text
stringlengths 105
4.57k
| label
int64 0
1
| label_text
stringclasses 2
values |
|---|---|---|
Besides the classic MAP groups, novel MAPs have been identified that bind the length of the microtubules. These include STOP (also known as MAP6), and ensconsin (also known as MAP7).
In addition, plus end tracking proteins, which bind to the very tip of growing microtubules, have also been identified. These include EB1, EB2, EB3, p150Glued, Dynamitin, Lis1, CLIP170, CLIP115, CLASP1, and CLASP2.
Another MAP whose function has been investigated during cell division is known as XMAP215 (the "X" stands for Xenopus). XMAP215 has generally been linked to microtubule stabilization. During mitosis the dynamic instability of microtubules has been observed to rise approximately tenfold. This is partly due to phosphorylation of XMAP215, which makes catastrophes (rapid depolymerization of microtubules) more likely. In this way the phosphorylation of MAPs plays a role in mitosis.
There are many other proteins which affect microtubule behavior, such as catastrophin, which destabilizes microtubules, katanin, which severs them, and a number of motor proteins that transport vesicles along them. Certain motor proteins were originally designated as MAPs before it was found that they utilized ATP hydrolysis to transport cargo. In general, all these proteins are not considered "MAPs" because they do not bind directly to tubulin monomers, a defining characteristic of MAPs. MAPs bind directly to microtubules to stabilize or destabilize them and link them to various cellular components including other microtubules. | 1 | Applied and Interdisciplinary Chemistry |
Ignition should not be confused with breakeven, a similar concept that compares the total energy being given off to the energy being used to heat the fuel. The key difference is that breakeven ignores losses to the surroundings, which do not contribute to heating the fuel, and thus are not able to make the reaction self-sustaining. Breakeven is an important goal in the fusion energy field, but ignition is required for a practical energy producing design.
In nature, stars reach ignition at temperatures similar to that of the Sun, around 15 million kelvins (27 million degrees F). Stars are so large that the fusion products will almost always interact with the plasma before their energy can be lost to the environment at the outside of the star. In comparison, man-made reactors are far less dense and much smaller, allowing the fusion products to easily escape the fuel. To offset this, much higher rates of fusion are required, and thus much higher temperatures; most man-made fusion reactors are designed to work at temperatures over 100 million kelvins (180 million degrees F).
Fusion ignition was first achieved by humans in the cores of detonating thermonuclear weapons. A thermonuclear weapon uses a conventional fission (U-235 or Pu-239/241) "sparkplug" to generate high pressures and compress a rod of fusion fuel (usually lithium deuteride). The fuel reaches high enough pressures and densities to ignite, releasing large amounts of energy and neutrons in the process.
The National Ignition Facility at Lawrence Livermore National Laboratory performs laser-driven inertial confinement fusion experiments that achieve fusion ignition. This is similar to a thermonuclear weapon, but the National Ignition Facility uses a 1.8 MJ laser system instead of a fission weapon to compress the fuel, and uses a much smaller amount of fuel (a mixture of deuterium and tritium, which are both isotopes of hydrogen).
In January 2012, National Ignition Facility Director Mike Dunne predicted in a Photonics West 2012 plenary talk that ignition would be achieved at NIF by October 2012.
By 2022 the NIF had achieved ignition.
Based on the tokamak reactor design, the ITER is intended to sustain fusion mostly by internal fusion heating and yield in its plasma a ten-fold return on power. Construction is expected to be completed in 2025.
Experts believe that achieving fusion ignition is the first step towards electricity generation using fusion power. | 0 | Theoretical and Fundamental Chemistry |
A quaternary carbon is a carbon atom bound to four other carbon atoms. For this reason, quaternary carbon atoms are found only in hydrocarbons having at least five carbon atoms. Quaternary carbon atoms can occur in branched alkanes, but not in linear alkanes. | 0 | Theoretical and Fundamental Chemistry |
X-ray spectroscopy methods can be used for genuine operando analyses of catalysts and other functional materials. The redox dynamics of sulfur with Ni/GDC anode during solid oxide fuel cell (SOFC) operation at mid- and low-range temperatures in an operando S K-edge XANES have been studied. Ni is a typical catalyst material for the anode in high temperature SOFCs.
The operando spectro-electrochemical cell for this high temperature gas-solid reaction study under electrochemical conditions was based on a typical high temperature heterogeneous catalysis cell, which was further equipped with electric terminals.
Very early method development for operando studies on PEM-FC fuel cells was done by Haubold et al. at Forschungszentrum Jülich and HASYLAB. Specifically they developed plexiglas spectro-electrochemical cells for XANES, EXAFS and SAXS and ASAXS studies with control of the electrochemical potential of the fuel cell. Under operation of the fuel cell they determined the change of the particle size of and oxidation state and shell formation of the platinum electrocatalyst. In contrast to the SOFC operation conditions, this was a PEM-FC study in liquid environment under ambient temperature.
The same operando method is applied to battery research and yields information on the changes of the oxidation state of electrochemically active elements in a cathode such as Mn via XANES, information on coronation shell and bond length via EXAFS, and information on microstructure changes during battery operation via ASAXS. Since lithium ion batteries are intercalation batteries, information on the chemistry and electronic structure going on in the bulk during operation are of interest. For this, soft x-ray information can be obtained using hard X-ray Raman scattering.
Fixed energy methods (FEXRAV) have been developed and applied to the study of the catalytic cycle for the oxygen evolution reaction on iridium oxide. FEXRAV consists of recording the absorption coefficient at a fixed energy while varying at will the electrode potential in an electrochemical cell during the course of an electrochemical reaction. It allows to obtain a rapid screening of several systems under different experimental conditions (e.g., nature of the electrolyte, potential window), preliminary to deeper XAS experiments.
The soft X-Ray regime (i.e. with photon energy < 1000 eV) can be profitably used for investigating heterogeneous solid-gas reaction. In this case, it is proved that XAS can be sensitive both to the gas phase and to the solid surface states. | 0 | Theoretical and Fundamental Chemistry |
Neocarzinostatin is a natural product of Streptomyces carzinostaticus. It forms an apoprotein with a 113-amino acid polypeptide which can cleave histone protein H1. Neocarzinostatin is an example of an enediyne that undergoes triggering via Myers-Saito cyclization. An analog of neocarzinostatin, SMANCS, has been approved for use in Japan as an antitumor drug for liver cancer. | 0 | Theoretical and Fundamental Chemistry |
Regulation of glyceroneogenesis is a therapeutic target of type 2 diabetes treatment, specifically inhibiting it in the liver and increasing it in adipose tissues. Insulin down-regulates glyceroneogenesis in the liver, but it also suppresses it in adipose tissue. To restrict the release of free fatty acids from adipose tissues, glyceroneogenesis must be increased so they are re-esterified. Thiazolidinedione is a substance that only affects glyceroneogenesis in adipose tissue by increasing transcription of PEPC-K to up-regulate glyceroneogenesis. | 1 | Applied and Interdisciplinary Chemistry |
In standard cis-splicing, the donor splice site in upstream position is required together with an acceptor site located on downstream position on the same pre-RNA molecule.
By contrast, the SL trans-splicing relies on a 3 acceptor splice site on the outron, and a 5 donor splice site (GU dinucleotide) located on a separate RNA molecule, the SL RNA.
Moreover, the outron of the premature mRNA contains a branchpoint adenosine — followed by a downstream polypyrimidine tract — which interacts with the intron-like portion of the SL RNA to form a Y branched byproduct, reminiscent of the lasso structure formed during intron splicing. Nuclear machinery then resolves this Y branching structure by trans-splicing the SL RNA sequence to the 3′ trans-splice acceptor site (AG dinucleotide) of the pre-mRNA.
When outrons are processed, the SL exon is trans-spliced to distinct, unpaired, downstream acceptor sites adjacent to each open reading frame of the polycistronic pre-mRNA, leading to distinct mature capped transcripts. | 1 | Applied and Interdisciplinary Chemistry |
Retention uniformity is calculated from the following formula:
where n is the number of compounds separated, R are the Retention factor of the compounds sorted in non-descending order. | 0 | Theoretical and Fundamental Chemistry |
Similar to yttrium, rare-earth metals from Gd to Lu can form REBSi-type boride. The first such compound was synthesized by solid-state reaction and its structure was deduced as YB. X-ray powder diffraction (XRD) and electron diffraction indicated that YB has an orthorhombic structure with lattice constants a = 1.66251(9), b = 1.76198 and c = 0.94797(3) nm. The space group was assigned as P222. Because of the close similarity in lattice constants and space group, one might expect that YB has the γ-AlB-type orthorhombic structure whose lattice constants and space group are a = 1.6573(4), b = 1.7510(3) and c = 1.0144(1) nm and P222. YB decomposes at ~1750 °C without melting that hinders growth of single crystals from the melt. Small addition of silicon made YB to melt without decomposition, and so enabled single-crystal growth from the melt and single-crystal structure analysis.
The structure analysis indicated that YBSi has not the γ-AlB-type lattice but a rare orthorhombic crystal structure (space group: Pbam, No. 55) with lattice constants of a = 1.674(1) nm, b = 1.7667(1) nm and c = 0.9511(7) nm. There are 58 independent atomic sites in the unit cell. Three of them are occupied by either B or Si atoms (mixed-occupancy sites), one is a Si bridge site and one is Y site. From the remaining 53 boron sites, 48 form icosahedra and 5 are bridging sites. Atomic coordinates and site occupancies are summarized in table III.
The boron framework of YBSi consists of five B icosahedra (I1–I5) and a BSi polyhedron shown in figure 8a. An unusual linkage is depicted in figure 8b, where two B-I5 icosahedra connect via two B atoms of each icosahedron forming an imperfect square. The boron framework of YBSi can be described as a layered structure where two boron networks (figures 9a,b) stack along the z-axis. One boron network consists of 3 icosahedra I1, I2 and I3 and is located in the z = 0 plane; another network consists of the icosahedron I5 and the BSi polyhedron and lies at z = 0.5. The icosahedron I4 bridges these networks, and thus its height along the z-axis is 0.25.
The I4 icosahedra link two networks along the c-axis and therefore form an infinite chain of icosahedra along this axis as shown in figure 10. The unusually short distances (0.4733 and 0.4788 nm) between the neighboring icosahedra in this direction result in the relatively small c-axis lattice constant of 0.95110(7) nm in this compound – other borides with a similar icosahedral chain have this value larger than 1.0 nm. However, the bonding distances between the apex B atoms (0.1619 and 0.1674 nm) of neighboring I4 icosahedra are usual for the considered metal borides.
Another unusual feature of YBSi is the 100% occupancy of the Y site. In most icosahedron-based metal borides, metal sites have rather low site occupancy, for example, about 50% for YB and 60–70% for REAlB. When the Y site is replaced by rare-earth elements, REBSi can have an antiferromagnetic-like ordering because of this high site occupancy. | 0 | Theoretical and Fundamental Chemistry |
The meaning of the term has evolved. The original meaning of transfection was "infection by transformation", i.e., introduction of genetic material, DNA or RNA, from a prokaryote-infecting virus or bacteriophage into cells, resulting in an infection. For work with bacterial and archaeal cells transfection retains its original meaning as a special case of transformation. Because the term transformation had another sense in animal cell biology (a genetic change allowing long-term propagation in culture, or acquisition of properties typical of cancer cells), the term transfection acquired, for animal cells, its present meaning of a change in cell properties caused by introduction of DNA. | 1 | Applied and Interdisciplinary Chemistry |
Sidney Cohen was a Los Angeles-based psychiatrist. His work focused on the effects of psychedelics, primarily LSD. Cohen published 13 books in his life, all of them based on drugs and substance abuse. He began working with LSD in the 1950s. One of his earlier works is a video of an experiment that shows Cohen interviewing a woman before and after administering her LSD.
