Datasets:

BASF-AI

/

WikipediaEasy2GeneExpressionVsMetallurgyClassification

like 0

Follow

BASF 26

The [https://cran.r-project.org/web/packages/caroline/index.html caroline CRAN R package] contains the only known implementation of an RA plot. However, the meta-transcriptomics [http://bioconductor.org/packages/devel/bioc/html/manta.html "manta" R package] provides a wrapper around this RA plot implementation and is used for assessing fold change in transcription of genes (the points) while simultaneously visualizing each gene's taxonomic distributions as individual pie chart points.

Gene expression + Signal Transduction

Nod factors structurally are lipochitooligosaccharides (LCOs) that consist of an N-acetyl--glucosamine chain linked through β-1,4 linkage with a fatty acid of variable identity attached to a non reducing nitrogen in the backbone with various functional group substitutions at the terminal or non-terminal residues. Nod factors are produced in complex mixtures differing in the following characteristics: * Length of the chain can vary from three to six units of N-acetyl--glucosamine with the exception of M. loti which can produce Nod factors with two unit only. * Presence or absence of strain-specific substitutions along the chain * Identity of the fatty acid component * Presence or absence of unsaturated fatty acids Nod gene expression is induced by the presence of certain flavonoids in the soil, which are secreted by the plant and act as an attractant to bacteria and induce Nod factor production. Flavonoids activate NodD, a LysR family transcription factor, which binds to the nod box and initiates the transcription of the nod genes which encode the proteins necessary for the production of a wide range of LCOs.

Gene expression + Signal Transduction

This gene encodes a member of the tyrosine kinase and, to be more specific, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. Cytokines play pivotal roles in immunity and inflammation by regulating the survival, proliferation, differentiation, and function of immune cells, as well as cells from other organ systems. Hence, targeting cytokines and their receptors is an effective means of treating such disorders. Type I and II cytokine receptors associate with Janus family kinases (JAKs) to affect intracellular signaling. Cytokines including interleukins, interferons and hemopoietins activate the Janus kinases, which associate with their cognate receptors. The mammalian JAK family has four members: JAK1, JAK2, JAK3 and tyrosine kinase 2 (TYK2). The connection between Jaks and cytokine signaling was first revealed when a screen for genes involved in interferon type I (IFN-1) signaling identified TYK2 as an essential element, which is activated by an array of cytokine receptors. TYK2 has broader and profound functions in humans than previously appreciated on the basis of analysis of murine models, which indicate that TYK2 functions primarily in IL-12 and type I-IFN signaling. TYK2 deficiency has more dramatic effects in human cells than in mouse cells. However, in addition to IFN-α and -β and IL-12 signaling, TYK2 has major effects on the transduction of IL-23, IL-10, and IL-6 signals. Since, IL-6 signals through the gp-130 receptor-chain that is common to a large family of cytokines, including IL-6, IL-11, IL-27, IL-31, oncostatin M (OSM), ciliary neurotrophic factor, cardiotrophin 1, cardiotrophin-like cytokine, and LIF, TYK2 might also affect signaling through these cytokines. Recently, it has been recognized that IL-12 and IL-23 share ligand and receptor subunits that activate TYK2. IL-10 is a critical anti-inflammatory cytokine, and IL-10 mice suffer from fatal, systemic autoimmune disease. TYK2 is activated by IL-10, and its deficiency affects the ability to generate and respond to IL-10. Under physiological conditions, immune cells are, in general, regulated by the action of many cytokines and it has become clear that cross-talk between different cytokine-signalling pathways is involved in the regulation of the JAK–STAT pathway.

Gene expression + Signal Transduction

DBT has been shown to physically interact with PER in vitro and in vivo, and to create a stable complex with PER throughout the circadian cycle. PER that has been phosphorylated by DBT is recognized by the Slimb protein. Slimb is a component of the Skp1/Cullin/F-box protein (SCF) ubiquitin ligase complex, which marks proteins for proteosomal degradation in a phosphorylation-dependent manner. Enhanced PER degradation in the cytoplasm is predicted to delay nuclear translocation of both PER and TIM, and to thus affect the period of circadian rhythms. The mutation dbtS, associated with a proline to serine substitution at residue 47 [P47S], shortens period length by about 6 h. dbtL contains an amino acid substitution of isoleucine for methionine at residue 80 (M80I) and lengthens period to 29 h. A third mutation, dbtAR, is associated with a change from histidine 126 to tyrosine and causes arrhythmia. PER protein in this mutant is hypophosphorylated. Each of these mutations maps to the kinase domain of DBT gene. The short- and long-period alleles of DBT enhance or attenuate, respectively, PER degradation in the nucleus, further demonstrating the importance of timely PER degradation as a critical determinant in establishing 24-h rhythmicity. In addition to influencing protein degradation, DBT affects the timing of nuclear accumulation of PER. The short-period mutant dbtS delays PER nuclear accumulation, which is independent of PER protein stability, and arrhythmic alleles of dbt cause nuclear accumulation of PER in clock-containing cells of larval and adult Drosophila. Both mammalian CK1δ and CK1ε contain closely related 123-amino-acid carboxy-terminal domains that can auto-regulate kinase activity. CK1δ and CK1ε are 53% identical. These domains are not related to the carboxy-terminal domain of double-time, suggesting a split in the evolution of the mammalian and fly homologs. A similar function for casein kinase 2 has been reported in Arabidopsis thaliana, Drosophila, and Neurospora.

Gene expression + Signal Transduction

The slip-line theory was co-developed by Hilda Geiringer in the early 1930s. She developed the Geiringer equations, which simplify the process of calculating the deformation.

Metallurgy

SH2 domains contain about 100 amino acid residues and exhibit a central antiparallel β-sheet centered between two α-helices. Binding to phosphotyrosine-containing peptides involves a strictly-conserved Arg residue that pairs with the negatively-charged phosphate on the phosphotyrosine, and a surrounding pocket that recognizes flanking sequences on the target peptide. Compared to other signaling proteins, SH2 domains exhibit only a moderate degree of specificity for their target peptides, due to the relative weakness of the interactions with the flanking sequences. Over 100 human proteins are known to contain SH2 domains. A variety of tyrosine-containing sequences have been found to bind SH2 domains and are conserved across a wide range of organisms, performing similar functions. Binding of a phosphotyrosine-containing protein to an SH2 domain may lead to either activation or inactivation of the SH2-containing protein, depending on the types of interactions formed between the SH2 domain and other domains of the enzyme. Mutations that disrupt the structural stability of the SH2 domain, or that affect the binding of the phosphotyrosine peptide of the target, are involved in a range of diseases including X-linked agammaglobulinemia and severe combined immunodeficiency.

Gene expression + Signal Transduction

While disposal into exhausted open pits is generally a straightforward operation, disposal into underground voids is more complex. A common modern approach is to mix a certain quantity of tailings with waste aggregate and cement, creating a product that can be used to backfill underground voids and stopes. A common term for this is HDPF – High Density Paste Fill. HDPF is a more expensive method of tailings disposal than pond storage, however it has many other benefits – not just environmental but it can significantly increase the stability of underground excavations by providing a means for ground stress to be transmitted across voids – rather than having to pass around them – which can cause mining induced seismic events like that suffered previously at the Beaconsfield Mine Disaster.

Metallurgy

Anti-sigma factors are small proteins that bind to sigma factors and inhibit transcriptional activity in regulating prokaryote gene expression. Anti-sigma factors have both a sigma-binding domain and a sensory/signaling domain; this allows them to respond to signals inside and outside the cell. Anti-sigma factors have been found in several bacteria, including Escherichia coli and Salmonella, and viruses such as the T4 bacteriophage. Anti-sigma factors have an antagonistic effect on sigma factors. Each sigma factor has an associated anti-sigma factor that regulates it. These anti-sigma factors are divided into cytoplasmic-bound anti-sigma factors and inner membrane-bound anti-sigma factors. The differences in these sigma factors are where in the cell they are bound. Cytoplasmic-bound anti-sigma factors include FlgM, DnaK, RssB, and HscC. Inner membrane-bound anti-sigma factors, also called extra-cytoplasmic function (ECF) anti-sigma factors, include FecR and RseA. ECF anti-sigma factors tend to be more diverse in genetic sequence than cytoplasmic-bound anti-sigma factors. These factors regulate many cellular processes, such as flagellum assembly, transport of materials, cell growth, and the cell's stress response.Sigma factors are essential proteins that start the transcription by binding with RNAP; anti-sigma factors are proteins that inhibit the activities of sigma factors affected by several mechanisms. These mechanisms include adding up the anti-sigma factor between sigma or twisting the anti-sigma factor around sigma—gene regulation, especially in bacteria, allows for adaptivity and normal cell differentiation and development. Gene regulation has many different layers of regulators. Yet, initiating transcription is crucial in controlling which genes are expressed. Anti-sigma factors are simultaneously transcribed with their associated sigma factor. This pairing creates a negative feedback loop, maintaining proper levels of both contrasting factors as there can only be one anti-sigma factor per sigma factor that is transcribed. Research shows anti-sigma factors have more activities than contouring sigma factors effects. Anti-sigma factors can also activate some cells while inhibiting others, meaning they have an essential role in cell function.

Gene expression + Signal Transduction

Axe-monies (Spanish: Tajaderos) refer to bronze artifacts found in both western Mesoamerica and the northern Andes. Based on ethnohistorical, archaeological, chemical, and metallurgical analyses, the scholars Hosler, Lechtman and Holm have argued for their use in both regions (which are separated by thousands of miles) through trade. In contrast to naipes, bow-tie- or card-shaped metal objects which appear in the archaeological record only in the northern Andean coastal region, axe-monies are found in both Mesoamerican and Andean cultural zones. More specifically, it is argued that the system of money first arose on the north coast of Peru and Ecuador in the early second millennium CE. In both regions, bronze was smelted, likely by family units, and hammered into thin, axe-shaped forms and bundled in multiples of five, usually twenty. As they are often found in burials, it is likely that in addition to their presumed economic use, they also had ceremonial value.

