#!/usr/bin/env python # # Restriction Analysis Libraries. # Copyright (C) 2004. Frederic Sohm. # # This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. # r"""Print the results of restriction enzyme analysis. PrintFormat prints the results from restriction analysis in 3 different format: list, column or map. The easiest way to use it is: >>> from Bio.Restriction.PrintFormat import PrintFormat >>> from Bio.Restriction.Restriction import RestrictionBatch >>> from Bio.Seq import Seq >>> pBs_mcs = Seq('GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTC') >>> restriction_batch = RestrictionBatch(['EcoRI', 'BamHI', 'ApaI']) >>> result = restriction_batch.search(pBs_mcs) >>> my_map = PrintFormat() >>> my_map.print_that(result, 'My pBluescript mcs analysis:\n', ... 'No site:\n') My pBluescript mcs analysis: ApaI : 12. EcoRI : 50. No site: BamHI >>> my_map.sequence = pBs_mcs >>> my_map.print_as("map") >>> my_map.print_that(result) 12 ApaI | | 50 EcoRI | | GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTC |||||||||||||||||||||||||||||||||||||||||||||||||||||| CCATGGCCCGGGGGGGAGCTCCAGCTGCCATAGCTATTCGAACTATAGCTTAAG 1 54 Enzymes which do not cut the sequence. BamHI >>> Some of the methods of PrintFormat are meant to be overridden by derived class. Use the following parameters to control the appearance: - ConsoleWidth : width of the console used default to 80. should never be less than 60. - NameWidth : space attributed to the name in PrintList method. - Indent : Indent of the second line. - MaxSize : Maximal size of the sequence (default=6: -> 99 999 bp + 1 trailing ',' people are unlikely to ask for restriction map of sequences bigger than 100.000 bp. This is needed to determine the space to be reserved for sites location. - MaxSize = 5 => 9.999 bp - MaxSize = 6 => 99.999 bp - MaxSize = 7 => 999.999 bp Example output:: <------------ ConsoleWidth ---------------> <- NameWidth -> EcoRI : 1, 45, 50, 300, 400, 650, 700, 1200, 2500. <--> Indent """ # noqa: W291 import re class PrintFormat: """PrintFormat allow the printing of results of restriction analysis.""" ConsoleWidth = 80 NameWidth = 10 MaxSize = 6 Cmodulo = ConsoleWidth % NameWidth PrefWidth = ConsoleWidth - Cmodulo Indent = 4 linesize = PrefWidth - NameWidth def print_as(self, what="list"): """Print the results as specified. Valid format are: 'list' -> alphabetical order 'number' -> number of sites in the sequence 'map' -> a map representation of the sequence with the sites. If you want more flexibility over-ride the virtual method make_format. """ if what == "map": self.make_format = self._make_map elif what == "number": self.make_format = self._make_number else: self.make_format = self._make_list def format_output(self, dct, title="", s1=""): """Summarise results as a nicely formatted string. Arguments: - dct is a dictionary as returned by a RestrictionBatch.search() - title is the title of the map. It must be a formatted string, i.e. you must include the line break. - s1 is the title separating the list of enzymes that have sites from those without sites. - s1 must be a formatted string as well. The format of print_that is a list. """ if not dct: dct = self.results ls, nc = [], [] for k, v in dct.items(): if v: ls.append((k, v)) else: nc.append(k) return self.make_format(ls, title, nc, s1) def print_that(self, dct, title="", s1=""): """Print the output of the format_output method (OBSOLETE). Arguments: - dct is a dictionary as returned by a RestrictionBatch.search() - title is the title of the map. It must be a formatted string, i.e. you must include the line break. - s1 is the title separating the list of enzymes that have sites from those without sites. - s1 must be a formatted string as well. This method prints the output of A.format_output() and it is here for backwards