In the later part of the 1960s he worked as a director for the National Institute of Mental Health in their Division of Narcotic Addiction and Drug Abuse. He has been open about having taken LSD many times himself, but was always opposed to the growing use of LSD amongst members of the counterculture movement. Cohen thought LSD was safe only if used under medical supervision and that the average person was not equipped with the ability to handle the drug safely. Through his work he had become known as one of the leading experts in LSD research. | 1 | Applied and Interdisciplinary Chemistry |
For mass spectrometry studies at low pressure, methenium can be obtained by ultraviolet photoionization of methyl radical, or by collisions of monatomic cations such as and with neutral methane. In such conditions, it will react with acetonitrile to form the ion .
Upon capture of a low-energy electron (less than ), it will spontaneously dissociate.
It is seldom encountered as an intermediate in the condensed phase. It is proposed as a reactive intermediate that forms upon protonation or hydride abstraction of methane with FSOH-SbF. The methenium ion is very reactive, even towards alkanes. | 0 | Theoretical and Fundamental Chemistry |
Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long:
GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT
When used alone without the gamma and beta WPRE components, the alpha component is only 9% as active as the full tripartite WPRE. The sequence for full tripartite WPRE is:
This sequence has 100% homology with base pairs 1093 to 1684 of the Woodchuck hepatitis B virus (WHV8) genome. When used in the 3' untranslated region (UTR) of a mammalian expression cassette, it can significantly increase mRNA stability and protein yield. | 1 | Applied and Interdisciplinary Chemistry |
A dynamic shear rheometer, commonly known as DSR is used for research and development as well as for quality control in the manufacturing of a wide range of materials. Dynamic shear rheometers have been used since 1993 when Superpave was used for characterising and understanding high temperature rheological properties of asphalt binders in both the molten and solid state and is fundamental in order to formulate the chemistry and predict the end-use performance of these materials. | 1 | Applied and Interdisciplinary Chemistry |
Real-time PCR permits the identification of specific, amplified DNA fragments using analysis of their melting temperature (also called T value, from melting temperature). The method used is usually PCR with double-stranded DNA-binding dyes as reporters and the dye used is usually SYBR Green. The DNA melting temperature is specific to the amplified fragment. The results of this technique are obtained by comparing the dissociation curves of the analysed DNA samples.
Unlike conventional PCR, this method avoids the previous use of electrophoresis techniques to demonstrate the results of all the samples. This is because, despite being a kinetic technique, quantitative PCR is usually evaluated at a distinct end point. The technique therefore usually provides more rapid results and/or uses fewer reactants than electrophoresis. If subsequent electrophoresis is required it is only necessary to test those samples that real time PCR has shown to be doubtful and/or to ratify the results for samples that have tested positive for a specific determinant. | 1 | Applied and Interdisciplinary Chemistry |
Electrochemical sensors can be used for label-free sensing of biomolecules. They detect changes and measure current between a probed metal electrode and an electrolyte containing the target analyte. A known potential to the electrode is then applied from a feedback current and the resulting current can be measured. For example, one technique using electrochemical sensing includes slowly raising the voltage causing chemical species at the electrode to be oxidized or reduced. Cell current vs voltage is plotted which can ultimately identify the quantity of chemical species consumed or produced at the electrode. Fluorescent tags can be used in conjunction with electrochemical sensors for ease of detection in a biological system. | 1 | Applied and Interdisciplinary Chemistry |
In chemistry, a trigonal bipyramid formation is a molecular geometry with one atom at the center and 5 more atoms at the corners of a triangular bipyramid. This is one geometry for which the bond angles surrounding the central atom are not identical (see also pentagonal bipyramid), because there is no geometrical arrangement with five terminal atoms in equivalent positions. Examples of this molecular geometry are phosphorus pentafluoride (), and phosphorus pentachloride () in the gas phase. | 0 | Theoretical and Fundamental Chemistry |
The ICBM carries out fundamental and applied research in marine and environmental sciences. Interdisciplinary research will provide understanding of the various interactions of marine environmental systems.
The research focuses on marine biogeochemical cycles and energy fluxes, as well as on the functional role of marine biodiversity, especially in coastal zones worldwide, and in the oceans.
The mathematic modelling of different environmental systems is complemented by modern, high-resolution analytics and in-house marine sensor developments.
The institute is composed of three sections covering altogether 18 research groups:
*Section Geochemistry and Analytics
*Section Biology and Ecology
*Section Physics and Modelling
For a better understanding of the complex relations the ICBM aims to foster interdisciplinary research. | 0 | Theoretical and Fundamental Chemistry |
A multichannel analyzer uses a fast ADC to record incoming pulses and stores information about pulses in one of two ways: | 0 | Theoretical and Fundamental Chemistry |
Dexketoprofen belongs to a class of medicines called NSAIDs. It works by blocking the action of a substance in the body called cyclo-oxygenase, which is involved in the production of chemicals in the body called prostaglandins. Prostaglandins are produced in response to injury or certain diseases and would otherwise go on to cause swelling, inflammation and pain. By blocking cyclo-oxygenase, dexketoprofen prevents the production of prostaglandins and therefore reduces inflammation and pain. Along with peripheral analgesic action, it possesses central analgesic action. | 0 | Theoretical and Fundamental Chemistry |
The functioning of a signal transduction pathway is based on extra-cellular signaling that in turn creates a response that causes other subsequent responses, hence creating a chain reaction, or cascade. During the course of signaling, the cell uses each response for accomplishing some kind of a purpose along the way. Insulin secretion mechanism is a common example of signal transduction pathway mechanism.
Insulin is produced by the pancreas in a region called Islets of Langerhans. In the islets of Langerhans, there are beta-cells, which are responsible for production and storage of insulin. Insulin is secreted as a response mechanism for counteracting the increasing excess amounts of glucose in the blood.
Glucose in the body increases after food consumption. This is primarily due to carbohydrate intake, but to a much lesser degree protein intake ([http://jcem.endojournals.org/content/89/6/3048.long])([http://genesdev.cshlp.org/content/24/24/2717.long]). Depending on the tissue type, the glucose enters the cell through facilitated diffusion or active transport. In muscle and adipose tissue, glucose enters through GLUT 4 receptors via facilitated diffusion ([http://ajpendo.physiology.org/content/299/2/E169.long]). In brain, retina, kidney, RBC, placenta and many other organs, glucose enters using GLUT 1 and GLUT 3. In the beta-cells of the pancreas and in liver cells, glucose enters through the GLUT 2 receptors
(process described below). | 1 | Applied and Interdisciplinary Chemistry |
Adam S. Veige is a professor of Chemistry at the University of Florida. His research focuses on catalysis and the usage of inorganic compounds, including tungsten and chromium complexes. | 0 | Theoretical and Fundamental Chemistry |
Agmatine produces mild reductions in heart rate and blood pressure, apparently by activating both central and peripheral control systems via modulation of several of its molecular targets including: imidazoline receptors subtypes, norepinephrine release and NO production. | 1 | Applied and Interdisciplinary Chemistry |
In July 2022, concerns were raised by Matthew Schrag, a Vanderbilt University neuroscientist, that certain images in the 2006 Nature paper were manipulated in the paper co-authored by Ashes postdoctoral Sylvain Lesné, whom she hired in 2002. These concerns were published in an article in Science authored by Charles Piller which questioned the association between the Aβ*56 protein and dementia symptoms. Ashe stated in July 2022 via email that "it is devastating to discover that a colleague may have misled me and the scientific community [... it is also] distressing that a major scientific journal has blatantly misrepresented the implications of my work." Ashe has stated that the edited images, which she agrees "should not have occurred", do not change the conclusions of the paper. No image inconsistencies have been found in other work published by Ashe without' Lesné as a co-author.
UMN is investigating the reports as of May 2023. The editors of Nature responded with a July 14, 2022 note stating they were aware of and investigating the concerns raised, that a "further editorial response [would] follow as soon as possible", and that "readers are advised to use caution when using results reported therein". The NIH, where Schrag lodged the whistleblower report, is also investigating the matter. Retraction Watch states that Ashe co-authored with Lesné other disputed papers, and that the authors in the disputed work do not overlap except for two from UMN Department of Neuroscience.
In May of 2023, the Star Tribune reported that Ashe was using new techniques to re-do the work reported in the 2006 Nature study, and that she stated "its my responsibility to establish the truth of what weve published". | 1 | Applied and Interdisciplinary Chemistry |
The Fridge Gate method is a theoretical application of using a single logic gate to drive a refrigerator in the most energy efficient way possible without violating the laws of thermodynamics. It operates on the fact that there are two energy states in which a particle can exist: the ground state and the excited state. The excited state carries a little more energy than the ground state, small enough so that the transition occurs with high probability. There are three components or particle types associated with the fridge gate. The first is on the interior of the refrigerator, the second on the outside and the third is connected to a power supply which heats up every so often that it can reach the E state and replenish the source. In the cooling step on the inside of the refrigerator, the g state particle absorbs energy from ambient particles, cooling them, and itself jumping to the e state. In the second step, on the outside of the refrigerator where the particles are also at an e state, the particle falls to the g state, releasing energy and heating the outside particles. In the third and final step, the power supply moves a particle at the e state, and when it falls to the g state it induces an energy-neutral swap where the interior e particle is replaced by a new g particle, restarting the cycle. | 0 | Theoretical and Fundamental Chemistry |
Although the exact route of vanillin biosynthesis in V. planifolia is currently unknown, several pathways are proposed for its biosynthesis. Vanillin biosynthesis is generally agreed to be part of the phenylpropanoid pathway starting with -phenylalanine, which is deaminated by phenylalanine ammonia lyase (PAL) to form t-cinnamic acid. The para position of the ring is then hydroxylated by the cytochrome P450 enzyme cinnamate 4-hydroxylase (C4H/P450) to create p-coumaric acid. Then, in the proposed ferulate pathway, 4-hydroxycinnamoyl-CoA ligase (4CL) attaches p-coumaric acid to coenzyme A (CoA) to create p-coumaroyl CoA. Hydroxycinnamoyl transferase (HCT) then converts p-coumaroyl CoA to 4-coumaroyl shikimate/quinate. This subsequently undergoes oxidation by the P450 enzyme coumaroyl ester 3’-hydroxylase (C3’H/P450) to give caffeoyl shikimate/quinate. HCT then exchanges the shikimate/quinate for CoA to create caffeoyl CoA, and 4CL removes CoA to afford caffeic acid. Caffeic acid then undergoes methylation by caffeic acid O-methyltransferase (COMT) to give ferulic acid. Finally, vanillin synthase hydratase/lyase (vp/VAN) catalyzes hydration of the double bond in ferulic acid followed by a retro-aldol elimination to afford vanillin. Vanillin can also be produced from vanilla glycoside with the additional final step of deglycosylation. In the past p-hydroxybenzaldehyde was speculated to be a precursor for vanillin biosynthesis. However, a 2014 study using radiolabelled precursor indicated that p-hydroxybenzaldehyde is not used to synthesise vanillin or vanillin glucoside in the vanilla orchids. | 0 | Theoretical and Fundamental Chemistry |
Hexosaminidases (Hex) are important glycoside hydrolases for the generation of plant-specific paucimannosidic proteins across Plantae. HEXO1-HEXO3 have been reported to be key mediators of paucimannose expression in various plant species including Nicotiana benthamiana, A.thaliana and L. japonicus. Moreover, α1,3-fucosyltransferase (FUT11/12) and β1,2-xylosyltransferase as well as α-mannosidase II were also reported to play critical roles in the generation of the paucimannosidic proteins expressed by plants. | 1 | Applied and Interdisciplinary Chemistry |
Mitochondrial disorders may be caused by mutations (acquired or inherited), in mitochondrial DNA (mtDNA), or in nuclear genes that code for mitochondrial components. They may also be the result of acquired mitochondrial dysfunction due to adverse effects of drugs, infections, or other environmental causes.