Metallurgy

Impurities usually enter the solder reservoir by dissolving the metals present in the assemblies being soldered. Dissolving of process equipment is not common as the materials are usually chosen to be insoluble in solder. * Aluminium – little solubility, causes sluggishness of solder and dull gritty appearance due to formation of oxides. Addition of antimony to solders forms Al-Sb intermetallics that are segregated into dross. Promotes embrittlement. * Antimony – added intentionally, up to 0.3% improves wetting, larger amounts slowly degrade wetting. Increases melting point. * Arsenic – forms thin intermetallics with adverse effects on mechanical properties, causes dewetting of brass surfaces * Cadmium – causes sluggishness of solder, forms oxides and tarnishes * Copper – most common contaminant, forms needle-shaped intermetallics, causes sluggishness of solders, grittiness of alloys, decreased wetting * Gold – easily dissolves, forms brittle intermetallics, contamination above 0.5% causes sluggishness and decreases wetting. Lowers melting point of tin-based solders. Higher-tin alloys can absorb more gold without embrittlement. * Iron – forms intermetallics, causes grittiness, but rate of dissolution is very low; readily dissolves in lead-tin above 427 °C. * Lead – causes Restriction of Hazardous Substances Directive compliance problems at above 0.1%. * Nickel – causes grittiness, very little solubility in Sn-Pb * Phosphorus – forms tin and lead phosphides, causes grittiness and dewetting, present in electroless nickel plating * Silver – often added intentionally, in high amounts forms intermetallics that cause grittiness and formation of pimples on the solder surface, potential for embrittlement * Sulfur – forms lead and tin sulfides, causes dewetting * Zinc – in melt forms excessive dross, in solidified joints rapidly oxidizes on the surface; zinc oxide is insoluble in fluxes, impairing repairability; copper and nickel barrier layers may be needed when soldering brass to prevent zinc migration to the surface; potential for embrittlement Board finishes vs wave soldering bath impurities buildup: * HASL, lead-free (Hot Air Level): usually virtually pure tin. Does not contaminate high-tin baths. * HASL, leaded: some lead dissolves into the bath * ENIG (Electroless Nickel Immersion Gold): typically 100-200 microinches of nickel with 3-5 microinches of gold on top. Some gold dissolves into the bath, but limits exceeding buildup is rare. * Immersion silver: typically 10–15 microinches of silver. Some dissolves into the bath, limits exceeding buildup is rare. * Immersion tin: does not contaminate high-tin baths. * OSP (Organic solderability preservative): usually imidazole-class compounds forming a thin layer on the copper surface. Copper readily dissolves in high-tin baths.

Metallurgy

Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long: GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT When used alone without the gamma and beta WPRE components, the alpha component is only 9% as active as the full tripartite WPRE. The sequence for full tripartite WPRE is: This sequence has 100% homology with base pairs 1093 to 1684 of the Woodchuck hepatitis B virus (WHV8) genome. When used in the 3' untranslated region (UTR) of a mammalian expression cassette, it can significantly increase mRNA stability and protein yield.

Gene expression + Signal Transduction

Mechanical alloying is akin to metal powder processing, where metals may be mixed to produce superalloys. Mechanical alloying occurs in three steps. First, the alloy materials are combined in a ball mill and ground to a fine powder. A hot isostatic pressing (HIP) process is then applied to simultaneously compress and sinter the powder. A final heat treatment stage helps remove existing internal stresses produced during any cold compaction which may have been used. This produces an alloy suitable for high heat turbine blades and aerospace components.

Metallurgy

Numerous gold artifacts recovered in the Philippines are believed to have ceremonial purposes. Some of these figures indicate the Hindu and Buddhist influence which came to the Philippines through regional trade in maritime southeast asia, while others reflect nature-based religious beliefs. A notable artifact reflecting indigenous beliefs depicts what has been described as "the large, triangular face of a woman drawn in sharp lines with little shoulders and arms raised in a gesture of worship." Visayan indigenous healing beliefs are likewise reflected in a particular variant of kamagi necklaces known as "tunga," which were snake-like in shape and made of “half gold and half tumbaga” gears strung together. These were believed to protect the wearer from the "folk illness" known as pasma. Other notable ceremonial artifacts include: the Agusan Image which depicts a female Hindu or Buddhist deity whose identity is disputed, and the gold kinnari, which shows a mythical half-human half-bird figure common in hindu and buddhist parts of Maritime Southeast Asia.

Metallurgy

Finally, biological and bio-hybrid drug carriers have shown potential for chemotactic applications. In general, these systems are inspired by microorganisms or cells to help design drug delivery systems that mimic their surface, shape, texture, and movement. One phenomenon that has become increasingly popular in improving the movement and release of bio-hybrid drug carriers is that of chemotaxis. Indeed, thanks to their natural chemotactic sensing property, bacteria can be used to locate a tumor, carry a therapeutic payload to the site, and release that drug in a controlled manner. Researchers can also genetically modify these bacteria to produce a specific protein like anti-tumor cytotoxins for cancer treatment. Yet, this is not to say that they dont come with their own set of challenges and limitations. For one, the genetic modifications of the bacteria used can be manipulated by recent or unforeseen mutations, leading to a decrease in the efficacy of the drug and drug carrier. Moreover, the therapeutic proteins produced may have incomplete protein folding, decreasing the drugs effectiveness or causing unforeseen side effects. Generally speaking, using bacteria may provide some advantages, but further research and development are still needed to address their limitations. Another example of bio-hybrid drug carriers is human cells, like macrophages, which offer compatibility with the human immune system and a simple way to load drugs as a bio-hybrid drug carrier. Leukocytes demonstrate great promise because Tumor cells secrete large amounts of chemoattractants when the cell undergoes inflammation. This secretion of chemoattractants naturally attracts leukocytes, such as macrophages, to the T cell location. Thus, with their well-known chemotactic homing behavior to inflammation or pathogens' sites in mind, researchers can manipulate leukocytes to carry and deliver a therapeutic payload to the tumor site. However, this is not to say that Biological and bio-hybrid drug carriers do not have challenges and limitations of their own. For example, Leukocytes cannot penetrate deeply into the tumors, have a low capacity for carrying drugs, and slow down when the tumor size reduces. Thus, similar to bacteria drug carriers, further research and development are still needed to address their limitations and improve the overall drug delivery system.

Gene expression + Signal Transduction

A metallurgical assay is a compositional analysis of an ore, metal, or alloy, usually performed in order to test for purity or quality. Some assay methods are suitable for raw materials; others are more appropriate for finished goods. Raw precious metals (bullion) are assayed by an assay office. Silver is assayed by titration, gold by cupellation and platinum by inductively coupled plasma optical emission spectrometry (ICP OES). Precious metal items of art or jewelry are frequently hallmarked (depending upon the requirements of the laws of either the place of manufacture or the place of import). Where required to be hallmarked, semi-finished precious metal items of art or jewelry pass through the official testing channels where they are analyzed or assayed for precious metal content. While different nations permit a variety of legally acceptable finenesses, the assayer is actually testing to determine that the fineness of the product conforms with the statement or claim of fineness that the maker has claimed (usually by stamping a number such as 750 for 18k gold) on the item. In the past the assay was conducted by using the touchstone method but currently (most often) it is done using X-ray fluorescence (XRF). XRF is used because this method is more than the touchstone test. The most exact method of assay is known as fire assay or cupellation. This method is better suited for the assay of bullion and gold stocks rather than works of art or jewelry because it is a completely destructive method.

Metallurgy

Testing and/or inspection are typically included in component manufacturing lines to verify the product meets some set of standards to ensure the desired performance in the field. Improper testing or inspection would circumvent these quality checks and could allow a part with a defect that would normally disqualify the component from field use to be sold to a customer, potentially leading to a failure.

Metallurgy

Structurally, rusticles contain channels which allow water to flow through, and they seem to build up in a ring structure similar to the growth rings of a tree. They are very delicate and can easily disintegrate into fine powder on even the slightest touch.

Metallurgy

It was the second stop codon mutation to be discovered. Reminiscent of the usual yellow-orange-brown color associated with amber, this second stop codon was given the name of "ochre", an orange-reddish-brown mineral pigment. Ochre mutant viruses had a property similar to amber mutants in that they recovered infectious ability within certain suppressor strains of bacteria. The set of ochre suppressors was distinct from amber suppressors, so ochre mutants were inferred to correspond to a different nucleotide triplet. Through a series of mutation experiments comparing these mutants with each other and other known amino acid codons, Sydney Brenner concluded that the amber and ochre mutations corresponded to the nucleotide triplets "UAG" and "UAA".

Gene expression + Signal Transduction

*The lac operon consists of 3 structural genes, and a promoter, a terminator, regulator, and an operator. The three structural genes are: lacZ, lacY, and lacA. **lacZ encodes β-galactosidase (LacZ), an intracellular enzyme that cleaves the disaccharide lactose into glucose and galactose. ** lacY encodes Beta-galactoside permease (LacY), a transmembrane symporter that pumps β-galactosides including lactose into the cell using a proton gradient in the same direction. Permease increases the permeability of the cell to β-galactosides. ** lacA encodes β-galactoside transacetylase (LacA), an enzyme that transfers an acetyl group from acetyl-CoA to thiogalactoside. Only lacZ and lacY appear to be necessary for lactose catabolic pathway.

Gene expression + Signal Transduction

DIC has largely replaced the older oblique illumination (OI) technique, which was available on reflected light microscopes prior to about 1975. In OI, the vertical illuminator is offset from perpendicular, producing shading effects that reveal height differences. This procedure reduces resolution and yields uneven illumination across the field of view. Nevertheless, OI was useful when people needed to know if a second phase particle was standing above or was recessed below the plane-of-polish, and is still available on a few microscopes. OI can be created on any microscope by placing a piece of paper under one corner of the mount so that the plane-of-polish is no longer perpendicular to the optical axis.

Metallurgy

Rust is a commonly used metaphor for slow decay due to neglect, since it gradually converts robust iron and steel metal into a soft crumbling powder. A wide section of the industrialized American Midwest and American Northeast, once dominated by steel foundries, the automotive industry, and other manufacturers, has experienced harsh economic cutbacks that have caused the region to be dubbed the "Rust Belt". In music, literature, and art, rust is associated with images of faded glory, neglect, decay, and ruin.

