Upload 1006 files to data/part_5

data/part_5/0011b9bd7dd8425824031da092b92fd4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0011b9bd7dd8425824031da092b92fd4","source":"gardian_index","url":"https://data.worldagroforestry.org/api/access/datafile/:persistentId/?persistentId=doi:10.34725/DVN/JDLCYF/JATLMK"},"pageCount":1,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"d2bdf310-d1b5-4161-a650-f808abc908bb","abstract":"Whilst utmost care has been taken by the World Agroforestry Centre and data authors while collecting and compiling the data, the data is however offered \"as is\" with no express or implied warranty. In no event shall the data authors, the World Agroforestry Centre, or relevant funding agencies be liable for any actual, incidental or consequential damages arising from use of the data.By using the World Agroforestry Centre Dataverse, the user expressly acknowledges that the Data may contain some nonconformities, defects, or errors. No warranty is given that the data will meet the user's needs or expectations or that all nonconformities, defects, or errors can or will be corrected. The user should always verify actual data; therefore the user bears all responsibility in determining whether the data is fit for the user's intended use."}

data/part_5/002de7f7b90d32ea37ceb705eb825f45.json

@@ -0,0 +1 @@
+{"metadata":{"id":"002de7f7b90d32ea37ceb705eb825f45","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ba30332b-6fe0-4d19-bdde-4b8d1234a99e/retrieve"},"pageCount":35,"title":"Toolkit for Facilitating Learning Alliance and other multi-stakeholder platforms","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":163,"text":"Agricultural research projects are increasingly required to go beyond research outputs to generate positive impacts for farmers and farming communities. Thus, engaging networks of people that can catalyze learning across stakeholder groups has been tested as an approach to achieve this. The engagement can be through varied platforms aimed at an effective embedding of new processes and technologies (practices and tools) that are scientifically proven in farming communities (Boogard et al 2013, Waters-Bayer et al 2015). In this context, multi-stakeholder engagement supports local innovation processes that stimulate the use of suitable technologies derived from research. This not only enhances the technologies' spread across geographic regions, but also provides interconnection with varied social arrangements and policies that more easily enable their use. This process of engaging networks of diverse stakeholders is not easy or straightforward. Dealing with complexities of human and ecological conditions requires a facilitator that can enable the group to implement learning activities and allow that learning to be shared across groups."}]},{"head":"Rationale","index":2,"paragraphs":[{"index":1,"size":65,"text":"Technological change, particularly in food systems, is an intricate and dynamic process. It requires change across varied groups from farmers to networks of stakeholders. It also requires adjustments in behaviors and processes as well as tools and techniques. Thus, it brings together a network of different stakeholders that is focused on learning about the changes. Such a network can be termed a Learning Alliance (LA)."},{"index":2,"size":97,"text":"LAs require buy-in to a process that is complex in its entirety but which must be simple in its implementation. Commitment to the process is vital, but few participants will commit to it in its entirety, preferring instead to focus on parts that seem most important to them. Therefore, they need to see the importance of their role within the overall LA process. It is also important to encourage the group to have space for tackling different types of learning topics that are of interest. This requires different methods to allow the group to capture the learning."}]},{"head":"The toolkit","index":3,"paragraphs":[{"index":1,"size":30,"text":"The toolkit is designed to provide facilitators and members of the LA or a multistakeholder platform with some guidance and tools that can help with supporting learning within a network."},{"index":2,"size":22,"text":"The toolkit is organized into two main sections to help navigate through the complex processes that together drive progress through the LA:"},{"index":3,"size":26,"text":"A. The LA roadmap, which outlines the entire process and provides an explanation of why it is important to drive actors through the Theory of Change."},{"index":4,"size":183,"text":"B. The methods, which include practically-oriented activities that organizers within the LA can use to accelerate change and link it to the research. Six main sections relate to: 1. Initiation, which includes assessment that is needed for forming the network. 2. Engagement, which generates interest and provides guidance on how to select priority learning topics. 3. Identifying priorities, which enables groups to form consensus on priority topics of interest. 4. Creating and sharing value, which is most needed when the process has progressed and the network has started learning activities. The suggested methods enable the groups to find and assess tools, practices, processes, and social arrangements creating value that, in turn, support further adoption of the technologies. 5. Social learning from on-farm experiments and use of data ensure that learning from farm trials is captured and shared across the network. 6. Learning about institutional change facilitates engagement for learning about the social context around the technologies. The methods presented address a specific purpose. Thus, the method finally selected is related to the objective needed for the learning target as planned by the facilitator."}]},{"head":"The LA roadmap","index":4,"paragraphs":[]},{"head":"Building upon IRRI's work on LA","index":5,"paragraphs":[{"index":1,"size":55,"text":"The drive behind this toolkit is to communicate methods and processes by which a facilitator of the LA can draw upon to support learning processes within a network. Practical insights from LAs that the International Rice Research Institute (IRRI) through the Closing Rice Yield Gaps (CORIGAP) and Sustainable Intensification Innovation Lab (SIIL)-Polder projects are shared."}]},{"head":"Why LAs are so important to the Asian Mega Deltas Initiative","index":6,"paragraphs":[{"index":1,"size":89,"text":"The toolkit is prepared with a view to provide resource materials to support the formation, organization, development, and function of LAs within the Asian Mega Deltas (AMD) Initiative. AMD tackles complex and urgent problems in deltas caused by a combination of climate change, natural resource mis-use, and adverse-development trajectories. Adaptation is vital, but solutions require insights from many different fields. Full solutions need to be crafted with and by the people who implement them. They alone experience the complex mix of influences to identify specific combinations of partial solutions."}]},{"head":"Iterative learning process","index":7,"paragraphs":[{"index":1,"size":48,"text":"While the facilitator and those in the network may have a vision of success and motivation to learn together, they also require a process for this learning. The LA is characterized by iterative learning, i.e., continuous learning built upon what was learned in a previous cycle (Fig. 1)."}]},{"head":"A vision for change: theory of change","index":8,"paragraphs":[{"index":1,"size":37,"text":"To anchor the goals of the LA, the theory of change for the AMDs is outlined in Table 1. The LA process is general, but the desired outcomes are specific to the problems faced in the AMDs."},{"index":2,"size":133,"text":"Work packages under the AMD initiative implement various research activities on food system adaptation. The work package used here is focused on adapting deltaic production systems and will implement research on potential production practices that address climate risks and limit impacts to the environment (i.e., reducing the carbon footprint, addressing climate mitigation). The skill in designing the work package ensures that the activities within it deliver science-based outputs that recognize the specific nature of the problems and substantially increase the scale and relevance of identifiable outcomes. The LA can be a platform for bringing in the insights from this research that enables further learning through a participatory manner and then aligning the learning on the farm with those of other stakeholders. The learning that is targeted includes farm as well as socio-technical aspects."}]},{"head":"First analysis","index":9,"paragraphs":[]},{"head":"Follow-up analysis","index":10,"paragraphs":[{"index":1,"size":4,"text":"Discuss with field managers  "}]},{"head":"Methods","index":11,"paragraphs":[{"index":1,"size":36,"text":"The sections below provide a selection of 16 methods across six activities that coordinators and organizers of LAs can use to enhance change. They are intended to be illustrative. Additional methods can be included after review."}]},{"head":"Initiation: What is the objective of the LA?","index":12,"paragraphs":[{"index":1,"size":41,"text":"Starting the LA requires clarifying the purpose of bringing together a multi-stakeholder group for learning activities. This enables a buy-in from the potential members of the group because their needs and priority topics are being discussed and addressed by the network."},{"index":2,"size":55,"text":"Defining the core objective of the LA requires an (1) initial broad topic of interest, (2) a potential geographic scope or context, and (3) a method to rapidly obtain perspectives from key stakeholders relating to this topic. A Needs Assessment or a Strengths, Weaknesses, Opportunities, and Threats (SWOT) Analysis could be used for rapid appraisal."},{"index":3,"size":38,"text":"The insights from the rapid appraisal can help facilitators of an LA to explain why they are bringing together a multi-stakeholder network. More importantly, the co-design process encourages potential members of an LA to be interested in participating."}]},{"head":"Method 1. Needs assessment","index":13,"paragraphs":[{"index":1,"size":41,"text":"Needs assessment enables the researcher/facilitator to explore the topic and obtain perspectives relating to the needs of stakeholders. It is a group-discussion method used to obtain information on key issues relating to a broad topic of interest. The key steps are:"}]},{"head":"Preparation","index":14,"paragraphs":[{"index":1,"size":33,"text":"Identify a broad topic of interest (e.g., experience and strategies to adapt food systems to climate change) and the context in which to tackle it (e.g., at the farming-community level or national level)."},{"index":2,"size":69,"text":"Prepare a guide or set of questions to ask in relation to the broad topic. This should allow stakeholders to describe the current conditions as well as issues or needs that they see in relation to the topic (e.g., for food-systems adaptation, start with what they currently experience in relation to climate change, then discuss the current food-production systems and cropping patterns, then go into the constraints they experience)."}]},{"head":"Selection of participants","index":15,"paragraphs":[{"index":1,"size":65,"text":"The participants do not need to be many (8 to 10 people per group discussion) but they must represent diverse stakeholders in the identified context who can talk about the topic of interest. For example, in a community-level discussion, they could be village leaders, women representatives, key farmers, or service-sector actors. Having more diverse participants can allow for various perspectives and needs to be discussed."}]},{"head":"Facilitating the group discussion","index":16,"paragraphs":[{"index":1,"size":61,"text":"Start the discussion by explaining the broad topic and why there is interest in it. Go through the questions and document the answers from the group. Ensure that the participants are afforded time to share their perspectives. At the end of the discussion, focus on the needs and allow participants to prioritize the key needs. These are potential topics of interest."}]},{"head":"Method 2. SWOT analysis","index":17,"paragraphs":[{"index":1,"size":32,"text":"The SWOT analysis enables the researcher/facilitator to narrow down into the current strategies the advantages of these, and then the constraints, potential opportunities for change, and threats around the topic of interest."}]},{"head":"Preparation","index":18,"paragraphs":[{"index":1,"size":34,"text":"Identify the starting point of the discussion. Usually, the discussion in a SWOT analysis will focus on strategies or activities (e.g., what they currently do within their food system to manage droughts and floods)."},{"index":2,"size":12,"text":"Have on hand materials for listing strategies, strengths, weaknesses, opportunities, and threats."}]},{"head":"Selection of participants","index":19,"paragraphs":[{"index":1,"size":23,"text":"The participants in a SWOT analysis can be experts or key stakeholders who have in-depth knowledge of the food system and the community."}]},{"head":"Facilitating the group discussion","index":20,"paragraphs":[{"index":1,"size":92,"text":"Open the discussion on the current strategies that the participants do or have done. Then list and discuss the strengths (good points or benefits) from these strategies. Discuss the weaknesses or constraints that prevent the community or system from benefiting from these. Following that, list and discuss the opportunities within the food system in relation to the current strategies, considering the good points and the constraints. These opportunities could relate to policy or a broader context or opportunities in the community, group, or individuals (e.g., available technologies and existing industries and markets)."},{"index":2,"size":68,"text":"The group then lists and discusses the risks that could prevent change or benefits from the strategies identified. At the end of the discussion, the group can prioritize key strategies that are of interest (have benefits and identify opportunities that could speed up implementation of the strategies). Also, considering the weaknesses and risks, they can identify other strategies of interest. These can be potential topics of the LA."}]},{"head":"Engagement","index":21,"paragraphs":[{"index":1,"size":30,"text":"Who needs to be engaged? Once the general objective of bringing together a multistakeholder network is defined, it is time to understand who should be a part of that network."},{"index":2,"size":69,"text":"From the key informants of experts who were part of the Needs Assessment or SWOT, an initial list of relevant stakeholders could be made. These initial stakeholders can then be brought together to think more in-depth about who needs to be engaged in the LA through Stakeholder Analysis and Network Mapping. These methods allow the participants in a workshop to identify and characterize the stakeholders and potential LA members."}]},{"head":"Method 3. Stakeholder analysis","index":22,"paragraphs":[{"index":1,"size":36,"text":"A stakeholder analysis allows a group of participants to consider in a more detailed manner who should be part of the network based on potential interest to join as well as the stakeholders' level of influence."}]},{"head":"Preparation and selection of stakeholders to include in starting the network","index":23,"paragraphs":[{"index":1,"size":45,"text":"This method can take off from the rapid appraisal by asking key participants to list potential stakeholders. From this list, representative stakeholders can then be invited to a workshop. Sheets of Manila paper for the grid, markers, and post-it notes are needed for this activity."}]},{"head":"Facilitating the group discussion","index":24,"paragraphs":[{"index":1,"size":73,"text":"With the participants, explain the results of the rapid appraisal, the potential LA, and the main objectives for it. Then proceed to expand the list of relevant stakeholders. Think not only of who is interested but also who may not be interested but will be affected or need to be involved for change to happen. Once the list is complete, write each name on a postit note (one group or individual per note)."},{"index":2,"size":61,"text":"After this, explain how some stakeholders have more power or influence to enable change in the system compared with others. These stakeholders also have a specific interest to join an LA. Introduce the grid (low to high influence, low to high interest; see Fig. 2). As a group, discuss the influence of each and put each stakeholder post-it under the grid."},{"index":3,"size":36,"text":"Lastly, discuss the implications in terms of involving these stakeholders that need to be \"kept satisfied,\" \"managed closely,\" \"monitored,\" or \"kept informed.\" This helps to identify who should be in the LA and in what way."}]},{"head":"Method 4. Network mapping","index":25,"paragraphs":[{"index":1,"size":37,"text":"Network mapping is a visualization method that can help representative stakeholders to identify others to involve, characterize them, and discuss the connections that these stakeholders have. This merges two types of analysis: social network and influence analysis."}]},{"head":"Preparation and selection of relevant stakeholders","index":26,"paragraphs":[{"index":1,"size":29,"text":"This method can take off from the rapid appraisal by asking key participants to list relevant stakeholders. From this list, representative stakeholders can then be invited to a workshop."},{"index":2,"size":69,"text":"A large sheet of paper for the network, markers with different colors, and post-it notes of different colors are needed for this activity. Determine the stakeholder types to identify (e.g., beneficiary/end user, extension intermediary, private sector, policy) for the post-it colors. Plan for the type of connections to document using the different colored markers (e.g., passing a product in the value chain, links for knowledge or information, regulation, funding/payments). "}]},{"head":"Facilitating the group discussion","index":27,"paragraphs":[{"index":1,"size":160,"text":"The representative stakeholders are first asked to consider the objectives of the LA and then to expand or specify the list of stakeholders (actors) that have been identified. Think not only of who is interested but also who may not be interested but will be affected or need to be involved for change to happen. Once the list is complete, identify the stakeholder type (e.g., beneficiary/end user, extension intermediary, private sector, policy). A specific color of post-it is designated for each type. Next, write the name of each actor on a post-it based on the type of stakeholder. Put the post-its on a large piece of paper, ensuring that those that have many connections are in the center of the paper. Ensure enough space in between post-it notes to allow clear drawing of the lines for the network. Be mindful that participants could make it into an organogram, but this would not be helpful to assess or map the network."},{"index":2,"size":72,"text":"Participants should further consider the network by discussing the potential interest of each actor that they identified. For each actor, describe the interest in being part of the LA. This could also be captured by simple markings on the corner of each post-it. A plus (+) mark could, for example, denote that the stakeholder would be interested to join the LA and minus (-) could mean he or she is not interested."},{"index":3,"size":69,"text":"The group then further discusses and draws arrows connecting the stakeholders. These arrows are based on the type of connection (e.g., passing or producing a product in the value chain, links for knowledge or information, regulation, funding/payments). The participants draw arrows with the arrowhead pointing to the receiver in the link. Ensure that links are drawn clearly to be able to see how each actor is linked to another."}]},{"head":"Setting priorities Method 5. Visioning","index":28,"paragraphs":[{"index":1,"size":53,"text":"To engage groups in shared learning activities, it is useful to understand what the group would like as a scenario for the future. Through this method, the facilitator can guide the group members to think about what they would like or what they see as a target of their projections for the future."}]},{"head":"Preparation","index":29,"paragraphs":[{"index":1,"size":24,"text":"This activity will start with individual brainstorming. Allow individuals time and provide a piece of paper to brainstorm their idea of that future scenario."}]},{"head":"Facilitating the group discussion","index":30,"paragraphs":[{"index":1,"size":43,"text":"The facilitator first asks the individuals to think about \"What do I want to see in my place 5-10 years from now?\" Avoid saying this is a dream because participants may become too optimistic or unrealistic in their expectations of that future scenario."},{"index":2,"size":61,"text":"To help them imagine and explicate that scenario, it could be in the context of a media interviewer coming to the area. Individuals describe what the interviewer would find there. It includes the activities and livelihoods that the people are engaged in, specific farming practices and the results, and attitudes and ways of thinking that may be different from current ones."},{"index":3,"size":47,"text":"On their own paper, individual participants will list the elements that they picture about that future scenario. Once everyone has finished, the participants can work in pairs to identify the five most important concrete elements of the vision. Their ideas will be shared in the plenary session."},{"index":4,"size":45,"text":"Together with all participants, the facilitator will group similar ideas. They will also discuss how each of these groups of vision elements relate to each other. They can summarize as one whole vision or keep them as separate elements of their shared or consolidated vision."}]},{"head":"Method 6. Prioritizing, weighting, or ranking","index":31,"paragraphs":[{"index":1,"size":67,"text":"During the discussions, there will be many ideas that the group will have to make decisions on which ones to pursue. This could be on learning topics, new linkages to make, preferred solutions to experiment on, etc. Thus, the facilitator should be able to guide the network to make decisions together on which ones to prioritize. This method can help them to facilitate prioritizing as a group."}]},{"head":"Preparation","index":32,"paragraphs":[{"index":1,"size":49,"text":"Before any prioritization exercise, the group should have a list of all potential ideas. These ideas would have been discussed and explained so that all have a basic understanding of each idea. Then, in a group meeting, the facilitator can use this list and start the discussion on prioritization."}]},{"head":"Facilitating the group discussion","index":33,"paragraphs":[{"index":1,"size":68,"text":"The first step is to reduce the list of ideas if the facilitator believes that too many may confuse the group. The entire group can discuss which ideas may be set aside for now and which ones look to be more promising. i.e., those that have a better chance of working, have resources, and can provide more benefits and best address the need. Similar ideas may be clustered."},{"index":2,"size":27,"text":"The group can decide on specific criteria to help select or set aside ideas. Examples include: most important, time needed, cost, urgency, feasibility, desirability, and next steps."},{"index":3,"size":78,"text":"From the smaller shortlist, participants can then vote. It depends on the group's desires as to how many ideas might make the final list. Participants can vote for one, two, or more ideas. Once the votes are cast, the facilitator counts the votes to determine which ideas are most popular. The group then chooses the most promising ideas (most voted), which can then be developed further. Participants can also discuss potential needs and constraints in pursuing these ideas."}]},{"head":"Method 7. Conflict resolution","index":34,"paragraphs":[{"index":1,"size":27,"text":"Within any group, there is bound to be competing interests, miscommunications, and differing opinions. There are various common strategies that can be used to manage group conflicts."}]},{"head":"Preparation","index":35,"paragraphs":[{"index":1,"size":83,"text":"In seeking to resolve conflicts, it is necessary to understand the key issues and why this conflict has emerged. It is also useful to think ahead of strategies that the group could think about to address the conflict. Among these are: • Accommodating. If there are requests within reasonable means of the LA to allow, then participants can solve the conflict by accommodating the request. • Avoiding. This happens when an issue is beyond the scope of the LA. It can also help"},{"index":2,"size":113,"text":"to acknowledge that such concerns exist and that they conflict with the perspectives of others in the network. Since there is no possibility for the LA itself to address the issue, it is best not to include it. • Compromising. This involves striking a workable balance that will be acceptable to all sides of the conflict. Those with differing perspectives may have to partially give in to allow the group to arrive at a common and workable resolution. • Collaborating. Since solutions are often not easy to find or implement, it will be an opportunity for the group to work together to find an effective solution(s) that will help to resolve the conflict."}]},{"head":"Facilitating the group discussion","index":36,"paragraphs":[{"index":1,"size":79,"text":"A first step to resolving the issue is understanding and discussing the problem within the group. It can help if participants meet on neutral ground and for the facilitator to take a neutral stance on the conflict. During the discussion, allow differing factions to state their views. Share the potential strategies to reach a resolution and allow the group to decide on the strategy. Finally, let the group agree on solutions and document these for sharing and revisiting later."}]},{"head":"Creating and sharing value","index":37,"paragraphs":[]},{"head":"Method 8. Business model canvas exercise","index":38,"paragraphs":[{"index":1,"size":96,"text":"At first glance, it might seem strange to use business modelling to help design the activities of the LA. However, the LA provides, in essence, a set of services and products that are intended to meet the needs of identifiable groups of people by means of targeted research and extension activities with partners. The process of designing products or services to meet customer needs has been used throughout the world for many different problems using the business model canvas concept (Osterwalder et al 2014). We use it here to support the design of the LA activities."},{"index":2,"size":31,"text":"The business model canvas takes the intentions for the LA, as expressed in the project theory of change, and converts them to specific actions that meet the needs of the stakeholders."},{"index":3,"size":32,"text":"The intended outcomes from both the theory of change and the business model are broadly the same. But the process of business modelling with partners tends to be more creative and stakeholder-focused."}]},{"head":"Preparation","index":39,"paragraphs":[{"index":1,"size":22,"text":"Osterwalder and Pigneur (2010, p. 248) identify five stages in the process of business model design: Mobilize, Understand, Design, Implement, and Manage."},{"index":2,"size":65,"text":"The entire process is beyond the scope of this toolkit and the purpose here is to focus on one key aspect: To understand the needs of stakeholders within the LA to ensure that the model targets specific needs. While this describes only a very small part of the entire business model design process, we expect this to help the LA deliver what its stakeholders need."},{"index":3,"size":14,"text":"At the end of this activity, we expect participants to have greater clarity about:"},{"index":4,"size":53,"text":"• The LAs different stakeholder groups. These will include the participants themselves, who are helping to deliver services from the LA, as well as \"external\" stakeholders who are targeted as users of such services. • The \"jobs they have to do' within the scope of the LA, i.e., their needs and general intentions."},{"index":5,"size":14,"text":"• The problems that the LA will reduce (including explanations how it does so)."},{"index":6,"size":17,"text":"• The gains the LA helps to create as well as the way that it does so."},{"index":7,"size":35,"text":"At the end of the exercise, participants should be able to offer the insight that the Learning Alliance provides: Services that help stakeholder groups who want to do actions by reducing problems and increasing gains."},{"index":8,"size":10,"text":"The details in bold face can be explained as follows:"},{"index":9,"size":239,"text":"• Services: What are the specific services, such as technical convening or products such as research insights or technologies that the LA provides? • Stakeholder groups: Who uses these services, as distinct from other groups? How do these stakeholder groups support change? The LA will most likely already have such groups identified and organized. They include farmer communities, policymakers, technical support, and value-chain actors or global research groups. • Actions: What actions do these groups each need to achieve to support the goals of the LA? Such actions could include testing of and investment in new farming techniques, policy guidance to accelerate adaptation to the effects of climate change, and valuechain development for high-value vegetable or fish products from the deltas. • Problems: What are the risks or barriers faced by stakeholders as they implement these actions? And how do the services provided by the LA help overcome them? For example, do investment uncertainties prevent timely adaptation and how does the LA help reduce them? How can the LA overcome communication barriers between producers and consumers? How can policy makers bridge the distinct and sometimes conflicting expectations around shared natural resources? • Gains (Fig. 3): What gains can the LA help enhance through its actions? For example, can it convene producers and traders to identify new markets? Can it bring water users together to accelerate long-term water security? How can it connect groups of farmerexperimenters to establish farmer-centric innovation?"}]},{"head":"Facilitating the group discussion","index":40,"paragraphs":[{"index":1,"size":7,"text":"The process comprises three activities (Fig. 4):"}]},{"head":"A. Profiling LA stakeholder needs","index":41,"paragraphs":[{"index":1,"size":14,"text":"Using sticky notes and an outline map of the customer profile, ask participants to:"},{"index":2,"size":82,"text":"1. Select one or two LA stakeholder groups to focus on. Work with one at a time. Ideally all stakeholder groups will be covered if several are worked on concurrently. 2. Identify all main actions that the stakeholders are trying to achieve through the LA. 3. Identify the major problems or barriers that confront them as they try to do so. 4. Identify the potential gains that the LA actions create for stakeholders. 5. Prioritize and order the actions, problems, and gains. "}]},{"head":"Gain Enhancers","index":42,"paragraphs":[]},{"head":"A. Profiling Learning Alliance Stakeholder Needs","index":43,"paragraphs":[]},{"head":"C. Comparing the 'Fit' between needs and activities B.","index":44,"paragraphs":[]},{"head":"Mapping Learning Alliance Activities","index":45,"paragraphs":[]},{"head":"B. Mapping the \"value proposition\"","index":46,"paragraphs":[{"index":1,"size":86,"text":"Using sticky notes and an outline of the value proposition, ask participants to work with the group(s) they selected above and do the following: 1. List the services (or research products) that the LA attempts to achieve for each group. 2. Outline the LA services that are intended to tackle problems. 3. Outline the LA services that aim to enhance the gains on behalf of stakeholders. 4. Rank the services, problem-reducers, and gain-enhancers by order of importance according to how essential they are to the stakeholders."}]},{"head":"C. Comparing the \"fit\"","index":47,"paragraphs":[{"index":1,"size":20,"text":"1. Review the profiles of specific LA stakeholders. If time is limited, focus on one or two stakeholder groups, recalling:"},{"index":2,"size":10,"text":"• actions they want the LA to help them achieve,"},{"index":3,"size":8,"text":"• problems that need to be tackled, and"},{"index":4,"size":17,"text":"• gains that the LA can help improve. 2. Review the LA value proposition map and recall:"},{"index":5,"size":4,"text":"• the general goals,"},{"index":6,"size":37,"text":"• the actions intended to overcome problems faced by specific stakeholders, and • the actions intended to enhance the gains sought by specific stakeholders 3. Map each action identified in (2) to the stakeholder needs from (1)."}]},{"head":"Method 9. Identifying outcomes-Linking measurable competencies to change processes","index":48,"paragraphs":[{"index":1,"size":42,"text":"Each LA will produce its own set of outcomes that reflect the situation within which it operates. The outcomes themselves are therefore difficult to compare and as a result cannot be used to manage the LA or evaluate the activities within it."}]},{"head":"The use of competency assessment (Catholic Relief Services 2021) is an attractive option for","index":49,"paragraphs":[{"index":1,"size":19,"text":"LAs because it links identifiable behaviors with the value people want to create. How can the linkage be clarified?"}]},{"head":"What changes in behaviors are desired?","index":50,"paragraphs":[{"index":1,"size":161,"text":"For some time, the outcomes of development have been recognized not as the impactssince these are often not realizable within the lifetime of the projects, but the changes in behaviors on which such impact depends. Such a move also recognizes that, while impacts are valid intentions, they are difficult to predict and even harder to attribute. So, behaviors are what we look for. The first question is: which changes in behavior do we want to see? The behaviors we want are linked to the objectives of system change. These are behaviors that help:  Organize-helping people get together and stay connected long enough to solve problems.  System analysis-recognizing system problems and opportunities. With others, work out what is happening to the system and whether this is problematic.  Change management-identifying some specific targets for change and agree how to get them. Based on what people already know, identifying some things that can be improved or that people can work towards."},{"index":2,"size":19,"text":" Dynamic system management-recognizing that the system is constantly evolving. Put into place a process of change that includes:"},{"index":3,"size":76,"text":"• Identifying \"what can change;\" • Exploring and experimenting within the resources available and instigating experiments or other cognitive processes to explore the system; • Updating beliefs-taking into account the range of perspectives by examining existing beliefs for consistency and agreeing to modify; • Bringing data into the process, where available and acquire and analyze data to understand more quickly how the system performs; and • Communicating what happened within and outside the group to support."}]},{"head":"Identifying behaviors","index":51,"paragraphs":[{"index":1,"size":25,"text":"What identifiable behaviors or actions will confirm that people demonstrate the desired competency? Table 2 shows examples to link the required competencies to observable behaviors:"},{"index":2,"size":50,"text":"Evidence can be defined for each of these behaviors and evaluated to indicate the level of competence. For example, organizational ability can be assessed by evidence of the ability to assemble, organize, and maintain LAs, with the level of competence indicated by the size, complexity, and challenges facing the organization. "}]},{"head":"Observable behaviours….","index":52,"paragraphs":[]},{"head":"Assemble","index":53,"paragraphs":[]},{"head":"Rewarding competency","index":54,"paragraphs":[{"index":1,"size":30,"text":"Why would people strive to develop the competencies needed for change to occur? Reward is necessary. Reward can take many forms: financial, social recognition, cognitive or spiritual, but must be:"},{"index":2,"size":2,"text":"• Unambiguous,"},{"index":3,"size":13,"text":"• Linked to the competency, and ��� Related logically to the \"value proposition.\""}]},{"head":"Unambiguous","index":55,"paragraphs":[{"index":1,"size":49,"text":"Some organizations tie competency development to contractual systems of financial reward. Formal contracts will be unhelpful in most LAs but people tend to tire of engagement unless the reward is clear. Periodic review of arrangements within the LA is helpful to confirm and update the appreciation of competency development."}]},{"head":"Linking rewards to competency","index":56,"paragraphs":[{"index":1,"size":53,"text":"A formal reward system needs to link the reward to the type and level of competency developed. Competency that is difficult to acquire is valued above that which is more easily acquired. Similar processes can be developed for informal rewards systems whereby communities specify that they need specific competencies to solve particular problems."}]},{"head":"Relating competency to the \"value proposition\"","index":57,"paragraphs":[{"index":1,"size":25,"text":"Arrangements for acquiring and sharing value are explained elsewhere. Here we focus on ensuring that the competencies listed are understood to help create overall value."},{"index":2,"size":62,"text":"Participants and investors expect the LA to create substantial value for participants by solving important problems or developing specific opportunities. The value can be understood in expected impacts (i.e., the capability to produce X tons per year of rice). The value could also be considered in terms of the human capital that the LA generates, identified as competency acquired to achieve impacts."},{"index":3,"size":54,"text":"The LA creates value through the actions that demonstrate competency, e.g., the capability of getting people together, understanding problems, solving problems etc. It is helpful to review this process from time to time to work out progress, obstacles, and how the people within the LA are demonstrating competency or the need to acquire it."}]},{"head":"Evaluating the benefit of science to the LA","index":58,"paragraphs":[{"index":1,"size":51,"text":"Finally, we need stakeholders to consider the role of science in the LA process. A direct benefit of doing so is that the interaction between scientists and stakeholders clarifies what science is needed to deliver the outcomes. Failure to do so may result in stakeholders' lack of confidence in the science."},{"index":2,"size":11,"text":"Some questions about the benefits of science to the LA include:"},{"index":3,"size":33,"text":"• How does scientific insight improve the overall design, function, or operation of the LA? For example, how can analysis of climate change help identify specific risks to analysis within the Learning Alliance?"},{"index":4,"size":96,"text":"• How does scientific insight or methods support specific processes within the LA? For example, how can hydrologic or agronomic methods be adopted by the actors? • Can science generate or acquire specific data to support the LA? For example, how can long-term climate data, high-resolution biomass productivity, or spatial analysis of livelihood support policy development? • How can scientific methods be converted to financial, policy, or social instruments in order to support scalable action? For example, how can data support the design of commercial financial instruments to support loans under risk within the LA region?"}]},{"head":"Social Learning through on-farm experiments and use of data","index":59,"paragraphs":[]},{"head":"Method 10. On-farm experimentation (OFE)","index":60,"paragraphs":[{"index":1,"size":42,"text":"Virtually all farmers do \"experiments.\" It is how they learn what works for them, given their preferences, interests, and resources. Such experimentation is different to that used by scientists, but the process can provide powerful support to the processes within an LA."},{"index":2,"size":64,"text":"Farmers like to try things that are close at hand, such as a new chemical or crop variety. They tend not to look at detailed results and care less about the causes of effects than their practical consequences. In farmers' hands, experimentation is a powerful \"bottom-up\" process of change that is waiting to be coupled with the \"top-down\" processes that scientists are used to."}]},{"head":"Facilitation","index":61,"paragraphs":[{"index":1,"size":88,"text":"1. Organize small groups within the LA to decide on what experiments to try and to share experience, solve problems, and scale-up insights. 2. Get farmers to work out what they want to trial and how to implement it on the ground. 3. Acquire enough data to interpret the experiment. The more the better, but at the least there should be sharable observations. 4. Collect and interpret the data, if necessary, with the support of scientists. Discuss what trial to conduct next and share results with other groups."},{"index":2,"size":37,"text":"The first goal of OFE should be to encourage farmers to explore and to increasingly adopt data-rich methods of such experimentation that provide clearer results. It is imperative not to overload farmers or to undervalue their experience."},{"index":3,"size":17,"text":"The OFE process will vary according to context. Some rules of thumb can help guide the process:"},{"index":4,"size":75,"text":"1. Keep it farmer-centric: Ask farmers what they are interested in and adjust the OFE process to meet their thinking and resources. 2. Keep it simple. OFE design should be as simple as possible. Follow an approach of progressive learning that is easy for the farmer to follow. 3. Keep the experiments relatable. As far as possible, have experiment plot size and operations that involve machinery or management practices that are familiar to the farmers."},{"index":5,"size":51,"text":"4. Keep exploring. OFE is not a \"one-off\" process but one of progressive learning and improvement. The major goal is to support progressive learning, not to arrive at \"the\" solution. 5. Keep out of the way! Understand that at certain times of the year farmers will be too busy to engage."}]},{"head":"Components of the process","index":62,"paragraphs":[{"index":1,"size":15,"text":"Experimentation is a cognitive process. The basic process tries to resolve information about three variables:"},{"index":2,"size":147,"text":"• The output or dependent variable [Y]. This is the feature that farmers believe will be affected by change. It can be crop yield, fish production, water consumption, ease of working, or product quality. • The management or control variable [X c ]. This is the variable farmers want to test. It could comprise fertilizer, irrigation, feed-rate, or timing. The logic is that a change in this will cause a change in output. • The environmental or uncontrolled variables [X u ]. These include other factors that can significantly affect the result and that may need to be considered in order to make sense of the result. These factors can include climate, soil, or disease that could seriously influence the output. Farmers can run experiments without taking account of these factors, but the inference they can make from the results improves dramatically when they are accounted for."},{"index":3,"size":18,"text":"The question that practitioners want to know is: \"What happens to the output if the control is changed?\""}]},{"head":"Experimental design, data, and analysis","index":63,"paragraphs":[{"index":1,"size":16,"text":"The design that farmers use for their OFE will determine how well it can answer questions."},{"index":2,"size":54,"text":"The better the design, the more certain the answers. Experimental components are illustrated in Table 3 Scientists are trained to work with many types of experimental design. Generally, these aim to improve the efficiency and precision of analysis. Few are practicable in OFE, which adopts very simple designs to assess-as far as practicable-the following:"},{"index":3,"size":10,"text":"• The treatment effect. \"Did it have a measurable effect?\""},{"index":4,"size":26,"text":"• Apparent variation of the treatment effect. \"How did it vary?\" • Effect of conditions. \"What was the effect of the things I could not control?\""},{"index":5,"size":42,"text":"A robust design is a simple contrast between pairs (e.g., blocks or strips). This can be improved by replication (including replication within strips) and by orienting across the principle environmental variation. More intricate designs might include blocks, strips, replicates, and so on."},{"index":6,"size":72,"text":"The quality of data and the precision of analysis that can be applied to it vary enormously from experiment to experiment. These depend mainly upon the resources dedicated to the experiment and the problem farmers want to solve. Since most farmers would not invest much until they see the value of the process, it is best to start as simple as possible and progress towards more complex ideas in response to demand."},{"index":7,"size":27,"text":"Data may include detailed quantitative crop yield measurement or high-resolution satellite imagery. Alternatively, a qualitative score may be all that farmers feel capable of at the time."},{"index":8,"size":36,"text":"Scientific support must accept these realities and work with farmers to provide the best inference.  This method brings the rigor of scientific research and then allows farmers to choose and then adjust to the selected technologies."}]},{"head":"Preparation","index":64,"paragraphs":[{"index":1,"size":60,"text":"This method could start with a needs assessment or survey and prioritization exercise to be done by farmers together with researchers. The researchers will then define a replicated experiment on the potential solutions. The farmers observe as these experiments are being implemented. At the end of the experiment, the farmers discuss and select components or technologies that they will implement."}]},{"head":"Facilitation","index":65,"paragraphs":[{"index":1,"size":79,"text":"The aim is to enable farmers and researchers to communicate with each other and learn together about the potential options (Fig. 5). The experiment is a learning tool to observe the performance of the technology and to see which components are of interest to the farmers. Once farmers observe, they will then implement their own demonstration trials to further their learning and integrate the technologies into their practice. Researchers may collect data from this to help further the learning."}]},{"head":"Rice health survey","index":66,"paragraphs":[{"index":1,"size":1,"text":"Review  "}]},{"head":"Method 12. Reflection meeting","index":67,"paragraphs":[{"index":1,"size":82,"text":"The reflection meeting is a way to allow farmers to observe more closely and explicate their feedback from experiments. This is also a way to allow the farmers who are doing the trials to share and support peer learning for those who are only observing. The farmers can be grouped either as trial cooperators (those who did the experiment on their farms, or the wife/ family of the farmer cooperator) or noncooperators (other farmers who are observing the field). See Table 4."}]},{"head":"Facilitation","index":68,"paragraphs":[{"index":1,"size":62,"text":"Start the activity by explaining the experiment and what has been done so far. Allow the cooperator-farmer to explain what he or she did on the field. Then the participants go to visit the field and observe. They then regroup for discussions. Each group will need a marker and Manila paper for documenting their discussions. A reporter is assigned for each group."},{"index":2,"size":30,"text":"For the trial cooperator group: Through plenary discussion, they then share their insights. One representative will report to both groups. During the reporting the noncooperator (observer only) group reports first."},{"index":3,"size":59,"text":"The reason is that we want to know what they have observed about the trial (they were not involved in it, so maybe they do not know or they have wrong perceptions about what was done). Then the cooperators (implementer group) report. In doing this, they can also address potential misunderstanding of wrong perceptions that the observer group had."},{"index":4,"size":27,"text":"It is also important that a technical guide or facilitator listens closely to their report to either correct misconceptions or clarify the technical details of the experiment."}]},{"head":"Method 13. Working out what data is needed: prioritization of questions","index":69,"paragraphs":[{"index":1,"size":96,"text":"Certainty analysis of the data is the objective-not the data itself. But once participants start the process, they tend to acquire more and more value from the data-so seek more. Data are increasingly available and our world is increasingly digital. Whether we appreciate it or not, data are entering virtually all aspects of our social and professional lives. Once participants start a process of data acquisition and analysis, they tend to increase it as they discover more questions for it to answer. Data and its analytics will therefore become an important part of the LA process."},{"index":2,"size":105,"text":"On the other hand, people are busy. Few will want to dedicate time and resources to this specialized area. So, the purpose here is to identify the minimum data and analytics tasks that participants feel the LA requires. All participants are asked to rank data processes that they consider essential, desirable, and optional. We consider these processes according to the need for strategic and operational issues. Strategic issues concern the medium-or long-term status and condition of the system; operational issues concern the activities in the system on which the LA focuses, such as crop or fish production, value chain development, water management, or land amelioration."}]},{"head":"Facilitation","index":70,"paragraphs":[{"index":1,"size":36,"text":"The process is driven by the LA participants since they are best placed to judge the relevance of the analysis. The aim is therefore to identify key questions that the data and resulting analyses can address."},{"index":2,"size":180,"text":" Assemble about 12-20 participants who are concerned with the medium-to long-term operation of the LA.  Brief participants on the purpose of the exercise. Ensure that they agree with the need to ensure that data and its analysis are used to support the LA process. Ensure that they understand this is not a one-off activity but a process of continual improvement.  Run through the logic shown in Table 5, emphasizing that the aim is not to focus on data (at least not initially), but on the questions that they consider important.  Form groups of 3-4 participants. Ideally there should be at least three groups to ensure a diversity of opinion. Try to ensure that the groups are mixed and that any data specialists are spread among groups and not concentrated in any one group.  Using Table 5 to provide examples, ask each group to propose 1-3 questions in each of the six categories. This should take 60 minutes or so.  For each question, the group should identify the degree to which the data and resulting"},{"index":3,"size":27,"text":"analyses can help answer the questions, i.e., increase the certainty to a level that the group feels acceptable. This could take the form of the following categorizations:"},{"index":4,"size":10,"text":"• No more information needed: participants already feel sufficiently certain."},{"index":5,"size":131,"text":"• Qualitative: More data are needed and the participants can get it by means of consultation or review of reports. • Basic quantitative: Quantitative data are needed. Basic analyses will most likely provide the certainty and clarity that is needed. • Advanced quantitative: Substantially more data are needed. This may require some advanced analyses.  Groups contribute their suggestions for questions and, in plenary, discuss them for clarification, focusing on the certainty that the data help the group progress the learning in an iterative learning process.  After discussion, the groups are asked to identify their top five priority questions. This should produce a priority list of about 10 questions.  For these 10 priority questions, identify where to acquire the data and how-if requiredanalyses can help deliver the insights needed."}]},{"head":"Learning about institutional change","index":71,"paragraphs":[{"index":1,"size":49,"text":"LAs seek changes in behaviors in ways that will solve challenges relating to multiple and complex themes. These could be climate change, production demand, value-chain development, and protection of vital natural resources. Such changes implicate change in established rules of behavior, so-called institutions (norms or established rules of behavior)."},{"index":2,"size":11,"text":"These are often at the level of groups, collectives, and organizations."},{"index":3,"size":146,"text":"Groups within the LA may undertake institutional analysis to identify the competence of organizations to deal with some difficult problems, including the need to:  Handle multiple themes at the same time, including rice production, water management, and market development all under pressures from such things as changes in climate, demographics, and markets (both within and outside the deltas).  Support concurrent change at multiple scales. Behavioral change needs to be supported among families within communities and nationally. Institutions need to couple change at a minimum of two scales to be sustainable. \"Top-down\" without change on the ground does not result in change. Local change alone will not lead to long-term improvement unless it is coupled with a broader picture.  Maintain equity among different groups by recognizing the diverse roles and behaviors of different communities that contribute to the vibrant life of densely-populated delta areas."}]},{"head":"Method 14. Meso-scale organizational mapping","index":72,"paragraphs":[{"index":1,"size":28,"text":"A modified version of the meso-level analysis (Holland 2007) will help participants in the LA identify the position of different groups with respect to the changes being proposed."},{"index":2,"size":79,"text":"Organizational mapping is a simple graphical process to visualize organizational arrangements. It consists of three processes. It can be done by reviewing case studies or interviews with participants, and involves:  Static mapping of what is considered to be the major groups of people and organizations,  Process tracing to identify what attributes each group influences and the major influences on them, and  Process mapping, which summarizes the major flows of resources or influences towards the principal outcomes."},{"index":3,"size":31,"text":"The intention of this procedure is to provide-to the best level that people are aware ofthe major processes for which organizations are responsible and the mismatches between existing organizations and expectations."}]},{"head":"Method 15. Institutional stakeholder analysis","index":73,"paragraphs":[{"index":1,"size":170,"text":"The purpose of this simple process is to reveal divergent influences of-and effects ondifferent groups of people in the deltas (Fig. 6). This can be accomplished by:  Nominating the principal groups of people active in the change process within the delta. These do not have to be exclusive, i.e., people can belong to more than one group but they need to be distinct.  Indicating the approximate size of each group: small/medium/large.  Defining the anticipated changes being sought by the LA.  For each change, voting on the perceived effect of change and on the perceived influence of each group on decisions leading towards it.  Discussing major features, such as the condition on groups that are profoundly influenced by change but that have no influence over the decisions. Consider mechanisms to correct these (e.g., environmental assessment).  The purpose of this method is to clarify the various forces acting on or opposing a proposed change. The process also indicates the perceived strength of support or opposition to change."},{"index":2,"size":129,"text":"A possible process follows:  Clarify a limited number (1 or 2) of major changes anticipated by the LA. These should be written down so that participants can refer to them later.  Considering each change in turn, identify the potential forces (both positive and negative) that will work for or against the change. For example, a proposal to pursue high-value vegetable production will have both positive and negative forces (Fig. 7). Within reason, try to consider all of them.  Discuss each force in turn, grouping together if feasible. Consider likely consequences and problems that these forces may raise and come up with possible solutions.  Allocate scores to each and re-order to indicate potential \"boom\" areas and potential problems for which solutions will need to be identified. "}]},{"head":"Conclusions","index":74,"paragraphs":[{"index":1,"size":90,"text":"This toolkit is designed to enable a facilitator of a multistakeholder platform, such as LAs, to start the process with a group, enable the network to define topics for learning and prioritize among various topics, and then further learn about these. The learning relates to creating value from a technique, tool, or process produced or learned about while participating in the network. It also includes harnessing insights from experiments and data. Lastly, it involves learning about the institutional context that will require change in support of the change in practice."}]}],"figures":[{"text":"Fig. 1 . Fig. 1. The iterative learning process in an LA. "},{"text":" Fig. 3. Alignment of LA activities with stakeholder needs and target gains (adapted from Osterwalder et al (2014). "},{"text":" of behaviors and associated competencies for managing change in a network. "},{"text":"Fig. 5 . Fig. 5. Adaptive research process with links to learning by nonfarmer stakeholders. "},{"text":"Fig. 6 . Fig. 6. Institutional analysis. The numbers represent groups with different interests and power. "},{"text":"Fig Fig. 7. Sample components or forces for high-value vegetable production, including drivers and constraints that affect potential change. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 . Simplified theory of change connecting the LA as and its outcomes within AMD.  Activities Outputs Outcomes Impacts ActivitiesOutputsOutcomesImpacts  Develop a Learning alliances Delta-specific learning Progressive, integrated  Develop aLearning alliancesDelta-specific learningProgressive, integrated framework to established to facilitate identified through change underwritten framework toestablished to facilitateidentified throughchange underwritten establish learning inclusive social learning behavioural change by strong and establish learninginclusive social learningbehavioural changeby strong and alliances (Taking around value chain and enshrined in informed institutions. alliances (Takingaround value chainand enshrined ininformed institutions. lessons from development within institutions.  lessons fromdevelopment withininstitutions. CORIGAP) complex and highly   CORIGAP)complex and highly  Establish common variable delta food Examples include:   Establish commonvariable delta foodExamples include: definition, structure, systems. • Agronomy \"in\"  definition, structure,systems.• Agronomy \"in\" scope, and  the environment  scope, andthe environment expectations from Specifics to include: • Value chains  expectations fromSpecifics to include:• Value chains learning alliances Cambodia: focus on linked to  learning alliancesCambodia: focus onlinked to  Outline the addressing drought environmental   Outline theaddressing droughtenvironmental type of trainings and flooding issues in and social  type of trainingsand flooding issues inand social and knowledge the delta consequences  and knowledgethe deltaconsequences enhancement  • Stronger  enhancement• Stronger needed Vietnam: include integration  neededVietnam: includeintegration  climate change • Better design  climate change• Better design  mitigation as rice of financial  mitigation as riceof financial  production and instruments  production andinstruments  diversification is more   diversification is more  advanced   advanced  Bangladesh: build   Bangladesh: build  upon existing hubs   upon existing hubs  for sustainable   for sustainable  intensification   intensification  "},{"text":"Keep Informed Interest Power Manage Closely Fig. 2. Stakeholder influence and interest map.  High  High Keep  Keep Satisfied  Satisfied Monitor  Monitor (Minimum  (Minimum Effort)  Effort) Low  Low Low High LowHigh  "},{"text":"Table 3 . Sample list of components (treatments, dependent variables, analysis and inferences) to note from on-farm experiments Method 11. Adaptive research   "},{"text":"Table 4 . Reflection questions for cooperators and noncooperators (observers) of trials in OFEs. For the noncooperator or observer group:  you implement in the trial plots?  What did you observe in the trial plots? you implement in the trial plots? What did you observe in the trial plots?  What did you observe to work (or what did you  What did you observe to work (or what did you  What did you observe to work (or what did you What did you observe to work (or what did you like) in the trial plots (compared to the farmers' like) in the trial plots (compared to the farmers' like) in the trial plots (compared to the farmers'like) in the trial plots (compared to the farmers' practice plot)? practice plot)? practice plot)?practice plot)?  What did not work (you did not like)?  What did not work (you did not like)?  What did not work (you did not like)? What did not work (you did not like)?  What will you do differently for next season?  What will you do differently for the next season?  What will you do differently for next season? What will you do differently for the next season?  "},{"text":"Government and State Agencies Private Sector Private Sector  The President Ministry of Land Lands Tribunal The Judiciary Office of the Vice-President Ministry of Legal Affair Commercial Farmers Small scale farmers Surveyors Lawyers Foreign Investors Commecial Banks The Chiefs Landless Herders FHHs, CHHs Minority Ethnic Groups Zambia National Farmers Union (ZNFU) The President Ministry of Land Lands Tribunal The Judiciary Office of the Vice-President Ministry of Legal AffairCommercial Farmers Small scale farmers Surveyors Lawyers Foreign Investors Commecial BanksThe Chiefs Landless Herders FHHs, CHHs Minority Ethnic Groups Zambia National Farmers Union (ZNFU) Ministry of Local Government and Housing The CIty, Municipal and District Councils Cooperatives Ministry of Agriculture and DFID, GTZ, EU Donors USAID WB/IMF Local NGOs International NGOs Media Ministry of Local Government and Housing The CIty, Municipal and District Councils Cooperatives Ministry of Agriculture andDFID, GTZ, EU Donors USAID WB/IMFLocal NGOs International NGOs Media Ministry of Works and Supply   Ministry of Works and Supply Ministry of Commerce, Trade,   Ministry of Commerce, Trade, and Industry   and Industry Ministry of Tourism,   Ministry of Tourism, Environment and Natural   Environment and Natural Resources   Resources Ministry of Finance   Ministry of Finance Parliament   Parliament The Police Force/Ministry of the   The Police Force/Ministry of the Interior   Interior  "}],"sieverID":"19fd5f5c-3479-44fc-9878-599d2bd9dccd","abstract":"Contents Introduction Rationale The toolkit A. The LA roadmap Building upon LAs from CORIGAP Why LAs are so important to the Asian Mega Deltas Initiative Key elements of an LA Multistakeholder network Iterative learning process A vision for change: Theory of Change B. Methods 1. Initiation Method 1. Needs assessment Method 2. SWOT analysis 2. Engagement Method 3. Stakeholder analysis Method 4. Network mapping 3. Setting priorities Method 5. Visioning Method 6. Prioritizing, weighting, or ranking Method 7. Conflict resolution 4. Creating and sharing value Method 8. Business model canvas exercise Method 9. Identifying outcomes-linking measurable competencies to change processes 5. Social learning through OFEs and use of data Method 10. On-farm experimentation Method 11. Adaptive research Method 12. Reflection meeting Method 13. Working out what data is needed: Prioritization of questions 6. Learning about institutional change Method 14. Meso-scale organizational mapping Method 15. Institutional Stakeholder analysis Method 16. Force field analysis Conclusions BibliographyLAs provide a platform by which researchers can bring partial solutions that can be tested and developed with implementers in strongly co-innovative processes. Rapid adaptation is vital to the future well-being of people in the deltas and co-innovation in LAs is key to the process."}

data/part_5/00ddd31dc6dd4e0db3147726a52438a4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"00ddd31dc6dd4e0db3147726a52438a4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b38ab22e-c462-4de0-bb5c-933b1b8ca6d7/retrieve"},"pageCount":44,"title":"","keywords":[],"chapters":[{"head":"Table of Contents","index":1,"paragraphs":[{"index":1,"size":114,"text":"A ccording to the Uganda Demographic and Health Survey (UDHS 2016), 33% of the Ugandan population was malnourished in 2016, 29% percent of children under 5 were stunted, 11% were underweight, 3.6% were wasted, 11.8% had low birth weight. Prevalence of anemia among women of child bearing age was at 31.8%. The current levels of malnutrition in Uganda are unacceptable. In Acholi region, 31% of children below 5 years of age are stunted, 4% are wasted and 15% are under weight. In Central region, 19% of children under 5 years are stunted, 4% are wasted and 7% are underweight. Therefore, nutrition warrants greater investment and commitment for Uganda to realize its full development potential."},{"index":2,"size":37,"text":"Among the main contributors of malnutrition is the low awareness of the available options and in some instances -the poverty levels within certain regions that limits households from accessing enough food or providing the appropriate health care."},{"index":3,"size":49,"text":"It is upon this background that the Government of Uganda with the support from the International Fund for Agricultural Development funded two projects in Kalangala region and northern Uganda. The objectives of the projects were to improve households' income by increasing productivity of farmers through adoption of commercial farming."},{"index":4,"size":46,"text":"The VODPII project in Kalangala was to achieve its objective through promoting commercial production of oil palm thus increasing household incomes. In northern Uganda, PRELNOR aimed at increasing production of food crops especially maize, beans, cassava and rice so that farmers have excess surplus to sell."}]},{"head":"VODPII","index":2,"paragraphs":[{"index":1,"size":58,"text":"In 2003 the Government of Uganda, International Fund for Agricultural Development (IFAD), BIDCO and individual farmers in Kalangala under Kalangala Oil Palm Growers Trust (KOPGT) teamed up to establish an oil palm project with expertise from Malaysia, the pilot was rolled out on Bugala Island with plans to expand the project to other neighbouring islands in the district."},{"index":2,"size":38,"text":"The project was designed to improve the livelihood of the people of Uganda and Kalangala in particular, more so on the nutrition status of the poor and reduction on the national cost burden of importation of vegetable oils."}]},{"head":"PRELNOR","index":3,"paragraphs":[{"index":1,"size":48,"text":"Although only 20% of the Uganda population lives in Northern Uganda, it accounts for 38% of the poor in Uganda with 26% of all the chronically poor living in the area. IFAD included Northern Uganda, particularly the Acholi region, as a high priority in the IFAD project pipeline."},{"index":2,"size":45,"text":"Most farmers returning from the IDP camps rely on the natural fertility of the soils, with minimal or no inputs leading to low yields and productivity. The sub-region has excellent potential for agricultural development, which is needed for lifting the rural poor out of poverty."},{"index":3,"size":26,"text":"The PRELNOR project aims to achieve increased incomes through; adoption of improved farming practices, improving market processes and structures and providing climate specific information to situation"}]},{"head":"Nutrition in Uganda","index":4,"paragraphs":[{"index":1,"size":133,"text":"Training manual for Project Management Unit Members | 5 enable improved farming. This Guide is therefore designed for use by field level staff. The guide gives details that are aimed at enabling the field service providers within PRELNOR and VODP II projects to gain an understanding major concepts in nutrition, identifying nutrition needs for different categories of people, identifying different forms of malnutrition, their causes, consequences, management and preventive strategies. Nutrition indicators and their measurement and monitoring methods are also included. Finally, information on food safety and hygiene is also given. The target trainees include: field level staff (Community based facilitators, Household Mentors and Unit leaders) following the trainings, the field extension service providers will have gained knowledge and skills that can be transferred to communities and household members in projects' target regions."}]},{"head":"Outcome","index":5,"paragraphs":[{"index":1,"size":97,"text":"This training guide is intended to build capacity of Project management Team to transfer knowledge on basic concepts regarding appropriate dietary patterns and use of existing farming systems for better household nutrition. In referring to this manual, the Project management team will be able to transfer the information gained to community level field extension workers. The expected impact is that enhanced knowledge of the links between agriculture, nutrition and health, formation and/or upgrading of existing home gardens into comprehensive gardens as well as proper dietary and health practices will eventually lead to enhanced nutrition and health status."}]},{"head":"Outputs","index":6,"paragraphs":[{"index":1,"size":41,"text":"Number of Project Management Unit members trained and able to train their field extension workers. This will be measured on number of households reached with the intervention, Number of households trained by extension field workers that can implement the recommended practices."}]},{"head":"Users of the Guide","index":7,"paragraphs":[{"index":1,"size":38,"text":"This guide it to be used in creating awareness of the field extension workers with regards to nutrition to enable mainstreaming of nutrition into PRELNOR & VODP II projects. It will be used for training Project management Team."}]},{"head":"Overview of the Training Guide","index":8,"paragraphs":[{"index":1,"size":6,"text":"The guide has 6 Main sections:"},{"index":2,"size":25,"text":"1. Basic Concepts in Nutrition 2. Recommended Feeding practices 3. Malnutrition, its forms and causes 4. Food and nutrition assessment 5. Food safety and hygiene"}]},{"head":"Nutrition assessment and related nutrition indicators","index":9,"paragraphs":[{"index":1,"size":94,"text":"Each section includes a time allocation, a pre-test, an overview of the learning objectives, materials needed, notes and facilitator fact sheets pertaining to the section. Also contained is an activity that generates discussion and helps in recapping information while focusing on the key learning objectives. Activity: (using a flip chart, ask at least three participants their understanding of the concepts below, What is good nutrition? What are some of the common nutrient groups? What are some local food sources of the common nutrient groups? What is the function or use of these nutrient groups?"}]},{"head":"(Facilitator asks at least three participants to describe their understanding of nutrition)","index":10,"paragraphs":[{"index":1,"size":41,"text":"After the participants provide the responses the facilitator moves forward to provide the right definition and details as provided in the session technical notes and ensuring there is great participation and discussion during the process and welcoming questions and making clarifications."}]},{"head":"Session technical notes","index":11,"paragraphs":[{"index":1,"size":23,"text":"Nutrition is all about the study of food and how our bodies use it as fuel for growth, reproduction and maintenance of health."},{"index":2,"size":15,"text":"Nutrition comprises the process of providing the nutrients needed for health, growth, development and survival."},{"index":3,"size":18,"text":"Food is any substance (solid, semi-solid, or liquid) taken into the body to provide one or more nutrients."}]},{"head":"Good nutrition is important for:","index":12,"paragraphs":[{"index":1,"size":6,"text":"Physical activity, movement, work, and warmth."},{"index":2,"size":16,"text":"Physical growth and brain development essential for learning, so good nutrition is especially important for children."},{"index":3,"size":9,"text":"Body building, replacement and repair of cells and tissues."},{"index":4,"size":9,"text":"Protection from illnesses, fighting infections and recovery from illnesses."},{"index":5,"size":17,"text":"For good health to be maintained, a daily diet of foods must accomplish the above four functions."},{"index":6,"size":18,"text":"The things in food that help us accomplish one or more of the four functions are called nutrients."}]},{"head":"Basic Concepts in Nutrition","index":13,"paragraphs":[]},{"head":"Learning Objectives","index":14,"paragraphs":[{"index":1,"size":22,"text":"At the beginning of the session the facilitator is expected to understand the entry level knowledge of participants regarding the session content."},{"index":2,"size":10,"text":"At the end of this session participants are expected to:"},{"index":3,"size":6,"text":"Briefly describe what good nutrition is."},{"index":4,"size":11,"text":"List at least six nutrients found in foods and their function."},{"index":5,"size":18,"text":"List at least five local sources of carbohydrates, proteins, vitamins and minerals. Carbohydrates (starches, sugars and dietary fire)."}]},{"head":"Fats Proteins","index":15,"paragraphs":[{"index":1,"size":1,"text":"Water."}]},{"head":"Micro (small) nutrients","index":16,"paragraphs":[{"index":1,"size":23,"text":"These are needed in small amounts. There are many of these but the ones most likely to be lacking in the diet are:"},{"index":2,"size":6,"text":"Minerals -iron, iodine, zinc and calcium."},{"index":3,"size":9,"text":"Vitamins -vitamin A, B-group vitamins, folate and vitamin C."},{"index":4,"size":14,"text":"Whether or not a food is a good source of a nutrient depends on:"},{"index":5,"size":51,"text":"The amount of nutrient in the food. Foods that contain large amounts of micronutrients compared to their energy content are called 'nutrient-rich' (or sometimes 'nutrient-dense') foods. They are preferred because they help ensure that the diet provides all nutrients needed. The Appendix lists foods that supply useful amounts of different nutrients."},{"index":6,"size":9,"text":"The amount of the food that is eaten usually."},{"index":7,"size":16,"text":"How readily available the nutrient in the food is for absorption and use by the body."}]},{"head":"Nutrients, functions and sources","index":17,"paragraphs":[{"index":1,"size":3,"text":"Time: 40 Minutes"}]},{"head":"Carbohydrates","index":18,"paragraphs":[{"index":1,"size":39,"text":"Carbohydrates provide your body with the fuel it needs to keep running. Depending on how quickly they convert to sugar in the body, they can be simple or complex, carbohydrates are mainly in form of starches, sugars or fiber."},{"index":2,"size":37,"text":"Starch and sugars provide energy needed to keep the body breathing and alive, for movement and warmth, and for growth and repair of tissues. Some starch and sugar is changed to body fat as storage of energy."},{"index":3,"size":35,"text":"The fiber in carbohydrates makes faeces soft and bulky and absorbs harmful chemicals, and so helps to keep the gut healthy. It slows digestion and absorption of nutrients in meals, and helps to prevent obesity."}]},{"head":"Sources of carbohydrates","index":19,"paragraphs":[{"index":1,"size":5,"text":"Main sources of carbohydrates are:"}]},{"head":"Cereals","index":20,"paragraphs":[]},{"head":"Starchy roots and tubers","index":21,"paragraphs":[{"index":1,"size":3,"text":"Maize/ maize flour "}]},{"head":"Fats and oils","index":22,"paragraphs":[{"index":1,"size":12,"text":"The fats and oils in foods serve many important functions such as;"},{"index":2,"size":34,"text":"Nutrient: Fat supplies essential fatty acids, which are needed for normal growth of infants and children and for production of hormone-like compounds that regulate a wide range of body functions and keep you healthy."},{"index":3,"size":15,"text":"Transport: Fat carries fat-soluble vitamins (A, D, E, and K) and assists in their absorption."},{"index":4,"size":10,"text":"Sensory: Fat contributes to the smell and taste of food."},{"index":5,"size":11,"text":"Texture: Fat helps make foods tender (especially meats and baked goods)."},{"index":6,"size":15,"text":"Satiety: Fat gives food satiety, so you feel full and satisfied longer after a meal."},{"index":7,"size":27,"text":"Energy: Fat provides a concentrated source of calories. This is good if you are travelling long distances, expending a lot of energy, and carrying your own food."},{"index":8,"size":8,"text":"In the body, fat has the following roles:"},{"index":9,"size":18,"text":"Fats are the body's main form of stored energy (important in times of illness and diminished food intake)."},{"index":10,"size":10,"text":"Fats provide most of the energy to fuel muscular work."},{"index":11,"size":13,"text":"Fat pads internal organs and insulates our bodies against temperature extremes and damage."},{"index":12,"size":13,"text":"Fats form the major material of cell membranes (especially brain and nerve cells)."},{"index":13,"size":10,"text":"Fats are converted to many important hormones (including sex hormones)."},{"index":14,"size":21,"text":"Fat is a good thing! It's only when there is too much of a good thing that it can become problematic."}]},{"head":"Requirements","index":23,"paragraphs":[{"index":1,"size":41,"text":"Fat needs are expressed as 'percent of total energy needs'. The percent of total energy that should come from fat in a healthy balanced diet is: 30-40 percent for children on complementary feeding and up to the age of two years;"},{"index":2,"size":17,"text":"15-30 percent for older children and most adults; for active adults up to 35 percent is acceptable;"},{"index":3,"size":15,"text":"At least 20 percent up to 30 percent for women of reproductive age (15-45 years)."},{"index":4,"size":25,"text":"Consuming more fats beyond what the body needs leads to overweight, and increases the risk of diseases like heart diseases, high blood pressure and diabetes."}]},{"head":"Proteins","index":24,"paragraphs":[{"index":1,"size":56,"text":"Proteins are the building blocks for muscles, organs and many of the substances that make up our bodies. They provide essential amino acids that the body uses to make muscle tissue. The body needs proteins and calories every day. Proteins also facilitate the production of enzymes that govern the body's processes such as growth and digestion."},{"index":2,"size":41,"text":"When you don't get enough of calories and protein everyday, your body breaks up its own supplies to make up for the lack of energy. This robs your body of the calories it needs to stay healthy leading to weight loss."}]},{"head":"Plant sources","index":25,"paragraphs":[{"index":1,"size":18,"text":"• Soy products (tofu, tempeh, soy milk, and other products made from soy), beans, peas, seeds, and nuts."},{"index":2,"size":19,"text":"• There are also small amounts of protein in breads, cereals, and other grains, as well as in vegetables."},{"index":3,"size":18,"text":"• Plant sources of protein are considered \"incomplete\" because they are missing one or more essential amino acids."},{"index":4,"size":10,"text":"• Soy protein is the one exception--it is considered \"complete.\""}]},{"head":"Sources of Proteins","index":26,"paragraphs":[{"index":1,"size":10,"text":"Protein can be found in both animal and plant foods."}]},{"head":"Animal sources","index":27,"paragraphs":[{"index":1,"size":9,"text":"• Meats, poultry, fish, eggs, cheese, milk and yogurt."},{"index":2,"size":33,"text":"• These foods are considered \"complete\" or \"high quality\" proteins because they contain all the \"essential\" amino acids. \"Essential\" means that they must be consumed in our diet; our bodies cannot manufacture them."},{"index":3,"size":9,"text":"• Edible insects: Grasshoppers, termites, white ants, crickets, caterpillars  "}]},{"head":"Requirements","index":28,"paragraphs":[{"index":1,"size":73,"text":"Requirements vary by age, sex, gender and activity (see appendix 1) but the general requirement is approximately 0.75 g per kg of body weight per day. Not consuming enough protein leads to reduced growth rate, loss of muscle and build-up of fluid in the body as the body breaks down the muscles to obtain the protein and energy needed for daily functions. In children it also leads to retarded growth and proteinenergy malnutrition."},{"index":2,"size":37,"text":"It should also be noted that consumption of high amounts of animal protein sources that are accompanied with a lot of fat like meats, milk and eggs leads to excess consumption of fat which has negative effects."}]},{"head":"Vitamins and Minerals","index":29,"paragraphs":[{"index":1,"size":16,"text":"Vitamins include both Fat-soluble (vitamins A, D, E, and K) and water-soluble (B-group and C vitamins)."},{"index":2,"size":10,"text":"Vitamins help the body turn food into energy and tissues."},{"index":3,"size":15,"text":"There are 13 vitamins in all: vitamin A; the vitamin B complex, which includes thiamine, "}]},{"head":"Sources","index":30,"paragraphs":[{"index":1,"size":28,"text":"• Orange vegetables, such as orange sweet potato and carrots, and orange fruits, such as mango and pawpaw and red palm oil are excellent sources of vitamin A."},{"index":2,"size":20,"text":"• Red meat, red offal and liver of all types are a very rich source of iron and vitamin A."},{"index":3,"size":12,"text":"• Most citric fruits and fresh (not overcooked) vegetables provide vitamin C."},{"index":4,"size":10,"text":"• Dark green vegetables supply folate and some vitamin A."},{"index":5,"size":21,"text":"• Many vegetables (e.g., tomatoes, onions) provide additional important micronutrients that may protect against some chronic conditions such as heart disease. "}]},{"head":"Requirements","index":31,"paragraphs":[{"index":1,"size":8,"text":"Vitamins and minerals are required in small quantities."},{"index":2,"size":20,"text":"Requirements are based on age, sex and activity level but consumption of a variety of fruits, vegetables and whole grains."},{"index":3,"size":29,"text":"The best way to make sure we get enough of each micronutrient and enough fibre is to eat a variety of vegetables and fruits and whole grains every day."}]},{"head":"Water","index":32,"paragraphs":[{"index":1,"size":35,"text":"Water just may be the most important nutrient. In fact, the body is more than half water. You can live without food for several weeks, but you can go less than a week without water."},{"index":2,"size":13,"text":"The body needs water to function. It is necessary for Maintaining body temperature;"},{"index":3,"size":5,"text":"Transporting nutrients throughout the body;"},{"index":4,"size":3,"text":"Keeping joints moist;"},{"index":5,"size":2,"text":"Digesting food;"},{"index":6,"size":6,"text":"Ridding the body of waste products."},{"index":7,"size":22,"text":"(Think of the use of water when building a house, without the water, the cement, sand and concrete will not be useful.)"}]},{"head":"Sources","index":33,"paragraphs":[{"index":1,"size":1,"text":"Water;"},{"index":2,"size":3,"text":"Fruit Juices; Soup;"},{"index":3,"size":1,"text":"Milk;"},{"index":4,"size":1,"text":"Porridge;"},{"index":5,"size":16,"text":"Non-caffeinated drinks (caffeinated and alcohol beverages contain diuretic substances that cause the body to lose water)."},{"index":6,"size":25,"text":"Requirements 1.5 liters/day or 8 glasses a day Not drinking enough water leads to constipation, dehydration, dry skin, and build-up of toxins in the body."}]},{"head":"Recommended feeding practices","index":34,"paragraphs":[{"index":1,"size":18,"text":"Activity: (using a flip chart, the facilitator asks at least three participants their understanding of the concepts below,"},{"index":2,"size":15,"text":"2. Do the different family members (age group and condition) have the same food needs?"}]},{"head":"After the participants provide the responses the facilitator moves forward to provide the right definition and details as provided in the session technical notes and ensuring there is great participation and discussion during the process and welcoming questions and making clarifications.","index":35,"paragraphs":[]},{"head":"Session technical notes","index":36,"paragraphs":[]},{"head":"Balanced meal","index":37,"paragraphs":[{"index":1,"size":58,"text":"A balanced diet provides the correct amounts of food energy and nutrients needed during the day to cover the dietary requirements of the person eating it. A balanced diet must be composed of a variety of different foods from different food groups so that it contains all the many macronutrients and micronutrients the person needs in sufficient quantities."}]},{"head":"A good meal should contain:","index":38,"paragraphs":[{"index":1,"size":28,"text":"A staple food. Look at the list of carbohydrate foods made in the previous session and see if it contains the local staple foods. Add them if necessary."},{"index":2,"size":15,"text":"Other foods that may be made into a sauce, stew or relish. These should include:"},{"index":3,"size":6,"text":"• Legumes and/or foods from animals"},{"index":4,"size":5,"text":"• At least one vegetable"},{"index":5,"size":48,"text":"• Some fat or oil (but not too much) to increase the energy and improve taste and facilitate absorption of some nutrients like fat-soluble vitamins. Most of the fat or oil should be from foods containing unsaturated fatty acids (See sources of fats listed in the previous session)."},{"index":6,"size":49,"text":"It is good to eat fruits with a meal (or as a snack) and to drink plenty of water during the day. Avoid drinking tea or coffee until 1-2 hours after a meal (when food will have left the stomach) as these reduce the absorption of iron from food."}]},{"head":"Learning Objectives","index":39,"paragraphs":[{"index":1,"size":24,"text":"At the beginning of the session the facilitator is expected to understand the entry level knowledge and behavior of participants regarding the session content."},{"index":2,"size":10,"text":"At the end of this session participants are expected to:"},{"index":3,"size":18,"text":"Know how to plan for a balanced meal Understand the food pyramid concept when planning and serving meals"},{"index":4,"size":14,"text":"Briefly describe the main differences between the food needs for the different family members  "}]},{"head":"Encourage families to use:","index":40,"paragraphs":[{"index":1,"size":7,"text":"Several groups of foods at each meal."},{"index":2,"size":25,"text":"Different vegetables and fruits at different meals because different vegetables and fruits contain varying amounts of the different micro-nutrients. The more colors consumed the better."},{"index":3,"size":35,"text":"Serve meat, poultry, and offal or fish daily if possible because these foods are the best sources of iron and zinc (which are often lacking in diets, especially the diets of young children and women)."}]},{"head":"Snacks","index":41,"paragraphs":[{"index":1,"size":6,"text":"Snacks are foods eaten between meals."},{"index":2,"size":45,"text":"Below are examples of foods that make good snacks Fresh milk, soured milk, yoghurt, cheese, roasted groundnuts, soybeans, melon seeds, sesame seeds, eggs, fried fish, bread, boiled/roasted maize cob, boiled or roasted cassava, plantain, yam, sweet potato, bananas, avocado, tomatoes, mangoes, oranges, pawpaw, passion fruits."},{"index":3,"size":73,"text":"Eating snacks like these is a good way of improving a diet which may lack food energy and nutrients. However, frequent eating (snacking) throughout the day increases the risk of tooth decay, particularly where oral hygiene is poor. This is particularly true for artificially sweetened snacks that stick to the teeth. It is better to eat the fruit than make juice as many people discard the fiber in the fruits when making juice."}]},{"head":"The Food Pyramid","index":42,"paragraphs":[{"index":1,"size":89,"text":"Although your food intake varies from meal to meal and from day to day, keeping a balanced view of your diet is a good idea. The food pyramid (see figure 5) is meant to be a guideline not rigid set of rules. It is healthy to eat more of the foods from the bottom levels of the pyramid and fewer of those from the top. The top of the pyramid is for foods that should be consumed in small quantities because large amounts are not good for the body."},{"index":2,"size":17,"text":"The Food Pyramid as a guide helps to promote the 3 basic rules for a healthy diet:"},{"index":3,"size":87,"text":"Variety means that you must include many different foods from each level of the Food Pyramid because no single food can supply all of the nutrients that your body needs on a daily basis. This can help to expand your food choices. It is best to eat foods of all colours. The more colours and textures in your daily meals, the better range of nutrients you'll get. You can choose to vary different foods in a day or aim to vary different foods across a whole week."},{"index":4,"size":37,"text":"Balance means that you must eat the right amounts of foods from all levels of the Food Pyramid each day. This way you will get all the calories and nutrients you need for proper growth and development."},{"index":5,"size":17,"text":"Moderation means that you are careful not to eat too much of any one type of food."},{"index":6,"size":71,"text":"Good nutrition during pregnancy and appropriate health seeking behavior are very important for both mother and child Pregnant women should receive ante-natal care from health facility. They should receive iron supplementation because of increased iron needs during pregnancy A pregnant or breastfeeding woman needs to eat enough food to supply the extra energy, protein, vitamins and minerals needed by the growing fetus or baby during breastfeeding. Her meals must be balanced."},{"index":7,"size":26,"text":"Early initiation of breastfeeding (within the first 30 minutes of delivery) whether at hospital, at home, or at the midwife's, and give colostrum to the baby."}]},{"head":"Colostrum protects infant from disease by providing the infant's first vaccine","index":43,"paragraphs":[{"index":1,"size":108,"text":"Exclusive breastfeeding of all children below 6 months of age. Breast milk provides all the nutrients needed to satisfy huger and promote growth No other foods or drinks should be given to children below 6 months of age. This reduces infections and diarrhoea Children at 6 months and above should be given a balanced diet in addition to the breast milk. These foods should not be too thin as they will not provide enough nutrients. The facilitator asks the participants to mention their understanding of the term malnutrition. The responses on a flip chart and the then gives the right content as detailed in the session technical notes."}]},{"head":"Session technical notes","index":44,"paragraphs":[{"index":1,"size":27,"text":"Malnutrition is the condition that develops when the body does not get the right amount of the nutrients it needs to maintain healthy tissues and organ function."}]},{"head":"Under Nutrition","index":45,"paragraphs":[{"index":1,"size":89,"text":"Under nutrition is a deficiency of food energy or nutrients, which leads to nutrient deficiencies. It is caused by inadequate intake or poor absorption of nutrients in the body. Acute malnutrition, chronic malnutrition, stunting, wasting, and underweight and micronutrient deficiencies occur because of undernutrition, and they can have serious consequences on the development and health of infants and young children. Undernutrition is one of the leading causes of mortality for young children across the globe and is often caused by an interaction between inadequate dietary intake and frequent illness."}]},{"head":"Over Nutrition","index":46,"paragraphs":[{"index":1,"size":37,"text":"Over nutrition is a condition caused by abnormal or excess fat accumulation in the body that may lead to health problems and reduced life expectancy. Overnutrition starts as overweight and if left uncontrolled may progress to obesity."}]},{"head":"Causes of malnutrition","index":47,"paragraphs":[{"index":1,"size":97,"text":"Malnutrition occurs when a person does not receive nutrients in the required amounts (less or excess). This can be a result of several factors and is a result of inadequate food intake and the health status (immediate causes, which are at an individual level). These factors in turn are affected by the individual or household's access to food, the care available, the availability of suitable health services and an unhealthy environment (underlying causes). The resources available in a household and community and how they are used are issues that influence underlying causes of malnutrition (see figure below)."}]},{"head":"Learning Objectives","index":48,"paragraphs":[{"index":1,"size":22,"text":"At the beginning of the session the facilitator is expected to understand the entry level knowledge of participants regarding the session content."},{"index":2,"size":12,"text":"At the end of the session, the participants should be able to:"}]},{"head":"Identify kinds of malnutrition in their community","index":49,"paragraphs":[]},{"head":"Understand causes of the kinds of malnutrition in their community","index":50,"paragraphs":[{"index":1,"size":20,"text":"Understand the consequences of malnutrition in the community Share actions they can take to prevent malnutrition among children and women"}]},{"head":"Time:","index":51,"paragraphs":[{"index":1,"size":2,"text":"60 minutes"}]},{"head":"Materials needed:","index":52,"paragraphs":[{"index":1,"size":9,"text":"Photos of children with different clinical signs of malnutrition "}]},{"head":"Forms of malnutrition A. Chronic malnutrition","index":53,"paragraphs":[{"index":1,"size":15,"text":"Chronic malnutrition is malnutrition caused by long-term food deprivation or illness. An example is stunting."}]},{"head":"Stunting","index":54,"paragraphs":[{"index":1,"size":39,"text":"This refers to a child having short height for their age. It can begin during pregnancy and through infancy (up to 5 year of age). If not corrected before two years of the child's age, the effects become irreversible. "}]},{"head":"Conceptual framework for analysing the causes of malnutrition","index":55,"paragraphs":[]},{"head":"B. Acute malnutrition","index":56,"paragraphs":[{"index":1,"size":21,"text":"Acute malnutrition is a result of short-term lack of food deprivation or illness that results in sudden weight loss or oedema."}]},{"head":"i. Underweight","index":57,"paragraphs":[{"index":1,"size":39,"text":"This refers to a child having a weight that is too low for their age. When severely underweight, the child is weak, has poor physical stamina and a weak immune system leaving them prone to other infections and illnesses."}]},{"head":"ii. Wasting","index":58,"paragraphs":[{"index":1,"size":27,"text":"Wasting refers to a child having a weight that is too low for their height. It is a strong predictor of mortality of children under 5 years."}]},{"head":"C. Micronutrient deficiencies i. Iron deficiency anaemia","index":59,"paragraphs":[{"index":1,"size":48,"text":"• Iron is required for the synthesis of haemoglobin, which transports oxygen to the cells in our body. It is required by every growing cell and therefore is essential for child growth and development. It is involved in energy production, immunity, and regulation of the central nervous system."},{"index":2,"size":20,"text":"• Iron deficiency may lead to iron deficiency anaemia, a condition experienced when the body is not making enough haemoglobin."},{"index":3,"size":35,"text":"• Signs of iron deficiency anaemia include fatigue, weakness, tiredness, loss of appetite, headaches, shortness of breath and paleness. Pale skin (especially on palms), pale lips and paleness on the inside of the bottom eyelid."},{"index":4,"size":12,"text":"• Iron deficiency during early childhood can impair physical and cognitive development."},{"index":5,"size":25,"text":"Signs of anaemia can be seen in the figure 8 below.  • Vitamin A helps keep eyes healthy, promotes vision, and provides protection against infection."},{"index":6,"size":16,"text":"• Vitamin A is needed by the tissues that line our lungs, gastrointestinal tract and eyes."},{"index":7,"size":27,"text":"• Without adequate vitamin A, these tissues are susceptible to bacterial invasion; as such, deficiency is associated with frequent illness and severe deficiency may result in blindness."},{"index":8,"size":17,"text":"• Signs of vitamin A deficiency include night blindness, Bigot's spots and keratomalacia (in order of severity)."},{"index":9,"size":13,"text":"• This deficiency is associated with high rates of respiratory and diarrheal infections."},{"index":10,"size":22,"text":"• Iodine is essential in the proper functioning of the thyroid gland, which helps to regulate the body's use of energy (metabolism)."},{"index":11,"size":17,"text":"• Iodine is essential for physical and mental growth, and it is particularly important during foetal development."},{"index":12,"size":16,"text":"• Goitre, a swelling of the thyroid gland, is the most notable symptom of iodine deficiency."},{"index":13,"size":20,"text":"• Severe maternal iodine deficiency can result in cretinism, whereby the child is born with severe physical and mental retardation."},{"index":14,"size":27,"text":"• Less severe forms of iodine deficiency in young children can cause mental deficits such as lower mental development, lower cognitive function and reduced ability to focus."},{"index":15,"size":8,"text":"• Goitre is reversible whereas cretinism is irreversible."},{"index":16,"size":8,"text":"ii. Vitamin A deficiency iii. Iodine deficiency disorder "}]},{"head":"Over nutrition","index":60,"paragraphs":[{"index":1,"size":16,"text":"Overnutrition is an excess consumption of energy and nutrients. It can lead to overweight and obesity."},{"index":2,"size":17,"text":"Being overweight or obese increases the likelihood of having diabetes and heart-related diseases like high blood pressure."},{"index":3,"size":61,"text":"Overweight and obesity ranges are determined by using weight and height to calculate a number called the body mass index (BMI). An adult who has a BMI between 25 and 29.9 is considered over weight and an adult who has a BMI of 30-35 is considered obese and an adult with a BMI of 40 or more, or 30 or more."},{"index":4,"size":12,"text":"BMI is established through dividing weight in kg by height (cm) squared."}]},{"head":"Cycle of malnutrition","index":61,"paragraphs":[{"index":1,"size":70,"text":"The consequences of malnutrition in an individual can extend to later in life. In addition, the effects can also affect future generations. This particularly occurs for women, where their nutrition status affects the unborn child. A stunted girl is likely to become a stunted adolescent and later a stunted woman. This affects her health, productivity, and nutrition. Which in turn increases the chance that her children will be born malnourished. "}]},{"head":"Prevention of undernutrition","index":62,"paragraphs":[{"index":1,"size":14,"text":"• Promotion of exclusive breastfeeding and continued breastfeeding up to 2 years and beyond"},{"index":2,"size":5,"text":"• Appropriate complementary feeding practices"},{"index":3,"size":8,"text":"• Supplementation with Vitamin A and iron/folic acid"}]},{"head":"• Immunization and deworming","index":63,"paragraphs":[{"index":1,"size":5,"text":"• Promotion of maternal nutrition"},{"index":2,"size":7,"text":"• Appropriate water, sanitation and hygiene practices"}]},{"head":"• Growth Monitoring and Promotion","index":64,"paragraphs":[]},{"head":"At the end of the session, let the facilitator ask whether there are any additional questions or points of clarification. After all clarifications are made (if any), the facilitator closes the session and mentions the next session and its facilitator.","index":65,"paragraphs":[]},{"head":"How to Prevent Malnutrition in Our Communities","index":66,"paragraphs":[{"index":1,"size":3,"text":"Feeding young children"},{"index":2,"size":16,"text":"• All new born babies should be put on the breast within one hour of birth"},{"index":3,"size":32,"text":"• New born babies should be fed only on breastmilk and not given any other food/drink (like animal milks, tea, water, soup, porridge, soda, juice, etc.) until they are six months old."},{"index":4,"size":27,"text":"• When babies are six months old, they should continue to be given breast milk AND also fed with other nutritious foods 3 to 4 times daily."},{"index":5,"size":8,"text":"• The foods for young children must contain:"},{"index":6,"size":7,"text":"Fruits (like avocado, pawpaw, mangoes, ripe bananas)"},{"index":7,"size":9,"text":"Vegetables (like mashed dodo/amaranth, spinach, [young] deep greeny leafs),"},{"index":8,"size":5,"text":"Pulses/legumes (like beans, peas, soy),"},{"index":9,"size":13,"text":"• Baby porridge should be enriched with avocado, groundnuts, mukene, ripe sweet bananas,"},{"index":10,"size":27,"text":"• Mashed pumpkin or Irish-potatoes are good foods for a young child. These foods can be enriched with avocado, groundnuts, mukene, soy flour, fortified cooking oil, meats)"},{"index":11,"size":24,"text":"• Babies should be fed on 1 or 2 snacks between meals (this can include, papaw, orange fleshed sweet potato, ripe bananas, mangoes, tomatoes."}]},{"head":"Keep clean and hygienic","index":67,"paragraphs":[{"index":1,"size":9,"text":"• Use toilets to defecate and throw children's faces"},{"index":2,"size":13,"text":"• Wash hands before food preparation/cooking, before feeding/eating and after visiting the toilet"},{"index":3,"size":21,"text":"• Keep compounds around the home clean, sweep all wastes, faecal matter, droppings of animals and get rid of stagnant water"},{"index":4,"size":17,"text":"• Always have treated water in the home (boiled or chlorinated) for drinking. Drink only treated water."}]},{"head":"Seek appropriate health care","index":68,"paragraphs":[{"index":1,"size":10,"text":"• Attend the clinics (for antenatal, immunization, supplementation, deworming, check-ups)"},{"index":2,"size":14,"text":"• Immediate treatment of fever (high temperature), diarrhea, poor (difficult) breathing, poor eating/ breastfeeding"},{"index":3,"size":9,"text":"• Seek advice on child spacing and family planning"}]},{"head":"Mitigate emergencies","index":69,"paragraphs":[{"index":1,"size":9,"text":"• Prepare savings to build wealth and deter emergencies"},{"index":2,"size":12,"text":"• Invest in productive assets (livestock, businesses, better seeds and farming inputs)"},{"index":3,"size":16,"text":"• Plant fruits (avocado, papaw, etc) and vegetables (pumpkin, amaranth, orange fleshed sweet potato, traditional vegetables)"}]},{"head":"Gender","index":70,"paragraphs":[{"index":1,"size":22,"text":"• Have cohesion in the family to work together and make decisions together for improved feeding, health and wealth in the family"}]},{"head":"Food safety and hygiene","index":71,"paragraphs":[]},{"head":"Method: Presentations and discussion","index":72,"paragraphs":[{"index":1,"size":10,"text":"Activity 1: Brainstorming, question and answer as slides are presented."}]},{"head":"The facilitator asks the participants to mention their understanding of the terms mentioned below, writes the responses on a flip chart and then gives the right content as detailed in the session technical notes.","index":73,"paragraphs":[{"index":1,"size":10,"text":"1. Mention any 5 practices related to good personal hygiene."},{"index":2,"size":13,"text":"2. What do you understand by safe storage of food (raw) and water?"},{"index":3,"size":12,"text":"3. Name three important practices in preparing, cooking and storing food safely."}]},{"head":"The facilitator takes 10 minutes to wrap up the session, making any clarification needed. Supplement the points they share with points from the manual if they have not been mentioned","index":74,"paragraphs":[]},{"head":"Session technical notes","index":75,"paragraphs":[]},{"head":"Why foods and drinks must be safe and clean","index":76,"paragraphs":[{"index":1,"size":72,"text":"It is important that the food we eat and the water we drink is clean and safe. So it is essential to prepare meals in a safe, hygienic way. If germs get into our foods and drinks, they may give us food poisoning (resulting, for example, in diarrhea or vomiting). The people most likely to become sick are young children and people who are already ill, particularly people living with HIV/ AIDS."},{"index":2,"size":6,"text":"Basic rules of hygiene aim to:"},{"index":3,"size":21,"text":"• Prevent germs from reaching foods and drinks. Many germs come from human or animal faeces. Germs can reach food via:"},{"index":4,"size":13,"text":"Dirty hands, flies and other insects, mice and other animals and dirty utensils"},{"index":5,"size":9,"text":"Water supplies if they are not protected from faeces."},{"index":6,"size":34,"text":"• Prevent germs from multiplying in foods and reaching dangerous levels. Germs breed fastest in food that is warm and wet (e.g., Porridge), especially if it contains sugar or animal protein, such as milk."}]},{"head":"Learning Objectives","index":77,"paragraphs":[{"index":1,"size":26,"text":"At the beginning of the session the facilitator is expected to understand the entry level knowledge and behavior of participants in regard to the session content."},{"index":2,"size":11,"text":"By the end of the chapter, learners should be able to:"},{"index":3,"size":10,"text":"List at least four practices importance in good personal hygiene;"},{"index":4,"size":9,"text":"Practice good hygienic during food preparation, cooking and storage"}]},{"head":"Time: 60 minutes","index":78,"paragraphs":[]},{"head":"Materials needed:","index":79,"paragraphs":[{"index":1,"size":9,"text":"Flip chart, Flip chart, board, Marker pens, Block notes"},{"index":2,"size":9,"text":"To help families have clean, safe foods and drinks:"},{"index":3,"size":45,"text":"• Find out about disposal of feaces, hand washing practices, the source and storage of water and ways in which food is prepared. This helps you identify ways in which germs may be reaching food and water, and foods in which germs may be breeding."},{"index":4,"size":31,"text":"• Suggest practical ways to improve water and food hygiene. Some of the suggestions listed below may be relevant and useful. But remember not to overburden families with too much advice."}]},{"head":"Clean and safe water","index":80,"paragraphs":[{"index":1,"size":3,"text":"Advise families to:"},{"index":2,"size":48,"text":"• Use safe water, such as treated pipe water, or water from a protected source, such as a borehole or protected well. If the water is not safe, it should be boiled (rapidly for one minute) before it is drunk or used in uncooked foods (e.g., fruit juices)."},{"index":3,"size":10,"text":"• Use clean, covered containers to collect and store water."},{"index":4,"size":11,"text":"• Use clean materials to filter your water in need be."},{"index":5,"size":9,"text":"• Use clean utensils to serve and drink water."}]},{"head":"Buying and storing food","index":81,"paragraphs":[{"index":1,"size":3,"text":"Advise families to:"},{"index":2,"size":23,"text":"• Buy fresh foods, such as meat or fish, on the day they will eat them. Look for the signs of poorquality food."},{"index":3,"size":14,"text":"• Cover raw and cooked foods to protect them from insects, rodents and dust."},{"index":4,"size":20,"text":"• Store fresh food (especially foods from animals) and cooked foods in a cool place, or a refrigerator if available."},{"index":5,"size":21,"text":"• Keep dry foods such as flours and legumes in a dry, cool place protected from insects, rodents and other pests."},{"index":6,"size":33,"text":"• Avoid storing leftovers for more than a few hours (unless in a refrigerator). Always store them covered and reheat them thoroughly until hot and steaming (bring liquid food to a rolling boil)."}]},{"head":"Preparing food","index":82,"paragraphs":[{"index":1,"size":5,"text":"Advise people preparing food to:"},{"index":2,"size":20,"text":"• Keep food preparation surfaces clean. Use clean, carefully washed dishes and utensils to store, prepare, serve and eat food."},{"index":3,"size":12,"text":"• Prepare food on a clean table where there is less dust."},{"index":4,"size":11,"text":"• Wash vegetables and fruits with clean/safe water. Peel if possible."},{"index":5,"size":31,"text":"• Prevent raw meat, offal, poultry and fish from touching other foods, as these animal foods often contain germs. Wash surfaces touched by these raw foods with hot water and soap."},{"index":6,"size":14,"text":"• Cook meat, offal, poultry and fish well. Meat should have no red juices."},{"index":7,"size":14,"text":"• Boil eggs so they are hard. Do not eat raw or cracked eggs."},{"index":8,"size":18,"text":"• Boil milk unless it is from a safe source. Soured milk may be safer than fresh milk."}]},{"head":"Hygiene around the home","index":83,"paragraphs":[{"index":1,"size":3,"text":"Advise families to:"},{"index":2,"size":14,"text":"• Keep the surroundings of the home free from animal faeces and other rubbish."},{"index":3,"size":22,"text":"• Keep rubbish in a covered bin and empty it regularly in appropriate places (pits, compost) so as not to attract flies."},{"index":4,"size":16,"text":"• For easy waste management separate the waste such as plastic, glass, paper and food/plant remains."},{"index":5,"size":15,"text":"• Make compost for the garden with suitable waste food, garden rubbish and animal faeces."},{"index":6,"size":69,"text":"Composting destroys germs in faeces. The compost pit should be at least partially shaded and at least 2 feet from a structure like your house or a fence. It should be at a place convenient for you to add materials, access to water and good drainage. In addition you should take into consideration the direction of the wind so that the smell or odors doesn't come to the house."}]},{"head":"Toxins and chemicals","index":84,"paragraphs":[{"index":1,"size":79,"text":"Food and water is unsafe if it contains toxins or dangerous chemicals. A toxin called \"aflatoxin\" is produced by a molds that grows on cereals and legumes. Eating aflatoxin can make someone seriously ill. Moulds should be prevented from growing on any food items and this can be done by drying crops thoroughly and storing them in a dry place. People should desist from eating moldy foods or giving them to animals but these can be added to compost."},{"index":2,"size":16,"text":"Pesticides and other harmful agricultural chemicals may get into food or water and cause poisoning if:"},{"index":3,"size":10,"text":"• The chemical is not used in the recommended way;"},{"index":4,"size":10,"text":"• The empty containers are used for food or water."}]},{"head":"Advise people to:","index":85,"paragraphs":[{"index":1,"size":8,"text":"• Follow carefully the instructions for using chemicals;"},{"index":2,"size":9,"text":"• Be strict about keeping chemicals away from children;"},{"index":3,"size":14,"text":"• Never put food or water into containers that have been used for chemicals;"},{"index":4,"size":18,"text":"• Wash hands after using chemicals, and wash any foods (e.g., Fruit) that have been sprayed with them."}]},{"head":"Activity","index":86,"paragraphs":[{"index":1,"size":12,"text":"Discuss steps that can be taken to put these recommendations into practice."}]},{"head":"Food and nutrition assessment","index":87,"paragraphs":[{"index":1,"size":2,"text":"Method: Discussion/question/answer"}]},{"head":"Dietary assessment part I Activity:","index":88,"paragraphs":[{"index":1,"size":30,"text":"The facilitator asks for a volunteer among the participants. The participant shares what they (or their household) consumed the day before the training started. Sharing all foods eaten and drunk."},{"index":2,"size":12,"text":"The facilitator probes for in-between meals, and details of the foods consumed."},{"index":3,"size":102,"text":"The facilitator then uses this example to show the participants how to determine the dietary diversity scores whether household of individual i.e. Minimum dietary diversity score for women. The facilitator used the food groups discussed earlier and works together with the participants to establish whether the example sites meets the required diversity. About 2-3 other volunteers with one describing how they fed their child is done to ensure understanding on how to determing whether different household members are meeting the required dietary diversity. The session's technical notes are used to provide details on the dietary diversity indicators and make any clarifications needed."}]},{"head":"Session technical notes","index":89,"paragraphs":[{"index":1,"size":54,"text":"Food intake can be measured in terms of quantity and quality. However, based on our communities and the capacity of service providers available, it is difficult to capture quality. We therefore focus on assessing quality. The quality of the diets is measured by assessing the diversity of the diets at individual and household level."},{"index":2,"size":41,"text":"Assessment of dietary diversity is about consumption of a balanced diet, one that has a variety of different foods from different food groups one that provides the correct amounts of nutrients needed by the body to maintain health, growth, and development."}]},{"head":"Household dietary diversity score (HDDS)","index":90,"paragraphs":[{"index":1,"size":33,"text":"The household dietary diversity score (HDDS) reflects the economic ability of a household to access a variety of foods. An increase in dietary diversity is associated with socio-economic status and household food security."}]},{"head":"Learning Objectives","index":91,"paragraphs":[{"index":1,"size":24,"text":"At the beginning of the session the facilitator is expected to understand the entry level knowledge of participants in regard to the session content."},{"index":2,"size":10,"text":"At the end of this session participants are expected to: "}]},{"head":"Individual dietary diversity score (IDDS)","index":92,"paragraphs":[{"index":1,"size":48,"text":"Individual dietary diversity scores aim to reflect nutrient adequacy. An increase in individual dietary diversity score is related to increased nutrient adequacy of the diet. Individual scores are preferable to household scores because they provide more specific reflection of the quality of the diet and status of nutrition."},{"index":2,"size":95,"text":"When assessing individual dietary diversity, the foods consumed by the individual over a 24-hour period are established. This included all food eaten or drunk both at home and away from home. After establishing the different foods consumed, the foods are grouped into the respective food groups. 12 food groups are used, similar to those for household dietary diversity above. Consumption of 3 or less food groups is considered low dietary diversity, consumption of between 4-5 food groups is considered moderate dietary diversity while consumption of more than 6 food groups is considered high dietary diversity."}]},{"head":"Dietary diversity of women","index":93,"paragraphs":[]},{"head":"Minimum Dietary Diversity Score for Women (MDDS-W)","index":94,"paragraphs":[{"index":1,"size":52,"text":"The Minimum Dietary Diversity Score for Women is a food group diversity indicator that has been shown to reflect an additional key dimension of diet quality that is micronutrient adequacy. The foods consumed over a 24-hour period are established including all food eaten or drunk both at home and away from home."},{"index":2,"size":14,"text":"After establishing the different foods consumed, the foods are grouped into 10 food groups."},{"index":3,"size":15,"text":"Consumption of foods from any 5 food groups and above indicates meeting minimum dietary diversity."},{"index":4,"size":44,"text":"Food groups are: 1. All starchy staples; 2. Beans peas; 3. Nuts and seeds; 4. Dairy; 5. Flesh foods (meats); 6. Eggs; 7. Vitamin A rich dark green leafy vegetables; 8. Other vitamin A rich vegetables and fruits; 9. Other vegetables; 10. Other fruits."}]},{"head":"Children dietary diversity i. Minimum meal frequency (MMF)","index":95,"paragraphs":[{"index":1,"size":24,"text":"This is a proxy for the child's energy requirements and is based on how much energy the child needs whether breast fed or not."},{"index":2,"size":37,"text":"Breastfed children are considered to be fed with a minimum meal frequency if they receive solid, semi sold or soft foods at least twice a day (6-8 months) or at least 3 times a day (9-23 months)"},{"index":3,"size":30,"text":"Non-breastfed children aged 6-23 months are considered to be fed with a minimum meal frequency if they receive solid, semi sold or soft foods at least 4 times a day"},{"index":4,"size":37,"text":"It is measured as a proportion of breastfed and nonbreastfed children 6-23 months of age who receive solid, semi-solid, or soft foods (but also including milk feeds for non-breastfed children) the minimum number of times or more."},{"index":5,"size":10,"text":"Calculation of the proportion of women with minimum dietary diversity"}]},{"head":"ii. Minimum dietary diversity (MDD)","index":96,"paragraphs":[{"index":1,"size":25,"text":"This indicator looks at food groups a child eats. This indicator is a measure for adequate macro and micronutrients and diet variety other than breastmilk."},{"index":2,"size":23,"text":"Their diet is assessed based on 8 food groups. If a child eats at least four or more food groups, it is assumed "}]},{"head":"iii. Minimum Acceptable Diets (MAD)","index":97,"paragraphs":[{"index":1,"size":69,"text":"Proportion of children 6-23 months of age who receive a minimum acceptable diet (apart from breast milk). This indicator measures both the minimum feeding frequency and minimum dietary diversity, as appropriate for various age groups. If a child meets the minimum feeding frequency and minimum dietary diversity for their age group and breastfeeding status, then they are considered to receive a minimum acceptable diet. Minimum is considered as follows:"},{"index":2,"size":12,"text":"-2 times for breastfed infants (6-8months -3 times for breastfed children (9-23months)"},{"index":3,"size":5,"text":"-4 times for non-breastfed children/infants"},{"index":4,"size":24,"text":"Meal is defined as any solid. Semi-solid or liquid food given to the child alone or within a composite dish within the previous day."},{"index":5,"size":57,"text":"Breastfed children 6-23 months of age who had at least the minimum dietary diversity and the minimum meal frequency during the previous day Non-breastfed children 6-23 months of age who received at least 2 milk feedings and had at least the minimum dietary diversity not including milk feeds and the minimum meal frequency during the previous day"},{"index":6,"size":37,"text":"This composite indicator will be calculated from the following two fractions: In the past four weeks, did you or any household member have to eat fewer meals in a day because there was not enough food? 7"},{"index":7,"size":27,"text":"In the past four weeks, was there ever no food to eat of any kind in your household because of lack of resources to get food? 8"},{"index":8,"size":24,"text":"In the past four weeks, did you or any household member go to sleep at night hungry because there was not enough food? 9"},{"index":9,"size":26,"text":"In the past four weeks, did you or any household member go a whole day and night without eating anything because there was not enough food?"}]},{"head":"Household food security indicators and measurement","index":98,"paragraphs":[{"index":1,"size":11,"text":"Time: 20 minutes Materials needed: Weighing scale, Height board, MUAC tapes"}]},{"head":"Method. Presentation and discussion","index":99,"paragraphs":[]},{"head":"Activity:","index":100,"paragraphs":[{"index":1,"size":47,"text":"After explaining minimum meal frequency, minimum dietary diversity and minimum acceptable diets for children, the facilitator presents the following children in different households. All children are 1 year old and are breast fed. And below are the number of meals and number of food groups they consumed."},{"index":2,"size":19,"text":"The facilitator reviews the refine points for each of these indicators for the example as shown in the table"},{"index":3,"size":35,"text":"The facilitator then asks the participants if the minimum meal frequency, minimum dietary diversity, and minimum acceptable diets have been met for each of the children. Placing an X or √ (for yes or no) "}]},{"head":"Anthropometric assessment","index":101,"paragraphs":[{"index":1,"size":3,"text":"Time: 60 Minutes"}]},{"head":"Method: Presentations and discussion","index":102,"paragraphs":[]},{"head":"Activity:","index":103,"paragraphs":[{"index":1,"size":13,"text":"After nutrition indicators and after the introduction of the section on anthropometric indicators"},{"index":2,"size":36,"text":"Facilitator requests for 5 Participants to volunteer, and each volunteer is allocated a measurement. Facilitators take 10 minutes teaching the volunteers how to take the respective measurements. Volunteers take 10 minutes to practice taking the measurements."},{"index":3,"size":26,"text":"The activity allows participants to cover the anthropometric measurements, how they are made and how the results are interpreted .The measurements to be taken will include:"},{"index":4,"size":6,"text":"1. MUAC 2. Weight 3. Height"}]},{"head":"Length","index":104,"paragraphs":[{"index":1,"size":19,"text":"Each group then takes 5 minutes to present how to take the measurements to the rest of the participants."},{"index":2,"size":13,"text":"The rest of the participants then take 15 minutes practicing the other measurements."},{"index":3,"size":24,"text":"Following this, the facilitator takes 10 minutes explaining the growth charts and how to plot the measurements to determine the nutrition status (stunting, underweight  "}]},{"head":"Household hunger scale (HHS)","index":105,"paragraphs":[{"index":1,"size":25,"text":"Most appropriate to use in areas of substantial food insecurity essentially a behavioural measure, captures more severe behaviours. It is based on 3 main questions:"},{"index":2,"size":22,"text":"• Was there ever no food to eat of any kind in your house because of lack of resources to get food?"},{"index":3,"size":19,"text":"• Did you or any household member go to sleep at night hungry because there was not enough food?"},{"index":4,"size":22,"text":"• Did you or any household member go a whole day and night without eating anything because there was not enough food?"},{"index":5,"size":30,"text":"For each of the questions one asks how often the occurrence was observed: never (0 times), rarely (1 or 2 times), sometimes (3-10 times, and often (more than 10 times)."},{"index":6,"size":15,"text":"One can either choose to use the HFIES or the HHS based on the context."}]},{"head":"Nutrition status assessment","index":106,"paragraphs":[{"index":1,"size":4,"text":"1. Time: 60 Minutes"}]},{"head":"Method: Presentations and discussion and demonstrations","index":107,"paragraphs":[]},{"head":"Activity:","index":108,"paragraphs":[{"index":1,"size":38,"text":"The facilitator introduces the section on nutrition status assessment. The facilitator explains that good nutrition care starts with good assessment of the nutritional status. The facilitator explains various methods of assessment which include; anthropometry, dietary, clinical and biochemical"}]},{"head":"methods. The facilitator then gives introductory paragraph about several methods, biochemical and anthropometric and scope of this manual in relation to the projects","index":109,"paragraphs":[{"index":1,"size":33,"text":"Participants form 2 groups, and each group is allocated 2 measurements. Facilitators take 10 minutes teaching the groups how to take the respective measurements. Groups take 10 minutes to practice taking the measurements."}]},{"head":"Technical session notes","index":110,"paragraphs":[{"index":1,"size":23,"text":"Anthropometry is the measurement of the human body's physical dimensions. The measures are used to establish the nutrition status of individuals and populations."}]},{"head":"Height / length 1) Height","index":111,"paragraphs":[{"index":1,"size":17,"text":"This measurement is taken for children two years and above and/or for those greater than 85 cm."},{"index":2,"size":9,"text":"The following as steps for taking accurate height measurements"},{"index":3,"size":11,"text":"• Set the measuring board vertically on a stable level surface."},{"index":4,"size":8,"text":"• Remove the child's shoes and any head-covering."},{"index":5,"size":16,"text":"• Place the child on the measuring board, standing upright in the middle of the board."},{"index":6,"size":38,"text":"• The child's heels and knees should be firmly pressed against the board by the assistant while the measurer positions the head and the cursor. The child's head, shoulders, buttocks, knees and heels should be touching the board."},{"index":7,"size":10,"text":"• Read and announce the measurement to the nearest 0.1cm."},{"index":8,"size":17,"text":"• Record and repeat the measurement to the measurer to make sure it has been correctly heard"}]},{"head":"1) Length","index":112,"paragraphs":[{"index":1,"size":24,"text":"This measurement is taken for children below two years of age and/or for those who are less than 85 cm or unable to stand."},{"index":2,"size":11,"text":"• Place the measuring board horizontally on a flat, level surface."},{"index":3,"size":9,"text":"• Remove the child's shoes and any head covering."},{"index":4,"size":18,"text":"• Place the child so he/she is lying down and face up in the middle of the board."},{"index":5,"size":23,"text":"• Allow the assistant to hold the sides of the child's head and position the head until it is touching the head board."},{"index":6,"size":39,"text":"• Allow the measurer to place his/her hands on the child and firmly hold the child's knees together while pressing down. The soles of the feet should be flat on the foot piece, toes pointing up at right angles."},{"index":7,"size":27,"text":"• The measurer should immediately remove the child's feet from contact with the footboard with one hand while holding the footboard securely in place with the other."},{"index":8,"size":45,"text":"• Read and record the measurement as shown in diagram above Ask the mother/caregiver to remove any clothing that may cover the child's less active arm. If the child can stand and it is possible, the child should stand erect and sideways to the measurer."},{"index":9,"size":24,"text":"Bend the arm at 90. Estimate the midpoint of the upper arm by locating the tip of the shoulder and tip of the elbow."},{"index":10,"size":31,"text":"Straighten the child's arm and wrap the tape around the arm at the midpoint. Make sure the numbers are right side up. Make sure the tape is flat around the skin."}]},{"head":"Oedema","index":113,"paragraphs":[{"index":1,"size":48,"text":"Oedema is a build-up of fluids in the tissues causing abnormal swelling of the hands and feet or other body parts. The body requires nutrients for various processes that lead to normal fluid balance. Oedema caused by malnutrition has to occur in both limbs at the same time."}]},{"head":"Measuring oedema","index":114,"paragraphs":[{"index":1,"size":8,"text":"• Apply normal thumb pressure on both feet"},{"index":2,"size":15,"text":"• Count the numbers 101, 102, 103 to estimate three seconds without using a watch"},{"index":3,"size":10,"text":"• Check if a shallow print persists on both feet"},{"index":4,"size":21,"text":"• If the print persits in both feet, it implies the child has nutritional odema (pitting oedema) and is severely malnourished"}]},{"head":"Recommendations","index":115,"paragraphs":[{"index":1,"size":17,"text":"• If no oedema is found (0): Advise the caregiver to continue with healthy feeding the baby"},{"index":2,"size":14,"text":"• If oedema is found, the child should be referred to a health facility."},{"index":3,"size":9,"text":"• Follow-up to ensure the child went for healthcare"}]},{"head":"Referral of malnourished children","index":116,"paragraphs":[{"index":1,"size":14,"text":"It is important that the malnourished children identified are referred to a health facility."},{"index":2,"size":99,"text":"The existing government health structures can be used, starting with a referral to the village health worker Community Health Extension Workers (CHEWs) are individuals within the community who are equipped to further refer the child to the appropriate health facility. The participants and the project management team can also be guided to develop an appropriate referral and reporting system. Because of its complexity and proneness to mistakes, Weight-for-Height/Length the persons taking the measurement need to be trained on how to use the equipment and that there is a need to do more than 1 measurement to catch any errors."},{"index":3,"size":24,"text":"Weight-for-Height implies the following steps:-Taking the height or length Calculating the weight for height/length percentages Taking the weight of a child/adolescent using electronic scales:"},{"index":4,"size":10,"text":"1. Place the electronic scale on a flat, level surface."},{"index":5,"size":9,"text":"2. Check and readjust the weight reading to zero."},{"index":6,"size":4,"text":"3. Undress the child."},{"index":7,"size":11,"text":"4. Make him/her stand on the middle of the scale's surface."},{"index":8,"size":38,"text":"5. When the child is settled and the weight reading is stable record the weight to the nearest 100g. Make sure that nobody holds the child during weighing and that the child stands freely without holding onto anything."},{"index":9,"size":23,"text":"6. Read and announce the value from the scale. The assistant should repeat the Value for verification and record 7. Record it immediately."},{"index":10,"size":11,"text":"Taking the weight of a caregiver with child using electronic scales:"},{"index":11,"size":10,"text":"1. Place the electronic scale on a flat, level surface."},{"index":12,"size":9,"text":"2. Check and readjust the weight reading to zero."},{"index":13,"size":4,"text":"3. Undress the child."},{"index":14,"size":39,"text":"4. Ask the caregiver to stand on the scale's surface in the middle and record their weight to the nearest 100g when the caregiver is settled and the weight reading is stable 5. Hand the child to the caregiver."},{"index":15,"size":22,"text":"6. When the caregiver is settled with the child and the weight reading is stable record the weight to the nearest 100g."},{"index":16,"size":21,"text":"7. Read and announce the value from the scale. The assistant should repeat the value for verification and record it immediately."}]},{"head":"Adults body mass index (BMI)","index":117,"paragraphs":[{"index":1,"size":50,"text":"A quite different anthropometric index is used to measure acute protein-energy malnutrition (sometimes called \"chronic energy deficiency\") in adults). This is the body mass index (BMI) unlike weight-for-height in children, you divide weight by height, or rather, and you divide weight in kilograms by the square of height in meters:"},{"index":2,"size":105,"text":"The cut-off point defining malnutrition is the same for all adults, regardless of their age, height, or sex: The household dietary diversity score (HDDS) is meant to reflect, in a snapshot form, the economic ability of a household to access a variety of foods. The increase in dietary diversity is associated with socio-economic status and household food security (household energy availability). To measure household dietary diversity, 12 standard food groups. Consumption of less than 4 food groups is considered low dietary diversity, consumption of between 4-5food groups is considered moderate dietary diversity while consumption of more than 6 food groups is considered high dietary diversity."},{"index":3,"size":33,"text":"Individual dietary diversity scores aim to reflect nutrient adequacy. Studies in different age groups have shown that an increase in individual dietary diversity score is related to increased nutrient adequacy of the diet."},{"index":4,"size":64,"text":"House Hold Hunger Scale (HHS); this focuses on the food quantity dimension of food access and does not measure dietary quality. It can be used to monitor prevalence of hunger over time, assess food security situation, monitor and evaluate the impact of ant hunger policies and programs, provide information for early warning of nutrition and food security surveillance. This involves asking 3 main questions:"},{"index":5,"size":22,"text":"• Was there ever no food to eat of any kind in your house because of lack of resources to get food?"},{"index":6,"size":19,"text":"• Did you or any household member go to sleep at night hungry because there was not enough food?"},{"index":7,"size":22,"text":"• Did you or any household member go a whole day and night without eating anything because there was not enough food?"},{"index":8,"size":9,"text":"For each question one asks how frequently that happened."},{"index":9,"size":47,"text":"HHS should therefore not be used as a standalone measure of food security but instead as one of the tools to measure complimentary aspects of food insecurity (such as anthropometric data, House hold income and expenditure, Food production and consumption and House hold and individual dietary diversity."}]}],"figures":[{"text":" plans for PMU members "},{"text":"Figure 2 . Figure 2. Example sources of animal protein. "},{"text":"Figure 3 . Figure 3. Example sources of plant protein. "},{"text":"Figure 4 . Figure 4. Example sources of vitamins and minerals. "},{"text":" Cereals and grains (6 slices of bread / 2 cupped palms Cooked Ugali, Matoke, Boiled banana / 3 cupped palms cooked Rice / 3 medium pieces of Cassava or Sweetpotatoes) "},{"text":"Figure 5 . Figure 5. The food pyramid. "},{"text":" Continue breast feeding up to at least 2 years of age even as you provide other foods If a child is sick, encourage them to eat and drink, even if they have little appetite. Increase breastfeeding frequency, provide more fluids (water, juice, soup) Ensure the diet includes foods rich in protein, vitamin A and iron to ensure the child's growth Obtain vitamin A supplementation for children under 5 years from the health centre Deworm all children every 6 months starting at 2 years Ensure that children are fully immunized and keep the health card/book safely Use iodized salt in the home for the whole family. Iodine promotes physical development and prevents miscarriages Have a backyard garden with different green leafy vegetables to provide the vegetables needed by the family throughout the year Important nutrition points to remember 3.0. Malnutrition Method: Presentations and discussion Activity 1: Brainstorming, question and answer as slides are presented. "},{"text":"Figure 6 : Figure6: showing conceptual framework of malnutrition(UNICEF, 1991)     "},{"text":"Figure 8 : Figure 8: clinical signs of anemia (source-UNICEF 2014) "},{"text":"Figure 9 : Figure 9: Picture showing Bigot's sport in a person with vit A deficiency (source-UNICEF 2014) "},{"text":"Figure 10 : Figure 10: Picture showing goitre as an advanced sign of iodine deficiency (source-UNICEF 2014) "},{"text":"Figure 13 .Figure 14 : Figure 13.Figure 2.Measuring the length of a child below 2 years of age.(source: Modified from multiple indicator cluster surveys) "},{"text":"Figure 15 . Figure15.assessment of bilateral oedema(UNICEF 1991)     "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Types of nutrients Facilitator asks the participants to mention the types of nutrients they know of and examples of food items available in their community that are rich in each of the nutrients listed, let participants mention as many types as they can. After the participants provide the responses the facilitator moves forward to provide the right information and details as provided in the session technical notes and ensuring there is great participation and discussion during the process and welcoming questions and making clarifications.  Time: 60 minutes Time:60 minutes Method: Question / answer Method:Question / answer Materials needed: Flip chart, Flip chart board, Marker pens, Block notes Materials needed: Flip chart, Flip chart board, Marker pens, Block notes Session technical notes Session technical notes 1. Macro (big) nutrients 1. Macro (big) nutrients These are nutrients needed in large amounts. They These are nutrients needed in large amounts. They include:  include:  "},{"text":" Which continues the cycle. It is therefore important that interventions to address and prevent malnutrition are taken at each stage of the life cycle. An illustration of the cycle of malnutrition   An illustration of the cycle of malnutrition The Cycle of Undernutrition  The Cycle of Undernutrition Inadequate food and health care PREGNANT WOMEN Low weight gain Increased maternal  Inadequate food and health carePREGNANT WOMEN Low weight gain Increased maternal  mortality  mortality ADOLESCENTS Stunted growth Decreased physical capacity ADULT MEN AND WOMEN Poor health Poor productivity in the work force INFANTS Low birth weight High mortality rate Impaired mental development Increased risk of adult ADOLESCENTS Stunted growth Decreased physical capacityADULT MEN AND WOMEN Poor health Poor productivity in the work forceINFANTS Low birth weight High mortality rate Impaired mental development Increased risk of adult   chronic disease chronic disease Inadequate food and health care CHILDREN Stunted growth Impaired immunity Reduced mental capacity Inadequate food and health care Frequent infections Inadequate food and health careCHILDREN Stunted growth Impaired immunity Reduced mental capacityInadequate food and health care Frequent infections Frequent infections   Frequent infections Copyright 2010, John Wiley & Sons, Inc.  Copyright 2010, John Wiley & Sons, Inc.  "},{"text":"Table showing child dietary diversity score exercise   Minimum Minimum Minimum MinimumMinimumMinimum  meal dietary acceptable diet mealdietaryacceptable diet  frequency diversity  frequencydiversity Reference 3 times a 4 food Has both Reference 3 times a4 foodHas both  day groups minimum meal daygroupsminimum meal    frequency, frequency,    minimum dietary minimum dietary    diversity diversity 1 2 (No) 4 (yes) No 12 (No)4 (yes)No 2 3 (yes) 3 (no) No 23 (yes)3 (no)No 3 4 (yes) 3 (no) No 34 (yes)3 (no)No 4 3 (yes) 5 (yes) Yes 43 (yes)5 (yes)Yes  "},{"text":"Table showing questions used to assess household food insecurity  1 Worry that you would not have enough food 1Worry that you would not have enough food  because of a lack of food, money or other because of a lack of food, money or other  resources?  resources? 2 Not able to eat healthy and nutritious food 2Not able to eat healthy and nutritious food  because of a lack of food, money or other because of a lack of food, money or other  resources?  resources? 3 Eat a limited variety of food because of a lack of 3Eat a limited variety of food because of a lack of  food, money or other resources? food, money or other resources? 4 Skip a meal because of a lack of food, money or 4Skip a meal because of a lack of food, money or  other resources?  other resources? 5 Eat a smaller meal than you felt you needed 5Eat a smaller meal than you felt you needed  because of a lack of food, money or other because of a lack of food, money or other  resources?  resources? 6 Have no food to eat of any kind in your household 6Have no food to eat of any kind in your household  of a lack of resources to get food? of a lack of resources to get food? 7 Were hungry but not able to eat of a lack of 7Were hungry but not able to eat of a lack of  resources to get food?  resources to get food? 8 Go a whole day without eating anything at all 8Go a whole day without eating anything at all  because of a lack of resources to get food? because of a lack of resources to get food? The answers are placed on a scale of severity of food The answers are placed on a scale of severity of food insecurity as shown below:  insecurity as shown below: Mild food insecurity  Severe food insecurity Mild food insecuritySevere food insecurity Uncertainty regarding Compromising on food Reducing food quantities, Experiencing Uncertainty regardingCompromising on foodReducing food quantities,Experiencing ability to obtain food quality and variety skipping meals hunger ability to obtain foodquality and varietyskipping mealshunger  "},{"text":" Is a food group diversity indicator that has been shown to reflect one key dimension of diet quality especially micronutrient adequacy. Ten food groups are considered here namely; 1. All starchy staples; 2. Beans peas; 3. Nuts and seeds; 4. Dairy; 5. Flesh foods (meats); 6. Eggs; 7. Vitamin A rich dark green leafy vegetables; 8. Other vitamin A rich vegetables and fruits; 9. Other vegetables; 10. Other fruits. Consumption of foods from any 5 food groups and above indicated meeting minimum dietary diversity. Anthropometric equipment needed Minimum Dietary Diversity Score for Women  Anthropometric equipment needed Minimum Dietary Diversity Score for Women (MDDS-W):   (MDDS-W): Height: height boards Weight: weighing scales MUAC: MUAC tapes Height: height boardsWeight: weighing scalesMUAC: MUAC tapes  "}],"sieverID":"99f097c2-c502-4046-a5ba-0703aa69313f","abstract":"Key messages from the sessions 4:30 -4.50 pm (20 minutes)Way forward How they will mainstream nutrition into the PRELNOR and VODP II frame work 4:50 -5:00pm Closure"}

data/part_5/011bc3e24807ec9880ccc059cbc8a49c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"011bc3e24807ec9880ccc059cbc8a49c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9ea1659d-3a91-4cbf-8d50-05c560039ffd/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[{"head":"Introduction Methodology","index":1,"paragraphs":[{"index":1,"size":29,"text":"Latin America plays an essential role in the global cattle industry, since it contributes with more than 25% to the global beef and 10% to the global milk supply."},{"index":2,"size":41,"text":"Despite the importance of the sector for the region and its growth potential, the environmental effects of traditional or conventional cattle production systems are multiple and include e.g., impacts on water sources, soil resources, a loss of biodiversity and GHG emissions."},{"index":3,"size":16,"text":"This has led to discussions about the transition from a conventional to a sustainable cattle sector."}]},{"head":"Objective","index":2,"paragraphs":[]},{"head":"Results","index":3,"paragraphs":[{"index":1,"size":29,"text":"To identify successes and difficulties in the implementation of public policies for the development of a sustainable cattle sector in Colombia, Argentina and Costa Rica between the years 2010-2020."}]},{"head":"COLOMBIA Successs","index":4,"paragraphs":[{"index":1,"size":70,"text":" Stability of the political-economic system for more than 3 decades.  Continuity of the promotion of a sustainable cattle sector in the NDPs.  Existence of a national level Roundtable for Sustainable Cattle.  Strong progress in the formulation of a national level public policy on sustainable cattle.  Promotion of SPS through on regional and national policies.  Existence of a credit line for the establishment of SPS."}]},{"head":"Difficulties","index":5,"paragraphs":[{"index":1,"size":163,"text":" The public policy framework is still very young and at its early stages.  The Departmental Agricultural Extension Plans are still very young and at their early stages, and they also do not exist for all departments with relevance to the cattle sector.  Insufficient coordination between national and regional level public policies.  Lack of clear budgets to carry out some of the policies, particularly from the NDP and the Departmental Agricultural Extension Plans. COSTA RICA Successs  Political stability for several decades.  Low inflation and stable exchange rates.  NDPs include sustainable production components.  Diversity of national and regional public policies framed in the objective of carbon neutrality.  Regional Livestock Development Plans with focus on environmental sustainability.  Promotion of SPS through both national and regional policies.  Existence of payment schemes for ecosystem services and agroforestry programs. Difficulties  Absence of a sustainable cattle roundtable or any similar initiative.  Postponement of the carbon neutrality objective."},{"index":2,"size":30,"text":"The sustainable development of the cattle sector is an unquestionable need. International demands, in addition to the role of different actors, deny any possibility of continuing with traditional production practices."},{"index":3,"size":29,"text":"Despite the fact that the results achieved so far are not fully satisfactory, the implemented policies should not be abandoned, but rather persist and be expressed in tangible effects."},{"index":4,"size":56,"text":"Finally, it is emphasized that although the policies achieved so far provide valuable contributions, it is necessary to assume them as a first stage in a long-term process. This process implies the contribution of all actors, from international organizations to public entities, cattle producers, unions and associations, the private sector, academia, and society as a whole."}]},{"head":"Conclusions","index":6,"paragraphs":[{"index":1,"size":28,"text":"In order to address the proposed objective, we decided to write a review article with a qualitative-descriptive approach. Literature review was used as the main data collection technique."},{"index":2,"size":29,"text":"Data collection was carried out from January to May 2021 and prioritized three types of data sources: a) governmental reports, b) publications of international organizations, and c) scientific articles."},{"index":3,"size":102,"text":"With the aim of presenting a picture as complete as possible of each of the studied scenarios, aspects such as the countries' context, National Development Plans (NDPs), legislative advances, multi-sectoral initiatives and regional and national policies were considered.   National public policies articulated with the provinces.  Regional policies that promote the adoption of SPS and good animal husbandry practices. Difficulties  Environmental conditions that affected and still affect the cattle sector.  High political instability that has led to changes in the devel. model.  Increased inflation and unstable exchange rate.  Decrease in wages and reduction in national beef consumption."}]}],"figures":[{"text":" This poster is licensed for use under the Creative Commons Attribution 4.0 International license (CC BY 4.0) 2023-10. Design: JL Urrea/CIAT. "},{"text":"Public policies for the development of sustainable cattle sector with silvo-pastoral systems in Colombia, Argentina, & Costa Rica Poster prepared for: ARGENTINA Successs Stefan Burkart ; Leonardo Moreno-Lerma 2 ; Manuel Díaz 2 ; Natalia Triana-Ángel 1 .International Center for Tropical Agriculture (CIAT), Tropical Forages Program; 2 Independent consultant, Cali-Colombia. CONTACT: [email protected]  NDP with an environmental sustainability component. Existence of laws that promote forest protection, environmental balance and climate change mitigation strategies.  Development of multi-sector initiatives that promote sustainable beef production.  Existence of the Argentine Sustainable Beef Board.  "}],"sieverID":"ddcd365c-96ce-4ac0-b420-46f46ce1bb46","abstract":""}