Nuclear DNA has two copies per cell (except for sperm and egg cells), one copy being inherited from the father and the other from the mother. Mitochondrial DNA, however, is inherited from the mother only (with some exceptions) and each mitochondrion typically contains between 2 and 10 mtDNA copies. During cell division the mitochondria segregate randomly between the two new cells. Those mitochondria make more copies, normally reaching 500 mitochondria per cell. As mtDNA is copied when mitochondria proliferate, they can accumulate random mutations, a phenomenon called heteroplasmy. If only a few of the mtDNA copies inherited from the mother are defective, mitochondrial division may cause most of the defective copies to end up in just one of the new mitochondria (for more detailed inheritance patterns, see human mitochondrial genetics). Mitochondrial disease may become clinically apparent once the number of affected mitochondria reaches a certain level; this phenomenon is called "threshold expression".
Mitochondria possess many of the same DNA repair pathways as nuclei do—but not all of them; therefore, mutations occur more frequently in mitochondrial DNA than in nuclear DNA (see Mutation rate). This means that mitochondrial DNA disorders may occur spontaneously and relatively often. Defects in enzymes that control mitochondrial DNA replication (all of which are encoded for by genes in the nuclear DNA) may also cause mitochondrial DNA mutations.
Most mitochondrial function and biogenesis is controlled by nuclear DNA. Human mitochondrial DNA encodes 13 proteins of the respiratory chain, while most of the estimated 1,500 proteins and components targeted to mitochondria are nuclear-encoded. Defects in nuclear-encoded mitochondrial genes are associated with hundreds of clinical disease phenotypes including anemia, dementia, hypertension, lymphoma, retinopathy, seizures, and neurodevelopmental disorders.
A study by Yale University researchers (published in the February 12, 2004, issue of the New England Journal of Medicine) explored the role of mitochondria in insulin resistance among the offspring of patients with type 2 diabetes.
Other studies have shown that the mechanism may involve the interruption of the mitochondrial signaling process in body cells (intramyocellular lipids). A study conducted at the Pennington Biomedical Research Center in Baton Rouge, Louisiana showed that this, in turn, partially disables the genes that produce mitochondria. | 1 | Applied and Interdisciplinary Chemistry |
On 10 July 2020, the first full test of the system was successfully conducted. Amid fanfare, the Italian prime minister, Giuseppe Conte, activated the 78 mobile barriers. MOSE is expected to be fully functional by the end of 2025. It was used to actively combat threatened flooding on 3 October 2020. | 1 | Applied and Interdisciplinary Chemistry |
Residential sound programs aim to decrease or eliminate the effects of exterior noise. The main focus of the residential sound program in existing structures is the windows and doors. Solid wood doors are a better sound barrier than hollow doors. Curtains can be used to dampen sound, either through use of heavy materials or through the use of air chambers known as honeycombs. Single-, double- and triple-honeycomb designs achieve relatively greater degrees of sound damping. The primary soundproofing limit of curtains is the lack of a seal at the edge of the curtain, although this may be alleviated with the use of sealing features, such as hook and loop fastener, adhesive, magnets, or other materials. The thickness of glass will play a role when diagnosing sound leakage. Double-pane windows achieve somewhat greater sound damping than single-pane windows when well-sealed into the opening of the window frame and wall.
Significant noise reduction can also be achieved by installing a second interior window. In this case, the exterior window remains in place while a slider or hung window is installed within the same wall openings.
In the US, the FAA offers sound-reducing for homes that fall within a noise contour where the average sound level is or greater. It is part of their Residential Sound Insulation Program. The program provides solid-core wood entry doors plus windows and storm doors. | 1 | Applied and Interdisciplinary Chemistry |
The I. I. Rabi Prize in Atomic, Molecular, and Optical Physics is given by the American Physical Society to recognize outstanding work by mid-career researchers in the field of atomic, molecular, and optical physics. The award was endowed in 1989 in honor of the physicist I. I. Rabi and has been awarded biannually since 1991.
The prize citation reads: | 0 | Theoretical and Fundamental Chemistry |
High-performance liquid chromatography (HPLC), formerly referred to as high-pressure liquid chromatography, is a technique in analytical chemistry used to separate, identify, and quantify specific components in mixtures. The mixtures can originate from food, chemicals, pharmaceuticals, biological, environmental and agriculture, etc, which have been dissolved into liquid solutions.
It relies on high pressure pumps, which deliver mixtures of various solvents, called the mobile phase, which flows through the system, collecting the sample mixture on the way, delivering it into a cylinder, called the column, filled with solid particles, made of adsorbent material, called the stationary phase.
Each component in the sample interacts differently with the adsorbent material, causing different migration rates for each component. These different rates lead to separation as the species flow out of the column into a specific detector such as UV detectors. The output of the detector is a graph, called a chromatogram. Chromatograms are graphical representations of the signal intensity versus time or volume, showing peaks, which represent components of the sample. Each sample appears in its respective time, called its retention time, having area proportional to its amount.
HPLC is widely used for manufacturing (e.g., during the production process of pharmaceutical and biological products), legal (e.g., detecting performance enhancement drugs in urine), research (e.g., separating the components of a complex biological sample, or of similar synthetic chemicals from each other), and medical (e.g., detecting vitamin D levels in blood serum) purposes.
Chromatography can be described as a mass transfer process involving adsorption and/or partition. As mentioned, HPLC relies on pumps to pass a pressurized liquid and a sample mixture through a column filled with adsorbent, leading to the separation of the sample components. The active component of the column, the adsorbent, is typically a granular material made of solid particles (e.g., silica, polymers, etc.), 1.5–50 μm in size, on which various reagents can be bonded. The components of the sample mixture are separated from each other due to their different degrees of interaction with the adsorbent particles. The pressurized liquid is typically a mixture of solvents (e.g., water, buffers, acetonitrile and/or methanol) and is referred to as a "mobile phase". Its composition and temperature play a major role in the separation process by influencing the interactions taking place between sample components and adsorbent. These interactions are physical in nature, such as hydrophobic (dispersive), dipole–dipole and ionic, most often a combination. | 0 | Theoretical and Fundamental Chemistry |
*Development of the Beckman pH meter by Arnold Orville Beckman in 1935
*Research on cotton products, including the development of durable press and flame retardant cotton by the USDA-Agricultural Research Service's Southern Regional Research Center in the 1950s and 1960s
*Research on carbohydrate metabolism and establishment of the Cori cycle in 1929 by Carl and Gerty Cori, at the Washington University School of Medicine | 1 | Applied and Interdisciplinary Chemistry |
Transcriptomic analyses may be validated using an independent technique, for example, quantitative PCR (qPCR), which is recognisable and statistically assessable. Gene expression is measured against defined standards both for the gene of interest and control genes. The measurement by qPCR is similar to that obtained by RNA-Seq wherein a value can be calculated for the concentration of a target region in a given sample. qPCR is, however, restricted to amplicons smaller than 300 bp, usually toward the 3’ end of the coding region, avoiding the 3’UTR. If validation of transcript isoforms is required, an inspection of RNA-Seq read alignments should indicate where qPCR primers might be placed for maximum discrimination. The measurement of multiple control genes along with the genes of interest produces a stable reference within a biological context. qPCR validation of RNA-Seq data has generally shown that different RNA-Seq methods are highly correlated.
Functional validation of key genes is an important consideration for post transcriptome planning. Observed gene expression patterns may be functionally linked to a phenotype by an independent knock-down/rescue study in the organism of interest. | 1 | Applied and Interdisciplinary Chemistry |
Hahn's intention was still to work in industry. He received an offer of employment from Eugen Fischer, the director of (and the father of organic chemist Hans Fischer), but a condition of employment was that Hahn had to have lived in another country and have a reasonable command of another language. With this in mind, and to improve his knowledge of English, Hahn took up a post at University College London in 1904, working under Sir William Ramsay, who was known for having discovered the inert gases. Here Hahn worked on radiochemistry, at that time a very new field. In early 1905, in the course of his work with salts of radium, Hahn discovered a new substance he called radiothorium (thorium-228), which at that time was believed to be a new radioactive element. (In fact, it was an isotope of the known element thorium; the concept of an isotope, along with the term, was only coined in 1913, by the British chemist Frederick Soddy).
Ramsay was enthusiastic when yet another new element was found in his institute, and he intended to announce the discovery in a correspondingly suitable way. In accordance with tradition this was done before the committee of the venerable Royal Society. At the session of the Royal Society on 16 March 1905 Ramsay communicated Hahns discovery of radiothorium. The Daily Telegraph' informed its readers:
Hahn published his results in the Proceedings of the Royal Society on 24 May 1905. It was the first of over 250 scientific publications of Otto Hahn in the field of radiochemistry. At the end of his time in London, Ramsay asked Hahn about his plans for the future, and Hahn told him about the job offer from Kalle & Co. Ramsay told him radiochemistry had a bright future, and that someone who had discovered a new radioactive element should go to the University of Berlin. Ramsay wrote to Emil Fischer, the head of the chemistry institute there, who replied that Hahn could work in his laboratory, but could not be a Privatdozent because radiochemistry was not taught there. At this point, Hahn decided that he first needed to know more about the subject, so he wrote to the leading expert on the field, Ernest Rutherford. Rutherford agreed to take Hahn on as an assistant, and Hahns parents undertook to pay Hahns expenses.
From September 1905 until mid-1906, Hahn worked with Rutherford's group in the basement of the Macdonald Physics Building at McGill University in Montreal. There was some scepticism about the existence of radiothorium, which Bertram Boltwood memorably described as a compound of thorium X and stupidity. Boltwood was soon convinced that it did exist, although he and Hahn differed on what its half life was. William Henry Bragg and Richard Kleeman had noted that the alpha particles emitted from radioactive substances always had the same energy, providing a second way of identifying them, so Hahn set about measuring the alpha particle emissions of radiothorium. In the process, he found that a precipitation of thorium A (polonium-216) and thorium B (lead-212) also contained a short-lived "element", which he named thorium C (which was later identified as polonium-212). Hahn was unable to separate it, and concluded that it had a very short half life (it is about 300 ns). He also identified radioactinium (thorium-227) and radium D (later identified as lead-210). Rutherford remarked that: "Hahn has a special nose for discovering new elements." | 0 | Theoretical and Fundamental Chemistry |
Bhushan began his education in his native India, completing his undergraduate degree and his master's from the University of Jodhpur. He received his Ph.D. in chemistry (working on structure elucidation of natural products isolated from certain desert plants) in 1978 at the University of Jodhpur. Bhushan joined as lecturer at the University of Roorkee (now Indian Institute of Technology Roorkee, India) in 1979 and was later selected for the position of full professor of chemistry in 1996 and served there till retirement in 2018. | 0 | Theoretical and Fundamental Chemistry |
Flight can be roughly classified in six categories:
For comparison: the required speed for low Earth orbit is approximately 7.5 km/s = Mach 25.4 in air at high altitudes.
At transonic speeds, the flow field around the object includes both sub- and supersonic parts. The transonic period begins when first zones of M > 1 flow appear around the object. In case of an airfoil (such as an aircraft's wing), this typically happens above the wing. Supersonic flow can decelerate back to subsonic only in a normal shock; this typically happens before the trailing edge. (Fig.1a)
As the speed increases, the zone of M > 1 flow increases towards both leading and trailing edges. As M = 1 is reached and passed, the normal shock reaches the trailing edge and becomes a weak oblique shock: the flow decelerates over the shock, but remains supersonic. A normal shock is created ahead of the object, and the only subsonic zone in the flow field is a small area around the object's leading edge. (Fig.1b)
Fig. 1. Mach number in transonic airflow around an airfoil; M < 1 (a) and M > 1 (b).