Metallurgy

A metallurgical method employed in the purification of copper which contains copper oxide as an impurity and also in the purification of tin which contains tin oxide (stannic oxide or "SnO") as an impurity. The impure metal, usually in the form of molten blister copper, is placed in an anode furnace for two stages of refining. In the first stage, sulphur and iron are removed by gently blowing air through the molten metal to form iron oxides and sulfur dioxide. The iron oxides are skimmed or poured off the top of the copper and the gaseous sulfur dioxide exits the furnace via the off-gas system. Once the first oxidation stage is complete, the second stage (reduction or poling) begins. This involves using a reducing agent, normally natural gas or diesel (but ammonia, liquid petroleum gas, and naphtha can also be used), to react with the oxygen in the copper oxide to form copper . In the past, freshly cut ("green") trees were used as wooden poles. The sap in these poles acted as the reducing agent. The heat of the copper makes the pole emit wood gas(CO and H) that reduces the cuprous oxide to copper. It was the use of these greenwood poles gave rise to the term "poling." Care must be taken to avoid removing too much of the oxygen from the anode copper, as this will cause other impurities to change from their oxide to metallic states and they will remain in solid solution in the copper, reduce its conductivity and change its physical properties. Also upper surface can be covered with coke to prevent reoxidation of metal.

Metallurgy

Depending on the size of the alloying element, a substitutional solid solution or an interstitial solid solution can form. In both cases, atoms are visualised as rigid spheres where the overall crystal structure is essentially unchanged. The rationale of crystal geometry to atom solubility prediction is summarized in the Hume-Rothery rules and Pauling's rules. Substitutional solid solution strengthening occurs when the solute atom is large enough that it can replace solvent atoms in their lattice positions. Some alloying elements are only soluble in small amounts, whereas some solvent and solute pairs form a solution over the whole range of binary compositions. Generally, higher solubility is seen when solvent and solute atoms are similar in atomic size (15% according to the Hume-Rothery rules) and adopt the same crystal structure in their pure form. Examples of completely miscible binary systems are Cu-Ni and the Ag-Au face-centered cubic (FCC) binary systems, and the Mo-W body-centered cubic (BCC) binary system. Interstitial solid solutions form when the solute atom is small enough (radii up to 57% the radii of the parent atoms) to fit at interstitial sites between the solvent atoms. The atoms crowd into the interstitial sites, causing the bonds of the solvent atoms to compress and thus deform (this rationale can be explained with Pauling's rules). Elements commonly used to form interstitial solid solutions include H, Li, Na, N, C, and O. Carbon in iron (steel) is one example of interstitial solid solution.

Metallurgy

NF-Y is a heterotrimeric complex composed of NF-YA, NF-YB, and NF-YC subunits. The key structural feature of the NF-Y/DNA complex is the minor-groove interaction of its DNA binding domain-containing subunit NF-YA, which induces an ~80° bend in the DNA. NF-YB and NF-YC interact with DNA through non-specific histone-fold domain-DNA contacts. NF-YAs unique DNA-binding mode and NF-YB/NF-YCs nucleosome-like properties of non-specific DNA binding impose sufficient spatial constraints to induce flanking nucleosomes to slide outward, making nearby recognition sites for other transcription factors accessible.

Gene expression + Signal Transduction

The evaluated parameters are: * time to specimen failure (e.g., breakage, or from other "failure" criteria) * ductility (by elongation to fracture or the reduction of the area) * ultimate tensile strength (from the maximum load) * area under the elongation - load curve (which represents the fracture energy) * percent of ductile/brittle fracture on the fracture surface * threshold stress for cracking The results of the SSRT tests are evaluated using the ratio: The departure of the ratio below unity quantifies the increased susceptibility to cracking. The test is best used in combination with electrochemical measurements and other stress corrosion cracking tests.

Metallurgy

STAT4 binds to hundreds of sites in the genome, among others to the promoters of genes for cytokines (IFN-γ, TNF), receptors (IL18R1, IL12rβ2, IL18RAP), and signaling factors (MYD88).

Gene expression + Signal Transduction

Proteins are translated by reading tri-nucleotides on the mRNA strand, also known as codons, from one end of the mRNA to the other (from the 5 to the 3 end) starting with the amino acid methionine as the start (initiation) codon AUG. Each codon is translated into a single amino acid. The code itself is considered degenerate, meaning that a particular amino acid can be specified by more than one codon. However, a shift of any number of nucleotides that is not divisible by 3 in the reading frame will cause subsequent codons to be read differently. This effectively changes the ribosomal reading frame.

Gene expression + Signal Transduction

Downs' process is an electrochemical method for the commercial preparation of metallic sodium, in which molten NaCl is electrolyzed in a special apparatus called the Downs cell. The Downs cell was invented in 1923 (patented: 1924) by the American chemist James Cloyd Downs (1885–1957).

Metallurgy

In order to see whether p53 re-expression in cancer cells (that have lost p53 expression) has the suppressive effect on the promoter of the survivin gene, a luciferase reporter construct was made. The isolated survivin promoter was placed upstream of the luciferase reporter gene. In a luciferase reporter assay, if the promoter is active, the luciferase gene is transcribed and translated into a product that gives off light that can measured quantitatively and, thus, represents the activity of the promoter. This construct was transfected into cancer cells that had either wild-type or mutant p53. High luciferase activity was measured in the cells with mutant p53 and significantly lower luciferase levels were measured for cells with wild-type p53. Transfection of different cell types with wild-type p53 was associated with a strong repression of the survivin promoter. Transfection with mutant p53 was not shown to strongly repress the survivin promoter. More luciferase constructs were prepared with varying degrees of deletion from the 5' end of the survivin promoter region. At one point, there was deletion that caused the survivin levels to be indifferent to the presence of the p53 over-expression plasmid, indicating that there is a specific region proximal to the transcription start site that is needed for p53 suppression of survivin. Although it has been found that two p53 binding sites are located on the survivin gene promoter, analysis using deletions and mutations has shown that these sites are not essential to transcriptional inactivation. Instead, it is observed that modification of the chromatin inside of the promoter region may be responsible for the transcriptional repression of the survivin gene. This is explained below in the epigenetic regulation section.

Gene expression + Signal Transduction

Some hydrogen sulfide gas diffuses into the headspace environment above the wastewater. Moisture evaporated from warm sewage may condense on unsubmerged walls of sewers, and is likely to hang in partially formed droplets from the horizontal crown of the sewer. As a portion of the hydrogen sulfide gas and oxygen gas from the air above the sewage dissolves into these stationary droplets, they become a habitat for sulfur oxidizing bacteria (SOB), of the genus Acidithiobacillus. Colonies of these aerobic bacteria metabolize the hydrogen sulfide gas to sulfuric acid.

Metallurgy

Coding regions are composed of codons, which are decoded and translated into proteins by the ribosome; in eukaryotes usually into one and in prokaryotes usually into several. Coding regions begin with the start codon and end with a stop codon. In general, the start codon is an AUG triplet and the stop codon is UAG ("amber"), UAA ("ochre"), or UGA ("opal"). The coding regions tend to be stabilised by internal base pairs; this impedes degradation. In addition to being protein-coding, portions of coding regions may serve as regulatory sequences in the pre-mRNA as exonic splicing enhancers or exonic splicing silencers.

Gene expression + Signal Transduction

RNA polymerase 1 (also known as Pol I) is, in higher eukaryotes, the polymerase that only transcribes ribosomal RNA (but not 5S rRNA, which is synthesized by RNA polymerase III), a type of RNA that accounts for over 50% of the total RNA synthesized in a cell.

Gene expression + Signal Transduction

Several genetic diseases may be the result of splice site mutations. For example, mutations that cause the incorrect splicing of β-globin mRNA are responsible of some cases of β-thalassemia. Another Example is TTP (thrombotic thrombocytopenic purpura). TTP is caused by deficiency of ADAMTS-13. A splice site mutation of ADAMTS-13 gene can therefore cause TTP. It is estimated that 15% of all point mutations causing human genetic diseases occur within a splice site.

Gene expression + Signal Transduction

Currently the most important application is due to the special magnetic properties of some ferromagnetic metallic glasses. The low magnetization loss is used in high efficiency transformers (amorphous metal transformer) at line frequency and some higher frequency transformers. Amorphous steel is a very brittle material which makes it difficult to punch into motor laminations. Also electronic article surveillance (such as theft control passive ID tags,) often uses metallic glasses because of these magnetic properties. A commercial amorphous alloy, Vitreloy 1 (41.2% Zr, 13.8% Ti, 12.5% Cu, 10% Ni, and 22.5% Be), was developed at Caltech, as a part of Department of Energy and NASA research of new aerospace materials. Ti-based metallic glass, when made into thin pipes, have a high tensile strength of , elastic elongation of 2% and high corrosion resistance. Using these properties, a Ti–Zr–Cu–Ni–Sn metallic glass was used to improve the sensitivity of a Coriolis flow meter. This flow meter is about 28-53 times more sensitive than conventional meters, which can be applied in fossil-fuel, chemical, environmental, semiconductor and medical science industry. Zr-Al-Ni-Cu based metallic glass can be shaped into pressure sensors for automobile and other industries, and these sensors are smaller, more sensitive, and possess greater pressure endurance compared to conventional stainless steel made from cold working. Additionally, this alloy was used to make the world's smallest geared motor with diameter to be produced and sold at the time.

Metallurgy

Hellenistic and Graeco-Roman forms are more conventional, and the new motives that belong to these periods are mostly floral. Busts and masks are the usual handle-plaques and spouts; heads and limbs of various animals are allotted certain decorative functions, as for instance the spirited mules' heads mentioned by Juvenal, which formed the elbow-rests of dining couches. These structural pieces are frequently inlaid with silver and niello. Bronze chairs and tables were commonly used in Hellenistic and Roman houses, and largely took the place of monumental vases that were popular in earlier days. Small household articles, such as lamps, when made of bronze are usually Roman, and a peculiarly Roman class of personal ornaments is a large bronze brooch inlaid with coloured enamels, a technique which seems to have had a Gaulish origin.