data/part_5/01642ef808e9254c6a700c28147d814e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01642ef808e9254c6a700c28147d814e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5917af0e-0bb2-4bbb-99a1-b4a2971f6f57/retrieve"},"pageCount":13,"title":"Delineating investment opportunities for stakeholders in sorghum seed systems: a logit model perspective","keywords":["Sorghum","Informal and formal seed systems","Seed business","Smallholder farmers","Tanzania"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":244,"text":"more food available to households [2]. Food security exists when all people, at all times have physical, socio, and economic access to sufficient, safe, and nutritious food that meets their dietary needs and food preferences for an active and healthy life [3]. For decades' food and nutrition security and poverty reduction have been among the top areas of interventions in SSA countries through various public policies and investments for agricultural development. Yet, tackling these issues in the developing countries continues to be a major challenge [4]. In most SSA countries, agricultural productivity challenges are still persistent, and the region has the lowest productivity in the world [5]. As a result, food insecurity and extreme poverty are still rampart, especially in rural areas. In addition, the challenges of rapidly increasing population, natural resource depletion, increased negative impacts of climate change further exacerbate the problems. The aforementioned factors are therefore compelling for an increased sustainable agriculture productivity [6]. Increased agricultural productivity can improve the welfare of households by enhancing their income and food security [7]. In that regard, sustainable agricultural intensification measures to raise yields and production in the currently available arable land without destroying the environment become a requisite. This is also one of the requirements for attaining the Malabo Declaration goal of eradicating hunger, halving poverty in Africa by 2025, as well as achieving the sustainable development goals by 2030, which particularly aims to achieve food security, improve nutrition, and promote sustainable agriculture [8]."},{"index":2,"size":241,"text":"Seed systems are considered as a vehicle through which the sustainable agricultural intensification can be achieved. By seed systems, we understand the different ways farmers can access seeds including the different actors involved in the seed value chain [9]. The seed sector plays an important role in combating food insecurity by availing quality seeds to farmers. Seed is the single most important input for agricultural systems [10]. It possesses a unique feature of being both an agricultural input and output at different periods to different users. Seed is a key determinant of agricultural productivity as it determines both the quantity and quality of the outputs [11]. It is a vehicle for delivering a range of advances such as promoting productivity, nutrition, and resilience, all of which benefit smallholder farmers [12]. In every country, the seed systems are composed of different components, broadly categorized into two and known as formal and informal seed systems [13]. The formal seed system is made up of strict quality-controlled seed. It is usually governed by strict policies and regulations. It is market-oriented and managed by public and private sectors [14]. The informal seed system is a farmer-and community-based, local or traditional seed sector. Activities in the informal seed system are mostly decentralized and depend on the farmers' knowledge [12]. It includes continuous use of home-saved seed [15]. It does not conform to any rule prescribed in the seed regulations at national, regional, and international levels [16]."},{"index":3,"size":145,"text":"Between the formal and informal seed systems, there is an intermediate system that integrates the formal and informal systems [17]. The intermediate seed system also called semi-formal seed system aims at empowering registered farmer groups to produce seeds from known source and make them accessible to their peer farmers [18]. These farmer groups are registered either at village or ward level by the local authority, programs or projects. Intermediate seed system looks for opportunities and options to improve both formal and informal systems by recognizing and supporting integration through combining methods from both systems [19]. The three principal components of the intermediate system include cultivars developed and used, seed produced, and stored by famers under local conditions and seed exchange mechanism [20]. Research and development organizations are the pioneers of the intermediate systems as a strategy to fast track quality seed supply to smallholder farmers."},{"index":4,"size":207,"text":"Investments to improve the delivery of seed systems have long been an important component of agricultural development strategies. This can yield high returns in terms of seed production security, food and nutritional security, agricultural productivity, as well as poverty reduction [21]. Diverse and often opposing philosophies shapes seed sector development and much depends on what actors see as the entry point [12]. Levels of investment in many national seed systems tend to be low, varieties produced are not being multiplied, and if they are multiplied, then they do not reach most of the small-scale farmers [22]. However, over the years, gaps within the seed systems have led to different types of interventions, supported by various narratives that foresee different pathways into the future, and it has attracted substantial investments. For instance, from 2007 to 2012, the World Bank has funded 87 seed sector projects worth $US 513 million with strong focus on marginal crops such as sorghum [12]. Although these projects vary in shape and scale, the majority strive to make quality seeds and traits more available and accessible to farmers. There is however still a notion that despite the tremendous investments, the outcomes are yet to meet expectations and interest of farmers are left unattended [23]."},{"index":5,"size":46,"text":"This justifies the need for further research to delineate investment opportunities for enhanced and sustainable quality seed production and delivery to marginalized farming communities in the dryland areas. Therefore, this study aims at delineating the investment opportunities in seed systems, with a case study on sorghum."}]},{"head":"Study context","index":2,"paragraphs":[{"index":1,"size":174,"text":"In Tanzania, agriculture accounts for 25.8% of the GDP and provides 80% of the total employment [24]. Like most SSA countries, Tanzanian seed industry consists of formal, informal, and intermediate seed systems [25]. With the formal system accounting for around 25% of required seeds [26], the informal system remains a highly important seed supply source for farmers who continue expanding it [27]. To meet seed demand, Government and development organizations, through public and private seed companies and farmer organizations [28] have been investing in seed delivery systems to facilitate quality seed access. Quality seed which in this study refers to improved variety seed can briefly be defined as seeds that have been produced using formal plant breeding methods with the aim of increasing productivity and production of crops to farmers. Food security and nutrition of people depends on the amount and stability of their farm outputs and income [29] which can be achieved through a good choice of seeds to grow and a strong seed system that supports delivery of quality seeds to farmers."},{"index":2,"size":47,"text":"Development organizations including CGIAR, ASARECA, and AGRA have undertaken many seed system initiatives through various projects and programs to ensure reliable supply of affordable quality seeds to the farmers [30], so that they can increase agricultural productivity, nutrition and rural well-being [31], as well as food security."},{"index":3,"size":103,"text":"Despite these public and private investments and assistance of development organizations, the seed sector is still underdeveloped with mixed performance in most SSA countries [32]. In the context of Tanzania, only a few crops such as maize and rice have a much-advanced seed production and delivery systems as compared to dryland crops like sorghum [33]. Insufficient policy initiatives, including poor public investments to support sorghum seed systems, undermine the reliable availability of quality sorghum seeds. It is still unclear whether the current sorghum seed system will generate enough motivations for the private sector to deliver quality seeds at affordable prices and at scale."},{"index":4,"size":73,"text":"The study aims to define the investment opportunities for stakeholders in the sorghum seed systems. It focuses on the following four research questions (i) to what extent farmers are growing improved variety seeds? (ii) What are the source farmers use to obtain improved varieties? (iii) What are the main factors positively associated with planting of improved variety seeds by farmers? (iv) Is there profitability of producing certified seed and quality declared seeds (QDS)?"},{"index":5,"size":116,"text":"This paper is organized into seven sections. \"Background\" section provides information on relevant literature related to seed systems, their categorization and functions; also efforts to invest in the existing seed systems are discussed. \"Study context\" section presents seed systems in Tanzania and initiatives that have been taken to improve it. \"Conceptual framework\" section discusses different approaches employed to uncover the investment opportunities in the sorghum seed systems. \"Data and Methodology\" section delivers the methodological approach to achieving the objectives of the study. \"Results\" section presents the findings and some analyses. \"Discussion\" section discusses results of the study and place them into the wider context. \"Conclusion\" section summarizes the paper and presents recommendations arising from this study."}]},{"head":"Conceptual framework","index":3,"paragraphs":[{"index":1,"size":87,"text":"Circumventing investment areas in seed systems to enhance seed production and delivery to farmers can be approached from various angles. In this study, we approach the subject from the perspective of existing gaps in the seed production and delivery systems. According to McGuire [34], gaps in seed system permit a holistic analysis of possible areas for investment. This involves analysis of the number of potential users, understanding seed sources farmers use, understanding factors correlated with farmer choices of improved variety, and profitability of producing seed and grain."},{"index":2,"size":175,"text":"On one hand, the low number of farmers using seed of improved varieties might indicate difficulties in new variety seed uptake. On the other hand, the low number of potential users is concerned with the assumption that there is a large market opportunity to conquer. Supplying seed to those farmers who have not been using improved varieties through collaboration with various stakeholders could then be explored. The sources farmers use to obtain seed of improved varieties provide option to identify the most predominant seed source and subsequent steps needed to boost quality seed demand. The different seed sources that farmers use shows the path that the public and private sectors can leverage on to disseminate improved variety seeds that reach more farmers. The channels farmers use to assess improved variety seeds are important especially in determining the degree and nature of investment within the seed systems [35]. In this study, the formal and intermediate seed systems are put together and termed as formal seed systems, while the informal seed system is taken as stand-alone system."},{"index":3,"size":105,"text":"The factors with positive correlation with improved variety seed planting by farmers indicate the areas to work on by various stakeholders. Understanding these factors and how they influence the use of improved variety seeds is important to develop strategies to sustain sorghum variety seed delivery. Farmer's decision to whether and how to use improved variety seeds are conditioned by a number of factors and circumstances [36]. Logit model can be used to analyze underlining factors of farmer's decision to use improved seeds. Several studies (e.g., [29], [37], [38]) have used logit model to analyze different factors influencing farmers' choice to use seed of improved varieties."},{"index":4,"size":150,"text":"The profitability of producing certified and QDS seeds and grain also provides investment incentive for seed producers and farmers. Profit is a main indicator of viability of an enterprise, and ideally, it can be measured using gross margin. This is supported by Mvungi et al. [39] that gross margin is used as a measure of enterprise profitability. Moreover, Fani et al. [40] asserted that gross margin has been used for many years in various literatures to analyze the profitability of farm production practices. Gross margin is the difference between total revenue and total variable cost associated with the enterprise [41]. In that regard, for this study, gross margin can be used to measure profitability of sorghum seed producers and farmers, since it analyzes the performance of an enterprise. Good margin would be an incentive to seed companies to invest in sorghum seed production and farmers to look for quality seed."}]},{"head":"Data and methodology","index":4,"paragraphs":[{"index":1,"size":82,"text":"The study was conducted in nine districts of which seven had undergone seed system interventions through project activities to facilitate seed access to communities. The project \"harnessing opportunities for productivity enhancement (HOPE)\" was implemented in the intervention areas between 2009-2020. The project facilitated seed production and delivery to farmers using public and private partnerships and community seed production scheme. These districts were Mkalama, Singida DC, Iramba, Ikungi, Serengeti, Rombo, and Momba, whereas the districts that had no intervention were Kongwa and Tarime."},{"index":2,"size":109,"text":"Cross-sectional research design was employed, and data were collected across the surveyed districts. To obtain detailed information, household survey was conducted as well as key informant interviews, with the household survey conducted using semi-structured interviews. To gather information from the respondents, face to face interviews were employed per person using a questionnaire. The sample frame was composed of farmers and seed producers. Some of the information collected from the households included type of varieties used by farmers, sources farmers use to obtain improved seeds, socio-economic characteristics, and cost of grain production. Seed producers' information included cost of seed production, price of seed sold/kg, and amount of sorghum seed sold."},{"index":3,"size":48,"text":"Two types of sampling were used namely purposive sampling and simple random sampling. The purposive sampling was used to select nine main sorghum growing districts and the main sorghum growing villages per selected district. The simple random sampling was used to select 212 farmers and five seed producers."},{"index":4,"size":88,"text":"Data were analyzed in Stata version 13 software using descriptive statistics, gross margin, and logit regression model. Descriptive statistics included percentage of growers of improved variety seeds vs. non-growers and sources used by farmers to obtain improved variety seeds. Gross margin was used to evaluate the profitability for seed enterprise and farmers but also one of the ways to identify investment opportunities in sorghum seed systems. Values computed for gross margin of seed production and grain production are individual data obtained from the interviews on a hectare basis."},{"index":5,"size":4,"text":"It was computed by"},{"index":6,"size":98,"text":"where GM = Gross Margin; Q y = Total output of crop (kg); P y = Unit of price of output (TZS); X i = Quantity of the input used (kg); P x i = Price per unit of the input (TZS); Q y P y = Total revenue associated with the output (TZS); ∑ X i P x i = Summation (overall inputs to give the Total Variable Costs). Thus GM = Gross total revenue − Total variable costs. Here, GM = Gross Margin (TZS/ha); GTR = Gross total revenue (TZS/ha); TVC = Total variable costs (TZS/ha)."},{"index":7,"size":126,"text":"Logit regression model was used to identify factors positively correlated with planting of improved variety seeds by sorghum farmers. The model was fit to estimate the relationship to planting of improved variety seeds, since it analyzes the association between a categorical dependent variable and a set of independent variables [42]. In this study, the dependent variable is the use or not of seed of improved sorghum varieties by farmers, taking the values of 1 or 0. The value 1 indicates farmers who planted improved sorghum seeds and value 0 indicates farmers who did not. The independent variables linked to the binary dependent variables were variety preference, group membership, availability of improved variety seeds, seed price, resistance to drought, resistance to disease, farm size, and education level."},{"index":8,"size":23,"text":"Past studies have suggested that farmer's decision to plant improved variety seeds is associated with different factors such as socio-economic, institutional, production (1)"},{"index":9,"size":293,"text":"characteristics, and preference. Socio-economic factors like education, whereby education level is associated with the ability to acquire and use improved seeds [43]. Hence, farmers who are educated may use improved seeds than farmers with no education. Farm size is a key indicator of the capacity to earn agriculture income [44], and often, it represents wealth status of the family. Therefore, farmers with large farm size may have more proceeds to purchase improved seeds than farmers with small farm size. Group membership of a farmer may increase access to information on improved seeds [45]. Thus, membership of a farmer's group may increase the likelihood of planting improved seeds. Variety preference has been incorporated in the model, because it captures the effect of farmer's variety preference which may affect farmers' choice of variety for planting. Availability of seed enhances the farmers' decision to plant improved seeds [44]. Availability of improved seeds ensures food security and prosperity of the farmer. Thus, when improved seeds are available to the farmers at the right time, then it may improve farmers' access to seed and ultimately influence the farmers to plant improved seeds. Production characteristics like resistance to drought and resistance to disease are important for explaining choice of planting improved seeds [46,47]. This is because varieties that can resist drought and disease have more potential of producing more yield than variety without these characteristics, therefore increasing the likelihood of farmers to plant improved seeds. Seed price is a valuable factor in shaping farmer's choice to plant improved seeds [48]. Although improved seeds might give high yield, but if it is not affordable, then it can cause farmers to be reluctant to plant it. The probability (P i ) that a farmer plants improved sorghum seeds is as follows:"},{"index":10,"size":1,"text":"(2)"},{"index":11,"size":53,"text":"where β 0 is constant and Y i is equal to one (1) when a choice is made to plant improved seed and zero (0) otherwise; this means: the equation represents a binary choice involving the estimation of the probability of planning improved sorghum seeds (Y) as a function of independent variables (X)."},{"index":12,"size":24,"text":"The logit model uses a logistic cumulative distributive function to estimate, P given by where k represents number of independent variables to be analyzed."},{"index":13,"size":10,"text":"The model is specified as indicated by Eq. ( 6):"},{"index":14,"size":69,"text":"where Y = growing of improved variety seeds; Ln ( P 1−P ) = the ratio of probability of planting improved variety seeds (p) to not planting improved variety seeds (1 − p); β = Slope of coefficient; X k = vector of the explanatory variables (variety preference, group membership, seed availability, seed price, resistance to diseases, resistance to drought, farm size, and education level); ε = error term."},{"index":15,"size":11,"text":"The model was expanded to include the variables in Table 1."},{"index":16,"size":1,"text":"( "}]},{"head":"Results","index":5,"paragraphs":[]},{"head":"Farmers growing improved variety seeds among intervention districts and non-intervention districts","index":6,"paragraphs":[{"index":1,"size":93,"text":"Out of the 212 farmers sampled, 39.2% were growing improved variety seeds. Table 2 shows that Singida DC in the intervention districts had the highest rate of farmers growing improved variety seeds of about 23%, followed by Momba with 20.7%. The results also show that within the intervention areas, there were districts that have below 5% of farmers producing improved varieties. Kongwa, a non-intervention district hosting the largest grain market in Tanzania, showed 20.4% of growers of improved variety seeds. The lowest percentage (1.3%) was recorded in Tarime which is a non-intervention district."}]},{"head":"Sources used by farmers to obtain seed of improved varieties","index":7,"paragraphs":[{"index":1,"size":156,"text":"Farmers using improved varieties obtained their seeds from both formal and informal sources. However, it was observed that 57.8% of the farmers used informal sources to acquire improved variety seeds (own-saved seeds, neighbor), while 42.2% of them obtained seeds from formal sources (NGOs, QDS producers, Government, agro-dealers). Specifically, the survey identified six different sources of seed supply used by farmers to access the improved variety seeds (Table 3). It was noted that 48.2% of the farmers obtained seeds from their own stock, indicating that this source was the most important of the six sources. The Government as well as NGOs were also important sources of seed supply to the farmers with 25.3% and 13.3%, respectively. The use of other sources than the ones mentioned above was modest with 9.6% farmers accessing seeds from neighbors and 2.4% farmers accessing seed from QDS producers. Seed access through agro-dealers was almost non-existent, representing only 1.2% of farmer's seed source."}]},{"head":"Factors correlated with planting of improved variety seed by farmers","index":8,"paragraphs":[{"index":1,"size":127,"text":"The results of the Chi-square test were statistically significant at 1% level, suggesting that the explanatory variables jointly account for planting of improved sorghum seeds. Variety preference, seed availability, diseases resistance, and drought resistance significantly influenced planting of improved sorghum seed. Variety preference had a positive influence on planting of improved variety seeds at 10% significance level (p < 0.1). It is estimated that farmer preference for improved variety leads to the increase of probability of growing the seed by 3.6% (Table 4). Seed availability was also positive and had a significant effect on planting of improved variety seeds (p < 0.01). This indicates that an increase in availability of improved variety seed enhances the probability of farmers growing improved seeds by 10.6% holding other factors constant."},{"index":2,"size":83,"text":"The estimated coefficients of resistance to diseases were positive and significant at 1% significance level (p < 0.01). Implying that ability of the improved variety seed to tolerate diseases increases the probability to grow improved variety seeds by 6.1%. Tolerance to drought was positively correlated with the planting of improved variety seeds and significant at 1% significance level (p < 0.01). The estimates show that the farmer planting of improved variety seeds increases by 7.2% if the improved variety is drought-tolerant (Table 4).  "}]},{"head":"Profitability of certified and QDS seed and grain production as a proxy for investment worth in seed systems","index":9,"paragraphs":[]},{"head":"Gross margin analysis of sorghum seed production by seed companies and QDS producers","index":10,"paragraphs":[{"index":1,"size":127,"text":"It was important to show the margins that different seed producers obtained from sorghum seed production per ha to understand the viability of the seed business. Seed producers interviewed included seed companies and farmers who produced quality declared seed. The quality declared seed was produced by either individual farmer or a farmer group. Results from the interview show that (Table 5) the expenses on materials and operations incurred by seed producers in the production of sorghum seed. The total variable costs of producing sorghum seed was 59,41,100 TZS for seed companies and 4,85,291 TZS for QDS producers. Among the components of the total variable costs, the expenditure on operational costs accounted for the largest cost item and amounted about 60% for both seed companies and QDS producers."},{"index":2,"size":118,"text":"For the seed companies, certification costs had the major operational costs accounting for about 15%, while for the QDS producers, weeding and land preparation were the major operational activities that contributed to the cost of sorghum seed production accounting for around 21% and 13%, respectively (Table 5). Cost of chemicals was highest for seed companies, accounting for about 34%, while for QDS producers, fertilizer and rented land were the major inputs on which material expenditure was substantial accounting for about 14% each. Cost of seeds, bags and fertilizer application accounted for smaller share of the variable cost for seed companies (about 0.5% each), while for QDS producers, the lowest cost was for chemical application accounting for about 0.2%."},{"index":3,"size":52,"text":"The revenue per hectare of the seed companies and QDS farmers is presented in Table 6. Results from the interviews show that sorghum seed production is highly variable. Both categories of seed producers obtained a positive return. Seed companies producing certified seeds make larger revenue from sorghum seed production than QDS producers."}]},{"head":"Gross margin for growers and non-growers of seeds of improved varieties","index":11,"paragraphs":[{"index":1,"size":142,"text":"Results from the interview show that the total variable cost for growers of improved variety seeds was 5,30,980 TZS/ha, while for the non-growers, it was 4,73,886 TZS/ ha (Table 7). Among the components of the total variable costs, land rental, weeding labor, and land preparation were high for farmers. For growers of improved variety seeds land rental, weeding labor and land preparation were about 37%, 17%, and 14%, respectively, whereas non-growers of improved variety were about 34%, 13%, and 15%, respectively. However, planting material added more cost for non-growers of improved variety accounting for about 11.5%, since broadcasting method involves more amount to plant as compared to growers of improved variety seeds. The cost of insecticide accounted for a small share especially for non-growers of improved variety (0.4%) of the total variable cost against about 2% for growers of improved variety seeds."},{"index":2,"size":43,"text":"Table 8 shows that the average gross margin earned by farmer for sorghum production was 5,18,346 TZS/ ha. For farmers growing improved varieties, the average gross margin was significantly higher (8,19,805 TZS) than their counterpart producing old varieties (3,17,373 TZS) (p < 1%)."},{"index":3,"size":53,"text":"When data are disaggregated by intervention and nonintervention areas (Table 9), the average gross margin was 5,34,517 TZS/ha for farmers in district that underwent project intervention, while for farmers in nonintervention districts, it was 4,51,738 TZS/ha. This shows   that farmers in the intervention districts were obtaining higher profit than those in non-intervention districts."}]},{"head":"Discussion","index":12,"paragraphs":[{"index":1,"size":45,"text":"Effective seed systems have the potential to increase productivity and production by delivering quality seeds of new varieties to farmers. The development of an impactoriented seed system is a strategic choice which can be done through appropriate handling of investments areas in the seed sector."}]},{"head":"Filling the gaps of improved variety seed use by farmers","index":13,"paragraphs":[{"index":1,"size":462,"text":"Quality seed is vital to raising agricultural production and it is one of the basic inputs needed for breakthrough in crop production. Unfortunately, the results of this study demonstrate that most of the farmers were not growing improved variety seeds. Only about 39% of farmers planted improved variety seed among sampled farmers. This conquers with Aloyce et al. [49] who observed that improved variety seed planting by most sorghum farmers is low. The low proportion of farmer growing improved varieties indicates that most farmers were not experiencing maximum benefits from sorghum production. The high number of non-growers of improved variety seed constitutes an investment opportunity for seed companies, QDS producers, and farmer organizations involved in seed business. It is believed that an effective way to increase productivity and enhance peoples' livelihood is broad-based use of new farming technologies such as improved quality seeds. Unfortunately, farmer demand for quality seed remains inconsistent in SSA. Seed companies in Southern Africa failed to invest in developing rural retail networks for open pollinated varieties (OPV) seeds because of the uncertainty in seed demand [50]. Similarly, McGuire et al. [12] added that over the years, seed producers have been producing and supplying seeds, but they have been hindered by lack of demand. Nevertheless, if there is still score number of farmers that are still using landraces, it pertains that there is a huge market gap for the improved variety seeds that needs to be filled. There have been efforts by development organizations to fund the research, production, and supply of improved variety seed and awareness creation through projects, but a few areas have been covered [12]. For instance, organizations such as the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) have been developing and evaluating sorghum varieties targeting the dry lands in collaboration with Tanzania Ministry of Agriculture and other partner organizations [49]. The survey showed that in the intervention areas, there were higher proportions of farmers growing improved variety seeds against the non-intervention districts. This is a clear indication of the milestones that can be achieved through awareness creation activities to increase use of improved varieties. Only about 2% of total demands of certified seeds of sorghum were made available to the farmers in Tanzania in 2019 [51]. This emphasize that more investment is needed in production, marketing, promotion, and distribution of improved variety seeds to reach the majority of farmers who are not growing improved varieties. ESAFF [14] acknowledges that the lack of awareness negatively impacts the wide use of improved variety seeds. There is a need to accelerate the use of improved variety seeds to enhance the seed systems through synergized interventions from public and private sectors [14]. The private sector also bears responsibilities to increase farmer's awareness to grow the seed market."}]},{"head":"Sources used by farmers to acquire improved variety and avenue for growing seed market","index":14,"paragraphs":[{"index":1,"size":141,"text":"The study shows that farmers used both the informal and formal seed systems to obtain improved variety seeds for planting, with 57.8% of the farmers obtaining planting material from the informal sources during planting season. Similar findings were reported by Louwaars et al. [19] that most of the improved variety seeds were accessed through the informal seed system. Kusena et al. [52] add that informal seed system supports more than 80% of farmers in sub-Saharan Africa and feeding more than 70% of its population. This system is dominated mostly by own-saved seeds and seeds from neighbors. This corroborates the findings by Alemu et al. [53] that most farmers still depend on the use of saved seed or locally purchased seed. Farmers asserted using their own-saved seeds, because it is usually available during planting season compared to other sources of seed [54]."},{"index":2,"size":386,"text":"The dominance of the informal seed system shows that it will continue to play a major role in supplying sorghum seeds to farmers for the coming years. NGOs and government officers were facilitating more in seed delivery than agro-dealers and QDS producers. According to ESAFF [14], the coverage from agro-dealers is minimal in rural areas resulting in limited use of agri-inputs. Agro-dealers have a major role in seed supply systems. For proximity seed supply, agro-dealers network needs to be expanded through close collaboration with public and private seed companies. In the same vain, win-win linkages between QDS producers and seed companies will introduce more farmers to improved varieties and significantly increase the seed market. Croft et al. [55] noted that formal systems contribute very little amount of seeds accessed by farmers, even though they are responsible for developing new improved varieties. The gap in formal seed system opens up an opportunity for investors both in public and private sectors to develop strategic business partnerships to make seed available and accessible to smallholder farmers. This would meet the criteria of strong seed systems as reported by Etten et al. [21] who posited that a strong seed system relies on the interconnected performance of three key functions namely seed production and distribution, innovation, and regulations. The observation showing farmers purchasing a modest part of their seed from various sources implies that farmers would be willing to buy seeds. Similar results were observed in the study conducted on seed systems smallholder farmers use [12]. Farmers are usually reluctant to invest in quality seeds [56]. Thus, the presence of farmers purchasing improved variety seeds shows that farmers are already making such investments and this presents an opportunity to define strategies to improve seed supply to farmers. Understanding the commercial behavior of farmers concerning seed in terms of purchasing practices or use of own-saved seeds helps to gauge the seed market and target promotion to create demand and ensure supply [53]. The integration of both formal and informal seed systems is a major avenue to enhance effectiveness and expansion of seed market. This integration strengthens breeder-led and farmer-led linkages [57]. Through this, more farmers who are experienced with proper technical support and capacity building can invest in producing and diffusing enough quantity and quality improved variety seeds to other peer farmers."}]},{"head":"Opening seed market though factors correlated with farmers' planting of improved variety","index":15,"paragraphs":[{"index":1,"size":38,"text":"It is vital to know the underlying factors that correlate positively with planting of improved variety seeds by farmers. Finding solutions to such factors may in turn improve the use of seeds and ultimately improve sorghum seed system."},{"index":2,"size":323,"text":"The results indicated that variety preference, availability of seeds, resistance to diseases, and drought as the most significant factors motivating farmers to grow improved variety. Similar findings were reported by Timu et al. [58] and Tambo et al. [59]. These factors are perceived to improve crop yield. Akwango et al. [60] asserted that poor harvest threatens food security and livelihoods of household who depends on agriculture for food and income. Moreover, the above-mentioned significant factors are also perceived to develop resource use efficiency, and show consumer preference and acceptability in grain market [58,61,62]. The aforementioned factors indicate opportunity for investment to all stakeholders such as research institutes, seed companies, NGOs, and international institutions to develop the improved variety that meet the consumer expectations. Furthermore, the findings show that farmers' preference for variety traits affects their choice, implying that if the variety that does not have the desired traits is produced and supplied, then very few farmers will be attracted to purchase. Improved assessment of farmers' desire and preference contributes to improved seed system interventions [63]. In the light of this, Fadillah et al. [48] opined that the knowledge of ecological, genetic diversity, and traditional varieties in the crops provides much needed resource to build priority breeding programs for varieties preferred by farmers and markets. This implies that through understanding different factors hindering the use of improved variety seed, there is an opportunity for public and private sectors to invest in advanced research, breeding, and development of varieties that meet the market demand. Once seed enters the market, it should be considered part of the farmers' asset to nurture and grow, with support from public and private sector institutions as well as expertise to maintain and improve those varieties [64]. It is crucial that more scientific technologies are developed such as mutation genes of sorghum varieties for improved resistance to biotic and abiotic stresses as well as informing the production environment of farmers [65]."}]},{"head":"Profitability of producing certified seed, QDS, and grain of improved variety as investment incentive","index":16,"paragraphs":[{"index":1,"size":252,"text":"The results showed a positive gross margin for both seed companies and QDS producers. The difference in the margins obtained was mostly due to the price difference between the seed company and QDS producers with the QDS farmers gaining lower margin than the seed companies. Similar findings were reported by Katungi et al. [66] on common bean, Akpo et al. [67] on groundnut. Moreover, QDS producers did not bear certification fee and are able to sell their seeds at a lower price. Pal et al. [5] reported that certification costs were additional cost that increased seed production cost. Even though QDS is availed at affordable prices, it only sells within their local areas (ward) [68]. As a result, farmers outside these areas could not access seed; thus, they either access seed through researchers or extension officers. The potential of QDS lies in the ability to produce and supply quality seeds addressing the issue of affordability and proximity availability. This is supported by Coomes et al. [31] that farmer's seed and networks can be advantageous in terms of crop choice, accessibility, and cost. The potential to invest in seed systems lies in the positive gross margin obtained by seed companies and QDS producers. Private companies are profit motivated and usually deal in only small volumes for the less profitable crops [50]. Therefore, only profitable crops and varieties will drive investments in the seed systems. Thus, this becomes a motivation for private seed companies and QDS producers to sustainably invest in sorghum seed business."},{"index":2,"size":204,"text":"The gross margin for grain producers showed that using improved variety significantly incurs higher gross margin compared to old varieties. This result is in conformity with the findings of Maroud et al. [69] that farmers who used improved varieties showed higher marginal returns as opposed to those that used local varieties. Seed system also involves farmers [23] and this implies that they are major stakeholders in the seed system to be critically considered. A positive gross margin for farmers growing improved variety becomes an incentive to their peer invest in improved varieties that meet market demand. An increase in seed demand will also encourage seed companies and other player to expand their activities to areas that have not been reached. According to Rohrbach et al. [22], seed enterprise will only thrive in an appropriate environment and the primary characteristic of such environment is the incentive for farmers to purchase seeds. Finally, project interventions showed positive effects on the realized gross margin by farmers. In the districts that underwent project interventions, the farmers made higher margin, indicating that investments through projects by public sector as well as private sector are critical for boosting the use of improved variety seed and enhancing the seed system performance."}]},{"head":"Conclusion","index":17,"paragraphs":[{"index":1,"size":190,"text":"In this study, we used survey data from farmers and seed producers to examine the investment opportunities for various stakeholders in the seed systems. The findings show that only 39.2% of the surveyed farmers used improved variety seeds, indicating that there is an investment opportunity in producing and supplying quality seeds for farmers who are currently growing old varieties. Researchers, extension agents, seed companies, agro-dealers, as well as NGOs will have a major role to play through awareness creation to enhance farmer knowledge of new varieties and increase demand. Variety demonstrations and field days are good mechanisms to upscale the new and improved varieties. The findings showing that farmers obtained improved variety seeds from both informal and formal seed systems indicate the need to support the farmer to shift from the informal sector through demand creation. There is an opportunity to invest in formal system, whereby seed companies and QDS farmers, agro-dealers can deliver more seeds and expand their business in areas that farmers have not yet accessed seeds. The proper use of informal seed systems through linkage with formal seeds is very important to promote integrated seed supply systems."},{"index":2,"size":151,"text":"Factors such as variety preference, availability of improved variety seeds, resistance to diseases, and drought had significantly correlated with planting of improved variety seeds by farmers. This shows that there is a need to invest in refining varieties that have desirable traits of farmer and consumers in the grain market. This calls for joint and coordinated collaboration between breeders, private sector, and the end-pull. Certified seed and QDS can be produced and availed to farmers' profitability. And this represents an incentive for investment by seed companies, individual seed entrepreneurs, as well as farmer groups or organizations. The higher earning of farmers using improved variety seeds is also an incentive for farmers to invest in the improved variety seeds. From the findings, we can argue that the investment potentials in sorghum seed system are still high and yet to be taped in by various stakeholders so has to develop the seed sector."}]},{"head":"Limitations to this study","index":18,"paragraphs":[{"index":1,"size":64,"text":"This study was conducted in nine districts of sorghum production in Tanzania. Even if few districts were sampled, the coverage of the main sorghum producing areas in the country allowed to capture the relevant information to uncover investment opportunities in sorghum seed systems. The findings are sound for the readily use by a wider audience and stakeholders interested in investing in sorghum seed systems."}]}],"figures":[{"text":"Table 1 Description of determinants affecting planting of improved sorghum seeds 1 USD = 2315 TZS during the period of data collection Variables Description Type of variable Minimum Maximum VariablesDescriptionType of variableMinimumMaximum Variety preference Group membership Seed availability Seed price 1 = improved; 0 = local 1 = yes; 0 = otherwise 1 = yes; 0 = otherwise TZS Dummy Dummy Dummy Continuous 120 5000 Variety preference Group membership Seed availability Seed price1 = improved; 0 = local 1 = yes; 0 = otherwise 1 = yes; 0 = otherwise TZSDummy Dummy Dummy Continuous1205000 Resistance to diseases Resistance to drought Farm size 1 = yes; 0 = otherwise 1 = yes; 0 = otherwise Ha Dummy Dummy Continuous 0.10 10.8 Resistance to diseases Resistance to drought Farm size1 = yes; 0 = otherwise 1 = yes; 0 = otherwise HaDummy Dummy Continuous0.1010.8  "},{"text":"Table 2 Distribution of farmers growing improved variety seeds within sampled intervention and non-intervention districts (n = 83)  Districts Growers of DistrictsGrowers of   improved variety improved variety   seeds (%) seeds (%) Intervention Ikungi 3.6 InterventionIkungi3.6  Iramba 8.4 Iramba8.4  Rombo 10.7 Rombo10.7  Mkalama 12.0 Mkalama12.0  Momba 20.7 Momba20.7  Singida DC 23.0 Singida DC23.0 Non-intervention Kongwa 20.4 Non-interventionKongwa20.4  Tarime 1.3 Tarime1.3 Total  100 Total100  "},{"text":"Table 3 Sources used by farmers to obtain improved variety seeds (n = 83) Seed sources Percentage (%) Seed sourcesPercentage (%) Informal sources  Informal sources Recycled by farmers (own-saved seed) 48.2 Recycled by farmers (own-saved seed)48.2 Neighbor/relatives 9.6 Neighbor/relatives9.6 Formal sources  Formal sources Government (extension, research) 25.3 Government (extension, research)25.3 NGOs 13.3 NGOs13.3 QDS farmers 2.4 QDS farmers2.4 Agro-dealers 1.2 Agro-dealers1.2  "},{"text":"Table 4 Factors with positive correlation with planting of improved variety seeds Variables Odd ratio Standard error Sig Z 95% Confidence interval VariablesOdd ratioStandard errorSigZ95% Confidence interval      Lower limit Upper limit Lower limitUpper limit Variety preference 3.603249 2.401482 0.054* 1.92 0.9758614 13.30456 Variety preference3.6032492.4014820.054*1.920.975861413.30456 Group membership 1.585764 0.7553391 0.333 0.97 0.6234333 4.033547 Group membership1.5857640.75533910.3330.970.62343334.033547 Seed availability 10.59282 7.564658 0.001*** 3.30 2.613017 42.94186 Seed availability10.592827.5646580.001***3.302.61301742.94186 Seed price Diseases resistance 0.9998588 6.105233 0.0002365 3.968429 0.551 0.005*** − 0.60 2.78 0.9993954 1.707723 1.000323 21.82665 Seed price Diseases resistance0.9998588 6.1052330.0002365 3.9684290.551 0.005***− 0.60 2.780.9993954 1.7077231.000323 21.82665 Drought resistance 7.20753 4.402005 0.001*** 3.23 2.17728 23.85935 Drought resistance7.207534.4020050.001***3.232.1772823.85935 Farm size 1.08244 0.1816287 0.637 0.47 0.7790692 1.503944 Farm size1.082440.18162870.6370.470.77906921.503944 Education level Constant Prob > chi 2 0.356938 0.1790915 0.2596398 0.1278157 0.157 0.016 0.0000*** − 1.42 − 2.41 0.085787 0.0442162 1.485129 0.7253847 Education level Constant Prob > chi 20.356938 0.17909150.2596398 0.12781570.157 0.016 0.0000***− 1.42 − 2.410.085787 0.04421621.485129 0.7253847 Pseudo R 2   0.5368    Pseudo R 20.5368 Log likelihood Number of obs   − 65.736921 212    Log likelihood Number of obs− 65.736921 212 *** Significant at 1%; * significant at 10%      *** Significant at 1%; * significant at 10%  "},{"text":"Table 5 Averages of estimated variable costs (TZS) of seed companies and QDS producers  "},{"text":"Table 6 Gross margin analysis of sorghum seed producer (TZS/ ha) Item (average) Certified QDS producers Item (average)CertifiedQDS producers Gross revenue 11,250,000 38,80,000 Gross revenue11,250,00038,80,000 Cost of materials 24,23,250 1,93,249 Cost of materials24,23,2501,93,249 Operational costs 35,17,850 2,92,042 Operational costs35,17,8502,92,042 Total variable costs 59,41,100 4,85,291 Total variable costs59,41,1004,85,291 Gross margin 53,08,900 33,94,709 Gross margin53,08,90033,94,709 1 USD = 2315 TZS during the period of data collection  1 USD = 2315 TZS during the period of data collection  "},{"text":"Table 7 Variable costs for growers (n = 83) and non-growers of improved varieties (n = 129) (TZS/ha) 1 USD = 2315 TZS during the period of data collection Figures in parentheses are percentage of items of total variable cost 1 USD = 2315 TZS during the period of data collection Figures in parentheses are percentage of items of total variable cost  "},{"text":"Table 8 Gross margin analysis for growers and non-growers of improved variety seeds (TZS/ha)  Mean gross margin Standard error Standard deviation 95% Confidence interval Mean gross marginStandard errorStandard deviation95% Confidence interval     Lower limit Upper limit Lower limitUpper limit Benefits 5,18,346.1 94,194.6 13,81,165 3,32,677.9 7,04,014.2 Benefits5,18,346.194,194.613,81,1653,32,677.97,04,014.2 Non-growers 3,17,373.3 70,892.8 8,05,188.5 1,77,099.6 4,57,647 Non-growers3,17,373.370,892.88,05,188.51,77,099.64,57,647 Growers 8,19,805.2 2,06,666.6 19,16,547 4,08,896.6 12,30,714 Growers8,19,805.22,06,666.619,16,5474,08,896.612,30,714 Diff Pr (T < t) − 5,02,431 0.0087 1,89,625.2  − 8,76,214.2 − 1,28,649.5 Diff Pr (T < t)− 5,02,431 0.00871,89,625.2− 8,76,214.2− 1,28,649.5 Pr (|T| > |t|) 0.0043     Pr (|T| > |t|)0.0043 Pr (T > t) 0.9957     Pr (T > t)0.9957 T Df − 2.649 213     T Df− 2.649 213  "}],"sieverID":"58e63991-6578-4409-9d35-5799f4db5461","abstract":"Background: Seed systems are considered as a vehicle through which the sustainable agricultural intensification can be achieved. However, most sub-Saharan African countries have been ineffective to provide sufficient incentives for stakeholders to consistently invest in the seed systems specifically for crops like sorghum. This study was therefore conducted to uncover investment opportunities for stakeholders in the sorghum seed systems to attain an impactoriented seed production and delivery systems."}

data/part_5/0174e30116ac5acb1d117c8574ac6aa2.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0174e30116ac5acb1d117c8574ac6aa2","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/fd41f0a4-1973-46c3-8c19-c17aed7511d9/retrieve"},"pageCount":25,"title":"Impact of Gender on Trait Prioritization and Food Product Profile (Fufu) Development in Nigeria: Guide to Breeders","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":5,"text":"The following characteristics were evaluated:"},{"index":2,"size":2,"text":"Colour Texture"},{"index":3,"size":3,"text":"End Product :"},{"index":4,"size":6,"text":"The final fufu products were evaluated:"},{"index":5,"size":4,"text":"Colour, Stretchability Smoothness Stickiness"},{"index":6,"size":5,"text":"Intermediate Product (Mash) Evaluation :"},{"index":7,"size":23,"text":"The study involved 300 consumers from different zones (75 rural and urban areas respectively) to evaluate five fufu products prepared by expert processors."},{"index":8,"size":9,"text":"▪The selection of traits was based on processors assessment."},{"index":9,"size":12,"text":"▪JAR (Just about Right) and ▪CATA (Check all that Apply), were adapted."},{"index":10,"size":11,"text":"▪The JAR method was employed to assess traits like Smoothness Colour"}]},{"head":"Stickiness and Stretchability","index":2,"paragraphs":[{"index":1,"size":22,"text":"The CATA method was used to evaluate traits thus; Step 2 provided information on indicators and priority level of each quality characteristics."},{"index":2,"size":15,"text":"Step 3 provided information on Cassava varieties with high quality and poor quality fufu product."}]},{"head":"Triangulation of characteristics","index":3,"paragraphs":[]},{"head":"High quality characterist ics","index":4,"paragraphs":[{"index":1,"size":3,"text":"Step 1 SoK"},{"index":2,"size":5,"text":"Step 2 Gendered food mapping"},{"index":3,"size":1,"text":"Step "}]},{"head":"Raw Cassava","index":5,"paragraphs":[{"index":1,"size":3,"text":"Triangulation of Characteristics"}]},{"head":"High quality characteri stics","index":6,"paragraphs":[{"index":1,"size":3,"text":"Step 1 SoK"},{"index":2,"size":5,"text":"Step 2 Gendered food mapping"},{"index":3,"size":4,"text":"Step 3 Processing demonstrations"}]},{"head":"Gelling capacity","index":7,"paragraphs":[{"index":1,"size":5,"text":"Ease to peel Key Results/Findings"},{"index":2,"size":22,"text":"• The research revealed variations in trait prioritization between men and women in terms of preferences for different cassava traits in Nigeria"},{"index":3,"size":28,"text":"• The result shows that women tend to prioritize quality traits, while men emphasize productivity-related traits The study reveals that the primary factors influencing Nigerian fufu consumption include:"},{"index":4,"size":22,"text":"• Smoothness; easy to swallow; odour; and Stickiness, which can either positively or negatively affect the texture, and appearance of the fufu"},{"index":5,"size":16,"text":"• Female respondents' preference for certain traits is linked to processing parameters and end product quality"},{"index":6,"size":60,"text":"• While male respondents' choices are influenced by economic factors • Root qualities like size, heaviness, outer skin appearance, and flesh colour affect peeling ease, colour, yield, and overall acceptance of cooked fufu. • Female respondents prioritized ease of peel, fresh roots, and root foaming traits(ability to ret fast and well), while male focus on white colour and fresh roots"},{"index":7,"size":58,"text":"• This suggests women play a central role in processing fufu mash, influencing specific stages like peeling and fermentation. Their indigenous knowledge and experience helps to understand these traits' impact on the final product • Female respondents indicated that the use of cassava varieties that are 'easy to peel' and easy to sieve enhances labour efficiency and drudgery."}]},{"head":"Conclusion","index":8,"paragraphs":[{"index":1,"size":22,"text":"• The sensory analysis of improved cassava clones revealed that smoothness and mouldability' were the most important traits,followed by stickiness,''stretchability,' and 'colour'"},{"index":2,"size":20,"text":"• The study also found that appearance, texture, and aroma were the primary factors influencing gender-specific consumer preferences for fufu"},{"index":3,"size":44,"text":"• The study suggests that these traits should be central to crop improvement efforts for cassava varieties • There is need therefore for sustained multidisciplinary and collaborative approach involving various stakeholders in crop improvement programs, especially those related to the science of food processing"},{"index":4,"size":27,"text":"• This approach would facilitate the breeding of cassava varieties that align with end-user preferences and enhance the adoption of these new varieties Thank You for Listening"}]}],"figures":[{"text":"Sticky aids in selecting cassava genotypes with desirable sensory properties and facilitates sensory profilingThe study used the SOP to assess sensory texture attributes of five cassava clones, involving 12 trained panelists.The SOP outlines the process of fufu preparation Preferred traits Preferred traits• Quality characteristics (High and Poor)-State of Knowledge (step 1)• Gendered food mapping (Step 2)• Processing diagnosis (Step 3)Triangulation: Consideration was on quality characteristics sited more than once in Steps 1,2 and 3. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"• Qualitative analysis to triangulate (by colouring) • Selection of characteristics + prioritisation with expert group  Methodology Raw Material Assessment  Methodology Raw Material Assessment • The methodology for this study involved the collaboration of four The following characteristics • The methodology for this study involved the collaboration of four The following characteristics expert processors to assess were accessed: 18 expert processors to assess were accessed:18 different cassava clones, including a different cassava clones, including a local and national standard, at two local and national standard, at two locations in Nigeria (North central and ✔Root shape locations in Nigeria (North central and ✔Root shape South East)  South East) • The assessment 18 cassava clones ✔Root skin colour (Outer skin) • The assessment 18 cassava clones ✔Root skin colour (Outer skin) was conducted at various stages:  was conducted at various stages: ✔Inner Root colour  ✔Inner Root colour raw material, processing, and ✔Skin Texture, and  raw material, processing, and ✔Skin Texture, and intermediate/end product ✔Ease of peeling  intermediate/end product ✔Ease of peeling  "},{"text":"3 Processing demonstrations Moderately size root Big sized root Easy to peel Heavy roots Fresh skin Not foamy root Smooth root skin Heavy tubers Fresh roots(freshly harvested root) Dark coloured peel Dark coloured skin/peel Easy to ferment (Retting ability) White coloured root Smooth skin No discolouration Easy to peel Easy to ferment (Retting ability)   "}],"sieverID":"b8601b24-c717-4acf-9149-3b9b4b58d066","abstract":""}

data/part_5/01d0b34efb3828ee3203c2164ed4af3f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"01d0b34efb3828ee3203c2164ed4af3f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d26020de-78f7-4dac-8548-f31c9e12b3eb/retrieve"},"pageCount":2,"title":"Web Platform for linking Community Forestry Information in the Gambia. Integrates quantitative and qualitative information for monitoring and planning","keywords":["P803 -9. Landscape Governance No milestones associated Sub-IDOs: Contributing Centers/PPA partners: Evidence link:","https://tinyurl.com/ybyx4t6d Reporting 2021 Innovation #790 Deliverables associated:","D7621 -[item 17] CF and EBA Good governance Experiences: 1 Policy Brief (T1) (Not disseminated) Contributing CRPs/Platforms:","FTA -Forests, Trees and Agroforestry"],"chapters":[],"figures":[],"sieverID":"8fb452a9-020f-4607-aa8e-46dd918d95d3","abstract":"Description of the innovation: Information Platform Development for EbA project. The platform is designed based on the region, entities and indicators such that a user can select specific regions, entities and indicators of interest. Ideally the platform will track and display the trend in the achievement of denoted project impacts.Beta version of the input platform for the information platform is ready and is accessible at https://intranet.worldagroforestry.org/temp/gambia11/index.php New Innovation: No Innovation type: Research and Communication Methodologies and Tools Stage of innovation: Stage 1: discovery/proof of concept (PC -end of research phase) Geographic Scope: National Number of individual improved lines/varieties: <Not Applicable> Country(ies): • Gambia Description of Stage reached: Under development. The information platform development will be completed once the database and the dashboard are in place in 2019 Name of lead organization/entity to take innovation to this stage: UN Environment -United Nations Environment Programme"}

data/part_5/021575617654ff50c052c4fc541a3022.json

@@ -0,0 +1 @@
+{"metadata":{"id":"021575617654ff50c052c4fc541a3022","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6e29e401-473c-4718-b395-cb44a9b20c6a/retrieve"},"pageCount":33,"title":"","keywords":["livestock","poverty","rangelands","rural","spatial","Kenya"],"chapters":[{"head":"Table of contents","index":1,"paragraphs":[{"index":1,"size":41,"text":". Impact of changes in soils and market access: An Illustrative Simulation …………..18 Table A1. Description of Variables ………………………………… ………………………24 Table A2. Descriptive statistics……………………………………………………………….. 27 Figure A1. Map of the spatial distribution of local R square in the rangelands ……….. 28"}]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":196,"text":"It is estimated that in the next two decades, the livestock sector will have significantly changed to produce about 30% of the value of global agricultural output and directly or indirectly use 80% of the world's agricultural land surface (World Bank 2001). This would make it the Worlds most important sub-sector in terms of land use. In Kenya, the livestock sector is dominated by small scale producers and is a very important sector for the economy since its products are important commodities both locally and internationally. The livestock is mainly concentrated in the arid and semi-arid lands (ASALs) covering over 75 percent of the country's land surface (FAO, 2005). There, it accounts for 90 percent and 95 percent of employment and family incomes respectively Despite the growing importance of livestock in the economy, very little is known about the nature and determinants of poverty among livestock keepers. Within Kenya, poverty has been highest in the rangelands, where most livestock keepers are found (CBS, 2003). In 1999, the year with which we are primarily concerned, the incidence of poverty in the rangelands was 56 percent and the Gini-coefficient, which is used to measure income inequalities, was 0.30."},{"index":2,"size":29,"text":"Within the rangelands, poverty is particularly severe in rural areas. Interestingly, despite their rural status and poverty, livestock related activities continue to generate the biggest proportion of their incomes."},{"index":3,"size":116,"text":"This paper aims to investigate the nature and determinants of poverty among livestock keepers in the rangelands of Kenya, as well as their distributional profile and poverty impact. The paper proceeds as follows. Section 2 provides a brief overview of general issues about livestock, poverty and environmental conditions in Kenya. Section 3 discusses the data and presents a brief overview of the analytical methods. Section 4 assesses the impact of geographical conditions on poverty by estimating a global and local model. An illustrative simulation is done in this section. The last section concludes with policy recommendations and some hypotheses about the effects of changes in geographic conditions on the course of rural poverty in the rangelands."}]},{"head":"Poverty, Livestock and the Environment in Kenya","index":3,"paragraphs":[{"index":1,"size":56,"text":"Kenya ranks among the least developed countries where the poverty index shows more than 50% of its population below the global described poverty line (World Bank 2004). Poverty is more pronounced among the livestock keepers (CBS and ILRI, 2003). Since independence, one of the principal goals of Kenya's development effort has thus been to reduce poverty."},{"index":2,"size":49,"text":"Successive governments have pursued this through development strategies emphasizing economic growth, employment creation and provision of basic services. In the first decades after independence, Kenya's development strategy was based on the idea that poverty would be alleviated through rapid economic growth, as the poor would benefit from sustained growth."},{"index":3,"size":43,"text":"However, poverty reduction was not realized even when the country was experiencing strong economic growth in the 1960s and 1970s. As a result, the growth led poverty reduction approach has been criticized on the grounds that it ignores the non-income aspects of poverty."},{"index":4,"size":138,"text":"In a participatory poverty assessment study (AMREF 1998 a,b,c,d), some Kenyan communities claimed that neither their district authorities nor the local governments had initiated effective poverty-alleviation measures. The communities attributed the lack of such to the failure by the administration to involve them in the development process. Thus, the consensus in development is that beneficiaries of anti-poverty programmes should be involved in the design and implementation of such programmes since they have valuable contributions to make in the design of these programmes. They can provide the data and detailed insights into the causes, nature and extent of poverty, as well as on what can be done to effectively tackle it (KIPRRA, 2000). The recently introduced constituency development fund is expected to go a long way in enabling this since it is the stakeholders who determine their development priorities."},{"index":5,"size":129,"text":"The relationship between the incidence of poverty and the livestock sector is often rather subtle. The most direct impact on poverty can be discerned when the sector offers employment opportunities to the poor with remuneration levels that are not sufficient to lift them out of poverty. But the literature on livestock rearing in Kenya describes how heterogeneous livestock activities can be, and suggest that they can be divided into two groups of income sources: high income activities which mainly result from diary farming and low income activities which mainly result from beef production (intensification and extensification). The latter activities can be quite common among the livestock keepers in the lowlands particularly in the Coast, North Eastern and Eastern provinces. The former is mainly found in the highlands and Rift"},{"index":6,"size":84,"text":"Valley areas. However, even if the 'low income' activities may offer no realistic prospects of lifting communities and households out of poverty, such income sources are clearly very important from a social welfare perspective, since they help reduce the severity of deprivation for many communities and families. In addition, for certain groups of the population who are in the ASAL and are unable to participate in productive farming these livestock keeping activities may offer the only means to some economic security (a safety net)."},{"index":7,"size":90,"text":"The Kenyan government has however continued to encourage farmers to engage in commercial livestock farming and today the cattle population (the most popular livestock among the livestock keepers) exceeds ten million heads with the large scale farmers keeping animals both for commercial and subsistence purposes. The government has of late taken steps to improve dairy farming by increasing extension services, extending credit facilities to farmers through co-operatives, investing in research and availing training opportunities. It has also set up demonstration farms and projects which breed high quality bulls (GOK, 2003)."},{"index":8,"size":50,"text":"The common view of the rangelands among policymakers in Kenya is that of a sector driven entirely by livestock keeping, and rural welfare in the rangelands is equated with income. Thus, policymakers view state efforts to combat rural poverty in the rangelands as policies to enhance productivity among livestock keepers."},{"index":9,"size":85,"text":"The issue of poverty among livestock keepers has however received little attention by researchers and policymakers. Most analyses on livestock keeping in Kenya are a by-product of the literature on rural poverty such as Mwabu et al., (2000), Oyugi (2000) and Geda et al., (2001) that deal with measurement, profile and determinants of poverty in Kenya using overall expenditures and food expenditures as dependent variables. These studies show that poverty prevalence is highest in the rural areas and that regional disparities are large and increasing."},{"index":10,"size":39,"text":"However, they do not include natural endowments in their analyses yet it is likely that certain natural endowments may enhance the opportunities of the rural poor to diversify incomes and at the same time lift themselves out of poverty."},{"index":11,"size":47,"text":"As regards environment, poverty is a major cause and consequence of the environmental degradation and resource depletion where major environmental challenges include deforestation, soil degradation and desertification, declining biodiversity and marine resources (Okwi et al 2005). Others include water scarcity and deterioration of water and air quality."},{"index":12,"size":64,"text":"Thus, though the country is implementing new national and multilateral environmental policies, their effectiveness is low. There is growing recognition that national environmental policies are more likely to be effectively implemented if they are supported by an informed and involved public. Thus environmental awareness and education programmes are expanding almost everywhere, while indigenous knowledge receives greater recognition and is increasingly used (UNEP, 2000) 1"},{"index":13,"size":113,"text":"The most pressing environmental health problems worldwide today in terms of their role in causing death and illness, are those associated with poor households and communities. In rural areas and in peri-urban slums in Kenya, inadequate shelter, overcrowding, inadequate safe water and sanitation are by far the greatest threats to human health (Dasgupta and Karl-Goran, 1994). According to World Health Organization (WHO) and the World Bank, environmental improvements at the household and community levels would make the greatest difference for global health. Specifically, the World Bank has calculated that improvements in the local environmental conditions facing the poor can lower the incidence of major killer diseases by up to 40 percent (Eckholm 1976)."},{"index":14,"size":107,"text":"By targeting policies that help to reduce environmental threats that contribute to both ill health and poverty, it is possible to produce good health faster than income growth would do on its own. Improving living conditions might itself help reduce poverty. This means that removing the environmental hazards that make people sick could keep people productive, which would in turn raise their incomes. Thus, continued environmental deterioration is a source of continued impoverishment. Livestock keepers depend on natural resources in the most vulnerable areas of Kenya and thus suffer most from deterioration in the environment because of the threat to their livelihoods and aggravation of health risks."},{"index":15,"size":124,"text":"There is a need to understand the interrelationships between poverty, livestock and environment in order to reduce poverty among the livestock keepers. Despite the fact that pastoralism presents a very efficient system to utilizing the heterogeinety of the rangelands, poor livestock keepers are often portrayed as having large numbers of livestock, which in turn contribute to environmental degradation thus compounding the problem of poverty. Pastoral areas are marginal and have largely relied on organized traditional institutions. However un informed government policies and actions that undermine such institutions have made these areas more vulnerable to degradation. Creating a balance in these areas is therefore key to reducing poverty among the pastoralists. Understanding interrelationship between the three is therefore critical as is sought in this article."},{"index":16,"size":153,"text":"Generally, we test the hypothesis that agro-climatic variables and market access explain the variation in poverty among the livestock keepers in Kenya. The ability of agro-climatic variables to explain differences in poverty indicates that poverty in remote areas may be linked to natural resource availability and lack of market access (see also Pender, et al., 1999;Pender, 2001), in this case for animals. Better roads and access to markets are expected to favor better returns among the livestock keepers and should therefore contribute to better welfare or higher incomes (Pender et al., 1999). Presence of social services such as hospitals and, schools may influence welfare by promoting better health, livelihood and other human capital variables. In this study, we investigate the impacts of these spatial variables. Such an understanding of poverty can effectively guide governments' and others' efforts to reduce poverty by adopting more specific and precise policy options specifically targeted to livestock farmers."}]},{"head":"Data and Empirical Implementation","index":4,"paragraphs":[]},{"head":"Data","index":5,"paragraphs":[{"index":1,"size":16,"text":"The data on poverty come from the poverty mapping results that were obtained from the 1997"},{"index":2,"size":128,"text":"Welfare Monitoring Survey (WMS) and the 1999 Population and Housing Census. The survey is similar to the LSMS conducted by the World Bank in various developing countries (see Grosh andGlewwe, 1995 andWorld Bank 1991). The 1999 Population and Housing Census were conducted by the same institution (CBS) and meant to cover the entire population in both rural and urban areas. The census and survey data have several common household variables such as household size composition, education, housing characteristics, access to utilities and location of residences. In this study, the location level poverty headcount estimates that were derived from the poverty mapping study for Kenya (CBS and ILRI, 2003) is used as the dependent variable. This paper uses only the rural sample for the rangelands, comprising of 1159 locations."},{"index":3,"size":151,"text":"The spatial analysis portion of this project uses a variety of spatially referenced variables describing topography, land cover and land use, climate, demography and market/town access derived from GIS data layers. Geo-referenced information from various government departments and institutions is used. Information about vegetation cover such as forests, grassland, wetlands, water resources and land use such as subsistence and commercial farmland, and other landscape aspects were obtained from Multipurpose Africover Database for Environmental Resources (MADE). Data on demographic attributes was obtained from CBS described above. Other natural and physical capital layers were derived from a wide array of local and global layers (for detailed description of data sources, see Table A1 in appendices). The data is extremely rich in bio-physical factors and also includes the distribution of infrastructure such as markets, towns and others. Subsets of these variables are used as independent variables and they are aggregated to the location level."}]},{"head":"Estimation Strategy","index":6,"paragraphs":[{"index":1,"size":47,"text":"Following the description of the data in the previous sub section, we present briefly the empirical model. We adopt the spatial regression approach developed by Anselin (1988) and used by Benson et al (2005) and Minot et al (2003). The analysis is typically divided into three stages:"},{"index":2,"size":7,"text":"• a simple ordinary least squares regression;"},{"index":3,"size":6,"text":"• a global spatial regression and;"},{"index":4,"size":6,"text":"• a local spatial regression analysis."},{"index":5,"size":24,"text":"These regression analyses aim to improve our understanding of how communities might be assisted in reducing poverty by targeting key spatial determinants of poverty."}]},{"head":"Generalized OLS regression model","index":7,"paragraphs":[{"index":1,"size":11,"text":"Applied to this context, we estimate the OLS regression model as:"},{"index":2,"size":163,"text":"where Y is a vector of observations on the dependent variable; X is a matrix of independent variables; ß is a vector of coefficients, and e is a vector of random errors. Despite the popularity of this approach, problems of spatial autocorrelation limit its application in analyzing spatial relationships. Spatial autocorrelation occurs if variables in one area are affected by the value of that variable in a neighboring area. Spatial autocorrelation can also manifest itself through the correlation of error terms. One way in which the error terms may be correlated is spatially, as evidenced by observations from locations near to each other having model residuals of a similar magnitude. Therefore, unless we correct for spatial autocorrelation, the assumptions of OLS regression are violated and thus the estimates derived from this method are likely to be biased. To assess spatial autocorrelation, the clustering of the residuals from the OLS model will be examined using the Moran's I statistic and the Langrange multiplier index."}]},{"head":"Global spatial regression model","index":8,"paragraphs":[{"index":1,"size":62,"text":"The literature on spatial econometrics identifies two types of spatial dependence 2 . First, the spatial dependence could be a result of the level of poverty (in this case our dependent variable) in one location affecting the level of poverty in another location, through for example, trade or investment linkages. Such a relationship is modeled as a spatial lag model as follows:"},{"index":2,"size":59,"text":"Where i y is the dependent variable for area i δ is the spatial autoregressive coefficient ij w is the spatial weight reflecting the proximity of i and j j y is the dependent variable for area j β is a vector of coefficients j X is a matrix of explanatory variables, and j ε is the error term."},{"index":3,"size":46,"text":"The spatial weights matrix, w, represents the degree of proximity between each pair of spatial observations. It is usually a binary variable based on whether the two areas are contiguous or a continuous variable based on a function of distance between the two areas or locations."},{"index":4,"size":12,"text":"Omitting this adjustment will result in the coefficients being biased and inconsistent."},{"index":5,"size":61,"text":"A second type of spatial dependence can be attributed to the error term of the model (see Anselin, 1992). This kind of spatial dependence occurs if there are variables that are omitted from the regression model but do have an effect on the dependent variable and they are spatially correlated. Such a relationship can be modeled as a spatial error model:"},{"index":6,"size":59,"text":"Where i y is the dependent variable for area i λ is the spatial autoregressive coefficient ij w is the spatial weight reflecting the proximity of i and j j y is the dependent variable for area j β is a vector of coefficients j X is a matrix of explanatory variables, and j ε is the error term."},{"index":7,"size":57,"text":"Here, the error term is disaggregated into the spatial lag of the error term of neighboring locations and the residual error term for the spatial unit in question. When there is spatial error dependence, OLS coefficients will be unbiased but not efficient (the standard errors will be larger than if there were no omitted variables) (Anselin, 1992)."},{"index":8,"size":66,"text":"In order to select which model to use, a Lagrange Multiplier test and Morans I is used to assess the statistical significance of the coefficients in each model, respectively. Where spatial autocorrelation is likely, usually the result of the test on each will be significant. The preferred model in such a case is the one with the highest Lagrange multiplier test value (Anselin & Rey, 1991)."}]},{"head":"Local Spatial Regression Analysis: Geographically Weighted Regression","index":9,"paragraphs":[{"index":1,"size":105,"text":"The models described above are referred to as global models because they assume that the relationship between poverty and the geographic factors is the same across the country. That is, the relationship is spatially stationary. Such an assumption might be reasonable when one is considering physical processes that are governed by universal physical relationships. However, at least at the generalized level of our analysis, few social processes will be found to be constant over space (Fotheringham, et al., 2002, p. 9). The generalized regression models described earlier will hide this potential heterogeneity, or spatial non-stationarity, in the determinants of the prevalence of poverty (Benson, 2005)."},{"index":2,"size":50,"text":"Local spatial regression analysis does not make this assumption and examines spatial variations in the relationship between poverty and geographic factors. A moving window regression framework, in which numerous regression models are estimated, each centered on a \"regression point\" and including nearby observations defined by a \"kernel bandwidth\" is used."},{"index":3,"size":9,"text":"Localized coefficient estimates are generated for each regression point."},{"index":4,"size":60,"text":"Using this method, which is closely related to the OLS, the results will be the usual standard regression output. This allows the regression output (including coefficients and R 2 ) to be mapped, showing their variation over space. This makes this technique particularly useful for analyzing relationships in spatial data (see Brunsdon, et al., 1996, for details of this method)."},{"index":5,"size":7,"text":"A standard global regression model, written as:"},{"index":6,"size":10,"text":"can be extended to a local regression model, written as:"},{"index":7,"size":6,"text":"where y is the dependent variable,"},{"index":8,"size":37,"text":"x is the independent variable, ij a is the regression coefficient, 0 a is a constant, i is an index for the location, j is an index for the independent variable, and ε is the error term."},{"index":9,"size":81,"text":"For each local regression at a regression point i, the observations are weighted depending on the distance from the regression point to the observation j. The size of the neighborhood to which the spatial weight matrix applies can be a fixed distance (bandwidth) or, alternatively, can be based on k-nearest neighbors with a varying, adaptive bandwidth applied to the weighting function. Finally, we should point out that the distance between spatial units is the distance between the center points of locations."},{"index":10,"size":93,"text":"Tests can also be done to determine whether a local model describes better the relationships than a global model by comparing global and local values of R 2 . Furthermore, Fotheringham et al., (2002) proposed a Monte Carlo test of whether spatial variations in the estimated coefficients are statistically significant. The test involves randomly adjusting the geographic location of the observations numerous times, running a GWR on each, and then comparing statistically the parameter estimates for the randomly distributed observations with the parameter estimates of the actual geographic distribution (Minot et al., 2003)."}]},{"head":"The Determinants of Poverty among Poor Livestock Farmers (rangelands) in Kenya","index":10,"paragraphs":[{"index":1,"size":137,"text":"Tables 1 to 4 present the results from the estimation models for the rangelands, estimated separately from the other areas. The rangelands provide an interesting case for analysis given that they account for a large proportion of poverty in Kenya and have specific features which make them unique from the other areas of Kenya. For example, these areas have inadequate infrastructure and are very remote. Moreover, these areas are typical livestock rearing areas and provide substantial supplies of beef and milk to the other areas of Kenya. Livestock, as we know, is a vital component of well being and provides a pathway out of poverty. Therefore, specific analysis of the determinants of poverty among poor livestock farmers could provide practical intervention areas if poverty is to be reduced in these areas and the role of livestock enhanced."},{"index":2,"size":42,"text":"The dependent variable used in the regressions is the poverty rate for each of the rural locations in the rangelands of Kenya. The explanatory variables included are listed in Table A1 in the appendices. About 1159 locations are used in the estimation."},{"index":3,"size":66,"text":"Table 1 below presents the tests for spatial dependence when an OLS model was estimated with location level poverty rate as the dependent variable against the variables listed in Table A1. Row-standardized weights are used to test for spatial dependence. According to the results, the tests for spatial dependence are all highly significant and the spatial error model should be used to correct for spatial autocorrelation. "}]},{"head":"Soil","index":11,"paragraphs":[{"index":1,"size":147,"text":"The coefficient for the variable good soil has a significant negative effect on community level welfare in the rangelands. The inverse relation between good soil and poverty, while an expected finding, is critically linked to the issue of agricultural potential or production. This result points to the ability of communities with better soils to compliment their earnings and livelihoods through farming unlike those with poor soils. Another reason for this inverse relationship could be that good soils lead to higher quality pasture and therefore increased animal production. Given the strength of this result and its dependence on other variables such as rainfall or irrigation, much gain can be obtained from this result. This result is not surprising and strongly justifies the need for diversification of income activities in these areas through farming and where possible attempts should be made to improve soil and irrigation in these areas."}]},{"head":"Agro-climatic variables","index":12,"paragraphs":[{"index":1,"size":30,"text":"Another result that is noteworthy is the length of growing period. Length of growing period refers to the period when temperature and moisture conditions are such to allow crop growth."},{"index":2,"size":96,"text":"To interpret the results, note that in rural areas, the longer the growing period the better the conditions for farming and the less likely the area is to be poor. Keeping in mind these facts, the findings can be explained as follows. It is not surprising the LGP affects rural poverty because poverty in rural areas is closely associated with agriculture. Locations in the rural areas of Kenya that have longer growing periods are capable of growing a variety of crops including perishable vegetables, maize, beans and even cash crops such as tea and sugar cane."},{"index":3,"size":67,"text":"It is therefore common that for rural locations that have longer growing periods, the rates of poverty are likely to be lower, ceteris paribus. A similar argument can be made regarding locations that have shorter growing periods. The implication of this result is rather direct and can be a point of emphasis in poverty alleviation programmes. These areas have the potential of both crop and livestock production."}]},{"head":"Wetlands and grasslands","index":13,"paragraphs":[{"index":1,"size":87,"text":"Water points and wetlands are important determinants of poverty among poor livestock farmers or in the rangelands. The effect of having larger water points and wetlands is negative and significant. Similarly, more grassland in the location is related to lower levels of poverty. This obviously reflects the effects of greater dependency of these communities on pasture for their livestock and water for their livestock and themselves. This result is not surprising given that about 90% of the population in the rangelands depend on pastoralism for their livelihoods."},{"index":2,"size":49,"text":"The fact that locations with larger areas under wetlands will tend to have lower poverty rates is also not surprising. These results agree with those for the national model for Kenya (see Okwi et al., 2005), which show that larger areas of the location under wetlands means less poverty."}]},{"head":"Farmlands","index":14,"paragraphs":[{"index":1,"size":45,"text":"With respect to the share of land under farmland, the results are as expected. An increase in the area of a location under farmland reduces the location's poverty rate. This implies that an additional increase in farming area spurs significantly the location's participation in farming."},{"index":2,"size":28,"text":"This implies diversification of activities from the traditional livestock rearing hence less reliance on livestock income. Diversification into farming activities increases the locations potential to earn agricultural income."}]},{"head":"Elevation and Slope","index":15,"paragraphs":[{"index":1,"size":213,"text":"An increase in elevation of the location by one meter has a significant negative effect on poverty. In other words, high elevations contribute negatively to rural poverty. This result is not consistent with the national model. This may be due to the fact that livestock producing areas in the high lands are the real agricultural high-potential areas and are therefore likely to be less poor compared to the flat areas of the rangelands. Another result that is noteworthy is the association between the slope variables and poverty. All the slope variables (share of land with a slope of 4-8 percent, 8-15 percent, 15-30 percent and above 30 percent) are statistically significant. With the exception of locations with 8-15 percent slope, the rest are positive and statistically significant. The results indicate that the amount of slope strongly explains the poverty levels in a rural location and locations with larger area of sloped land will have higher poverty rates than those with more flat area of about 8-15 percent slope. The negative effect could be due to some collinearity between these variables. Again, this result is not surprising given the difficulties associated with cultivation on sloped land. This results points to the need to introduce better farming methods like terracing and grazing in these areas."}]},{"head":"Demographic variables","index":16,"paragraphs":[{"index":1,"size":158,"text":"Among the demographic related variables, only the level of income inequality is negatively significant. The results arising from this variable agree with those from CBS and ILRI (2003) which show that areas with higher inequality tend to have lower poverty rates. This result captures the variation in poverty levels as it is often true that there is a tendency for poor communities to locate themselves together hence the inequality levels are not very high among the poor communities. Like in the (ILRI and CBS, 2005) study, this result is capturing the cases of areas with high potential and probably urban growth. Finally, among the rangelands, the location variables or provincial dummies variables are important, though the levels may be different. When dummy variables for the provinces where rangelands are found are included in the rural poverty model, they are jointly significant. Relative to the other regions, Coast, North eastern and Rift Valley are among the significant location variables."},{"index":2,"size":141,"text":"Our results concerning the determinants of poverty among poor livestock farmers in the rangelands provide very interesting findings. The soil quality, agro climatic conditions, land use under wetlands and farming, slope and elevation, income inequality and location specific variables have direct effects on rural poverty. All these variables have the expected sign although the magnitude of the coefficients varies and is in some cases very small. It is not surprising that these variables explain more than 60 percent of the variation in location level poverty in the rangelands of Kenya. The experience from the rangelands suggests that it is possible to isolate general factors affecting poverty in the rangelands. These results are important as they provide specific information about the pattern and spatial determinants of poverty in the rangelands of Kenya, which is of importance in designing effective poverty alleviation policies."}]},{"head":"Spatial Variation in Poverty Determinants","index":17,"paragraphs":[{"index":1,"size":88,"text":"In this section, we present the results of an analysis of the spatial variation in relationships between poverty and a number of agro-ecological variables (Table 3). The Geographically weighted regression technique is used. This method allows for spatially varying relationships between rural poverty and the determinants across the rangelands. The model does not control for spatial autocorrelation. Instead, the GWR analysis attempts to explain the nature of spatial dependence as part of the local analysis. Therefore, the spatial autocorrelation becomes part of what the local GWR model explains."},{"index":2,"size":149,"text":"A global model is first estimated. The same regression is then re-estimated using a local model based on the geographically-weighted regression technique. First, we present the results of the global model. More than 32 percent of the variation on global poverty in the rangelands is explained by the variables. Most of the variables have the expected correct sign and are significant. These variables show consistency with those from the earlier model. Slope, soil quality, length of growing period and land use for farmland and wetlands are significant. However, we do not repeat the explanation of these variables here. Instead, we attempt to explain whether a local model would bring improvements in the explanatory power of the model and whether there are significant spatial variations in the relationship between poverty and the independent variables. The local model explains 69 percent of the variation in location level poverty in the rangelands."},{"index":3,"size":78,"text":"However, these variables do not include the location dummy variables. The implication of this result is that the local model presents a better fit by about 37 percentage points. Likewise, the residual sum of squares for the local model is about 3 times less than for the global model (6.2 compared to 16.9 for the global model). From these diagnostics, it is clear that the local model has smaller errors and a better fit than the global model."},{"index":4,"size":16,"text":"Figure A3 shows the local values of the adjusted R-Square for each rural location in Kenya."},{"index":5,"size":56,"text":"The expectation from this kind of exposition is that examining the pattern of areas with low R square statistics will enable the determination of any missing variables in the model. It is evident that in all the locations, the value of the R-square from the local model is higher than the global model score of 0.32."},{"index":6,"size":61,"text":"The results of the GWR model can be useful in for those interested in a particular location or area in the rangelands of Kenya and can be used to obtain a multivariate understanding of the important location level determinants of poverty. An assessment of the maps provides a clear view of which locations have stronger explanatory power from the selected variables."},{"index":7,"size":33,"text":"The spatial variation in the variables used is presented in Table A2 below. From this result, a clear variation is observed over space in all the variables that were used in the regression."}]},{"head":"Poverty Simulations","index":18,"paragraphs":[{"index":1,"size":117,"text":"In this section we test the effect of different policy initiatives on the proportion of the poor in the rangelands. Clearly, there are an infinite number of permutations of policy changes that can be considered, and we limit our results to a few indicative cases. The effects of a policy change are simulated by changing the values of one or more of the explanatory variables in accord with the policy in question. The changes in explanatory variables result in changes in the predicted probabilities, and these are taken to be the effect of the policy. However, the results of the simulations should be treated as suggestions that are plausible but not real, and therefore treated with caution."},{"index":2,"size":141,"text":"The simulation study in this case is defined by interventions aimed at improving welfare. Our desired result is to reduce the percentage of poor people in the Locations. We therefore suggest interventions in soil improvement in areas where the rainfall is above the rangelands mean of 810m and a reduction in non monetary access costs. In our model non-monetary access costs are measured by travel time. The simulation assumes that improvements are made to roads in these areas so as to reduce every ones travel time to the nearest road (tarmac or murram) to within one hour or less (i.e. to reduce the probability of traveling more than one hour to the nearest road to zero). This is a fairly egalitarian change because our data show that the median travel times are similar for most of the areas in the rangelands."},{"index":3,"size":212,"text":"Table 4 below presents the results of the soil and travel time simulations. They report the expected change in poverty due to improvement in soil conditions (in areas with relatively higher rainfall than the rangeland mean of 810mm. The results show that improving soils in this area alone can generate substantial improvements in welfare by reducing poverty rates from 56 percent to 50.4 percent, but, of course holding other variables constant. Even though the aggregate changes in poverty appear to be modest, the effects may be larger if other variables are included in the model. At this point, the focus should be more on the direction of change rather than the magnitude. Under the travel time scenario, a reduction in travel time to less than an hour reduces the poverty from 56 percent to 48. Therefore, improving road infrastructure in the Rangelands will pay off in terms of improved overall welfare at the Location level. The missing comparison of this simulation is the imputed cost of soil improvement and road construction in these areas. The study also does not provide options to cover costs of road construction and soil improvement. Generally, there would be relatively large welfare improvement among the communities of the rangelands if there are interventions in these two areas. "}]},{"head":"Conclusions and Implications for Policy","index":19,"paragraphs":[{"index":1,"size":97,"text":"Rural poverty in the rangelands, where most livestock farmers are, remains a crucial part of the poverty story in Kenya as a whole. Kenya is largely a rural based country and poverty in the rural areas is so widespread and persistent that more than half of the country's poor are found in the rural areas. Add this to the fact that rural poverty itself appears to be concentrated among the livestock farms in the rangelands, and it seems clear that the economy of the rangelands must remain a central focal point for policymakers aiming to alleviate poverty."},{"index":2,"size":74,"text":"We investigated the determinants of poverty in the rural rangelands of Kenya. Our approach to modeling the determinants of poverty is to model the determinants of the location level welfare indicator, namely poverty incidence. Three different models are estimated, the OLS, global and local regression models. A number of geographic variables are included in the model as explanatory variables. We use rural regression models to predict changes in poverty levels from simulated policy changes."},{"index":3,"size":66,"text":"A key conclusion of our study has to do with the important instrumental role of geographic conditions in determining poverty rates. The results show the need to take into consideration spatial variables when undertaking such studies with likelihood to influence policy. The results also give an indication of the need to base conclusions on multistage analysis since different factors were found useful at the various scales."},{"index":4,"size":101,"text":"There are several geographical factors influencing poverty among the livestock keepers in Kenya. The magnitude, however, changes with the different variables. Soil quality, agroclimatic variables, wetlands and farmlands, proportion of the location under slope, elevation and income inequality variables tend to have significant effects of poverty. The latter result implies that the higher income households tend to be very concentrated in the main economic centers where many of the productive activities are based, hence they have low poverty in those locations. Levels of poverty are high in the low inequality areas, reflecting less economic opportunities available to households in these areas."},{"index":5,"size":158,"text":"Besides identifying some of the key contributory causes of poverty in rangelands of Kenya at location level, the other objective of this paper was to carry out simulation analysis. This has been considered at two levels, first looking at the factors which can be influenced by policy or area amenable to change. Within this framework, poverty is seen to rise or decline if either (a) a change in the conditions due to a policy effect can lead to a rise or fall in poverty at the location level; or (b) analysis of changes in either direction of certain important geographic conditions that have significant effects on the level of poverty. We can observe that improvements in soil and road infrastructure will reduce poverty by 5 and 7 percentage points, respectively. Broadly therefore, this analysis provides important spatial information about the determinants of poverty and how changes in policy can affect location level poverty in the rangelands of Kenya."},{"index":6,"size":1,"text":"Appendices."}]},{"head":"Table A1. Description of Variables","index":20,"paragraphs":[]},{"head":"Short description Source Explanation","index":21,"paragraphs":[]},{"head":"Agroclimatological","index":22,"paragraphs":[{"index":1,"size":12,"text":"Annual Rainfall (mm) The WorldClim interpolated global terrestrial climate surfaces. Version 1.3."},{"index":2,"size":27,"text":"The average annual rainfall within the location boundaries, calculated as the sum of all the monthly rainfall figures derived from the original Worldclim1.3 dataset of monthly layers."}]},{"head":"Rainfall coefficient of variation","index":23,"paragraphs":[{"index":1,"size":9,"text":"The WorldClim interpolated global terrestrial climate surfaces. Version 1.3."},{"index":2,"size":34,"text":"The average coefficient of variation (CV) of rainfall between the months within 1 year within the location boundaries. This variable was derived from the worldclim1.3 dataset of bio-climatic information, which describes the \"rainfall seasonality\". "}]},{"head":"Distance and Access to services","index":24,"paragraphs":[]},{"head":"Land use","index":25,"paragraphs":[]},{"head":"Percent of location under Protected Area","index":26,"paragraphs":[{"index":1,"size":20,"text":"World Database on Protected Areas (WDPA -sea.unep-wcmc.org/wdbpa) This variable represents the percent of location that is under the Protected Area."}]},{"head":"Percent of location under Wetlands","index":27,"paragraphs":[{"index":1,"size":5,"text":"Africover landcover multipurpose database (FAO)"},{"index":2,"size":21,"text":"The original land cover was produced from visual interpretation of digitally enhanced LANDSAT TM images (Bands 4,3,2) acquired mainly in 1999."},{"index":3,"size":18,"text":"Wetland areas are extracted on the basis of code1 of the original layer (considered to be wetland areas)"},{"index":4,"size":8,"text":"Elevation (masl) NASA, Shuttle Radar Topography Mission (SRTM)"},{"index":5,"size":19,"text":"The average elevation in meters above sea level within the location. Percent of location Steep land (I.e. > 10%)"}]},{"head":"NASA, Shuttle Radar Topography Mission (SRTM)","index":28,"paragraphs":[{"index":1,"size":55,"text":"This variable represents the percentage of the location's area that is defined as steep. Steep land was defined as having a slope of more than 10%. The slope was calculated based on the elevation and can be expressed in degrees or percent. Percent of location with 0 -4% slope NASA, Shuttle Radar Topography Mission (SRTM)"},{"index":2,"size":27,"text":"The percentage of the location's area with a slope between 0 and 4 %. Percent of location with 4 -8% slope NASA, Shuttle Radar Topography Mission (SRTM)"},{"index":3,"size":27,"text":"The percentage of the location's area with a slope between 4 and 8 %. Percent of location with 8 -15% slope NASA, Shuttle Radar Topography Mission (SRTM)"},{"index":4,"size":27,"text":"The percentage of the location's area with a slope between 8 and 15 %. Percent of location with 15 -30% slope NASA, Shuttle Radar Topography Mission (SRTM)"},{"index":5,"size":27,"text":"The percentage of the location's area with a slope between 15 and 30 % Percent of location with over 30% slope NASA, Shuttle Radar Topography Mission (SRTM)"},{"index":6,"size":14,"text":"The percentage of the location's area with a slope of more than 30 %.  "}]}],"figures":[{"text":" List of Tables ................................................................................................................................. iii Acknowledgements........................................................................................................................ iv Abstract........................................................................................................................................... v 1.0 Introduction......................................................................................................................... 1 2.0 Poverty, Livestock and the Environment in Kenya ................................................................. 2 3.0 Data and Empirical Implementation ......................................................................................... 6 3.1 Data ....................................................................................................................................... 6 3.2 Estimation Strategy............................................................................................................... 6 3.2.1 Generalized OLS regression model ............................................................................... 7 3.2.2 Global spatial regression model..................................................................................... 7 3.2.3 Local Spatial Regression Analysis: Geographically Weighted Regression .................. 9 4.0 The Determinants of Poverty among Poor Livestock Farmers (rangelands) in Kenya .......... 10 4.1 Spatial Error Model............................................................................................................. 11 4.2 Spatial Variation in Poverty Determinants ......................................................................... 15 5.0. Poverty Simulations ............................................................................................................... 176.0 Conclusions and Implications for Policy ................................................................................ 18 7.0.References............................................................................................................................... 21 Appendices.................................................................................................................................... 24 iii List of Tables "},{"text":" Diagnostics for spatial dependence................................................................................. Table 2. Results of the spatial error model ................................................................................... Table 3. Summary results of global model .................................................................................. Table "},{"text":" The study sets out to answer the following questions. What spatial factors are dominant in influencing variation in poverty among livestock keepers in Kenya? Does the relationship between agroclimatic variables and poverty differ significantly among poor livestock keepers in Kenya? In other words, what spatial factors are important in explaining the level of poverty in livestock keeping areas in Kenya? What are the implications of changes in spatial factors and policies for poverty among livestock keepers in Kenya? "},{"text":" Figure A1 "},{"text":"Table 1 . Diagnostics for spatial dependence Table 2 below shows the results of the spatial error model based on a regression of a set of unrestricted exogenous variables on poverty rate. The model explains more than 60 percent of the variation in rural poverty and 14 of the 22 coefficients are statistically significant. Based on the preferred parameter estimates shown in Table 2 below, the following points about the determinants of poverty among livestock keepers are notable. FOR WEIGHT MATRIX :(row-standardized weights)   FOR WEIGHT MATRIX :(row-standardized weights) TEST Value Probability TESTValueProbability Moran's I 33.5100 0.0000 Moran's I33.51000.0000 Lagrange Multiplier (lag) 738.6246 0.0000 Lagrange Multiplier (lag)738.62460.0000 Robust LM (lag) 88.3999 0.0000 Robust LM (lag)88.39990.0000 Lagrange Multiplier (error) 849.5040 0.0000 Lagrange Multiplier (error)849.50400.0000 Robust LM (error) 199.2792 0.0000 Robust LM (error)199.27920.0000 Source: Authors computations   Source: Authors computations 4.1 Spatial Error Model   4.1 Spatial Error Model  "},{"text":"Table 2 . Results of the spatial error model  Dependent Variable Poverty incidence   Dependent VariablePoverty incidence Variable Coefficient Std.Error Probability VariableCoefficientStd.Error Probability CONSTANT 0.9318 0.0552 0.0000 CONSTANT0.93180.05520.0000 Demographic    Demographic POPDEN 0.0000 0.0000 0.7967 POPDEN0.00000.00000.7967 Provincial dummy variables    Provincial dummy variables reg3 (Coast) -0.1070 0.0396 0.0069 reg3 (Coast)-0.10700.03960.0069 reg4 (East) 0.0218 0.0262 0.4065 reg4 (East)0.02180.02620.4065 reg5 (North Eastern) 0.0716 0.0379 0.0587 reg5 (North Eastern)0.07160.03790.0587 Reg7 (Rift Valley) -0.0344 0.0190 0.0704 Reg7 (Rift Valley)-0.03440.01900.0704 Distance and travel time    Distance and travel time Average travel time to Type 1 or 2 Road (minutes) 0.0000 0.0000 0.1501 Average travel time to Type 1 or 2 Road (minutes) 0.00000.00000.1501 Mean distance to town 50,000 people 0.0001 0.0002 0.4458 Mean distance to town 50,000 people0.00010.00020.4458 Mean distance to town 200,000 people 0.0000 0.0000 0.1096 Mean distance to town 200,000 people0.00000.00000.1096 Land use    Land use Percent of location under grass -0.0006 0.0004 0.1240 Percent of location under grass-0.00060.00040.1240 Percent of location under farmland -0.0005 0.0002 0.0474 Percent of location under farmland-0.00050.00020.0474 Percent of location wooded 0.0001 0.0002 0.6391 Percent of location wooded0.00010.00020.6391 Percent of location under wetland -0.0013 0.0006 0.0347 Percent of location under wetland-0.00130.00060.0347 Natural Factors    Natural Factors Average Elevation (meters above sea level) -0.0001 0.0000 0.0004 Average Elevation (meters above sea level)-0.00010.00000.0004 Percent of location with 4 -8% slope 0.0018 0.0003 0.0000 Percent of location with 4 -8% slope0.00180.00030.0000 Percent of location with 8 -15% slope -0.0025 0.0005 0.0000 Percent of location with 8 -15% slope-0.00250.00050.0000 Percent of location with 15 -30% slope 0.0022 0.0006 0.0004 Percent of location with 15 -30% slope0.00220.00060.0004 Percent of location with over 30% slope 0.0015 0.0005 0.0024 Percent of location with over 30% slope0.00150.00050.0024 Percent of location with LGP less than 60 days 0.0002 0.0002 0.3523 Percent of location with LGP less than 60 days0.00020.00020.3523 Percent of location with LGP 180 days -0.0007 0.0001 0.0000 Percent of location with LGP 180 days-0.00070.00010.0000 Good soil (dummy) -0.0146 0.0074 0.0491 Good soil (dummy)-0.01460.00740.0491 LAMBDA 0.8559 0.0260 0.0000 LAMBDA0.85590.02600.0000 Observations 1159   Observations1159 Adjusted R-squared 0.6069   Adjusted R-squared0.6069 Log likelihood 1089.3881   Log likelihood1089.3881 Source: Authors computations    Source: Authors computations  "},{"text":"Table 3 . Summary results of global model  Variable Parameter Standard  VariableParameterStandard  Estimate Error T EstimateErrorT Intercept 1.13193 0.04556 24.84479 Intercept1.131930.0455624.84479 gini -1.89441 0.11599 -16.33279 gini-1.894410.11599-16.33279 pden 0.00002 0.00004 0.49258 pden0.000020.000040.49258 elev -0.00005 0.00001 -5.41664 elev-0.000050.00001-5.41664 pcfrm 0.00042 0.00029 1.46745 pcfrm0.000420.000291.46745 pcgrs -0.00142 0.00044 -3.19560 pcgrs-0.001420.00044-3.19560 pc48sp 0.00310 0.00038 8.12871 pc48sp0.003100.000388.12871 p815sp -0.00210 0.00063 -3.32066 p815sp-0.002100.00063-3.32066 p1530s 0.00136 0.00078 1.72895 p1530s0.001360.000781.72895 pc30sp 0.00137 0.00057 2.38402 pc30sp0.001370.000572.38402 trod12 0.00000 0.00001 -0.27440 trod120.000000.00001-0.27440 lgp60 0.00048 0.00016 3.03990 lgp600.000480.000163.03990 gdsoil -0.02892 0.00865 -3.34254 gdsoil-0.028920.00865-3.34254 dst502 -0.00020 0.00008 -2.58885 dst502-0.000200.00008-2.58885 dt2002 0.00001 0.00001 1.28147 dt20020.000010.000011.28147 pcwod 0.00040 0.00021 1.94122 pcwod0.000400.000211.94122 pcwtld -0.00182 0.00073 -2.49048 pcwtld-0.001820.00073-2.49048 lgp180 -0.00041 0.00013 -3.25238 lgp180-0.000410.00013-3.25238 Adjusted R-square.. 0.321775  AdjustedR-square..0.321775 Number of observations 1159  Number ofobservations1159 Source: Authors computations   Source: Authors computations  "},{"text":"Table 4 . Impact of changes in soils and market access: An Illustrative Simulation  Variable Obs Level Std. Dev. VariableObsLevel Std. Dev. Base Poverty Rate before soil improvement 1159 55.9 0.147 Base Poverty Rate before soil improvement115955.90.147 Poverty rate after soil improvement 1159 50.4 0.126 Poverty rate after soil improvement115950.40.126 Poverty rate after road improvement 1159 48.3 0.144 Poverty rate after road improvement115948.30.144  "},{"text":"Table A2 : Descriptive statistics  Variable Obs Mean Std. Dev. Min Max VariableObsMeanStd. Dev.MinMax avg_fgt0 1159 0.56 0.15 0.13 0.91 avg_fgt011590.560.150.130.91 avg_gini 1159 0.30 0.04 0.19 0.55 avg_gini11590.300.040.190.55 popden 1159 86.81 128.35 0.12 1318.44 popden115986.81128.350.121318.44 Elevation 1159 1012.18 646.15 2.82 3087.83 Elevation11591012.18646.152.823087.83 perc_farmlandd 1159 14.62 20.87 0.00 97.95 perc_farmlandd115914.6220.870.0097.95 perc_grass 1159 24.80 13.38 0.00 82.11 perc_grass115924.8013.380.0082.11 perc_wetla~s 1159 1.74 5.41 0.00 51.67 perc_wetla~s11591.745.410.0051.67 perc_wooded 1159 22.75 22.19 0.00 93.09 perc_wooded115922.7522.190.0093.09 perc4_8slop 1159 18.73 14.90 0.00 60.31 perc4_8slop115918.7314.900.0060.31 perc8_15slop 1159 11.45 11.32 0.00 56.74 perc8_15slop115911.4511.320.0056.74 perc15_30s~p 1159 8.82 11.02 0.00 59.20 perc15_30s~p11598.8211.020.0059.20 perc30_abo~p 1159 5.72 10.41 0.00 70.87 perc30_abo~p11595.7210.410.0070.87 goodsoil 1159 0.39 0.49 0.00 1.00 goodsoil11590.390.490.001.00 lgparids~180 1159 38.54 46.28 0.00 100.00 lgparids~180115938.5446.280.00100.00 lgp60days 1159 91.45 25.99 0.00 100.00 lgp60days115991.4525.990.00100.00 t_trav_ro~12 1159 261.26 383.81 7.21 4275.04 t_trav_ro~121159261.26383.817.214275.04 d_dist_200k2 1159 2224.22 1831.33 96.19 7982.93 d_dist_200k211592224.221831.3396.197982.93 d_dist_50k 1159 117345.30 133542.50 2708.51 547139.10 d_dist_50k1159 117345.30 133542.50 2708.51 547139.10 reg3 1159 0.12 0.33 0.00 1.00 reg311590.120.330.001.00 reg4 1159 0.25 0.43 0.00 1.00 reg411590.250.430.001.00 reg5 1159 0.17 0.38 0.00 1.00 reg511590.170.380.001.00 reg7 1159 0.37 0.48 0.00 1.00 reg711590.370.480.001.00  "}],"sieverID":"ea6d1336-961c-49b8-a407-74b59b12d1a1","abstract":"This paper explores the spatial determinants of poverty among livestock keepers by taking an econometric approach that combine poverty indices for livestock keeping areas in Kenya as the dependent variable and relating this to a variety of spatial variables likely to contribute to poverty at a local scale. We use both global and local regression models. In carrying out this analysis, elimination of spatial autocorrelation was done by use of the Moran's I and Lagrange multiplier. The results show different spatial variables to influence poverty at the different scales and to be geographically related at the local scale. Soil quality, agro-climatic conditions, slope, land use and demographic variables are important factors in determining poverty. These variables offer a challenge to policymakers in deciding on the measures to take to enable the reduction of poverty in the rangelands of Kenya. With the establishment of constituency development funds, tackling the problem at the local scale could be the most feasible option for the national government when such information is made available."}

data/part_5/028c4f950d6f38678201bd00dad5d535.json

@@ -0,0 +1 @@
+{"metadata":{"id":"028c4f950d6f38678201bd00dad5d535","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6ff89c5b-ef46-4e0c-bfc3-007b6c790876/retrieve"},"pageCount":2,"title":"The 3 rd International Forum on Water and Food","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":" out in a given territory with resources that often come form outside "}],"sieverID":"2e120999-a642-41fd-8d7c-e8132922a2d6","abstract":""}

data/part_5/028d11e9db6939487b79e8f2da958852.json

@@ -0,0 +1 @@
+{"metadata":{"id":"028d11e9db6939487b79e8f2da958852","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/392f23e1-88c5-4839-b3f1-1b4d0ed98c0e/retrieve"},"pageCount":2,"title":"Digital imaging as scoring method for spittlebug tolerance in Urochloa humidicola hybrids","keywords":[],"chapters":[],"figures":[],"sieverID":"8ac28d38-c862-40a4-80aa-6503cf1a1e0b","abstract":"P1685 -Product Line 3.2.1: Improved feed & forage germplasm and new tools and technologies for breeding Description of the innovation: American spittlebug complex (Hemiptera: Cercopidae) is a critical pest for Urochloa humidicola. Visual scoring of plant damage by spittlebugs, the standard method to screen for variation in plant tolerance, is slow, prone to human bias, and reliant on trained personnel. Damage estimated from digital images was twice as fast as expert visual scoring and gave heritability values for plant damage as good as, or better than, those obtained by expert visual scoring."}

data/part_5/0291ecb0eaa7ed0013085113fa755c94.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0291ecb0eaa7ed0013085113fa755c94","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c8854548-b51d-463c-8032-080a31be8c23/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[{"head":"Partners","index":1,"paragraphs":[{"index":1,"size":14,"text":"• Developing a better understand of the feeding opportunities and challenges facing dairy cooperatives."},{"index":2,"size":20,"text":"• Conducted a fodder markets study to understand the rice straw marketing chain and explore potential linkages to dairy cooperatives."},{"index":3,"size":12,"text":"• Assessments of rice straw fodder quality traits (nutritional and farmer preferences)"},{"index":4,"size":21,"text":"• Developing a feed quality database of common local feeds to support feed utilisation using the On-farm Feed Advisor (OFA) App."},{"index":5,"size":14,"text":"• Providing technical information to support broader dissemination/ promotion of feed interventions to farmers"},{"index":6,"size":14,"text":"• Low livestock productivity amongst smallholders mainly constrained by seasonal, inadequate and poor-quality feeding."},{"index":7,"size":19,"text":"• There is a lack of focus on crop residues despite their importance and potential as a feed resource."},{"index":8,"size":10,"text":"• The quality and volumes of traded fodder is unknown."},{"index":9,"size":15,"text":"• There is a lack of nutrition information to compound feeds locally and promote utilisation. "}]}],"figures":[{"text":"FeedsFigure 1 : Figure 1: Box plot showing (a) crude protein (DM%) and (b) metabolizable energy (ME (MJ/kg) ; n=470 "}],"sieverID":"f275fc56-47c3-4a89-b929-199ae4d97da6","abstract":""}

data/part_5/02ba84c5faef7e91d37039bce28fbf96.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02ba84c5faef7e91d37039bce28fbf96","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/89aedb74-9543-4fad-9431-6abf16a4f9fa/retrieve"},"pageCount":25,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":101,"text":"Feed shortage and poor quality of available feeds are major factors that have constrained the livestock production sector in Ethiopia. The increasing human and livestock population has resulted in continuous natural resources degradation and decline in productivity. Moreover, drought and natural disasters like flooding becomes more frequent in many parts of the country. The expansion of croplands to meet the food demands makes the grazing lands to shrink continuously. Despite all these constraints, livestock plays a major role in the livelihood of most pastoralists and farmers by providing food to the family, supporting crop production and contributes to the national economy."},{"index":2,"size":106,"text":"The government of Ethiopia, in its growth and transformation plan, has considered livestock as the main agenda of development and a driver of change. In this plan, the major intervention is transforming the feed supply and quality, in which cultivated forage production is the main target. On the other hand, the national Climate Resilient Green Economy (CRGE) strategy targets the reduction of greenhouse gas emissions from livestock through improved feeding and increased productivity. The main strategy is keeping crossbred animals and improved feeding through cultivation of forages. Similarly, the Livestock Master Plan (LMP) has also designed livestock development primarily with increased access to cultivated forage production."},{"index":3,"size":66,"text":"Currently, the major feed sources for livestock are natural grazing lands and crop residues. The contribution of agro-industrial by products concentrate feeds and cultivated forage crops is minimal. Adoption of cultivated forage crops in the farming system is very low. The main reasons for this low adoption include lack of awareness, shortage of inputs, use of low producing animals, poor supply of seeds and planting materials."},{"index":4,"size":79,"text":"Different species of cultivated forage crops have been evaluated for their various uses and their production in the different agro-ecologies of Ethiopia. These forage crops are broadly categorized as forage grasses, legumes and browses. With the current scenario of very critical feed shortage in Ethiopia, use of cultivated forage crops is not a choice but is a must. However, cultivation of forage crops, particularly by smallholder farmers, is feasible when various appropriate options of forage production strategies are practiced."}]},{"head":"Forage cultivation niches Cultivation of forage crops in arable lands","index":2,"paragraphs":[{"index":1,"size":51,"text":"In small and medium scale market-oriented livestock producers especially, dairy producers need to cultivate forage crops in a conventional way. Depending on the number of animals and feed requirements farmers could decide the size of the farm to cultivate forage crops. Forage crops cultivated should primarily consider adaptability, productivity and quality."},{"index":2,"size":98,"text":"In areas where communal grazing is practiced and if there is communal after-math grazing then forage crops cultivated should preferably be annuals like oats, vetch, lablab, Sudan grass, cowpea etc. Such forage crops should be grown in the normal cropping seasons usually under rainfed conditions, harvested and conserved as hay or silage. The produced forage should be properly conserved and fed to livestock in a well-planned way. On the other hand, cultivation of perennial forage crops may create difficulties to keep them during the offseason unless and otherwise it is fenced and well protected from free grazing livestock."},{"index":3,"size":43,"text":"Forage crops can also be cultivated under irrigation where such areas are protected from livestock grazing. Under such conditions, highly productive annual and perennial forage crops can be cultivated and used either in a cut and carry or conserved and fed to animals."},{"index":4,"size":84,"text":"Generally, when planning cultivation of forage crops, one needs to consider gathering information on the soil and production system and identify suitable and productive forage species to the area (annuals vs perennials, grasses vs legumes and mixtures) Effective planning and targeting of cultivated forages can enable smallholders and commercial producers to get adequate feed year-round and most importantly farmers who do not have access to or the capacity to purchase concentrate feeds can get good quality feed with relatively cheaper prices in their vicinity."}]},{"head":"Backyard forage cultivation","index":3,"paragraphs":[{"index":1,"size":115,"text":"One of the strategies to produce a small scale but high-quality forage production is cultivation of forages in and around the backyards. Backyard of smallholder farmers are usually small but with high soil fertility. Farmers use the backyards for different purposes. They planted mostly perennial crops of high-value crops like spices, fruits and vegetables. However, farmers with productive animals can grow very high quality and a remarkable good quantity of forages in and around the backyards. In addition to this various forage crops could be planted along the fence lines and could provide multipurpose uses. It provides forages, serve as fence and wind protection. The forages to be grown in the backyards needs to be."},{"index":2,"size":59,"text":"• Adaptable for the targeted agro-ecology • High in quality in terms of animal preference and nutrients especially Crude proteins • Highly productive per unit area • Highly prolific with fast regrowth ability • Very good compatibility with other guarded crops • When planted along the fence lines browse trees and taller forages like elephant grass could be used"},{"index":3,"size":50,"text":"The availability of irrigation from different sources (rivers, shallow wells, boreholes, reservoirs etc) around the backyards would be an additional advantage. The water could be used as a supplemental irrigation during the dry season or when there is moisture stress to have fresh and quality feed supply throughout the year."}]},{"head":"Forage production on soil and water conservation structures","index":4,"paragraphs":[{"index":1,"size":69,"text":"The crop livestock mixed production systems are practiced dominantly in the highland and mountainous areas of Ethiopia. These areas were traditionally cultivated for hundreds of years. The human and livestock population was tripled during the last forty or so years, which creates a lot of pressure on land and natural resources. Currently, land degradation is a serious challenge in Ethiopia, which is also aggravated by climate variability and changes."},{"index":2,"size":103,"text":"In this regard, various efforts are going on nationally on natural resources conservation especially in the areas of water and soils. Forage crops have an important role in natural conservation practices. Using forages in conservation activities have the advantage of protecting the land from soil and water erosion and could also provide forage as feed source to livestock. These activities are widely practiced by the ministry of agriculture, ministry of natural resources and environmental protection and many other NGO engaged in agricultural development. Forages are planted on soil bands, gullies, enclosures, degraded grazing lands and sloppy areas to protect soil and water resources."},{"index":3,"size":58,"text":"Such activities are widely implemented at community and individual levels. Communities have participated in communal lands, enclosures where the management of the outputs and the overall efficiency are low. On the other hand, individual farmers are making conservation structures on their arable lands, plant forage crops on conservation structures and farmers are benefited a lot from such activities."},{"index":4,"size":120,"text":"The forage species to be used in the conservation structure could be selected based on their adaptability to the given agro-ecology. In the highland areas species well adapted to the highlands (cooler environment) could be used similarly well performing species in the mid and low altitude areas are pertinent in the warmer and hot areas (Table 1). In addition to their forage productivity and vegetative growth, forages for conservation practice need to have deep and fibrous roots to hold the soil firmly, bunch types of growth habit with numerous tillers, tolerant to trampling and possible grazing of animals, drought and moisture tolerant so that it can persist the longer dry season, and quickly responsive to small showers with fast growth."},{"index":5,"size":88,"text":"Oat-vetch mixture forage Description Oat and vetch are annual forages, which-when grown using intercropping-provide a high biomass yield of good nutritional quality. While oat comes from the grass family, vetch is a leguminous forage. Consequently, oat-vetch mixture is a balanced feed in terms of energy and protein contents and has very high feed values for animals as green fodder or hay. Moreover, vetch potentially offers substantial improvements in terms of soil fertility through nitrogen fixation and serves as a weed and disease break when used in crop rotations."}]},{"head":"Growth","index":5,"paragraphs":[{"index":1,"size":73,"text":"• Oat and vetch are compatible when grown using intercropping and have a short growth cycle, ranging from 60-90 days before the forage can be used as feed. • This feature enables farmers to effectively use available rain to produce good quality fodder in a short period of time and free up their land for other crops. • The short growth cycle also makes these forage combinations suitable to be grown under irrigation."}]},{"head":"Land preparation","index":6,"paragraphs":[{"index":1,"size":51,"text":"• The land preparation for oat and vetch is like that needed for other crops. It needs to be plowed repeatedly, preparing a smooth plot, before the seeds can be sown. • The land also needs to be well drained, as water logging has a significantly negative effect on yield rates."}]},{"head":"Sowing","index":7,"paragraphs":[{"index":1,"size":149,"text":"• Seed rates of 75 kg/ha for oats and 25 kg/ha for vetch are recommended with a high germination rate (above 90%). The seed rate can be increased to 90 kg/ha for oats and 30 kg/ha for vetch to provide allowance for low seed emergence. • Both row planting and broadcasting may be used depending on the amount of land and the availability of labour. In case of row planting, the spacing between rows should be 15 cm and oat and vetch should be sown on alternate rows (i.e. oats on the first row, vetch on the second one, etc.). It is a good practice to divide the seeds between the total number of rows before starting to sow to make sure the distribution is even. • When a broadcast method is used, the seeds need to be thoroughly mixed to ensure a uniform distribution of the two forages."}]},{"head":"Harvesting","index":8,"paragraphs":[{"index":1,"size":16,"text":"• The ideal moment for harvesting oat-vetch is when the forage has reached the bloom stage."},{"index":2,"size":24,"text":"• The forage can be conserved in the form of hay or used as a green feed mixed with other locally available feed resources."}]},{"head":"Benefits","index":9,"paragraphs":[{"index":1,"size":113,"text":"The oat-vetch mixture provides high biomass yields (approximately 12 tonnes of dry matter per hectare) of good nutritional quality (crude protein of 15.5% and metabolizable energy of 10 MJ/kg of dry matter. The mixture provides a balanced diet in terms of protein and energy. The forage can be used as a very good supplement for lactating cows, fattening sheep or beef cattle. Mixing about 30% of the oat-vetch mixture with about 70% of locally available feeds, such as crop residues, improves utilization and animal productivity. Milk yields of lactating cows consuming crop residue-based diets have increased by more than 50% when supplemented daily with approximately 2 kg of dry matter of oat-vetch mixture."},{"index":2,"size":4,"text":"Tree Lucerne (Chamaecytices palmensis)"}]},{"head":"Description","index":10,"paragraphs":[{"index":1,"size":63,"text":"Tree Lucerne (Chamaecytices palmensis) is one of the few leguminous fodder and fertilizer tree species that perform well in areas of high altitude. The plant fixes and adds nitrogen to the system, enhancing livestock, crop and soil productivity. Commonly referred to as tree lucerne or tagasaste, it is native to Spain and exotic species to Australia, Ethiopia, South Africa, Rwanda and New Zealand"}]},{"head":"Growing ecology","index":11,"paragraphs":[{"index":1,"size":13,"text":"-Lucerne can grow in areas from 2,000-over 3,000 masl of the Ethiopian highlands."},{"index":2,"size":7,"text":"-It requires from 350-1,600 mm of rainfall."},{"index":3,"size":11,"text":"-The soil in which it is planted should be well drained."}]},{"head":"Establishment of tree lucerne","index":12,"paragraphs":[{"index":1,"size":26,"text":"Photo 1 . A farmer in Lemo district, southern Ethiopia harvesting oat-vetch mixture forage in his backyard for feeding to lactating cows (photo credit: ILRI/Kindu Mekonnen)"},{"index":2,"size":25,"text":"-The identification of farmers interested in planting, managing and using tree lucerne is important. -Seed sources: Seeds can be collected locally or sourced from suppliers."},{"index":3,"size":23,"text":"-Seedling raising: Private, community and government nurseries are involved in this area of business. -Seedling production systems include bare rooted and container systems."},{"index":4,"size":24,"text":"-Seed treatment: Tree lucerne seeds require scarification or immersion in boiled water for one minute. -Ensuring the compatibility of farmer planting niches needs supervision."},{"index":5,"size":12,"text":"-A seedling size of more than 45 cm is preferable for planting."},{"index":6,"size":9,"text":"-Seedlings require at least three months in the nursery."},{"index":7,"size":54,"text":"-A planting hole of 30-40 cm deep is recommended to protect the tap roots from being harmed. -It can be planted as a live fence, fodder lot, soil and water conservation structures, and boundary planting and intercropped with crops and vegetables. -Lucerne trees should be planted at least 25 cm apart from each other."}]},{"head":"Management of tree Lucerne","index":13,"paragraphs":[{"index":1,"size":6,"text":"-Regularly spot weeding around the seedling."},{"index":2,"size":45,"text":"-Fencing should be erected to protect the trees against incursion by livestocktrampling and browsing. -The use of mulch/manure is recommended to help retain moisture in the soil and suppress weeds. -The plants should be watered at an early on to improve survival and growth rates."},{"index":3,"size":12,"text":"-Cutting the tree at a height of 1-1.5 m provides good biomass."},{"index":4,"size":16,"text":"-The plant can be harvested two-three times a year, depending on growing niches and management practices."}]},{"head":"Utilization of tree lucerne","index":14,"paragraphs":[{"index":1,"size":146,"text":"-In a well-managed farm, the plant can be harvested and used as an animal feed with nine months of planting. -The lucerne tree can produce more than 4-7 ha-1 of dry biomass year-1 under and when planted at 1 m x 1 m spacing. -The leaf and edible branches of tree lucerne contain large amounts of crude protein (20-25%) and digestible organic matter (> 70%). -The foliage of tree lucerne can be fed green or wilted or preserved in the form of hay and used as needed. -A 1 kg supplement of dried tree lucerne leaf feed to a lactating dairy cow can give up to 1.2 liters of extra milk. -A 300-400 g supplement of tree lucerne hay fed to a fattening sheep is enough to achieve a daily body weight gain of 70 g. -Tree lucerne seeds serve as good sources of poultry feed."},{"index":2,"size":11,"text":"-Tree lucerne flowers are a very good source of bee fodder."}]},{"head":"Important tip","index":15,"paragraphs":[{"index":1,"size":41,"text":"Household size, access to reliable water supply, and management factors-including fencing planted seedlings to protect from browsing, mulching during dry periods, clean spot weeding and applying organic fertilizers-significantly enhanced survival and growth of tree lucerne at the Africa RISING planting sites."}]},{"head":"Fodder beet Description","index":16,"paragraphs":[{"index":1,"size":82,"text":"Fodder beet (Beta vulgaris subsp. Vulgaris L) is an annual/ biennial plant with thick roots and is cultivated in a cooler climate. The roots are a rich energy source for livestock. Fodder beet needs a long growing season (6-7 months), and rich soil to perform well. It grows in the highlands of Ethiopia (1800-3000 masl) with 750 mm rain and above. The high sugar content makes fodder beet palatable and a valuable energy source for ruminants and to some extent for pig."}]},{"head":"Objective","index":17,"paragraphs":[{"index":1,"size":16,"text":"To provide palatable and high energy feed for livestock with nutritive value equivalent to cereal grains."}]},{"head":"Management","index":18,"paragraphs":[{"index":1,"size":11,"text":"• Field preparation A clean and well-prepared seed bed is required."}]},{"head":"• Establishment","index":19,"paragraphs":[{"index":1,"size":67,"text":"Fodder beet does better on light or medium soils to avoid harvest problems. The recommended seed rate is 5-10 kg/ha or use raised seedlings from nursery. Seeds can be row planted in June at 2 cm sowing depth and in rows 50 cm apart. Thinning can be done to give 20-25 cm spacing between plants or seedlings that can be transplanted from nurseries 1-2 months after planting."}]},{"head":"• Fertilizer","index":20,"paragraphs":[{"index":1,"size":21,"text":"Photo 2. Farmers at the Endamehoni Africa RISING site, Tigray region, feeding tree lucerne to small ruminants (photo credit: ILRI/Kindu Mekonnen."},{"index":2,"size":32,"text":"Apply DAP at 100 kg/ha during establishment or about 10-15 t/ha of farmyard manure. Manure is very variable in quality and hence rates may vary depending upon soil types and previous cropping."}]},{"head":"• Weeding and cultivation","index":21,"paragraphs":[{"index":1,"size":31,"text":"Requires effective hand weeding especially during the early establishment period (the first one-two months). Hoeing and piling the soil around the roots is essential to facilitate increased root development and growth."}]},{"head":"Performance","index":22,"paragraphs":[{"index":1,"size":73,"text":"Fodder beet requires a lot of work, but rewards are high in terms of yield and animal performance. The average tuber yield is around 20 tons dry matter/ha. The leaves/tops will also contribute a further 3-4 tons dry matter/ha. Roots are high in energy (12-13 MJ ME/kg DM) but low in protein with crude protein values of 6-10%. It is highly digestible (70-80%). Tops (leaves) are relatively better in nutrient levels than bulbs(roots)."}]},{"head":"Seed production","index":23,"paragraphs":[{"index":1,"size":37,"text":"Fodder beet flowers and produces seeds in the second year and the root decreases in size. When seed of fodder beet is ready for harvest, stripping is used for seed collection. Seed yield is about 400-500 kg/ha."}]},{"head":"Utilization","index":24,"paragraphs":[{"index":1,"size":196,"text":"The roots can be harvested after about 6 months from planting when they are at their maximum size. The roots are harvested carefully by digging them out of the ground. They need to be washed and separated from any soil material. In general, washed roots can be used for intensive management systems in dairy or fattening farms by chopping before feeding. Tops may also be fed after wilting. The tops can also be grazed or ensiled. Roots can be stored in the field (underground soil) or can be stored in stores after harvest for 4-5 months if not damaged during harvest. Cows must be adapted to feeding the tuber gradually, by starting with a low level of an offer for the first time (e.g. 1 kg of tuber in the morning and 1 kg in the afternoon) and gradually increasing the amount of tuber provided over a week time. However, intake should not exceed 0.8% of the animal's live weight to avoid risk of acidosis. Feeding the fodder beets after the cows have been fed to other roughage feeds is advisable to reduce risk of potential toxicity if fed in the morning as a starter feed."}]},{"head":"Limitations","index":25,"paragraphs":[{"index":1,"size":101,"text":"• Porcupine damage can be a problem Sweet lupine (Lupinus albus) as a feed and food crop Description Sweet lupine is a leguminous crop that was recently introduced to Ethiopia. As opposed to the local bitter lupine variety-which has high alkaloid content-sweet lupine has minimal levels of secondary metabolites, and the grain's crude protein content is high (35%); this makes it suitable for use as food and feed. As a legume crop, it contributes to soil fertility and can serve as a rotation crop, especially in areas where disease affecting pulse crops, such as faba bean, has become a serious problem."}]},{"head":"Growing sweet lupine","index":26,"paragraphs":[{"index":1,"size":69,"text":"• Sweet lupine varieties, such as Sanabor and Vitabor, released by Amhara Agricultural Research Institute through the national system have been found to perform very well at the Africa RISING research sites. • While sweet lupine varieties are generally susceptible to water logging and do not grow well on vertisols, they tolerate soil acidity. • Farmers can grow sweet lupine as a sole crop or intercrop it with maize."}]},{"head":"Land preparation and sowing","index":27,"paragraphs":[{"index":1,"size":75,"text":"• Sweet lupine has a slow initial root establishment period. To compensate for that, the land needs to be prepared well through repeated ploughing (at least twice). • Water drainages should be established to ensure that run-offs do not negatively impact the sweet lupine plot. • A seed rate of 80 kg/ha is generally recommended. In the case of row planting, the nationally recommended spacing is 30 cm between rows and 7 cm between plants."},{"index":2,"size":57,"text":"However, with a high germination rate (above 90%), the spacing between plants can be increased to 15 cm. • Initial fertilizer application equivalent to 100 kg DAP/ha may be applied. As a legume crop, sweet lupine fixes nitrogen and does not need additional fertilization at later stages. • Mid-July is a suitable period for planting sweet lupine."}]},{"head":"Weeding","index":28,"paragraphs":[{"index":1,"size":26,"text":"• Ideally, the crop should be weeded twice during the growth cycle, the first time after full emergence, and the second just before the plant flowers."}]},{"head":"Harvesting","index":29,"paragraphs":[{"index":1,"size":37,"text":"• The crop reaches gain harvesting stage around the end of December. When mature, sweet lupine pods tend to shatter. It is, therefore, important to closely monitor sweet lupine fields and harvest the pods as they mature."}]},{"head":"Yield and uses","index":30,"paragraphs":[{"index":1,"size":15,"text":"• Sweet lupine yields up to three tonnes of grain/ha, and eight tonnes of haulm/ha."},{"index":2,"size":14,"text":"• The grain is a very good protein and energy supplement for fattening animals."},{"index":3,"size":105,"text":"• Supplementation of 200 g of sweet lupine grain daily to fattening sheep results in a daily body weight gain of about 75 g. The grain can effectively replace commercial concentrate supplements and help farmers finish fattening their animals using a farm grown energy and protein diet. • Like other pulse crops, such as the faba bean and field pea, it can be used for human consumption. Mixed one-one with field pea grain, the Shiro from the grain has been very well received by farmers in north western Ethiopia. • The grain can be processed into various products in the same way as soya bean."},{"index":4,"size":25,"text":"• Generally, integrating sweet lupine into the mixed farming system provides multiple functions-ranging from soil fertility improvement to animal feed supplements and human food resources."},{"index":5,"size":13,"text":"Photo 4 Sweet lupin field and sweet lupin grain (Photo credits: ILRI/Melkamu Bezabih)"},{"index":6,"size":3,"text":"Lablab (Lablab purpureus)"}]},{"head":"Description","index":31,"paragraphs":[{"index":1,"size":91,"text":"Lablab is a leguminous annual or short-lived perennial fodder crop with a very good potential to provide high quality feed for livestock in midland areas and lowland drylands. Lablab is suitable for intercropping with other food crops such as maize and growing under perennial crops. The forge has large leaves, white flowers and light brown seeds. It is fast growing and produces fodder in three months and tolerates drought and cool temperatures. As a legume, it restores soil fertility. It can be used for grazing or cut and carry feeding system."}]},{"head":"Management","index":32,"paragraphs":[{"index":1,"size":43,"text":"-Field preparation-well prepared and ploughed field -Establishment-broadcast seed at 30 kg/ha at 3 cm depth and cover -Fertilizer-apply 100 kg DAP or manure per hectare -Weeding-slow early growth so weed once after the third weeks after establishment -Harvesting-at flowering after about three months"}]},{"head":"Performance","index":33,"paragraphs":[{"index":1,"size":28,"text":"On average about 30 t/ha fresh forage can be harvested, which can be wilted or used as cut and carry. Protein content of the forage is about 18% "}]},{"head":"Limits of use","index":34,"paragraphs":[]},{"head":"Alfalfa (Medicago sativa) Description","index":35,"paragraphs":[{"index":1,"size":114,"text":"Alfalfa is a perennial 1egume that can remain productive for over a decade with good management. It has a deep tap root system that enables the crop to extract moisture deeper soil layers and withstands frost. It has mainly purplish flowers, but also yellow colored cultivars are available. Pods of alfalfa range from the sickle type to those that are twisted into spirals. Each pod contains several small kidney-shaped seeds. New growth occurs from buds in the crown. Leaves are alternately arranged on the stem and are normally trifoliate. Alfalfa is highly palatable with high levels of protein. It is a highly suitable crop for conservation as hay or silage and can be grazed."}]},{"head":"Adaptation","index":36,"paragraphs":[{"index":1,"size":277,"text":"Alfalfa grows best on deep, well-drained, friable soils. Lands subject to frequent overflows or high-water tables are unfavorable for alfalfa. The pH of the soil should be 6.5 or above. It can grow well in cool highlands and warm lowlands of Ethiopia Establishment -A seedbed must be smooth, firm, free of weeds and trash, and contain adequate moisture for germination and emergence. Seeds can be broadcast or drilled in rows or on ridges 50 to 70 cm apart at 8 to 10 kg/ha -Fertilizer-apply 100 kg DAP per hectare -Weeding-weeding is essential in establishment stage and crop requires frequent cultivation -Harvesting-harvested for hay by cutting at 5 cm height at first flowering Performance About 20 t/ha dry matter per year from about 6 to 8 cuts in well managed stands. Protein content of the forage is usually from 20-25% with digestibility of about 70% Limits of use -Not tolerant of continuous grazing -Poor drought tolerance and require water for year-round production -Not very tolerant to acidic soils and waterlogging -Susceptible to many pests and diseases -Bloat in livestock is the major limitation to grazing alfalfa Desho grass (Pennisetum pedicellatum) Description Desho is an indigenous grass belonging to the family of Poaceae. It is a perennial grass that has an extensive root system that anchors well with the soil. It produces high biomass (10-20-ton DM/ha) with a potential of 2-4 times cutting with rainfed production and up to 9 times cutting using irrigation per year. It grows upright with the potential of reaching 90-120 cm based on soil fertility. It can grow anywhere from 1500-2800 masl with optimum elevation over 1700 masl on medium to low soil fertility."}]},{"head":"Uses:","index":37,"paragraphs":[{"index":1,"size":28,"text":"-For a year-round livestock fodder -For erosion control through strip planting -To rehabilitate degraded land -To improve grazing land management -As silage or hay for dry season feed"}]},{"head":"Land preparation and planting:","index":38,"paragraphs":[{"index":1,"size":106,"text":"-Desho needs very good land preparation -Splits of grass from root clump can be used as planting material -Grass clumps should be uprooted and split into several splits -Stem cutting of matured plant that has ≥ 3 nodes can also be used as planting material -Recommended to plant at 10 cm by 10 cm intervals along bunds for SWC -Recommended to plant at 50 cm by 50 cm intervals for grazing land management -Remove the leafy part before planting to reduce competition before it establishes well -Open the soil with hoes and place the split in the soil before pressing the basal soil around the seedling"}]},{"head":"Fertilization:","index":39,"paragraphs":[{"index":1,"size":25,"text":"-Compost/manure of about 4500 kg/ha for establishment and 1000 kg for maintenance -Use about 100 kg/ha of fertilizer for establishment and 25 kg for maintenance"}]},{"head":"Harvesting:","index":40,"paragraphs":[{"index":1,"size":29,"text":"-Cut and carry system is encouraged -Should be harvested at 8 cm high from ground level -Highest yield can be obtained if first harvested at 4 months after planting"}]},{"head":"Economics of production:","index":41,"paragraphs":[{"index":1,"size":28,"text":"-Desho provides a small business opportunity for Ethiopian farmers (sale of the cut and planting materials) -The use of Desho for feed and land management is increasing rapidly"}]},{"head":"Limitations for wider adoption:","index":42,"paragraphs":[{"index":1,"size":11,"text":"-The grass rarely seeds, and propagation is mainly through root splits "}]},{"head":"Seedbed preparation","index":43,"paragraphs":[{"index":1,"size":61,"text":"Brachiaria would require a well-prepared seed bed. Due to the small seeds. A fine seedbed would be preferable. As for most crops, seedbed preparation should be done well before the rains for ease of preparation and killing of weeds. If the piece of land is prone to obnoxious weeds, e.g., couch grass, herbicide spraying is advisable to systematically control these weeds."},{"index":2,"size":38,"text":"Plough to about 25 cm depth and harrow the land to obtain a fine soil tilth necessary for seeds that are small. Preferably avoid sloping and uneven land for lay the plots and minimize likely variations in performance."}]},{"head":"Establishment","index":44,"paragraphs":[{"index":1,"size":55,"text":"Mulatto II (and also other brachiaria grasses) does not bear viable seed under the Ethiopian climatic conditions. So, the main mechanism of propagation, unless seeds are sourced from outside of the country, is through root splits and cuttings. Root splits are planted in a row (40-50 cm between rows and 20 -25 cm between plants)."},{"index":2,"size":127,"text":"If seeds are available, it can be either planted in rows, 40-50 cm apart (8 kg /ha) or broadcasted sown at 10-12 kg/ha. For drilling through seed drills, be very careful not to bury the seed more than 2 cm in depth. Roller drills are preferred because they do not bury the seed too deeply, but instead press the seed just below the soil surface. For broadcast sowings, seed can be spread mechanically or hand sown. The seed must be covered after sowing by harrows. On small areas, tree branches or large brooms can be used to lightly cover the seeds with soil. Be careful not to bury the seed no more than 1-2 cm under the soil. Seeding can be started after 30 mm of rainfall."}]},{"head":"Fertilization","index":45,"paragraphs":[{"index":1,"size":65,"text":"After fertilizer application during planting (for the initial fertilization use a phosphorus dominated fertilizer to support root development -DAP), subsequent applications should be annually with nitrogenous fertilizer at a rate of 100 kg/ha of urea. Application should be done after rains and the soils is wet enough to dissolve the fertilizer. Preferably, application should be after harvesting and the soils are wet, for the regrowth."}]},{"head":"Management","index":46,"paragraphs":[{"index":1,"size":28,"text":"Brachiaria will take 70-80 days till the first cut. In rotation the following cuts can be done after 25-45 days while rainy season respectively 60-70 while dry season. "}]},{"head":"Establishment","index":47,"paragraphs":[{"index":1,"size":91,"text":"Napier is mainly established using cuttings. Cuttings are taken from the basal 2/3 of moderately mature stems and each cutting should contain at least 3 nodes. These are pushed into the soil at 45º, basal end down, with 2 nodes buried. Cuttings can also be planted horizontally into a furrow, to a depth of 5-10 cm. Normally planted in rows 0.5m -1m apart and 0.5 cm apart between plants. Closer spacing is required for soil conservation contour hedgerows and for high rainfall environments. More open spacing is used in drier environments."}]},{"head":"Fertilizer","index":48,"paragraphs":[{"index":1,"size":40,"text":"Should be planted into fertile soil. Once established, requires, 150-200 kg/ha/yr N, together with other nutrients as indicated by soil tests. Responses at much higher levels of applied N have been obtained. Yields decline rapidly if fertility is not maintained."}]},{"head":"Dry matter","index":49,"paragraphs":[{"index":1,"size":41,"text":"Yields depend on fertility, moisture, temperature and management. DM yields of 10-30 t/ha/yr are common, (and up to 85 t/ha/yr) if well fertilized. More frequent cuts (up to 45 days) give less dry matter, but better leaf production than infrequent cuts."}]},{"head":"Limits of use","index":50,"paragraphs":[{"index":1,"size":39,"text":"-Not adapted to areas with frost -Not suited to waterlogged areas -Will not persist without fertilizer -Coarse, fibrous and sharp leaves if not cut frequently Photo 8 Napier grass intercropped with Silver leaf Desmodium (Photo credits: ILRI/ Aberra Adie)"}]},{"head":"Improved feeding management","index":51,"paragraphs":[{"index":1,"size":166,"text":"As feed is the main cost of livestock production, it is essential that available feed resources are used for feeding livestock in an optimal way. Among several measures that need to be taken to optimize feed utilization, the first one is to minimize postharvest losses during feeding and storage. Feeding troughs and feed storage sheds play an important role in minimizing feed wastage. The other important measure is to mix feed ingredients in a proportion that can supply a balanced ration for livestock. In this regard, feed troughs also play an important role because mixing can be done easily, and animals can be offered mixed diets on feeding troughs conveniently. Therefore, it is highly advisable that individual farmers construct their own feed storage sheds for dried feed stuffs including crop residues and hay and feeding troughs for cattle and small ruminants. Traditional practices of chopping cultivated fodders, stovers and leaves before feeding also contribute to increasing feed intakes, minimizing wastages and easing mixing of different feeds."}]},{"head":"Feed troughs Description","index":52,"paragraphs":[{"index":1,"size":80,"text":"Traditionally, dried feed resources-such as hay and crop residues-are stored as heaps in the open air and feeding takes place by spreading a portion on the ground. These management practices are associated with considerable loss of feed biomass and quality as a result of weather, pests, contamination and moulding. Moreover, in a cut-and carry feeding system-where fresh cultivated forages form the basic component of animal diets-traditional feeding practices incur feed biomass wastage due to trampling and defecation on the feed."},{"index":2,"size":13,"text":"Photo 9 A two-sided feeding trough prototype for cattle (photo credits: ILRI/Kindu Mekonnen)"}]},{"head":"Specifications","index":53,"paragraphs":[{"index":1,"size":52,"text":"-Feeding troughs and storage sheds can be constructed from locally available materials; nails are the main external inputs required. -Depending upon where the trough is placed, it can be either one-or two-sided. -A two-sided feeding trough is desirable if it is to be located in the middle of a barn or backyard."},{"index":2,"size":112,"text":"-A one-sided feeding trough is convenient if it is to be attached to a wall of a barn or house. -In line with the size specification indicated in figures 1 and 2, the length of the trough depends upon the number of animals feed on it, allowing for a 70 cm per animal spacing requirement. For instance, a two-sided trough for four animals needs to be 1.4 m long, while one-sided trough for the same animals should be 2.8 m long. -Adding a roof for feeding trough is optional and can be done using locally available materials (grass mat), or plastic and corrugated iron sheets, depending on the capacity of the farmers."}]},{"head":"Storage sheds","index":54,"paragraphs":[{"index":1,"size":107,"text":"-As a basic requirement, all sheds should be built with a roof and a raised floor platform to avoid spoilage from above and below. -The floor needs to be raised 30-40 cm from the ground and aerated with the regular cleaning of the surface underneath. This ensures that the floor is protected from mould and rodent infestation. -The size of the shed depends on the amount of feed (crop residues and hay) that need to be stored there. It is generally recommended that on average a farmer should build a shed of at least 4 m by 3 m to store his or her feed resources safely."}]},{"head":"Benefits","index":55,"paragraphs":[{"index":1,"size":46,"text":"-The evaluation results showed that use of a combination of feed troughs and storage sheds saves individual farmers from 30-50% of feed biomass that would be otherwise wasted. -The labour requirement for feeding is reduced by a minimum of 10-20% due to use of feeding troughs."},{"index":2,"size":49,"text":"-The sensory quality of crop residues and hay is preserved static when stored in sheds, opposed to when it is stored in heaps in the open air. -The cost incurred in the construction of feeding troughs is recovered within a year, while that of storage sheds within three-four years."}]}],"figures":[{"text":"• Photo 3 Fodder beet grown under farmers condition and ready for use (Photo credits: ILRI/Aberra Adie) "},{"text":"- Photo 5 Lablab forage in demonstration sites in Angacha district (Photo credits: ILRI/ Melkamu Bezabih) "},{"text":"- Photo 6 Desho grass (Photo credits: ILRI/Melkamu Bezabih) "},{"text":"Figure 1 . Figure 1. Specification for two-sided feeding trough for mature zebu cattle "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" DescriptionA very tall perennial grass which tends to become coarse as it matures. It Has vigorous deep-rooted grass which tolerates limited dry spells. It tolerates poor drainage and is good for soil stability and as a wind break. It is a fast growing and good palatability in early growth stage if cut often. It is useful for cut and carry, hay or silage. Napier or elephant grass (Pennisetum Napier or elephant grass (Pennisetum purpureum) purpureum)  "}],"sieverID":"cb940ee1-9bae-48fb-912b-eb400f99bf83","abstract":"Through action research and development partnerships, Africa RISING is creating opportunities for smallholder farm households to move out of hunger and poverty through sustainably intensified farming systems that improve food, nutrition, and income security, particularly for women and children, and conserve or enhance the natural resource base."}

data/part_5/02d7ff1ef3d750a00f10540754c60524.json

@@ -0,0 +1 @@
+{"metadata":{"id":"02d7ff1ef3d750a00f10540754c60524","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/49be7357-0aef-4cfb-8c79-d0ea82ce6194/retrieve"},"pageCount":6,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":54,"text":"COlECClON HISTORICA -\\ : . B 1 n ', De este hecho se han derivado algunos beneficios como lo son: la canprobación de que existe un entusiasmo renovador para estudiar la fijación biológica del nitrógeno con la finalidad de ahorrar en e rgía y la consecución de fuentes de financiación para realizar tales estudios."},{"index":2,"size":44,"text":"La plena eXPlotaci6n~\"'n b¡.<• ='>¡gJJf,-\"p.¡;; -nitrógeno en la agric ultura es un ejemplo de có~+~v~r 9 rm-a: rá tica, la estrategia de mínima B IBLI OTECA , I -2 -• utilización de insumos la cual es una caractérística de la filosofía del ClA T."},{"index":3,"size":39,"text":"En esta presentación, podernos comparar el flujo y utilización de energía a través de sistemas de producción primaria, en los cuales el nitrógeno se suministra en forma de fertilizante con aquellos que utilizan la capacidad de fijar nitrógeno biológicamente."},{"index":4,"size":40,"text":"Cuando estemos convencidos de las ventajas de la fijación biológica de nitrógeno, procedernos a examinar cual es el papel que está jugando actualmente y que podría jugar este proc e so en los varios programas de investigación del CIA T."},{"index":5,"size":22,"text":"Teóricamente, la reducción del dínitrógeno a amoníaco es exergónico, es decir, debería ocurrir con una liberación de ~rgía libre de 9 Kcal."},{"index":6,"size":211,"text":"Esta es una aparente contradicción con respecto a lo que todos sabernos es un proceso que requiere el consumo de una gran cantidad de energía; el proceso ocurre debido a que uno de los participantes en la reacción, el energía de enlace en los carbohidrato s, de tal manera que, en general, flujo de energía y flujo de carbono son sinónimos. Los carbohidratos pueden ser utilizados directamente para el crecimiento de la parte a~rea de la planta o bien, translocados para dar soporte al metabolismo de raíces y n6dulos. Una porci6n de la energía del A TP Y de los compuestos reducidos generados por la actividad respiratoria de los n6dulos, sirve para efectuar la reducci6n del dinitr6geno a amoníaco, reacci6n catalizada por la nitrogenasa. El amoníaco es incorporado en los amino ácidos y transportado inicialmente al tallo; éstos son destinados a ser, finalmente, un componente de la proteina de las semillas. Esto constituye un requerimiento especial de carbono, desde que cada 6tonio de nitr6geno es transportado unido a un esqueleto carbonado. La predominancia de compuestos con una relaci6n C:N baja. como lo son la glutamina y la asparagina, que son moléculas transportadoras en las leguminosas; este proceso refleja una adaptaci6n que favorece al máximo la economía en la utili-zaci6n del carbono."},{"index":7,"size":150,"text":"Otra alternativa en un sistema de producci6n de alimentos puede ser el caso de los cereales. En este caso, tamién hay fijaci6n de la energía solar como energía de enlace en los carbohidratos. Sin embargo, mientras que las leguminosas pueden ser auto suficientes en cuanto al abastecimiento de nitrógeno, las plantas no leguminosas requieren nitr6geno combinado y en ellas, el costo en energía para la incorporaci6n del niltr6geno está • • -4 asociado a la absorción y reducción del nitrato en raíces y/u hojas para sintetizar compuestos aminados. Como en las plantas legunlÍnosas, estos compuestos nitrogenados al final forman parte de la proteina de las semillas. Cuando se hace un balance de costos de energía para la producción de proteina en los sistemas de producción que son diferentes al empleo de las leguminosas, se deben tomar en consideración los altos costos involucrados en el suministro de nitrógeno en forma combinada."},{"index":8,"size":204,"text":"La denominación fijaci6n \"quírnica ll del nitrógeno es, a fin de cuentas, también biológica , puesto que los combustibles fósiles de los cuales depende, se originaron a través de la producción de carbohidratos por organismos fotosintéticos. El catabolismo de los carbohidrato s genera hidrógeno gaseoso y energía de activación para la reducción del dinitrógeno a amoníaco, en el proceso Haber-Bosh. Algunos autores han querido comparar este paso breve en la reducción química (en el cual el hidrógeno es recuperado casi cuantitativamente como amoníaco) con el sistema biológico completo y -sin razón para sorprenderse-dicen que el sistema de fijación biológica de nitrógeno es extremada~ nte ineficiente. Otros investigadores han intentado comparar el paso correspondiente a la reducción del nitrato con el total del sistema biológico. La única comparación válida del costo de energía, para la producción de proteina, por las dos alternativas, debe estar basado en la ecuación de la materia prima. La energía en el sistema de utilización de leguminosas es la radiación solar Si dentro del contexto se incluyen los elementos de contaminación ambiental resultante de estos componentes , resulta muy claro que la fijación biológica del nitrógeno es fundamentalmente más eficiente y ecológicamente más aceptable que la reducción química del nitrógeno ."},{"index":9,"size":1,"text":"•"},{"index":10,"size":95,"text":"Obviamente, los Programasde Frijol y de Ganado de Carne del CIAT están utilizando esta fuent e biológica de nitrógeno debido al énfasis que ambos programas dan a las leguminosas. Pero, además de la conocida asociación del Rhizobium con las leguminosas, existen varios microorganismos, los cuales -independientemente o en asociación con plantas superiores-fijan nitrógeno en cantidades sufientJs para cons i derarlas de importancia en la agricultura. Estos microorganismos también merecen ser investigados intensamente para evaluar la factibilidad de su explotación en el desarrollo de sistemas de producción que verdaderamente sean de \"mínima utilización de insmnos t'"}]}],"figures":[{"text":" de 1973/ 1974  puso en evidencia el peligro de la sobredependencia en la utilización de combustibles fósiles. E s tos son recursos no renovables y su precio y disponibilidad pued e n fluctuar caprichosamente. "},{"text":" pérdidas son la respiración en los tallos, hojas, semillas, raíc e s y nódulos. En las plantas no leguminosas, hay una doble dosis de radiación solar puesto que se están involucrando los sistemas fotosintetizadores actual e s y los del pasado. Las pérdidas son: la respiración del organismo fotosint é tico original y un número no determinado de transiciones anabólicas durante el período de tiempo d e la formación de los combustibles fosilizados; las pérdidas por calor en el proceso Haber-Bosh; transporte y aplicación; escurrimiento , lixiviación; crecimiento de malezas; nitrificación; denitrificación y finalmente , las pérdidas por respiración de los tejidos del organismo en crecimiento.No hay datos disponibles que permitan hacer un análisis cuantitativo del gasto energético ocasionado por los dos sistemas, pero podemos hacer algunas e stimaciones. Los gastos e n e l siste ma químico son mayores qu e cuando s e utilizan plantas le g uminosas. No hay ninguna razón para supon e r que las pérdidas de Bnergía en las raíces y en la parte aérea, bajo los do s sistemas, sean sustancialmente diferentes. La respiración de los nódulos y la inte nsidad ligeramente mayor de respiración de las leguminosas son ampliame nte superados por las pérdidas ya mencionadas. "}],"sieverID":"5d55b74d-b8ae-4b2a-8fea-1e616be0a290","abstract":""}

data/part_5/03405e79441068a8b2b2e630de628c90.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03405e79441068a8b2b2e630de628c90","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ab69ecf9-0a8e-4971-a2a2-235e8cb0088b/retrieve"},"pageCount":18,"title":"","keywords":[],"chapters":[{"head":"Intercropping in CropSyst","index":1,"paragraphs":[{"index":1,"size":8,"text":"\"As simple as possible, but not any simpler.\""},{"index":2,"size":2,"text":"• 1D"},{"index":3,"size":19,"text":"• 2 crops with now distinct row arrangement (no alley cropping or wide bed&furrow systems with distinct 2D pattern)"},{"index":4,"size":46,"text":"• different planting dates possible (relay cropping) • dominance of one species over the other may change over time (e.g. maize cow pea system) • simulate the growth of these two species and the influence of competition  The PAR fraction intercepted by the upper canopy is:"},{"index":5,"size":13,"text":"The PAR fraction intercepted by the taller species at the lower canopy is:"},{"index":6,"size":6,"text":"and that of the shorter species:"},{"index":7,"size":4,"text":"Light interception (I )"},{"index":8,"size":8,"text":"The PAR intercepted at the upper canopy is:"},{"index":9,"size":14,"text":"The available PAR reaching the lower canopy must be reduced by this intercepted radiation."},{"index":10,"size":13,"text":"Thus, the radiation intercepted by the two species at the lower canopy is:"},{"index":11,"size":13,"text":"\uD835\uDC3C \uD835\uDC3F_\uD835\uDC46 = \uD835\uDC53 \uD835\uDC3F_\uD835\uDC46 * (\uD835\uDC43\uD835\uDC34\uD835\uDC45 − \uD835\uDC3C \uD835\uDC48 ) eq. 8"},{"index":12,"size":4,"text":"Transpiration and evaporative demand"},{"index":13,"size":22,"text":"• Partitioning of evaporative demand between the upper and lower canopy and between species done using actual radiation interceptions as scaling factors."},{"index":14,"size":1,"text":"9"},{"index":15,"size":3,"text":"Water and N-uptake"},{"index":16,"size":4,"text":"• Non limiting conditions:"},{"index":17,"size":24,"text":"• uptake is calculated for each species as if it was growing alone using either the evaporative demand or crop-specific N-uptake boundaries as \"sink\"."},{"index":18,"size":3,"text":"• Limited conditions:"},{"index":19,"size":31,"text":"• demand/uptake of each species is reduced based on a user-defined \"competiveness factor\", so as to allow the sum of both demands to be equal to the available water or N. "}]}],"figures":[{"text":" row spacing• Fertilizer application• 1.5 t/ha manure (maize and beans), incorporated before 5 day before planting • 25 kg/ha DAP at planting (maize only) • 50 kg/ha CAN topdressing of maize (16 Dec.)• Maize phenology• 50% tasseling: 14 Dec. • 50% silking: 25 Dec. • maturity: 5 Feb. 2016 • harvest: 16 Feb. 12 • Bean phenology • start flowering: • start grain filling: • maturity: • harvest: Results -leaf area index and aboveground biomass Maize dots = observed (± SD); lines = simulations "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Three cases to consider: 1. Interception by the taller (T) species above the shorter species 2. Interception by the taller species within/below the shorter species 3. Interception of the shorter (S) species  \uD835\uDC3C = \uD835\uDC53  *  \uD835\uDC43\uD835\uDC34\uD835\uDC45  \uD835\uDC3C = \uD835\uDC53  *  \uD835\uDC43\uD835\uDC34\uD835\uDC45  Upper Upper \uD835\uDC53 = 1 − \uD835\uDC52 −\uD835\uDC58 * \uD835\uDC3F\uD835\uDC34\uD835\uDC3C canopy \uD835\uDC53 = 1 − \uD835\uDC52 −\uD835\uDC58 * \uD835\uDC3F\uD835\uDC34\uD835\uDC3Ccanopy  (U) (U)  Lower Lower  canopy canopy  (L) (L)  6 6  "}],"sieverID":"93995f57-e3c2-46ee-bc39-c61dc2c9e9ff","abstract":""}

data/part_5/0397873f618b1d02bc33669e9a019dd6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0397873f618b1d02bc33669e9a019dd6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/078ebd13-6a59-48f5-9927-bd3f49e8dac7/retrieve"},"pageCount":8,"title":"Decision support tools for adaptation planning in Africa","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":110,"text":"Climate change and variability are increasingly threatening food systems and livelihoods in Africa, a continent with most of the vulnerable people in the world. Human-induced climate change has led to more frequent and more intense climate extremes (Magnan et al. 2021). In sub-Saharan Africa, for example, the occurrence of droughts nearly tripled and that of floods increased more than tenfold by 2010-2019 relative to 1970-1979. Global surface temperature has increased by 0.99 °C from 1850-1900 to the first two decades of the 21st century (2001-2020) and by 1.09 °C from 1850-1900 to 2011-2020 (Arias et al. 2021). Mean precipitation changes have been observed all over Africa (Almazroui et al. 2020)."},{"index":2,"size":48,"text":"Consequently, food systems across the world are continually disrupted (Nelson et al. 2014). Both the crop and livestock sectors are increasingly threatened. Moreover, spatially concurrent climate extremes impose a great risk to the global food supply chain and amplify threats to global food security (Gaupp et al. 2020)."},{"index":3,"size":85,"text":"Adaptation efforts are crucial. The cost of no action is already immense and will only get more expensive. Taking action not only implies the need for identifying strategies and responses that are practical, sound and meet the actors' varied interests but also requires careful and flexible planning. Adaptation planning in human systems generally entails a process of iterative risk management. Effective responses require both immediate relief as well as the development of longerterm plans. Good collaboration among affected stakeholders is crucial for effective adaptation action."},{"index":4,"size":62,"text":"Therefore, addressing climatic shocks in Africa requires suitable tools, frameworks and methodologies for coordinating the actions of different actors and developing effective responses to climate change across multiple levels of time, space and socio-political organization. While many tools and frameworks for adaptation planning exist, access and use by national stakeholders for adaptation planning is often hindered by lack of awareness and knowledge."},{"index":5,"size":55,"text":"The goal of the 'Facilitating knowledge management for adaptation planning in Africa' project is to enhance resilience of farming systems and livelihoods to climate change through wide-scale use of suitable adaptation planning tools. Funded by the GIZ through the Global Center on Adaptation (GCA), the project is implemented by the International Livestock Research Institute (ILRI)."}]},{"head":"The project has three main objectives:","index":2,"paragraphs":[{"index":1,"size":47,"text":"• To produce an inventory of adaptation planning tools and frameworks; • To assess the suitability and promote the dissemination of prioritized adaptation decision support tools and frameworks; and • To build the capacity of national stakeholders in the implementation of adaptation decision support tools and frameworks."},{"index":2,"size":69,"text":"The 'Facilitating knowledge management for adaptation planning in Africa' project identifies adaptation decision support tools and frameworks. It then disseminates the tools widely and builds the capacity of national stakeholders to apply them. This project was implemented in three countries: Kenya (representing East Africa); Zambia (representing southern Africa); and Senegal (representing West Africa). However, the identified tools are promoted more widely for application in the entire continent of Africa."}]},{"head":"Methodology","index":3,"paragraphs":[{"index":1,"size":65,"text":"To address the first objective, the study conducted a desk literature review. Searches were conducted in English language peer-reviewed journals, and grey literature such as institutional reports and briefs accessible on the internet and organizational websites. Focus was on articles, reports and briefs that described an adaptation planning tool, framework or database. The titles and abstracts of these references were screened and duplicate records removed."},{"index":2,"size":64,"text":"A two-stage screening strategy was used to determine the relevance of articles returned from search strings to the research objective. Article abstracts and titles were screened in stage one. In stage two, the full texts for those abstracts meeting the initial inclusion criteria were downloaded and screened using the same eligibility criteria. In addition to the literature review, CGIAR researchers and projects were consulted."},{"index":3,"size":89,"text":"To assess the suitability of the tools and frameworks for adaptation planning, three dissemination workshops were organized: one in Kenya, one in Zambia and one in Senegal. The countries were selected as representative of eastern, southern and western Africa, respectively. During the one-day workshops, an inventory of adaptation planning tools and frameworks was presented to the participants. A participatory exercise followed, where workshop attendees working in smaller groups evaluated and prioritized the tools and frameworks most suitable for adaptation planning in their country contexts. The process was as follows:"},{"index":4,"size":19,"text":"• Tools and frameworks were identified and grouped into nine main categories. • Participants were divided into heterogeneous groups."},{"index":5,"size":69,"text":"The 'Facilitating knowledge management for adaptation planning in Africa' project identifies adaptation decision support tools and frameworks. It then disseminates the tools widely and builds the capacity of national stakeholders to apply them. This project was implemented in three countries: Kenya (representing East Africa); Zambia (representing southern Africa); and Senegal (representing West Africa). However, the identified tools are promoted more widely for application in the entire continent of Africa."},{"index":6,"size":103,"text":"• Each group was assigned two or three categories of tools/framework. • Each group was tasked to identify and prioritize at least three tools/frameworks from each category. • Each group provided reasons why they picked each tool/framework, the likely users of the tool, the geographical region or sector where the tool is most applicable, and how it can be applied (e.g. what capacities/resources are needed for the tool to be applied). • Each group chose one member to document the outputs from the group discussions. • The outputs from the small group discussions were then presented to all the participants in the plenary."},{"index":7,"size":36,"text":"To achieve the objective of capacity building, we conducted two workshops: one in Kenya and another one in Senegal. Focus was on two of the prioritized tools in Kenya and four decision support tools in Senegal. "}]},{"head":"Tools and frameworks for land use planning and conservation","index":4,"paragraphs":[{"index":1,"size":1,"text":"This "}]},{"head":"Tools and frameworks for adaptation tracking","index":5,"paragraphs":[{"index":1,"size":50,"text":"Tracking adaptation is crucial to help national governments assess progress towards their nationally determined contributions (NDCs). At the project level, adaptation tracking is important to assess the effectiveness of interventions and to improve the overall contribution of the projects. Examples of these tools at the national and regional levels are: "}]},{"head":"Tools and frameworks for monitoring climatic shocks, forecasting and early warning, and dissemination of climate information services","index":6,"paragraphs":[{"index":1,"size":13,"text":"Examples of the tools and frameworks that were identified in this category include: "}]},{"head":"Tools and frameworks for natural resource management","index":7,"paragraphs":[{"index":1,"size":50,"text":"The tools considered in this category are helpful in helping land managers understand potential impacts and integrate climate change into their planning and management. Such tools can also be used to map climate risks and support assessment and planning in land and water management. In this category, the study identified: "}]},{"head":"Climate-smart agriculture and adaptation intervention prioritization tools and frameworks","index":8,"paragraphs":[{"index":1,"size":105,"text":"Several climate smart agriculture (CSA) and adaptation interventions have been identified and applied in varied settings. It is important to prioritize CSA interventions to ensure local relevance and increase effectiveness. The tools presented in this category take a multidimensional approach to prioritizing CSA interventions (e.g. the Climate-Smart Agriculture Prioritization Framework, CSA-PF). Some tools, such as the Climate-Smart Agriculture Investment Plan (CSAIP), emphasize a value chain approach in the prioritization of CSA. Other tools take a multidisciplinary approach (e.g. the Climatesmart agriculture rapid appraisal, CSA-RA). Other tools in this category include the Participatory Social Return on Investment (PSROI) and Economics of Climate Adaptation (ECA)-Guidebook for practitioners."}]},{"head":"Climate risk and vulnerability assessment tools and frameworks","index":9,"paragraphs":[{"index":1,"size":47,"text":"In order to effectively address climate change impacts, it is crucial to understand the risks and vulnerabilities that exist within systems. Assessment should further account for spatial and temporal heterogeneity that exists across contexts, sectors and value chains. In this category, the study identified the following tools: "}]},{"head":"Tools for adaptation support","index":10,"paragraphs":[{"index":1,"size":59,"text":"Finally, the study identified tools for supporting adaptation. These tools include:    In terms of adaptation decision support, the Robust Adaptation Planning (RAP) Framework was the most prioritized because it builds a robust action approach that allows for long-term actions, is useful in planning adaptation intervention in climate-vulnerable multisector and multi-level settings and reduces the complexity of implementing chosen adaptations. "}]},{"head":"Zambia","index":11,"paragraphs":[{"index":1,"size":24,"text":"In Zambia, the most prioritized tool for land use planning and conservation was conservation standards. The reasons for ranking this framework highest were that:"},{"index":2,"size":58,"text":"• It provides a clear systematic approach for monitoring, planning and learning from past conservation efforts; promotes use of best practices; • It is easy for communities to apply; • It allows for easy sharing of data; • It helps to further refine conservation standards; and • It facilitates real-time decision-making because data is available on real-time basis."},{"index":3,"size":109,"text":"The Stocktaking for National Adaptation Planning framework (SNAP) was the most prioritized for adaptation tracking. National stakeholders indicated that SNAP targets a wide range of stakeholders, generates a comprehensive database usable for many stakeholders (nongovernmental organizations), highlights the country's capacity, and is a familiar tool that has been tested making easier to adopt and adapt.In terms of tools and frameworks for modelling and simulation of climate change impacts, the Climate Adaptation in Rural Development (CARD) assessment tool was identified as the most prioritized because it provides qualitative and quantitative information for decision-making on the yield of major crops, identifies priority areas for investment and indicates alternative enterprises for famers."},{"index":4,"size":34,"text":"The Climate Adaptation Knowledge Exchange (CAKE) was the most prioritized knowledge exchange platform. Through knowledge sharing, CAKE can facilitate better preparation for disasters, enhance the ability to adapt and encourage learning through others' experiences."},{"index":5,"size":38,"text":"The Participatory Integrated Climate Services for Agriculture (PICSA) tool ranked highest for monitoring climatic shocks and dissemination of climate information services. The main reason for selecting PICSA was that it has the potential to enhance weather information systems."},{"index":6,"size":47,"text":"For climate risk vulnerability assessment, the most prioritized tool was the Community Based Risk Screening Tool -Adaptation and Livelihoods (CRiSTAL), which equips project planners and managers with the capacity to design strategies for addressing potential future hazards. CRiSTAL can also facilitate the mapping of local livelihood resources."},{"index":7,"size":14,"text":"Similar to Kenya, CSAPF ranked highest for the prioritization of CSA and adaptation interventions."},{"index":8,"size":51,"text":"Stakeholders indicated that the framework is helpful in identifying and prioritizing options following a step-by-step process. CSAPF guarantees community participation, maps out all the value chain actors and provides them with the relevant information for choosing the viable options. In terms of adaptation decision support, Climate Canvas was the most prioritized."}]},{"head":"Senegal","index":12,"paragraphs":[{"index":1,"size":71,"text":"In Senegal, the most prioritized tool for land use planning and conservation was the Northeast Climate Data (NCD). The reasons for ranking this framework highest were that it considers many natural resources at the same time (land, water etc.); allows for monitoring, prediction and adaptation to climate change using many variables such as temperature, relative humidity, sunlight, precipitation and wind; and presents results in an easy to understand and usable format. "}]},{"head":"Learnings and next steps","index":13,"paragraphs":[{"index":1,"size":60,"text":"In all three countries where the project was implemented, awareness exposure on adaptation decision support tools was generally low. This means that while farming systems and livelihoods are increasingly threatened by adverse climate change impacts, and although there exist tools and frameworks to facilitate planning and decisionmaking, the effectiveness of adaptation is still largely hampered by awareness and knowledge gaps."},{"index":2,"size":82,"text":"On a positive side, there was enormous interest among national stakeholders in implementing prioritized adaptation decision support tools. The identified and prioritized tools should be applied at different levels and require varied capabilities. While some tools could readily be implemented using existing capacities, the study identified several areas for capacity building (at individual and institutional level) and partnerships in skill development, data collection and analysis, downscaling data to local levels, adapting the tools to local contexts, and development of data sharing protocols."},{"index":3,"size":58,"text":"The study further shows that stakeholders in each of the three countries prioritized the tools differently, meaning that context matters. A tool that is prioritized in one context cannot be generalized for application in other countries in Africa. A more appropriate approach will require prioritization and capacity building efforts beyond the three countries that the study focused on."},{"index":4,"size":54,"text":"Relatedly, the technical capacity building workshops were quite intense. In-person meetings are more suitable for such detailed training sessions compared to virtual sessions. As a general recommendation, it would be important to conduct similar activities in northern Africa while including more countries in the current project regions (i.e. in East, West and southern Africa)."}]}],"figures":[{"text":"Figure 1 . Figure 1. A national stakeholder contributes to a discussion about adaptation decision support tools during a capacity building workshop in Kenya "},{"text":" category of tools mostly focuses on assessing the vulnerability of different species to climate change impacts, understanding the preparedness of different ecosystems to climate change impacts, and evaluation of conservation efforts and interventions. Notable examples include: • The framework for categorizing the relative vulnerability of threatened and endangered species; • Climate Change-Resilience and Adaptation Planning Tool (CC-RAPT); • Northeast Climate Data; and • Conservation standards. "},{"text":" • Robust Adaptation Planning (RAP) framework; • Robust Decision Making (RDM); • Adaptation Database for Planning Tool (ADAPT); • Climate Canvas; • Adaptation Support Tool (AST); • Climate, Environment and Disaster Risk Reduction Integration Guidance (CEDRIG); • Training manual on bundled climate-smart agriculture, climate information services and One Health technologies for priority value chains; • A guidebook for operationalizing climate-smart agriculture into local action planning; • Climate-smart agriculture training manual for training of trainers; • Land Degradation Surveillance Framework (LDSF); and • The framework for the assessment of skills for national adaptation planning. "},{"text":"Figure 3 . Figure 3. A facilitator at a capacity building workshop in Senegal explains the tools developed and used by ANACIM to deliver climate information services (photo credit: Lamine Diedhiou/ILRI). "},{"text":"Figure 4 . Figure 4. A pre-season decision tree as part of the iSAT tool, presented by ILRI during the capacity building workshop in Senegal. "},{"text":"Figure 5 . Figure 5. An example of the forecast information provided by ANACIM as presented during a capacity building workshop in Senegal. "},{"text":"  "},{"text":" Climate Change Response Framework (CCRF) was the highest ranked. This tool was prioritized because it is collaborative, focuses on forestry resources, can be adapted to different locations and landscapes, and integrates a monitoring and evaluation component. KAZNET was ranked highest amongst the tools for KAZNET was ranked highest amongst the tools for monitoring climatic shocks and dissemination of climate monitoring climatic shocks and dissemination of climate information services. The main reasons for selecting information services. The main reasons for selecting KAZNET were that it is an open-source platform, allows KAZNET were that it is an open-source platform, allows mobile and web application, has data quality control mobile and web application, has data quality control mechanisms, is accessible in remote locations, and mechanisms, is accessible in remote locations, and provides data on near-real time basis. provides data on near-real time basis. For climate risk vulnerability assessment, the most For climate risk vulnerability assessment, the most prioritized tool was the Platform for Agricultural Risk prioritized tool was the Platform for Agricultural Risk Management (PARM), not only because it is applicable Management (PARM), not only because it is applicable in developing countries, but also because it has in developing countries, but also because it has potential to contribute to sustainable agricultural growth, potential to contribute to sustainable agricultural growth, increased rural investment, reduced food insecurity, and increased rural investment, reduced food insecurity, and improved resilience of poor rural households to climate improved resilience of poor rural households to climate and market shocks through better management of risks. and market shocks through better management of risks. The Climate Smart Agriculture Prioritization Framework The Climate Smart Agriculture Prioritization Framework (CSAPF) ranked highest for the prioritization of CSA and (CSAPF) ranked highest for the prioritization of CSA and adaptation interventions. Stakeholders indicated that adaptation interventions. Stakeholders indicated that the framework is helpful in determining the best ways the framework is helpful in determining the best ways to prioritize adaptation options and guiding resource to prioritize adaptation options and guiding resource allocation among various alternatives in different value allocation among various alternatives in different value chains. CSAPF takes a multidimensional approach to chains. CSAPF takes a multidimensional approach to identifying manageable and feasible portfolio options. It identifying manageable and feasible portfolio options. It is also applicable to various value chain actors within all is also applicable to various value chain actors within all sectors. sectors.  "},{"text":" In terms of adaptation decision support, the Adaptation Support Tool (AST) was the most prioritized because it has all the sequential steps that enable adaptation (i.e. from conception and evaluation of strategies to development of climate change adaptation plans); enables mitigation of the risks linked to climate change by controlling the pollution of water bodies, drought, and floods; and considers the efficiency and costs of interventions. The Adaptation Monitoring and Assessment Tool (AMAT) The Adaptation Monitoring and Assessment Tool (AMAT) was the most prioritized for adaptation tracking. National was the most prioritized for adaptation tracking. National stakeholders indicated that AMAT is multi-sectoral, stakeholders indicated that AMAT is multi-sectoral, allows regular updating of indicators over the years, and allows regular updating of indicators over the years, and provides the instructions and methodologies used to provides the instructions and methodologies used to develop each indicator. develop each indicator. In terms of tools and frameworks for modelling and In terms of tools and frameworks for modelling and simulation of climate change impacts, the Land Use simulation of climate change impacts, the Land Use Portfolio Modeler (LUPM) was the most prioritized Portfolio Modeler (LUPM) was the most prioritized because it can help to understand the cost:efficacy ratio because it can help to understand the cost:efficacy ratio of adaptation options, predicts the effects of adaptation of adaptation options, predicts the effects of adaptation strategies and allows monitoring. strategies and allows monitoring. Similar to Kenya, CCKP was the most prioritized Similar to Kenya, CCKP was the most prioritized knowledge exchange platform. CCKP generates data knowledge exchange platform. CCKP generates data to inform planning decisions at multiple levels and to inform planning decisions at multiple levels and integrates past data with projections. integrates past data with projections. The highest ranked tool for natural resource management The highest ranked tool for natural resource management was the Spatial Trends in Coastal Socioeconomics was the Spatial Trends in Coastal Socioeconomics (STICS). Stakeholders in Senegal found this tool relevant (STICS). Stakeholders in Senegal found this tool relevant because of the country's long and vulnerable coastline because of the country's long and vulnerable coastline and the need to monitor the fishing and tourism sectors and the need to monitor the fishing and tourism sectors (which are among the largest contributors to the (which are among the largest contributors to the economy). economy). The CCAFS Regional Agricultural Forecasting Toolbox The CCAFS Regional Agricultural Forecasting Toolbox (CRAFT) tool ranked highest for monitoring climatic shocks (CRAFT) tool ranked highest for monitoring climatic shocks and dissemination of climate information services. The and dissemination of climate information services. The main reasons for selecting CRAFT were that it can support main reasons for selecting CRAFT were that it can support decisions in agricultural seasons, including the choice of decisions in agricultural seasons, including the choice of crop varieties and application of agricultural inputs. crop varieties and application of agricultural inputs. For climate risk vulnerability assessment, the most For climate risk vulnerability assessment, the most prioritized tool was the Climate Change Vulnerability prioritized tool was the Climate Change Vulnerability Index (CCVI) because it covers all dimensions of Index (CCVI) because it covers all dimensions of vulnerability (environmental, economic and social), is vulnerability (environmental, economic and social), is multisectoral and looks at multiple risks. multisectoral and looks at multiple risks. Participatory Social Return on Investment (PSROI) ranked Participatory Social Return on Investment (PSROI) ranked highest for the prioritization of CSA and adaptation highest for the prioritization of CSA and adaptation interventions. Stakeholders indicated that the tool interventions. Stakeholders indicated that the tool is aligned to the principles of locally led adaptation, is aligned to the principles of locally led adaptation, considers endogenous practices and facilitates capacity considers endogenous practices and facilitates capacity building of community planning. building of community planning.  "}],"sieverID":"b0505b2c-8818-4853-8711-75bba4e6f9c6","abstract":"Adaptation decision support tools and frameworks are crucial for coordinating the actions of different actors and developing responses to climate change across multiple levels of time, space and sociopolitical organization. • Adaptation decision support tools and frameworks are prioritized differently by national stakeholders across countries and this reflects the heterogeneity in constraints faced as well as existing capacities for implementation. • Although many tools and frameworks already exist, awareness and knowledge among national stakeholders remain low, making it imperative to invest efforts in the dissemination of the tools and capacity building."}