When an aircraft exceeds Mach 1 (i.e. the sound barrier), a large pressure difference is created just in front of the aircraft. This abrupt pressure difference, called a shock wave, spreads backward and outward from the aircraft in a cone shape (a so-called Mach cone). It is this shock wave that causes the sonic boom heard as a fast moving aircraft travels overhead. A person inside the aircraft will not hear this. The higher the speed, the more narrow the cone; at just over M = 1 it is hardly a cone at all, but closer to a slightly concave plane.
At fully supersonic speed, the shock wave starts to take its cone shape and flow is either completely supersonic, or (in case of a blunt object), only a very small subsonic flow area remains between the object's nose and the shock wave it creates ahead of itself. (In the case of a sharp object, there is no air between the nose and the shock wave: the shock wave starts from the nose.)
As the Mach number increases, so does the strength of the shock wave and the Mach cone becomes increasingly narrow. As the fluid flow crosses the shock wave, its speed is reduced and temperature, pressure, and density increase. The stronger the shock, the greater the changes. At high enough Mach numbers the temperature increases so much over the shock that ionization and dissociation of gas molecules behind the shock wave begin. Such flows are called hypersonic.
It is clear that any object travelling at hypersonic speeds will likewise be exposed to the same extreme temperatures as the gas behind the nose shock wave, and hence choice of heat-resistant materials becomes important. | 1 | Applied and Interdisciplinary Chemistry |
ACE-inhibitors like lisinopril are considered to be generally safe for people undergoing routine dental care, though the use of lisinopril prior to dental surgery is more controversial, with some dentists recommending discontinuation the morning of the procedure. People may present to dental care suspicious of an infected tooth, but the swelling around the mouth may be due to lisinopril-induced angioedema, prompting emergency and medical referral. | 0 | Theoretical and Fundamental Chemistry |
Tropical forests receive more insolation and rainfall over longer growing seasons than any other environment on earth. With these elevated temperatures, insolation and rainfall, biomass is extremely productive leading to the production of as much as 800 grams of carbon per square meter per year (8 tons of C/hectare/year). Higher temperatures and larger amounts of water contribute to higher rates of chemical weathering. Increased rates of decomposition cause smaller amounts of fulvic acid to percolate and leach metals from the zone of active weathering. Thus, in stark contrast to soil in temperate forests, tropical forests have little to no podzolization and therefore do not have marked visual and chemical contrasts with the soil layers. Instead, the mobile metals Mg, Fe and Al are precipitated as oxide minerals giving the soil a rusty red color. | 0 | Theoretical and Fundamental Chemistry |
In polymer chemistry, there are several mechanisms by which a polymerization reaction can terminate depending on the mechanism and circumstances of the reaction. A method of termination that applies to all polymer reactions is the depletion of monomer. In chain growth polymerization, two growing chains can collide head to head causing the growth of both of the chains to stop. In the case of radical or anionic polymerization, chain transfer can occur where the radical at the end of the growing chain can be transferred from the chain to an individual monomer unit causing a new chain to start growing and the previous chain to stop growing. With step-growth polymerization, the reaction can be terminated by adding a monofunctional species containing the same functionality as one or more of the types of monomer used in the reaction. For example, an alcohol can be used to stop a reaction between a polyisocyanate and a polyol because it will react with the isocyanate functionality to produce which is then no longer reactive with the polyol. | 0 | Theoretical and Fundamental Chemistry |
Al-Kindi was the first great theoretician of music in the Arab-Islamic world. He is known to have written fifteen treatises on music theory, but only five have survived. He added a fifth string to the 'ud. His works included discussions on the therapeutic value of music and what he regarded as "cosmological connections" of music. | 1 | Applied and Interdisciplinary Chemistry |
Aces II (Advanced Concepts in Electronic Structure Theory) is an ab initio computational chemistry package for performing high-level quantum chemical ab initio calculations. Its major strength is the accurate calculation of atomic and molecular energies as well as properties using many-body techniques such as many-body perturbation theory (MBPT) and, in particular coupled cluster techniques to treat electron correlation. The development of ACES II began in early 1990 in the group of Professor Rodney J. Bartlett at the Quantum Theory Project (QTP) of the University of Florida in Gainesville. There, the need for more efficient codes had been realized and the idea of writing an entirely new program package emerged. During 1990 and 1991 John F. Stanton, Jürgen Gauß, and John D. Watts, all of them at that time postdoctoral researchers in the Bartlett group, supported by a few students, wrote the backbone of what is now known as the ACES II program package. The only parts which were not new coding efforts were the integral packages (the MOLECULE package of J. Almlöf, the VPROP package of P.R. Taylor, and the integral derivative package ABACUS of T. Helgaker, P. Jorgensen J. Olsen, and H.J. Aa. Jensen). The latter was modified extensively for adaptation with Aces II, while the others remained very much in their original forms.
Ultimately, two different versions of the program evolved. The first was maintained by the Bartlett group at the University of Florida, and the other (known as ACESII-MAB) was maintained by groups at the University of Texas, Universitaet Mainz in Germany, and ELTE in Budapest, Hungary. The latter is now called CFOUR.
Aces III is a parallel implementation that was released in the fall of 2008. The effort led to definition of a new architecture for scalable parallel software called the super instruction architecture. The design and creation of software is divided into two parts:
# The algorithms are coded in a domain specific language called super instruction assembly language or SIAL, pronounced "sail" for easy communication.
# The SIAL programs are executed by a MPMD parallel virtual machine called the super instruction processor or SIP.
The ACES III program consists of 580,000 lines of SIAL code of which 200,000 lines are comments, and 230,000 lines of C/C++ and Fortran of which 62,000 lines are comments. The latest version of the program was released on August 1, 2014. | 0 | Theoretical and Fundamental Chemistry |
Jostels TSH index (TSHI or JTI), also referred to as Jostels thyrotropin index or Thyroid Function index (TFI), is a method for estimating the thyrotropic (i.e. thyroid stimulating) function of the anterior pituitary lobe in a quantitative way. The equation has been derived from the logarithmic standard model of thyroid homeostasis. In a paper from 2014 further study was suggested to show if it is useful, but the 2018 guideline by the European Thyroid Association for the diagnosis of uncertain cases of central hypothyroidism regarded it as beneficial. It is also recommended for purposes of differential diagnosis in the sociomedical expert assessment. | 1 | Applied and Interdisciplinary Chemistry |
Nuclear fission splits a heavy nucleus such as uranium or plutonium into two lighter nuclei, which are called fission products. Yield refers to the fraction of a fission product produced per fission.
Yield can be broken down by:
# Individual isotope
# Chemical element spanning several isotopes of different mass number but same atomic number.
# Nuclei of a given mass number regardless of atomic number. Known as "chain yield" because it represents a decay chain of beta decay.
Isotope and element yields will change as the fission products undergo beta decay, while chain yields do not change after completion of neutron emission by a few neutron-rich initial fission products (delayed neutrons), with half-life measured in seconds.
A few isotopes can be produced directly by fission, but not by beta decay because the would-be precursor with atomic number one greater is stable and does not decay. Chain yields do not account for these "shadowed" isotopes; however, they have very low yields (less than a millionth as much as common fission products) because they are far less neutron-rich than the original heavy nuclei.
Yield is usually stated as percentage per fission, so that the total yield percentages sum to 200%. Less often, it is stated as percentage of all fission products, so that the percentages sum to 100%. Ternary fission, about 0.2–0.4% of fissions, also produces a third light nucleus such as helium-4 (90%) or tritium (7%). | 0 | Theoretical and Fundamental Chemistry |
* DMSO
* Ethylene glycol
* Glycerol
* 2-Methyl-2,4-pentanediol (MPD)
* Propylene glycol
* Sucrose
* Trehalose
*Heavy water [7] | 1 | Applied and Interdisciplinary Chemistry |
Quantification of RT-PCR products can largely be divided into two categories: end-point and real-time. The use of end-point RT-PCR is preferred for measuring gene expression changes in small number of samples, but the real-time RT-PCR has become the gold standard method for validating quantitative results obtained from array analyses or gene expression changes on a global scale. | 1 | Applied and Interdisciplinary Chemistry |
Born in Eastleigh, Hampshire, he was educated at Denstone College and received his Bachelor of Science degree from Acton Technical College (London University External Regulations) in 1956 and his PhD from Imperial College of Science and Technology in 1959 for research carried out under the supervision of Geoffrey Wilkinson. | 0 | Theoretical and Fundamental Chemistry |
As α-cyano carbanions may be used in many of the same contexts as α-sulfonyl anions, reductive decyanation methods offer a viable alternative to reductive desulfonylation. Dissolving metal reductions are most useful for the decyanation of tertiary nitriles (primary and secondary nitriles give the corresponding amines in addition to decyanated products), but potassium is a more general reducing agent that reduces primary, secondary, and tertiary nitriles.
A wide variety of carbonyl olefination methods that are direct alternative to the Julia olefination are known: the Wittig reaction, the Horner-Wadsworth-Emmons reaction, Peterson olefination, and others. The primary advantage of Julia olefination is that the sulfone precursors are sometimes more readily available and easier to purify than the corresponding phosphorus- or silicon-containing compounds. Additionally, a variety of methods to synthesize sulfones exist. Nonetheless, the sometimes limited stereoselectivity (and in particular, the difficulty of accessing (Z) -alkenes) of the Julia reaction can be problematic. Many alternative methods for olefination, including the Peterson reaction, do not have this issue. | 0 | Theoretical and Fundamental Chemistry |
Structural equivalences between atoms of a parent molecule reduce the number of positional isomers that can be obtained by replacing those atoms for a different element or group. Thus, for example, the structural equivalence between the six hydrogens of ethane means that there is just one structural isomer of ethanol, not 6. The eight hydrogens of propane are partitioned into two structural equivalence classes (the six on the methyl groups, and the two on the central carbon); therefore there are only two positional isomers of propanol (1-propanol and 2-propanol). Likewise there are only two positional isomers of butanol, and three of pentanol or hexanol. | 0 | Theoretical and Fundamental Chemistry |
Gene therapy may be classified into two types by the type of cell it affects: somatic cell and germline gene therapy.
In somatic cell gene therapy (SCGT), the therapeutic genes are transferred into any cell other than a gamete, germ cell, gametocyte, or undifferentiated stem cell. Any such modifications affect the individual patient only, and are not inherited by offspring. Somatic gene therapy represents mainstream basic and clinical research, in which therapeutic DNA (either integrated in the genome or as an external episome or plasmid) is used to treat disease. Over 600 clinical trials utilizing SCGT are underway in the US. Most focus on severe genetic disorders, including immunodeficiencies, haemophilia, thalassaemia, and cystic fibrosis. Such single gene disorders are good candidates for somatic cell therapy. The complete correction of a genetic disorder or the replacement of multiple genes is not yet possible. Only a few of the trials are in the advanced stages.
In germline gene therapy (GGT), germ cells (sperm or egg cells) are modified by the introduction of functional genes into their genomes. Modifying a germ cell causes all the organism's cells to contain the modified gene. The change is therefore heritable and passed on to later generations. Australia, Canada, Germany, Israel, Switzerland, and the Netherlands prohibit GGT for application in human beings, for technical and ethical reasons, including insufficient knowledge about possible risks to future generations and higher risks versus SCGT. The US has no federal controls specifically addressing human genetic modification (beyond FDA regulations for therapies in general). | 1 | Applied and Interdisciplinary Chemistry |
Artists and metalworkers often deliberately add patinas as a part of the original design and decoration of art and furniture, or to simulate antiquity in newly made objects. The process is often called distressing.