Metallurgy

In microwave sintering, heat is sometimes generated internally within the material, rather than via surface radiative heat transfer from an external heat source. Some materials fail to couple and others exhibit run-away behavior, so it is restricted in usefulness. A benefit of microwave sintering is faster heating for small loads, meaning less time is needed to reach the sintering temperature, less heating energy is required and there are improvements in the product properties. A failing of microwave sintering is that it generally sinters only one compact at a time, so overall productivity turns out to be poor except for situations involving one of a kind sintering, such as for artists. As microwaves can only penetrate a short distance in materials with a high conductivity and a high permeability, microwave sintering requires the sample to be delivered in powders with a particle size around the penetration depth of microwaves in the particular material. The sintering process and side-reactions run several times faster during microwave sintering at the same temperature, which results in different properties for the sintered product. This technique is acknowledged to be quite effective in maintaining fine grains/nano sized grains in sintered bioceramics. Magnesium phosphates and calcium phosphates are the examples which have been processed through the microwave sintering technique.

Metallurgy

Signal transducer and activator of transcription 5 (STAT5) refers to two highly related proteins, STAT5A and STAT5B, which are part of the seven-membered STAT family of proteins. Though STAT5A and STAT5B are encoded by separate genes, the proteins are 90% identical at the amino acid level. STAT5 proteins are involved in cytosolic signalling and in mediating the expression of specific genes. Aberrant STAT5 activity has been shown to be closely connected to a wide range of human cancers, and silencing this aberrant activity is an area of active research in medicinal chemistry.

Gene expression + Signal Transduction

Scribing is the removal of maskant on the areas to be etched. For decorative applications, this is often done by hand through the use of a scribing knife, etching needle or similar tool; modern industrial applications may involve an operator scribing with the aid of a template or use computer numerical control to automate the process. For parts involving multiple stages of etching, complex templates using colour codes and similar devices may be used.

Metallurgy

The ability of the immune system to recognize molecules that are broadly shared by pathogens is, in part, due to the presence of immune receptors called toll-like receptors (TLRs) that are expressed on the membranes of leukocytes including dendritic cells, macrophages, natural killer cells, cells of the adaptive immunity T cells, and B cells, and non-immune cells (epithelial and endothelial cells, and fibroblasts). The binding of ligands - either in the form of adjuvant used in vaccinations or in the form of invasive moieties during times of natural infection - to the TLR marks the key molecular events that ultimately lead to innate immune responses and the development of antigen-specific acquired immunity. Upon activation, TLRs recruit adaptor proteins (proteins that mediate other protein-protein interactions) within the cytosol of the immune cell to propagate the antigen-induced signal transduction pathway. These recruited proteins are then responsible for the subsequent activation of other downstream proteins, including protein kinases (IKKi, IRAK1, IRAK4, and TBK1) that further amplify the signal and ultimately lead to the upregulation or suppression of genes that orchestrate inflammatory responses and other transcriptional events. Some of these events lead to cytokine production, proliferation, and survival, while others lead to greater adaptive immunity. If the ligand is a bacterial factor, the pathogen might be phagocytosed and digested, and its antigens presented to CD4+ T cells. In the case of a viral factor, the infected cell may shut off its protein synthesis and may undergo programmed cell death (apoptosis). Immune cells that have detected a virus may also release anti-viral factors such as interferons. Toll-like receptors have also been shown to be an important link between innate and adaptive immunity through their presence in dendritic cells. Flagellin, a TLR5 ligand, induces cytokine secretion on interacting with TLR5 on human T cells.

Gene expression + Signal Transduction

Soluble adenylyl cyclase (sAC) is a regulatory cytosolic enzyme present in almost every cell. sAC is a source of cyclic adenosine 3’,5’ monophosphate (cAMP) – a second messenger that mediates cell growth and differentiation in organisms from bacteria to higher eukaryotes. sAC differentiates from the transmembrane adenylyl cyclase (tmACs) – an important source of cAMP; in that sAC is regulated by bicarbonate anions and it is dispersed throughout the cell cytoplasm. sAC has been found to have various functions in physiological systems different from that of the tmACs.

Gene expression + Signal Transduction

Laser peening (LP), or laser shock peening (LSP), is a surface engineering process used to impart beneficial residual stresses in materials. The deep, high-magnitude compressive residual stresses induced by laser peening increase the resistance of materials to surface-related failures, such as fatigue, fretting fatigue, and stress corrosion cracking. Laser shock peening can also be used to strengthen thin sections, harden surfaces, shape or straighten parts (known as laser peen forming), break up hard materials, compact powdered metals and for other applications where high-pressure, short duration shock waves offer desirable processing results.

Metallurgy

CK2 typically appears as a tetramer of two α subunits; α being 42 kDa and α’ being 38 kDa, and two β subunits, each weighing in at 28 kDa. The β regulatory domain only has one isoform and therefore within the tetramer will have two β subunits. The catalytic α domains appear as an α or α’ variant and can either be formed in a homodimer (α & α, or α’ & α’) formation or heterodimer formation (α & α’). It is worth noting that other β isoforms have been found in other organisms but not in humans. The α subunits do not require the β regulatory subunits to function, this allows dimers to form of the catalytic domains independent of β subunit transcription. The presence of these α subunits does have an effect on the phosphorylation targets of CK2. A functional difference between α and α’ has been found but the exact nature of differences isn't fully understood yet. An example is that Caspase 3 is preferentially phosphorylated by α’ based tetramers over α based tetramers.

Gene expression + Signal Transduction

Microstructure is the very small scale structure of a material, defined as the structure of a prepared surface of material as revealed by an optical microscope above 25× magnification. The microstructure of a material (such as metals, polymers, ceramics or composites) can strongly influence physical properties such as strength, toughness, ductility, hardness, corrosion resistance, high/low temperature behaviour or wear resistance. These properties in turn govern the application of these materials in industrial practice. Microstructure at scales smaller than can be viewed with optical microscopes is often called nanostructure, while the structure in which individual atoms are arranged is known as crystal structure. The nanostructure of biological specimens is referred to as ultrastructure. A microstructure’s influence on the mechanical and physical properties of a material is primarily governed by the different defects present or absent of the structure. These defects can take many forms but the primary ones are the pores. Even if those pores play a very important role in the definition of the characteristics of a material, so does its composition. In fact, for many materials, different phases can exist at the same time. These phases have different properties and if managed correctly, can prevent the fracture of the material.

Metallurgy

The Pidgeon process is a practical method for smelting magnesium. The most common method involves the raw material, dolomite being fed into an externally heated reduction tank and then thermally reduced to metallic magnesium using 75% ferrosilicon as a reducing agent in a vacuum. Overall the processes in magnesium smelting via the Pidgeon process involve dolomite calcination, grinding and pelleting, and vacuum thermal reduction. Besides the Pidgeon process, electrolysis of magnesium chloride for commercial production of magnesium is also used, at one point in time accounting for 75% of the world's magnesium production.

Metallurgy

The TFs binding sites are physical DNA sites recognized by transcription factors within a genome, including enhancer, upstream activator (UAS) and operator sites that may bind repressors or activators.

Gene expression + Signal Transduction

In the regulation of heating and cooling, thermostats that operate over a wide range of temperatures are used. In these, one end of the bimetallic strip is mechanically fixed and attached to an electrical power source, while the other (moving) end carries an electrical contact. In adjustable thermostats another contact is positioned with a regulating knob or lever. The position so set controls the regulated temperature, called the set point. Some thermostats use a mercury switch connected to both electrical leads. The angle of the entire mechanism is adjustable to control the set point of the thermostat. Depending upon the application, a higher temperature may open a contact (as in a heater control) or it may close a contact (as in a refrigerator or air conditioner). The electrical contacts may control the power directly (as in a household iron) or indirectly, switching electrical power through a relay or the supply of natural gas or fuel oil through an electrically operated valve. In some natural gas heaters the power may be provided with a thermocouple that is heated by a pilot light (a small, continuously burning, flame). In devices without pilot lights for ignition (as in most modern gas clothes dryers and some natural gas heaters and decorative fireplaces) the power for the contacts is provided by reduced household electrical power that operates a relay controlling an electronic ignitor, either a resistance heater or an electrically powered spark generating device.

Metallurgy

The methylation of certain CpG clusters (i.e. DNA areas high in cytosine and guanine) regulate the transcriptional activity of nearby genes. That is, the methylation of a cluster(s) regulates its nearby gene by blocking it from making mRNAs and thereby the proteins encoded by these mRNAs. Studies find that the CMTM5 gene in the DNA isolated from the blood of individuals with the autoimmune diseases of systemic lupus erythematosus and primary Sjögrens syndrome (i.e. Sjorgens syndrome not associated with other health problems or connective tissue diseases) is hyper-methylated at its CpG cluster(s) and thereby less active or inactive. On the other hand, the CpG cluster(s) controlling the CMTM5 gene in the blood of individuals with the autoimmune disease of rheumatoid arthritis are hypo-methylated and therefore highly active. These methylation changes, the studies suggest, regulate the function of immunologically active blood cells (and, perhaps, blood platelets) and thereby the development, maintenance, and/or worsening of the cited autoimmune diseases. Further studies are required to prove that these methylations contribute to the immunologic dysregulations occurring in these (and perhaps other) autoimmune diseases and can serve as clinical markers of disease severity and/or as therapeutic targets for controlling the diseases.

Gene expression + Signal Transduction

Copper does not require cleaning or maintenance. It is particularly suited for areas that are difficult or dangerous to access after installation.

Metallurgy

The CTCF insulator appears to have enhancer blocking activity via its 3D structure and have no direct connection with barrier activity. Vertebrates in particular appear to rely heavily on the CTCF insulator, however there are many different insulator sequences identified. Insulated neighborhoods formed by physical interaction between two CTCF-bound DNA loci contain the interactions between enhancers and their target genes.

