence , a new periphery p2 has been established , one which will accept the replacement window 30 being installed . the determination of a new perimeter about an opening may vary depending on the configuration of the opening . for example , whether the opening may be arcuate , circular , elliptical , et cetera . the opening illustrated was chosen for simplification of this description . now , referring to fig4 through 7 , after the new periphery p2 has been marked , cut through the stucco surface s along the chalk line l . this step may be performed with the aid of worm drive saw having a diamond or abrasive blade ( not shown ). the structure or building b associated with the existing window 20 should be sealed so as to prevent any dust created through the cutting of this stucco surface s from entering interiorly of the building b . the depth of the cut c should be slightly less that of the thickness of the stucco surface s . preferably , the integrity of the underlayment 14 , that is , the underlying asphalt impregnated felt paper , should not be compromised . typically , standard stucco thickness ranges between seven eighths of an inch to one inch . cutting the stucco at a depth d of three quarters of an inch could reduce and possibly eliminate the disfigurement of the felt paper 14 . flashing paper and caulking ( not shown ) can be used , if necessary , to repair areas of damage to the underlayment 14 . the margin m1 , m2 of stucco surface s defined within the new periphery p2 is now removed . this task could be completed through the use of a small cold chisel ( not shown ), holding the chisel centrally in the margin m1 , m2 against the stucco surface s . the chisel should be held at an angle 45 degrees relative to the stucco surface s . in most circumstances , this margin m1 , m2 of stucco surface s cleanly separates form the underlying wire or mesh lathing 16 . occasionally , it may be necessary to cut the lathing 16 which secures the stucco surface s along the periphery of the cut c , and thus , prevent any unnecessary damage to the stucco surface s outside of the margin m1 , m2 and beyond the area which the molding system 100 will cover . wire nippers ( not shown ) may facilitate in cutting the lathing 16 . if during this removal step the stucco surface s becomes damaged beyond the area in which the molding system 100 ( shown in fig1 through 12 ) will cover , the damaged area may easily be repaired with proper color coating or through patching damaged area and painting the patched damaged area with matching masonry paint . after the necessary margin m1 , m2 of stucco surface s has been removed , the remaining lathing 16 is cut with the wire nippers as closely to the cut c or the new periphery p2 as possible . all of the lathing nails 18 are removed from the margin m1 , m2 as well . this renders a clean cut condition within the margin m1 , m2 which maximizes the removal of the existing window 20 as well as the quality of impending installation of the replacement window 30 in regards to vapor barrier , durability , and aesthetic appearance . once the aforementioned steps have been completed , a thorough clean up of the exterior of the building b is conducted . this reduces the risk of any dust or debris ( created in the foregoing steps ) from entering into the building b , thus lessening the amount of interior clean up . next , remove the fasteners 22 from the mounting flange 24 or nail on fin which secures the existing window 20 to the surrounding framing members 26 . it may be necessary to lift the flashing paper 14 about the sides and top of the existing window 20 in order to gain access to fasteners 22 therebehind . just prior to removing the last fastener from the mounting flange 24 , apply a slight inward force f in against the existing window 20 to ensure that the same does not fall forward out of the opening 10 , as is shown in fig7 . when the last fastener 22 is removed and with the existing window 20 being supported from the exterior of the building b , the top of the existing window 20 may freely fall forward out of the opening 10 , pivoting on the bottom thereof . the bottom may now be lifted and completely removed from the opening 10 . if necessary , a gentle outward force f out may need to be exerted against a top interior portion of the existing window 20 to urge the same outward . this type of pivotal or &# 34 ; hinge - type &# 34 ; removal may reduce the risk of injury . once the existing window 20 has been removed , the replacement window 30 may be installed . measure the cross - section of the opening 10 . compare these measurements with those required by the manufacturer &# 39 ; s specifications for the installation of the replacement window 30 ( shown in fig8 through 10 ). if the opening 20 is too large , shim the opening 10 equally about the periphery p1 until the opening 10 is sized according to the specifications . it is crucial that the opening 10 be shimmed equally about the periphery p1 so as to ensure that the replacement window 30 is centered within the opening 10 when the shimming is completed . it is advisable that the opening 10 be measured once again and that this measurement be compared with the manufacturers specification . also , measure the replacement window 30 and compare this measurement with the measurement of the opening 10 . this will further ensure that the opening 