data/part_5/03ed4a48e43a0ab018e7d328ff3df6d3.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03ed4a48e43a0ab018e7d328ff3df6d3","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/587d3a7e-dd06-49e4-a41f-bab888dbdce8/retrieve"},"pageCount":12,"title":"\\ Docume nto de trabajo ,No. 4l Parcelas de comprobac'ión y participación RESUMEN dei agricultor Q","keywords":[],"chapters":[{"head":"Al INTRODUCCION","index":1,"paragraphs":[{"index":1,"size":36,"text":"1. Una parcela de comprobación representa el último paso en el proceso de la investigació n agraria : Los investigadores quieren , somete'r una tecnológía promis oria a su última prueba, en campos de agricultores ."},{"index":2,"size":45,"text":"En la mayor ía de los casos este p~oceso empieza con la id e ntificación del proqlema por parte del investigador y termina con la comprobación de la s olución en campos de agricultores, si~ndo propu esta ésta última por el mismo inves t igador,."},{"index":3,"size":35,"text":"Si se 't ra ta de buena inv es t igación, e l investigador identifica un proble ma verdad e ro y encuentra una solución ~f ic~z y ac ep table por el agric ultor."},{"index":4,"size":56,"text":"Pero a veces los agricultores no aceptan la nueva tecn o logía en una ~ayor escala, a p eSa r de que l a parcela de comprobación ha ' dado resultados estimu lantes. Se cree que lo que puede poner, remedio a es te problema es la participación del agricultor ell el mismo proceso de investigación."},{"index":5,"size":41,"text":"2 . Cómo se pueden co mbillar el trabajo del inv es tigador y una mayor participac ión del agr i cultor? La expe riencia de trabajo' del proyecto de frijol INIAA-CIAT en Cusco ha conduci do a la siguiente propuesta:"},{"index":6,"size":27,"text":"A la co's echa d e , la parcela ele co rnprobaci ón se lleva a cabo una evaluación de la nueva tecnolo gía por el agricultor."},{"index":7,"size":59,"text":"Se dis c ute,! tarnbien los tratam ientos del ensayo co n él. En base a la conversa ción sobre es tos aspec to s se llega a u'n acuerdo sobre la instalación de un ensayo própuesto por el agricultor, proba ndo la misma tecnologia de l a parc e la de comprobación (muchas veces una variedad de fríjol)."},{"index":8,"size":131,"text":"Si se han ins talado X parce las de comprobación, en un a campaña, se puede n establecer hast a X e nsayos diferente s en el siguiente año, siepdó la única razón para la diversidad de e nsayos la v ariabilidad et~ las propu estas de los agri c ultores. Pero en el mismo segundo año los inves tigad ores tendrdn lista yá otra tec;nologia para ponerla en parcelas de comprobación, y a la cosecha , de estas parcelas se proc ede igual en cuanto al seguimiento de la nue va t ec nologia. El siguiente esquema puede ilustrar la idea:  El proyecto de Frijol INIAA-CIAT (Cusca) ha establecido, junto con agricultores, 10 parcelas de cOfIJ¡Jrubación en la campana 1988/89. Se trató de comprobar la ~ariedad de frijol ZAV 83099."},{"index":9,"size":210,"text":"El aspecto que más importa por el momento es el hábito de crecímiento de esta variedad. La ZAV se propone como alternativa al Q'ello Poroto (del mismo color de grano), el frijol más c,otizado el) el mercado actualmente. Una desventaja del Q'ello Poroto es la agresividad de la planta que Causa en algunas circunstancias tumbamiento de plantas de maíz y -sembrado en alta densidad-ocasiona una alta competencia con el maíz, lo que se traduce en una disminución significativa• del rendimiento del cultivQ principal. Según las conversaciones con agricultores maiceros y la investigación pertinente., se debe la reserva de los agricultores a sembrar el Q'ello Poroto en más extensión y en una densidad más alta en SUG campos de maíz, justamente a la agresividad de la variedad local. La ZAV se identificó-mediante un proceso de mejoramiento -como alternativa al Q'ello Poroto por su hábito de crecimiento .menos• agresivo (4a frente a 4b del Q'ello Poroto) .. ' La ZAV permite una alta densidad de siembra sin reducir .significativamente el rendimiento del maiz y s'in riesgo de tumbar las plantas del cul t i va principal ~ E¡n otras palab¡:-as: La ZAV ayuda a abrir agronómicamente'el paso para una mayor difusión del frijol voluble en 'las zonas productoras de maíz en Cusc6."},{"index":10,"size":23,"text":"Otras características de la ZAV dignas de fllención son su prccociuild y lo r QslstcflciéJ () untracnósis, una enfer~edad importante en la zona."},{"index":11,"size":41,"text":"( 1 Rendimiento de frijol muy bajo debido a: Sequia d.d.s. con pérdidas de plantas 80%; 2 fuertes grpnizadas con lesiones e n plantas de frijol; ataque de Phoma; se cosech,' iran 2-4 vainas por planta con 2-3 granos por vaina."},{"index":12,"size":23,"text":"2 Maiz perdido por efec to del Puka-poncho (posible cOflple jo viral) 3 Se perdió la información (le la cos eclla de rmiz."},{"index":13,"size":160,"text":"* En dos localidades (Piri y Ccaytupampa) se cosechó el maíz en ch oclo., Evaluación Económica. Se apl i có la me t odo l og ia de l PRESU-PUESTO PARCI AL p~ra determ in ar e l retorno marginal qu e se con sigue con l a d e c isi ón de añadir frijol (ZAV) a un campo de ma iz. Como ba s e de dat o s no s sirven las cifra s pre se nt adas en el cuad ro 2. Para completar el análisis agronómico y económico de los investigadores se realizó una evaluación del ensayo por los agricultores, * 1 (i) Todos los agricultores han observado la ventaja que les ofrece la •ZAV en cljanto al hábito de crecimientb del frijol y la poca competencia con el maíz.: Ellos están contentos con el rendimiento del frijpl y no perciben ning0n efecto negativo del frijol en la producción del maiz en el mismo campo."},{"index":14,"size":86,"text":"(ii) Igualmente a todos les conviene la precocidad de la variedad ZAV. (iii )Según los' agricul•tores la ZAV muestra un buen color y una' buena forma del grano, el tamano sin embargo, podria ser más grande. (iv) Como otro aspecto P9sitivo de la ZAV los agricultores mencionan el buen n0m,ero de granos por vaina. (v) Finalmente, todos quieren volver a t rabaj ar con es te f rij 01 la próxima célmpailo, les con v ienc en este contexto particularmente la posibilidad de obtener doble cosecha."},{"index":15,"size":93,"text":"Entonces, se observa una buena conformidad entre el análisis agronómico y económico por un lado, y la evaluación de los agricultores por otro lado. Pero lo que más inte'resa aholia son las propuestas de los agricultores parij realiza~ otra \"pr~eba\" u otro \"experimen to\" con la misma ZAV en la s iguien te campana. Se util~zó una hoja de evaluación con 9 preguntas sobre rendimiento, comportamiento, agronómico, caracteris ticas del grano y de la vaina del fríjol, el estado del, maíz, el patrón de cultivo y posibles modificaciones de éste últ~no. , *2"},{"index":16,"size":24,"text":"A parte de es tos ensayos 'propues tos por agricul tares se observa un gran interés por la producción cOm2rcial de es ta variedad."},{"index":17,"size":21,"text":"Pero corno este dOC;lUllBnto no es un es tudio de adopción y difusión no se corren tan estos aspectos en detalle."},{"index":18,"size":11,"text":"Yanahuara / Humberto Chávez 1 ZAV Un icultivo y sin tutor."},{"index":19,"size":6,"text":"2 ZAV + Maíz Siembra simultánea."}]},{"head":".","index":2,"paragraphs":[{"index":1,"size":75,"text":"Cuáles son los factores que entraJl en las pruebas de los agric u l t ores? Cuatro ensayos contienen un cambio de época de s i e mbra. En ' tres . se ' quiere comparar directamente la ZAV con el. Q ' ello Poroto, trat .-Ind o s e entonces del factor yariedad . Dos ensayos tienen que ver con la densidad de plantas y un ensayo illdaga un cambio del piso ecológico ."},{"index":2,"size":69,"text":"AgronÓmicame n te estos cua t ro factores complementan mu y bie n el factor patrón de cultLvo (unicultivo vs . asoc i ac i ón) que fué sometido a una ~rueba en la parcela de comprobación,. En otras palabra,;: los agricul tores han aceptado la tecndlogía propuesta en la PDC y ahora tra t an de, afinar esta tecnología bajo condi c iones prop i as . 2.."}]},{"head":"JI","index":3,"paragraphs":[{"index":1,"size":154,"text":"La idea básica' del esquema presentado en el gráfico 1 consiste en : c ompartir el proceso de investigación entre agricultore s e 'invest igadores según los c ampos que domina cada uno. En el prese nt e caso, e l investigador tiene mayor a cc eso al material y al mejoramiento genético, una condiciÓn que le permite solucionar los problemas del co mportamient o agronómico de la variedad local. , Por otro lado, el agricultor conoce muy bien las condiciones especiales de su sistema de producción y:siempre busca integra r una nu eva tecnol og ia dentro de su manejo del sistema. Esta \"espec ia lización\" de ambas partes se reflej a en lo s d os pasos de la investigación:, Parcela de comprobaci ón (PDC), bajo la responsabilidad del ' invep tigador y -en la , , fase de seguimiento-Ensayo propuesto por el agricultor (EPA), bajo la responsabilidad del agri cultor. ,"}]},{"head":"7.","index":4,"paragraphs":[{"index":1,"size":130,"text":"Para realizar la ' fase\"pel seguimien to en l a campa ña 89 /90 se neces~tan ~'-pa rte del cumplimiento por los agricultores algunai' med idas técnicas. Habrá que tomar los da tos, res'pecfiyos a la siembra (fecha, modalidad de siembra, ' exten'sión _ 'del terreno, va ri ed ad de maiz y otros), durante la campaña (de sa rrollo de los cultivos, aSPectos fitosanitarios) y a la cos echa (rendimientos, calidad del producto y análisis económico). Además se necesiiará otra evaluació~ por los agricul tores para determinar sí, s egú n los criterios de ellos, han logrado e l objetivo de su propio ens a yo. Al fín se piensa reunir a lo s siete agricultores cooperadores y a loS investigadores para discutir las experiencias, y buscar recomendaciones prácticas."}]}],"figures":[{"text":" Nos perm itfmos citar una parte del inf o r me a nual sobre PARCELAS DE COMPROBACION DE FRIJ OL ASOCIADO CON MArZ, del PI~G-Cu sco, ca mpana 1988 / 89 (en preparación). ' Veá se este informe para e l a ná l is is d etallad o que inclyye todos l os demás aspectos. de maiz (8 localidad~s *) en el tratamierlto MAIZ + fRIJOL llegan a 3227 Kg/ha, y en el tratamiento MAIZ SOLO a 3139 Kg/ha. Entonces, respondiendo a la pregunta (a ) , obse rvamos que el frijol ZAV 83099 no ocasiona ninguna disminución en el rendimiento del maiz. (Veáse c uadro 1).        1) Maiz solo ( va rie - 1) Maiz solo ( va rie -        dad y te c n o l og ía dad y te c n o l og ía        del agricultor) del agricultor)        (2) Maiz (variedad y (2) Maiz (variedad y        tecnología del tecnología del        agricultor)+ Frijol agricultor)+ Frijol Cuadro No. 1 -Rendimientos praredios' Kg/ha  (variedad de la Cuadro No. 1 -Rendimientos praredios' Kg/ha(variedad de la  Est ación Exper i-Tratamientos: Maíz del agricultor + Frijol '/,AV 83099 Est ación Exper i-Tratamientos: Maíz del agricultor + Frijol '/,AV 83099  Y na.iz del agricultor solo. :  me ntal y recomen- Y na.iz del agricultor solo. :me ntal y recomen-  8 parcelas de crnprobación -~ 1988/89 dación e n c uant o 8 parcelas de crnprobación -~ 1988/89dación e n c uant o        a densidad) a densidad)  Gráfico No. 2 ' san SiLva:br Q:scp Ay lliJ Cl::EytJ..p'rr¡ 1, 11 Repeticiones YcmIul¡:a H.ascaray Gráfico No. 2 ' san SiLva:br Q:scp Ay lliJ Cl::EytJ..p'rr¡1, 11 Repeticiones YcmIul¡:a H.ascaray  M'Iiz Fl:jl M'Iiz, Fl:jl M'Iiz Fl:jl M'Iiz Fl:jl M'Iiz Fl:jl M'Iiz Fl:jlM'Iiz, Fl:jlM'Iiz Fl:jlM'Iiz Fl:jlM'Iiz Fl:jl M'Iiz+fti jol 3396 92 1) 3818 ,479 3417 ' 320 5771 379 O 2) 1184 M'Iiz+fti jol339692 1) 3818,4793417 ' 3205771 379O 2) 1184 M'Iiz solo 3243  3567  3894  5679 O M'Iiz solo3243356738945679O  (b) ¿Cu ál es la ga rldrlci a  eC Oll()lnic¿¡ (b)¿Cu ál es la ga rldrlci aeC Oll()lnic¿¡   de fri jo l a l maíz?  de fri jo l a l maíz?  M3:lia I..uu Linatart:XJ J-\\..I'mlI\"P\"l ta M3:lias F€rI:Jimientcs X M3:lia I..uuLinatart:XJJ-\\..I'mlI\"P\"l taM3:lias F€rI:Jimientcs X  M'Iiz Fl:jl M'Iiz Fl:jl. M'Iiz Fl:jl ' M'Iiz Fl:jl M'Iiz Fl:jlM'Iiz Fl:jl.M'Iiz Fl:jl ' M'IizFl:jl M'Iiz+ftijol M'Iiz solo La sequía ocas ionó problemas de emergencia y pérdidas de p lantas de fríjol mientras que las abundantes llu v i as (y 3077, 959 3112 1220 3227 675 -3) 764 2m 2870 3139 M'Iiz+ftijol M'Iiz soloLa sequía ocas ionó problemas de emergencia y pérdidas de p lantas de fríjol mientras que las abundantes llu v i as (y 3077, 959 3112 1220 3227 675 -3) 764 2m 2870 3139  granizada) favorecieron la p res enc ia de PHOMA (Phoma granizada) favorecieron la p res enc ia de PHOMA (Phoma  exigua) .     exigua) .  Ev a luación Ag r o,nómica . * Los r endim ient os promedios Ev a luación Ag r o,nómica . *Los r endim ient os promedios  "},{"text":", El fríjol ZAV 83099 np reduce los rendimientos de l maíz. Desde este punto de vista agronómico no hay impedimento para la asociación' maíz + fríjol , siendo el maíz el cultivo principal. * Pero no solo el frtjól ZAV 83099 no limita la producción del maíz , sino que tambtén se obt iene con él una gana ncia adicional muy atractiva. Observamos que los cos tos variables (costos adicionales de producción ocasionado's por la decisión de añadir fríjol 4. Observamos que los cos tos variables (costos adicionales de producción ocasionado's por la decisión de añadir fríjol 4. al maíz) son de 22750'0 Intis por hectárea. Estos costos , debemos relacionarlos ,con la ganancia adioional que asciende al maíz) son de 22750'0 Intis por hectárea. Estos costos , debemos relacionarlos ,con la ganancia adioional que asciende a 872278 Intis por hect~rea . De t al man era resulta un retor- a 872278 Intis por hect~rea . De t al man era resulta un retor- no marginal de satisfactorio, siendo el retorho marginQl mínimo que se 383 % que se puede consid~rar como bastante , Cuacho No. 2 -Presupuesto parcial de datos prc.rre<liados de 8 localidades requiere en el caso de introducción de una nueva tecnología: Parcelas de cx:nprobación de frijol. ZAV 83099 asociado =n mll.z. 100%. (CIMMYT 1988) , no marginal de satisfactorio, siendo el retorho marginQl mínimo que se 383 % que se puede consid~rar como bastante , Cuacho No. 2 -Presupuesto parcial de datos prc.rre<liados de 8 localidades requiere en el caso de introducción de una nueva tecnología: Parcelas de cx:nprobación de frijol. ZAV 83099 asociado =n mll.z. 100%. (CIMMYT 1988) , Resumen     Resumen Tratamientos ( a )    Maiz solo Maíz + Frijol Tratamientos ( a )Maiz soloMaíz + Frijol Beneficios     Beneficios Rendimiento X de maiz Kg;ha Rend~ent o X de frijol Kg / ha (b)   3139 3227 675 Rendimiento X de maiz Kg;ha Rend~ent o X de frijol Kg / ha (b)31393227 675 Beneficio total (Benefi cio bru to •  2'62l907 3'721685 Beneficio total (Benefi cio bru to •2'62l9073'721685 de campo) I/ha   de campo) I/ha Costos variables     Costos variables Semilla de frijol     100000 Semilla de frijol100000 Siembra 2.62 j ornales/ha    786 0 Siembra 2.62 j ornales/ha786 0 Insecticida frij ol     30000 Insecticida frij ol30000 Cosecha de frijol.: ( Prorred io )   Cosecha de frijol.: ( Prorred io ) Recojo 18.00' Jornales/ha 540 15 Recojo18.00' Jornales/ha540 15 Trilla frijol 7.25, 11 ' \" 21750 Trilla frijol7.25, 11'\"21750 Venteo 2.00,' \"  \" 6000 Venteo2.00,'\"\"6000 Selección frijol 2 . 62 \"  11 7875 Selección frijol2 . 62\"117875 Total costos variables l/ha   o 227500 Total costos variables l/hao227500 Beneficios netos I/ha   2'621907 3'494185 Beneficios netos I/ha2'6219073'494185 (*) Precio Ma iz. Chacra   (*) Precio Frijol. Chacra (*) Precio Ma iz. Chacra(*) Precio Frijol. Chacra Blanco Urubamba Amarillo Calca Sin entrar en una discusión sobre las demás bondades I/Kg 1100 Fri jol ZAV 83099 l / Kg 1500 800 Mezcla maices \" de este fríjol, queremos , mencionar su precocidad y 600 , su tipo de grano aceptado por los agricultores y los Blanco Urubamba Amarillo Calca Sin entrar en una discusión sobre las demás bondades I/Kg 1100 Fri jol ZAV 83099 l / Kg 1500 800 Mezcla maices \" de este fríjol, queremos , mencionar su precocidad y 600 , su tipo de grano aceptado por los agricultores y los comerciantes . (Véáse documento de trabajo CIAT-INIAA comerciantes . (Véáse documento de trabajo CIAT-INIAA (Cus ca) No. 3)    (Cus ca) No. 3)  "},{"text":"'!>OL; .. c...;c: . . . . )   Queremos re'sumir lo dicho en el siguiente Queremos re'sumir lodicho en el siguiente gráfico : ' gráfico :'   Gráfico No . 3 Gráfico No . 3   E PA E PA -E f oc. Co d.1t. s~t. \\+\\ b{q, (,A<' f•~i.1)  -E f oc. Co d.1t. s~t. \\+\\ b{q, (,A<' f•~i.1) _ •V .. f~eJ.o.cl  _ •V .. f~eJ.o.cl   2. 2. 2 2. 22.  "}],"sieverID":"c49e1bee-b29f-48af-b5d8-5f8618b2c0cb","abstract":"Este documento de tr abajo expone una propu esta para integrar la comprobació n (verificación) de tecn ologias promisoria s) co n l a pa rti c ip acié¡n de l os agricultores en el proces o de investigación. Se presenta un caso concreto de ap licación de esta propuesta que se encuentra en ¡nedio ca min o de su realización.' (1) Antropólogo , CIA~ (Cusco) (2) Agrónomo, INIAA (Cusco) C:l hlc . lI CA•PE \" Tdex 2%72 PE . 'n1• n i:llcol,n ID 57. CC II 09 • fAX (5 1-I1H 11 7 11 . I d 4 11 711"}

data/part_5/04cd23f1fb60ea857b2cbf089bd61388.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04cd23f1fb60ea857b2cbf089bd61388","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/39093367-f49a-4585-95a9-dc3fb5aa4e76/retrieve"},"pageCount":1,"title":"Reach out to policy makers, private businesses & development practitioners to develop ways to make use of the scientific evidence","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":6,"text":"Why are market services so important?"},{"index":2,"size":21,"text":"• Ethiopia has around 120 government-recognized livestock markets where efficiency is heavily compromised due to lack of basic services and infrastructure."},{"index":3,"size":28,"text":"• National livestock development initiatives suffer from high uncertainty resulting from major gaps in grass roots level information that reflect consumer willingness to pay for essential market services."},{"index":4,"size":5,"text":"Scan to find out more"},{"index":5,"size":4,"text":"Creating jobs and growth"}]},{"head":"INCLUSIVE GROWTH","index":2,"paragraphs":[]},{"head":"Willingness to pay for livestock market services in Ethiopia","index":3,"paragraphs":[{"index":1,"size":16,"text":"This document is licensed for use under the Creative Commons Attribution 4.0 International Licence. May 2019"},{"index":2,"size":57,"text":"The CGIAR Research Program on Livestock thanks all donors and organizations which globally support its work through their contributions to the CGIAR Trust Fund: https://www.cgiar.org/funders/ § Small ruminant keepers in rural Ethiopia are willing to pay for market infrastructure. § Veterinary clinics, watering troughs, feed shops, and pit latrines are the services farmers are most interested in."},{"index":3,"size":11,"text":"Rural markets in Ethiopia often lack basic infrastructure and essential services."}]},{"head":"Other findings","index":4,"paragraphs":[{"index":1,"size":46,"text":"• Econometric models estimated that small ruminant keepers are willing to pay as high as 3 birr/sheep for a vet clinic, 2.85 birr for a watering trough, 2.80 birr for a feed shop, and 2.45 birr/sheep for a pit latrine in or close to the markets."},{"index":2,"size":14,"text":"• Preferences vary across location, number of small ruminants owned, and age of respondents."}]},{"head":"Our innovative approach","index":5,"paragraphs":[{"index":1,"size":12,"text":"• We estimated willingness to pay for market services using choice experiments."},{"index":2,"size":26,"text":"• The study covered Wag Himra Zone in Northern Ethiopia, Horro Gudru Zone in Central Western Ethiopia, and Menz in North Shewa zone of central Ethiopia."}]}],"figures":[],"sieverID":"ae5834e9-f37e-4eb0-9e50-8e2aa6402062","abstract":"Marginal willingness to pay in Ethiopian Birr for selected market facilities [pooled vs after attention reminder]"}

data/part_5/04f0a017e31bc981fab98d02490bbcfa.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04f0a017e31bc981fab98d02490bbcfa","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6793abfc-392b-4e19-ab76-09028bbe0834/retrieve"},"pageCount":3,"title":"","keywords":[],"chapters":[{"head":"OUTCOME STORY/IMPACT STATEMENT","index":1,"paragraphs":[{"index":1,"size":103,"text":"In Colombia, the Alliance led a technical process to formulate the Interministerial Resolution 249 of 2022. This is a public policy document of great importance for guiding the response to agricultural activities prohibited by the Law 1930 of 2018 but continue to be carried out in delimited moorlands, generating significant negative impacts on those ecosystems. This document requires public institutions working in these ecosystems to adjust their programs, projects and actions to comply with these new regulations. The benefits of the Technical document of guidelines for the design, training, and implementation of programs, plans, and projects for the conversion and substitution of agricultural "}]},{"head":"ELABORATION","index":2,"paragraphs":[{"index":1,"size":115,"text":"OF OUTCOME/IMPACT STATEMENT According to Humboldt Institute data, Colombia has 52% of the world's moorlands, ecosystems that supply water to 16 capital cities and nearly 17 million people, representing 35% of the national population. In addition, these ecosystems are home to nearly 4,000 species of plants, of which 734 are endemic, 70 species of mammals, 154 species of birds, and 90 species of amphibians. The diversity of plants represents 17% of Colombia's floristic diversity in only 2.5% of the continental territory [3]. Understanding the importance of these ecosystems and considering that there are still communities carrying out agricultural activities within the moorlands, the country has been developing processes to delimit and protect the 37 moorlands."}]}],"figures":[{"text":" activities in delimited moorlands that resulted in the Inter-ministerial Resolution 249 of 2022, are as follows: Resolution 249 of 2022 issued by MADR and MADS: here Blog: Los páramos, un ecosistema hoy reglamentado. CGIAR Initiative on National Policies and Strategies. Diciembre de 2022 LINKS TO ANY COMMUNICATIONS MATERIALS RELATING TO THIS led technical process resulted in two ministries adopting guidance for sustainable agriculture in Colombia´s fragile moorlands CGIAR INNOVATION(S) OR FINDINGS THAT HAVE RESULTED IN THIS OUTCOME OR IMPACT The adoption of a technical document of guidelines for the design, training, and implementation of programs, plans, and projects for the conversion and substitution of agricultural activities in delimited moorlands [1]. This document contains the methodological framework to determine when a process of reconversion or substitution of agricultural activities is required, based, among other reasons, on the level of affectation of the moorland ecosystem and the viability of the proposed alternatives [2]. For this purpose, Law 1930 of 2018, or the \" Moorland Law,\" provides the legal framework for the comprehensive management of the moorlands in the country, where the \"prohibited activities\" are listed, primarily agricultural and mining activities [4]. The law distinguishes between lowand high-impact activities, and for each category, it establishes that the ministries of environment and agriculture must develop strategies to address them on a case-by-case basis [4]. Low-impact activities are regulated by Resolution 1294 of 2021 [5] and high-impact activities by Resolution 249 of 2022 [1]. To address high-impact activities prohibited by the Law, Resolution 249 of 2022 proposes productive reconversion and substitution. In a very summarized form, productive reconversion seeks to progressively replace high-impact activities with others in accordance with socioenvironmental conditions; substitution, on the other hand, is the change of the activity for another one that is not prohibited [2]. Resolution 249 of 2022 was the result of a process led and facilitated by the Alliance Bioversity-CIAT [6], following the guidelines of the Ministries of Environment and Agriculture, as mandated by Article 10 of Law 1930 of 2018 [4]. The Alliance supported the Rural Agricultural and Livestock Planning Unit (UPRA) to develop and refine the final technical document that adopted the resolution. During this process, the Alliance facilitated different spaces with the legal and technical directorates of the ministries and the UPRA, ensuring clarity and consensus on the content of the technical document [6]. The Alliance also led the process of formulating the resolution and adopting the technical document, supporting the ministries in the different stages of the process. The role of the Alliance was to reconcile environmental and productive positions, which required a strategic and participatory methodology based on a deep understanding of what reconversion and substitution actions are and what they imply [6]. Technical and legal directorates of the Ministry of Environment and Sustainable Development. Technical and legal departments of the Ministry of Agriculture and Rural Development. Rural Agricultural and Livestock Planning Unit -UPRA. "},{"text":"  "}],"sieverID":"152d2e74-be58-483a-abab-aee37e2648f3","abstract":"PART 1: Description and all information of the outcome/impact reported TYPE OICR: Outcome Impact Case Report Protection of valuable ecosystems: The resolution evaluates the impact of activities and the options for generating the least possible damaging impact or, as a last resort, the substitution of the activity for another with less impact. This will help to protect the country's 36 delimited moorland ecosystems. Subsistence of those who live in and depend on these ecosystems: The resolution will help to ensure the subsistence of those who live in and depend on these ecosystems by providing them with alternative activities that have less impact on the environment. Reconciliation of environmental and productive positions: The resolution has been developed through a process of consultation and collaboration between different stakeholders, which has helped to reconcile environmental and productive positions. This is a positive step towards sustainable development.Collective construction: The resolution has been developed through a process of collective construction, which has helped to ensure that it is relevant to the needs of all stakeholders. This is a positive step towards good governance."}

data/part_5/0523818272a1cbdf3342b5722b03b740.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0523818272a1cbdf3342b5722b03b740","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7daa0c7f-4406-484b-bf59-47a5994e5ea6/retrieve"},"pageCount":8,"title":"Cartes préliminaires de risque de l'infl uenza aviaire: Information au lecteur Cartographie du risque d'infl uenza aviaire de sous-type","keywords":[],"chapters":[{"head":"Le projet:","index":1,"paragraphs":[{"index":1,"size":79,"text":"Cette publication fait partie d'une série de documents élaborés pour aider la prise de décision en matière de prévention et de contrôle de la grippe aviaire hautement pathogène de sous-type H5N1 par l'utilisation d'une cartographie du risque, et est le résultat du projet Détection rapide et surveillance de l'infl uenza aviaire en Afrique (EDRS-AIA) mis en oeuvre par l'Institut International pour la Recherche sur l'Élevage (ILRI) en collaboration avec le Bureau interafricain des ressources animales de l'Union africaine (UA-BIRA)."},{"index":2,"size":53,"text":"Chercheurs et auteurs: Une équipe conjointe de chercheurs de Royal Veterinary College (RVC) de Londres et de ILRI a élaboré cette série de publications sous la supervision du Professeur Dirk Pfeiffer. Les membres de l'équipe sont Solenne Costard, Kim Stevens, Raphaelle Metras, Wachira Theuri, Russ Kruska, Tom Randolph, Delia Grace, et Saskia Hendrickx."}]},{"head":"Rédaction:","index":2,"paragraphs":[{"index":1,"size":2,"text":"Carole Douglis"}]},{"head":"Graphisme:","index":3,"paragraphs":[{"index":1,"size":4,"text":"Lilian Ohayo, Eric Ouma"}]},{"head":"Photographie:","index":4,"paragraphs":[{"index":1,"size":2,"text":"Stevie Mann/ILRI"}]},{"head":"Remerciements:","index":5,"paragraphs":[{"index":1,"size":10,"text":"Nous remercions les personnes suivantes pour leurs observations et suggestions:"},{"index":2,"size":29,"text":"Gary Smith, de l'Agence américaine pour le développement international (USAID) ainsi que les membres du projet Détection rapide et surveillance de l'infl uenza aviaire en Afrique (EDRS-AIA) de ILRI/UA-IBAR."}]},{"head":"Financement:","index":6,"paragraphs":[{"index":1,"size":45,"text":"Cette série de publications a été rendue possible par la généreuse contribution du Peuple américain à travers l'Agence américaine pour le développement international (USAID). Le contenu de cette publication relève de la responsabilité  Les facteurs de risque d'introduction et de propagation de la grippe aviaire:"},{"index":2,"size":27,"text":"Les cartes prennent en compte, en tout point, les facteurs de risque connus qui peuvent être cartographiés, pondérés de leur importance relative. Ces facteurs de risque sont:"},{"index":3,"size":20,"text":"Les lieux où les volailles sont importées, commercialisées (légalement ou illégalement) produites et consommés. Que montrent les cartes de risque?"},{"index":4,"size":8,"text":"Si l'infl uenza aviaire devait s'introduire en Afrique…"},{"index":5,"size":23,"text":"Les zones du continent pour lesquelles l'infl uenza aviaire serait le plus susceptible de s'introduire -sur la base des facteurs de risque considérés."},{"index":6,"size":22,"text":"Les zones du continent pour lesquelles l'infl uenza aviaire serait le moins susceptible de s'introduiresur la base des facteurs de risque considérés."},{"index":7,"size":8,"text":"Une fois l'infl uenza aviaire introduite en Afrique…"},{"index":8,"size":54,"text":"Les zones du continent pour lesquelles l'infl uenza aviaire serait le plus susceptible de se propager -sur la base des facteurs de risque considérés Les zone(s) du continent pour lesquelles l'infl uenza aviaire serait le moins susceptible de se propager (i.e. elle demeurerait un cas isolé) -sur la base des facteurs de risque considérés."},{"index":9,"size":15,"text":"Cartes préliminaires de risque: Résultats clés Zones à haut risque d'introduction de la grippe aviaire:"},{"index":10,"size":70,"text":"Les zones identifi ées comme ayant le risque le plus élevé d'introduction de la grippe aviaire sont le Delta du Nil, la côte de l'Afrique du Nord, l'Afrique de l'Ouest et de certaines parties de l'Afrique du Sud (Figure 1, page 6). Les zones identifi ées comme ayant le risque le moins élevé d'introduction de la grippe aviaire sont l'Afrique du Nord, la Somalie, l'Ethiopie, et le Botswana (Figure 1)"},{"index":11,"size":15,"text":"Zones à risque de propagation potentielle de l'infl uenza aviaire une fois la maladie introduite:"},{"index":12,"size":43,"text":"La plupart de l'Afrique sub-saharienne est identifi ée comme ayant le risque de propagation le plus élevé (Figure 2, page 7). Autrement dit, la plupart des zones du continent africain seraient plus favorable à la propagation de la maladie qu'à son introduction ."},{"index":13,"size":34,"text":"Les zones identifi ées comme ayant le risque le plus faible de propagation de la maladie sont l'Afrique du Nord, la Somalie, l'Angola, la Namibie et le Sud-ouest de l'Afrique du Sud (Figure 2)."}]},{"head":"Recommandations pour l'utilisation des cartes de risque","index":7,"paragraphs":[{"index":1,"size":22,"text":"Ces cartes préliminaires de risque ne montrent que la probabilité relative d'introduction ou de propagation de la grippe aviaire dans une région."},{"index":2,"size":39,"text":"Elles ne peuvent pas déterminer les lieux des prochains foyers de grippe aviaire. De même, les cartes de risque de propagation de la grippe aviaire ne montrent que les zones de risque de propagation et non l'étendue de celleci."},{"index":3,"size":69,"text":"Ces cartes ont été élaborées sur la base de notre connaissance actuelle des facteurs de risque et leur relative importance ; la connaissance de l'épidémiologie de la maladie sur le continent africain reste encore partielle. En outre, les données nécessaires à la production de telles cartes sont souvent incomplètes, obsolètes et dans certains cas erronées. Ces cartes de risque seront validées au cours de la prochaine étape du projet."},{"index":4,"size":51,"text":"Utilisation: ces cartes peuvent être utilisées pour aider à l'identifi cation des zones où les autorités et les agents sanitaires vétérinaires peuvent cibler leurs efforts de surveillance, conjointement avec des outils complémentaires et en tenant compte d'autres facteurs qui infl uencent le risque d'introduction ou de propagation de la grippe aviaire."},{"index":5,"size":17,"text":"Les limitations de ces cartes de risque sont présentées de façon plus détaillée dans le rapport initial. "}]},{"head":"1) Identifi cation des zones de risque d'introduction de la grippe aviaire en Afrique","index":8,"paragraphs":[]},{"head":"Résultats clés pour le risque d'introduction au niveau continental","index":9,"paragraphs":[{"index":1,"size":37,"text":"Les zones identifi ées comme ayant le risque le plus élevé d'introduction de la grippe aviaire sont le Delta du Nil, la côte de l'Afrique du Nord, l'Afrique de l'Ouest et certaines parties de l'Afrique du Sud."},{"index":2,"size":95,"text":"Les zones identifi ées comme ayant le risque le moins élevé d'introduction de la grippe aviaire sont l'Afrique du Nord, la Somalie, l'Ethiopie et le Bostwana. Ces cartes ont été élaborées sur la base de notre connaissance actuelle des facteurs de risque et leur relative importance ; la connaissance de l'épidémiologie de la maladie sur le continent africain reste encore partielle. En outre, les données nécessaires à la production de telles cartes sont souvent incomplètes, obsolètes et dans certains cas erronées. Ces cartes de risque seront validées au cours de la prochaine étape du projet."}]},{"head":"Résultats clés pour le risque de propagation au niveau continental","index":10,"paragraphs":[{"index":1,"size":17,"text":"La plupart de l'Afrique sub-saharienne est identifi ée comme ayant le risque de propagation le plus élevé."},{"index":2,"size":32,"text":"Les zones identifi ées comme ayant le risque le plus faible de propagation de la maladie sont l'Afrique du Nord, la Somalie, l'Angola, la Namibie et le Sud-ouest de l'Afrique du Sud."},{"index":3,"size":10,"text":"Cartes préliminaires de risque de l'influenza aviaire: Information au lecteur"}]}],"figures":[{"text":"Figure 1 : Figure 1: Probabilité relative d'introduction de la grippe aviaire en Afrique "},{"text":" Figure 2 : Probabilité relative de propagation de la grippe aviaire en Afrique, une fois la maladie introduite "}],"sieverID":"f8773464-5297-4213-89be-0ab2e9f4d9b3","abstract":""}

data/part_5/057075e9b1939038c9682a5780180205.json

@@ -0,0 +1 @@
+{"metadata":{"id":"057075e9b1939038c9682a5780180205","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/a3087cc5-07dc-4ebf-9e45-532563cc4d40/retrieve"},"pageCount":4,"title":"Integrating gender into rural advisory services","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":128,"text":"A profound need exists for specific guidelines for integrating gender into rural advisory services. Acknowledgement of the significant function women serve in agricultural development around the world has not always rendered effective ways of working with women farmers. In many countries, women make up over 70% of the agricultural labour. Women participate along the entire agricultural value chain, contributing as producers, distributors, processors, storers and marketers, as well as being responsible for feeding and caring for their families. Women and men assume different roles in society and therefore often have unique needs. The World Bank, FAO and IFAD (2009 p. 2) state that the \"failure to recognize the roles, differences and inequalities [between men and women] poses a serious threat to the effectiveness of the agricultural development agenda\"."},{"index":2,"size":175,"text":"Integration of gender principles and practices into rural advisory services is critical for increasing productivity in both rural sectors and the national economy and for providing adequate and appropriate services for both women and men. The analysis and incorporation of gender issues is rarely included in rural advisory services. Yet, women as the primary agricultural labour force throughout the world, perform agricultural tasks with fewer resources, less access to technology and the added responsibility of child and family oversight. The vast majority of rural advisory service workers are male, and are not trained in how to work with women farmers. Few recognize the contributions that women make to agriculture or are aware of how best to Rationale for the workshops Women, on average, comprise 43% of the agricultural labour force in developing countries and account for an estimated two-thirds of the world's 600 million poor livestock keepers. Of those women in the least developed countries who report being economically active, 79% report agriculture as their primary course of livelihood (48% of economically active women worldwide)."},{"index":3,"size":24,"text":"Rural women typically work longer hours than men, when one takes into account both paid productive and unpaid reproductive or domestic and care responsibilities."},{"index":4,"size":45,"text":"When these tasks are taken into account, women's total work hours are longer than men's in all regions. Women tend to be employed for labour-intensive tasks, generally earn lower wages than men and are more likely to be paid at piece rate (Farming First 2013)."}]},{"head":"Participant reactions to workshops","index":2,"paragraphs":[{"index":1,"size":85,"text":"Participant reactions to the gender workshops were overwhelmingly positive and enthusiastic. The participants were very interested in and appreciative of the participatory, hands-on methodology demonstrated throughout the workshop. Many commented that they had never received any training of this nature where they could be actively engaged and involved in practising skills and knowledge. The participants expressed how the workshop had both a personal and professional impact. The methodology and subject matter resonated deeply as they contemplated ways to integrate gender more effectively in their work."},{"index":2,"size":76,"text":"Before the start of the workshop, pre-evaluation forms were issued to assess general knowledge about gender. At the end of each workshop participants were asked to complete a post evaluation form. The evaluation forms consisted of 15 items rated on a four-point scale ranging from 0 ('Not at all') to 3 ('To a great extent'). Scores could range from 0 to 45. Pre-evaluation scores ranged from 7 to 37. Post-evaluation scores ranged from 34 to 45."},{"index":3,"size":80,"text":"Recognizing factors that promote gender equality is essential when planning and implementing agricultural programming for both men and women farmers. The strategy and plan of action of the International Livestock Research Institute to mainstream gender into its work acknowledges that gender equality is an important prerequisite for agricultural growth and sustainable development. Promoting equality of opportunity and outcomes between women and men in the livestock sector at local, national, regional and global levels is a major objective for the institute."},{"index":4,"size":105,"text":"Integrating gender into rural advisory services: A participatory workshop approach One method for promoting gender equality is to provide training and instruction for rural advisory service workers on ways to integrate gender into their work. Two workshops were conducted that focused on methods for gender integration. The workshops took place on 6-8 June 2012 at Makerere University in Kampala, Uganda and 14-16 June 2012 at Sokoine University of Agriculture, in Morogoro, Tanzania and involved 26 and 30 participants, respectively. The majority of participants were male field extension agents, with attendance also by university faculty and partner organizations. The primary objectives of the workshop were to:"}]},{"head":"•","index":3,"paragraphs":[{"index":1,"size":16,"text":"Differentiate between sex and gender and analyze connections among gender, agricultural productivity and rural advisory services."},{"index":2,"size":31,"text":"• Identify the main elements of gender analysis, review basic tools for conducting a gender analysis and assess when and how to apply these tools in the field using participatory techniques."}]},{"head":"•","index":4,"paragraphs":[{"index":1,"size":15,"text":"Examine critical issues affecting work with women farmers, including gender-sensitive message design and communication strategies."}]},{"head":"•","index":5,"paragraphs":[{"index":1,"size":11,"text":"Compare or contrast participatory techniques to engage mixed and single-gender groups."},{"index":2,"size":14,"text":"• Define the key elements of an agricultural value chain using a gendered approach."},{"index":3,"size":92,"text":"The workshops embraced and incorporated participatory and capacity-building facilitation methods to assist rural advisory service workers to become more effective and capable in their work with women and men farmers. A participatory approach encourages openness to new ideas and techniques, nurtures a creative, appreciative spirit, recognizes the value of traditional knowledge and promotes a willingness to share and apply the skills and knowledge experienced in the workshop setting. Capacity-building activities enable workshop participants to build and strengthen their individual and collective abilities as they work in the field to facilitate lasting change."},{"index":4,"size":22,"text":"Increasing the longevity and meaningful output of the workshops through participatory, capacity-building activities is crucial for ensuring continued progress toward gender equality."},{"index":5,"size":80,"text":"On average, the percentage change in the participants' self-reported knowledge was an increase of 87%. The items that showed the least change between pre-and post-evaluations were related to 'differentiating between sex and gender' and 'explaining the concept of gender mainstreaming' . 'Applying a specific gender analysis tool' showed the highest percentage change (214%) between pre-and post-evaluation measurements. Reasons for these changes varied by individual, but the majority of participants had never attended any training on integrating gender into their work."}]},{"head":"Next steps","index":6,"paragraphs":[{"index":1,"size":27,"text":"At the conclusion of the training, participants reflected on what questions remained as they began to apply and implement the skills and knowledge gained in the workshops:"},{"index":2,"size":20,"text":"• How can we simplify the training for the grassroots level, while at the same time retain the key concepts?"},{"index":3,"size":23,"text":"• How do we talk with, for example, a traditional Muslim male to help him consider incorporating females into the discussion and decision-making?"},{"index":4,"size":15,"text":"Gender constraints significantly reduce the productivity of both the rural sector and entire national economies."},{"index":5,"size":50,"text":"Misunderstanding of gender differences leads to inadequate planning and design of projects and the perpetu-ation of gender inequalities and diminished returns on investments. Addressing gender equality requires a commitment to providing adequate training for rural advisory service workers as they continue to assist both women and men in the field."}]}],"figures":[{"text":"  "}],"sieverID":"72c78dc9-e902-45f8-8ccb-1bf1cde64a47","abstract":"serve this population's needs. As extension and other development organizations and agencies remain a significant resource of information for limited resource farmers, (the majority of whom are women), the inclusion of methods and approaches that address gender is critical for the continued success of rural advisory services.Taking gender into account usually, but not always, involves a focus on women since women most often occupy a subordinate position in society or are the most marginalized in their communities. Women have traditionally held lower status than men in most countries around the world. Experience has shown that sustainable changes are most fully realized through activities focused on engaging both men and women to transform harmful attitudes and behaviours. This is because men can also be disadvantaged due to their sex and their related gender roles. For instance, young boys in southern Africa are taken out of school at certain times of the year due to animal herding responsibilities. In cases where there is societal pressure for men to be aggressive and dominant, such male gender norms may negatively impact women, families and communities by encouraging violence against women. Thus, even programs that primarily focus on women should also work with men to transform harmful attitudes and behaviours. A program that promotes women's economic empowerment should consider whether there are societal expectations for men to be the sole provider in their families; if so, men may feel disempowered by such a program, and domestic violence could be an unintended consequence."}

data/part_5/05792eed7205f474298c20ef9ef1fbc5.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05792eed7205f474298c20ef9ef1fbc5","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/96a6182c-34d4-4156-8197-f52540f6383b/retrieve"},"pageCount":32,"title":"","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":115,"text":"Water, land, energy, forests, and biodiversity systems are highly interconnected. Together, they are critical to innumerable essential services at multiple scales that support sustainable development goals through multiple pathways, including: food and nutrition security, health, poverty reduction, livelihoods and jobs, gender equality, youth empowerment, social inclusion and cohesion, climate adaptation and mitigation, environmental health, and human wellbeing. Reflecting the deep and complex interconnections among these sectors, the UN Sustainable Development Goals (SDGs) are likewise systemic, with interdependencies across the water, energy, food, and ecosystems that sustain life. However, governments, stakeholders, and investors struggle to manage systems-level change in the water-energy-food-ecosystems (WEFE) nexus, and to ensure such changes are robust in the context of climate change."},{"index":2,"size":103,"text":"CGIAR's NEXUS Gains Initiative aims to realize gains across water, energy, food, and ecosystems (with a focus on forests and biodiversity) in selected transboundary river basins by leading global nexus thinking and providing tools, guidelines, training and facilitation for analysis, and research for development. The Initiative focuses on addressing the challenges of sectoral siloes, mitigating tradeoffs, and optimizing synergies to support SDG achievement through food, land, and water systems transformations. Furthermore, NEXUS Gains aims to strengthen capacities to develop and implement nexus solutions among key stakeholders (of all genders and at multiple levels) who have a critical role to play in this area."},{"index":3,"size":107,"text":"Work Package (WP) 5 of NEXUS Gains specifically aims to develop the capacity of WEFE actors. A core component of the capacity strengthening program is a leadership development package tailored to WEFE nexus leaders, with emphasis on emerging women leaders. This package will combine technical learning with leadership skills for developing and implementing WEFE nexus solutions. The Alliance of Bioversity International and the International Center for Tropical Agriculture (CIAT) is leading WP5 of NEXUS Gains, and the International Water Management Institute (IWMI) is taking the lead in providing technical expertise and overseeing Initiative activities in Nepal in collaboration with the Department of Water Resources and Irrigation (DWRI)."},{"index":4,"size":32,"text":"Against this backdrop, this concept note outlines the planned co-development and implementation of the WEFE Nexus Leadership Program targeted at women and men professionals who are emerging WEFE sector leaders in Nepal."}]},{"head":"Gender and social inclusion in WEFE institutions in Nepal","index":2,"paragraphs":[{"index":1,"size":303,"text":"Nepal's commitment to promoting gender equality and social inclusion (GESI) in development, state governance, policymaking, and decision-making has been elevated since the instatement of the Constitution of Nepal in 2015 (GON, 2015) 1 . The Constitution adheres to the principle of proportional inclusion and participation to ensure an equitable economy, prosperity, and social justice for all (ibid.). On this basis, it guarantees the reservation of 33% of seats for women in the federal and provincial assemblies, and 40% representation in local governments. It also enshrines the rights of women, Dalits and other marginalized groups to participate in all state structures and bodies. Similar provisions have been made in the civil service, in which 45% of the total seats for open competition are reserved for women, Dalits, Janajatis, Madhesi, people with a disability, and people from remote regions (Khadka and Sunam, 2018). The implementation of an affirmative action policy in the civil service since 2008 has contributed to women's increased inclusion in the state workforce. As of 2021, women made up 26% of the total workforce of the civil service (MoWCSC, 2021). However, women remain underrepresented in higher bureaucratic and administrative positions (Wagle, 2019). GESI considerations play an important role in the Government of Nepal's 15th Plan, 2019-2023, the country's first post-federalist national policy framework and development plan (NPC, 2019). The Plan provides a 25-year vision of national prosperity, and includes a section dedicated to gender equality and women's empowerment. This section outlines several strategies to achieve gender equality in Nepal. The Plan furthermore aims to enable 'gender accountable' governance mechanisms at all levels, supported by the eventual inclusion of 50% women at all levels and in all development processes of the state (NPC, 2019, p. 208). It also assumes that the poorest and most marginalized women would receive additional support from state interventions."},{"index":2,"size":129,"text":"While the Government of Nepal (GoN) has committed to GESI as a process and outcome of national development, the literature points to significant gaps between GESI narratives in national policy frameworks and practices by both state and non-state actors. In practice, WEFE sectors are characterized by limited understanding of, and actions to implement, GESI principles in policymaking and practices. Sectoral plans, policies, and programs in Nepal tend to overlook differential experiences, needs, challenges, priorities, and capacities among diverse women and men. Although women are key nexus stakeholders and actors in sustainable management of WEFE resources in Nepal (Upadhyay, 2005), they are frequently unable to participate meaningfully in water-energyfood (WEF)-related user groups and committees due to the lack of an enabling environment at the local level (Goodrich et al., 2017)."},{"index":3,"size":85,"text":"Adding to these challenges, the policy frameworks guiding the WEF sectors see gender equality and women's empowerment as something to be achieved at the grassroots level, rather than at the policy level. While sectoral policies mention women, the poor, and smallholder farmers, they are silent on strategies and actions to transform unfair power relations at scales (e.g., household, community, markets, and state) and to increase the voice and agency of women and marginalized groups in WEF technology adoption and governance (Khadka et al., in preparation)."},{"index":4,"size":167,"text":"In spite of systemic barriers in government and sectoral spaces, however, women are increasingly emerging as leaders in politics and state governance (TAF, 2018). From an instrumentalist perspective, women's increased involvement can yield positive results for WEFE governance; some studies reveal that \"women's participation in decision-making can lead to better environment outcomes, including by strengthening environment policies\" (Strumskyte et al., 2022, p. 7). In addition, research shows that women in leadership have historically prioritized environmental impacts and their implications for women and other marginalized groups more than their male counterparts (ibid). Hence, building an enabling environment for women professionals can not only enhance their capacities for and influence on decision-making in WEFE-sector institutions at scales, but also generate transformational change and sustainable management of water resources, agriculture, natural resources, and environment. To support women leaders, address the abovementioned barriers, and make progress towards gender equality, there is a need to institutionalize values and behaviors that promote positive masculine discourses, norms, and organizational culture (Shrestha and Clement, 2019)."}]},{"head":"Rationale for WEFE leadership development","index":3,"paragraphs":[{"index":1,"size":82,"text":"A scoping study, conducted for the NEXUS Gains Initiative in 2022 to assess the current capacities and needs of stakeholders, including women professionals working in WEFE sectors in Nepal, found that there is a low level of understanding and capacity to implement WEFE nexus approaches at scales (Buchy et al., 2022). Moreover, women professionals face gender-specific challenges for advancing and influencing strategic decisions in WEFE sectors. Despite their increasing numbers, women professionals working for the GoN continue to be sidelined and overlooked."},{"index":2,"size":135,"text":"While WEFE-sector women professionals of all ages and levels of seniority expressed confidence about their own knowledge and skills in the scoping study, they also expressed feeling that they need to constantly prove themselves (Buchy et al., 2022). Women across government, research, civil society, media, and NGO sectors stressed the need for more confidence-building to operate effectively and have influence in a male-dominated work environment characterized by skewed gendered power relations, while also advancing their knowledge and skills in WEFE nexus science (ibid). In addition to building strong leadership skills to help women speak up and be heard in decision-making spaces, the scoping study suggested that leadership activities should equip women and men with gender and social analysis skills, as well as the capacity to understand intersectionality dynamics among women as a heterogeneous group (ibid)."}]},{"head":"Aim and objectives of the WEFE leadership program","index":4,"paragraphs":[{"index":1,"size":117,"text":"The CGIAR NEXUS Gains Initiative aims to work with local partners to co-design, pilot, and scale a WEFE Nexus Leadership Program to enhance the capacities of professionals to co-develop and implement equitable and sustainable WEFE nexus solutions. During the first phase of the NEXUS Gains initiative (2022)(2023)(2024), the Program will be delivered to 40 professionals (with a target quota of 70% women) working in the WEFE sector in the Ganges and other Initiative river basins. The program, which will first be developed and implemented in Nepal (targeting 20 participants), intends to advance the agency and leadership of WEFE actors, with an emphasis on women professionals, while affording them opportunities and enabling them to champion a nexus approach."},{"index":2,"size":108,"text":"Nepal needs strong women leaders able to contribute to social change and lead GESI-based development processes, and emerging women leaders in WEFE sectors have promising roles to play in operationalizing a nexus approach. Yet, dominant masculine attitudes and disabling work environments in WEFE sectors often undermine this potential. Women also have limited social capital and lack safe spaces for sharing their experiences, knowledge, and learning regarding barriers and strategies for tackling gender discrimination and exclusion in institutions at different scales. This leadership program will therefore be conducted with the understanding that many women and men actors across WEFE sectors have limited opportunities to champion nexus thinking and approaches."},{"index":3,"size":9,"text":"The WEFE Nexus Leadership Program has the following objectives:"},{"index":4,"size":21,"text":"▪ Develop the technical knowledge and analytical and advocacy skills of WEFE sector professionals on WEFE nexus approaches and their operationalization."},{"index":5,"size":23,"text":"▪ Develop the leadership capacity of women actors across WEFE sectors to participate meaningfully in nexus discourses, policy processes, decision-making, planning, and implementation."},{"index":6,"size":13,"text":"▪ Develop strong and collaborative networks for co-developing and implementing WEFE nexus solutions."},{"index":7,"size":29,"text":"▪ Capitalize on women professionals' assets, develop a cadre of professionals aware of and able to address structural barriers to gender equality and social inclusion within the WEFE sectors."},{"index":8,"size":129,"text":"While this program focuses on WEFE professionals, with an emphasis on women professionals, there are also many women leaders at the grassroots level who could benefit from support to strengthen their leadership capacities. Ideally the leadership program would include women at the federal, provincial, and local government levels, but this presents logistical difficulties in practice, as women at different levels need different skills and tools, and have different educational backgrounds. Ideally a shorter capacity strengthening package would be developed in parallel for key women actors at the local government level in Madhesh province (Terai) and Karnali province (Hills), where NEXUS Gains will implement most of its activities in Nepal. While this may materialize in the future, such a venture is outside the scope of the program at this stage."}]},{"head":"Expected outcomes","index":5,"paragraphs":[{"index":1,"size":7,"text":"The WEFE Nexus Leadership Program expects to:"},{"index":2,"size":13,"text":"▪ Strengthen participants' capacities (technical and general skills) to apply WEFE nexus approaches."},{"index":3,"size":30,"text":"▪ Enhance the leadership capacities of WEFE women and men professionals by providing tools, techniques, and knowledge related to WEFE nexus concepts and their operationalization in the context of Nepal."},{"index":4,"size":19,"text":"▪ Strengthen networks (including via implementation of Communities of Practice (CoP)) to collaboratively develop and implement WEFE nexus innovations."},{"index":5,"size":39,"text":"▪ Equip participants with strategies for tackling gendered barriers persistent in WEFE sector policies, programs, and organizations. The Program will therefore support gender equality and social inclusion in the WEFE sectors, while promoting cross-sectoral and inclusive policymaking and practices."}]},{"head":"Review of existing women's leadership courses","index":6,"paragraphs":[{"index":1,"size":290,"text":"Several organizations are developing women's leadership courses related to the environment and natural resource management in the global south, with the objective of increasing women's access to and control over resources. Some distinguished examples include Regional Community Forestry Training Center's (RECOFTC) Weaving Leadership for Gender Equality (WAVES) program; Women Organizing for Change in Agriculture and Natural Resource Management's (WOCAN) course on Reframing Leadership for Gender Equality; African Women in Agricultural Research and Development's (AWARD) courses on leadership and mentoring; and Gender at Work's (G@W) courses on Transformative Leadership. All these courses aim to build the capacities of women leaders, professionals, activists, and community actors working on agriculture and environmental issues, to enhance their ability to position themselves to advocate for gender equality in their professional and personal lives. ▪ RECOFTC's WAVES is a women's leadership program designed for leaders, experts, politicians, academics, and senior officials involved in forest and natural resource management. Using a participatory approach, the program is based on co-engagement and co-production of knowledge, followed by regular mentoring for participants. It aims to maximize gender leaders' potential by providing psychosocial counselling, nurturing leadership skills, and extending technical and financial support to implement action plans during the leadership program. The action plans consist of activities enabling participants to influence government and non-government leaders as well as plans, policies, and strategies at the institutional and government levels, and to create and strengthen gender networks and groups. 2 ▪ WOCAN's Reframing Leadership for Gender Equality course uses a participatory and reflexive approach, allowing women and men professionals to reflect on the challenges encountered in traditional (patriarchal) leadership practices and resulting impacts on the professional and personal performance of individuals. 3 WOCAN also supported RECOFTC in the creation of its WAVES program."},{"index":2,"size":122,"text":"▪ AWARD offers women's leadership courses with a focus on agriculture and natural resources management. 4   ▪ Gender at Work uses a reflexive approach in its courses on natural resource management based on gender transformative approaches. It also uses a gender-action-learning methodology to identify gaps in skills and knowledge, mark trajectories of change, and design action plans for change projects. The change projects aim to contribute to transforming a participant's institution, community, and personal life. 5   Drawing from the learnings and experiences of the above-mentioned leadership programs, the WEFE Nexus Leadership Program will be tailored to the goals of the NEXUS Gains Initiative. Some leadership skills are generic, but some will need to be tailored to the specificities of WEFE nexus approaches."}]},{"head":"Guiding principles","index":7,"paragraphs":[{"index":1,"size":18,"text":"Four principles will guide the WEFE Nexus Leadership Program, following the broader principles of participatory action research (PAR)."},{"index":2,"size":54,"text":"▪ Participatory engagement: This principle adheres to the values of meaningful engagement, power sharing, co-creation, and ownership of knowledge (Gurung, 2021). For this, the program intends to provide equal space for participants and facilitators to collaborate in dialogue and discussions throughout the program to look at WEFE nexus and GESI issues through multiple lenses."},{"index":3,"size":99,"text":"▪ Reflexivity: This principle will encourage participants to reflect on their own experience, position, challenges, and learnings within their professional and personal lives. Identity and circumstances based on sex, gender roles, caste, religion, class, marital status, educational status, etc., influence professional life (Tabassum and Nayak, 2021). Hence, it is important to reflect on both personal and professional lives from multiple perspectives. This will allow participants to self-assess and work towards self-improvement while addressing barriers. To this end, the program intends to provide a safe space for participants to share in a trusting and non-judgmental environment without fear or hesitation."},{"index":4,"size":101,"text":"▪ Demand-driven: The leadership program will be demand-driven, as it is based on the learnings from the aforementioned scoping study (Buchy et al., 2022). The program will be tailored to co-produce knowledge between program facilitators and participants on WEFE nexus issues, GESI, governance, and transformational change in tandem with leadership development skills. The leadership program will also provide mentorship to participants via women leader role models after the leadership course is completed. Changes in knowledge, attitudes, and practices-including the level of engagement of participants in their institution's decision-making and planning-would be assessed through roundtable discussions (see below) and/or semi structured interviews."},{"index":5,"size":149,"text":"▪ Engaging men: In a brainstorming session during the scoping study, women professionals insisted on the inclusion of men colleagues in GESI-related discussions. The program intends to engage men professionals working in WEFE sectors to support collaboration in this area. These men should represent 30% of program participants. These men should be committed to promoting inclusive nexus approaches and able to influence change within their respective WEFE sectors. Through their inclusion, men should be able to better understand issues around social and gender equality, the challenges their women co-workers face in their personal and professional lives, and how to act as champions to defend and advance GESI in the context of a wholistic nexus approach. This will encourage men professionals to collaborate more with women professionals, and for professionals of all genders to collaborate across WEFE sectors to formulate and implement socially just and genderinclusive policies at all levels."},{"index":6,"size":222,"text":"▪ Embed impact and sustainability through partnerships: Sustainability of outcomes and lessons learned from training and capacity building programs in the WEFE sector is an issue. There are large numbers of development programs and projects invested in local capacity building, but these are frequently designed as one-off events, with limited follow-up and outcome monitoring. To sustain positive change, the program will be co-developed and codelivered in solid partnership with local collaborators able to advocate, cascade, and upscale WEFE approaches. Before the first round of the course begins, participants will be given the opportunity to share their needs and expectations for the course, which will be taken into consideration while finalizing the content. Similarly, participants will be invited to provide ongoing feedback during the course, so they can contribute to refining the curriculum. This will also expand WEFE champions' networking through ongoing monitoring using reflective learning techniques encouraging participants to assess their own change and changes around them. Additionally, through a practical exercise, participants will be expected to develop and test some innovative ways to work together across sectors to start a process which can continue beyond the training cycle. To sustain peer-to-peer collaboration and support once the course has ended, the course will encourage the formation of an informal alumni group to enable participants to benefit from each other's expertise and experience."}]},{"head":"Program monitoring and evaluation","index":8,"paragraphs":[{"index":1,"size":103,"text":"The program pilot will be monitored for the purpose of adaptive learning and to support eventual scaling to other NEXUS Gains basins. A survey will be conducted to assess participants' knowledge, attitudes, and practice (KAP) related to the WEFE nexus, GESI issues, and the status of their leadership skills. The assessment will be conducted before the leadership workshop and at the end of the program to assess changes in participant's understanding of WEFE nexus approaches and GESI that may be attributed to the program. This will help to tailor the course to participants' specific needs and to monitor the outcomes of the program."}]},{"head":"Participant selection","index":9,"paragraphs":[{"index":1,"size":69,"text":"In total the program intends to train 40 leaders (~70% women) to promote the development of inclusive nexus approaches. For the first year, the program will involve 20 to 25 carefully chosen participants among NEXUS Gains partners and researchers at the federal level. 6 During the NEXUS Gains inception and subsequent workshops and dialogues organized by IWMI for different projects, an initial list of potential participants has been compiled."},{"index":2,"size":41,"text":"The selection of the participants will be based on following criteria: ▪ Women and men professionals working in WEFE sectors in public and private organizations, CSOs, and academic institutions; these professionals should be in influencing or decisionmaking positions within their organizations."},{"index":3,"size":79,"text":"▪ Early-to mid-career WEFE-sector professionals with the prospect to hold influence in their employing institutions or in national and community spheres in the long term. A balance between mid-career and senior professionals will be sought, as senior staff generally have more influence but less time available for long-term training. Ideally there will be 2 participants from the each organization so as to create a small critical mass better able to stimulate change within the organization beyond the training cycle."},{"index":4,"size":31,"text":"▪ Participants should be open to committing to work in a collaborative way across organizations and sectors, and to promote gender-responsive and socially inclusive ways of working within their own organizations."},{"index":5,"size":28,"text":"▪ Diversity of castes, ethnicities, and levels of seniority. Priority will be given to professionals working in the locations where the NEXUS Gains Initiative is implementing its programs."},{"index":6,"size":80,"text":"▪ Participants are expected to participate in the whole program cycle, and to support scaling of the program after completion of the training. To support this, an approval letter stating the intent of program will be sent to the respective relevant line manager at the participant's organization. The letter will clarify what is required from the organization to support the participant during the workshop cycle, including a commitment to program participation even if the participant is transferred to another location."},{"index":7,"size":62,"text":"▪ Line managers of participants will also be kept informed of the course development and progress to the greatest possible extent, for example through invitation to the first introductory session, or to specific reporting/debriefing sessions. This is intended to encourage line managers to support their staff during the training, but also support subsequent activities such as those included in the cascading process."}]},{"head":"Cascading","index":10,"paragraphs":[{"index":1,"size":69,"text":"The NEXUS Gains Initiative intends to cascade the learnings and networks created during the WEFE Nexus Leadership Program in Nepal to others working in that space. For this, the participants will be asked to share their learnings with colleagues in their organizations and encourage them to join the WEFE leaders' network; participate in webinars through the network; and give visibility and share information across sectors (e.g., through social media)."},{"index":2,"size":105,"text":"Contingent upon funding, the course can be adapted and scaled out to other NEXUS Gains basins (Indus, Limpopo, and Nile) starting in 2024. Ultimately, the program is expected to expand the WEFE community of practice to the provincial and community levels through its first cohort and their networks, with the aim that the WEFE approach could reach the grassroots level. To this end, an adapted training cycle could be designed and delivered at the province level in an iterative process involving participants from the year one training cycle to strengthen coordination between the federal and the provincial/local levels as well as learning across program cohorts."}]},{"head":"Partnership and potential co-convenors","index":11,"paragraphs":[{"index":1,"size":46,"text":"The Department of Water Resources and Irrigation (DWRI) of the Ministry of Energy, Water Resources, and Irrigation is the key partner of the NEXUS Gains Initiative. The DWRI has assigned a focal point for participating in the design and implementation of the WEFE Nexus Leadership Program."},{"index":2,"size":97,"text":"The Alliance of Bioversity International and CIAT and IWMI will establish a leading partnership with a national institute in Nepal. To ensure the sustainability of the program, this institute will have experience and expertise in nexus science as well as conducting capacity development courses integrating natural resource management, gender issues, and leadership development. The lead partner selected for the WEFE leadership training will convene and coordinate with co-partners for the design and implementation of, and reflection upon, impacts of the programs, and to ensure a suitable balance between technical aspects of nexus sciences and leadership development skills."},{"index":3,"size":119,"text":"The selection of this lead partner will be based on their potential influence amongst WEFE stakeholders and capacity to successfully deliver such a program. Once the first round of training has been completed and the curriculum refined, this lead partner must be able to continue to support the delivery of leadership training for the next generation of leaders at federal, provincial, and local levels beyond the life of the NEXUS Gains Initiative. For this reason, the partner should not be identified solely as a training organization, but also as a strategic partner able and willing to co-develop a suitable program customized to the Nepalese context, taking into account the organizational culture of various government departments in the WEFE sectors."},{"index":4,"size":83,"text":"Using stakeholder mapping, we have identified eight institutions with potential to participate as lead and/or co-lead of the leadership program (see Figure 1). A SWOT analysis of the following six potential partners is presented in Annex 1: Acting together for Governance Resources and the Environment(GREAT) International, Center for Water Resource Studies/Institute of Engineering (CWES/IoE), Regional Community Forestry Training Center (RECOFTC) Nepal, Women Organizing for Change in Natural Resources (WOCAN), Nepal Administrative Staff College (NASC), and the Federation of Community Forestry Users, Nepal (FECOFUN)."},{"index":5,"size":91,"text":"As the SWOT analysis shown in Annex 1 demonstrates, GREAT International is a strong contender for the design and implementation of the leadership courses. Although it is a young organization, its founders are highly respected in the WEFE sectors as well as in development circles. They have also developed extended networks within Nepal as well as within the development partners community. Importantly, the organization has a GESI-focused mindset, and their overall intention is to empower local actors and capitalize on skills and expertise in Nepal to reduce dependency on external actors. "}]},{"head":"Course contents, duration, and session methodology Contents","index":12,"paragraphs":[{"index":1,"size":108,"text":"The courses for the leadership training will comprise both technical and personal skills development (Fig. 2). The technical component will focus on WEFE nexus science, analysis and advocacy skills, tools, and operational strategies. The leadership skills component will focus on agency and leadership challenges, and will include mentorship and peer-to-peer learning, as well as tools and techniques for negotiating, networking, and decision-making, with emphasis on the needs and realities of women professionals in the context of WEFE nexus sectors. Tasks will be assigned after sessions or in between blocks. Guest speakers will be invited according to the planned content of the session. Sessions will be interactive and participatory. "}]},{"head":"Duration","index":13,"paragraphs":[{"index":1,"size":11,"text":"The training will consist of 12 sessions over an eight-month period:"},{"index":2,"size":118,"text":"✓ Conducting the training over an eight-month period in short, frequent sessions will allow participants with a heavy workload to more evenly distribute their efforts and dedicate time to the training. This format was recommended during the scoping study. ✓ A succession of training events will allow for homework-style tasks to be scheduled between events. This will help participants stay focused, and will encourage the testing of small initiatives or experiments to be discussed at subsequent events. ✓ An eight-month duration also fits well within a mentoring approach. It provides time for mentors and mentees to build a strong and nurturing relationship; share knowledge, experiences, and challenges; and support enhancement of leadership skills to strengthen the mentee's career."},{"index":3,"size":28,"text":"Note: careful consideration will be given to the choice of mentors with the understanding that social factors including gender, seniority, and age may negatively impact the mentor-mentee relationship."},{"index":4,"size":28,"text":"Though mentors need to be influential individuals with experience and power, they also need to have the appropriate facilitation and nurturing skills to help their mentee to grow."}]},{"head":"The sessions will be organized in blocks (see diagram 2):","index":14,"paragraphs":[{"index":1,"size":7,"text":"Block 1 (4 hours) will focus on:"},{"index":2,"size":81,"text":"✓ Introducing the program ✓ Conducting the KAP survey, which could include organization related questions in order to establish a baseline ✓ Introducing the WEFE nexus concept and nexus science ✓ Working lunch for participants to socialize and network ✓ Task 1: Small sub-teams of participants who can easily meet outside of trainings (e.g., those working within the same GoN department) would be assigned a small task (Task 1) to complete before the next session, to take place 4 weeks later."},{"index":3,"size":8,"text":"Block 2 (two 3-hour sessions) will focus on:"},{"index":4,"size":76,"text":"✓ Introducing GESI concepts (evolution of concepts -Women in Development (WID), gender, masculinities, social inclusion, gender transformative approaches, intersectionality, gender inclusive workplace) ✓ Analyzing the current status of exclusion and inclusion within the WEFE sectors and their impact on promoting a nexus approach ✓ Task 2: Participants will be asked to keep a journalistic record of evidence of exclusion and marginalization as well as inclusion they witness or encounter during the periods between sessions (Task 2)"},{"index":5,"size":7,"text":"Block (three 3-hour sessions) will focus on:"},{"index":6,"size":149,"text":"✓ Sharing experiences of exclusion and marginalization (between participants as well as through the testimony of an invited guest) ✓ Understanding power, differences in leadership styles of women and men with different social identities, and roles of men in gender equality and their impact on a nexus approach ✓ Analysis of existing organizational policies to understand opportunities and bottlenecks to a gender and socially inclusive workplace ✓ Leadership and transformative leadership: leadership types, negotiation and communication, confidence-building tools, emotional regulation, decision-making tips, and networking; a woman leader will be invited as a guest speaker to share her experience of leadership journey ✓ Task 3: Participants document how they have used newly acquired skills (negotiation, advocacy and communication, emotional regulation, decision-making and networking, etc.) to achieve a goal (personal and/or professional). These reflections will be shared in block 4, with some specific suggestions to strengthen the skills provided as feedback."},{"index":7,"size":7,"text":"Block (three 3-hour sessions) will focus on:"},{"index":8,"size":63,"text":"✓ Self-confidence building, negotiation, advocacy and networking tools and tips ✓ Practical exercise on influencing WEFE concepts in the day-to-day work of leaders ✓ Reflection on the training and learning, and preparation of an action plan. Line managers will be invited to attend and reflect on their potential contributions to the development of the action plan in order to strengthen post-training dissemination activities.  "}]}],"figures":[{"text":"Figure 1 : Figure 1: Potential institutions for convening and co-leadership of the WEFE leadership program "},{"text":"Figure 2 : Figure 2: Tentative training contents (3 consecutive days per block or 2-3 monthly sessions over an eight-month period) "},{"text":"  "},{"text":"  "},{"text":" we need to talk to them and analysis SWOT, as Manohara has put this analysis based on her awareness of the institution Institutions Institutions Institutions Institutions Strength Strength Strength Strength Weakness Weakness Weakness Weakness Opportunity Opportunity Opportunity Opportunity Risk Risk Risk Risk Institutions Institutions Institutions InstitutionsStrength Strength Strength StrengthWeakness Weakness Weakness WeaknessOpportunity Opportunity Opportunity OpportunityRisk Risk Risk Risk research and development ▪ Can co-lead WEFE leadership ▪ Executive Director is highly professionals and leaders to Annex 1: SWOT analysis of the potential partners experience of influence at the and is familiar with CGIAR's collaboration with lead partner work policy level course design and NEXUS Gains Initiative commendable leader in the (either GREAT International or speak up against gender from the NG Initiative for about GESI needed to run quality assurance the course, and could rely research and development ▪ Can co-lead WEFE leadership ▪ Executive Director is highly professionals and leaders to Annex 1: SWOT analysis of the potential partners experience of influence at the and is familiar with CGIAR's collaboration with lead partner work policy level course design and NEXUS Gains Initiative commendable leader in the (either GREAT International or speak up against genderfrom the NG Initiative for about GESI needed to run quality assurance the course, and could rely ✓ Task 4: TBD Block (three 3-hour sessions) ✓ Sharing of experiences in achieving task 4, reflecting on strengths and weaknesses; discussions around potential observed changes ✓ Nexus leadership community of practice, connecting with gender and nexus-champion Institutions Strength Weakness Opportunity ▪ One of the founding members of implementation, especially in ▪ CWRS/IoE could partner with the agriculture sector other actors that we would exclusion and discrimination GREAT International, Kathmandu ▪ Highly credible organization founded by forestry, agriculture, and development experts and policymakers who hold nationally and regionally influential positions in Nepal's policy processes and reputable think tanks ▪ Brings excellent expertise and passion regarding GESI, as well as bottom-up and participatory forestry/natural resource management policy and practices ▪ The firm's organizational mission strives for transformation at people, systems, and institutional levels for achieving equitable development ▪ Currently exploring partnership opportunities with research institutions and development organizations to showcase their capability for ▪ Organization is new ▪ Has not implemented leadership training institutionally, although individual founding members are leaders and are familiar with leadership challenges and measures ▪ Partnering with the organization would be an entry point for exploring opportunities for sustainability and scaling of WEFE leadership courses from the national to the local level, as firm members have the ability to fundraise resources to continue leadership courses targeted at local-level emerging women leaders in the new federal system ▪ One of the organizational founders is a GESI expert in natural resource management (NRM), a female role model policy actor who is an MP in national assembly ▪ Can be a lead partner for the WEFE women leadership course in collaboration with other national partners ▪ Would ensure visibility of the program and its observed impacts throughout the country, as GREAT International has GREAT International is a mentor the WEFE concept session lead partner for the leadership select) in the workplace ▪ Was a partner of CCAFS parliamentarians grassroots and local government leaders ▪ FECOFUN could partner with the lead partner CWRS/IoE ▪ Is a partner of the WEFE curricula development of the NG Initiative ▪ Staff includes influential and reputed scholars of water resources ▪ CWRS/IoE is doing a few research projects, and timely delivery would be a challenge ▪ Limited GESI expertise and participatory action learning experience ▪ CWRS/IoE is working on the WEFE nexus curricula for graduate students, policymakers and practitioners ▪ Institute has technical staff with understanding of WEFE concepts self-confidence of women impact, especially in building ▪ Visible evidence of WAVES' LIBIRD ▪ Reputed agriculture and development NGO in Nepal ▪ Brings expertise on local capacity building, research, and development ▪ Might have limited experience of organizing women's leadership training programs ▪ Technical capacity to run the training could be a limitation ▪ A reputed NGO with ample experience of project implementation in agriculture, forestry, and natural resources management ▪ Can implement the WEFE women's leadership training in leadership in NRM developing women's leadership curricula has specifically focused on customized to develop WEFE ▪ RECOFTC's WAVES initiative ▪ The WAVES course can be grassroots gender leadership and community development in Nepal training including trainings on forestry, forest management, expertise in the field of forestry organization providing NRM trained in community founded to provide technical RECOFTC Nepal ▪ RECOFTC is a long-standing ▪ The NGO has Nepali experts ▪ RECOFTC Nepal is a national NGO women staff and leaders assemblies and federal leadership trainings targeted at sponsor capacity building for contexts the lead partner to one IWMI/AWARD Leadership course and could thus strengthen organizational relationships FECOFUN ▪ Is a partner of NEXUS Gains for capacity building of policymakers around WEFE concepts ▪ A powerful and credible CSO in the forestry sector ▪ Some FECOFUN members and/or community forestry practitioners were elected as local and provincial ▪ Limited human resources dedicated to women's empowerment and GESI outcomes of development in the forestry sector ▪ FECOFUN has a wide network from the local, national, and global levels ▪ Would ensure visibility of the program and its observed impacts throughout the country, as FECOFUN has policy advocacy experience and members partners and the GoN can Nepal and other South Asian engaged as a resource person by ▪ FECOFUN can run future WEFE provided development facilitator is familiar with Nepal ▪ WOCAN's Nepali expert can be throughout the country course NASC 7 ▪ National entity that runs different thematic trainings targeted at civil servants in Nepal ▪ Implements studies and research on collaboration with partners ▪ The WEFE leadership course can be institutionalized in the NASC's training curricula, ▪ No experience of organizing a women's leadership training program ▪ Technical capacity could be a limitation ▪ Potentially low interest to implement a women's leadership training ▪ Organizes gender training targeted at government employees ▪ Only institution in Nepal that designs and implements short courses related to public administration, management, and development staff in the public sector ▪ Could be relevant for later scaling initiative of CGIAR MinErgy ▪ Partner of NEXUS Gains WP3 ▪ Experience is limited to socio-▪ Operates on a service-delivery ▪ Familiar with CGIAR WOCAN ▪ Has its own women's leadership courses (3 and 5 days) ▪ Implements leadership courses based on the need of funding agencies and/or partners ▪ Co-facilitators of WOCAN are Nepali, and the main ▪ International firm based in Washington, D.C. ▪ Limited or no experience of WEFE concept curricula development ▪ Limited flexibility to implement a course over a long time period, as the lead facilitator does not reside in ▪ WOCAN's global presence can support amplification of the WEFE leadership course at the global level ▪ Designing a course that meets the need of the NG Initiative would not take too much time, as WOCAN has expertise on women's leadership training ▪ Experiments with and technical services in the basis, thus has flexibility to mentoring of women training, coaching, and in the development sector based empowerment' about and has experience of GESI ▪ Has experience of 'agency-▪ Managing Director is passionate level actors technologies at the grassroots technology and train field-level powered irrigation (implementation level) ▪ Ability to disseminate new disseminates alternative solar energy sector provide human resource support on a subcontractor Risk ▪ Challenges for time management by the core experts of the leadership training when their demand for services by other sectors is increased (less likely to be a critical issue for 2023) ▪ NEXUS Gains researchers might need to spend relatively more time to develop common understanding of the implementation between NG and the firm in the initial stage ▪ CWRS has a largely biophysical focus; technocratic approaches might dominate in inadequate expertise leadership course ▪ RECOFTC Nepal may have implementing the WEFE WEFE leadership course designing and implementation of the backstopping is needed vacuum for design and ▪ More technical WAVES) will create a leadership training implementation of persons required for lead in the design and to mobilize the resource Bangkok (who was the workforce and networks specialist from RECOFTC ▪ Might have limited ▪ Departure of the GESI process of quality assurance organization course design and from the NG Initiative for an international backstopping is needed a challenge, as WOCAN is ▪ Limited availability of FECOFUN experts who would be involved in the WEFE training design and deliberation. ▪ Lack of experience in designing and implementing women's leadership courses ▪ Might have limited workforce and networks to mobilize the resource persons required for leadership training ▪ More technical ▪ Limited exposure and engagement at the ▪ Potentially high ▪ Sustainability of course is WEFE leadership course implementing a tailored designing and the NG and WOCAN for understanding between establish common transaction costs to policymaking level ✓ Task 4: TBD Block (three 3-hour sessions) ✓ Sharing of experiences in achieving task 4, reflecting on strengths and weaknesses; discussions around potential observed changes ✓ Nexus leadership community of practice, connecting with gender and nexus-champion Institutions Strength Weakness Opportunity ▪ One of the founding members of implementation, especially in ▪ CWRS/IoE could partner with the agriculture sector other actors that we would exclusion and discrimination GREAT International, Kathmandu ▪ Highly credible organization founded by forestry, agriculture, and development experts and policymakers who hold nationally and regionally influential positions in Nepal's policy processes and reputable think tanks ▪ Brings excellent expertise and passion regarding GESI, as well as bottom-up and participatory forestry/natural resource management policy and practices ▪ The firm's organizational mission strives for transformation at people, systems, and institutional levels for achieving equitable development ▪ Currently exploring partnership opportunities with research institutions and development organizations to showcase their capability for ▪ Organization is new ▪ Has not implemented leadership training institutionally, although individual founding members are leaders and are familiar with leadership challenges and measures ▪ Partnering with the organization would be an entry point for exploring opportunities for sustainability and scaling of WEFE leadership courses from the national to the local level, as firm members have the ability to fundraise resources to continue leadership courses targeted at local-level emerging women leaders in the new federal system ▪ One of the organizational founders is a GESI expert in natural resource management (NRM), a female role model policy actor who is an MP in national assembly ▪ Can be a lead partner for the WEFE women leadership course in collaboration with other national partners ▪ Would ensure visibility of the program and its observed impacts throughout the country, as GREAT International has GREAT International is a mentor the WEFE concept session lead partner for the leadership select) in the workplace ▪ Was a partner of CCAFS parliamentarians grassroots and local government leaders ▪ FECOFUN could partner with the lead partner CWRS/IoE ▪ Is a partner of the WEFE curricula development of the NG Initiative ▪ Staff includes influential and reputed scholars of water resources ▪ CWRS/IoE is doing a few research projects, and timely delivery would be a challenge ▪ Limited GESI expertise and participatory action learning experience ▪ CWRS/IoE is working on the WEFE nexus curricula for graduate students, policymakers and practitioners ▪ Institute has technical staff with understanding of WEFE concepts self-confidence of women impact, especially in building ▪ Visible evidence of WAVES' LIBIRD ▪ Reputed agriculture and development NGO in Nepal ▪ Brings expertise on local capacity building, research, and development ▪ Might have limited experience of organizing women's leadership training programs ▪ Technical capacity to run the training could be a limitation ▪ A reputed NGO with ample experience of project implementation in agriculture, forestry, and natural resources management ▪ Can implement the WEFE women's leadership training in leadership in NRM developing women's leadership curricula has specifically focused on customized to develop WEFE ▪ RECOFTC's WAVES initiative ▪ The WAVES course can be grassroots gender leadership and community development in Nepal training including trainings on forestry, forest management, expertise in the field of forestry organization providing NRM trained in community founded to provide technical RECOFTC Nepal ▪ RECOFTC is a long-standing ▪ The NGO has Nepali experts ▪ RECOFTC Nepal is a national NGO women staff and leaders assemblies and federal leadership trainings targeted at sponsor capacity building for contexts the lead partner to one IWMI/AWARD Leadership course and could thus strengthen organizational relationships FECOFUN ▪ Is a partner of NEXUS Gains for capacity building of policymakers around WEFE concepts ▪ A powerful and credible CSO in the forestry sector ▪ Some FECOFUN members and/or community forestry practitioners were elected as local and provincial ▪ Limited human resources dedicated to women's empowerment and GESI outcomes of development in the forestry sector ▪ FECOFUN has a wide network from the local, national, and global levels ▪ Would ensure visibility of the program and its observed impacts throughout the country, as FECOFUN has policy advocacy experience and members partners and the GoN can Nepal and other South Asian engaged as a resource person by ▪ FECOFUN can run future WEFE provided development facilitator is familiar with Nepal ▪ WOCAN's Nepali expert can be throughout the country course NASC 7 ▪ National entity that runs different thematic trainings targeted at civil servants in Nepal ▪ Implements studies and research on collaboration with partners ▪ The WEFE leadership course can be institutionalized in the NASC's training curricula, ▪ No experience of organizing a women's leadership training program ▪ Technical capacity could be a limitation ▪ Potentially low interest to implement a women's leadership training ▪ Organizes gender training targeted at government employees ▪ Only institution in Nepal that designs and implements short courses related to public administration, management, and development staff in the public sector ▪ Could be relevant for later scaling initiative of CGIAR MinErgy ▪ Partner of NEXUS Gains WP3 ▪ Experience is limited to socio-▪ Operates on a service-delivery ▪ Familiar with CGIAR WOCAN ▪ Has its own women's leadership courses (3 and 5 days) ▪ Implements leadership courses based on the need of funding agencies and/or partners ▪ Co-facilitators of WOCAN are Nepali, and the main ▪ International firm based in Washington, D.C. ▪ Limited or no experience of WEFE concept curricula development ▪ Limited flexibility to implement a course over a long time period, as the lead facilitator does not reside in ▪ WOCAN's global presence can support amplification of the WEFE leadership course at the global level ▪ Designing a course that meets the need of the NG Initiative would not take too much time, as WOCAN has expertise on women's leadership training ▪ Experiments with and technical services in the basis, thus has flexibility to mentoring of women training, coaching, and in the development sector based empowerment' about and has experience of GESI ▪ Has experience of 'agency-▪ Managing Director is passionate level actors technologies at the grassroots technology and train field-level powered irrigation (implementation level) ▪ Ability to disseminate new disseminates alternative solar energy sector provide human resource supporton a subcontractor Risk ▪ Challenges for time management by the core experts of the leadership training when their demand for services by other sectors is increased (less likely to be a critical issue for 2023) ▪ NEXUS Gains researchers might need to spend relatively more time to develop common understanding of the implementation between NG and the firm in the initial stage ▪ CWRS has a largely biophysical focus; technocratic approaches might dominate in inadequate expertise leadership course ▪ RECOFTC Nepal may have implementing the WEFE WEFE leadership course designing and implementation of the backstopping is needed vacuum for design and ▪ More technical WAVES) will create a leadership training implementation of persons required for lead in the design and to mobilize the resource Bangkok (who was the workforce and networks specialist from RECOFTC ▪ Might have limited ▪ Departure of the GESI process of quality assurance organization course design and from the NG Initiative for an international backstopping is needed a challenge, as WOCAN is ▪ Limited availability of FECOFUN experts who would be involved in the WEFE training design and deliberation. ▪ Lack of experience in designing and implementing women's leadership courses ▪ Might have limited workforce and networks to mobilize the resource persons required for leadership training ▪ More technical ▪ Limited exposure and engagement at the ▪ Potentially high ▪ Sustainability of course is WEFE leadership course implementing a tailored designing and the NG and WOCAN for understanding between establish common transaction costs to policymaking level researchers and leaders, setting up a network    researchers and leaders, setting up a network ✓ Evaluation/reflection of learning and skills development among participants; moving ahead  ✓ Evaluation/reflection of learning and skills development among participants; moving ahead and next steps    and next steps  "}],"sieverID":"0c39152a-b8a3-4a30-90ae-82c3353dfdf4","abstract":""}

data/part_5/05d8700db138fb07a8fb618bfc43e0f7.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05d8700db138fb07a8fb618bfc43e0f7","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9c6ef7fb-b2f1-4360-98f3-571c5deb9a44/retrieve"},"pageCount":18,"title":"The contestations of diversity, culture and commercialization: why tissue culture technology alone cannot solve the banana Xanthomonas wilt problem in central Uganda","keywords":["Banana tissue culture planting material","Cultural values","Diversity","Banana Xanthomonas Wilt (BXW)","Technology uptake"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":231,"text":"Banana (Musa spp.) is a staple and cash crop in the East African region with over 30 million people depending on the crop for food and income (Dotto et al. 2019). The crop highly nutritious, providing a good source of carbohydrates, vitamins (A, B 1 , B 2 , B 6 , and C), minerals (potassium, iron, zinc, calcium, phosphorous, magnesium and selenium), polyphenols, resistant starch, and antioxidants (Hardisson et al. 2001;Haslinda et al. 2009). Banana is a major staple for more than a half of Uganda's population. The average national per capita annual consumption of bananas is estimated at close to 1 kg per person per day, the highest in the world (Edmeades et al. 2015). The crop occupies the largest cultivated area (about 30% of cropland) on plots of less than 0.5 ha (Ngambeki et al. 2003;Edmeades et al. 2015). Banana cultivation in Uganda is dominated by the locally evolved clones known as the East African Highland bananas (EAHB) (Gold et al. 2002), which include the harder green cooking bananas locally called \"matooke\". Matooke is the leading staple food with an annual production of over 6 million tonnes (Kilwinger et al. 2019). The crop also provides a wide range of products (animal feeds, charcoal briquettes, crafts, and construction materials) which significantly contribute to food and income security of the populace and consequently to national development (Kikulwe et al. 2018)."},{"index":2,"size":194,"text":"Banana Xanthomonas Wilt (BXW) disease, caused by the bacterium Xanthomonas campestris pv. musacearum, is currently an important threat to banana production in East and Central Africa (Kikulwe et al. 2019). The disease can cause up to 100% yield loss where highly susceptible genotypes dominate the farming systems, severely compromising food security and livelihoods for banana-based farming households (Kubiriba et al. 2012;Cori et al. 2018). This disease has no cure and has been a main reason for poor yields since its emergence in the African Great Lakes (AGL) region in 2001 (Tushemereirwe et al. 2004;Kubiriba and Tushemereirwe 2014). In Uganda, the disease was first reported in Mukono District, Central Uganda in 2001 (Tushemereirwe et al. 2004) and by 2005 it had rapidly spread to South Western Uganda, the major banana producing areas. Between 2002Between -2005, the disease caused a cumulative economic loss of 61.1 million dollars by the country, mainly affecting EAHB, 'Matooke' (AAA-EAHB genome) and the 'Kayinja' beer banana (ABB genome) (Tushemereirwe et al. 2009). According to McCampbell et al. 2018, the disease is also of prominent importance in neighboring banana producing countries, namely: Burundi, Kenya, the Democratic Republic of Congo, Rwanda, and Tanzania."},{"index":3,"size":100,"text":"The causative bacterium Xanthomonas campestris pv. musacearum is highly transmissible mainly through infected plant material, contaminated farm tools and soil, trade of banana and its products, and occasionally through vectors such as insects, birds, and bats (Blomme et al. 2014;Ocimati et al. 2019) (Fig. 1). The mode of spread varies significantly based on the production system, agroecology and cultivars grown. All cultivars grown in the Great Lakes region of Eastern Africa are susceptible, and no source of resistance has been identified (Kalyebara et al. 2007;Tripathi et al. 2009;Kubiriba and Tushemereirwe 2014). Figure 1 illustrates the transmission pathways of the bacterium."},{"index":4,"size":208,"text":"Over the past 16 years, various research and extension efforts at global, national and local echelons have converged to manage and contain the disease (Ocimati et al. 2019;Gotor et al. 2020). Epidemiology studies of BXW (e.g., see Blomme et al. 2005Blomme et al. , 2017;;Kubiriba et al. 2012;Nakato et al. 2015;Ocimati et al. 2015) informed control strategies including farmers sensitization and development and enforcement of bylaws for control of the disease (Kubiriba et al. 2012;Blomme et al. 2014). These efforts, however, have not been effective for landscape-wide control of BXW. Once the disease is established, its eradication has proved difficult (Eden-Green, 2004;Ocimati et al. 2019) due to inappropriate recommendations for agronomic and/or technical practices 1 (Karamura et al. 2008). Some farmers do not adhere to these recommendations due to the associated high labor cost and perceptions about the management practices (Jogo et al. 2013;Uwamahoro et al. 2019). Farmers are usually reluctant to employ labor-intensive and costly disease control measures (Namukwaya et al. 2011). These practices require regular monitoring, adding to the labor and time burden for the farmer. This compromises BXW eradication, resulting in farmers' reluctance to apply the recommended practices. Consequently, systematic application of such control practices is frequently done in large-sized households (Mbabazi et al. 2021)."},{"index":5,"size":176,"text":"Establishing banana plantations with clean (pathogenfree) seed 2 is the most effective way to manage the BXW (Also see Thomas-Sharma et al. 2016). This has led to popularization of Tissue Cultured (TC) plant material as a response strategy to supply disease-free seed and enhance productivity (Dubois et al. 2013;Mulugo et al. 2020). In this aspect, TC banana epitomizes many of the principles of the New Green Revolution of Africa 3 (Vercillo et al. 2015;Schnurr 2019). It is a form of micro-propagation that allows for replicating, regenerating, and rapid/y disseminating planting materials that are genetically identical and disease free (Kikulwe, 2016). Tissue Culture encapsulates a new paradigm of agricultural development efforts, in which its promoters have stepped in to address crop productivity failure by investing in the technology to manage and contain crop diseases whilst expanding farmers' livelihood opportunities, especially amongst vegetatively-propagated crops such as banana (Schnurr 2019). Therefore, adoption of TC seed has been collaboratively promoted by the Ministry of Agriculture Animal Industries and Fisheries, National Agricultural Research Institutes, CGIAR centers and private institutions (Mulugo 2021)."},{"index":6,"size":318,"text":"However, the penetration of TC banana planting materials is reportedly low-only 7% of national plantings (Dubois et al. 2013), with reported highest levels (19.3%) in the western region (Mmurongo et al. 2018). Reluctance by farmers to take up TC planting materials has to-date been explained by economic factors namely: access and high cost of plantlets, labor costs and input requirements (Kabunga et al.2012;Njau et al. 2011). Without discounting the importance of these factors, they do not sufficiently embed banana cultivation in the cultural values and practices of central Uganda built on cultivar diversity. The economic perspective alone for example, cannot adequately explain the low uptake of TC planting materials among commercially-oriented farmers whose aim is supposedly to maximize productivity. In central Uganda, bananas are not only a commercial food crop, but also a cultural artefact. Values and cultural attachments to specific banana cultivars construct a contextual setting around the banana production system in Central Uganda that needs to be considered while assessing uptake of TC planting materials. In other circumstances, it has been shown that uptake of agricultural innovations in farming systems is influenced by cultural values (Warren et al. 2016), that are deeply ingrained in societal norms, belief systems, behavioral patterns and the way of life (Idang 2015). Whereas promotion of TC planting materials has focused on supplying a few commercial cultivars that can offset the labor and input costs, these cultivars do not meet the diverse cultural interests of farmers in central Uganda. Literature shows that though there are several drivers of TC technology adoption including economic, climatic and agronomic, there is scant emphasis on cultural aspects that may influence uptake of the technology. This study therefore contributes to the known literature by assessing the cultural context/dimension influencing uptake of TC technology using TC banana. We unravel critical cultural aspects of relevance in the enhancement, use and acceptance of TC technology by farmers in central Uganda."}]},{"head":"Methodology","index":2,"paragraphs":[]},{"head":"Study area","index":3,"paragraphs":[{"index":1,"size":206,"text":"The study was conducted in central Uganda where banana production is anchored in cultural values and practices beyond food and income. Bananas have been grown for centuries in central Uganda (Lwandasa et al. 2014) then spreading to Western and South-western Uganda largely as a commercial crop. It is estimated that about 58% of agricultural households in central Uganda grow bananas (Uganda Census of Agriculture 2010) for multiple purposes. The study was carried out in Luwero and Mukono districts, where TC banana seed has been promoted by the International Institute of Tropical Agriculture (IITA), Bioversity International 4 and private institutions (e.g. Agro-Genetic Technologies Limited, Biocrops Uganda Limited) for more than a decade. Despite this the region still continues to experience high BXW prevalence (Ocimati et al. 2015). The two districts pioneered community-based TC banana nurseries to facilitate farmer access to TC seed. The community nurseries were linked to TC laboratories that supplied the materials. Villages that hosted community nurseries were targeted on assumption that proximity enhances access to and hence uptake of TC banana plantlets. Nambi and Gonve villages in Luwero and Mukono districts respectively were the study sites (Fig. 2). The two were the pioneer villages where community TC nurseries and TC demonstration gardens were established."}]},{"head":"Research Design and data collection","index":4,"paragraphs":[{"index":1,"size":55,"text":"A qualitative study design was developed to better understand the cultural values, traditions, beliefs and practices associated with banana cultivation in the study communities. The purpose of this study is to go beyond commercial, economic and agronomic aspects such as cost of plantlets, and begin to understand how farmers think and understand what they do."},{"index":2,"size":203,"text":"Focus Group Discussions (FGDs) and key informants' interviews were used to collect data between August 2016 and February 2017. Village leaders (Local Council I [LC 1] Chairpersons) provided a list of farmers who had accessed TC banana seed. Farmers who had not accessed TC planting materials were excluded from the study as they were presumed not to have experience with the materials. From the list for each village, the village leaders helped identify 32 farmers (16 male and 16 female) who could participate in the FGDs and transmit their experiences. FGDs were conducted in each village guided by a checklist (attached) separately for male and female farmers. Gender segregation was necessary to allow freedom of expression (Braga 2001). For effective discussion and involvement of all FGD participants, two FGDs for male and female farmers were conducted each FGD involving eight farmers as summarized in Table 1. The intention was to generate diverse cultural practices, beliefs and values from the perspectives of male and female farmers. Farmers were also questioned to determine whether or not they had observed any differences between using TC seed and banana suckers. Farmer responses were noted based on their consensus about the expressed views, explanations, attributes, ideas or reasons."},{"index":3,"size":87,"text":"Based on the interactions of the researchers with farmers during FGDs, ten key informants (4 male and 6 female banana farmers from both villages) were identified (based on their wealth of knowledge and ability to articulate issues) for follow-up to obtain more in-depth information and clarification on the cultural practices and rituals performed associated  with different banana varieties. The interviews were conducted in the local language (Luganda) and recorded using a digital recorder for accurate capture of the narratives. Photographs illustrating cultural practices were taken for visualization."}]},{"head":"Data analysis","index":5,"paragraphs":[{"index":1,"size":109,"text":"The narratives were translated from Luganda to English and transcribed for analysis. Thematic-content analysis as described by Braun and Clarke (2006) was applied. Specifically, (i) chunks of data with similar information were clustered; (ii) initial codes for each chunk of data generated using the inductive coding approach (Chandra and Shang 2019); and lastly, (iii) themes were synthesized, reviewed, described and named. A thematic network (Fig. 3) was drawn to illustrate the relationships between, and interrelatedness of the themes developed. The works of Karamura et al. (2012) andHamilton et al. (2016) were used to categorize the banana cultivars found in the study communities (by clone sets, genomes and genome groups)."}]},{"head":"Results and discussion","index":6,"paragraphs":[{"index":1,"size":41,"text":"Three themes emerged regarding the major uses of banana in central Uganda: Banana as food; Banana as a cultural artefact; and Banana as medicine (Fig. 3). The uses are inter-related though specific cultivars are associated with or preferred for each use."}]},{"head":"Banana cultivars and their cultural uses","index":7,"paragraphs":[{"index":1,"size":16,"text":"Forty-five banana cultivars were found to be grown by farmers in the two villages studied ( "}]},{"head":"Taboos Rituals","index":8,"paragraphs":[{"index":1,"size":258,"text":"Fig. 3 Thematic map of uses of bananas in the Baganda culture known as matooke; dessert banana-eaten when ripe; brewing banana for making local beer known as tonto, and roasting banana. Most of these belong to the East African Highland genome group (AAA-EA), which according to Karamura et al. (2012) are grouped into five major clone sets namely: Musakala, Nakitembe, Mbidde, Nfuuka, and Nakabululu-each one with unique characteristic attributes. The cooking-type group has the highest diversity in respect to cultivars than the other groups. Cultivars for brewing have high tannin content and astringent fruit (Hamilton et al. 2016). In addition to the economic use (food, or brewing), the cultivars have multiple cultural uses that compel a single farmer to grow several cultivars in the same plantation. Table 2 presents the cultivars found in the study area and those that were available through TC. It is noted that the cultivars supplied through TC represent only a very small proportion of the cultivars that farmers currently grow. Farmers make choices of cultivars planted to meet their diverse uses including the cultural values. This implies that even farmers who choose to grow the cultivars supplied through TC also grow other cultivars (in the same plantation) to include a range of banana uses. This practice encourages cross-infection thereby defeating the intention of controlling BXW using TC technology. We discuss how the different uses of banana are embedded in the culture and traditional practices of the Baganda with a view of elucidating how the TC planting materials may be ineffective in controlling BXW."}]},{"head":"Banana cultivars as food","index":9,"paragraphs":[{"index":1,"size":213,"text":"As food, bananas are consumed in different forms; as matooke, 5 roasted (plantain), dessert, juice/traditional beer. Among the cooking varieties, farmers may prefer specific ones for their own consumption while others are grown for the market (also see Bagamba et al. 2006;Kitanishi et al. 2018). Those for family consumption may not be high yielding but are preferred for their taste, color (yellowish) and texture (soft). Food in the cultural context wields power to bring joy and happiness to the consumer (Lee 2011). Culinary practices in Uganda call for different kinds of banana for different kinds of dishes/beverages that bring pleasure or good taste. However, the matooke Cultivars introduced under TC (Mpologoma, FHIA-01 and FHIA-17) were reported to have undesirable color (whitish) when cooked, with no aroma and a 'flat' taste. This finding is in tandem with Kikulwe et al. (2011) who found out that consumers in Uganda are willing to purchase genetically modified (GM) banana cultivars only if they contain tangible benefits, such as agronomic, nutritional and taste traits. Similarly, according to Schnurr et al. (2020), if banana cultivars targeted for biofortification to address vitamin A deficiency in children under five and lactating mothers in Uganda are not the preferred traditional varieties, such biofortified cultivars are less likely to be adopted by consumers."},{"index":2,"size":240,"text":"For some cultural events like traditional marriage ceremonies known as 'kwanjula', the specific cultivar (Nakitembe) is used to prepare a special meal for the groom's family and/or presented as gift to the bride's family. Its stem and leaves also possess medicinal properties useful for treating menstrual pains and infants' skin diseases (ekyogero). Out of the seven cultivars that constitute the Nakitembe clone-set for example, only one cultivar was supplied through TC. This constrains the diversity of cultivars within a particular clone-set that is used for several cultural functions. It is noted that cultivars supplied through TC were based on commercial considerations (bunch and finger size) focusing on the market value and household income (also see Bagamba et al. 2006;Kitanishi et al. 2018) and inadequate attention was paid to cultural significance. In Central Uganda, farmers choose cultivars not only for food and income but also the cultural practices among the Baganda. Even for food, not all commercial cultivars would be preferred for household consumption. The available TC planting materials do not provide a wide range of choices to serve farmers' diverse uses and preferences. For example, one of the farmers in an FGD in Luweero District stated: Not all cooking-type cultivars make good matooke. Some cultivars are better and as a farmer who has a choice, I would prefer matooke from specific cultivars like Nakitembe, Mukubyakonde, Muziranyama and Nakawere even though these may not be the best commercial varieties (October, 2016)."},{"index":3,"size":111,"text":"Other cooking cultivars have special cultural significance. For example, the Ndibwabalangira literally by its name implies, it is best for royalty-meaning it has attributes that only royalty merits. Another variety, Nakawere by its name implies it is best for mothers that have just given birth, probably due to its nutritional value. Atwalirannyina's name implies that the cultivar is the best gift one can give to their mother because of its taste, large finger and bunch size. Banana cultivars also symbolize social status and therefore focusing solely on commercial value in selecting TC-produced cultivars will also encourage growing local cultivars infected with BXW alongside the TC varieties, thus compromising overall BXW control."},{"index":4,"size":136,"text":"Traditional beer (omwenge omuganda-tonto, akaliga, kwete, omusetulo and enguli) is central and used at all cultural and social functions whether it is a celebration or funeral or other cultural ceremonies. Brewing banana cultivars are also used to produce juice (omubisi). None of the traditional brewing cultivars were supplied through TC, instead new hybrid cultivars (FHIA-25 and KM5) were provided, to which farmers are unaccustomed. The scientific explanation was that the local brewing cultivars are highly susceptible to BXW (Adikini et al. 2013;Tripathi et al. 2009) but at the same time farmers claim new cultivars have low sugar content and do not make good quality beer. It is not possible for farmers to abandon such an important cultural value and will continue to plant their local cultivars even though this practice favors cross-infection and hence BXW spread."},{"index":5,"size":261,"text":"Though in varying proportions, all farmers grow a wide range of cultivars in the same plantation to meet both their 5 Matooke is prepared by peeling green fingers of a mature bunch. They are wrapped in banana leaves, steamed, and mashed. Different varieties present different taste, flavour, colour, texture and aroma. economic and socio-cultural interests (Gold et al. 2002;Karamura et al. 2012). Specific to the central region, banana plantations are at times split into part for the male and part for the female household members-the former producing mainly for the market and the latter for home consumption and including cultural uses (Karamura et al. 2004). In these two parts, the cultivars may be different. Diversity is also desirable for food security and sustainability of the food system (Bioversity International 2017). Nonetheless, it is difficult to maintain this diversity with TC due to high cost of propagation and yet some cultivars may not be in sufficiently high demand to be economically viable for any TC business. Our findings are consistent with previous studies (Kabunga et al. 2012;Mmurongo et al. 2018) postulating cultural values, higher labor and input requirements as key barriers to TC use. However, these findings notably diverge with Mukasa (2018) who associates limited uptake of innovations in Tanzania and Uganda with long distances-limiting farmer accessibility to agricultural technologies. This study is nested in a specific cultural context and cannot be generalized, the same way that other studies need not overgeneralize. Effective BXW management and promotion of TC technology require context-specific considerations cially for communities where banana is a traditional crop."},{"index":6,"size":310,"text":"Additionally, in our study men preferred growing high yielding cultivars with big fingers and bunches (e.g., Mpologoma, Musakala, Kisansa) for the market, which are mainly promoted through TC. However, women preferred cultivars that yield multiple bunches (e.g., Nakabululu, Nakabinyi, Mukubyakonde) continuously throughout the year (Plate 1). These cultivars produce small-to mediumsized bunches with perceived good taste (in relation to flavor, color, texture and aroma), but there are hardly available through TC. A possible explanation for men's interest in high-yielding cultivars is that men traditionally control household finances (e.g. for education, healthcare, and investments) while women customarily ensure their household food security, a key cultural role especially in central Uganda (Sanya et al. 2020). Results also showed that women prefer traditional cultivars with soft leaves (e.g., Kayinja, Bogoya, Ndizi) important for steaming food and preparing traditional dishes locally known as mpombo (see Plates 2 and 3). Leaves of introduced TC cultivars such as FHIA 17 were mentioned to be very large and brittle, seldom used during traditional ceremonies like burial ceremonies and last funeral rites when large amounts of matooke are prepared. In such situations, the large leaves are the final wrapping material to cover the huge mounds of food. In terms of division of labour in banana production in central Uganda, men mostly perform labour-intensive activities such as digging holes, removal of unwanted suckers, stump removal, harvesting for the market and transportation of large bunches. The women carry out activities requiring less physical strength such as weeding, removal of old leaves and fibres and harvesting bunches for food. Our findings resonate with Rietveld et al. (2016) whose results show different roles of men and women among banana-producing households in South Western Uganda. To foster uptake of TC banana, especially among women, it is imperative that promoters of TC technology factor in cultivar diversity and womenpreferred attributes in their promotion campaigns."},{"index":7,"size":26,"text":"In comparison of performance between TC seed and suckers, farmers had perceptions that tended to disadvantage the use of TC seed as outlined in Fig. 4."},{"index":8,"size":203,"text":"From their own experience, farmers observed that any new cultivar supplied through TC required more intensive management including greater use of fertilizers/manure, mulching and water availability than in the traditional system. It is noted that since these are largely selected for high yields, their crop nutrient requirements are also higher for optimum performance. If managed the same way as the local varieties, they may yield even less than the local varieties. This increases management costs in addition to the high seed cost. In this perspective, TC plantlets are considered to offer no relative advantage, complicated to grow, and require changes in practices which have to be accompanied by new management information. Some farmers who planted TC seed complained about not being able to precisely identify the cultivars before planting unlike for the suckers. It is possible that plantlets are mixed up in the nursery or mislabeled and the farmer may only realize after a long time. Bananas being a perennial crop, farmers have to bear with the undesired effects for several years. This complexity exists not only at the farm level, but also across in the entire seed system, posing a greater risk where a farmer may have mistakenly planted an unintended variety."},{"index":9,"size":11,"text":"One of the farmers expressed disappointment with TC materials as follows:"},{"index":10,"size":45,"text":"These are the kind of 'plants' (referring to TC) that can be easily identified from your plantation due to poor growth characteristics, in spite of the fertilizers, labor, capital and time you spend on them. They simply 'refuse' to grow! (FGD Mukono District November 2016)."},{"index":11,"size":36,"text":"It is also possible that such disappointment could be due other factors such as weevil damage (also see Robinson 1996) and therefore a package of knowledge and management practices is required to effectively grow TC bananas."},{"index":12,"size":23,"text":"Additionally, farmers indicated TC seed established plantations did not last as long as those planted with suckers. In the words of one farmer:"},{"index":13,"size":69,"text":"We got fifteen (15) free TC plantlets and a bag of manure each to establish a demo TC plantation. We were also encouraged to plant 10 local banana cultivars alongside the TC plants for comparison. However, due to prolonged dry spells we experienced in the recent past, currently, all the TC plants wilted and dried but the 10 local cultivars survived and still exist. (FGD Mukono district, November 2016)."},{"index":14,"size":165,"text":"This may be attributable to challenges in the tissue culture micro propagation process related to somaclonal variations (Damasco et al. 1996), poor physiology (George 1996) and the lack of soil micro-biota. As established by Nowak (1998), these factors can render the performance of TC seed to be poor, especially under environmental stress. It is also argued that the survival of TC seed at establishment may be hampered by climatic stress since plantlets are devoid of food reserves (Kavoo-Mwangi et al. 2014). Besides, the performance of commercial cultivars (big bunches and big fingers) as is the case with newly introduced TC seed requires higher soil fertility to sustain their production. Nevertheless, the soils in the central region have for various reasons considerably deteriorated in fertility (Zake et al. 2000;Nyombi 2013) which can contribute to a shorter survival period of TC-established plantations. In such aspects, there is lack of demonstrated relative advantages that TC seed has over suckers to convince farmers to take up TC planting materials."}]},{"head":"Banana as a cultural artefact","index":10,"paragraphs":[{"index":1,"size":57,"text":"Specific banana cultivars were used for different cultural practices. The banana in this case is not just a crop but also a cultural artefact. Propagation of TC planting materials would therefore have to accommodate the cultural use of banana and supply essential varieties. Table 3 presents the cultural uses of five different banana cultivars in central Uganda."},{"index":2,"size":38,"text":"These cultural practices are performed at household level, thereby requiring every household to have these varieties. Such cultivars are not among those supplied through TC because they are not of commercial value. A farmer in Nambi village emphasized:"},{"index":3,"size":24,"text":"It is almost mandatory that in every household, each banana plantation will have cultivars such as Nakitembe, Embidde enganda and even Gonja. (October 2016)."},{"index":4,"size":129,"text":"These cultivars are used in several cultural practices related to child-birth ceremonies, marriage ceremonies, funerals and funeral rites. Even with current modernization, it is common for women to give birth at home or within the community. Traditionally, when a mother gives birth at home, the placentas are not thrown away as they are symbolic to the new-born child. For example, if a baby girl is borne, the placenta is wrapped in cloth by family and/or clan members and placed in a mat of Nakitembe cultivars (Plate 1). For a baby boy, the placenta is placed in a mat of Embidde enganda or Kayinja varieties. It is then covered with herbs-'bombo' [Mormodica foetida Schum.] and 'lweza' [Aerva lanata (L.) Juss. ex Schult.] that connote peace and blessings upon the newborn."},{"index":5,"size":90,"text":"The Gonja cultivar is used in cleansing ceremonies and restoring peace and harmonious relationships in families or in practices for reconciling individuals and families. Literally translated, Gonja, means 'soften' implying that when people share Gonja in a peace-making ceremony, the parties involved soften and become more tolerant of each other. The leaves of Kayinja, Ndiizi and Bogoya are preferred for preparing a special sauce (luwombo) or matooke before they are steamed. In particular, luwombo is special way of preparing sauce for respectable guests such as inlaws (Plate 2 and 3)."}]},{"head":"Beliefs associated with bananas","index":11,"paragraphs":[{"index":1,"size":209,"text":"Farmer beliefs associated with banana cultivars (Table 4) guide farmers' use and cultural connections with the cultivars that they grow. These relate to taboos and norms that are strongly held and observed in relation to some banana varieties. For example, in one of the FGDs in Mukono district the TC nursery operator specified: Some time ago I had the Gonja cultivar among the TC planting materials and that season, my sales were very low. A community member advised that my sales were very low because of the bad luck associ- Disposal of placentas of newborn baby boys Cleaning of the dead (males) before burial. Mid rib of pseudo stems crushed and used by relatives to 'wash' the deceased's face Herbal bath 'Ekyogero' for male babies Leaves used for herbal baths of bridegrooms Kayinja Used in practices to divert rains. A stick is pierced through a banana finger and roasted in a fireplace ('Ekyoto') Used in practices for celebrating last funeral rites and burial ceremonies. Dry leaves 'essanja' laid on the ground and the casket is placed on it. The dry leaves are also used to make huts for household members and guests at the last funeral rites Gonja Used in cleansing ceremonies. Believed to cleanse curses and bad omen "}]},{"head":"Nakabinyi","index":12,"paragraphs":[{"index":1,"size":52,"text":"Banana bunches not fit to be given as gifts to in-laws since shape of male bud elongates in the semblance of a male human reproductive organ Mbwazirume Believed to 'change' to Nakitembe (losing the reddish color of the mid ribs of its banana leaves) if its leaves are used in food preparation"}]},{"head":"Siira","index":13,"paragraphs":[{"index":1,"size":34,"text":"Transforms to Nfuuka cultivar if leaves are used in food preparation Embidde enganda (Kabula & Nsowe) Believed to be the 'husband' of a plantation. The first cultivar planted in the middle of a plantation"}]},{"head":"Embidde (Kabula & Nsowe)& Kayinja","index":14,"paragraphs":[{"index":1,"size":33,"text":"Considered 'male' varieties Nfuuka Changes to another cultivar if knife used to cut animal meat is used to cut the leaves Nakitembe Embidde enganda/Kayinja Bestow blessings to infants when used for herbal baths"}]},{"head":"Tissue culture banana varieties","index":15,"paragraphs":[{"index":1,"size":47,"text":"Hybrids which have been modified from their original form and even some farmers have perceptions that they are GMOs ated with the Gonja cultivar and he cautioned that I get rid of them. When I did as advised, my sales went higher the next season. (November, 2016)."},{"index":2,"size":150,"text":"This finding implies that some cultivars such as Gonja are associated with bad luck and are not commonly grown in the region or where grown, caution is taken. For instance, it is believed that farmers have higher chances of experiencing lightning if they plant Gonja around their homesteads. As such, in homesteads where it is grown (most especially for use in performance of particular rituals), only a few mats are planted and precisely on the peripheries of plantations. Additionally, even buyers are keen not to carry Gonja among other bananas and to minimize on this effect, a finger of Gonja is placed under the vehicle wheel so that it is crushed prior to transportation. Unless going for burial, caution is taken by farmers not to consume Gonja or have anything to do with this cultivar as it is believed any anticipated success for the day will ultimately turn to failure."},{"index":3,"size":53,"text":"Similarly, some banana cultivars are believed to 'transform' to other cultivars when specific norms are evaded. For example, Nambi is believed to change to Nakitembe when its banana leaves are used for cooking food. However, this is indicative of such cultivars belonging to the Nfuuka clone set (characterized by high susceptibility to morphological "}]},{"head":"Skin diseases and epilepsy","index":16,"paragraphs":[{"index":1,"size":145,"text":"Plate 1 A placenta wrapped in cloth and placed in shallow hole between two 'Nakitembe' pseudo stems change) (Karamura et al. 2012) and not necessarily because particular norms have been evaded. Banana cultivars are known to present superficial expressions of morphological traits which are often not stable and some cultivars as well show different phenotypic expressions under different ecological conditions (also see Karamura and Karamura 1994;Karamura 1999). It is also believed by farmers in the study communities that the TC planting materials are 'hybrids' meaning that such a cultivar has been modified from its original form; implying that such cultivars are not suitable for performing cultural functions and rituals. This points to farmers' perceived incompatibility of TC banana planting materials with their socio-cultural identity, which acts a significant barrier to using the technology in the study communities since tradition as a cultural value is compromised."},{"index":2,"size":50,"text":"On the contrary, TC-established cultivars are genetically similar with the original (local) cultivars from which they are cloned (Hrahsel and Thangjam 2013). The hesitation to take on TC planting materials is therefore partly attributed to inadequate information and understanding of processes of TC propagation on the part of the farmers."}]},{"head":"Banana as medicine","index":17,"paragraphs":[{"index":1,"size":186,"text":"Some banana cultivars are also used as medicine in the Baganda culture. Table 5 illustrates how these cultivars are used to treat various ailments. For instance, epilepsy in infants is treated through a ritual where the infant is bathed from a Mbidde mat. Whereas neither fire nor hot water are used, the leaves of the cultivar Mbidde should appear 'burnt/ scotched' after the ritual-a sign that the epileptic 'demon' is gone and if it does not, the child is not healed, and the procedure has to be repeated. On the contrary, piles in males is treated by placing a patient up on Mbidde's pseudostem (for females a Nakitembe pseudo stem is used) that has not flowered. S/he faces in the sun's direction and is gently lowered every morning and evening. It is believed that by the time the banana plant flowers, s/he will have healed. However, farmers indicated that TC cultivars do not harbor desirable traditional characteristics important for treatment/management of ailments. For example, a farmer expressed: …Those TCs are not our own, they are 'adulterated' and cannot be used for our traditional medicine… (October 2016)."},{"index":2,"size":2,"text":"Another explained:"},{"index":3,"size":34,"text":".. TCs lack traditional characteristics and we cannot use them for medicinal purposes. They make a swordlike corm beneath the mat rather than a semi-flat base that culturally is not acceptable … (October 2016)."},{"index":4,"size":155,"text":"Worldwide, cultural systems recognize health and wellbeing of individuals' as being complex, combining spiritual and physical dimensions (Bodeker 1989;Fisher 2011). It is believed that both dimensions have to be harmoniously developed for the total well-being of an individual. In accordance with our findings, studies (Shibre et al. 2008;Degonda and Scheidegger 2012;Sorketti et al. 2013) have documented positive outcomes from traditional medicine in sub-Saharan Africa, a factor which could explain the popularity attributed to the treatment. Traditional medicine is often preferred over western medicine, being viewed as a culturally meaningful approach, easily accessible, affordable and at times given free (Degonda and Scheidegger 2012). In Uganda, estimates indicate that the ratio of traditional medicine practitioners to the population is 1:700, significantly contrasting with available trained medical personnel for whom the ratio is 1:8547 (Kasilo et al. 2010;Akol et al. 2018). These statistics point to the crucial role that traditional medicine still plays in the Ugandan health system."},{"index":5,"size":101,"text":"Nevertheless, as indicated above and earlier (Table 4), farmers' beliefs that TC materials are genetically modified (or hybrids) was mentioned to be an impediment to farmer use of banana cultivars generated from TC as medicinethey are not trusted for potency of their medicinal properties. Elsewhere, authors (Mcrobert and Rickards 2010;Jha et al. 2020) have shown that farmers' beliefs and opinions are at the center in their decision-making regarding uptake of agricultural technologies. For this reason, farmers in the study communities will continue to plant their local materials even alongside the TC seed, and thereby sustaining the risk of BXW through cross-contamination."}]},{"head":"Conclusion and implications","index":18,"paragraphs":[{"index":1,"size":227,"text":"This study highlights how culture and traditions may constrain uptake and effectiveness of TC banana planting materials as a strategy for controlling BXW in central Uganda and in the context of the Baganda culture. Findings indicate that farming is indeed 'agri-culture', not merely economic or scientific. Culture is integral to agriculture and has to be considered in all agricultural technologies. The cultural uses of banana in central Uganda are anchored in diversity of cultivars where different cultivars are used for specific cultural practices, and yet TC promotes only a few commercial varieties. In the attempt to accommodate their diverse uses of banana, farmers will plant TC seed alongside their local preferred varieties, which facilitates cross-infection of BXW. To enhance effectiveness of TC in control of BXW, it is important to identify the cultivars of cultural importance and broaden the range of TC cultivars available to the farmers. It is imperative that a wide range of cultivars through TC seed are provided which fit the socio-cultural context and satisfy the multiple functions of banana to foster greater uptake. Even so, TC seed producers (e.g. TC laboratories and TC nursery operators) should consider this whilst increasing seed supplies to break-even in their businesses. Only a few plantlets (one or two for a farmer) suffice for cultural purposes and as such not all cultivars may be in sufficiently high demand."},{"index":2,"size":161,"text":"Farmers' beliefs that TC seed is genetically modified and that such cultivars would not be suitable for cultural practices also constrain the uptake of TC materials. Increased awareness creation is needed among banana farmers in central Uganda regarding the processes of TC and the non-interference of the propagation technique with the genetic composition of the variety. The commercial cultivars promoted through TC are also heavy feeders and require soil fertility improvement practices such as use of organic manure or fertilizers to sustain productivity. Otherwise, farmers believe that their soils are not suitable for TC banana as productivity declines faster compared to their traditional varieties. It is therefore important that to disseminate TC technology widely, NGOs, local extension staff, the TC laboratories and nursery operators all better package the technology with detailed information showing its production process, advantages and disadvantages, and agronomic practices. This can be disseminated through farmer-preferred information dissemination pathways such as radios as reported by Kikulwe et al. (2019)."},{"index":3,"size":199,"text":"The cultural dimensions of bananas in central Uganda present a more complex context for technology uptake than anticipated by many stakeholders in the industry. Such circumstances call for deeper engagement and involvement of men and women farmers who are the intended users of the technology to understand their unique context in order to tailor the technology to the diverse interests and uses of the products promoted. In this case, the tension between gender, cultivar diversity, cultural practices, and commercialization of banana hinders using TC plantlets to control BXW. The results not only provide a 'reality check' but also highlight the importance of farmer engagement in the development and promotion of any agricultural-related innovation. For sustainable use of agricultural innovations such as TC, it is important that breeders and TC plantlet producers not only put into consideration economic and biological attributes of targeted crops, but also gender and cultural aspects. This will help promoters of agricultural technologies to diversify gender-responsive cultivar attributes required by end-users, and in turn will increase adoption of such innovations. Future efforts towards the control of pests and diseases would benefit from more location-specific and holistic approaches that integrate gender and cultural dimensions alongside clean seed."},{"index":4,"size":122,"text":"It should, however, be noted that this is a field note and that many important questions remain unanswered due to limitations of methods and space for publication. For instance, the \"politics\" of TC varieties, whether the farmers see themselves as upholding local traditions in light of globalization, or are experimenting with TC technologies to maintain good relations with government technocrats for benefits is not captured. Therefore, it is highly recommended that future research should consider incorporating such aspects to develop a better understanding of the political factors that might influence uptake of agricultural innovations. In addition, the authors recommend a systematic and scientific inquiry regarding the medicinal values of some banana cultivars and to address farmer concerns about TC innovations being 'adulterated'."},{"index":5,"size":13,"text":"approaches for the control of banana diseases and cropping and seed systems health."},{"index":6,"size":74,"text":"Enoch Kikulwe is a scientist at Bioversity International. His current work is focusing on adoption and impact assessment of agricultural technologies and sustainable use of natural resources in smallholder crop systems of East and Southern Africa. He has vast experience in evaluating the suitability of crop productivity enhancing technologies and policies in different agro-climatic environments as well as performing rigorous econometric impact assessments of these technologies and policies on livelihoods, food and nutritional security."}]}],"figures":[{"text":"Fig. 1 Fig. 1 Transmission pathways for the bacterium Xanthomonas campestris pv. Musacearum causing BXW "},{"text":"Fig. 4 Fig. 4 Farmers' comparison by performance of TC banana seed and suckers "},{"text":"Plate 2 A -Preparing 'luwombo' with ground nut sauce: B-Groundnut sauce wrapped in 'empombo' and tied with a banana fiber, traditionally referred to as 'luwombo' ready to be steamed Plate 3 Preparing matooke the traditional way. A-Peeled cooking banana, 'matooke' placed in banana leaves; B-Matooke wrapped in banana leaves and tied with banana fiber; C-Matooke covered with banana leaves in a saucepan ready to be steamed "},{"text":"Table 1 Proportion of focus group participants by location Location Number of FGDs by sex Participants Number of focus group participants by locationLocationNumber of FGDs by sexParticipantsNumber and sex Village: Nambi Male Female Male (16) and female (16) farmers 32 and sexVillage: NambiMaleFemaleMale (16) and female (16) farmers32  Luwero district 2 2   Luwero district22  Village: Gonve 2 2 Male (16) and female (16) farmers 32 Village: Gonve22Male (16) and female (16) farmers32  Mukono district     Mukono district  Total 4 4  64 Total4464  "},{"text":" Table2). The diversity of cultivars is also associated with the wide range of uses and preferences. Farmers usually grow several in the same garden partly to accommodate critical values/needs as explained later in this paper. With regard to use, cultivars are generally categorized as: cooking banana-commonly  BANANA BANANA   THE THE BANANA THE FOOD BANANA THEFOOD  CULTURAL  CULTURAL  ARTEFACT  ARTEFACT  Traditional  Traditional  banana cuisines banana cuisines Beliefs Traditional  BeliefsTraditional Norms Practices Traditional banana beer & NormsPracticesTraditional banana beer &   juice juice BANANA   BANANA THE   THE MEDICINE   MEDICINE  "},{"text":"Table 2 Banana cultivars grown in Gonve and Nambi communities in central Uganda + Cultivars introduced under TC; * Nearly extinct and still desired banana cultivars Banana varieties Clone set Genome Genome Group Major Use Banana varietiesClone setGenomeGenome GroupMajor Use Kisansa + Musakala East African Highland AAA-EA Cooking Kisansa +MusakalaEast African HighlandAAA-EACooking Mpologoma +     Mpologoma + Mpologoma omukadde     Mpologoma omukadde Musakala +     Musakala + Muvubo*     Muvubo* Namunwe     Namunwe Mayovu*     Mayovu* Mbwazirume Nakitembe East African Highland AAA-EA Cooking MbwazirumeNakitembeEast African HighlandAAA-EACooking Nakamali     Nakamali Nakitembe +     Nakitembe + Nalugolimo     Nalugolimo Nandigobe     Nandigobe Nasalugiri-Soola mwana     Nasalugiri-Soola mwana Wakirigga     Wakirigga Nabununike     Nabununike Kibuzi + Nakabululu East African Highland AAA-EA Cooking Kibuzi +NakabululuEast African HighlandAAA-EACooking Mukubyakonde*     Mukubyakonde* Nakabululu     Nakabululu Nakyetengu*     Nakyetengu* Atwalirannyina Nfuuka East African Highland AAA-EA Cooking AtwalirannyinaNfuukaEast African HighlandAAA-EACooking Katwalo     Katwalo Lusumba     Lusumba Muziranyama     Muziranyama Nabusa     Nabusa Nakabinyi     Nakabinyi Nakawere*     Nakawere* Nakinyika     Nakinyika Nambi*     Nambi* Namwezi*     Namwezi* Ndibwabalangira     Ndibwabalangira Nfuuka +     Nfuuka + Siira*     Siira* Kyesusa     Kyesusa Embidde enganda Mbidde East African Highland AAA-EA Juice/Brewing Embidde engandaMbiddeEast African HighlandAAA-EAJuice/Brewing (Kabula & Nsowe)*     (Kabula & Nsowe)* Improved Ndiizi +    Dessert Improved Ndiizi +Dessert Bogoya  Gros Michel AAA Dessert BogoyaGros MichelAAADessert FHIA -17 +  Tetraploid hybrids AAAA Cooking & Dessert FHIA -17 +Tetraploid hybridsAAAACooking & Dessert FHIA -01 +  Tetraploid hybrids AAAA Cooking FHIA -01 +Tetraploid hybridsAAAACooking FHIA 25 +  Tetraploid hybrids AAAA Juice/brewing FHIA 25 +Tetraploid hybridsAAAAJuice/brewing KM5(Kabana 5) +    Dessert KM5(Kabana 5) +Dessert Gonja (Nakatansese & Manjaya) +  Plantain AAB Roasting Gonja (Nakatansese & Manjaya) +PlantainAABRoasting Kayinja  Pisang Awak ABB Brewing KayinjaPisang AwakABBBrewing Kisubi  Ney Poovan AB Brewing KisubiNey PoovanABBrewing Kivuuvu  Bluggoe ABB Dessert KivuuvuBluggoeABBDessert Sukali Ndiizi  Kamaramasenge AAB Dessert Sukali NdiiziKamaramasengeAABDessert  "},{"text":"Table 3 Banana cultivars and their cultural practices in central UgandaNakitembeDisposal of placentas for newly borne baby girls Treating menstrual pains especially for young girls experiencing menstruation for the first time Herbal baths for baby girls Practices for celebrating birth of twins Cleaning of the dead (females) before burial (Mid rib of Nakitembe pseudo stems crushed and used to 'wash' the deceased's face. Believed to keep away the spirits of the dead) Marriage ceremonies -Leaves used in matooke preparation for in-laws during introduction (Kwanjula) ceremonies -Leaves important for herbal baths of brides before marriage -Ceremonial meal to husband prepared by bride after honeymoon Variety Cultural importance VarietyCultural importance Embidde enganda  Embidde enganda (Kabula & Nsowe)  (Kabula & Nsowe)  "},{"text":"Table 4 Banana cultivars and their associated beliefs in central Uganda Variety Associated beliefs VarietyAssociated beliefs  "},{"text":"Table 5 Medicinal uses of banana cultivars in central UgandaDiarrhea -Sap from suckers mixed with herbs and drank Treatment of umbilical cords in infants -Sap from suckers placed on the umbilical cords of infants Fractures in both humans and animals -Sap from suckers used to set and massage fractured bones Snake bites -Sap from sucker mixed with tree herbs and drank Abscesses -Sap from sucker mixed with herbs, ant hill 'ekifulufu' soil and concoction smeared on boils Gonja Healing of umbilical cords in infants -A finger is burnt, resultant ash gently rubbed on umbilical cords of infants Childbirth -Mother in labor chews roots to hasten the child delivery process Colic in infants -A mother of twins (Nalongo) weaves a small rope from banana fiber that is tied around the waist of the infant Diarrhea in infants -Fiber tied around waist of sick infant till the condition stops Mumps -Banana fiber tied around the child's chest Kibuzi Wounds and skin infections -Rachis cut into pieces, boiled and resultant liquid bathed or applied on wounds Nakamali Impotence in men -Geotropic roots crushed, mixed with hot water and drank Variety Disease/ailment VarietyDisease/ailment Embidde  Embidde enganda  enganda (Kabula &  (Kabula & Nsowe)  Nsowe)  "}],"sieverID":"b56a2a0b-80cf-4eda-bb1f-824bb5cff9c2","abstract":"Several initiatives by the Government of Uganda, Research Institutes and CGIAR centers have promoted the use of tissue culture (TC) banana technology as an effective means of providing clean planting material to reduce the spread of Banana Xanthomonas wilt (BXW) but its uptake is still low. We examine factors that constrain uptake of tissue culture banana planting materials in central Uganda by considering the cultural context of banana cultivation. Data were collected using eight focus group discussions involving 64 banana farmers and 10 key informant interviews and subjected to thematic analysis. Results showed that banana cultivars in the study communities were important for food, cultural practices and medicine. Cultivars supplied through TC were based on commercial considerations focusing on market value and household income and insufficient attention was given to their cultural importance. Farmers regard banana from TC planting material to be incompatible with their tastes and preferences for traditional food and drinks, culture and medicine. Furthermore, the plantlets are perceived as complicated to use, and farmers report requiring more knowledge and information on how to plant and maintain the plantlets on-farm. In these aspects, TC planting material does not align with cultural values linked to societal welfare. Future efforts aimed at controlling pests and diseases would benefit from more location-specific and holistic approaches that integrate cultural dimensions alongside planting material hygiene, quality and vigor."}