Gene expression + Signal Transduction

The basic oxygen process developed outside of traditional "big steel" environment. It was developed and refined by a single man, Swiss engineer Robert Durrer, and commercialized by two small steel companies in allied-occupied Austria, which had not yet recovered from the destruction of World War II. In 1856, Henry Bessemer had patented a steelmaking process involving oxygen blowing for decarbonizing molten iron (UK Patent No. 2207). For nearly 100 years commercial quantities of oxygen were not available or were too expensive, and the invention remained unused. During WWII German (Karl Valerian Schwarz), Belgian (John Miles) and Swiss (Durrer and Heinrich Heilbrugge) engineers proposed their versions of oxygen-blown steelmaking, but only Durrer and Heilbrugge brought it to mass-scale production. In 1943, Durrer, formerly a professor at the Berlin Institute of Technology, returned to Switzerland and accepted a seat on the board of Roll AG, the country's largest steel mill. In 1947 he purchased the first small 2.5-ton experimental converter from the US, and on April 3, 1948 the new converter produced its first steel. The new process could conveniently process large amounts of scrap metal with only a small proportion of primary metal necessary. In the summer of 1948, Roll AG and two Austrian state-owned companies, VÖEST and ÖAMG, agreed to commercialize the Durrer process. By June 1949, VÖEST developed an adaptation of Durrers process, known as the LD (Linz-Donawitz) process. In December 1949, VÖEST and ÖAMG committed to building their first 30-ton oxygen converters. They were put into operation in November 1952 (VÖEST in Linz) and May 1953 (ÖAMG, Donawitz) and temporarily became the leading edge of the worlds steelmaking, causing a surge in steel-related research. Thirty-four thousand businesspeople and engineers visited the VÖEST converter by 1963. The LD process reduced processing time and capital costs per ton of steel, contributing to the competitive advantage of Austrian steel. VÖEST eventually acquired the rights to market the new technology. Errors by the VÖEST and the ÖAMG management in licensing their technology made control over its adoption in Japan impossible. By the end of the 1950s, the Austrians lost their competitive edge. In the original LD process, oxygen was blown over the top of the molten iron through the water-cooled nozzle of a vertical lance. In the 1960s, steelmakers introduced bottom-blown converters and developed inert gas blowing for stirring the molten metal and removing phosphorus impurities. In the Soviet Union, some experimental production of steel using the process was done in 1934, but industrial use was hampered by lack of efficient technology to produce liquid oxygen. In 1939, the Russian physicist Pyotr Kapitsa perfected the design of the centrifugal turboexpander. The process was put to use in 1942–1944. Most turboexpanders in industrial use since then have been based on Kapitsa's design and centrifugal turboexpanders have taken over almost 100% of industrial gas liquefaction, and in particular the production of liquid oxygen for steelmaking. Big American steelmakers were late adopters of the new technology. The first oxygen converters in the US were launched at the end of 1954 by McLouth Steel in Trenton, Michigan, which accounted for less than 1% of the national steel market. U.S. Steel and Bethlehem Steel introduced the oxygen process in 1964. By 1970, half of the worlds and 80% of Japans steel output was produced in oxygen converters. In the last quarter of the 20th century, use of basic oxygen converters for steel production was gradually, partially replaced by the electric arc furnace using scrap steel and iron. In Japan the share of LD process decreased from 80% in 1970 to 70% in 2000; worldwide share of the basic oxygen process stabilized at 60%.

Metallurgy

Of the known types of bronze or brass, not distinguished in classical antiquity and interchangeably known in Latin as aes and in Greek as χαλκός, Corinthian bronze was the most valuable. Statues, vases and vessels, or other objects formed of this metal were priceless, of greater value than if they had been made of silver or gold. Pliny the Elder distinguished it into three kinds, depending on the metal that is added to the copper base: in the first, gold is added (luteum); in the second, silver (candidum); in the third, gold, silver, and copper are equally blended. Plutarch and Cicero both comment that Corinthian bronze, unlike many other copper alloys, is resistant to tarnishing. Pliny also refers to a fourth, dark alloy, known as hepatizon. Petronius and other authors mocked the connoisseurs of their day who claimed to be able to identify it. According to legend, Corinthian bronze was first created by accident, during the burning of Corinth by Lucius Mummius Achaicus in 146 BC, when the city's immense quantities of gold, silver, and copper melted together. Pliny however, remarked that this story is unbelievable, because most of the creators of the highly valued works in Corinthian bronze in Ancient Greece lived at a much earlier period than second century BC. According to Pliny, the method of making it had been lost for a long time, although some sources describe the process by which it is created, involving heat treatment, quenching, leaching, and burnishing, in a process similar to depletion gilding. The lost ability to give an object made from bronze the appearance of gold or silver may be one strand behind the later alchemical quest to turn base metals into precious metals.

Metallurgy

Some invertebrates use calcium compounds for building their exoskeleton (shells and carapaces) or endoskeleton (echinoderm plates and poriferan calcareous spicules).

Gene expression + Signal Transduction

Bluing is a technique that can provide limited resistance to rusting for small steel items, such as firearms; for it to be successful, a water-displacing oil is rubbed onto the blued steel and other steel .

Metallurgy

A metabotropic receptor, also referred to by the broader term G-protein-coupled receptor, is a type of membrane receptor that initiates a number of metabolic steps to modulate cell activity. The nervous system utilizes two types of receptors: metabotropic and ionotropic receptors. While ionotropic receptors form an ion channel pore, metabotropic receptors are indirectly linked with ion channels through signal transduction mechanisms, such as G proteins. Both receptor types are activated by specific chemical ligands. When an ionotropic receptor is activated, it opens a channel that allows ions such as Na, K, or Cl to flow. In contrast, when a metabotropic receptor is activated, a series of intracellular events are triggered that can also result in ion channels opening or other intracellular events, but involve a range of second messenger chemicals.

Gene expression + Signal Transduction

In September 2011, three NASA investigators claimed that they identified tin whiskers on the accelerator position sensors of sampled Toyota Camry models that could contribute to the "stuck accelerator" crashes affecting certain Toyota models during 2005–2010. This contradicted an earlier 10-month joint investigation by the National Highway Traffic Safety Administration (NHTSA) and a large group of other NASA researchers that found no electronic defects. In 2012, NHTSA maintained: "We do not believe that tin whiskers are a plausible explanation for these incidents...[the likely cause was] pedal misapplication." Toyota also maintains that tin whiskers were not the cause of any stuck accelerator issues: "In the words of U.S. Transportation Secretary Ray LaHood, 'The verdict is in. There is no electronic-based cause for unintended high-speed acceleration in Toyotas. Period. According to a Toyota press release, "no data indicates that tin whiskers are more prone to occur in Toyota vehicles than any other vehicle in the marketplace." Toyota also states that "their systems are designed to reduce the risk that tin whiskers will form in the first place."

Metallurgy

Geometallurgy relates to the practice of combining geology or geostatistics with metallurgy, or, more specifically, extractive metallurgy, to create a spatially or geologically based predictive model for mineral processing plants. It is used in the hard rock mining industry for risk management and mitigation during mineral processing plant design. It is also used, to a lesser extent, for production planning in more variable ore deposits. There are four important components or steps to developing a geometallurgical program,: *the geologically informed selection of a number of ore samples *laboratory-scale test work to determine the ore's response to mineral processing unit operations *the distribution of these parameters throughout the orebody using an accepted geostatistical technique *the application of a mining sequence plan and mineral processing models to generate a prediction of the process plant behavior

Metallurgy

Many different microscopy techniques are used in metallographic analysis. Prepared specimens should be examined with the unaided eye after etching to detect any visible areas that have responded to the etchant differently from the norm as a guide to where microscopical examination should be employed. Light optical microscopy (LOM) examination should always be performed prior to any electron metallographic (EM) technique, as these are more time-consuming to perform and the instruments are much more expensive. Further, certain features can be best observed with the LOM, e.g., the natural color of a constituent can be seen with the LOM but not with EM systems. Also, image contrast of microstructures at relatively low magnifications, e.g., <500X, is far better with the LOM than with the scanning electron microscope (SEM), while transmission electron microscopes (TEM) generally cannot be utilized at magnifications below about 2000 to 3000X. LOM examination is fast and can cover a large area. Thus, the analysis can determine if the more expensive, more time-consuming examination techniques using the SEM or the TEM are required and where on the specimen the work should be concentrated.

Metallurgy

ASF/SF2 has been shown to have a critical function in heart development, embryogenesis, tissue formation, cell motility, and cell viability in general.

Gene expression + Signal Transduction

In metallurgy, a ladle is a bucket-shaped container or vessel used to transport and pour out molten metals. Ladles are often used in foundries and range in size from small hand-carried vessels that resemble a kitchen ladle and hold to large steelmill ladles that hold up to . Many non-ferrous foundries also use ceramic crucibles for transporting and pouring molten metal and will also refer to these as ladles.

Metallurgy

Several properties make NiSi an important local contact material in the area of microelectronics, among them a reduced thermal budget, low resistivity of 13–14 μΩ·cm and a reduced Si consumption when compared to alternative compounds.

Metallurgy

In nickel-based superalloys, regions of NiAl (called γ' phase) precipitate out of the nickel-rich matrix (called γ phase) to give high strength and creep resistance. Many alloy formulations are available and they usually include other elements, such as chromium, molybdenum, and iron, in order to improve various properties.

Metallurgy

Each of the functional regions of TFIIB interacts with different parts of RNA polymerase II. The amino terminal B ribbon is located on dock domain of RNA polymerase II and extends in to the cleft towards the active site. Extending the B ribbon is the B reader that extends via the RNA exit tunnel to the binding site of the DNA-RNA hybrid and towards the active site. The B linker is the region between the B reader and the B core that is found in the cleft of RNA polymerase II and continues by the rudder and the clamp coiled-coil until it reaches the C terminal B core that is found above the wall of RNA polymerase II. The B reader and the B linker consist of highly conserved residues that are positioned through the RNA polymerase II tunnel towards the active site and ensure tight binding, without these key residues dissociation would occur. These two domains are also thought to adjust the position of some of the more flexible areas of RNA polymerase II to allow for the precise positioning of the DNA and allowing the addition of the new NTPs onto the nascent RNA chain. Upon binding RNA polymerase II, the B reader and B linker cause slight repositioning of the protrusion domain of RNA polymerase II which allows an essential second magnesium ion to bind in the active site. It forms a beta sheet and an ordered loop that helps with the stability of the structure when transcription is initiated.

