content
stringlengths 1
34.9k
| document_title
stringlengths 2
250
| section_title
stringlengths 0
362
| last_edit_date
timestamp[ns]date 2008-06-15 10:45:44
2024-10-09 14:23:49
| url
stringlengths 33
548
| num_tokens
int64 4
15.9k
| block_metadata
dict |
|---|---|---|---|---|---|---|
| RahXephon O.S.T. 2 | |
| --- | --- |
| Soundtrack album by Ichiko Hashimoto | |
| Released | June 21, 2002 |
| Label | Victor EntertainmentVICL\-60871 (Japan, CD) |
| Producer | Yoshimoto Ishikawa |
| Ichiko Hashimoto chronology | |
| | *RahXephon O.S.T. 1*(2002\) | ***RahXephon O.S.T. 2***(2002\) | *RahXephon O.S.T. 3*(2002\) | | --- | --- | --- | | | | List of RahXephon albums | Albums > RahXephon O.S.T. 2 | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#RahXephon%20O.S.T.%202 | 199 | {
"language": "en",
"type": "infobox"
} |
| RahXephon O.S.T. 3 | |
| --- | --- |
| Soundtrack album by Ichiko Hashimoto | |
| Released | August 21, 2002 |
| Label | Victor EntertainmentVICL\-60915 (Japan, CD) |
| Producer | Yoshimoto Ishikawa |
| Ichiko Hashimoto chronology | |
| | *RahXephon O.S.T. 2*(2002\) | ***RahXephon O.S.T. 3***(2002\) | *Turned Perspective 1994\-2001*(2002\) | | --- | --- | --- | | | | List of RahXephon albums | Albums > RahXephon O.S.T. 3 | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#RahXephon%20O.S.T.%203 | 197 | {
"language": "en",
"type": "infobox"
} |
| RahXephon Pluralitas Concentio O.S.T. | |
| --- | --- |
| Soundtrack album by Ichiko Hashimoto | |
| Released | 23 April 2003 |
| Label | Victor EntertainmentVICL\-61105 (Japan, CD) |
| Ichiko Hashimoto chronology | |
| | *Turned Perspective 1994\-2001*(2002\) | ***RahXephon Pluralitas Concentio O.S.T.***(2003\) | *Ub\-X*(2003\) | | --- | --- | --- | | | | List of RahXephon albums | Albums > RahXephon Pluralitas Concentio O.S.T. | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#RahXephon%20Pluralitas%20Concentio%20O.S.T. | 192 | {
"language": "en",
"type": "infobox"
} |
| | |
| --- | --- |
| Stockton\-Curry House | |
| U.S. National Register of Historic Places | |
| | |
| | |
| Stockton-Curry HouseShow map of FloridaStockton-Curry HouseShow map of the United States | |
| Location | 121 N. Duval St.,Quincy, Florida |
| Coordinates | 30°35′23″N 84°34′28″W / 30\.58972°N 84\.57444°W / 30\.58972; \-84\.57444 |
| Area | less than one acre |
| Built | c. 1842 |
| Architect | Isaac R. Harris |
| Architectural style | Classical Revival |
| NRHP reference No. | 74000629 |
| Added to NRHP | December 31, 1974 | | Stockton-Curry House | 2023-10-06T17:45:57 | https://en.wikipedia.org/wiki/Stockton-Curry_House# | 240 | {
"language": "en",
"type": "infobox"
} |
|
| "Hemisphere" | |
| --- | --- |
| Single by Maaya Sakamoto | |
| from the album *RahXephon O.S.T. 1* | |
| Released | February 21, 2002 |
| Songwriter(s) | Yuho Iwasato, Yoko Kanno |
| Producer(s) | Yoko Kanno |
| Maaya Sakamoto singles chronology | |
| | "Mameshiba" (2000\) | "**Hemisphere**" (2002\) | "Gravity" (2002\) | | --- | --- | --- | | | | List of RahXephon albums | Singles > Hemisphere | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Hemisphere | 186 | {
"language": "en",
"type": "infobox"
} |
The Stockton-Curry House (also known as the Philip A. Stockton House or C.H. Curry House) is a historic house located in Quincy, Florida. It is locally significant as a surviving example of antebellum-era Classic Revival architecture. | Stockton-Curry House | 2023-10-06T17:45:57 | https://en.wikipedia.org/wiki/Stockton-Curry_House# | 70 | {
"language": "en",
"type": "text"
} |
|
| "Tune the Rainbow" | |
| --- | --- |
| Single by Maaya Sakamoto | |
| from the album *RahXephon Pluralitas Concentio O.S.T., and Single Collection\+ Nikopachi* | |
| Released | April 2, 2003 |
| Songwriter(s) | Yuho Iwasato, Maaya Sakamoto, Yoko Kanno, Chris Mosdell |
| Producer(s) | Yoko Kanno |
| Maaya Sakamoto singles chronology | |
| | "Gravity" (2002\) | "**Tune the Rainbow**" (2003\) | "Loop" (2005\) | | --- | --- | --- | | | | List of RahXephon albums | Singles > Tune the Rainbow | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Tune%20the%20Rainbow | 211 | {
"language": "en",
"type": "infobox"
} |
It was originally of clap-boarded frame construction, two-and-a-half stories in height, and covered by a moderately pitched roof. It had a rectangular plan with a broad central hall, two rooms deep, and the stairs were partitioned within one of the rear bedrooms. It was added to the National Register of Historic Places on December 31, 1974. | Stockton-Curry House | Description and history | 2023-10-06T17:45:57 | https://en.wikipedia.org/wiki/Stockton-Curry_House#Description%20and%20history | 97 | {
"language": "en",
"type": "text"
} |
This is a list of music albums and singles from the Anime series RahXephon. | List of RahXephon albums | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums# | 30 | {
"language": "en",
"type": "text"
} |
|
RahXephon O.S.T. 1 is the first soundtrack album released for RahXephon. Except for the opening track, Hemisphere, all music and lyrics are by Ichiko Hashimoto and performed by her. She is joined by her sister Mayumi Hashimoto on the last track. "Yume no Tamago (Egg of the Dream)", the last track, was used as the ending theme for all but the last episode. The musical theme from this track also appears as one of the musical themes in the ending of the last episode, "Before you know". It is also used by "Second Sorrow" in episode 19 "Blue Friend". | List of RahXephon albums | RahXephon O.S.T. 1 | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#RahXephon%20O.S.T.%201 | 168 | {
"language": "en",
"type": "text"
} |
"Hemisphere" (Maaya Sakamoto, Yoko Kanno, Yuho Iwasato)
"Members Only"
"Avant, Rendezvous"
"Misty Midnight"
"He Feels Uneasy"
"Fate of Katun"
"12 Years"
"Lovely Night"
"Temptation"
"Flew Over"
"Face Lost"
"Invisible Motion"
"The Chariot"
"Their Daily Lives"
"Bad News"
"Winning Sound of Her"
"Magic Handling"
"Mulians"
"The Tremendous Egg"
"Solitudes"
"Yume no Tamago (Egg of the Dream)" | List of RahXephon albums | Track listing | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Track%20listing | 159 | {
"language": "en",
"type": "text"
} |
RahXephon O.S.T. 2 is the second soundtrack album from the anime series RahXephon. All music and lyrics are by Ichiko Hashimoto and performed by her. She is again joined by her sister Mayumi Hashimoto on the song "Yume no Tamago (Egg of the Dream)". Houko Kuwashima, the voice of Quon, also sings on this album. Hashimoto described this as "more organic" than the first soundtrack, and it contains some music that was recorded after the series had begun airing. The theme of "La, la Maladie du Sommeil" is from Polovetsian Dances. This track is featured on the album Junsyoku Brilliant (緋色brilliant) (VICL-61796). | List of RahXephon albums | RahXephon O.S.T. 2 | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#RahXephon%20O.S.T.%202 | 199 | {
"language": "en",
"type": "text"
} |
The track "Huge Suites" (sampleⓘ) features a melody played in turn by different instruments, over a snare drum rhythm and a counter-melody, beginning quietly and rising in a crescendo. This track thus shares some of its structure with Maurice Ravel's Boléro. The initial rhythmic pattern in "Huge Suites" is simpler than that in Boléro, consisting of only 6 beats. The track as a whole is more ornate, however, with transitions in melody theme and rhythmic pattern. While the main melody of Boléro transitions back and forth between two themes ( ), this track transitions back and forth between four themes. The first rhythmic change is at 1:23, coinciding with the third theme transition. At 2:00, the string section returns to the original rhythmic pattern while the percussion does not; the previous rhythm thus becomes a counter-rhythm. In contrast, Boléro keeps the same rhythmic pattern going all the way until the end. "Huge Suites" has its final transition at 2:18, where the counter melodies end and both the rhythm and theme dive into a crescendo that builds for the last 40 seconds of the track. The main theme from this track is also used for the song "Brave" on the next album. | List of RahXephon albums | Content and use | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Content%20and%20use | 316 | {
"language": "en",
"type": "text"
} |
"Runnin'"
"l'Aile"
"Their Secret"
"A Few Memories"
"Protocols"
"La, la Maladie du Sommeil" Vocals: Houko Kuwashima and Ichiko Hashimoto.