10 has been properly sized . referring to fig8 through 10 , after the opening 10 has been sized , the replacement window 30 can be installed in the opening 10 . caulk the innermost edge of the new mounting flange 34 and set the replacement window 30 in the opening 10 . both the sides and the top of the existing flashing paper 14 should overlap the new mounting flange 34 and the new mounting flange 34 should overlap the existing bottom strip of flashing paper 14 along the bottom of the replacement window 30 ( shown in fig9 ). this overlapping is a conventional practice which prevents penetration of moisture beyond the new mounting flange 34 . the caulking of the innermost edge of the mounting flange 34 further prevents penetration of moisture beyond the new mounting flange 34 . the replacement window 30 is now checked to ensure that the same is square as well as level and plumb in the opening 10 . more shimming about the opening 10 , such as with shim 28 , may be necessary to properly center the replacement window 30 therein . this guarantees the long lasting functional and aesthetic qualities of the replacement window 30 . at this point , the replacement window 30 is secured in place , preferably with corrosion resistant ( i . e . galvanized ) fasteners 32 to the underlying or surrounding framing members 26 . determine the dimensions and the desired mounting locations of the angular stress retention clips 102 . cut the angular stress retention clips 102 according to the dimensions and apply a generous and uninterrupted bead of adhesive caulk 106 along the entire length of each angular stress retention clip 102 . the caulk 106 is applied on the surface of the angular stress retention clip 102 which abuts the cut c or the new periphery p2 the stucco surface s . the angular stress retention clips 102 are each then pressed into position within the recess r about the perimeter of the replacement window 30 . the innermost edge 108 of each angular stress retention clip 102 overlaps the previously secured new mounting flange 34 of the replacement window 30 . an angular stress retention clip 102 is secured along each the top , the bottom , and the two sides of the replacement window 30 . corrosion resistant fasteners 22 are used to secure the angular stress retention clips 102 in place , the angular stress retention clips 102 being secured to the existing underlying framing members 26 surrounding the replacement window 30 . next , determine the necessary dimensions for the peripheral molding 120 . measure from the exterior molding receptor groove 36 located along one edge of the replacement window 30 to the exterior molding receptor groove 36 on an opposite edge of the replacement window 30 . this will provide the interior lengths i1 , i2 of the peripheral molding 120 ( shown in fig9 ). cutting opposite ends of each piece of peripheral molding 120 at an angle of 45 degrees will ensure a continuous engagement of the peripheral molding 120 about the perimeter of the replacement window 30 and a solid engagement of the peripheral molding 120 with both the angular stress retention clips 102 and the receptor groove 36 . finally , after having measured and cut the pieces of peripheral molding 120 , apply the peripheral molding 120 by first engaging a return 122 located at one end of the peripheral molding 120 with a tab 110 located on the underside of the angular stress retention clips 102 juxtaposed the surface s of the supporting structure . next , engage a return 124 located at an opposite end of the peripheral molding 120 with the receptor groove 36 located about the perimeter of the replacement window 30 . it may be necessary to gently tap the peripheral moulding 120 into the tab 110 and the receptor groove 36 , such as with a rubber mallet ( not shown ). fig1 and 12 show the molding system 100 being comprised of two parts , an angular stress retention clips 102 and a peripheral molding 120 . the peripheral molding 120 is comprised of an elongated substantially u - shaped member having a first substantially planar surface 126 . the first surface 126 has a second surface 128 attached at one end and a third surface 130 at an opposite end . each of these surfaces 128 , 130 are attached at substantially right angles relative to the first surface 126 . the second surface has a bend 132 lying in a plane parallel to that of the first surface 126 and being directed toward the third surface 130 . the bend 132 has a protrusion 134 directed toward the first surface 126 . the bend 132 and protrusion 134 in combination with the second surface 128 form a first return 122 which is frictionally engagable with the angular stress retention clip 102 . the third surface 130 has a protrusion 134 in a direction away from the second surface 128 . the protrusion 134 in combination with the third surface 130 form a second return 124 which is frictionally engagable with a receptor groove 34 located around the perimeter of the replacement window 30 . when the peripheral molding 120 is installed about a window , the joint between the window and the supporting surface is concealed . the angular stress retention clips 102 is an elongated substantially z - shaped member having a first substantially planar surface 112 integral with a second substantially planar surface 114 , these surfaces 112 , 114 being disposed at an angle a of 90 degrees relative