data/part_5/067c090a28cbb0cb563d8bee2556c3a7.json

@@ -0,0 +1 @@
+{"metadata":{"id":"067c090a28cbb0cb563d8bee2556c3a7","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1a98fcc0-28c2-4c3d-89d3-b50cfc087b61/retrieve"},"pageCount":16,"title":"\"You worked where this summer?!\" A brief summary of my experiences working at the International Livestock Research Institute in Nairobi, Kenya","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":113,"text":"In September of 1994, I met John Crystal in the basement of Westminster Presbyterian Church. Earlier in the year, I had been asked to prepare a paper on sustainability and food security for the first annual World Food Prize Youth Institute. Knowing virtually nothing about agriculture, I interviewed Mr. Crystal in an attempt to learn more about the problems facing it, both in Iowa and around the world. I cannot recall exactly what was said on that Saturday morning in the basement of Westminster, only that the conversation started a chain of events that would eventually lead me to the office I sit in as I write this, in the middle of Kenya."},{"index":2,"size":100,"text":"Mr. Crystal fascinated me with his conversations of international agriculture and his experiences around the world. When I later that year attended the World Food Prize ceremonies and the Youth Institute-then just a small gathering of about 20 high school students-I was amazed at the attention given to agriculture. Having grown up in Des Moines, only occasionally visiting my relatives' farms in rural Iowa, I thought of agriculture as something distant and not too terribly important. But through the Youth Institute and my conversations with John Crystal, I began to understand just how ubiquitous agriculture is in the world today."},{"index":3,"size":102,"text":"Those ideas lay dormant in me for three years, until, as a senior in high school, my advisor during the first Youth Institute asked me to prepare another paper, this time regarding Sub-Saharan Africa and food security, for the fourth annual Youth Institute. By this time, the Youth Institute had grown significantly, including dozens of high school students from across Iowa. Once again, I started thinking of all the ways agriculture permeates society and of food security and its importance in the future and yet I still relegated these thoughts to the back of my mind once the Youth Institute was finished."},{"index":4,"size":24,"text":"Later that year, another teacher of mine informed me of an essay contest on sustainable development sponsored by the American Society of Civil Engineering."},{"index":5,"size":124,"text":"Knowing my past participation in the World Food Prize, he suggested I enter. Having a multitude of incredibly incoherent ideas regarding sustainability, I submitted a paper, written in the pre-dawn hours on the postmark deadline. Imagine my surprise when, in November, I received a letter congratulating me on winning the high school essay contest and inviting me to present my paper at the International Civil Engineering Conference, in Manila, Philippines. At the conference, I listened to discussions on environmental development, sustainability, natural resource management and conservation. It was at that point in my education that I realized that I had developed more than a passing interest in the subject of sustainability and the environment. This was something that I wanted to learn more about."},{"index":6,"size":86,"text":"In the fall of 1998 I entered Grinnell College-which John Crystal spoke so highly of four years ago-as an intended biology major. I wanted to learn more about Environmental Studies and ecosystems, tying together sustainability and conservation. However, I found that I wasn't satisfied with studying only the biological aspects of these issues. I found myself becoming more and more interested in the economic implications of environmental studies and also in Global Development Studies, which looks at the broader area of international development, including environmental sustainability."},{"index":7,"size":86,"text":"Unfortunately, Grinnell does not offer a major incorporating all the components I was interested in, so I decided to try and create my own major. After months of planning and organizing, in June of 2000, I received my notice that I was officially an Independent Major in International Development. The major combines biology, economics, environmental studies and global development studies, and will hopefully give me the opportunity to study more in depth the issues that first interested me so many years ago, talking with John Crystal."},{"index":8,"size":30,"text":"How did I end up in Kenya? In January of 2000, as I was planning my independent major, I realized that I needed an internship to count towards my graduation "}]},{"head":"The Problem","index":2,"paragraphs":[{"index":1,"size":14,"text":"By the year 2020, Africa's population will increase by 2.5 billion people (ILRI, 2000)."},{"index":2,"size":107,"text":"This enormous swell in the population will severely strain the continent, as food production falls further and further behind demand. To add to the problem of food security in Africa, income is also expected to rise in the next 20 years, and because livestock products are normal goods--meaning that as income increases, demand for the products will increase--individuals will consume more livestock products than they do now (Staal et al, 2000;Mankiw, 2001). This, coupled with the increasing population, indicates that demand for livestock products--including milk and meat--will more than double by the year 2020 (Mohammed-Saleem, 1995;ILRI, 2000). How will Africa be able to supply the food needed?"},{"index":3,"size":62,"text":"Even in the past two decades, food production in Africa has not been able to keep up with increasing population (Logan-Henfrey, 1992). If food supply is to meet demand in the future, livestock production must increase. However, land is already becoming scarce and it is clear that current methods of agricultural production cannot accommodate the anticipated upsurge in demand for livestock products."},{"index":4,"size":24,"text":"To complicate things even more, livestock production efficiency in the developing world (including sub-Saharan Africa) is one-fourth that of the developed regions (ILRI, 2000)."},{"index":5,"size":38,"text":"Goals of food security and standard-of-living increases will not be met by simply adjusting policy or by enacting emergency aid programs. Research must be done to find new ways of increasing production and production efficiency in developing countries."},{"index":6,"size":6,"text":"ILRI is involved in this effort."},{"index":7,"size":38,"text":"Research at ILRI deals with a plethora of topics, including livestock health and nutrition, smallholder dairy markets, public health issues caused by livestock products, farm intensification, crop and livestock systems management and genetically-modified organisms. ILRI's long-term goals include:"},{"index":8,"size":8,"text":"• improving the productivity of crop-livestock farming systems "}]},{"head":"The Kenyan Dairy System","index":3,"paragraphs":[{"index":1,"size":144,"text":"Dairy farming in Kenya is performed predominately by smallholder farmers, contributing approximately 56% of all milk produced and 70% of the marketed milk in Kenya. The average farm has between two and three cows, most of these being dairy cattle (80%), although some are indigenous breeds (Omore et al, 1999). From these small farms, the portions of milk not being consumed on-farm are sold, most likely through the informal \"hawker\" market. These hawkers buy raw milk from farmers and sell it (still raw) to others, usually in urban areas. Farmers may also sell to local dairy co-operations that may or may not process the milk. Sub-projects of the MOSD look at how the infrastructure and dairy production technology can be improved to support market growth, ways of improving livestock health and nutrition, and processes of agricultural intensification and how they impact the dairy market."},{"index":2,"size":12,"text":"Infrastructure is one of the most important characteristics of the dairy market."},{"index":3,"size":38,"text":"Before 1992, the dairy sector was regulated by the government, however when the market was liberalized in '92 and the market came under more intense supply and demand pressures, prices fell and the infrastructure began collapsing (Omore, 1992)."},{"index":4,"size":62,"text":"Due to government changes and privatization of most of the country's services, including road maintenance, water allocation, electricity generation and welfare services are virtually non-existent. This lack of basic services has made rebuilding the dairy market even more difficult. Services like insemination, veterinary care and even adequate feed for livestock are difficult to procure and prices of milk are unsteady (Omore, 1999)."},{"index":5,"size":137,"text":"One of the factors leading to the dairy market's instability is the lack of adequate roads which allow the farmers and hawkers access to the buyers and sellers. Whether a farmer can get his milk to the market is highly dependent upon the condition of the roads between his farm and the market. Geographers at ILRI are working to create accurate and updated roadmaps for various markets in Kenya to begin to understand where milk is going and coming from and how easily it traverse the market. A major constraint to this is the lack of road maps available for most of Kenya, therefore one of the projects MOSD is working on is the construction of updated road mapping and classification. The geographer I worked with over the summer responsible for this project was Tineke de Wolff."},{"index":6,"size":44,"text":"One faces many problems when attempting to revamp the road maps of an entire country, the first one being: what is a road? Kenya has many different types of \"roads\", ranging from tarmac (paved) roads to mud roads. Often, the roads are classified as:"},{"index":7,"size":80,"text":"paved, unpaved but all-season roads, and unpaved seasonal roads. However, I found that these definitions change depending on who you're talking with. For example, while working with de Wolff in western Kenya, we took one such road from one village to another while it was raining. While I would definitely classify this particular road as a seasonal road--because it took hours to navigate it while raining and was complete mud-another person we talked with classified this as an all-season road."},{"index":8,"size":141,"text":"Another problem involves finding out where all the roads are. While it would be most accurate to drive around the country marking all the roads, this is highly inefficient and resource-consuming. de Wolff started by speaking with the roads departments in all of the districts, but found that often, these departments only record classified roads and do not include any unclassified roads. She also found that even these departments did not always have the most updated maps. One strategy de Wolff used to compensate for this was to survey the various tea factories in the area. These factories are dependent upon deliveries of tea leaves from farmers in the area and thus keep track of the location and condition of the roads, and also work to maintain some of these roads, to ensure that they maintain their supply of tea leaves."},{"index":9,"size":72,"text":"I accompanied de Wolff on two of her trips to Western Kenya and the Embu/Meru district in central Kenya (near Mt. Kenya). This was a fascinating experience because it allowed me to see many parts of Kenya which I would not otherwise have seen, and also because I was able to interact with many of the Kenyans working with the roads departments, the tea factories and various other governmental and nongovernmental agencies."}]},{"head":"System-wide Livestock Program","index":4,"paragraphs":[{"index":1,"size":19,"text":"The System-wide Livestock Program (SLP) looks at declining fertility in the Kenyan highlands and how livestock impact soil fertility."},{"index":2,"size":51,"text":"Declining soil fertility is a major problem in the Kenyan highlands and is jeopardizing the future of smallholder farming and food security in East Africa. As population densities increase and land continues to be subdivided with each generation, the land available to a household is diminishing rapidly (Lekasi et al, 1998)."},{"index":3,"size":53,"text":"Intensification 1 of the land is required to feed the growing population, but with potentially disastrous consequences for the land. People are more often farming land not suitable for farming, and the traditional practice of observing fallow systems 2 is almost completely gone (ILRI, 1999). Erosion is increasing while soil fertility is declining."},{"index":4,"size":21,"text":"When this happens, crop yields fall and Africa falls further and further behind in it's effort to feed it's bulging population."},{"index":5,"size":158,"text":"In parts of the East African Highlands, population density is as high as 1000 persons/km 2 (2200 persons/mile 2 ), and the average farm size is often not more than one hectare per household (Lekasi et al, 1998). Land must be intensively cropped in an attempt to meet the increasing demands for food. Because farms are most often also financially constrained, the farmers try to get as much out of the land in the form of crops and livestock without putting anything back. Because of the high price of inorganic fertilizers, most cannot afford to apply the ample amounts of nutrients needed to sustain crop yields and soil fertility (ILRI, 1999). This trend of intensive agriculture is putting 1 Intensification refers to the agricultural practice in which farming is concentrated and intensified due to diminishing farm sizes. 2 A fallow system is the practice of rotating cultivated land to allow the soil to regain nutrients, and thus fertility."},{"index":6,"size":16,"text":"enormous pressure on the land and leading to severe and often irreversible environmental degradation (SLP, 1999)."},{"index":7,"size":68,"text":"The Consultative Group on International Agricultural Research has created a program to study the causes of soil fertility depletion. The CGIAR has centers around the world and the SLP is a joint effort of many of these centers. SLP has many different components and research areas, one of which looks at the productivity and sustainability of crop-livestock systems. This project, a joint effort between ILRI, ICRAF, KARI and"},{"index":8,"size":11,"text":"MoA is currently researching the role of livestock in soil fertility."},{"index":9,"size":45,"text":"The continuous cropping and intensive farming in the Kenyan highlands has no doubt let to decreased soil fertility and most agree that nutrient balances on these intensive farms are negative. What SLP is studying is whether livestock on a farm can slow the nutrient depletion."},{"index":10,"size":210,"text":"Livestock are an important part of the smallholder farming of the Kenyan highlands, because they are able to convert inedible products like crop residues and grasses into nutritious products like milk and meat. More importantly to soil fertility, livestock can also provide organic fertilizer to the farmer that often cannot afford inorganic fertilizer (ILRI, 1999). The crop residues that it feeds off of could be used as organic fertilizer, but it would take months for them to decompose and release their nutrients for the crops to use. Ruminants can make this nutrient turnover happen much more quickly because the rumen bacteria can easily break down the crop residues and release them in the form of manure (ILRI, 1999). This aspect of livestock usage is most important to the study of soil fertility. Between 80-95% of the nitrogen (N) and phosphorus (P) consumed by livestock is excreted. If this is used on crops, it can significantly increase the amount of nutrients in the soil, even though overall nutrient content may be declining (Lesaki et al, 1998). Livestock can also serve as a vehicle for importing nutrients. Because intensification has required that farmland be used more for mixed crops and less for animal feed, many farmers now buy fodder for their animals."},{"index":11,"size":12,"text":"SLP intends to look at just how much livestock effect soil fertility."},{"index":12,"size":132,"text":"My role in SLP was to help analyze data collected in preliminary surveys in the Embu district in central Kenya. 263 households were surveyed to obtain baseline information on farming systems and the presence of livestock in the area.. I spent much of the summer cleaning up the database, standardizing the responses and reviewing the answers for accuracy. Although this may seem like incredibly mundane work, I actually found it fascinating to look at the original surveys and to have a chance to look at all the data in it's original form. I learned a great deal about the Kenyan agricultural system and the social structure of agricultural households simply by pouring over the data for a few weeks. This project also required an extensive literature search that I learned much from."}]},{"head":"Trypanosomosis","index":5,"paragraphs":[{"index":1,"size":64,"text":"The final project which I worked on involved the cattle disease trypanosomosis. This project was very engaging because it gave me the chance to look at some of the actual research going on involving genetics, epidemiology and immunology 3 . As a student interesting in biology, it was very reassuring to know that people actually do interesting and meaningful research in the real world."}]},{"head":"Implications","index":6,"paragraphs":[{"index":1,"size":43,"text":"What did all of this research mean? There were times throughout the summer that I wondered that. Although all of these projects are interesting as scientific articles, I kept wondering how the information would get back to those people who really needed it."},{"index":2,"size":233,"text":"How would the farmers find out whether they were utilizing their livestock most efficiently? What would the updated roads mapping do for the average farmer that lives dozens of kilometers away from the nearest all-weather road? And what does the average small-scale agricultural household care about the similarities between bovine and murine genomes and their trypanotolerance? Perhaps not much, but the research being done at ILRI is providing the foundation for more involved projects aimed at integrating the results of these projects into real-world applications that benefit the farmers of Kenya, East Africa and the world. ILRI also organizes feedback sessions with the people involved in their studies for projects such as SLP and MOSD, in an attempt to keep the research focused on those who will benefit most from it. It was very rewarding for me to be able to work with such a cast of talented, incredible, energetic and ingenious scientists. As I reach a point in my education where I am beginning to make decisions regarding my career, I felt it was very beneficial for me to experience an aspect of international agricultural research, as this is probably something I will continue to pursue. I think back to that day in 1994 when I first heard about the World Food Prize and muse about how my entire educational and professional career was altered by participating in that first Youth Institute."}]},{"head":"Things I learned this summer","index":7,"paragraphs":[{"index":1,"size":73,"text":"I learned that you can do something with a liberal arts degree, and that my independent major is not as crazy as some people may think. I learned that people actually do worthwhile research on many different things, and that this research is not entirely based on the physical/natural sciences, but that social sciences also allow for interesting and valid research. I learned that this research actually makes a difference in people's lives."},{"index":2,"size":59,"text":"Although I have been to other developing countries, I was reminded of the incredible disparities between developed and undeveloped worlds. I also learned that those labels mean absolutely nothing. As for how the entire experience effected me, I can only say that this summer has changed me in so many ways, most of which I haven't realized fully yet."}]}],"figures":[{"text":"• conserving the natural resources that sustain crop-livestock farming While at ILRI, I worked with the Market-oriented Smallholder Dairy Project, one of the major areas of research at ILRI. This project was concerned with dairy markets in Kenya, how and why they fail and what can be done to correct these failures. I also worked with a collaborative project between ILRI, the International Centre for Research in Agroforestry (ICRAF), the Kenya Agricultural Research Institute (KARI) and the Ministry of Agriculture (MoA). This project, the System-wide Livestock Program dealt with the effects of farming systems and livestock on soil fertility. Finally, I prepared a research paper for my college discussing the cattle disease trypanosomosis. "},{"text":"I admit, I began the summer a bit skeptical of the top-down development so prevalent in Africa today. ILRI's funding comes mainly from the British and US aid 3 For more information on trypanosomosis and ILRI's research, please see author's paper entitled Trypanosomosis in sub-Saharan Africa agencies Department for International Development (DFID) and United States Agency for International Development (USAID), respectively. It also receives funding from international agencies including the World Bank. This is typically the type of development that my fellow Grinnellians enjoy protesting by chaining themselves together, not the type that a Grinnellian usually works for. But I was truly impressed at the level of interaction between ILRI and the communities it worked with. And contrary to the popular beliefs regarding larger development agencies and research institutes, the people I worked with genuinely cared about the people involved in the topics they researched. "}],"sieverID":"39266116-4614-40ee-a353-e1a435fe464c","abstract":"The livestock revolution, driven by consumers, is inevitable, but its effects-for good or ill-on smallholders and the environment will depend to a large extent on the work of researchers.\" --Synergies in Science: Intercenter Collaboration to Eradicate Hunger and Poverty (2000)"}

data/part_5/06c79597831c23529c504b1b9ad89a8c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06c79597831c23529c504b1b9ad89a8c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/776dae45-a211-4d09-b596-7bae5501159f/retrieve"},"pageCount":21,"title":"Genetic diversity and population structure of cacao (Theobroma cacao L.) germplasm from Sierra Leone and Togo based on KASP-SNP genotyping","keywords":["cacao","Sierra Leone","Togo","KASP-SNPs","genetic diversity"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":188,"text":"Cacao, Theobroma cacao L., is a tropical tree native to humid tropics of the central and northern parts of South America. It is the major ingredient used in the multi-billion-dollar chocolate and confectionaries industry as well as other intermediary products such as cacao butter, cacao powder, cacao cake, and cacao liquor. The coastal countries in West Africa, known as the West Africa cacao belt [1], from Sierra Leone, Guinea, and Liberia to Southern Cameroon, apart from Benin Republic, are responsible for production of about 70% of the world's cacao (http://faostat.fao.org). The chocolate and confectionary industry around the world is heavily dependent on cacao beans from West African countries, both due to the high production and the high quality of beans (bulk cacao, may not be specialty cacao) that are not produced in other cacao producing regions such as Asia or Central and Southern America. In 2020, cacao was the primary agricultural commodity that was exported by Cote d'Ivoire, Ghana, Nigeria, Cameroon and Sierra Leone, and the second most important commodity exported from Guinea, Togo, and Liberia, thus contributing towards the GDP (gross development price) of these countries (www.statista.com)."},{"index":2,"size":132,"text":"It is estimated that the Brazilian cacao (Amelonado type which is also known as Lower Amazon Forastero type) was rst introduced into West Africa in the 19th and early 20th centuries by the Portuguese [2], and since then cacao is cultivated by smallholder farmers in this region. Cote d'Ivoire and Ghana remain the highest producers of cacao in the world accounting for over 60% of global world production of around 4.9 million tonnes in the 2021/2022 cacao season [3][4]. Among cacao producing countries in the world, Togo and Sierra Leone ranks 15th and 17th with a production of 22,522 and 14,670 metric tonnes, respectively [5]. In 2017, the World Bank Trade Statistics recorded an export earnings of about US$ 14,461 million from cacao beans in Sierra Leone [6] even with low productivity."},{"index":3,"size":82,"text":"Over the years, the cacao yield has increased in both countries, which corresponds to an increase in the area under cultivation. However, the future yield is expected to be adversely affected by changing climatic conditions. Similar to other West African countries, cacao cultivation in Sierra Leone and Togo faces the challenges of old trees, aged farmers, black pod disease, mirids, poor access to improved planting materials, and other challenges (such as cacao swollen shoot virus disease) related with its cultivation, and management."},{"index":4,"size":198,"text":"Cacao germplasm introduction in Sierra Leone and Togo followed the same trend as introductions in other West African countries, which is from a common source -Fernando Po. However, it is believed that in Sierra Leone, there may have been introductions from other sources (the West Indies) raising questions as to the origin of cacao in this country [7]. There is, therefore, an interesting probability that the presentday cacao in West Africa (apart from recent introductions through University of Reading and germplasm exchanges between West African countries such as introductions from Ghana to both Sierra Leone and Togo (at experimental stations of national institutes) is of dual origin. In Togo, cacao germplasm is conserved in a gene bank consisting of clones introduced from countries in the sub-region (Ghana, Côte d'Ivoire, Cameroon, and Nigeria) and international collections (University of Reading, United Kingdom). It is necessary to understand and assess the genetic relationships and genetic diversity among cacao germplasm within and between these two countries. Several efforts have been put forward to understand and assess the genetic diversity currently available in major cacao growing countries in the world, including several West African countries using both molecular markers and morphological traits [8][9][10][11][12]."},{"index":5,"size":35,"text":"However, there is no study available so far that targeted germplasm collection from different cacao growing regions in Sierra Leone and Togo to assess genetic diversity and understand population structure present in these two countries."},{"index":6,"size":188,"text":"There is a general agreement that the cultivated cacao in West Africa, the region with highest production, has a narrow genetic base and faces issues of mislabeling. Studies that compared both modern and historical introductions did not detect signi cant genetic diversity and improvements in yield or pest and disease resistance during the last 20 years [13]. Any improvement in yield resulted from better management practices, although some of the recent varieties or hybrids developed in major West African countries produced signi cantly higher yields with better pest and disease resistance under intensive cultivation. Similar improvements in yield as well as other traits are needed in other countries so that there will be enough supply for the increasing demand of dry cacao beans in the world. Therefore, it is necessary that the cacao germplasm available in other producing countries within West Africa is characterized, documented, identi ed, conserved, and utilized. This will allow searches for promising unique genetic materials that can be used in developing strong breeding programs in these countries as well, which currently depend on Cote d'Ivoire, Ghana or Nigeria for improved varieties or planting materials."},{"index":7,"size":209,"text":"The assessment of genetic diversity or identi cation of mislabeled accessions in germplasm collections with single nucleotide polymorphism (SNP) markers has been used extensively in several crops and is being adopted as a fast, high-throughput, and affordable tool for whole-genome genetic diversity analysis. SNPs have been successfully used to characterize crops such as maize [14], soybean [15] and several others. Similarly, SNP markers have been used for ngerprinting cacao germplasm collection in several studies [16][17][18][19][20]. To our knowledge, KASP-SNPs have been used in only two studies for cacao germplasm from West Africa [10,11]. High-throughput sequence-based SNP markers such as the KASP (Kompetitive allele-speci c PCR) platform emerged as an attractive method in comparison to traditional genotyping with SNP markers using electrophoresis systems because of low genotyping error rate, and exibility to automation that resulted in drastic reduction in cost per data point [21]. In the present study, a subset of 20 KASP-SNPs, from a set of 100 KASP-SNPS used in genotyping cacao samples from Nigeria and Ghana, was used for genotypic characterization of cacao from Sierra Leone and Togo. This is the rst study that aimed to use the subset of 20 selected KASP-SNPs to understand the extent of genetic diversity and population structure within and among cacao germplasm."}]},{"head":"Results","index":2,"paragraphs":[]},{"head":"Cacao accessions from Sierra Leone and Togo","index":3,"paragraphs":[{"index":1,"size":123,"text":"The cacao accessions collected from both Sierra Leone and Togo represented several clones with the same name (Supplementary Table S1) even when these were collected from different trees either from the same farm or from different farms. The GPS coordinates as well as the village/farm names and the district name for each sample are provided in Supplementary Tables S2a and S2b. The majority of the cacao samples from Sierra Leone with similar names were collected from trees located in different farms, indicating that these trees either belong to the same clone or there are issues of mislabeling. The situation is the same in Togo although samples with the same genotype names are present in the same farm as well as in different farms."},{"index":2,"size":181,"text":"The 235 cacao samples from Sierra Leone represented 144 accessions with unique names. These 144 accessions were sourced from either Ghana (66 accessions) or from the University of Reading (77 accessions) while the source of one sample was unknown (Supplementary Table S1). Similarly, the samples from Togo represented 77 accessions with unique names. These 77 accessions were sourced from Cameroon (4 accessions), Cote d'Ivoire (11 accessions), Ghana (17 accessions), Nigeria (28 accessions), Togo (9 accessions), with a few clones representing both Cameroon and Ghana (ICS 6 x NA33; ICS16), Cote d'Ivoire and Cameroon (IFC1 x SNK13), Ghana and Cote d'Ivoire (NA2), Ghana and Nigeria (SCA 12 x NA32; C23; C26 x SCA 6), and ve samples whose accession names were lost (Supplementary Table S1). For the accessions with lost names, it is assumed that these may represent PA7/A19 clones (Supplementary Table S1). There are eleven accessions/accession names common between both Sierra Leone and Togo, of which PA7, ICS60, IMC47, Na34 and Pa35 represented the University of Reading and Nigeria as the source for Sierra Leone and Togo, respectively. C20 and C70"},{"index":3,"size":75,"text":"represented Ghana as the source country for both Sierra Leone and Togo; C26 and C42 represented Ghana and Nigeria as source country for Sierra Leone and Togo, respectively; C23 represented Ghana for Sierra Leone and Nigeria/Ghana for Togo as the source country; Pound 7 represented Gene Bank of SLARI and Ghana as the source for Sierra Leone and Togo, respectively while PA7 represented Gene Bank of SLARI and Nigeria as the source (Supplementary Table S1)."}]},{"head":"Genetic diversity parameters","index":4,"paragraphs":[{"index":1,"size":178,"text":"The 20 KASP-SNP markers used in the present study were distributed across the ten chromosomes of cacao, with two SNPs on each chromosome (Supplementary Table S3). The average PIC (polymorphic information content), He (expected heterozygosity), Ho (observed heterozygosity) and MAF (minor allele frequency) values for 235 cacao accessions collected from Sierra Leone were 0.22, 0.30, 0.24, and 0.21, respectively while for 141 accessions collected from Togo these values were 0.21, 0.29, 0.22, and 0.19, respectively. For the combined population of 376 cacao accessions, the average PIC, He, Ho, and MAF values were 0.24, 0.30, 0.26, and 0.23, respectively (Table 1). Supplementary Fig. 1 represents the distribution of He, Ho, MAF, and PIC values for the combined population. Of the 20 SNPs used in the study, many had a minor allele frequency (MAF) above 0.2 and showed high PIC values with a peak distribution above 0.2. Similarly, low observed and expected heterozygosity was recorded. The observed heterozygosity for the combined population was higher than individual country-level observed heterozygosity, and this is also represented by higher PIC values (Table 1). "}]},{"head":"Population Structure and Genetic Relationships","index":5,"paragraphs":[{"index":1,"size":195,"text":"The model-based population structure analysis combined cacao population (235 accessions from Sierra Leone and 141 accessions from Togo) showed that the delta K values from the mean log-likelihood probabilities stagnated at K = 4 (Fig. 1a). The 376 cacao accessions divided into four subpopulations at K = 4 (Fig. 1b). Based on an 80% membership probability threshold, 270 accessions (73.37%) were successfully assigned to the four sub-populations. In comparison, 106 accessions with a probability less than 80% were designated as an admixed population (Supplementary Table S1). Sub-population 1 consisted of 123 accessions (Sierra Leone: 94 accessions; and Togo: 29 accessions). Sub-population 2, 3 and 4 constituted 3.72%, 22.07% and 13.30% of the accessions, respectively with a composition of 10 accessions from Sierra Leone and 4 accessions from Togo in sub-population 2, 36 accessions from Sierra Leone and 47 accessions from Togo in sub-population 3, and 26 accessions from Sierra Leone and 24 accessions from Togo in sub-population 4 (Supplementary Table S1, Fig. 1b). The admixed group consisted of 69 accessions from Sierra Leone and 37 accessions from Togo. Few additional smaller peaks observed (Fig. 1b) implied the presence of subgroups within the four major subpopulations."},{"index":2,"size":149,"text":"Therefore, individual STRUCTURE analysis was performed for accessions representing Sierra Leone and Togo. Sub-clustering of cacao germplasm from Sierra Leone and Togo showed that delta K values stagnated at K = 3 and K = 4, respectively (Fig. 2a, b). A substantial degree of admixture was observed in cacao germplasm from Togo in comparison to the cacao germplasm from Sierra Leone. The 235 cacao accessions from Sierra Leone divided in three subpopulations with 102 accessions in subpopulation 1, 29 in subpopulation 2 and 93 in subpopulation 3, while only 11 accessions (4.7%) were in the admixed group (Supplementary Table S1; Fig. 2a). Similarly, 141 cacao accessions from Togo grouped into four subpopulations with 4 accessions in subpopulation 1, 36 in subpopulation 2, 50 in subpopulation 3 and 25 in subpopulation 4. The admixed group consisted of 26 accessions, representing 18.4% admixture among the accessions (Supplementary Table S1; Fig. 2b)."},{"index":3,"size":96,"text":"Using the Bayesian information criterion (BIC) implemented in DAPC, a maximum of K = 4 was obtained, which corresponded to four groups obtained for the combined population and for the germplasm collection from Togo (Fig. 3). Estimation of cluster membership revealed that cluster 3 consisted of the highest number of accessions (158) followed by cluster 2 with 116 accessions, cluster 1 with 86 accessions, and cluster 4 had the least number of accessions (16). Out of 158 accessions in cluster 3, 105 accessions (66.5%) were from Sierra Leone and 53 (33.5%) from Togo (Supplementary Table S1)."},{"index":4,"size":45,"text":"The cluster 2 represented 51 accessions from Sierra Leone and 65 accessions from Togo, while cluster 1 had 68 accessions from Sierra Leone and 18 accessions from Togo. The smallest cluster 4 represented 11 (68.8%) accessions from Sierra Leone and 5 (31.3%) accessions from Togo."},{"index":5,"size":204,"text":"Contrary to the results of STRUCTURE and DAPC, the hierarchical clustering assigned all the 376 cacao accessions to two major clusters with several sub-clusters representing a higher degree of admixture among the accessions across both countries (Fig. 4a). The hierarchical clustering performed for cacao accessions from Sierra Leone and Togo independently is represented in Fig. 5b. The cacao accessions from Sierra Leone divided into three main clusters [Fig. 4b (i)] while that from Togo divided into four main clusters [Fig. 4b (ii)] (Supplementary Table S1), which is in line with the results obtained with STRUCTURE and DAPC analyses. For Sierra Leone, cluster 1 was the largest with 119 cacao accessions while 72 accessions and 44 accessions grouped in cluster 2 and 3, respectively. For Togo, cluster 3 was the largest with 52 cacao accessions followed by cluster 1 (46 accessions), cluster 2 (29 accessions) and cluster 4 with 14 accessions (Supplementary Table S1). A network analysis between cacao accessions from Sierra Leone and Togo (Fig. 5) showed a strong genetic relationship indicating that the cacao accessions share a similar genetic background between these two countries. The central core of the QGRAPH represented a set of cacao accessions that are genetically similar to each other."},{"index":6,"size":105,"text":"The comparison of all three methods (STRUCTURE, DAPC and hierarchical clustering) did not reveal any common clustering patterns among 376 cacao accessions except two accessions which were both from Sierra Leone and represented the same accession name (C77) (Supplementary Fig. 2; Supplementary Table S1). However, the DAPC and hierarchical clustering showed similar patterns of clustering among 135 out of 376 cacao accessions in which 127 accessions were from Sierra Leone and 8 accessions were from Togo, while the DAPC and STRUCTURE analyses showed similar patterns of grouping among 61 out of 376 cacao accessions (30 from Sierra Leone and 31 from Togo) (Supplementary Fig. 2)."}]},{"head":"Analyses of Molecular Variance and Genetic Differentiation","index":6,"paragraphs":[{"index":1,"size":100,"text":"The AMOVA analysis revealed a variability of 86% within accessions and 14% among populations (Combined data) (Table 2). The overall F ST value was 0.601. A signi cant level of population divergence based on pairwise F ST (p < 0.0001) was also observed between different populations while strong genetic relationships with some divergence observed within each population (Table 3). The average F ST -based population differentiation was highest for the combined population (0.096) and lowest for cacao accessions from Sierra Leone (0.049). The pairwise F ST values ranged from 0.010 (combined population vs. Togo) to 0.045 (Sierra Leone vs. Togo). "}]},{"head":"Discussion","index":7,"paragraphs":[{"index":1,"size":92,"text":"The results revealed that genotyping of cacao germplasm collection from Sierra Leone and Togo using 20 KASP-SNPs was highly e cient in assessing the genetic diversity and population structure. The 20 SNPs used were a subset of 100 KASP-SNPs carefully selected based on their polymorphic nature, reproducibility and higher e ciency from earlier studies used in ngerprinting cacao germplasm collection from Ghana [10], Nigeria [11] and other West African countries (unpublished). The biallelic nature of these selected SNPs has a lower error rate in allele calling with higher accuracy and e ciency."},{"index":2,"size":102,"text":"The germplasm studied represent collections maintained in different seed gardens as well as farmers' elds in both countries. Currently, cacao cultivation is unstructured in Sierra Leone with cacao trees labeled as Forestero as the main variety cultivated in the country [22]. However, the other varieties grown are called as 'Amazon cacao', 'Ghanian cacao' and 'Ivorian cacao' with signi cant exchange of planting materials among the farmers. The situation is similar in Togo. A thorough assessment of available genetic diversity and population structure is necessary for genetic enhancement and utilization of wellcharacterized and diverse germplasm in cacao improvement programs in these two countries."},{"index":3,"size":232,"text":"In the present study, diversity indices revealed the presence of substantial genetic diversity in the cacao germplasm from both Sierra Leone and Togo indicated by average He (0.30 and 0.29, respectively) and Ho (0.24 and 0.22, respectively). Similar He was reported for cacao germplasm collections in other West African countries such as Nigeria [11] and Ghana [10] although these studies recorded higher observed heterozygosity in comparison to the current study. This difference in observed heterozygosity detected in the current study could be explained either by the lower number of KASP-SNPs used or may re ect differences in the different genetic materials. Nonetheless, the average He and Ho for the combined (Sierra Leone and Togo) population in the current study was comparable to that obtained for each country individually, indicating that the cacao germplasm present in both countries may share the same genetic background. The study did reveal that eleven accession names are common between both countries and the presence of mislabeled cacao accessions in seed gardens as well as farmers' elds has already been reported in most West African countries [9][10][11]23]. It is also obvious that a set of common cacao germplasm is shared by major cacao producing West African countries such as Cote d'Ivoire, Ghana, Nigeria, and Cameroon including other smaller countries in the region and beyond, indicating that mislabeled and duplicated cacao germplasm may be shared with these smaller countries."},{"index":4,"size":452,"text":"The assessment of genetic relatedness, performed by three different analyses (model-based population structure, IBS-based clustering and DAPC), revealed that the combined population (including cacao accessions from Sierra Leone and Togo) and the germplasm collection from Togo was composed of four main subpopulations while that from Sierra Leone was composed of three main subpopulations. The fact that this clustering was supported by a Bayesian approach, a genetic distance-based method, and a DAPC-based analysis, provides a strong justi cation for the observed population structure and genetic relationships among the cacao accessions. It is worth noticing that in the combined analysis, most cacao accessions (73.37%) were assigned to one of the four subpopulations with probabilities higher than 0.8 and only 106 out of 376 cacao accessions (28.19%) were admixtures. In a recent study of cacao germplasm from Nigeria, the rate of admixtures or off-types ranged from 10-73% among the clones in the seed gardens [11]. These kinds of admixtures and presence of off-types in cacao germplasm from both Sierra Leone (4.7%) and Togo (18.4%) probably indicates labeling errors present in introduced germplasm from other West African countries. This is also supported by the fact that lower mislabeling was observed for cacao accessions from Sierra Leone (33.33%) in comparison to Togo (45.45%). Additionally, the presence of higher level of admixed accessions or mislabeling in cacao samples from Togo probably re ects recent breeding advances involving open pollination and bi-parental crossing among the accessions coupled with strong selection pressure [24]. The labeling errors pose a higher risk of misidenti cation of clones which further gets multiplied when beans/pods from such clones are shared or used for the establishment of new seed gardens or when neighboring farmers share materials with each other, or farmers bring materials from neighboring countries without knowing the genetic potential, which is a common practice in both Sierra Leone and Togo. Olasupo et al [11] explained how the presence of 58% mislabeled accessions in an old seed garden translated into 100% mislabeling in a newly established seed garden in Nigeria. The presence of mislabeling in introduced germplasm from the University of Reading into Sierra Leone and the seed gardens of National Institute in Togo indicates the loss of labels or human errors in writing the labels or misidenti cation, which is commonly observed in clonally propagated crops with long life cycles such as tree crops. There is an enormous implication of introduction of mislabeled or misidenti ed germplasm as it leads to improper prediction in the performance of such accessions and further selection in the improvement program. This may be one of the reasons for lower yields of these introduced cacao germplasm from neighboring countries, in addition to the prevalence of pests and diseases."},{"index":5,"size":71,"text":"1. Network analysis was used to unravel the genetic relationships among the cacao accessions from Sierra Leone and Togo. In the absence of pedigree records and comparison to any international reference clones, the dissection of genetic relationships among cacao accessions from these two countries through network analysis was a reliable methodology. Network analysis has been successfully used in other clonally propagated food crops such as cassava [25] and white yam [26]."},{"index":6,"size":177,"text":"In tree crops such as cacao, which is an outbreeding species with a long life cycle, open pollination is a common process wherein the source of pollen is often unknown. The extent of genetic diversity observed within cacao accessions in the present study could be attributed to this factor as well as identi cation of a good number of unique accessions in both the countries. Hence, these unique cacao accessions in each country can be used as parents in the cacao improvement programs after the preliminary evaluation of these accessions in multi-locations and trait pro ling have been carried out. There is also a need for eld conservation of unique cacao accessions in each country with provision for good management practices and irrigation facilities to mitigate against loss of accessions associated with biotic and abiotic stresses. It may also be necessary to mainstream DNA ngerprinting of introduced germplasm from neighboring countries and international collections for regular auditing of cacao accessions for their true-to-typeness and also to check for pollen contamination during hybridization through open or manual pollination."}]},{"head":"Conclusions","index":8,"paragraphs":[{"index":1,"size":171,"text":"In this study, we made use of KASP-SNP markers to assess the genetic diversity of cacao germplasm from Sierra Leone and Togo. The genetic relationships elucidated among the accessions in each country as well as identi cation of mislabeling has provided the knowledge to carefully explore future cacao improvement by identifying diverse and correct parents. This study also con rmed the reliability and accuracy of KASP-SNPs generated from next-generation sequencing-based genotyping coupled with complementary statistical analyses to generate knowledge on genetic diversity and population structure. Further studies are needed for multi-location phenotyping as well as genotyping with high-density DNA markers. In this study, we identi ed a high degree of mislabeling in most of the introduced materials, which has been attributed to errors from the sources of introduction, labeling errors, and lost labels. This has a consequence on the improvement programs and caution should be taken in the future, to ensure accuracy in labeling and identi cation of the clones/accessions before establishing seed gardens and distribution of planting materials to farmers."}]},{"head":"Materials and Methods","index":9,"paragraphs":[]},{"head":"Cacao sampling","index":10,"paragraphs":[{"index":1,"size":263,"text":"A total of 235 and 141 cacao accessions respectively from Sierra Leone and Togo were sampled from different cacao growing regions (Supplementary Table S1). In Sierra Leone, samples were collected from the existing cacao farms across the three major cacao producing districts: Kenema (N: 08°02.805', W: 011°02.032'), Kailahun (N: 08°21.570', W: 010°23.477'), and Kono (N: 08°36.196', W: 010°56.458'). In addition, samples were collected from minor cacao producing districts such as Bo (N: 08°10.653', W: 011°41.720') and Pujehun Districts (N: 07°08.684', W: 011°22.652'). Samples were also collected from abandoned trees at Njala University research garden in Moyamba district (N: 08°06.493', W: 012°04.950') (Fig. 6a). Similarly, in Togo, samples were collected from 15 cacao plantations located in the areas of Agou (N: 6°49'18'', E : 0°52'04''), Kloto (N: 6°82', E : 0°62'), Danyi (N: 6°49'40,2\", E : 0°43'07\") and Litimé (N: 7°59' ; E : 0°63') (Fig. 6b). Individual trees were tagged and geo-referenced from which fresh young cacao leaf samples were collected and dried using silica gel. The samples were then shipped to the Bioscience Center of the International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria. At IITA, six leaf discs of approximately 5 mm diameter from dried leaf samples of each genotype was punched into labeled 8-strip 1.1 ml propylene tubes with strip caps, up to 12 strips placed on 96-well boxes. A total of four labeled 96well boxes were then shipped to a genotyping service provider (Intertek, Sweden) for automated DNA extraction and genotyping with 20 SNP markers using the KASP assay. Two blank controls were included in each box during genotyping."}]},{"head":"DNA extraction, preparation and genotyping","index":11,"paragraphs":[{"index":1,"size":303,"text":"DNA quantity checked on a 0.8% agarose gel. A total of 20 high quality SNPs were used to genotype the cacao samples. These 20 SNPs belongs to a set of 1536 SNPs identi ed from previous studies that used expressed sequence tags (ESTs) of a wide range of cacao tissue and organs displaying differences in the transcriptome [27,28]. A total of 100 SNPs were then selected from this set of 1536 SNPs based on call rate, representativeness across the ten chromosomes and heterozygosity, and their use by cacao researchers for various studies [18,29,30]. The selected 100 SNPs were then converted using KASP™ assays at LGC Genomics (http://www.lgcgroup.com/kasp) in previous studies on cacao genetic diversity from West Africa [10,11]. For the present study, a subset of 20 highly polymorphic and high quality KASP-SNPs (Supplementary Table S3) was selected from 100 KASP-SNPs, and genotyping was carried out at Intertek, Sweden. The KASP assay protocol followed the KASP manual [31] in which genotyping was carried out using high-throughput PCR SNPline work ow using 1 µL reaction volume in 384-well PCR plate. The KASP genotyping reaction mix consisted of three components including sample DNA (10 ng), marker assay mix comprising target-speci c primers, and KASP-TF™ master mix containing two universal uorescence resonant energy transfer cassettes (FAM and HEX), passive reference dye (ROX™), Taq polymerase, free nucleotides, and MgCl 2 in an optimized buffer solution. The SNP assay mix is speci c to each marker and consisted of kompetitive allele-speci c forward and reverse primer. After PCR, the plates were uorescently read, and allele calls were made using KRAKEN™ software (LGC Biosearch Technologies, UK) and scored on a Cartesian plot, (cluster plot), in order to assign each DNA sample to a genotype class, namely homozygous for either allele 1 or 2 or heterozygous in case of biallelic SNPs."}]},{"head":"Data analyses","index":12,"paragraphs":[{"index":1,"size":265,"text":"Genetic diversity analyses carried out using minor allele frequency (MAF), polymorphism information content (PIC), expected heterozygosity (He) and observed heterozygosity (Ho) parameters were estimated using vcftools and plink 1.9 [32]. A matrix-based identity by state (IBS) was generated and used for hierarchical clustering. An unrooted phylogenetic tree was constructed for visualizing how closely accessions were related within each country using the ape (analyses of phylogenetics and evolution) library package (Paradis et al., 2004) and phangon, an R package [33]. The dissimilarity matrix was then used to construct the network relationships among the cacao accessions from Sierra Leone and Togo using QGRAPH [34] implemented in R. In addition, and as a complementary analysis, Discriminant Analysis of Principal Component (DAPC) was carried out using 'genind object' and the nd.clusters function in the adegenet package. In order to properly assign the accessions to groups, the Bayesian information criterion (BIC) was used to determine the optimum number of clusters to be retained. A binary le was generated from the ltered VCF le and was then subjected to cross-validation approaches for population structure analysis. A cut-off value of 50% ancestry suggested through the Admixture analysis was used to estimate membership probabilities of the accessions for the groups identi ed [35]. The genetic differentiation among and within groups (individual country level and combined) was estimated using the analysis of molecular variance (AMOVA), and the signi cance was tested with a non-parametric approach with 999 permutations using GenAlex v. 6.503 [36]. The coe cient of genetic differentiation among the populations (Sierra Leone, Togo and combined) was calculated based on pairwise F ST  "}]}],"figures":[{"text":"(Figure 1 Figures "},{"text":"Figure 4 a Figure 4 "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1  Descriptive statistics based on 20KASP-SNP markers across Descriptive statistics based on 20KASP-SNP markers across  cacao accessions   cacao accessions Cacao Population N He Ho MAF PIC Cacao PopulationNHeHoMAFPIC Sierra Leone 235 0.30 0.24 0.21 0.22 Sierra Leone2350.300.240.210.22 Togo 141 0.29 0.22 0.19 0.21 Togo1410.290.220.190.21 Combined 376 0.30 0.26 0.23 0.24 Combined3760.300.260.230.24 N: Number of accessions     N: Number of accessions  "},{"text":"Table 2 Analysis of molecular variance (AMOVA) among and within three different genetic populations (Sierra Leone, Togo and Combined) Source d.f. SS MS Est. Var. % Var. p Value Sourced.f.SSMSEst. Var.% Var.p Value Among populations 3 189.16 63.05 0.362 14 0.001 Among populations3189.1663.050.362140.001 Among accessions 372 690.62 1.86 0.000 0 0.001 Among accessions372690.621.860.00000.001 Within accessions 376 809.50 2.15 2.153 86 0.001 Within accessions376809.502.152.153860.001 Total 751 1689.28  2.515 100  Total7511689.282.515100 Fixation index (F ST ) 0.601     0.001 Fixation index (F ST )0.6010.001 d.f.: Degree of freedom, SS: Sum of squares, MS: Mean sum of squares, Est. Var.: Estimated variance, d.f.: Degree of freedom, SS: Sum of squares, MS: Mean sum of squares, Est. Var.: Estimated variance, % Var.: Percent Variance       % Var.: Percent Variance   Table 3    Table 3 Pairwise xation index (F ST ) values among the three populations of cacao  Pairwise xation index (F ST ) values among the three populations of cacao   accessions    accessions   Sierra Leone Togo Combined Population  Sierra Leone TogoCombined Population Sierra Leone  -0.0024     Sierra Leone-0.0024 Togo  0.0451 -0.0040    Togo0.0451-0.0040 Combined Population 0.0201 0.0101 -0.0015   Combined Population0.02010.0101-0.0015 Average F ST  0.049 0.073 0.096   Average F ST0.0490.0730.096  "}],"sieverID":"746cea5e-46c5-4da0-9461-237aab7b0c9e","abstract":"Cacao (Theobroma cacao L.) is a tropical tree species belonging to Malvaceae family and originated in the lowland rainforests of the Amazon. It is one of the major agricultural commodities contributing towards the GDP (gross domestic product) of West African countries contributing about 70% of world's production."}

data/part_5/06cc25e91ac4300e6a23f8661158f49c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06cc25e91ac4300e6a23f8661158f49c","source":"gardian_index","url":"https://dataverse.harvard.edu/api/access/datafile/:persistentId/?persistentId=doi:10.7910/DVN/7ASMDM/FU2S3X"},"pageCount":4,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"b397f20e-778b-42b3-ae4a-ccda4a31d6bd","abstract":""}

data/part_5/0729a159608c58489d1fa07de7ba0308.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0729a159608c58489d1fa07de7ba0308","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7f950fff-a47f-4e5d-aa14-2b84603f438b/retrieve"},"pageCount":23,"title":"","keywords":[],"chapters":[{"head":"Main barrier to implementation","index":1,"paragraphs":[{"index":1,"size":18,"text":"Lack of rapidly available, site-and system-specific knowledge about such solutions and their potential environmental impacts What is CLEANED? "}]},{"head":"What is CLEANED","index":2,"paragraphs":[{"index":1,"size":16,"text":"The CLEANED tool lets users explore multiple impacts of developing livestock value chains in explicit ways."},{"index":2,"size":16,"text":"These indicators fully align with the environmental dimensions of concern, as prioritised by the global experts."}]},{"head":"User Inputs Outputs Group","index":3,"paragraphs":[]},{"head":"CLEANED tool INPUT tab","index":4,"paragraphs":[{"index":1,"size":2,"text":"The Architecture  "}]},{"head":"Outputs and Outcomes","index":5,"paragraphs":[{"index":1,"size":13,"text":"• Rapid results: flagging potential environmental issues associated with planned livestock development strategies"},{"index":2,"size":35,"text":"→So that environmental results can be considered when designing livestock development/investment programs and policies →Promotion of sustainable livestock production practices →Users acknowledge (i) increased recognition of environmental issues, (ii) guidance on policy and investment decisions"}]},{"head":"Impact assessment","index":6,"paragraphs":[{"index":1,"size":12,"text":"An example from Northern Tanzania's dairy VC Focus = intensifying dairy systems"},{"index":2,"size":8,"text":"In 3 distinct sites with 3 typical systems"}]},{"head":"System descriptions","index":7,"paragraphs":[{"index":1,"size":7,"text":"Intervention package -changes in inputs and parameters"}]},{"head":"Results","index":8,"paragraphs":[{"index":1,"size":4,"text":"• Clear environmental co-benefits"},{"index":2,"size":4,"text":"• Overall improved efficiency"},{"index":3,"size":14,"text":"• More absolute emissions with increase in land requirements in Muheza highland and Hai."},{"index":4,"size":48,"text":"• Potential reduction in total GHG emissions in Muheza lowland driven by improved feed efficiency and lower animal numbers • More land required in Muheza highland and Hai but less in Muheza lowland, driven by high yield of improved forages and reduced animal numbers as compared to baseline"}]}],"figures":[{"text":"  "}],"sieverID":"0f6c5146-9d10-49d6-824b-9b98b5b72baa","abstract":""}

data/part_5/0737bd22a97b5d6070e05e2fd5b7caaf.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0737bd22a97b5d6070e05e2fd5b7caaf","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/36854f2e-f829-4547-b99a-df7369e50682/retrieve"},"pageCount":21,"title":"Unravelling marker trait associations linking nutritional value with pigmentation in rice seed","keywords":["AMOVA, analysis of molecular variance","bHLH, basic helix-loop-helix","Bp, base pairs","CV, coefficient of variation","FIS, inbreeding coefficient","GBS, genotyping by sequencing","GI, glycemic index","GLM, generalized linear model","GWAS, genome-wide association study (GWAS","He, expected heterozygosity","Ho, observed heterozygosity","HPLC, high-performance liquid chromatography","LD, linkage disequilibrium","MAF, minor allele frequency","MLM, mixed linear model","MTA, marker trait association","Na, number of alleles","PCA, principal component analysis","Q-Q, quantile-quantile","QTL, quantitative trait loci","RIL, recombinant inbred line","SD, standard deviation","SNP, single nucleotide polymorphism"],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":207,"text":"As the world's population continues to grow, being projected to reach 10.4 billion by 2100 (UN DESA PD, 2022), crop productivity needs to be increased to meet the associated demand for food. However, increasing yields alone does not address the increasing global problems of the double burden of malnutrition. This is particularly relevant for the staple crop rice, which is mostly consumed as polished, white rice. The milling process removes many essential nutritional components, including essential micronutrients such as iron and zinc, vitamins, fatty-acids, phytochemicals, and fiber. This can lead to the development of micronutrient deficiencies among peoples for whom rice is the primary source of calories (Sarma et al., 2018;Sharma et al., 2013;Verma & Shukla, 2011). Furthermore, white rice tends to have a high glycemic index (GI), the starch being rapidly digested in the human intestine (Oko et al., 2012;Valarmathi et al., 2014). The consumption of high GI and glycemic load foods, alongside a decrease in physical activity and rapid urbanization, has contributed to the expansion of non-communicable diseases such as type 2 diabetes, with the Philippines having the highest recorded levels (Ludwig et al., 2018;Saneei et al., 2016). Thus, high consumption of white rice presents as a prime example of the double burden of malnutrition."},{"index":2,"size":114,"text":"Variation in pericarp color is well known in rice, with colors ranging from brown, red, purple to black. Prized in ancient times, pigmented rice is regaining popularity owing to its higher nutritional value (Mbanjo et al., 2020;Priya et al., 2019). The deposition of flavonoid and anthocyanin compounds in the seed pericarp layer, responsible for the color of unpolished rice (Gunaratne et al., 2013;Samyor et al., 2017), also confer many positive health benefits, having anti-cancer, anti-diabetic, and anti-hyperlipidemic properties (Berni et al., 2018;Bhat & Riar, 2015). While major enzymes of the flavonoid pathways have been identified, many aspects underlying the regulation of these pathways in rice seed are less well understood (Mbanjo et al., 2020)."},{"index":3,"size":136,"text":"The ancestor of modern rice varieties had red grain. The wild rice species Oryza rufipogon has red grains and is thought to have a common ancestor with Oryza sativa. The intensity of the red coloration is determined by a complementary interaction between the gene Rc and a second gene, Rd (Furukawa et al., 2006;Sweeney et al., 2006). While Rc is responsible for the accumulation of proanthocyanidins in the pericarp, Rd regulates the level of accumulation. A loss of function mutation within the Rc gene (a 14-bp deletion within exon 6) is thought to be the original mutation that gave rise to the white rice rc allele (Furukawa et al., 2006;Sweeney et al., 2006). Singh et al. (2017) identified an independent haplotype, Rc-H2, which was associated with white pericarps in the Aus group of rice cultivars. Subse-"}]},{"head":"Core Idea","index":2,"paragraphs":[{"index":1,"size":34,"text":"• Rc/bHLH17 and OsIPT5 are associated with a range of nutritionally valuable compounds. • Additional rice candidate genes associated with nutritional value were identified. • Linkages between color-related phenotypes and nutritional content were found."},{"index":2,"size":37,"text":"quent studies have identified additional mutations within the Rc gene, including the Rc-S, rc-gl, and Rc-g alleles that result in reversion to red pigmentation (Brooks et al., 2008;Gross et al., 2010;Singh et al., 2017;Sweeney et al., 2007)."},{"index":3,"size":20,"text":"More recently, Mbanjo et al. (2019) identified other possible mutations, either in Rc or other genes, that affect pericarp coloration."},{"index":4,"size":234,"text":"The regulation of anthocyanins, responsible for blackpurple rice pericarps, is less well understood. Early studies identified two classes of regulatory gene families (R or B, and C1 or Pl) that affect anthocyanin accumulation and regulate the deposition of anthocyanin in various tissues in rice. Two genes were characterized in rice, Ra and Rb, which mapped to chromosomes 4 and 1, respectively (Hu et al., 1996). Maeda et al. (2014) identified three loci that controlled black pigmentation in the rice pericarp, Kala1, Kala3, and Kala4 on chromosomes 1, 3, and 4, respectively. Ectopic expression of Kala4, a member of the basic helix-loop-helix (bHLH) transcription factor gene family, caused by a rearrangement in the promoter region, was shown to result in black seeded rice (Oikawa et al., 2015). The C-S-A gene model has also been proposed as a model for rice seed coloration, the pattern of anthocyanin pigmentation being determined by the allelic status of the genes A1, C1, and S1 (Rachasima et al., 2017;Saitoh et al., 2004;X. Sun et al., 2018). The presence of a functional copy of both C1 and S1 is required for pericarp coloration, while A1 acts as a catalyst for the development of purple pericarps (X. Sun et al., 2018). Sequence variants in other regulatory and/or structural genes associated with purple coloration could also explain the diversity of phenotypes observed (Rachasima et al., 2017;Sakulsingharoj et al., 2016;X. Sun et al., 2018)."},{"index":5,"size":224,"text":"Interrogation of the genetic basis underlying rice pericarp color has also identified a number of quantitative trait loci (QTL; Dong et al., 2008;Matsuda et al., 2012;Tan et al., 2001;Xu et al., 2017). Tan et al. (2001) identified nine QTL in an analysis of flour color parameters using 238 recombinant inbred lines (RILs), while Dong et al. (2008), measuring the extent of the red coloration of the pericarp, found four QTL in a population of 182 RILs. In Dong et al. (2008), the two largest QTL co-located with the genetic loci Rc on The Plant Genome chromosome 7 and Rd on chromosome 1. A QTL analysis using 85 lines suggested that flavonoid content was governed by genetic factors that controlled flavone glycosylation (Matsuda et al., 2012). More recently, 21 QTL were identified that affected the composition and concentration of anthocyanins and proanthocyanidins (Xu et al., 2017). Using a diversity panel of 416 rice accessions, Shao et al. (2011) identified 25 marker-trait associations (MTAs) with color-related traits, confirming the major role of Ra and Rc, but also identifying a number of genetic regions with minor effects. Yang et al. (2018) reported 763 single nucleotide polymorphisms (SNPs) tightly linked to pericarp color in rice landrace germplasm, further confirming the polygenic nature of rice pericarp coloration and demonstrating the need to capture this genetic variation for rice breeding."},{"index":6,"size":133,"text":"Developments in genetic technologies now offers new prospects for crop improvement. Low-cost and parallel sequencing platforms such as genotyping-by-sequencing (GBS) have facilitated high-density marker discovery for crop genetic studies, while cutting-edge analytical technologies have enabled sensitive and accurate detection of the genetic loci associated with the trait of interest (Elshire et al., 2011;He et al., 2014;Mgonja et al., 2017). Spectral imaging techniques have been increasingly used as a rapid phenotyping tool to quantify several seed traits (Elmasry et al., 2019;Mbanjo et al., 2019;D. Sun et al., 2019) and enable efficient assessment of the phenotypic diversity of rice germplasm. Together, the improvements in phenotypic and genotypic analyses support the extensive mining of natural variation in rice germplasm, and discovery of new genes/alleles associated with important rice traits such as those associated with grain coloration."},{"index":7,"size":143,"text":"The aim of this study was to identify genetic associations between pericarp color parameters and nutritional traits that would enable a better understanding of the genetic regulation of these characteristics, while providing simple seed phenotypes that could be screened for by breeders to improve nutritional value in rice. To this aim, we assessed a range of grain nutritional and color parameters, using multispectral imaging, in 364 rice accessions from the International Rice Research Institute (IRRI) Genebank. The rice accessions were subjected to genotyping-by-sequencing, enabling high-density genome-wide SNP markers to be generated. The SNP markers were used to estimate linkage disequilibrium (LD) decay, assess genetic diversity and population structure within the rice germplasm, and perform genome-wide association mapping using the seed traits. Candidate genes within genomic regions identified as showing a highly significant MTA were further analyzed via targeted gene-based association and haplotype analyses."}]},{"head":"MATERIALS AND METHODS","index":3,"paragraphs":[]},{"head":"Plant material","index":4,"paragraphs":[{"index":1,"size":67,"text":"A total of 376 rice accessions from 24 countries were selected from the IRRI Genebank (Table S1). Accessions were chosen to generate a panel of rice genotypes that presented a full range of colored grain, represented the geographical diversity across South-East Asia, and included both traditional rice varieties and landraces. Visual assessment of color was undertaken using Biodiversity indicators for pericarp color (Bioversity International et al., 2007)."}]},{"head":"DNA extraction and genotyping-by-sequencing","index":5,"paragraphs":[{"index":1,"size":161,"text":"Fresh leaf material from seedlings of each rice accession was lyophililized using an Alpha 1-4LD plus Martin Christ Freeze dryer for 72 h, with vacuum set at 0.630 mbar and condenser temperature at −55˚C. DNA extraction was performed using the KingFisher Flex System (www.thermofisher.com). DNA quality was checked on 1% agarose gels, while DNA quantity was assessed using PicoGreen® (www.thermofisher. com) and then standardize to 100 ng/μL for library preparation. To ensure that the DNA was of high quality and suitable for genotyping-by-sequencing (GBS), a trial digest of DNA from 10% of the accessions was performed using the restriction enzyme ApekI. The DNA (minimum concentration of 100 ng/μL) was shipped to Elshire Group Ltd (https:// www.elshiregroup.co.nz) for GBS library construction and sequencing. Libraries were prepared in 188-plex using the ApekI restriction enzyme, following the standard procedure proposed by Elshire et al. (2011). Paired-end sequencing of 188-plex libraries per flow cell channel was performed on the Illumina Hiseq X Ten sequencing platform."}]},{"head":"SNP identification","index":6,"paragraphs":[{"index":1,"size":268,"text":"The Fastq raw files received from Elshire Group Ltd. were processed using the workflow proposed by Elshire (https://gitlab.com/relshire/gbs-pipeline-scripts) with some modifications. The paired-end reads were demultiplexed into individual samples using axe-demux (Murray & Borevitz, 2018). Seqhax (https://github.com/kdmurray91/seqhax) was used to add fake barcodes and append 130 Ns. Seqhax was also used to trim the reads to 130 bp for efficient downstream processing. SNP calling was performed with TASSEL v.5.0 (Bradbury et al., 2007) using the modified enzyme definition. SNP calling was achieved by aligning the tags to the Nipponbare RefSeq genome (Nipponbare IRGSP 1.0 genome). Indels and multiallelic markers were discarded, with only SNP markers being retained. The SNP data were extracted in hapmap file format. Control quality of the genotypic data was performed using SNP & Variation Suite (SVS v8.8.3) (Golden Helix, Inc., Bozeman, MT, USA). Markers with a call rate (CR) of <0.90 and a minor allele frequency (MAF) of <0.05 were removed from the data set. The observed SNP heterozygosity (Ho)/expected SNP heterozygosity (He) values were calculated for individual SNPs using the hardy function in PLINK 1.9 (Chang et al., 2015). SNP inbreeding coefficients were estimated as F = 1 − Ho/He. A cut-off Ho/He <0.5 was used to remove SNPs with an excessive number of heterozygotes. The remaining markers were pruned using SNP & Variation Suite (SVS v8.8.3) (Golden Helix) and the default parameters (window size = 50, window increment = 5, r 2 = 0.5) to produce a set of 5181 markers for LD, population structure, and genetic diversity studies. Rice accessions with a heterozygosity rate above 10% were discarded, leaving 364 accessions."}]},{"head":"Linkage disequilibrium","index":7,"paragraphs":[{"index":1,"size":90,"text":"Genome-wide and chromosome-specific LD values were estimated based on adjacent and pairwise measurements in SNP & Variation Suite (SVS v8.8.3) (Golden Helix, Inc.) and TAS-SEL v.5.0 (Bradbury et al., 2007). The genome-wide LD decay was plotted as LD (r 2 ) versus physical distance using the ggplot 2 function (Wickham, 2016) of R statistical software (Rstudio Team, 2016). A cut-off value of r 2 = 0.2 was set to estimate the average LD. EM algorithm was used as an interactive technique for obtaining maximum likelihood estimates of sample haplotype frequency."}]},{"head":"Population structure","index":8,"paragraphs":[{"index":1,"size":89,"text":"The population structure of the rice accessions was assessed using the selected 5181 SNP markers that reduced the influence of strong LD. The maximum likelihood estimate, implemented in the admixture program (Alexander & Lange, 2011), was used to assign rice accessions to hypothetical groups without prior knowledge of their population affinity. This analysis was carried out using the CoARE facility of the DOST-Advanced Science and Technology Institute (DOST-ASTI) and the Computing and Archiving Research Environment (CoARE) project. A 10-fold cross-validation procedure was used to estimate the most suitable K-value."},{"index":2,"size":88,"text":"The number of K-value computes ranged from 1 to 15. Cross-validation error estimates were compared to identify the K-value with the lowest cross-validation error. The proportion of the putative ancestral population of each rice accession was defined in the Q-matrix. Rice accessions were assigned to a group if the probability of their group membership, as determined by ADMIXTURE, was ≥80%. Accessions with less than 80% probability of a single group membership were classified as admix. Population information of previously characterized accessions was used to identify distinct genetic groups."},{"index":3,"size":88,"text":"Population structure was also assessed using principal component analysis (PCA). The genomic additive relationship matrix was computed using the \"A.mat\" function from the rrBLUP package in the statistical software R (Endelman, 2011), and PCA was performed using the prcomp command in R. The genetic distance between all possible pairs of rice accessions was calculated using the bitwise.dist function implemented in the R package Poppr (Kamvar et al., 2014). A phylogenetic tree was constructed and visualized in the R package-Analyses of phylogenetics and Evolution (ape) (Paradis et al., 2004)."}]},{"head":"Genetic diversity","index":9,"paragraphs":[{"index":1,"size":22,"text":"The following genetic metrics were estimated: the number of alleles (Na), observed heterozygosity (Ho), expected heterozygosity (He), and the inbreeding coefficient (FIS)."},{"index":2,"size":127,"text":"Estimates of genetic diversity were performed with the R package diveRsity, using the divBasic function (Keenan et al., 2013). The genetic metrics He and FIS were estimated for each individual rice accession using Golden Helix SNP & Variation Suite (Golden Helix, Inc.). FIS significance was assessed using a 95% confidence interval and 1000 bootstrap replicates. Significant differences in diversity between groups were estimated using Wilcoxon signed rank test in R (RStudio Team, 2016). Analysis of molecular variance (AMOVA) was performed to estimate the variance between populations and/or groups using R package Poppr (Kamvar et al., 2014). Population differentiation was evaluated using pairwise F ST estimate based on Wright F statistics (Weir & Cockerham, 1984) using the R package diversity (Keenan et al., 2013) and the diffCalc function."}]},{"head":"Multi-spectral imaging of rice pericarps","index":10,"paragraphs":[{"index":1,"size":112,"text":"Dehulled rice seed was used for multi-spectral phenotyping. All digital images were captured using VideometerLab 4 (https://videometer.com) using the method described by Mbanjo et al. (2019). Color difference metrics measured included a* (green to red shade), b* (blue to yellow shade), L (lightness, clarity of the pericarp), intensity, saturation (the saturation of a color describes its degree of purity in relation to neutral gray), and hue (angular specification of the color The Plant Genome perceived as red, yellow, blue, or green), as well as providing an estimate of anthocyanin levels. Geometric traits assessed were area, length, width, and roundness (an estimate of how closely the shape of the grain resembles a circle)."}]},{"head":"Nutritional profiling of rice grain","index":11,"paragraphs":[{"index":1,"size":247,"text":"Eighteen phenolic compounds associated with pericarp pigmentation and nutritional potential (referred to as nutritional traits) were quantified in dehulled seed of the 364 retained rice accessions using high-performance liquid chromatography (HPLC). These compounds included quercetin, kaempferol, catechin, myricetin, flavone, ferulic acid, vanillic acid, syringic acid, gallic acid, cinnamic acid, p-coumaric acid, protocatechuic acid, peonidin and peonidin glycoside, delphinin and delphinidin glycoside, and cyanidin and cyanidin glycoside. Dehulled, unpolished seeds of each rice accession were milled using a Glen Creston Mill and a sieve size of 2 mm. Flour samples of approximately 2.5 g were extracted into 50 mL of ethanol-acetic acid (10% 1 M acetic acid v/v) under reflux conditions for 2 h. Extracts were stored at −20˚C until analyzed. The extracts were prepared for chromatography by centrifugation for 2 min at 13,000 rpm (approximately 10,000 g) and then filtered through a 0.2 μm filter. The compounds were separated using the Dionex Ultimate 3000 HPLC system. A 150 mm × 4.6 mm × 5 μm × 100 Å Kinetix C18 column was used. The mobile phase was a mixture of 1% formic acid and neat acetonitile, ran at 0.2 ml/min, generating a gradient of 0.95:0.05 for 2 min, 0.72:0.10 for 18 min, 0.00:0.28 for 28 min, and then held until 45 min. The column effluent was monitored with a photo diode array detector between 200 and 600 nm, with data recorded at 254, 280, 340, and 520 nm. Three technical replications were performed on each grain sample."}]},{"head":"Phenotype data analysis","index":12,"paragraphs":[{"index":1,"size":21,"text":"The average values from 2 to 3 readings of 20 grain for each accession were calculated and used in further analyses."},{"index":2,"size":160,"text":"Descriptive statistics for each trait (minimum and maximum values, range, median, variance, coefficient of variation [CV], standard deviation [SD]) were obtained using the R package pastecs describe function (Grosjean et al., 2018). Boxplots were constructed to assess variability of the phenotypes and histograms to evaluate trait distributions. Correlations between traits and their level of significance were conducted in the R package Hmisc (Harrell et al., 2020) using the function rcorr. Correlograms were generated using library \"corrplot.\" A correlation network, to visualize interconnectivity between the traits, was built using the R package qgraphic. Phenotypic data were subjected to PCAs using the R package factorMineR (Lê et al., 2008). The relationship between the 364 rice accessions was evaluated using the grain trait phenotypic data sets. Dissimilarity values were computed using the function dist () implemented in R (RStudio Team, 2016) and used with Ward's minimum variance method for hierarchical clustering. The hierarchical clustering result was visualized using ggtree (Yu et al., 2017)."}]},{"head":"Genome-wide association study","index":13,"paragraphs":[{"index":1,"size":113,"text":"The Shapiro-Wilk test was used to check phenotype data for normality. The generalized linear model (GLM) with the appropriate distribution was used for traits that did not follow a normal distribution. Outliers were excluded after computing residuals for each trait. The process was repeated until the model fitted the data. A genome-wide association study (GWAS) was performed in SNP & Variation Suite (SVS v8.8.3) (Golden Helix, Inc.) using the initial data with normally distributed residuals. The geometric and color-related data obtained from the videometer, multispectral analyses of rice grain, as well as the phenolic data, were used to identify MTAs. Several approaches were assessed, including the naïve and mixed linear model (MLM) approaches."},{"index":2,"size":63,"text":"The naïve approach assumes independence of samples, and although the input data were corrected for population stratification, a high inflation rate was obtained (data not shown). Therefore, MLMs implemented in SNP & Variation Suite (SVS v8.8.3) were used. MLM approaches included the single-locus method developed by Efficient Mixed-Model Association eXpedited Model (EMMAX), and the multiplelocus linear mixed model (MLMM; Segura et al., 2012)."},{"index":3,"size":164,"text":"With EMMAX, one SNP at a time is tested for associations with the phenotypic data set (Kang et al., 2010). MLMM assumes that multiple loci are associated with the phenotype and involves a stepwise implementation of EMMAX with multiple iterations. Cofactors were selected at each stepwise implementation by choosing the SNP with the smallest pvalue and adding that as a cofactor in subsequent, forward including steps. A PCA matrix (first three vectors used as fixed covariates) and a GBLUP matrix were used to correct for population stratification and genetic relatedness, respectively. Ten steps were implemented in the MLMM. The optimal step at Bonferroni correction was considered. To evaluate the extent of quantile-quantile (Q-Q)-plot inflation, Q-Q-plots were generated by plotting the negative log10-transformed observed p-values obtained for each SNP marker association against their expected distribution under the null hypothesis of no genetic association. The p-value for each SNP was subject to Bonferroni multiple comparison adjustment. The Bonferroni corrected p-value [−log10(P) = ; P = 0.05/N],"},{"index":4,"size":60,"text":"where N is the total number of markers, was used as a threshold p-value. Markers exhibiting a Bonferroni p-value ≤7.80 10 −7 were considered associated with the trait. In addition, we considered a p-value ≤1 × 10 −5 (−log10(P) ≥ 5) as being suggestive of an SNP/trait association. Manhattan plots of associated SNPs were visualized in GenomeBrowse V1.0 (Golden Helix)."}]},{"head":"Targeted association analysis and functional annotation of target loci","index":14,"paragraphs":[{"index":1,"size":188,"text":"All putative genes lying within the genomic region of significant SNPs, as identified by single-locus GWAS, were subjected to targeted association analysis. The candidate genes were annotated based on the Nipponbare Reference Genome (MSU7) using ANNOVAR (Wang et al., 2010). All SNPs located in the 2 kb upstream (to include promoter region), genic coding, and 1 kb downstream (to include 3′UTR) regions of each gene were extracted using PLINK (Purcell et al., 2007) and tested for association with each trait of interest using EMMAX (Kang et al., 2010), similar to the method of Misra et al. (2020). The Bonferroni correction method (Haynes, 2013) was used to control the false positive rate and further filter for significant SNPs for each candidate gene, using the formula: α/m, where α = 0.05 and m is the number of SNPs per gene. Results were visualized using Cytoscape (Shannon et al., 2003). Edges were defined based on the beta effect of each SNP to the trait of interest, with blue and red representing positive and negative effects, respectively. Source nodes represented the traits of interest, and the target nodes represented the candidate genes."}]},{"head":"RESULTS","index":15,"paragraphs":[]},{"head":"Assessment of rice grain color and nutritional traits","index":16,"paragraphs":[{"index":1,"size":141,"text":"The 364 rice accessions originated from 24 countries, primarily collected from South-East Asia. The number of accessions by country ranged from 1 to 141 (Figure S1, Table S1). Visual assessment of pericarp color qualified 36.54% as red, 24.45% as variable purple, 10.99% as purple, 26.92% as white, with 1.10% being classified as mixed color (Figure S2). The descriptive statistics of the grain geometric and color-related traits (Table S2), and the nutritional traits (Table S3), are shown in Table S4. The greatest CV was observed in the nutritional parameters, as compared to pericarp color and grain geometric parameters. The quantitative variation within each trait is displayed in boxplots (Figure S3). The Shapiro-Wilk test indicated departure from a normal distribution (p < 0.05) for all traits except grain length and width, which showed no significant deviation from normality (p > 0.05) (Figure S4)."},{"index":2,"size":241,"text":"Analysis of the plant phenolic compounds (Figure 1) revealed differences in whole grain between rice accessions, both within and between color groups (Figure S3). Kaempferol, ferulic acid, and protocatechuic acid were present in all rice accessions, while cyanidin, peonidin, and delphinidin were not detected, being found only in the glycosylated form. Gallic acid was also not detected in any of the rice accessions. Quercetin was detected in 84.6% of the accessions and across all grain color types. Catechin was detected in all accessions, except in one purple accession. Delphinidin glycoside and peonidin glycoside were absent from all of the white rice accessions. Delphinidin glycoside was only found in purple and variable purple rice accessions. Peonidin glycoside was predominately present in purple and variable purple rice accessions but was also found in three red accessions. Delphinidin glycoside and peonidin glycoside are recognized as the dominant anthocyanins in rice varieties with black and purple grain (Frank et al., 2012;Shao et al., 2018;Sompong et al., 2011). Cyanidin glycoside, a precursor of anthocyanin, was more abundant in purple and variable purple rice accessions. Vanillic acid, cinnamic acid, and p-coumaric acid were detected in all color groups, and in nearly all accessions. Syringic acid was also reported in all the rice grain color groups. However, a large proportion of red rice accessions (64%) and a considerable number of white rice accessions (19.4%) were devoid of syringic acid. Flavone was present in 27.7% of the rice accessions."},{"index":3,"size":188,"text":"The interconnectivity between geometric, color-related and nutritional traits was revealed by the network visualization analysis (Figure 2) and Pearson's correlation (Figure S5). The network visualization analysis (Figure 2) highlighted the interconnectivity between geometric traits, as well as between videometric color traits. Phenolic compounds that are closely associated through their biochemical synthesis pathways (Figure 1) also clustered together. As expected, network 1 consists of quercetin, kaempferol, cyanidin glycoside, and peonidin glycoside; however, ferulic acid was also part of this cluster, despite being on a different part of the shikimate pathway. Network 2 consisted of the color parameters L, a*, b*, intensity, saturation and hue, and anthocyanin. Catachin, a flavonoid, connected the two networks. Cinnamic acid was not connected to any of the other traits measured. Similarly, Pearson's correlation analysis indicated significant positive correlations between the color parameters saturation and b*, and L and intensity. The highest positive correlation between nutritional parameters was observed between vanillic acid and syringic acid. Anthocyanin levels (measured using the VideometerLAB4) exhibited a strong negative correlation with L and intensity, while vanillic and syringic acid exhibited strong negative correlations with L, intensity, b*, and saturation."},{"index":4,"size":52,"text":"PCA of the geometric, color-related and nutritional traits separated the accessions into three main groups F I G U R E 1 Biochemical pathway of selected phenolic compounds. The schematic shows the biochemical relationship between the phenolic compounds measured in this study (shown in bold) (Katsumoto et al., 2017;Mbanjo et al., 2020)."}]},{"head":"F I G U R E 2","index":17,"paragraphs":[{"index":1,"size":147,"text":"Correlation-based network visualization of geometric, color-related and nutritional traits. Correlation was computed using the rcorr function implemented in the R package Hmisc, and the correlation-based network was constructed using the R package qgraph (Re). Only significant correlations are depicted. The traits are presented as nodes and their relationships as links. Positive correlations are denoted as green edges and negative correlations as red edges. The size of the link corresponds to their relative connectedness. (Figure 3A). The first group contained white accessions and the second group contained red accession, while the third group contained mix, purple, and variable purple accessions. Considerable phenotypic variation was observed among variable and purple rice accessions. The first principal component (PC) explained 39.1% of the phenotypic variation, while PC2 explained 12.8%. The variation in PC1 was mainly associated with nutritional traits, while variation in the PC2 was driven by color-related traits (Figure 3B)."}]},{"head":"SNPs discovery and quality control","index":18,"paragraphs":[{"index":1,"size":96,"text":"The unfiltered hapmap file obtained from Elshire Group Ltd. contained 558,526 SNP markers. After removing SNP with CR <0.9 and MAF <0.05, a total of 81,580 SNP markers were retained. The distribution of the ratio Ho/He showed a binomial distribution (Figure S6). Using a cut-off value of Ho/He < 0.5, heterozygous SNPs markers were filtered out, leaving 64,139 SNPs markers for subsequent analyses (Figure S7). The number of markers on each chromosome The Plant Genome Observed heterozygosity across loci (Ho). Expected heterozygosity across loci (He). Inbreeding coefficient (FIS) showing the 95% confidence intervals (FIS_Low and FIS_High)."},{"index":2,"size":39,"text":"varied from 3,478 on chromosome 12 to 8,756 markers on chromosome 1, with an overall marker density of 1 marker every 5.93 kb (Table S5, Figure S8). Filtering resulted in 64,139 high-quality markers that were used for the GWAS."},{"index":3,"size":43,"text":"Twelve rice accessions with a heterozygosity rate of above 10% were removed, leaving 364 rice accessions for subsequent analyses (Table S1). A selection of 5,181 SNP markers, which reduced the influence of strong LD, were retained for population structure and genetic diversity assessment."},{"index":4,"size":81,"text":"When considering all 364 rice accessions, the LD decay distance was 350.58 kb at r 2 = 0.2. For indica accessions, the value of r 2 decreased to 0.2 at about 223.29 kb, while in japonica the value r 2 decreased to 0.2 at about 189.64 kb (Figure S9). The LD decay varied across chromosomes, with the shortest LD decay distance of 105.34 kb being seen with chromosome 5, and the longest distance of 498.35 kb with chromosome 1 (Table S5)."}]},{"head":"Genetic diversity within the rice accessions","index":19,"paragraphs":[{"index":1,"size":100,"text":"High genetic diversity was present within the 364 accessions (He = 0.24 ± 0.12; Wilcoxon signed rank test, p < 0.05), with higher levels of diversity being observed within the indica (He = 0.24 ± 0.18) compared to japonica (He = 0.18 ± 0.18) rice accessions (Table 1). Within grain color groups, the highest diversity was observed in red rice accessions (He = 0.25 ± 0.13), followed by purple (He = 0.24 ± 0.14) and then non-pigmented (He = 0.22 ± 0.14). The level of inbreeding was high across all groups (He = 0.96 ≤ FIS ≥ 0.97) (Table 1)."},{"index":2,"size":81,"text":"An F ST test was used to assess genetic differentiation between all groups based on allele discrepancies. Genetic differentiation was high between indica and japonica (F ST = 0.31), between indica and temperate japonica (F ST = 0.36), tropical japonica and indica (F ST = 0.33), and between tropical and temperate japonica (F ST = 0.29) groups (Table 2). When accessions were assessed based on pericarp coloration, little differentiation was observed between the different groups (F ST < 0.05) (Table 2)."},{"index":3,"size":111,"text":"AMOVA indicated that 30.30% of the total genetic variation occurred between the indica and japonica groups, while within group differences accounted for 67.53% of the variation. Residual, within rice accession heterozygosity, accounted for 2.18% of the total genetic variation. Comparing groups within sub-species, the molecular variance increased to 32.49%, while between the accessions within those groups, the variation was 65.26% (Table 3). When rice color groups were compared, most of the genetic variation was within the groups (95.02%), with very little between group variation (2.45%), indicating that diversity for pericarp color was equally as high in indica and japonica subspecies groups. The remaining variation was within rice accessions (2.53%) (Table 3)."}]},{"head":"Population structure within the 364 retained rice accessions","index":20,"paragraphs":[{"index":1,"size":186,"text":"The population structure of the 364 rice accessions was evaluated using 5,181 independent SNP markers. Structure analysis indicated the presence of the two main rice subspecies, indica and japonica, as well as subdivisions within each (Figure 4A). The majority of the rice accessions belonged to the japonica sub-species (60.71%), while 36.54% were classified as indica, leaving 2.75% of accessions as admixed (Table S1). PCA supported the ADMIXTURE results, with a clear separation between japonica and indica types (Figure 4B). Subdivisions were identified within each subspecies. Japonica accessions were separated into tropical japonica and temperate japonica, and a subset of indica accessions was classified as aus T A B L E 2 Pairwise F ST comparison between rice subspecies and seed color groups. (Figure 4B). While most of the accessions from the Philippines and Indonesia were tropical japonica, and most of the accessions in the temperate japonica sub-group originated from Thailand, Myanmar, Cambodia, Thailand, and Lao Pdr, PCA did not suggest a relationship between geographical origin and genetic structure (Figure S10). The neighbor-joining tree analysis (Figure 4C) produced similar results to those obtained with PCA and ADMIXTURE."}]},{"head":"Populations","index":21,"paragraphs":[]},{"head":"Genome-wide marker trait associations","index":22,"paragraphs":[{"index":1,"size":81,"text":"A total of 64,139 polymorphic markers with a call rate ≥0.9 and MAF ≥0.5 were used to identify genomic regions associated with the geometric, color-related and nutritional parameters measured in the retained 364 rice accessions. Two MLM approaches were utilized: the single-locus MLM method developed by EMMAX (Kang et al., 2010) and the MLMM (Segura et al., 2012), which assumes that multiple loci are associated with the phenotype. Manhattan plots from the EMMAX and MLMM analyses are shown in Figure S11."},{"index":2,"size":175,"text":"Using EMMAX and the nominal threshold (p ≤ 1 × 10 −5 ) as the cut-off for significance, a total of 743 SNPs, corresponding to 423 unique loci, were identified for 20 of the 25 traits (Table 4, Table S6). The number of MTAs varied from 2 for the color-related traits L and anthocyanin to 204 for ferulic acid. Using MLMM, 93 SNPs, corresponding to 70 unique loci, were detected. The number of MTAs varied from 1 for width and roundness to 9 for ferulic acid (Table 4, Table S7). After applying the Bonferroni correctionvalue of −log10(P) = 6.1, EMMAX identified 401 significant SNPs located within 228 putative loci (Table 4, Table S8). Using the MLMM, 53 significant SNPs, corresponding to 40 loci, were found associated with 16 traits (Table 4, Table S9). No MTAs were reported for the multi-spectral imaging trait intensity, or the phenolic compounds flavone, p-coumaric acid, cyanidin glycoside, and delphinidin glycoside using any of the above approaches. Therefore, these nutritional phenotypes were scored as a binary phenotype, that is, the phenolic "}]},{"head":"Trait","index":23,"paragraphs":[{"index":1,"size":5,"text":"EMMAX nominal threshold (Table S6)"},{"index":2,"size":6,"text":"Chrom. S7) S8) Chrom. S9) Chrom."}]},{"head":"MLMM nominal threshold (Table","index":24,"paragraphs":[]},{"head":"Chrom. EMMAX Bonferroni correction (Table","index":25,"paragraphs":[]},{"head":"MLMM Bonferroni correction (Table","index":26,"paragraphs":[{"index":1,"size":237,"text":"Area MTA for these nutritional traits were only identified when assessing the data set as phenolic compound present or absent (Table S10). Abbreviations: Chrom., chromosome number; n/a, not applicable. compound either being detected (present) or not detected (absent). Applying the Bonferroni correction, this approach detected 12 MTAs using EMMAX and MLMM (Table S10). Significant SNPs associated with grain length on chromosome 3 explained 6.60%-7.92% of the phenotypic variance (Tables S6-S8). The most significant SNP (S03_16840706) was located at the 5′ UTR of LOC_Os03g29540, which encodes for an ATP-dependent protease. SNPs significantly associated with roundness were also found on chromosome 3, accounting for 7.55% of the phenotypic variance (Tables S6-S8). The most significant SNP (S03_16725803) was within an intergenic region between loci LOC_Os03g29370 and LOC_Os03g29389, both of which are annotated as hypothetical proteins without a known functional. Five SNPs were associated with width on chromosome 5, accounting for 7.01%-10.78% of the phenotypic variance (Table S8). We identified 25 SNPs significantly associated with saturation on chromosomes 2, 3, 4, and 7 that explained 6.78%-11.51% of the phenotypic variance (Table S8). For a*, 47 significant SNPs were detected on chromosome 7, while 42 SNPs associated with b* were located on chromosomes 1, 2, 3, 4, and 7 (Table S8). The phenotypic variance explained by the individual SNPs ranged from 6.53% to 16.16%. Thirty-nine SNPs were identified on chromosome 7 associated with hue, explaining 10.51%-19.89% of the phenotypic variation (Table S8)."}]},{"head":"F I G U R E 4","index":27,"paragraphs":[{"index":1,"size":433,"text":"Six significant SNPs associated with syringic acid were found on chromosome 7 (Table S8). The most significant SNP (S07_6090597) was a synonymous SNP within the rice gene OsIPT5, which encodes for the isopentenyl transferase 5 protein (Nguyen et al., 2021). SNP S07_6090597 was also significantly associated with the color-related traits a*, b*, saturation and hue, and catechin levels (Table S8). Forty-six SNPs were associated with catechin on chromosome 7 (Table S8) with the most significant SNP S07_6069227, which explained 26.06% of the phenotype variance, being located at the 3′ UTR of the Rc/OsbHLH17 gene. With ferulic acid, 112 significant SNPs were identified across chromosomes 1, 2, 3, 4, 5, 8, 10 and 12, with phenotypic variance values ranging from 6.68% to 18.11% (Table S8). The most significant SNPs laid within predicted genes peroxidase 2, stress repressive zinc finger protein 3, grain weight 2, DnaJ domain protein C30, and spotted leaf 11. A total of 17 MTAs were found for vanillic acid on chromosome 4 (Table S8). The most significant SNP, explaining 11.37% of the phenotypic variance, was located upstream of the Subtilisin 44 gene involved in protein degradation. The 31 SNPs associated with quercetin were identified on eight chromosomes and explained 7.93% 19403372, 0, Downloaded from https://acsess.onlinelibrary.wiley.com/doi/10.1002/tpg2.20360 by Nigeria Hinari NPL, Wiley Online Library on [12/10/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License The Plant Genome to 15.69% of the phenotypic variance (Table S8). Two of the most significant SNPs (S02_8132119 and S01_8132119), explaining 15.69% and 14.61% of the phenotypic variance of quercetin, were located in the intergenic position between the gene grain weight 2 and LOC_Os02g14730, and within an intronic regions of OsGSTF7, respectively. Eleven SNPs were found to be associated with kaempferol (Table S8). These SNPs were located on chromosomes 1, 2, 3, and 4 and explained between 6.70% to 8.92% of the phenotypic variance. MTAs associated with protocatechuic acid were located on chromosomes 2 and 3, and explained 7.93% to 9.70% of the phenotypic variance (Table S8). The most significant SNP on chromosome 2 (S02_8132119) was located within an intergenic region between a Grain Weight 2 gene and a gene encoding for a ubiquitin carboxyl-terminal hydrolase family protein. On chromosome 3, SNP S02_10771077 was located downstream of LOC_Os03g19200, within an exon of OsALS, which encodes for acetolactate synthase. With peonidin glycoside, seven significant SNPs were detected on chromosomes 3, 4, and 6, with phenotypic variance ranging from 8.79% to 13.47% (Table S8). The most significant SNP (S03_16672065) lies within an exon of LOC_Os03g29280."},{"index":2,"size":105,"text":"Significant MTAs were not found for myricetin and cinnamic acid when applying the Bonferroni correction, but only when using the nominal threshold (Table S7). Assessing the data as a binary phenotype, seven statistically significant associations were detected between SNP markers and cyanidin glycoside located on chromosomes 3 and 4, explaining 7.0% to 9.58% of the phenotypic variance (Table S10). SNP associations with p-coumaric acid were found on chromosome 1 and explained 7.09% to 9.92% of the phenotypic variance (Table S10). A single MTA was found for flavone on chromosome 1, while two MTAs were found for delphinidin glycoside on chromosomes 1 and 3 (Table S10)."},{"index":3,"size":286,"text":"The MLMM approach resulted in fewer significant hits between SNPs and phenotypic traits, using both the nominal and Bonferroni thresholds (Tables S7 and S9), compared to EMMAX (Tables S6 and S8). However, MLMM did identify MTA that were not detected by EMMAX. A significant SNP on chromosome 7 (S07_2177220) was found to be associated with the color-related traits saturation and b*, while an MTA was found for b* on chromosome 1 (S01_15126251) (Table S9). An MTA was found for anthocyanin on chromosome 1 (S01_28051821) (Table S9). This SNP was located in the 5′ UTR of a wax synthase gene, LOC_Os01g48874. Numerous MTAs were found for ferulic acid when applying EMMAX with the Bonferroni correction (Table S8); however, only eight significant SNPs were identified to be associated with ferulic acid levels when applying MLMM and the Bonferroni correction (Table S9), including four SNPs that were not detected by EMMAX. Four MTAs were found for kaempferol on chromosomes 3, 7, 9, and 11, and three MTAs for quercetin on chromosomes 4 (S04_1780371), chromosome 10 (S10_13843153), and chromosome 12 (S12_9926677) (Table S9). The SNP on chromosome 12 was located within LOC_Os12g17340, which encodes for a CC-NBS-LRR resistance protein MLA13. The SNP on chromosome 4 was also associated with ferulic acid (Table S8). Two MTAs were found for syringic acid on chromosomes 5 and 6, located in LOC_Os05g31525 and LOC_Os06g03676 (Table S9). An additional MTA was found for catechin on chromosome 7 (S07_6259359) that was also associated with the color-related traits hue and a* (Table S7). Four MTAs were found for peonidin glycoside, two on chromosome 9 (S09_21842414 and S09_5624836), one on chromosome 3 (S03_2052290), and a fourth on chromosome 1 (S01_28597777), which was also associated with kaempferol (Table S6)."}]},{"head":"Co-localization of marker trait associations between traits","index":28,"paragraphs":[{"index":1,"size":193,"text":"Many of the significant SNPs were associated with more than one trait (Tables S11-S14). Most colocalization occurred between nutritional traits, and nutritional and color-related traits. Many of the multi-trait loci involved MTA for ferulic acid, quercetin, and kaempferol. In addition, some of these loci were also associated with b*. A large number of multi-trait loci were found that linked catechin levels with the color-related traits hue, a* and b*, as well as saturation and syringic acid. Links were also found between vanillic acid and saturation and b*, and between peonidin glycoside and saturation and b*. The SNP S07_6069227, located in the 3′ UTR of the RC/OsbHLH17 gene, was associated with catechin and syringic acid, and the color-related traits hue, saturation, a*, and b*. The SNP S03_16672065, located within LOC_Os03g29280 (hypothetical protein), was linked with saturation, b*, and peonidin glycoside. The SNP S02_8132119 was associated with quercetin, ferulic acid and protocatechuic acid, and the color-related traits saturation and b*. S02_8132119 is located between the rice gene OsGW2, which encodes for Grain Width and Weight2, and LOC_Os02g14730. OsGW2 represses cell expansion in rice endosperm, affecting grain filling, weight, width, and yield (Song et al., 2007)."}]},{"head":"Association network of targeted multi-spectral imaging and nutritional data","index":29,"paragraphs":[{"index":1,"size":124,"text":"Targeted association analysis identified 520 significant SNPtrait interactions with high beta effects (−0.3 > β or β > 0.3), which involved 67 unique SNPs, within 52 candidate genes, that were associated with 24 traits of interest (Figure 5, Figure S12, Table S15). The reference alleles of 14 candidate genes with positive beta effects associated with nutritional traits displayed negative beta effects with color-related traits. Four F I G U R E 5 Association network summary of candidate genes linked with rice grain geometric, color-related and nutritional traits. Targeted association analysis identified 520 significant single nucleotide polymorphism (SNP)-trait interactions with high beta effects (−0.3 > β or β > 0.3), which involved 67 unique SNPs, within 52 candidate genes, associated with 24 traits of interest."},{"index":2,"size":182,"text":"SNPs within an acetolactate synthase gene (OsALS) showed positive beta effects for cyanide glycoside, ferulic acid, peonidin glycoside, quercetin, syringic acid, and vanillic acid but negative beta effects with b* and saturation. Similarly, the candidate gene OsIPT5 showed positive effects with cyanidin glycoside, peonidin glycoside, syringic acid, and vanillic acid but negative effects with saturation, a*, and b*. The reference alleles of three significant SNPs within the gene Rc/bHLH17 showed positive effects for syringic acid and vanillic acid but negative effects for saturation, a*, and b*. Both candidate genes OsIPT5 and Rc/bHLH17 exhibited strong associations with catechin content. The candidate gene OsGSTF7, which encodes a glutathione S-transferase, contained two intronic SNPs positively associated with cyanidin glycoside, ferulic acid, kaempferol, myricetin, peonidin glycoside, quercetin, syringic acid, and vanillic acid but showed negative effects with a*, b*, and saturation. Similarly, two candidate genes involved in protein degradation, OsSub44 (Subtilisin 44, with potential serine-type endopeptidase activity; Zheng et al., 2022) and OsFbox97 (a cyclin-like F-box domain containing protein 97; Hua et al., 2011) exhibited positive effects with nutritional traits but negative effects with color-related traits."},{"index":3,"size":81,"text":"Nine candidate genes, having SNPs positively affecting color-related traits but negatively affecting nutritional traits, included OsSRZ3 (C. Zhang et al., 2020), which positively affected saturation, a*, b*, and L, but negatively affected cyanidin glycoside, ferulic acid, kaempferol, peonidin glycoside, quercetin, and vanillic acid levels. Similarly, OsDiC30 (a DnaJ domain protein C30) was negatively associated with anthocyanin, cyanidin glycoside, protocatechuic acid, ferulic acid, myricetin, peonidin glycoside, quercetin, syringic acid, and vanillic acid, while showing positive effects with b*, L, intensity, and saturation."},{"index":4,"size":100,"text":"The association network analysis also helped to identify candidate genes unique to specific phenolic compounds. LOC_Os03g14349, a Ty1-copia subclass retrotransposon and LOC_Os03g02280, a DUF584 domain containing protein, were associated with quercetin. An upstream SNP of LOC_Os03g62530, a conserved gene with unknown function, strongly associated with kaempferol, while protocatechuic acid was associated with the predicted gene LOC_Os05g43800 and cinnamic acid with an exonic SNP of LOC_Os05g38984. With grain geometric traits, the known gene OsGW5 was positively associated with width but negatively associated with roundness. Grain length was also associated with SNPs from three loci on chromosome 3: LOC_Os03g29540, LOC_Os03g29389, and LOC_Os03g29370."}]},{"head":"3.8","index":30,"paragraphs":[{"index":1,"size":123,"text":"Traits associated with Rc/bHLH17 and IPT5 gene haplotypes Significant SNPs found within the 3′UTR and exonic regions of the Rc/bHLH17 gene identified four haplotypes, each contributing to distinct phenotypes (Figure S13). Rice accessions with the haplotype AGC were mostly red, while the rice accessions with the TAT haplotype varied in grain color. The Plant Genome Accessions carrying the TAT haplotype in general had higher levels of cinnamic acid, cyanidin glycoside, kaempferol, myricetin, p-coumaric acid, peonidin glycoside, quercetin, and vanillic acid, while AGC haplotype accessions showed higher a*, b*, and saturation values. However, AGC rice accessions had higher levels of catechin compared to TAT accessions. The other two haplotypes, AAT and TGC, were rare haplotypes represented by only nine and three rice accessions, respectively."},{"index":2,"size":63,"text":"The four haplotypes found by five significant SNPs located within exonic regions of the IPT5 gene also showed distinct phenotypes (Figure S14). The haplotype CGCCT showed lower a*, b*, saturation and catechin levels, but higher levels of cyanidin glycoside, ferulic acid, flavone, quercetin, vanillic acid, myricetin, p-coumaric acid, peonidin glycoside, and syringic acid, as well as less roundness compared to other haplotype groups."},{"index":3,"size":96,"text":"Combining SNPs from Rc/bHLH17 and IPT5 generated six haplotypes with distinct phenotypes (Figure 6). Most of the rice accessions had haplotype TATCGCCT and included rice lines of all grain color groups. Haplotype TATCGCCT had significantly higher levels of cyanidin glycoside, myricetin, and p-coumaric acid but lower levels of catechin than haplotype AGCTAGGC, as well as low saturation, a* and b* levels, and high hue compared to the red accessions within haplotype AGCTAGGC. Haplotype AATCGCCT also differed from the other haplotypes, having lower saturation, a*, b*, anthocyanin, and catechin values and high values of L and intensity."}]},{"head":"DISCUSSION","index":31,"paragraphs":[{"index":1,"size":96,"text":"The international rice genebank maintained by IRRI hosts an untapped reservoir of rice accessions with varying pericarp coloration, providing a wealth of biodiversity for rice nutritional breeding. By targeting specific phenolic compounds, with known nutritional potential, this study was able to identify rice accessions, candidate genes and specific haplotypes of value for the enhancement of the nutritional potential of new rice varieties. The identification of multi-trait loci, that contribute to both pericarp color-related parameters and the level of valuable phenolic compounds, provides the opportunity to select for nutritionally valuable rice accessions based on these color-related parameters."},{"index":2,"size":105,"text":"GWAS is a powerful tool to identify genetic variation associated with traits. Using a panel of 364 accessions and 64,139 SNPs markers, significant genomic regions associated with geometric, color-related, and nutritional-related traits were identified. Many of the significant SNPs were associated with more than one trait, with most colocalization occurring between nutritional traits, and between nutritional and color-related traits. The colocalization of trait loci aligned well with the correlations seen between traits in the Pearson correlation and network visualization analyses. The association networks, based on the identified candidate genes, further emphasized the interconnectivity between traits, highlighting the genetic linkage between pericarp pigmentation and secondary metabolites."},{"index":3,"size":132,"text":"One of the most significant SNPs, S07_6069227, was located in the 3′ UTR of the gene Rc/bHLH17 and associated with catechin and syringic acid, and the color-related traits hue, saturation, a*, and b*. Being a positive regulator of proanthocyanidin, Rc/bHLH17 is known to play a key role in regulating pericarp color in rice (Sweeney et al., 2006). The targeted association analysis further identified positive beta effects for the gene OsIPT5, which encodes for an isopentenyl transferase and has previously been suggested to play a role in pericarp color and metabolite accumulation (Brotman et al., 2021). Positive beta effects were found between OsIPT5 and cyanidin glycoside, peonidin glycoside, syringic acid, and vanillic acid, as well as with roundness and hue, while negative beta effects were found for OsIPT5 with a*, b*, and saturation."},{"index":4,"size":148,"text":"The six haplotypes identified from significant SNPs within the genes Rc/bHLH17 and OsIPT5 identified a range of phenotypes, particularly for color-related traits (Figure 6). The genes Rc/bHLH17 and OsIPT5 have previously been suggested to play a role in catechin accumulation, pericarp color determination, starch structural composition, glycemic index values, and antioxidant metabolites (Brotman et al., 2021). The haplotypes identified in this study were similar to the haplotypes identified by Brotman et al. (2021), of which haplotype 4 (GATGCGACCAGAGTTAGAGGTGT) exhibited antioxidant activity, contributing to increased anti-cancer properties, as demonstrated using cancer cell lines. However, in this study, phenotypic variation between the six haplotypes was observed not only for catechin but also for protocatechuic acid, anthocyanin, cyanidin glycoside, myricetin, and p-coumaric acid, suggesting that Rc/bHLH17 and OsIPT5 may have an important role in the regulation of a wider range of phenolic compounds, and not only those directly conferring pericarp color."},{"index":5,"size":106,"text":"Aside from Rc/bHLH17 and OsIPT5, multiple candidate genes, not previously reported, were found to be linked to the color-and nutritional-related traits analyzed. These genes fell into two groups, those that conferred positive effects toward nutritional traits, but negative effects towards color-related traits, and those that conferred positive effects toward colorrelated traits, but negative effects toward nutritional traits. It is evident that both groups of candidate genes could be key regulators of pigmentation, as well as metabolite profiles in rice. Moreover, color-parameters such as a*, b*, L*, saturation, and intensity could be used as indicators of the presence or abundance of the associated phenolic compounds in rice."},{"index":6,"size":463,"text":"F I G U R E 6 Haplotype analysis of significant single nucleotide polymorphisms (SNPs) identified in Rc/bHLH and IPT5 genes. Significant SNPs within the genes Rc/bHLH17 and OsIPT5 showed functional haplotypes explaining variation within geometric, color-related, and nutritional-related traits of the 364 rice accessions. The Plant Genome Some of the candidate genes included OsPhyB, OsGSTF7, OsALS, OsSub44, OsRopGEF, OsSRZ3, and OsBCH2. The candidate gene OsPhyB encodes for a phytochrome B protein, which is the main photoreceptor for red light (Nagy & Schafer, 2002) and interacts with bHLH transcription factors to regulate red/far-red light phototransduction (Rausenberger et al., 2010). Previously, it has been noted that the biosynthesis of anthocyanin and proanthocyanidin is influenced by high light intensity (Ma et al., 2018;Y. Zhang et al., 2018), supporting the observations of rice grain having deeper pigmentation when grown at higher elevations. The gene OsGFT7 encodes for a glutathione S-transferase (GST). The family of GST genes is known to be involved in detoxification of xenobiotics (Armstrong, 1997), regulation of redox homeostasis for cell protection against UV radiation and oxidative stress (Jiang et al., 2010), herbicide response (Cummins et al., 2013), as well as biosynthesis and transport of secondary metabolites (Dixon et al., 2010). OsALS encodes for an acetolactate synthase, a thiamine pyrophosphate enzyme involved in the first biosynthetic step in branched-chain amino acid synthesis, catalyzing the reaction of two pyruvate molecules to produce acetolactate, which is known as an intermediate product of valine, leucine, and isoleucine (Yean et al., 2021). OsSub44 encodes for a putative subtilisin homologue having orthologues functions with cucumisin and/or xylem serine proteinase 1. These proteinases are known to be involved in pathogen response and programmed cell death in plants (Vartapetian et al., 2011). OsRopGEF encodes for a rho guanine nucleotide exchange factor whose orthologue in Arabidopsis, ATROPGEF7, is involved in pattern formation during the formation of secondary cell wall pits (Nagashima et al., 2018). The candidate gene OsSRZ3, which was negatively associated with the phenolic compounds kaempferol, quercetin, ferulic and vanillic acids, and cyanidin and peonidin glycosides, but positively associated with the color-related traits a*, b*, L, and saturation, encodes for a stress repressive zinc finger protein. It belongs to a gene family where the genes contain at least one highly conserved SRZ domain and are known to be involved in abiotic stress responses (C. Zhang et al., 2020). The color-related traits intensity and L* were positively associated with the candidate gene OsBCH2, which encodes a beta-carotene hydroxylase 2 involved in the hydroxylation of beta-carotene, producing zeaxanthin, known to be important in the regulation of the xanthophyll cycle in plants and adaptation to high light stress (Johnson et al., 2008). Zeaxanthin, together with lutein, comprises more than 90% of the total carotenoids found in rice (Ashraf et al., 2017;Melini & Acquistucci, 2017)."},{"index":7,"size":129,"text":"The development of markers that identify the Rc/bHLH17 and IPT5 haplotypes associated with enhanced nutritional value would provide robust tools for selecting these positive alleles at early stages within a rice breeding program, eliminating the need for extensive phenotyping. Bi-parental mapping of informative crosses would further validate many of the additional MTAs and candidate genes identified in this study. These candidate genes, interlinking color-related traits with phenolic content, provide useful targets for future experimental studies, including haplotype analysis. The relevant haplotypes could then be used to screen further rice accessions to select appropriate rice donor lines to breed for new rice varieties with enhanced nutritional value. The associations between phenolic compound content and color-related traits could also enable nutritionally valuable rice genotypes to be identified quickly through videometer analysis. "}]},{"head":"AU T H O R C O N T R I B U T I O N S","index":32,"paragraphs":[]},{"head":"A C K N O W L E D G M E N T S","index":33,"paragraphs":[{"index":1,"size":23,"text":"The work in this manuscript was supported by the UK Biotechnology and Biological Sciences Research Council (BBSRC) Newton Fund Rice Initiative project BB/N013603/1."}]},{"head":"C O N F L I C T O F I N T E R E S T S T A T E M E N T","index":34,"paragraphs":[{"index":1,"size":7,"text":"The authors declare no conflict of interest."}]},{"head":"D A T A AVA I L A B I L I T Y S T A T E M E N T","index":35,"paragraphs":[{"index":1,"size":13,"text":"All data are available in the manuscript and the supplementary materials section online."}]},{"head":"O R C I D","index":36,"paragraphs":[{"index":1,"size":4,"text":"Lesley Ann Boyd https://orcid.org/0000-0001-6420-0990 "}]},{"head":"R E F E R E N C E S","index":37,"paragraphs":[]}],"figures":[{"text":"F I G U R E 3 Principal component analysis (PCA) of the 364 retained rice accessions using geometric, color-related and nutritional traits. (A) PCA showing the distribution of the 364 rice accessions relative to visual color assessment. (B) PCA trait distribution and contribution to the total variance for the Videometer parameters saturation (Sat), Cielab_L (L), Cielab_A (a*), Cielab_B (b*), hue, intensity (Int), and anthocyanin (Anth), and the nutritional traits protocatechuic acid (DBHA), peonidin glycoside (Pn-gly), quercetin (Que), kaempferol (KEM), cinnamic acid (CA), syringic acid (SA), vanillic acid (VA) ferulic acid (FA), and cyanidin glycoside (Cy-gly). "},{"text":"19403372, 0 , Downloaded from https://acsess.onlinelibrary.wiley.com/doi/10.1002/tpg2.20360 by Nigeria Hinari NPL, Wiley Online Library on [12/10/2023]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License T A B L E 4 Summary of the marker trait associations (MTAs) detected by applying a single locus mixed-linear model implemented in Efficient Mixed-Model Association eXpedited Model (EMMAX) and the multi-locus linear mixed model (MLMM). "},{"text":" Analysis of the genetic relationship between the 364 retained rice accessions, applying 5,181 independent single nucleotide polymorphism (SNP) markers. (A) Structure analysis. Each individual accession is represented by a vertical line. The proportion of the color of each vertical line represents the proportion contributed by the ancestral population. The best supported clustering (K = 2) divided the 364 rice accessions into two main groups, corresponding to indica and japonica rice types. With increased K values (K = 3, 4, and 5), additional substructure within each cluster was observed. (B) Principal component analysis (PCA). The additive relationship matrix was calculated in rrBLUP using the R package rrBLUP (Endelman, 2011) and used as input to the PCA. (C) Neighbor-joining tree, constructed based on bitwise genetic distance. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" Summary statistics of genetic diversity indicators across rice subspecies and seed color groups. Total number of alleles observed across SNP marker loci (A). Total observed alleles per locus as a percentage of population samples (%). Mean allele richness (Ar).   A ± SD Percentage Ar ± SD Ho ± SD He ± SD Fis Fis_Low Fis_High A ± SDPercentageAr ± SDHo ± SDHe ± SDFisFis_LowFis_High Subspecies Indica 9444 ± 0.38 91.14 1.79 ± 0.38 0.01 ± 0.03 0.24 ± 0.18 0.96 0.95 0.97 SubspeciesIndica9444 ± 0.3891.141.79 ± 0.380.01 ± 0.030.24 ± 0.180.960.950.97 groupings          groupings  Japonica 9139 ± 0.42 88.2 1.7 ± 0.42 0.01 ± 0.02 0.18 ± 0.18 0.96 0.95 0.97 Japonica9139 ± 0.4288.21.7 ± 0.420.01 ± 0.020.18 ± 0.180.960.950.97  temperate 7840 ± 0.50 75.68 1.47 ± 0.47 0.01 ± 0.03 0.13 ± 0.18 0.95 0.92 0.96 temperate7840 ± 0.5075.681.47 ± 0.470.01 ± 0.030.13 ± 0.180.950.920.96  japonica         japonica  Tropical 8849 ± 0.45 85.4 1.59 ± 0.45 0.01 ± 0.02 0.16 ± 0.18 0.96 0.95 0.97 Tropical8849 ± 0.4585.41.59 ± 0.450.01 ± 0.020.16 ± 0.180.960.950.97  japonica         japonica Color Purple 10328 ± 0.08 99.67 1.98 ± 0.10 0.01 ± 0.02 0.24 ± 0.14 0.97 0.96 0.98 ColorPurple10328 ± 0.0899.671.98 ± 0.100.01 ± 0.020.24 ± 0.140.970.960.98  Red 10356 ± 0.03 99.94 1.99 ± 0.04 0.01 ± 0.02 0.25 ± 0.13 0.97 0.97 0.98 Red10356 ± 0.0399.941.99 ± 0.040.01 ± 0.020.25 ± 0.130.970.970.98  White 10311 ± 0.1 99.51 1.97 ± 0.12 0.01 ± 0.02 0.22 ± 0.14 0.96 0.93 0.97 White10311 ± 0.199.511.97 ± 0.120.01 ± 0.020.22 ± 0.140.960.930.97  "},{"text":" Analysis of molecular variance (AMOVA) between and within rice subspecies and seed color groups.     F ST Lower Upper F STLowerUpper Subspecies groupings Indica vs. japonica   0.31 0.30 0.31 Subspecies groupingsIndica vs. japonica0.310.300.31  Indica vs. temperate japonica  0.36 0.34 0.38 Indica vs. temperate japonica0.360.340.38  Indica vs. tropical japonica  0.33 0.32 0.33 Indica vs. tropical japonica0.330.320.33  Temperate japonica vs. tropical japonica 0.29 0.26 0.31 Temperate japonica vs. tropical japonica0.290.260.31 Color groupings Purple vs. red   0.02 0.01 0.04 Color groupingsPurple vs. red0.020.010.04  Purple vs. white   0.03 0.02 0.05 Purple vs. white0.030.020.05  Red vs. white   0.02 0.01 0.05 Red vs. white0.020.010.05 T A B L E 3 Source of variation Degree of freedom Sum of squares Mean sum of square Estimate variance Percentage of variation T A B L E 3 Source of variationDegree of freedomSum of squaresMean sum of squareEstimate variancePercentage of variation Sub-species Between groups 1 99,218.84 99,218.84 299.86 30.30 Sub-speciesBetween groups199,218.8499,218.84299.8630.30  Between accessions within group 349 474,011.20 1358.20 668.33 67.53 Between accessions within group349474,011.20 1358.20668.3367.53  Within accessions 351 7557.52 21.53 21.53 2.18 Within accessions3517557.5221.5321.532.18  Total 701 580,787.57 828.51 989.72 100 Total701580,787.57 828.51989.72100 Color Between groups 2 12,438.21 6219.10 19.69 2.45 ColorBetween groups212,438.216219.1019.692.45  Between accessions within group 356 550,759.52 1547.08 763.38 95.02 Between accessions within group356550,759.52 1547.08763.3895.02  Within accessions 359 7290.82 20.31 20.31 2.53 Within accessions3597290.8220.3120.312.53  Total 717 570,488.55 795.66 803.38 100 Total717570,488.55 795.66803.38100 Subspecies groups Between groups 2 132,656.7 66,328.33 309.75 32.49 Subspecies groups Between groups2132,656.766,328.33309.7532.49  Between accessions within groups 348 440,573.4 1266.02 622.242 65.26 Between accessions within groups348440,573.41266.02622.24265.26  Within accessions 351 7557.52 21.53 21.53 2.26 Within accessions3517557.5221.5321.532.26  Total 701 580,787.6 828.51 953.53 100 Total701580,787.6828.51953.53100  "},{"text":" Edwige Gaby Nkouaya Mbanjo: Data curation; formal analysis; investigation; methodology; resources; validation; writing-original draft; writing-review & editing. Erstelle A. Pasion: Formal analysis; writing-original draft; writing-review & editing. Huw Jones: Formal analysis; investigation; methodology; writing-original draft; writing-review & editing. Socorro Carandang: Methodology; writing-review & editing. Gopal Misra: Formal analysis; writing-review & editing. John Carlos Ignacio: Data curation; formal analysis; writing-review & editing. Tobias Kretzschmar: Conceptualization; data curation; investigation; project administration; supervision; writingreview & editing. Nese Sreenivasulu: Conceptualization; data curation; project administration; resources; supervision; writing-review & editing. Lesley Ann Boyd: Conceptualization; funding acquisition; investigation; project administration; supervision; writing-original draft; writing-review & editing.  "},{"text":" Alexander, D. H., & Lange, K. (2011). Enhancements to the ADMIX-TURE algorithm for individual ancestry estimation. BMC Bioinfor-  "}],"sieverID":"69fdfede-e0dc-499a-8256-ff45e5b7008d","abstract":"While considerable breeding effort has focused on increasing the yields of staple crops such as rice and the levels of micronutrients such as iron and zinc, breeding to address the problems of the double-burden of malnutrition has received less attention. Pigmented rice has higher nutritional value and greater health benefits compared to white rice. However, the genetic associations underlying pericarp coloration and accumulation of nutritionally valuable compounds is still poorly understood. Here we report the targeted genetic analysis of 364 rice accessions, assessing the genetic relationship between pericarp coloration (measured using multi-spectral imaging) and a range of phenolic compounds with potential nutritional and health-promoting characteristics. A genome-wide association study resulted in the identification of over 280 single nucleotide polymorphisms (SNPs) associated with the traits of interest.Many of the SNPs were associated with more than one trait, colocalization occurring between nutritional traits, and nutritional and color-related traits. Targeted association analysis identified 67 SNPs, located within 52 candidate genes and associated with 24 traits. Six haplotypes identified within the genes Rc/bHLH17 and OsIPT5 indicated that these genes have an important role in the regulation of a wide range of phenolic compounds, and not only those directly conferring pericarp color. These identified genetic linkages between nutritionally valuable phenolic compounds and pericarp color present not only a valuable resource for the enhancement of the nutritional value of rice but an easy method of selection of suitable genotypes."}

data/part_5/07b1b169db1a7b1a7e5ad47833998464.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07b1b169db1a7b1a7e5ad47833998464","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/914744ab-241f-4032-96c8-f52eca363156/retrieve"},"pageCount":25,"title":"Between a Rock and a Hard Place: Early Experience of Migration Challenges under the Covid-19 Pandemic","keywords":[],"chapters":[{"head":"IWMI -vi","index":1,"paragraphs":[{"index":1,"size":2,"text":"Executive Summary"}]},{"head":"Context","index":2,"paragraphs":[{"index":1,"size":77,"text":"The context of global migration has changed dramatically since the beginning of 2020. Both within and between countries there has been a substantial curtailment of movement. As a result of multiple lockdowns, economic activity has severely declined and labor markets have ground to a halt. In mid-2020, the spectre of mass unemployment in industrialized economies loomed on the horizon. For both migrant hosting and origin countriessome are substantially both -this poses a set of complex development challenges."},{"index":2,"size":102,"text":"Some speak of a 'new normal' emerging, perhaps with less movement, more use of technology and, overall, a reduction in the global transport system that we have become accustomed to using. However, this suggests that there is suppressed demand to move for work elsewhere as well as a change in the nature of labor markets, particularly those that seek to make profits from large wage differentials within and between countries. There is no apparent evidence that this is yet the case; and an eagerness to work abroad, or in cities, remains the norm among the burgeoning youth in many low-and middleincome economies."},{"index":3,"size":74,"text":"The wider context of economic shock and changes to social systems, including the widely-reported mass movements of people within -and to some extent between -countries, seem to herald a different global migration order. However, it is worth asking whether this is really going to be the case, as many of the country examples in this short report make plain (note: this report was compiled from information available at an early stage of the pandemic)."},{"index":4,"size":47,"text":"While the coupling of health risks with migrant movement may establish new levels of control and scrutiny, and to some degree attach new stigmas to migration in some contexts, the economic imperative of labor demand and supply at an international level means challenges will probably be overcome."}]},{"head":"Findings","index":3,"paragraphs":[{"index":1,"size":150,"text":"The project titled AGRUMIG -'Leaving something behind' -Migration governance and agricultural & rural change in 'home' communities: Comparative experience from Europe, Asia and Africa works in seven countries (China, Ethiopia, Kyrgyzstan, Moldova, Morocco, Nepal and Thailand). All these countries have been severely affected by the rupture in migration patterns. The impacts are a complex of factors related to movement into, within and from countries. Some countries are both sending and receiving migrants, others are predominantly sending. Although many migrant communities have been stranded abroad, and some have been repatriated, or have returned voluntarily, the experience varies enormously. Overall, there would seem to have been in reality little migrant return, not just because of the significant travel barriers in place, but because some have opted to remain and continue to seek work. In other words, the rupture is in the logistics of movement, rather than in the economic logic of migration."},{"index":2,"size":97,"text":"Where migrants have been left jobless and marooned in host countries, there has been substantial hardship, but little support provided by their countries of origin. Some have eventually been repatriated, but the challenges of abrupt return without substantial resources to fall back on, and the weight of expectation not fulfilled, can be substantial. In some cases, families had invested heavily and accumulated large debts to send family members abroad. For some who remain in host countries, their situation is tenuous and, if informal and 'ungoverned' by an official contract, they may be at constant risk of deportation."},{"index":3,"size":73,"text":"At a wider level, there is perhaps a new 'health nationalism' emerging, that is both rooted in class perceptions of risk and the 'othering' of foreign communities. Being on the outside coming in implies possible exposure to and transmission of the coronavirus. In a certain sense, moreover, governments may not be keen on too many migrants returning, not so much because of infection risk, but because there are no jobs to return to."},{"index":4,"size":99,"text":"Those living in more crowded communities within countries may be stigmatized by association with 'breaching' lockdowns -largely out of necessity due to the informal nature of their working environments and the reality of living in higher-density communities. An emerging 'moralizing discourse' can stigmatize the inhabitants of working class neighborhoods, where there is greater spread associated with proximity and the need to go about their (often informal) livelihood activities, the accusation being that they are not respecting the 'rules of confinement'. The rupture is also, therefore, perhaps at a societal level, with additional implications for internal migration in some countries."},{"index":5,"size":14,"text":"Livelihoods. For communities of origin, there are immediate impacts including loss of remittance income."},{"index":6,"size":50,"text":"There are other effects too, including the impact of mass quarantining of returnees, with attendant stress on their well-being. It is apparent that in some countries mechanisms of deprivation and differentiation are present as a result of impacts on migration, leading to more entrenched poverty and possibly slippage into deprivation."},{"index":7,"size":75,"text":"The opportunity for successful reintegration of returnees varies according to preexisting wealth, as does the impact on households that have lost remittance income. An example are the successful returnees in Kyrgyzstan who had made earlier agricultural investments at home, and who do not plan to migrate again. It is likely that the current situation will push certain categories of people into poverty again. That gaps may increase and differentiation will increase seems a likely scenario."},{"index":8,"size":105,"text":"'Sitting it out' is both a societal and governmental reaction, not least because of the uncertain futures hindering effective planning and responding. It is possible that as a result the larger impacts on (rural) livelihoods are yet to be felt. The sense that these are very early days in this pandemic's economic impact is widely felt, and premature conclusions are therefore risky. The major effects will be felt more when people (and countries) have run out of reserves and stored assets. The likelihood that a number of people will fall into deprivation is high, as also that income gaps will increase as social differentiation progresses."},{"index":9,"size":68,"text":"Governance. Governments are undertaking a range of measures to provide income support and stimulate employment in home areas, mainly related to business entrepreneurship. It is likely that the larger impact on (rural) livelihoods -both impacts of the pandemic and major response measures -may still be round the corner. The longer-term planning options of governments include a stronger focus on agriculture and agro-enterprises, including in China, Moldova and Nepal."},{"index":10,"size":111,"text":"Individuals. Is there evidence of a change in the individual calculus about whether, where and how to migrate? In this early analysis, there seems to be little suggestion that this is yet the case. Currently, there may be a reassessment of risk -particularly related to the likelihood of getting stranded en route or in host countries -but there is a lack of definitive data on which to make a clear argument. Part of any calculus change may relate to relative 'transaction' costs of migration, and how these are felt and responded to by different migration groups -from older men to younger women -and, indeed, by those intermediaries responsible for facilitating movement."}]},{"head":"Possible Futures","index":4,"paragraphs":[{"index":1,"size":23,"text":"Despite the 'rupture' in migration, there is every indication that structural conditions (e.g., inequalities in access to assets, low employment, import dependence, etc."},{"index":2,"size":39,"text":") have yet to change and domestic labor markets in agriculture will resume once transport connections have been reestablished. This is likely to lead to continued migration, particularly in countries such as Ethiopia, Nepal, Moldova, Morocco, Thailand and Kyrgyzstan."},{"index":3,"size":40,"text":"Nepal seems to have signalled as such in policy through the reissuance of government labor permits from late June 2020. In contrast with Thailand, there have been no changes in how migrants are recruited or in how permits are issued."},{"index":4,"size":91,"text":"Within governance responses, new notions have emerged of 'foreignness' in economic development. The notion of the migrant as someone from elsewhere, and of those from home areas regarded as being 'foreign', distant, etc., may grow. Issues of 'foreignness' and coming from abroad have left some migrants stigmatized and unwelcome in their own countries due to fears of disease transmission, but also because some have returned without income. At the same time, governments are likely to impose more severe conditions on migration, including closer tracking of who is moving where and how."},{"index":5,"size":59,"text":"The restrictions on, or banning of, free movement are likely to be long-lasting and, when relaxed, will be accompanied by stronger control, including tracking and tracing measures utilizing digital innovations and smartphone use. This may have a significant impact on the future governance of migration, including health 'passporting' and other measures involving stronger accounting for, and scrutiny of, movements."},{"index":6,"size":121,"text":"In conclusion, migration and migrants remain high on the development policy agenda.  Thailand). The initial task of the AGRUMIG project was to assess the nature of migration and rural development relationships in these seven countries, and to consider how stronger governance of systems could enhance development benefits and reduce migration risks and uncertainties. This was premised on migration remaining a major feature of the development landscape. As we are now approaching a situation in which an estimated 50% of the global labor force could be unemployed by the end of the year, contributing to a 20% reduction in international remittances (IOM 2020a), the task of understanding linkages and finding ways of governing migration more effectively is probably more important than ever."},{"index":7,"size":83,"text":"This rapid review of evidence emerging from the seven AGRUMIG project countries suggests a wide variety of impacts due to the global Covid-19 pandemic and a range of responses by governments and people. Many of these responses have been abrupt policy shifts, emerging in near real-time as this report was compiled. The purpose of this report, therefore, is not to establish definitive trends and relationships, but rather to quickly collate some of the observed changes and assess their implications for wider policy environments."},{"index":8,"size":27,"text":"Given the unprecedented nature of the current situation, the environment facing migrants and would-be migrants is one of grave uncertainty. Whether there will be a return to "}]},{"head":"Emerging Evidence","index":5,"paragraphs":[{"index":1,"size":16,"text":"This section presents a summary of the emerging evidence collected rapidly from the AGRUMIG project countries."},{"index":2,"size":16,"text":"While not detailing all of the material provided, it draws together some of the common features."}]},{"head":"Livelihood Ruptures and Future Challenges","index":6,"paragraphs":[{"index":1,"size":68,"text":"There have been clear impacts on livelihood systems in both rural and urban areas across countries. The background to these impacts can vary widely. In some cases, impacts have been caused by a sudden drop in internal migration to and from urban areas, and between rural areas. This has directly affected rural production systems. In other areas, a slump in remittances is affecting income streams into rural households."},{"index":2,"size":85,"text":"In Ethiopia, reports suggest that many migrants have been unable to send remittances home, either because of lockdowns and movement restrictions affecting their working situations, or because of direct job losses. This applies across a range of countries, including migrants in the United States where a substantial number of Ethiopians remit income back home to support their families (Samuel 2020). Ethiopian migrants in other countries, also stranded with no work, are now seeking recourse to social safety nets, including in neighboring countries such as Kenya."},{"index":3,"size":96,"text":"In Morocco, there has been a sharp decline in remittances as a result of the pandemic (World Bank 2020a). These remittances include amounts that would have come from seasonal workers in France and Spain, whose movement the government of Morocco opted to stop on health grounds. Some of the gaps in labor markets in European countries have, in part, been filled by employing local labor. Barriers to the harvesting of agricultural goods in Europe may even provide an opportunity for the export of similar products from Morocco.  regions, etc.) is this in political versus economic terms?"},{"index":4,"size":75,"text":"In addition to job losses of migrants abroad, Covid-19 has resulted in significant loss of employment in Morocco across a range of sectors: 85% in the leather industry, 78% in the tourism sector and more than 70% in the textiles sector (CGEM 2020). It is possible, and perhaps predictable, that these job losses will cause social pressures that further fuel the propensity for migration -perhaps triggering a new wave of migration when movement is restored."},{"index":5,"size":114,"text":"Migration 'home countries', including Morocco, can also be destination countries. In the case of Morocco, this includes people from countries in sub-Saharan Africa who are living in Morocco. Many of them have been left destitute and have resorted to begging. Evidence of food availability in urban markets, which are largely supplied by large-scale farms, suggests that this part of the agricultural sector has not suffered from a shortage of labor. However, this is not the case for family farms, which have to compete for labor with large farms (Box 1). This represents another way in which the pandemic situation can further 'enable differentiation' of development pathways, with adverse effects felt most by smallholder farmers."},{"index":6,"size":68,"text":"Economic disruptions due to the coronavirus pandemic in Thailand have affected the tourism, production and export sectors, and supply chains. It is estimated the economy could shrink by 3-5% in 2020 and exports decline by 5-10%, according to the Joint Standing Committee on Commerce, Industry and Banking (JSCCIB) (Sriring and Thaichareon 2020). The JSCCIB also estimates that some seven million people could lose their jobs as a result."},{"index":7,"size":106,"text":"While Thailand's social security system covers formal workers who have lost their jobs, it does not cover the 20.4 million informal workers ( just over half of all workers), many of whom are migrant workers (Box 2). In a further sign that Covid-19 impacts could include slippage into social deprivation, Covid-19 has reduced the negotiating power of informal workers in relation to their employers. As a result, they might suffer wage and benefit reductions or be required to work harder or longer hours. New graduates or young laborers, particularly in the tourism and service sectors, may be cut off completely from the labor market (Tancharoenpol 2020)."}]},{"head":"Box 1. Labor and Fruit Production in Morocco.","index":7,"paragraphs":[{"index":1,"size":83,"text":"In the fruit production areas of the Middle Atlas and Upper Moulouya regions of Morocco, restrictions on the mobility of agricultural workers were initially strict and farmers had difficulty finding farm workers; and buyers of standing crops became scarce. Many farms appealed to family and community solidarity at the village level to get agricultural and harvesting work done. With the approach of deconfinement, controls were relaxed within administrative districts, which made it possible for farmers to call on labor available in their locations."},{"index":2,"size":6,"text":"Source: AGRUMIG project team in Morocco."},{"index":3,"size":7,"text":"Box 2. Thai Workers in South Korea."},{"index":4,"size":393,"text":"South Korea is among the top five migration destinations for Thai workers, due to its higher wages and visa exemption. However, only 57,470 of the 209,909 Thai workers working in South Korea are legal migrants. Many Thai workers travel to South Korea as tourists and overstay, taking up work illegally. During the initial Covid-19 outbreak in South Korea in December 2019, illegal Thai workers were given an opportunity to voluntarily leave, regardless of the length of their illegal stay, without having to pay a fine (KRW 20 million, EUR 14,800) and be blacklisted (a ban of up to 10 years). This amnesty began on December 11, 2019, and continued until June 30, 2020. In early March 2020, the South Korea Immigration Office reported that 5,386 Thai workers had voluntarily gone home. South Korea announced a temporary halt to visa exemptions for Thais from April 13, 2020, as part of measures to stop Covid-19 cases from entering the country. However, there are some concerns regarding the Korean amnesty. Illegal migrants are required to register and fill out information such as recent job, address, number of workers, etc. Some feel this information might be used for searching and banning illegal migrants in future. While Thailand's Ministry of Labour has initiated a relief package for returnees from South Korea and other countries, it is available only to legal migrants who are members of the Overseas Workers Fund (which gives them THB 15,000 as compensation after a 14-day state or home quarantine). Illegal migrants have no access to this package. The Department of Employment has identified over 81,562 domestic jobs for returnees from overseas. The Department of Skill Development is aiming at upskilling or reskilling 30,000 returnees. According to the Thai government, Thai migrants overseas are in Central and East Asia (96,486), the Middle East (25,514), and the remainder in Europe and the United States. On return they are quarantined for 14 days and required to get a medical certificate and entry approval from the Royal Thai Embassy or Consulate. On entering Thailand, another 14 days of state quarantine are required. With the onset of the pandemic, some seasonal labor migrants -including wild berry-pickers travelling to Finland and Sweden -cancelled their trips. Remittances from Thai migrants have significantly decreased due to a number of reasons including loss of jobs, reduced hours, curtailment of overtime and reduced wages."},{"index":5,"size":148,"text":"In China, the number of unemployed workers has increased, and rural laborers have been getting fewer days of work due to the government's Covid-19 prevention and control measures. After the Spring Festival in late January, many migrant workers in Guangdong, Zheijang, Jiangsu, Beijing and Shanghai postponed their return to work by more than two weeks. Overall, the number of returning migrant workers has dropped significantly (Sang 2020). Migrant farm workers have declined by about 3.5 million (Ye et al. 2020). An estimated 60% of migrant workers have not been able to return to work because of the epidemic (Lu et al. 2020). Income loss has varied by province, but in the worst-hit Hubei province, the more than 10 million migrant workers there were unable to work for at least a month. Short-term losses have been significant, with knock-on effects for rural residents dependent on income received from elsewhere."},{"index":6,"size":69,"text":"Depending on the host country, an estimated 10-30% of Nepalese migrant workers are expected to lose their jobs as a result of the Covid-19 impact, according to the Nepal Association of Foreign Employment Agencies. Livelihood insecurity as a result of Covid-19 has already grown, with 10% of households in a recent World Food Programme survey (WFP and MoALD 2020) reporting loss of livelihood and 30% reporting loss of income."},{"index":7,"size":105,"text":"Food insecurity is particularly high for those with marginal holdings or those who are tenant farmers. Normally, migration-related income would cover the food needs of these people for part of the year. Most Covid-19 assistance from the government, it was reported, came in the form of food aid (nearly 70%). In Nepal's far west, agricultural livelihoods are structurally dependent upon seasonal migration to India, which makes up for shortfalls in food once grain stocks are depleted. Any closure of the border with India can therefore have a devastating impact. Many workers have already returned from India due to loss of jobs and the Indian lockdown."},{"index":8,"size":86,"text":"Return migration from the Persian Gulf countries has been lower, partly because of transport restrictions. Those who were about to migrate have had to stay put, and some who lost their jobs or are undocumented are in the process of being repatriated. For some Nepalese women returnees, there is an additional social stigma attached to having migrated, which can cause difficulties when reintegrating back into Nepali communities. In addition, there are differences in accessing credit or financial services once back, due to gender biases (ILO 2016)."},{"index":9,"size":63,"text":"To assist the economy in Nepal, the government has offered a 20% rebate on income tax for the fiscal year 2076/77 (Nepali calendar). In addition, the value-added tax (VAT) return submission period for the Tourism Sector and Freight Service is now also reduced. Other support measures have been put in place for telecommunications and the import of raw materials for the medicines industry."},{"index":10,"size":112,"text":"In Moldova, small agricultural producers have been affected in two main ways: agricultural activity was forbidden in villages under lockdown, and access to markets was limited due to the restrictions imposed. The most-affected were small farmers who could not reach local markets and had no other means to sell their products, including direct delivery to consumers. To help ameliorate this, the Ministry of Agriculture, Regional Development and Environment developed a web-based platform to help small farmers sell their products. While reflecting the pandemic's potential to serve as a deprivation and differentiation mechanism, this indicates that the current economic crisis could also serve as a trigger for innovations in market and producer behavior."},{"index":11,"size":309,"text":"For migrants from Kyrgyzstan, mainly to Russia, the pandemic-triggered reduction in global demand for oil and the resulting fall in oil prices negatively affected Russia's economy and, by extension, the demand for labor. For many migrants this meant either complete loss of employment or reduction in wages (Box 3). As a result, it is estimated that remittance inflows from Russia to Kyrgyzstan fell by 62% in April 2020 compared to the same period in 2019 (ADB and UNDP 2020, p. 61) Some Kyrgyz migrants have been able to overcome the current challenges as they had previously invested their remittances in productive ventures at home, such as farming and construction. According to one migrant interviewed: \"I did not save money while I was migrating. I immediately sent everything home, and built a house here. We used to live in a temporary hut before. Everything that I learned in Russia, I use here in a village, on a construction site. If you work in the village, you can earn.\" (pers. comm. interview conducted with former migrant in Jashtyk community, Batken, Kyrgyzstan, April 15, 2020). Some of the livelihood ruptures caused by Covid-19 suggest income differentiation is increasing. Some returnees have displayed resilience, such as the individual above, and can chart a successful livelihood on their return. However, the crisis has pushed many households with fewer assets and less access to alternative livelihoods into deprivation, not least because of the heavy investment and indebtedness that may have been required to assist migration in the first place -particularly in countries such as Ethiopia and Nepal where households take on loans to pay significant upfront fees to middlemen or recruitment agents. An intensified cycle of poverty may then emerge, impacting both returnees who have no source of income, and households for which foreign remittances were a crucial part of securing food and other essentials."},{"index":12,"size":203,"text":"It is worth noting that the more urban presence of Covid-19 -and the reporting on it -is a feature of the disease in some countries, imparting, perhaps, an urban bias to debates on its economic impact. This is not surprising perhaps given the high rates of infection associated with proximity between individuals in densely populated areas. However, in Morocco this has meant that, by and large, the countryside as a socio-spatial category has become invisible during the pandemic. According to the High Commission for Planning, in May, some 86% of cases had occurred in the most urbanized areas of Morocco's Atlantic coast, where industrial, service and commercial activities are concentrated. Government responses have largely been tailored to the urban situation, recognizing that in these working class neighborhoods and shanty towns unsanitary conditions and overcrowding can prevail, assisting the spread of the virus (HCP 2020a(HCP , 2020b)). For some in these low-income areas, the choice is, however, as stark as 'coronavirus or starvation'. As noted by one author (Gilbert 2020), \"Because of the various inequalities which affect them -health, housing, work and transporthouseholds and working class neighborhoods are particularly exposed to the virus and ultimately risk paying a very high price for the pandemic.\""},{"index":13,"size":47,"text":"There are important ways in which any urban bias in responding to Covid-19 may be a problem. These include possibly creating policy misfits with rural areas, but also somewhat blindly ignoring the very many rural-urban linkages that exist, including in terms of seasonal and other migration patterns."}]},{"head":"Systems Stalling and Under Stress","index":8,"paragraphs":[{"index":1,"size":56,"text":"Established migration systems are being severely tested by the Covid-19 pandemic. There is a lack of transport, increasingly complex border procedures are evolving (where borders are open at all), and travel costs are rising -quite steeply in many cases. In some destinations, migrants are stranded -both out of work and lacking access to any financial assistance."},{"index":2,"size":45,"text":"In Ethiopia, well-established migration systemsformal and in formal -have declined rapidly (Box 4). Early indications suggest a drop of at least 15% in remittances due to Covid-induced job losses in Western and Gulf State labor markets and repatriation of workers from these regions (UN 2020)."},{"index":3,"size":128,"text":"According to recent data, there have been a number of returnees to Ethiopia from countries in the Middle East and elsewhere in East Africa. However, the numbers cited -some 16,400 from April to mid-June 2020 (IOM 2020b) -suggest only a small percentage of migrants abroad have returned. Given the large drop in remittances, this suggests many are still in the destination countries, suffering a severe depletion in their income. Some of the Ethiopian migrants have returned as a result of deportations from countries such as Saudi Arabia (Getachew 2020). In Lebanon, the Covid-19 pandemic has exacerbated an already catastrophic economic situation in that country, which led to Ethiopian domestic workers being thrown out of households and left with no assistance (Rose 2020; Ethiopian Monitor 2020; El Deeb 2020)."}]},{"head":"Box 3. Challenges in the Russian Federation.","index":9,"paragraphs":[{"index":1,"size":103,"text":"According to Abdusattor Esoev, the International Organization for Migration (IOM) chief of mission in the Russian Federation, 60% of migrants in the country were unable to pay their rent in mid-May, and more than 40% could not afford food; \"Millions of people are teetering on the brink,\" he said. The pandemic situation made 30-50% of labor migrants from Central Asia unemployed (DW 2020). Considering that informal labor is still very common in Russia, people have not received any compensation after redundancies (Novaya Gazeta 2020). Difficulties of paying rent have pushed many of them into debt. Thousands of migrants were stuck at Russian airports."},{"index":2,"size":6,"text":"Source: AGRUMIG project team in Kyrgyzstan."},{"index":3,"size":12,"text":"1 USD 1 was equivalent to about KGS 10 in November 2020."},{"index":4,"size":98,"text":"The wider systems challenge in relation to migration and Covid-19 contains a key element of the AGRUMIG project: the link between migrant return and their reintegration into economies and societies. In Ethiopia, the experience of previous mass deportations from Saudi Arabia in 2013 and 2014 was particularly difficult (Dessalegn 2019). Reintegration in the current situation is compounded by difficult quarantine processes that migrants have to observe upon returning. In Ethiopia, a mandatory 14-day quarantine was imposed in late March, and reports from quarantine centers suggest that unsanitary conditions in some cases may even contribute to infections (ECC 2020)."},{"index":5,"size":81,"text":"After release from quarantine, migrants may face returning to their home areas without any accumulated income. Reports indicate some returnees may feel guilty about returning empty-handed, not least because of the substantial loans households may have taken to finance migration abroad (Wuilbercq 2020). In such situations, the challenge of slippage into deprivation may arise, not just for the migrant, but his or her whole household. The incentive remains, therefore, to 'bounce back' and migrate again, perhaps taking greater risks than before."},{"index":6,"size":104,"text":"In Nepal, an estimated quarter of a million migrants out of some four million working abroad are reported to want to return. Only 3.8% of the recent returnee migrants are women. Most returnees work in construction (28.4%), agriculture, forestry and fishing (20%), and wholesale, retail, repair and motor vehicles (14%) (Government of Nepal 2020). Recent reports suggest that not only have a large number of migrant workers lost their employment status abroad due to Covid-19 impacts, some 115,000 whose labor permits had already been issued by the government could not travel due to pandemic restrictions such as suspension of international flights out of Nepal."},{"index":7,"size":73,"text":"Not only have flows of people stalled, but goods and services too. In Dhanusha in the Terai region of Nepal (Box 5), people have had to take loans to buy food supplies, or have borrowed rice from landowners. Before the lockdown, cheaper products from India were available, but now people are having to buy more expensive local goods. Local business owners, forced to comply with lockdown regulations, have suffered severely curtailed retail opportunities."},{"index":8,"size":134,"text":"According to a community member in Dhanusha, some migrant workers have been unable to repay the loans they had taken for migration or land purchases; some have had to borrow from moneylenders to meet their daily expenses. The chairman of a municipal ward committee said, \"Families without migrant members are only worried about their livelihoods. However, those with a family member abroad are worried about their livelihoods as well as about the migrant member, and keep worrying about their return.\" In other parts of Nepal, feminization of agricultural production as a consequence of male migration has left women especially vulnerable, including by impacting non-farm rural livelihoods, with local market closures preventing the sale of goods. The concern of some people was less the immediate-term impact, but rather the long-term implications of the crisis continuing."},{"index":9,"size":130,"text":"Kyrgyz migrants were both locked into their home country after returning over the winter, and stranded in Russia. At the end of April, figures suggested that 6,000 had returned from Russia while 10,000 were still seeking to return. This situation also posed the related challenge of migrants returning with Covid-19 to health systems that were already overstretched. Hundreds of migrants from Kyrgyzstan were stuck at the borders. The government responded by providing food and shelter for those in extreme need and those stranded at Russian airports, including working with international organizations such as IOM, which launched their own international appeals to support migrants from across Central Asia and the Russian Federation. The government also set up a migrant support fund of KGS 15 million 1 to support Kyrgyz migrants abroad."}]},{"head":"Box 5. Quarantine Uncertainties in Nepal.","index":10,"paragraphs":[{"index":1,"size":195,"text":"In one ward of Bideha Municipality in Dhanusha, 29 people have returned -28 from India and one from Qatar. The returnees from different parts of India, including Maharashtra (Mumbai), Punjab and Gujarat (Surat) were sent, straight from the border, to a quarantine facility in Janakpur. The chairman of the municipal ward said there was fear that the returning migrants would go directly to their villages without undergoing any test for the coronavirus. He said 40 people were mobilized to ensure that migrants were taken to quarantine first. Four out of the 29 returnees tested positive for the coronavirus and were undergoing hospital treatment. He said some internal migrants too returned from Pokhara and Kathmandu, but since it was before the virus had started to spread, they were not sent to quarantine. Some migrants who had returned from Saudi Arabia, Qatar and Malaysia one or two months earlier too did not have to stay in quarantine. These workers came for their holidays and have not been able to return due to lockdown in those countries. In some communities, there were concerns about the lack of testing of people in quarantine before allowing them to return home."},{"index":2,"size":6,"text":"Source: AGRUMIG project team in Nepal."},{"index":3,"size":84,"text":"In many cases, travel bans have affected the physical capacity of migrants to return. Ethiopian Airlines suspended flights to some 30 destinations as part of the government's Covid-19 response, including to key worker destinations in the Persian Gulf countries. This accompanied bans by countries on immigration from Ethiopia, including into Saudi Arabia, a key destination (Zelalem 2020). This has had a direct impact on the migration system, only two years after a ban on overseas labor migration had been lifted (Dessalegn et al. 2020)."},{"index":4,"size":86,"text":"In Thailand, according to lockdown and social distancing measures, the government has a limited quota for entry into the country over the land border. Migrants confront other risks of infection at the border and bear additional costs for food and accommodation. This has resulted in a significant number of illegal entries across the land borders, especially between Thailand and Malaysia. In Moldova, all regular flights were cancelled in late March, and only charter flights were allowed, including those arranged to bring people based abroad back home."},{"index":5,"size":60,"text":"The sense of migration systems stalling and under stress is evident across all seven AGRUMIG project countries, but to varying degrees, not least because they are so different geographically, socially and economically. The challenge for longer-term development is that these system stresses are triggering possibly longer-term structural changes in societies and rural economies. This includes deepening deprivation and increasing vulnerability."}]},{"head":"Governance Responses and Future Uncertainties","index":11,"paragraphs":[{"index":1,"size":90,"text":"Given the impact on migration systems and the resulting livelihoods insecurity, there are new governance uncertainties affecting migration. These uncertainties are a result of both the (probably temporary) rupture in migration systems and possible changes in the calculus people apply toward migration decision-making -such as 'what is the net benefit versus risk for me'; 'how far and for how long should I move'; and whether people will move at all beyond their home country, or rather choose internal migration now that the stakes have changed in terms of international movement."},{"index":2,"size":68,"text":"In common with other governments, Ethiopia's initial response was to ban overcrowded public transport (halving the numbers of passengers that could be carried locally and nationally), as well as halting the movement of people across the country's borders (Ethiopian Health Data 2020), and imposing a mandatory quarantine. The border closures immediately restricted the movement of migrants, leaving some stranded en route to and from their destinations (Rodríguez 2020)."},{"index":3,"size":66,"text":"To prevent return may not be a governance strategy in many countries, but in the present circumstances, amidst the complicated and potentially serious economic circumstances in which countries find themselves, a massive return of migrants from abroad is potentially problematic. This sheds further light on the reality that migration is an essential part of national economic 'strategies', though it may not be formally stated as such."},{"index":4,"size":89,"text":"In some cases, the immediate effect of resource diversion to tackle Covid-19 has been a reduction in support for migration agencies. In Kyrgyzstan, for instance, the State Migration Service budget was reduced by over 18% between 2019 and 2020 as a result of Covid-19. It is possible, though no evidence has been presented, that similar situations may exist in other countries, where migration assistance programs and budgets are squeezed as a result of new development priorities -just at a time when demand for them is likely to be greatest."},{"index":5,"size":69,"text":"In the case of Moldova, the number of migrants returning as a consequence of the pandemic is estimated not to have been high. Destination countries provided (or extended) residence and working permits to migrants who decided not to return to their home countries. Sometimes, when migrants decided to return, in particular women in the care sector, they then migrated again to another country in the European Union or Russia."},{"index":6,"size":120,"text":"The Kyrgyzstan ambassador to the Russian Federation stated, \"More than 60% of Kyrgyzstani citizens in Russia were unemployed during Covid-19. At the same time there are jobs in construction. There are offers of employment in the Moscow region and in other regions. The Russian economy is stronger and more stable than ours. After quarantine, the economic crisis will continue around the world. I advised our countrymen to wait for the crisis here [to be over] and not to go anywhere.\" 2 This admission that home economies can still not (and are even less likely now to be able to) provide employment for large segments of the population was stark, and probably reflects opinion in other countries with substantial outmigration populations."},{"index":7,"size":120,"text":"The institutional crisis management involved in responding at national levels to the Covid-19 migration challenge includes examples of cross-institutional working, as in the case of the rapid-response group set up under the MFA in Kyrgyzstan, bringing together the State Migration Service (SMS), IOM, Ministry of Internal Affairs and leaders of the Kyrgyz diaspora in Russia (pers. comm. interviews conducted with a representative from IOM Bishkek, June 17, 2020 [online]). This tighter networking around migration in response to Covid-19 could be one important avenue for strengthening the overall national governance of migration systems, and could form a focus for AGRUMIG project working groups in respective countries, namely how to transition from crisis-response networking to longer-term cross-sector and crossinstitutional work on migration."},{"index":8,"size":53,"text":"In China, the government's strategy in response to the virus was termed 'foreign defence importation and internal defence rebound'. This focused on prevention and control of the disease spread in China, including tackling epidemic 'hot spot' clusters, as well as promoting the resumption of production by sector and caring for overseas Chinese citizens."},{"index":9,"size":170,"text":"From the end of April there was resumption in economic activity, accompanied by widespread support measures by the government to stimulate economic activity (e.g., consumption vouchers). The Covid-19 impact on agriculture was substantial, not least because of its occurrence during the planting and breeding season, its impact on the mobility of migrant workers and the poor protection conditions prevalent in rural areas (Ye et al. 2020). Its impact on the grain industry, for example early season rice in parts of southwestern China, was considerable (Zhong et al. 2020) because spring cultivation requires substantial labor for planting, fertilizer and pesticide application, and operation of farm machinery. It was reported that more than half of the service providers could not function normally during this period (Lu et al. 2020). The result included shortages of fertilizer leading to price rises from late February onward (Song et al. 2020). In addition, wholesale food prices of different products rose; for example, pork product prices increased by 7.8%, japonica rice by 9.6% and soybean by 8.5%."},{"index":10,"size":74,"text":"The impact on transportation fuelled a price rise in some places, but a decline in others, including for pork. There was a shortage in the south and a glut in the north of the country. Prices have also been severely affected by low demand for fresh products due to the closure of roads, businesses and markets which have affected supply and demand during what is normally the peak consumption season (Wei and Lu 2020)."},{"index":11,"size":60,"text":"China's measures in response to Covid-19 have included speeding up economic reconstruction, including guaranteeing food supplies for essential products. Other measures include streamlining and simplifying government approval processes and promoting online tools to help stimulate economic activity (Box 6). Many of the measures are aimed at maintaining food supplies to urban areas, and securing the sustainability of rural production mechanisms."},{"index":12,"size":59,"text":"In Nepal, the response has been two-pronged: first, diplomatic channels were used to secure current migrant jobs in destination countries; and second, efforts have been made to create a conducive environment for generating self-employment in commercial agriculture and the restaurant sector, take up infrastructure projects and implement the Prime Minister's Employment Programme, a 100-day informal employment scheme (Box 7)."},{"index":13,"size":221,"text":"In Thailand, authorities imposed a lockdown in Bangkok and adjacent provinces in late March, resulting in an outflow of migrant workers from Cambodia, Lao People's Democratic Republic (PDR) and Myanmar. The International Labour Organization (ILO) estimates that at least 260,000 legal migrant workers have returned to their home country, but may not include those who have returned unofficially (ILO 2020). By the end of May only around 14,728 Thais had been repatriated from abroad. For the informal migrant workers who remain, one challenge is that they cannot afford Covid-19 testing and treatment, due to the costs involved and the fear of arrest by authorities (Box 8). The Ministry of Finance offered a special scheme of financial relief for informal workers (counting about 14 million people) of some THB 5,000 a month for three months, aiming to relieve the financial burden caused by Covid-19. The Ministry of Labour introduced a raft of other measures to help boost the skills of unemployed informal workers, and to boost their liquidity. For official migrant workers in Thailand from Cambodia, Lao PDR and Myanmar, in order to reduce their movement back home, the Thai government approved the extension of work permits up to the end of November, and provided exemptions from overstay penalties (World Bank 2020b). Box 6. The Quick Response (QR) Health Code in China."},{"index":14,"size":252,"text":"In February, Hangzhou City in Zheijang Province took the lead in launching the health code model to manage the entry of people into Hangzhou. People planning to enter the city apply online, and after a review of their health information, are given a color code (green, yellow or red). Only someone with a green code can pass into the city, whereas those with yellow or red codes need to follow rules for isolation, and are converted to a green code only when certain conditions are met. The idea of the health code is to achieve an efficient flow of people, enabling resumption of production and other activities, as well as avoiding excessive contact and gatherings. Those who have to home isolate are quarantined in their place of residence and their temperature is measured daily. During isolation they cannot participate in gatherings or group activities. After two weeks of isolation, if there are no symptoms, they are then allowed to continue. Reacting to the large number of returnees due to Covid-19, the Ministry of Labour in Thailand intends to improve its database on overseas Thai migrants and informal workers, to improve monitoring and management during a crisis. The ministry also plans to expand the labor migrant quota under bilateral agreements with major destination countries such as Taiwan and South Korea and to reduce the amount of irregular or illegal migration, with a view to increasing the numbers of Thai migrants who can access social security and other benefits from Thailand and destination countries."},{"index":15,"size":63,"text":"Overall, the Thai government has devolved responsibility for screening and regulating the home quarantine of returnees. Health volunteers monitor the health of returnees from countries such as South Korea, China, Malaysia and Indonesia and from areas at high risk of infection within Thailand. Returnees must report to the village head of health volunteers for a 14-day quarantine at home or in community facilities."}]},{"head":"Back to Normality or Something Different?","index":12,"paragraphs":[{"index":1,"size":110,"text":"At a global level, the desire to 'act together' has always existed but did not translate into the Global Compact for Migration until September 2016. The Pact is supposed to offer \"an opportunity to improve governance in the area of migration and to face the challenges associated with today's migration, and to strengthen the contribution of migrants and migration to sustainable development\". The agenda for its implementation has now been 'disturbed' by the Covid-19 crisis. However, perhaps it is more relevant than ever. Arguably now is the time for the Pact to show its mettle (Box 9). Nepal's government has a number of initiatives that support migrant returnees. These include:"},{"index":2,"size":34,"text":"Recognizing skills and providing soft loans: Loans of a million Nepalese rupees (USD 8,908) are given for business development to people who returned in the past three years. A skill verification test is required."},{"index":3,"size":27,"text":"Youth and Small Enterprise Self-Employment Scheme: Aimed at unemployed youth, this scheme offers collateral-free loans of up to NPR 200,000 (USD 1,745) for enterprise establishment (e.g., rickshaw)."},{"index":4,"size":30,"text":"Returnee Migrants Entrepreneurship Award Program: This provides certificates of recognition and monetary incentives. Sector engagement in 2019 was with poultry farming, metal industries, animal husbandry, garment manufacturing and vegetable farming."},{"index":5,"size":85,"text":"Migrants, agriculture and land management: Under this program, migrants can engage in agriculture via a 'land bank' with investment capital of USD 4.13 million. One challenge, however, is the often large gap between the skills acquired in the more advanced economies and the opportunities to adapt them to Nepal, where mechanization and industrialization is far more limited. Other challenges include difficulties in obtaining loans without collateral. Some note that many migrants will not necessarily wish to return to agriculture, having changed their lifestyles while abroad."},{"index":6,"size":6,"text":"Source: AGRUMIG project team in Nepal."}]},{"head":"Box 8. Stringent Controls for Thai Returnees.","index":13,"paragraphs":[{"index":1,"size":189,"text":"The Civil Aviation Authority of Thailand (CAAT) announced that Thais wishing to return to their country must present two documents to the airline: a medical certificate and a travel certificate issued by the Embassy or Consulate General of Thailand within 72 hours of departure, a so-called 'fit to fly' certificate. To get such a certificate, migrants have to show proof of their 14-day quarantine including location of hotel, their reservation, or house registration to the airline. Requesting such a certificate in many foreign countries is not easy. In addition, the cost of an additional 14-day quarantine prior to travel and medical certification have created additional burdens and costs, particularly for migrants who have just finished their working contracts. They receive no support or extra compensation from either employer or government, and they must cover all extra costs on their own. Perhaps the biggest question is whether the pre-existing migration system can or should return to 'normality'? The Global Compact was an attempt to do things differently, but was non-binding on countries. Indications are that the wider systemic drivers of migration remain intact, and may even be stronger than before."},{"index":2,"size":55,"text":"Poverty-induced migration may increase even as the economic capacity to absorb migrants is likely to be challenged. Interviews with migrants in Kyrgyzstan revealed that many perceive the current crisis as temporary and expect removal of restrictions on movement this autumn. This may be a feeling shared widely among prospective migrants across the AGRUMIG project countries."},{"index":3,"size":87,"text":"Concerns about the situation clearly vary with household type -no migrant household is the same -as do coping strategies. In Kyrgyzstan, households with more diversified income sources are less concerned, while households more heavily dependent on remittances have begun to reduce their expenditure. \"Those who could not leave, because of closed borders, joined the sowing works, but as soon as it is completed, and the borders will open again, they all will leave.\" (pers. comm. Interview conducted with householder, Jany-Jer Ayil Aimak community, Batken, March 18, 2020)."},{"index":4,"size":234,"text":"In some areas of Nepal, particularly where there is high outmigration to India, people will 're-migrate' sooner or later, some argue. One informant stated: \"This situation has definitely compelled people to think. They might not migrate with the whole family now, and some might stay behind to cultivate fallow land.\" Another key informant who had returned from India said, \"The menial jobs do not pay well here and the government has not made any effort to make the environment favorable for business and investment. So, the last alternative is always India… [some of his friends] have said they will do something in their own village. They have said that they will do livestock farming with new techniques. However, they will go back to India after the situation improves.\" Another suggested that after the lockdown is eased, it depends on how the government negotiates with labor-importing countries. \"They can earn at least NPR 30,000-40,000 a month if they migrate. Doing agricultural work [in Nepal] will only earn them NPR 5,000-10,000 a month.\" This implies that the compelling economic logic for migration has not dissipated. But the assumption of better earning opportunities abroad may be affected by the upcoming global slump. Importantly, for those with marginal holdings, migration to India is the only way to meet shortfalls, and therefore a migrant's position within the agrarian structure is likely to be significant in shaping future migration decisions."},{"index":5,"size":71,"text":"As migration is so entrenched and embedded in existing inequalities, it is doubtful that the Covid-19 crisis will stop migration. Perhaps some who are better off may be able to stay on the land and identify opportunities. However, a large-scale change in migration flows is not anticipated. For instance, in early July, the Nepali government restarted the issuance of labor permits, in anticipation of a resumption in travel to key countries."},{"index":6,"size":112,"text":"In Thailand, many unemployed (internal) workers who returned home as a result of Covid-19 are looking for an opportunity to work abroad, particularly in South Korea, after the pandemic situation improves. They will try to go to the chosen destination either through an official channel or via irregular migration. In Moldova, the government has instituted new controls over the compulsory purchase of health insurance by returnee migrants. Previously, although this was a requirement, it was not enforced. The links between migration and health may become stronger and feature more fully in future migration governance decision-making. Countries may have to establish systems that can prove their citizens travelling for work are 'virus free'."},{"index":7,"size":202,"text":"One of the apparent challenges is the effect of the pandemic on stigmatizing migrants. This can be through negative association-building between movement and the epidemiology of Covid-19. As described in the context of Morocco, there is a new discourse on 'us' (people living in the country, including foreigners) and 'others' (living abroad, including Moroccans) -the political border becoming a new 'line in the sand' for health identity. \"This year is supposed to be about bringing the compact from paper to reality. For the first time, states will come together for a regional review in the second half of 2020 to present and share progress on the national action plan. These meetings offer a change to demonstrate the relevance of the compact at a time when the pandemic presents a common challenge to states across the migration continuum. However, governments may have a difficult time bringing attention to the meetings or moving to implementation of tangible compact deliverables at a time they face more pressing domestic concerns. Overhanging all this is the knowledge that the political price to enact the compact was extremely steep for some states and may now have been for naught if the agreement fails to deliver on its ambitions.\""},{"index":8,"size":3,"text":"Source: Kainz 2020."}]},{"head":"Implications for Future Research","index":14,"paragraphs":[{"index":1,"size":64,"text":"The observed policy responses to Covid-19 seem to fall into three categories: (i) emergency measures to tackle disease transmission that affect capacity for movement (from, within and between home and destination areas); (ii) emergency financial and economic measures to tackle home and destination economic problems that result from the rapid decline in economic activity; and (iii) longer-term structural readjustments in economic and social/health policy."},{"index":2,"size":79,"text":"A secondary set of important changes relate to the control side of migration, including the use of digital tracking and greater combining of individual health data with movement, including via health tracking apps. Presaging perhaps a greater role for the state in tracking individuals -including those who migrate -this has implications for both the use of data by states and, potentially, the safety of migrants themselves. In future, this may have potential influence over wider systems of migration governance."},{"index":3,"size":102,"text":"From this rapid study, preliminary analysis suggests there is no simple narrative on what is happening, but that amidst the confusion and range of responses, some new, potentially complex phenomena are emerging. These may include changes to perceptions of migrants in relation to health which, though not known, has become a more mainstream concern of populations. In addition, how migrants (and those surrounding them who may be investing in their movement) perceive 'risk and reward' in making migration decisions. This may shape where and how people choose to migrate with knock-on effects on systems and, to some extent, the wider 'migration industry'."},{"index":4,"size":55,"text":"Migration is associated with remittance income. The rupture in repatriation of remittances, and of future remittance flow potential, has had a deeper impact on households heavily reliant on remittances for capacity to access food markets. These market relationships will be heavily affected in the near-term and, depending on future migration 'normalization', may have longer-lasting consequences."},{"index":5,"size":98,"text":"While analysis suggests that migration is a necessity more than a choice, the post-pandemic situation (assuming one arises) will present a different set of economic opportunities where the demand for and type of labor required may change. This suggests the need to shape future research questions in new ways as the AGRUMIG project tackles the new situation. A key part of the narrative will be the intersection of health and migration in new ways, how states control and manage data on migration and assess risk, and lastly, how the 'migration calculus' by individuals in particular circumstances may change."},{"index":6,"size":78,"text":"Some of this suggests a future with the potential for greater risk and exploitation, and a stronger gap between formal and informal migration, in particular risk where 'ungoverned' routes and processes may be associated with crowded spaces and unsanitary conditions. Furthermore, a greater polarization in migration processes may emerge before international deliberation and rule-making catches up, within an international environment that has possibly become more rather than less fragmented as nationalism(s) overtake collective action in tackling the pandemic."}]}],"figures":[{"text":" Source: AGRUMIG project team in Thailand. IWMI -4 Working Paper 195 -Between a Rock and a Hard Place: Early Experience of Migration Challenges under the Covid-19 Pandemic "},{"text":"Source: AGRUMIG project team in China. IWMI -9 Working Paper 195 -Between a Rock and a Hard Place: Early Experience of Migration Challenges under the Covid-19 Pandemic "},{"text":" Source: AGRUMIG project team in Thailand. IWMI -10 Working Paper 195 -Between a Rock and a Hard Place: Early Experience of Migration Challenges under the Covid-19 Pandemic "},{"text":"Box 9 . Future of the Global Compact for Migration. "},{"text":"Table 1 . Set of core questions used for the analysis.  What is actually How are migrants How are What are the What are the What is actually How are migrants How areWhat are theWhat are the  happening? responding? governments key sector emerging happening?responding?governmentskey sectoremerging    responding? intersections? consequences for responding?intersections?consequences for      migration migration      governance? governance? Data Data on flow of New data New policy Impacts on Formal, informal; DataData on flow ofNew dataNew policyImpacts onFormal, informal;  people and trends, measures, inequalities, is there a change in people andtrends,measures,inequalities,is there a change in  remittances e.g., migrant investments, Human the 'migration remittancese.g., migrantinvestments,Humanthe 'migration   returns, subsidies Development industry' returns,subsidiesDevelopmentindustry'  Gender repatriations  Index (HDI), (e.g., cost 'per GenderrepatriationsIndex (HDI),(e.g., cost 'per  disaggregation (forced and  Gini movement') disaggregation(forced andGinimovement')   voluntary)  coefficient, etc.  voluntary)coefficient, etc. Policy How have policies What are the Strictures, laws Intersectoral policy Are policy changes PolicyHow have policies What are theStrictures, lawsIntersectoral policy Are policy changes  changed (or been new pressures (e.g., curbing changes (agriculture, shifting the nature of changed (or been new pressures(e.g., curbingchanges (agriculture, shifting the nature of  revived)? on policy makers? of informal education, health, power to make revived)?on policy makers?of informaleducation, health,power to make    migration) etc.) decisions in particular migration)etc.)decisions in particular      directions? directions? Voices Who is saying Different types Is the government Who is saying what Are there voices that VoicesWho is sayingDifferent typesIs the government Who is saying whatAre there voices that  what, and why? of migrants, what challenged by and where; and are not being allowed what, and why?of migrants, whatchallenged byand where; andare not being allowed   are they saying oppositional how much is this to be heard? Are there are they sayingoppositionalhow much is thisto be heard? Are there   (seasonal, short- politics at any in response to new voices emerging (seasonal, short-politics at anyin response tonew voices emerging   term, gender levels on any others; how do in debates? term, genderlevels on anyothers; how doin debates?   disaggregated, key issues? people articulate  disaggregated,key issues?people articulate   geographical  their own position;  geographicaltheir own position;  "}],"sieverID":"bb7d95d8-5180-495e-a196-1e5b6ad37296","abstract":"This research study was conducted under the project titled AGRUMIG -'Leaving something behind' -Migration governance and agricultural & rural change in 'home' communities: Comparative experience from Europe, Asia and Africa."}