Gene expression + Signal Transduction

Recent studies have shown that decreased TFIIB levels do not affect transcription levels within cells, this is thought to be partially because over 90% of mammalian promoters do not contain a BRE or TATA box. However, it has been shown that TFIIB is vital to the in vitro transcription and regulation of the herpes simplex virus. This is thought to be due to similarity TFIIB has to cyclin A. In order to undergo replication, viruses often stop host cells progression through the cell cycle, using cyclins and other proteins. As TFIIB has a similar structure to cyclin A it has been suggested that depleted levels of TFIIB could have antiviral effects.

Gene expression + Signal Transduction

In 1994, Dunne was appointed as a Postdoctoral research associate in the Department of Mechanical Engineering, University of Manchester (UMIST), before being appointed a Research Fellowship at Hertford College, Oxford and the Department of Engineering Science, University of Oxford from 1996 until 2012. He became the dean of the department but moved to Imperial College London in 2012. He is an Emeritus Fellow of Hertford College, Oxford. While in Oxford, Dune was part of the Materials for fusion & fission power program. He led the Micro-mechanical modelling techniques for forming texture, non-proportionality and failure in auto materials program at the Department of Engineering Science, University of Oxford between October 2011 and June 2012, when he moved the grant with him to the Department of Materials, Imperial College London from June 2012 until it ended in March 2015. He also led the Heterogeneous Mechanics in Hexagonal Alloys across Length and Time Scales (HexMat) program, which was Engineering and Physical Sciences Research Council (EPSRC) funded at a value of £5 million between May 2013 and November 2018. Dunne was the director of the Rolls-Royce Nuclear University Technology Centre at Imperial College London. He is part of a £7.2 million program on Mechanistic understanding of Irradiation Damage in fuel Assemblies (MIDAS) that is funded by Engineering and Physical Sciences Research Council until April 2024 As of November 2022, Dunne is a Professor of Materials Science at Imperial College London and holds the Chair in Micromechanics and the Royal Academy of Engineering (RAEng)/Rolls-Royce Research Chair. He is also a Rolls-Royce consultant, and an Honorary Professor and co-director of the Beijing International Aeronautical Materials (BIAM). Dunne's research focuses on computational crystal plasticity, discrete dislocation plasticity, and microstructure-sensitive nucleation and growth of short fatigue cracks in engineering materials, mainly Nickel, Titanium, and Zirconium alloys.

Metallurgy

miRBase is considered to be the gold-standard miRNA database—it stores miRNA sequences detected by thousand of experiments. In this database each miRNA is associated with a miRNA precursor and with one or two mature miRNA (-5p and -3p). In the past it had always been said that the same miRNA precursor generates the same miRNA sequences. However, the advent of deep sequencing has now allowed researchers to detect a huge variability in miRNA biogenesis, meaning that from the same miRNA precursor many different sequences can be generated potentially have different targets, or even lead to opposite changes in mRNA expression.

Gene expression + Signal Transduction

Thomas James Marrow (born 23 November 1966) is a British scientist who is a professor of nuclear materials at the University of Oxford and holds the James Martin Chair in Energy Materials. He specialises in physical metallurgy, micromechanics, and X-ray crystallography of engineering materials, mainly ceramic matrix composite and nuclear graphite.

Metallurgy

There are several kinds of Dimetcote, designed for different working environments. * Dimetcote 21-5 * Dimetcote 3a * Dimetcote 9H * Dimetcote 9 * Dimetcote 11 * Dimetcote 302H * Dimetcote 4

Metallurgy

The C-terminus of RPB1 is appended to form the C-terminal domain (CTD). The carboxy-terminal domain of RNA polymerase II typically consists of up to 52 repeats of the sequence Tyr-Ser-Pro-Thr-Ser-Pro-Ser. The domain stretches from the core of the RNAPII enzyme to the exit channel, this placement is effective due to its inductions of "RNA processing reactions, through direct or indirect interactions with components of the RNA processing machinery". The CTD domain does not exist in RNA Polymerase I or RNA Polymerase III. The RNA Polymerase CTD was discovered first in the laboratory of C.J.Ingles at the University of Toronto and also in the laboratory of J Corden at Johns Hopkins University during the processes of sequencing the DNA encoding the RPB1 subunit of RNA polymerase from Yeast and Mice respectively. Other proteins often bind the C-terminal domain of RNA polymerase in order to activate polymerase activity. It is the protein domain that is involved in the initiation of transcription, the capping of the RNA transcript, and attachment to the spliceosome for RNA splicing.

Gene expression + Signal Transduction

The New Jersey Zinc Company invented this process in 1930. The process take advantage of the relatively low boiling point of zinc () as compared to the impurities being removed in the first "column": iron and aluminium. Therefore, in the first column the zinc is heated above its boiling point and allowed to rise to a condenser. The iron and aluminium impurities sink to the bottom in the form of a solid or liquid. There are still lead and cadmium vapor impurities. In order to remove the lead 2-3% of the vapor is condensed, which draws the majority of the lead out of the vapor; down to the point where it is only 0.003% of the total contents. Finally the vapor is pumped into the cadmium column where it is cooled to an intermediate temperature below the boiling point zinc, but still above the boiling point of cadmium (). The zinc leaves out the bottom as a refined liquid, while the cadmium leaves out the top as vapor.

Metallurgy

An induction furnace is an electrical furnace in which the heat is applied by induction heating of metal. Induction furnace capacities range from less than one kilogram to one hundred tons, and are used to melt iron and steel, copper, aluminum, and precious metals. The advantage of the induction furnace is a clean, energy-efficient and well-controlled melting process, compared to most other means of metal melting. Most modern foundries use this type of furnace, and many iron foundries are replacing cupola furnaces with induction furnaces to melt cast iron, as the former emit much dust and other pollutants. Induction furnaces do not require an arc, as in an electric arc furnace, or combustion, as in a blast furnace. As a result, the temperature of the charge (the material entered into the furnace for heating, not to be confused with electric charge) is no higher than required to melt it; this can prevent the loss of valuable alloying elements. The one major drawback to induction furnace usage in a foundry is the lack of refining capacity: charge materials must be free of oxides and be of a known composition, and some alloying elements may be lost due to oxidation, so they must be re-added to the melt.

Metallurgy

The specific study of the non-ferrous metals used in past. Gold, silver and copper were the first to be used by ancient humans. Gold and copper are both found in their native state in nature, and were thus the first to be exploited as they did not need to be smelted from their ores. They could be hammered into sheets or decorative shapes. The extraction of copper from its ores may have developed due to the attractive colouring and value of ores such as malachite.

Metallurgy

Null mutants die at an early gestational age (embryonic day 11.5). By investigating hypomorphic mutants (which can survive 2 days longer), it was found that placental defects were primarily lethal and that there were also defects in cardiac and hepatic development, but many other organs were normal

Gene expression + Signal Transduction

E.coli are shown to be more sensitive to accumulations of guanosine tetraphosphate than guanosine pentaphosphate. A complete absence of (p)ppGpp causes multiple amino acid requirements, poor survival of aged cultures, aberrant cell division, morphology, and immotility, as well as being locked in a growth mode during entry into starvation.

Gene expression + Signal Transduction

Twenty-three out of 25 patients showed high expression of SFRP1 mRNA in leiomyoma than the matched normal myometrium. During the menstrual cycle, the level of SFRP1 mRNA in leiomyoma was highest in the follicular phase. Gonadotropin releasing hormone analogue (GnRHa) decreases estrogen secretion from the ovary. Patients treated with (GnRHa) presurgically showed the lowest expression of SFRP1 in both myometrial and leiomyoma tissues. These findings suggest that SFRP1 could be under the control of estrogen. Gene expression of estrogen receptors in leiomyomas is stronger than that in the myometrium. This suggests that leiomyoma possess increased sensitivity to E2 (estradiol, a form of estrogen) and the estrogen-dependent expression of SFRP1 in leiomyoma could be associated with the growth and pathogenesis of leiomyoma.

Gene expression + Signal Transduction

The journal included reviews of research, books, and academic conferences, as well as primary results in the form of brief reports. It also reviewed what it considered to be notable aspects of patents and relevant scientific literature. Occasionally articles on the history, geological occurrences, and exploitation of platinum group metals were also published.

Metallurgy

S. pneumoniae is human pathogenic bacterium in which the process of genetic transformation was first described in the 1930s. In order for a bacterium to take up exogenous DNA from its surroundings, it must become competent. In S. pneumoniae, a number of complex events must occur to achieve a competent state, but it is believed that quorum sensing plays a role. Competence stimulating peptide (CSP) is a 17-amino acid peptide autoinducer required for competency and subsequent genetic transformation. CSP is produced by proteolytic cleavage of a 41-amino acid precursor peptide (ComC); is secreted by an ABC transporter (ComAB); and is detected by a sensor kinase protein (ComD) once it has reached a threshold concentration. Detection is followed by autophosphorylation of ComD, which in turn, phosphorylates ComE. ComE is a response regulator responsible for activating transcription of comX, the product of which is required to activate transcription of a number of other genes involved in the development of competence.

Gene expression + Signal Transduction

Acute lymphoblastic leukemia (ALL) is a blood cancer of malignant B lymphocytes (termed B-cell ALL) or T lymphocytes (termed T-cell ALL) that typically occurs in infants and young children. In a three population-representative cohort study, NUTM1 gene rearrangements (i.e. fusion genes) occurred in 0.28 to 0.86% of pediatric patients with B-cell ALL. Among a total of 71 NUTM1-rearranged cases, 10 fusion partners of NUTM1 were identified: ACIN1-NUTM1 (24 cases), BRD9-NUTM1 (10 cases), CUX1-NUTM1 (15 cases), ZNF618-NUTM1 (9 cases; ZNF618 is the zinc finger protein 618 gene) fusion genes, and (in 1 to 4 cases each) AFF1-NUTM1, C17orf78-NUTM1 (C17orf78 is also termed ATAD5), CHD4-NUTM1, RUNX1-NUTM1, IKZF1-NUTM1, and SLC12A6-NUTM1 fusion genes. Individuals with these NUTM1 fusion gene-associated leukemias had appreciably better prognoses than those who had NUTM1 fusion gene negative B-cell acute lymphoblastic leukemias. It is thought that the cited fusion genes contribute to the development and/or progression of these NUTM1 fusion gene-associated ALL cases but the molecular mechanism(s) for this is unknown. Some HOXA genes, particularly HOXA9, are upregulated in these NUTM1 fusion gene-associated ALL cases as well as in cases of NUTM1 fusion gene-negative ALL. Further studies are required to determine if the overexpression of one or more HOXA genes contributes to NUTM1 fusion gene-associated B-cell ALL.