to one another . these two surfaces 112 , 114 are fastened in a recess r about the perimeter of the replacement window 30 such that the first surface 112 contacts the flashing 14 and overlaps the new flange 34 and the second surface 114 contacts the cut edge c of the surface s of the supporting structure b . a third substantially planar surface 116 is integral with the second surface . these two surfaces 114 , 116 are disposed at an angle b less than 90 degrees relative two one another and opposite to angle a . this configuration creates a tension force f t between the third surface 116 and the surface s of the supporting structure b attached thereto . a tab 110 is provided at an end of the third surface 116 opposite the end integral with the second surface 114 . the first return 122 of the peripheral molding 120 is frictionally engagable with the tab 110 . the tension force f t holds the first return 122 tight between the third surface 116 of the angular stress retention clip 102 and the surface s of the supporting structure b . it is to be understood that the present invention is not limited to the sole embodiment described above , but encompasses any and all embodiments within the scope of the following claims . | 4 |
in one embodiment of the invention , a twin chamber microwave ablation hub comprises a plurality of inserts and o - rings causing seals between the chambers . a first chamber provides fluidic connection to an input port and a second chamber provides fluidic connection to an exit port . a dual path lumen provides fluidic connection from the first chamber to the second chamber . the first and second chambers are adapted to minimize the presence of air bubbles in a cooling fluid as the fluid travels through the input port and the first chamber , through a first path in the lumen to the distal end of an ablation probe . the cooling fluid returns via a second path in the lumen to the second chamber and exits the hub via the exit port . the first path and second path are concentric . the term “ probe ” is not limited to the present embodiment or depiction . naturally , the efficacy of the present invention may be optimized by different types of devices intended to facilitate energy focalization in a body , such as electrodes , antennas or other suitable device . the term “ probe ” is used to include any device , mechanism or structure capable of being inserted into a body and allowing an energy source to be focalized for ablation or other medical treatment . fig1 is a view of an embodiment of the invention showing a hub 10 and probe 20 . hub 10 comprises a first chamber 30 , a second chamber 40 , a first lumen path 50 , a second lumen path 60 , a first port 70 and a second port 72 . first port 70 fluidicly couples to first chamber 30 . first chamber 30 fluidicly couples to first lumen path 50 . first lumen path 50 extends along a substantial portion of the probe 20 . the second lumen path 60 extends around and along the first lumen path 50 and fluidicly couples with the second chamber 40 . the first 30 and second 40 chambers are defined by inserts inside the hub 10 . a first insert 80 fits inside one end of hub 10 . in one embodiment , the first chamber 30 is at one end by the first insert toward the handle end of the hub 10 . the first insert 80 is positioned against stops 88 . stops 88 provide a positioning stop on the interior walls 90 of the hub for the first insert 80 . the stops 88 provide a more precise positioning for the first insert 80 and eliminate placement guesswork . this allows for ease of insertion by providing a physical indicator of the proper insertion position . the interior walls 90 of the hub 10 may be graduated so that they are of decreasing diameter from the handle end of the hub to the stops 88 . this also allows for ease of insertion as well as precision in placement . in an embodiment of the invention , the graduation of the interior walls ceases prior to the stop 88 , creating a zone where the interior wall 90 is flat . as discussed below , the flat zone in wall 90 allows for more reliable sealing of the first chamber 30 . an o - ring 82 is positioned in space 83 of the insert first 80 . it is understood that the space 83 is a groove or other indentation in the first insert 80 . when the first insert 80 in inserted into the hub 10 to the proper depth , the o - ring 82 will contact the flat portion of the interior wall . the o - ring 82 provides for continued sealing in the event of slight movement or slight inaccuracies in the manufacture of the first insert 80 or hub 10 . the flat area allows for continued contact of the o - ring 82 in the event of slight movement . the o - ring 82 provides a water - tight seal for the first chamber 30 . accordingly , any cooling fluid will not flow around chamber 30 and past stops 88 . the second chamber 40 is positioned distally of the first chamber 30 , toward the probe end of the hub 10 . as noted above , the first insert 80 is inserted inside the hub 10 to stops 88 . one end of the second chamber 40 is formed by the back side of the first insert 80 . the second chamber 40 is completed by second insert 95 opposite the first insert 80 . insert 95 is inserted into the distal end of the hub 10 opposite the first insert 80 . in one embodiment , the interior walls of the hub 10 at the distal end are graduated so that they are of decreasing