A wide range of chemicals, both household and commercial, can give a variety of patinas. They are often used by artists as surface embellishments either for color, texture, or both. Patination composition varies with the reacted elements and these will determine the color of the patina. For copper alloys, such as bronze, exposure to chlorides leads to green, while sulfur compounds (such as "liver of sulfur") tend to brown. The basic palette for patinas on copper alloys includes chemicals like ammonium sulfide (blue-black), liver of sulfur (brown-black), cupric nitrate (blue-green), and ferric nitrate (yellow-brown). For artworks, patination is often deliberately accelerated by applying chemicals with heat. Colors range from matte sandstone yellow to deep blues, greens, whites, reds, and various blacks. Some patina colors are achieved by the mixing of colors from the reaction with the metal surface with pigments added to the chemicals. Sometimes the surface is enhanced by waxing, oiling, or other types of lacquers or clear-coats. More simply, the French sculptor Auguste Rodin used to instruct assistants at his studio to urinate over bronzes stored in the outside yard. A patina can be produced on copper by the application of vinegar (acetic acid). This patina is water-soluble and will not last on the outside of a building like a "true" patina. It is usually used as pigment.
Patina is also found on slip rings and commutators. This type of patina is formed by corrosion, what elements the air might hold, residue from the wear of the carbon brush, and moisture; thus, the patina needs special conditions to work as intended.
Patinas can also be found in woks or other metal baking dishes. The process of applying patinas to cookware is known as seasoning. The patina on a wok is a dark coating of oils that have been polymerized onto it to prevent food from sticking. Scrubbing or using soap on a wok or other dishware could damage the patina and possibly allow rust.
Knife collectors that own carbon steel blades sometimes force a patina onto the blade to help protect it and give it a more personalized look. This can be done using various chemicals and substances such as muriatic acid, apple cider vinegar, or mustard. It can also be done by sticking the blade into any acidic vegetable or fruit such as an orange or an apple. | 1 | Applied and Interdisciplinary Chemistry |
Transfer RNA or tRNA is the most abundantly modified type of RNA. Modifications in tRNA play crucial roles in maintaining translation efficiency through supporting structure, anticodon-codon interactions, and interactions with enzymes.
Anticodon modifications are important for proper decoding of mRNA. Since the genetic code is degenerate, anticodon modifications are necessary to properly decode mRNA. Particularly, the wobble position of the anticodon determines how the codons are read. For example, in eukaryotes an adenosine at position 34 of the anticodon can be converted to inosine. Inosine is a modification that is able to base-pair with cytosine, adenine, and uridine.
Another commonly modified base in tRNA is the position adjacent to the anticodon. Position 37 is often hypermodified with bulky chemical modifications. These modifications prevent frameshifting and increase anticodon-codon binding stability through stacking interactions. | 1 | Applied and Interdisciplinary Chemistry |
The spontaneous redox reactions of a conventional battery produce electricity through the different reduction potentials of the cathode and anode in the electrolyte. However, electrolysis requires an external source of electrical energy to induce a chemical reaction, and this process takes place in a compartment called an electrolytic cell. | 0 | Theoretical and Fundamental Chemistry |
In inorganic chemistry, the trans effect is the increased lability of ligands that are trans to certain other ligands, which can thus be regarded as trans-directing ligands. It is attributed to electronic effects and it is most notable in square planar complexes, although it can also be observed for octahedral complexes. The analogous cis effect is most often observed in octahedral transition metal complexes.
In addition to this kinetic trans effect, trans ligands also have an influence on the ground state of the molecule, the most notable ones being bond lengths and stability. Some authors prefer the term trans influence to distinguish it from the kinetic effect, while others use more specific terms such as structural trans effect or thermodynamic trans effect.
The discovery of the trans effect is attributed to Ilya Ilich Chernyaev, who recognized it and gave it a name in 1926. | 0 | Theoretical and Fundamental Chemistry |
Photovoltaics (PV) use silicon solar cells to convert the energy of sunlight into electricity. Operates under the photoelectric effect which results in the emission of electrons. Concentrated solar power (CSP) Uses lenses or mirrors and tracking devices to focus a large area of sunlight into a small beam. Solar power is anticipated to be the world's largest source of electricity by 2050. Solar power plants, such as Ivanpah Solar Power Facility in the Mojave Desert produces over 392MW of power. Solar projects exceeding 1 GW (1 billion watts) are in development and are anticipated to be the future of solar power in the US. | 0 | Theoretical and Fundamental Chemistry |
Mutations in the ALMS1 gene have been found to be causative for Alström syndrome with a total of 81 disease-causing mutations.
Multiple mutations are known: the current (2007) total is 79. These include both nonsense and frameshift mutations. Most of the mutations have been found in exons 8,10 and 16. | 1 | Applied and Interdisciplinary Chemistry |
Substrate-like inhibitors (Figure 4) are more common than the non-substrate-likes. They bind either covalently or non-covalently and have a basic structure where the P1-substituent occupies the S1-pocket and the P2-substituent occupies the S2-pocket. Usually they contain a proline mimetic that occupies the S1-pocket. Large substituents on the 2-cyanopyrrolidine ring are normally not tolerated since the S1-pocket is quite small.
Since DPP-4 is identical with the T-cell activation marker CD26 and DPP-4 inhibitors are known to inhibit T-cell proliferation, these compounds were initially thought to be potential immunomodulators. When the function against type 2 diabetes was discovered, the cyanopyrrolidines became a highly popular research material. A little later vildagliptin and saxagliptin, which are the most developed cyanopyrrolidine DPP-4 inhibitors to date, were discovered. | 1 | Applied and Interdisciplinary Chemistry |
Epoxy resins are typically cured by the use of additives, often called hardeners. Polyamines are often used. The amine groups ring-open the epoxide rings.
In rubber, the curing is also induced by the addition of a crosslinker. The resulting process is called sulfur vulcanization. Sulfur breaks down to form polysulfide cross-links (bridges) between sections of the polymer chains. The degree of crosslinking determines the rigidity and durability, as well as other properties of the material.
Paints and varnishes commonly contain oil drying agents, usually metallic soaps that catalyze cross-linking of the unsaturated drying oils that largely comprise them. When paint is described as "drying" it is in fact hardening by crosslinking. Oxygen atoms serve as the crosslinks, analogous to the role played by sulfur in the vulcanization of rubber. | 0 | Theoretical and Fundamental Chemistry |
Animal models are used to learn more about a disease, its diagnosis and its treatment, with animal models predicting human toxicity in up to 71% of cases. The human equivalent dose (HED) or human equivalent concentration (HEC) is the quantity of a chemical that, when administered to humans, produces an effect equal to that produced in test animals by a smaller dose. Calculating the HED is a step in carrying out a clinical trial of a pharmaceutical drug. | 1 | Applied and Interdisciplinary Chemistry |
In 2005, the water supply to the city of Harbin in China with a population of almost nine million people, was cut off because of a major benzene exposure. Benzene leaked into the Songhua River, which supplies drinking water to the city, after an explosion at a China National Petroleum Corporation (CNPC) factory in the city of Jilin on 13 November 2005.
When plastic water pipes are subject to high heat, the water may be contaminated with benzene. | 1 | Applied and Interdisciplinary Chemistry |
For hypervalent compounds in which the ligands are more electronegative than the central, hypervalent atom, resonance structures can be drawn with no more than four covalent electron pair bonds and completed with ionic bonds to obey the octet rule. For example, in phosphorus pentafluoride (PF), 5 resonance structures can be generated each with four covalent bonds and one ionic bond with greater weight in the structures placing ionic character in the axial bonds, thus satisfying the octet rule and explaining both the observed trigonal bipyramidal molecular geometry and the fact that the axial bond length (158 pm) is longer than the equatorial (154 pm).
For a hexacoordinate molecule such as sulfur hexafluoride, each of the six bonds is the same length. The rationalization described above can be applied to generate 15 resonance structures each with four covalent bonds and two ionic bonds, such that the ionic character is distributed equally across each of the sulfur-fluorine bonds.
Spin-coupled valence bond theory has been applied to diazomethane and the resulting orbital analysis was interpreted in terms of a chemical structure in which the central nitrogen has five covalent bonds;
This led the authors to the interesting conclusion that "Contrary to what we were all taught as undergraduates, the nitrogen atom does indeed form five covalent linkages and the availability or otherwise of d-orbitals has nothing to do with this state of affairs." | 0 | Theoretical and Fundamental Chemistry |
After his graduation, Arusi worked in the Sirte Oil Company in different management positions from September 1992 to June 1998. He was then detained in prison between 1998 and 2006. After being released, he held various executive management positions in many engineering companies, including the one in the United Kingdom. He served as executive manager of Libya's Green Holding Company from the end of 2011 to November 2012.
In November 2012, he was appointed minister of oil and gas to the cabinet headed by prime minister Ali Zeidan. Arusi replaced Abdulrahman Ben Yezza as oil minister. Shortly after his appointment, in December 2012, Arusi announced the establishment of the National Corporation for the Exploration and Production of Oil and Gas, a national oil company based in Tripoli. In February 2013, he reported that a new oil area was found in Ghadames Basin, about 650 km southwest of Tripoli, in the western Libya. Arusi's term ended in January 2014 and Omar Shakmak was appointed acting oil minister. | 1 | Applied and Interdisciplinary Chemistry |
Methane functionalization is the process of converting methane in its gaseous state to another molecule with a functional group, typically methanol or acetic acid, through the use of transition metal catalysts.
In the realm of carbon-hydrogen bond activation and functionalization (C-H activation/functionalization), many recent efforts have been made in order to catalytically functionalize the C-H bonds in methane. The large abundance of methane in natural gas or shale gas deposits presents a large potential for its use as a feedstock in modern chemistry. However, given its gaseous natural state, it is quite difficult to transport economically. Its ideal use would be as a raw starting material for methanol or acetic acid synthesis, with plants built at the source to eliminate the issue of transportation. Methanol, in particular, would be of great use as a potential fuel source, and many efforts have been applied to researching the feasibilities of a methanol economy.
The challenges of C-H activation and functionalization present themselves when several factors are taken into consideration. Firstly, the C-H bond is extremely inert and non-polar, with a high bond dissociation energy, making methane a relatively unreactive starting material. Secondly, any products formed from methane would likely be more reactive than the starting product, which would be detrimental to the selectivity and yield of the reaction.
The main strategy currently used to increase the reactivity of methane uses transition metal complexes to activate the carbon-hydrogen bonds. In a typical C-H activation mechanism, a transition metal catalyst coordinates to the C-H bond to cleave it, and convert it into a bond with a lower bond dissociation energy. By doing so, the product can be used in further downstream reactions, since it will usually have a new functional group attached to the carbon. It is also important to note the difference between the terms "activation" and "functionalization," since both terms are often used interchangeably, but should be held distinct from each other. Activation refers to the coordination of a metal center to the C-H bond, whereas functionalization occurs when the coordinated metal complex is further reacted with a group "X" to result in the functionalized product. | 0 | Theoretical and Fundamental Chemistry |
CKLF-like MARVEL transmembrane domain-containing protein 3 (i.e. CMTM3), also termed chemokine-like factor superfamily 3 (i.e. CKLFSF3), is a member of the CKLF-like MARVEL transmembrane domain-containing family (i.e. CMTM) of proteins. In humans, CMTM2 protein is encoded by the CMTM3 gene located in band 22.1 on the long (i.e. "q") arm of chromosome 16. This protein is expressed in a wide range of tissues, including fetal tissues. It is highly expressed in the male reproductive system, particularly testicular tissues and may play a role in the development of this tissue. It is also highly expressed in the immune system including circulating blood cells, i.e. B lymphocytes, CD4+ T lymphocytes, and monocytes. However, CMTM3 protein is weakly expressed or unexpressed in the malignant tissues of several types of cancers. In many but not all of theses cancers, this decreased or lack of expression appears due to methylation of the GpC islands in the promoter region, and thereby the silencing, of the CMTM3 gene.