data/part_5/07d8415003354aa2a733984640d63d72.json

@@ -0,0 +1 @@
+{"metadata":{"id":"07d8415003354aa2a733984640d63d72","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/24b0bb4d-cd54-4a0c-b2a3-c77536290c50/retrieve"},"pageCount":33,"title":"","keywords":["Productivity","land","water","irrigation","typology","water scarcity","Ethiopia"],"chapters":[{"head":"1.","index":1,"paragraphs":[{"index":1,"size":2,"text":"Introduction 1"}]},{"head":"Materials and methods 2","index":2,"paragraphs":[{"index":1,"size":21,"text":"2.1. Location and farm characterization 2 2.2. Data identification and acquisition methods 4 2.3. Irrigation typology building and data analysis 5"}]},{"head":"3.","index":3,"paragraphs":[{"index":1,"size":4,"text":"Results and discussion 7"},{"index":2,"size":10,"text":"3.1. Land productivity of major irrigated vegetables and cereals 7"},{"index":3,"size":38,"text":"3.2. Gross and net value of production based on all irrigated crops 11 3.3. Irrigation water productivity for major crops 13 4. Synthesis of key challenges and entry points to addresses issues of on farm irrigation performance 19"}]},{"head":"References","index":4,"paragraphs":[{"index":1,"size":11,"text":"Tables Table 1: On-farm management features of the study irrigation schemes  "}]},{"head":"Introduction","index":5,"paragraphs":[{"index":1,"size":107,"text":"Land and water are the two important but scarce resources for agricultural development and globally these resources are shrinking (CPWF 2007). Schultz et al. (2005) suggested that the largest proportion of the required increase in agricultural production would have to be realized from already cultivated lands through intensification (e.g. through irrigation). CPWF ( 2007) suggested that while it is possible, with good management, to treat the symptoms of water scarcity, it is also possible, with bad management, to create water problems in areas of abundance. As such, enhancing productivity of irrigated lands remains one of the key approaches to meet ever increasing demands for food and fibre."},{"index":2,"size":53,"text":"In contrast to the popular perception, closing the yield gap is not only about increased infrastructure to enhance water abstraction and delivery. There is ample evidence suggesting the need to integrate practices of soil nutrient replenishment and high yielding varieties into optimum water allocation and change in cropping pattern (Drechsel et al. 2015)."},{"index":3,"size":31,"text":"In this context, on-farm water management targeted at narrowing-down yield gaps refers to practices that involve optimum and timely water application and those enhancing plant water uptake (Rockström and Barron 2007)."},{"index":4,"size":108,"text":"Although households on schemes might have many things in common (e.g. governance), decisions made at farm household levels are divergent and could be the potential sources of information to enhance productive uses of water (Lempériere et al. 2014). Farm households make decisions regarding the selection of crops, and the allocation of labour, inputs and capital with due considerations to the constraints they face and the opportunities they want to use. But also the decision is influenced by many exogenous factors. For example in many large scale communal irrigation schemes serving smallholders, there are possibilities that government policy and market circumstances influence the crop choice of farmers (Yami 2013)."},{"index":5,"size":135,"text":"Smallholder irrigation schemes in Ethiopia are generally characterized by poor on-farm water management practices and hence poor performances (Derib et al. 2011;Van Halsema et al. 2011;Eguavoen et al. 2012). The poor on-farm water management emanates from both excesses and insufficient allocation of resources that enables optimum and timely water supply and also plant water uptake. Putting it differently, inappropriate irrigation scheduling, non-uniform on-farm water distribution, wrong duration of irrigation, etc. are some of the factors contributing to poor on-farm water management. Farmers' lack sound knowledge on on-farm water management, particularly on how much to irrigate and when to irrigate (as they tend to over-irrigate as long as water is available) results in water shortages and conflicts in other parts of the schemes. This also means on-farm water management places direct costs on scheme level performance."},{"index":6,"size":173,"text":"Irrigation enables the abstraction of more nutrients from the soil. This needs to be replenished to maintain soil fertility and sustain productivity. Numerous scholars argue that poor soil nutrient replenishment is one of the chief causes of yield gaps [nutrient limited yield gaps (Erkossa et al. 2011;Alemu et al. 2010)]. Contrastingly emerging evidence also suggests that many intensively managed smallholder irrigation schemes in Ethiopia are over applying fertilizer. Implicitly smallholder irrigation systems are trapped in a manifold situation (both for water and nutrient). Smallholder irrigation schemes are acquired, used and managed in various ways (Derib et al. 2011;Awulachew et al. 2005;Eguavoen et al. 2012). Production systems, land and water rights, as well as their accompanying social dynamics, are not homogeneous and subtly influence on-farm management and performance. This calls for better understanding of these between and within diversity through empirical evaluation of indicators (Van Halsema et al. 2011). In the present study, we focus on land and water productivity and their concurrence across reaches and schemes, and the implications for equity and sustainability."}]},{"head":"Materials and methods","index":6,"paragraphs":[]},{"head":"Location and farm characterization","index":7,"paragraphs":[{"index":1,"size":182,"text":"The present study is based on nine irrigation schemes located across four regional states of Ethiopia (Figure 1). The study sample schemes were selected using criteria such as representativeness for different scales (large, medium and small) and managed by smallholders; crop types, agro ecology (e.g. altitude range 1500-2725 masl). Salient features of the schemes related to on-farm management are summarized in Table 1. All study schemes are located within a range of 2-30 km from main roads and have diverse soil texture. Clay to clay loam and sand and loamy are major texture of the soils. Onion (Allium cepa L.) tomato (Solanum lycopersicum) cabbage (Brassica oleracea) and pepper (Capsicum annuum) are major high value vegetable crops grown in all the schemes. Staple cereal crops, such as maize (Zea mays) and wheat (Triticum aestivum), are also cultivated in most of the study schemes. Perennial crops are not common with the exception of Gelana and Hare schemes where coffee (Coffea arabica), ensete (Ensete venticosum) and banana (Musa species), respectively, are commonly grown. Meki scheme has the largest mean land holding size followed by Koga."},{"index":2,"size":71,"text":"The lowest land holding sizes were recorded for May Nigus and Gelana (Table 1). The common field water application technique is furrow, but from field observation it was apparent that the skill of farmers in deciding the length and depth of furrow is different. In some cases furrow irrigation was recently introduced (e.g. Gelana); therefore farmers lack experience, while in other schemes the practice is well developed (e.g. Meki scheme).  1."},{"index":3,"size":40,"text":"Hare weir and diversion have the same source of water (Hare river); however their headworks are different. Hare weir have a permanent diversion weir, while Hare diversion have a temporary diversion structure; hence the two were considered as separate schemes."}]},{"head":"Data identification and acquisition methods","index":8,"paragraphs":[]},{"head":"Selection of performance indicators","index":9,"paragraphs":[{"index":1,"size":109,"text":"The number of indictors are developed to assess on farm performance of irrigation (e.g. Molden et al. 1990). The indicators to evaluate on farm performance of irrigated agricultural systems are hence related to yields, economic value of agricultural produce, water consumed per unit of produce, yield per unit of water used, etc. However, indicators of on-farm performance are not necessarily results of the quality of water management, but are also affected by other elements of the production process (Bos 1997). The following performance indicators were selected from literature to answer the questions related to the on-farm management (Bos 1997;Dejen et al. 2012;Van Halsema et al. 2011;Malano and Burton 2001)."},{"index":2,"size":142,"text":"Land productivity for major crops (land productivity) (tonnes/ha): The yield of major irrigated crops per unit area of land is an important indicator of on-farm management (Bos 1997). Estimating yields is often a difficult exercise during a diagnosis study even if one wants to know them with, say a 20% margin of error (Lempériere et al. 2014). However, there is no better way than collecting the information from the farmers as direct measurement on many schemes has implication for cost. So, for this study, yields were estimated from data of the household survey, and values on productivity were validated with similar studies across regions. Irrigation land productivity indicator can be represented by equation 1 below, where by LP stands for land productivity, Y is yield of the major crop in kg and A is the area under major crop in hectare (ha)."}]},{"head":"LP=(Y (kg))/(A (ha)) (Eq1)","index":10,"paragraphs":[{"index":1,"size":80,"text":"Gross value of production (GVP, USD/ha): This is the total annual value of agricultural production received by farmers per unit area of irrigated land (Malano and Burton 2001). The value of agricultural production received by farmers is at the local markets. Here this was determined based on the household survey data and the computation of the GVP can be represented by Eq 2 below: where GVA is gross value of production in USD, and A is area irrigated in ha."}]},{"head":"GVP =(GVA (USD))/(A (ha)) (Eq2)","index":11,"paragraphs":[{"index":1,"size":182,"text":"Irrigation water physical productivity (IWPP, kg/m 3 ): Enhancing water productivity is a major concern both globally and locally (Haileslassie et al. 2009). Water productivity is particularly important in areas of water scarcity. Excess water supply and wastage are the main causes of low agricultural water productivity. Low water productivity may also result under water shortage conditions if the stress is to the extent to significantly affect yields. For the study schemes, water shortage in some parts and over-supply in others are major observations. It is important to understand the position of different schemes and reaches within schemes, their level of productivity, and benchmark of those performing well (Malano et al. 2004). IWPP can be represented by equation 3 below where IWPP stands for irrigation water physical productivity; Yj stands for yield of crop j and IWJ stands for irrigation water supply to crop j for the given area. Alternatively water lost as evapotranspiration (ET) can be also used to estimate water productivity (eq 4) where WPet stands for water productivity for evapotraspired water, ETj stands for evapotraspired water for crop j"},{"index":2,"size":160,"text":"Irrigation financial water productivity of major crops (IFWP-USD/m 3 ): A recently emerging concept is the economic water productivity of irrigation schemes. This approach is more relevant in areas where the major purpose of irrigation is more cash income and food security than food self-sufficiency. This is also more relevant in irrigation schemes under multiple cropping systems. It helps to aggregate values of production of different crops and compare different schemes under different cropping system by converting to similar unit. IFWP can be represented by equation 5 below, where IFWP is as defined above, Vj stands for value of crop j and IWJ stands for irrigation water supply to crop j. Irrigation water supply to each of the individual crops was estimated based on consultation with sampled farmers on their irrigation schedules for each crop. The farmers tell the interval of irrigation, duration of application and area under each crop. However, they cannot reasonably tell the rate of application [(Q,(Eq6)]."},{"index":3,"size":176,"text":"Sampling, irrigation strata and data acquisition Following identification of indicators, a household survey tool, checklists for transect walk and discussion with key informants were developed. The questionnaire covered the size of land holding, major crops, input types and quantities, productivity, irrigation frequencies and length of growing period and farm characteristics. This was also suggested by Van Halsema et al. (2011) for evaluation of on-farm management. Smallholder farmer-managed irrigation schemes are heterogeneous and thus there are arguments that analysis would give better insights if a scheme is disaggregated into reaches; head, mid and tail (Şener et al. 2007). In this study we used this approach to stratify each of the study schemes as head, mid and tail irrigators based on their physical location within the schemes. Approximate boundaries were drawn between these clusters and about 10 plots were randomly selected for each reach (total 30 plots per scheme). The households who own each of the targeted plots were considered as sample for the household interview. The questionnaire was then administered during January-February 2015 targeting 2014 production season."},{"index":4,"size":154,"text":"In addition to the household survey, FGD was used to gain in-depth information on specific topics from farmers and extension workers. Groups consisting of 5-10 farmers were considered for the FGD. Bio-physical data related to the on-farm management, on-site determination of soil textures, landholding sizes of sampled farmers, irrigation supply at the farm inlets, and on-farm water distribution uniformity, were also recorded in transect walk. To estimate the sample plot areas GPS was used, and taping was made around the farm plots. For the water supply and on-farm water distribution, we collected data on water flow at the inlet of the plots. Float method was used for discharge at the inlets of the plots. Data on depth and width of the canal for a known canal length was measured repeatedly and then Eq 6 was used to calculate the discharge. The total volumes of water applied to the plots were determined by equation 7."},{"index":5,"size":52,"text":"Where D is the depth of water in the canals, W is the width of the canals, L is the length of the canal reach considered to be advanced by the float, T is the time needed by the float to advance the distance L, m is metres and s is seconds."},{"index":6,"size":60,"text":"The above equation will provide only a single event value of discharge. Discharges were monitored twice a day to capture fluctuations. Therefore to estimate the total volume of water used for irrigation (TIW) we multiplied the average discharge (Qa) with total number of irrigation events (nr) per season and duration of irrigation event (du) as illustrated in Eq 7 below."},{"index":7,"size":2,"text":"TIW=Qa*nr*du (Eq7)"}]},{"head":"Irrigation typology building and data analysis","index":12,"paragraphs":[{"index":1,"size":277,"text":"Smallholder irrigation schemes in Ethiopia are customarily classified into traditional and modern schemes based on the types of water source or the physical infrastructure for water acquisition, conveyance and distribution or both. (Yami 2013;Dejen et al. 2012). For typology building, a comprehensive and inclusive approach-whereby seven criteria were considered-was followed. Water source, water abstraction method, conveyance, distribution, flow control, on-farm application and institutions were the criteria considered for clustering the schemes as traditional, semi-modern and modern. Several methods of assigning weights for the criteria are proposed. In this study, participatory approach whereby experts involved in data collection process were consulted to assign weight to each indicator on consensus basis was followed. The final results on the rank are presented as mean of all grades on the criteria. While a scheme is classified as modern based on water abstraction structures, it might fail to meet the expectation due to poor water distribution, inequity and low productivity. On the other hand, there are cases where traditional schemes performed better than those classified as modern on mere consideration of headwork. Seven major criteria were identified to determine the typology of schemes. For each of these criteria, a weightage is assigned (out of 10) based on its relative importance. Then the condition of each scheme was evaluated against these criteria and graded on a scale ranging from 0 to 10 by a group of experts (data collectors and other experts) from IWMI. Accordingly irrigation systems of this study are categorized into three namely: modern systems, semi-modern systems and traditional systems. We fixed the weighted grade scales of the schemes and the schemes were classified based on the fixed grades (Table 2)."},{"index":2,"size":23,"text":"As indicated in Table 2, one scheme came up to be modern, five schemes to be semi-modern and three schemes to be traditional. "}]},{"head":"Results and discussion","index":13,"paragraphs":[]},{"head":"Land productivity of major irrigated vegetables and cereals","index":14,"paragraphs":[{"index":1,"size":267,"text":"Figures 2-5 present land productivity of common crops by schemes and by typology. We focused on two clusters of major crops grown in the study schemes: Vegetables (onion and tomato) and cereals (maize and wheat) and also presented the overall land productivity for different crops in terms of their financial value. These crops are not all grown at a specific irrigation scheme, there are some crops commonly grown at one scheme, but not at another. Variation in land productivity for observed crops was apparent. Land productivity for onion ranged between 7.13-14.55 tonnes/ha -1 , while for tomato the range was wider (0.9-10.29 tonnes/ha -1 ). Meki scheme showed the highest land productivity for onion and tomato with the magnitude of 14.55 and 10.29 tonnes/ha -1 respectively (Figure 2 and 3). Both values were very close (onion 13.9 and tomato 11.2 tonnes/ha -1 ) to observations by Van Halsema et al. (2011). Although this value for onion at Meki was on higher side when compared to the national average indicated by Ethiopian Investment Agency (EIA) which is 10.2 tonnes/ha -1 in 2012, and also by Abdissa et al. 10.5 tonnes/ha in 2011.This was lower than SSA and global average. Yields of onion at Megech, May Nigus and Wukro are much lower. The yield of tomato at Meki scheme is 10.29 tonnes/ha -1 , which is higher than the national average for tomato (7.83 tonnes/ha -1 ). However, the yields at May Nigus, Wukro, Waro and Gelana are much lower than the national average. The question is also to understand whether these yields are water, fertilizer or variety limited."},{"index":2,"size":146,"text":"As Meki irrigation scheme is located closer to the major market, Addis Ababa, 135 km away, farmers practice intensive irrigation and thus a combination of better agronomic practices, better access to inputs and markets, and climatic factors might explain the reason for higher productivities of Meki scheme. In view of the prevailing overirrigation and unbalanced nutrient application, it is obvious that the irrigation schemes are performing much lower than the regional and global average. The study showed that the very low yield, particularly at Wukro scheme (e.g for tomato), is primarily due to water stresses. There is an intense competition for water at the Wukro scheme between the head and tail users, particularly throughout low river flows. During field visits, it was confirmed that the serious level water stresses had caused significant loss of yields.  Figure 3: Land productivity for tomato across sample study schemes (tonnes/ha)."},{"index":3,"size":133,"text":"Figure 4 and 5 depict land productivity for maize and wheat respectively. Similar to variability in productivity of vegetables, variations is also observed across schemes for cereals. The recorded values of productivity range between 0.65 and 3.92 tonnes/ha -1 for maize and 0.6 and 1.56 tonnes/ha -1 for wheat. The highest value was recorded at Meki for maize and Koga for wheat. Average maize yield in SSA is about 2 tonnes/ha -1 , and the national average of Ethiopia is also 2 tonnes/ha -1 . Maize productivity at Meki and Megech are almost about twice of the national average. Hence land productivity at Meki scheme is adequately high for most of the crops with the exception of wheat compared to the other schemes as well as the national average yields of these crops."},{"index":4,"size":170,"text":"On the other hand, wheat crop productivity is highest at Koga scheme followed by May Nigus. Wheat is the major irrigated crop at Koga due to favourable climate condition and suitable soils. The irrigation schemes cropping pattern is also influenced by the government food self-sufficiency policy during the project design period. The average wheat yield in Ethiopia from 2004 to 2011 was 1.68 tonnes/ha -1 , which significantly lags behind other major producers in Africa such as Kenya and South Africa (FAO 2013). While the yield at Koga is nearly similar to the national average, the yields at the other schemes stand very low (Figure 5). According to CAB (2009), the SSA average land productivity for wheat is also nearly 2 tonnes/ha -1 . The land productivity for wheat at schemes Wukro, Meki and Waro (Figure 5) remained below 1 tonne/ha -1 (less than 50% of the SSA average. The largest productivity obtained in this study at Koga (1.56 tonnes/ha -1 ) is also less than the average for SSA."},{"index":5,"size":190,"text":"Generally a number of biophysical and socioeconomic factors exert constraints on crop yields, resulting in yield gaps that can be tackled with adequate agricultural input and water management. In view of a prevailing yield gaps, particularly for vegetables, the result here suggests the potential that irrigated crop can contribute to food and nutritional security in Ethiopia. In addition to the differences in yield gaps between the two clusters of major irrigated crops, farmers' choice to grow cereals or vegetable has implication on land productivity and water productivity.  Cereals (maize and wheat) are more common crops across all schemes. However, except at Koga and to some extent at May Nigus and Wukro schemes, these two crops are mainly grown during the rainy season, and hence little irrigation is used to supplement rainfall. Particularly at Koga scheme wheat is the major irrigated crop during the dry season covering over 80% of the irrigated area. This means the point of land productivity between cereals and vegetables when viewed from water, fertilizer input perspectives has contrasting implication and thus, to be conclusive, further analysis in terms of value added and water productivity is needed."},{"index":6,"size":415,"text":"To closely examine variation in land productivity among irrigation typologies land productivity was aggregated by irrigation typology for the two major crops: maize and wheat (Figure 6). Accordingly, the productivity of maize does not show significant variation among typologies unlike for wheat (Figure 6). Productivity is highest for the modern scheme (Koga) followed by semi-modern and traditional typologies. The question is also why the difference for maize productivity among scheme typology is not strong and why it does for wheat? Discussion with experts in the field suggests that this could be also partly due to attention paid by different national and international research institutes. The above observation of land productivity differences across schemes and typologies is just an aggregation to some extent. To see variability within schemes Table 3 shows the average land productivity for different reaches. From Table 3, it can be noted that the yield generally decreases from the head to tail reaches for many of the schemes. Some exceptions also exist where yields in the middle reach are higher than those at the head. These are observed for instance at May Nigus (for onion) and at Gelana (for tomato). These are actually not related to water supplies, but could be accounted for to soil variability. Particularly at Gelana scheme, the head reach is so hilly (>15% slope) and the water quickly runs down the furrows and field channels resulting in serious soil erosion. For many of the study, irrigation schemes trends in yield variations across the reaches as schemes are strongly related to head-middle-tail competitions for water and inequity levels. For instance, assessment of the water delivery system indicated that the competitions for access to water and inequity levels are high at Meki, Wukro and Megech schemes. In each of these schemes, tail users are the most disadvantaged ones in terms of water delivery. It can be noted that at each of these schemes, yields of crops declined from head to tail (Table 3). On the other hand, at Koga and Waro schemes, the water delivery is reasonably equitable across reaches. As such, differences in yield were not remarkable across reaches. Hence, the conclusion is while other factors could contribute to yield differences across reaches, what is observed here is mainly correlated to magnitude of variations in access to water over reaches. This means also addressing yield gap is not only about dealing with inputs as discussed above. Adjusting social components such as equity through proper organizational arrangement is important to consider. "}]},{"head":"Gross and net value of production based on all irrigated crops","index":15,"paragraphs":[{"index":1,"size":270,"text":"While the GVP in USD/ha is more useful as it is related to land which is limiting, total household production in USD can indicate the general economic situation at a scheme. The average gross and net values of household production for each scheme are shown in Figure 7. These are based on incomes from all irrigated crops. It shows that both the gross and net household production values are highest for Meki scheme. Higher values of household production do not necessarily imply higher land productivity of irrigated crops, but could imply larger landholding sizes. Of course the highest values of gross and net household production at Meki scheme are the combined effects of both higher land productivity as was already determined and larger land holding sizes. So this indicator tells the wellbeing (the income) of average households without due consideration of the productivity levels. It is also interesting to note the relative amount of the production costs and the net household incomes. While for all the schemes, the production costs are less than the net incomes, Megech is the exception at which the production costs are higher than the net income. At Megech, farmers use either communal or private diesel engine pumps to pump water from the river. Fuel costs and maintenance costs of pumps, including spare parts, are the major costs of production. This tells that diesel pumping schemes can be justified by growing cash crops, with good market access and adequate technology support services. A recent study by Gebregziabher et al. (2016 in press) suggests that pump based irrigation for below certain irrigable land is not financially remunerative."},{"index":2,"size":239,"text":"However, gross and net values of productions per hectare of land is a more important indicator to assist efforts to maximize benefits per unit of land cultivated in multi-crop situation. Obviously land is a limiting resource and thus a closer observation on the gross and net value of production per unit area gives better insight. Figure 8 shows the average net values of production derived from all irrigated crops/ha of land/year. Crop selection and markets play significant role to affect the value of production/ha. The net value of production per hectare is highest for Gelana scheme, probably due to large coffee production in the scheme. Net output per hectare at Meki scheme stands as the second highest. Results indicate that land productivity, values of total household production and net values of production per hectare of land perform adequate and better for Meki scheme, which can be attributed to crop selection, better access to technology and better market access, all of which better financially justify the use of diesel engine pumps. Waro, being a traditional scheme has the third highest net value of production per hectare, better access to water, suitable soils and market access are the factors. The lowest net production values were recorded for Wukro and Megech schemes. For Wukro, the main attributer is water stress and competition for water, while for Megech the main reasons are the operation and maintenance costs of pumps and limited market access."},{"index":3,"size":243,"text":"The net output per hectare of land for all irrigated crops (by values of crops at local price) was also then aggregated by typologies in order to enable better and logical comparison (Figure 9). It was observed that semi-modern irrigation schemes had the best net output values per hectre of irrigated land. The reason for better value of production is not straight forward due to the complex nature of the factors affecting the agricultural production system. But the overall lesson here is that modern irrigation does not necessarily imply higher values of production per unit of land or per family. Several factors other than the water supply system, such as crop selection and agronomic practices, agro-climatic condition, soil type and fertility, access to inputs, condition of irrigation water availability, market chain, etc. affect the value of gross and net productivity per household and per unit of land. Hence performance evaluation of irrigated agriculture, particularly at farm levels, needs to combine water management and other equally important elements in the production process. Crop selection plays a major role for the higher value of production in the semimodern schemes in this case. Major crops at the semi-modern irrigation schemes are either high value vegetable crops (Meki, May Nigus and Wukro) or annual crops (coffee or fruits) at Gelana and Hare weir. Wheat being the major irrigated cereal crop and specialized at the modern scheme (Koga), the yield and value of production is by far lower."},{"index":4,"size":422,"text":"Crop selection in public irrigation schemes are very often affected by government policies and priorities. For example, when the Koga irrigation scheme was initiated in the early eighties, food self-sufficiency was the apriority and the road to the main market centre was not well developed. Thus in the feasibility study of the scheme wheat and maize constituted the major cropping pattern and farmers start producing what they were advised to produce. The question is whether food self-sufficiency or food security focused irrigation is water productive and sustainable. As part of this work, we asked farmers whether they do irrigation for food security or food self-sufficiency or both. The result illustrates that there is little specialization for food self-sufficiency or cash income. The majority of the farms in the study schemes were focusing on both. The major driver for these variations can be associated with access to market and land holding size. For example in Meki irrigation schemes, which is about 100km from the capital and crossed by a highway connecting the capital and Hawasa, a significant proportion of farmers (63%) responded as cash oriented, whilst in south Wollo where land is fragmented and rain fall is less reliable, significant proportion of farmers (50%) responded that the purpose of irrigation is mainly food self-sufficiency. According to a widely accepted definition from the Food and Agriculture Organization, food security is achieved when \"when all people, at all times, have physical and economic access to sufficient, safe and nutritious food to meet their dietary needs and food preferences for an active and healthy life\". In contrast, food self-sufficiency is defined as being able to meet consumption needs (particularly for staple food crops) from own production rather than by buying or importing. There is a longstanding debate as to whether food selfsufficiency is a useful strategy to achieve food security. Supporters of this proposition argue that relying on the market to meet food needs is a risky strategy because of volatility in food prices and possible interruption in supplies. The opposing view is that it is costly for a household (or country) to focus on food self-sufficiency rather than producing according to its comparative advantage and purchasing some of its food requirements from the market. From the angle of productive water use recent attention is to high value crops such as vegetables and fruits despite a more water demand. Thus in view of conserving water while achieving food security, it is important that government policy support the transition of smallholder irrigation systems to high value crops."}]},{"head":"Irrigation water productivity for major crops","index":16,"paragraphs":[{"index":1,"size":51,"text":"Irrigation water is generally limited or mismanaged in all irrigation schemes and water scarcities in the whole scheme or part of a scheme are among the major challenges constraining agricultural production. Hence, management of irrigation water should aim at increasing the yield (production/value) per drop of water (Haileslassie et al. 2009)."},{"index":2,"size":57,"text":"Water productivity can be determined based on water delivery at different locations within the irrigation system. For instance, water productivity determined at the headwork (head of the scheme), at the tertiary canal offtake or at the field levels in canal irrigation systems will be different due to unavoidable conveyance, distribution and on-farm application water losses (Dejen 2014)."},{"index":3,"size":105,"text":"Water productivity can also be determined based on water supply or water demand (potential ET). Water productivity based on ET depends basically on climatic factors affecting ET, and it has less significance for water management under water scarcity as it assumes sufficient water supply which is optimum (CPWF 2007). However, water productivity based on water supply can significantly vary from one scheme to another, because it depends on the nature of irrigation water supply, type of water conveyance system, on-farm water management, scheme water use efficiency, etc. Water productivity indicators can give a clue about the entry point for efficient and productive uses of water."},{"index":4,"size":247,"text":"In this study, water productivity (WP) was determined based on both water supplies at field level and ET (demand) in USD/m -3 to compare the difference across commodities and schemes (Figures 9 to 10). Comparison of water productivity based on field supply (WPf) with that of water productivity based on evapotranspiration (WPet) provides a useful idea of the on-farm water losses during irrigation of each crop. For instance, for onion (Figure 9), Meki, May Nigus and Megech schemes have WPf values less than WPet values for all crops, showing that the field water application is higher than the ET demands. On the other hand, at Wukro scheme WPf is higher than WPet which indicates field water stress. The same is true for tomato crop at Wukro, Gelena and Waro schemes (Figure 10). For wheat (Figure 11), the WPf is higher than the WPet which indicates field water supply lower than ET demand. Similarly for maize (Figure 12), the WPf is less than WPet at Hare weir, Hare diversion and Gelana schemes. Generally at Wukro and Gelana schemes, and to some extent Waro and Hare (weir and diversion), farmers practice deficit on-farm supply. Particularly Wukro and Gelana schemes have significant head-tail reach water delivery inequity and competition for water, with head users are significantly over-supplied, while tails are generally under-supplied. The irrigation practice at these schemes particularly in the middle and tail reaches is generally deficit irrigation. There is generally large variability in the WP values across schemes."},{"index":5,"size":273,"text":"The WP values reported here are in many case lower than the global values and but there are also cases that complement the findings of the present study (Maurya et al. 2014). While WPf for cereals at the schemes is generally on the lower side, it is somewhat on the higher side for vegetables. For instance, the average WP of tomato is reported to vary between 0.20 and 0.31 USD/m 3 at two irrigation schemes (Tono and Dorongo) in Ghana (Mdemu 2008). WPf for tomato in this study varied between USD 0.23/m 3 and USD 1.12/ m 3 .    For the common cultivated crops across the study schemes (maize and wheat), water productivity (WPf) was aggregated by typology (Figure 13 and 14). Similar to the value added by irrigation, water productivity decreased from modern to traditional typologies for wheat; while it increased from modern to traditional typologies for maize. The WP values for semi-modern and traditional schemes for maize are almost the same and higher than that for modern (Koga). The comparatively low WP for maize at Koga is probably due to excess on-farm water delivery and less specialization of maize at the scheme. The WP values obtained for the two cereals are low even compared to SSA. Molden et al. (2007) state that typical water productivity figures for wheat is 0.5 kg/m -3 in low-performing irrigation systems and 0.2 kg/ m 3 in rain-fed SSA. The WPf values obtained in this study for wheat varied from 0.11 to 0.17 kg/m -3 , which is by far low. Improving land productivity through intensification of water saving strategies would help to improve water productivity."},{"index":6,"size":13,"text":"Figure 13: Physical water productivity in kg m -3 field supply by typology."},{"index":7,"size":13,"text":"Figure 14: Economic water productivity USD m -3 of field supply by typology."}]},{"head":"I","index":17,"paragraphs":[{"index":1,"size":769,"text":"In addition to WP for individual crops, the total WP at headwork was aggregated by typology (Figure 15). The WP is higher for the traditional typology and is lower for the modern typology. These can be mainly attributed to the supply of irrigation water (non-reliability of the water diversion, control and distribution). The temporary structures for water diversion and distribution do not allow adequate and equitable water distribution, which occasionally cause shortages particularly during low flow in the rivers; as such water is generally in deficit at these schemes. Deficit irrigation with acceptable yield reductions in these schemes combined with lower water diversion resulted in higher total water productivity in the traditional typology. Lower water productivity at Koga (modern typology) is mainly due to excess water diversion at the headwork and the main irrigated crop type. The relative irrigation supply (RIS) which is the ratio of diverted to required flow at Koga is 1.9 and 3.4 for seasons I and II respectively, and the type of crop grown (wheat) which has lower value compared to vegetables. Note that land productivity is relatively low for traditional irrigation schemes, while having high total WP. Hence, enhancing land productivity can result in higher WP; however it cannot ensure it due to several other factors. One of the factors that can significantly affect the productivity of the field supplied water is the relative location of the fields in the scheme; head, middle, tail (Molden, Gates. (1990). This is due to the fact that the location of the farmers' fields will determine their level of access to water and efficiency of water use and hence agricultural production, particularly in gravity irrigation systems. The water supplied to sample fields in the head, middle and tail reaches of the schemes along with the total values of agricultural productions needs to be determined for this. The total values of production for sample farmers were collected with the household surveys. The water supplied to sample fields in the head, middle and tail reaches were determined by combining household surveys on farmers' irrigation practices and field measurements. The reach water productivity for each scheme is shown in Table 4. There were apparent variations in WP across reaches. Variations in water productivity across reaches does not only relate to the general consensus that tail users are more efficient in their water use. While tail users are more efficient, the reductions in yields due to water shortages play an equal role in WP values. Tail users can be more water productive provided the water stresses are within acceptable limits, and sometimes farmers have smart ways of dealing with water scarcity, for instance through crop selection. Tail farmers at May Nigus scheme, for instance, grow crops that are less water intensive (mainly legumes). These crops can be grown with less volume of water compared to vegetables (onion or tomato); however, their financial outputs are lower. For the individual schemes, reach water productivity (Table 4), tail farmers are generally more water productive (WPf) than head users. The exception being at Megech scheme where head productivity is higher than tail. This is reasonable because in this scheme water is pumped from a river and there are occasions where the river flow cannot reach the tails. In order to create temporary water storages, groups of farmers block the river flow using sand bags and materials like soil and stones there by creating a pool from which they pump. This ultimately causes critical water stresses to the tail users, drying up the river during low flows, and leaving them at a risk of losing their harvest. WP at Wukro is highest for the middle reaches, primarily due to serious water stress in the tail parts when the river flow is totally stopped by head users, which causes series yield losses at the tail. The average total field water productivity (WPf) (value of irrigation water) of all the schemes were then determined for each reach (Figure 16). The average WPf increased from the head to the tail reaches. This was also observed from the water productivity of individual schemes. Most of the schemes under consideration have significant excess diversions at their headworks and the losses are in the distribution system and mainly in the head and middle reach fields. Although tail reaches have the lowest total value of household production, they produce it with much less water. Regardless of large inequity levels and water stresses at the tail ends, farmers are able to cope by using different approaches of their own, such as crop selection, better on-farm water management, and hence higher water productivity as discussed earlier."},{"index":2,"size":128,"text":"Water productivity in SSA and in some parts of Asia is generally low compared to other regions. Kadigi et al. (2012) state that WP for water consumed in agriculture ranges from USD 0.05 to 0.90/m -3 , with the majority of observations in the range of USD 0.10 to 0.20/m -3 . Savoskul et al. (2003) found that water productivity calculated on the basis of three major crops (cotton, wheat, rice) in Syr Darya in Central Asia is 0.11 USD/m -3 . Average total economic water productivity for SSA ranges between 0.1 and 0.3 USD/m -3 (Demeku et al. 2011). The total WP values obtained for the schemes under consideration are comparable. The question then is whether higher WP implies higher farmer benefits, short-term economic progress and equity?"},{"index":3,"size":211,"text":"Higher water productivity does not ensure higher economic return for farmers, at least in the short term. This is the case as evidenced by analysis of land and water productivities for traditional schemes and tail irrigators. Higher land productivity does not ensure higher water productivity (modern irrigation) and vice versa (traditional irrigation). Smallholder farmers are more interested in their economic return from their plot of irrigated land, and higher yield per drop of water is not of big interest to them. There is no incentive for fairness for saving irrigation water, and irrigation water prices are not well set or does not exist in many cases. Kumar and van Dam (2010) state that the main considerations involved in analysing WP in the west are in reducing the amount of water required to produce a unit weight of crop, but this is not the concern in many developing economies like in Asia, where land use intensity is already very high in many regions. Higher WP would be more important in the schemes considered in this study if there were appropriate irrigation water pricing in place and water costs were set so as to discourage excess deliveries. 4. Synthesis of key challenges and entry points to addresses issues of on farm irrigation performance"},{"index":4,"size":53,"text":"In the preceding section empirical values illustrating on farm irrigation performances based on the most commonly used indicators such as land productivity; water productivity and gross value of output across three scale in interactive way were presented. Based on these findings the following sections will summarize key challenges and opportunities to address them."},{"index":5,"size":162,"text":"i. Low land productivity: As observed from empirical evidences presented earlier land productivity of crops is generally low. There is greater variability among schemes and within schemes as displayed by analysis at schemes level and by irrigation reaches. The lowest value of land productivity is estimated for the traditional schemes. Achievable yield reported by the Ethiopian Institute of Agricultural Research (EIAR 2004) for many varieties of maize, for example, is 200% higher than the values recorded here with and among scheme variation. The gaps for vegetables are even greater. This indicates the potential of irrigation commodities to contribute to food and nutritional security if the major yield limiting factors are properly addressed. Major contributors to yield gap, in addition to the over-application of water (in modern and many semi-modern typologies) and under-application (in traditional typologies and tail reaches), involve a lack of adequate knowledge of agricultural extension and limited access to improved seeds (DCG 2009;IFPRI 2010) and the injudicious management of fertilizer."},{"index":6,"size":213,"text":"Suitable methods of irrigation, direction of furrows (irrigation), amount of application, duration of application, irrigation scheduling, uniform on-farm water distribution techniques, etc. are some of the skill gaps identified in discussions with farmers. This is basically what drives over-application of water in many cases and this is accounted for the dominant poor on-farm water management leading to non-uniformity of distribution along farms, water losses and under supplies. Farmers manage their irrigation water by themselves in many cases and they get very limited practical training on on-farm irrigation. So, adequate training on on-farm irrigation water management practices, including crop based duration of irrigation, field application rates, irrigation scheduling, on-farm water application methods, method of on-farm uniform water distribution, etc. are crucial for more efficient and sustainable irrigation management. The next important thing to consider is factors that help to convert the depleted water to beneficial outputs. These involve better quality seed, fertilizer and proper pest and disease control. The seed supply system in Ethiopia is generally not well developed and in some cases it lacks transparency. In almost all studied irrigation schemes, farmers indicated that limited supply of seeds particularly for vegetables is seen as a major concern limiting productivity of farmers. Formal, transparent and wellestablished seed supply system can significantly improve farmer outputs."},{"index":7,"size":328,"text":"Nutrient depletion is one of the major attributors to low productivity in Ethiopia, and nutrient limited productivity gaps are well established. As such, the fertilizer input rate is a major aspect of on-farm management. Data on the rates of fertilizer use were collected from household surveys and focus group discussions. Average fertilizer inputs at each scheme for different crops was determined. Fertilizer inputs for Meki and May Nigus schemes are significantly higher than at any other scheme for all the major crops and also well above the blanket recommendation rate. A simple partial factor productivity (PFP) and agronomic efficiencies analysis indicate that fertilizer application is in transition for Ethiopian smallholder farmers: i.e. in contrast to widely recognized low fertilizer inputs (Haileslassie et al. 2005;Haileslassie et al. 2006), high rate of application is emerging in intensively managed irrigation systems such as Meki. Drechsel et al. (2015) indicated the typical values of PFP for N is 40-90 and for P is 75-200 for cereals. Lower values suggest less responsive soils or over application of nutrients, while higher values suggest nutrient supply is limiting agricultural productivity. Accordingly, our estimated values of the PFP for maize for both N and P were lower than the typical values for modern and semi-modern typologies, showing over application of fertilizers. However, for the traditional schemes, the PFP values for both N and P are higher and lie within the typical ranges of PFP. This suggests that the yield at the traditional schemes could be limited by nutrient availability. On the other hand, for wheat the PFP for both N and P are lower than the typical ranges of PFP for all the schemes. Hence, either fertilizer is over applied or the soils are less responsive to nutrient supply for wheat. Although these arguments need further analysis, it is important to understand that the trend has both environmental and economic implications if not well addressed and the research system should pursue context-specific water and fertilizer optimization."},{"index":8,"size":1,"text":"ii."},{"index":9,"size":231,"text":"Low physical and financial water productivity: Improving water productivity of irrigation scheme is one of the Ethiopian government strategic directions in relation to smallholder farmers. In principle, higher water productivity agriculture means higher outputs per unit of water input. As illustrated in this work this does not always hold true. Schemes for higher land productivity does not necessarily shows higher WP. The situation as indicated in this report is contrasting. Modern schemes and head irrigators have usually higher land productivity, but low water productivity. The opposite holds true for the traditional irrigation and tail irrigators. The reason for this is that modern schemes and head irrigators usually over irrigate and thus elevate the denominator of the WP. The traditional schemes and tail irrigator normally suffer from water shortages and most often practicing deficit irrigation and also select crops with low water requirement. Hence they save water while trying to minimize the impact on the yield through crop selection. Partly this could be accounted for by the fact that water is a free commodity and farmers do not consider water as an economic good as they do not pay for it. This also means future direction of improving smallholder irrigation needs to acknowledge this reality and make efforts to save water on head irrigators and increase land productivity under traditional and tail irrigators as the road to sustainability and equitable water allocation."},{"index":10,"size":153,"text":"iii. Head-tail water access disparity: Inequity in water distribution across reaches is a serious challenge in almost all the schemes except at Koga (modern typology scheme). In semi-modern and traditional schemes head reaches are generally over supplied, while tails are undersupplied. It is evident that the water productivity in the head reaches is lower in many cases due to excess application. Tail irrigators are observed to have higher water productivity, although their total return is lower as indicated earlier. Water stresses at the tails in the schemes considered are serious, often causing major loss of production. There are often differences in crop selection between the head and tail irrigators. This urges aggressive intervention in the areas of optimum water application; the need to strengthen the governance including irrigation water user association and also support in maintenance of irrigation schemes. A better insight in the water cost and recovery can help with determining charges."}]}],"figures":[{"text":"FiguresFigure 1 :Figure 2 :Figure 6 :Figure 7 :Figure 8 :Figure 9 : Figures "},{"text":"Figure 1 : Figure 1: Location map of the irrigation schemes studied. "},{"text":" Study by Getnet et al. (2015 in press) on profit and financial risk in the smallholder irrigated agriculture of Ethiopia complement the findings of the current work. "},{"text":"Figure 2 : Figure 2: Land productivity for onion across schemes (tonnes/ha). "},{"text":"Figure 4 : Figure 4: Land productivity for maize across sample irrigation schemes. "},{"text":"Figure 5 : Figure 5: Land productivity for wheat across sample irrigation schemes. "},{"text":"Figure 6 : Figure 6: Land productivity by typology for two crops. "},{"text":"Figure 7 : Figure 7: Average gross and net values of total household production for all crops. "},{"text":"Figure 8 : Figure 8: Average net values of production per hectre by typology for all irrigated crops. "},{"text":"Figure 9 : Figure 9: Irrigation water productivity for onion. "},{"text":"Figure 10 : Figure 10: Irrigation water productivity for tomato. "},{"text":"Figure 11 : Figure 11: Irrigation water productivity USD/m -3 for wheat. "},{"text":"Figure 12 : Figure 12: Irrigation water productivity USD/m -3 for maize. "},{"text":"Figure 15 : Figure 15: Total economic irrigation water productivity at intake (diversion) by typology. "},{"text":"Figure 16 : Figure 16: Aggregated water productivity by reaches across all schemes. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 2 : Typologies of schemes as classified by multi-criteria analysis  "},{"text":"Table 3 : Yield of crops by reaches for different schemes in tonnes/ha  "},{"text":"Table 4 . Total water productivity of schemes (based on water supplied at the head of the fields) by reach  "},{"text":"Table 1 : On-farm management features of the study irrigation schemes Features Tigray  Amhara  Oromia  SNNPR  FeaturesTigrayAmharaOromiaSNNPR    The study irrigation schemes   The study irrigation schemes  Wukro May Nigus Koga Megech Meki Waro Hare weir/ Gelana WukroMay NigusKogaMegech MekiWaroHare weir/Gelana        Diversion 1  Diversion 1 Distance 30 5 3 20 3 10 3 10 Distance305320310310 from main         from main road (km)         road (km) Method Diversion Embankment Embankment Diesel Diesel Temporary Diversion Diversion MethodDiversionEmbankmentEmbankmentDieselDieselTemporaryDiversionDiversion of water weir dam dam pumps pumps diversion weir/ weir of waterweirdamdampumpspumpsdiversionweir/weir abstraction       temporary  abstractiontemporary        diversion  diversion Water Canals Canals Canals Canals Pipes/ Canals Canals Canals WaterCanalsCanalsCanalsCanalsPipes/CanalsCanalsCanals conveyance     canals    conveyancecanals Dominant CL/SCL C/CL SIC C SL/SCL L SICL C/CL DominantCL/SCLC/CLSICCSL/SCLLSICLC/CL soil texture         soil texture Major crops Onion, Onion, maize, Wheat, Onion, Onion, Potato, Banana, Coffee, Major crops Onion,Onion, maize,Wheat,Onion,Onion,Potato,Banana,Coffee,  tomato, cabbage potato, onion garlic, tomato onion, maize, onion, maize, ensete, tomato,cabbagepotato, oniongarlic,tomatoonion,maize, onion,maize, ensete,  maize   tomato  tomato tomato tomato maizetomatotomatotomatotomato Average land 0.6 0.3 1.2 0.8 2.0 1.0 1.1 0.3 Average land0.60.31.20.82.01.01.10.3 holding, (ha)         holding, (ha) Water Furrow Furrow Furrow Baisn Furrow Furrow Flood Flood/furrow WaterFurrowFurrowFurrowBaisnFurrowFurrowFloodFlood/furrow application         application methods         methods Average land 0.6 Onion, maize, 1.2 0.8 2.0 Potato, 1.1 Coffee, Average land0.6Onion, maize,1.20.82.0Potato,1.1Coffee, holding, (ha) Water Furrow cabbage 0.3 Furrow Baisn Furrow onion, tomato Flood maize, ensete, tomato holding, (ha) WaterFurrowcabbage 0.3FurrowBaisnFurrowonion, tomatoFloodmaize, ensete, tomato application  Furrow    1.0  0.3 applicationFurrow1.00.3 methods      Furrow  Flood/furrow methodsFurrowFlood/furrow  "},{"text":"Table 2 : Typologies of schemes as classified by multi-criteria analysis Scheme Grade Typology Criteria for classification SchemeGradeTypologyCriteria for classification Koga 92.5 Modern If grade > 80% Koga92.5ModernIf grade > 80% May Nigus 62.25   May Nigus62.25 Meki 59.0   Meki59.0 Wukro 58.5 Semi-modern If 50% < Grade < 80% Wukro58.5Semi-modernIf 50% < Grade < 80% Hare Weir 58.0   Hare Weir58.0 Gelana 50.25   Gelana50.25 Waro 42.5   Waro42.5 Megech 42.25 Traditional If Grade < 50% Megech42.25TraditionalIf Grade < 50% Hare diversion 36.5   Hare diversion36.5  "},{"text":"Table 3 : Yield of crops by reaches for different schemes in tonnes/ha Onion               Onion Scheme  Meki   May Nigus   Wukro   Megech   - SchemeMekiMay NigusWukroMegech- Reach Head Middle Tail Head Middle Tail Head Middle Tail Head Middle Tail Head Middle Tail ReachHead Middle Tail Head Middle Tail Head Middle Tail Head Middle Tail Head Middle Tail Yield, 17.0 15.5 12 7.4 9.7 6.2 10.0 7.0 5.5 11.5 8.0 4.0 - - - Yield,17.015.5127.49.76.210.0 7.05.5 11.58.04.0--- tonnes/ha               tonnes/ha Tomato               Tomato Scheme Meki   May Nigus  Wukro   Waro   Gelana  SchemeMekiMay NigusWukroWaroGelana Yield, 12.2 12.2 8.3 4.8 4.8 3.6 1.2 1 0.9 2 2 2 3 5.5 2.8 Yield,12.212.28.3 4.84.83.61.210.9 22235.52.8 tonnes/ha               tonnes/ha Maize               Maize Scheme Megech   Koga   May Nigus  Wukro   Meki  SchemeMegechKogaMay NigusWukroMeki Yield, 4.2 3.6 2.0 2.4 2.4 2.4 2.3 2.1 2 4 3.2 2.1 4.2 4 3.2 Yield,4.23.62.0 2.42.42.42.32.1243.22.14.243.2 tonnes/ha               tonnes/ha Scheme Waro   Hare weir  Hare diversion  Gelana     SchemeWaroHare weirHare diversionGelana Yield, 1.67 1.67 1.67 2.0 1.8 1.6 2.0 1.8 1.6 0.7 1.6 0.6   Yield,1.671.671.67 2.01.81.62.01.81.6 0.71.60.6 tonnes/ha               tonnes/ha Wheat               Wheat Scheme Koga   Meki   May Nigus  Wukro   Waro  SchemeKogaMekiMay NigusWukroWaro Yield, 1.56 1.56 1.56 1.1 1.0 0.76 1.35 1.35 0.7 0.7 0.7 0.5 0.6 0.6 0.6 Yield,1.561.561.56 1.11.00.76 1.35 1.350.7 0.70.70.50.60.60.6 tonnes/ha               tonnes/ha  "},{"text":"Table 4 . Total water productivity of schemes (based on water supplied at the head of the fields) by reach   Water productivity, USD/m -3 Water productivity, USD/m -3 Scheme Head Middle Tail SchemeHeadMiddleTail Koga 0.07 0.10 0.10 Koga0.070.100.10 Meki 0.12 0.12 0.14 Meki0.120.120.14 May Nigus 0.09 0.09 0.22 May Nigus0.090.090.22 Wukro 0.09 0.31 0.17 Wukro0.090.310.17 Hare weir 0.43 0.30 0.64 Hare weir0.430.300.64 Gelana 0.34 0.50 0.86 Gelana0.340.500.86 Megech 0.18 0.17 0.13 Megech0.180.170.13 Waro 0.10 0.27 0.47 Waro0.100.270.47 Hare diversion 0.74 0.50 0.82 Hare diversion0.740.500.82  "}],"sieverID":"45af1548-e888-4fd9-8b87-0f5f3788d9aa","abstract":"The performance of smallholder irrigation schemes are challenged by several factors: among which water insecurity and low land and water productivity are the main ones. This paper evaluates the on-farm management of nine smallholder irrigation schemes from four regional states in Ethiopia. The schemes are diverse in several aspects and we clustered them into three typologies: Modern, semi-modern and traditional. Indicators such as land productivity (LP), crop water productivity (CWP) were used in evaluating performances. Data input to the target indicators was collected through household survey, field observation, measurements (canal water flow monitoring), literature review and focus group discussion (FGD). The result illustrates apparent variability of LP among schemes; scheme typology and reaches. The lowest value of LP was estimated for the traditional schemes and inter-scheme variation was also notable. For example for onion, the value for LP ranged between 7.13 and 14.55 tonnes/ha. For tomato the range was even wider: 0.9-10.29 tonnes/ha. Meki scheme showed the highest land productivity for onion and tomato with the magnitude of 14.55 and 10.29 tonnes/ha respectively. For irrigated cereals (maize and wheat) LP values showed a similar trend as for vegetables. For example the LP value for maize range between 0.65 and 3.92 tonnes/ha and for wheat the range was narrower (0.6 and 1.56 tonnes/ha). Generally these values are less than the values reported as sub-Saharan Africa (SSA) regional average suggesting the need to address yield limiting factors in smallholder schemes in Ethiopia. Water productivity by water supplied at field levels (WPf) for cereals was generally on the lower side; it is somewhat on the higher side for vegetables compared to observations from SSA. Schemes and reaches with higher land productivity do not necessarily shows higher WPf. Modern schemes and head irrigators have usually higher land productivity but low water productivity. The opposite holds true for the traditional irrigation and tail irrigators. The traditional schemes and tail irrigator normally suffer from water shortage and most often practicing forced deficit irrigation and also select crops with low water requirement. Hence they save water while trying to minimize impact on the yield through crop selection. Implicitly future direction of improving smallholder irrigation need to acknowledge this reality and put efforts to save water on head irrigators and increase land productivity under traditional and tail irrigators and promote sustainability and equitable share of water in smallholder irrigation. Probably alternatives such as valuation of water and a consumption-based water charge need to be taken into account in efforts to discourage over irrigation and enhance equitable water management by smallholders. It is also important to note that smallholder water management decisions are complex and so are the values for their performance indicators. Therefore, any development efforts dealing with smallholder irrigation need to disentangle and understand this diversity and ensure interventions are context specific."}

data/part_5/08defc3eccdaf6ff4e801d1aeec33217.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08defc3eccdaf6ff4e801d1aeec33217","source":"gardian_index","url":"https://digitalarchive.worldfishcenter.org/bitstream/handle/20.500.12348/3841/4641778bbfa576750c50d36e47ac9314.pdf"},"pageCount":1,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[]}],"figures":[{"text":"Fish lethargic at surface and not feeding Eye exophthalmia/popeye Eye endopthalmia/eye shrinkage Eye opacification  Photo credit: Chong Sabrina/WorldFish Photo credit: Shimaa Ali/WorldFish Photo credit: Partho Debnath/WorldFish Photo credit: Jerome Delamare-Deboutteville/WorldFish Photo credit: Chong Sabrina/WorldFishPhoto credit: Shimaa Ali/WorldFishPhoto credit: Partho Debnath/WorldFishPhoto credit: Jerome Delamare-Deboutteville/WorldFish Photo credit: Jerome Delamare-Deboutteville/WorldFish Photo credit: Shimaa Ali/WorldFish Photo credit: Shimaa Ali/WorldFish Photo credit: Partho Debnath/WorldFish Photo credit: Jerome Delamare-Deboutteville/WorldFishPhoto credit: Shimaa Ali/WorldFishPhoto credit: Shimaa Ali/WorldFishPhoto credit: Partho Debnath/WorldFish Gill paleness (anemia) Gill rot Fin rot/tail rot Swollen anus Gill paleness (anemia)Gill rotFin rot/tail rotSwollen anus  "},{"text":"hemorrhagic lesion Skin discoloration Open wounds  Photo credit: Partho Debnath/WorldFish Photo credit: Partho Debnath/WorldFish Photo credit: Chong Sabrina/WorldFish Photo credit: Partho Debnath/WorldFishPhoto credit: Partho Debnath/WorldFishPhoto credit: Chong Sabrina/WorldFish  "},{"text":"Abdominal distension/swelling Scale protrusion/detachment Fish gasping air at the surface   "}],"sieverID":"920f2e8a-2529-4c77-bc09-118f40f98edd","abstract":"This tilapia disease extension material and photographs were developed by the CGIAR Research Program on Fish Agri-Food Systems (FISH) led by WorldFish. It was produced as part of the WorldFish better management practice (BMP) resources to support sustainable and responsible tilapia farming. The translation into Odia language and printing of this material were funded by the Fisheries and Animal Resources Development (FARD) Department, Government of Odisha under the ongoing Odisha-WorldFish project."}

data/part_5/095df23f7ff237980fb3e2c92ff87dc6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"095df23f7ff237980fb3e2c92ff87dc6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f00077d6-d53d-4a78-a763-fd5ab19b5cfd/retrieve"},"pageCount":28,"title":"Walnuts are one of the target crops for the UNEP/GEF-Bioversity International project on crop wild relatives","keywords":["Armenia Wheat","barley","rye","pulses","pear","beet Bolivia Potato","sweet potato","quinoa","cassava","bean","capsicum","pineapple","peanut","cacao","cashew","sugar apple","papaya","palm heart","tree tomato","palmito","blackberry Madagascar Rice","banana","coffee","yam","vanilla Sri Lanka Rice","cowpea","black pepper","banana","cinnamon Uzbekistan Onion","almond","pistachio","walnut","apple","barley For further information","contact Annie Lane","Bioversity International"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":110,"text":"Crop wild relatives include crop ancestors as well as other species more or less closely related to crops. They are a critical source of genes for resistance to diseases, pests and stresses such as drought and extreme temperatures. The use of wild relatives has led to improved resistance to wheat curl mite, to late blight in potato and to grassy stunt disease in rice. They have been used to improve tolerance of drought in wheat and acid sulphate soils in rice. Wild relatives have also been used to raise the nutritional value of some crops, including protein content in durum wheat, calcium content in potatoes and provitamin A in tomato."},{"index":2,"size":92,"text":"Protecting crop wild relatives helps to ensure that adequate genetic diversity exists in a particular crop's gene pool. The increasing genetic uniformity of crop varieties, combined with the effects of climate change, makes crops more vulnerable to stress. The devastating losses in the American maize crop caused by the Southern corn blight outbreak in the USA in the 1970s highlighted the real risk of relying on a few highyielding varieties. While the USA produces about half of the world's maize, production is based on less than 5% of the diversity available worldwide."},{"index":3,"size":111,"text":"Crop wild relatives are valuable tools that we can use to adapt to changing environmental conditions and human needs, but natural populations of wild relatives are increasingly at risk, due to over-exploitation and the loss of habitat. A global project, launched in 2004, addresses these risks. The project, funded by the Global Environment Facility and implemented by the United Nations Environment Programme, involves partners from five countries-Armenia, Bolivia, Madagascar, Sri Lanka and Uzbekistan-with significant, important and threatened crop wild relatives. For more information about the project, see the story on p. 2. This special section of Geneflow is sponsored by the Crop Wild Relatives Project as part of its awareness-raising activities."},{"index":4,"size":106,"text":"As understanding and knowledge of crop wild relatives increases, plant breeders will increasingly look to them for solutions to many of the world's unsolved plant disease problems. One such major threat is Ug99, a black-stem rust first found in Ugandan wheat in 1999. This pathogen has been appearing in fields throughout East Africa ever since, where it is reducing grain yields by up to 71%. If not conquered soon, Ug99 could become a global epidemic within the next 15 years. The conservation and use of crop wild relatives could hold the key to meeting the challenge of Ug99 and other threats to agriculture and food security."}]},{"head":"By Annie Lane, Bioversity International n introduction to crop wild relatives","index":2,"paragraphs":[{"index":1,"size":36,"text":"For further information, contact Annie Lane, Bioversity International [email protected] Passion fruit, Bolivia. Crop wild relatives are a valuable source of variation that can be used to help crops adapt to changing environmental conditions and human needs."},{"index":2,"size":58,"text":"Bringing together five countries-Armenia, Bolivia, Madagascar, Sri Lanka and Uzbekistan-the Crop Wild Relatives Project aims to protect natural populations of crop wild relatives while setting a precedent for conservation that the rest of the world can follow. These countries contain some of the world's biodiversity hotspots, areas that are also at greatest risk from the loss of diversity."},{"index":3,"size":106,"text":"Crop wild relatives are essential for adapting crops to changing environmental conditions and human needs. Nevertheless, many natural populations of these highly compatible species are increasingly at risk due to climate change, over-exploitation and loss of habitat. The five-year project, which is funded by the Global Environment Facility and implemented by the United Nations Environment Programme, promotes effective in situ conservation of crop wild relatives to ensure their availability for improving global food security. Each of the five project countries has a remarkably rich and unique diversity of crop wild relatives, many of which have contributed vital genes for crop improvement in developed and developing countries."},{"index":4,"size":32,"text":"Although most of the partner countries have identified the conservation of crop wild relatives as a strategic national priority, they have had limited resources to invest in conservation programmes in the past."},{"index":5,"size":6,"text":"The project has three broad goals:"},{"index":6,"size":33,"text":"• To develop national and international information systems on crop wild relatives that include data on species biology, ecology, conservation status, distribution, crop production potential, uses, existing conservation actions and existing information sources."},{"index":7,"size":24,"text":"• To build the capacity of national partners to use this information to develop and implement rational, cost-effective approaches to conserving crop wild relatives."},{"index":8,"size":25,"text":"• To raise awareness of the potential of crop wild relatives for improving agricultural production among policy-makers, conservation managers, plant breeders, educators and local users."},{"index":9,"size":71,"text":"The project outcomes will provide the basis for strategies that could be applied in other countries with significant populations of crop wild relatives. In this way, these five nations, with little in common beyond the fact that they are located in centres of crop diversity and possess important and endangered crop wild relatives in their mountain systems, will collectively make a major contribution to the conservation of crop wild relatives globally."},{"index":10,"size":55,"text":"Bioversity International is the executing agency for the project and five other international organizations are partners in the initiative: the Food and Agriculture Organization of the United Nations, Botanic Gardens Conservation International, the United Nations Environment Programme World Conservation Monitoring Centre, the World Conservation Union, and the Information and Coordination Centre for Biological Diversity (IBV)."}]},{"head":"By Annie Lane, Bioversity International","index":3,"paragraphs":[{"index":1,"size":20,"text":"The Crop Wild Relatives Project Crops whose wild relatives have been given priority by the countries participating in the project"}]},{"head":"The project outcomes will provide the basis for strategies that could be applied in other countries","index":4,"paragraphs":[{"index":1,"size":27,"text":"Despite the immense diversity of wild relatives and their potential to resist challenges ranging from disease to drought, wild relatives are little used in crop improvement efforts."},{"index":2,"size":57,"text":"Using crop relatives involves crossing the crop with a wild relative that has the desired character, obtaining the hybrid offspring and then backcrossing this over several generations with the crop parent to obtain a type with the desired new character. However, in order to achieve the desired product, plant breeders often have to overcome some major problems."},{"index":3,"size":55,"text":"Often the hybrids and subsequent generations of offspring continue to possess undesirable traits derived from the wild relative. They may have poor production or quality characteristics and perform poorly in agricultural production. Efforts to remove these undesirable characteristics through further backcrossing can slow progress and delay the development of new varieties with the desired traits."},{"index":4,"size":16,"text":"Another major factor that has limited the use of wild relatives has been poor interspecific crossability."},{"index":5,"size":22,"text":"Many wild relatives are difficult to cross with the crop; even when they can be crossed the hybrid offspring may be sterile. "}]},{"head":"Wild foods are rich in micronutrients","index":5,"paragraphs":[{"index":1,"size":9,"text":"For further information, contact Pablo Eyzaguirre, Bioversity International [email protected]"}]},{"head":"The Maasai provide living proof of the impact wild plants can have on health","index":6,"paragraphs":[{"index":1,"size":38,"text":"The Maasai consume a diet rich in animal fats and yet they do not suffer from dietrelated health problems or diseases associated with high fat consumption. Researchers attribute this to the fact that they regularly eat wild plants."}]},{"head":"S. Mann/ ILRI","index":7,"paragraphs":[{"index":1,"size":48,"text":"Common nutritional deficiencies, the related health problems and the potential role of wild foods (adapted from the 'Report of the International Expert Consultation on Non-Wood Forest Products. Non-wood Forest Products,' FAO 1995) The benefits of foods from the forests For further information, contact Pablo Eyzaguirre, Bioversity International [email protected]"}]},{"head":"Forest resources are essential for local communities","index":8,"paragraphs":[{"index":1,"size":15,"text":"A villager in north-east Thailand returns from the forest with a harvest of wild tubers."}]},{"head":"L. Thomson/Bioversity International","index":9,"paragraphs":[{"index":1,"size":64,"text":"A wild tomato has allowed plant breeders to boost the level of solids in commercial varieties by 2.4%, an increase worth US$250 million annually to farmers in California (USA) alone. Meanwhile, three different wild peanuts have been used to breed commercial varieties resistant to root knot nematodes. This development is helping to save peanut growers around the world an estimated US$100 million a year."},{"index":2,"size":30,"text":"Crop wild relatives make a huge contribution to plant breeding. Wild relatives have provided traits such as disease resistance, tolerance of extreme temperatures, tolerance of salinity and resistance to drought."},{"index":3,"size":39,"text":"In the 1970s an outbreak of grassy stunt virus devastated the rice fields of millions of farmers in South and South-East Asia. The virus, transmitted by the brown plant hopper, prevents the rice plant from producing flowers and grain."},{"index":4,"size":71,"text":"Scientists from the International Rice Research Institute (IRRI) screened more than 17 000 samples of cultivated and wild rices for resistance to the disease. A wild relative of rice growing in Uttar Pradesh, India was found to have a gene for resistance to the grassy stunt virus. This gene is now routinely incorporated in all new varieties of rice grown across more than 100 000 km ² of Asian rice fields."},{"index":5,"size":75,"text":"Breeders have also used wild relatives to boost the nutritional value of foods. By crossing cultivated broccoli with a wild Sicilian relative, scientists are breeding a variety that contains higher levels of the cancer-fighting chemical, sulphoraphane, an antioxidant that destroys compounds that can damage DNA. The new variety of broccoli contains 100 times more sulphoraphane. Wild relatives have also helped increase the nutritional value of the cultivated tomato by providing more vitamin C and beta-carotene."},{"index":6,"size":97,"text":"Wheat is the staple food for approximately one in three of the world's population. But diets based solely on cereals lack important nutrients such as iron, zinc and vitamin A. A wild relative of wheat from the eastern Mediterranean was used to increase the protein content of bread and durum wheat. The International Maize and Wheat Improvement Center (CIMMYT) has shown that wild relatives of wheat have up to 1.8 times more zinc and 1.5 times more iron in their grains than ordinary wheat and could be used to increase levels of these minerals in wheat varieties."},{"index":7,"size":101,"text":"The growing recognition of the value of wild relatives in crop improvement comes at a time of increasing concern over the loss of these genetic resources. For example more than one in 20 of the species of Poaceae, the botanical family that includes cereal crops such as wheat, maize, barley and millet, are threatened with extinction from deforestation, habitat loss and intensive agriculture. Forests are rich in wild plants that may be new sources of novel genetic traits for improved crops including coffee, mango and rubber. Yet during the 1990s, 94 million hectares, or 2.4% of total forest cover, was lost."},{"index":8,"size":50,"text":"Recent experience shows that using crop wild relatives to improve production and the nutritional contents of crops can improve people's livelihoods and their health. Taking action now to rescue endangered crop wild relatives is the only way to ensure that this value will continue to be available to future generations."}]},{"head":"By Ruth Raymond, Bioversity International","index":10,"paragraphs":[{"index":1,"size":36,"text":"The value of wild relatives  Visitors to Sri Lanka's Department of Agriculture Information Park are given a tour through a variety of exhibits including fields of vegetables, home gardens, the national genebank and an agriculture museum."},{"index":2,"size":2,"text":"A. Wijesekara"},{"index":3,"size":8,"text":"The entrance to Sri Lanka's Agriculture Information Park."},{"index":4,"size":54,"text":"Cinnamon is big business in Sri Lanka, with the potential to get even bigger if efforts to safeguard the wild relatives of the spice succeed. More than 100 000 Sri Lankans depend on cinnamon for their livelihoods. Close-up of a banana flower, Sri Lanka. Banana is the most important fruit crop in Sri Lanka."}]},{"head":"D. Yakandawela","index":11,"paragraphs":[{"index":1,"size":42,"text":"The Armenian highlands are home to a rich diversity of crop wild relatives. Some are ancestors of cultivated varieties; others cross freely with their related cultigens and can be used in breeding or to study the relationship between wild and cultivated plants."},{"index":2,"size":133,"text":"Armenia is a centre of origin for cereals. Here, the use of wheat dates back more than two millennia. Archaeological excavations have revealed well-preserved granaries and clay vessels filled with a grain identified as Triticum urartu, a wheat species named after the ancient kingdom of Urartu whose inhabitants were skilled agriculturists. It is believed that the ancestors of T. urartu played a role in the origin of wheat varieties cultivated today. Another ancient type, known as korkot, is used in modernday Armenian kitchens. Wheat grains discovered in the storehouses of the ancient Urartu fortress still grow in the Ararat valley. Today, about 13 species and more than 360 varieties of cultivated and wild wheat can be found in Armenia. Three out of the four known wild wheat species can be found in Armenia."},{"index":3,"size":72,"text":"The wild wheats of Armenia have a high potential for use in improving cultivated wheat varieties. Some of the wild species are drought-resistant, which is particularly important in Armenia due to the dry climate and frequent water shortages. The wild species Triticum boeoticum Bois is resistant to fungal diseases and has high variability, which makes it a valuable subject for research. Triticum araraticum Jakubz could be used to breed proteinrich wheat varieties."},{"index":4,"size":88,"text":"The use of wild relatives to improve Armenian wheat is an important strategy: wheat is absolutely central to the country's culture and customs. Traditionally, the mother of the groom puts lavash-a type of flat bread-on the shoulders of the bride and the groom when they are about to enter their new home for the first time. It is believed that this will keep the new family productive, affluent and fertile. In other words, as an Armenian saying would have it, \"there will always be bread on the table.\""},{"index":5,"size":8,"text":"By Armen Danielian, Ministry of Nature Protection, Armenia"},{"index":6,"size":23,"text":"Wild relatives offer new lease on life to an ancient grain For further information, contact Armen Danielian, Ministry of Nature Protection, Armenia [email protected]"}]},{"head":"The use of wild relatives to improve Armenian wheat is an important strategy","index":12,"paragraphs":[{"index":1,"size":3,"text":"Women preparing lavash."}]},{"head":"A. Danielian","index":13,"paragraphs":[{"index":1,"size":4,"text":"Lavash, traditional Armenian bread."},{"index":2,"size":75,"text":"Although the wild relatives of crop plants have been used by farmers for millennia and by plant breeders for over a century, remarkably, efforts to ensure the continued availability of these valuable resources are very recent. The Crop Wild Relatives Catalogue for Europe and the Mediterranean was created by matching the regional flora (held in the Euro+Med Plantbase: www.euromed.org.uk) with specialist socio-economic plant databases. Individual country catalogues can be extracted by filtering the regional database."},{"index":3,"size":29,"text":"Researchers are using wild relatives to create wheat varieties containing valuable traits that were thought to have been lost forever, watered down by thousands of years of wheat breeding."},{"index":4,"size":19,"text":"When farmers started to domesticate wheat thousands of years ago, they were given a great head start by nature."},{"index":5,"size":67,"text":"The original primitive wheats were the results of spontaneous crossings of wild grasses, the wild relatives of wheat. Those grasses had been exposed to cold, drought, heat, waterlogging and all kinds of diseases and pests. The grass species alive today resisted those scourges and carried resistance in their seeds as part of their genetic heritage. They also brought those characteristics to the first wheats planted by farmers."},{"index":6,"size":57,"text":"Wheat today comes in two broad categories. Durum wheat resulted from the crossing of two wild grasses and today is best known as the wheat used for pasta, couscous and semolina products. Bread wheat, a cross between durum and another grass, is thought to have arisen about 10 000 years ago, in the Caspian area of Iran."},{"index":7,"size":59,"text":"Wheat is the staple food for a third of the world, providing more calories and protein in people's diets than any other crop. Ninetenths of the world's wheat is bread wheat. The rise of wheat as an important food crop came at a cost to its genetic diversity, especially when landraces were replaced over large areas by fewer varieties. "}]},{"head":"Wheat is the staple food for a third of the world","index":14,"paragraphs":[{"index":1,"size":15,"text":"Three synthetic wheats (right) derived from crosses of durum wheat (left) with wild grass species."}]},{"head":"CIMMYT","index":15,"paragraphs":[{"index":1,"size":37,"text":"The Persian or common walnut (Juglans regia) is native to Central Asia. This species has been widely cultivated for many thousands of years, but its wild relatives have been sadly neglected, putting them at risk of disappearing."},{"index":2,"size":59,"text":"The story has it that Alexander of Macedonia ordered the importation of the Persian walnut to Greece, ascribing to it the power to protect his soldiers against disease. Numerous ancient historians, such as Arrianos, Teofrast and others, claim that Alexander's army was saved from certain death by the large numbers of walnuts they ingested during his campaign in Turkistan."},{"index":3,"size":78,"text":"Apparently, this is not far fetched. Walnuts are an excellent source of omega-3 fatty acids and have been shown to be helpful in lowering cholesterol, both of which characteristics help guard against heart disease. In addition, walnuts contain a host of other important vitamins, minerals, protein and antioxidants. Walnuts are cited as the second richest source of antioxidants, next to rose hips, according to a study by the University of Minnesota, USA, and the University of Oslo, Norway."},{"index":4,"size":107,"text":"Close to 200 species of Persian walnut grow in Central Asia. Long prized for its beautiful wood, as well as for its fruit, the dangers faced by walnut diversity in the region are very real. To protect walnut trees in their native lands, the Crop Wild Relatives Project, funded by the Global Environment Facility and implemented by the United Nations Environment Programme, is working with partners throughout the region to set up modern walnut plantations. If successful, the project should reduce the exploitation of natural stands of walnut trees, allowing diversity to flourish while establishing a sustainable approach to enriching the livelihoods of people in the region. "}]},{"head":"Close to 200 species of Persian walnut grow in Central Asia","index":16,"paragraphs":[{"index":1,"size":28,"text":"Walnuts are a good source of omega-3 fatty acids and can help lower cholesterol. Pistachio plays an important role in the culture and culinary traditions of Central Asia."}]},{"head":"L. Nikolyai","index":17,"paragraphs":[{"index":1,"size":41,"text":"Scientists are on a hunt for genes in the land where farming began, searching for lost genetic resources that scientists say will be crucial for the world to keep feeding itself as climate change and deteriorating agricultural landscapes begin to bite."},{"index":2,"size":48,"text":"High in the mountains of southern Armenia, the farmer's tanned, furrowed face is thoughtful. \"You should ask the old women,\" he said after a pause. From village to village, others agree. \"Ask the old women.\" They are helpful and nostalgic and, after an obligatory vodka or two, melancholy."},{"index":3,"size":56,"text":"The old women emerge from lightless kitchens and farm buildings and the scientists explain their quest to find places where ancestral plants might still grow on high plains that have been overgrazed or mined. The women hurry away and with extraordinary generosity reemerge with tins, jars and knotted cloth containing biological treasures-the seeds of bygone crops."},{"index":4,"size":23,"text":"Grains of wheat, barley, beans and peas disappear into small yellow envelopes. Some of the old women cry, because these visiting scientists seem"},{"index":5,"size":101,"text":"to understand what they have known intuitively all along-that the traditional varieties were special. The team scours the birthplace of agriculture, the Caucasus-Armenia, Azerbaijan, Georgia and parts of Russia-for remnant on-farm seed stocks and for the ancestral wild grasses from which modern crops like wheat and barley were first bred some 5000 or so years ago. They are focused on the two or three degree increase in average temperatures that the globe is likely to face due to global warming. A fraction of a degree change can be enough to stop many food plants from flowering and delivering grains and fruits."},{"index":6,"size":98,"text":"It is the genes that allow the old relatives of modern crops to flourish in frozen or arid landscapes that need to be found and reintroduced. \"We are going back through time, backwards through human-induced evolution,\" explained Street. \"We are looking for the grasses that were used for bread-making thousands of years ago. We are searching for what our far-distant ancestors were using, because these plants have a wider genetic base. A modern wheat plant might have a few hundred parents from a breeding programme, but the ancient wild varieties had hundreds of thousands, perhaps millions, of parents."},{"index":7,"size":62,"text":"\"The world is losing irreplaceable seeds. This is frightening, because the genetic origins for a very large proportion of the world's food crops do not exist anywhere else. So we are desperately trying to collect, store, document and manage as much diversity from old varieties and wild relatives as we can before they are gone forever. It's a survival issue,\" Street said."},{"index":8,"size":52,"text":"By Brad Collis, Coretext Pty Ltd sk the old women the search for hardy survivors Follow-up to the project will involve additional collecting and evaluation of the promising plants, as well as the development of methods for commercial production in order to ensure against overharvesting from the wild populations of vulnerable species."}]},{"head":"By Kelly Wagner, Bioversity International","index":18,"paragraphs":[{"index":1,"size":64,"text":"Tapping the potential of medicinal and aromatic plants in northern Europe show that within the next 50 years climate change is likely to dramatically affect all three crops. Strikingly, the study predicts that by 2055, 18-25% of all potato, peanut and cowpea species could become extinct and that most species could lose over 50% of the land area that is currently suited to them."},{"index":2,"size":103,"text":"Wild peanuts are predicted to be the hardest hit, with as many as 31 of the 51 wild species studied likely to become extinct and the distribution area of the remainder to be reduced by more than 90%. In addition, up to 13 of 107 wild species of potato studied could become extinct by 2055, with the potential distribution area of the remaining species reduced by over 70%. Up to three of 48 species of cowpea are likely to disappear, and the distribution area could be reduced by 65%, with 41 out of 48 species losing more than 50% of their current ranges."},{"index":3,"size":45,"text":"The study also estimates that the average patch size of populations will diminish by as much as 75%, indicating greater fragmentation of populations and reduced viability for survival. Moreover, habitat fragmentation will create spatial barriers to species migration, effectively isolating populations and narrowing genetic diversity."},{"index":4,"size":90,"text":"The findings demonstrate that climate change will drive many wild relatives of important crops to extinction through habitat reduction and fragmentation, without even considering other continuing drivers of habitat loss such as deforestation and over-exploitation. The wild relatives of peanut, potato and cowpea have already proven to be important sources of genes for improving agricultural production. For example, wild relatives of the potato have provided resistance to late blight, Colorado potato beetle and various viruses, and wild relatives of cultivated peanut have been used to breed resistance to root-knot nematode."},{"index":5,"size":85,"text":"Unfortunately, it is rare for crop wild relatives to be targeted for conservation actions. Equally rare is their use in adapting modern crops to the impacts of climate change, although they are a promising source of genes for hardiness, often growing off the beaten track in already challenged environments. While much attention is given to the benefits to be obtained from the use of crop wild relatives in breeding, it is worth sparing a thought for the problems of collecting these plants from the wild."},{"index":6,"size":106,"text":"Crop wild relatives occupy a very wide range of habitats throughout the world, some of which pose serious difficulties for the plant collector. Some grow in inaccessible rocky habitats. The plants that grow on rock faces or cliffs often have a highly specialized ecology and may even be nichespecific-they will grow only on overhangs or on vertical faces, for example. According to Ehsan Dulloo, senior scientist at Bioversity International and co-chair of the expert group, \"They may look scruffy and worthless, but wild relatives are a goldmine of genes for helping farmers to combat challenges such as pests and diseases, climate change, water stress and salinity.\""},{"index":7,"size":34,"text":"Although agricultural scientists identified crop wild relatives as a conservation target over 30 years ago, it was not until the 1990s that the in situ conservation of wild relatives began to be taken seriously."},{"index":8,"size":54,"text":"Ex situ conservation of wild relatives, while a desirable back-up to in situ conservation, can be tricky because the wild relatives tend to contain fewer seeds than their cultivated counterparts. Only about 5% of the crop diversity conserved in European and CGIAR genebanks is from crop wild relatives; the rest is from domesticated crops."},{"index":9,"size":77,"text":"One of the first actions of the specialist group, currently in its formative days, will be to establish a global database on crop wild relatives. The group plans a major effort to raise the profile of wild relatives and stimulate their conservation. Dulloo believes that the future of wild relatives is safe in the hands of the group. \"The Crop Wild Relatives Specialist Group will become the global authority on the conservation of wild relatives,\" he said."}]},{"head":"By Kelly Wagner, Bioversity International","index":19,"paragraphs":[{"index":1,"size":69,"text":"Spreading the word about wild relatives Wild relatives provide a valuable source of variation that can be used to improve the quality of many cultivated species. In the past, wild relatives have been used to improve the flavour of tomatoes, the disease resistance of potatoes and the drought tolerance of chickpeas. Now, studies are being conducted to see if wild relatives can boost the marketability of pepino (Solanum muricatum)."},{"index":2,"size":106,"text":"Golden yellow or purplish green and covered with darker stripes, the pepino is a juicy, mildly sweet and aromatic berry that is also referred to as pepino melon or melon pear. The fruit is native to the temperate Andean region that includes Chile, Colombia, Ecuador and Peru. Today, it is grown commercially in Chile, New Zealand and Western Australia. The introduction of pepino as a new fruit on European markets has potential for increasing the incomes of poor farmers in Latin America. However, existing pepino varieties are not sweet enough and do not have enough solid mass to be marketed in Europe in their present state."},{"index":3,"size":75,"text":"Environmental conditions influence the fruit quality of pepino. For example, high temperature during ripening reduces the sugar content, making the fruit less sweet. On the other hand, when the crop grows in a cooler environment, the soluble solids concentration levels-sugar and organic acid content in fruitincrease, although they still are normally too low to meet European consumer demands. Now, research is underway to improve the sweetness of pepinos by crossbreeding them with their wild relatives."},{"index":4,"size":72,"text":"Difficulties often arise when breeding cultivated crops with their wild relatives due to crossability barriers between species. Fortunately, pepino crosses easily with two wild species that are its accepted ancestors, S. caripense and S. tabanoense. These species are harvested and eaten by rural people in the Andean region and have high acidity and mass. Although the wild species have smaller fruit, this undesirable trait can be reduced in a few backcrossing generations. "}]},{"head":"The introduction of pepino as a new fruit on European markets has potential for increasing the incomes of poor farmers in Latin America","index":20,"paragraphs":[{"index":1,"size":15,"text":"Researchers are looking to wild relatives of pepino for ways to increase the fruit's sweetness."},{"index":2,"size":28,"text":"For years, groundnut fields have been laid waste by devastating fungal diseases. Now, thanks to the wild relatives of the groundnut, farmers around the world can breathe easier."},{"index":3,"size":39,"text":"A few spots on the leaves of the groundnut plant are enough to strike fear into the hearts of farmers around the world. Cultigen: Cultivated plant, such as the banana, not known to have a wild or uncultivated counterpart."}]},{"head":"CGIAR:","index":21,"paragraphs":[{"index":1,"size":25,"text":"The Consultative Group on International Agricultural Research, a strategic alliance of countries, international and regional organizations and private foundations supporting 15 international agricultural research centres."},{"index":2,"size":20,"text":"Desertification: Land degradation in arid, semiarid and dry subhumid areas resulting from various factors including climatic variability and human actions."},{"index":3,"size":17,"text":"Ecosystem: An ecological system formed by the interaction of a community of organisms with its physical environment."},{"index":4,"size":14,"text":"Ex situ conservation: Conservation of a plant outside of its original or natural habitat."},{"index":5,"size":52,"text":"Genebank: A facility where crop diversity is stored in the form of seeds, pollen, in vitro culture or DNA or in the case of a field genebank as plants growing in the field. Genebanks can also be used to store the genetic resources of animals, microbes and other elements of agricultural biodiversity."}]},{"head":"Genetic diversity:","index":22,"paragraphs":[{"index":1,"size":9,"text":"The genetic variation present in a population or species."}]},{"head":"Genetic resources:","index":23,"paragraphs":[{"index":1,"size":19,"text":"Genetic material of plants, animals and other organisms that is of value for present and future generations of people."},{"index":2,"size":17,"text":"Genotype: 1. The genetic constitution of an organism. 2. A group of organisms with similar genetic constitutions."},{"index":3,"size":11,"text":"Germplasm: A set of genotypes that can be conserved or used."},{"index":4,"size":1,"text":"In "}]}],"figures":[{"text":"A wild relative of rice provided resistance to grassy stunt virus, a disease that caused devastating losses to farmers across South and South-East Asia in the 1970s. Sri Lanka. The Sri Lankan Department of Agriculture is taking advantage of its beautiful setting to bring the story of agriculture-including the role played by wild relatives-directly to the public. The Department of Agriculture is the only government department whose headquarters are located outside the capital city of Colombo. The Department was first established at the Royal Botanic Gardens during the colonial era and it can still be found in an enchanting environment in the central hills of Sri Lanka along both banks of the Mahaweli, the longest river in the country. Inspired by its attractive location, Rohan Wijekoon of the Department of Agriculture came up with the idea of giving the public the opportunity to see the new agricultural technologies used on the Department's research and farming fields. Today, the Department's Agriculture Information Park welcomes about 30 000 people annually.Visitors to the park are guided by trained agricultural instructors through its main attractions, which include fields of vegetables, root and tuber crops, fruit orchards, a home garden, paddy cultivation fields, traditional farming systems, the national genebank and an agriculture museum. Along the way, colourful signboards explain the exhibits to visitors. The genebank tour guide explains the importance of crop diversity conservation, while the home garden and the traditional agriculture and leafy vegetable exhibits display Sri Lanka's own crop diversity. The paddy cultivation role of wild relatives in crop improvement. So far, wild relatives of pepper, bean, okra, banana and rice have been established along the banks of the Mahaweli river. The Department is in the process of establishing a second information park in southern Sri Lanka, which will also feature a section devoted to crop wild relatives.The success of the park has prompted plans by the Department of National Botanic Gardens to establish similar exhibits throughout the country.And the idea has caught on beyond the crop sector. Using a similar concept, the Forest Department has established a Forest Education Park at Kande Ela, in the central hills of Sri Lanka near Horton Plains, a popular national park. "},{"text":"For further information, contact Åsmund Asdal, Norwegian Crop Research Institute [email protected] Creating a commercial value for the plants is a great incentive to keep them safe Roseroot, a wild plant used to combat depression, has gone into commercial production in Norway and Finland. As global temperatures continue to rise, crop wild relatives are threatened with extinction at the very time they are needed the most. Climate change is making major new demands on crop diversity as well as creating new opportunities for using diversity to mitigate its adverse impacts on agricultural systems. Crop wild relatives can help adapt cultivated crops to changing climactic conditions, but their very survival has been placed in jeopardy by climate change. A study conducted by Bioversity International and the International Rice Research Institute (IRRI) estimated the current and future geographical distribution of the wild relatives of three of the world's important food crops-potato, peanut and cowpea-based on 19 climate variables. The results "},{"text":" the Web site of the Institute for Conservation and Improvement of Agrobiodiversity of Valencia, Spain, at http://www.comav. upv.es/index2.html "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" vegetable stall in Cochabamba, Bolivia, boasts a striking display of potato diversity. A recent study by IRRI and Bioversity International estimates that up to 13 of 107 wild species of potato being studied could become extinct by 2055. Climate change threatens  Climate change threatens wild relatives with extinction  wild relatives with extinction  Climate change Climate change  is making major is making major  new demands on new demands on  crop diversity crop diversity  The selection of in situ The selection of in situ  conservation areas for crop conservation areas for crop  wild relatives and species- wild relatives and species-  specific management specific management  strategies need to factor strategies need to factor  in climate change as in climate change as  a significant driver of a significant driver of  species distribution and species distribution and  conservation status. conservation status.  Climate modellers, Climate modellers,  plant breeders and plant breeders and  conservationists also conservationists also  need to work together to need to work together to  identify vulnerable areas identify vulnerable areas  and species, evaluate the and species, evaluate the  species that are important species that are important  to crop improvement and to crop improvement and  develop integrated climate- develop integrated climate-  change conservation change conservation  and breeding strategies. and breeding strategies.  Threatened species will Threatened species will  require targeted monitoring require targeted monitoring  and conservation measures and conservation measures  in order to ensure their in order to ensure their  survival in the face of survival in the face of  climate change. The more climate change. The more  threatened species will threatened species will  require targeted ex situ require targeted ex situ  conservation interventions. conservation interventions. For further information, contact By Annie Lane and For further information, contactBy Annie Lane and Annie Lane, Andy Jarvis, Bioversity Annie Lane,Andy Jarvis, Bioversity Bioversity International International, and Robert Bioversity InternationalInternational, and Robert [email protected] Hijmans, IRRI [email protected], IRRI  "},{"text":" Pistachio's broad genetic base is being lost as a few high-yielding commercial types replace ancient varieties, and human activity destroys wild species. It was not until It was not until the 1990s that the 1990s that the in situ the in situ conservation of conservation of wild relatives wild relatives began to be began to be taken seriously taken seriously For further information, contact For further information, contact the co-chairs of the specialist the co-chairs of the specialist group: Ehsan Dulloo, group: Ehsan Dulloo, Bioversity International Bioversity International [email protected] [email protected] and Nigel Maxted, and Nigel Maxted, University of Birmingham University of Birmingham [email protected] [email protected]  "},{"text":" Two fungal diseases-early leaf spot and late leaf spotcan seriously damage the plant and have a major impact on crop yields.  Groundnut relatives hit the spot Groundnut relatives hit the spot   96% of the land planted Now, the International wild peanut varieties- 96% of the land plantedNow, the Internationalwild peanut varieties-   to groundnut and for 92% Crops Research Institute Arachis stenosperma, A. to groundnut and for 92%Crops Research InstituteArachis stenosperma, A.   of global production. for the Semi-Arid Tropics kempff-mercadoi, A. diogoi of global production.for the Semi-Arid Tropicskempff-mercadoi, A. diogoi   Clearly, coming to grips (ICRISAT) is developing and A. cardenasii-yielded Clearly, coming to grips(ICRISAT) is developingand A. cardenasii-yielded   with leaf spot could have groundnuts with resistance progeny with resistance to with leaf spot could havegroundnuts with resistanceprogeny with resistance to  Agrobiodiversity: The major implications for to the two dread diseases. late leaf spot. Thanks to its Agrobiodiversity: Themajor implications forto the two dread diseases.late leaf spot. Thanks to its  elements of biodiversity-including plants, animals and micro-organisms-that the livelihoods of poor countries. Fortunately, many wild relatives of groundnut are nutty relatives, it looks like groundnut is here to stay. elements of biodiversity-including plants, animals and micro-organisms-thatthe livelihoods of poor countries.Fortunately, many wild relatives of groundnut arenutty relatives, it looks like groundnut is here to stay.  benefit people.  good sources of resistance benefit people.good sources of resistance  Biodiversity: The total variability within and Early leaf spot is caused by the fungus Cercospora to both leaf spot diseases. By crossing wild groundnut By N. Mallikarjuna, ICRISAT Biodiversity: The total variability within andEarly leaf spot is caused by the fungus Cercosporato both leaf spot diseases. By crossing wild groundnutBy N. Mallikarjuna, ICRISAT  among species of all arachidicola. Reports with the cultivated type, among species of allarachidicola. Reportswith the cultivated type,  living organisms and their habitats. indicate that yield losses due to this pathogen can ICRISAT scientists have already managed to living organisms and their habitats.indicate that yield losses due to this pathogen canICRISAT scientists have already managed to  Climate change: A be as high as 50%. Late produce resistant types. Climate change: Abe as high as 50%. Lateproduce resistant types.  change in climate that can be directly or indirectly attributed to human activity leaf spot is caused by Phaeoisariopsis personata, Given the dynamic and change in climate that can be directly or indirectly attributed to human activityleaf spot is caused by Phaeoisariopsis personata,Given the dynamic and  and that is in addition to which has caused ever-evolving character and that is in addition towhich has causedever-evolving character  natural climate variability over comparable time periods. economic losses totalling US$599 million in the of diseases, ICRISAT scientists are constantly on natural climate variability over comparable time periods.economic losses totalling US$599 million in theof diseases, ICRISAT scientists are constantly on  Groundnut is the groundnut growing areas the hunt for new sources Groundnut is thegroundnut growing areasthe hunt for new sources  thirteenth most important of the world, including of resistance to leaf spot. thirteenth most importantof the world, includingof resistance to leaf spot.  food crop in the world, Asia and Africa. Recently, crosses of four food crop in the world,Asia and Africa.Recently, crosses of four  the fourth most important   the fourth most important  source of edible oil and   source of edible oil and  the third most important   the third most important  source of vegetable   source of vegetable  protein. It is grown on   protein. It is grown on  26.4 million hectares   26.4 million hectares  worldwide with a total   worldwide with a total  production of 36.1 million   production of 36.1 million  tonnes. Developing   tonnes. Developing  countries account for   countries account for  A few spots on   A few spots on  the leaves of the   the leaves of the  groundnut plant   groundnut plant  are enough to   are enough to  strike fear into   strike fear into For further information, contact N. Mallikarjuna, ICRISAT the hearts of farmers around   For further information, contact N. Mallikarjuna, ICRISATthe hearts of farmers around [email protected] the world   [email protected] world  "}],"sieverID":"50e6fa92-4807-42a6-a16f-2a29c6f626e3","abstract":""}

data/part_5/09927e1a7b002027bad5b78ef82103cb.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09927e1a7b002027bad5b78ef82103cb","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/fc104797-d3d0-4895-84cb-1451bf68e60c/retrieve"},"pageCount":7,"title":"Multitraits evaluation of Pakistani ecotypes of berseem clover (Trifolium alexandrinum L.) under full-irrigation and water restriction conditions","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":425,"text":"Trifolium alexandrinum L. (berseem clover or Egyptian clover) is one of the most important leguminous forages in the Mediterranean region and the Middle-East (Sardana and narwal, 2000;El-BaBly, 2002;IannnuccI, 2002;dE SantIS et al., 2004). It contributes to soil fertility and improves soil physical characteristics (GravES et al., 1996) and its forage is superior to grasses in protein and mineral contents (laGharI et al., 2000). Berseem clover originated in Syria and was introduced into Egypt in the 6 th century (hannaway and larSon, 2004), India in the 19 th century and Pakistan, South Africa, the USA and Australia in the 20 th century (hEuzé et al., 2014). It is grown in the semi-arid regions of the world under pure stand and crop mixture (MartInEllo and IannuccI, 1998;vaSIlakoGlou and dhIMa, 2008). Limitation of water supply is a major production constraint for this crop (IannuccI et al., 2000;lazarIdou and koutrouBaS, 2004). Studies concerning the evaluation of tolerance to water restriction are scarce in berseem clover. IannuccI et al. (2000) reported a significant reduction in total dry weight, plant height and proline content due to water stress treatments. lazarIdou and tSIrIdIS (2004) noted a 75 % decrease in biomass, leaf area and transpiration rate as a result of water restriction. Evaluation and selection of berseem clover germplasm in a specific environment have generally con-cerned small sets of ecotypes and have been based on a single or a reduced number of traits (IannuccI et al., 2000;lazarIdou and koutrouBaS, 2004). The present experiment compared the yield of a large set of berseem clover ecotypes originated from different regions of Pakistan under full irrigation and water restriction conditions. As in the semi-arid environment and under limited irrigation the berseem plant has often to rely on moisture stored in a deep profile of soil to maintain its growth, the water restriction treatment consisted in maintaining humidity only in the deep profile of the soil. The ability of the different ecotypes to utilize the stored soil moisture content and maintain its yield under these specific water restriction conditions was evaluated using a multiplicity of traits including canopy temperature (and its response to variation in air temperature), gas exchange parameters, osmotic potential, chlorophyll and carotenoid contents, water use efficiency, recovery rate index and wilting rate index, as well as calculating a drought resistance index on the basis of comparisons between the two treatments. The genetic variability and heritability of the assessed traits and their relation with yield were also examined, in order to identify potential criteria for the further selection of ecotypes under stored moisture stress."}]},{"head":"Materials and methods","index":2,"paragraphs":[]},{"head":"Plant material","index":3,"paragraphs":[{"index":1,"size":42,"text":"Twenty Pakistani berseem clover ecotypes were provided by the National Agriculture Research Council and the Forage Research Institute of Faisalabad, Pakistan. Out of them, 17 originated from Punjab, one from Balochistan, one from Khyber Pakhtunkhwa and one from Singh Provinces (Tab. 1)."}]},{"head":"Experimental conditions","index":4,"paragraphs":[{"index":1,"size":229,"text":"The experiments were conducted in lysimeters of 60 cm diameter and 40 cm depth. Field conditions are known to exploit full yield potential of the ecotypes but make difficult to ensure uniform moisture storage and avoid confounding factors such as soil heterogeneity or presence of multiple stress factors (arauS and caIrnS, 2014). Conversely, the use of lysimeters facilitates better control in the application of uniform treatments (MaSuka et al., 2012). Each lysimeter was filled with 50 kg of dry soil with an equal quantity of silt and loam. Soil fertility was increased by adding 5 % of organic matter. The field capacity of the soil, measured using the gravimetric method, was 14 % by weight. The seeds were inoculated before sowing with 5 μL of rhizobium bacterial suspension (Rizobium leguminosarum bv. trifolii). The experiment was conducted in a completely randomized design with three replications and two factors, i.e. ecotypes (20) and water regimes (2). The two contrasting water regimes consisted in a full irrigation and a water restriction regime. In the full irrigation regime, soil was flooded when the moisture level fell below the field capacity of the soil, while the water restriction regime was created by irrigating the crop when severe wilting (90 %) was observed for each ecotype, through a 3 cm diameter pipe allowing storing the moisture in the lower profile of the soil (30-40 cm)."},{"index":2,"size":152,"text":"The quantities of water supplied to each lysimeter were 16.5 L in the full-irrigation regime (11 irrigations) and 4.5 L in the water restriction regime (3 irrigations). The lysimeters were covered with a plastic tunnel to avoid chilling stress or damage due to frost during the night and maintain the optimum temperature for growth (25±3 °C) during the day. Relative humidity was around 40 % and photon flux density was 600 μmol m -2 s -1 during the peak photosynthesis hour. Air temperature and humidity in the tunnel were registered at regular intervals using a digital thermometer and a hygrometer. Thinning was carried out to keep the plant population close to 100 plants per lysimeter. During the entire crop growth cycle, weeds were removed manually and no herbicide or pesticide was applied. The different ecotypes were regularly evaluated for insect and disease, and no attacks were identified during the entire crop cycle."}]},{"head":"Soil and plant trait measurements","index":5,"paragraphs":[{"index":1,"size":58,"text":"A soil sampler with a coring cylinder of 3.8 × 10 cm was used to collect soil samples at various depths (10-40 cm) in each lysimeter. The samples were quickly transported to the laboratory without exposure to air. The soil sample was oven-dried at 60 °C (ED-115, Binder, Tuttlingen, Germany) to determine soil moisture content at constant weight."},{"index":2,"size":88,"text":"All ecotypes were harvested at 70 and 110 DAE. For each harvest, fresh biomass (FB) was measured on a digital balance (GW 6202, Sartorius, Germany). Plants were then dried in a heating oven (ED-115, Binder, Tuttlingen, Germany) at 70 °C for 72 hours to determine dry biomass (DB). Forage yield was estimated as the sum of biomass of the two harvests (krEnzEr et al., 1992). Leaf area (LA) was measured on well expanded leaves at 70 days after emergence (DAE), using a leaf area meter (CI-202, Camas, USA)."},{"index":3,"size":65,"text":"Canopy temperature was assessed at 60 DAE using a hand-held infrared thermometer (model IR-AHT, Chino Co., Tokyo, Japan) at a uniform height (1.5 m), angle (60°) and distance between the thermometer and the target. Measurements were made in windless conditions during the afternoon. Each measurement was repeated three times. The air temperature was subtracted from the canopy temperature to determine the canopy temperature depression (CTD)."},{"index":4,"size":297,"text":"Net photosynthesis rate (P N ), transpiration rate (T r ), leaf temperature and ambient air temperature were measured at 68 DAE on 10 days old leaves at the top of canopy around noon with a gas exchange apparatus (CI-340, Camas, USA). Each measurement was repeated three times. Leaf temperature depression (LTD) was measured by subtracting the temperature of ambient air around the leaf from the leaf temperature. Chlorophyll contents were measured using the acetone extraction method. Collected samples (0.5 g of fresh leaf) were dissolved in 15 ml of acetone. The leaf extract was centrifuged at 8000 RPM for 5 minutes and absorbance was assessed at 663 nm, 645 nm and 470 nm using a UV-Vis spectrophotometer (UV 2600, Schemadzo, Japan). Chlorophyll a (Chla), Chlorophyll b (Chlb) and carotenoids (Car) were calculated according to hIScox and ISraElStaM (1979) as Chla = 11.75A 663 -2.35A 645 , Chlb = 18.61A 645 -3.96A 663 and Car = (1000A 470 -2.27 Chla -81.4 Chlb)/227 withA 663 , A 645 and A 470 being the absorption values at 663, 645 and 470 nm, respectively. Osmotic adjustment (OA) was determined for each ecotype by subtracting the osmotic potential under full irrigation from the osmotic potential under water restriction, after irrigation and recuperation of full turgor, as described by BaBu et al. (1999). Osmotic potential was measured using a vapor pressure osmometer (VAPRO 5520, Wescor, Utah, USA). At 70 DAE and after irrigation leaf samples were collected in both treatments when 80 % of plants recovered from wilting. The leaf samples were pressed in the Eppendorf tube to extract the cell sap which was centrifuged at 8000 RPM for five minutes to collect the supernatants. 10 μL of supernatants were used for the measurement of osmotic potential (in MPa) in both regimes."},{"index":5,"size":358,"text":"The water used by the plant (WU) was estimated as the product of transpiration rate (T r ) by leaf area (lazarIdou and noItSakIS, 2003). Transpiration was asses on fully expanded leaves at the top of canopy with a hand-held photosynthesis system (CI-340 4845 NW, Camas, WA, USA) between 10:00 and 11:00 am. Plant water use efficiency (WUE) was calculated according to lazarIdou and koutrouBaS (2004) as the ratio of above-ground dry biomass to the water transpired by the plant. Drought resistance index was calculated as DRI = (Y S /Y N ) / (M S /M N ) where Y S was the biomass of an ecotype under stress (water restriction) conditions, Y N the biomass of this ecotype under non-stress (full irrigation) conditions, M S the mean biomass yield of all ecotypes under stress and M N the mean yield of all ecotypes under non-stress conditions. A recovery rate index was calculated for each ecotype as RRI = [(R 1 /T 1 ) + (R 2 /T 2 ) + (R 3 /T 3 )] / R where R 1 was the number of plants which recovered from wilting the first day after restoring water in the lower profile of the lysimeter, R 2 the number of plants which recovered from wilting during the second day, R 3 the number of plants which recovered from wilting during the third day and R the final recovery after 3 days. T 1 , T 2 and T 3 had values of 1, 2 and 3, respectively. A wilting rate index was also calculated for each ecotype as WRI = (W 1 / T 1 +W 2 /T 2 +W 3 /T 3 ) / % W where W 1 was the number of plants showing symptoms of wilting 10 days after restoring the soil moisture content, W 2 and W 3 being the number of plants that showed symptoms of wilting 2 and 3 days after the first measurement, respectively, and W the total number of wilted plants wilting after 3 days. T 1 , T 2 and T 3 had values of 1, 2 and 3, respectively."}]},{"head":"Statistical analyses","index":6,"paragraphs":[{"index":1,"size":367,"text":"The data were subjected to the analysis of variance using the CROP-STAT 7.2 software. Genotypic and phenotypic coefficients of variation were estimated as GCV % = √Genotypic variance/overall average of the ecotypes × 100 and PCV % = √Phenotypic variance/ overall average of the ecotypes × 100, respectively. PCV % and GCV % reflected the variation in the germplasm at phenotypic and genotypic levels. The phenotypic variation is the sum of genotypic variance (σ 2 g )+ environmental variance (σ 2 E ). Genetic purity of each of the ecotypes (inbreeding coefficient = 1) was maintained for several generations by growing them in isolation. Therefore variation within ecotypes was considered environmental which was used to estimate overall σ 2 E . Variation between ecotypes was used to estimate the phenotypic variance (σ 2 p ). Genotypic variance was estimated by subtracting the environmental variance from the phenotypic variance. Broad sense heritability (h 2 ) was calculated according to allard (1960) as h 2 = (σ 2 g / σ 2 p ) × 100. A stepwise selection procedure based on the Akaike information criterion for multiple regression models (vEnaBlES and rIplEy, 2002) was conducted to determine the traits associated with fresh and dry biomass. The plant trait values were used to describe multiple regression models for fresh forage yield (sum of first and second harvest) and dry forage yield (sum of first and second harvest), both measured in the water restriction treatment. Calculation of regressions and stepwise selection were carried out using the 'lm' and 'step' procedures of the R software (R 2013), respectively. A genotype plus genotype by environment (GGE) analysis (yan and kanG, 2003) was carried out to analyze the fresh and dry biomass in the first and second harvests for the two treatments. Both fresh and dry biomasses were arranged into a two-way genotype-by-combination of the harvest number and the water regime. A biplot analysis was carried out on traits showing positive influence on yield in order to select promising ecotypes. The traits were standardized before the analysis in accordance with different scales of the chosen variables. The biplot calculations were made using the 'scale' and 'svd' procedures of the R software (R 2013)."}]},{"head":"Results","index":7,"paragraphs":[{"index":1,"size":242,"text":"As shown by the average pattern of water removal in different layers at various intervals (Tab. 2) moisture content was higher in upper layers in the full irrigation treatment, compared to the water restriction treatment. In this last one, moisture content was maintained higher in the lower layers than in the upper ones. Significant effects due to ecotypes, water regimes and interaction (ecotypes × water regimes) were noted for all traits, except carotene contents which showed insignificant differences due to water treatments (Tab. 3). Water restriction effects were particularly drastic on fresh forage yield (FFY), canopy temperature depression (CTD) and transpiration rate (T r ) which reduced 160, 79 and 61 %. Water restriction increased the phenotypic and genotypic coefficients of variation for all traits except leaf area. High phenotypic and genotypic coefficients of variation were noted in both treatments except for leaf area. The broad sense heritability of FFY, leaf area (LA), chlorophyll b (Chlb) and carotene content (CAR) was less under water restriction conditions. Most physiological traits had a higher heritability than forage yield. Osmotic adjustment (OA) had higher phenotypic and genotypic coefficients of variation than drought resistance index (DRI), recovery rate index (RRI) and survival rate index (SRI) (Tab. 4). DRI and SRI had higher heritability than water use efficiency (WUE), OA and RRI. The biplot analysis realized on biomass retained 88 % of the variation for fresh biomass (Fig. 1) and 80 % for dry biomass (Fig. 2)."},{"index":2,"size":191,"text":"In both treatments, the evaluated ecotypes showed differential performance across the two harvests. Under full irrigation conditions, the highest fresh biomass was noted in 'SB-10' and 'L-94' for the first harvest and in 'Berseem Tandojam', 'Pachati' and 'Agaiti' for the second harvest. The highest dry biomass was noted in 'SB-10' and 'L-94' for the first harvest and in 'SB-10' and 'Sandal bar' for the second harvest. Under water restriction, the highest biomass was noted in 'SB-12', 'Berseem Queta' and 'P-22'. The best fitted models for fresh biomass under water restriction and full irrigation conditions were respectively FB (fresh biomass) = 6.63 -0.02 Chla + 0.8 LTD -0.17P N + 3.18 DRI + 0.84 WUE + 0.03 RRI -0.01 SRI (R 2 = 0.4) and FB = 15.07 + 0.06 LA + 2.09 LTD (R 2 = 0.1). The best fitted model explaining dry biomass under water restriction and full irrigation conditions were DB (dry biomass) = 1.560 + 0.26 LTD + 0.73 DRI + 0.21 WUE (R 2 = 0.32) and DB = 2.45 + 0.01 LA + 0.13 P N -1.02 E + 0.42 CTD (R 2 = 0.47), respectively."},{"index":3,"size":119,"text":"The biplot analysis realized on the traits associated to yield under water restriction (ie, DRI, LTD, RRI and WUE) showed a negative association between WUE and LTD, and between DRI and RRI (Fig. 3). The ecotypes 'Anmol', 'Agaiti' and 'SB-12' had the highest WUE (and the lowest LTD values). Conversely, the ecotypes 'Super' and 'Chenab', followed by 'Samarkand', 'L-48', 'SK-1', 'P-Tab. 3: Mean, analysis of variance, genotypic coefficient of variation (GCV%), phenotypic coefficient of variation (PCV%) and heritability (h 2 ) for fresh forage yield (FFY), dry forage yield (DFY), canopy temperature depression (CTD), leaf temperature depression (LTD), net photosynthesis rate (P N ) and transpiration rate (T r ) of berseemclover under full irrigation and water restriction conditions.  "}]},{"head":"Plant traits","index":8,"paragraphs":[]},{"head":"Discussion","index":9,"paragraphs":[{"index":1,"size":435,"text":"After having used yield as an exclusive breeding objective, many breeders progressively replaced this empirical approach by indirect Tab. 4: Mean, analysis of variance, genotypic coefficient of variation (σ 2 g ), phenotypic coefficient of variation (σ 2 p ) and broad sense heritability (h 2 ) for osmotic adjustment (OA), drought resistance index (DRI), water use efficiency (WUE), recovery rate index (RRI) and survival rate index (SRI) under water restriction conditions. selection (JackSon et al., 1996), based on the selection for 'secondary traits' or plant characteristics that provide additional information about how the plant performs under a given environment (lafIttE et al., 2003). Any trait to be used as a surrogate of yield in the evaluation or selection process has to be genetically variable, highly heritable, genetically associated with yield, easy, inexpensive and fast to observe or measure, non-destructive and stable over the measurement period (EdMEadES et al., 1997). In the present study, all measured traits had high genotypic and phenotypic coefficients of variation. Moreover, water restriction increased the variability of various traits as previously observed by IannuccI et al. ( 2000),  El-BaBly (2002) and lazarIdou and koutrouBaS (2004). Physiological traits had higher broad sense heritability than yield. Finally, an association was noted between forage yield and LTD and RRI under water restriction conditions, suggesting the use of these traits as indirect selection criteria for yield under stress in berseem clover. Under full irrigated conditions, yield was positively associated to P N , canopy temperature depression (CTD) and leaf area. Gas exchange measurements which provide simultaneous information about LTD and P N appears provide useful prediction of forage yield. The use of leaf gas exchange traits has been proposed for the selection of sunflower (kalyar et al., 2013). These measurements however require expensive equipment and are slow, stable over the measurement period. The use of the recovery index consequently appears as a good option for the prediction of forage yield under water restriction. Similarly, under full irrigated conditions, leaf area and canopy temperature depression could represent good candidates for indirect selection. Leaf area is strongly reduced by water stress in berseem clover (MartInIEllo and tExEIra da SIlva, 2011) and is closely associated to yield in these conditions (ahMEd, 2006). CTD is a highly integrating trait resulting from the effects of several biochemical and morpho-physiological features acting at the root, stomata, leaf, and canopy levels. It is useful mainly in hot and dry environments, with high vapor pressure deficits (tuBEroSa, 2012). In wheat, significant genetic gains in yield have been reported in response to direct selection for CTD in these environments (BrEnnan et al., 2007)."},{"index":2,"size":149,"text":"The mean sum of square (MSS) due to ecotypes × water regimes was high when compared with MSS due to ecotypes for traits such as FFY and DMY (Tab. 3), suggesting differential performance of ecotypes over water regimes (dESMaraIS et al., 2013). This was confirmed by the magnitude of genetic variation (GCV%) which increased under water restriction, particularly for CTD, LTD and P N, indicating that this treatment successfully discriminated the ecotypes for their tolerance. GGE biplot analysis of multiple harvests under water regimes showed that the biomass of the first cut is not always a good indicator of biomass of the second cut. Some ecotypes like 'SB-10' from Punjab, however, showed stable biomass across cuts. As the development of high-yielding and stable ecotypes across multiple harvests is a major breeding objective of forage breeding (chakroun et al., 1990;krEnzEr et al., 1992), these ecotypes should be recommended for cultivation."},{"index":3,"size":165,"text":"The relationships observed between traits under water restriction conditions suggest that ecotypes with a higher LTD may recover well from drought stress. LTD is an important index of drought avoidance, transpiration and root growth under drought stress. It has been noted earlier that this trait positively correlated with biomass in various forage grass species (acuna et al., 2011;MErEwItz et al., 2014). It also appears that simultaneous selection for LTD and DRI or for RRI and WUE might be difficult. However, simultaneous selection may be practiced to some extent for LTD and RRI or WUE and DRI. Under full irrigated conditions, simultaneous selection for P N and CTD or P N and LA may be possible for the selection of highyielding ecotypes under irrigated conditions. Selection for low LA might lead to higher CTD. kalyar et al. ( 2013) also showed that a higher temperature depression was negatively related with leaf area in irrigated sunflower and suggested that reduced leaf area could participate in leaf cooling."},{"index":4,"size":136,"text":"A large variation has been reported in berseem clover for the adaptation to multiple cuts (GravES et al., 1996;putnaM et al., 1999;roSS et al., 2003;ranJBar, 2007) and the knowledge of productivity across cutting regimes is of primary importance in breeding programs (JuSkIw et al., 2000). Among the tested ecotypes, 'SB-10' (from Punjab) showed the highest productivity. This ecotype was also characterized a good aptitude for double harvesting in irrigated conditions. This aptitude that highly depends harvesting management (aBdEl-Gawad, 1993;GEwEIfEl and raMMah 1990;IannuccI et al., 2000) should however be confirmed under in different dates of harvest. Under water restriction conditions, the highest forage yield was noted in 'SB-12' (Punjab), 'Berseem Queta' (Balochistan) and 'P-22' (Punjab). These ecotypes could be recommended to farmers according to their needs and demand and for further use as progenitors in breeding programs. "}]}],"figures":[{"text":"Fig. 1 : Fig. 1: GGE biplot of fresh biomass in the first (1) and second (2) cuts under water restriction (S) full irrigation (W) for twenty ecotypes of berseem clover (Trifolium alexandrinum L.). 22', 'SB-10', 'Sanadal bar', 'Pak berseem' and 'Punjab' had high LTD and low WUE values. The highest DRI and lowest RRI values were observed in 'Berseem Peshawar', 'Agati', 'Sandal Bad', 'Super', 'Pachati', 'L-48', 'Berseem Tandojam' and 'Sanadal bar'. The ecotypes 'L-94', 'SB-10', 'P-209', 'P-22', 'Anmol' and 'Punjab' had the highest RRI and lowest DRI values. The biplot analysis realized on the traits associated to yield under full irrigation (ie, P N , LA and CTD) showed a positive association between P N and LA (Fig. 4). Those traits were poorly correlated to CTD. The ecotype 'SB-10' had high P N and LA values. 'P-209', 'P-22', 'Sanadal Bar', 'Samarkand' and 'Pachati' showed high P N values, while 'Berseem Peshawar', 'Berseem Queta', 'Sandal Bad', 'Berseem Tandojam', 'L-48', 'L-94', 'Anmol' and 'Punjab' had low P N values. The ecotypes 'P-209', 'P-22', 'Sandal Bar', 'Samarkand', 'L-94' and 'SK-1' had the highest LA while 'Punjab', 'Berseem Peshawar', 'Agaiti', 'SB-12' and 'Chenab' had the lowest. 'Punjab', 'Chenab', 'Pak', 'Agaiti', 'SB-12' and 'Pachati' had high CTD values. Contrastingly, the ecotypes 'L-94', 'Sandal Bad', 'Anmol', 'Berseem Queta', 'Berseem Tandojam','P-209' and 'L-48' had low CTD values. P N was not associated to CTD and LA. 'Pachati' and 'Pak Berseem' combined high CTD and P N values, while 'P-209', 'P22', 'Sanadal Bar', 'Samarkand' and 'SK-1' had high LA and P N values. The ecotypes 'Berseem Peshawar', 'Berseem Queta', 'Berseem Tandojam' and 'L-48' had lower CTD, P N and LA values. "},{"text":"Fig. 2 : Fig. 2: GGE biplot of dry biomass in the first (1) or second (2) cut under water restriction (S) andfull irrigation (W) for twenty ecotypes of berseem clover (Trifolium alexandrinum L.). "},{"text":"Fig. 3 : Fig. 3: GGE biplot for standardized leaf temperature depression (LTD), drought resistance index (DRI), recovery rate index (RRI) and water use efficiency (WUE) for twenty ecotypes of berseem clover (Trifolium alexandrinum L.) under water restriction. LTD, DRI, RRI, and WUE were averaged across replications for each combination of Genotype-by-Trait. The first principal component axis (PC1) retains 41% and the second 31 % of sum of squares. "},{"text":"Fig. 4 : Fig. 4: GGE biplot for standardized net photosynthesis rate (P N ), leaf area (LA), and canopy temperature depression (CTD) under full irrigation for twenty ecotypes of berseem clover (Trifolium alexandrinum L.). The first principal component axis (PC1) retains 47 % and the second 36% of sum of squares of averaged by replications trait-by-ecotypes combinations. "}],"sieverID":"ce84a906-448f-4615-a867-9ecf6c492546","abstract":"Berseem clover (Trifolium alexandrinum L.) is an important forage crop in Pakistan and many ecotypes are grown across the country. Its yield is however frequently affected by insufficient irrigation due to unavailability of water. In the present study, twenty Pakistani ecotypes of berseem clover have been evaluated in lysimeters under full irrigation and water restriction conditions. In the full irrigation treatment soil humidity was maintained at field capacity, while in the water restriction treatment water was only supplied after severe wilting and to maintain humidity in the deep profile of the soil. Assessed traits included forage yield, calculated as the sum of the biomass harvested at 70 and 110 DA days after emergence, and morpho-physiological traits. Significant effects of water restriction were noted on yield, leaf gas exchange parameters, canopy temperature and osmotic adjustment. Most morpho-physiological traits had higher broad sense heritability than forage yield, both under full irrigation and water restriction conditions. Water restriction increased genetic and phenotypic variability and heritability of most traits under study. Under these conditions forage yield was positively associated to leaf temperature and recovery rate index and, under full irrigation, to net photosynthetic rate, canopy depression temperature and leaf area. The possible use of these traits as indirect selection criteria in berseem clover breeding programs is discussed. Some ecotypes with favorable traits such as high forage yield potential, good adaptation to water restriction and aptitude to multiple harvesting have also been identified."}