"Adolescent"
"Quantum Corridor"
"TERRA"
"Huge Suites"
"Her Hatching"
"Orchestra Stalls"
"Synchronic Brake Down"
"Vanishing Jupiter"
"Flying Fighter"
"Ramblin'"
"Phantom of Theatre"
"Perfect Noise"
"The Other Stranger"
"Yume no Tamago" (Egg of the Dream) (English version) | List of RahXephon albums | Track listing | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Track%20listing | 165 | {
"language": "en",
"type": "text"
} |
RahXephon O.S.T. 3 is the third and last soundtrack album from the anime television series RahXephon, but it is followed by the soundtrack to the RahXephon movie. All music and lyrics are by Ichiko Hashimoto and performed by her and supporting musicians. Houko Kuwashima, the voice of Quon, sings an intentionally distorted theme from Alexander Borodin's Polovetsian Dances on track 18 "Way to the Tune". | List of RahXephon albums | RahXephon O.S.T. 3 | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#RahXephon%20O.S.T.%203 | 129 | {
"language": "en",
"type": "text"
} |
The album opens on "Midday Dream", a slightly chaotic jazz improvisation that is followed by two tracks with shouting vocals: "Guten Morgen" and "First Explosion". "Mad Wing" takes the chaos to a crescendo. "Brave" has a fast-beat backing track heavy on percussions with occasional electric guitar solos and English vocals performed by Hashimoto; the melody is the main theme from "Huge Suites" on the previous album. Track 6 "Tailspins" is a fast-beat track that was used for the air battle in the series episode 1. | List of RahXephon albums | Content and use | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Content%20and%20use | 149 | {
"language": "en",
"type": "text"
} |
Tracks 7 through 12 are piano sonatas; the first one, "Innocent World", is playful and up-tempo while the rest are calmer, meditative pieces similar to "Solitudes" from the first album. Track 14 "Writes herself" was used for episode 19, as was track 16 "Second Sorrow", which is a version of the ending theme "Yume no Tamago". Track 15 "Reverse Point" is a piece performed by a double string quartet (an octet) and used for the planning scene in episode 21. | List of RahXephon albums | Content and use | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Content%20and%20use | 136 | {
"language": "en",
"type": "text"
} |
"Object Float" is used in the "tuning", along with "My Soundscape", which also appears in some "eyecatches" (commercial bumpers) in previous episodes. "Way to the Tune" starts out as a distorted version of Gliding Dance of the Maidens from Polovetsian Dances performed by Houko Kuwashima, receding into synthesizer ambience. | List of RahXephon albums | Content and use | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Content%20and%20use | 108 | {
"language": "en",
"type": "text"
} |
"Before you know" is used for the ending credits of the final episode. It starts out as symphonic piece with french horns, strings, harp and wood blocks. Clarinette and flute then play the lead, joined by strings. A string bridge takes the track to a transition where the lead is played by drawn strings accentuated by pizzicato violin, while an electronic hi-hat and brush beat fades into the symphony. The melody transitions into a version of "Yume no Tamago", brought to the fore with tubular bells and grand piano, while a pronounced snare drum is added to the beat. The final track "Previous notice" is a short and fast composition for piano and drum kit that was used for the episode previews. | List of RahXephon albums | Content and use | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Content%20and%20use | 196 | {
"language": "en",
"type": "text"
} |
"Midday Dream"
"Guten Morgen"
"First Explosion"
"Mad Wing"
"Brave"
"Tailspins"
"Innocent World"
"Forbidden Ponds"
"Secret Seeker"
"Inner Take"
"Door Of Adolescence"
"Over The Senses"
"Dense Blue Water"
"Writes Herself"
"Reverse Point"
"Second Sorrow"
"Object Float"
"Way to the Tune"
"My Soundscape"
"Before You Know"
"Previous Notice" | List of RahXephon albums | Track listing | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Track%20listing | 138 | {
"language": "en",
"type": "text"
} |
RahXephon Pluralitas Concentio O.S.T. is the official soundtrack album from the anime movie RahXephon: Pluralitas Concentio, part of the RahXephon series. The album does not contain all the music featured in the film, but the "missing" music can be found on the other RahXephon sound track albums. All music, except for the single tracks "Tune the Rainbow" and "Hemisphere", is composed by Ichiko Hashimoto. | List of RahXephon albums | RahXephon Pluralitas Concentio O.S.T. | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#RahXephon%20Pluralitas%20Concentio%20O.S.T. | 143 | {
"language": "en",
"type": "text"
} |
Tracks 1 through 12 on the original version are original compositions for the movie, while tracks 13 through 21 are reprises from the TV series soundtracks. "Yesterday, today"
"Opening title"
"Sleeping beauty"
"Lost memories"
"Tenderness"
"Fatal request"
"Her decision"
"Loud conductor"
"Words at abyss"
"Déjà vu"
"Promised world"
"Tune the Rainbow"
"Fledgling dream" (English version of "Yume no tamago")
"Katun no sadame" (Fate of Katun)
"L'aile"
"Melancholia"
"Un rêve ~ Yume"
"La maladie du sommeil"
"Brave"
"Hemisphere"
"Yume no tamago" | List of RahXephon albums | Original version | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Original%20version | 192 | {
"language": "en",
"type": "text"
} |
"Yesterday, Today"
"Opening Title"
"Sleeping Beauty"
"Tenderness"
"Lost Memories"
"Blue"
"Yume No Tamago" (Piano version)
"Fatal Request"
"Her Decision"
"Loud Conductor"
"If, We Were"
"Words At Abyss"
"Deja Vu"
"Promised World"
"Tune the Rainbow" | List of RahXephon albums | Box set version | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Box%20set%20version | 107 | {
"language": "en",
"type": "text"
} |
"Hemisphere" (ヘミソフィア, Hemisofia) is the 10th single by Japanese singer Maaya Sakamoto. The lyrics were written by Yuho Iwasato and the music was composed and arranged by Yoko Kanno. "Hemisphere" was used as the opening theme for Yutaka Izubuchi's anime series RahXephon, in which Sakamoto also played a character. The track is included in the soundtrack albums RahXephon O.S.T. 1 and Super Robot Wars MX OST. It is also included in Sakamoto's Single Collection+ Nikopachi single collection album. | List of RahXephon albums | Hemisphere | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Hemisphere | 154 | {
"language": "en",
"type": "text"
} |