compatibility. """ print(self.format_output(dct, title, s1)) def make_format(self, cut=(), title="", nc=(), s1=""): """Virtual method used for formatting results. Virtual method. Here to be pointed to one of the _make_* methods. You can as well create a new method and point make_format to it. """ return self._make_list(cut, title, nc, s1) # _make_* methods to be used with the virtual method make_format def _make_list(self, ls, title, nc, s1): """Summarise a list of positions by enzyme (PRIVATE). Return a string of form:: title. enzyme1 : position1, position2. enzyme2 : position1, position2, position3. Arguments: - ls is a tuple or list of cutting enzymes. - title is the title. - nc is a tuple or list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. """ return self._make_list_only(ls, title) + self._make_nocut_only(nc, s1) def _make_map(self, ls, title, nc, s1): """Summarise mapping information as a string (PRIVATE). Return a string of form:: | title. | | enzyme1, position | | | AAAAAAAAAAAAAAAAAAAAA... | ||||||||||||||||||||| | TTTTTTTTTTTTTTTTTTTTT... Arguments: - ls is a list of cutting enzymes. - title is the title. - nc is a list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. """ return self._make_map_only(ls, title) + self._make_nocut_only(nc, s1) def _make_number(self, ls, title, nc, s1): """Format cutting position information as a string (PRIVATE). Returns a string in the form:: title. enzyme which cut 1 time: enzyme1 : position1. enzyme which cut 2 times: enzyme2 : position1, position2. ... Arguments: - ls is a list of cutting enzymes. - title is the title. - nc is a list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. """ return self._make_number_only(ls, title) + self._make_nocut_only(nc, s1) def _make_nocut(self, ls, title, nc, s1): """Summarise non-cutting enzymes (PRIVATE). Return a formatted string of the non cutting enzymes. ls is a list of cutting enzymes -> will not be used. Here for compatibility with make_format. Arguments: - title is the title. - nc is a list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. """ return title + self._make_nocut_only(nc, s1) def _make_nocut_only(self, nc, s1, ls=(), title=""): """Summarise non-cutting enzymes (PRIVATE). Return a formatted string of the non cutting enzymes. Arguments: - nc is a tuple or list of non cutting enzymes. - s1 is the sentence before the non cutting enzymes. """ if not nc: return s1 st = "" stringsite = s1 or "\n Enzymes which do not cut the sequence.\n\n" Join = "".join for key in sorted(nc): st = Join((st, str.ljust(str(key), self.NameWidth))) if len(st) > self.linesize: stringsite = Join((stringsite, st, "\n")) st = "" stringsite = Join((stringsite, st, "\n")) return stringsite def _make_list_only(self, ls, title, nc=(), s1=""): """Summarise list of positions per enzyme (PRIVATE). Return a string of form:: title. enzyme1 : position1, position2. enzyme2 : position1, position2, position3. ... Arguments: - ls is a tuple or list of results. - title is a string. - Non cutting enzymes are not included. """ if not ls: return title return self.__next_section(ls, title) def _make_number_only(self, ls, title, nc=(), s1=""): """Summarise number of cuts as a string (PRIVATE). Return a string of form:: title. enzyme which cut 1 time: enzyme1 : position1. enzyme which cut 2 times: enzyme2 : position1, position2. ... Arguments: - ls is a list of results. - title is a string. - Non cutting enzymes are not included. """ if not ls: return title ls.sort(key=lambda x: len(x[1])) iterator = iter(ls) cur_len = 1 new_sect = [] for name, sites in iterator: length = len(sites) if length > cur_len: title += "\n\nenzymes which cut %i times :\n\n" % cur_len title = self.__next_section(new_sect, title) new_sect, cur_len = [(name, sites)], length continue new_sect.append((name, sites)) title += "\n\nenzymes which cut %i times :\n\n" % cur_len return self.