data/part_5/099b3d48bf42abc6dae4ac7a176ad929.json

@@ -0,0 +1 @@
+{"metadata":{"id":"099b3d48bf42abc6dae4ac7a176ad929","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ca162cc0-fac0-4f8b-a500-b50ab16fd0bb/retrieve"},"pageCount":16,"title":"Making Smallholder Value Chain Partnerships Inclusive: Exploring Digital Farm Monitoring through Farmer Friendly Smartphone Platforms","keywords":["collaboration","partnerships","value chains","smallholders","inclusiveness","digital agriculture"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":114,"text":"Smallholder farmers in developing countries generally lack access to advanced agricultural supplies, timely market information, and a full range of financial services [1]. Stimulating partnerships, which include mutual benefits for smallholder groups and value chain actors, is increasingly seen as a means to improve smallholder access to these crucial services [2]. These multi-actor partnerships leverage collaboration to create services to smallholders [3] and therewith reduce the transaction costs [4]. Research however notes that such multi-actor partnerships are often driven by power dynamics and stakeholder interests [5,6]. Hence, deliberate actions are needed to safeguard inclusiveness for weaker groups like smallholders [7]. Without such measures, partnerships may reproduce extant forms of marginalization for smallholder farmers [8]."},{"index":2,"size":148,"text":"For smallholder value chains, making partnerships inclusive for farmers presents a unique challenge. In partnerships, smallholders tend to be engaged as a collective, receiving general support 2 of 16 measures such as improved seeds and credit [9]. This structure is pragmatic but poses some challenges as farmers are heterogeneous in nature and face diverse socio-ecological challenges which necessitate more personalized support than offered [10]. At the same time, smallholder farm settings are highly variable making it essential for farmer conditions to be frequently communicated, understood, and responded to if their needs would be appropriately met by the support mechanisms offered by partnerships. Resource limitations and communication difficulties that characterize smallholder institutional contexts however limit the ability of individual farmers to communicate and influence partnership decisions to align with their needs [11]. As such Bitzer and Glasbergen argue that smallholder organizations often lack genuine representation in partnership arrangements [12]."},{"index":3,"size":122,"text":"Tackling these communication constraints is crucial in making partnerships more inclusive for smallholder farmers. Several studies have highlighted the potential and actual contributions of mobile technology in enabling this in smallholder value chains [13,14]. Smartphones, with features like cameras, internet, and access to global positioning systems (GPS) offer further opportunities in this domain [15]. Leveraging these advanced mobile features, smartphone devices could contribute to more detailed forms of farm monitoring and communication that enhance information flow, mutual understanding, responsiveness, and accountability between smallholders and partners. This digital approach to farm monitoring and communication by smallholders, offers a new means of capturing and communicating locally specific farm information [16,17]. In this way, smartphone devices could contribute to building more inclusive value chain partnerships."},{"index":4,"size":216,"text":"Although smartphones have become more accessible in recent years due to rapidly declining costs, a persisting constraint to their adoption is that most smallholders lack the capacity to navigate their interface or use their advanced features. Caine et al. reason that to overcome this capacity gap, attention should be paid to designing digital tools to meet the information needs and technological abilities of smallholder farmers [18]. Such an approach should seek to reflect the local context, user capacities and the cultural background in smartphone applications, and therewith make digital tools more user friendly to farmers [19][20][21]. These arguments suggest that a participatory design approach, adapting digital tools to smallholder needs and capacities, is essential for smallholders to harness these communicative benefits of smartphones. There is however a knowledge gap on the efficacy of such an approach in enabling farmer use of smartphones for monitoring purposes. More specific, not much is understood about how smallholder farm monitoring and communication through smartphones could influence smallholder inclusiveness in value chain partnerships. This study therefore seeks to answer two research questions: (i) In what way does co-designing farm monitoring platforms with smallholders influence farmer capability to monitor and collect farm information via smartphones, and related to that (ii) how does this influence farmer sense of inclusiveness in value chain partnerships?"},{"index":5,"size":91,"text":"We study these questions by focusing on the case of smallholder maize farmers in the Techiman locality (Ghana). In this case, we reflect on the participation of farmers in a co-designing process for farm monitoring through online platforms. To this end, we present the theoretical framework for the study in the next section, followed by our methods and results. In the final section of this paper, we discuss and conclude on both the reflection on the co-design process and the influence of this process on the inclusiveness of value chain partnerships."}]},{"head":"Theoretical Framework","index":2,"paragraphs":[]},{"head":"Value Chain Partnerships and Inclusiveness","index":3,"paragraphs":[{"index":1,"size":71,"text":"Partnerships are defined as collaborative institutional arrangements between actors from various sectors of society [22]. In the context of smallholder agriculture, Bitzer et al. theorize that value chain partnerships are about the construction of institutions that enable smallholders to participate in value chains [9]. By engaging different actors, partnerships have the ambition to leverage divergent expertise and specialized roles that can complement each other and address the constraints faced by smallholders."},{"index":2,"size":148,"text":"In pooling actors, value chain partnerships bring together actors with different interests as well as ways of reasoning and knowing. For instance, value chain partnerships may involve smallholders collaborating with bankers, insurers, and/or agribusinesses, who tend to be business-oriented in their thinking and have formalized rules and relationships whereas smallholders are relation-oriented and rely more on interpersonal relationships. As partners seek to conduct activities according to their ways of knowing and reasoning, there is an on-going tussle to meet different actor interests [6]. These differences mean that although partnerships may be formed with the intention to improve smallholder circumstances, they may not necessarily be inclusive [12], nor do they always result in beneficial outcomes [23], especially for those less empowered or able to speak up. Value chain partnerships aiming for inclusion, thus, not seldomly result in the opposite, calling for a re-examination of the inclusiveness of such arrangements."},{"index":3,"size":182,"text":"To do so, Vermeulen and Cotula offer four criteria for determining the inclusiveness of value chain collaborative arrangements for smallholder farmers [2]. These consist of the level of ownership, voice, risk, and reward that farmers have in the collaboration. Ownership relates to how much of the key project assets are owned by smallholders. Voice represents the extent to which farmers can communicate with partners and influence the decisions and actions taken in the value chain set up. The level of Risk borne by smallholders and the commensurate Reward in the given arrangement are also argued to be critical measures of how inclusive a value chain collaboration is. These four criteria are argued to be interconnected as changes in one can lead to alterations in the others, and consequently the overall level of inclusiveness in the value chain arrangement [2]. Enabling inclusiveness in partnerships thus goes beyond linking farmers to key value chain actors, to enhancing farmer ability to make these linkages work for their benefit [24] by ensuring that partnerships function in ways which improve smallholder ownership, voice, risk, and rewards [2]."}]},{"head":"Smartphone Platforms for Inclusive Partnerships","index":4,"paragraphs":[{"index":1,"size":240,"text":"Vermeulen and Cotula aver that enhanced communication mechanisms help to give voice to actors, which could make value chain collaborations more inclusive [2]. For instance, since smallholders are heterogeneous and have diverse needs [10], allowing farmers in collectives to communicate their farm-specific conditions would improve partners' awareness and understanding of farmers' contexts, and help farmers to attain more farm specific and timely support services [25]. Thus by providing credible information, smallholders could counter ignorance, distrust, and self-protective behavior of powerful value chain partners. Transparency creates a public space in which value chain partners are called upon to reconsider their decision-making. Reducing information asymmetry may enable farmers and partners to mitigate conflicts by building transparency, accountability, and trust in the partnership [12]. To attain more inclusive partnerships, smallholders need to be able to communicate their farming activities, conditions and needs in ways that partners can comprehend, trust, and respond to [26]. On the other hand, heightened monitoring for information symmetry could contribute to counter inclusive outcomes through farmer experiences of surveillance and being controlled [27]. However, by making smartphone platforms more user friendly for smallholders, through an inclusive co-design process that involves them, farmers could take the lead in farm monitoring and communication that might enable an accretion of their agency in partnerships. In other words, inclusive partnerships could be facilitated through smartphones by empowering smallholders with a voice and systematically increasing their capability to influence change in their context [28,29]."},{"index":2,"size":55,"text":"Using these theoretical concepts, we explore how farmer oriented smartphone platforms for farm monitoring in a specific smallholder context influences partnership inclusiveness. We do this by developing and reflecting on a co-design process (see methods section for a further elaboration on the co-design method). In this process, we focus our analysis on farmer views of:"},{"index":3,"size":25,"text":"(i) the extent to which the co-design process enhanced farmer perception of their ability to use smartphones for farm monitoring and communication in partnership arrangements;"},{"index":4,"size":19,"text":"(ii) the extent to which this increased farmers' perception of inclusion in terms of ownership, voice, risk, and reward."}]},{"head":"Materials and Methods","index":5,"paragraphs":[]},{"head":"Study Context","index":6,"paragraphs":[{"index":1,"size":243,"text":"The study was conducted in the Techiman municipal district in Ghana's Bono East region (see Figure 1). About 46.2% of the households in the municipality are engaged in agriculture; of these 95.4% are crop farmers. In the rural localities, 75.8% of the households are engaged in agriculture whereas in urban localities the figure falls to 33%. Maize is a major food crop produced in the area with the district's center having one of the biggest market centers for maize trade both within and across Ghana's borders [30]. Smallholder maize farming in the Techiman area, like most parts of Ghana, is characterized by rain-fed production, limited storage facilities, poor information flow, powerful traders, and weak farmer groups. These have historically translated into many experiences of uncertainties, unfair farmer treatment, strategic defaults, conflicts, and mistrust when value chain actors partner for collaboration. Farmers generally have limited options for financial and material support from formal sources, resulting in significant reliance on value chain actors for such needs and a precarious position in partnerships [31]. The study area was chosen as it resembles a prime example of a context in which multiple actors interact in varying maize value chain partnerships. In addition, several projects have been implemented in the area to help facilitate value chain development and collaboration enhancement. These characteristics provided the appropriate conditions for this study. (ii) the extent to which this increased farmers' perception of inclusion in terms of ownership, voice, risk, and reward."}]},{"head":"Materials and Methods","index":7,"paragraphs":[]},{"head":"Study Context","index":8,"paragraphs":[{"index":1,"size":224,"text":"The study was conducted in the Techiman municipal district in Ghana's Bono East region (see figure 1). About 46.2% of the households in the municipality are engaged in agriculture; of these 95.4% are crop farmers. In the rural localities, 75.8% of the households are engaged in agriculture whereas in urban localities the figure falls to 33%. Maize is a major food crop produced in the area with the district's center having one of the biggest market centers for maize trade both within and across Ghana's borders [30]. Smallholder maize farming in the Techiman area, like most parts of Ghana, is characterized by rain-fed production, limited storage facilities, poor information flow, powerful traders, and weak farmer groups. These have historically translated into many experiences of uncertainties, unfair farmer treatment, strategic defaults, conflicts, and mistrust when value chain actors partner for collaboration. Farmers generally have limited options for financial and material support from formal sources, resulting in significant reliance on value chain actors for such needs and a precarious position in partnerships [31]. The study area was chosen as it resembles a prime example of a context in which multiple actors interact in varying maize value chain partnerships. In addition, several projects have been implemented in the area to help facilitate value chain development and collaboration enhancement. These characteristics provided the appropriate conditions for this study.  "}]},{"head":"Scope","index":9,"paragraphs":[{"index":1,"size":140,"text":"The study involved farmers who had been a part of a partnership arrangement facilitated by the Ghana Agricultural Development and Value Chain Enhancement (ADVANCE) II project. The project aimed to support smallholder farmer groups by linking them to markets, finance, inputs, and information through larger farmers and traders. For the study, we purposively selected 6 villages in the Techiman municipality in which farmer groups and collaborative arrangements with value chain actors had been established under the ADVANCE project. One farmer group was randomly selected from each village. Five members were then nominated from each farmer group to participate in co-designing a farmer friendly farm monitoring platform. Each farmer group was provided with a smartphone on which the finalized platform would be installed for farm monitoring purposes. In total, 30 fields were to be monitored by the farmers via the platform."}]},{"head":"Co-Design Approach","index":10,"paragraphs":[{"index":1,"size":267,"text":"Since the study aims to facilitate the design of a digital platform and understand the influence of the process and output, we adopted the Action Design Research (ADR) method. The ADR as a research method looks to utilize a building and evaluation process for garnering relevant knowledge for effective design in a given organizational context [32]. This approach is undergirded by the principle that information technologies are shaped through actor interactions in relation to their specific context. In this way, building, implementing, and evaluation are not seen to be iterative processes but an intertwined process of inquiry in the development of information technologies that both represent the intentions of researchers as well as the influence of users. The method enables co-design through three main phases: (i) problem formulation; (ii) building, intervention, and evaluation; (iii) reflection and learning. Reflection and evaluation however happened though all three phases especially on anticipated social/technical risks in implementing agreed design decisions and suggested responses for improvement. Since the co-design process involved diverse groups, different communication strategies were used and reflected on, including narratives, storytelling, interactive games, images, and prototypes. These strategies were chosen to bridge communication gaps between the researchers and other stakeholders, and played an integral role in the co-design process [33]. Table 1 below presents our data gathering methods for each of the phases. All interviews and discussions were tape-recorded, transcribed, and translated where necessary. Translation was conducted with key focus on maintaining content and semantic equivalence in English as possible [34]. Afterwards and following our theoretical exploration, the data were analyzed in terms of ownership, voice, risk, and reward. "}]},{"head":"Refection on co-design process and platform in relation to learning and inclusiveness","index":11,"paragraphs":[{"index":1,"size":108,"text":"To facilitate the design of the mobile farm monitoring platform on smartphones, we adopted the Sapelli mobile application. Sapelli is an open-source application which uses highly configurable icon-driven user interface to overcome literacy and/or language barriers in data collection. The application allows for configuring icons in a manner which reflects local perspectives and needs in order to enhance user friendliness [35]. Records of data are generated and stored automatically on the application and presented in an XML or CSV file format. These records can either be downloaded or sent via sms to another actor. Sapelli was thus appropriate in exploring digital farm monitoring in the African smallholder context."}]},{"head":"Results","index":12,"paragraphs":[{"index":1,"size":70,"text":"The results section describes the outcomes from the co-design process following the ADR method which was undertaken in three iterative phases: (i) Multi-stakeholder discussion; (ii) building, implementing, and evaluating the mobile platform; (iii) actor reflections on the co-design process and output (the platform). As this results section reflects the different roles and characteristics of these phases in the co-design process, each section of the results hold a slightly different style."}]},{"head":"Phase 1: Multi-Stakeholder Discussion","index":13,"paragraphs":[{"index":1,"size":218,"text":"For purposes of establishing the contextual frame within which farmers operated, and in particular the problems impeding collaboration, we deemed it necessary to engage with wider actors within the value chain as a starting point of the co-design process. To do this, phase 1 centers around a multi-stakeholder discussion as kick-off between traders, farmer leaders, and government extension agents who were partners under the ADVANCE program. The actors explained that their partnership worked as an out-grower scheme with an agribusiness, called 'Agricare', serving as a creditor. Agricare provides inputs to a farmer group and receives predetermined quantities of maize from each farmer as repayment. This repayment was done through the traders who served as middlemen between the farmer group and the agribusiness, and signed contracts with the agribusiness to guarantee the supply of a given number of bags from the farmers in repayment of the credited inputs. Agricare expected the traders to work with the farmer leaders to monitor production and ensure that the contract terms were met. This was because Agricare deemed the traders and leaders to be better placed to ensure that farmers provided the required maize since they had better relations and more frequent interactions with the farmers than the agribusiness. The farmer group members agreed to share joint liability in the event of defaults."},{"index":2,"size":416,"text":"During the meeting, we sought for a joint identification of the main problems impeding the partnership. Most of the collaboration challenges raised by the actors were related to crop yields and production output. Since the partnership revolved around a reciprocal relationship of inputs for crops issues regarding crop failures, that is, the emergence of diseases and pests, failure of seeds to germinate, fertilizer application, or the onset of drought/overly wet periods, were highlighted as sources of tension in the partnership. One trader expressed a perspective that was felt among traders, that crop failure was used as a major excuse by farmers to free ride and avoid repaying partners who support them: \"For some farmers, all they want is a little excuse so they can blame their defaulting on crop failure, so we need to monitor various things\" (trader). This assertion was consented to by the other traders as well as the Agricare representative. The farmers did not dispute this claim but argued against the generalization of this perspective. Farmers argued that only a few recalcitrant farmers seek to default, however for the majority, crop failure was a genuine problem which occurs due to farmers lacking support for appropriate and timely response to farming challenges. This was countered by Agricare who intimated that most of the farmers are experienced farmers and if they undertake the right farming practices, barring unknowns like drought and novel diseases/pests, they should be able to respond adequately to farm challenges. Information asymmetry in relation to crop yield and production was as such a source of conflicting viewpoints and contention in the partnership. Following an inquiry whether improved information flow regarding these issues would be relevant for addressing the conflicts in the partnership, Agricare affirmed this position, arguing that this could help farmers gain some reasonable support for timely resolution of problems when necessary or at least let partners gain awareness of developments. Farmers and traders also agreed with this claim. On the issue of what to monitor, the traders and Agricare indicated that key observations that were necessary for conflict reduction included regular descriptions of the state of farms in relation to agricultural practice, pest, diseases, and the weather. One trader suggested monitoring of harvesting, de-shelling and storage as also important for tracking maize produce to prevent losses from improper handling or side selling activities. Based on this, we highlighted these issues as key information needs with choice and decision-making implications in the partnership in the following steps of the co-design process."},{"index":3,"size":230,"text":"Following this, we sought to understand actor perceptions on mobile devices and whether/how they had been used previously in attempts to address such information related conflicts. In general, the actors had a highly positive perception about mobile technology and its role in facilitating their collaboration. One trader mentioned that he and a farmer had tried to use a camera phone to help them work together: \"There was one farmer I worked with who had a smartphone, so sometimes he will take pictures of the crops and show it to you so that you will see what is going on\". Mobile devices were deemed to be very important by the traders but mainly used for interpersonal verbal communication with farmers but not explored for farm monitoring purposes at group level. This was due to the fact that most of the farmers did not have such smartphones and were unfamiliar with using the devices. Farmers also shared this concern: \"We farmers we don't have those kinds of phones. Also those phones; most of us cannot use it, so you have to teach us\" [leader]. \"We know there's so much you can do with phones but with farmers it will be difficult for them to use\" [trader]. There was therefore consensus on the potential utility of smartphones for collaboration purposes but challenges of access and capability were seen as major barriers to adoption."},{"index":4,"size":222,"text":"To further open up the discussion on the possibility for using mobile devices, we asked the actors to imagine that farmers had been given smartphones that they could easily operate to share images of their farming situations with the other actors and what concerns they would have if this were possible. This framing of the issue allowed actors' discourse to move away from perceived barriers to smartphone use. From this angle, the conversation very quickly centered on the authenticity of information provided such as images. Interestingly, the first actor to raise this concern was a farmer and not the traders as we expected. This farmer was the only farmer who indicated owning a smartphone and as such his experience may have contributed to his insights: \"But what if a farmer is taking pictures of someone else's farm because I can go anywhere and take pictures\". Thus, we noted that for information to be effective in improving collaboration, its trustworthiness was crucial. To enhance perceptions of trustworthiness, a trader suggested that if farmers were to undertake monitoring through user friendly platforms, it would be best to begin with farmer leaders as monitoring actors, instead of perhaps a rotation of a smartphone among farmers. This was because the leaders were already trusted by traders and farmers alike to monitor and keep farmers in check."},{"index":5,"size":566,"text":"Based on these responses, stakeholders were asked to reflect on the possible approach of farmer leaders monitoring farms with smartphones and anticipate potential issues/risks which could emerge from such an approach. Through this anticipation process there were some concerns about the use of farmer leaders for this detailed monitoring. A leader raised the issue of superstition and suspicion in relation to their presence on the farms of other group members. A key concern was that some farmers may associate certain negative developments on their farms as emanating from their farm visits: \"Some farmers believe that some people can do something in the farm which will affect their farm's productivity. As for me the leader, now they trust me but people are people so we have to be careful\". This concern was backed by another leader who highlighted that this could be an issue particularly when a farmer was not on very good terms with the leader. From this perspective, leaders noted that such circumstances could generate some conflict between leaders and certain group members. To address this issue, leaders suggested that farm visits should involve farm owners as often as was possible. In addition, one leader suggested that to introduce such an approach, initial farm visits should include the researchers, together with the farm owner, to get farmers used to the idea of these farm visits by the leaders. This extra level of transparency was to serve as means of maintaining social relations while altering the configuration of interactions, and added in phase 2. Table 2 presents a summary of key findings from this phase of co-design. Building on phase 1, another meeting was organized to deliberate on the digital platform. This time only the 36 farmers and farm leaders were participants. This discussion was meant to transition interactions towards the designing of the platform. We began by revisiting the information issues which had been agreed upon at the multi-stakeholder meeting as relevant to monitor (Table 2). Based on smartphone perceptions that we found in the first phase, we concluded that a simple non-text platform with an image based interface would best suit the local context and foster inclusion. Therefore, our co-design process centered on using a participatory process for selecting images to use on the platform as representative icons for each of the information needs that needed to be monitored. Other design issues like layout and structure were constructed by the researchers. We had printed a collection of images, which we believed could provide good pictorial cues of the key issues which needed monitoring. The image that most farmers associated with an issue was to be adopted as that issue's icon on the platform. We presented this association activity to the farmers as a game to enable them participate in the abstract design process. We reframed the issues that had been identified as questions, for instance, 'are there any pests on the farm?'. While doing so we would raise an image, go through the questions and ask farmers to mention what issue/question they assumed fitted best with the raised image. We allowed open discussion about the image when farmers had different views to see if consensus would emerge. We played this 'game' for three rounds, dropping images that were difficult for most farmers to agree on. By the third round, there was at least one image that farmers generally agreed to associate with each issue/question."},{"index":6,"size":202,"text":"Building upon this, we introduced the farmers to another aspect of the game. This time, farmers were to respond to the questions posed by the images with another set of printed images. These responses were to be provided using colors printed on A4 sheets. We adopted a color scheme which most of the farmers were familiar with: the traffic lights. We explained that based on the traffic light color scheme, red represented danger, amber showed emerging/developing danger, and green was an all-clear. Farmers were to use these colors in response to the questions/issues they had associated with images earlier. Farmers were taken to random farm plots in the community where they were asked to give their individual assessment of the farm plots using these colors. The process was non-verbal. At each point, researchers simply raised an image corresponding to an issue and based on this, farmers assessed the farm and responded using their colors. After farmers responded, we inquired of the reasoning behind their responses to determine their comprehension of the associated question and the evaluation task. Farmers were generally successful with this task and in this way the game was effective in creating an abstract representation for monitoring real life situations."},{"index":7,"size":152,"text":"Following these activities, we uploaded the selected images unto the Sapelli interface as icons. The platform interface was a simple linear process where a user selects a farmer profile from the home page and proceeds to monitor each of the issues as prompted by their associated images being displayed. To simplify the interface, we focused on only monitoring issues related to on-farm activities, excluding post-harvest treatment and storage. To provide an assessment of each issue, a user selects from the red, yellow and green colors. Each assessment is followed automatically by a camera screen for farmers to capture evidence of their assessment. These pictures are automatically geo-tagged and stored. Figure 2 presents the Sapelli interface adapted to the farming context. Screens A, B, C, D, and E represent the farmer profile, farm state, weather state, pest state and disease state respectively. These are evaluated using the color scheme and photographed where applicable."},{"index":8,"size":14,"text":"the game was effective in creating an abstract representation for monitoring real life situations."},{"index":9,"size":281,"text":"Following these activities, we uploaded the selected images unto the Sapelli interface as icons. The platform interface was a simple linear process where a user selects a farmer profile from the home page and proceeds to monitor each of the issues as prompted by their associated images being displayed. To simplify the interface, we focused on only monitoring issues related to on-farm activities, excluding post-harvest treatment and storage. To provide an assessment of each issue, a user selects from the red, yellow and green colors. Each assessment is followed automatically by a camera screen for farmers to capture evidence of their assessment. These pictures are automatically geo-tagged and stored. Figure 2 presents the Sapelli interface adapted to the farming context. Screens A, B, C, D, and E represent the farmer profile, farm state, weather state, pest state and disease state respectively. These are evaluated using the color scheme and photographed where applicable. After developing the platform, farmers were taken through training over a period of two weeks on how to use the co-designed platform. We found that some people developed proficiency with the software very quickly, as early as on their first try whereas others required more familiarization. Most had however gained significant mastery over the application within half an hour of use. By practicing the use of images as metaphors for inquiry and the use of colors for response, the farmers were ready to transfer the concepts to the smartphone application, facilitating speedy comprehension: \"Because from the beginning we went through some question and answering where we used some pictures to represent the problems we talked about before. So since they were the same pictures it was easy to remember\"."},{"index":10,"size":162,"text":"From this perspective, the use of games and images in the co-design process was significant for farmer learning how to use the digital platform. This also meant that processes which could not be After developing the platform, farmers were taken through training over a period of two weeks on how to use the co-designed platform. We found that some people developed proficiency with the software very quickly, as early as on their first try whereas others required more familiarization. Most had however gained significant mastery over the application within half an hour of use. By practicing the use of images as metaphors for inquiry and the use of colors for response, the farmers were ready to transfer the concepts to the smartphone application, facilitating speedy comprehension: \"Because from the beginning we went through some question and answering where we used some pictures to represent the problems we talked about before. So since they were the same pictures it was easy to remember\"."},{"index":11,"size":235,"text":"From this perspective, the use of games and images in the co-design process was significant for farmer learning how to use the digital platform. This also meant that processes which could not be practiced through the co-design process but remained an abstract concept on the platform posed some difficulty for some. For instance, a challenge for some farmers was in comprehending the concept of going back in the application using the back arrow. Most were more comfortable with the step by step process and not when one needed to navigate backwards and forward in the app. This aspect of the interface took more time to grasp for some farmers. On the other hand, most of the group leaders more easily remembered abstract icons such as crosses and ticks. There appeared to be some familiarity with these common symbolic conventions on smartphones. We attribute this to the fact that most farmer leaders had some form of basic education which meant that they could appreciate concepts such as a tick implying correct and a cross indicating wrong. Age of the farmers was no impediment to comprehension as most of the farmers were above 45 years and still were able to grab the concept of the application fairly quickly. During practice, some farmers had their children present who were more conversant with smartphones to serve as a helpful assistant when they forget the required action on the platform."},{"index":12,"size":237,"text":"Following the training, it was agreed that farmer leaders would monitor the farms every 2 weeks. This time period was deemed as optimal for monitoring changes in the farms and also to allow leaders collect data without much stress. In the first month, leaders were phoned to remind them when monitoring was due. Farmer leaders were observed and assisted by researchers as they monitored the farms during this period. A few challenges were observed at this stage regarding leaders' handling of the smartphone device. The first issue was that some pictures were a bit blurry due to the leader's hands being a bit shaky while capturing images. This was due to nervousness in handling the devices and reduced after a few farm visits. Again, during use of the platforms, some leaders inadvertently pressed the side buttons on their phones. When the power button was pushed, resulting in the screen going off, leaders became confused as they thought something was wrong. In addition, when selecting icons on the platform, the touch screen presented some frustration to farmers as selected options were not always effected on the first attempt due to callouses on their fingers. Finally, on occasions when the GPS locator delayed for a while in establishing the geo-location of the image, leaders were uncertain on what to do next or how long to wait. These experiences needed further discussion to better guide use of the digital platform."},{"index":13,"size":280,"text":"After the first month, leaders were allowed to follow the protocols without researchers being present for the next two months. All the leaders were consistent with their farm visits even when the reminders ceased. After the two months, farmer leaders had successfully captured farm photographs for the period via the platform. Farmers were asked at key points during this period to recount the processes involved in using the platform as well as the meaning associated with its images. Most of the farmers were able to provide satisfactory explanations and descriptions over the period. This demonstrated general comprehension of the platform throughout the season: \"as for now no fear, now we can do it on our own...it's not difficult\". Assessment of the images generated showed that farmers faced a few challenges in the process. The first difficulty farmers faced was in reporting on the general condition of the farm. Farmer leaders faced difficulty remembering how to get a good wide view photo of the farms. Some often took portrait shots when landscape images would have been a better option. Furthermore, as the maize crops grew, finding a good position to stand to capture wide view of a farm became more difficult in some farms where farmers had only narrow paths to stand on between fields. This gave limited space to move back for wider pictures. In terms of picture quality, the images were generally in focus. The main challenge faced here was with the timing of the photographs. Some leaders monitored farms around dusk when there was limited lighting. This led to some pictures being unclear. It was necessary to have some further discussion on best times for capturing farm images."},{"index":14,"size":317,"text":"After using the device over the period some leaders identified an issue which needed to be anticipated and addressed regarding the protocols of the digital approach of data collection. The agreed protocols for farm data collection was that each of the 5 farms would be visited every two weeks. However, during implementation, leaders had questions about how to effectively collect data should the group numbers be increased. For instance, if the group size were to increase to 10, leaders would have to do twice as much work which would claim more time. Leaders noted that even though they were motivated to help with monitoring, the approach would need to find ways of addressing such challenges. A key suggestion which some leaders had explored was engaging local motorcycle users in the community during their monitoring activities. This enabled monitoring to be undertaken rapidly and also provided the opportunity for covering more farmers. This could have cost implications. If this option is not available in a given community's context, farmers suggested that other group members could be trained and recruited to assist leaders. It was noted however that this would result in some degree of trade off with the trust which the leaders offered. Table 3 presents a summary of key findings from this phase of co-design. At the end of the season, the farmers were brought together again to reflect with the researchers on their experience in using the digital platform and their perceptions on the co-design approach. The reflexive process aimed to review farmer perceptions and experience vis-a-vis our assumptions and observations on (i) the linkages between the co-design process and farmer capability to use smartphones for farm monitoring and (ii) the link between enhanced communication and a sense of inclusiveness, described here as a sense of being able to influence change in ownership, voice, risks, and reward. In the discussions, the following subjects were brought up:"},{"index":15,"size":189,"text":"On the first issue, farmers discussed what factors they thought contributed to their ability to follow the protocols in the use of the platform. The simplicity of the platform was identified as an important reason for this. By providing a simple and intuitive platform based on issues they could identify with as well as icons they had participated in selecting, farmers felt they were able to quickly feel a sense of competency without much supervision or facilitator present: \"It is not complicated so we just follow one step after the other and you are done. And it is also our issues that we talked about so it is straight forward\" [leader]. The ease of use offered by the interface meant that farmers felt ownership over the platform and confidence to use the smartphone application was high after trying the platform a couple of times. Leaders indicated and demonstrated that they were confident they could use the platform on their own effectively. By this, farmers confirmed that co-designing and using the platform for monitoring their farms had positively influenced their perceptions on their capacity to use smartphones for farm monitoring."},{"index":16,"size":343,"text":"On the second issue, whether enhanced communication via the smartphones could affect farmer sense of being able to influence change, the farmers had two positions. First, farmers highlighted that the use of pictures could help them alleviate the challenge of describing conditions they encounter on their farms. This took away earlier feeling of risk that was associated with sharing information as misunderstandings were less likely to occur and that it was easier to voice up their point of view to traders. An extension agent confirmed this with an example: \"there was this farmer, she spent so much money on different chemicals, more than 1500 cedis ($300) dealing with the fall army worm, so later I went to look at what chemicals she had been applying and she was using fungicides! She says that's what the chemical shop gave her after she described her problem\" [extension agent]. By capturing and viewing images from each other's farms, farmers indicated that they felt ownership over the platform and better positioned to interact with traders and other farmers on farm issues, increasing their position to voice their perspectives and interests. In addition, one trader stated in an interview that with the farm images he would be better placed to help the farmer make decisions on what measures to take given the specific conditions identified: \"If I am just explaining to him is different. But if I can add picture then that one it will be clear\". Additionally, the trader indicated he could contribute to bridging the extension agent-farmer gap by sharing the farm images with extension officers within his network. It was indicated by an extension agent that some extension agents already use WhatsApp groups to interact and seek information from each other concerning field conditions. Thus, some of the farm pictures could be shared on these platforms by partnering with extension agents who were already present on these WhatsApp platforms. Based on the outputs from the digital platform, traders, extension agents, and the farmers perceived opportunities for better extension support and tailored advice through digital communication."},{"index":17,"size":229,"text":"The farmers however had a less certain position on their ability to influence responsiveness from partners when the response would involve material support from value chain partners in general. This was due to certain experiences with partners in the past. For instance, some farmers indicated that in a previous season, they discovered during de-husking that the fall army worm had decimated the maize cobs. They attempted using photographs of the harvest to convince the agribusiness to delay their debt repayment due to this unforeseen predicament. These photographs were however ignored along with their request. Farmers therefore distrusted partners and had concerns on their being inflexible with the contract agreements that guide their collaboration. In this way farmers were pointing to the overarching socio-political frame within which their contractual agreements were implemented, which is characterized by mistrust and a sense of lack of power to push for responsiveness from more powerful actors in the partnership. Farmers agreed that if farm monitoring via the platform was to be accepted by partners as a mutually agreed process for responding to farmer needs, and integrated into their contract agreements, they would feel more confident of using the platform to influence material support. In present contexts, where there is mistrust and power inequalities between collaborators from different backgrounds, improving communication appears but a first step to building and reconfiguring relationships towards more inclusive partnerships."}]},{"head":"Discussion","index":14,"paragraphs":[{"index":1,"size":180,"text":"Our results show that the participatory process for co-designing a farm monitoring platform was effective in enabling the successful development of a farmer friendly smartphone platform which facilitated rapid farmer learning and capacity to use. The success of the process was significantly influenced by the use of story narration, images, games, and prototypes. These activities and artefacts served as effective bridging mechanisms for linking actors from different social worlds, e.g., farmers and researchers; traders and credit institutions, in the co-design process [33]. By this we contribute to a growing literature on co-designing digital platforms through such bridging mechanisms by showing further evidence of the efficacy of the design approach [36,37]. In addition, our findings show that aligning digital platform design with the capabilities of farmers as well as focusing directly on their key needs enabled farmer comprehension, ownership, and ease of adoption of the platform. This finding is in line with theory on information technology acceptance [38][39][40] as it demonstrates how perceived usability and usefulness of farmer oriented platforms motivated and influenced speedy farmer understanding and engagement with the platforms."},{"index":2,"size":223,"text":"Reflecting with farmers on whether the co-designed farmer-oriented platform could make partnerships more farmer inclusive, we found that farmers had positive perceptions about the platform as a communicative tool that could bridge the communication gap between them and other actors. In particular, the platform was perceived as an effective mechanism for breaching the information and knowledge differences in smallholder partnerships. Farmers felt empowered to influence change in two main ways. The first was in their ability to share farm information with partners for specific extension advice either from extension agents or traders. Secondly, farmers felt empowered to demonstrate transparency in transactions as a means to enhance trust with partners. In line with Vermeulen and Cotula's criteria for inclusiveness in value chain collaborations [2], we argue that through these communicative roles, farmer-oriented platforms contribute to inclusiveness by enhancing farmer voice and ability to influence partner decisions and actions that relate to extension support and accountability. By so doing, the platform further contributes to smallholder risk reduction as it helped mitigate farming risks which emanate from lack of extension access. Moreover, actors also indicated that the co-design process resulted in a stronger feeling of ownership and fit of the platform to the local context. In this way, farmer-oriented platforms enable a more inclusive partnership arrangement for farmers by improving conditions of farmer voice and risks."},{"index":3,"size":169,"text":"On the other hand, farmers were less certain about using the platform to get other partners to support farmer needs that require further commitment of resources or flexibility with terms of agreement. This is because in this scenario, partners would take on more risks by their additional investments or flexibility. The predominance of mistrust between actors due to past negative experiences makes them cautious about taking on further costs and risks [41]. Since other actors tend to be more powerful than the farmers, the farmers were less confident about using the platform to influence partner response in such scenarios. This situation shows that even though farmer oriented platforms help to level the communication field between farmers and other actors, the power relations between them generally remained the same, affecting farmer perception of ability to influence change via the platform when conflicting interests arise. In essence, negative past experiences and power differences contributed to path dependence and perceived resistance to the institutional changes being introduced by the digital platform [42]."},{"index":4,"size":171,"text":"From the perspective of Vermeulen and Cotula's criteria for inclusiveness [2], we interpret this development to mean that farmer voice in negotiating risks and costs with partners through the digital platform was limited by the existing power inequality and mistrust. This was possible because although the platform contributed to one aspect of the voice criteria of inclusiveness, which is the provision of a means to reduce information asymmetry, other aspects of the criteria such as improving farmer weight in decision making or a clear process of review and grievance addressing against more powerful actors were not contributed to. Prowse argues that asymmetrical power relations between commercial actors and smallholder farmers skews negotiation power significantly away from farmers [43]. Even though farmers perceived the platform as an effective means for communication with partners, farmers sensed little empowerment to enforce their communicated needs when there was conflicting interest with more powerful actors. This situation suggests that effectiveness of digital platforms for inclusiveness in partnerships may be constrained in such instances by power differences."},{"index":5,"size":194,"text":"Thus, there is a crucial role for governing the development and implementation of smartphone platforms for farm monitoring, especially in negotiating trust, interests and power dynamics. There is a need to focus efforts on developing platforms to empower farmers and farmer groups not just from a communicative perspective, that is, through user friendly platforms, but to look critically and more broadly at how the platform's functioning is influenced by its contexts and potentially influences its context, including existing structures and relations. To begin to facilitate this, attention needs to be turned to partnership agreements and contracts, which usually serve as mechanisms for governing interactions between farmers and partners [9]. For partners to be more responsive to farmers through the use of the platform, our results suggest that contractual agreements need to acknowledge and indicate the role of intended farm information that would be provided via the platform. This implies that in order to empower farmers, digital platforms must work together with contract agreements. For instance, clear guidelines and criteria for conducting digital monitoring as well as the protocols for response by partners must be negotiated and integrated in contractual arrangements in partnerships with farmers."},{"index":6,"size":130,"text":"From this perspective, there is the need for more in-depth reorganization and transformation of partnership processes and practices, through the establishment of new practices in which contract agreements capture and integrate the role of information output from farmer led platforms, so as to empower farmers and make partnerships more inclusive. This re-echoes arguments on the need to combine technological innovation together with institutional innovation particularly when power inequities and diverging political agendas are present [44,45]. In making partnerships more inclusive for smallholders, then, there is a necessity for critical political considerations of stakeholder practices and interests in smallholder partnerships, and the processes by which these may be re-negotiated and re-organized in relation to technological innovations such as farmer oriented platforms. Further research is therefore needed to address this knowledge gap."}]},{"head":"Conclusions","index":15,"paragraphs":[{"index":1,"size":180,"text":"In conclusion, our study sought to understand the extent to which smallholder value chain partnerships could be made more inclusive for smallholders through enhanced communication between farmers and other stakeholders in the value chain. In this, we focused specifically on farmers' perceptions on inclusion in the process of design and usage. Our findings show that a participatory process of co-designing a simple platform interface was significant in improving farmer ability to comprehend and use smartphone based digital platforms for monitoring and communicating farm conditions with value chain partners. Through the use of context relevant stories, game activities, and field testing, an image based and non-textual interface was developed, which enabled smallholder use of smartphones for digital monitoring. Concerning the extent to which the farmer oriented platform enabled inclusiveness of farmers in value chain partnerships, we found that farmers were empowered through the use of the platform to bring attention to their farm conditions. This was particularly deemed helpful in enabling them gain access to specific extension advice as well as demonstrating individual accountability to partners as a trust building mechanism."},{"index":2,"size":223,"text":"On the other hand, farmers did not feel empowered to use the platforms to push for material support or flexibility from partners in response to emerging farm conditions such as pest and disease outbreaks, particularly since this would involve further costs and risk to the more powerful partners. As such farmers saw the platforms as a means to appeal to the benevolence of partners by building trust through transparency, without a sense of empowerment to engage further with these partners. Even though the digital platform improved farmer ability to communicate with partners to an extent, we found that on matters where conflicts of interests were expected to arise, unequal power relations reduced expectations of the platform's effectiveness at enabling inclusiveness. This highlights a need for critical consideration and adjustment of the social and political dimensions of partnership interactions, in tandem with the advancement of digital innovations, in order to effectively facilitate inclusiveness and equality in partnerships. Such consideration might include advancing the power position of smallholder farmers in specific contexts in order to move away from existing power inequalities that show a strong path dependency. As the growth of digital innovations rapidly accelerate in smallholder contexts, it is necessary to commensurately rethink, renegotiate, and reorganize the structure of value chain partnerships in order to progressively make actor interactions more inclusive through digital tools."}]}],"figures":[{"text":"Sustainability 2020 , 12, x FOR PEER REVIEW 4 of 17 "},{"text":"Figure 1 . Figure 1. Location of study site. "},{"text":"Figure 1 . Figure 1. Location of study site. "},{"text":"Figure 2 . Figure 2. Co-designed platform interface. "},{"text":"Figure 2 . Figure 2. Co-designed platform interface. "},{"text":"Table 1 . Data gathering methods for each phase. Phase Data Gathering Methods Stakeholders Purpose PhaseData Gathering MethodsStakeholdersPurpose Phase 1 Preliminary semi-structured interviews Multi-stakeholder discussions Farmer leaders (6), Traders (3), Agribusiness representatives (2), Extension agents (2) Joint problem definition, information needs assessment, mobile phone perceptions, and experiences Phase 1Preliminary semi-structured interviews Multi-stakeholder discussionsFarmer leaders (6), Traders (3), Agribusiness representatives (2), Extension agents (2)Joint problem definition, information needs assessment, mobile phone perceptions, and experiences Phase 2 Observation Focus group discussion Semi-structured interviews Farmers (5 per village) Farmer leaders (6) Developing context relevant platform for farm monitoring Phase 2Observation Focus group discussion Semi-structured interviewsFarmers (5 per village) Farmer leaders (6)Developing context relevant platform for farm monitoring   Farmers (5 per village)  Farmers (5 per village) Phase 3 Focus group discussion Semi-structured interviews Farmer leaders (6) Traders (3)  Phase 3Focus group discussion Semi-structured interviewsFarmer leaders (6) Traders (3)   Extension agents (2)  Extension agents (2)  "},{"text":"Table 2 . Summary of findings from multi-stakeholder discourse. Farm Information Needs of VC Partners Smartphone Perceptions Anticipated Risks Suggested Response Farm Information Needs of VC PartnersSmartphone PerceptionsAnticipated RisksSuggested Response State of farm in relation    State of farm in relation to GAPs Pest/disease presence General weather condition Harvesting, shelling and High utility potential Non-complex interface needed for farmers Needs verifiable outputs False information provision Suspicion and conflict with farm monitors Use of trusted actors (leaders) for information collection Transparent processes needed to GAPs Pest/disease presence General weather condition Harvesting, shelling andHigh utility potential Non-complex interface needed for farmers Needs verifiable outputsFalse information provision Suspicion and conflict with farm monitorsUse of trusted actors (leaders) for information collection Transparent processes needed storage    storage 4.2. Phase 2: Building, Implementing, and Evaluating the Farm Monitoring Platform 4.2. Phase 2: Building, Implementing, and Evaluating the Farm Monitoring Platform  "},{"text":"Table 3 . Findings from building, implementing, and evaluating the platform. Observations During Information Collection Via The Platform Anticipated Risks Suggested Responses Observations During Information Collection Via The PlatformAnticipated RisksSuggested Responses Positives Challenges   PositivesChallenges Farmers demonstrated recall of icon/issue association Farmers were able to follow protocols without assistance Abstract concepts Calloused fingers Understanding of basic photography dynamics Time costs of monitoring Differing picture standards Use of locally available motorcycles More training and familiarity with phone photography Farmers demonstrated recall of icon/issue association Farmers were able to follow protocols without assistanceAbstract concepts Calloused fingers Understanding of basic photography dynamicsTime costs of monitoring Differing picture standardsUse of locally available motorcycles More training and familiarity with phone photography 4.3. Phase 3: Reflecting on the co-design Process and the Farm Monitoring Platform  4.3. Phase 3: Reflecting on the co-design Process and the Farm Monitoring Platform  "}],"sieverID":"ac8f60dc-2fcc-487c-ba66-cc2911b77d11","abstract":"Value chain partnerships face difficulties achieving inclusive relations, often leading to unsustainable collaboration. Improving information flow between actors has been argued to contribute positively to a sense of inclusion in such partnership arrangements. Smallholders however usually lack the capability to use advanced communication technologies such as smartphones which offer a means for elaborate forms of information exchange. This study explores to what extent co-designing smartphone platforms with smallholders for farm monitoring contributes to smallholder ability to communicate, and how this influences smallholder sense of inclusion. The study uses an Action Design Research approach in engaging smallholders in Ghana, through multi-stakeholder and focus group discussions, in a reflexive co-design process. The research finds that co-designing a platform interface was significant in improving farmer ability to comprehend and use smartphone based platforms for communicating farm conditions and their needs with value chain partners. Farmers were however skeptical of making demands based on the platform due to their lack of power and mistrust of other actors. This highlights a need for adjusting the social and political dimensions of partnership interactions, in tandem with the advancement of digital tools, in order to effectively facilitate a sense of inclusiveness in partnerships."}

data/part_5/09b4db3bce7ada95f4b0e870c225d2bd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09b4db3bce7ada95f4b0e870c225d2bd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3487ba58-643c-46c4-922b-6abf9a2731a8/retrieve"},"pageCount":31,"title":"","keywords":["Organizations","water users associations","operation and maintenance services","sustainable irrigation development"],"chapters":[{"head":"Tables","index":1,"paragraphs":[{"index":1,"size":143,"text":"Salient features of the schemes related to organizations for water management Table 2. Irrigation scheme typology based on multi-criteria evaluation  Irrigation systems are not stand alone physical entities, and require the active involvement of the community for their sustainable operation. In Ethiopia, although organizations for irrigation management existed in different forms, they were neither generally well recognized nor endorsed by the public sector. Where they existed, they generally lacked appropriate regulation and the legal basis to function properly. In several irrigation schemes in Ethiopia, cooperatives and water committees are involved in serving some of the purposes of irrigation water users associations (IWUAs) (Yami 2013). However, there are major differences between these organizations and IWUA. The pre-existing legal framework in Ethiopia, i.e. cooperatives and associations proclamations (FDRE 1998) does not provide an appropriate legal basis for IWUA for different reasons (Lempériere et al. 2014)."},{"index":2,"size":68,"text":"Irrigation systems cannot meet their intended objectives without appropriate organizations to manage, maintain and operate the systems. There are arguments emphasizing that irrigation service delivery and thus irrigations systems performance can be improved by transferring the management of public irrigation systems to IWUA or farmers organizations (Lempériere et al. 2014). Transfer of irrigation management from government agencies to farmer organizations or IWUA can have the following positive implications:"},{"index":3,"size":19,"text":"i. it can serve as a mechanism to reduce the financial burden of operation and maintenance of irrigation schemes;"},{"index":4,"size":20,"text":"ii. it builds a sense of ownership of irrigation schemes by the farmers and hence ensures better asset management; and"},{"index":5,"size":25,"text":"iii. it can result in better irrigation water management and service delivery as there is better cooperation between the water users (Lempériere et al. 2014)."},{"index":6,"size":137,"text":"Several global experiences also show that irrigation management by government agencies exert heavy financial burden on governments and irrigation performance has been disappointing in some cases. Farmers, hence, have preferred managing their schemes themselves, organizing themselves into legal institutions mandated for the provision of irrigation services to their members and the collection of service fees. Irrigation management transfer (IMT) has been widely practised for more than two decades in several countries in Asia and Latin America (e.g. Dadaser-Celik et al. 2008). Many countries around the world are currently moving to devolve a range of irrigation water management tasks from state agencies to participatory, autonomous and financially self-supporting water user associations (JICA and OIDA 2014). A very good example for the success of irrigation management transfer from the government to water user associations is the case of Turkey."},{"index":7,"size":189,"text":"Turkey undertook large changes to irrigation management institutions and policies since the early 1990s. The State Hydraulic Works of Turkey was responsible for planning, implementing, operating and maintaining irrigation systems prior to the start of irrigation management transfer to farmers. Turkey started an accelerated program of transferring the responsibilities of operation and management of irrigation to farmers (Dadaser-Celik et al. 2008). As a result, Svendsen and Murray-Rust (2001) stated that by 1996, 61% of the irrigated area (about 1 million ha) and by 2001, more than 80% of irrigated area was transferred to irrigation associations. Kuscu et al. (2009) stated that the major reason for IMT Turkey is to decrease the budget and other assets required for the management of irrigation systems, which the farmers often perform it more economically. Samad and Vermillion (1999) stated that government expenditure on irrigation management significantly decreased after IMT in Sri Lanka and other countries. Several researchers that conducted comparative performance evaluations on irrigation schemes before and after IMT generally confirm that they perform better in terms of cost effectiveness, irrigation efficiency, water fee collection efficiency, water productivity, satisfaction on service delivery etc."},{"index":8,"size":225,"text":"To date the role played by irrigation organizations in irrigation management in Ethiopia is not significant (Yami 2013). Different organizations have existed at several irrigation schemes, particularly over the past decade, with the expansion of traditional irrigation schemes. Many of the local institutions (e.g. traditional irrigation schemes) often have very limited external support and most were established and operated on the initiative of the farmers (Yami 2013). However, several of these organizations have very limited financial and technical capacities and their performance has been poor (Yami 2013). Awulachew et al. (2010) stated that in many irrigation schemes in Ethiopia issues like water fees, water rights, water conflict resolution, incentives for collaboration between the local, regional, and federal levels of government and incentives for accurate reporting of current projects etc. lack a regulatory framework. Public investment in irrigation in Ethiopia has largely focused on infrastructural development, with very little attention given to operation and maintenance and long-term sustainability issues (Brown 2011;Tilahun et al. 2011;Yami 2013). Even in several modern irrigation schemes in Ethiopia, formal, legitimate and public law of irrigation water users' organizations are generally given less attention and often neglected. Hence, schemes often failed to meet their expectations in terms of sustainability and outputs due to inadequate user involvements and poor institutional setup for proper operation, maintenance and irrigation service provision (Yami and Snyder 2012)."},{"index":9,"size":125,"text":"There are a few irrigation schemes where the irrigation organizations perform well. However, institutionalizing, setting up the underlying legal framework and building the capacity of irrigation associations is highly relevant for better irrigation management in Ethiopia (Yami and Snyder 2012;Yami 2013). Establishing water users associations (WUAs) would enhance the operation, maintenance and water management of irrigation schemes, particularly of the water distribution, water allocation, and scheduling and maintenance aspects of irrigation schemes in Ethiopia. It is with this intent that a proclamation was recently passed by the Federal Democratic Republic of Ethiopia for establishment of WUAs (FDRE 2014). The proclamation creates a legal basis for the establishment of WUAs as a particular type of legal entity for the operation and management (O&M) of irrigation systems."},{"index":10,"size":140,"text":"The significance of irrigation development is well reflected in the policy documents of the Ministry of Water, Irrigation and Energy and the Ministry of Agriculture (MoWR 1999). One of the important aspects of the water resources policy of Ethiopia (MoWR 1999) is that it envisages for sustainability, equity and efficiency in use of the water resources of the country. There are large gaps in terms of capacity and finance particularly at lower levels. Operation and maintenance planning and cost implications, particularly those at tertiary canal levels are commonly not well developed and often neglected or left to the farmers without the provision of the proper capacity development support. As a result, issues like poor maintenance, poor asset management, poor irrigation service, and inequitable water allocation continue to be key concerns that need to be addressed by irrigation organizations (Yami 2013)."},{"index":11,"size":42,"text":"This study intends to assess the nature and diversity of irrigation institutions in the study schemes in 10 irrigation schemes located in four regional states of Ethiopia (Tigray, Amhara, Oromia and SNNPRS) and to evaluate the existing service delivery by these institutions."},{"index":12,"size":4,"text":"2 Materials and methods"}]},{"head":"Location of the study schemes and key features of irrigation institutions","index":2,"paragraphs":[{"index":1,"size":63,"text":"The 10 irrigation schemes studied here are located in four regional states of Ethiopia (Figure 1). The study sample schemes were selected using criteria such as representativeness for different scales (large, medium and small) and managed by smallholders, crop types and agro-ecology (e.g. altitude range 1500-2725 masl). Some salient features of the irrigation schemes as related to institutions are depicted in Table 1.  "}]},{"head":"Data collection","index":3,"paragraphs":[{"index":1,"size":169,"text":"Data on irrigation organizations was collected from primary sources using various tools. The tools include focus group discussions (FGDs), household surveys (HHS), key informant interviews (KII), transect walks and systematic observations. The FGDs comprised 5-10 individuals from the schemes. The composition of the FGD unit was farmers, kebele 1 development agents (DAs), a kebele administrator, and the chairperson of water committees or the fourth canal water users team in cases where the existing institution is an IWUA. For schemes that have no irrigation institution the FGD unit was limited to the first three groups. For the household survey, 30 farm households were selected from each scheme using stratified random sampling method. An arbitrary strata (as head, tail and mid irrigators) was primarily defined through transect walk in the schemes. Hence 10 farmers were selected from each stratum: head, middle and tail reaches. The KII was undertaken with focal persons of the woreda 2 irrigation development office, kebele DA, kebele administrator and chairpersons of irrigation institutions wherever such organizations existed."}]},{"head":"Irrigation schemes typology building","index":4,"paragraphs":[{"index":1,"size":85,"text":"Accordingly, 3 out of 10 schemes are clustered under traditional, 1 as modern and 6 as semi-modern schemes. From the 10 studied schemes, 3 have no irrigation institution. In these schemes where institutions exist, membership is optional except in the case of the modern schemes. Traditionally, irrigation schemes are just clustered as traditional or modern depending on whether their headwork is from locally available material or concrete. Here, we adopt the irrigation 1 Kebele is the lowest administrative unit in Ethiopia, also called peasant association."},{"index":2,"size":13,"text":"2 Woreda is the second lowest administrative unit in Ethiopia, also called districts."},{"index":3,"size":166,"text":"typologies developed by Agide et al. (2015, in press). The authors classified the schemes into three typologies based on multiple criteria (Agide et al. 2015, in press). Seven criteria considered for building the typology of irrigation schemes were the water source, type of intakes (headworks), conveyance and distribution systems, flow control structures, on-farm water application methods, drainage conditions and irrigation organizations (Agide et al. 2015, in press). To each of these criteria, a weight was assigned by a team of experts so that the total weight sums up to 10. Then each scheme was graded against each criterion out of 10, and the grades were then added together to find the final grade which was then converted to 100. The schemes were hence categorized into modern, semi-modern and traditional typologies based on the total grades. The basis for categorization is arbitrary and is as follows: modern (grade >80%), semi-modern (grade >50 <80%) and traditional (grade <50%). The typology of the schemes is shown in Table 2. "}]},{"head":"Performances evaluation of irrigation schemes' in irrigation service delivery","index":5,"paragraphs":[{"index":1,"size":66,"text":"Evaluating the nature and performance of institutions for irrigation water management is not based on numerical values of certain indicators; but on qualitative descriptions, comparisons and responses from stakeholders, including farmers, development agents, kebele administrators (compare also Yami 2013). To characterize the nature of organizations for irrigation management and for evaluation of irrigation institutions service delivery, the indicators used involve (see also Lempériere et al. 2014):"},{"index":2,"size":5,"text":"• existence/absence of irrigation institutions;"},{"index":3,"size":4,"text":"• functions of institutions;"},{"index":4,"size":8,"text":"• institutional achievement to ensure water delivery equity;"},{"index":5,"size":7,"text":"• farmers' perception of the services rendered;"},{"index":6,"size":11,"text":"• willingness of the farmers to contribute to operation and maintenance;"},{"index":7,"size":9,"text":"• incidence of conflicts between farmers and organizations; and"},{"index":8,"size":6,"text":"• role of women irrigation organizations."},{"index":9,"size":89,"text":"Data related to irrigation organizations at the irrigation schemes are mainly qualitative and the analysis is based on a qualitative comparison and descriptive statistics of pertinent information. As such, qualitative data obtained from the FGD, KII and HHS at each of the schemes were described more logically, and compared to each other to find out diversities and similarities among their organizational setups. This gives a better understanding of the types of irrigation organizations that have already existed in these schemes and their shortcomings in terms of accomplishing their tasks."},{"index":10,"size":4,"text":"3 Results and discussion"}]},{"head":"Irrigation institutions and their autonomy","index":6,"paragraphs":[{"index":1,"size":57,"text":"Institutions for irrigation water management for the Ethiopian case are generally diverse, but not well developed in their nature and functions. For instance, farmers' cooperatives in several schemes in Ethiopia were involved to a certain extent in the management of irrigation schemes, in addition to marketing of products and supply of inputs (Yami and Snyder 2012;Yami 2013)."},{"index":2,"size":205,"text":"There have been differences in the naming of local irrigation institutions at several irrigation schemes in Ethiopia. In the 10 schemes covered in this study, irrigation institutions existed in 7 schemes, while they were totally absent in 3 schemes. Even for those schemes with institutions, there are several differences in terms of the type, capacities, and functions of the organizations (Table 3). While institutions are totally absent at some schemes, at others they exist in name only and their impact is insignificant. Yami (2013) explains this as due to interventions of external bodies in the establishment of the IWUA bylaws and in how the determination of the responsibilities of users and IWUA committees contributed to a low level of participation. Sometimes the traditional organizations on these schemes have been replaced by or incorporated into government-promoted IWUAs. Yami (2013) further argued that the way participatory approaches are used in developing interventions and the lack of understanding of power distribution among different actors and local institutional arrangements have reduced the effectiveness of the approach in the planning and implementation of projects. This can also be comprehended from the fact that many institutions locally established by the water users themselves are working much better (Tilahun et al. 2011)."},{"index":3,"size":123,"text":"IWUAs, in principle, are self-managed and governed by their members, and the general assembly is the highest body of the IWUA (FDRE 2014; Lempériere et al. 2014). However, in the irrigation schemes in this study, irrigation institutions are not fully self-managed. The highest supervisory bodies in the existing irrigation institutions are government administrative offices (Figure 2) and also cooperatives. In this regard scholars argue that given the basic differences between the purposes of cooperatives and water users institution, it is unwise to let cooperatives run irrigation water institutions. For example, Lempériere et al. (2014) indicated the following features of IWUAs that make it different from cooperatives and other associations: i) IWUAs are public legal organizations and their mandate is of a public interest;"},{"index":4,"size":6,"text":"ii) membership of IWUAs is compulsory;"},{"index":5,"size":56,"text":"iii) IWUAs operate on a non-profit/non-commercial basis, but they nevertheless provide services to their members, namely the provision of irrigation water, on a payment basis; and iv) IWUAs are self-managed organizations governed by their members but due to the public interest nature of their tasks, they are subject to some form of supervision by the state."},{"index":6,"size":307,"text":"Building up irrigation institutions in a pragmatic and socially embedded process instead of imposing cooperative framework could work better in managing irrigation schemes (Yami 2013). Generally lack of a clear-cut distinction between the roles of agricultural cooperatives and IWUAs creates confusion in the governance of irrigation schemes in Ethiopia (Yami and Snyder 2012; Amede 2014).  In addition to the structure of the institutions, issues with membership are the major hurdle in irrigation institutions (Lempériere et al. 2014). Membership of water users in the IWUA should ideally be compulsory and is linked to the presence of irrigable land (land use rights) within the service area of the irrigation scheme (FDRE 2014). Membership of IWUAs should be compulsory because in surface irrigation systems where water flows in canals, illegal diversion and hence free riding cannot be totally avoided (FDRE 2014). Membership of water users in existing irrigation organizations at different schemes of this study is shown in Table 4. It was observed that there are non-member farmers in some of the schemes. Non-members do not pay irrigation water fees (whenever this exists) and hardly participate in maintenance activities. Generally, non-members make the enforcement of rules and regulation very difficult and thus create opportunity for free riders. Implicitly, the existing irrigation institutions fail to meet the criteria of self-governance and, thus, existing institutions are different from IWUAs. Users also complain about abuse of power and corruption by the officers. In fact, the new IWUA proclamation (FDRE 2014) stipulates the need for a 'supervising body'; this means the irrigation infrastructure constructed by the federal government and the state government budget need a body designated by the government that is responsible for organizing and registering associations, providing training and other technical assistance to associations. In reality, there is a top down approach and existing institutions are not empowered for self-governances (Yami 2013)."}]},{"head":"A B C","index":7,"paragraphs":[{"index":1,"size":62,"text":"Irrigation involves multiple stakeholders with varying interests (Amede 2014; Dessalegn and Merrey 2014). Careful consideration of the context of user participation needs to be emphasized. 'Participation' is often understood in terms of the actors and stakeholders using water and their involvement in water governance (Montaña et al. 2009). It generally implies empowering users to varying degrees to take responsibility for their schemes."}]},{"head":"Function of irrigation water management institutions","index":8,"paragraphs":[{"index":1,"size":93,"text":"The tasks of irrigation water user institutions in Ethiopia are often limited to providing irrigation services and activities. FDRE (2014) suggests that IWUAs are mandated to the operation and maintenance of the irrigation infrastructure within the hydraulic boundaries of the irrigation systems, decision-making to facilitate the operation and maintenance and decision-making on finance. Lempériere et al. (2014) generally classify the task of irrigation institutions, specifically IWUAs, into three categories: governance, operation and maintenance, and financial management. The following section illustrates how these functions are performed by the water institutions in the study areas."},{"index":2,"size":74,"text":"Key elements of governance Ghazouani et al. (2012) argues that water governance is a range of political, socio-economic and administrative system established for the development and management of water resources and water services in irrigation schemes. It includes establishing the rules, responsibilities, operating mechanisms, policies and users, and official accountability systems. Ghazouani et al. (2012) emphasized that effective governance is that which provides water for livelihood and economic growth, yet maintains a sustainable environment."},{"index":3,"size":71,"text":"Governance generally relates to the roles of the general assembly of the IWUA. It includes the approval of budgets, action plans and reports, as well as the adoption and amendment of regulations governing the day-to-day operational activities of the IWUA. As depicted in Table 4, the task of existing irrigation institutions is limited to few activities. In exceptional cases, seasonal/annual budget are set and implemented across schemes where irrigation institutions exist."},{"index":4,"size":151,"text":"The second most important task implemented across study schemes was arbitration and dispute settlement. For the rest of the tasks, there were apparent variations among the schemes in terms of accomplishment. For example, the election of the officer was only recorded for three; approval of annual/seasonal budgets was recorded in two schemes (Table 5). This also means officers are assigned by the local administration or in accordance with traditional norms and procedures. A democratic process for the selection of users' representatives and a directive board seems to be a desirable feature of legal framework of IWUAs. These almost invariably have provisions for the election of user representatives as general assembly members and for board positions (president, secretary and treasurer). Democratic procedures for choosing and removing leaders and staff members are important in creating healthy relations between farmers and formal organizations, and increase the legitimacy of the latter (Ghazouani et al. 2012)."},{"index":5,"size":58,"text":"Irrigation water fees are collected from the members only at Meki scheme; this is a pumping scheme where water is pumped from Lake Ziway with large electric pumps to a large main canal from which farmers pump using small diesel pumps. Electricity costs are significant for this scheme and almost all of the fee goes towards electricity bills."},{"index":6,"size":561,"text":"For the other schemes, where there is no irrigation fee, budgets for some activities may be set in a way in which members contribute at the moment of need; however, budgets do not generally need approval. In view of the level of accomplishment of governance tasks by the study irrigation schemes, it can be concluded that irrigation institutions perform poorly and tasks are left uncompleted. Discussions with key informants also revealed that the major contributory factors to these problems were low levels of awareness and autonomy. Setting internal regulations is one of the major tasks of IWUAs (FDRE 2014). Internal regulations, also called bylaws, are specific to each irrigation organization and they are set based on the existing situations in the irrigation system, including source of water, level of water scarcity, irrigated crops, irrigation service type, water fees, operation and maintenance requirements of the scheme etc. Internal regulations may generally be revised periodically. The irrigation schemes covered in the study have their own regulations which in many cases were not written or well documented. Experiences elsewhere in Ethiopia suggests that they are developed and imposed particularly when IWUAs are directly linked to cooperatives (Yami 2016). When this happens acceptability by users will be challenged. For example, as indicated on Table 6, the internal regulations are not fully accepted by the farmers. Modern and traditional schemes have the highest acceptability of regulations, while farmers at semi-modern schemes rated the regulations as comparatively less acceptable. The highest level of unacceptability was recorded for Meki scheme which has a direct linkage to a cooperative. Although we have no evidence as to who developed the regulations for Meki scheme, we argue that existing regulations could be an imposition by cooperatives (Yami 2016). Discussion with farmers also clearly elucidates that water shortages and a lack of comprehensive and documented regulations are some of the major causes of conflict between users. This case is substantiated by Amede (2014) who suggested water shortages and poor upstream downstream linkage as one of the major causes of conflict across irrigation schemes. Here we considered conflict from two major angles: conflict between users and institutions (Table 7) and conflict between users themselves (Table 8). Conflicts between farmers and irrigation organizations generally occur when the agreed irrigation services are not delivered as per the agreement or the regulations for water distribution and when deliveries are not respected. The responses of farmers on the incidence of conflicts with irrigation organizations are shown in Table 7. The proportion of farmers who did not experience conflicts with the irrigation organizations is much lower than those who experienced conflicts at each scheme. Despite low level of acceptability of internal regulation, Meki recorded a low level of conflict, posing a contrasting situation. This can probably be explained by the fact that farmers at this scheme pump water from the main canal using individual or communal pumps, and hence the irrigation organization has little mandate for water allocation and distribution. The main task of the organization is to ensure timely maintenance of the main pumping station from the lake. Farmers pay a fee of Ethiopian birr 3 1000/ha per year which is exclusively for electricity costs and the maintenance of the pump from Lake Ziway into the main canal. Conflicts can occur between farmers at different reaches of the scheme or farmers within the same reach or block."},{"index":7,"size":77,"text":"Conflicts between head and tail reaches is mainly due to irrigation flow cut-offs at the tail ends due to excess diversions at the head or due to water shortages at the source. Conflicts between farmers within the same irrigation blocks occur mainly due to issues related to sharing of irrigation water and water theft. More frequent conflicts between farmers indicate, among others, the weaknesses of the organization in ensuring smooth operation of the scheme and water management."},{"index":8,"size":124,"text":"The results in Table 8 show the responses of the sample farmers on conflicts with other farmers regarding water allocation and sharing. In terms of the incidence of conflict between users, from Table 8, it is evident that schemes with no water institutions and modern schemes has the highest levels of conflict and this also holds true at typology level. One of the major reasons for the great incidence of conflict in traditional schemes is the fact that in these schemes water distribution, operation and maintenance are largely governed by unwritten regulations, which often creates ambiguity in their enforcement. Farmers also often have different levels of understanding regarding the governing regulations, and a minor breach of these leds to conflicts with the local organizations."},{"index":9,"size":202,"text":"As suggested by Amede (2014) water shortages can be one of the major causes of conflict. In fact this underlines that the presence of organizations, regulations, traditions and rules alone will not lead to sustainable irrigation practices. A closer look at the reason for water shortages reveals a mismatch between irrigated areas and water supply (Amede 2014). Obviously, the generation of such empirical evidence by the traditional irrigators can be an impossible exercise and there is a need for some level of support by the government body as dictated in FDRE (2014). In contrast to the conflicts of users with the water institutions at Koga (only 17%), the conflict between users themselves was apparently high at Koga irrigation schemes (modern). This could be due to the fact that it is sole responsibility of the farmers within a quaternary unit to share the proportional flow allocated to them. Farmers employ either rotational water allocation within their quaternary units to their individual farms, which often causes conflict with respect to flow durations, flow volumes and irrigation turns between farmers. Moreover, farmers can do little to change the water delivery schedules at the main levels as this is the responsibility of the Abay Basin Authority."},{"index":10,"size":83,"text":"The staff from the Abay Basin Authority are responsible for the operation and water management at the main and tertiary levels. Water is delivered to a group of farmers at a quaternary off-take, which the farmers need to share among themselves. This implies that farmers cooperate better among themselves as long as they have complete control over over the operation of the whole scheme; conflicts increase under imposed water allocation systems as farmers attempt to access more than their fair share of water."}]},{"head":"Operational management and level of equitable water distribution","index":9,"paragraphs":[{"index":1,"size":134,"text":"The operational management of IWUAs includes the day-to-day activities to ensure good functioning of the irrigation scheme. The activities include planning, implementing and monitoring of water distribution works. Tasks related to maintenance planning and implementing are also part of operational management. The operational management tasks are given in Table 9. From the six tasks listed in Table 9, only monitoring equity of water distribution is implemented across all study schemes. One of the major operational mandates of irrigation institutions is to ensure the fair allocation of water to farmers based on either a pre-scheduled arrangement or on-request (FDRE 2014;Lempériere et al. 2014). Non-conformity of the water distribution to arranged delivery schedules needs to be corrected in the process of operational decision-making. Hence equity of water distribution is a major performance indicator for irrigation organizations."},{"index":2,"size":170,"text":"Figure 3 shows the equity levels of water distribution based on farmers' perceptions. According to farmers' responses, unfair water distribution prevailed in Meki, followed by the Mai Nigus and Hare diversion schemes. For Meki, this can be accounted for by the absence of a water distribution system. Field observation and discussion with users clearly indicated that secondary and tertiary canals and structures for water distribution and control were not constructed at the Meki scheme. Hence, water can hardly advance down the scheme, leaving the tail end users facing serious water scarcity. Farmers pump water from the main canal to their fields using small private pumps. Irrigation organisations exist at the scheme; however, they have limited responsibilities for water distribution. They are more focused on the collection of annual fees for pumping costs (electricity) from the lake to the main canal. Hence, head users generally have a generous water supply, causing excessive use on farms at the head, while water does not reach tail users (Agide et al. 2015, in press)."},{"index":3,"size":253,"text":"Many of water distribution structures even in the main reach are damaged, causing significant off-farm losses (Figure 4). Though farmers' claim maintenance is ineffective either due to a lack of technical knowhow and a limitation of financial resources for canal maintenances, this contrasts with Ethiopian government water policy which stipulates the need for cost recovery of irrigation schemes (MoWR 1999). The existing irrigation organization at Meki scheme lacks the main function of an IWUA and requires reformulation of the mandate of the association to perform the major task of operational management (water allocation and distribution) for its members. In fact, in many cases, the literature also attributes such poor performance to linkages with cooperatives (Figure 3) which usually develop regulations without the proper engagement of the users (Yami 2013). Initially, when designed, the May Nigus scheme water used to reach tail users.   However, over time, water failed to reach the tail ends due to a deterioration of the water distribution systems and reduced storage capacity of the May Nigus reservoir due to sedimentation (Figure 5). The farmers also revealed the decline of the annually irrigated area. Poor maintenance of irrigation canals (Figure 6) and hence huge seepage losses add up to increase high inequity levels. The irrigation institution that exists at May Nigus scheme has limited capacity particularly for timely maintenance and equitable water allocation. On the contrary, Figure 3 shows that about 13% of respondents, apparently those users at the head, assessed the equity level at May Nigus scheme as very fair."},{"index":4,"size":11,"text":"Figure 5. Sedimentation at the intake structure of May Nigus reservoir."},{"index":5,"size":258,"text":"Hare diversion is a traditional scheme where water is being diverted using stones and soil bunds to irrigated farms in two kebeles. There are no modern flow control structures and water distribution is unfair and apparently favours head users; this argument is also substantiated empirically by the highest proportion of water users (60%) who evaluated the water distribution as unfair. Figure 7 shows the main canal of the Hare diversion scheme (Dorga kebele) with no permanent water flow control structures.  It is interesting to note the divergent responses of the farmers on fairness of water distribution at Waro (Figure 3). Waro is a traditional irrigation scheme with no permanent water diversion and control structures. Farmers use locally available materials, such as stones, soils and crop residue, for flow control. Still, they ensured equitable water distribution and all the farmers were satisfied with it. Waro is a typical example of a traditional scheme with excellent irrigation water management by the community with their own established regulations. All the respondents assessed the water distribution as fair. Hence, the lesson here is that it is not only the existence of physical infrastructure that guarantee equity. Good water distribution can also be achieved with little or no modern structures provided particularly when there is good communication and social cooperation among farmers. In community-managed irrigation schemes, cooperation is essential for pooling labour and other resources to construct and maintain canals, allocate and share water, regulate and monitor the provision and use of water, and facilitate other necessary joint ventures (Dessalegn and Merrey 2014)."},{"index":6,"size":106,"text":"Figure 8 shows a traditional cross drainage used at Waro scheme for conveying water over a depression indicating labour input as the major cost to run these schemes. On the other hand, there is large unwillingness to make financial contribution for maintenance at Waro scheme. Farmers at Waro indeed have managed their schemes well by themselves. Farmers' responses as unwilling to contribute are probably because they are satisfied with the existing irrigation services and infrastructure level. The fact that annual maintenance cost for such schemes, as mentioned above, demand more of human labour than material cost can explain why Waro scheme users are unwilling to contribute."},{"index":7,"size":12,"text":"Figure 8. Method of conveying water over a depression at Waro scheme."},{"index":8,"size":136,"text":"At Koga (modern scheme), the record of level of fairness was the second highest. Recent water delivery and on farm water management analysis suggest that there is an oversupply of irrigation water at scheme level (Agide et al. 2015;Haileslassie et al. 2015, in press). As the scheme is new, the water control and delivery infrastructure is in good shape and there are minimum water losses (except for evaporation). Probably, the perceived unfairness can be accounted for by the way IWUA is established and level of accountability given to them. For example, all the operational management of the scheme is undertaken by a government organization (Abay Basin Authority) and the farmers' contribution to maintenance planning and implementation is insignificant and their role is mainly limited to the fourth canal in terms of organizing and managing water users."},{"index":9,"size":85,"text":"In principle, such a role needs the understanding of the volume of water flow in the canal and the duration required to irrigate a given crop. From discussions with farmers and water users' team leaders, farmers generally lack awareness and the tools that enable them to make informed decisions. This creates a gap so that water users manipulate the gates of the fourth canal to get more water and thus the tail farmers get less water or those waiting for their turn will experience delays."},{"index":10,"size":93,"text":"From the analysis, it is evident that the major ingredients of effective service delivery (e.g. infrastructure, institutional settings and capacity) never coincided. In schemes with better infrastructure (e.g. Koga) the institutions are not capacitated to take over the full responsibilities of running the schemes. However, in schemes with poor levels of infrastructure (including water flow regulation and distribution canals) the institutions and associated social norms were strong and thus level of equity is fair. But the two categories also share a common problem: water wastage and consequently threaten the suitability of the schemes."}]},{"head":"Financial management and farmers willingness to contribute","index":10,"paragraphs":[{"index":1,"size":150,"text":"The main source of income for IWUAs is fees collected from its members (irrigation service fees or/and maintenance fees). For the IWUAs to be self-sufficient and financially sustainable, sound financial management is crucial. The idea of water pricing and hence the introduction of irrigation water fees is stipulated in water resources policy of Ethiopia (MoWR 1999), but the practical application is new to the country. Empirical evidence on irrigation water pricing supporting the enforcement of the policies are virtually absent with the exception of Awash basin (Malik et al. 2014). As such, even at the schemes with irrigation organizations, irrigation fees have not yet been introduced. In addition to the lack of empirical evidence indicated above, the following are cited as some of the major obstacles to the introduction of irrigation fees: i) farmers' have no experience with water pricing and the perception of water as a free commodity prevails;"},{"index":2,"size":15,"text":"ii) farmers' resistance to the payment of fees and their preference for contributing labour instead;"},{"index":3,"size":20,"text":"iii) generally poor irrigation service levels; and iv) poor capacity of irrigation organizations for financial management (Malik et al. 2014)."},{"index":4,"size":107,"text":"Despite these important roles of financing, establishing the amount to be paid by farmers is a perilous task. In the absence of empirical evidence as to who used how much water and fees for water, infrastructure or services, the situation gets more complicated; this is the situation in Ethiopia in general and specifically for the study schemes. This level of sophistication (especially because the full costs calculated are invariably not commensurate with farmers' incomes and ability to pay), always gives way to more mundane political arbitrage whereby water prices are a compromise between actual O&M costs and what farmers will accept to pay (Ghazouani et al. 2012)."},{"index":5,"size":20,"text":"Table 10. Major financial management-related tasks of institutions at schemes. √ shows that the irrigation institutions fulfil the evaluation criteria."},{"index":6,"size":10,"text":"X shows that the institutions do not fulfil the criteria."},{"index":7,"size":121,"text":"Of the schemes studied, irrigation water fees exist only at Meki and May Nigus (Table 11). In view of the above argument on the lack of proper irrigation water pricing, it is likely that water fee payment is based on area of land irrigated, and therefore there is no incentive for a farm to select water saving practices. Even at these two schemes, the tasks of IWUAs related to financial management are limited. Financial self-sufficiency for operation and maintenance and hence issues of irrigation service fees are important in view of the earlier argument (Ghazouani et al. 2012). Hence, enhancing the willingness of farmers to contribute to the operation and maintenance of their schemes is key to ensuring sustainability (Amede 2014)."},{"index":8,"size":18,"text":"The willingness of farmers to contribute to O&M (maintenance fee, labour or both) was surveyed at each scheme."},{"index":9,"size":233,"text":"Table 11 shows the results of the willingness of farmers at different schemes to contribute to the operation and maintenance. The overall result is encouraging, except for traditional schemes where a significant proportion of respondents are unwilling to contribute. The point is how this can be operated given the low enforcement capacity of the institutions. Equally important is understanding how much is enough to meet the financial needs of irrigation schemes under the irrigation scheme cost recovery scenarios. However, these aggregated values do not give a clear view of the willingness to pay (contribute), as for instance, farmers at Hare diversion (traditional scheme) are 100% willing to contribute to operation and maintenance, while the willingness at Waro (traditional) is 52%. The willingness of farmers to pay (contribute) for O&M apparently depends on the income they earn from their irrigated plots. For instance, farmers at Hare weir and Hare diversion are 100% willing, which might be due to the better outputs from perennial crops (banana and mango). Waro is a traditional scheme with good performance in terms of sustainability of irrigated land and water delivery equity, but the farmers are less willing to contribute. This could be mainly due to the fact that famers maintain their schemes and manage their water themselves according to their own established norms that ensures equity, and hence they are less willing to accept the involvement of external actors."}]},{"head":"Role of women in irrigation organizations","index":11,"paragraphs":[{"index":1,"size":17,"text":"Irrigation organizations provide services to their members who have land use rights within the irrigation service area."},{"index":2,"size":141,"text":"Whether women manage their own farms or are family labourers in a particular rural society, there are key underlying gender issues (Lempériere et al. 2014). In the irrigation schemes in this study, society of course does not give men and women equal opportunities for decision-making in irrigation, farming activities and access to land. In such a society where women are significantly excluded from economic farm opportunities, in terms of access to land, skills, inputs, capital, markets etc., providing irrigation water alone can hardly ensure equitable access to agricultural income. Even access to water by women and men farmers in many irrigation schemes in Ethiopia is not the same and favours the latter (compare also Yami 2013). As such, involving and empowering women in all aspects of decision-making in rural economic activities is required to ensure equitable benefits for all community segments."},{"index":3,"size":205,"text":"Table 12 shows the responses of farmers on their perceptions of the role of women in decision-making in the irrigation associations at different schemes. The role of women in the organizations at all schemes is generally very low according to farmers' opinion (Table 12). This perception of farmers on the role of women was highest at May Nigus scheme followed by Koga and Wukro. Although it is not possible to draw straightforward conclusions for the regions concerned, women's role in irrigation organizations was observed to be better for the schemes in Tigray and Amhara regions. It is also of note that for the schemes in Oromia (Meki and Waro), nearly all the respondents stated that women have no role in decision-making in the irrigation organizations. This is in line with Yami (2013) who argued that the lower status given to women in relation to decision-making processes has hindered the benefits of having women on IWUA committees. According to Yami (2013), this gap in balancing the decision-making power of men and women demands the intervention of the local authorities and local non-governmental organizations (NGOs) in changing perceptions and attitudes on gender equity towards sustaining the positive outcomes of irrigation for livelihoods at household and community levels."}]},{"head":"Conclusions","index":12,"paragraphs":[{"index":1,"size":72,"text":"Irrigation development in Ethiopia, as elsewhere in sub-Saharan Africa, Asia and beyond, is hindered by serious problems related to water management. As a result, unfair water distribution within the schemes and inefficient water use are common in Ethiopia. Storage structures (e.g. dams, reservoirs etc.) and primary and secondary channels are not properly maintained due to a lack of resources. These phenomena are the result of the absence or weakness of irrigation institutions."},{"index":2,"size":17,"text":"This study made an assessment of existing irrigation institutions at 10 irrigation schemes of LIVES intervention areas."},{"index":3,"size":31,"text":"The study evaluated service delivery of irrigation institutions in terms of governance, operation and maintenance, and financial management using selected indicators. In view of the findings, the following conclusions are drawn:"},{"index":4,"size":168,"text":"• Establishing IWUAs with roles in water allocation and conflict resolution, collecting water fees etc. (FDRE 2014) is a step in the right direction. Besides implementing appropriate legislative decisions of putting the establishment of IWUAs on a legislative footing, these irrigation institutions need to be strengthened through appropriate government support, such as capacity building measures. Given the appropriate capacity development support to ensure limited government interference and proper governance structures, only then will water institutions be in a position to assume the roles of defining the rules of water development, allocation and utilization (Saleth and Dinar 2004). This study supports Saleth and Dinar's (2004) suggestion that African governments need to begin by enhancing the wealth-creating potential of smallholder irrigated farming by strengthening market access, promoting high-value crops, and improving systems for providing extension and technical support to smallholder irrigators. However, the study is cognizant of the risks of establishing multiple-tasked water institutions with mandates broader than water distribution and conflict resolution, marketing, extension, etc. (Malik et al. 2014)."},{"index":5,"size":55,"text":"• Irrigation institutions are available in about 70% of the studied schemes and there is apparent diversity in terms of the way they are organized. In view of their current reporting relationship with local public administrations, and the minimal support offered to these institutions, existing irrigation institutions do not fulfil the standards set for IWUAs."},{"index":6,"size":78,"text":"• In many cases membership in irrigation water institutions, contrary to the current legislation, is not compulsory and very often the rules and regulations are not documented. This creates opportunities for free riders; put differently some individuals in the user group either consume more than their fair share of water, or pay less than their fair share of the cost of this common resource. The consequence, as revealed in many cases of the study schemes, is increased inequity."},{"index":7,"size":33,"text":"• The irrigation organizations at the study schemes do not bear their full responsibilities regarding all aspects of the management of IWUAs that ensure sustainable operational and financial management of the irrigation schemes."},{"index":8,"size":100,"text":"Existing organizations have very limited capacity to provide effective irrigation services in a sustainable way. This also means there is no accountability for the required service delivery and as a result sustainability is threatened. The issue emerged here was also the technical knowhow and capacity limitations of both service providers (government institutions) and clients (water users) in terms of the irrigation service types and delivery. Probably, this triggers the questions as to how to standardize and operate services required for the sustainable management of irrigation schemes. In this regard, capacities of both service providers and clients need to be strengthened."},{"index":9,"size":226,"text":"• Irrigation service fees are only paid in few schemes and only member users are paying. Problems associated with lack of empirical evidence guiding what to pay for and how much to pay are the prevailing questions. An absence of capable institutions for financial management and hence irrigation services was one of the major reasons for nonsustainability and hence poor maintenance. As a result, it was observed that even minor failures and maintenance needs cause significant water distribution chaos at several of the schemes. In contrast, many farmers are willing to contribute, particularly those at modern schemes. The question is how to exploit these opportunities and make the service delivery of irrigation schemes sustainable is most pressing. Water pricing is a way of ensuring the sustainability of the irrigation infrastructure and irrigation services, and can also serve as a mechanism for enhancing the efficiency of water use. Suitable levels of irrigation service fees differ from one scheme to another based on existing local conditions, gender disparities in income and incentives gained from irrigated crop types, irrigation infrastructure, and maintenance needs. The widely applied flat rates, fixed amount per household or per unit area, does not offer an incentive to prudently use water or invest in productive water technologies and therewith improve equity. Hence the assessment of irrigation water pricing and exploration of payment modalities are needed."},{"index":10,"size":94,"text":"• Women as users and decision-makers in most irrigation schemes were found to have minimal roles. In most cases, they are not seen as major actors in male-dominated irrigation farming though they are the ones who contribute most of the labour and routine activities related to irrigation farming. Female-headed households are hardly encouraged to engage in labour and capital intensive irrigation farming due to a lack of finance, labour, inputs and services, and above all have less access to market related information and informal networks that usually shape the market situation for irrigated crops."}]}],"figures":[{"text":"FiguresFigure 1 . Figures "},{"text":"Figure 1 . Figure 1. Location map of the studied irrigation schemes. "},{"text":"Figure 2 . Figure 2. Examples of structure of irrigation institutions: Meki scheme (A); May Nigus and Wukro/Hayelom schemes (B) and Hare/Waro schemes (C). "},{"text":"Figure 3 . Figure 3. Responses of farmers on equity of water distribution at different schemes. "},{"text":"Figure 4 . Figure 4. Damaged water distribution structure in the head reach of Meki scheme. "},{"text":"Figure 6 . Figure 6. Poor canal maintenance is responsible for inequitable water distribution and water losses at May Nigus scheme. "},{"text":"Figure 7 . Figure 7. Earthen canal at Hare diversion scheme with no flow control structures. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 3 . Existence of irrigation organizations in the study schemes  "},{"text":"Table 4 . Membership of users in existing irrigation organizations  "},{"text":"Table 5 . Major governance tasks of organizations at schemes  "},{"text":"Table 6 . Acceptability of internal regulations  "},{"text":"Table 7 . Occurrence of conflicts between farmers and irrigation organization  "},{"text":"Table 8 . Incidence of conflicts between farmers  "},{"text":"Table 9 . Major operation and maintenance tasks of irrigation institutions across study schemes  "},{"text":"Table 10 . Major financial management-related tasks of institutions across study schemes  "},{"text":"Table 1 . Salient features of the schemes related to organizations for water management. Scheme  Koga Megech Kelena May Nigus Wukro/ Hayelom Meki Waro Hare* diversion weir/Hare Gelana SchemeKogaMegechKelenaMay NigusWukro/ HayelomMekiWaroHare* diversion weir/HareGelana Location,  West North South Central Eastern East Shoa Jimma Gamo Gofa Sidama Location,WestNorthSouthCentralEasternEast ShoaJimmaGamo Gofa Sidama zone  Gojam Gondar Wollo Tigray Tigray    zoneGojamGondarWolloTigrayTigray Typology  Modern Traditional Traditional Semi- Semi- Semi- Traditional Semi- Semi- TypologyModernTraditional Traditional Semi-Semi-Semi-TraditionalSemi-Semi-      modern modern modern  modern/ modern modernmodernmodernmodern/modern          traditional traditional Major crops Wheat, Onion, Tomato, Onion, Onion, Onion, Potato, Banana, Coffee, Major cropsWheat,Onion,Tomato,Onion,Onion,Onion,Potato,Banana,Coffee,   potato, garlic, onion, maize, tomato, tomato onion, maize, maize potato,garlic,onion,maize,tomato,tomatoonion,maize,maize   onion tomato potato cabbage maize  tomato onion, ensete, oniontomatopotatocabbagemaizetomatoonion,ensete,          tomato tomato tomatotomato Presence of Yes No No Yes Yes Yes Yes Yes No Presence ofYesNoNoYesYesYesYesYesNo irrigation          irrigation organization         organization   IWUA   WC WC IWUA WC WC IWUAWCWCIWUAWCWC Function of Water - - Water Water Permission Water Water - Function ofWater--WaterWaterPermissionWaterWater- organization allocation   diversion, diversion, to new diversion, allocation, organizationallocationdiversion,diversion,to newdiversion,allocation,   and   allocation allocation users, allocation maintenance andallocationallocationusers,allocationmaintenance   maintenance   and overall and overall water fee and  maintenanceand overalland overallwater feeand   at   maintenance maintenance collection maintenance  atmaintenancemaintenancecollectionmaintenance   quaternary     and pump   quaternaryand pump   levels     maintenance   levelsmaintenance Condition of Compulsory - - Optional Optional Optional Optional Optional - Condition ofCompulsory --OptionalOptionalOptionalOptionalOptional- membership         membership Internal  No - - Yes Yes Yes Yes No No InternalNo--YesYesYesYesNoNo regulations         regulations Irrigation  No No - Yes No Yes No No No IrrigationNoNo-YesNoYesNoNoNo service fee         service fee Contribution Labour None - Labour Labour Labour/fee Labour Labour Labour ContributionLabourNone-LabourLabourLabour/feeLabourLabourLabour to          to maintenance         maintenance * Hare has both traditional and modern schemes.      *Hare has both traditional and modern schemes.  "},{"text":"Table 2 . Irrigation scheme typology based on multi-criteria evaluation. Scheme Grade (multi-criteria analysis) Typology SchemeGrade (multi-criteria analysis)Typology Koga 92.5 Modern Koga92.5Modern May Nigus 62.25  May Nigus62.25 Meki 59  Meki59 Wukro/Hayelom 58.5 Semi-modern Wukro/Hayelom58.5Semi-modern Hare Weir 58  Hare Weir58 Gelana 50.25  Gelana50.25 Kelena 46.5  Kelena46.5 Waro Megech 42.5 42.25 Traditional Waro Megech42.5 42.25Traditional Hare diversion 36.5  Hare diversion36.5  "},{"text":"Table 3 . Existence of irrigation organizations in the study schemes. Scheme name Types of organization* Scheme nameTypes of organization* Koga IWUA KogaIWUA Meki IWUA MekiIWUA May Nigus WC May NigusWC Wukro/Hayelom WC Wukro/HayelomWC Hare Weir WC Hare WeirWC Gelana X GelanaX Megech X MegechX Waro WC WaroWC Hare diversion WC Hare diversionWC Kelena X KelenaX  "},{"text":"Table 4 . Membership of users in existing irrigation organizations. Scheme Total no. of respondents Members Number % Non-members Number % SchemeTotal no. of respondentsMembers Number%Non-members Number % Koga 30 29 97 1 3 Koga30299713 Meki 30 21 70 9 30 Meki302170930 May Nigus 25 16 64 9 36 May Nigus251664936 Hayelom/ 53 37 70 16 30 Hayelom/5337701630 Wukro      Wukro Hare weir 20 20 100 0 0 Hare weir202010000 Hare diversion 20 20 100 0 0 Hare diversion 202010000 Waro 30 30 100 0 0 Waro303010000  "},{"text":"Table 5 . Major governance tasks of organizations at schemes.    Tasks  Tasks Scheme* Election of officer Approval of annual/ seasonal budget Setting up annual/ seasonal budget Arbitration and settling disputes Scheme*Election of officerApproval of annual/ seasonal budgetSetting up annual/ seasonal budgetArbitration and settling disputes  "},{"text":"Table 6 . Acceptability of internal regulations. Scheme Total no. of respondents Acceptable Number % Not acceptable Number % Don't mind Number % SchemeTotal no. of respondentsAcceptable Number %Not acceptable Number %Don't mind Number % Koga 24 21 88 1 4 2 8 Koga2421881428 Meki 30 18 60 11 37 1 3 Meki301860113713 May Nigus 30 22 73 4 13 4 13 May Nigus 302273413413 Wukro/ 56 53 95 0 0 3 5 Wukro/5653950035 Hayelom        Hayelom Hare weir 21 16 76 5 24 0 0 Hare weir21167652400 Hare 18 14 78 4 22 0 0 Hare18147842200 diversion        diversion Waro 30 30 100 0 0 0 0 Waro30301000000  "},{"text":"Table 7 . Occurrence of conflicts between farmers and irrigation organization.   Had conflicts with  Did not have conflicts with Had conflicts withDid not have conflicts with Scheme Total no. of respondents organization No. of respondents % organization respondents No of % SchemeTotal no. of respondentsorganization No. of respondents%organization respondents No of % Koga 30 5 17 25 83 Koga305172583 Meki 30 0 0 30 100 Meki300030100 May Nigus 32 7 22 25 78 May Nigus327222578 Wukro 35 5 14 30 86 Wukro355143086 Hare weir 19 7 37 12 63 Hare weir197371263 Waro 28 4 14 24 86 Waro284142486 Hare diversion 17 5 29 12 71 Hare diversion175291271  "},{"text":"Table 8 . Incidence of conflicts between farmers. Scheme Total no. of respondents Had conflicts respondents No. of % Did not have conflicts No. of respondents % SchemeTotal no. of respondentsHad conflicts respondents No. of %Did not have conflicts No. of respondents % Koga 29 18 62.07 11 37.93 Koga291862.071137.93 Meki 30 1 3.33 29 96.67 Meki3013.332996.67 May Nigus 32 6 18.75 26 81.25 May Nigus 32618.752681.25 Waro 35 6 17.14 29 82.86 Waro35617.142982.86 Hare weir 18 3 16.67 15 83.33 Hare weir 18316.671583.33 Wukro/      Wukro/ Hayelom 17 5 29.41 12 70.59 Hayelom17529.411270.59 Hare      Hare diversion 30 5 16.67 25 83.33 diversion30516.672583.33 Megech 30 15 50.00 15 50.00 Megech301550.001550.00 Kelena 30 13 43.33 17 56.67 Kelena301343.331756.67 Gelana 30 12 40.00 18 60.00 Gelana301240.001860.00  "},{"text":"Table 9 . Major operation and maintenance tasks of irrigation institutions across study schemes.     Tasks   Tasks Scheme Prepare operation plan Implement operation plan per the plan Monitor equity of water distribution as Prevent water wastage plan Prepare and implement maintenance Inspect irrigation structures SchemePrepare operation planImplement operation planper the plan Monitor equity of water distribution asPrevent water wastageplan Prepare and implement maintenanceInspect irrigation structures  "},{"text":"Table 11 . Willingness of farmers to contribute to operation and maintenance (fee or labour). Scheme Total number of respondents Number Willing % Unwilling Number % SchemeTotal number of respondentsNumberWilling %Unwilling Number% Koga 30 27 90 3 10 Koga302790310 Meki 29 22 76 7 24 Meki292276724 May Nigus 32 21 66 11 34 May Nigus3221661134 Wukro 35 33 94 2 6 Wukro35339426 Waro 27 14 52 13 48 Waro2714521348 Hare weir 20 20 100 0 0 Hare weir202010000 Hare diversion 20 20 100 0 0 Hare diversion202010000 Megech 30 21 70 9 30 Megech302170930 Kelena 30 25 83 5 17 Kelena302583517 Gelana 30 27 90 3 10 Gelana302790310  "},{"text":"Table 12 . Farmers' perception on the role of women in their irrigation institutions. Scheme Total no. of respondents None No. of responses Insignificant Fair SchemeTotal no. of respondentsNoneNo. of responses Insignificant Fair Koga 26 14 5 7 Koga261457 Meki 30 30 0 0 Meki303000 May Nigus 32 15 7 10 May Nigus3215710 Wukro/Hayelom 35 20 7 8 Wukro/Hayelom352078 Hare weir 23 1 22 0 Hare weir231220 Hare diversion 17 0 17 0 Hare diversion170170 Waro 30 28 0 2 Waro302802  "}],"sieverID":"78d25e91-b99a-4859-867d-ca0027dee2cf","abstract":"Irrigation systems cannot ensure the equitable distribution of water among users and sustainable operation and maintenance of the schemes without capable irrigation institutions. In Ethiopia, traditional institutions have emerged with the expansion of traditional irrigation schemes and most of them were established and operated on the initiative of the farmers. These often have very limited financial and technical capacities. Current trends show that developing infrastructure is the major concern in irrigation development efforts. However, managing the schemes is largely overlooked, particularly for externally initiated irrigation schemes. Operation and maintenance of the irrigation schemes, particularly those at tertiary levels, are commonly not well set and often neglected or left to farmers without building their capacities. The overarching objectives of the study were to: i) assess the nature and diversity of irrigation institutions in the study schemes; ii) evaluate existing institutions service delivery with respect to selected attributes and draw useful lessons; and iii) identify appropriate interventions. This study focused on 10 irrigation schemes located in four regional states of Ethiopia (Tigray, Amhara, Oromia and SNNP). Various approaches were used to generate data required for this study, such as household interview, transect walk and systematic observation, focus group discussion, key informant interviews and the review of existing literature. We clustered the study schemes as modern, semi-modern and traditional, using selected criteria (operation and maintenance service delivery, managing financial service delivery, level of inequity) to generate empirical evidence for evaluation of their performances. The results found two forms of irrigation institutions: irrigation water users associations (IWUA) and irrigation cooperatives or water committee. More than 30% of the irrigation schemes considered in the study, regardless of their typology, had no institution. Membership in the irrigation institution for traditional schemes was 100%, while the average membership both in modern and semi-modern schemes was about 70% of the respondents. This contrasts with the new proclamation in Ethiopia on IWUA which suggest mandatory membership for any water user in a scheme. Without exception bylaws were either not detailed enough to address scheme specific problems or not recorded at all. Ambiguity associated with these, and probably presence of non-member water users, deterred the decision-making processes and the enforcement of rules and regulations for water use, thus create opportunities for free riders. This also explains the reason for occasional conflict between irrigators and the inequity of water distribution within scheme. In many cases, irrigation institutions service delivery limited to operational management and other services, such as financial management, were not common even at those schemes where irrigation fee exists. Problems associated with a lack of empirical evidence as to what to pay for and how much to pay and the application of flat rate-regardless of the amount of irrigation water used, which is not measured-and crop types grown as currently practised will not act as an incentive for prudent water use. Establishing the amount and types of irrigation water fees will be an important step to finance irrigation schemes. Understanding this diversity and these gaps and tailoring actions to local conditions is vital efforts to improve the service delivery of irrigation institutions in Ethiopia. Secondly, the service required for the sustainable management of irrigation schemes and mechanisms to operate them needs to be standardized."}

data/part_5/0a1c4dd0a64a3121fb30b5ed1a0c81ae.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a1c4dd0a64a3121fb30b5ed1a0c81ae","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f8a06498-1647-4c94-b4c5-726617077376/retrieve"},"pageCount":11,"title":"The Effect of Climate-Smart Agriculture on Soil Fertility, Crop Yield, and Soil Carbon in Southern Ethiopia","keywords":["Tadesse, M.","Simane, B.","Abera, W.","Tamene, L.","Ambaw, G.","Recha, J.W.","Mekonnen, K.","Demeke, G.","Nigussie, A.","Solomon, D. The climate change","climate-smart agriculture","soil fertility","crop yield","soil carbon","soil moisture content"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":222,"text":"There is a wide scientific consensus that agricultural production is being affected by extreme weather events such as droughts, heavy rainfalls, and high temperature [1]. In the last decade, for instance, the agriculture sector shared about 25% of climate changeassociated disasters and losses of around 25 billion USD [2]. In the current climate change scenario, crop yield is estimated to decrease by 30-82% at the end of the 21st century [3], and food production is expected to decrease by 1-5% per decade [4]. The negative impact of climate change on food security is expected to be more severe in low-income countries where crop production depends entirely on rainfall, and the production systems are characterized by low input in such things as fertilizer, agrochemicals, and improved seeds [5,6]. In Africa, climate change is estimated to reduce yield of maize (Zea mays), sorghum (Sorghum bicolor), and millet (Panicum miliaceum) by 5%, 14.5%, and 9.6%, respectively, at the end of the 21st century [7]. Similarly, Ramirez-Villegas and Thornton [4] predicted that maize yield would decrease by ~42 to ~37 million tons per year if climate-smart practices were not implemented. It is therefore important to develop technologies to curb the adverse impacts of climate change on food production and to realize the sustainable development goals, which are aimed at eradicating poverty and hunger by 2030 [8]."},{"index":2,"size":139,"text":"Climate-smart agriculture (CSA) has been promoted as a prominent strategy to increase crop production in a changing climate, ensure farmers' resilience to climate change, and reduce greenhouse gas emissions [9][10][11]. Subsequently, several CSA practices have been identified, and their significance towards addressing food security challenges and mitigating climate change is very well documented [10,11]. There are extensive studies on the benefits of CSA practices, including minimum tillage [12,13], crop residue management [14], soil and water conservation [15,16], agroforestry [17], and area closure [18]. However, most of this evidence has mainly been provided by short-term and/or researcher-managed field experiments, and it is therefore not possible to draw any general conclusions. Quantitative evidences from landscape-scale studies are required, particularly in Sub-Saharan African regions, to clarify doubts about the long-term effects of CSA practices on crop yield, soil quality, and carbon sequestration."},{"index":3,"size":280,"text":"Climate change will likely have small effects on average yields of major crops in Ethiopia (i.e., maize, wheat, and sorghum) [19] because agronomic conditions for cultivation of these crops may actually improve in large parts of the country. However, it is also believed that extreme weather events, such as drought and floods, will have a greater effect on crop yields. In collaboration with national and international research and development partners, the government of Ethiopia is implementing several CSA interventions to restore degraded landscapes and improve farmers' resilience to climate change. Due to the complex socioeconomic nature of agricultural systems in Sub-Saharan Africa, integrated CSA approaches have been advocated to optimize the benefits as well as adoption of CSA practices by smallholder farmers. On this premise, the CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) implemented integrated CSA practices in highly degraded landscapes across different developing countries, including Lushoto (Tanzania), Wote and Nyando (Kenya), Hoima and Rakai (Uganda) [5], and Doyogena (Ethiopia). The integrated CSA practices in these regions include soil and water conservation measures, grazing management, crop rotation, incorporation of crop residues, and perennial-crop based agroforestry systems [5,9]. This study therefore aimed at determining the effect of long-term implementation of integrated CSA interventions on crop yield, soil fertility, and carbon sequestration. It is hypothesized that CSA practices increase crop yield, improve soil fertility, and mitigate greenhouse gas (GHG) emissions through soil carbon sequestration, thereby ensuring adaptation and resilience of smallholder farmers to climate variability. This study was entirely based on evidence from climate-smart villages (CSVs) in Southern Ethiopia (Doyogena) which have been established since 2012, but the findings could be extrapolated to other CSVs in low-income countries."}]},{"head":"Materials and Methods","index":2,"paragraphs":[]},{"head":"The Study Area","index":3,"paragraphs":[{"index":1,"size":231,"text":"The study was conducted at the Tula-Jana climate-smart landscape in South Ethiopia. The Tula-Jana climate-smart landscape is located in the Doyogena district (7 • 17 -7 • 19 N latitude and 37 • 45 -37 • 47 E longitude), in the Kembata Tembaro zone, Southern Nations, Nationalities, and Peoples' Region (SNNPR) of Ethiopia (Figure 1). The mean annual rainfall of the district ranges from 1000 to 1400 mm. There are two rainfall seasons in the area: Belg (the short rainy season) from February to April and Meher (the main rainy season) from June to October. It is a highland with altitude ranging from 2420 to 2740 m asl. The annual temperature ranges from 12 to 20 • C. The main economic activity is characterized by enset (Enset ventricosum) based mixed cereal-livestock farming system. Wheat (Triticum sp.), barley (Hordeum vulgare), and faba bean (Vicia faba) are the main crops grown in the area. Potatoes (Solanum tuberosum), carrots (Daucus carota), and Ethiopian mustard (Brassica carinata) are the main vegetables grown. Enset (Ensete ventricosum), a false banana, is grown in almost all homestead households and is an important food source, particularly during the drought season. The enset-based agroforestry system has been practiced for generations. Cattle, donkeys, and sheep are the main livestock types kept by farmers. Most of the households are small-scale subsistence farms with an average land size of less than one-half hectare. "}]},{"head":"CSA Practices in the Study Area","index":4,"paragraphs":[{"index":1,"size":108,"text":"The Tula-Jana climate-smart landscape is characterized by a steep slope and thereby contributes to the high soil erosion rate in the area. To reduce soil erosion and soil nutrient depletion, a combination of CSA practices has been implemented (Table 1), including physical soil and water conservation (SWC) structures coupled with Desho grass (Pennisetum pedicellatum), hedgerow planting, crop-residue incorporation, manure application, crop rotation, intercropping, cover crops, and restricted grazing systems (i.e., cut-and-carry system). Tree species such as Erythrina abyssinica, Eucalyptus obliqua, and Juniperus procera have also been introduced in croplands. The agroforestry system, which involves enset and vegetables (cabbage, carrot, beetroot, and garlic), has been practiced near the homestead."}]},{"head":"Data Sources","index":5,"paragraphs":[{"index":1,"size":84,"text":"Multiple data collection techniques were employed to determine whether CSA practices ensured climate change resilience through improving crop yield, reducing soil nutrient depletion, and sequestering soil carbon. The effect of CSA practices on wheat yield was measured from 245 farmers through a household (HH) survey. Wheat was selected because it is the main crop grown in the area. A total of 196 randomly selected farmers from CSA adopters (i.e., treatment group) and 49 farmers from non-adopters (i.e., control group) were included in the survey."},{"index":2,"size":177,"text":"Soil samples were collected in April 2018 from croplands at ploughing depth (0-15 cm) to assess the impact of CSA practices on plant-available nutrient contents. In addition, soil samples were collected from CSA-improved croplands, grasslands, forestland, and agroforestry to estimate the soil carbon stock within 1 m depth (Figure 2). In order to determine the effect of CSA practices on crop yield and soil fertility with time, grain yield and soil samples were collected from croplands where CSA interventions were implemented for (i) 3 years, (ii) 6 years, and (iii) 10 years. The grain yield and soil samples were also collected from the control farmers' business-as-usual practice. All soil samples were collected from three replications and air-dried, mixed thoroughly, passed through a <2 mm sieve, and stored in a plastic bag prior to laboratory analysis. Soil reaction (pH KCl) was determined from a soil-to-solution ratio of 1:2.5 (w/v) [20]. Soil organic carbon (SOC) was analyzed using the Walkley-Black method, total nitrogen using the Kjeldahl method, phosphorus using the Olsen method, and plant-available nutrients using Mehlich extraction [21]."},{"index":3,"size":11,"text":"The soil carbon (SOC) stock was calculated using the following equation:"},{"index":4,"size":17,"text":"Soil carbon stock (Mg ha −1 ) = soil carbon (%) × bulk density (g/cm 3 )"},{"index":5,"size":64,"text":"where CF represents the coarse fraction (%) and D is the actual depth. The temporal soil moisture change due to CSA practices was determined using satellite images. The time series Normalized Difference Water Index (NDWI) was used as a proxy to assess soil moisture stress risk [22][23][24]. NDWI is derived from the Near-Infrared (NIR) and Short-Wave Infrared (SWIR) reflectance [25]. NDWI was calculated as"},{"index":6,"size":64,"text":"NDWI values range from −1 (low soil moisture content) to +1 (high soil moisture content). Satellite images for the years 2010, 2014, and 2017 were downloaded from Landsat 4-5 Thematic Mapper (TM) Level 1 and Landsat 8 to calculate NDWI (Table 2). Two satellite images were acquired for each year, and the average values were used for the analysis to have better representative data. "}]},{"head":"Data Analyses","index":6,"paragraphs":[{"index":1,"size":119,"text":"The linear mixed model was used to test the effects of CSA practices on soil fertility indicators and crop yield along a chronosequence, and to compare soil carbon stock under CSA improved croplands with the different land-use types (i.e., grassland, agroforestry, and forest). Replication was used as a random factor, whereas duration of CSA intervention or land-use types were considered as a fixed factor. Mean separation was carried out using least significant difference (LSD) when significance differences were found between CSA implementation year-/land-use types. Prior to data analysis, the homogeneity of variance assumption was checked using Levene's test, while the Shapiro-Wilk test was used to check the normality. All the statistical analysis was carried out using R version 3.6.0."}]},{"head":"Results","index":7,"paragraphs":[]},{"head":"CSA Effects on Soil Fertility and Crop Yield","index":8,"paragraphs":[{"index":1,"size":279,"text":"The soil fertility indicators such as soil organic carbon (SOC), total nitrogen (TN), and plant-available phosphorus increased (p < 0.05) under CSA compared to the farmers' usual practices (Figure 3). The SOC content was 2.8-3.1 times higher under CSA interventions than the control (Figure 3a). The highest SOC content (35.1 g kg −1 ) was observed in the landscapes where CSA practices have been practiced for 10 years. Similarly, CSA exhibited 2.2-2.6 and 1.7-2.7 times more total nitrogen and plant-available phosphorus, respectively, compared to the control (Figure 3b,c). Although the soils remained slightly acidic, CSA practices slightly increased soil pH (p < 0.05) (Figure 3f). The Mehlich-extractable sulfur content and bulk density were higher under croplands improved through CSA practices, but the effect was marginal (p > 0.05). The NDWI analysis showed that soil moisture content was increased with time due to the use of integrated CSA interventions (Figure 4). The soil moisture content increased substantially since 2010, following the implementation of CSA practices in the area.  In accordance with the soil fertility indicators, wheat yield under CSA was increased by 30-45% compared to the control (p < 0.05). The highest yield was observed under the landscapes that were improved through CSA practices for 6 years (1.48 t ha −1 ) and followed by 3 years (1.45 t ha −1 ) and 10 years (1.33 t ha −1 ). The wheat yield under the control was 1.02 t ha −1 (Figure 5). Both soil fertility indicators and wheat yield did not differ along a chronosequence of CSA implementation, implying that CSA practices aid resource-poor farmers to build climate change resilience within a short period of time (i.e., three years). "}]},{"head":"CSA Effects on Soil Carbon Stocks","index":9,"paragraphs":[{"index":1,"size":108,"text":"Different CSA interventions were implemented across different land-use types (i.e., cropland, forestland, and agroforestry) (Table 1), and the SOC stock at a 1 m depth was compared with the control (i.e., lands without CSA interventions). As compared to the control, CSA interventions increased SOC stock by 3.2, 4.6, 5, and 6.9 times under forestland, grassland, cropland, and agroforestry, respectively (Figure 6). The highest SOC stock was observed under agroforestry (312 Mg C ha −1 ) and followed by croplands (229 Mg C ha −1 ), grassland (209 Mg C ha −1 ), forestland (145 Mg C ha −1 ), and the control (45 Mg C ha −1 ). "}]},{"head":"Discussion","index":10,"paragraphs":[{"index":1,"size":449,"text":"Moisture stress and nutrient depletion are the main biophysical factors that challenge smallholder farmers in Sub-Saharan African countries to maximize crop yields [26]. This study is therefore initiated to investigate whether a package of CSA practices improves farmers' resilience to climate change through increasing soil fertility, moisture content, and crop yield. The findings demonstrated that CSA significantly increased soil moisture content, soil pH, and nutrient concentration compared with the farmers' usual practices (Figures 3 and 4). High nutrient concentration under CSA could be attributed to the addition of crop residues and farmyard manure, which increase nutrient availability through mineralization [27]. The NDWI analysis showed that CSA practices increased soil moisture content by twofold, which is comparable with Adimassu et al. [28], Amare et al. [29], and Kosmowski [30] who reported a significant and positive contribution of soil conservation structures against extreme drought events. Owing to high moisture content and nutrient concentration, the higher wheat yield under CSA-improved cropland compared with the control is evident (Figure 5). The wheat yield gap in the Sub-Saharan region is estimated to be 50% [31]. In addition, previous studies suggested that crop yield should be increased by 25-35% at the end of the 21st century to meet future food demand [3,32]. The Food and Agriculture Organization (FAO) estimates that total agricultural production should be increased by 60% to feed the world population [33]. The observed increase in wheat yield due to CSA interventions (i.e., 30-45%) (Figure 5) has therefore confirmed the significant contributions of CSA practices to address the future food insecurity in low-income countries where climate shock adaptive capacity is weaker. Many smallholder farmers in the tropics have croplands less than 1 ha [34], and earlier studies showed lower crop yield under physical soil conservation structures because the structures preoccupy productive lands [31]. The findings of this study, however, implied that soil physical conservation structures should be coupled with biological conservation measures and agronomic practices such as cereal-legume rotation, improved seed varieties, cover crops, and control grazing to downscale the negative impacts of climate change on crop production and to assist resource-poor farmers to deal with the current climate change risks. In agreement with our findings, Branca et al. [35], Adgo et al. [36], Tadele et al. [37], and Mesfin et al. [38] found 2-6 times more crop yield following implementation of integrated sustainable landmanagement practices such as soil and water conservation measures, crop rotation, and cereal-legumes intercropping. High soil degradation and environmental variables (i.e., low rainfall amount) could explain the lower effect of CSA practices on wheat yield in the present study as compared to the values reported by Branca et al. [35], Adgo et al. [36], and Tadele et al. [37]."},{"index":2,"size":120,"text":"The effects of CSA interventions on soil fertility indicators and crop yield did not vary along a chronosequence (Figures 3 and 5), suggesting that CSA interventions have a potential to improve soil fertility and curb the negative impacts of extreme weather events on food security within a short period of time (i.e., three years). Even though there was non-significant difference along a chronosequence, the crop yield tended to decline after 10 years of implementing CSA interventions (Figure 5). It is mainly due to the mismanagement of soil and water conservation structures by the local communities over time [39]. Hence, proper management and maintenance is required to ensure sustainable and long-term benefits of CSA interventions on crop yield and soil fertility."},{"index":3,"size":222,"text":"This study demonstrated the substantial potential of integrating CSA interventions in mitigating climate change through soil carbon sequestration (Figure 6). SOC stock was increased by 100-267 Mg C ha −1 under land uses improved through CSA interventions compared with the control lands where no CSA interventions had been implemented. Previously, Ambaw et al. [9] evaluated the contribution of CSA portfolio to soil carbon sequestration under different Eastern African countries and found out that CSA stored 50-95 Mg C ha −1 more SOC than the control, which is comparable with this study. The slightly higher carbon sequestration in this study than the one reported by Ambaw et al. [9] could be explained by the following: (i) the farming systems are more intensive in this study than those identified by Ambaw et al. [9], and (ii) the CSA interventions have been practiced for a decade in the present study. Higher SOC stock under CSA is mainly attributed to carbon input through a combination of different practices, including crop residue incorporation [40], farmyard manure application [41], minimum tillage [42], and restricted-grazing which prevents residue removal [43]. Unlike our expectation, SOC stock was also the lowest under forestland compared to other land-use types. The plantation forests were established on steep slopes and highly eroded landscapes; hence, the slight increase in SOC stock is expected in forestlands."}]},{"head":"Conclusions","index":11,"paragraphs":[{"index":1,"size":117,"text":"This study discussed the impact of integrated CSA practices on soil productivity indicators and wheat yield, using the Southern Ethiopia climate-smart landscapes as a case study. The findings showed that soils under CSA practices exhibited almost twice more total nitrogen and plant-available phosphorus content, respectively, than the farmers' usual practices. In addition, CSA practices increased soil carbon stock by three-to sevenfold and wheat yield by 30-45% as compared to business-as-usual practices. However, there were indications that implied long-term benefits of CSA can only be realized when adopted technologies are properly managed and maintained over time. There is a need for inclusive systems and institutional arrangements to be in place to ensure the continual use of CSA practices."},{"index":2,"size":148,"text":"The findings also clearly demonstrated that different land uses presented different soil carbon stocking capacities. Even though the perennial-crop based agroforestry system presented the highest mean soil carbon stock, it would be difficult to conclude that the farming system should shift entirely to that system, as the existing land uses are essential for the livelihood of the community as well as the biodiversity of the area. Therefore, the landscape approach, integrating CSA at the farm-level with other land-use systems, including agroforestry, grasslands, and forests, needs to be considered to maximize soil carbon stock and to ensure the overall ecological health of the area. Climate-smart practices, including cover crops, present a substantial opportunity to further reduce GHG emissions; therefore, scaling the introduction of multi-purpose cover crops, like vetch and lupin, will not only benefit the soil fertility but also will contribute considerably to the country's nationally determined contributions (NDC)."},{"index":3,"size":68,"text":"It is seen from the study that CSA implementation has the ability to build up soil carbon stocks. Storing carbon in soils has high relevance for Ethiopia's CRGE strategy as well as nationally determined contributions because soil is the largest terrestrial carbon pool. Given this context, the country needs to develop and implement policies that focus on promoting sustainable agricultural practices such as CSA at a landscape level."}]}],"figures":[{"text":"Figure 1 . Figure 1. Location of Tula-Jana landscape, Doyogena District, SNNPR, Ethiopia. "},{"text":"Figure 2 . Figure 2. The selected soil profiles (a) farmers' business-as-usual practice (i.e., control), (b) agroforestry, and (c) cropland. "},{"text":"Figure 3 . Figure 3. An overview of the change in selected soil fertility indicators under the different years of practicing climate-smart agriculture (CSA) and the control (i.e., farmers' business-as-usual practices). (a) Soil organic carbon, (b) total nitrogen, (c) available phosphorus, (d) sulfur, (e) bulk density, and (f) soil pH. Bars with different letters represent significant difference at p < 0.05. The error bars indicate standard deviation (n = 3). "},{"text":"Figure 4 . Figure 4. Time series soil moisture content distribution curve. "},{"text":"Figure 5 . Figure 5. Average wheat yield under the different years of practicing CSA and the control (i.e., farmers' business-as-usual practices). Bars with different letters represent significant difference at p < 0.05. The error bars indicate standard deviation. "},{"text":"Figure 6 . Figure 6. Soil carbon stocks within 1 m depth under the different land uses and control (i.e., lands without CSA interventions). Bars with different letters represent significant difference at p < 0.05. The error bars indicate standard deviation (n = 3). "},{"text":"Table 1 . Summary of CSA practices implemented in different land uses across the CSV. Land Uses CSA Practices Implemented Land UsesCSA Practices Implemented Cropland Integrated physical and biological SWC measures; crop rotation, improved varieties, intercropping, restricted grazing, cover crop (at pilot), crop residue, and hedgerow planting CroplandIntegrated physical and biological SWC measures; crop rotation, improved varieties, intercropping, restricted grazing, cover crop (at pilot), crop residue, and hedgerow planting Agroforestry Use of farmyard manure, ash, and household waste; integration of enset, leguminous trees, and vegetables (carrot, beetroot, and cabbage) AgroforestryUse of farmyard manure, ash, and household waste; integration of enset, leguminous trees, and vegetables (carrot, beetroot, and cabbage) Forest Area enclosure ForestArea enclosure Grassland Open grazing land shared by the community GrasslandOpen grazing land shared by the community Control (BAU) CSA practices were not implemented (i.e., without SWC measures, without open grazing, without incorporation of crop residues and farmyard manure, and without cover crops) Control (BAU)CSA practices were not implemented (i.e., without SWC measures, without open grazing, without incorporation of crop residues and farmyard manure, and without cover crops)  "},{"text":"Table 2 . Satellite images accusation information. Sensor Sensor ID WRS Path and Row No of Bands Pixel Size Year Acquisition Date SensorSensor IDWRS Path and RowNo of BandsPixel SizeYearAcquisition Date Landsat 4-5 TM P 169 r 055 7 30 m × 30 m 2010 16 December 2010 30 January 2010 Landsat 4-5TMP 169 r 055730 m × 30 m201016 December 2010 30 January 2010 Landsat 8 OLI-TIRS P 169 r 055 11 30 m × 30 m 2014 2017 11 December 2014 25 January 2014 3 December 2017 17 January 2017 Landsat 8OLI-TIRSP 169 r 0551130 m × 30 m2014 201711 December 2014 25 January 2014 3 December 2017 17 January 2017  "}],"sieverID":"45042b74-af7b-4576-92c6-e9b8a8be78ae","abstract":"It is critical to develop technologies that simultaneously improve agricultural production, offset impacts of climate change, and ensure food security in a changing climate. Within this context, considerable attention has been given to climate-smart agricultural practices (CSA). This study was conducted to investigate the effects of integrating different CSA practices on crop production, soil fertility, and carbon sequestration after being practiced continuously for up to 10 years. The CSA practices include use of soil and water conservation (SWC) structures combined with biological measures, hedgerow planting, crop residue management, grazing management, crop rotation, and perennial crop-based agroforestry systems. The landscapes with CSA interventions were compared to farmers' business-as-usual practices (i.e., control). Wheat (Triticum sp.) yield was quantified from 245 households. The results demonstrated that yield was 30-45% higher under CSA practices than the control (p < 0.05). The total carbon stored at a soil depth of 1 m was three-to seven-fold higher under CSA landscapes than the control. CSA interventions slightly increased the soil pH and exhibited 2.2-2.6 and 1.7-2.7 times more total nitrogen and plant-available phosphorus content, respectively, than the control. The time series Normalized Difference Water Index (NDWI) revealed higher soil moisture content under CSA. The findings illustrated the substantial opportunity of integrating CSA practices to build climate change resilience of resource-poor farmers through improving crop yield, reducing nutrient depletion, and mitigating GHG emissions through soil carbon sequestration."}

data/part_5/0b12f6d93b355a132717c1fa40fba4f0.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b12f6d93b355a132717c1fa40fba4f0","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/babb3387-6e6e-4fb7-a649-07e0e1e122c1/retrieve"},"pageCount":28,"title":"CCAFS Climate-Smart Villages AR4D sites location","keywords":["Barley","Enset","Legumes","Beans","Potatoes Cow","Sheep","Poultry Basona-Werana Basona-Werana district","Central Highlands 2650 -3350 0.75 N.A. 12.5% Barley","Faba Beans","Wheat","Potatoes Cow","Sheep","Horse","Donkey","Poultry Cow","Sheep","Goats","Pigs","Poultry"],"chapters":[{"head":"Country","index":1,"paragraphs":[]}],"figures":[{"text":"CSA Practices Implemented and/or Evaluated across the CCAFS AR4D Climate-Smart Villages in 2019  CCAFS Climate-Smart Villages CCAFS Climate-Smart Villages AR4D sites characteristics AR4D sites characteristics CSV sites Latin America Closer admin unit Implemented: 77 Top 10 CSA Practices Mitigation potential # CSV sites i Altitude (m.a.s.l) Region Farm size (Ha) Evaluated: 25 Total HH Women headed HH Country CSV site Doyogena Crops Implemented # HHs 107 # HHs Evaluated* 140 Gender impacts assessed Animals X CSV sites Latin America Closer admin unit Implemented: 77 Top 10 CSA Practices Mitigation potential # CSV sites iAltitude (m.a.s.l) RegionFarm size (Ha) Evaluated: 25 Total HH Women headed HH Country CSV site DoyogenaCrops Implemented # HHs 107# HHs Evaluated* 140Gender impacts assessed Animals X Colombia Top 10 CSA Practices Cauca Popayan municipality, Cauca department Mitigation potential # CSV sites 1760 Region Ethiopia Country 2-5 1491 Basona-CSV site 9% Werana Coffee, Sugar cane, Beans, Vegetables # HHs Implemented # HHs Evaluated* Pigs, Hen Gender assessed impacts N.A. N.A. - Colombia Top 10 CSA Practices CaucaPopayan municipality, Cauca department Mitigation potential # CSV sites1760 RegionEthiopia Country 2-51491 Basona-CSV site 9% WeranaCoffee, Sugar cane, Beans, Vegetables # HHs Implemented # HHs Evaluated* Pigs, Hen Gender assessed impacts N.A. N.A. - Guatemala Water Harvesting (terraces) Olopa Olopa municipality Chiquimula department -6 EA 1585 <1 Ethiopia Kenya Kenya Tanzania 555 Doyogena 13% Nyando Nyando Lushoto Coffee, Cocoa, Maize, Beans 90 140 N.A. 9518 N.A. X Banana, Pigs -- Guatemala Water Harvesting (terraces)OlopaOlopa municipality Chiquimula department -6EA1585<1 Ethiopia Kenya Kenya Tanzania555 Doyogena 13% Nyando Nyando LushotoCoffee, Cocoa, Maize, Beans 90 140 N.A. 9518 N.A.X Banana, Pigs -- Honduras Improved Varieties Santa Rita Santa Rita municipality Copan department -6 EA 660 1-5 Tanzania Uganda 479 Lushoto Hoima 15% N.A. Coffee, Cocoa, Maize, 7326 N.A. Beans -Turkeys, Pigs - Honduras Improved Varieties Santa RitaSanta Rita municipality Copan department -6EA6601-5 Tanzania Uganda479 Lushoto Hoima15%N.A. Coffee, Cocoa, Maize, 7326 N.A. Beans-Turkeys, Pigs -          Uganda Hoima 8046 N.A. N.A. - - UgandaHoima8046N.A. N.A.--       SEA SEA Philippines Phlippines Guinayangan Guinayangan 1440 40 N.A. N.A. - - SEA SEAPhilippines PhlippinesGuinayangan Guinayangan1440 40N.A. N.A.-- South East Asia WA Mali Kenya Cinzana Nyando 258 258 N.A. - X South East AsiaWAMali KenyaCinzana Nyando258258 N.A.-X Country Philippines Intercrop (N fixing & Alleycropping (N fixing) non N fixing) CSV sites Guinayangan X - Closer admin unit Guinayangan municipality (Quezon province) 4 EA EA 4 Altitude (m.a.s.l) Kenya 10-180 Tanzania Farm size (Ha) 2.5 Tanzania Uganda Uganda Nyando Women Total HH headed HH 2162 Not available Lushoto Lushoto Hoima Hoima 9518 Crops Rice, Maize, Groundnut, N.A. Coconut 7326 N.A. N.A. 8046 N.A. N.A. -Animals Goat, Carabao, Chicken ---- Country Philippines Intercrop (N fixing & Alleycropping (N fixing) non N fixing)CSV sites GuinayanganX-Closer admin unit Guinayangan municipality (Quezon province) 4 EA EA 4Altitude (m.a.s.l) Kenya 10-180 Tanzania Farm size (Ha) 2.5 Tanzania Uganda UgandaNyando Women Total HH headed HH 2162 Not available Lushoto Lushoto Hoima Hoima9518 Crops Rice, Maize, Groundnut, N.A. Coconut 7326 N.A. N.A. 8046 N.A. N.A.-Animals Goat, Carabao, Chicken ----       SEA  Philippines Guinayangan 180 N.A. SEAPhilippinesGuinayangan180N.A.       SEA  Philippines Guinayangan 180 N.A. - SEAPhilippinesGuinayangan180N.A.-         Ethiopia Doyogena 59 140 X EthiopiaDoyogena59140X       EA  Tanzania Lushoto N.A. - EATanzaniaLushotoN.A.- Crop Rotation         Crop Rotation (mixed legume/   -  5   Uganda Hoima N.A. - (mixed legume/-5UgandaHoimaN.A.- non-legume)         non-legume)         Colombia Cauca 9 9 X ColombiaCauca99X       LAM   LAM         Guatemala Olopa 67 52 X GuatemalaOlopa6752X Improved Cookstoves  X  1 SEA  Philippines Guinayangan N.A. - Improved CookstovesX1SEAPhilippinesGuinayanganN.A.-  "},{"text":"Top 10 CSA Practices Implemented and/or Evaluated across the CCAFS AR4D Climate-Smart Villages in 2019 Top 10 CSA Practices Implemented and/or Evaluated across the CCAFS AR4D Climate-Smart Villages in 2019  42 CSA Practices with     42 CSA Practices with mitigation potential     mitigation potential Implemented and/or     Implemented and/or Evaluated across the CSVs    Evaluated across the CSVs   in 2019       in 2019 Top 10 CSA Practices CSA Practices with mitigation potential Mitigation potential # CSV sites # CSV sites Region SEA Region Country Country Philippines CSV site CSV site Guinayangan # HHs Implemented # HHs Implemented 1440 # HHs Evaluated* Evaluated* X Gender impacts Gender impacts assessed assessed - Top 10 CSA Practices CSA Practices with mitigation potential Mitigation potential# CSV sites # CSV sites Region SEA RegionCountry Country PhilippinesCSV site CSV site Guinayangan# HHs Implemented # HHs Implemented 1440# HHs Evaluated* Evaluated* XGender impacts Gender impacts assessed assessed - Agroforestry Fodders (added)  2          Agroforestry Fodders (added)2      WA Ethiopia Senegal Doyogena Kaffrine 15 140 X X X WAEthiopiaSenegalDoyogena Kaffrine15140XXX Agroforesty Fodders (substituted)  1 EA SEA  Philippines Guinayangan 1440  - - Agroforesty Fodders (substituted)1EASEAPhilippinesGuinayangan1440-- Improved breeds (small ruminants) X 3    Kenya Kenya Nyando Nyando 5677 4556 N.A. - - - Improved breeds (small ruminants)X3KenyaKenyaNyando Nyando5677 4556N.A.---      EA   Tanzania Lushoto 4982  - - EATanzaniaLushoto4982-- Alleycropping (N fixing)   4          Alleycropping (N fixing)4     SEA  Philippines Uganda Guinayangan Hoima 450 6255 N.A. - - - SEAPhilippines UgandaGuinayangan Hoima450 6255N.A.---      SEA   Philippines Guinayangan 180  - - SEAPhilippinesGuinayangan180--     SEA  Philippines Guinayangan 1440 N.A.  - SEAPhilippinesGuinayangan1440N.A.- Agroforestry Fodders Alleycropping (non N fixing) X 2 1  SEA   Philippines Guinayangan 360  - - Agroforestry Fodders Alleycropping (non N fixing)X21SEAPhilippinesGuinayangan360--     WA  Senegal  Kaffrine 23 23  X WASenegalKaffrine2323X Alleycropping (unspecified)   1  SEA   Philippines Guinayangan 360  - - Alleycropping (unspecified)1SEAPhilippinesGuinayangan360--     SEA  Philippines Guinayangan 1440 N.A.  - SEAPhilippinesGuinayangan1440N.A.- Alternate Wetting & Drying (AWD)  1  SEA   Philippines Guinayangan   - - Alternate Wetting & Drying (AWD)1SEAPhilippinesGuinayangan-- Farmer Managed Natural Regeneration Animal Manures (added) X 3 1  WA Ghana Ghana Lawra-Jirapa Lawra-Jirapa 92 N.A. X X X Farmer Managed Natural Regeneration Animal Manures (added)X31WAGhanaGhanaLawra-Jirapa Lawra-Jirapa92N.A.XXX     WA         WA Aquasilviculture   1  SEA Senegal Philippines Kaffrine Guinayangan 63 40 - X - Aquasilviculture1SEASenegalPhilippinesKaffrine Guinayangan6340-X-     SEA  Philippines Guinayangan 1440 N.A.  - SEAPhilippinesGuinayangan1440N.A.- Silvopasture X 2           SilvopastureX2  "},{"text":"Boundary Planting (living Fences or Hedgerows) 3  CSA Practices with mitigation potential # CSV sites Region Country CSV site # HHs Implemented Evaluated* Gender impacts assessed CSA Practices with mitigation potential# CSV sitesRegionCountryCSV site# HHs ImplementedEvaluated*Gender impacts assessed   EA Ethiopia Doyogena 108 X X EAEthiopiaDoyogena108XX Cut & Carry 2       Cut & Carry2   SEA Philippines Guinayangan 180 - - SEAPhilippinesGuinayangan180--   SEA Philippines Guinayangan 1440 - - SEAPhilippinesGuinayangan1440-- Farmer Managed Natural Regeneration 3  Ghana Lawra-Jirapa 92 - X Farmer Managed Natural Regeneration3GhanaLawra-Jirapa92-X   WA      WA    Senegal Kaffrine 63 X X SenegalKaffrine63XX Green Manure (N fixing In Space) 1 EA Ethiopia Doyogena 40 X X Green Manure (N fixing In Space)1EAEthiopiaDoyogena40XX Green Manure (N fixing In Time) 1 SEA Philippines Guinayangan 54 - - Green Manure (N fixing In Time)1SEAPhilippinesGuinayangan54-- Green Manure (non N fixing In Time) 1 SEA Philippines Guinayangan 54 - - Green Manure (non N fixing In Time)1SEAPhilippinesGuinayangan54-- Improved Cookstoves 1 SEA Philippines Guinayangan 7700 - - Improved Cookstoves1SEAPhilippinesGuinayangan7700--    Colombia Cauca  X X ColombiaCaucaXX   LAM      LAM    Guatemala Olopa  X X GuatemalaOlopaXX   SEA Philippines Guinayangan  - - SEAPhilippinesGuinayangan-- Compost 1 SEA Philippines Guinayangan 180 - - Compost1SEAPhilippinesGuinayangan180-- Controlled Grazing 1 EA Ethiopia Doyogena 109 X X Controlled Grazing1EAEthiopiaDoyogena109XX Crop Fodders (added) 1 SEA Philippines Guinayangan 1440 - - Crop Fodders (added)1SEAPhilippinesGuinayangan1440-- Crop Fodders (substituted) 1 SEA Philippines Guinayangan 1440 - - Crop Fodders (substituted)1SEAPhilippinesGuinayangan1440--   EA Ethiopia Doyogena  X X EAEthiopiaDoyogenaXX Crop Residue Incorporation (unspecified) 3 LAM Colombia Cauca  X X Crop Residue Incorporation (unspecified)3LAMColombiaCaucaXX   SEA Philippines Guinayangan 180 - - SEAPhilippinesGuinayangan180-- Crop Residue Unresolved (N fixing) 1 WA Ghana Lawra-Jirapa  X X Crop Residue Unresolved (N fixing)1WAGhanaLawra-JirapaXX *Evaluation through the CSA Monitoring Framework       *Evaluation through the CSA Monitoring Framework  "},{"text":"Improved breeds (small ruminants) 3     Ethiopia Doyogena 15 X X EthiopiaDoyogena15XX   EA      EA    Kenya Nyando 5677 - - KenyaNyando5677--   SEA Philippines Guinayangan 450 - - SEAPhilippinesGuinayangan450--   SEA Philippines Guinayangan 180 - - SEAPhilippinesGuinayangan180-- Intercrop (N fixing) 2       Intercrop (N fixing)2   WA Mali Cinzana 92 X X WAMaliCinzana92XX    Ghana Lawra-Jirapa 9 X X GhanaLawra-Jirapa9XX Manure 2 WA      Manure2WA    Senegal Kaffrine 69 X X SenegalKaffrine69XX Manure management (collection) 1 SEA Philippines Guinayangan 360 - - Manure management (collection)1SEAPhilippinesGuinayangan360-- Manure management (storage) 1 SEA Philippines Guinayangan 180 - - Manure management (storage)1SEAPhilippinesGuinayangan180-- Manure Treatment 1 SEA Philippines Guinayangan 180 - - Manure Treatment1SEAPhilippinesGuinayangan180--  "},{"text":"CSA Practices with mitigation potential Implemented and/or Evaluated across the CSVs in 2019  CSA Practices with mitigation potential # CSV sites Region Country CSV site # HHs Implemented Evaluated* Gender impacts assessed CSA Practices with mitigation potential# CSV sitesRegionCountryCSV site# HHs ImplementedEvaluated*Gender impacts assessed    Mali Cinzana 46 X X MaliCinzana46XX Micro dose of inorganic fertilizer 2 WA      Micro dose of inorganic fertilizer2WA    Senegal Kaffrine 25 X X SenegalKaffrine25XX Micro dose mix of inorganic fertilizer & organic matter 1 WA Senegal Kaffrine 44 X X Micro dose mix of inorganic fertilizer & organic matter1WASenegalKaffrine44XX   LAM Guatemala Olopa 20 X X LAMGuatemalaOlopa20XX Minimum conservation tillage 3 SEA Philippines Guinayangan 720 - - Minimum conservation tillage3SEAPhilippinesGuinayangan720--   WA Senegal Kaffrine 112 X X WASenegalKaffrine112XX Mix Organic & Inorganic fertilizers 1 WA Mali Cinzana 120 X X Mix Organic & Inorganic fertilizers1WAMaliCinzana120XX Mulch (other materials) 1 SEA Philippines Guinayangan 540 - - Mulch (other materials)1SEAPhilippinesGuinayangan540-- Mulch (unspecified plants) 1 SEA Philippines Guinayangan 360 - - Mulch (unspecified plants)1SEAPhilippinesGuinayangan360--   EA Ethiopia Doyogena N.A. X X EAEthiopiaDoyogenaN.A.XX Multistrata Agroforestry 3 LAM Honduras Santa Rita 67 X X Multistrata Agroforestry3LAMHondurasSanta Rita67XX   SEA Philippines Guinayangan 360 - - SEAPhilippinesGuinayangan360-- No or Zero Tillage 1 SEA Philippines Guinayangan 1080 - - No or Zero Tillage1SEAPhilippinesGuinayangan1080--    Colombia Cauca 28 X X ColombiaCauca28XX Organic Fertilizer 3 LAM Guatemala Olopa 125 X X Organic Fertilizer3LAMGuatemalaOlopa125XX    Honduras Santa Rita 116 X X HondurasSanta Rita116XX Reduced Water Use in Rice 1 SEA Philippines Guinayangan 40 - - Reduced Water Use in Rice1SEAPhilippinesGuinayangan40-- Rice Management (SRI) 1 SEA Philippines Guinayangan 60 - - Rice Management (SRI)1SEAPhilippinesGuinayangan60-- Scattered Trees 1 SEA Philippines Guinayangan 540 - - Scattered Trees1SEAPhilippinesGuinayangan540--  "},{"text":"CSA Practices with mitigation potential Implemented and/or Evaluated across the CSVs in 2019  CSA Practices with mitigation potential # CSV sites Region Country CSV site # HHs Implemented Evaluated* Gender impacts assessed CSA Practices with mitigation potential# CSV sitesRegionCountryCSV site# HHs ImplementedEvaluated*Gender impacts assessed   SEA Philippines Guinayangan 1440 - - SEAPhilippinesGuinayangan1440-- Silvopasture 2       Silvopasture2   WA Mali Cinzana 46 - - WAMaliCinzana46-- Terraces with boundary planting (living fences or hedgerows) 1 LAM Honduras Santa Rita 50 X X Terraces with boundary planting (living fences or hedgerows)1LAMHondurasSanta Rita50XX Tree Prunings Incorporated (unspecified) 1 SEA Philippines Guinayangan 720 - - Tree Prunings Incorporated (unspecified)1SEAPhilippinesGuinayangan720--  "},{"text":"CSA Practices with mitigation potential Implemented and/or Evaluated across the CSVs in 2019 CSA Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Agroforestry (1)        Agroforestry (1) CSA sub-practice CSA sub-practice Mitigation potential Mitigation potential # CSV sites # CSV sites Region Region Country Country CSV site CSV site Related crop/animal Related crop/animal # HHs Implemented # HHs Implemented Evaluated* Evaluated* CSA sub-practice CSA sub-practiceMitigation potential Mitigation potential# CSV sites # CSV sitesRegion RegionCountry CountryCSV site CSV siteRelated crop/animal Related crop/animal# HHs Implemented # HHs ImplementedEvaluated* Evaluated* Agroforestry Fodders (added) X 2 SEA WA SEA Philippines Senegal Philippines Guinayangan Kaffrine Guinayangan Small animals N.A. Fruits, nuts 1440 23 1440 -X - Agroforestry Fodders (added)X2SEA WA SEAPhilippines Senegal PhilippinesGuinayangan Kaffrine GuinayanganSmall animals N.A. Fruits, nuts1440 23 1440-X - Agroforestry         Agroforestry Fodders Farmer Managed (substituted) Natural X X 1 3 SEA Philippines Ghana Guinayangan Lawra-Jirapa Small animals N.A. 1440 92 -- Fodders Farmer Managed (substituted) NaturalX X1 3SEAPhilippines GhanaGuinayangan Lawra-JirapaSmall animals N.A.1440 92-- Regeneration     Nyando Casuarina, grevillea,beans,   RegenerationNyandoCasuarina, grevillea,beans,    WA Kenya  maize, sorghum, cowpea, 4556 - WAKenyamaize, sorghum, cowpea,4556-       sweet potato   sweet potato (N fixing) Alleycropping X 4 EA Tanzania Senegal Hoima Lushoto Kaffrine Casuarina, grevillea, fruit trees, beans , maize, potato Casuarina, grevillea, fruit N.A. 4982 40 -X (N fixing) AlleycroppingX4EATanzania SenegalHoima Lushoto KaffrineCasuarina, grevillea, fruit trees, beans , maize, potato Casuarina, grevillea, fruit N.A.4982 40-X    EA Uganda Ethiopia Doyogena trees, beans , maize, sweet potato Vegetables, enset 6255 100 -X EAUganda EthiopiaDoyogenatrees, beans , maize, sweet potato Vegetables, enset6255 100-X    SEA Philippines Guinayangan Fruits, nuts 180 - SEAPhilippinesGuinayanganFruits, nuts180- Alleycropping (non N fixing) Multistrata Agroforestry X X 1 3 SEA LAM Philippines Honduras Guinayangan Santa Rita Fruits, nuts Coffee, trees 360 67 -X Alleycropping (non N fixing) Multistrata AgroforestryX X1 3SEA LAMPhilippines HondurasGuinayangan Santa RitaFruits, nuts Coffee, trees360 67-X Alleycropping (unspecified) X 1 SEA SEA Philippines Philippines Guinayangan Guinayangan Fruits, nuts Fruits, cash crops 360 360 -- Alleycropping (unspecified)X1SEA SEAPhilippines PhilippinesGuinayangan GuinayanganFruits, nuts Fruits, cash crops360 360-- Aquasilviculture X 1 SEA Philippines Guinayangan Small animals 30 - AquasilvicultureX1SEAPhilippinesGuinayanganSmall animals30- Scattered Trees X 1 SEA Philippines Guinayangan Fruits, nuts 540 - Scattered TreesX1SEAPhilippinesGuinayanganFruits, nuts540-     Colombia Cauca Coffee 11 X ColombiaCaucaCoffee11X    LAM      LAM Boundary Planting   SEA Philippines Guinayangan Fruits, cash crops 1440 - Boundary PlantingSEAPhilippinesGuinayanganFruits, cash crops1440- (live fences or X 3  Guatemala Olopa Coffee 58 X (live fences orX3GuatemalaOlopaCoffee58X hedgerows) Silvopasture X 2       hedgerows) SilvopastureX2    SEA WA Philippines Mali Guinayangan Cinzana Fruits, cash crops Fodder species 90 46 -- SEA WAPhilippines MaliGuinayangan CinzanaFruits, cash crops Fodder species90 46-- Tree Prunings         Tree Prunings Applied - 1 SEA Philippines Guinayangan Fruits, cash crops 720 - Applied-1SEAPhilippinesGuinayanganFruits, cash crops720- (unspecified)         (unspecified) Tree Prunings         Tree Prunings Incorporated X 1 SEA Philippines Guinayangan Fruits, cash crops 720 - IncorporatedX1SEAPhilippinesGuinayanganFruits, cash crops720- (unspecified)         (unspecified)  "},{"text":"CSA Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Animals         Animals CSA sub-practice Mitigation potential # CSV sites Region Country CSV site Related crop/animal # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV siteRelated crop/animal# HHs ImplementedEvaluated* Animal manures (added) X 1 WA Ghana Lawra-Jirapa N.A. 11 - Animal manures (added)X1WAGhanaLawra-JirapaN.A.11- Crop Fodder (added) X 1 SEA Philippines Guinayangan Fodders, legumes, vegetables 1440 - Crop Fodder (added)X1SEAPhilippinesGuinayanganFodders, legumes, vegetables1440- Crop Fodders (substituted) X 1 SEA Philippines Guinayangan Fodders, legumes, vegetables 1440 - Crop Fodders (substituted)X1SEAPhilippinesGuinayanganFodders, legumes, vegetables1440-    EA Ethiopia Doyogena Desho grass  X EAEthiopiaDoyogenaDesho grassX Cut & Carry X 2       Cut & CarryX2    SEA Philippines Guinayangan Meat  - SEAPhilippinesGuinayanganMeat- Hybridization or Cross Breeding - 1 SEA Philippines Guinayangan Meat -small and large animals 1440 - Hybridization or Cross Breeding-1SEAPhilippinesGuinayanganMeat -small and large animals1440-     Ethiopia Doyogena Sheep 15 X EthiopiaDoyogenaSheep15X    EA      EA Improved breeds (small ruminants) X 3  Kenya Nyando Sheep, goat 5677 - Improved breeds (small ruminants)X3KenyaNyandoSheep, goat5677-    SEA Philippines Guinayangan Meat-small ruminants  - SEAPhilippinesGuinayanganMeat-small ruminants- Manure         Manure management X 1 SEA Philippines Guinayangan Small animals  - managementX1SEAPhilippinesGuinayanganSmall animals- (collection)         (collection) Manure         Manure management X 1 SEA Philippines Guinayangan Small animals  - managementX1SEAPhilippinesGuinayanganSmall animals- (storage)         (storage) Manure treatment X 1 SEA Philippines Guinayangan Vegetables  - Manure treatmentX1SEAPhilippinesGuinayanganVegetables- Non crop fodders (added) - 1 SEA Philippines Guinayangan Small animals 1440 - Non crop fodders (added)-1SEAPhilippinesGuinayanganSmall animals1440- Non crop fodders (substituted) - 1 SEA Philippines Guinayangan Small animals 1440 - Non crop fodders (substituted)-1SEAPhilippinesGuinayanganSmall animals1440-  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Crop Management (1)       Crop Management (1) CSA sub-practice Mitigation potential # CSV sites Region Country CSV site Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV siteRelated crop# HHs ImplementedEvaluated* Crop rotation (complex) - 1 SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - Crop rotation (complex)-1SEAPhilippinesGuinayanganLegumes, cereals, vegetables180-     Ethiopia Doyogena Wheat, beans, potato, barley 59 X EthiopiaDoyogenaWheat, beans, potato, barley59X    EA Tanzania Lushoto Beans, maize, cassava 7326 - EATanzaniaLushotoBeans, maize, cassava7326-     Uganda Hoima Maize, beans, finger millet 8046 - UgandaHoimaMaize, beans, finger millet8046- Crop rotation (mixed legume/ non-legume) - 5    Leafy greens (other), cauliflower, broccoli, carrot, parsnips,   Crop rotation (mixed legume/ non-legume)-5Leafy greens (other), cauliflower, broccoli, carrot, parsnips,     Colombia Cauca cucumbers, beetroot, 9 X ColombiaCaucacucumbers, beetroot,9X    LAM   celery, lettuce, scallion,   LAMcelery, lettuce, scallion,       green onion, spinach,   green onion, spinach,       tomato, beans   tomato, beans     Guatemala Olopa Beans, maize 67 X Guatemala OlopaBeans, maize67X       Cauliflower, broccoli,   Cauliflower, broccoli,       carrot, parsnip,   carrot, parsnip,     Guatemala Olopa cucumber, beetroot, celery, lettuce, scallion, 125 - Guatemala Olopacucumber, beetroot, celery, lettuce, scallion,125-   2 LAM   green onion, spinach,   2LAMgreen onion, spinach, Home gardens      tomato   Home gardenstomato (organic & -        (organic &- diversified)      Cauliflower, broccoli,   diversified)Cauliflower, broccoli,       carrot, parsnip,   carrot, parsnip,     Honduras Santa Rita cucumber, beetroot, celery, lettuce, scallion, 90 X HondurasSanta Ritacucumber, beetroot, celery, lettuce, scallion,90X       green onion, spinach,   green onion, spinach,       tomato   tomato Home gardens with         Home gardens with roof (organic & - 1 LAM Guatemala Olopa N.A. 9 X roof (organic &-1LAMGuatemala OlopaN.A.9X biodiversified)         biodiversified)       Leafy greens (other),   Leafy greens (other),       cauliflower, broccoli,   cauliflower, broccoli,       carrot, parsnip,   carrot, parsnip,    LAM Colombia Cauca cucumber, beetroot, 67 X LAMColombiaCaucacucumber, beetroot,67X       celery, lettuce, scallion,   celery, lettuce, scallion, Intercrop (complex) - 2    green onion, spinach,   Intercrop (complex)-2green onion, spinach,       tomato, beans   tomato, beans    SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - SEAPhilippinesGuinayanganLegumes, cereals, vegetables180-  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Crop Management (2)       Crop Management (2) CSA sub-practice Mitigation potential # CSV sites Region Country CSV site Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV siteRelated crop# HHs ImplementedEvaluated*     Kenya Nyando Sorghum, pigeon pea, beans, maize 9518 - KenyaNyandoSorghum, pigeon pea, beans, maize9518-    EA Tanzania Lushoto Beans, maize, cassava 7326 - EATanzaniaLushotoBeans, maize, cassava7326- Intercrop         Intercrop (N fixing & - 4       (N fixing &-4 non N fixing)         non N fixing)     Uganda Hoima Beans, maize 8046 - UgandaHoimaBeans, maize8046-    SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - SEAPhilippinesGuinayanganLegumes, cereals, vegetables180-    SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - SEAPhilippinesGuinayanganLegumes, cereals, vegetables180- Intercrop (N fixing) X 2       Intercrop (N fixing)X2    WA Mali Cinzana Millet, cowpea, sorghum 92 - WAMaliCinzanaMillet, cowpea, sorghum92- Intercrop (non N fixing) - 1 SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - Intercrop (non N fixing)-1SEAPhilippinesGuinayanganLegumes, cereals, vegetables180- Intercrop rotation (complex) - 1 SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - Intercrop rotation (complex)-1SEAPhilippinesGuinayanganLegumes, cereals, vegetables180- Partial intercrop (N fixing & non N fixing) - 1 SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - Partial intercrop (N fixing & non N fixing)-1SEAPhilippinesGuinayanganLegumes, cereals, vegetables180- Partial intercrop (non N fixing) - 1 SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - Partial intercrop (non N fixing)-1SEAPhilippinesGuinayanganLegumes, cereals, vegetables180-       Leafy greens (other),   Leafy greens (other), Resilient home      cauliflower, broccoli,   Resilient homecauliflower, broccoli, gardens      carrot, parsnip,   gardenscarrot, parsnip, (water harvesting - 1 LAM Colombia Cauca cucumber, beetroot, 6 X (water harvesting-1LAMColombiaCaucacucumber, beetroot,6X from roof and drip      celery, lettuce, scallion,   from roof and dripcelery, lettuce, scallion, irrigaiton)      green onion, spinach,   irrigaiton)green onion, spinach,       tomoato   tomoato  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Crop Management (3)       Crop Management (3) CSA sub-practice Mitigation potential # CSV sites Region Country CSV site Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV siteRelated crop# HHs ImplementedEvaluated* Rotation (N fixing) - 1 SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - Rotation (N fixing)-1SEAPhilippinesGuinayanganLegumes, cereals, vegetables180- Rotation (non N fixing) - 1 SEA Philippines Guinayangan Legumes, cereals, vegetables 180 - Rotation (non N fixing)-1SEAPhilippinesGuinayanganLegumes, cereals, vegetables180- Energy         Energy CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated* Improved Cookstoves X 1 SEA Philippines Guinayangan N.A. 7700 - Improved CookstovesX1SEAPhilippinesGuinayanganN.A.7700-  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Genetic Improvement (1)       Genetic Improvement (1) CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated*     Ethiopia Doyogena Wheat, bean, potato 161 X EthiopiaDoyogenaWheat, bean, potato161X     Kenya Nyando Sorghum, pigeon pea, beans, maize 9518 - KenyaNyandoSorghum, pigeon pea, beans, maize9518-    EA      EA     Tanzania Lushoto Cassava, potato, beans, maize 7326 - TanzaniaLushotoCassava, potato, beans, maize7326-       Maize, sorghum,   Maize, sorghum, Improved varieties - 6  Uganda Hoima finger millet, beans, cassava, sweet 8046 - Improved varieties-6UgandaHoimafinger millet, beans, cassava, sweet8046-       potato   potato    SEA Philippines Guinayangan Cereals, vegetables 1440 - SEAPhilippinesGuinayanganCereals, vegetables1440-       Maize, millet,   Maize, millet,       sorghum, cowpea,   sorghum, cowpea,    WA Mali Cinzana pepper, onion, tomato, amaranth, 258 - WAMaliCinzanapepper, onion, tomato, amaranth,258-       African eggplant,   African eggplant,       okra   okra Improved varieties:         Improved varieties: biofortified and - 1 LAM Colombia Cauca Beans 25 X biofortified and-1LAMColombiaCaucaBeans25X drought tolerant         drought tolerant Improved varieties:         Improved varieties: biofortified and - 1 LAM Honduras Santa Rita Beans 79 X biofortified and-1LAMHondurasSanta RitaBeans79X tolerant to pests         tolerant to pests Improved varieties: biofortified - 1 LAM Guatemala Olopa Beans 42 - Improved varieties: biofortified-1LAMGuatemalaOlopaBeans42-    SEA Philippines Guinayangan Cereal 630 - SEAPhilippinesGuinayanganCereal630- Improved varieties: drought tolerant - 2       Improved varieties: drought tolerant-2    WA Senegal Kaffrine N.A. 23 X WASenegalKaffrineN.A.23X Improved varieties: heat tolerant - 1 SEA Philippines Guinayangan Cereal 126 - Improved varieties: heat tolerant-1SEAPhilippinesGuinayanganCereal126-  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Genetic Improvement (2)       Genetic Improvement (2) CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated* Improved varieties: salinity tolerant - 1 SEA Philippines Guinayangan Cereals  - Improved varieties: salinity tolerant-1SEAPhilippinesGuinayanganCereals- Nutrient Management (1)      Nutrient Management (1) CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated* Compost X 1 SEA Philippines Guinayangan Vegetables 180 - CompostX1SEAPhilippinesGuinayangan Vegetables180- Crop residue         Crop residue incorporation X 1 LAM Colombia Cauca Coffee  X incorporationX1LAMColombiaCaucaCoffeeX (unspecified)         (unspecified) Crop residue unresolved (N fixing) X 1 WA Ghana Lawra-Jirapa N.A.  - Crop residue unresolved (N fixing)X1WAGhanaLawra-JirapaN.A.- Crop residue         Crop residue unresolved - 1 SEA Philippines Guinayangan Vegetables 180 - unresolved-1SEAPhilippinesGuinayangan Vegetables180- (non N fixing)         (non N fixing) Green manure (N fixing In Space) X 1 EA Ethiopia Doyogena Vetch, lupin  X Green manure (N fixing In Space)X1EAEthiopiaDoyogenaVetch, lupinX Green manure (N fixing In Time) X 1 SEA Philippines Guinayangan Vegetables  - Green manure (N fixing In Time)X1SEAPhilippinesGuinayangan Vegetables- Green manure (non N fixing In Time) X 1 SEA Philippines Guinayangan Vegetables  - Green manure (non N fixing In Time)X1SEAPhilippinesGuinayangan Vegetables- Inorganic fertilizer (urea) - 1 SEA Philippines Guinayangan Vegetables 180 - Inorganic fertilizer (urea)-1SEAPhilippinesGuinayangan Vegetables180- Inorganic K inputs - 1 SEA Philippines Guinayangan Vegetables 180 - Inorganic K inputs-1SEAPhilippinesGuinayangan Vegetables180- Inorganic N inputs - 1 SEA Philippines Guinayangan Vegetables 180 - Inorganic N inputs-1SEAPhilippinesGuinayangan Vegetables180- Inorganic P inputs - 1 SEA Philippines Guinayangan Vegetables 180 - Inorganic P inputs-1SEAPhilippinesGuinayangan Vegetables180-     Ghana Lawra-Jirapa N.A. 9 - GhanaLawra-JirapaN.A.9- Manure X 2 WA      ManureX2WA     Senegal Kaffrine N.A.  X SenegalKaffrineN.A.X Micro dose of inorganic fertilizer X 2 WA Mali Cinzana Millet, cowpea, sorghum  - Micro dose of inorganic fertilizerX2WAMaliCinzanaMillet, cowpea, sorghum-     Senegal Kaffrine N.A.  X SenegalKaffrineN.A.X  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Nutrient Management (2)      Nutrient Management (2) CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated* Minimum conservation tillage X 1 LAM Guatemala Olopa Beans, maize 20 X Minimum conservation tillageX1LAMGuatemalaOlopaBeans, maize20X       Pepper, onion,   Pepper, onion,     Mali Cinzana tomato, amaranth, African eggplant, 120 - MaliCinzanatomato, amaranth, African eggplant,120- Mix organic & inorganic fertilizers X 2 WA   okra, millet, maize   Mix organic & inorganic fertilizersX2WAokra, millet, maize     Senegal Kaffrine N.A. 44 X SenegalKaffrineN.A.44X       Coffee, sugar cane,   Coffee, sugar cane,       beans, plantains,   beans, plantains,       cooking bananas,   cooking bananas,       leafy greens (other),   leafy greens (other),       cauliflower, broccoli,   cauliflower, broccoli,     Colombia Cauca carrot, parsnip, 28 X ColombiaCaucacarrot, parsnip,28X       cucumber, beetroot,   cucumber, beetroot,       celery, lettuce,   celery, lettuce,       scallion, green   scallion, green       onion, spinach,   onion, spinach,       tomato   tomato       Coffee, beans,   Coffee, beans,       plantains, cooking   plantains, cooking       bananas, leafy   bananas, leafy       greens (other),   greens (other),       cauliflower, broccoli,   cauliflower, broccoli, Organic fertilizer X 3 LAM Guatemala Olopa carrot, parsnip, 125 X Organic fertilizerX3LAMGuatemalaOlopacarrot, parsnip,125X       cucumber, beetroot,   cucumber, beetroot,       celery, lettuce,   celery, lettuce,       scallion, green   scallion, green       onion, spinach,   onion, spinach,       tomato   tomato       Coffee, beans,   Coffee, beans,       plantains, cooking   plantains, cooking       bananas, leafy   bananas, leafy       greens (other),   greens (other),       cauliflower, broccoli,   cauliflower, broccoli,     Honduras Santa Rita carrot, parsnip, 116 X HondurasSanta Ritacarrot, parsnip,116X       cucumber, beetroot,   cucumber, beetroot,       celery, lettuce,   celery, lettuce,       scallion, green   scallion, green       onion, spinach,   onion, spinach,       tomato   tomato  "},{"text":"CSA Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Other         Other CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated* Enclosures - 1 EA Ethiopia Basona-Werana N.A. N.A. X Enclosures-1EAEthiopiaBasona-WeranaN.A.N.A.X Pasture Management       Pasture Management CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated* Controlled Grazing X 1 EA Ethiopia Doyogena Sheep, cattle, donkey 109 X Controlled GrazingX1EAEthiopiaDoyogenaSheep, cattle, donkey109X Post Harvest         Post Harvest CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated* Harvesting Timing - 1 WA Ghana Lawra-Jirapa N.A. N.A. - Harvesting Timing-1WAGhanaLawra-JirapaN.A.N.A.-  "},{"text":"CSA Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Soil Management        Soil Management CSA sub-practice Mitigation potential # CSV sites Region Country CSV sites Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV sitesRelated crop# HHs ImplementedEvaluated*    EA Ethiopia Doyogena Wheat, barley 60 X EAEthiopiaDoyogenaWheat, barley60X Crop residue         Crop residue incorporation X 2       incorporationX2 (unspecified)         (unspecified)    SEA Philippines Guinayangan Vegetables 180 - SEAPhilippinesGuinayanganVegetables180- Gully Rehabilitation - 1 EA Ethiopia Basona-Werana N.A. N.A. X Gully Rehabilitation-1EAEthiopiaBasona-WeranaN.A.N.A.X    SEA Philippines Guinayangan Fruits, nuts 720 - SEAPhilippinesGuinayanganFruits, nuts720- Minimum conservation tillage X 2       Minimum conservation tillageX2    WA Senegal Kaffrine N.A. 112 X WASenegalKaffrineN.A.112X Mulch (other materials) X 1 SEA Philippines Guinayangan Vegetables 540 - Mulch (other materials)X1SEAPhilippinesGuinayanganVegetables540- Mulch (plastics) - 1 SEA Philippines Guinayangan Vegetables 90 - Mulch (plastics)-1SEAPhilippinesGuinayanganVegetables90- Mulch (unspecified plants) X 1 SEA Philippines Guinayangan Vegetables, fruit trees 360 - Mulch (unspecified plants)X1SEAPhilippinesGuinayanganVegetables, fruit trees360- No or zero tillage X 1 SEA Philippines Guinayangan Fruits, nuts 1080 - No or zero tillageX1SEAPhilippinesGuinayanganFruits, nuts1080-  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Water Management (1)       Water Management (1) CSA sub-practice Mitigation potential # CSV sites Region Country CSV site Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV siteRelated crop# HHs ImplementedEvaluated* Alternate Wetting & Drying (AWD) X 1 SEA Philippines Guinayangan Cereal  - Alternate Wetting & Drying (AWD)X1SEAPhilippinesGuinayangan Cereal-     Guatemala Olopa N.A.  X GuatemalaOlopaN.A.X Aquaculture & irrigation reservoir - 2 LAM      Aquaculture & irrigation reservoir-2LAM     Honduras Santa Rita N.A.  X HondurasSanta RitaN.A.X Dam - 1 SEA Philippines Guinayangan Cereal  - Dam-1SEAPhilippinesGuinayangan Cereal- Irrigation (sprinkler) - 1 SEA Philippines Guinayangan Vegetables 360 - Irrigation (sprinkler)-1SEAPhilippinesGuinayangan Vegetables360- Percolation pits - 1 EA Ethiopia Basona-Werana N.A. N.A. X Percolation pits-1EAEthiopiaBasona-WeranaN.A.N.A.X Reduced water use in rice X 1 SEA Philippines Guinayangan Cereal  - Reduced water use in riceX1SEAPhilippinesGuinayangan Cereal- Rice management (SRI) X 1 SEA Philippines Guinayangan Cereal  - Rice management (SRI)X1SEAPhilippinesGuinayangan Cereal- Terraces with         Terraces with boundary planing (living fences or X 1 LAM Honduras Santa Rita Coffee, trees  X boundary planing (living fences orX1LAMHondurasSanta RitaCoffee, treesX hedgerows)         hedgerows) Water harvesting - 1 EA Kenya Nyando N.A. 1334 - Water harvesting-1EAKenyaNyandoN.A.1334- Water harvesting (check-dams) - 1 EA Ethiopia Basona-Werana N.A. N.A. X Water harvesting (check-dams)-1EAEthiopiaBasona-WeranaN.A.N.A.X       Beans, plantains,   Beans, plantains,       cooking bananas,   cooking bananas,       leafy greens (other),   leafy greens (other), Water harvesting (cisterns and tanks) - 1 LAM Colombia Cauca cauliflower, carrots, parsnips, cucumbers,  X Water harvesting (cisterns and tanks)-1LAMColombiaCaucacauliflower, carrots, parsnips, cucumbers,X       beetroot, celery, lettuce,   beetroot, celery, lettuce,       scallion, green onion,   scallion, green onion,       spinach, tomoato   spinach, tomoato Water harvesting (countour ridges) - 2 LAM WA Guatemala Mali Olopa Cinzana Coffee, plantains, cooking bananas Millet, cowpea, sorghum, maize 125 X - Water harvesting (countour ridges)-2LAM WAGuatemala MaliOlopa CinzanaCoffee, plantains, cooking bananas Millet, cowpea, sorghum, maize125X -  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019  Water Management (2)       Water Management (2) CSA sub-practice Mitigation potential # CSV sites Region Country CSV site Related crop # HHs Implemented Evaluated* CSA sub-practiceMitigation potential# CSV sitesRegionCountryCSV siteRelated crop# HHs ImplementedEvaluated*       Cauliflower, broccoli,   Cauliflower, broccoli,       carrot, parsnip,   carrot, parsnip,     Guatemala Olopa cucumber, beetroot, celery, lettuce, scallion, 125 X GuatemalaOlopacucumber, beetroot, celery, lettuce, scallion,125X       green onion, spinach,   green onion, spinach, Water harvesting (from roof) - 2 LAM   tomato Cauliflower, broccoli,   Water harvesting (from roof)-2LAMtomato Cauliflower, broccoli,       carrot, parsnip,   carrot, parsnip,     Honduras Santa Rita cucumber, beetroot, celery, lettuce, scallion, 62 X HondurasSanta Ritacucumber, beetroot, celery, lettuce, scallion,62X       green onion, spinach,   green onion, spinach,       tomato   tomato Water harvesting (microcatchment) - 1 SEA Philippines Guinayangan Fruits 360 - Water harvesting (microcatchment)-1SEAPhilippinesGuinayangan Fruits360-       Cauliflower, broccoli,   Cauliflower, broccoli,       carrot, parsnip,   carrot, parsnip,     Guatemala Olopa cucumber, beetroot, celery, lettuce, scallion, 20 X GuatemalaOlopacucumber, beetroot, celery, lettuce, scallion,20X       green onion, spinach,   green onion, spinach, Water harvesting (reservoirs) - 2 LAM   tomato Cauliflower, broccoli,   Water harvesting (reservoirs)-2LAMtomato Cauliflower, broccoli,       carrot, parsnip,   carrot, parsnip,     Honduras Santa Rita cucumber, beetroot, celery, lettuce, scallion, 48 X HondurasSanta Ritacucumber, beetroot, celery, lettuce, scallion,48X       green onion, spinach,   green onion, spinach,       tomato   tomato      Doyogena N.A. 107 X DoyogenaN.A.107X     Ethiopia Basona-Werana N.A. N.A. X EthiopiaBasona-WeranaN.A.N.A.X Water harvesting (terraces) - 6 EA Kenya Nyando N.A. 9518 - Water harvesting (terraces)-6EAKenyaNyandoN.A.9518-     Tanzania Lushoto N.A. 4982 - TanzaniaLushotoN.A.4982-     Uganda Hoima N.A. 4055 - UgandaHoimaN.A.4055-    SEA Philippines Guinayangan Cereal 40 - SEAPhilippinesGuinayangan Cereal40- Water harvesting (tied ridges) - 1 WA Ghana Lawra-Jirapa N.A. 10 - Water harvesting (tied ridges)-1WAGhanaLawra-JirapaN.A.10- Water harvesting (trenches) - 1 EA Ethiopia Basona-Werana N.A. N.A. X Water harvesting (trenches)-1EAEthiopiaBasona-WeranaN.A.N.A.X  "},{"text":"Practices Implemented and/or Evaluated across the CCAFS AR4D Climate- Smart Villages in 2019 CSA AgroMet Services Implemented and Evaluated in the AR4D Climate-Smart Villages in 2019       Available in    Available in Agro-Met service Region Country CSV sites Implemented by CCAFS the CSV (not related to # of HHs # of males involved # of females involved Agro-Met serviceRegionCountryCSV sitesImplemented by CCAFSthe CSV (not related to# of HHs# of males involved# of females involved      CCAFS)    CCAFS)  "}],"sieverID":"902f9d52-a028-4d97-80ec-f56c5bd03798","abstract":""}