The single includes the instrumental version of "Hemisphere" that was used for the opening of RahXephon episode 4. Not included is a re-arranged synthesizer version of "Hemisphere" that appeared in the Super Robot Wars MX game itself. The only other song featured on the single is called "Music". | List of RahXephon albums | Hemisphere | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Hemisphere | 85 | {
"language": "en",
"type": "text"
} |
"Hemisphere" (ヘミソフィア)
"Music" (音楽, Ongaku)
"Hemisphere" (ヘミソフィア) (instrumental) | List of RahXephon albums | Single track listing | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Single%20track%20listing | 52 | {
"language": "en",
"type": "text"
} |
"Tune the Rainbow" is the 12th single by Japanese singer Maaya Sakamoto. The lyrics to the title track were written by Yuho Iwasato and the music was composed and arranged by Yoko Kanno. It was used as the ending theme for the anime television movie RahXephon: Pluralitas Concentio in which Sakamoto also voiced a character. It was included in both the soundtrack album RahXephon Pluralitas Concentio O.S.T. and in the Single Collection+ Nikopachi single collection. The single features a track called "The Garden of Everything", with lyrics by Sakamoto and Chris Mosdell, and sung by Steve Conte and Sakamoto. This track is also composed by Kanno, with a submelody from Alexander Borodin's Polovetsian Dances. | List of RahXephon albums | Tune the Rainbow | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Tune%20the%20Rainbow | 193 | {
"language": "en",
"type": "text"
} |
The single reached the weekly top ten Oricon ranking. | List of RahXephon albums | Tune the Rainbow | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Tune%20the%20Rainbow | 27 | {
"language": "en",
"type": "text"
} |
"Tune the Rainbow"
"The Garden of Everything ~Taking You on an Electric Rocket~" (~電気ロケットに君を連れて~, ~Denki Roketto ni Kimi wo Tsurete~) (English lyrics, featuring Steve Conte)
"Small Hemisphere" (ちいさなヘミソフィア, Chīsa na hemisofia) | List of RahXephon albums | Single track listing | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Single%20track%20listing | 95 | {
"language": "en",
"type": "text"
} |
An audio drama titled RahXephon Sound Drama was released on CD in Japan in September 2002. It consists of 1 teaser track, 13 scene tracks, 2 music tracks and 1 "preview" track. The story is about Ayato receiving a box of chocolates as an anonymous Valentine's Day gift, and the quest to find out who sent it. | List of RahXephon albums | Audio drama | 2024-03-14T09:48:59 | https://en.wikipedia.org/wiki/List_of_RahXephon_albums#Audio%20drama | 90 | {
"language": "en",
"type": "text"
} |
Angélique is a 1927 French opera by Jacques Ibert to a libretto by "Nino", a pseudonym of Michel Veber, Ibert's brother-in-law. A 1996 recording conducted by Yoram David was released on Fonit. | Angélique (opera) | 2023-10-12T16:30:16 | https://en.wikipedia.org/wiki/Ang%C3%A9lique_(opera)# | 62 | {
"language": "en",
"type": "text"
} |
|
Look up artwork in Wiktionary, the free dictionary. An artwork, or work of art, is an aesthetic item or artistic creation. Artwork or Artworks may also refer to: | Artwork (disambiguation) | 2022-10-22T15:47:16 | https://en.wikipedia.org/wiki/Artwork_(disambiguation)# | 59 | {
"language": "en",
"type": "text"
} |
|
Artwork (album), by The Used, 2009
Artworks (album), by Art Pepper, 1984
Artwork (musician), a member of Magnetic Man
Artworks (film), a 2003 crime film | Artwork (disambiguation) | Arts and entertainment | 2022-10-22T15:47:16 | https://en.wikipedia.org/wiki/Artwork_(disambiguation)#Arts%20and%20entertainment | 58 | {
"language": "en",
"type": "text"
} |
Artwork (graphic arts), a graphical representation of an image used in the printing process
Cover art, the illustration or photograph on the outside of a published product
Album cover, front of the packaging of a commercially released audio recording
ArtWorks, a software package | Artwork (disambiguation) | Other uses | 2022-10-22T15:47:16 | https://en.wikipedia.org/wiki/Artwork_(disambiguation)#Other%20uses | 70 | {
"language": "en",
"type": "text"
} |
| Al\-e Yusefi\-ye Olya ال يوسفي عليا | |
| --- | --- |
| village | |
| Al-e Yusefi-ye OlyaAl\-e Yusefi\-ye Olya | |
| Coordinates: 29°23′45″N 51°09′46″E / 29\.39583°N 51\.16278°E / 29\.39583; 51\.16278 | |
| Country | Iran |
| Province | Bushehr |
| County | Dashtestan |
| Bakhsh | Sadabad |
| Rural District | Zirrah |
| Population (2006\) | |
| • Total | 222 |
| Time zone | UTC\+3:30 (IRST) |
| • Summer (DST) | UTC\+4:30 (IRDT) | | Al-e Yusefi-ye Olya | 2017-03-11T09:13:23 | https://en.wikipedia.org/wiki/Al-e_Yusefi-ye_Olya# | 237 | {
"language": "en",
"type": "infobox"
} |
|
Al-e Yusefi-ye Olya (Persian: ال يوسفي عليا, also Romanized as Āl-e Yūsefī-ye ‘Olyā and Āl-e Yūsofī-ye ‘Olyā; also known as Āl-e Sefī-ye Bālā, Āl-e Yūsefī-ye Bālā, Āl-e Yūsofī, and Āl-e Yūsofī-ye Bālā) is a village in Zirrah Rural District, Sadabad District, Dashtestan County, Bushehr Province, Iran. At the 2006 census, its population was 222, in 53 families. | Al-e Yusefi-ye Olya | 2017-03-11T09:13:23 | https://en.wikipedia.org/wiki/Al-e_Yusefi-ye_Olya# | 155 | {
"language": "en",
"type": "text"
} |
|
Locution can refer to: a figure of speech
Locution (paranormal), a mode of supernatural revelation
Locution (catchphrase), a particular word, phrase, or expression, especially associated with a particular person, region, group, or cultural level
Interior locution, the phenomenon when a person reportedly receives a set of ideas, thoughts, or visions from an outside spiritual source | Locution | 2020-09-06T10:29:13 | https://en.wikipedia.org/wiki/Locution# | 96 | {
"language": "en",
"type": "text"
} |
|
| *Kullashara* | |
| --- | --- |
|
| Scientific classification | |
| Kingdom: | Animalia |
| Phylum: | Arthropoda |
| Class: | Insecta |
| Order: | Lepidoptera |
| Family: | Autostichidae |
| Genus: | ***Kullashara***Gozmány, 1963 |
| Species: | ***K. kalifella*** |
| Binomial name | |
| ***Kullashara kalifella***(Amsel, 1949\) | |
|
| Synonyms | |
| * *Symmoca kalifella* Amsel, 1949 | | | Kullashara | 2022-12-28T01:36:06 | https://en.wikipedia.org/wiki/Kullashara# | 193 | {
"language": "en",
"type": "infobox"
} |
|
Kullashara is a moth genus in the family Autostichidae. It contains the species Kullashara kalifella, which is found in Iran. | Kullashara | 2022-12-28T01:36:06 | https://en.wikipedia.org/wiki/Kullashara# | 39 | {
"language": "en",
"type": "text"
} |
|
| Shark | |
| --- | --- |
| | |
| Role | Light aircraftType of aircraft |
| National origin | Slovakia |