diameter from the end of hub 10 to the interior . the graduation of the interior walls ceases at the location where the o - ring 84 reside . this creates a flat zone which allows continued sealing in the event of slight movement or slight inaccuracies in the manufacture of the insert 95 or hub 10 . the graduation of the interior walls of hub 10 allow for ease of insertion of insert 95 as well as precision in placement . the insert 95 comprises an end portion 96 adapted to provide a stopping mechanism . the end portion 96 acts to contact the end of hub 10 . end portion 96 abuts the hub 10 and provides for precision in placement . an o - ring 84 is positioned in the second insert 95 to contact the interior wall 90 when the second insert 95 is inserted into the hub 10 . the o - ring 84 is positioned in space 98 of the second insert 95 . the o - ring 84 provides a water - tight seal for the second chamber 40 . accordingly , cooling fluid will not flow around chamber 40 or into the first chamber 30 . the second insert 95 is molded to hub 10 on the opposite end of the hub 10 from handle 100 . the molding maintains closure and sealing during high pressure conditions . when the second insert 95 is inserted , a centered position in the hub is desired to help eliminate any leakage that may occur otherwise . an annular ring 120 is utilized to maintain a centered position of the second insert 95 and the o - ring 84 within the hub 10 . when the second insert 95 in inserted so that the end portion 96 abuts the hub 10 , the annular ring 120 contacts the interior wall 90 and disallows movement of the second insert 95 . a third o - ring 86 is positioned in handle 100 . the third o - ring 86 provides a fluid seal on the back side of chamber 30 . the handle 100 in inserted into the end of the hub 10 opposing the position of insert 95 . in an embodiment , the handle 100 is molded to hub 10 . the handle 100 is adapted to abut or closely abut first insert 80 . the position of insert 80 is maintained by the handle 100 under high pressure conditions . handle 100 connects to the probe 20 . box 110 disallows improper insertion of the handle 100 and ensures that the probe 20 is connected properly through the hub 10 . box 110 protrudes away from the hub to disallow upside down insertion of the handle 100 . the probe 20 protrudes through the first 30 and second 40 chambers and first 80 and second 95 inserts . fig2 is a perspective view of an embodiment of the invention showing hub 210 and probe 220 extending from within the handle 299 out through the distal end of the hub 210 . the probe 220 connects within the handle 299 to a power source ( not shown ). hub 210 comprises a first chamber 230 , a second chamber 240 , a first lumen path 250 , a second lumen path 260 and a first 270 and second 272 port . in an embodiment , the first 270 and second 272 ports are angled in relation to the axis of the hub 210 so that they are not perpendicular to the axis . the angle of the ports 270 , 272 forms an acute angle toward the proximal end of the hub 210 . the handle 299 forms a seal at the proximal end of the hub 210 . a first insert 280 forms the first chamber 230 between the handle 299 and the first insert 280 . a second insert 295 forms the second chamber 240 between the first insert 280 and the second insert 295 . the first chamber 230 is sealed by an o - ring 282 on the distal end of the chamber 230 and an o - ring 286 on the proximal end of the chamber 230 . the second chamber 240 is sealed by o - ring 282 and an o - ring 284 on the distal end of the second chamber 240 . each o - ring 282 , 284 , 286 resides in a groove , or other formation , formed to receive the o - ring in the first insert 280 , the second insert 295 and the handle 299 , respectively . the first lumen path 250 forms a fluid passage allowing a cooling fluid to travel from the first chamber 230 along the probe 220 to the distal end of the probe 220 . the cooling fluid provides a cooling action along the length and tip ( not shown ) of the probe 220 . the second lumen path 260 provides a return passage for the cooling liquid and is fluidicly coupled to the second chamber 240 . the cooling liquid returns concentrically and outside the first lumen path 250 and empties into the second chamber 240 . as noted above relating to fig1 and 2 , the first insert ( 80 in fig1 and 280 in fig2 ) defines a boundary for the first chamber ( 30 in fig1 and 230 in fig2 ) and causes the cooling fluid to spin and thus reduce the presence of air bubbles . fig3 provides a detailed view of the first insert 280 . as noted above , the first insert 280 creates the first chamber ( 230 fig2 ). the first insert 280 creates the chamber by using a seal 310 in the hub ( 210 fig2 ). in an embodiment , the seal 310 is an o - ring which fits in a grooved portion 320 , or other formed recess , of the insert . the grooved portion 320 is adapted to accommodate the o - ring 310 . cooling fluid flows into the first chamber and fills the space within the first insert 280 . the geometry 325 on the insert 280 is concave and induces spin in the cooling fluid as it enters the first chamber . the vortex type action induced on the cooling fluid allows it to move around the probe as it moves down the first lumen path . the vortex action aids in the elimination of air bubbles which may cause overheating of the probe . the