data/part_5/0b7d5ea143121e14f8ea8037972f93b4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b7d5ea143121e14f8ea8037972f93b4","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8831de4b-4a3f-4e32-acbb-1f616aa23d32/retrieve"},"pageCount":41,"title":"Baseline evaluation of Akorion's EzyAgric innovation platform","keywords":[],"chapters":[{"head":"ABSTRACT","index":1,"paragraphs":[{"index":1,"size":508,"text":"Digital innovations, for instance, in extension, finance, and logistics can play an important role in agri-food systems. They can address bottlenecks in access to extension services, marketing systems, suitable financial products, reliable weather information, transport services and logistics as well as supply chain management. For the benefits of digital innovations to be realized, the innovations must be adopted at scale. The literature, however, shows that the reach of digital innovations is limited by challenges, such as lack of awareness of existing innovations and information asymmetries in different contexts. This was also evident from a recent scoping study that we conducted in Uganda. The scoping study was conducted under the CGIAR's initiative on Rethinking Food Markets and Value Chains for Inclusion and Sustainability. The initiative aims to transform value chains through policies that ensure creation of efficient, inclusive value chains with equitable income sharing, greater job creation and adoption of sustainable practices among small and medium enterprises and smallholder farmers, especially women and youth. The scoping study revealed that access to digital innovations is hampered by low awareness of existing innovations, limited digital literacy, and social norms and powerrelations in some segments of the population, such as the women and youth. Against this background, we designed an intervention including digital literacy training and awareness creation that we intend to implement through a randomized controlled trial (RCT) to address the information gap in the literature. The RCT will entail a treatment group which will receive digital literacy training coupled with some basic agronomic training. The control group will not receive training. To help us implement the intervention, we partnered with Akorion Limited (EzyAgric), a digital innovations company that promotes the use of bundled digital technologies in the agrifood sector in Uganda. The bundled services include farm management services, linking farmers with agro-input providers, credit access, extension services, and linking farmers to product markets. As a starting point to the planned intervention, we designed and implemented a baseline study. The baseline survey covered 536 households in five districts of central Uganda, with 282 households randomly assigned into the treatment group, and 254 households randomly assigned into the control group. Preliminary results from the baseline survey revealed that the means or averages of main indicators, such as inorganic fertilizer use, credit access, and welfare measures (e.g., revenue from crop harvest and non-farm business operations) do not differ significantly between famers in the treatment and control groups. Livestock revenues, consumption expenditure, household food insecurity experience scale and the value of assets were also found to be statistically insignificant between the two groups. This suggests that the randomization worked and provides a basis for simple comparison of mean outcomes in the followup survey. However, for some variables, such as the use of fungicides and total value of production, the differences between the treatment and control group were statistically significant. In such cases where the variables are unbalanced, analysis of covariance (ANCOVA) or regression analysis with the control variables, such as the difference-in-differences regression will be estimated to net out the effects of the intervention."}]},{"head":"INTRODUCTION","index":2,"paragraphs":[{"index":1,"size":133,"text":"Modern agricultural production systems and related value chains face many challenges ranging from pests and diseases, extension gaps, marketing and supply chain failures, input access among others (Ball & Quintart, 2023). These challenges are widely acknowledged drivers limiting attainment of globally set sustainable food production goals (McKenzie and Williams;Muhie, 2022). Due to the wide range of existing constraints, numerous ecosystem-services ranging from extension, disease identification and management, marketing and supply chains, input access among others, most of which are not readily available are required in order to enhance productivity and guarantee food security for the global population (Finger et al., 2023). The increasing integration between industry and agriculture under the fourth industrial revolution, however, appears promising with the emergence of digital technologies specially tailored to addressing the challenges within the current agri-food system."},{"index":2,"size":157,"text":"Digital technologies in agriculture basically revolve around artificial intelligence, automation, big data, and robotics which are connected to agricultural production systems through the Internet of things to help in making informed agricultural related decisions and operations (Lioutas et al., 2021;Abiri et al., 2023). A practical example is the wide use of robots to perform agricultural applications such as pruning, weeding, spraying, and monitoring light, temperature, humidity, and soil moisture within farmer's fields (Ane and Yasmin, 2019). This enables farmers to work more precisely as it helps guide resource and labor allocation thus improving production efficiency and overall farm productivity (Ball et al., 2015: Fu andZhang, 2022). Also, digital innovations (e.g., in extension, finance (digital payments, insurance), and logistics (transportation, warehousing, cold storage)) play a significant role in addressing bottlenecks associated with access to extension services, marketing systems, suitable financial products, reliable weather information, transport services and logistics as well as supply chain management (Ajambo et al., 2023)."},{"index":3,"size":126,"text":"Additionally, technological developments, such as mobile phones and the internet can substantially improve information flow, produce marketing, and reduce transaction costs along the value chains (Trienekens, 2011). Whereas commercial integrations like banks and mobile payments have great potential to increase financial inclusion and empower women and youth in agriculture. The use of digital tools reduces leakages in input distribution, enhances produce aggregation, transport coordination and delivery of products along the value chains, and facilitate contract farming to guarantee farmer incomes (Deichman et al., 2016). Overall, digital innovations can lead to greater incomes for smallholder farmers, improve agricultural value chains for the benefit of both large and small agribusinesses, expand the economic inclusion of youth and women, and build climate resilience (Tsan et al., 2019;World Bank, 2020)."},{"index":4,"size":73,"text":"With high investment costs associated with digital technologies, yet various services need to be accessed by farmers to improve production efficiency, digital tools that offer bundled services (more than one service) have been introduced to offer a more sustainable solution. However, adoption of such technologies has remained very low due to information asymmetries (Aker et al., 2016;Ajambo et al., 2023), justifying the need for conducting awareness and digital literacy trainings to enhance uptake."}]},{"head":"BACKGROUND & PROJECT DESCRIPTION","index":3,"paragraphs":[{"index":1,"size":87,"text":"In a bid to extend the revolutionization of the agriculture to Uganda, Akorion Limited introduced the EzyAgric platform that offers guidance and connects small and large-scale farmers to agricultural service providers, including agro-input dealers, soil laboratories, meteorology departments, produce markets and agricultural financing. It also acts as a knowledge hub providing crop-specific extension information and pest and disease diagnoses. The App offers a one-stop-shop for profiled/registered farmers, service providers and agribusinesses to meet and trade to deliver inclusive production, financial and marketing services at the farmer's doorstep."},{"index":2,"size":232,"text":"Three hundred thousand (300,000) farmers are currently registered on the App in Uganda, with only about 60,000 (20%) being regular users. The App bundles various services including 1. Farm Manager: which enables farmers to receive guidance on how to undertake farming activities with a cost benefit analysis and proper record management, registering the biodata and all the incomes and expenses as the season progresses; 2. Agri-shop: is an online trading place with registered genuine and credible major input suppliers. This service allows smallholders and commercial farmers, as well as the small-scale merchants to subscribe to the platform to digitally purchase genuine agricultural inputs such as seeds, fertilizers, agro-chemicals (pesticides and herbicides) and tools at an affordable price from certified bulk agro-input manufacturers. Also, it provides an end-to-end feedback loop and a traceability trail. 3. EzyCredits enables farmers to receive credits redeemable for purchase exclusively via the Agri-shop. EzyCredits are calculated based on information generated from a registered farmer's Farm Manager profile and prior activity on Agrishop as collateral; 4. The Agri-Extension service provides timely, on-demand information and training, tailored to specific agronomic needs; and 5. The Produce Market service enables farmers to be linked to aggregation centres established around off-takers and payments made directly to the farmer's mobile money in collaboration with mobile network operators such as MTN and Airtel money and credit deductions subsequently effected with clear traceability of the transactions."},{"index":3,"size":135,"text":"A model of working through a network of community-based service providers/village agents (VAs) equipped with smartphones is used to ensure that every farmer is served. The model leverages the agent distribution channels to emphasize last-mile delivery and support the usage and agronomy practices of these products. A toll-free call and SMS platform is available for the most-vulnerable farmers who do not have access to smartphones can access information on quality seeds, agro-inputs, extension services, credit, and markets. EzyAgric deals with over 30 perishable and non-perishable crop and livestock value chains including coffee, maize, tomatoes, chilli, bananas, cabbages, and livestock value chains including dairy, poultry, and piggery. The App is readily accessible in most districts in central Uganda; however, its active usage remains low despite a hefty investment amounting of USD 25 million for the innovation."},{"index":4,"size":92,"text":"The scoping study conducted in Uganda 2022 under the CGIAR Initiative on Rethinking Food Markets revealed that limited awareness of existing innovations, low digital literacy, and low responsiveness of the innovations to gender differences are behind the limited uptake and use of digital innovations. Thus, a recommendation was made to prioritize addressing the problem of low awareness of the innovative services and lack of information to support farmers in making a case for investing in digital services so that they can harness the full range of benefits that come with the innovation."}]},{"head":"CURRENT STATUS OF THE PROJECT","index":4,"paragraphs":[{"index":1,"size":276,"text":"After the scoping study, Akorion Company Limited (EzyAgric) embarked on onboarding new agroinput merchants for the pilot study under the Rethinking Food Markets and Value Chains for Inclusion and Sustainability Initiative of the CGIAR's. This was conducted from October 23-27, 2023, in central Uganda. The primary goal of this initiative was to onboard new agro-input merchants on the EzyAgric platform, train them on the EzyAgric App usage and introduce them to some basic agronomic training. Before the pilot intervention commences, the project team conducted a baseline study in 5 districts of the central region, with approximately 80 onboarded merchants, between November and December 2023 to generate data on the farmers served by each onboarded merchants. The five districts include Mubende and Kassanda (planned control districts) and Mityana, Nakaseke and Luwero (Planned treatment districts). A two-stage sampling procedure was employed to recruit farmers into the study. In the first stage, villages with the highest composition of EzyAgric onboarded merchants' input buyers were purposely selected. In the second stage, a list of farmers within the sampled villages was generated with the aid of the local council authorities. A random list of farmers within the sampled villages was generated with the aid of the local council authorities. A random sample of about seven households per village was drawn from the list. Five hundred thirty-six farming households were selected and interviewed during the baseline survey (252 from the two planned control districts and 284 from the three planned treatment districts). Figure 1 below shows the location of baseline study districts and the distribution of the sampled respondents (the black stars on the individual district maps) within the five surveyed districts."}]},{"head":"Figure 1: Map of Uganda showing baseline survey districts and location of sampled respondents","index":5,"paragraphs":[{"index":1,"size":172,"text":"Following the completion of the baseline data collection process, planned interventions that mainly involve digital literacy training and awareness creation centered around the EzyAgric's innovation are set to be introduced in the treatment districts. The training content and mode of delivery will be either in-person or digital. During the training, critical information related to the bundled services on the EzyAgric platforms, access to existing services and the use of the Apps/innovations' platforms, the potential benefits of using the innovations, and some basic/cross-cutting agricultural extension advice will be provided to farmers. After implementing the digital literacy and awareness-raising trainings on the selected innovation (EzyAgric), a follow up study will be conducted in late 2024 to understand the impact of the trainings on the uptake of the innovation, and on various outcomes (e.g., input use, access to credit, yield, income). The evaluation will be disaggregated by gender as the scoping review revealed that most of the innovations are not responsive to gender differences. The specific objectives that will guide this evaluation are listed below."},{"index":2,"size":19,"text":"To examine the effects of awareness creation/digital literacy training on the uptake/adoption of bundled digital innovations, differentiated by gender."},{"index":3,"size":20,"text":"To evaluate the impact of the innovation training on (input use/seed or fertilizer orders placed, access to credit, yield, income)."},{"index":4,"size":26,"text":"To assess the heterogeneous effects of innovation training on various outcomes (input use, access to credit, yield, income) by gender, age cohort, and other socioeconomic characteristics."}]},{"head":"STUDY DESIGN","index":6,"paragraphs":[{"index":1,"size":108,"text":"To evaluate the impacts of training on the uptake of the bundled innovations and input use (seed or fertilizer orders placed), access to credit, yield, and income, panel data which allow study households to be observed across time will be used in combination with panel data regression models in an RCT set-up. The difference-in-differences (DID) estimator will be used to account for potential unobserved time-invariant, and observed confounding factors (Greene, 2012). The DID will be applied in case perfect balance in the covariates is not achieved, otherwise ordinary least squares regressions will be used or a simple comparison of means. The DID estimator can be expressed as follows:"},{"index":2,"size":169,"text":"Where \uD835\uDC4C \uD835\uDC56\uD835\uDC61 is the outcome variable of interest e.g., adoption or uptake of bundled innovations, \uD835\uDEFD 0 denotes the constant, \uD835\uDEFD 1 captures the unobserved time effects, and \uD835\uDEFD 2 represents the unobserved effects among program beneficiaries (treatment group) relative to non-beneficiaries (control group) in absence of the program (treatment). The coefficient on the interaction term \uD835\uDEFD 3 is our parameter of interest or the DID estimator, which estimates the effects of the program or treatment. The DID estimator \uD835\uDEFD 3 relies on the parallel trend's assumption, which postulates that in the absence of the program, the difference between the program beneficiaries' group and the nonbeneficiary group is constant over time (Angrist & Pischke, 2008;Cameron & Trivedi, 2005). \uD835\uDF17 is the coefficient for the vector of control variables, \uD835\uDEFC is the coefficient for the vector of district dummy variables which will be interacted with time to control for possible unobserved time-varying district differences, and \uD835\uDF00 \uD835\uDC57\uD835\uDC61 is the error term. Subscripts \uD835\uDC57 and \uD835\uDC61denote group and time, respectively."},{"index":3,"size":173,"text":"The RCT will entail one treatment arm and a control group. EzyAgric mainly reaches its farmers through 1) smartphones where farmers with smartphones access all bundled services via their smart phones; 2) agro-input merchant where farmers who do not have smartphones access the bundled services via agro-input merchants with smartphones; or 3) a combination of both smartphones and agro-input merchants. Due to limited resources, our treatment or training will entail creation of awareness to farmers on how they can use a combination of smartphones and village agents to access easy agric's bundled services. Farmers in the treatment group will receive training on accessing EzyAgric's bundled services through smartphones and agro-input merchants. They will also receive some basic agronomic training. In contrast, those in the control group will not receive any training. The control group will not receive any training. After implementation of the treatment or RCT for two seasons (one year), we will evaluate the impact of the treatments on uptake of EzyAgric innovations and other outcomes in comparison with the control group."},{"index":4,"size":13,"text":"As mentioned, EzyAgric onboarded about 80 agro-input merchants located in around 80 villages."},{"index":5,"size":174,"text":"All 80 onboarded agro-input merchants were trained on by EzyAgric on the EzyAgric App usage and introduced to some basic agronomic training that they can assist farmers with incase they need assistance. About seven farmers located in each agrodealer's village were randomly selected for inclusion in the survey, making a total target sample of 560 farmers in around 80 villages located in five districts in central Uganda. The districts include Mubende and Kassanda (control districts) and Mityana, Nakaseke and Luwero (treatment districts). Half of the villages were randomly assigned into treatment arm (280 farmers), while the other half (280 farmers) was randomly assigned into the control group. Farmers in the treatment group will be trained on how to access EzyAgric's bundled services via both the agro-input merchants and the smartphone app. EzyAgric will design and implement the training. Farmers in the control group will not receive training. A total of 536 farming households were interviewed during the baseline survey (252 from the two planned control districts and 284 from the three planned treatment districts)."}]},{"head":"RESULTS OF THE BASELINE SURVEY","index":7,"paragraphs":[{"index":1,"size":110,"text":"One fundamental assumption underpinning the use of Randomized Controlled Trials (RCT) as an identification strategy is the absence of difference in both observed and unobserved attributes of subjects before administering the treatment (Glennerster & Takavarasha, 2013). We have conducted a baseline survey on a sample of villages across five districts in Uganda. In this report, we present the results of the survey. Firstly, we describe the socio-demographic characteristics of the surveyed population. Next, we present the baseline results of the agricultural production activities. We then present the results of non-farm income-generating activities. Finally, we discuss the results of welfare indicators, such as income, consumption expenditure, assets, and food security measures."}]},{"head":"Socio-demographic characteristics","index":8,"paragraphs":[{"index":1,"size":257,"text":"Table 1 presents the results of the socio-demographic attributes of the sampled farmers by full sample and treatment status. Women farmers constitute approximately 19% of the total sample. The average farmer is around 51 years old, has approximately eight years of formal education, and a household size of seven people. Disaggregated data shows significantly more women (22%) in the control group than men (16%) in the treatment group. Farmers in the treatment group are also older than farmers in the control group. On average, 69% of the sampled household members are members of associations. Being a member of these associations can facilitate the spread of information, promoting peer-to-peer learning and ultimately enhancing technology adoption (Abdul-Mumin and Abdulai 2022). On average, the distance to an extension agent's office is approximately 3.5 km. Treatment households are located 3.2 km away, while control households are located approximately 4 km away. There is a distance of 2.7 km between the respondents' residences and the agro-input dealers. The village market is typically located about 1.7 km away from the homestead of the sampled respondents. Overall, for most of the sociodemographic variables the differences are statistically insignificant suggesting that randomized worked well. Table 2 presents the households' housing characteristics by treatment status. Nearly all respondents own their homes. In terms of the materials for construction such as roof, floor and wall, the results showed that respondents are not significantly different, suggesting subjects in the two groups have similar housing characteristics. However, there exist statistically significant differences in the access to improved energy sources."},{"index":2,"size":19,"text":"Specifically, households in the control villages reported higher access to improved energy source (98%) compared to treatment households (94%)."}]},{"head":"Agricultural Production","index":9,"paragraphs":[{"index":1,"size":64,"text":"Agriculture is important for the economy of Uganda, as it is in many developing countries in sub-Saharan Africa. It is a major source of income for a large majority of the population. Land ownership plays a crucial role in farmers' investment decisions in agriculture and overall economic wellbeing. In this section, we will explore the various land tenure dynamics and plot-level characteristics in detail."}]},{"head":"Farmland Characteristics","index":10,"paragraphs":[{"index":1,"size":16,"text":"In this subsection, we present results of agricultural activity for food crop production, cash crops, overall."}]},{"head":"Food Crop cultivation","index":11,"paragraphs":[{"index":1,"size":188,"text":"Farmers in our sample are largely smallholders, with plot sizes of around 2 acres, as shown in  After the Mailo tenancy arrangement is the freehold tenancy, which makes up about 17% of land arrangements on all plots investigated. Unlike the Mailo the freehold arrangement has comparatively more rights, including that to sell. Under such arrangement, farmers are incentivized to increase investments in such plots, in theory. Results also show that only 8% of farmers perceive the soil on their plots to be fertile, and only 2% of all plots are cultivated under irrigation. This suggests that farmers are mainly dependent on rainfall. Comparison of the results by treatment status revealed that farmers in the control group cultivate significantly larger plots on average (2.5 acres) compared to those in the treatment group who only cultivate about 1.5 acres. Farmers in the treated group have about 8% of their plots under customary tenure arrangements compared to 3% for the control group. Similarly, while approximately 3% of the plots operated by farmers in the treatment category irrigate their plots, only about 1% of those in the control group irrigate their plots."}]},{"head":"Cash Crop Cultivation","index":12,"paragraphs":[{"index":1,"size":135,"text":"Table 4 displays the results of plot characteristics under cash crops. As per the table, on average, farmers cultivate 2 acres of land. However, the control group cultivates significantly larger plot sizes (2.4 acres) compared to the treated group, which cultivates 1.5 acres of land. The plots under cash crop cultivation have similar patterns to those under food crop production in terms of variables such as tenancy arrangements, plot fertility status, and irrigation. With the exception of the percentage of plots under irrigation, which does not show any statistical significance for plots under cash crop production, all other variables exhibit similar patterns to those under food crop cultivation. To explore the impact of gender on land tenure arrangements, we have plotted a graph of land tenure arrangements by household gender, as shown in Figure 2."}]},{"head":"Figure 2:Gendered distribution of Land tenure arrangements","index":13,"paragraphs":[{"index":1,"size":34,"text":"The results reveal that land tenure arrangements are quite similar for both men and women with the exception of plots under the freehold arrangements where men appear to have more plots compared to women."}]},{"head":"Input use","index":14,"paragraphs":[{"index":1,"size":69,"text":"In this subsection, we present results of the comparison of productivity-enhancing inputs such as fertilizers (both organic and inorganic), use of tractor/oxen services, pesticides, fungicides, and herbicides by treatment status. Table 5 shows that about 65% of the farm households apply chemical fertilizer. Although not statistically significant, more farmers in the control group (about 66%) applied inorganic fertilizer compared to about 64% of the farmers in the treatment group."},{"index":2,"size":98,"text":"Farm households use relatively less (58%) organic fertilizers compared to inorganic fertilizers (65%). Results of Table 5 also show that the treatment households are more likely to apply organic fertilizer (66%) compared to about 48% of the households in the control group. However, the treatment households were less likely to apply pesticides and herbicides on their plots compared to the control group. About 80% of the households in the treatment group apply pesticides compared to 82% in the control group, while 66% of the households in the treatment group applied herbicides compared to 83% in the control group."}]},{"head":"Production output and marketing","index":15,"paragraphs":[{"index":1,"size":151,"text":"Table 6 presents results of agricultural yield and sales by treatment status. Panel A of Table 6 presents results of the total values of production and yield for three important crops (coffee, maize and bananas). Results shows significantly higher values for farmers belonging to the control group compared to the treatment group. The differences in banana, coffee and maize yields per acre were statistically insignificant across the groups. Regarding the value of sales, results in Table 6 shows significant differences in the total value of sales, sales of coffee and maize per acre. Consistent with production results, control households have significantly higher values of sales compared to treatment households. The higher total sales values seem to be driven by their higher coffee sales compared to the treatment group. The treatment group recorded significantly higher values for maize sales compared to the control group, while for bananas the differences were statistically insignificant."}]},{"head":"Figure 3: Gendered distribution of use of harvest","index":16,"paragraphs":[{"index":1,"size":119,"text":"In Figure 3, we present the chart showing the percentage of harvest sold, consumed and used for other activities such as planting or as gifts. Regardless of the gender of the household head, farmers sell about 58% of their harvest. In terms of consumption, about 35% of the total harvest is used for household consumption. When the results are disaggregated by the gender of the household head, we find no significant differences. For example, while about 34.6% of the harvested products are consumed in a male-headed household, a similar (34.7%) is consumed in a female-headed household, suggesting gender parity. The results appear to show that farmers are quite market oriented. However, farmers also reported facing marketing challenges, which are"},{"index":2,"size":15,"text":"shown in Figure 4. The graph presents the extent of these challenges, disaggregated by gender."}]},{"head":"Figure 4:Ease of market access by gender of household head","index":17,"paragraphs":[{"index":1,"size":59,"text":"Generally, more than half of the farmers of both genders reported having it very easy marketing their produce. However, a small percentage (0.2%) of females reported difficulty marketing their produce. When implementing the project, this observation needs to be considered through a thorough investigation to identify the exact difficulties women farmers face to devise effective remedies to address them."}]},{"head":"Non-agricultural income generating activities","index":18,"paragraphs":[{"index":1,"size":162,"text":"The results shown in Figure 5 indicate that a greater number of men than women, across both treatment and control sites, are involved in non-farm business activities. It is clear from the data that individuals from the control sites, both men and women, were more actively engaged in nonfarm business operations than those from the treatment areas. When looking at the gross revenue values generated from non-farm businesses, as presented in Figure 6, it is observed that men and women from the treatment sites receive higher gross revenue from non-farm business activities compared to their counterparts in the control sites. Tables 7 and 8 present results of the balance test of gross revenue from non-farm busines operations, first by the treatment status in Table 7, and then by gender of household heard in Table 8. The tables also present results from the percentage of households engaged in wage employments and the annual wages they earn, also analyzed along the lines indicated above."},{"index":2,"size":56,"text":"The findings show that there are no significant differences in relation to the total revenues earned from non-farm business operated by men and women. However, farming households from the control sites earn higher gross revenues fron non-farm business operations compared to those in the control group.  Exchange rate in November 2023: USD 1 = UGX 3,785"}]},{"head":"Credit access and use","index":19,"paragraphs":[{"index":1,"size":34,"text":"Access to credit is one key variable that has an influence on technology and input use. Following the baseline study, we summarize key outcomes linked to credit access in Figure 7 and Table 9."},{"index":2,"size":28,"text":"The results in Figure 7 show that more women in the control group had relatively more access to credit (44%) compared to those in the treatment group (20%)."}]},{"head":"Figure 7:Access to credit by gender and treatment status","index":20,"paragraphs":[{"index":1,"size":35,"text":"Surprisingly, the results show the opposite when it came to access to credit by male headed households. About 39% of male headed households reported having access to credit compared to 34% in the control group."},{"index":2,"size":289,"text":"The Balance test presented in Table 9 Shows no significant difference in credit access among farming households in control and treatment groups. Results on sources of credit and their proportions by treatment status are presented in Table 9A in the appendix. Tables (10 and 11) present a statistical test that compares the means of key variables to investigate how familiar and how frequently farmers use the digital EzyAgric application before interventions. The baseline results indicate that farming households have low awareness of the technology, as only about seven percent of them reported having any knowledge about it. Even in the villages that would receive treatment, only nine percent of the households in treatment sites reported being aware of it. This figure was not statistically different from the reported six percent by households in control sites. Additionally, the results show that app usage is also quite low as only about 8 percent who responded in the affirmative to the question of whether they were aware of the App. Regarding the source of information about the EzyAgric App, results show that agents from the company and radio programs are the primary source of information for the groups treated by the EzyAgric app. Meanwhile, fellow farmers or neighbors and extension agents are the dominant sources of information among the potential control group. If extension agents in the control villages become aware of the treatment, it may lead to contamination. Therefore, mechanisms for managing spill-over effects must be considered. The results in Table 11 show that there is no significant difference in the source of information between the potential treatment and control groups, suggesting that the information is not affected by whether one is in the treatment or control arm of the experiment. "}]},{"head":"Welfare measures","index":21,"paragraphs":[{"index":1,"size":35,"text":"This section presents results of key baseline welfare indicators drafted by treatment and control group status. Results linked to consumption are presented in subsection 5.4.1, while those linked to assets are presented in subsection 5.4.2."}]},{"head":"Consumption","index":22,"paragraphs":[{"index":1,"size":336,"text":"Results of the food insecurity experience scale indicators presented in Table 12 show no differences between the control and treatment groups with respect to the indicators assessed. Summarily, it can be revealed from the results that at least 60% of the households were unable to eat the kinds of foods they preferred. About two percent of the respondents originated from households that had at least gone hungry at night in the past one month, with a further 4% faced with a situation where they had to go day and night without food. Livestock ownership status and breakdown on the receipt of income from livestock and its related products are presented in Table 13. The results show that 84% of the sampled households owned livestock within the last 12 months, though no statistical differences was recorded for the treatment and control groups. The average tropical livestock unit owned by a household is about 4. A bigger proportion (23%) of farming households from the treatment group received income from animal products compared to those in the control group (15%). Nonetheless no differences are observed in the overall revenues generated from livestock for households from both groups. The well-being indicators presented in Table 14 reveal significant differences in the annual household income between the control and treatment groups. However, these differences are not observed in the income per capita per annum values of both groups which provides for a better comparison of the households. The results of household consumption did not reveal any significant differences across treatment and control groups. Additionally, households in the treatment group have higher asset index scores than those in the control group. No differences were found among the two groups for households that do not earn any income. The results of the balance test on food and non-food expenditure by treatment status are presented in Table 15. The results, overall, reveal no statistically significant differences for farming households in control and treatment groups, regardless of whether food and non-food expenditures are per capita computed. "}]},{"head":"Assets","index":23,"paragraphs":[{"index":1,"size":95,"text":"The results on value of asset by age category presented in Figure 8 shows that farmers from the treatment group who fell within the age category below 35 years of age held more assets compared to their counterparts in the control group. Within the age category ranging 36 to 60 years, the value of assets owned by farmers in both the treatment and control groups is similar. Above the 60 years cutoff, farmers in the treatment group however exhibited an edge over their counterparts in the control group in terms of value of assets owned. "}]},{"head":"SUMMARY AND CONCLUSION","index":24,"paragraphs":[{"index":1,"size":76,"text":"Agriculture stands to benefit greatly from the use of digital innovations that can enhance productivity and efficiency. Despite the significant investment in the EzyAgric app by Akorion Limited, its uptake is still far below its potential, mainly due to a lack of awareness and information asymmetry among communities. To address this, a randomized controlled treatment study is being planned, which will involve digital literacy training and awareness campaigns to increase awareness and uptake of the app."},{"index":2,"size":88,"text":"As part of the preparations for the study, a baseline study was conducted with 536 farmers living near EzyAgric merchants to assess key indicators for the potential treatment and control groups targeted for the interventions. The results showed that there were no significant differences between the treatment and control group farmers for most outcomes, including household characteristics and welfare measures. This is a crucial finding that ensures the effective implementation of the treatment, as any difference in outcomes after the intervention can be attributed to the intervention itself."},{"index":3,"size":125,"text":"The results of the baseline study can be used to structure the randomization process for the RCT, with clustering effects taken into consideration before deciding to adopt or drop indicators measured at baseline. However, spill-over effects and contamination must be addressed by considering mechanisms to prevent them. Overall, the planned intervention through an RCT can proceed, and the results can be used to increase the uptake of EzyAgric and other digital innovations in agriculture to enhance productivity and efficiency.       i Improved roof is one with iron sheet. House roofs made of thatch, bamboo etc. are described as unimproved ii Walls made of bricks or cement are grouped under the improved wall materials, while those made of iron sheet, wood, mud are in the unimproved category"}]},{"head":"ABOUT THE AUTHORS","index":25,"paragraphs":[{"index":1,"size":106,"text":"iii Takes a value 1 if floor is made of cement, 0 otherwise iv Drinking water sourced from protected borehole (private or public), piped water (in and outside compound) are grouped under the improved drinking water source. The remaining sources are grouped under the unimproved sources v Electricity and solar are described as improved source of light while generator, wood fuel etc. are considered to be unimproved. vi Flush toilet facilities are considered under the improved category while pit latrine and using the bush are considered unimproved vii The use of charcoal and fuel wood are considered traditional cooking fuel, all others are categorized under non-traditional"}]}],"figures":[{"text":"Table 1 :FIGURESFigure 1 : FIGURESFigure 1: Map of Uganda showing baseline survey districts and location of sampled respondents .............................................................................................................................................................. "},{"text":"Figure 2 : Figure 2:Gendered distribution of Land tenure arrangements ....................................................... "},{"text":"Figure 3 : Figure 3: Gendered distribution of use of harvest .......................................................................... "},{"text":"Figure 4 : Figure 4:Ease of market access by gender of household head ..................................................... "},{"text":"Figure 5 : Figure 5:Non-Farm Business Operation .......................................................................................... "},{"text":"Figure 6 : Figure 6:Gross revenue (UGX) by gender and treatment status .................................................... "},{"text":"Figure 7 : Figure 7:Access to credit by gender and treatment status ............................................................. "},{"text":"Figure 8 : Figure 8:Age distribution value of assets (UGX) ............................................................................. "},{"text":"FigureFigure 6 : Figure 5:Non-Farm Business Operation "},{"text":"Figure 8 : Figure 8:Age distribution value of assets (UGX) "},{"text":"Fig: Fig: Decision maker on the use of sale revenue by treatment status "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 :Demographic characteristics of household head : This table presents results of a balanced test on a set of socio-demographic covariates. Values in parentheses are standard errors. *, ** and *** respectively denote significance at 10, 5 and 1% respectively. Variable Pooled Control Treated Mean diff. Obs VariablePooledControl TreatedMean diff.Obs  Sample    Sample Female head (dummy) 0.191 0.158 0.221 0.063** Female head (dummy)0.1910.1580.2210.063**  (0.393) (0.022) (0 .024) (1.163) (0.393)(0.022)(0 .024)(1.163) Age of household head (years) 51.414 50.087 52.623 2.535** Age of household head (years)51.41450.08752.6232.535**  (13.701) (0.831) (0.812) (1.163) (13.701)(0.831)(0.812)(1.163) Education (years) 7.669 7.468 7.854 0.3867 Education (years)7.6697.4687.8540.3867  (4.038) (0.161) (0.151) (0.343) (4.038)(0.161)(0.151)(0.343) Household size (count) 6.590 6.603 6.577 0.0259 Household size (count)6.5906.6036.5770.0259  (2.603) (0.161) (0.151) (0.221) (2.603)(0.161)(0.151)(0.221) Married head (dummy) 0.794 0.848 0.744 0.104*** Married head (dummy)0.7940.8480.7440.104***  (0.017) (0.022) (0.026) (0.035) (0.017)(0.022)(0.026)(0.035) Head is group member (dummy) 0.679 0.692 0.667 0.026 Head is group member (dummy)0.6790.6920.6670.026  (0.020) (0.029) (0.028) (0.040) (0.020)(0.029)(0.028)(0.040) Farm size (acres) 1 7.614 10.482 5.031 5.451 Farm size (acres) 17.61410.4825.0315.451  (0.490) (0.908) (0.387) (0.953) (0.490)(0.908)(0.387)(0.953) Distance to extension agent (km) 3.554 3.993 3.159 0.833 Distance to extension agent (km)3.5543.9933.1590.833  (0.355) (0.281) (0.626) (0.712) (0.355)(0.281)(0.626)(0.712) Distance to agro-dealer (km) 2.673 2.149 3.255 1.106 Distance to agro-dealer (km)2.6732.1493.2551.106  (0.209) (0.195) (0.383)  (0.209)(0.195)(0.383) Distance to village market (km) 1.741 1.936 1.566 0.370 Distance to village market (km)1.7411.9361.5660.370  (0.105) (0.155) (0.141) (0.209) (0.105)(0.155)(0.141)(0.209)  "},{"text":"Table 2 : Household housing characteristics by treatment status  Variable Pooled Sample (254) Con-trol (282) Treated diff Mean Obs VariablePooled Sample(254) Con-trol(282) Treateddiff MeanObs Home ownership (%) 96.2 97.6 95.0 2.6 536 Home ownership (%)96.297.695.02.6536 Improved roof material i (%) 99.6 99.6 99.6 0.0 536 Improved roof material i (%)99.699.699.60.0536 Improved wall material ii (%) 88.1 85.4 90.4 4.9 536 Improved wall material ii (%)88.185.490.44.9536 Improved floor material iii (%) 73.9 71.2 76.2 5.0 536 Improved floor material iii (%)73.971.276.25.0536 Access to safe drinking water iv (%) 53.2 51.9 54.3 2.3 536 Access to safe drinking water iv (%)53.251.954.32.3536 Access to improved source of energy v (%) 95.5 97.6 93.6 4.0*** 536 Access to improved source of energy v (%)95.597.693.64.0***536 Access to improved toilet vi (%) 1.3 1.2 1.4 0.2 536 Access to improved toilet vi (%)1.31.21.40.2536 Traditional cooking fuel use vii (%) 99.6 100.0 99.3 0.7 536 Traditional cooking fuel use vii (%)99.6100.0 99.30.7536 Observations 536 254 282   Observations536254282 Note: Values in parentheses are standard errors. *, ** and *** denote significance at 10, 5 and 1% respectively  Note: Values in parentheses are standard errors. *, ** and *** denote significance at 10, 5 and 1% respectively  "},{"text":"Table 3   "},{"text":"Table 3 : Farmland characteristics for food crops cultivation (plot level) This table presents results of a balanced test on a set of farm-level covariates for food crops. Values in parentheses are standard errors. *, ** and *** respectively denote significance at 10, 5 and 1% respectively. Variable Pooled Sam- Control Treated Mean Observa- VariablePooled Sam-ControlTreatedMeanObserva-  ple   Diff. tions (N) pleDiff.tions (N) Plot size (acre) 2.126 2.534 1.549 0.987 *** 1,039 Plot size (acre) 2.1262.5341.5490.987 ***1,039  (0.131) (0.201) (0.092) (0.265)  (0.131)(0.201)(0.092)(0.265) Freehold ten- 0.167 0.166 0.166 0.000 1,039 Freehold ten-0.1670.1660.1660.0001,039 ure      ure (Yes/No) (0 .373) (0.015) (0.018) (0.023)  (Yes/No)(0 .373)(0.015)(0.018)(0.023) \"Mailo\" tenure 0.722 0.736 0.709 0.039 1,039 \"Mailo\" tenure0.7220.7360.7090.0391,039 (Yes/No) (0.447) (0.018) (0.022) (0.034)  (Yes/No)(0.447)(0.018)(0.022)(0.034) Customary 0.055 0.029 0.087 0.058 *** 1,039 Customary0.0550.0290.0870.058 ***1,039 Ten- (0.228) (0.007) (0.013) (0.014)  Ten-(0.228)(0.007)(0.013)(0.014) ure(Yes/No)      ure(Yes/No)  "},{"text":"Table 4 : Farm land characteristics for cash crops (plot level)  Variable  Pooled Control Treated Mean Observa- VariablePooledControlTreatedMeanObserva-   Sample   Diff. tions (N) SampleDiff.tions (N) Plot size 2.064 2.441 1.549 0.891 *** 1,011 Plotsize2.0642.4411.5490.891 ***1,011 (acre)  (0.123) (0.201) (0.092) (0.248)  (acre)(0.123)(0.201)(0.092)(0.248)   1,011 584 427   1,011584427 Freehold ten- 0.166 0.166 0.166 0.000 1,011 Freehold ten-0.1660.1660.1660.0001,011 ure (Yes/No) (0.012) (0.015) (0.018) (0.023)  ure (Yes/No)(0.012)(0.015)(0.018)(0.023)  "},{"text":"Table 5 : Input use at household level by treatment status (household level)  Variable Pooled Sam- Control Treated Mean Observa- VariablePooled Sam-ControlTreatedMeanObserva-  ple   Diff. tions (N) pleDiff.tions (N) Improved seed 0.854 0.854 0.855 0.001 536 Improved seed0.8540.8540.8550.001536 used (dummy) (0.012) (0.017) (0.016) (0.023)  used (dummy)(0.012)(0.017)(0.016)(0.023) Inorganic Fert. 0.649 0.661 0.638 0.023 536 Inorganic Fert.0.6490.6610.6380.023536 (Yes/No) (0.020) (0.029) (0.028) (0.041)  (Yes/No)(0.020)(0.029)(0.028)(0.041) Organic Manure 0.580 0.484 0.666 0.182 *** 536 Organic Manure 0.5800.4840.6660.182 ***536 (Yes/No) (0.021) (0.031) (0.028) (0.042)  (Yes/No)(0.021)(0.031)(0.028)(0.042) Pesticides 0.813 0.822 0.804 0.017 *** 536 Pesticides0.8130.8220.8040.017 ***536 (Yes/No) (0.016) (0.024) (0.023) (0.033)  (Yes/No)(0.016)(0.024)(0.023)(0.033) Fungicides 0.121 0 .133 0.109 0.023 536 Fungicides0.1210 .1330.1090.023536 (Yes/No) (0.014) (0.021) (0.018) (0.028)  (Yes/No)(0.014)(0.021)(0.018)(0.028) Herbicides 0.740 0.826 0.663 0.163 *** 536 Herbicides0.7400.8260.6630.163 ***536 (Yes/No) (0.018) (0.023) (0.028) (0.037)  (Yes/No)(0.018)(0.023)(0.028)(0.037) Tractor/Oxen 0.004 0.035 0.046 0.010 536 Tractor/Oxen0.0040.0350.0460.010536 (Yes/No) (0.002) (0.011) (0.012) (0.017)  (Yes/No)(0.002)(0.011)(0.012)(0.017) Observation 536 254 282   Observation536254282 Note: This table presents results of a balanced test on a set of input use covariates. Values in parentheses are standard errors. *, ** Note: This table presents results of a balanced test on a set of input use covariates. Values in parentheses are standard errors. *, ** and *** respectively denote significance at 10%, 5% and 1%.    and *** respectively denote significance at 10%, 5% and 1%.  "},{"text":"Table 6 :Agricultural yield and sales by treatment   Pooled sample Control Treated Mean dif-ference N Pooled sampleControlTreatedMean dif-ferenceN Panel A: Produced output      Panel A: Produced output Household-level      Household-level Value of total production 944.487 1019.897 874.664 145.232 * 520 Value of total production944.4871019.897874.664145.232 *520 ('0,000 UGX) (41.680) (59.020) (58.5843) (83.259)  ('0,000 UGX)(41.680)(59.020)(58.5843)(83.259) Obs 520 250 270   Obs520250270 Maize yield (kg/acre) 583.269 485.395 682.817 197.421 ** 236 Maize yield (kg/acre)583.269485.395682.817197.421 **236  (45.511) (57.878) (69.489) (90.303)  (45.511)(57.878)(69.489)(90.303) Obs 236 119 117   Obs236119117 Coffee yield (kg/acre) 916.2265 1090.785 724.910 365.874 262 Coffee yield (kg/acre)916.22651090.785724.910365.874262  (123.799) (195.012) (146.068) (247.294)  (123.799)(195.012)(146.068)(247.294) Obs 262 137 125   Obs262137125 Banana yield (bunches/acre) 383.262 423.556 343.481 80.075 312 Banana yield (bunches/acre) 383.262423.556343.48180.075312  (55.448) (94.992) (58.014) (110.984)  (55.448)(94.992)(58.014)(110.984) Obs 312 155 157   Obs312155157 Panel B: Sold output      Panel B: Sold output Household-level      Household-level Value of total sales 719.258 821.871 626.504 195.367 *** 535 Value of total sales719.258821.871626.504195.367 ***535 ('0,000 UGX) (30.782) (45.929) (40.657) (61.118)  ('0,000 UGX)(30.782)(45.929)(40.657)(61.118) Obs 535 254 281   Obs535254281  "},{"text":"Table 7 :Revenue from non-farm business by treatment status  Variable Pooled Control Treatment Mean Obs VariablePooledControlTreatmentMeanObs  Sample   Diff.  SampleDiff. Gross revenue 371.630 468.920 282.507 186.413 ** 525 Gross revenue371.630468.920282.507186.413 **525 (10,000 UGX) (45.018) (76.361) (50.0102) (89.840)  (10,000 UGX)(45.018)(76.361)(50.0102)(89.840) Obs 525 251 274   Obs525251274 Wage empl. 6.3 5.9 6.7 0.8 536 Wage empl.6.35.96.70.8536 (%)      (%) Obs 536 254 282   Obs536254282 Annual wages 8.248 7.316 9.088 1.772 536 Annual wages8.2487.3169.0881.772536 (if Yes) (1.982) (2.394) (3.092) (3.972)  (if Yes)(1.982)(2.394)(3.092)(3.972) (10,000 UGX)      (10,000 UGX) Obs 536 254 282   Obs536254282  "},{"text":"Table 8 :Revenue from non-farm business by gender  Variable Pooled Sam- Female Male Mean Obs VariablePooled Sam-FemaleMaleMeanObs  ple   Diff.  pleDiff. Gross revenue 371.630 303.946 386.392 82.445 525 Gross revenue371.630303.946386.39282.445525 (10,000 UGX) (45.018) (125.027) (699003) (117.477)  (10,000 UGX)(45.018)(125.027)(699003)(117.477)  525 94 431   52594431  "},{"text":"Table 9 :Balance test on access to credit  Variable Pooled Sam- Control Treated Mean N VariablePooled Sam-ControlTreatedMeanN  ple   Diff.  pleDiff. Credit access 0.815 0.840 0.791 0.048 525 Credit access0.8150.8400.7910.048525  (0 .029) (0.044) (0.040) (0.059)  (0 .029)(0.044)(0.040)(0.059) Obs 525 251 274   Obs525251274  "},{"text":"Table 10 :Awareness and Use of EzyAgric Application  Variable  Pooled Control Treated Abs. Mean Diff N VariablePooledControlTreatedAbs. Mean DiffN   Sam-     Sam-   ple     ple Heard  0.074 0.055 0.092 0.037 536 Heard0.0740.0550.0920.037536 EzyAgric  (0.011) (0.014) (0.017) (0.022)  EzyAgric(0.011) (0.014)(0.017)(0.022) (Yes/No)       (Yes/No) Obs  536 254 282   Obs536254282 Use EzyAgric App 0.075 0.143 0.038 0.104 40 Use EzyAgric App0.0750.1430.0380.10440 (Yes)       (Yes)   (0.042) (0.097) (0.038) (0.087)  (0.042) (0.097)(0.038)(0.087) Obs  40 14 26   Obs401426 Duration of 7 6.5 8 1.5 3 Durationof76.581.53 EzyAgric       EzyAgric Use (month)       Use (month) Obs  3 2 1 3  Obs3213  "},{"text":"Table 11 :Information source by treatment status  Info_Source Treatment Status  Info_SourceTreatment Status  Treated Control Total TreatedControlTotal Extension staff 1 4 5 Extension staff145  (20.00%) (80.00%) (100.00%) (20.00%)(80.00%)(100.00%)  [3.85%] [28.57%] [12.50%] [3.85%][28.57%][12.50%] EzyAgric staff/agent 3 1 4 EzyAgric staff/agent314  (75.00%) (25.00%) (100.00%) (75.00%)(25.00%)(100.00%)  [11.54%] [7.14%] [10.00%] [11.54%][7.14%][10.00%] Farmer group 2 1 3 Farmer group213  (66.67%) (33.33%) (100.00%) (66.67%)(33.33%)(100.00%)  [7.69%] [7.14%] [7.50%] [7.69%][7.14%][7.50%] Fellow farmer (neighbor/relative) 7 4 11 Fellow farmer (neighbor/relative)7411  (63.64%) (36.36%) (100.00%) (63.64%)(36.36%)(100.00%)  [26.92%] [28.57%] [27.50%] [26.92%][28.57%][27.50%] Other 5 2 7 Other527  (71.43%) (28.57%) (100.00%) (71.43%)(28.57%)(100.00%)  [19.23%] [14.29%] [17.50%] [19.23%][14.29%][17.50%] Radio programme 8 2 10 Radio programme8210  (80.00%) (20.00%) (100.00%) (80.00%)(20.00%)(100.00%)  [30.77%] [14.29%] [25.00%] [30.77%][14.29%][25.00%] Total 26 14 40 Total261440  (65.00%) (35.00%) [100.00%] (65.00%)(35.00%)[100.00%]  [100.00%] [100.00%] [100.00%] [100.00%][100.00%][100.00%] Pearson Chi2 = 5.76 Prob = 0.3308    Pearson Chi2 = 5.76 Prob = 0.3308  "},{"text":"Table 12 :Household Food Security by treatment status  Food insecurity experience scale Pooled Treat- Control Mean dif- Obs (N) Food insecurity experience scalePooledTreat-Control Mean dif-Obs (N) (FIES) indicators Sam- ment  ference  (FIES) indicatorsSam-mentference  ple     ple Worried that your household would not 17.54 17.00 18.02 1.02 536 Worried that your household would not17.5417.0018.021.02536 have enough food -WORRIED (%)      have enough food -WORRIED (%) Not able to eat the kinds of foods you 59.70 60.47 59.01 1.47 536 Not able to eat the kinds of foods you59.7060.4759.011.47536 preferred -UNHEALTHY (%)      preferred -UNHEALTHY (%) Ate a limited variety of foods -FEW 43.28 43.87 42.76 1.11 536 Ate a limited variety of foods -FEW43.2843.8742.761.11536 FOODS (%)      FOODS (%) Ate a smaller meal than you felt you 14.37 14.23 14.49 0.26 536 Ate a smaller meal than you felt you14.3714.2314.490.26536 needed -ATELESS (%)      needed -ATELESS (%) Ate fewer meals in a day -SKIPPED 13.43 12.65 14.13 1.48 536 Ate fewer meals in a day -SKIPPED13.4312.6514.131.48536 (%)      (%) No food to eat of any kind in your 20.71 20.55 20.85 0.30 536 No food to eat of any kind in your20.7120.5520.850.30536 household -RUNOUT (%)      household -RUNOUT (%) Slept hungry at night -HUNGRY (%) 2.43 1.58 3.18 1.60 536 Slept hungry at night -HUNGRY (%)2.431.583.181.60536 Went without food for a whole day and 4.10 3.56 4.59 1.03 536 Went without food for a whole day and4.103.564.591.03536 night -WHLDAY (%)      night -WHLDAY (%)  "},{"text":"Table 13 :Livestock ownership and animal product sales  Livestock ownership Pooled Sample Control Treated Mean dif-ference Obs Livestock ownershipPooled SampleControlTreatedMean dif-ferenceObs Own livestock in the last 12 months (%) 84.3 85.4 83.3 2.0 536 Own livestock in the last 12 months (%)84.385.483.32.0536 Obs. 536 254 282   Obs.536254282 Tropical livestock Units (TLUs) 3.500 3.891 3.149 0 .741 536 Tropical livestock Units (TLUs)3.5003.8913.1490 .741536  (0 .315) (0 .530) (0 .362) (0 .632)  (0 .315)(0 .530)(0 .362)(0 .632) Received income from ani-mal/product (%) 19.2 14.7 23.3 8.6*** 525 Received income from ani-mal/product (%)19.214.723.38.6***525 Obs. 525 251 251   Obs.525251251 Livestock revenue (UGX) 1,857,379 1,656,313 2,066,902 410,588.9 437 Livestock revenue (UGX)1,857,3791,656,3132,066,902 410,588.9 437  (420,440.9) (453,098.3) (717,999.1 ) (841,796. 2)  (420,440.9) (453,098.3)(717,999.1 )(841,796. 2) Note: Values in parentheses are standard errors. *, ** and *** denote significance at 10, 5 and 1% respectively  Note: Values in parentheses are standard errors. *, ** and *** denote significance at 10, 5 and 1% respectively  "},{"text":"Table 14 :Well-being indicators by treatment status  Income Pooled Sample Control Treated Mean diff. N IncomePooled SampleControlTreatedMean diff.N Household income per annum ('0,000UGX) 1,346.86 ) (1,279.20 1,475.30 (1,299.62) 1231.18 (1251.57) 244.12 ** 536 Household income per annum ('0,000UGX)1,346.86 ) (1,279.201,475.30 (1,299.62)1231.18 (1251.57)244.12 **536 Income per capita per 256.75 276.92 238.59 38.33 536 Income per capita per256.75276.92238.5938.33536 annum ('0,000 UGX) (365.07) (400.82) (329.25)   annum ('0,000 UGX)(365.07)(400.82)(329.25)  "},{"text":"Table 15 :Balance test on household food and non-food expenditure ('0,000 UGX)  Variable Pooled Control Treatment Mean Obs VariablePooledControlTreatment MeanObs  Sample   Diff.  SampleDiff. Food expenses per an- 255.916 250.263 260.877 10.613 522 Food expenses per an-255.916250.263260.87710.613522 num      num ('0,000UGX) (7.401) (10.548) (10.374) (14.841)  ('0,000UGX)(7.401)(10.548)(10.374)(14.841) Obs 522 244 278   Obs522244278  "},{"text":" Sylvester Ogutu is a Postdoctoral Fellow at the Alliance of Bioversity International and CIAT. Enoch Kikulwe is Senior Scientist at the Alliance of Bioversity International and CIAT. Susan Ajambo is Associate Scientist at the Alliance of Bioversity International and CIAT. Eliud Birachi is a Project Leader, Crops for Nutrition and Health at the Alliance of Bioversity International and CIAT. Inorganic Fert. 0.095 0.096 0.093 0.003 1,258 Inorganic Fert.0.0950.0960.0930.0031,258 (Yes/No) (0.008) (0.011) (0.012) (0.019)  (Yes/No)(0.008)(0.011)(0.012)(0.019) Organic Manure 0.342 0.387 0.303 0.083*** 1,258 Organic Manure 0.3420.3870.3030.083***1,258 (Yes/No) (0.013) (0.020) (0.016) (0.026)  (Yes/No)(0.013)(0.020)(0.016)(0.026) Pesticides 0.178 0.215 0.162 0.053*** 1,258 Pesticides0.1780.2150.1620.053***1,258 (Yes/No) (0.013) (0.015) (0.015) (0.022)  (Yes/No)(0.013)(0.015)(0.015)(0.022) Fungicides 0.013 0.006 0.020 0.015** 1,258 Fungicides0.0130.0060.0200.015**1,258 (Yes/No) (0.003) (0.003) (0.006) (0.006)  (Yes/No)(0.003)(0.003)(0.006)(0.006) Herbicides 0.238 0.286 0.183 0.103*** 1,258 Herbicides0.2380.2860.1830.103***1,258 (Yes/No) (0.014) (0.017) (0.016) (0.028)  (Yes/No)(0.014)(0.017)(0.016)(0.028) Tractor/Oxen 0.004 0.004 0.003 0.001 1,258 Tractor/Oxen0.0040.0040.0030.0011,258 (Yes/No) (0.002) (0.002) (0.002) (0.004)  (Yes/No)(0.002)(0.002)(0.002)(0.004) Obs 1,258 672 586   Obs1,258672586 A1: Input use by gender     A1: Input use by gender  "},{"text":"Table 2A : Inorganic fertilizer application by gender for cash crop production  b4_1. Apply fertilizer on this Sex of HH Head  b4_1. Apply fertilizer on thisSex of HH Head plot?    plot?  Female Male Total FemaleMaleTotal No 381 452 833 No381452833  45.74 54.26 100.00 45.7454.26100.00  89.02 90.40 89.76 89.0290.4089.76 Yes 47 48 95 Yes474895  49.47 50.53 100.00 49.4750.53100.00  10.98 9.60 10.24 10.989.6010.24 Total 428 500 928 Total428500928  46.12 53.88 100.00 46.1253.88100.00  100.00 100.00 100.00 100.00100.00100.00 Pearson Chi2 = 0.48 Prob = 0.4890; First row has frequencies; second row has row Pearson Chi2 = 0.48 Prob = 0.4890; First row has frequencies; second row has row percentages and third row has column percentages   percentages and third row has column percentages  "},{"text":"Table 3A : Organic manure application by gender cash crop production Pearson Chi2 = 0.00 Prob = 0.9697; First row has frequencies; second row has row percentages and third row has column percentages  35.28 35.40 35.34 35.2835.4035.34 Total 428 500 928 Total428500928  46.12 53.88 100.00 46.1253.88100.00  100.00 100.00 100.00 100.00100.00100.00 b5_1. Apply Manure on plot? Sex of HH Head  b5_1. Apply Manure on plot?Sex of HH Head  Female Male Total FemaleMaleTotal No 277 323 600 No277323600  46.17 53.83 100.00 46.1753.83100.00  64.72 64.60 64.66 64.7264.6064.66 Yes 151 177 328 Yes151177328  46.04 53.96 100.00 46.0453.96100.00  "},{"text":"Table 4A : Pesticide application by gender cash crop production Pearson Chi2 = 0.02 Prob = 0.8767; First row has frequencies; second row has row percentages and third row has column percentages b6_1. Apply Pesticide on plot Sex of HH Head  b6_1. Apply Pesticide on plotSex of HH Head  Female Male Total FemaleMaleTotal No 351 412 763 No351412763  46.00 54.00 100.00 46.0054.00100.00  82.01 82.40 82.22 82.0182.4082.22 Yes 77 88 165 Yes7788165  46.67 53.33 100.00 46.6753.33100.00  17.99 17.60 17.78 17.9917.6017.78 Total 428 500 928 Total428500928  46.12 53.88 100.00 46.1253.88100.00  100.00 100.00 100.00 100.00100.00100.00  "},{"text":"Table 5A : Fungicide application by gender for cash crop production Pearson Chi2 = 5.01 Prob = 0.0252; Note: First row has frequencies; second row has row percentages and third row has column percentages b7_1. Apply Fungicide on plot Sex of HH Member  b7_1. Apply Fungicide on plotSex of HH Member  Female Male Total FemaleMaleTotal No 426 489 915 No426489915  46.56 53.44 100.00 46.5653.44100.00  99.53 97.80 98.60 99.5397.8098.60 Yes 2 11 13 Yes21113  15.38 84.62 100.00 15.3884.62100.00  0.47 2.20 1.40 0.472.201.40 Total 428 500 928 Total428500928  46.12 53.88 100.00 46.1253.88100.00  100.00 100.00 100.00 100.00100.00100.00  "},{"text":"Table 6A : Herbicide application by gender for cash crop production Pearson Chi2 = 0.01 Prob = 0.9229; First row has frequencies; second row has row percentages and third row has column percentages  100.00 100.00 100.00 100.00100.00100.00 b8_1. Apply herbicide on plot Sex of HH Member  b8_1. Apply herbicide on plotSex of HH Member  Female Male Total FemaleMaleTotal No 329 383 712 No329383712  46.21 53.79 100.00 46.2153.79100.00  76.87 76.60 76.72 76.8776.6076.72 Yes 99 117 216 Yes99117216  45.83 54.17 100.00 45.8354.17100.00  23.13 23.40 23.28 23.1323.4023.28 Total 428 500 928 Total428500928  46.12 53.88 100.00 46.1253.88100.00  "},{"text":"Table 7A : Type of Seed and Gender Pearson Chi2 = 0.78 Prob = 0.3763; First row has frequencies; second row has row percentages and third row has column percentages b2_2. Seed Type[1 = Traditional 0 = Sex of HH Member  b2_2. Seed Type[1 = Traditional 0 =Sex of HH Member Improved]    Improved]  Female Male Total FemaleMaleTotal Improved 67 68 135 Improved6768135  49.63 50.37 100.00 49.6350.37100.00  15.65 13.60 14.55 15.6513.6014.55 Traditional 361 432 793 Traditional361432793  45.52 54.48 100.00 45.5254.48100.00  84.35 86.40 85.45 84.3586.4085.45 Total 428 500 928 Total428500928  46.12 53.88 100.00 46.1253.88100.00  100.00 100.00 100.00 100.00100.00100.00  "},{"text":"Production output and sales Table 8A: Point of Cash crop sales by gender First row has frequencies; second row has row percentages and third row has column percentage c2_13. Point of Sales of Output Sex of HH Member  c2_13. Point of Sales of OutputSex of HH Member  Female Male Total FemaleMaleTotal Collection center 19 29 48 Collection center192948  39.58 60.42 100.00 39.5860.42100.00  6.40 9.21 7.84 6.409.217.84 Farm gate 273 274 547 Farm gate273274547  49.91 50.09 100.00 49.9150.09100.00  91.92 86.98 89.38 91.9286.9889.38 Main market 0 3 3 Main market033  0.00 100.00 100.00 0.00100.00100.00  0.00 0.95 0.49 0.000.950.49 Other specify 3 5 8 Other specify358  37.50 62.50 100.00 37.5062.50100.00  1.01 1.59 1.31 1.011.591.31 Village market 2 4 6 Village market246  33.33 66.67 100.00 33.3366.67100.00  0.67 1.27 0.98 0.671.270.98 Total 297 315 612 Total297315612  48.53 51.47 100.00 48.5351.47100.00  100.00 100.00 100.00 100.00100.00100.00 Pearson Chi2 = 5.73 Prob = 0.2205;   Pearson Chi2 = 5.73 Prob = 0.2205;  "},{"text":"Table 9A : Sources of credit by treatment status First row has frequencies; second row has row percentages, and third row has column percentages  Treatment Status   Treatment Status m1_2. Name of Credit Source    m1_2. Name of Credit Source  Control Treated Total ControlTreatedTotal Agricultural / livestock producer's and marketing 48 33 81 Agricultural / livestock producer's and marketing483381 group    group  59.26 40.74 100.00 59.2640.74100.00  22.12 15.64 18.93 22.1215.6418.93 Civic groups (improving community) or charitable 19 25 44 Civic groups (improving community) or charitable192544 group (helping others)    group (helping others)  43.18 56.82 100.00 43.1856.82100.00  8.76 11.85 10.28 8.7611.8510.28 Credit or microfinance group (including village 109 105 214 Credit or microfinance group (including village109105214 funds)    funds)  50.93 49.07 100.00 50.9349.07100.00  50.23 49.76 50.00 50.2349.7650.00 Forest users' group 1 0 1 Forest users' group101  100.00 0.00 100.00 100.000.00100.00  0.46 0.00 0.23 0.460.000.23 Local government bodies (e.g. councils) 24 34 58 Local government bodies (e.g. councils)243458  41.38 58.62 100.00 41.3858.62100.00  11.06 16.11 13.55 11.0616.1113.55 Other (Specify) 3 4 7 Other (Specify)347  42.86 57.14 100.00 42.8657.14100.00  1.38 1.90 1.64 1.381.901.64 Religious group 11 4 15 Religious group11415  73.33 26.67 100.00 73.3326.67100.00  5.07 1.90 3.50 5.071.903.50 Trade/business association 2 6 8 Trade/business association268  25.00 75.00 100.00 25.0075.00100.00  0.92 2.84 1.87 0.922.841.87 Total 217 211 428 Total217211428  50.70 49.30 100.00 50.7049.30100.00  100.00 100.00 100.00 100.00100.00100.00 Pearson Chi2 = 11.72 Prob = 0.1101    Pearson Chi2 = 11.72 Prob = 0.1101  "}],"sieverID":"40b3f333-1b6f-4d64-9c13-14d25ee9c325","abstract":"This publication has been prepared as an output of the CGIAR Research Initiative on Rethinking Food Markets and has not been independently peer reviewed. Any opinions expressed here belong to the author(s) and are not necessarily representative of or endorsed by IFPRI or CGIAR."}

data/part_5/0b8dfe6d1ef594b73706f2b58fa41d35.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b8dfe6d1ef594b73706f2b58fa41d35","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/81d769a3-95d1-4787-9aec-ed982ecc8126/retrieve"},"pageCount":17,"title":"Atelier de priorisation pour le Plan d'Investissement d'une Agriculture Intelligente face au Climat au Sénégal","keywords":[],"chapters":[{"head":"2: Démarche et livrables de l'atelier","index":1,"paragraphs":[{"index":1,"size":40,"text":"Comme résultats atteints au terme de cet atelier, pour une étude plus approfondie, a été identifiée pour le Sénégal une liste restreinte de 09 potentiels investissements incluant pour chacun d'entre eux une composante sur le renforcement des capacités des acteurs."}]},{"head":"Critères de priorisation","index":2,"paragraphs":[{"index":1,"size":30,"text":"Les participants ont procédé à la priorisation des investissements de la longue liste à l'aide de 17 critères (voir tableau II) sur une échelle de 0 (faible) à 5 (élevé).  "}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table des matières  Introduction 1. Rappels des objectifs de l'atelier 2. Démarche et livrables de l'atelier 2.1 Critères de priorisation 2.2 Liste des investissements AIC prioritaires et quelques contraintes/solutions à leur réalisation A l'instar des pays sahéliens, le secteur agricole au Sénégal a été et demeure toujours très important ce qui le rend vulnérable aux variabilités et changements climatiques. Pour y faire face, le Sénégal a, à travers son Plan Sénégal Emergent (PSE) appuyé par sa Contribution Déterminée au niveau National (CDN), basé sa stratégie de croissance économique sur la réduction de la pauvreté et des inégalités, l'atténuation et l'adaptation aux changements climatiques. durable sur les plans environnemental et social, renforcer la résilience des agriculteurs aux changements climatiques et réduire la contribution de l'agriculture au changement climatique en réduisant les émissions de gaz à effet de serre et en augmentant le stockage de carbone sur les terres agricoles. Le projet 'Accelerating the Impact of CGIAR Climate Research for Africa (AICCRA)' soutenu par une subvention de l'Association Internationale de Développement (IDA) de la Banque mondiale s'efforce de rendre les services d'information climatique et l'agriculture Dans un premier temps, des présentations ont été effectuées lors de cet atelier pour présenter les définitions/concepts et surtout l'analyse situationnelle du Sénégal avant de procéder aux travaux de groupes suivis de présentations en plénière. Les travaux de groupe ont porté sur : ■ l'établissement de la longue liste des investissements; ■ la priorisation des investissements à l'aide de 17 critères (voir tableau I); ■ l'analyse des contraintes et solutions des Recommandations et prochaines étapes Introduction intelligente face au climat plus accessibles à investissements priorisés (tableau III). Introduction 1. Rappels des objectifs de l'atelier 2. Démarche et livrables de l'atelier 2.1 Critères de priorisation 2.2 Liste des investissements AIC prioritaires et quelques contraintes/solutions à leur réalisation A l'instar des pays sahéliens, le secteur agricole au Sénégal a été et demeure toujours très important ce qui le rend vulnérable aux variabilités et changements climatiques. Pour y faire face, le Sénégal a, à travers son Plan Sénégal Emergent (PSE) appuyé par sa Contribution Déterminée au niveau National (CDN), basé sa stratégie de croissance économique sur la réduction de la pauvreté et des inégalités, l'atténuation et l'adaptation aux changements climatiques. durable sur les plans environnemental et social, renforcer la résilience des agriculteurs aux changements climatiques et réduire la contribution de l'agriculture au changement climatique en réduisant les émissions de gaz à effet de serre et en augmentant le stockage de carbone sur les terres agricoles. Le projet 'Accelerating the Impact of CGIAR Climate Research for Africa (AICCRA)' soutenu par une subvention de l'Association Internationale de Développement (IDA) de la Banque mondiale s'efforce de rendre les services d'information climatique et l'agriculture Dans un premier temps, des présentations ont été effectuées lors de cet atelier pour présenter les définitions/concepts et surtout l'analyse situationnelle du Sénégal avant de procéder aux travaux de groupes suivis de présentations en plénière. Les travaux de groupe ont porté sur : ■ l'établissement de la longue liste des investissements; ■ la priorisation des investissements à l'aide de 17 critères (voir tableau I); ■ l'analyse des contraintes et solutions des Recommandations et prochaines étapes Introduction intelligente face au climat plus accessibles à investissements priorisés (tableau III).  des millions de petits exploitants agricoles des millions de petits exploitants agricoles  en Afrique. Grâce à un meilleur accès aux en Afrique. Grâce à un meilleur accès aux  technologies et aux services de conseil technologies et aux services de conseil  les agriculteurs peuvent mieux anticiper les agriculteurs peuvent mieux anticiper  les événements liés au climat et prendre les événements liés au climat et prendre  des mesures préventives qui aident leurs des mesures préventives qui aident leurs  communautés à préserver leurs moyens de communautés à préserver leurs moyens de  subsistance et l'environnement. C'est dans ce subsistance et l'environnement. C'est dans ce  cadre-là que le projet AICCRA appuie le Sénégal cadre-là que le projet AICCRA appuie le Sénégal  dans l'élaboration du Plan d'Investissement dans l'élaboration du Plan d'Investissement  d'une Agriculture Intelligente face au Climat d'une Agriculture Intelligente face au Climat  (PIAIC). Le PIAIC est élaboré sous la coordination (PIAIC). Le PIAIC est élaboré sous la coordination  de l'Alliance Bioversity International-CIAT de l'Alliance Bioversity International-CIAT  (ABC) qui s'appuiera sur les programmes, les (ABC) qui s'appuiera sur les programmes, les  politiques et les plans stratégiques du pays tels politiques et les plans stratégiques du pays tels  que la CDN et la contribution de nombreuses que la CDN et la contribution de nombreuses  institutions locales, nationales, régionales et institutions locales, nationales, régionales et  internationales et les acteurs clés des chaînes internationales et les acteurs clés des chaînes  de valeur des cultures et de l'élevage. de valeur des cultures et de l'élevage.  Ainsi, du 02 au 03 novembre 2022 s'est tenu Ainsi, du 02 au 03 novembre 2022 s'est tenu  au Centre d'Etude Régional pour l'Amélioration au Centre d'Etude Régional pour l'Amélioration  de l'Adaptation à la Sécheresse (CERAAS) de l'Adaptation à la Sécheresse (CERAAS)  l'atelier sur la priorisation des investissements l'atelier sur la priorisation des investissements  AIC pour le Sénégal avec la participation AIC pour le Sénégal avec la participation Spécifiquement, il s'agissait lors de cet atelier effective des parties prenantes provenant des Spécifiquement, il s'agissait lors de cet ateliereffective des parties prenantes provenant des de :  de :  "},{"text":"Risque & atténuation climatiques et productivité Financement et engagement du secteur privé Politiques et institutions Avantages sociaux et filets de sécurité Critères de pondération  Sous-secteur Sous- investissements AIC Investissements Objectifs 2.2 Liste des Investissements Objectifs  Zones agroécologiques Zones Spéculations/ filières Spéculations/ Pratiques AIC associées Pratiques AIC associées Sous-secteur Sous-investissements AIC Investissements Objectifs 2.2 Liste des Investissements ObjectifsZones agroécologiques ZonesSpéculations/ filières Spéculations/Pratiques AIC associées Pratiques AIC associées secteur prioritaires et quelques Gestion holistique ■ Augmenter la production de la contraintes/solutions à leur réalisation Gestion durable de la fertilité des sols des parcours viande et lait, ■ Réduire l'evaporation et controler l'erosion à travers l'association culturale; assolement,rotation de culture (hydraulique ■ Diminuer les conflits entre les pastorale, couloir, unite pastorale, cadre de concertation, parc de vaccination) acteurs, ■ Améliorer la nutrition des animaux ■ Diminuer les risques de feux de brousse agroécologiques ■ Basse Casamance ■ Bassin arachidier ■ Sénégal oriental ■ Ferlo ■ Vallée filières ■ Bétails (ovin/ bovin/caprin/ camélidé) ■ Hydraulique (aménagement des mares, fleuve, puits non cimenté, puits cimentés, forage), ■ Gestion, sécurisation, enrichissement de la diversité floristique des parcours (type de fourrages) secteurprioritaires et quelques Gestion holistique ■ Augmenter la production de la contraintes/solutions à leur réalisation Gestion durable de la fertilité des sols des parcours viande et lait, ■ Réduire l'evaporation et controler l'erosion à travers l'association culturale; assolement,rotation de culture (hydraulique ■ Diminuer les conflits entre les pastorale, couloir, unite pastorale, cadre de concertation, parc de vaccination) acteurs, ■ Améliorer la nutrition des animaux ■ Diminuer les risques de feux de brousseagroécologiques ■ Basse Casamance ■ Bassin arachidier ■ Sénégal oriental ■ Ferlo ■ Valléefilières ■ Bétails (ovin/ bovin/caprin/ camélidé)■ Hydraulique (aménagement des mares, fleuve, puits non cimenté, puits cimentés, forage), ■ Gestion, sécurisation, enrichissement de la diversité floristique des parcours (type de fourrages)  Promotion de    ■ Bétails (ovin/ ■ Banque fourragère/amélioration Promotion de■ Bétails (ovin/■ Banque fourragère/amélioration  la production    bovin/caprin/ des espèces fourragères, la productionbovin/caprin/des espèces fourragères, Agriculture Elevage/Pêche déchêts animaux ) Tableau I : Liste des 17 critères d'évaluation pour la priorisation des potentiels investissements semi-intensive et stabulation (intégration / utilisation des camélidé) amélioration des espèces fourragères et valorisation des sous produits agricoles, conservation, ■ Valorisation des sous-produits agricoles (e.g. fan d'arachide, etc), et des sous-produit agro industriels (SPIA), e.g. son et tourteau Agriculture Elevage/Pêchedéchêts animaux ) Tableau I : Liste des 17 critères d'évaluation pour la priorisation des potentiels investissements semi-intensive et stabulation (intégration / utilisation des camélidé) amélioration des espèces fourragères et valorisation des sous produits agricoles,conservation, ■ Valorisation des sous-produits agricoles (e.g. fan d'arachide, etc), et des sous-produit agro industriels (SPIA), e.g. son et tourteau  Promotion des    Promotion des  systèmes de    systèmes de  production Amelioration    production Amelioration  intégrée des habitats et    intégrée des habitats et  agriculture-génétique pour    agriculture-génétique pour  1 Traite les principaux risques la volaille dans élevage-pisciculture-les exploitations agroforesterie familiales 5 Améliore l'accès et l'abordabilité du financement 9 S'aligne sur les politiques nationales (pour 14 Favorise la création d'opportunités 1 Traite les principaux risques la volaille dans élevage-pisciculture-les exploitations agroforesterie familiales5 Améliore l'accès et l'abordabilité du financement9 S'aligne sur les politiques nationales (pour14 Favorise la création d'opportunités  climatiques pour l'AIC l'AIC)  d'emplois climatiquespour l'AICl'AIC)d'emplois  2 Augmente la 6 Améliore la 10 Améliore les 15 Améliore l'équité 2 Augmente la6 Améliore la10 Améliore les15 Améliore l'équité  productivité compétitivité du capacités entre les sexes et productivitécompétitivité ducapacitésentre les sexes et  agricole secteur agricole institutionnelles fait recours aux agricolesecteur agricoleinstitutionnellesfait recours aux  3 Permet l'adaptation et renforce la résilience aux risques climatiques 4 Réduit les émissions de gaz à effet de serre (émissions absolues ou intensité d'émissions) par le biais d'infrastructures, d'incitations et d'autres moyens 7 Fournit des investissements du secteur privé et des opportunités d'affaires (y compris les PPP) 8 Durabilité à long terme des (économique, financière, gestion des ressources naturelles et la gouvernance locale) 11 Engage et renforce les réseaux/ organisations d'agriculteurs 12 Améliore jeunes 16 Protège les pauvres et les personnes vulnérables grâce à des filets de sécurité sociale 17 Améliore l'accès à l'eau potable et à l'assainissement 3 Permet l'adaptation et renforce la résilience aux risques climatiques 4 Réduit les émissions de gaz à effet de serre (émissions absolues ou intensité d'émissions)par le biais d'infrastructures, d'incitations et d'autres moyens 7 Fournit des investissements du secteur privé et des opportunités d'affaires (y compris les PPP) 8 Durabilité à long terme des(économique, financière, gestion des ressources naturelles et la gouvernance locale) 11 Engage et renforce les réseaux/ organisations d'agriculteurs 12 Améliorejeunes 16 Protège les pauvres et les personnes vulnérables grâce à des filets de sécurité sociale 17 Améliore l'accès à l'eau potable et à l'assainissement   investissements l'extension investissementsl'extension   et de l'adoption (publique et/ou et de l'adoption(publique et/ou   des interventions privée)  des interventionsprivée)    13 Améliore la 13 Améliore la    recherche et le recherche et le    développement développement    à soutenir l'AIC à soutenir l'AIC  "},{"text":"fourragères et valorisation des sous produits agricoles, utilisation des déchets animaux ) Contraintes et solutions pour la réalisation des investissements potentiels AIC Atelier de priorisation pour le Plan d'Investissement d'une Agriculture Intelligente face au Climat au Sénégal 2 . D É M A R C H E E T L I V R A B L E S D E L ' A T E L I E R 2 . D É M A R C H E E T L I V R A B L E S D E L ' A T E L I E R   2 . D É M A R C H E E T L I V R A B L E S D E L ' A T E L I E R 2 . D É M A R C H E E T L I V R A B L E S D E L ' A T E L I E R Sous-secteur Services transversaux Sous-secteur Sous-secteur Sous-secteur Recommandations Investissements Objectifs Production et dissémination des services climatiques à fine échelle et agro-conseil (agriculture et élevage/pêche) ■ Développer les systèmes d'alerte précoce dans le secteur agricole et de l'élevage/pêche ■ Gérer efficacement les troupeaux, diminue les risques ■ Rendre l'IC disponible pour la transhumance/alerte de la transhumance Gestion post-récolte et stockage avec la promotion de fond de commercialisation ■ Développer des infrastructures de stockage et de conservation des produits agricoles ■ Renforcer les unités de transformation conditionnement et labellisation des produits agricoles Accès aux intrants (agriculture, élevage et pèche) certifiés et diversifiés ■ Améliorer le système actuel de distribution de semences certifiées ■ Promouvoir les espèces/variétés locales plus adaptées Investissements Contrainte 1 : les politiques Investissements Contrainte 1 : les politiques Investissements Contrainte 1 : les politiques Contrainte 2 : le financement Agriculture Gestion durable de la fertilité des sols ■ La difficulté dans la mise en oeuvre des politiques pour faciliter l'analyses des sols au niveau des petits producteurs Gestion holistique des ■ Sécurisation foncière : Production et dissémination NA ■ Le défis de paiements des et prochaines étapes Maîtrise de l'eau/ Aménagement hydro-agricole Promotion des systèmes de production intégrée agriculture-élevage-pisciculture-agroforesterie ■ Insuffisance de l'application de la règlementation au niveau du secteur ■ Problème de foncier/Politique foncière Elevage/Pêche parcours (hydraulique pastorale, couloir, unité pastorale, cadre de concertation, parc de vaccination) contraintes locales (autorisation des Zones agroécologiques Contrainte 2 : le financement Contrainte 2 : le Spéculations/ filières Contrainte 3 : Pratiques AIC associées ■ Information climatique (agrométéo) Solutions ? financement Contrainte 3 : environnement favorable aux Solutions ? Contrainte 3 : environnement Solutions ? favorable aux affaires environnement favorable aux affaires ■ Insuffisance de subventions pour la production de fertilisants biologiques ■ Coûts relativement élevés de l'analyse du sol pour les petits producteurs ■ Le problème de titre foncier pour l'acquisition des prêts ■ Insuffisance de personnes ressources qualifiées affaires ■ Harmoniser des lois ■ Réfléchir et évaluer des 'business modèles' potentiels ■ S'inspirer des modèles de réussite de programme (par exemple le projet POS de la SAED et ANCAR) et envisager leur duplication ■ Renforcer les capacités des acteurs ■ La lenteur dans le financement des projets ■ Difficulté dans la mobilisation de la contrepartie de l'Etat ■ Difficulté d'accès aux crédits ■ Taux d'intérêt élevé ■ Problème foncier est une contrainte aux développements des affaires ■ Renforcer les capacités des acteurs chefs locaux) et administratives pour traverser les collectivités territoriales (inclusivité) ■ Problème d'harmonisation entre les différentes organisations ■ Manque d'implémentation de la loi agro sylvo pastorale (pas encore promulguée) ■ Manque d'harmonisation entre les pays voisins pastorales ■ Promulguer de la loi agrosylvopastorale des services climatiques à fine échelle et agro-conseil (agriculture et élevage/pêche) services climatiques ■ Renforcement des capacités des acteurs par les producteurs Au titre des recommandations, les participants Jour 1 Activités Lead/Facilitateur ■ La durabilité ont fait la suggestion de : financière du 08:30 -09:00 Installation service/la question ■ Renforcement du statut des ■ reprendre les projections climatiques 09:00 -09:30 ■ Mots de bienvenue ■ Aliou Faye des capacités des services climatiques avec des modèles intermédiaires moins ■ Présentation des objectifs et de l'atelier CERAAS acteurs Promotion de la production semi-intensive et stabulation (integration / amelioration des espèces ■ Offre inadaptée aux systèmes d'élevage. (Les banques manquent de produits adaptés au secteur) ■ les prêts ne sont pas adaptés au cycle de production ■ Manque des marchés ■ Problème de transports décélère le rythme de production ■ Adapter les produits bancaires au cycle de production (prendre exemple banque crédit mutuel et LBA et autres) ■ Améliorer, élargir et faciliter l'accès au marché Amélioration des habitats et génétique pour la volaille ■ Difficulté dans l'accès aux intrants (vaccins, e.g. maladies de Newcastle) ■ Difficulté pour accéder aux petits ■ Difficulté à accéder à ■ Améliorer l'accès aux intrants, (devraient-ils être des services publics ?) Gestion post-récolte et stockage avec la promotion de fond de commercialisation NA ■ La faisabilité financière pour un tel programme aussi large ■ Faire la situation (revue de littérature) des programmes/projets antérieurs ayant abordé ce sujet et apprendre de leurs expériences (l'exemple de CNAAS avec l'Office de Régulations des Entrepôts de Sénégal) pessimistes ;les projections issues du scenario 8.5 jugées plus pessimistes ; ■ prendre en compte le renforcement de capacités des acteurs pour chacun des investissements ; ■ s'inspirer des résultats des programmes/ projets réalisés antérieurement ayant un lien avec les investissements priorisés et envisager la duplication si nécessaire. Tour de table (présentation) ■ Issa Ouedraogo Bioversity-CIAT 09:30 -10:00 Présentation I : Alliance Bioversity -CIAT 10:00 -10:30 Pause-café/thé 10:30 -11:30 Presentation II : Services transversaux Accès aux intrants (agriculture, élevage et pèche) certifiés et diversifiés ■ La plupart des financements sont faits par l'Etat ■ Très onéreux ■ Financement étatique pour la plupart du temps ■ Le processus prend beaucoup de temps ce qui pourrait être une entrave au Alliance Bioversity -CIAT ■ Envisager la faisabilité d'élargir le marché ■ Identifier les cas de sinistres liés au climat, de semences certifiées les causes de ces sinistres afin de trouver ■ Envisager des achats groupés pour les des solutions des plans d'investissements 12:30 -13:00 Présentation III : producteurs/éleveurs développement des affaires adaptés ; ■ S'inspirer des modèles de réussite (expériences) de vente de semences Alliance Bioversity -CIAT ■ La non-harmonisation des textes ■ La lourdeur dans la mise en oeuvre de garantie/ du marché organisation ■ Renforcement des capacités des acteurs et surtout la mise en place de véritable des volontés (lourdeur; lenteur) dans les exploitations crédits l'information certifiées auprès des privés afin d'établir ■ Envisager de développer l'interconnexion/ ■ Réfléchir à familiales ■ Manque de fonds ■ Problème prix une meilleure un plan d'investissement adapté harmonisation entre les communautés 13:00 - Sous-secteur Services transversaux Sous-secteur Sous-secteur Sous-secteur Recommandations Investissements Objectifs Production et dissémination des services climatiques à fine échelle et agro-conseil (agriculture et élevage/pêche) ■ Développer les systèmes d'alerte précoce dans le secteur agricole et de l'élevage/pêche ■ Gérer efficacement les troupeaux, diminue les risques ■ Rendre l'IC disponible pour la transhumance/alerte de la transhumance Gestion post-récolte et stockage avec la promotion de fond de commercialisation ■ Développer des infrastructures de stockage et de conservation des produits agricoles ■ Renforcer les unités de transformation conditionnement et labellisation des produits agricoles Accès aux intrants (agriculture, élevage et pèche) certifiés et diversifiés ■ Améliorer le système actuel de distribution de semences certifiées ■ Promouvoir les espèces/variétés locales plus adaptées Investissements Contrainte 1 : les politiques Investissements Contrainte 1 : les politiques Investissements Contrainte 1 : les politiques Contrainte 2 : le financement Agriculture Gestion durable de la fertilité des sols ■ La difficulté dans la mise en oeuvre des politiques pour faciliter l'analyses des sols au niveau des petits producteurs Gestion holistique des ■ Sécurisation foncière : Production et dissémination NA ■ Le défis de paiements des et prochaines étapes Maîtrise de l'eau/ Aménagement hydro-agricole Promotion des systèmes de production intégrée agriculture-élevage-pisciculture-agroforesterie ■ Insuffisance de l'application de la règlementation au niveau du secteur ■ Problème de foncier/Politique foncière Elevage/Pêche parcours (hydraulique pastorale, couloir, unité pastorale, cadre de concertation, parc de vaccination) contraintes locales (autorisation des Zones agroécologiques Contrainte 2 : le financement Contrainte 2 : le Spéculations/ filières Contrainte 3 : Pratiques AIC associées ■ Information climatique (agrométéo) Solutions ? financement Contrainte 3 : environnement favorable aux Solutions ? Contrainte 3 : environnement Solutions ? favorable aux affaires environnement favorable aux affaires ■ Insuffisance de subventions pour la production de fertilisants biologiques ■ Coûts relativement élevés de l'analyse du sol pour les petits producteurs ■ Le problème de titre foncier pour l'acquisition des prêts ■ Insuffisance de personnes ressources qualifiées affaires ■ Harmoniser des lois ■ Réfléchir et évaluer des 'business modèles' potentiels ■ S'inspirer des modèles de réussite de programme (par exemple le projet POS de la SAED et ANCAR) et envisager leur duplication ■ Renforcer les capacités des acteurs ■ La lenteur dans le financement des projets ■ Difficulté dans la mobilisation de la contrepartie de l'Etat ■ Difficulté d'accès aux crédits ■ Taux d'intérêt élevé ■ Problème foncier est une contrainte aux développements des affaires ■ Renforcer les capacités des acteurs chefs locaux) et administratives pour traverser les collectivités territoriales (inclusivité) ■ Problème d'harmonisation entre les différentes organisations ■ Manque d'implémentation de la loi agro sylvo pastorale (pas encore promulguée) ■ Manque d'harmonisation entre les pays voisins pastorales ■ Promulguer de la loi agrosylvopastorale des services climatiques à fine échelle et agro-conseil (agriculture et élevage/pêche) services climatiques ■ Renforcement des capacités des acteurs par les producteurs Au titre des recommandations, les participants Jour 1 Activités Lead/Facilitateur ■ La durabilité ont fait la suggestion de : financière du 08:30 -09:00 Installation service/la question ■ Renforcement du statut des ■ reprendre les projections climatiques 09:00 -09:30 ■ Mots de bienvenue ■ Aliou Faye des capacités des services climatiques avec des modèles intermédiaires moins �� Présentation des objectifs et de l'atelier CERAAS acteurs Promotion de la production semi-intensive et stabulation (integration / amelioration des espèces ■ Offre inadaptée aux systèmes d'élevage. (Les banques manquent de produits adaptés au secteur) ■ les prêts ne sont pas adaptés au cycle de production ■ Manque des marchés ■ Problème de transports décélère le rythme de production ■ Adapter les produits bancaires au cycle de production (prendre exemple banque crédit mutuel et LBA et autres) ■ Améliorer, élargir et faciliter l'accès au marché Amélioration des habitats et génétique pour la volaille ■ Difficulté dans l'accès aux intrants (vaccins, e.g. maladies de Newcastle) ■ Difficulté pour accéder aux petits ■ Difficulté à accéder à ■ Améliorer l'accès aux intrants, (devraient-ils être des services publics ?) Gestion post-récolte et stockage avec la promotion de fond de commercialisation NA ■ La faisabilité financière pour un tel programme aussi large ■ Faire la situation (revue de littérature) des programmes/projets antérieurs ayant abordé ce sujet et apprendre de leurs expériences (l'exemple de CNAAS avec l'Office de Régulations des Entrepôts de Sénégal) pessimistes ;les projections issues du scenario 8.5 jugées plus pessimistes ; ■ prendre en compte le renforcement de capacités des acteurs pour chacun des investissements ; ■ s'inspirer des résultats des programmes/ projets réalisés antérieurement ayant un lien avec les investissements priorisés et envisager la duplication si nécessaire. Tour de table (présentation) ■ Issa Ouedraogo Bioversity-CIAT 09:30 -10:00 Présentation I : Alliance Bioversity -CIAT 10:00 -10:30 Pause-café/thé 10:30 -11:30 Presentation II : Services transversaux Accès aux intrants (agriculture, élevage et pèche) certifiés et diversifiés ■ La plupart des financements sont faits par l'Etat ■ Très onéreux ■ Financement étatique pour la plupart du temps ■ Le processus prend beaucoup de temps ce qui pourrait être une entrave au Alliance Bioversity -CIAT ■ Envisager la faisabilité d'élargir le marché ■ Identifier les cas de sinistres liés au climat, de semences certifiées les causes de ces sinistres afin de trouver ■ Envisager des achats groupés pour les des solutions des plans d'investissements 12:30 -13:00 Présentation III : producteurs/éleveurs développement des affaires adaptés ; ■ S'inspirer des modèles de réussite (expériences) de vente de semences Alliance Bioversity -CIAT ■ La non-harmonisation des textes ■ La lourdeur dans la mise en oeuvre de garantie/ du marché organisation ■ Renforcement des capacités des acteurs et surtout la mise en place de véritable des volontés (lourdeur; lenteur) dans les exploitations crédits l'information certifiées auprès des privés afin d'établir ■ Envisager de développer l'interconnexion/ ■ Réfléchir à familiales ■ Manque de fonds ■ Problème prix une meilleure un plan d'investissement adapté harmonisation entre les communautés 13:00 - coopérative des producteurs. ■ Problème d'accès a ■ Renforcement coopérative des producteurs.■ Problème d'accès a■ Renforcement  l'information des capacités des l'informationdes capacités des Comme actions à suivre, il faudra :  acteurs Comme actions à suivre, il faudra :acteurs ■ ■ 13 • AICCRA Senegal procéder à la documentation et à l'approfondissement des potentiels investissements à travers la consultation des documents et experts de référence ; Elaborer une concept note pour chacun des investissements à partir de la documentation et des modèles climatiques plus appropriés ;   ■ ■ 13 • AICCRA Senegal procéder à la documentation et à l'approfondissement des potentiels investissements à travers la consultation des documents et experts de référence ; Elaborer une concept note pour chacun des investissements à partir de la documentation et des modèles climatiques plus appropriés ;  "},{"text":"14:00 Pause-déjeuner 14:00 -14:15 Présentation en plénière, discussion et validation : Sélection de la liste des critères à utiliser pour la hiérarchisation de la liste restreinte (15 mins) Jour 2 Annexe 1 : Programme Activités 09:30 -09:45 Présentation en plénière, discussion et Lead/Facilitateur Jour 2 Annexe 1 : Programme Activités 09:30 -09:45 Présentation en plénière, discussion etLead/Facilitateur de l'atelier validation : Alliance Bioversity -CIAT de l'ateliervalidation :Alliance Bioversity -CIAT  ■ Aperçu de l'approche de priorisation (15  ■ Aperçu de l'approche de priorisation (15  mins)  mins) 09:45 -10:30 Travaux de groupe : Moderateurs 09:45 -10:30Travaux de groupe :Moderateurs  ■ Évaluation de chaque investissement en ■ Philippe Chabot, ■ Évaluation de chaque investissement en■ Philippe Chabot,  fonction des critères (60 min) ■ Siagbé Golli et fonction des critères (60 min)■ Siagbé Golli et   ■ Stéphanie Jaquet ■ Stéphanie Jaquet   Alliance Bioversity -CIAT Alliance Bioversity -CIAT 10:30 -11:00 Pause-café/thé  10:30 -11:00Pause-café/thé 11:00 -13:00 Travaux de groupe (suite) :  11:00 -13:00Travaux de groupe (suite) :   Alliance Bioversity -CIAT Alliance Bioversity -CIAT 13:00-14:00 Pause-déjeuner  13:00-14:00Pause-déjeuner 14:00 -15:45 Travaux de groupe :  14:00 -15:45Travaux de groupe :   Moderateurs : Moderateurs :  ■ la longue liste sur les investissements AIC est Alliance Bioversity -CIAT ■ la longue liste sur les investissements AIC estAlliance Bioversity -CIAT  validée (30min)  validée (30min) 15:00-15:30 Travaux de groupes : Modérateurs : 15:00-15:30Travaux de groupes :Modérateurs :  ■ Définir et ajuster la liste longue  ■ Définir et ajuster la liste longue  d'investissements AIC pour les trois sous-  d'investissements AIC pour les trois sous-  secteurs : (i) les cultures, (ii) le bétail, (iii) les  secteurs : (i) les cultures, (ii) le bétail, (iii) les  services transversaux Alliance Bioversity -CIAT services transversauxAlliance Bioversity -CIAT 15:30 -16:00 Pause-café/thé  15:30 -16:00Pause-café/thé 16:00 -17:00 Travaux de groupes (suite): Modérateurs : 16:00 -17:00Travaux de groupes (suite):Modérateurs :  ■ Définir et ajuster une liste longue  ■ Définir et ajuster une liste longue  d'investissements AIC pour les trois sous-  d'investissements AIC pour les trois sous-  secteurs : (i) les cultures, (ii) le bétail, (iii) les  secteurs : (i) les cultures, (ii) le bétail, (iii) les  services transversaux Alliance Bioversity -CIAT services transversauxAlliance Bioversity -CIAT 17:00 Synthèse de la journée  17:00Synthèse de la journée  "},{"text":"00 -16:30 Conclusion et café   "}],"sieverID":"89c51e79-04e7-4c2c-827c-ee525d3a86e2","abstract":""}

data/part_5/0bb9ca33f8394cafa6e7d0bf0749fd72.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0bb9ca33f8394cafa6e7d0bf0749fd72","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/1678e128-8053-4a53-91dd-6ca6ef760592/retrieve"},"pageCount":11,"title":"Report of the workshop on training of trainers on technologies for the promotion of local poultry value chain in Africa","keywords":[],"chapters":[{"head":"©2021","index":1,"paragraphs":[{"index":1,"size":85,"text":"The Program thanks all donors and organizations which globally support its work through their contributions to the CGIAR Trust Fund. This publication is copyrighted by the International Livestock Research Institute (ILRI). It is licensed for use under the Creative Commons Attribution 4.0 International Licence. To view this licence, visit https://creativecommons.org/licenses/by/4.0. Unless otherwise noted, you are free to share (copy and redistribute the material in any medium or format), adapt (remix, transform, and build upon the material) for any purpose, even commercially, under the following conditions:"},{"index":2,"size":109,"text":"ATTRIBUTION. The work must be attributed, but not in any way that suggests endorsement by ILRI or the author(s). NOTICE: For any reuse or distribution, the licence terms of this work must be made clear to others. Any of the above conditions can be waived if permission is obtained from the copyright holder. Nothing in this licence impairs or restricts the author's moral rights. Fair dealing and other rights are in no way affected by the above. The parts used must not misrepresent the meaning of the publication. ILRI would appreciate being sent a copy of any materials in which text, photos etc. have been used. (see agenda attached)"}]},{"head":"Name of training event","index":2,"paragraphs":[]},{"head":"Training of Trainers on technologies for the promotion of local poultry value chain in Africa","index":3,"paragraphs":[]},{"head":"Links to training material, if available","index":4,"paragraphs":[{"index":1,"size":11,"text":"Not yet Available, as AU-IBAR will be load from their website"}]},{"head":"Any other remarks","index":5,"paragraphs":[{"index":1,"size":133,"text":"Generally, the workshop went well with emphasis on interactive discussions, experiences sharing and working groups on innovative technologies. There were some challenges of time management due to the fact that most participants were not lodging at the training venue. The facilitators had many activities including training, facilitating, taking notes, preparing daily reports and debriefing, daily evaluation, and other administrative tasks. It was clear that there were few known innovations and technologies on local poultry farming and local chicken value chain development. This was evidenced in the proposed required innovations and technologies for the sector, such as for genetic improvement, breeding and production (meat and eggs). The trainees showed enthusiasm and will be future trainers and create the expected « snowball » effect in line with the expectations of the Live2Africa project of AU-IBAR."},{"index":2,"size":35,"text":"It's advisable for further training to make a local poultry value chain situation analysis in a country to enable all participants to have the same starting point and to propose innovations based on existing technologies."},{"index":3,"size":46,"text":"It was recommended that similar workshops are organised in other ECCAS countries and create family poultry value chains across the Central Africa (ECCAS) region. This will encourage sharing of genetic resources, equipment, expertise and markets. Pictures and videos from the workshop are share in different files."}]},{"head":"Photos","index":6,"paragraphs":[{"index":1,"size":21,"text":"View of workshop set up at ONOMO Hotel conference hall Douala A breakout session during the workshop supervised by Dr Zambou"}]}],"figures":[{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Aim of the course To build the capacity of the participants on the development process of the poultry value chain using technologies innovation Course summary or agenda A training workshop \"Training of Trainers (ToT) on technologies for the promotion of local poultry value chain in Africa\" was held from 16 -20 November 2020 in Douala-Cameroon. This workshop was supported by the Live2Africa Project of AU-IBAR. The main objective of the workshop was to build the capacity of the participants on the latest technologies and developments in the local poultry value chain. The specific objectives of the pilot ToT workshop in Cameroon were to:• Identify key components and priority interventions areas of the local poultry value chain in Cameroon • Validate and adopt models of community-based poultry breeding programmes while addressing technical gaps in the value chain • Highlight and promote the appropriate technology and start up innovations to sustain the Cameroon local poultry value chain • Design the way forward towards developing the local poultry cooperatives, Cameroon branches of the world Poultry science association (WPSA), Cameroon poultry inter-profession (IPAVIC) and the value chain • Develop a stepwise Action Plan to guide the sustainability of the Cameroon local poultry value chain. Participants consisted of local poultry geneticists, scientists, producers, poultry equipment manufacturers, ICT start-ups, technology developers, feed producers, poultry cooperatives promoters and animal health service providers from the five agro-ecological zones of Cameroon. Also present were government officials from m the Ministry of Livestock, Fisheries and Animal Industries (MINEPIA), and the Regional Delegate for MINEPIA in the Littoral Region of Cameroon; World Poultry Science Association (WPSA) Cameroon branch; the Cameroon poultry interprofession (IPAVIC). The training was facilitated by Drs Christian Keambou Tiambo from CTLGH/ILRI (Kenya) and Henri Rene Zambou from Equavet Group (Cameroon). The Director of AU-IBAR, Prof Ahmed Elsawalhy, through a video-conference link welcomed the participants. In his opening remarks, he highlighted the importance of technology and innovations to drive development and stressed how small improvements in techniques, procedures and methods can have positive impacts on local poultry production and productivity. The representative of the Ministry of Livestock, Fisheries and Animal Industries (MINEPIA), Mrs Annie Claire Ngo Ongla, who officially chaired the workshop, in her opening remarks emphasized the role of livestock, particularly poultry, on food and nutrition security. Over the five days training, the facilitators and workshop participants shared, and exchanged experiences on innovative technologies for the development of the Cameroon local poultry value chain. The emphasis was on developing and promoting local poultry genetic resources and breeding, eggs and meat production and processing of local poultry products and by-products for value addition. Marketing channels development supported by information technology innovations were also discussed. These were presented by JANGOLO start-up (https://www.jangolo.cm/ ). The training workshop improved the capacity of participants who were exposed to innovative technologies, modern tools and opportunities to develop and sustain the local poultry value chain. It is envisaged that the enhanced capacity of stakeholders will result in increased agri-entrepreneurship, technology development and uptake by the local poultry industry. The participants are expected to train other stakeholders, thereby increasing the pool of expertise in the local poultry value chain.  4 District. The workshop also analysed case studies, best practices and causes of • Organize farmers into co-operatives to facilitate access to training, 4 District. The workshop also analysed case studies, best practices and causes of • Organize farmers into co-operatives to facilitate access to training,  bottlenecks in local poultry value chain. funding, and other support bottlenecks in local poultry value chain. funding, and other support  Participants were informed of success stories and experiences in local poultry • Train poultry farmers on housing, feeding, health management Participants were informed of success stories and experiences in local poultry • Train poultry farmers on housing, feeding, health management Dates 16-20 November 2020 breeding and distribution from Kenya (KALRO); Tanzania (AKM Glitters) and Ethiopia (ACGG). The investment and business opportunities in the development • Design the epidemiological map and related prophylactic program Dates16-20 November 2020 breeding and distribution from Kenya (KALRO); Tanzania (AKM Glitters) and Ethiopia (ACGG). The investment and business opportunities in the development • Design the epidemiological map and related prophylactic program Venue of the local poultry value chain, were also demonstrated. Other topics covered • Train farmers on ICT and establish networks/platforms to facilitate Douala, Cameroon (Onomo Hotel) included: reproductive technologies; feed technologies and feeding systems; online training, sharing experiences, links with customers Venueof the local poultry value chain, were also demonstrated. Other topics covered • Train farmers on ICT and establish networks/platforms to facilitate Douala, Cameroon (Onomo Hotel) included: reproductive technologies; feed technologies and feeding systems; online training, sharing experiences, links with customers Instructors and their affiliation Christian Keambou Tiambo (CTLGH/ILRI) and Dr Henri Rene Zambou (Equavet Group) health, public health and biosecurity; housing and other infrastructures; • Organize annual national or regional local poultry day where poultry designing successful local poultry agri-business; project design and cycle, cost-benefit analysis; value addition, processing, biosecurity; conservation and bio products are exhibited and producers given awards as incentives Instructors and their affiliationChristian Keambou Tiambo (CTLGH/ILRI) and Dr Henri Rene Zambou (Equavet Group) health, public health and biosecurity; housing and other infrastructures; • Organize annual national or regional local poultry day where poultry designing successful local poultry agri-business; project design and cycle, cost-benefit analysis; value addition, processing, biosecurity; conservation and bio products are exhibited and producers given awards as incentives  Participants consisted of local poultry geneticists, scientists, producers, poultry banking of local poultry genetic resources; and utilization and distribution of elite Participants consisted of local poultry geneticists, scientists, producers, poultry banking of local poultry genetic resources; and utilization and distribution of elite  equipment manufacturers, ICT start-ups, technology developers, feed producers, breeds. equipment manufacturers, ICT start-ups, technology developers, feed producers, breeds. Participant information, including number by gender poultry cooperatives promoters and animal health service providers from the five There were presentations and showcasing by the poultry industry stakeholders agro-ecological zones of Cameroon. Also present were government officials from including: egg incubators manufacturers (GIC-APME and GIC DALUCAM), feed m the Ministry of Livestock, Fisheries and Animal Industries (MINEPIA), and the producer (SPRADY Ltd), animal health service provider (Equavet group), ICT start-Regional Delegate for MINEPIA in the Littoral Region of Cameroon; World Poultry up innovator for poultry information system to support production, market and Science Association (WPSA) Cameroon branch; the Cameroon poultry inter-services delivery (JANGOLO), cooperatives of producers (BUPOFAI COOP, AZ profession (IPAVIC). Among the participants were 11 women and 32 men (see list Elevage, Socoo PRORALOC-Cam, Happy-Birds Happy Eggs, KFARM INDUSTRY, and attached) GreenGold AgroVenture. Participant information, including number by genderpoultry cooperatives promoters and animal health service providers from the five There were presentations and showcasing by the poultry industry stakeholders agro-ecological zones of Cameroon. Also present were government officials from including: egg incubators manufacturers (GIC-APME and GIC DALUCAM), feed m the Ministry of Livestock, Fisheries and Animal Industries (MINEPIA), and the producer (SPRADY Ltd), animal health service provider (Equavet group), ICT start-Regional Delegate for MINEPIA in the Littoral Region of Cameroon; World Poultry up innovator for poultry information system to support production, market and Science Association (WPSA) Cameroon branch; the Cameroon poultry inter-services delivery (JANGOLO), cooperatives of producers (BUPOFAI COOP, AZ profession (IPAVIC). Among the participants were 11 women and 32 men (see list Elevage, Socoo PRORALOC-Cam, Happy-Birds Happy Eggs, KFARM INDUSTRY, and attached) GreenGold AgroVenture.  AU-IBAR, Live2Africa project Key outputs and recommendations of the training workshop included: AU-IBAR, Live2Africa project Key outputs and recommendations of the training workshop included: Funder Press release: https://www.au-ibar.org/home/486-en/media/press-• Need for legal frameworks and regulations to protect local poultry FunderPress release: https://www.au-ibar.org/home/486-en/media/press-• Need for legal frameworks and regulations to protect local poultry  releases/live2/1580-workshop-on-training-of-trainers-tot-on-technologies-for-resources from crossbreeding releases/live2/1580-workshop-on-training-of-trainers-tot-on-technologies-for-resources from crossbreeding  the-promotion-of-local-poultry-value-chain-in-africa • Mapping (GIS) of existing breeders and farmers the-promotion-of-local-poultry-value-chain-in-africa • Mapping (GIS) of existing breeders and farmers  • Characterisation of existing genetic resources, and bio-banking; •Characterisation of existing genetic resources, and bio-banking;  • Identification and selection of pilot local poultry breeders for training •Identification and selection of pilot local poultry breeders for training  • Creation of a platform for stakeholders from the ministry of livestock •Creation of a platform for stakeholders from the ministry of livestock   research, universities, and producers to condense and package and research, universities, and producers to condense and package and   disseminate the results of research on local poultry development disseminate the results of research on local poultry development  • Introduction and promotion of local solar incubators for eggs •Introduction and promotion of local solar incubators for eggs  • The workshop was participatory, consisting of plenary presentations by the Introduce breeding cocks selected from the local gene pool and promote artificial insemination and the primordial germ cell (PGC) facilitators followed by discussions, clarification and sharing of experiences on the various components of the value chain. Working groups were also technology. • The workshop was participatory, consisting of plenary presentations by the Introduce breeding cocks selected from the local gene pool and promote artificial insemination and the primordial germ cell (PGC) facilitators followed by discussions, clarification and sharing of experiences on the various components of the value chain. Working groups were also technology.  established for more focussed deliberations. Hands-on practical field visits were • Determine nutritional requirements of local poultry breeds in established for more focussed deliberations. Hands-on practical field visits were • Determine nutritional requirements of local poultry breeds in  made to Nono Nono Gomes family poultry farm at Lendi at Douala 5 district and a Cameroon made to Nono Nono Gomes family poultry farm at Lendi at Douala 5 district and a Cameroon  structure provider of animal health, EQUAVET GROUP based at Bonaberi, Douala • Formulate complete diets using locally available feed resources in structure provider of animal health, EQUAVET GROUP based at Bonaberi, Douala • Formulate complete diets using locally available feed resources in   each agro-ecological zone each agro-ecological zone  "}],"sieverID":"8567bee2-a9a1-4f93-b3e3-0f89a1b60fa8","abstract":""}

data/part_5/0bf00e299bd4dbb454e284ec29c3c80b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0bf00e299bd4dbb454e284ec29c3c80b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5e5af451-2e54-4115-ab80-769c31ad126f/retrieve"},"pageCount":22,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":89,"text":"Livestock form the main source of livelihoods for smallholder livestock keepers in Ethiopia. Production diseases are among the major constraints to livestock production. Ectoparasitic infestations are common infectious diseases affecting cattle and small ruminant production having huge economic implications. Good hygienic practices play a significant role in preventing and controlling ectoparasitic infestations. However, smallholder livestock keepers have limited awareness and knowledge of the prevention and control of ectoparasites. Raising awareness and knowledge of livestock keepers through experiential training can help prevent and control ectoparasites resulting in decreased economic losses."}]},{"head":"Training objectives and intended outcomes","index":2,"paragraphs":[{"index":1,"size":49,"text":"The overall objective of the training is to increase awareness and knowledge of female and male livestock keepers about the classes, lifecycle and transmission of ectoparasites affecting camel, sheep and goats so that they can take measures to prevent and control infestations and reduce economic and animal welfare impacts."},{"index":2,"size":5,"text":"Specifically, the training aims to:"},{"index":3,"size":16,"text":"• Explain veterinary ectoparasites, their types, general lifecycle and the damage they can cause to animals."},{"index":4,"size":10,"text":"• Describe common veterinary ectoparasites affecting camels, sheep and goats."},{"index":5,"size":21,"text":"• Implement herd health intervention developed to prevent and control the deleterious effect of veterinary ectoparasites on camels, sheep and goats."},{"index":6,"size":2,"text":"Training content "}]},{"head":"Training approach and process","index":3,"paragraphs":[{"index":1,"size":44,"text":"The training adopts a participatory, interactive and gender sensitive approach drawing on livestock keepers' knowledge and experiences. The intrahousehold impact of animal diseases and the roles of different household members in the prevention and control of diseases will be explored. Training methods and materials "}]},{"head":"Session 1. Introduction to ectoparasites","index":4,"paragraphs":[{"index":1,"size":29,"text":"In this session, livestock keepers will learn about the classes, general lifecycle and damages of ectoparasites. They will discuss the economic and public health importance of common ectoparasitic infestations."}]},{"head":"Learning outcomes","index":5,"paragraphs":[{"index":1,"size":12,"text":"By the end of the session, livestock keepers will be able to:"},{"index":2,"size":5,"text":"• Explain what ectoparasites are."},{"index":3,"size":6,"text":"• Identify classes of common ectoparasites."},{"index":4,"size":8,"text":"• Explain the general lifecycle of common ectoparasites."},{"index":5,"size":7,"text":"• Appreciate the damage caused by ectoparasites."}]},{"head":"Content","index":6,"paragraphs":[{"index":1,"size":2,"text":"• Definition"},{"index":2,"size":4,"text":"• Classes of ectoparasites"},{"index":3,"size":8,"text":"Methods and materials Activity 2. What are ectoparasites?"},{"index":4,"size":17,"text":"Find out the local term for 'parasite' and ask participants to share what they know about parasites."},{"index":5,"size":15,"text":"Then, show the images below and ask participants to discuss it in pairs or trios."},{"index":6,"size":8,"text":"• What do you see in the pictures?"},{"index":7,"size":6,"text":"• What could be the problem?"},{"index":8,"size":68,"text":"Ask a few pairs to share their discussion results. Summarize the discussion and highlight the main points. Mention that a parasite is an organism that lives on or in a host organism and gets its food from or at the expense of its host. Ectoparasites are parasites that live outside the body (skin or coat) of another organism called the host. They are usually located in hard-to-reach places."},{"index":9,"size":23,"text":"Communicate the following points to supplement livestock keepers' understanding. As you discuss the points, ask farmers to give examples or share their experiences."},{"index":10,"size":3,"text":"Main learning points:"},{"index":11,"size":34,"text":"• Ectoparasites are organisms that live on or burrow into the surface of their host's epidermis (superficial layers of the skin) upon which they depend for food, shelter and other basic needs to survive."},{"index":12,"size":13,"text":"• Ectoparasites spend all or some portion of their lives parasitizing their hosts."},{"index":13,"size":21,"text":"• Ectoparasites parasitize a wide range of hosts, including: Then, show the image below and explain the common classes of ectoparasites."},{"index":14,"size":18,"text":"Mention that structurally ectoparasites are divided into arachnids (ticks and mites) and insects (flies, mosquitoes, fleas and lice)."},{"index":15,"size":32,"text":"Mention that ectoparasites are generally arthropods that live and feed on the exterior of the host. The most common ectoparasites that infest camel, sheep and goats are ticks, mites, lice and fleas."},{"index":16,"size":25,"text":"Show the image below and discuss the lifecycle of common ectoparasites. Ask participants to share their experiences on the distribution and prevalence of common ectoparasites."},{"index":17,"size":43,"text":"Mention that ectoparasites can reproduce and spread in several ways. The most common form of reproduction is through contact with another host. This can happen when an animal rubs against another animal, encounters a contaminated surface or shares sleeping quarters with another animal."}]},{"head":"Key learning points:","index":7,"paragraphs":[{"index":1,"size":19,"text":"• Generally, ectoparasites reproduce by laying eggs and the biological developmental process through which they pass is called metamorphosis."},{"index":2,"size":10,"text":"• Metamorphosis includes various morphological changes through the developmental stages."},{"index":3,"size":21,"text":"• Understanding the life cycle of ectoparasites is essential to preventing their spread and keeping animals healthy and in good condition."},{"index":4,"size":9,"text":"Activity 4. Economic and public health importance of ectoparasites"},{"index":5,"size":22,"text":"Ask participants to mention what they think are the effects of ectoparasites on camel, sheep and goat production, their livelihoods and health."},{"index":6,"size":5,"text":"Use the following discussion questions:"},{"index":7,"size":14,"text":"• What could be the effects of ectoparasites on camel, sheep and goat production?"},{"index":8,"size":13,"text":"• What could be the effect of ectoparasites on livelihood and public health?"},{"index":9,"size":12,"text":"• How could ectoparasitic infestations affect men, women, boys and girls differently?"},{"index":10,"size":8,"text":"Summarize the discussion and highlight the main points."},{"index":11,"size":34,"text":"Mention that ectoparasites are involved in mechanical damage, anaemia, loss of condition, irritation, allergic reaction, toxicosis, morbidity and mortality. They are detrimental to the life of the host, causing cutaneous lesions and transmitting pathogens."},{"index":12,"size":11,"text":"Communicate the following main points, asking farmers to share their stories."},{"index":13,"size":3,"text":"Main learning points:"},{"index":14,"size":27,"text":"• Effect on animal health and production In this session, smallholder livestock keepers will learn about common ectoparasites affecting camels, sheep and goats and how they spread."}]},{"head":"Learning outcomes","index":8,"paragraphs":[{"index":1,"size":12,"text":"By the end of the session, livestock keepers will be able to:"},{"index":2,"size":10,"text":"• Explain how ectoparasites of camels, sheep and goats spread."},{"index":3,"size":11,"text":"• Explain the damage ectoparasites cause on camels, sheep and goats."},{"index":4,"size":11,"text":"• Identify species of common ectoparasites of camels, sheep and goats."},{"index":5,"size":9,"text":"• Explain transmission pathways of mange mites and lice."},{"index":6,"size":9,"text":"• List parasitic flies of camels, sheep and goats."}]},{"head":"Content","index":9,"paragraphs":[{"index":1,"size":10,"text":"• Common ticks affecting camels, sheep and goats Discussion questions:"},{"index":2,"size":8,"text":"• What do they see in the picture?"},{"index":3,"size":7,"text":"• What is happening in the picture?"},{"index":4,"size":5,"text":"• Why is it happening?"},{"index":5,"size":6,"text":"Encourage participants to share their views."},{"index":6,"size":8,"text":"Summarize the discussion and highlight the main points."},{"index":7,"size":20,"text":"Mention that ticks are external parasites, living by feeding on the blood of mammals, birds and sometimes reptiles and amphibians."},{"index":8,"size":14,"text":"Find out the local term for 'tick' and why it is named like that."},{"index":9,"size":16,"text":"Using the image below, discuss the common species of ticks that affect camels, sheep and goats."},{"index":10,"size":13,"text":"Discuss the following points, asking farmers to give examples or share their experiences."},{"index":11,"size":11,"text":"Check for understanding and ask farmers if they have any questions."},{"index":12,"size":3,"text":"Main learning points:"},{"index":13,"size":20,"text":"• Ticks are obligate, blood feeding ectoparasites of camel, goat, sheep, cattle, horse, donkey, humans, birds, wild animals and others."},{"index":14,"size":23,"text":"• They remove large amount of blood from their hosts, transmit several diseases and their saliva cause irritation and sometimes paralysis in animals."},{"index":15,"size":10,"text":"• Ticks can transmit different diseases from animals to humans."},{"index":16,"size":8,"text":"• There are two types (families) of ticks:"},{"index":17,"size":9,"text":"°The hard ticks (Ixodidae) and °The soft ticks (Argasidae)"},{"index":18,"size":33,"text":"• Hard ticks have a hard covering (scutum), which extends over the whole dorsal surface of the adult male (small) but covers only a small area in the larva, nymph and female (big)."},{"index":19,"size":15,"text":"• Some ticks have coloured enamel like areas on the body and some are not."},{"index":20,"size":20,"text":"• Some ticks stay on one host and others move from one animal to another in their development (life) cycle."}]},{"head":"Activity 2. Common mites affecting camels, sheep and goats","index":10,"paragraphs":[{"index":1,"size":12,"text":"Show the images below and ask participants what they think about them."},{"index":2,"size":2,"text":"Discussion questions:"},{"index":3,"size":8,"text":"• What do you see in the pictures?"},{"index":4,"size":7,"text":"• What is happening in the pictures?"},{"index":5,"size":5,"text":"• Why is it happening?"},{"index":6,"size":9,"text":"Activity 3. Find out the local term for 'lice'."},{"index":7,"size":26,"text":"Using the poster below, discuss the transmission of lice, asking participants to share their experiences of how lice spread and cause damage in humans and animals."},{"index":8,"size":3,"text":"Main learning points:"},{"index":9,"size":11,"text":"• Lice are permanent obligate ectoparasites, which are highly host specific."},{"index":10,"size":19,"text":"• They are small wingless insects and possess stout legs and claws for clinging tightly to fur and hair."},{"index":11,"size":19,"text":"• Transfer of lice from animal to animal or from herd to herd is usually by direct physical contact."},{"index":12,"size":16,"text":"• Lice are blood feeders and heavy infestations can significantly reduce weight gain and milk production."},{"index":13,"size":21,"text":"• Light infestation may have no obvious effects, but pruritis, dermatitis and hair loss are usually evident at heavier parasite loads."},{"index":14,"size":16,"text":"• Linognathus species and Bovicola species are the most common lice specious infesting sheep and goats."},{"index":15,"size":10,"text":"• Microthoracius cameli is the most common louse infesting camels."}]},{"head":"Activity 4. Common fleas affecting camels, sheep and goats","index":11,"paragraphs":[{"index":1,"size":12,"text":"Show the images below and ask participants what they think about them."},{"index":2,"size":33,"text":"Then, using the poster below, discuss common parasitic flies that affect camels, sheep and goats. Explain how they spread and the damage they cause to animals, asking for examples and experiences from participants."},{"index":3,"size":3,"text":"Main learning points:"},{"index":4,"size":16,"text":"• Flies have one pair of wings and they can be parasites as larvae or adults."},{"index":5,"size":15,"text":"• Some adult flies feed on body secretions, blood and tissue fluid of their hosts."},{"index":6,"size":22,"text":"• The larvae of certain dipterans can develop in the tissues of many domestic animals. This results in a condition called myiasis."},{"index":7,"size":13,"text":"• The larvae of myiasis producing flies are extremely host and site specific."},{"index":8,"size":11,"text":"Session 3. Preventing and controlling common ectoparasites affecting camels and shoats"},{"index":9,"size":42,"text":"In this session, livestock keepers will learn about a herd health approach to preventing and controlling common ectoparasites affecting camels and small ruminants. Drawing on their experiences, participants will discuss integrated prevention and control measures for common ectoparasites affecting camels and shoats."}]},{"head":"Learning outcomes","index":12,"paragraphs":[{"index":1,"size":11,"text":"By the end of the session, participants will be able to:"},{"index":2,"size":8,"text":"• Attend community based strategic ectoparasite control programs."},{"index":3,"size":9,"text":"• Seek treatment of infested animals from professional personnel."},{"index":4,"size":15,"text":"• Improve hygienic practices within the herd. Summarize the discussion and highlight the main points."}]},{"head":"Content","index":13,"paragraphs":[{"index":1,"size":14,"text":"Then, discuss the following points, asking farmers to give examples or share their experiences."},{"index":2,"size":3,"text":"Main learning points:"},{"index":3,"size":10,"text":"• Isolating clinically diseased animals (in the case of mange)"},{"index":4,"size":7,"text":"• Avoiding sharing of harnesses between animals"},{"index":5,"size":9,"text":"• Early treatment of a wound to avoid myiasis"},{"index":6,"size":15,"text":"• Do not pick ticks with your hand Activity 4. Learning integration and action plans"},{"index":7,"size":20,"text":"Recap and communicate key action messages that livestock keepers should take to prevent and control ectoparasites affecting camel and shoats."},{"index":8,"size":21,"text":"Ask a few female and male livestock keepers to reflect on their learning experiences and identify key home take action messages."},{"index":9,"size":22,"text":"Then, encourage them to identify practical actions that they can take to prevent and control common ectoparasites affecting camels, sheep and goats."}]}],"figures":[{"text":"Find out the local term for 'ectoparasite'. Then, ask participants to explain what they think are ectoparasites, giving examples from their experiences. "},{"text":" °Livestock (camel, goats, sheep, cattle, equines, poultry) °Companion animals (dogs, cats) °Fishes °Bees °Humans Activity 3. Classes and lifecycle of common ectoparasites Ask livestock keepers to mention examples of ectoparasites from their experiences. "},{"text":" °Blood loss (anaemia) °Myiasis: the infestation of the living tissues with fly larvae °Skin inflammation and pruritus °Toxic and allergic responses °Disturbance and self wounding °Serve as a vector for several diseases • Economic effect °Skin damage causes poor skin and hides quality °Additional cost for treatment and control • Public health effect °Ectoparasites affecting animals may also parasitize humans and cause diseases (e.g. infestation of mites) °Some ectoparasites serve as vectors of human diseases (e.g. Hyalomma species transmit Anaplasma pathogens to humans) °Ectoparasites can also cause a social nuisance Session 2. Common ectoparasites affecting camels, sheep and goats "},{"text":"• Community based strategic ectoparasite control program • Treating ectoparasite infested animals • Improving hygienic practices within the herd Community based strategic ectoparasite control program Find out what ectoparasite control services participants receive in their community. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":" as the development agents continue mentoring and supporting the livestock keepers after the training. Participating couples (both wife and husband) in farmer/pastoralist training events will also increase training application at the household level.  "},{"text":" Mention that the training is about common ectoparasite prevention and control. Ask participants what they expect from the training and what they hope to change due to the training. Then, explain the training objectives and expected outcomes. • Interactive discussion • Interactive discussion • Examples/scenarios • Examples/scenarios • Pictures • Pictures Duration: 1 hour Duration: 1 hour Learning activities Learning activities Activity 1. Welcome and expectations Activity 1. Welcome and expectations  "},{"text":" Show the image below and ask participants what they think about it. Learning activities Learning activities Activity 1. Common ticks affecting camels, sheep and goats Activity 1. Common ticks affecting camels, sheep and goats Methods and materials Methods and materials • Interactive discussion • Interactive discussion • Storytelling/experience sharing • Storytelling/experience sharing • Pictures/posters • Pictures/posters • Cases/scenarios • Cases/scenarios Duration: 2 hours Duration: 2 hours  "},{"text":" Common lice affecting camels, sheep and goats Show the image below and ask participants what they think about it. Ask them to give examples of insects that feed on human and animal blood.  "}],"sieverID":"f631fb3f-c78e-4447-b516-4e426094f956","abstract":""}