| Manufacturer | Fly\-Fan, AENEA Services |
| Designer | Frantisek Sustek |
| First flight | 29 June 2011 |
| Status | Under development (2015\) |
| | Fly-Fan Shark | 2022-12-07T03:57:30 | https://en.wikipedia.org/wiki/Fly-Fan_Shark# | 109 | {
"language": "en",
"type": "infobox"
} |
|
The Fly-Fan Shark is a Slovak light aircraft designed by Frantisek Sustek and initially developed by Fly-Fan of Trenčín. Development continues under the new owner of the design, AENEA Services. The design was introduced at the AERO Friedrichshafen show in 2007 as a mock up and in 2011 as a flying aircraft. The aircraft first flew on 29 June 2011 and is intended to be supplied as a complete ready-to-fly-aircraft. | Fly-Fan Shark | 2022-12-07T03:57:30 | https://en.wikipedia.org/wiki/Fly-Fan_Shark# | 111 | {
"language": "en",
"type": "text"
} |
|
The Shark was designed with the goal of providing similar performance to other twin-engined light aircraft, but on 30% less power. It features a cantilever low-wing, a five-seat enclosed cabin, retractable tricycle landing gear and twin wing-mounted engines in tractor configuration. | Fly-Fan Shark | Design and development | 2022-12-07T03:57:30 | https://en.wikipedia.org/wiki/Fly-Fan_Shark#Design%20and%20development | 81 | {
"language": "en",
"type": "text"
} |
The aircraft is made from Kevlar and carbon fibre. Its 11.4 m (37.4 ft) span wing employs a Jd 16 (40) 162 airfoil at the wing root, transitioning to a Jd 17 (40) 157 at mid-span and a Jd 15 (35) 136 at the wing tip. The wing has an area of 16.2 m2 (174 sq ft) and mounts split flaps that can be extended 50°. The standard engines fitted are a pair of 160 hp (119 kW) Lycoming O-320-D1A four-stroke powerplants. The aircraft has an empty weight of 1,221 kg (2,692 lb) and a gross weight of 1,500 kg (3,300 lb), giving a useful load of 279 kg (615 lb). | Fly-Fan Shark | Design and development | 2022-12-07T03:57:30 | https://en.wikipedia.org/wiki/Fly-Fan_Shark#Design%20and%20development | 196 | {
"language": "en",
"type": "text"
} |
Data from Bayerl and Fly-FanGeneral characteristics | Fly-Fan Shark | Specifications (Shark) | 2022-12-07T03:57:30 | https://en.wikipedia.org/wiki/Fly-Fan_Shark#Specifications%20%28Shark%29 | 27 | {
"language": "en",
"type": "text"
} |
Crew: one
Capacity: four passengers
Length: 8.9 m (29 ft 2 in)
Wingspan: 11.4 m (37 ft 5 in)
Height: 3.07 m (10 ft 1 in)
Wing area: 16.2 m2 (174 sq ft)
Airfoil: wing root: Jd 16 (40) 162 airfoil, mid-span: Jd 17 (40) 157, wing tip: Jd 15 (35) 136
Empty weight: 1,221 kg (2,692 lb)
Gross weight: 1,500 kg (3,307 lb)
Powerplant: 2 × Lycoming O-320-D1A four cylinder, air-cooled, four stroke aircraft engine, 120 kW (160 hp) each
Propellers: 3-bladed MT-Propeller or Hartzell Propeller constant speed, 1.78 m (5 ft 10 in) diameter | Fly-Fan Shark | Specifications (Shark) | 2022-12-07T03:57:30 | https://en.wikipedia.org/wiki/Fly-Fan_Shark#Specifications%20%28Shark%29 | 208 | {
"language": "en",
"type": "text"
} |
Performance Cruise speed: 260 km/h (160 mph, 140 kn)
Stall speed: 140 km/h (87 mph, 76 kn)
Never exceed speed: 330 km/h (210 mph, 180 kn)
Range: 1,600 km (990 mi, 860 nmi)
Endurance: 8 hours
Maximum glide ratio: 16:1 at 160 km/h (99 mph)
Rate of climb: 10.6 m/s (2,090 ft/min)
Wing loading: 92.6 kg/m2 (19.0 lb/sq ft) | Fly-Fan Shark | Specifications (Shark) | 2022-12-07T03:57:30 | https://en.wikipedia.org/wiki/Fly-Fan_Shark#Specifications%20%28Shark%29 | 142 | {
"language": "en",
"type": "text"
} |
Look up kranen or Kranen in Wiktionary, the free dictionary. Kranen is a surname. Notable people with the surname include: Kathryn Kranen (fl. 2003), American electronic design automation engineer and business executive
Henrique Kranen (1911–1974), Brazilian rower | Kranen | 2023-07-02T00:32:16 | https://en.wikipedia.org/wiki/Kranen# | 72 | {
"language": "en",
"type": "text"
} |
|
| Government offices | | |
| --- | --- | --- |
|
| Preceded byJohn J. Young Jr. | **Assistant Secretary of the Navy (Research, Development and Acquisitions)** November 7, 2005 – November 15, 2007 | Succeeded byJohn S. Thackrah | | Delores M. Etter | External links | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#External%20links | 93 | {
"language": "en",
"type": "table"
} |
| Delores M. Etter | |
| --- | --- |
| | |
| Born | Delores Maria Van Camp (1947\-09\-25) September 25, 1947 (age 76\) |
| Nationality | American | | Delores M. Etter | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter# | 71 | {
"language": "en",
"type": "infobox"
} |
|
Delores Maria Etter (née Van Camp September 25, 1947 in Denver, Colorado) is a former United States Deputy Under Secretary of Defense for Science and Technology from 1998 to 2001 and former Assistant Secretary of the Navy for research, science, and technology from 2005 to 2007. | Delores M. Etter | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter# | 63 | {
"language": "en",
"type": "text"
} |
|
Delores M. Etter attended the Oklahoma State University–Stillwater and the University of Texas at Arlington before going on to receive two degrees from Wright State University (B.S. in Mathematics, 1970; M.S. in Mathematics, 1972). She attended grad school at the University of New Mexico, receiving her Ph.D. in Electrical Engineering in 1979. | Delores M. Etter | Education | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#Education | 93 | {
"language": "en",
"type": "text"
} |
Upon receiving her Ph.D., Etter joined the faculty of the University of New Mexico's Department of Electrical and Computer Engineering. As a professor, Etter's research interests focused on adaptive signal processing; speech recognition; digital filter design; engineering education and software engineering. She would ultimately author several well-known textbooks on software engineering and computer languages. While a faculty member at the University of New Mexico, she served as Associate Chair of her department 1987–1989, and as the university's associate vice president for academic affairs in 1989. She also spent two summers working at Sandia National Laboratories (where her work focused on seismic signal processing) and was the National Science Foundation Visiting Professor in the Electrical Engineering Department at Stanford University for the 1983–84 academic year. A member of the Institute of Electrical and Electronics Engineers, Etter served as president of the IEEE Acoustics, Speech, and Signal Processing Society from 1988 to 1989, and was editor-in-chief of the IEEE Transactions on Signal Processing from 1993 to 1995. | Delores M. Etter | Academic career | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#Academic%20career | 249 | {