first insert 280 comprises a plurality of legs 330 . in one embodiment , four legs 330 provide support for the first insert 280 . the legs 330 provide a mechanism to abut the handle ( not shown in fig3 ) when the hub ( not shown in fig3 ) is assembled . the legs 330 will push against the handle to force the insert 280 against the stops on the interior of the hub . referring again to fig1 , regarding the operation of the invention . cooling fluid flows into the first port 70 and fills the first chamber 30 . in one embodiment , the first chamber 30 is sized so that it fills with fluid relatively rapidly . the first insert 80 is shaped so that the fluid entering the first chamber 30 spins in a circular manner . the spinning of the fluid causes any residual air bubbles to be removed from the probe 20 and the walls of the first chamber 30 . air bubbles are known in the art to cause over - heating of the probe 20 and lead to failure of the device . the o - ring 82 in the first insert 30 seals the chamber 30 , thus not allowing fluid to enter the second chamber 40 . it is understood by those skilled in the art that the first insert 30 provides sealing . the o - ring 82 provides an extra level of sealing to ensure integrity under pressure conditions . the handle 100 has the o - ring 86 to create a seal on the back side of the first chamber 30 . it is understood by those skilled in the art that the handle 100 provides a level of sealing . the o - ring 86 provides an extra level of sealing to ensure integrity under pressure conditions . the cooling fluid flows out of chamber 30 and through the first lumen path 50 . the first lumen path 50 carries the cooling fluid to the proximal end of the probe 20 providing a cooling effect on the probe 20 . the cooling fluid returns to the hub 10 via the second lumen path 60 . the cooling fluid empties from the second lumen path 60 into the second chamber 40 . the second chamber is sealed by the o - ring 82 on one end which is positioned in the first insert 80 and the o - ring 84 which is positioned in the second insert 95 . it is understood by those skilled in the art that the second insert 95 provides a level of sealing . the o - ring 84 provides and extra level of sealing to ensure integrity under pressure conditions . as the cooling fluid pressure increases in the hub 10 , the pressure will cause a separating force on the components within the hub 10 . this pressure will stress the position of the o - ring 82 in the first insert 80 and the o - ring 84 of the second insert 95 . an external geometry ( not shown ) positioned on the outside of the handle 100 will hold the handle 100 in place and resist movement of the inserts 80 , 95 and o - rings 82 , 84 . referring again to fig2 , the microwave assembly is easily manufactured with the hub 210 , the first insert 280 , the second insert 295 and the handle 299 . the first insert 280 is inserted into the hub 210 until it abuts the stops 288 which are formed on the inside of the hub 210 . the o - ring 282 in the first insert provides a seal against the interior wall of hub 210 . in an embodiment , the wall of the hub 210 is graduated so that the circumference lessens toward the middle of the hub 210 . the graduation levels off and ceases as the wall nears the stop 288 to allow a location for the o - ring 282 to seal . the interior lumen path 260 connects to the central hole 292 in the first insert 280 . the lumen paths 250 , 260 protrude through the end of the hub 210 . the second insert 295 is inserted over the lumen paths 250 , 260 and into the distal end of the hub 210 . o - ring 284 fits in a groove around the second insert 295 and forms a seal against the interior wall of the hub 210 . in one embodiment , the wall at the distal end of the hub 210 is also graduated so that the circumference lessens toward the middle of the hub 210 . the graduation levels off and ceases at a predetermined location which coincides with the position of the o - ring 284 . the second insert 295 is molded to the distal end of the hub 210 to provide stability during high pressure situations . the handle 299 and the probes are inserted into the proximal end of the hub 210 . the probe 220 passes through the central holes in the inserts 280 , 295 and helps create and enforce the lumen paths 250 , 260 . in an embodiment , the handle 299 and probe 220 are pre - assembled to maintain a sound electrical connection . a lip portion 298 extends from the portion of the hub 210 opposite the ports 270 , 272 . the lip portion 298 allows the insertion of the handle 299 in only one way to assure proper insertion of the handle 299 . insertion of the handle 299 provides sufficient pressure on the first insert 280 to maintain the insert 280 in the proper position . the stop 288 on the interior of the hub 210 wall prevents the first insert from being inserted too far inside the hub 210 . the handle 299 is then molded to the hub 210 . it is understood that the above described embodiments are only illustrative of the application of the principles of the present disclosure . numerous modifications and alternative arrangements may be devised by those skilled in the art without departing from the spirit and scope of the present disclosure . the appended claims are intended to cover such modifications and arrangements . | 0 |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.