Gene expression + Signal Transduction

The IX Brigade, led by Okladnikov, worked in the Greater Balkan region of Turkmenistan, and in the plateau of Krasnovodsk. The finds at the Jebel rock shelter site near the Caspian Sea on the southwestern end of the Uly Balkan massif was a stratigraphic sequence of Mesolithic and Neolithic deposits, considered a model for the Turkmenistan Caspian Mesolithic period. Two other sites, located in the southern escarpments of the Greater Balkan, were examined in great detail by G. E. Markov of Moscow State University; these were the Mesolithic sites of Dam-Dam Cheshme 1 and 2. The XIV Brigade occurred in 1952 and researched primitive settled-agriculturalist settlement attributed to the Copper and Bronze periods.

Metallurgy

The earliest recorded metal employed by humans appears to be gold, which can be found free or "native". Small amounts of natural gold have been found in Spanish caves dating to the late Paleolithic period, 40,000 BC. Silver, copper, tin and meteoric iron can also be found in native form, allowing a limited amount of metalworking in early cultures. Early metallurgy using native copper is documented at sites in Anatolia and at the site of Tell Maghzaliyah in Iraq, dating from the 7th/6th millennia BC. Certain metals, such as tin, lead, and copper can be recovered from their ores by simply heating the rocks in a fire or blast furnace in a process known as smelting. The first evidence of copper smelting, dating from the 6th millennium BC, has been found at archaeological sites in Majdanpek, Jarmovac and Pločnik, in present-day Serbia. The site of Pločnik has produced a smelted copper axe dating from 5,500 BC, belonging to the Vinča culture. The Balkans and adjacent Carpathian region were the location of major Chalcolithic cultures including Vinča, Varna, Karanovo, Gumelnița and Hamangia, which are often grouped together under the name of Old Europe. The Carpatho-Balkan region has been described as earliest metallurgical province in Eurasia, with a scale and technical quality of metal production in the 6th-5th millennia BC that totally overshadows that of any other contemporary production centre. The earliest documented use of lead (possibly native or smelted), dating from the 6th millennium BC, is from the late Neolithic settlements of Yarim Tepe and Arpachiyah in Iraq. The artifacts suggest that lead smelting may have predated copper smelting. Copper smelting is documented at sites in Anatolia and at the site of Tal-i Iblis in southeastern Iran from c. 5000 BC. Copper smelting is first documented in the Delta region of northern Egypt in c. 4000 BC, associated with the Maadi culture. This represents the earliest evidence for smelting in Africa. The Varna Necropolis, Bulgaria, is a burial site located in the western industrial zone of Varna, approximately 4 km from the city centre, internationally considered one of the key archaeological sites in world prehistory. The oldest gold treasure in the world, dating from 4,600 BC to 4,200 BC, was discovered at the site. The gold piece dating from 4,500 BC, found in 2019 in Durankulak, near Varna is another important example. Other signs of early metals are found from the third millennium BC in Palmela, Portugal, Los Millares, Spain, and Stonehenge, United Kingdom. The precise beginnings, however, have not be clearly ascertained and new discoveries are both continuous and ongoing. In approximately 1900 BC, ancient iron smelting sites existed in Tamil Nadu. In the Near East, about 3,500 BC, it was discovered that by combining copper and tin, a superior metal could be made, an alloy called bronze. This represented a major technological shift known as the Bronze Age. The extraction of iron from its ore into a workable metal is much more difficult than for copper or tin. The process appears to have been invented by the Hittites in about 1200 BC, beginning the Iron Age. The secret of extracting and working iron was a key factor in the success of the Philistines. Historical developments in ferrous metallurgy can be found in a wide variety of past cultures and civilizations. This includes the ancient and medieval kingdoms and empires of the Middle East and Near East, ancient Iran, ancient Egypt, ancient Nubia, and Anatolia in present-day Turkey, Ancient Nok, Carthage, the Greeks and Romans of ancient Europe, medieval Europe, ancient and medieval China, ancient and medieval India, ancient and medieval Japan, amongst others. Many applications, practices, and devices associated or involved in metallurgy were established in ancient China, such as the innovation of the blast furnace, cast iron, hydraulic-powered trip hammers, and double acting piston bellows. A 16th century book by Georg Agricola, De re metallica, describes the highly developed and complex processes of mining metal ores, metal extraction, and metallurgy of the time. Agricola has been described as the "father of metallurgy".

Metallurgy

Ferroxyl indicator is a solution containing potassium hexacyanoferrate(III) and phenolphthalein. It turns blue in the presence of Fe ions, and pink in the presence of hydroxide ions. It can be used to detect metal oxidation, and is often used to detect rusting in various situations. It can be prepared by dissolving 10g sodium chloride and 1g potassium hexacyanoferrate(III) in distilled water, adding 10 cm phenolphthalein indicator, then making up to 500 cm with distilled water.

Metallurgy

Besides the smelters named so far, the BBOC has been licensed to the operators of the Trail smelter in British Columbia, the Belledune smelter in New Brunswick, the Noyelles Godault smelter in France, the Korea Zinc zinc smelter in Onsan, South Korea, and the lead smelter at Chanderiya in India.

Metallurgy

Thermocouples ideally should be very simple measurement devices, with each type being characterized by a precise curve, independent of any other details. In reality, thermocouples are affected by issues such as alloy manufacturing uncertainties, aging effects, and circuit design mistakes/misunderstandings.

Metallurgy

In addition to treating copper concentrates, ISASMELT furnaces have also been built to treat secondary (scrap) copper materials.

Metallurgy

It is known through early Spanish accounts that native Ecuadorians used balsa rafts fitted with sails to travel along the northern Andean coast to trade. Indeed, the first king of Lambayeque, where axe-monies are known to have been manufactured, is said in ethnohistorical accounts to have arrived in the city by raft. The Chincha of Peru and Manteño of Ecuador in particular are good candidates for the origin many of these traders. Furthermore, there is solid archaeological evidence for the trade of Spondylus shells, which can be gathered between the Gulf of Guayaquil in Ecuador and the Gulf of Mexico, in the Andean highlands during the Chavín culture. Furthermore, contemporary accounts from the Balsas River in western Mexico report that the fathers and grandfathers of local men had traded with canoe-borne traders, who sometimes spent as long as half a year in the area. However, there is as yet no firm archaeological evidence of the presence of either Ecuadorians in Mexico or vice versa. This trading system was therefore ancient; it is suggested by Dewan and Hosler that these traders operated along the Andean coast from Colombia in the north to Chile in the south as early as 100 BCE. Using mathematical models, they demonstrate that it is hypothetically possible for balsa rafts to sail not just along coastal routes, but in the open ocean between Ecuador and Michoacán. An earlier proposal for the route by Coe suggest a more coastal route for trade. Hosler suggests that traders from South America introduced metallurgical techniques into western Mexico in two waves. First between and 1250 CE, and second between c. 1250 and the Spanish conquest. It was during the second period that axe-monies are found in western Mexico, though antecedent forms are found in contexts dated as early as 800 CE in Ecuador. Yet while both South American traditions were influential in western Mexico, idiomatic traits and styles arose in the region, growing out of the imported traditions.

Metallurgy

The main application of Ellingham diagrams is in the extractive metallurgy industry, where it helps to select the best reducing agent for various ores in the extraction process, purification and grade setting for steel manufacturing. It also helps to guide the purification of metals, especially the removal of trace elements. The direct reduction process for making iron rests firmly on the guidance of Ellingham diagrams, which show that hydrogen by itself can reduce iron oxides to the metal.

Metallurgy

Intermetallic compounds are generally brittle at room temperature and have high melting points. Cleavage or intergranular fracture modes are typical of intermetallics due to limited independent slip systems required for plastic deformation. However, there are some examples of intermetallics with ductile fracture modes such as Nb–15Al–40Ti. Other intermetallics can exhibit improved ductility by alloying with other elements to increase grain boundary cohesion. Alloying of other materials such as boron to improve grain boundary cohesion can improve ductility in many intermetallics. They often offer a compromise between ceramic and metallic properties when hardness and/or resistance to high temperatures is important enough to sacrifice some toughness and ease of processing. They can also display desirable magnetic and chemical properties, due to their strong internal order and mixed (metallic and covalent/ionic) bonding, respectively. Intermetallics have given rise to various novel materials developments. Some examples include alnico and the hydrogen storage materials in nickel metal hydride batteries. NiAl, which is the hardening phase in the familiar nickel-base super alloys, and the various titanium aluminides have also attracted interest for turbine blade applications, while the latter is also used in very small quantities for grain refinement of titanium alloys. Silicides, inter-metallic involving silicon, are utilized as barrier and contact layers in microelectronics.

Metallurgy

Compacted oxide layer glaze describes the often shiny, wear-protective layer of oxide formed when two metals (or a metal and ceramic) are slid against each other at high temperature in an oxygen-containing atmosphere. The layer forms on either or both of the surfaces in contact and can protect against wear.

Metallurgy

Metals such as aluminum naturally form a passivating oxide layer which provides moderate protection against corrosion. The layer is strongly adherent to the metal surface, and it will regrow quickly if scratched off. In conventional anodizing, this layer of oxide is grown on the surface of the metal by the application of electrical potential, while the part is immersed in an acidic electrolyte. In plasma electrolytic oxidation, higher potentials are applied. For example, in the plasma electrolytic oxidation of aluminum, at least 200 V must be applied. This locally exceeds the dielectric breakdown potential of the growing oxide film, and discharges occur. These discharges result in localized plasma reactions, with conditions of high temperature and pressure which modify the growing oxide. Processes include melting, melt-flow, re-solidification, sintering and densification of the growing oxide. One of the most significant effects, is that the oxide is partially converted from amorphous alumina into crystalline forms such as corundum (α-AlO) which is much harder. As a result, mechanical properties such as wear resistance and toughness are enhanced.