"language": "en",
"type": "text"
} |
In 1990, Etter left New Mexico to become professor of electrical and computer engineering at the University of Colorado at Boulder. In 1991, while still a professor at the University of Colorado, Etter became a member of the Naval Research Advisory Committee, and would go on to chair that committee 1995–97. | Delores M. Etter | Academic career | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#Academic%20career | 73 | {
"language": "en",
"type": "text"
} |
Etter left the University of Colorado at Boulder in 1991 after President of the United States Bill Clinton nominated her as Deputy Under Secretary of Defense for Science and Technology, a post she held from June 1998 through July 2001. In this capacity, she was responsible for American Defense Science and Technology strategic planning, budget allocation, and program execution and evaluation for the United States Department of Defense Science and Technology Program. She was the principal U.S. representative to the NATO Research and Technology Organisation's Research and Technology Board and also oversaw the Defense Modeling and Simulation Office, the High Performance Computing Modernization Office, the Software Engineering Institute, and the Department of Defense's high-energy laser research program. | Delores M. Etter | Naval service | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#Naval%20service | 159 | {
"language": "en",
"type": "text"
} |
Upon leaving office, Etter joined the Electrical Engineering faculty of the United States Naval Academy. There, she became the first-ever Office of Naval Research Distinguished Chair in Science and Technology. In 2000, Etter was elected a member of the National Academy of Engineering for the authorship of textbooks on computer applications in engineering, contributions to digital signal processing, and service to the profession. | Delores M. Etter | Naval service | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#Naval%20service | 101 | {
"language": "en",
"type": "text"
} |
President George W. Bush nominated Etter as Assistant Secretary of the Navy (Research, Development and Acquisitions) on September 6, 2005, and she subsequently held this office from November 7, 2005, until November 15, 2007. In this capacity, she was senior acquisition executive for the United States Navy and the United States Marine Corps and the Navy's representative for joint acquisitions with other branches of the United States Armed Forces (for example: the F-35 Lightning II and the MRAP). She was responsible for the Navy and Marine Corps' acquisition of ships, aircraft, vehicles, and information technology. The Dr. Delores M. Etter Top Scientists and Engineers award was named for her. | Delores M. Etter | Naval service | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#Naval%20service | 170 | {
"language": "en",
"type": "text"
} |
In June 2008, Etter joined Southern Methodist University in a joint appointment between the Electrical Engineering and Computer Science departments. At Southern Methodist, she became the Texas Instruments Distinguished Chair in Engineering Education; director of the Caruth Institute for Engineering Education; and a Senior Fellow of the John Goodwin Tower Center for Political Studies. She retired in 2017. | Delores M. Etter | Post-naval career | 2024-03-23T15:35:50 | https://en.wikipedia.org/wiki/Delores_M._Etter#Post-naval%20career | 90 | {
"language": "en",
"type": "text"
} |
| Regnal titles | | |
| --- | --- | --- |
| Preceded byJushur | **King of Sumer** legendary | Succeeded byNangishlishma |
| **Lugal of Kish** legendary | | Kullassina-bel | References | 2023-06-17T11:45:16 | https://en.wikipedia.org/wiki/Kullassina-bel#References | 80 | {
"language": "en",
"type": "table"
} |
Kullassina-bel of Kish was the second king in the First Dynasty of Kish according to the Sumerian king list, which adds that he reigned for 960 years (or 900 in some copies). As the name seems to be an Akkadian phrase meaning "All(kullat) of them(šina) (were) lord(bēl)", it has sometimes been suggested that the occurrence of this name on the list was intended to denote a period of no central authority in the early period of Kish. An alternative translation of the name is "Lord(bēl) of all(kullat) of them [the women](šina)". | Kullassina-bel | 2023-06-17T11:45:16 | https://en.wikipedia.org/wiki/Kullassina-bel# | 160 | {
"language": "en",
"type": "text"
} |
|
| Preceded by**Fontana di Piazza d'Aracoeli** | **Landmarks of Rome**Fontana di Piazza Colonna | Succeeded by**Fontane di Piazza Farnese** |
| --- | --- | --- | | Fontana di Piazza Colonna | External links | 2023-07-03T19:48:59 | https://en.wikipedia.org/wiki/Fontana_di_Piazza_Colonna#External%20links | 73 | {
"language": "en",
"type": "table"
} |
| Fontana di Piazza Colonna | |
| --- | --- |
| Fountain | |
| 19th century print of the fountain in the Piazza Colonna | |
| Design | Giacomo Della Porta |
| Location | Rome |
| Click on the map for a fullscreen view | |
| Coordinates: 41°54′03″N 12°28′49″E / 41\.90083°N 12\.48028°E / 41\.90083; 12\.48028 | | | Fontana di Piazza Colonna | 2023-07-03T19:48:59 | https://en.wikipedia.org/wiki/Fontana_di_Piazza_Colonna# | 143 | {
"language": "en",
"type": "infobox"
} |
|
The fountain in the Piazza Colonna is a fountain in Rome, Italy, designed by the architect Giacomo Della Porta and constructed by the Fiesole sculptor Rocco Rossi between 1575 and 1577. | Fontana di Piazza Colonna | 2023-07-03T19:48:59 | https://en.wikipedia.org/wiki/Fontana_di_Piazza_Colonna# | 56 | {
"language": "en",
"type": "text"
} |
|
The fountain was one of a group of sixteen fountains built by Della Porta following the reconstruction of the Acqua Vergine aqueduct, a project begun by Pope Pius IV in 1561 and finished by Pope Pius V in 1570. The fountain itself was built under Pope Gregory XIII, best known for creating the Gregorian calendar. Like the other Roman fountains of its time, it was built to provide clean drinking water to the Roman residents, who before then had to drink the polluted water of the Tiber River. Also like the other fountains of its time, it operated purely by gravity; the source of the water was higher than the fountain itself, causing the water to spout into the air. | Fontana di Piazza Colonna | 2023-07-03T19:48:59 | https://en.wikipedia.org/wiki/Fontana_di_Piazza_Colonna# | 176 | {
"language": "en",
"type": "text"
} |
|