Studies of CMTM3 protein levels in normal versus malignant tissues found that the malignant tissue levels of several types of cancer were lower, in a variable percentage of cases, than the levels in the normal tissues as well as the cases with high CMTM2 levels in the same cancer type. These cancers included those of the stomach, breast, nasopharynx (e.g. oral squamous cell carcinoma), male larynx, esophagus, prostate gland, colon, and kidney (i.e. the kidney clear-cell type). Moreover, low cancer tissue levels of CTMT3 protein were found to be associated with poorer prognoses compared to cases with higher levels of this protein in cancers of the stomach, esophagus, nasopharynx (i.e. oral squamous cell carcinoma type), and prostate gland. These finding suggest that the CMTM3 protein may act to suppress the development and/or progression of these cancers. Further studies are needed to support this suggestion and determine if CMTM3 protein can be a useful clinical marker to predict the severity of these cancers and/or serve as a therapeutic target for treating them.
Contrastingly, other studies have reported that: 1) CMTM3 protein promoted the proliferation of cultured glioblastoma immortalized cells; 2) high levels of CMTM3 protein were associated with shorter survival times in individuals with glioblastomas and gastric cancer; 3) analyses of 178 patients with pancreatic cancer found that their tumor tissues had higher CMTM3 protein levels than normal nearby pancreas tissues; and 4) patients with high levels of CMTM3 protein in their pancreatic cancer tissues had poorer prognoses and overall survival rates compared to patients with lower CMTM3 levels in their pancreatic cancer tissues. These findings suggest that CMTM3 acts to promote the development and/or progression of these three cancer types. They support further studies to confirm this suggestion, to determine if CMTM3 can be use as a prognostic indicator and a clinical therapeutic target for these three cancer types. Further investigations into the mechanisms behind the apparent ability of CMTM3 to suppress or promote these cancers are also needed. | 1 | Applied and Interdisciplinary Chemistry |
Somatic fusion, also called protoplast fusion, is a type of genetic modification in plants by which two distinct species of plants are fused together to form a new hybrid plant with the characteristics of both, a somatic hybrid. Hybrids have been produced either between different varieties of the same species (e.g. between non-flowering potato plants and flowering potato plants) or between two different species (e.g. between wheat Triticum and rye Secale to produce Triticale).
Uses of somatic fusion include developing plants resistant to disease, such as making potato plants resistant to potato leaf roll disease. Through somatic fusion, the crop potato plant Solanum tuberosum – the yield of which is severely reduced by a viral disease transmitted on by the aphid vector – is fused with the wild, non-tuber-bearing potato Solanum brevidens, which is resistant to the disease. The resulting hybrid has the chromosomes of both plants and is thus similar to polyploid plants.
Somatic hybridization was first introduced by Carlson et al. in Nicotiana glauca. | 1 | Applied and Interdisciplinary Chemistry |
One of the primary goals of CTD is to advance the understanding of the effects of environmental chemicals on human health on the genetic level, a field called toxicogenomics.
The etiology of many chronic diseases involves interactions between environmental factors and genes that modulate important physiological processes. Chemicals are an important component of the environment. Conditions such as asthma, cancer, diabetes, hypertension, immunodeficiency, and Parkinson's disease are known to be influenced by the environment; however, the molecular mechanisms underlying these correlations are not well understood. CTD may help resolve these mechanisms. The most up-to-date extensive list of peer-reviewed scientific articles about CTD is available at their publications page | 1 | Applied and Interdisciplinary Chemistry |
After structural comparison with different species of Penicillium, Fleming initially believed that his specimen was Penicillium chrysogenum, a species described by an American microbiologist Charles Thom in 1910. He was fortunate that Charles John Patrick La Touche, an Irish botanist, had just recently joined St Marys as a mycologist to investigate fungi as the cause of asthma. La Touche identified the specimen as Penicillium rubrum,' the identification used by Fleming in his publication.
In 1931, Thom re-examined different Penicillium including that of Flemings specimen. He came to a confusing conclusion, stating, "Ad. 35 [Flemings specimen] is P. notatum WESTLING. This is a member of the P. chrysogenum series with smaller conidia than P. chrysogenum itself." From then on, Flemings mould was synonymously referred to as P. notatum and P. chrysogenum. But Thom adopted and popularised the use of P. chrysogenum. In addition to P. notatum, newly discovered species such as P. meleagrinum and P. cyaneofulvum were recognised as members of P. chrysogenum in 1977. To resolve the confusion, the Seventeenth International Botanical Congress held in Vienna, Austria, in 2005 formally adopted the name P. chrysogenum as the conserved name (nomen conservandum). Whole genome sequence and phylogenetic analysis in 2011 revealed that Flemings mould belongs to P. rubens, a species described by Belgian microbiologist Philibert Biourge in 1923.
The source of the fungal contamination in Flemings experiment remained a speculation for several decades. Fleming suggested in 1945 that the fungal spores came through the window facing Praed Street. This story was regarded as a fact and was popularised in literature, starting with George Lackens 1945 book The Story of Penicillin. But it was later disputed by his co-workers including Pryce, who testified much later that Flemings laboratory window was kept shut all the time. Ronald Hare also agreed in 1970 that the window was most often locked because it was difficult to reach due to a large table with apparatuses placed in front of it. In 1966, La Touche told Hare that he had given Fleming thirteen specimens of fungi (ten from his lab) and only one from his lab was showing penicillin-like antibacterial activity. After this, a consensus developed that Flemings mould had come from La Touches lab, a floor below Flemings, as spores which had drifted in through the open doors.
Craddock developed severe infection of the nasal antrum (sinusitis) and had undergone surgery. Fleming made use of the surgical opening of the nasal passage and started injecting penicillin on 9 January 1929 but without any effect, probably because the infection was with H. influenzae, a bacterium unsusceptible to penicillin. Fleming gave some of his original penicillin samples to his colleague, surgeon Arthur Dickson Wright for clinical testing in 1928. Although Wright reportedly said that it "seemed to work satisfactorily," there are no records of its use. In 1930 and 1931, Cecil George Paine, a pathologist at the Royal Infirmary in Sheffield, was the first to successfully use penicillin for medical treatment. He attempted to treat sycosis (eruptions in beard follicles) with penicillin but was unsuccessful, probably because the drug did not penetrate deep enough into the skin. He cured three babies with ophthalmia neonatorum, an eye infection, and a local coal miner whose eye had become infected after an accident, but he did not publish his work. | 1 | Applied and Interdisciplinary Chemistry |
Edwin Haslam (1932 – 3 October 2013) was an organic chemist and an author of books on polyphenols. He was an alumnus of Sir John Deane's College in Northwich, Cheshire, United Kingdom and was for many years Professor of Organic Chemistry at the University of Sheffield.
Haslam proposed a first comprehensive definition of plant polyphenols based on the earlier proposals of Edgar Charles Bate-Smith, Tony Swain and Theodore White, which includes specific structural characteristics common to all phenolics having a tanning property. It is referred to as the White–Bate-Smith–Swain–Haslam (WBSSH) definition. | 0 | Theoretical and Fundamental Chemistry |
For a binary mixture the following functions are used:
with
Here, and are the dimensionless interaction parameters, which are related to the interaction energy parameters and by:
Here R is the gas constant and T the absolute temperature, and U is the energy between molecular surface i and j. U is the energy of evaporation. Here U has to be equal to U, but is not necessary equal to .
The parameters and are the so-called non-randomness parameter, for which usually is set equal to . For a liquid, in which the local distribution is random around the center molecule, the parameter . In that case the equations reduce to the one-parameter Margules activity model:
In practice, is set to 0.2, 0.3 or 0.48. The latter value is frequently used for aqueous systems. The high value reflects the ordered structure caused by hydrogen bonds. However, in the description of liquid-liquid equilibria the non-randomness parameter is set to 0.2 to avoid wrong liquid-liquid description. In some cases a better phase equilibria description is obtained by setting . However this mathematical solution is impossible from a physical point of view, since no system can be more random than random ( =0). In general NRTL offers more flexibility in the description of phase equilibria than other activity models due to the extra non-randomness parameters. However, in practice this flexibility is reduced in order to avoid wrong equilibrium description outside the range of regressed data.
The limiting activity coefficients, also known as the activity coefficients at infinite dilution, are calculated by:
The expressions show that at the limiting activity coefficients are equal. This situation that occurs for molecules of equal size, but of different polarities.<br /> It also shows, since three parameters are available, that multiple sets of solutions are possible. | 0 | Theoretical and Fundamental Chemistry |
ASTM International has an international standard for artificial seawater: ASTM D1141-98 (Original Standard ASTM D1141-52). It is used in many research testing labs as a reproducible solution for seawater such as tests on corrosion, oil contamination, and detergency evaluation. | 0 | Theoretical and Fundamental Chemistry |
There are currently very few ova banks in existence.
Generally, the main purpose of storing ova, at present, is to overcome infertility which may arise at a later age, or due to a disease. The ova are generally collected between 31 and 35 years of age.
The procedure of collecting ova may or may not include ovarian hyperstimulation.
It can be expected however that ova collection will become more important in the future, i.e. for third party reproduction, and/or for producing stem cells, i.e. from unfertilized eggs (oocytes). | 1 | Applied and Interdisciplinary Chemistry |
According to the Big Bang theory, stable isotopes of the lightest three elements (H, He, and traces of Li) were produced very shortly after the emergence of the universe, in a process called Big Bang nucleosynthesis. These lightest stable nuclides (including deuterium) survive to today, but any radioactive isotopes of the light elements produced in the Big Bang (such as tritium) have long since decayed. Isotopes of elements heavier than boron were not produced at all in the Big Bang, and these first five elements do not have any long-lived radioisotopes. Thus, all radioactive nuclei are, therefore, relatively young with respect to the birth of the universe, having formed later in various other types of nucleosynthesis in stars (in particular, supernovae), and also during ongoing interactions between stable isotopes and energetic particles. For example, carbon-14, a radioactive nuclide with a half-life of only years, is constantly produced in Earth's upper atmosphere due to interactions between cosmic rays and nitrogen.
Nuclides that are produced by radioactive decay are called radiogenic nuclides, whether they themselves are stable or not. There exist stable radiogenic nuclides that were formed from short-lived extinct radionuclides in the early Solar System. The extra presence of these stable radiogenic nuclides (such as xenon-129 from extinct iodine-129) against the background of primordial stable nuclides can be inferred by various means.
Radioactive decay has been put to use in the technique of radioisotopic labeling, which is used to track the passage of a chemical substance through a complex system (such as a living organism). A sample of the substance is synthesized with a high concentration of unstable atoms. The presence of the substance in one or another part of the system is determined by detecting the locations of decay events.