__next_section(new_sect, title) def _make_map_only(self, ls, title, nc=(), s1=""): """Make string describing cutting map (PRIVATE). Return a string of form:: | title. | | enzyme1, position | | | AAAAAAAAAAAAAAAAAAAAA... | ||||||||||||||||||||| | TTTTTTTTTTTTTTTTTTTTT... Arguments: - ls is a list of results. - title is a string. - Non cutting enzymes are not included. """ if not ls: return title resultKeys = sorted(str(x) for x, y in ls) map = title or "" enzymemap = {} for (enzyme, cut) in ls: for c in cut: if c in enzymemap: enzymemap[c].append(str(enzyme)) else: enzymemap[c] = [str(enzyme)] mapping = sorted(enzymemap.keys()) cutloc = {} x, counter, length = 0, 0, len(self.sequence) for x in range(60, length, 60): counter = x - 60 loc = [] cutloc[counter] = loc remaining = [] for key in mapping: if key <= x: loc.append(key) else: remaining.append(key) mapping = remaining cutloc[x] = mapping sequence = str(self.sequence) revsequence = str( self.sequence.complement(inplace=False) ) # TODO: remove inplace=False a = "|" base, counter = 0, 0 emptyline = " " * 60 Join = "".join for base in range(60, length, 60): counter = base - 60 line = emptyline for key in cutloc[counter]: s = "" if key == base: for n in enzymemap[key]: s = " ".join((s, n)) chunk = line[0:59] lineo = Join((chunk, str(key), s, "\n")) line2 = Join((chunk, a, "\n")) linetot = Join((lineo, line2)) map = Join((map, linetot)) break for n in enzymemap[key]: s = " ".join((s, n)) k = key % 60 lineo = Join((line[0 : (k - 1)], str(key), s, "\n")) line = Join((line[0 : (k - 1)], a, line[k:])) line2 = Join((line[0 : (k - 1)], a, line[k:], "\n")) linetot = Join((lineo, line2)) map = Join((map, linetot)) mapunit = "\n".join( ( sequence[counter:base], a * 60, revsequence[counter:base], Join( ( str.ljust(str(counter + 1), 15), " " * 30, str.rjust(str(base), 15), "\n\n", ) ), ) ) map = Join((map, mapunit)) line = " " * 60 for key in cutloc[base]: s = "" if key == length: for n in enzymemap[key]: s = Join((s, " ", n)) chunk = line[0 : (length - 1)] lineo = Join((chunk, str(key), s, "\n")) line2 = Join((chunk, a, "\n")) linetot = Join((lineo, line2)) map = Join((map, linetot)) break for n in enzymemap[key]: s = Join((s, " ", n)) k = key % 60 lineo = Join((line[0 : (k - 1)], str(key), s, "\n")) line = Join((line[0 : (k - 1)], a, line[k:])) line2 = Join((line[0 : (k - 1)], a, line[k:], "\n")) linetot = Join((lineo, line2)) map = Join((map, linetot)) mapunit = "" mapunit = Join((sequence[base:length], "\n")) mapunit = Join((mapunit, a * (length - base), "\n")) mapunit = Join((mapunit, revsequence[base:length], "\n")) mapunit = Join( ( mapunit, Join( ( str.ljust(str(base + 1), 15), " " * (length - base - 30), str.rjust(str(length), 15), "\n\n", ) ), ) ) map = Join((map, mapunit)) return map # private method to do lists: def __next_section(self, ls, into): """Next section (PRIVATE). Arguments: - ls is a tuple/list of tuple (string, [int, int]). - into is a string to which the formatted ls will be added. Format ls as a string of lines: The form is:: enzyme1 : position1. enzyme2 : position2, position3. then add the formatted ls to tot return tot. """ indentation = "\n" + (self.NameWidth + self.Indent) * " " linesize = self.linesize - self.MaxSize pat = re.compile(r"([\w,\s()]){1,%i}[,\.]" % linesize) several, Join = "", "".join for name, sites in sorted(ls): stringsite = "" output = Join((", ".join(str(site) for site in sites), ".")) if len(output) > linesize: # # cut where appropriate and add the indentation # output = [x.group() for x in re.finditer(pat, output)] stringsite = indentation.join(output) else: stringsite = output into = Join( (into, str(name).ljust(self.NameWidth), " : ", stringsite, "\n") ) return into