The water for the fountain first arrived at the old Trevi Fountain, then went to two reservoirs at the foot of the butte of San Sebastiancello, then through a series of the channels to the corner of via Condotti and the via del Corso, to Piazza Venezia, to the foot of the column of Marcus Aurelius. The source of the water for the fountain of Piazza Colonna was only 67 feet above sea level; like the Trevi Fountain, the Fontana della Barcaccia, and the fountains of Piazza Navona, all connected to the Acqua Vergine, the fountain of Piazza Colonna was unable to jet water high into the air. | Fontana di Piazza Colonna | 2023-07-03T19:48:59 | https://en.wikipedia.org/wiki/Fontana_di_Piazza_Colonna# | 159 | {
"language": "en",
"type": "text"
} |
|
The original project of Della Porta was to place an antique Roman statue of a sea god, called Marforio, in the fountain, against a background of a rocky grotto, behind which the column of Marcus Aurelius would be seen. The final fountain was simpler: the octagonal basin of the fountain was made of pink marble from the island of Chios in Greece, the same marble that Della Porta used for frame of the doorway of St. Peter's Basilica. Della Porta also designed the sixteen carved lion heads around the basin. A circular stone vasque was placed on a pedestal in the center, and water poured from this vasque into the basin. | Fontana di Piazza Colonna | 2023-07-03T19:48:59 | https://en.wikipedia.org/wiki/Fontana_di_Piazza_Colonna# | 170 | {
"language": "en",
"type": "text"
} |
|
The fountain was slightly restored by Bernini during the pontificate of Pope Alexander VII. In 1702 Pope Clement XI placed his own coat of arms, a star with eight points, on top of the original vasque in the center, but this was removed after his death. In 1830 the architect Alessandro Stocchi removed the original central vasque and replaced it with the current vasque, made of white marble. He also added two groups of sculptures of dolphins, their tails wrapped around seashells, spouting water from their mouths, at either end of the basin. | Fontana di Piazza Colonna | 2023-07-03T19:48:59 | https://en.wikipedia.org/wiki/Fontana_di_Piazza_Colonna# | 141 | {
"language": "en",
"type": "text"
} |
|
| Wolfgang R. Wasow | |
| --- | --- |
| Born | (1909\-07\-25)July 25, 1909Vevey, Switzerland |
| Died | September 11, 1993(1993\-09\-11\) (aged 83\)Madison, Wisconsin |
| Nationality | American |
| Alma mater | New York University |
| Known for | Singular Perturbation Theory |
| **Scientific career** | |
| Fields | Applied Mathematics |
| Institutions | University of Wisconsin–Madison |
| Doctoral advisor | Kurt Otto Friedrichs |
| | | | Wolfgang R. Wasow | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow# | 178 | {
"language": "en",
"type": "infobox"
} |
|
Wolfgang R. Wasow (25 July 1909 – 11 September 1993) was an American mathematician known for his work in asymptotic expansions and their applications in differential equations. | Wolfgang R. Wasow | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow# | 49 | {
"language": "en",
"type": "text"
} |
|
Wasow was born as Wolfgang Richard Thal in Vevey, Switzerland, to Jewish parents, Alma Thal and Max Richard Kleineibst, who had met in Paris.
Alma Thal was from Jelgava in Latvia, a part of Czarist Russia at the time. Her family had sent her to Switzerland to put an end to her political activities. Richard Kleineibst was also a political activist and later gained prominence as a leftwing social democrat in the Weimar Republic. He became a founding member of Socialist Workers' Party of Germany in 1931 and was the first editor in chief of Sozialistische Arbeiter-Zeitung, its main organ. | Wolfgang R. Wasow | Early life | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Early%20life | 153 | {
"language": "en",
"type": "text"
} |
Alma Thal moved to Germany in 1910 and then several more times within Germany. And so Wolfgang grew up first in Munich, and then in Freiburg, Heidelberg and Berlin. When Alma Thal married the Munich photographer Eduard Wasow, Wolfgang took his name. In 1921, Wolfgang Wasow was sent to a boarding school, the Freie Schul- und Werkgemeinschaft Letzlingen, founded by Bernhard Uffrecht, located in the Magdeburg district of Prussia. He passed the Abitur exam and graduated from the school in 1928. After studies at Humboldt and Sorbonne, he enrolled at Göttingen and passed the Staatsexamen (a government licensing examination for future teachers) in mathematics, physics and geology in 1933. | Wolfgang R. Wasow | Early life | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Early%20life | 176 | {
"language": "en",
"type": "text"
} |
Wasow left Germany in 1933 and spent time in Paris and Cambridge before taking a job as a teacher at boarding schools for children of (predominantly Jewish) German emigrants in Italy, first in Florence (1935–37) and then in Lana in Alto Adige (1937–38). After the closure of the latter school in 1938 due to the passage of the Italian Racial Laws, Wasow emigrated to England and then to the United States in 1939. | Wolfgang R. Wasow | Emigration | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Emigration | 111 | {
"language": "en",
"type": "text"
} |
| Degimai | |
| --- | --- |
| Village | |
| DegimaiDegimaiLocation in LithuaniaShow map of Kėdainiai District MunicipalityDegimaiDegimaiDegimai (Lithuania)Show map of Lithuania | |
| Coordinates: 55°21′0″N 23°37′0″E / 55\.35000°N 23\.61667°E / 55\.35000; 23\.61667 | |
| Country | Lithuania |
| County | Kaunas County |
| Municipality | Kėdainiai district municipality |
| Eldership | Krakės Eldership |
| Population (2011\) | |
| • Total | 0 |
| Time zone | UTC\+2 (EET) |
| • Summer (DST) | UTC\+3 (EEST) | | Degimai, Krakės | 2021-01-31T10:22:00 | https://en.wikipedia.org/wiki/Degimai,_Krak%C4%97s# | 224 | {
"language": "en",
"type": "infobox"
} |
|
| Al\-Arkam School | |
| --- | --- | | Al-Arkam School | 2023-10-31T16:21:41 | https://en.wikipedia.org/wiki/Al-Arkam_School# | 27 | {
"language": "en",
"type": "infobox"
} |
|
Wasow taught at Goddard College
(1939–1941) and Connecticut College (1941–42) and
was at the same time a PhD student in mathematics
under the supervision of Kurt Otto Friedrichs
at New York University.
He received
his PhD in 1942 and
stayed to work as an
instructor for mathematics until 1946. He then held academic and research positions at
Swarthmore, UCLA and University of Wisconsin–Madison 1946–1957, interrupted by a
Fulbright Fellowship in Rome (1954–55).
He was appointed full professor of mathematics in 1957
at
Madison
and
Rudolf
E. Langer Professor of Mathematics in 1973.
He was department chair 1970–72.