On the premise that radioactive decay is truly random (rather than merely chaotic), it has been used in hardware random-number generators. Because the process is not thought to vary significantly in mechanism over time, it is also a valuable tool in estimating the absolute ages of certain materials. For geological materials, the radioisotopes and some of their decay products become trapped when a rock solidifies, and can then later be used (subject to many well-known qualifications) to estimate the date of the solidification. These include checking the results of several simultaneous processes and their products against each other, within the same sample. In a similar fashion, and also subject to qualification, the rate of formation of carbon-14 in various eras, the date of formation of organic matter within a certain period related to the isotope's half-life may be estimated, because the carbon-14 becomes trapped when the organic matter grows and incorporates the new carbon-14 from the air. Thereafter, the amount of carbon-14 in organic matter decreases according to decay processes that may also be independently cross-checked by other means (such as checking the carbon-14 in individual tree rings, for example). | 0 | Theoretical and Fundamental Chemistry |
Substitution of all 20 hydrogens by fluorine atoms yields the relatively unstable perfluorododecahedrane CF, which was obtained in milligram quantities. Trace amounts of the analogous perchlorododecahedrane CCl were obtained, among other partially chlorinated derivatives, by reacting dissolved in liquid chlorine under pressure at about 140 °C and under intense light for five days. Complete replacement by heavier halogens seems increasingly difficult due to their larger size. Half or more of the hydrogen atoms can be substituted by hydroxyl groups to yield polyols, but the extreme compound C(OH) remained elusive as of 2006. Amino-dodecahedranes comparable to amantadine have been prepared, but were more toxic and with weaker antiviral effects.
Annulated dodecahedrane structures have been proposed. | 0 | Theoretical and Fundamental Chemistry |
After Henderson died on November 16, 1983, the Colorado mountain property, including the underground home, was put up for sale for $1.5 million dollars. It was purchased for $1.17 million by the Sacred Mountain Ashram on June 9, 1988 from a mysterious reclusive millionaire who was "terrified...of being caught in a nuclear holocaust." After the sale, the exterior walls of the underground house were dug free of dirt, windows were built to allow sunlight to come into the home. | 0 | Theoretical and Fundamental Chemistry |
In some countries, ibuprofen lysine (the lysine salt of ibuprofen, sometimes called "ibuprofen lysinate") is licensed for treatment of the same conditions as ibuprofen; the lysine salt is used because it is more water-soluble.
Ibuprofen lysine is sold for rapid pain relief; given in the form of its lysine salt, absorption is much quicker (35 minutes for the salt compared to 90120 minutes for ibuprofen). However, a clinical trial with 351 participants in 2020, funded by Sanofi, found no significant difference between ibuprofen and ibuprofen lysine concerning the eventual onset of action or analgesic efficacy.
In 2006, ibuprofen lysine was approved in the US by the Food and Drug Administration (FDA) for closure of patent ductus arteriosus in premature infants weighing between , who are no more than 32 weeks gestational age when usual medical management (such as fluid restriction, diuretics, and respiratory support) is not effective. | 0 | Theoretical and Fundamental Chemistry |
Space disposal is attractive because it removes nuclear waste from the planet. It has significant disadvantages, such as the potential for catastrophic failure of a launch vehicle, which could spread radioactive material into the atmosphere and around the world. A high number of launches would be required because no individual rocket would be able to carry very much of the material relative to the total amount that needs to be disposed of. This makes the proposal impractical economically and increases the risk of one or more launch failures. To further complicate matters, international agreements on the regulation of such a program would need to be established. Costs and inadequate reliability of modern rocket launch systems for space disposal has been one of the motives for interest in non-rocket spacelaunch systems such as mass drivers, space elevators, and other proposals. | 0 | Theoretical and Fundamental Chemistry |
In order to load a gas as a sample of pressure transmitting medium, the gas must be in a dense state, as to not shrink the sample chamber once pressure is induced. To achieve a dense state, gases can be liquefied at low temperatures or compressed. Cryogenic loading is a technique that uses liquefied gas as a means of filling the sample chamber. The DAC is directly immersed into the cryogenic fluid that fills the sample chamber. However, there are disadvantages to cryogenic loading. With the low temperatures indicative of cryogenic loading, the sample is subjected to temperatures that could irreversibly change it. Also, the boiling liquid could displace the sample or trap an air bubble in the chamber. It is not possible to load gas mixtures using the cryogenic method due to the different boiling points of most gases. Gas compression technique densifies the gases at room temperature. With this method, most of the problems seen with cryogenic loading are fixed. Also, loading gas mixtures becomes a possibility. The technique uses a vessel or chamber in which the DAC is placed and is filled with gas. Gases are pressurized and pumped into the vessel with a compressor. Once the vessel is filled and the desired pressure is reached the DAC is closed with a clamp system run by motor driven screws. | 0 | Theoretical and Fundamental Chemistry |
In July 2016 Florida declared a state of emergency for four counties as a result of blooms. They were said to be "destroying" a number of businesses and affecting local economies, with many needing to shut down entirely. Some beaches were closed, and hotels and restaurants suffered a drop in business. Tourist sporting activities such as fishing and boating were also affected.
In 2019, the biggest Sargassum bloom ever seen created a crisis in the Tourism industry in North America. This event was likely caused by climate change and nutrient pollution from fertilizers. Several Caribbean countries considered declaring a state of emergency due to the impact on tourism as a result of environmental damage and potentially toxic and harmful health effects. | 0 | Theoretical and Fundamental Chemistry |
According to the US Food and Drug Administration (FDA), an orphan drug is defined as one "intended for the treatment, prevention or diagnosis of a rare disease or condition, which is one that affects less than 200,000 persons in the US" (which equates to approximately 6 cases per 10,000 population) "or meets cost recovery provisions of the act". | 1 | Applied and Interdisciplinary Chemistry |
The copper-bronze metallurgy in the Harappan civilization was widespread and had a high variety and quality. The early use of iron may have developed from the practice of copper-smelting. While there is to date no proven evidence for smelted iron in the Indus Valley civilization, iron ore and iron items have been unearthed in eight Indus Valley sites, some of them dating to before 2600 BCE. There remains the possibility that some of these items were made of smelted iron, and the term "kṛṣṇa-ayas" might possibly also refer to these iron items, even if they are not made of smelted iron.
Lothali copper is unusually pure, lacking the arsenic typically used by coppersmiths across the rest of the Indus valley. Workers mixed tin with copper for the manufacture of celts, arrowheads, fishhooks, chisels, bangles, rings, drills and spearheads, although weapon manufacturing was minor. They also employed advanced metallurgy in following the cire perdue technique of casting, and used more than one-piece moulds for casting birds and animals. They also invented new tools such as curved saws and twisted drills unknown to other civilizations at the time. | 1 | Applied and Interdisciplinary Chemistry |
According to electron diffraction, the and distances in ethylene sulfide are respectively 1.473 and 1.811 Å. The and angles are respectively 66.0 and 48.0°. | 0 | Theoretical and Fundamental Chemistry |
TLC helps show the purity of a sample. A pure sample should only contain one spot by TLC. TLC is also useful for small-scale purification. Because the separated compounds will be on different areas of the plate, a scientist can scrape off the stationary phase particles containing the desired compound and dissolve them into an appropriate solvent. Once all the compound dissolves in the solvent, they filter out the silica particles, then evaporate the solvent to isolate the product. Big preparative TLC plates with thick silica gel coatings can separate more than 100 mg of material.
For larger-scale purification and isolation, TLC is useful to quickly test solvent mixtures before running flash column chromatography on a large batch of impure material. A compound elutes from a column when the amount of solvent collected is equal to 1/R. The eluent from flash column chromatography gets collected across several containers (for example, test tubes) called fractions. TLC helps show which fractions contain impurities and which contain pure compound.
Furthermore, two-dimensional TLC can help check if a compound is stable on a particular stationary phase. This test requires two runs on a square-shaped TLC plate. The plate is rotated by 90º before the second run. If the target compound appears on the diagonal of the square, it is stable on the chosen stationary phase. Otherwise, it is decomposing on the plate. If this is the case, an alternative stationary phase may prevent this decomposition.
TLC is also an analytical method for the direct separation of enantiomers and the control of enantiomeric purity, e.g. active pharmaceutical ingredients (APIs) that are chiral. | 0 | Theoretical and Fundamental Chemistry |
It has been shown that host cells regulate L1 retrotransposition activity, for example through epigenetic silencing.
For example, the RNA interference (RNAi) mechanism of small interfering RNAs derived from L1 sequences can cause suppression of L1 retrotransposition.
In plant genomes, epigenetic modification of LINEs can lead to expression changes of nearby genes and even to phenotypic changes: In the oil palm genome, methylation of a Karma-type LINE underlies the somaclonal, mantled variant of this plant, responsible for drastic yield loss.
Human APOBEC3C mediated restriction of LINE-1 elements were reported and it is due to the interaction between A3C with the ORF1p that affects the reverse transcriptase activity. | 1 | Applied and Interdisciplinary Chemistry |
For pipe flows a so-called transit time method is applied where a radiotracer is injected as a pulse into the measured flow. The transit time is defined with the help of radiation detectors placed on the outside of the pipe. The volume flow is obtained by multiplying the measured average fluid flow velocity by the inner pipe cross-section. This reference flow value is compared with the simultaneous flow value given by the flow measurement to be calibrated.
The procedure is standardised (ISO 2975/VII for liquids and BS 5857-2.4 for gases). The best accredited measurement uncertainty for liquids and gases is 0.5%. | 1 | Applied and Interdisciplinary Chemistry |
Decarburization (or decarbonization) is the process of decreasing carbon content, which is the opposite of carburization.
The term is typically used in metallurgy, describing the decrease of the content of carbon in metals (usually steel). Decarburization occurs when the metal is heated to temperatures of 700 °C or above when carbon in the metal reacts with gases containing oxygen or hydrogen. The removal of carbon removes hard carbide phases resulting in a softening of the metal, primarily at the surfaces which are in contact with the decarburizing gas.
Decarburization can be either advantageous or detrimental, depending on the application for which the metal will be used. It is thus both something that can be done intentionally as a step in a manufacturing process, or something that happens as a side effect of a process (such as rolling) and must be either prevented or later reversed (such as via a carburization step).
The decarburization mechanism can be described as three distinct events: the reaction at the steel surface, the interstitial diffusion of carbon atoms and the dissolution of carbides within the steel. | 1 | Applied and Interdisciplinary Chemistry |
Ahrland, Chatt and Davies proposed that metal ions could be described as class A if they formed stronger complexes with ligands whose donor atoms are nitrogen, oxygen or fluorine than with ligands whose donor atoms are phosphorus, sulfur or chlorine and class B if the reverse is true. For example, Ni forms stronger complexes with amines than with phosphines, but Pd forms stronger complexes with phosphines than with amines. Later, Pearson proposed the theory of hard and soft acids and bases (HSAB theory). In this classification, class A metals are hard acids and class B metals are soft acids. Some ions, such as copper(I), are classed as borderline. Hard acids form stronger complexes with hard bases than with soft bases. In general terms hard–hard interactions are predominantly electrostatic in nature whereas soft–soft interactions are predominantly covalent in nature. The HSAB theory, though useful, is only semi-quantitative.
The hardness of a metal ion increases with oxidation state. An example of this effect is given by the fact that Fe tends to form stronger complexes with N-donor ligands than with O-donor ligands, but the opposite is true for Fe. | 0 | Theoretical and Fundamental Chemistry |
*Ensembl: [http://www.ensembl.org/biomart/martview/4e6c01c28faed033db52d0d30e4c21ab]
*OmicTools: [https://omictools.com/mtd-3-tool]
*Transcriptome Browser: [http://tagc.univ-mrs.fr/tbrowser/]
*ArrayExpress: [http://www.ebi.ac.uk/arrayexpress/] | 1 | Applied and Interdisciplinary Chemistry |
A total synthesis of enantiopure phorbol was developed in 2015. While this synthesis will not replace natural isolation products, it will enable researchers to create phorbol analogs for use in research, especially creating phorbol derivatives that can be evaluated for anti-cancer activity. Previously, the difficulty with synthesizing phorbol had been creating C–C bonds, especially in the six-membered ring at the top of the molecule. This synthesis starts from (+)-3-carene, and uses a series of 19 steps to eventually create (+)-phorbol. | 0 | Theoretical and Fundamental Chemistry |
There are a large number of other possible approximations to fluid dynamic problems. Some of the more commonly used are listed below.