Metallurgy

Often referred to as a bearing heater, the mains frequency unit employs standard transformer principles for its operation. An internal winding is wound around a laminated core similar to a standard mains transformer. The core is then passed through the work-piece and when the primary coil is energised, a magnetic flux is created around the core. The work-piece acts as a short circuit secondary of the transformer created, and due to the laws of induction, a current flows in the work-piece and heat is generated. The core is normally hinged or clamped in some way to allow loading or unloading, which is usually a manual operation. To cover variations in part diameter, the majority of units will have spare cores available which help to optimise performance. Once the part is heated to the correct temperature, assembly can take place either by hand or in the relevant jig or machine press.

Metallurgy

Besides the ex vivo approach by the City of Hope National Medical Center discussed above, the Center for Infection and Immunity Amsterdam (CINIMA), the University of Amsterdam, the Netherlands, is extensively researching the composition of multi-cassette DNA constructs to tackle HIV.

Gene expression + Signal Transduction

The pillar was installed as a trophy in building the Quwwat-ul-Islam mosque and the Qutb complex by Sultan Iltutmish in the 13th century. Its original location, whether on the site itself or from elsewhere, is debated. According to the inscription of king Chandra, the pillar was erected at Vishnupadagiri (Vishnupada). J. F. Fleet (1898) identified this place with Mathura, because of its proximity to Delhi (the find spot of the inscription) and the citys reputation as a Vaishnavite pilgrimage centre. However, archaeological evidence indicates that during the Gupta period, Mathura was a major centre of Buddhism, although Vaishnavism may have existed there. Moreover, Mathura lies in plains, and only contains some small hillocks and mounds: there is no true giri' (hill) in Mathura. Based on paleographic similarity to the dated inscriptions from Udayagiri, the Gupta-era iconography, analysis of metallurgy and other evidence, Meera Dass and R. Balasubramaniam (2004) theorized that the iron pillar was originally erected at Udayagiri. According to them, the pillar, with a wheel or discus at the top, was originally located at the Udayagiri Caves. This conclusion was partly based on the fact that the inscription mentions Vishnupada-giri (IAST: Viṣṇupadagiri, meaning "hill with footprint of Viṣṇu"). This conclusion was endorsed and elaborated by Michael D. Willis in his The Archaeology of Hindu Ritual, published in 2009. The key point in favour of placing the iron pillar at Udayagiri is that this site was closely associated with Chandragupta and the worship of Vishnu in the Gupta period. In addition, there are well-established traditions of mining and working iron in central India, documented particularly by the iron pillar at Dhar and local place names like Lohapura and Lohangī Pīr (see Vidisha). The king of Delhi, Iltutmish, is known to have attacked and sacked Vidisha in the thirteenth century and this would have given him an opportunity to remove the pillar as a trophy to Delhi, just as the Tughluq rulers brought Asokan pillars to Delhi in the 1300s.

Metallurgy

In aluminium alloys containing magnesium, magnesium oxides (MgO), cuboids (MgAlO-cuboid) and metallurgical spinel (MgAlO-spinel) can form. They result from the reaction between magnesium and oxygen in the melt. More of them will form with time and temperature. Spinel can be highly detrimental because of its big size and high hardness.

Metallurgy

This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signalling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), GM-CSF, and interferon-gamma (IFN-γ). The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-γ action, which is required for normal postnatal growth and survival. Several recent viral studies have shown that viral genes, such as Tax gene product (Tax), encoded by HTLV-1, could hijack SOCS1 to inhibit host antiviral pathways, as a strategy to evade host immunity.

Gene expression + Signal Transduction

In the arts, silicon carbide is a popular abrasive in modern lapidary due to the durability and low cost of the material. In manufacturing, it is used for its hardness in abrasive machining processes such as grinding, honing, water-jet cutting and sandblasting. SiC provides a much sharper and harder alternative for sand blasting as compared to aluminium oxide. Particles of silicon carbide are laminated to paper to create sandpapers and the grip tape on skateboards. In 1982 an exceptionally strong composite of aluminium oxide and silicon carbide whiskers was discovered. Development of this laboratory-produced composite to a commercial product took only three years. In 1985, the first commercial cutting tools made from this alumina and silicon carbide whisker-reinforced composite were introduced into the market.

Metallurgy

At low temperatures, some metals can undergo a ductile-brittle transition which makes the material brittle and could lead to catastrophic failure during operation. This temperature is commonly called a ductile-brittle transition temperature or embrittlement temperature. Research has shown that low temperature embrittlement and brittle fracture only occurs under these specific criteria: # There is enough stress to nucleate a crack. # The stress at the crack exceeds a critical value that will open up the crack (also known as Griffith's criterion for crack opening). # High resistance to dislocation movement. # There should be a small amount of viscous drag of dislocation to ensure opening of crack. All metals can fulfill criteria 1, 2, 4. However, only BCC and some HCP metals meets the third condition as they have high Peierls barrier and strong energy of elastic interaction of dislocation and defects. All FCC and most HCP metals have low Peierls barrier and weak elastic interaction energy. Plastics and rubbers also exhibit the same transition at low temperatures. Historically, there are multiple instances where people are operating equipment at cold temperatures that led to unexpected, but also catastrophic, failure. In Cleveland in 1944, a cylindrical steel tank containing liquefied natural gas ruptured because of its low ductility at the operating temperature. Another famous example was the unexpected fracture of 160 World War II liberty ships during winter months. The crack was formed at the middle of the ships and propagated through, breaking the ships in half quite literally.

Metallurgy

For the creation of dies for producing jewelry and badges, or blanking and piercing (through use of a pancake die) by the coinage (stamping) process, the positive master may be made from sterling silver, since (with appropriate machine settings) the master is significantly eroded and is used only once. The resultant negative die is then hardened and used in a drop hammer to produce stamped flats from cutout sheet blanks of bronze, silver, or low proof gold alloy. For badges these flats may be further shaped to a curved surface by another die. This type of EDM is usually performed submerged in an oil-based dielectric. The finished object may be further refined by hard (glass) or soft (paint) enameling, or electroplated with pure gold or nickel. Softer materials such as silver may be hand engraved as a refinement.

Metallurgy

Bainite is a plate-like microstructure that forms in steels at temperatures of 125–550 °C (depending on alloy content). First described by E. S. Davenport and Edgar Bain, it is one of the products that may form when austenite (the face-centered cubic crystal structure of iron) is cooled past a temperature where it is no longer thermodynamically stable with respect to ferrite, cementite, or ferrite and cementite. Davenport and Bain originally described the microstructure as being similar in appearance to tempered martensite. A fine non-lamellar structure, bainite commonly consists of cementite and dislocation-rich ferrite. The large density of dislocations in the ferrite present in bainite, and the fine size of the bainite platelets, makes this ferrite harder than it normally would be. The temperature range for transformation of austenite to bainite (125–550 °C) is between those for pearlite and martensite. In fact, there is no fundamental lower limit to the bainite-start temperature. When formed during continuous cooling, the cooling rate to form bainite is more rapid than that required to form pearlite, but less rapid than is required to form martensite (in steels of the same composition). Most alloying elements will retard the formation of bainite, though carbon is the most effective in doing so. Aluminium or cobalt are exceptions in that they can accelerate the decomposition of austenite and raise the transformation temperature. The microstructures of martensite and bainite at first seem quite similar, consisting of thin plates which in low-alloy steels cluster together. This is a consequence of the two microstructures sharing many aspects of their transformation mechanisms. However, morphological differences do exist that require a transmission electron microscope to see. Under a light microscope, the microstructure of bainite appears darker than untempered martensite because the bainite has more substructure. The hardness of bainite can be between that of pearlite and untempered martensite in the same steel hardness. The fact that it can be produced during both isothermal or continuous cooling is a big advantage, because this facilitates the production of large components without excessive additions of alloying elements. Unlike martensitic steels, alloys based on bainite often do not need further heat treatment after transformation in order to optimise strength and toughness.

Metallurgy

Ribosomal frameshifting may be controlled by mechanisms found in the mRNA sequence (cis-acting). This generally refers to a slippery sequence, a RNA secondary structure, or both. A −1 frameshift signal consists of both elements separated by a spacer region typically 5–9 nucleotides long. Frameshifting may also be induced by other molecules which interact with the ribosome or the mRNA (trans-acting).

Gene expression + Signal Transduction

Froth flotation is a process for separating minerals from gangue by exploiting differences in their hydrophobicity. Hydrophobicity differences between valuable minerals and waste gangue are increased through the use of surfactants and wetting agents. The flotation process is used for the separation of a large range of sulfides, carbonates and oxides prior to further refinement. Phosphates and coal are also upgraded (purified) by flotation technology. "Grade-recovery curves" are tools for weighing the trade-off of producing a high grade of concentrate vs cost. These curves only compare the grade-recovery relations of a specific feed grade and feed rate.

Metallurgy

In the late 1950s and early 1960s, the French molecular biologists François Jacob and Jacques Monod became the first to explain enzyme induction, in the context of the lac operon of Escherichia coli. In the absence of lactose, the constitutively expressed lac repressor protein binds to the operator region of the DNA and prevents the transcription of the operon genes. When present, lactose binds to the lac repressor, causing it to separate from the DNA and thereby enabling transcription to occur. Monod and Jacob generated this theory following 15 years of work by them and others (including Joshua Lederberg), partially as an explanation for Monod's observation of diauxie. Previously, Monod had hypothesized that enzymes could physically adapt themselves to new substrates; a series of experiments by him, Jacob, and Arthur Pardee eventually demonstrated this to be incorrect and led them to the modern theory, for which he and Jacob shared the 1965 Nobel Prize in Physiology or Medicine (together with André Lwoff). * Aryl hydrocarbon receptor

Gene expression + Signal Transduction