He retired in 1980. | Wolfgang R. Wasow | Academic career | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Academic%20career | 168 | {
"language": "en",
"type": "text"
} |
Degimai ('burnt places') is a village in Kėdainiai district municipality, in Kaunas County, in central Lithuania. According to the 2011 census, the village was uninhabited. It is located 2 kilometres (1.2 mi) from Guptilčiai, in the Lapkalnys-Paliepiai Forest. | Degimai, Krakės | 2021-01-31T10:22:00 | https://en.wikipedia.org/wiki/Degimai,_Krak%C4%97s# | 80 | {
"language": "en",
"type": "text"
} |
|
Wolfgang Wasow's main research area was singular perturbation theory. A classical application is the thin boundary layer that forms on a solid surface as a fluid flows over it. Above the boundary layer, the fluid behaves approximately like a perfect fluid. But within the boundary layer, the velocity of the flow changes rapidly from the high velocity above the boundary layer to a velocity of 0 at the solid surface. Many technical problems can be modeled this way, including the flow of a liquid through a pipe and the flow of air over an airplane wing. Boundary layer problems are instances of a more general class of problems that today is part of the field of singular perturbations. | Wolfgang R. Wasow | Academic career | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Academic%20career | 168 | {
"language": "en",
"type": "text"
} |
Al-Arkam school (Arabic: مدرسة دار الأرقم) is a school in Gaza City which was established by Hamas leader Sheikh Ahmed Yassin. In September, 2005, it was partially destroyed in an airstrike carried out by Israel in retaliation for rocket attacks launched by Palestinian militants. | Al-Arkam School | 2023-10-31T16:21:41 | https://en.wikipedia.org/wiki/Al-Arkam_School# | 75 | {
"language": "en",
"type": "text"
} |
|
Starting with his 1941 PhD thesis, Wasow was one of the main contributors to developing a mathematical theory of the boundary layer problem and singular perturbations. The organizers of a symposium in his honor at the Mathematics Research Center at Madison write: | Wolfgang R. Wasow | Academic career | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Academic%20career | 69 | {
"language": "en",
"type": "text"
} |
| Hatchet | |
| --- | --- |
| Consensus secondary structure and sequence conservation of Hatchet ribozyme | |
| Identifiers | |
| Symbol | Hatchet |
| Rfam | RF02678 |
| Other data | |
| RNA type | Gene; Ribozyme |
| GO | GO:0003824 |
| SO | SO:0000374 |
| PDB structures | PDBe | | Hatchet ribozyme | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme# | 133 | {
"language": "en",
"type": "infobox"
} |
|
In May 1980, the Mathematics Research Center organized a
successful Advanced Seminar on Singular Perturbations and
Asymptotics in honor of the retirement of a colleague,
Wolfgang R. Wasow. His fundamental research is responsible
for many other rapid developments in this field since 1940,
and continues to play a vital role in modern theory and
current applications. Wasow's Ph.D. dissertation (N.Y.U.,
1941) ... represents the starting point of this important
flourish of modern applicable research. ... MRC is
printing his 1941 thesis in its entirety ... Readers will
note that the name "singular perturbations" (which was
only coined several years later by K. O. Friedrichs or W. Wasow or possibly
jointly, but neither is now able to recall the details) does
not appear anywhere explicitly! | Wolfgang R. Wasow | Academic career | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Academic%20career | 195 | {
"language": "en",
"type": "text"
} |
Background: The hatchet ribozyme is an RNA structure that catalyzes its own cleavage at a specific site. In other words, it is a self-cleaving ribozyme. Hatchet ribozymes were discovered by a bioinformatics strategy as RNAs Associated with Genes Associated with Twister and Hammerhead ribozymes, or RAGATH. Subsequent biochemical analysis supports the conclusion of a ribozyme function, and determined further characteristics of the chemical reaction catalyzed by the ribozyme. | Hatchet ribozyme | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme# | 130 | {
"language": "en",
"type": "text"
} |
|
Wasow was "a substantial contributor to the study of singular perturbations for over twenty years".
His textbook
"Asymptotic expansions for ordinary differential equations"
was the first "authoritative treatment"
of the subject. The Wolfgang Wasow Memorial Lecture, an annual lecture
at the University of Wisconsin–Madison, was established in Wasow's honor by his children in 1993. | Wolfgang R. Wasow | Academic career | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Academic%20career | 99 | {
"language": "en",
"type": "text"
} |
Nucleolytic ribozymes are small RNAs that adopt compact folds capable of site-specific cleavage/ligation reactions. 14 unique nucleolytic ribozymes have been identified to date, including recently discovered twister, pistol, twister-sister, and hatchet ribozymes that were identified based on application of comparative sequence and structural algorithms. | Hatchet ribozyme | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme# | 91 | {
"language": "en",
"type": "text"
} |
|
Wasow had three sons: Tom Wasow (linguist), Bernard Wasow (economist), and Oliver Wasow (artist). He also had two step-children.[citation needed] Wolfgang Wasow self-published an autobiography for his family in 1986. | Wolfgang R. Wasow | Personal life | 2023-10-07T08:04:49 | https://en.wikipedia.org/wiki/Wolfgang_R._Wasow#Personal%20life | 71 | {
"language": "en",
"type": "text"
} |
The consensus sequence and secondary structure of this class includes 13 highly conserved and numerous other modestly conserved nucleotides inter-dispersed among bulges linking four base-paired substructures. A representative hatchet ribozyme requires divalent cations such as Mg2+ to promote RNA strand scission with a maximum rate constant of ~4/min. As with all other small self-cleaving ribozymes discovered to date, hatchet ribozymes employ a general mechanism for catalysis consisting of a nucleophilic attack of a ribose 2′-oxygen atom on the adjacent phosphorus center. Kinetic characteristics of the reaction demonstrate that members of this ribozyme class have an essential requirement for divalent metal cations and that they have a complex active site which employs multiple catalytic strategies to accelerate RNA cleavage by internal phosphoester transfer. | Hatchet ribozyme | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme# | 211 | {
"language": "en",
"type": "text"
} |
|
Nucleolytic ribozymes like the Hatchet Ribozyme adopt an SN2-like mechanism that results in site-specific phosphodiester bond cleavage. An activated 2′-OH of the ribose 5′ to the scissile phosphate adopts an in-line alignment to target the adjacent to-be-cleaved P-O5′ phosphodiester bond, resulting in formation of 2′,3′-cyclic phosphate and 5′-OH groups. X-ray crystallographic structural studies on the hammerhead, hairpin, GlmS, hepatitis delta virus (HDV), Varkud satellite, and pistol ribozymes have defined the overall RNA fold, the catalytic pocket arrangement, the in-line alignment, and the key residues that contribute to the cleavage reaction. The cleavage site is located at the 5' end of its consensus secondary motif. | Hatchet ribozyme | Mechanism | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Mechanism | 225 | {
"language": "en",
"type": "text"
} |
In addition, the removal of the nucleophilic hydroxyl renders the ribozyme inactive as it is not able to create the cleavage site. More specifically, if the 2'-ribose or 2'-OH is replaced with a 2'-deoxyribose or 2'-H, there are no electrons available to perform the nucleophilic attack on the adjacent phosphate group. This results in no phosphoester bond being formed, which again inactivates the ribozyme's enzymatic cleavage ability. | Hatchet ribozyme | Mechanism | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Mechanism | 134 | {
"language": "en",
"type": "text"
} |