* The Boussinesq approximation neglects variations in density except to calculate buoyancy forces. It is often used in free convection problems where density changes are small.
* Lubrication theory and Hele–Shaw flow exploits the large aspect ratio of the domain to show that certain terms in the equations are small and so can be neglected.
* Slender-body theory is a methodology used in Stokes flow problems to estimate the force on, or flow field around, a long slender object in a viscous fluid.
* The shallow-water equations can be used to describe a layer of relatively inviscid fluid with a free surface, in which surface gradients are small.
* Darcys law' is used for flow in porous media, and works with variables averaged over several pore-widths.
* In rotating systems, the quasi-geostrophic equations assume an almost perfect balance between pressure gradients and the Coriolis force. It is useful in the study of atmospheric dynamics. | 1 | Applied and Interdisciplinary Chemistry |
During his lifetime, Lavoisier was awarded a gold medal by the King of France for his work on urban street lighting (1766), and was appointed to the French Academy of Sciences (1768). He was elected as a member of the American Philosophical Society in 1775.
Lavoisiers work was recognized as an International Historic Chemical Landmark by the American Chemical Society, Académie des sciences de Linstitut de France and the Société Chimique de France in 1999. Antoine Laurent Lavoisiers Louis 1788 publication entitled Méthode de Nomenclature Chimique', published with colleagues Louis-Bernard Guyton de Morveau, Claude Louis Berthollet, and Antoine François, comte de Fourcroy, was honored by a Citation for Chemical Breakthrough Award from the Division of History of Chemistry of the American Chemical Society, presented at the Académie des Sciences (Paris) in 2015.
A number of Lavoisier Medals have been named and given in Lavoisier's honour, by organizations including the Société chimique de France, the International Society for Biological Calorimetry, and the DuPont company He is also commemorated by the Franklin-Lavoisier Prize, marking the friendship of Antoine-Laurent Lavoisier and Benjamin Franklin. The prize, which includes a medal, is given jointly by the Fondation de la Maison de la Chimie in Paris, France and the Science History Institute in Philadelphia, PA, USA. | 1 | Applied and Interdisciplinary Chemistry |
Under 1.59 GPa pressure at 25 °C, methane converts to a cubic solid. The molecules are rotationally disordered. But over 5.25 GPa the molecules become locked into position and cannot spin. Other hydrocarbons under high pressure have hardly been studied. | 0 | Theoretical and Fundamental Chemistry |
More complex rate laws have been described as being mixed order if they approximate to the laws for more than one order at different concentrations of the chemical species involved. For example, a rate law of the form represents concurrent first order and second order reactions (or more often concurrent pseudo-first order and second order) reactions, and can be described as mixed first and second order. For sufficiently large values of [A] such a reaction will approximate second order kinetics, but for smaller [A] the kinetics will approximate first order (or pseudo-first order). As the reaction progresses, the reaction can change from second order to first order as reactant is consumed.
Another type of mixed-order rate law has a denominator of two or more terms, often because the identity of the rate-determining step depends on the values of the concentrations. An example is the oxidation of an alcohol to a ketone by hexacyanoferrate (III) ion [Fe(CN)] with ruthenate (VI) ion (RuO) as catalyst. For this reaction, the rate of disappearance of hexacyanoferrate (III) is
This is zero-order with respect to hexacyanoferrate (III) at the onset of the reaction (when its concentration is high and the ruthenium catalyst is quickly regenerated), but changes to first-order when its concentration decreases and the regeneration of catalyst becomes rate-determining.
Notable mechanisms with mixed-order rate laws with two-term denominators include:
* Michaelis-Menten kinetics for enzyme-catalysis: first-order in substrate (second-order overall) at low substrate concentrations, zero order in substrate (first-order overall) at higher substrate concentrations; and
* the Lindemann mechanism for unimolecular reactions: second-order at low pressures, first-order at high pressures. | 0 | Theoretical and Fundamental Chemistry |
Plants are exposed to many stress factors such as disease, temperature changes, herbivory, injury and more. Therefore, in order to respond or be ready for any kind of physiological state, they need to develop some sort of system for their survival in the moment and/or for the future. Plant communication encompasses communication using volatile organic compounds, electrical signaling, and common mycorrhizal networks between plants and a host of other organisms such as soil microbes, other plants (of the same or other species), animals, insects, and fungi. Plants communicate through a host of volatile organic compounds (VOCs) that can be separated into four broad categories, each the product of distinct chemical pathways: fatty acid derivatives, phenylpropanoids/benzenoids, amino acid derivatives, and terpenoids. Due to the physical/chemical constraints most VOCs are of low molecular mass (< 300 Da), are hydrophobic, and have high vapor pressures. The responses of organisms to plant emitted VOCs varies from attracting the predator of a specific herbivore to reduce mechanical damage inflicted on the plant to the induction of chemical defenses of a neighboring plant before it is being attacked. In addition, the host of VOCs emitted varies from plant to plant, where for example, the Venus Fly Trap can emit VOCs to specifically target and attract starved prey. While these VOCs typically lead to increased resistance to herbivory in neighboring plants, there is no clear benefit to the emitting plant in helping nearby plants. As such, whether neighboring plants have evolved the capability to "eavesdrop" or whether there is an unknown tradeoff occurring is subject to much scientific debate.
As related to the aspect of meaning-making, the field is also identified as phytosemiotics. | 1 | Applied and Interdisciplinary Chemistry |
There is no electron repulsion in a d complex, and the single electron resides in the t orbital ground state. A d octahedral metal complex, such as [Ti(HO)], shows a single absorption band in a UV-vis experiment. The term symbol for d is D, which splits into the T and E states. The t orbital set holds the single electron and has a T state energy of -4Dq. When that electron is promoted to an e orbital, it is excited to the E state energy, +6Dq. This is in accordance with the single absorption band in a UV-vis experiment. The prominent shoulder in this absorption band is due to a Jahn–Teller distortion which removes the degeneracy of the two E states. However, since these two transitions overlap in a UV-vis spectrum, this transition from T to E does not require a Tanabe–Sugano diagram. | 0 | Theoretical and Fundamental Chemistry |
In 2006, the U.S. National Academy of Sciences released the report of a study of molecular manufacturing as part of a longer report, A Matter of Size: Triennial Review of the National Nanotechnology Initiative The study committee reviewed the technical content of Nanosystems, and in its conclusion states that no current theoretical analysis can be considered definitive regarding several questions of potential system performance, and that optimal paths for implementing high-performance systems cannot be predicted with confidence. It recommends experimental research to advance knowledge in this area:
"Although theoretical calculations can be made today, the eventually attainable range of chemical reaction cycles, error rates, speed of operation, and thermodynamic efficiencies of such bottom-up manufacturing systems cannot be reliably predicted at this time. Thus, the eventually attainable perfection and complexity of manufactured products, while they can be calculated in theory, cannot be predicted with confidence. Finally, the optimum research paths that might lead to systems which greatly exceed the thermodynamic efficiencies and other capabilities of biological systems cannot be reliably predicted at this time. Research funding that is based on the ability of investigators to produce experimental demonstrations that link to abstract models and guide long-term vision is most appropriate to achieve this goal." | 0 | Theoretical and Fundamental Chemistry |
Perhaps surprisingly, the effect of temperature is often greater than the effect of UV exposure. This can be seen in terms of the Arrhenius equation, which shows that reaction rates have an exponential dependence on temperature. By comparison the dependence of degradation rate on UV exposure and the availability of oxygen is broadly linear. As the oceans are cooler than land plastic pollution in the marine environment degrades more slowly. Materials buried in landfill do not degrade by photo-oxidation at all, though they may gradually decay by other processes.
Mechanical stress can effect the rate of photo-oxidation and may also accelerate the physical breakup of plastic objects. Stress can be caused by mechanical load (tensile and shear stresses) or even by temperature cycling, particularly in composite systems consisting of materials with differing temperature coefficients of expansion. Similarly, sudden rainfall can cause thermal stress. | 0 | Theoretical and Fundamental Chemistry |
In terms of course structure, M.Chem degrees have the same content that is usually seen in other degree programmes, i.e. lectures, laboratory work, coursework and exams each year. There are also usually one or more substantial projects undertaken in the fourth year, which may well have research elements. At the end of the second or third years, there is usually a threshold of academic performance in examinations to be reached to allow progression into the final year. Final results are awarded on the standard British undergraduate degree classification scale. | 1 | Applied and Interdisciplinary Chemistry |
All viruses bind to their hosts and introduce their genetic material into the host cell as part of their replication cycle. This genetic material contains basic instructions of how to produce more copies of these viruses, hacking the bodys normal production machinery to serve the needs of the virus. The host cell will carry out these instructions and produce additional copies of the virus, leading to more and more cells becoming infected. Some types of viruses insert their genome into the hosts cytoplasm, but do not actually enter the cell. Others penetrate the cell membrane disguised as protein molecules and enter the cell.
There are two main types of virus infection: lytic and lysogenic. Shortly after inserting its DNA, viruses of the lytic cycle quickly produce more viruses, burst from the cell and infect more cells. Lysogenic viruses integrate their DNA into the DNA of the host cell and may live in the body for many years before responding to a trigger. The virus reproduces as the cell does and does not inflict bodily harm until it is triggered. The trigger releases the DNA from that of the host and employs it to create new viruses. | 1 | Applied and Interdisciplinary Chemistry |
Polymer degradation is a change in the properties—tensile strength, color, shape, or molecular weight—of a polymer or polymer-based product under the influence of one or more environmental factors, such as heat, light, and the presence of certain chemicals, oxygen, and enzymes. This change in properties is often the result of bond breaking in the polymer backbone (chain scission) which may occur at the chain ends or at random positions in the chain.
Although such changes are frequently undesirable, in some cases, such as biodegradation and recycling, they may be intended to prevent environmental pollution. Degradation can also be useful in biomedical settings. For example, a copolymer of polylactic acid and polyglycolic acid is employed in hydrolysable stitches that slowly degrade after they are applied to a wound.
The susceptibility of a polymer to degradation depends on its structure. Epoxies and chains containing aromatic functionalities are especially susceptible to UV degradation while polyesters are susceptible to degradation by hydrolysis. Polymers containing an unsaturated backbone degrade via ozone cracking. Carbon based polymers are more susceptible to thermal degradation than inorganic polymers such as polydimethylsiloxane and are therefore not ideal for most high-temperature applications.
The degradation of polyethylene occurs by random scission—a random breakage of the bonds that hold the atoms of the polymer together. When heated above 450 °C, polyethylene degrades to form a mixture of hydrocarbons. In the case of chain-end scission, monomers are released and this process is referred to as unzipping or depolymerization. Which mechanism dominates will depend on the type of polymer and temperature; in general, polymers with no or a single small substituent in the repeat unit will decompose via random-chain scission.
The sorting of polymer waste for recycling purposes may be facilitated by the use of the resin identification codes developed by the Society of the Plastics Industry to identify the type of plastic. | 0 | Theoretical and Fundamental Chemistry |
To a first approximation, an example of radiative exchange equilibrium is in the exchange of non-window wavelength thermal radiation between the land-and-sea surface and the lowest atmosphere, when there is a clear sky. As a first approximation (W. C. Swinbank 1963, G. W. Paltridge and C. M. R. Platt 1976, pages 139–140), in the non-window wavenumbers, there is zero net exchange between the surface and the atmosphere, while, in the window wavenumbers, there is simply direct radiation from the land-sea surface to space. A like situation occurs between adjacent layers in the turbulently mixed boundary layer of the lower troposphere, expressed in the so-called "cooling to space approximation", first noted by C. D. Rodgers and C. D. Walshaw (1966). | 0 | Theoretical and Fundamental Chemistry |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.