In 2019, researchers crystallized a 2.1 Å product of the Hatchet Ribozyme. The consensus sequence is depicted in the image to the right. Most hatchet ribozymes and ribozymes in general adopt a P0 configuration. P0 is an additional hairpin loop located at the 5' end of the cleavage site, though it does not contribute to catalytic activity or functionality unlike Hammerhead ribozymes which have a short consensus sequence near P1, or the 5' end, that promotes high speed catalytic activity. About 90% of the sequence is conserved and similar to other ribozymes in this class. | Hatchet ribozyme | Secondary Structure | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Secondary%20Structure | 160 | {
"language": "en",
"type": "text"
} |
Based on the RNA sequence, the resulting DNA sequence which ends up coding for the Hatchet Ribozyme is as follows from 5'-3' because in DNA uracil is replaced by thymine. TTAGCAAGAATGACTATAGTCACTG TTTGTACACCCCGAATAGATTAGAA GCCTAATCATAATCACGTCTGCAAT TTTGGTACA Due to this sequence construct, after self catalyzed cleavage, it leaves an 8 nucleotide residue upstream on the 3'-end of the RNA. | Hatchet ribozyme | Secondary Structure | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Secondary%20Structure | 147 | {
"language": "en",
"type": "text"
} |
Each ribozyme may have different motifs and thus different tertiary structures: | Hatchet ribozyme | Tertiary Structure | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Tertiary%20Structure | 32 | {
"language": "en",
"type": "text"
} |
The Tertiary structure of the Hatchet Ribozyme with the motif of HT-UUCG is through dimerization. The dimer is formed through the swapping of the 3' ends of the pairing strands which is also in equilibrium with the dimer formed product of HT-GAAA. Therefore, the RNA sequence shifts between monomer and dimer configurations. To view the 3-D shape of the ribozyme see Figure S1A and B. Two molecules of the HT-GAAA ribozyme can actually form a pseudosymmetric dimer with both monomers of the ribozyme exhibiting relatively well-defined electron density. The tertiary fold consists of four stem substructures which covalently stack upon each other forming the helical and loop structures, called P1, P2, P3, and P4, L1, L2 and L3 respectively (though not shown in the figure above). The actual cleavage site is positioned between the junction of P1 and P2 adjacent to P3 and L2. P1 is composed of three or six base pairs roughly 40% and 60% of the time respectively in its natural state, suggesting that length corresponds to catalytic function. | Hatchet ribozyme | Tertiary Structure | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Tertiary%20Structure | 300 | {
"language": "en",
"type": "text"
} |
There is also a conserved palindromic sequencing between base U70' and A67', which likely triggers the formation of the dimer due to Watson-Crick base pair interactions. The tertiary structure also has long range implications within itself based on interactions between its loops. | Hatchet ribozyme | Tertiary Structure | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Tertiary%20Structure | 80 | {
"language": "en",
"type": "text"
} |
Ribozyme catalysis experiments were done by the addition of MgCl2 and stopped for measurement at each time point by the addition of a stop solution containing urea and EDTA. | Hatchet ribozyme | Effect of pH and Mg2+ | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Effect%20of%20pH%20and%20Mg2%2B | 60 | {
"language": "en",
"type": "text"
} |
A plot of the kobs values measured at pH 7.5 with increasing concentrations of Mg2+. There is a sharp increase in ribozyme function that plateaus as the concentration approaches 10 mM. The steep slope observed at lower Mg2+ concentrations suggests that more than one metal ion is necessary for each RNA to achieve maximal ribozyme activity. Moreover, this suggests that the construct requires higher than normal physiological concentrations of Mg2+ to become completely saturated with Mg2+ as the cofactor. It is possible that native unimolecular constructs, also carrying P0, might achieve saturation at concentrations of Mg2+ that are closer to normal physiological levels. | Hatchet ribozyme | Effect of pH and Mg2+ | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Effect%20of%20pH%20and%20Mg2%2B | 177 | {
"language": "en",
"type": "text"
} |
The effect of pH on ribozyme rate constant in reactions containing 10 mM Mg2+ was also experimentally measured. pH-dependent ribozyme activity increases linearly with a slope of 1 until reaching a kobs, of a Michaelis-Menten plot, plateau of ~4/min near a pH value of 7.5. Any higher pH has the same catalytic effect and more acidic pH's begin denaturing the ribozyme and thus reducing catalytic function. Both the pH dependency and the maximum rate constant have interesting implications for the possible catalytic strategies used by this ribozyme class. | Hatchet ribozyme | Effect of pH and Mg2+ | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Effect%20of%20pH%20and%20Mg2%2B | 156 | {
"language": "en",
"type": "text"
} |
The Hatchet ribozyme construct remains completely inactive when incubated in the absence of Mg2+ in reactions containing only other monovalent cations at 1 M (Na+, K+, Rb+, Li+, Cs+), 2.5 M (Na+, K+), or 3 M (Li+). In contrast, other divalent metal ions such as Mn2+, Co2+, Zn2+, and Cd2+ support ribozyme function with varying levels of efficiency. Furthermore, two metal ions (Zn2+, Cd2+) function only at low concentrations, and three metal ions (Ba2+, Ni2+, and Cu2+) inhibit activity at 0.5 mM, even when Mg2+ is present. These results indicate that hatchet ribozymes are relatively restrictive in their use of cations to promote catalysis, perhaps indicating that one or more specialized binding sites that accommodate a limited number of divalent cations are present in the RNA structure or perhaps even at the active site. Inhibition by certain divalent metal ions could be due to the displacement of critical Mg2+ ions or by general disruption of RNA folding. | Hatchet ribozyme | The effects of various mono- and divalent metal ions on hatchet ribozyme activity | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#The%20effects%20of%20various%20mono-%20and%20divalent%20metal%20ions%20on%20hatchet%20ribozyme%20activity | 304 | {
"language": "en",
"type": "text"
} |
One standard application is to use flanking self-cleaving ribozymes to generate precisely cut out sequences of functional RNA molecules (i.e. shRNA, saiRNA, sgRNA). This is especially useful for in vivo expression of gene editing systems (i.e. CRISPR/Cas sgRNA) and inhibitory systems. Another method is for in vivo transcription of siRNA. This design uses multiple self-cleaving ribozymes, which are all transcribed from the same gene. After cleavage, both parts of the precursor siRNA (siRNA 1 and 2) can form a double strand and act as intended. To see the setup, see saiRNA graphic | Hatchet ribozyme | Significance/Applications | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Significance/Applications | 171 | {
"language": "en",
"type": "text"
} |
Lastly, if you want to combine self-cleaving ribozymes with protein sequences, it is important to know that the self-cleaving mechanism of the ribozymes will modify the mRNA. A 5' ribozyme will modify the downstream 5' end of the pre-mRNA, disabling the cell from creating a 5' cap. This decreases the stability of the pre-mRNA and prevents it from being fully functional mature mRNA. On the other side, a 3' ribozyme would prevent polyadenylation of the upstream pre-mRNA, again decreasing stability and preventing maturation. Both interfere with translation as well. | Hatchet ribozyme | Significance/Applications | 2024-02-22T12:19:07 | https://en.wikipedia.org/wiki/Hatchet_ribozyme#Significance/Applications | 165 | {
"language": "en",
"type": "text"
} |
| Ashava | |
| --- | --- |
| Village | |
| AshavaAshavaLocation in Afghanistan | |
| Coordinates: 35°7′5″N 69°6′28″E / 35\.11806°N 69\.10778°E / 35\.11806; 69\.10778 | |
| Country | Afghanistan |
| Province | Parwan Province |
| District | Ghorband District |
| Time zone | UTC\+04:30 (AST) | | Ashava | 2023-11-11T04:38:39 | https://en.wikipedia.org/wiki/Ashava# | 138 | {
"language": "en",
"type": "infobox"
} |
|
Ashava or Ashawa is a village and valley in Ghorband District, Parwan Province of Afghanistan. It is noted for its cheese, Ashava cheese (Panir-e-Ashawa). A road connects it to Towtamdarreh-ye `Olyā in the east where it joins the A76 highway.[citation needed] | Ashava | 2023-11-11T04:38:39 | https://en.wikipedia.org/wiki/Ashava# | 83 | {
"language": "en",
"type": "text"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.