data/part_5/0bf3a9ad948b34159f21fed2ee77b1d4.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0bf3a9ad948b34159f21fed2ee77b1d4","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H041922.pdf"},"pageCount":10,"title":"","keywords":[],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":139,"text":"It is estimated that the health impact of naturally occurring fluoride is widespread (WHO, 2004) with more than 200 million people worldwide estimated to be drinking water in excess of the WHO guideline value of 1.5 mg/l (Edmunds and Smedley, 2005). Fluoride is beneficial to bone and dental development in humans but the consumption of high fluoride (> 1.5 mg/l) may cause severe health hazards such as dental mottling, skeletal fluorosis and, more rarely, skeletal radiculomyopathy (WHO, 1970;1984). Changes in groundwater quality are caused directly or indirectly by various human activities. Direct effects occur when natural or artificial substances are introduced into a hydrochemical cycle by human activities. Indirect effects are considered to be those changes, for example in fluoride content, that occur in a hydrochemical cycle without the addition of substances by human activities (Matthess et al., 1985)."},{"index":2,"size":35,"text":"In this paper, groundwater vulnerability in the crystalline rock aquifers in southern Sri Lanka is discussed in terms of inorganic (principally fluoride) and microbiological contamination that may pose permanent or temporary health effects in humans."},{"index":3,"size":123,"text":"Groundwaters that contain high hardness, salinity, iron and manganese are rarely consumed by the local communities in the area due to the colour and unpleasant taste of the water. Consequently, less attention is given to the study of the adverse effects of these parameters as they do not pose as much risk to human heath in the area. However, there is a greater risk of high ferrous iron and aluminium contamination from surface waters mainly in the south of the region thought to be associated with waste disposal and migration of wastes by surface runoff which, in turn, feeds the irrigation canals in downstream areas. Aluminium can pose permanent health (neurotoxic) effects causing brain damage in people who consume surface waters (Bilkei-Gorzo, 1993)."},{"index":4,"size":432,"text":"Fluoride poisoning from groundwaters is the greatest threat in the south of Sri Lanka in terms of health advisory concerns. This risk has already been identified by various people (e.g. Dissanayake, 1979) but the distribution of fluoride in the area has not been well understood. The WHO recommended level for fluoride (1.5 mg/l) is inappropriate for hot and dry climates such as experienced in Sri Lanka, given the high intake of water by people of 3 to 4 litres per day (Apambire et al., 1997). Consequently, the recommended upper limit for fluoride in drinking water is Vulnerability of regional crystalline rock aquifers to fluoride contamination: a case study from southern Sri Lanka L.D. Rajasooriyar 1,3 , K.M. Hiscock 1 & E. Boelee 2 1 School of Environmental Sciences, University of East Anglia, Norwich NR4 7TJ, UK 2 International Water Management Institute, Colombo, Sri Lanka 3 Present address: Department of Geography, University of Jaffna, Jaffna, Sri Lanka ABSTRACT: The estimated health impact of naturally occurring fluoride is considered to be more widespread than arsenic (WHO, 2004). From the known global distribution of endemic fluorosis, the most affected regions are in arid to semi-arid climatic zones. Fluoride (F -) in its most common form is found in several geological environments including igneous, sedimentary and metamorphic rocks and leaching of Finto surface, soil and ground waters is the most common cause of fluoride endemics worldwide. This paper presents a groundwater pollution vulnerability assessment based on the detailed hydrochemical survey completed by Rajasooriyar (2003) of the regional distribution of high-Fgroundwaters in the Uda Walawe Basin in the dry zone of southern Sri Lanka. Fluoride in groundwater was found to be predominantly from a geological source, mainly fluorine-bearing silicate minerals such as biotite and hornblende. Specific hydrogeological conditions, mainly rock-water interactions and groundwater recharge and discharge patterns, were found to determine the vulnerability of groundwater to fluoride. The groundwater vulnerability is higher in areas where there is limited recharge that promotes longer residence times and greater rock-water interaction. Of secondary importance is high evapotranspiration in the downstream catchment areas where Fis concentrated in shallow groundwaters, whereas in upstream areas Fconcentrations are additionally controlled by dilution in those areas that have been developed under an irrigation scheme. 0.8 mg/l for Sri Lanka (Warnakulasuriya et al., 1990). Across southern Sri Lanka, fluoride shows concentrations above the health advisory limits (either >0.8 mg/l or 1.5 mg/l) in several isolated localities. These concentrations are above the levels at which propagation of dental fluorosis is thought to occur and are high enough that skeletal fluorosis and skeletal radiculomyopathy may occur (Hudak, 1999)."},{"index":5,"size":142,"text":"Endemic dental fluorosis in relation to drinking water fluoride concentrations has already been identified in some high Fregions in Sri Lanka (e.g. Dissanayake, 1991;Dissanayake, 1996). In the Uda Walawe Basin in southern Sri Lanka, van der Hoek et al. (2003) studied the relationship between the sources of drinking water and other potential risk factors that determine dental fluorosis in the basin. Children aged 14 were selected since by that age the permanent dentition is complete. Two schools, Padalangala and Suriyawewa showed a prevalence of dental fluorosis of 55% (n=99) and 36% (n=69), respectively. Prevalence of dental fluorosis in the whole catchment (among 518 14-year old students) was 43%. It was found that the consumption of high fluoride water was the major factor controlling the prevalence of dental fluorosis. No data were available to study the prevalence of skeletal fluorosis in the basin."},{"index":6,"size":92,"text":"The study reported in this paper is based on research in the Uda Walawe Basin situated in the southern lowlands of Sri Lanka extending south from the Central Highlands. For the purpose of this study, an area of the Uda Walawe Basin covering approximately 350 km 2 was selected, divided into the Uda Walawe, Suriyawewa and Ridiyagama subcatchments. This region experiences hot and humid conditions with an average annual temperature of 28ºC, approximate humidity of 77%, average annual rainfall of 1979 mm and average annual potential evapotranspiration of 1988 mm (Nandalal, 2001)."},{"index":7,"size":129,"text":"The basin has been developed under an irrigation scheme based on a large dam and reservoir on the Walawe River. The Walawe River runs across the region from north of the reservoir to Ambalantota on the coast in the south. Surface water reservoirs and a network of main and distribution canals cover a large area of the region except in the south-east corner of the downstream area. Recent studies in the Uda Walawe sub-catchment have demonstrated a close relationship between water flows in the unlined irrigation canals and nearby shallow groundwater levels. Measures to increase the efficiency of transport of irrigation water to the downstream areas have included the lining of the irrigation canals; however shallow wells fall dry within a few months after lining (Meijer et al., 2006)."}]},{"head":"GEOLOGY AND GROUNDWATER QUALITY","index":2,"paragraphs":[{"index":1,"size":43,"text":"Geology is important in controlling the contaminants related to groundwater such as fluoride and arsenic and in determining their concentrations (Hudak, 1999;Smedley and Kinniburgh, 2002). In the Uda Walawe Basin, geology is one of the major factors that determine the quality of groundwater."},{"index":2,"size":202,"text":"Most of the fluoride-rich areas in Sri Lanka show high fluoride concentrations in association with charnokitic gneisses associated with pegmatites and intrusive granites. A survey carried out by the National Water Supply and Drainage Board (Ariyaratne et al., 1982) in the north-eastern part of the Uda Walawe Basin (Monaragala district) indicated clusters of high fluoride concentrations in association with charnockites and hornblende-biotite gneisses. Marbles and calc gneisses also constitute rock assemblages associated with high fluoride zones. Dharmagunewardene (1999), who studied the north-central province of Sri Lanka, found Fin abundance (30 to 90% of F -) in association with biotite. Dharmagunewardene (1999) also noticed a wide occurrence of biotite among all granites and gneisses. Fluoride occurrences in similar geological environments have been noticed in many parts of the world and also in sedimentary formations such as sandstone, siltstone and conglomerate sediments (Boyle and Chagnon, 1995). In the Indian sub-continent, Norway, China and Ghana, Foccurrences have been noticed in association with crystalline rocks, in charnockites, granites, pegmatites and gneisses. Association of Fwith biotite and hornblende has been observed in most of these geologies (Liu Yong and Zhu Wan Hua, 1991;Vijayakumar et al., 1991;Apambire et al., 1997;Sarma and Rao, 1997;Rao, 1997;Banks et al., 1998;Moreau, 2001)."},{"index":3,"size":108,"text":"Commonly occurring fluorine-bearing minerals in the Uda Walawe Basin are biotite and hornblende but fluoride can also be attributed to apatite (though present in accessory amounts), plagioclase and Kfeldspar-bearing rocks (Sahasrabudhe, 1977;Jacks, 1979). Figure 1  land Series. Both regions are covered by fluorinebearing rocks but the Vijayan Complex is abundant in granites that are rich in fluorine-bearing-minerals (Dissanayake and Weerasooriya, 1985). Although rock water interaction patterns strengthen the argument for release of fluoride, the distribution does not show similar geological patterns throughout the north-western area. In general, it is important to note the marked variation in the geological structure and the hydrogeological conditions of the two geological provenances."},{"index":4,"size":98,"text":"The south-eastern corner of the basin is well known for the nature of its fracture discontinuities related to the geological structure. This nature is also observed in the aquifer properties and the well yields. This area lacks an irrigation network and totally depends on rainfall to recharge the aquifers directly or through leakage of seasonal surface water bodies. Depending on the above conditions, longer groundwater residence times can occur in this area as indicated by high concentrations of magnesium. This suggests more rock-water interaction in the southeast part of the basin and more fluoride release into the system."},{"index":5,"size":63,"text":"The north-west area (Highland Series) shows patterns of better hydraulic continuity of aquifer properties indicating quite substantial groundwater flow from interconnected fractures. Mixing of waters from interconnected fractures may be one of the major factors controlling the high concentrations of fluoride in this area. Also, the north-west corner is not subjected to direct irrigation return flows which may limit dilution and increase Fconcentrations."},{"index":6,"size":124,"text":"Geology may also play a role in controlling microbiological contamination in deeper aquifers in the Uda Walawe Basin where there are more confined conditions. Confined or semi-confined aquifers are less vulnerable to microbial pollution as they are not affected by direct surface water infiltration. This was confirmed by Prado (2002) who showed that the isotopic composition of deep groundwater has signatures suggesting an origin from less evaporated rain water (Prado, 2002) with E.coli. pollution observed only in a single deep well. Tube wells are more protected from surface contamination than shallow wells and are therefore less likely to be affected by faecal pollution. This was confirmed by a study carried out by Shortt et al. (2003) on thermotolerant coliform bacteria in the Suriyawewa sub-catchment."},{"index":7,"size":21,"text":"According to Shortt et al. (2003), lower E.coli. counts were found in the deep tube wells than the shallow dug wells."}]},{"head":"LAND","index":3,"paragraphs":[{"index":1,"size":198,"text":"USE, IRRIGATION AND GROUNDWATER QUALITY Leachate from human and animal waste matter and industrial and agricultural inputs or wastes are major sources of groundwater pollution in many parts of the world (Dissanayake and Chandrajith, 1999). Contaminant loading of the surface or sub-surface in the Uda Walawe Basin is primarily from the following sources: (i) the intensification of irrigated agriculture and the accompanying use of fertilisers and pesticides; and (ii) widespread on-site disposal of wastes or un-sewered domestic wastes. Lawrence (1986) suggested that in basement aquifers in Sri Lanka into which water supply tube wells are drilled, the pollution risk from pit latrines are due to the following reasons: (i) a thin unsaturated zone; (ii) a thin overburden into which pit latrines penetrate or are close to the top of the bedrock; (iii) groundwater movement restricted to joints and fissures; (iv) pressure to reduce the distance between latrines and water supply tube wells (mostly in urban areas); (v) water-flush pit latrines commonly in use and so increasing the fluid loading and likelihood of microbiological pollution, and in the longer term, nitrate contamination of groundwater; and (vi) a generally steep water table gradient, thus increasing the rate of groundwater movement."},{"index":2,"size":63,"text":"The Uda Walawe Basin was developed under a dry zone irrigation agricultural scheme. When land is brought under cultivation and irrigation, the composition of groundwaters tend to show changes related to local conditions. This is mainly due to the following factors: (i) irrigation water differs in composition compared to groundwater; and (ii) irrigation water promotes leaching of natural and artificial constituents into groundwater."},{"index":3,"size":84,"text":"Leaching of constituents through irrigation water has been noticed in many parts of the world. In southern Texas, low recharge rates, irrigation return flow and natural constituents of water-bearing rock formations contribute to high fluoride levels (Hudak, 1999). However, studying the impact of irrigation water on groundwater composition has its limitations as land under cultivation in the Uda Walawe Basin is cultivated depending on the seasonal rainfall and irrigation water availability. Irrigation returns can even occur during rainy seasons depending on short-term drought conditions."},{"index":4,"size":84,"text":"There is little evidence to show that land use is controlling fluoride concentrations across the area (Ra-jasooriyar 2003). Fluoride occurrence is predominantly controlled by the geological factors with a very limited input of phosphate fertilisers in the area. Fluoride occurrence shows no correlation with nutrients (particularly phosphate) that are associated with fertilisers. Areas associated with high concentrations of fluoride are not in agricultural areas but occur in areas of scrub and forest that experience low recharge (a minimum recharge of 80 mm/year) from rainfall."},{"index":5,"size":258,"text":"The irrigation system may have a significant influence in controlling the concentrations of ions in the Uda Walawe Basin. In general, shallow dug wells situated close to the irrigation canals have lower concentrations of ions compared to wells located further from the canals. Results obtained from a dental fluorosis survey showed low fluoride concentrations in wells located closer to surface waters or paddy fields but high concentrations in wells more than 20 m away (van der Hoek et al., 2003). Low Fconcentrations in wells close to the irrigation canals suggest that irrigation water may play a significant role in diluting F -. However, dilution effects depend on a number of factors, such as concentrations of fluoride in both surface and ground waters in relation to individual localities, amount of recharge, evaporation, local geology and hydrochemistry of the local area. Figure 2 shows the distribution of fluoride in relation to the irrigation water canals and includes a number of shallow water localities which were sampled in the dry season. Figure 2 shows only the main canals in Uda Walawe and Suriyawewa sub-catchments and the branch canals in Ridiyagama sub-catchment. Fluoride concentrations show both low and high concentrations along the canals but most of the shallow well localities show patterns of lower concentrations in wells that are in closer proximity to surface water. However, dilution effects do not necessarily reduce the risk of fluoride in the Uda Walawe Basin as most of the wells that have lower Fconcentrations due to dilution are still above the Sri Lankan health advisory limit."},{"index":6,"size":145,"text":"Even recharge though irrigation water apparently plays a role in diluting groundwater, there is little additional evidence to show that the surface water chemistry is impacting the shallow groundwaters. Substances, mainly fluoride, in shallow groundwater always occur in very high concentrations compared to surface water. As noticed, the Uda Walawe and Suriyawewa sub-catchments that receive water from the Uda Walawe reservoir (low metal concentrations) do not show any marked variation in the shallow water ion concentrations compared to the Ridiyagama sub-catchment which receives water from a different diversion and which was noticed to have a different quality (high metal concentrations) of irrigation water. In general, high concentrations of dissolved constituents were measured in water in the wet season when weathered materials are washed out by rain water. There is, therefore, a higher risk from consuming water in the wet season than in the dry season."},{"index":7,"size":158,"text":"Irrigation water may play a major role in determining the distribution of microbial contamination. Canal water is used by the villagers for domestic purposes and by animals, mainly cattle and buffalo. According to Shortt et al. (2003), numbers of E.coli. were observed to decrease from surface water to shallow groundwater and from shallow to deep groundwaters. Shortt et al. (2003) also noted lower levels of microbial pollution in lined wells compared to unlined wells but noticed no variation in bacteria levels along an irrigation canal. However, this pattern was not seen in the study by Prado (2002) who measured increasing numbers of E.coli. along irrigation canals. In general, no relationship was established by Shortt et al. (2003) and Prado (2002) between the level of faecal pollution in wells and their relative distance from irrigation canals and this suggests both a pollution migration from surface water into groundwater and a predominance of point source pollution from sewage waste disposal."},{"index":8,"size":160,"text":"Most of the agricultural land in the area is subjected to high fertiliser inputs. In addition, there are no proper human and animal waste disposal systems with an estimated 30% of residences without human waste disposal systems and the remaining 70% with water-flush pit latrine systems. These conditions, along with a shallow water table and the prevailing geological conditions mean that groundwater in the area is subject to a serious pollution risk. The land under paddy and banana cultivation in the Uda Walawe Basin does not show any evidence of groundwater contamination by high nitrate loading from fertiliser applications. Nitrate can be reduced in water-logged conditions and this is the principal mechanism controlling NO 3 concentrations in these areas. However, there is a risk of high NO 3 concentrations from improper human and animal waste disposal as observed in the south-east part of the basin. This risk is minimised in areas with lower recharge where there are favourable oxidation conditions. "}]},{"head":"Position of Figure 2 (full width across the type area, near to the end of this section of text)","index":4,"paragraphs":[]},{"head":"DEVELPOMENT OF A GROUNDWATER VULNERABILITY MAP","index":5,"paragraphs":[{"index":1,"size":95,"text":"Groundwater vulnerability mapping identifies regions that are likely to be affected by contamination. The actual risk of contamination will be dependent upon sources of contaminant being present in selected locations and their occurrence. The factors (limitations) that led to the development of a groundwater vulnerability map for the Uda Walawe Basin were as follows: (i) availability of mineralogical and geological structural information; (ii) knowledge of aquifer heterogeneity; (iii) absence of a detailed soil map; (iv) absence of an up-to-date land use map; and (v) knowledge of hydrochemical parameters showing spatial variation in point source contamination."},{"index":2,"size":157,"text":"The groundwater vulnerability map created during this study (Figure 3) was developed mainly with regard to the main risk parameters of fluoride, nitrate and arsenic. The area is also subjected to high microbiological pollution risk, but this factor was not included due to limitations on available information. A few factors were selected in addition to the hydrochemical parameters in order to assess the groundwater vulnerability and to decide qualitatively the vulnerability rating. These factors included: (i) geological classification into two major groups depending on mineralogy (fluorine-bearing minerals) and geological structure; (ii) hydrogeological classification as shallow regolith (weathered) aquifers and deep hard rock (fracture) aquifers and, additionally, high transmissivity aquifer zones and low or moderate transmissivity aquifer zones; (iii) recharge classified into two major groups as areas subjected to rainfall and irrigation recharge and areas subject only to rainfall recharge; and (iv) salt-water mixing classified into two major groups as areas close to and away from the coast."},{"index":3,"size":141,"text":"Mineralogy was classified as rocks that are likely or unlikely to bear Fand As. Geological structure was classified according to the major geological units: the Highland series with a greater fracture network and few clay formations and the Eastern Vijayan Complex with a lower fracture network and more clay formations. Good and poor transmissivity zones were defined according to the geological units: the Highland Series with good transmissivity and the Eastern Vijayan Complex with low and moderate transmissivity. Rainfall recharge areas were classified as low recharge areas and the areas with rainfall and irrigation as high recharge areas. Depending on the above factors, low, medium and high vulnerable areas were defined qualitatively using expert judgement. Chloride risk was assessed by relating the areas to the proximity of the sea that are likely to be affected by sea-salt spray and saline intrusion."},{"index":4,"size":175,"text":"The results of the groundwater vulnerability classification are shown in Figure 3. The Eastern Vijayan Complex is underlain by more fluorine-bearing minerals and subjected to limited fracture continuities, limited transmissivity and more clay formations. This allows more rock-water interactions and greater release of F -. However, areas subjected to irrigation recharge in the Eastern Vijayan Complex show dilution effects and less Fin general. The Highland Series rocks contain more fracture continuities, higher transmissivities and less clay formations and are subjected to a dense irrigation network. In places, fractures tend to increase Fconcentrations due to groundwater flow from the interconnected fractures or aquifers but, in general, geological structures and high irrigation recharge in turn control the risk of Fand As in the Highland Series zone. Nitrates and phosphates do not pose any immediate risk in paddy and banana cultivated lands in both geological areas where they are subjected to irrigation recharge, although there is a large amount of fertiliser input. Shallow wells close to the sea face the risk of seasalt spray and mixing with seawater."}]},{"head":"Position of Figure 3 (one column width, near to the end of this section of text)","index":6,"paragraphs":[{"index":1,"size":41,"text":"Figure 3. Groundwater vulnerability map for the lower Uda Walawe Basin, Sri Lanka, derived qualitatively with regard to the locally important human health risk parameters of fluoride, arsenic and nitrate in groundwater from dug wells and tube wells. After Rajasooriyar (2003)."}]},{"head":"STRATEGY FOR GROUNDWATER PROTECTION IN THE UDA WALAWE BASIN","index":7,"paragraphs":[{"index":1,"size":160,"text":"The control of irrigation in determining the concentrations of ions is clearly observed in the area. However, irrigation water returns cannot always minimise the risk of groundwater contamination as in the case of fluoride where high concentrations of fluoride are found close to the irrigation canals. The western half of the Uda Walawe Basin which is covered by the Highland Series rocks is a good example of this situation. In general, this area exhibits low groundwater vulnerability except in the north-west corner which is subjected to fracture continuities that control the hydrochemistry. As a result, this area experiences a high risk of fluoride concentrations even though it is subjected to irrigation water returns. However, in general, it is clear that the problems related to high concentrations of fluoride are effectively reduced in the irrigated areas compared to the areas that lack irrigation. In terms of health advisory limits, fluoride concentrations in the irrigated areas pose lower health risks to humans."},{"index":2,"size":56,"text":"Irrigation water practices may also play a significant role in controlling the hydrogeology of the area. It is clear that the shallow wells are fed by irrigation returns which may also feed the Walawe River through baseflows. Any attempt made to control the seepage from canals may therefore result in a hazardous hydrogeological and hydrochemical situations."},{"index":3,"size":77,"text":"In conclusion, irrigation water management and maintenance of wells in shallow aquifers may help improve the inorganic quality of shallow groundwater but may result in an unintended outcome in consideration of microbiological conditions. This is unavoidable due to current human activities, where surface water is commonly in use for domestic purposes (for people and animals) and used as a media for waste disposal. Therefore, appropriate measures should be taken to overcome the microbiological contamination in shallow groundwaters.  "}]}],"figures":[{"text":"Figure 1 . Figure 1. Fluoride distribution in relation to geology in the Uda Walawe Basin during the wet season (January-February, 2001).AfterRajasooriyar (2003). "},{"text":"Figure 2 . Figure 2. Fluoride concentration in relation to irrigation in the Uda Walawe Basin during the wet and dry seasons (January-February and July-August, 2001). After Rajasooriyar (2003). "},{"text":" Figure1 "},{"text":"Figure 3 Figure 3 "}],"sieverID":"4dd4d921-6404-4332-ad3e-4aa3618e66f9","abstract":""}

data/part_5/0c475023d57ce43c8c503f2668c3f965.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0c475023d57ce43c8c503f2668c3f965","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7c31576c-42ff-4aab-91c8-4089477c35b3/retrieve"},"pageCount":9,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":27,"text":"• Goats and engagement in goat value chains offer a strategic opportunity to strengthen women's empowerment, climate resilience, and improved nutrition: Research Questions Results: Women's Empowerment (WE)"},{"index":2,"size":71,"text":"Goat Management: Primarily women's responsibility; men are engaged in other livelihood activities and larger ruminants • \"Usually, women have no decision on sheep and cattle. However, they are the ones who mainly manage the goats. They meet most of their needs and those of their children thanks to these goats\" [FGD, Men]. • \"Women do not always have access to fertile land to be able to fully develop their agricultural activities."},{"index":3,"size":15,"text":"Therefore, we can only fall back on goat breeding to fill the gap\" [FGD, Women]."},{"index":4,"size":104,"text":"Processing Products: Women's roles differ by geography; many women process goat milk into different products; lack of training and capacity building opportunities or reliable access to electricity and/or cold chain support limit upgrading • \"We want to process goat's milk but unfortunately, we do not have the required skills. We have not received any training for this\" [FGD, Women] • \"We also have a concern about preserving our products, especially milk. In the whole village, there are only four fridges and it's really minimal\" [FGD, Women] Marketing and Sales: Given social norms, men manage all goat sales but these incomes are managed by women"},{"index":5,"size":27,"text":"• \"Goats generally belong to women, but men are responsible for selling them. However, the income from this sales activity belongs entirely to [women]\" [FGD, Women] #AdaptFutures23"},{"index":6,"size":3,"text":"Results: Climate Resilience "}]},{"head":"However, variable climate conditions affect goat breeding and management","index":2,"paragraphs":[{"index":1,"size":115,"text":"• Reduced pasture/grazing lands: \"The rains have become more and more irregular, and temperatures are increasing day by day. This has a negative impact on our goats because pasture is becoming rarer and even the small trees that served them as aerial grazing are starting to disappear, we hardly see them anymore. So, we are forced to feed them on our own\" [FGD, Women] • Additional investments required to supplement goat feed: \"Last year, due to a bad rainy season, we did not have enough grass to feed our goats and we recorded many deaths among them. So, we had to buy livestock feed to feed them, and it was so expensive\" [FGD, Women] #AdaptFutures23"}]},{"head":"Results: Nutrition","index":3,"paragraphs":[{"index":1,"size":43,"text":"Preferences to consume goat milk from household herd, but preferences vary • \"We even had the tradition of first giving goats milk to our newborns before mother's milk because it is considered that the goat has a high degree of intelligence\" [FGD, Women]."},{"index":2,"size":36,"text":"• \"I personally don't like goat milk. By consuming it, I can spend a whole day scratching my skin, it makes me really uncomfortable. This may be because I'm not used to pasteurizing it\" [FGD, Women]."}]},{"head":"Households only slaughter goats for ceremonies or celebrations","index":4,"paragraphs":[{"index":1,"size":31,"text":"• \"We are really not used to eating goat meat without any ceremony. Instead, we prefer to sell the goat and use the money to pay for our needs\" [FGD, Women]."},{"index":2,"size":50,"text":"Preferences to sell goats for income, but purchase meat from the market • \"Generally, the meat we eat is bought at the market. Indeed, our goats constitute our portfolio, they allow us to obtain income and meet our family needs. So, we cannot afford to consume them constantly\" [FGD, Men].  "}]}],"figures":[{"text":" Source of livelihoods: Through income generation (Thornton 2010) ➢ WE: Women are often primarily responsible for goat management (Sow et al. 2021; 3ie 2020; Ogolla et al. 2022) ➢ Climate resilience: Low maintenance, tolerant of variable and harsh conditions; and short gestation periods (Darcan and Silanikove 2018; Duebuf et al. 2023); source of insurance and adaptation strategy during periods of shocks and stress ➢ Source of nutrition: Goat milk often consumed by young children; goat meat is more often consumed for celebrations and ceremonies (Traore et al. 2018) • These conditions apply in Senegal as well (Sow et al. 2021) #AdaptFutures23 "},{"text":"• Opportunities to address acute challenges and barriers faced by negative impacts of climate change or structural/normative barriers for women to expand their engagement in such activities• Addressing women's limited access to land to grow their own fodder to supplement goat feed • Expanding access to vaccination services to maintain quality and health of goat herd • Providing capacity building on best goat management and processing practices for increasing income sources as well as consumption #AdaptFutures23 "},{"text":"  "},{"text":"of goat products contribute to the diets of rural and urban communities compared to other  Methods     Methods • Qualitative methods:     • Qualitative methods: • Key informant interviews: 17 total Region Area Type of System Data Collection • Key informant interviews: 17 totalRegion Area Type of SystemData Collection • Focus group discussions: 12 total (6    Methods • Focus group discussions: 12 total (6Methods men / 6 women) • Primary data collected in 3 regions of Senegal in June-July 2022 • Thematic qualitative analysis using Fatick Niakhar Extensive agro-pastoral system • Focus Group Discussions • Individual Interviews men / 6 women) • Primary data collected in 3 regions of Senegal in June-July 2022 • Thematic qualitative analysis usingFatick NiakharExtensive agro-pastoral system• Focus Group Discussions • Individual Interviews ASF? Nvivo software • Codebook included inductive and deductive codes • Ethics Louga Dahra Djolof Extensive pastoral system • Focus Group Discussions • Individual Interviews ASF? Nvivo software • Codebook included inductive and deductive codes • EthicsLougaDahra DjolofExtensive pastoral system• Focus Group Discussions • Individual Interviews • What are the main interventions to strengthen women's consent to participate value chain in Senegal? • All participants provided informed empowerment, climate resilience and nutrition in the goat • Approved by IFPRI IRB and Senegal national ethics committee Dakar Intensive peri-urban • Individual Interviews • What are the main interventions to strengthen women's consent to participate value chain in Senegal? • All participants provided informed empowerment, climate resilience and nutrition in the goat • Approved by IFPRI IRB and Senegal national ethics committee DakarIntensive peri-urban• Individual Interviews     #AdaptFutures23 #AdaptFutures23  "},{"text":"reliable source of income/diets: \"On the other hand, it impacts our food security to the extent that our food availability is reduced. Most of the crops that were grown in this locality are being abandoned given the scarcity of rain. So, we can only fall back on goat breeding. These constitute our main resource. Goats are a durable livelihood activity Goats are a durable livelihood activity • Require minimal investments to manage: \"But speaking of resilience, I think the goat is the most resilient • Require minimal investments to manage: \"But speaking of resilience, I think the goat is the most resilient small ruminant to climate change compared to the sheep. Indeed, the goat is resourceful and resistant and if small ruminant to climate change compared to the sheep. Indeed, the goat is resourceful and resistant and if left alone, it can enhance plants that neither sheep nor cows can enhance\" [KII, Association Coordinator]. left alone, it can enhance plants that neither sheep nor cows can enhance\" [KII, Association Coordinator]. • Represent a • Represent a  "},{"text":"Key Interventions to Strengthen Nexus of Women's Empowerment, Climate Resilience, and Improved Nutrition • Strengthening livestock associations that promote women's participation in and benefit from goat activities, particularly processing and marketing • Delivering technical training to improve capacity and know-how to process goat milk into various products (cheese, yoghurt, curds, and soap) • Provide collective resources for cold chain equipment • Identify market links for for processed products  "}],"sieverID":"1ad68678-3928-4f89-a00f-3a7c5efd5616","abstract":""}

data/part_5/0cd35a35e3162972ebd0d7f556798336.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0cd35a35e3162972ebd0d7f556798336","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8a307638-065a-48d4-8ab3-2e55aae8aaa0/retrieve"},"pageCount":6,"title":"Study #2204 Contributing Projects: • P598 -Synthesis of land restoration successes and failures with a special focus on Ethiopia • P477 -Integrated Watershed Management for enhanced productivity with sustained environmental services","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":156,"text":"Description of activity / study: The elimination of taxes on imported irrigation technologies creates a policy environment conducive to more affordable, and therefore more rapid adoption of pumps, including solar pumps, drip irrigation, etc. for smallholder farmers. The SLMP innovations will help reverse degradation and improve productivity sustainably. In addition, the new soil strategy will contribute to the sub-IDO \"More efficient use of inputs.\" All of the WLE innovations, but especially the tax reform, will contribute to the sub-IDO \"Increased livelihood opportunities\". WLE has placed a strong emphasis on strengthening the capacities of our Ethiopian research partners, which contributes to the sub-IDO \"Enhanced individual capacity in partner research institutions through training and exchange.\" These innovations will help restored degraded land, especially in the highlands, and will assist people to exit poverty through more efficient use of fertilizers and the adoption of irrigation technologies. WLE research shows that women have a strong interest in solar PV pumps."}]},{"head":"Geographic scope:","index":2,"paragraphs":[{"index":1,"size":119,"text":"• As confirmed by an email from ATA [1], the policy to make all imported water technologies tax exempt was strongly influenced by IWMI's study of irrigation technology adoption and the pump supply chain [1][2][3] and more recent work on solar PV irrigation pumps [4]. The ATA has requested IWMI's involvement to assess the impacts of this policy change on smallholder farmers. The adoption of a revised \"Soil Strategy\" is based on work by ICRISAT and partners that developed and validated a decision-support tool to target soil fertility management interventions in various soil types and landscape niches [5]. By serving on a core advisory team, WLE scientists were able to help build this tool into the new soil strategy."},{"index":2,"size":198,"text":"The SLMP targets restoring 15 million ha by 2025 under Ethiopia's AFR100 commitment [6]. CIAT's work with partners on integrated landscape management through the Africa RISING program demonstrated that using its tools and procedures to target interventions produces significant benefits: soil erosion can be reduced by up to 75%; baseflow can be enhanced by up to 40%; and food security can be improved [7][8][9][10]. This has led to growing demand for WLE support of restoration efforts. WLE and its predecessor program have a long history of collaboration with Ethiopian partners on management of natural resources and irrigation policies [11,12]. This has contributed significantly to building research capacity and supporting policy-making, developing a network of strong trustful relationships, and acquiring a deep understanding of the context. WLE scientists participate in multiple government committees and task forces, such as the core advisory team on the new soil strategy. Our research is done in collaboration with Ethiopian partners, including research institutions and potential users in the government and donor community. Workshops to discuss research findings and implications are held frequently at multiple levels; and WLE supports a wide variety of training activities (over 200 people) as well as postgraduate student research."}]}],"figures":[{"text":"or findings that have resulted in this outcome or impact: <Not  National National Country(ies): Country(ies): • Ethiopia • Ethiopia Comments: <Not Defined> Comments: <Not Defined> Key Contributors: Key Contributors: Contributing CRPs/Platforms: Contributing CRPs/Platforms: • WLE -Water, Land and Ecosystems • WLE -Water, Land and Ecosystems Contributing Flagships: Contributing Flagships: • F2: Land and Water Solutions for Sustainable Intensification (LWS) • F2: Land and Water Solutions for Sustainable Intensification (LWS) • F1: Restoring Degraded Landscapes (RDL) • F1: Restoring Degraded Landscapes (RDL) Contributing Regional programs: <Not Defined> Contributing Regional programs: <Not Defined> Contributing external partners: Contributing external partners: • Mekelle University • Mekelle University • MEFCC -Ministry of Environment, Forest and Climate change (Ethiopia) • MEFCC -Ministry of Environment, Forest and Climate change (Ethiopia) • ATA -Agricultural Transformation Agency (Ethiopia) • ATA -Agricultural Transformation Agency (Ethiopia) • GIZ -Deutsche Gesellschaft für Internationale Zusammenarbeit / German Society for • GIZ -Deutsche Gesellschaft für Internationale Zusammenarbeit / German Society for International Cooperation International Cooperation • EIAR -Ethiopian Institute of Agricultural Research • EIAR -Ethiopian Institute of Agricultural Research • Inter Aide • Inter Aide • The World Bank • The World Bank • MoANR -Ministry of Agriculture and Natural Resources (Ethiopia) • MoANR -Ministry of Agriculture and Natural Resources (Ethiopia) • USAID -U.S. Agency for International Development • USAID -U.S. Agency for International Development CGIAR innovation(s) CGIAR innovation(s)  "}],"sieverID":"3ae5a397-8d59-4d36-8ac5-2bf82768a7bb","abstract":"In 2017, the Prime Minister approved a policy to make all agricultural water technologies tax exempt. Ethiopia also adopted a new Soils Strategy to target soil fertility management interventions in various landscape niches; and the Sustainable Land Management Program (SLMP) began adopting new implementation interventions that target interventions at different landscape levels following community-led processes. These outcomes are a direct result of WLE research, capacity strengthening and policy engagement. Together, they can greatly enhance the impacts of agricultural investments."}

data/part_5/0cd8fb181798be75fb6672eb88d16500.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0cd8fb181798be75fb6672eb88d16500","source":"gardian_index","url":"https://www.iwmi.cgiar.org/Publications/wle/legacy/wle_legacy_series-5.pdf"},"pageCount":34,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":91,"text":"The CGIAR 2030 Research and Innovation Strategy states that \"under resource scarcity and global connectivity, the challenges of food and nutrition insecurity, poverty, gender inequality, climate change, and environmental degradation are simply not separable\" (CGIAR System Organization 2021: 14). In other words, the One CGIAR aim of a \"radical realignment of food systems around the world\" (CGIAR System Organization 2021: 8) to end hunger and malnutrition in all its forms, can only be ensured through innovations that also further gender equality and social inclusion, and opportunities for youth across agri-food systems."},{"index":2,"size":64,"text":"\"Most social science research over the past few decades has argued that agricultural innovationswhether technological, social or financial -end up reinforcing existing socio-economic hierarchies\" (Najjar and Baruah 2019). A critical part of the realignment to transformative change process must, therefore, include a rigorous examination of how agricultural research for development (AR4D) impacts people of different \"genders, economic classes, and generations\" (Najjar and Baruah 2019)."},{"index":3,"size":20,"text":"Are our research systems and institutions designed to address the 'transformations' needed to eliminate persisting and deeply crosscutting gender inequalities?"}]},{"head":"EoPRE design and approach","index":2,"paragraphs":[{"index":1,"size":88,"text":"The objective of the CGIAR Research Program on Water, Land and Ecosystems (WLE) End of Program Reflection and Evaluation (EoPRE) of gender and inclusion was to facilitate a selected number of project teams and individual researchers to reflect on, untangle and self-analyze successes, complexities and ground realities of knowing and doing gender research (Box 1). Our focus was not on analyzing research outputs and deliverables, but rather on mapping personal learning trajectories, institutional practices and other practical factors that shape gender knowledge and gender research in WLE projects."},{"index":2,"size":11,"text":"Box 1: What do we mean by knowing and doing gender?"},{"index":3,"size":24,"text":"Past analysis of gender research in CGIAR pointed out unevenness in the understanding of gender among researchers, projects and CGIAR Research Programs (CGIAR-IEA 2017)."},{"index":4,"size":54,"text":"Gender knowing: Feminist analysis demonstrates that our knowing of 'gender' is intimately tied to our personal experiences, identities and worldviews, which both shape and are shaped by the institutional settings and cultures where we are situated as researchers. The EoPRE focus was mapping what shapes different understandings: conceptualizations of gender between and within projects."},{"index":5,"size":39,"text":"Gender doing: How we conceptualize gender determines how we operationalize gender in research projects. Gender doing is about the design and implementation of research activities (the rationale behind these), and about how collaborations are established with partners and stakeholders."},{"index":6,"size":125,"text":"\"Research is always influenced by a number of factors, including those related to the research process as a whole and the researcher's position and influence in this context. Explicitly describing this, along with the intended and unintended consequences of these influences and assumptions, is the mark of a considered and reflexive approach to the research process.\" (Barrett et al. 2020: 10) The increasingly complex challenges we encounter in AR4D are not experienced universally by a diverse group of local communities -the end users of our research. Attention to these pluralities requires our research to be deliberately transdisciplinary, through the application of more participatory methods and approaches that make the complexity of problems and challenges, particularly the deeply intersecting factors and forces of inequality, more visible."},{"index":7,"size":73,"text":"As scientists, we tend to agree that the quality of research is relative to the quality of research tools and methods. This is because \"objectivity is a value … most strongly associate [d] with science…. applying objective methodology would be a good strategy for generating an accurate (and thus objective) picture of the world\" (Stemwedel 2013). A core rule of science is not to let \"bias\" influence \"the production of scientific knowledge\" (ibid)."},{"index":8,"size":66,"text":"As cited by Stemwedel (2013), Grinnell (1992) noted in his book The Scientific Attitude that in something as technical as observing cells under a microscope, there was a tendency among students to observe different things. This was not a technical problem; rather, it was a mix of personal factors, from conceptual background to training, which influenced what objects were seen by some and invisible to others."},{"index":9,"size":35,"text":"The concept of \"relational epistemology\", which has roots in feminist thinking, recognizes \"the self (individuals, researchers) as porous and permeable, in interdependent co-relation … with the focus of research, theory, and practice\" (Lange 2015: 29)."},{"index":10,"size":63,"text":"This approach informs the Three Spheres of Transformation framework (Sharma 2007). Applied recently in analyzing the \"roadmaps and pathways … consistent to the Paris Agreement,\" the analysis is evident: \"deliberate social transformations\" can only happen when we can look beyond \"technical solutions and behavioral approaches\" to acting on \"three related and interacting 'spheres' of transformation: the practical, political, and personal\" (O'Brien 2018: 153)."},{"index":11,"size":26,"text":"Attention to these overlapping dimensions is said to be crucial for understanding and addressing complex human-nature interrelations in operationalizing the \"how\" of climate transformations (Youngman 2021)."},{"index":12,"size":35,"text":"Adapting the Three Spheres of Transformation framework into the EoPRE design, our focus was to analyze key barriers and challenges to gender transformative research and outcomes by looking at these three interrelated spheres of influence:"},{"index":13,"size":86,"text":"• Personal: Do our individual experiences, biases and assumptions shape what and how we prioritize and make (in)visible in gender-related research? The EoPRE methodology consisted of three interrelated steps. The evaluation team initially facilitated WLE Flagship leads and gender researchers to identify eight projects. The focus was: i) diversity -projects with varying degrees of gender focus and in different stages of completion; and ii) willingness of project teams to engage in a deep-dive, tiered, reflexive self-analysis process. These steps allowed triangulation of data, perceptions and insights:"},{"index":14,"size":203,"text":"• Project teams invited to self-evaluate the quality of their research process and outputs, using The EoPRE of gender and inclusion in WLE projects is a qualitative, reflexive and participatory exploration of the processes of knowing and doing gender, and project results and outcomes (Figure 1). All knowledge is embodied, situated and political \"Feminist epistemology recognizes that our ideas of knowledge and methods of knowledge production, how we function as knowledge producers, the practices of inquiry we adopt, and what and how we present and justify as knowledge is not dissociated from our deeply personal, individual experiences, values and worldviews; as well as the structure, and cultures of the institutions in which we work, and the wider economic and political contexts of where our work is located.\" (Anderson 2000) The above reasons explain why feminist researchers recognize \"knowledge as situated\" and find claims of \"science objectivity\" problematic (Haraway 1988). Considering the value given to knowledge and science in policy decision making, knowledge processes and outcomes are often shaped by personal, political and institutional interests and mandates. Not paying attention to overlapping \"The crisis (of increasingly complex problems) is in our individual and shared (institutional) mindsets, where psychological and cultural factors and forces reign."},{"index":15,"size":28,"text":"This crisis challenges all of us.\" (Sharma 2007: 31) Box 3: Reflections as evaluators By placing feminist epistemology at the center of the EoPRE, we acknowledge the following:"},{"index":16,"size":12,"text":"• The evaluation team's values, perceptions, worldviews and experiences shaped the EoPRE."},{"index":17,"size":172,"text":"In other words, 'we' are written into this evaluation process. • We deliberately privileged perceptions, emotions and everyday lived experiences of the participants as individuals, as project teams and as staff of different institutions. Making situated and embodied experiences visible matters, as it brings to view often invisible and under-recognized opportunities and challenges that impact planned outputs and outcomes. • We aimed to understand the process and not just results and outputs, recognizing that how knowledge is produced and presented is shaped by overlapping personal, political/institutional and practical factors and contexts. • We recognized that the plurality of personal, political/institutional and practical challenges and opportunities meant that there are different starting points to knowing and doing gender for each researcher, and for different projects. Our focus was, therefore, not to grade and score all projects with a standard reference -but rather to make visible this plurality of not just where we start, but also where we can go, and what we can achieve or not as diverse teams working on different projects."}]},{"head":"Key findings and recommendations","index":3,"paragraphs":[{"index":1,"size":1,"text":"1."},{"index":2,"size":39,"text":"Increasing institutional commitment to gender needs to be better operationalized in projects -key to which would be more honest and open conversations on gender and social inclusion among disciplinary researchers, and especially in projects with a core technical/biophysical focus."},{"index":3,"size":66,"text":"An independent review of WLE (CAS Secretariat 2020: 26-30) noted that across WLE Flagships, \"Gender is considered in project approaches … with an emphasis on drivers of change and on equitable benefits. WLE is contributing to more comprehensive thinking about gender and inclusion at the program level and beyond.\" These changes are an outcome of a stronger programmatic focus on gender both within CGIAR and WLE."},{"index":4,"size":35,"text":"One CGIAR advocates for systemic transformations through a gender transformative approach (Gadeberg 2021). WLE adopted a gender transformative focus even earlier, in its 2014 Gender Strategy, with commitment to its implementation in the 2017-2022 proposal."},{"index":5,"size":121,"text":"\"I would like to share one experience and I'm sure that [name of one of the evaluators] remembers this, the meeting that we had in London where gender was on the agenda, and we discussed gender transformative approaches and how to do 'gender' differently. We came together and said for the next two to three years, we have to really think about how to put gender as a topic.… this meeting led to more attention to the topic of gender, at least for me.\"  : 2) noted that adoption of new ideas often takes place in development agendas \"without appreciation for the history of [these] ideas… this strips ideas of their transformative potential, … renders their implementation solely a technical exercise.\""},{"index":6,"size":55,"text":"Organizational cultures hold great power over how gender is written into project intervention strategies, implemented and given value and importance. Several EoPRE project teams discussed that when the dominant focus is technical AR4D, unpacking complex ground realities and the politics of situated knowledge are not always encouraged, as they \"slow down\" the project's main ambitions."}]},{"head":"\"As researchers, we [already] take a stand [early in the project cycle], not really understanding the ground realities or the stark contrasts that [shape] people's [diverse] everyday lived experiences.\" (EoPRE participant)","index":4,"paragraphs":[{"index":1,"size":41,"text":"\"For all of our projects in [name of area], our entry point is technical and ecological issues and after that we add more activities. Without targeting ecological issues, we cannot target other [social] activities in a sustainable way …\" (EoPRE participant)"},{"index":2,"size":29,"text":"During the dialogue sessions, we also heard stories of how qualitative, participatory gender research and researchers tend to be undervalued and under-resourced, relative to biophysical, technical research and interventions."},{"index":3,"size":91,"text":"Institutions with a history of disciplinary, technocratic ways of knowing and doing science tend to encourage and reward \"gender-lite\" research and researchers who do not challenge underlying power structures of knowledge production (Dieltiens et al. 2009). This translates to a \"kind of boundary making … as a way of keeping … gender work safe from [the politics of] feminism (Kunz et al. 2019, as cited in Resurrección andElmhirst 2021: 9). But these are the very same reasons why \"gender inequality is so hard to advance and, in places, retreat\" (ODI 2020)."},{"index":4,"size":65,"text":"\" Regardless of these challenges, individual gender researchers as well as project teams show significant commitment to gender. Gender research and success tends to happen against a tide of constraints and challenges. A way forward would be to engender the CGIAR Quality of Research for Development framework and to make this a hands-on planning and implementation as well as robust monitoring, evaluation and learning tool."}]},{"head":"2.","index":5,"paragraphs":[{"index":1,"size":38,"text":"Unevenness in gender research and outputs has been noted in CGIAR gender research. The EoPRE shows the overlapping personal, institutional and practical dimensions of this challenge, and how tackling this requires deliberately and periodically making time to reflect."},{"index":2,"size":106,"text":"An independent review of gender in CGIAR (CGIAR-IEA 2017: 10) noted an \"unevenness\" in the quality of gender research and capacity of gender researchers. In our evaluation of eight projects, this unevenness was visible. Most projects are gender integrative -focusing on the symptoms of women's inequality (interpreting gender as women, and inequality as a simplistic binary between women and men). A much smaller number of projects adopt gender transformative approaches -focusing on unpacking and tackling systemic, core factors of gender inequality and social inclusion (relational and intersectional). In projects where the primary focus is not gender, there is significant unevenness in capacity and knowledge on gender."}]},{"head":"\"I have been struggling with the definition of gender and have sometimes been demotivated by the overall vague talk about gender, but doing something very concrete about gender is what motivates [my work] moving forward.\" (EoPRE participant)","index":6,"paragraphs":[{"index":1,"size":39,"text":"Our intention was not to score the projects on their gender understanding and outcomes. Rather, our focus was to analyze if these differences are shaped by personal biases, assumptions or experiences as well as institutional or other practical contexts."},{"index":2,"size":110,"text":"In sum, where does our gender bias come from? Using the \"River of Life\" method (Mercer 2008), we facilitated EoPRE participants to reflect on how their life experiences shape the ways in which they understood and operationalized gender professionally in their work. For many young women, personal experiences as women of color, working at the lower rungs of the institutional hierarchy or in cultures of patriarchy with project partners and/or in the research locations, help make gender and intersectionality prominently visible and relevant. Those who do not face the same challenges in their lives and work might find these issues less visible, unless specifically trained to look out for inequalities."},{"index":3,"size":28,"text":"\" Often gender-aware researchers make conscious choices to do less, because the context -their own institutions, the project timeline, partners, project locations, resources -will only allow so much."},{"index":4,"size":53,"text":"\"Differences in institutional narratives on gender and social inclusion matters as each framing shapes the questions that are asked, prioritizes the production of different types of knowledge and emphasizes different types of AR4D interventions related to gender and social inclusion.\" (EoPRE participant) \"[The project] is gender sensitive, rather than aiming for transformative change."},{"index":5,"size":76,"text":"And that's because, we only have three years. We don't have anywhere near enough time or money to do even the level of investigation of the social and cultural issues. That would be really terrific [but]  When project teams have resources and commitment, as well as agency to cyclically look back and critically learn, the outcomes lead to significant gains in gender doing -even for projects where gender is an add-on to an initial technical design."},{"index":6,"size":101,"text":"\"We have specifically, consciously created more space for gender in these new learning modules. It comes perhaps a little bit late in the process, but it has been a little bit of a searching process -building on both our previous experiences and the interest that we see for work on gender. We have been thinking about how best to focus on gender in a project …\" (EoPRE participant) However, projects do not always allow for reflection, or there is a reluctance to share stories of 'failures' because this is regarded as negative; projects are rewarded when successful in meeting planned deliverables."},{"index":7,"size":168,"text":"\"… reflexivity is difficult because we [as researchers] are not accustomed to examining our engagement with our work with the same intensity as we regard our research subjects.\" (Dowling 2016: 35) \"… we came to this project with the idea of how this project could be transformative. But we came across several constraints to doing that. And that's just a reminder about how this is all a process, it's not like you go from 0 to 100 (through one project). It's really a process of bringing the thinking together, of bringing the capacities together, of having the right timeframe, the right partners, the right everything, to be able to do that. And that takes time. And there's only so much that you can do, with the many shortcuts that you need to take. So that was a reality check and something that we really have to be aware of as we work on -and depending on what we promise to do as well in different projects.\" (EoPRE participant)"},{"index":8,"size":95,"text":"\"… multidisciplinary teams, where not everybody has a gender understanding or orientation, partner organizations who lack a focus on gender ... gender challenges in the institutions in which we are working, which are just as prominent as challenges that exist in the field, in communities we are working with … there needs to be more discussions about how we understand gender in our research … and where we intervene … we need to reintroduce this need for building a common understanding of what gender is -first and foremost into our own institutions ...\" (EoPRE participant)"}]},{"head":"3.","index":7,"paragraphs":[{"index":1,"size":52,"text":"Regardless of how gender is written into project proposals, there is change during the course of a project. Incremental gender gains in a project are often the outcome of collaboration between disciplinary researchers and innovative interventions, but above all, enabling and encouraging project teams and leaders, which helps capacitate younger gender researchers."},{"index":2,"size":33,"text":"Often, critical gaps emerge between including 'the right gender words' in proposals and project designs and implementing these ambitious goals in diverse local contexts, or in the face of unpredictable shocks and changes."},{"index":3,"size":111,"text":"In one of the projects, the core project team recalled how they realized early on that they were all \"outsiders,\" not even from the same country of the research, and in that sense, unaware of the deeper nuances of social norms, relations and ways of life of the community. In the reflective dialogue, the team recognized that as outsiders, it would be challenging to engage with and address social relations of power that are so often hidden from view, both from the researchers and from the research participants themselves. Quite by accident, COVID-19 allowed the \"outsider experts\" to take a back seat, and literally \"hand over\" the pen to local researchers."},{"index":4,"size":49,"text":"COVID-19 and civil strife also impacted another project, which had taken on an ambitious gender transformative approach. Here, the project team innovatively built collaborations with other gender researchers, and used different methods and approaches, including digital text mining, to critically review the relative inattention to gender in restoration initiatives."},{"index":5,"size":143,"text":"\"Yes, the gender transformative approach was new and unique, and it was beyond binary ... it was more a process and focused on different stages of inclusion and this was the part that clicked the most for me … also brought to the table a lot of literature and I was willing to learn. This is important because setting aside time to learn requires extra time, resources and energy. It took longer and it was more difficult to bring all these pieces together -compared to just publishing something. The effort in building these bridges and developing methodologies that [allowed]  One of the project teams elaborated on the difficulties faced by junior female researchers in navigating asymmetrical relationships in interview settings, where key informants are often men in senior positions of power who can be dismissive of both young women researchers and gender research."},{"index":6,"size":49,"text":"\"I just got this feeling [in] most of my interviews … that there are, quote, unquote, more important things to do, than gender … only once was I regarded as a person who [had] her own knowledge [and] there was a certain amount of respect involved there.\" (EoPRE participant)"},{"index":7,"size":80,"text":"The findings we discussed above show that a complex mix of personal, political/institutional and practical factors and forces (Figure 2) can \"render technical\" gender agendas and ambitions (Li 2007: 7). The focus of this EoPRE was in mapping processes of change and understanding what enables certain projects to build on these challenges for innovative approaches and pathways to change. In Table 1 below we summarize key lessons emerging from these three dimensions at the intersection of gender knowing and doing."},{"index":8,"size":6,"text":"Table 1: Summary of key findings."}]},{"head":"Dimension Theme Summary of lessons learned","index":8,"paragraphs":[]},{"head":"Personal dimension","index":9,"paragraphs":[]},{"head":"Researcher bias","index":10,"paragraphs":[{"index":1,"size":53,"text":"Subjective values, worldviews and individual experiences influence how we understand gender at a personal level. In the reflective dialogues, several research teams reflected on both conscious and unconscious biases, and how these biases can shape the way that we understand gender, as well as how gender research is conducted, its outcomes and results."}]},{"head":"Personal learning trajectories","index":11,"paragraphs":[{"index":1,"size":83,"text":"Both the document analysis and the reflective dialogues made evident that gender knowing and doing are not static endeavors. On the contrary, several EoPRE participants reflected on the ways in which their understanding of gender is essentially learning in action. Small (sometimes big), messy, fragmented challenges can result in success or failure to address gender goals; the difference lies in whether the project and its team members are poised and agile to grasp the possibilities and choices of \"doing things differently\" (O'Brien 2012)."}]},{"head":"Dimension Theme Summary of lessons learned","index":12,"paragraphs":[]},{"head":"Institutional dimension","index":13,"paragraphs":[]},{"head":"Organizational cultures","index":14,"paragraphs":[{"index":1,"size":86,"text":"Our findings show that organizational cultures hold great power over how research teams conceptualize gender and write this knowing into project goals, activities and strategies. In other words, the rationale and theory of change of AR4D projects are shaped by different organizational cultureswhich are a mix of norms, values, practices, relevance and credibility of some ideas and approaches over others. Regardless of the commitment to diversity and equality, there are conscious and unconscious biases in organizations, which shape differential privileging of skills, capacities and social identities."}]},{"head":"Social hierarchies","index":15,"paragraphs":[{"index":1,"size":96,"text":"Several project teams discussed the challenges that arise as they (as researchers) enter different institutional arenas where they must navigate complex social hierarchies and a myriad of social relations of power. In some project teams, there were honest discussions on the emotionality and difficulties of being a young woman researcher from the Global South when conducting research in the field, especially in patriarchal societies, and with senior male colleagues from other institutions. These discussions point to asymmetrical relationships in the research domain, and how these can result in diverse consequences for the quality of gender outputs."}]},{"head":"Practical dimension","index":16,"paragraphs":[]},{"head":"Time and resources","index":17,"paragraphs":[{"index":1,"size":69,"text":"The theme time and resources demonstrates that while many project teams recognize the importance of transformative change and intersectionality, they don't have sufficient time and resources to move from, for example, an intersectional framing of gender to an intersectional doing of gender. Project teams commonly expressed a genuine desire to do both intersectional and gender transformative research -but time and resource constraints can often make this an impossible task."}]},{"head":"Collaboration","index":18,"paragraphs":[{"index":1,"size":143,"text":"The theme collaboration emerged in several of the reflective dialogues. This type of learning, as explained by the different project teams, sparks changes in our gender knowing/doing, including how we see and experience our gendered selves and in terms of which activities researchers might deem appropriate to achieve different types of gender outcomes. The theme brings into focus the significance of multidisciplinary teams. The reflective dialogues demonstrated that collaboration between biophysical scientists and gender experts triggered new research directions, as well as personal growth. The reflective dialogues also highlighted the importance of celebrating individual strengths that interdisciplinary teams bring to the table, all the while also pushing team members to learn new ways of knowing and doing gender. We, therefore, find that multidisciplinarity has been a key element enabling several EoPRE participants to identify new and innovative ways of framing and operationalizing gender."}]},{"head":"Conclusion","index":19,"paragraphs":[{"index":1,"size":133,"text":"The processes of self-evaluation and carefully guided discussions allowed the EoPRE participants to deeply reflect on their experiences as individuals as well as professionals. This allowed us, the evaluation team, to triangulate data related to perceptions of the quality of research, document analysis and reflective dialogues. The findings summarized in Table 1 are an outcome of connecting the dots between research processes, outputs and outcomes. These findings show that perceptions of the quality of gender research, and what emerges as knowledge outputs with scope and relevance for impact and change, are shaped by researcher positionality and experience as well as institutional and other practical factors. More attention to these factors would help enhance the quality of gender and inclusion research -including who benefits and who does not among the end users of AR4D."},{"index":2,"size":83,"text":"As is now well known, gender norms are the unwritten rules of behavior which determine what are considered appropriate ways of being and doing for women and men. These norms are crosscut by underlying factors like poverty, age, religion and different social cultures. What is less well known or considered is that these norms, as well as other crosscutting power relations, function as the unwritten rules of behavior in institutions across scale. Institutionalizing gender in AR4D would require paying attention to these issues."},{"index":3,"size":16,"text":"The transformative changes we aim to achieve require -as we often say -doing business as unusual."},{"index":4,"size":70,"text":"In terms of gender knowing and doing, this implies paying explicit attention to: i) what types of knowledge are valued and why; ii) how research is defined and implemented; iii) the relationships between researchers in any given project and/or within an institution; and iv) the nature of relationships and engagements between researchers, the researched and a wider subset of other stakeholders in any project or program (Gender at Work 2021)."},{"index":5,"size":94,"text":"\" \"… the one-way dissemination of knowledge which is often found in science, when practiced in any social context or institution with existing hierarchies can exacerbate or increase knowledge 'monopolies'. Without addressing power, in other words, the means of producing, controlling, and using knowledge stays in the hands of the privileged few and in fact, prompts bias.\" (Ferdous et al. 2015: 10, as cited in Gender at Work 2021: 14) Building on the EoPRE findings and linking these to other change initiatives within CGIAR, we highlight three key conceptual issues for consideration going forward."}]},{"head":"1.","index":20,"paragraphs":[{"index":1,"size":31,"text":"External facilitation can enable critical reflection for transformative change, but pathways to achieving these can only surface from within the institution, and from rethinking new ways of knowing, learning and doing."},{"index":2,"size":30,"text":"There has been significant progress in enhancing gender equality, diversity and inclusion in CGIAR workplaces. The goal is to design and sustain workplaces that are \"inclusive and enabling\" (CGIAR 2021)."},{"index":3,"size":32,"text":"In In many development institutions, reflection, while encouraged on an individual basis as part of personal evaluations, is rarely practiced as a systemic, methodological issue in projects or at an institutional scale."},{"index":4,"size":80,"text":"Our design of a reflexive EoPRE was initially met with some skepticism about who we were doing it for. Our answer, \"for ourselves\", raised both caution and surprise. The culture we work in requires us to deliver, mostly to those above in the hierarchy of development. How can a reflexive, inward-looking evaluation possibly be useful, for those who matter most, including funders and donors? It took effort and time for the evaluation team to both explain and implement this process."},{"index":5,"size":95,"text":"A historic gap in research for development has been the tendency to understand problems as being linear and external -out there among partners, in local communities, in policies and outdated technologies -and thus relatively easily addressed with new policies, technologies, tools and interventions deemed appropriate by expert researchers. This, according to the Three Spheres of Transformation framework, is only partially true (O'Brien and Sygna 2013; O'Brien 2018). The problems we encounter are often shaped by personal biases and assumptions, and in turn by the structure and culture of the systems we live and work in."},{"index":6,"size":61,"text":"Looking deep, getting a full insight of the complexity of challenges, can only happen from within. Until then, what happens inside the institutions we work in, the processes of how we work and collaborate (or not), remain a proverbial 'black box', even though these are precisely the spaces where policy and institutional intent get diluted and reinterpreted or misinterpreted (Mosse 2011)."},{"index":7,"size":85,"text":"The practice of reflexivity opens the door to meaningfully investigate issues and considerations that can be \"intense, surprising, or upsetting\" (Probst 2015: 43) in the process of doing research, and how these can impact the quality of science. According to Probst (2015: 43), reflexivity can be used as a \"framework for processing, sustaining, renewing and gaining insight both into the research and oneself.\" It is thus \"a tool not only for managing the research experience\" but also to avoid \"becoming side-tracked or emotionally depleted\" (ibid)."},{"index":8,"size":32,"text":"Personal learning trajectories built into project and program theories of change can enable researchers to reflect on mapping change and exploring solutions to small or large, potential and unpredictable challenges and changes."}]},{"head":"2.","index":21,"paragraphs":[{"index":1,"size":18,"text":"Potential gender-power imbalances in the research process and in research institutions need to be unpacked, acknowledged and addressed."},{"index":2,"size":61,"text":"Power is a core element of knowledge and science domains. It exists in all social relations, including in relations between researchers and the researched and among researchers themselves (Dowling 2016). Mapping how power operates requires looking from the inside out and from the outside in. These processes will be transformative only when actors across power hierarchies are part of the exercise."},{"index":3,"size":74,"text":"To deliver relevant and gender transformative science, which is the aim of One CGIAR, we need to better map asymmetrical relationships at scale between processes and outputs, within our institutions, with our partners and stakeholders, and in the contexts of our planned research. This would allow, for one, reversals in accountability of our knowledge and science to our end usersmarginalized women, men and youth. This what feminist researchers argue will add value to science."},{"index":4,"size":49,"text":"At a more fundamental level, unpacking gender-power asymmetries would allow mapping and tackling key barriers to gender equality and social inclusion in projects, programs and institutions, as well as in policy advocacy and impact. This would allow asking questions like the following at the start of any research initiative:"},{"index":5,"size":10,"text":"• Whose logic and mandates define research agendas and initiatives?"},{"index":6,"size":44,"text":"• How do we make visible organizational cultures that sidestep tackling systemic, structural inequalities? • How do we ensure that gender, inclusion and intersectionality lie at the core of our research design, and then how do we operationalize these concepts in our research process?"},{"index":7,"size":60,"text":"AR4D institutions can help achieve transformative change at local, national and global levels by engaging with grassroots and feminist organizations and actors, who are often driving radical social change (DFID 2018). This will require significantly new ways of working, including encouraging and rewarding gender transformative research that can unpack and challenge underlying power structures across institutions (Dieltiens et al. 2009)."}]},{"head":"3.","index":22,"paragraphs":[{"index":1,"size":8,"text":"Transformative ideas require proportionate financing, and much more."},{"index":2,"size":65,"text":"We make the case here for improved financing of gender and social inclusion in the new One CGIAR initiatives, because the EoPRE discussions reveal that resource constraints are a key practical challenge to institutional aspirations to gender transformative change. This is not simply a practical challenge -the lack of adequate finances to support gender and inclusion can be embedded in deeper institutional and political issues."},{"index":3,"size":61,"text":"Our findings show that the practical context of any given project varies significantly, and it is often difficult, if not impossible, to know up front the extent or magnitude of contextual barriers to achieving gender equality and social inclusion. This calls for buffers of time and other resources, including budgets, to help navigate challenges with diverse partners and in complex situations."},{"index":4,"size":69,"text":"There are also fears that the COVID-19 pandemic could potentially disrupt the 2030 Agenda for Sustainable Development with cutbacks in financial commitment to gender research (UN n.d.). In 2017 and 2018, 42% of bilateral aid was targeted to gender equality and women's empowerment, and 4% of this overall to projects with an explicit, primary gender focus. This was the highest ever commitment of funds to gender equality (OECD 2020)."},{"index":5,"size":123,"text":"There is good reason to believe this will not now be the case. First, recent shocks have most impacted marginalized women, men and children across the Global South and North. Second, COVID-19 has made visible the invisibility of the care economy -whose unpaid workers are largely women. This pandemic has reminded us of the true scale of the distorted assumption that care work of children and the elderly can be soaked up by private citizens who are mostly always women -effectively providing a huge subsidy to the paid economy (Lewis 2020). This has led many development actors and organizations to prioritize a \"feminist, human rights-based approach to economic development\" amid other pressures that have arisen during this global pandemic (Denomy et al. 2020)."},{"index":6,"size":8,"text":"In conclusion, transforming the system will require \"new "}]}],"figures":[{"text":" CGIAR's Quality of Research for Development framework, adapted for an explicit focus on gender. • A thorough review of project documentation (53 documents from eight projects) by the evaluation team to analyze any changes in ways of knowing and doing gender during different stages of the project. • Two rounds of facilitated reflective dialogues separately with each project team (31 researchers from the eight projects) to map the personal, institutional and practical dimensions of knowing and doing gender, and how these experiences relate to research quality (perceptions) and knowledge outputs (documentation). "},{"text":"Figure 1 : Figure 1: The four elements of the EoPRE design. "},{"text":"Figure 2 : Figure 2: The three dimensions of gender knowing and doing. "},{"text":"self-evaluate the quality of gender research processes   "},{"text":"the gender scientist and now she will start asking about what happened to the women'…. And These biases -both personal and institutional -persist because there are rarely open conversations on why and how gender matters and should be considered, between disciplinary project researchers and in projects where gender is not a primary focus.\"There needs to be[more]  discussions about how we understand gender in our research. We need to reintroduce that element into our own institution. This also goes for the organizations that we're working with, especially the partner organizations that we see lacking a focus on gender. How do we understand gender and where do we intervene? I see this as an important dimension that has emerged from our experiences [of doing gender research]. We understand the challenges that exist in the communities [where we work], but we have not seen on the other side of the coin -what are the gender challenges in the institutions in which we are working?… We are working in multidisciplinary teams so it's natural that not everybody will have a gender understanding or orientation, so that is why it is so important to engage with institutions for us to have a common understanding of what gender is.\" (EoPRE participant)  "},{"text":" When I go out, for example, in [name of country], we meet a lot of people. Like municipalities or local government officials. And when we introduce each other, I go with my male co-workers like this is Doctor X…. They call him Doctor, but they call me Madam. They can never bring themselves to say Doctor -I don't know why this happens a lot, even though I introduce myself with my title most of the time.… People put value on those titles, and they will listen if they see that title.… We are all young and they may not take us seriously, so it's important that you put that title so that they know that you come with that -you know, knowledge and experience, but still [even] that does not work.\" (EoPRE participant)These symmetries and hierarchies are often deeply institutionalized and experienced across career paths.\"… earlier in my career, I was appointed as a research graduate assistant in a university … in a big study led by an all-male team. One of the requirements from the donor side was that they must [include] a female researcher … I never knew if I was hired because of my merit or because I was a woman (and supposed to know gender). As I started to understand more about who's doing the research,  "},{"text":"EoPRE participants reflecting on one project during the dialogue sessions \" [Gender knowing and doing]  can become very disembodied, then it's very kind of dry and top down. And, you know, it's not very interesting as well … being with people [in the field] and learning from[lived]  gender, social inclusion experiences … that's really where the magic happens …\" \"In facilitating women to play 'the game', I expected they would play more conservatively … explaining … the classic narrative that men are exploiters and women are the keepers of the Earth kind of thing.… I was really surprised that women were not more conservative in their water consumption … they might even be more willing to deplete resources in order to earn an income. I went into this project with … my own assumptions on gender[women]  and water.… two key takeaways for me out of that was that the framing of the game matters and that the timing and details of the game matter.\" Box 4: Box 4: we framed our goals in a way we framed our goals in a way that is achievable, and therefore we're actually doing what we said we were that is achievable, and therefore we're actually doing what we said we were going to do.\" (EoPRE participant) going to do.\" (EoPRE participant)  "},{"text":" answered the multiple research questions [in spite of the practical challenges] was very important.\" (EoPRE participant) Meaningful, respectful collaborations went a long way in helping to tackle challenges.  "},{"text":" this context, the EoPRE sees a critical need for infusing this emerging culture of gender equality, diversity and inclusion within CGIAR into research domains -in the design of research initiatives; in project management; in our partnerships for research, communication and advocacy; and essentially in the fabric of our everyday 'research doing' and decision making. At a very basic level, these changes would help contextualize research -allowing better insight on what needs to and can be changed, where and how -to achieve greater inclusion and equality.  "},{"text":" perspectives, new norms of behavior, and a new culture\" (Gender at Work 2021: 28). We recommend simple first steps to enabling more open discussions; collaborative critical reflection on what works well and what does not; and encouraging new ways of thinking, doing and learning gender.  "}],"sieverID":"c8afdb99-3949-4d1c-9b56-d9da4544a774","abstract":"Front cover photo: Head of a Water Users' Association in southern Tajikistan meets with cotton farmers to discuss irrigation requirements; Neil Palmer / IWMI.First and foremost, we acknowledge all the researchers from the eight projects under the CGIAR Research Program on Water, Land and Ecosystems (WLE) who kindly agreed to participate in this reflexive evaluation process and contributed richly by making available time, sharing their personal experiences, and reviewing and providing feedback. We acknowledge Ruth Mendum (Associate Director for Gender Initiatives, Penn State College of Agricultural Sciences, Pennsylvania, USA) for her extensive review of the End of Program Reflection and Evaluation (EoPRE) Final Report, which enabled us to synthesize large volumes of data into this more concise Technical Report. Finally, we are grateful to all the researchers and practitioners whose knowledge, insights and commitment have inspired and guided this evaluation process."}

data/part_5/0ce1d164d3dea4910c4d5eb765298b10.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0ce1d164d3dea4910c4d5eb765298b10","source":"gardian_index","url":"https://dataverse.harvard.edu/api/access/datafile/:persistentId/?persistentId=doi:10.7910/DVN/TMUJ7X/VEDVML"},"pageCount":83,"title":"Auki fish market survey Acknowledgements","keywords":[],"chapters":[{"head":"Table of Contents Executive Summary","index":1,"paragraphs":[{"index":1,"size":80,"text":"Between November 2016 and December 2017 WorldFish conducted a survey of fish sold at the Auki market. The objectives of the survey were to: i) document the species, volumes and values of fish sold at Auki market, and the fishing grounds where this fish was caught; ii) document and describe the fisheries that supply the biggest market in Malaita Province; and iii) support the Ministry of Fisheries & Marine Resources (MFMR) in establishing a baseline of the fisheries in Malaita."},{"index":2,"size":18,"text":"The survey used digital photography to record, store, and process images of fish sold at the Auki market."},{"index":3,"size":114,"text":"We recorded a total of 100,042 fishes, and identified 400 species from 47 fish families. A total of 134 tonnes of fish with an estimated value of SBD$5.4 million passed through the Auki market during the survey period. Skipjack tuna (Katsuwonus pelamis) is the most often sold fish at the Auki market. Most of the reef fishes were above size at sexual maturity. Two pelagic species, yellowfin tuna (Thunnus albacares) and bigeye tuna (Thunnus obesus) were predominantly sold at size below sexual maturity. The most important fishing grounds which supply fish to Auki market are Ramos Island and Alite Reef, two off-shore uninhabited islands. This has important implications for fisheries management in the province."},{"index":4,"size":32,"text":"Green humphead parrotfish (Bolbometopon muricatum) and Maori wrasse (Cheilinus undulatus) were regularly sold at the Auki market. Selling these fish below 65 cm was prohibited by the national fisheries management regulations 2018."},{"index":5,"size":42,"text":"Based on the information generated by the survey we make the following recommendations to MFMR: i) Enable the provincial fisheries office to regularly monitor the Auki fish market to check minimum sizes, prohibited species and communicate with fish vendors and consumers; ii)"},{"index":6,"size":25,"text":"Prioritize the management of the main fishing locations that supply most of the reef fish to Auki market, particularly Alite Reef and Ramos Island; iii)"},{"index":7,"size":9,"text":"Enforce the Fisheries Management (Prohibited activities) regulations 2018; iv)"},{"index":8,"size":22,"text":"Raise awareness of consumers on minimum sizes, prohibited species and food safety (for example by placing informative billboards on the market); v)"},{"index":9,"size":27,"text":"Provide information on fish handling and processing, hygiene and fisheries management to fishers and fish vendors (for example by organizing training workshops or distributing information sheets); vi)"},{"index":10,"size":36,"text":"Prohibit the sale of discarded tuna ('solfis') from industrial fishing boats; vii) Support the provincial government in improving the infrastructure of the fish section of the Auki market, particularly the water system, pavement and roofing; viii)"},{"index":11,"size":14,"text":"Generate information on the impact of coastal fisheries on yellowfin and bigeye tuna; ix)"},{"index":12,"size":31,"text":"Replicate the Auki fish market survey in 2020 to detect temporal trends (including a survey on marine invertebrates); and x) Develop a program to monitor rural fish markets in Malaita Province."}]},{"head":"Introduction","index":2,"paragraphs":[{"index":1,"size":64,"text":"The work reported here are the results of a one-year (November 2016 to December 2017) survey of finfish conducted at the Auki market by WorldFish. The survey was necessary because the Malaita Provincial fisheries office lacks the necessary comprehensive information on production, catch, fishing practices, species targeted, fish markets, trade, and threats to effectively implement fisheries regulations under the Provincial Fisheries Ordinance 1 ."},{"index":2,"size":37,"text":"Basic information which this report provides are; fish quantities passing through Auki market, fish families and species targeted, important fishing sites which supply the Auki market and the size structure of the top 23 commonly caught species."},{"index":3,"size":50,"text":"The Ministry of Fisheries and Marine Resources (MFMR) had previously conducted similar fish market surveys in Honiara (2014)(2015)(2016), Gizo in the Western Province (2016)(2017) and Lata in Temotu province (2016)(2017). This survey is aimed at supporting the work of the MFMR in collecting data and understanding Solomon Islands small-scale fisheries."},{"index":4,"size":78,"text":"The Auki market serves as an important trading centre in Malaita Province. The market is predominantly the focal area for trading agricultural and fisheries products. The majority of those who sell produce at the market are local producers (farmers or fishers themselves), although there are also middle-men/middle-women who buy products from farmers and fishers and then on-sell them either in Auki or Honiara. Most customers of the Auki market are local residents of Auki town and surrounding communities."},{"index":5,"size":8,"text":"Photo 1: Fish vendors at the Auki market"}]},{"head":"Methodology","index":3,"paragraphs":[{"index":1,"size":209,"text":"The methods employed were similar to those employed by the MFMR (Rhodes 2016;Rhodes and Tua, 2017) with some variations. Prior to the fish market survey, personnel from MFMR conducted a training for the WorldFish staff on the methods which involved; basic fish species identification, measurement of fish weights and the use of photography to record individual fish species and length measurements. The digital photographic system comprised of a basic digital camera connected to a PVC arm that allows the camera to focus downward to a fish measuring board. The measuring board was designed to accommodate fish up to 100 cm in 1-mm increments. Individual fish weights were recorded on a subsample of 49% of all the fish. However, total fish weight sold by each vendor was collected. A monitoring code, associated with each vendor or fisher, along with an associated code for the market and date, is placed on the board to allow a visual linkage between the vendor/fisher and the catch and individual fish weights (where they were measured). Photographs of individual fish were stored in an SD card and later downloaded on a computer and viewed to identify individual fish species, fish total length, vendor information and fishing site and entered into a Microsoft Excel spread sheet."},{"index":2,"size":28,"text":"Photo 2: Enumerator collects data from a fish vendor at the Auki market. Note the fish measuring board with camera on the right and spring scale near it"},{"index":3,"size":109,"text":"Resources used for fish species identification were; Allen et al. (2003), Chapman et al (2008), Fishbase (https://www.fishbase.de/), Moore and Colas (2016), SPC (2015) and World Register of Marine Species (WORMs) (http://www.marinespecies.org). Checking and confirmation of fish species was jointly undertaken by MFMR staff who have been involved in similar surveys in Honiara, Gizo and Temotu and other staff of WorldFish. The Microsoft Access database system developed by Javier and Ismael Cuetos-Bueno (Rhodes and Tua, 2017), which was used by MFMR in the HapiFis project, was not used; the main reason being that there were glitches with the database system at that time and the developers were rectifying the glitch."},{"index":4,"size":66,"text":"Prior to data analysis, further data cleaning was undertaken to remove incomplete data and correct fish family and species names and to group fishing sites to broader geographical regions. All data analysis and graphics were undertaken in 'R' (R Development Core Team, 2009) using the following packages: FSA,dplyr,xlsx,tidyr,magrittr,ggplot2,data. Photo 3: Marine products such as shells, crabs, crayfish and mangrove beans were not included in the survey."}]},{"head":"Results","index":4,"paragraphs":[]},{"head":"Volumes","index":5,"paragraphs":[{"index":1,"size":91,"text":"The survey covered a total of 250 days over the period November 2016-December 2017 and sampled 100,042 individual fishes. A total of 134 tonnes of fish was recorded. The volume of fish which comes through the market varied between months with the highest volume in February 2017 (Figure 1), however disaggregation of the data according to different fishing sites (Figure 2) shows that the large volumes of fish in February are mainly due to large volumes of fish obtained by local fishers from industrial fishing boats at the industrial FADs. 2"},{"index":2,"size":77,"text":"Photo 4: 'Solfis', discarded fish from industrial fishing boats 2 When small-scale fishers from Lilisiana encountered purse seiners fishing at the industrial FADS, they are occasionally 'given' undersized fish. The survey recorded 11 days on which discarded fish from industrial fishing vessels, locally called 'solfis', was sold at the market. Prices drop significant when large volumes of solfis are sold (solfis represents 4.73 % of total value -see table 4), forcing other fish vendors out of business.  "}]},{"head":"Species","index":6,"paragraphs":[{"index":1,"size":150,"text":"A total of 400 species from 47 fish families (Table 1, Appendix 1) were recorded. The top 10 families comprising the most diverse fish species were: Lutjanidae, Serranidae, Acanthuridae, Carangidae, Scaridae, Lethrinidae, Holocentridae, Mullidae, Siganidae and Labridae (Table 1). When considering total fish abundance in terms of individual fish counts to the Auki market, Scombridae contribute the highest total count of fish (Table 2), followed by Siganidae, Lutjanidae, Lethrinidae and other families. The main Scombridae fishing locations were: Alite reef and Nggela (Figure 3 and for details see Appendix 2). Most of the Siganidae species comes from Lau Lagoon (Lau) in North Malaita, while most of the Lutjanidae and Lethrinidae come from Ramos Island, Lau Lagoon and Alite Reef. 3 The three most important fishing locations when considering the total counts of fish from different fishing sites were, Ramos Island, Alite Reef and Lau Lagoon (Figure 3 and Appendix 2)."},{"index":2,"size":76,"text":"When considering the total count of different fish species, Katsuwonus pelamis is the most abundant and comprised 37% of the total count of individual fishes which comes through the Auki market during the survey period, this is followed by Thunnus albacares contributing 9.5% to total fish counts, Lutjanus gibbus contributing 4.3%, Siganus canaliculatus contributing 3.1% and Elagatis bipinnulata contributing 2.6% (Appendix 3). All other species contributed 2% or less to the overall total individual fish counts.    "}]},{"head":"Habitats","index":7,"paragraphs":[{"index":1,"size":77,"text":"Appendix 1 classifies species on their main habitat: pelagic, reef associated or deep (>300m). Seasonal trends in total counts of reef associated and pelagic species (P) differed remarkably. Large numbers of pelagic species are sold on the Auki market in January and February (Figure 4A). The supply of reef associated species is more evenly distributed throughout the year, also due to differences between sites (Figure 4B). Relatively few deep sea (>300m) species were sold at the market.  "}]},{"head":"Value","index":8,"paragraphs":[{"index":1,"size":127,"text":"All of the fish sold at the Auki market were sold by piece or as heaps rather than per weight. Sampling of individual fish weights and their prices enabled us to calculate unit price per Kilogram ($/Kg) for the top 23 species sold at the Auki market. Prices range considerably (Table 3). The mean price per kg for the top 23 species ranges between SBD$26.50 up to a maximum of SBD$48.70 per kilogram (Table 3). Forty-nine percent of the sampled fish had their values recorded: a total value of SBD$2,622,763. The total value of the fish sold annually at the Auki market is therefore estimated at more than SBD$5.4 million. The top three fish families making the highest economic contribution were; Scombridae, Lutjanidae and Carangidae (Table 2)."},{"index":2,"size":75,"text":"With regards to the economic contribution of fish from different fishing sites, Ramos Island makes the highest contribution. This is followed by Alite reef, Nggela and South Malaita (Table 4). When considering the type of habitat where fish were caught, pelagic species makes the highest (79%) contribution to the value of fish sold at Auki Market, this was then followed by reef associated species (20%). Contribution by deep sea species was very low (Table 5).  "}]},{"head":"Size","index":9,"paragraphs":[{"index":1,"size":54,"text":"Size distribution and general trends in numbers over the survey period for the 23 most abundant fish species are discussed below. These fish species comprise 75% of the total fish count at the Auki market (shaded in grey in Appendix 3). Size at Sexual Maturity (SSM) is available for 19 of the 23 species."},{"index":2,"size":130,"text":"The most abundant fish species by weight and count at the Auki market was skipjack tuna (Katsuwonus pelamis). Minimum SSM for K. pelamis is 41cm total length for females and 42cm for males (red and blue vertical lines respectively in Figure A4-1); more than 80% of skipjack tuna which passes through the Auki market were above SSM (Figure A4-1). Landings for K. pelamis at the Auki market were generally highest between the months of January and April (Figure A4-2). SSM for rainbow runner (Elagatis bipinnulata) is 64.6 cm. About 70% of the rainbow runners which were sold at the Auki fish market were below SSM (Figure A4-9). Peak period for rainbow runner at Auki Market was similar to that for skipjack tuna and yellowfin tuna: January to April (Figure A4-10)."},{"index":3,"size":51,"text":"SSM for spot-cheek emperor (Lethrinus rubrioperculatus) is 20.5 cm. Almost all (99%) of spot-cheek emperor recorded at the Auki market were above SSM (Figure A4    No SSM data is available for the ember parrotfish (Scarus rubroviolaceus). Size frequency distribution was normal with the highest frequency at 25-36cm total length (Figure A4-41)."},{"index":4,"size":8,"text":"Landings are uniform throughout the year (Figure A4-42)."},{"index":5,"size":25,"text":"SSM for the brassy chub (Kyphosus vaigiensis) is 39cm. Ninety-nine percent (99%) of Brassy chub encountered at the Auki market were below SSM (Figure A4-43)."},{"index":6,"size":21,"text":"There was no SSM data available for the barred spinefoot (Siganus doliatus). Highest frequency is at 18-25cm total length (Figure A4-45). "}]},{"head":"Discussion and recommendations","index":10,"paragraphs":[{"index":1,"size":36,"text":"This survey has for the first time provided information about the fish sold at the Auki market: the families and species, the typical volumes and their total value in Solomon dollars, and the main fishing sites."},{"index":2,"size":140,"text":"The predominant species at the Auki Market were the pelagic species, skipjack tuna and yellowfin tuna (K. pelamis and T. albacares) which comprised together 40% of total counts of fish at Auki Market. These pelagic species are usually fished from distant locations: South Malaita and Nggela. All yellowfin tuna and bigeye tuna (99% of the individuals) were not sexually mature. However, these findings have to be considered in the context of broader studies on these species within the Pacific region. According to the South Pacific Forum Fisheries Agency (2017), yellowfin tuna and bigeye tuna are currently not overfished and not under threat. It is unlikely that small-scale fisheries on Malaita, which seem to mainly target juveniles, have a significant effect on these species. More studies on the impact of small scale fisheries on tuna will be required to confirm this."},{"index":3,"size":86,"text":"The other 60% of species encountered are predominantly reef fishes. Alite reef, Ramos Island and Lau Lagoon are important locations where a lot of reef fish comes from. The size at sexual maturity information of 19 of the top 23 species is available on Fishbase (https://www.fishbase.de/). Most of the reef fishes sold at the market are above SSM. It is possible that fishers actually catch smaller sized fishes as well, and then select larger sizes for the market while leaving the smaller ones for home consumption."},{"index":4,"size":35,"text":"The Fisheries Management (Prohibited activities) regulations 2018 set minimum sizes (65 cm) for green humphead parrotfish (Bolbometopon muricatum) and Maori wrasse (Cheilinus undulatus), which are regularly sold on the Auki market, although in limited numbers."},{"index":5,"size":34,"text":"This survey provides a baseline for fisheries management on Malaita. Furthermore, it adds on to similar work that was undertaken in Honiara, Gizo and Lata by MFMR in the context of the HapiFis project."},{"index":6,"size":13,"text":"Based on the information presented here, we make the following recommendations to MFMR:"},{"index":7,"size":26,"text":"i) Enable the provincial fisheries office to monitor the Auki fish market to check minimum sizes, prohibited species and communicate with fish vendors and consumers; ii)"},{"index":8,"size":25,"text":"Prioritize the management of the main fishing locations that supply most of the reef fish to Auki market, particularly Alite Reef and Ramos Island; iii)"},{"index":9,"size":9,"text":"Enforce the Fisheries Management (Prohibited activities) regulations 2018; iv)"},{"index":10,"size":22,"text":"Raise awareness of consumers on minimum sizes, prohibited species and food safety (for example by placing informative billboards on the market); v)"},{"index":11,"size":23,"text":"Provide information on fish handling and processing, hygiene and fisheries management to fishers and fish vendors (for example by organizing training workshops); vi)"},{"index":12,"size":36,"text":"Prohibit the sale of discarded tuna (solfis) from commercial fishing boats; vii) Support the provincial government in improving the infrastructure of the fish section of the Auki market, particularly the water system, pavement and roofing; viii)"},{"index":13,"size":43,"text":"Generate information on the impact of coastal fisheries on yellowfin and bigeye tuna; ix) Replicate the Auki fish market survey to detect temporal trends (including a survey on marine invertebrates); and x) Develop a program to monitor rural fish markets in Malaita Province.                   "}]}],"figures":[{"text":"Figure 1 : Figure 1: General trend of the volumes of fish passing through the Auki market on a daily basis (details of fish volumes from different fishing sites are shown in Figure 2 below). "},{"text":"Figure 2 : Figure 2: General trend of volumes of fish from different fishing sites on a daily basis "},{"text":"Photo 5 : Photo 5: Variety of reef fish sold at Auki market "},{"text":"Figure 3 : Figure 3: Count plot (n) of individual fishes belonging to different families from different fishing sites (see Appendix 3 for details) "},{"text":"Figure 4A : Figure 4A: Trends in counts of pelagic species, for the main fishing areas. "},{"text":"Figure 4B : Figure 4B: Trends in counts of reef associated species, for three main fishing areas "},{"text":"Photo 12 : Photo 12: Skipjack tuna or bonito(Katsuwonus pelamis)     "},{"text":" -11). The period of the highest count of spot-cheek emperor at Auki market was January and February 2017.No SSM data was available for golden-lined spinefoot (Siganus lineatus). The size frequency distribution is skewed towards the right with highest frequency at 27cm total length (FigureA4-13). Highest counts at the Auki market were during January to April 2017 (FigureA4-14). SSM for the Pacific longnose parrotfish (Hipposcarus longiceps) is 27.5cm. Fifty percent of the Pacific longnose parrotfish were above SSM (Figure A4-15). Counts of Pacific longnose parrotfish at Auki market was general similar for the 11 months the year (Figure A4-16). "},{"text":" Photo 14: Spot-cheek emperor (Lethrinus rubrioperculatus) "},{"text":"Photo 15 : Photo 15: Redbelly yellowtail fusilier(Caesio cuning)     "},{"text":"Photo 16 : Photo 16: Longface emperor (Lethrinus olivaceus) "},{"text":"Figure A4- 5 : Figure A4-5: Size frequency distribution of Lutjanus gibbus. Red-dotted line represents Size at Sexual Maturity (SSM). "},{"text":"Figure Figure A4-6-General trend of the number of Lutjanus gibbus at Auki Market during the period November 2016-December 2017. "},{"text":"Figure Figure A4-8: General trend of numbers of Siganus canaliculatus at Auki Market during the period November 2016-December 2017 "},{"text":"Figure Figure A4-10: General trend of numbers of Elagatis bipinnulata at Auki Market during the period November 2016-December 2017. "},{"text":"Figure Figure A4-12: General trend of the number of Lethrinus rubrioperculatus during the period November 2016-December 2017 "},{"text":"Figure Figure A4-16: General trend of the number of Hipposcarus longiceps over the period November 2016-December 2017 "},{"text":"Figure Figure A4-18: General trend on number of Thunnus obesus at Auki Market during the period November 2016-December 2017 "},{"text":"Figure A4- 20 : Figure A4-20: General trend of Siganus fuscescens at Auki Market during the period November 2016-December 2017 "},{"text":"Figure Figure A4-22: General trend of Lethrinus harak at Auki Market during the period November 2016-December 2017. "},{"text":"Figure Figure A4-24: General trend of Acanthurus lineatus at Auki Market during the survey period "},{"text":"Figure Figure A4-28: General trend of Siganus argenteus at Auki Market during the period November 2016-December 2017. "},{"text":"Figure A4- 29 : Figure A4-29: Size distribution of Lethrinus xanthochilus. Red-dotted line represents Size at Sexual Maturity (SSM). "},{"text":"Figure Figure A4-30: General trend of Lethrinus xanthochilus at Auki Market during the period November 2016-December 2017 "},{"text":"Figure A4- 34 : Figure A4-34: General trend of Tylosurus crocodilus at Auki Market during the period November 2016-December 2017 "},{"text":"Figure Figure A4-36: General trend of Mulloidichthys flavolineatus at Auki Market during the period November 2016-December 2017 "},{"text":"Figure Figure A4-40: General trend of Parupeneus barberinus at Auki Market during the period November 2016-December 2017. "},{"text":"Figure A4- 43 : Figure A4-43: Size frequency distribution of Kyphosus vaigiensis. Red-dotted line represents Size at Sexual Maturity (SSM). "},{"text":"Figure Figure A4-44: General trend of Kyphosus vaigiensis at Auki Market during the period November 2016-December 2017 "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 : Total number of species for the different fish families Family Number of Species FamilyNumber of Species Lutjanidae 45 Lutjanidae45 Serranidae 38 Serranidae38 Acanthuridae 34 Acanthuridae34 Carangidae 33 Carangidae33 Scaridae 33 Scaridae33 Lethrinidae 25 Lethrinidae25 Holocentridae 22 Holocentridae22 Mullidae 18 Mullidae18 Siganidae 18 Siganidae18 Labridae 16 Labridae16 Haemulidae 11 Haemulidae11 Scombridae 11 Scombridae11 Balistidae 10 Balistidae10 Nemipteridae 10 Nemipteridae10 Caesionidae 7 Caesionidae7 Mugilidae 6 Mugilidae6 Sphyraenidae 6 Sphyraenidae6 Belonidae 4 Belonidae4 Ephippidae 4 Ephippidae4 Gerreidae 4 Gerreidae4 Chaetodontidae 3 Chaetodontidae3 Kyphosidae 3 Kyphosidae3 Pomacentridae 3 Pomacentridae3 Priacanthidae 3 Priacanthidae3 Terapontidae 3 Terapontidae3 Atherinidae 2 Atherinidae2 Clupeidae 2 Clupeidae2 Gempylidae 2 Gempylidae2 Istiophoridae 2 Istiophoridae2 Leiognathidae 2 Leiognathidae2 Monacanthidae 2 Monacanthidae2 Platycephalidae 2 Platycephalidae2 Pomacanthidae 2 Pomacanthidae2 Carcharhinidae 1 Carcharhinidae1 Chanidae 1 Chanidae1 Coryphaenidae 1 Coryphaenidae1 Hemiramphidae 1 Hemiramphidae1 Megalopidae 1 Megalopidae1 Menidae 1 Menidae1 Monodactylidae 1 Monodactylidae1 Paralichthyidae 1 Paralichthyidae1 Polynemidae 1 Polynemidae1 Scatophagidae 1 Scatophagidae1 Scorpaenidae 1 Scorpaenidae1 Soleidae 1 Soleidae1 Toxotidae 1 Toxotidae1 Zanclidae 1 Zanclidae1  "},{"text":"Table 2 : Total count of individual fishes from different families, their total weights (Kg) 4 based on individual fish weights, and estimated total value in SBD$. Family Total Count of Total weight (Kg) Total value (SBD$) Adjusted estimate total FamilyTotal Count ofTotal weight (Kg)Total value (SBD$)Adjusted estimate total  individual fishes  based on survey value of all fishes sold at the individual fishesbased on surveyvalue of all fishes sold at the     Auki market (SBD$) Auki market (SBD$) Scombridae 49362 62899.36 1979893 3959786 Scombridae4936262899.3619798933959786 Siganidae 8499 221.5 56515 113030 Siganidae8499221.556515113030 Lutjanidae 8146 2607.59 143991 287982 Lutjanidae81462607.59143991287982 Lethrinidae 7920 1694.98 106632 213264 Lethrinidae79201694.98106632213264 Scaridae 5687 689.49 64027 128054 Scaridae5687689.4964027128054 Carangidae 4242 2961.6 110679 221358 Carangidae42422961.6110679221358 Acanthuridae 3669 418.25 35847 71694 Acanthuridae3669418.253584771694 Mullidae 2975 109.4 20293 40586 Mullidae2975109.42029340586 Caesionidae 1657 199.7 12684 25368 Caesionidae1657199.71268425368 Belonidae 1098 303.45 15452 30904 Belonidae1098303.451545230904 Serranidae 1062 318.47 17621 35242 Serranidae1062318.471762135242 Kyphosidae 841 76.4 8064 16128 Kyphosidae84176.4806416128 Holocentridae 819 66.75 3691 7382 Holocentridae81966.7536917382 Sphyraenidae 733 414.55 14094 28188 Sphyraenidae733414.551409428188 Labridae 677 23 5620 11240 Labridae67723562011240 Haemulidae 609 76.9 9471 18942 Haemulidae60976.9947118942 Mugilidae 549 46.8 4687 9374 Mugilidae54946.846879374 Hemiramphidae 277 0.75 1805 3610 Hemiramphidae2770.7518053610 Atherinidae 238 41 396 792 Atherinidae23841396792 Gerreidae 209 6.55 995 1990 Gerreidae2096.559951990 Nemipteridae 155 11.79 934 1868 Nemipteridae15511.799341868 Priacanthidae 106 66.45 1032 2064 Priacanthidae10666.4510322064 Terapontidae 90 4.9 288 576 Terapontidae904.9288576 Ephippidae 87 11.2 1242 2484 Ephippidae8711.212422484 Clupeidae 77 28 56 112 Clupeidae772856112 Balistidae 72 38.55 1153 2306 Balistidae7238.5511532306 Coryphaenidae 53 195.7 3880 7760 Coryphaenidae53195.738807760 Monodactylidae 27 - 82 164 Monodactylidae27-82164 Leiognathidae 22 0.1 139 278 Leiognathidae220.1139278 Menidae 16 - - - Menidae16--- Toxotidae 12 - 24 48 Toxotidae12-2448 Pomacentridae 10 - 55 110 Pomacentridae10-55110 Gempylidae 8 0.8 45 90 Gempylidae80.84590 Pomacanthidae 7 3 115 230 Pomacanthidae73115230 Megalopidae 4 - 12 24 Megalopidae4-1224 Platycephalidae 4 2.7 110 220 Platycephalidae42.7110220 Scatophagidae 4 - 32 64 Scatophagidae4-3264 Carcharhinidae 3 - - - Carcharhinidae3---  "},{"text":"Table 3 : Selling prices of the top 23 species at the Auki market Species Unit price range Mean unit price Sample size (n) used to SpeciesUnit price rangeMean unit priceSample size (n) used to  ($/Kg) ($/Kg) calculate unit price ($/Kg)($/Kg)calculate unit price Katsuwonus pelamis 1.42 -1500 37.45 2008 Katsuwonus pelamis1.42 -150037.452008 Thunnus albacares 8.69 -444 41.93 636 Thunnus albacares8.69 -44441.93636 Lutjanus gibbus 4.44 -400 43.75 344 Lutjanus gibbus4.44 -40043.75344 Siganus canaliculatus 4.00 -220 38.77  Siganus canaliculatus4.00 -22038.77 Elagatis bipinnulata 10 .00 -411.76 42.83 243 Elagatis bipinnulata10 .00 -411.7642.83243 Lethrinus rubrioperculatus 10.00 -300 38.44 153 Lethrinus rubrioperculatus10.00 -30038.44153 Siganus lineatus 15.00 -66.67 37.36  Siganus lineatus15.00 -66.6737.36 Hipposcarus longiceps 11.10 -125 34.83  Hipposcarus longiceps11.10 -12534.83 Thunnus obesus 4.00 -266.67 38.17 156 Thunnus obesus4.00 -266.6738.17156 Siganus fuscescens 20.00 -50 35.11  Siganus fuscescens20.00 -5035.11 Lethrinus harak 20.00 -50 31.83  Lethrinus harak20.00 -5031.83 Acanthurus lineatus 2.50 -100 26.5  Acanthurus lineatus2.50 -10026.5 Caesio cuning Not recorded Not recorded Not recorded Caesio cuningNot recordedNot recordedNot recorded Siganus argenteus 6.00 -100 35.04  Siganus argenteus6.00 -10035.04 Lethrinus xanthochilus 5.00 -75 36.26  Lethrinus xanthochilus5.00 -7536.26 Lethrinus olivaceus 17.24 -342.85 48.7  Lethrinus olivaceus17.24 -342.8548.7 Tylosurus crocodilus Not recorded Not recorded Not recorded Tylosurus crocodilusNot recordedNot recordedNot recorded Mulloidichthys flavolineatus 40 -50 46.67 3 Mulloidichthys flavolineatus40 -5046.673 Lethrinus obsoletus 25 -50 34.72 7 Lethrinus obsoletus25 -5034.727 Parupeneus barberinus 12.00 -50 29.23  Parupeneus barberinus12.00 -5029.23 Scarus rubroviolaceus 12.00 -120 30.11  Scarus rubroviolaceus12.00 -12030.11 Kyphosus vaigiensis 12.5 -50 29.73  Kyphosus vaigiensis12.5 -5029.73 Siganus doliatus 16.67 -50 31.5  Siganus doliatus16.67 -5031.5  "},{"text":"Table 4 : Total value of fish from different fishing sites Fishing site Total Value (SBD$) Adjusted estimate total value Percent contribution to Fishing siteTotal Value (SBD$)Adjusted estimate total valuePercent contribution to  based on surveyed of all fishes from site (SBD$) total value of fish at Auki based on surveyedof all fishes from site (SBD$)total value of fish at Auki  vendors  Market (%) vendorsMarket (%) Ramos Island 825885  31.50 Ramos Island82588531.50 Alite Reef 586224  22.35 Alite Reef58622422.35 Nggela 429295  16.37 Nggela42929516.37 South Malaita 279130  10.64 South Malaita27913010.64 Lau Lagoon 146165  5.57 Lau Lagoon1461655.57 Fishing boats 124271  4.73 Fishing boats1242714.73 Ndai Island 85307  3.25 Ndai Island853073.25 Langalanga Lagoon 79850  3.04 Langalanga Lagoon798503.04 East Kwara'ae and Kwaio 55702  2.12 East Kwara'ae and Kwaio557022.12 West Kwara'ae 9982  0.38 West Kwara'ae99820.38  "},{"text":"Table 5 : Total value of fish from different habitat types Habitat type Economic Value (SBD$) of Adjusted estimate total Percent Habitat typeEconomic Value (SBD$) ofAdjusted estimate totalPercent  contribution based on value of contributions contributions to contribution based onvalue of contributionscontributions to  vendor survey (SBD$) value of fish (%) vendor survey(SBD$)value of fish (%) Pelagic 2083605 4167210 79.47 Pelagic2083605416721079.47 Reef associated 531401 1062802 20.26 Reef associated531401106280220.26 Deep sea (>300m) 6805 13610 0.25 Deep sea (>300m)6805136100.25  "},{"text":"Table 6 : Globally threatened species at the Auki market(IUCN 2018)    Species Species  "},{"text":" Total count of different fish species and their weights in Kg (based on individual fish weights) at Auki Market during the survey period. Appendices Appendix 1: Fish families and species observed at Auki fish market Family Species Melichthys vidua Odonus niger Pseudobalistes flavimarginatus Rhinecanthus verrucosus Selar crumenophthalmus Seriola dumerili Seriola lalandi Seriola rivoliana Lutjanus fulvus Lutjanus gibbus Lutjanus kasmira Lutjanus lemniscatus Siganidae Siganus argenteus Siganus canaliculatus Siganus corallinus Appendix 2: Count (n) of individual fishes according to different families from different fishing sites. Associated habitat type Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Pelagic Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Family Fishing Site Total count (n) Acanthuridae Alite Reef 1221 East Kwara'ae and Kwaio 1060 Chanidae Lau Lagoon East Kwara'ae and Kwaio Clupeidae Ramos Island Kyphosidae Lau Lagoon East Kwara'ae and Kwaio Alite Reef Mugilidae Langalanga Lagoon Lau Lagoon East Kwara'ae and Kwaio Scatophagidae Langalanga Lagoon Lau Lagoon Lutjanus semicinctus 317 0.32 18.25 Acanthurus auranticavus 121 0.12 10.85 Planiliza macrolepis 51 0.05 -Epinephelus ongus 28 0.03 4.6 Parupeneus insularis 15 0.01 1.25 Acanthurus leucocheilus 8 0.01 -Appendix 3: Species Total Count Percent Contribution to Naso vlamingii 305 0.30 64.93 Lethrinus miniatus 117 0.12 12.95 Scolopsis margaritifera 50 0.05 0.99 Acanthurus dussumieri 28 0.03 2.8 Megalaspis cordyla 15 0.01 -Dischistodus pseudochrysopoecilus 8 0.01 -Total weight in Kg Parupeneus indicus 305 0.30 10.9 Crenimugil crenilabis 117 0.12 11.7 Lutjanus malabaricus 48 0.05 33.35 Epinephelus merra 28 0.03 1.5 Myripristis chryseres 15 0.01 -Myripristis woodsi 8 0.01 -total fish count (%) Pristipomoides auricilla 301 0.30 56.75 Scarus oviceps 116 0.12 20.95 Acanthurus xanthopterus 48 0.05 7.5 Etelis carbunculus 27 0.03 20.35 Neoniphon argenteus 15 0.01 -Xanthichthys caeruleolineatus 8 0.01 - Appendices Appendix 1: Fish families and species observed at Auki fish market Family Species Melichthys vidua Odonus niger Pseudobalistes flavimarginatus Rhinecanthus verrucosus Selar crumenophthalmus Seriola dumerili Seriola lalandi Seriola rivoliana Lutjanus fulvus Lutjanus gibbus Lutjanus kasmira Lutjanus lemniscatus Siganidae Siganus argenteus Siganus canaliculatus Siganus corallinus Appendix 2: Count (n) of individual fishes according to different families from different fishing sites. Associated habitat type Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Pelagic Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Reef associated Family Fishing Site Total count (n) Acanthuridae Alite Reef 1221 East Kwara'ae and Kwaio 1060 Chanidae Lau Lagoon East Kwara'ae and Kwaio Clupeidae Ramos Island Kyphosidae Lau Lagoon East Kwara'ae and Kwaio Alite Reef Mugilidae Langalanga Lagoon Lau Lagoon East Kwara'ae and Kwaio Scatophagidae Langalanga Lagoon Lau Lagoon Lutjanus semicinctus 317 0.32 18.25 Acanthurus auranticavus 121 0.12 10.85 Planiliza macrolepis 51 0.05 -Epinephelus ongus 28 0.03 4.6 Parupeneus insularis 15 0.01 1.25 Acanthurus leucocheilus 8 0.01 -Appendix 3: Species Total Count Percent Contribution to Naso vlamingii 305 0.30 64.93 Lethrinus miniatus 117 0.12 12.95 Scolopsis margaritifera 50 0.05 0.99 Acanthurus dussumieri 28 0.03 2.8 Megalaspis cordyla 15 0.01 -Dischistodus pseudochrysopoecilus 8 0.01 -Total weight in Kg Parupeneus indicus 305 0.30 10.9 Crenimugil crenilabis 117 0.12 11.7 Lutjanus malabaricus 48 0.05 33.35 Epinephelus merra 28 0.03 1.5 Myripristis chryseres 15 0.01 -Myripristis woodsi 8 0.01 -total fish count (%) Pristipomoides auricilla 301 0.30 56.75 Scarus oviceps 116 0.12 20.95 Acanthurus xanthopterus 48 0.05 7.5 Etelis carbunculus 27 0.03 20.35 Neoniphon argenteus 15 0.01 -Xanthichthys caeruleolineatus 8 0.01 - Acanthuridae Scombridae Katsuwonus pelamis Parupeneus macronemus Acanthurus achilles Sufflamen fraenatum Trachinotus baillonii Lutjanus madras Siganus doliatus Lau Lagoon Alite Reef Langalanga Lagoon Alite Reef Alite Reef 37584 301 Selar crumenophthalmus 114 Myripristis amaena 48 Canthidermis maculata 27 Pinjalo pinjalo 15 Lutjanus sebae 7 37.57 0.30 0.11 0.05 0.03 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 982 50536.31 6.9 23 -12.5 -8.5 Acanthuridae Scombridae Katsuwonus pelamis Parupeneus macronemus Acanthurus achilles Sufflamen fraenatum Trachinotus baillonii Lutjanus madras Siganus doliatus Lau Lagoon Alite Reef Langalanga Lagoon Alite Reef Alite Reef 37584 301 Selar crumenophthalmus 114 Myripristis amaena 48 Canthidermis maculata 27 Pinjalo pinjalo 15 Lutjanus sebae 737.57 0.30 0.11 0.05 0.03 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated 98250536.31 6.9 23 -12.5 -8.5 Acanthurus albipectoralis Xanthichthys caeruleolineatus Trachinotus blochii Lutjanus malabaricus Siganus fuscescens Langalanga Lagoon Ramos Island Ramos Island Ramos Island 9536 Lethrinus erythracanthus Thunnus albacares 287 Lethrinus semicinctus 111 Parupeneus multifasciatus 47 Scolopsis lineata 27 Plectorhinchus albovittatus 15 Pristipomoides multidens 7 9.53 0.29 0.11 0.05 0.03 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 274 10329.4 191.8 35.35 3.95 7.5 -7.5 Acanthurus albipectoralis Xanthichthys caeruleolineatus Trachinotus blochii Lutjanus malabaricus Siganus fuscescens Langalanga Lagoon Ramos Island Ramos Island Ramos Island 9536 Lethrinus erythracanthus Thunnus albacares 287 Lethrinus semicinctus 111 Parupeneus multifasciatus 47 Scolopsis lineata 27 Plectorhinchus albovittatus 15 Pristipomoides multidens 79.53 0.29 0.11 0.05 0.03 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated 27410329.4 191.8 35.35 3.95 7.5 -7.5 Acanthurus auranticavus Uraspis helvola Lutjanus monostigma Siganus guttatus Ramos Island Nggela Nggela 4372 285 104 47 27 Cephalopholis sonnerati Coryphaenidae Lutjanus gibbus Siganus punctatus Pinjalo lewisi Scarus globiceps Platax teira 14 Pristipomoides flavipinnis 7 4.37 0.28 0.10 0.05 0.03 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 115 1315.64 26.4 24.85 0.85 4.1 8.25 4.8 Acanthurus auranticavus Uraspis helvola Lutjanus monostigma Siganus guttatus Ramos Island Nggela Nggela 4372 285 104 47 27 Cephalopholis sonnerati Coryphaenidae Lutjanus gibbus Siganus punctatus Pinjalo lewisi Scarus globiceps Platax teira 14 Pristipomoides flavipinnis 74.37 0.28 0.10 0.05 0.03 0.01 0.01Reef associated Reef associated Reef associated Reef associated 1151315.64 26.4 24.85 0.85 4.1 8.25 4.8 Acanthurus bariene Hyporhamphus dussumieri Lutjanus quinquelineatus Siganus lineatus West Kwara'ae Alite Reef Lau Lagoon Lau Lagoon Langalanga Lagoon 3148 285 Grammatorcynus bilineatus Belonidae Labridae Mullidae Siganus canaliculatus Lutjanus ehrenbergii 102 Priacanthus blochii 46 Monodactylus argenteus 27 Epinephelus fasciatus 14 Carangoides ferdau 7 3.15 0.28 0.10 0.05 0.03 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 16 36.45 1.8 57.7 58.2 -4.3 1.6 Acanthurus bariene Hyporhamphus dussumieri Lutjanus quinquelineatus Siganus lineatus West Kwara'ae Alite Reef Lau Lagoon Lau Lagoon Langalanga Lagoon 3148 285 Grammatorcynus bilineatus Belonidae Labridae Mullidae Siganus canaliculatus Lutjanus ehrenbergii 102 Priacanthus blochii 46 Monodactylus argenteus 27 Epinephelus fasciatus 14 Carangoides ferdau 73.15 0.28 0.10 0.05 0.03 0.01 0.01Reef associated Reef associated Reef associated Reef associated 1636.45 1.8 57.7 58.2 -4.3 1.6 Acanthurus blochii Strongylura incisa Carcharhinus brachyurus Lutjanus rivulatus Siganus puelloides South Malaita Ramos Island East Kwara'ae and Kwaio East Kwara'ae and Kwaio South Malaita 2666 277 98 46 26 Plectorhinchus chaetodonoides Carcharhinidae Elagatis bipinnulata Hemiramphus far Gerres oyena Chlorurus spilurus Gymnosarda unicolor 14 Selar boops 7 2.66 0.28 0.10 0.05 0.03 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 1 2430.45 0.75 0.75 7.76 40.65 2.75 1.4 Acanthurus blochii Strongylura incisa Carcharhinus brachyurus Lutjanus rivulatus Siganus puelloides South Malaita Ramos Island East Kwara'ae and Kwaio East Kwara'ae and Kwaio South Malaita 2666 277 98 46 26 Plectorhinchus chaetodonoides Carcharhinidae Elagatis bipinnulata Hemiramphus far Gerres oyena Chlorurus spilurus Gymnosarda unicolor 14 Selar boops 72.66 0.28 0.10 0.05 0.03 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated 12430.45 0.75 0.75 7.76 40.65 2.75 1.4 Acanthurus dussumieri Tylosurus crocodilus Lutjanus rufolineatus Siganus puellus Ndai Island Langalanga Lagoon Langalanga Lagoon Fishing boats Lethrinus rubrioperculatus 1983 Caranx papuensis 274 Caesio lunaris 97 Siganus punctatissimus 45 Sargocentron violaceum 26 Naso brevirostris 14 Neoniphon sammara 7 1.98 0.27 0.10 0.04 0.03 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 543.75 81.65 15 16.15 5.7 2.45 1.05 Acanthurus dussumieri Tylosurus crocodilus Lutjanus rufolineatus Siganus puellus Ndai Island Langalanga Lagoon Langalanga Lagoon Fishing boats Lethrinus rubrioperculatus 1983 Caranx papuensis 274 Caesio lunaris 97 Siganus punctatissimus 45 Sargocentron violaceum 26 Naso brevirostris 14 Neoniphon sammara 71.98 0.27 0.10 0.04 0.03 0.01 0.01Reef associated Reef associated Reef associated Reef associated543.75 81.65 15 16.15 5.7 2.45 1.05 Acanthurus grammoptilus Zenarchopterus dispar Chaetodon rafflesii Lutjanus russellii Siganus punctatissimus Langalanga Lagoon Fishing boats Alite Reef Alite Reef Ndai Island 1799 271 97 Cephalopholis sexmaculata Chaetodontidae Atherinidae Siganus lineatus Lutjanus monostigma Scarus frenatus 45 Acanthurus nigroris 25 Pterocaesio capricornis 14 Epibulus insidiator 7 1.80 0.27 0.10 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 190 44.5 52.1 13.35 15.3 2.1 1.8 0.6 Acanthurus grammoptilus Zenarchopterus dispar Chaetodon rafflesii Lutjanus russellii Siganus punctatissimus Langalanga Lagoon Fishing boats Alite Reef Alite Reef Ndai Island 1799 271 97 Cephalopholis sexmaculata Chaetodontidae Atherinidae Siganus lineatus Lutjanus monostigma Scarus frenatus 45 Acanthurus nigroris 25 Pterocaesio capricornis 14 Epibulus insidiator 71.80 0.27 0.10 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated 19044.5 52.1 13.35 15.3 2.1 1.8 0.6 Acanthurus leucocheilus Chaetodon vagabundus Lutjanus sebae Siganus punctatus Lau Lagoon Lau Lagoon Ramos Island Ramos Island West Kwara'ae 1323 268 90 Plectropomus areolatus Hipposcarus longiceps Caesio teres Myripristis berndti 44 Caranx ignobilis 24 Epinephelus fuscoguttatus 13 Parupeneus ciliatus 7 1.32 0.27 0.09 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 48 114.9 35.2 10.2 24.85 43.7 10.15 0.5 Acanthurus leucocheilus Chaetodon vagabundus Lutjanus sebae Siganus punctatus Lau Lagoon Lau Lagoon Ramos Island Ramos Island West Kwara'ae 1323 268 90 Plectropomus areolatus Hipposcarus longiceps Caesio teres Myripristis berndti 44 Caranx ignobilis 24 Epinephelus fuscoguttatus 13 Parupeneus ciliatus 71.32 0.27 0.09 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated 48114.9 35.2 10.2 24.85 43.7 10.15 0.5 Acanthurus lineatus Caesio caerulaurea Heniochus varius Lutjanus semicinctus Siganus randalli West Kwara'ae West Kwara'ae Lau Lagoon 1298 268 87 44 24 13 Lipocheilus carnolabrum Caesionidae Thunnus obesus Scarus rivulatus Epinephelus corallicola Terapon jarbua Aphareus furca Diagramma pictum 6 1.30 0.27 0.09 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 1576.05 29.85 11.95 2.5 12.65 8.6 6.6 Acanthurus lineatus Caesio caerulaurea Heniochus varius Lutjanus semicinctus Siganus randalli West Kwara'ae West Kwara'ae Lau Lagoon 1298 268 87 44 24 13 Lipocheilus carnolabrum Caesionidae Thunnus obesus Scarus rivulatus Epinephelus corallicola Terapon jarbua Aphareus furca Diagramma pictum 61.30 0.27 0.09 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated1576.05 29.85 11.95 2.5 12.65 8.6 6.6 Acanthurus maculiceps Caesio cuning Lutjanus timoriensis Siganus spinus Nggela South Malaita Lau Lagoon East Kwara'ae and Kwaio 1261 254 86 44 Cephalopholis spiloparaea Balistidae Leiognathidae Siganus fuscescens Kyphosus cinerascens Cetoscarus ocellatus Gerres erythrourus 24 Cephalopholis urodeta 13 Caranx tille 6 1.26 0.25 0.09 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 26 18.95 44.05 42.15 0.2 8.2 4.2 4.8 Acanthurus maculiceps Caesio cuning Lutjanus timoriensis Siganus spinus Nggela South Malaita Lau Lagoon East Kwara'ae and Kwaio 1261 254 86 44 Cephalopholis spiloparaea Balistidae Leiognathidae Siganus fuscescens Kyphosus cinerascens Cetoscarus ocellatus Gerres erythrourus 24 Cephalopholis urodeta 13 Caranx tille 61.26 0.25 0.09 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated 2618.95 44.05 42.15 0.2 8.2 4.2 4.8 Acanthurus mata Caesio lunaris Chanos chanos Lutjanus vitta Siganus stellatus Alite Reef Alite Reef Lau Lagoon Pseudobalistes flavimarginatus Chanidae Nemipteridae Lethrinus harak Scarus dimidiatus Acanthurus olivaceus Siganus randalli Euthynnus affinis Cephalopholis miniata 1251 254 86 43 23 13 6 1.25 0.25 0.09 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 18 21.6 41.19 7.05 10.7 22.4 3.8 3.5 Acanthurus mata Caesio lunaris Chanos chanos Lutjanus vitta Siganus stellatus Alite Reef Alite Reef Lau Lagoon Pseudobalistes flavimarginatus Chanidae Nemipteridae Lethrinus harak Scarus dimidiatus Acanthurus olivaceus Siganus randalli Euthynnus affinis Cephalopholis miniata1251 254 86 43 23 13 61.25 0.25 0.09 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated 1821.6 41.19 7.05 10.7 22.4 3.8 3.5 Acanthurus nigricans Caesio teres Macolor macularis Siganus vermiculatus Lau Lagoon Lau Lagoon Langalanga Lagoon Alite Reef Alite Reef 1059 242 85 43 Pristipomoides filamentosus Ephippidae Scorpaenidae Acanthurus lineatus Plectorhinchus vittatus Sphyraena obtusata Myripristis murdjan 23 Acanthurus pyroferus 13 Epinephelus areolatus 6 1.06 0.24 0.08 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 14 67.3 24.9 0.3 5.3 1.3 0.3 2.4 Acanthurus nigricans Caesio teres Macolor macularis Siganus vermiculatus Lau Lagoon Lau Lagoon Langalanga Lagoon Alite Reef Alite Reef 1059 242 85 43 Pristipomoides filamentosus Ephippidae Scorpaenidae Acanthurus lineatus Plectorhinchus vittatus Sphyraena obtusata Myripristis murdjan 23 Acanthurus pyroferus 13 Epinephelus areolatus 61.06 0.24 0.08 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated 1467.3 24.9 0.3 5.3 1.3 0.3 2.4 Acanthurus nigricauda Caesio varilineata Amblygaster sirm Macolor niger Siganus virgatus Ramos Island Alite Reef Langalanga Lagoon 1014 231 83 Plectropomus leopardus Clupeidae Caesio cuning Decapterus macarellus Myripristis adusta 42 Naso caeruleacauda 23 Pelates quadrilineatus 13 Siganus virgatus 6 1.01 0.23 0.08 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 10 133.15 43.5 1.75 2.75 0.3 -1.5 Acanthurus nigricauda Caesio varilineata Amblygaster sirm Macolor niger Siganus virgatus Ramos Island Alite Reef Langalanga Lagoon 1014 231 83 Plectropomus leopardus Clupeidae Caesio cuning Decapterus macarellus Myripristis adusta 42 Naso caeruleacauda 23 Pelates quadrilineatus 13 Siganus virgatus 61.01 0.23 0.08 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated 10133.15 43.5 1.75 2.75 0.3 -1.5 Acanthurus nigroris Pterocaesio capricornis Herklotsichthys quadrimaculatus Paracaesio kusakarii Siganus vulpinus Langalanga Lagoon Langalanga Lagoon Ramos Island East Kwara'ae and Kwaio Alite Reef 952 230 81 42 Hemigymnus melapterus Lethrinidae Serranidae Siganus argenteus Rastrelliger kanagurta Lutjanus kasmira Cheilinus trilobatus 23 Parupeneus pleurostigma 12 Sargocentron caudimaculatum 6 0.95 0.23 0.08 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 4 31.75 44.8 14.65 1.2 -7.8 1.2 Acanthurus nigroris Pterocaesio capricornis Herklotsichthys quadrimaculatus Paracaesio kusakarii Siganus vulpinus Langalanga Lagoon Langalanga Lagoon Ramos Island East Kwara'ae and Kwaio Alite Reef 952 230 81 42 Hemigymnus melapterus Lethrinidae Serranidae Siganus argenteus Rastrelliger kanagurta Lutjanus kasmira Cheilinus trilobatus 23 Parupeneus pleurostigma 12 Sargocentron caudimaculatum 60.95 0.23 0.08 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated 431.75 44.8 14.65 1.2 -7.8 1.2 Acanthurus olivaceus Pterocaesio tile Paracaesio sordida Signanus argenteus Ramos Island Lau Lagoon Ramos Island Ramos Island 911 226 80 40 Mulloidichthys mimicus Lethrinus xanthochilus Paracaesio kusakarii Acanthurus blochii Aphareus rutilans 22 Cephalopholis igarashiensis 12 Caesio varilineata 6 0.91 0.23 0.08 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 372.05 124.6 7.5 74.05 0.25 3 0.4 Acanthurus olivaceus Pterocaesio tile Paracaesio sordida Signanus argenteus Ramos Island Lau Lagoon Ramos Island Ramos Island 911 226 80 40 Mulloidichthys mimicus Lethrinus xanthochilus Paracaesio kusakarii Acanthurus blochii Aphareus rutilans 22 Cephalopholis igarashiensis 12 Caesio varilineata 60.91 0.23 0.08 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated372.05 124.6 7.5 74.05 0.25 3 0.4 Acanthurus pyroferus Coryphaena hippurus Paracaesio xanthura Langalanga Lagoon Alite Reef East Kwara'ae and Kwaio 787 226 77 40 22 Ctenochaetus flavicauda Coryphaenidae Belonidae Lethrinus olivaceus Plectorhinchus lineatus Scarus tricolor Pentapodus trivittatus Paracanthurus hepatus 12 Lutjanus boutton 6 0.79 0.23 0.08 0.04 0.02 0.01 0.01 Reef associated Pelagic Reef associated 682 261.4 35.55 7.75 2.1 --0.25 Acanthurus pyroferus Coryphaena hippurus Paracaesio xanthura Langalanga Lagoon Alite Reef East Kwara'ae and Kwaio 787 226 77 40 22 Ctenochaetus flavicauda Coryphaenidae Belonidae Lethrinus olivaceus Plectorhinchus lineatus Scarus tricolor Pentapodus trivittatus Paracanthurus hepatus 12 Lutjanus boutton 60.79 0.23 0.08 0.04 0.02 0.01 0.01Reef associated Pelagic Reef associated 682261.4 35.55 7.75 2.1 --0.25 Carangidae Soleidae Gempylidae Paralichthyidae Tylosurus crocodilus Naso hexacanthus Scarus prasiognathos Siganus stellatus Scarus forsteni Lutjanus vitta Myripristis vittata Acanthurus triostegus Alectis ciliaris Parapristipomoides squamimaxillaris Synaptura marginata Lau Lagoon Alite Reef East Kwara'ae and Kwaio Langalanga Lagoon Langalanga Lagoon 779 0.78 224 0.22 75 0.07 40 0.04 21 0.02 12 0.01 6 0.01 Reef associated Reef associated Reef associated Reef associated 200 240.7 89.15 16.55 -3.6 -0.1 Carangidae Soleidae Gempylidae Paralichthyidae Tylosurus crocodilus Naso hexacanthus Scarus prasiognathos Siganus stellatus Scarus forsteni Lutjanus vitta Myripristis vittataAcanthurus triostegus Alectis ciliaris Parapristipomoides squamimaxillaris Synaptura marginata Lau Lagoon Alite Reef East Kwara'ae and Kwaio Langalanga Lagoon Langalanga Lagoon 779 0.78 224 0.22 75 0.07 40 0.04 21 0.02 12 0.01 6 0.01Reef associated Reef associated Reef associated Reef associated 200240.7 89.15 16.55 -3.6 -0.1 Acanthurus xanthopterus Atule mate Platax batavianus Pinjalo lewisi Alite Reef Ramos Island Langalanga Lagoon Lau Lagoon Mulloidichthys flavolineatus Ephippidae 672 Acanthurus mata 222 Scarus schlegeli 75 Siganus spinus 38 Carangoides gymnostethus 21 Neoniphon aurolineatus 12 Acanthurus grammoptilus 6 0.67 0.22 0.07 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated 139 1.5 52.46 12.25 4.25 --- Acanthurus xanthopterus Atule mate Platax batavianus Pinjalo lewisi Alite Reef Ramos Island Langalanga Lagoon Lau Lagoon Mulloidichthys flavolineatus Ephippidae 672 Acanthurus mata 222 Scarus schlegeli 75 Siganus spinus 38 Carangoides gymnostethus 21 Neoniphon aurolineatus 12 Acanthurus grammoptilus 60.67 0.22 0.07 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated 1391.5 52.46 12.25 4.25 --- Ctenochaetus flavicauda Carangoides bajad Platax boersii Pinjalo pinjalo Sphyraena barracuda Ramos Island Ndai Island Lau Lagoon South Malaita 665 Parupeneus crassilabris Sphyraenidae Platycephalidae Lethrinus obsoletus 220 Cheilinus undulatus 75 Carangoides plagiotaenia 38 Herklotsichthys quadrimaculatus 21 Toxotes jaculatrix 12 Anampses caeruleopunctatus 6 0.66 0.22 0.07 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Pelagic 71 11.6 9.9 1.6 4.1 --- Ctenochaetus flavicauda Carangoides bajad Platax boersii Pinjalo pinjalo Sphyraena barracuda Ramos Island Ndai Island Lau Lagoon South Malaita 665 Parupeneus crassilabris Sphyraenidae Platycephalidae Lethrinus obsoletus 220 Cheilinus undulatus 75 Carangoides plagiotaenia 38 Herklotsichthys quadrimaculatus 21 Toxotes jaculatrix 12 Anampses caeruleopunctatus 60.66 0.22 0.07 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Pelagic 7111.6 9.9 1.6 4.1 --- Ctenochaetus striatus Carangoides chrysophrys Platax orbicularis Pristipomoides argyrogrammicus Sphyraena forsteri Fishing boats Lau Lagoon West Kwara'ae Alite Reef West Kwara'ae 660 Parupeneus cyclostomus Gerreidae Parupeneus barberinus 215 Strongylura incisa 72 Parupeneus heptacanthus 38 Leiognathus equulus 20 Balistoides viridescens 11 Lethrinus variegatus 6 0.66 0.21 0.07 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Pelagic 6 29.65 23.1 18.8 1.4 0.1 19 - Ctenochaetus striatus Carangoides chrysophrys Platax orbicularis Pristipomoides argyrogrammicus Sphyraena forsteri Fishing boats Lau Lagoon West Kwara'ae Alite Reef West Kwara'ae 660 Parupeneus cyclostomus Gerreidae Parupeneus barberinus 215 Strongylura incisa 72 Parupeneus heptacanthus 38 Leiognathus equulus 20 Balistoides viridescens 11 Lethrinus variegatus 60.66 0.21 0.07 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Pelagic 629.65 23.1 18.8 1.4 0.1 19 - Naso annulatus Carangoides ferdau Platax teira Pristipomoides auricilla Sphyraena jello Langalanga Lagoon Nggela Nggela 603 213 Bolbometopon muricatum Scarus rubroviolaceus Moolgarda seheli 69 Scarus spinus 37 Siganus corallinus 19 Scarus altipinnis 11 Oxycheilinus unifasciatus 6 0.60 0.21 0.07 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Deep (>300m) Pelagic 146.05 30.3 4.3 4.1 2 3.1 - Naso annulatus Carangoides ferdau Platax teira Pristipomoides auricilla Sphyraena jello Langalanga Lagoon Nggela Nggela 603 213 Bolbometopon muricatum Scarus rubroviolaceus Moolgarda seheli 69 Scarus spinus 37 Siganus corallinus 19 Scarus altipinnis 11 Oxycheilinus unifasciatus 60.60 0.21 0.07 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Deep (>300m) Pelagic146.05 30.3 4.3 4.1 2 3.1 - Naso brachycentron Carangoides fulvoguttatus Pristipomoides filamentosus Sphyraena obtusata Alite Reef Alite Reef East Kwara'ae and Kwaio 571 Atherinomorus lacunosus Caesionidae Polynemidae Kyphosus vaigiensis 206 Cheilinus chlorourus 66 Gerres filamentosus 37 Siganus guttatus 19 Plectropomus maculatus 11 Parapristipomoides squamimaxillaris 6 0.57 0.21 0.07 0.04 0.02 0.01 0.01 Reef associated Reef associated Deep (>300m) Pelagic 1092 32.05 25 2.75 2.6 0.8 2.7 - Naso brachycentron Carangoides fulvoguttatus Pristipomoides filamentosus Sphyraena obtusata Alite Reef Alite Reef East Kwara'ae and Kwaio 571 Atherinomorus lacunosus Caesionidae Polynemidae Kyphosus vaigiensis 206 Cheilinus chlorourus 66 Gerres filamentosus 37 Siganus guttatus 19 Plectropomus maculatus 11 Parapristipomoides squamimaxillaris 60.57 0.21 0.07 0.04 0.02 0.01 0.01Reef associated Reef associated Deep (>300m) Pelagic 109232.05 25 2.75 2.6 0.8 2.7 - Naso brevirostris Carangoides gymnostethus Rexea prometheoides Pristipomoides flavipinnis Sphyraena putnamae Ramos Island Ramos Island Lau Lagoon 543 205 Epinephelus coeruleopunctatus Gempylidae Lutjanidae Siganidae Siganus doliatus Caesio caerulaurea 65 Lutjanus timoriensis 36 Scarus chameleon 18 Novaculichthys taeniourus 11 Rastrelliger faughni 6 0.54 0.20 0.06 0.04 0.02 0.01 0.01 Reef associated Reef associated Pelagic Reef associated Pelagic 192 16 13.55 7 14.85 6.4 1.1 - Naso brevirostris Carangoides gymnostethus Rexea prometheoides Pristipomoides flavipinnis Sphyraena putnamae Ramos Island Ramos Island Lau Lagoon 543 205 Epinephelus coeruleopunctatus Gempylidae Lutjanidae Siganidae Siganus doliatus Caesio caerulaurea 65 Lutjanus timoriensis 36 Scarus chameleon 18 Novaculichthys taeniourus 11 Rastrelliger faughni 60.54 0.20 0.06 0.04 0.02 0.01 0.01Reef associated Reef associated Pelagic Reef associated Pelagic 19216 13.55 7 14.85 6.4 1.1 - Haemulidae Pomacanthidae Sarda orientalis Scarus psittacus Siganus vermiculatus Cephalopholis argus Trachinotus baillonii Naso annulatus Rexea prometheoides Naso caeruleacauda Carangoides oblongus Thyrsitoides marleyi Pristipomoides multidens Sphyraena qenie East Kwara'ae and Kwaio Lau Lagoon Alite Reef East Kwara'ae and Kwaio East Kwara'ae and Kwaio 542 197 65 36 18 11 6 0.54 0.20 0.06 0.04 0.02 0.01 0.01 Reef associated Reef associated Pelagic Deep (>300m) Pelagic 181 270.55 15.6 -12.4 5.75 0.9 - Haemulidae Pomacanthidae Sarda orientalis Scarus psittacus Siganus vermiculatus Cephalopholis argus Trachinotus baillonii Naso annulatus Rexea prometheoidesNaso caeruleacauda Carangoides oblongus Thyrsitoides marleyi Pristipomoides multidens Sphyraena qenie East Kwara'ae and Kwaio Lau Lagoon Alite Reef East Kwara'ae and Kwaio East Kwara'ae and Kwaio 542 197 65 36 18 11 60.54 0.20 0.06 0.04 0.02 0.01 0.01Reef associated Reef associated Pelagic Deep (>300m) Pelagic 181270.55 15.6 -12.4 5.75 0.9 - Naso caesius Carangoides orthogrammus Pristipomoides sieboldii Langalanga Lagoon Alite Reef Lau Lagoon Alite Reef Alite Reef 491 194 64 36 Cephalopholis cyanostigma Naso lituratus Naso unicornis Seriola lalandi Pristipomoides zonatus 18 Scarus xanthopleura 11 Scolopsis trilineata 6 0.49 0.19 0.06 0.04 0.02 0.01 0.01 Reef associated Reef associated Deep (>300m) 142 30.96 17.6 68.9 10.5 1.7 0.8 - Naso caesius Carangoides orthogrammus Pristipomoides sieboldii Langalanga Lagoon Alite Reef Lau Lagoon Alite Reef Alite Reef 491 194 64 36 Cephalopholis cyanostigma Naso lituratus Naso unicornis Seriola lalandi Pristipomoides zonatus 18 Scarus xanthopleura 11 Scolopsis trilineata 60.49 0.19 0.06 0.04 0.02 0.01 0.01Reef associated Reef associated Deep (>300m) 14230.96 17.6 68.9 10.5 1.7 0.8 - Naso hexacanthus Carangoides plagiotaenia Gerres erythrourus Pristipomoides zonatus Mesopristes argenteus Lau Lagoon East Kwara'ae and Kwaio East Kwara'ae and Kwaio Langalanga Lagoon 472 Hyporhamphus dussumieri Gerreidae Terapontidae Lethrinus atkinsoni 190 Lutjanus fulviflamma 61 Scomberoides tol 36 Kuhlia petiti 18 Scarus flavipectoralis 11 Siganus puelloides 6 0.47 0.19 0.06 0.04 0.02 0.01 0.01 Reef associated Reef associated Reef associated Deep (>300m) Reef associated 50 25.71 15.45 0.9 6.45 -0.5 - Naso hexacanthus Carangoides plagiotaenia Gerres erythrourus Pristipomoides zonatus Mesopristes argenteus Lau Lagoon East Kwara'ae and Kwaio East Kwara'ae and Kwaio Langalanga Lagoon 472 Hyporhamphus dussumieri Gerreidae Terapontidae Lethrinus atkinsoni 190 Lutjanus fulviflamma 61 Scomberoides tol 36 Kuhlia petiti 18 Scarus flavipectoralis 11 Siganus puelloides 60.47 0.19 0.06 0.04 0.02 0.01 0.01Reef associated Reef associated Reef associated Deep (>300m) Reef associated 5025.71 15.45 0.9 6.45 -0.5 - Naso lituratus Caranx ignobilis Gerres filamentosus Symphorichthys spilurus Pelates quadrilineatus Langalanga Lagoon Langalanga Lagoon East Kwara'ae and Kwaio Ramos Island Lethrinus erythropterus Pomacentridae 443 Lutjanus bohar 186 Sphyraena putnamae 58 Anyperodon leucogrammicus 35 Carangoides chrysophrys 17 Etelis coruscans 10 Upeneus taeniopterus 6 0.44 0.19 0.06 0.03 0.02 0.01 0.01 Reef associated Reef associated Reef associated Reef associated Reef associated 12.7 108 114.3 11.7 3.15 20.7 - Naso lituratus Caranx ignobilis Gerres filamentosus Symphorichthys spilurus Pelates quadrilineatus Langalanga Lagoon Langalanga Lagoon East Kwara'ae and Kwaio Ramos Island Lethrinus erythropterus Pomacentridae 443 Lutjanus bohar 186 Sphyraena putnamae 58 Anyperodon leucogrammicus 35 Carangoides chrysophrys 17 Etelis coruscans 10 Upeneus taeniopterus 60.44 0.19 0.06 0.03 0.02 0.01 0.01Reef associated Reef associated Reef associated Reef associated Reef associated12.7 108 114.3 11.7 3.15 20.7 - Naso minor Caranx lugubris Gerres oblongus Terapon jarbua Ramos Island Ramos Island Nggela West Kwara'ae 418 173 57 35 17 10 Scomberomorus commerson Carangidae Lutjanus fulvus Siganus puellus Zenarchopterus dispar Alectis ciliaris Liza vaigiensis Epinephelus coioides 5 0.42 0.17 0.06 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 1906 3.7 10.05 28.5 -0.9 5.4 19.7 Naso minor Caranx lugubris Gerres oblongus Terapon jarbua Ramos Island Ramos Island Nggela West Kwara'ae 418 173 57 35 17 10 Scomberomorus commerson Carangidae Lutjanus fulvus Siganus puellus Zenarchopterus dispar Alectis ciliaris Liza vaigiensis Epinephelus coioides 50.42 0.17 0.06 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated 19063.7 10.05 28.5 -0.9 5.4 19.7 Naso thynnoides Caranx melampygus Gerres oyena Megalops cyprinoides Langalanga Lagoon Ndai Island Alite Reef 418 172 57 34 17 Pristipomoides argyrogrammicus Megalopidae Priacanthidae Leptoscarus vaigiensis Myripristis violacea Naso brachycentron Etelis radiosus Upeneus tragula 10 Macolor niger 5 0.42 0.17 0.06 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 699 1.55 6.45 12.05 22.15 0.15 5 3.1 Naso thynnoides Caranx melampygus Gerres oyena Megalops cyprinoides Langalanga Lagoon Ndai Island Alite Reef 418 172 57 34 17 Pristipomoides argyrogrammicus Megalopidae Priacanthidae Leptoscarus vaigiensis Myripristis violacea Naso brachycentron Etelis radiosus Upeneus tragula 10 Macolor niger 50.42 0.17 0.06 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated 6991.55 6.45 12.05 22.15 0.15 5 3.1 Naso tonganus Caranx papuensis Toxotes jaculatrix Lau Lagoon Lau Lagoon South Malaita Ramos Island Langalanga Lagoon 413 165 57 Pristipomoides sieboldii Toxotidae Hemiramphidae Soleidae Sphyraena forsteri Calatomus carolinus Priacanthus hamrur 33 Lutjanus argentimaculatus 16 Epinephelus miliaris 10 Atule mate 5 0.41 0.16 0.06 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated 544 162 3.45 7.15 20.1 26.9 3.4 1.25 Naso tonganus Caranx papuensis Toxotes jaculatrix Lau Lagoon Lau Lagoon South Malaita Ramos Island Langalanga Lagoon 413 165 57 Pristipomoides sieboldii Toxotidae Hemiramphidae Soleidae Sphyraena forsteri Calatomus carolinus Priacanthus hamrur 33 Lutjanus argentimaculatus 16 Epinephelus miliaris 10 Atule mate 50.41 0.16 0.06 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated 544162 3.45 7.15 20.1 26.9 3.4 1.25 Naso unicornis Caranx sexfasciatus Diagramma pictum Mene maculata Alite Reef Alite Reef West Kwara'ae Langalanga Lagoon Mulloidichthys vanicolensis Haemulidae Menidae 402 Paracaesio sordida 163 Platax boersii 57 Mesopristes argenteus 33 Lutjanus rivulatus 16 Acanthocybium solandri 10 Sargocentron tiereoides 5 0.40 0.16 0.06 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 387 11.15 39.6 6.75 2.4 9.45 1.8 1.25 Naso unicornis Caranx sexfasciatus Diagramma pictum Mene maculata Alite Reef Alite Reef West Kwara'ae Langalanga Lagoon Mulloidichthys vanicolensis Haemulidae Menidae 402 Paracaesio sordida 163 Platax boersii 57 Mesopristes argenteus 33 Lutjanus rivulatus 16 Acanthocybium solandri 10 Sargocentron tiereoides 50.40 0.16 0.06 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated 38711.15 39.6 6.75 2.4 9.45 1.8 1.25 Naso vlamingii Caranx tille Plectorhinchus albovittatus Zanclus cornutus South Malaita Langalanga Lagoon East Kwara'ae and Kwaio Ramos Island 396 Sargocentron spiniferum Zanclidae Sphyraenidae Choerodon anchorago 163 Amblygaster sirm 56 Hypoatherina barnesi 32 Aethaloperca rogaa 16 Naso thynnoides 10 Acanthurus nigricans 5 0.40 0.16 0.06 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 361 13.95 16.5 28 16 4.6 0.6 1 Naso vlamingii Caranx tille Plectorhinchus albovittatus Zanclus cornutus South Malaita Langalanga Lagoon East Kwara'ae and Kwaio Ramos Island 396 Sargocentron spiniferum Zanclidae Sphyraenidae Choerodon anchorago 163 Amblygaster sirm 56 Hypoatherina barnesi 32 Aethaloperca rogaa 16 Naso thynnoides 10 Acanthurus nigricans 50.40 0.16 0.06 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated 36113.95 16.5 28 16 4.6 0.6 1 Paracanthurus hepatus Decapterus macarellus Plectorhinchus chaetodonoides Aluterus scriptus Nggela Langalanga Lagoon Lau Lagoon Alite Reef 394 150 56 32 16 9 Oxycheilinus digramma Monacanthidae Megalopidae Lethrinus lentjan Lethrinus amboinensis Myripristis pralinia Scomberoides lysan Sargocentron tiere Gymnocranius euanus 5 0.39 0.15 0.06 0.03 0.02 0.01 0.00 Reef associated Pelagic Reef associated Reef associated 215 90 78 13.7 10.7 1.6 1.57 0.9 Paracanthurus hepatus Decapterus macarellus Plectorhinchus chaetodonoides Aluterus scriptus Nggela Langalanga Lagoon Lau Lagoon Alite Reef 394 150 56 32 16 9 Oxycheilinus digramma Monacanthidae Megalopidae Lethrinus lentjan Lethrinus amboinensis Myripristis pralinia Scomberoides lysan Sargocentron tiere Gymnocranius euanus 50.39 0.15 0.06 0.03 0.02 0.01 0.00Reef associated Pelagic Reef associated Reef associated 21590 78 13.7 10.7 1.6 1.57 0.9 Zebrasoma veliferum Elagatis bipinnulata Plectorhinchus chrysotaenia Amanses scopas Fishing boats Lau Lagoon South Malaita Lau Lagoon 390 144 55 32 16 Plectorhinchus gibbosus Holocentridae Acanthurus nigricauda Sphyraena qenie Carangoides oblongus Sphyraena barracuda Myripristis kuntee 9 Balistapus undulatus 5 0.39 0.14 0.05 0.03 0.02 0.01 0.00 Reef associated Pelagic Reef associated Reef associated 57 25.4 127.05 1.8 9.9 0.75 1.2 0.8 Zebrasoma veliferum Elagatis bipinnulata Plectorhinchus chrysotaenia Amanses scopas Fishing boats Lau Lagoon South Malaita Lau Lagoon 390 144 55 32 16 Plectorhinchus gibbosus Holocentridae Acanthurus nigricauda Sphyraena qenie Carangoides oblongus Sphyraena barracuda Myripristis kuntee 9 Balistapus undulatus 50.39 0.14 0.05 0.03 0.02 0.01 0.00Reef associated Pelagic Reef associated Reef associated 5725.4 127.05 1.8 9.9 0.75 1.2 0.8 Gerres longirostris Plectorhinchus flavomaculatus East Kwara'ae and Kwaio Alite Reef Langalanga Lagoon Ndai Island 377 141 Gnathanodon speciosus Menidae Caranx sexfasciatus Scarus quoyi 55 Upeneus vittatus 32 Lutjanus carponotatus 16 Chlorurus frontalis 9 Neoniphon opercularis 5 0.38 0.14 0.05 0.03 0.02 0.01 0.00 Reef associated Reef associated 45 139.5 19.54 1.05 1 0.4 1 0.8 Gerres longirostris Plectorhinchus flavomaculatus East Kwara'ae and Kwaio Alite Reef Langalanga Lagoon Ndai Island 377 141 Gnathanodon speciosus Menidae Caranx sexfasciatus Scarus quoyi 55 Upeneus vittatus 32 Lutjanus carponotatus 16 Chlorurus frontalis 9 Neoniphon opercularis 50.38 0.14 0.05 0.03 0.02 0.01 0.00Reef associated Reef associated 45139.5 19.54 1.05 1 0.4 1 0.8 Atherinidae Monodactylidae Scaridae Scarus ghobban Monotaxis grandoculis Siganus vulpinus Lethrinus ornatus Kyphosus bigibbus Epinephelus spilotoceps Atherinomorus lacunosus Gnathanodon speciosus Plectorhinchus gibbosus Monodactylus argenteus Ndai Island Langalanga Lagoon Lau Lagoon Langalanga Lagoon 364 140 54 30 16 9 Naso caesius 5 0.36 0.14 0.05 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 20 14.75 14.8 2 3.45 0.3 0.85 0.2 Atherinidae Monodactylidae Scaridae Scarus ghobban Monotaxis grandoculis Siganus vulpinus Lethrinus ornatus Kyphosus bigibbus Epinephelus spilotoceps Atherinomorus lacunosus Gnathanodon speciosus Plectorhinchus gibbosus Monodactylus argenteus Ndai Island Langalanga Lagoon Lau Lagoon Langalanga Lagoon 364 140 54 30 16 9 Naso caesius 50.36 0.14 0.05 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated 2014.75 14.8 2 3.45 0.3 0.85 0.2 Hypoatherina barnesi Kuhlia petiti Plectorhinchus lessonii West Kwara'ae East Kwara'ae and Kwaio East Kwara'ae and Kwaio Alite Reef East Kwara'ae and Kwaio 356 138 Plectorhinchus chrysotaenia Monacanthidae Variola albimarginata Monotaxis heterodon 54 Gerres oblongus 30 Gymnocranius frenatus 16 Zebrasoma veliferum 9 Acanthurus bariene 5 0.36 0.14 0.05 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated 8 119.31 11.5 -3 0.1 0.6 - Hypoatherina barnesi Kuhlia petiti Plectorhinchus lessonii West Kwara'ae East Kwara'ae and Kwaio East Kwara'ae and Kwaio Alite Reef East Kwara'ae and Kwaio 356 138 Plectorhinchus chrysotaenia Monacanthidae Variola albimarginata Monotaxis heterodon 54 Gerres oblongus 30 Gymnocranius frenatus 16 Zebrasoma veliferum 9 Acanthurus bariene 50.36 0.14 0.05 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated 8119.31 11.5 -3 0.1 0.6 - Mugilidae Scarus niger Ellochelon vaigiensis Coryphaena hippurus Acanthurus triostegus Lutjanus russellii Scolopsis temporalis Naso tonganus Megalaspis cordyla Plectorhinchus lineatus Crenimugil crenilabis Ramos Island Langalanga Lagoon East Kwara'ae and Kwaio Fishing boats 355 136 53 30 16 9 5 0.35 0.14 0.05 0.03 0.02 0.01 0.00 Pelagic Reef associated Reef associated 49.35 1.5 195.7 1.85 -0.25 - Mugilidae Scarus niger Ellochelon vaigiensis Coryphaena hippurus Acanthurus triostegus Lutjanus russellii Scolopsis temporalis Naso tonganusMegalaspis cordyla Plectorhinchus lineatus Crenimugil crenilabis Ramos Island Langalanga Lagoon East Kwara'ae and Kwaio Fishing boats 355 136 53 30 16 9 50.35 0.14 0.05 0.03 0.02 0.01 0.00Pelagic Reef associated Reef associated49.35 1.5 195.7 1.85 -0.25 - Balistidae Carcharhinidae Chlorurus japanensis Paracaesio xanthura Caranx lugubris Plectorhinchus flavomaculatus Abalistes stellatus Scomberoides lysan Plectorhinchus picus Ellochelon vaigiensis Alite Reef West Kwara'ae Langalanga Lagoon South Malaita 334 130 53 29 Mene maculata 16 Sufflamen fraenatum 9 Pomacanthus sexstriatus 4 0.33 0.13 0.05 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 3 31.5 31.1 31.05 2.1 -0.15 3 Balistidae Carcharhinidae Chlorurus japanensis Paracaesio xanthura Caranx lugubris Plectorhinchus flavomaculatus Abalistes stellatus Scomberoides lysan Plectorhinchus picus Ellochelon vaigiensis Alite Reef West Kwara'ae Langalanga Lagoon South Malaita 334 130 53 29 Mene maculata 16 Sufflamen fraenatum 9 Pomacanthus sexstriatus 40.33 0.13 0.05 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated 331.5 31.1 31.05 2.1 -0.15 3 Monodactylidae Chlorurus bleekeri Ctenochaetus striatus Variola louti Cheilinus fasciatus Myripristis botche Sargocentron ittodai Plectorhinchus lessonii Balistapus undulatus Scomberoides tala Plectorhinchus vittatus Liza vaigiensis Lau Lagoon Ramos Island 330 127 53 29 16 9 4 0.33 0.13 0.05 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 16.6 6.35 23.1 ---0.2 Monodactylidae Chlorurus bleekeri Ctenochaetus striatus Variola louti Cheilinus fasciatus Myripristis botche Sargocentron ittodai Plectorhinchus lessoniiBalistapus undulatus Scomberoides tala Plectorhinchus vittatus Liza vaigiensis Lau Lagoon Ramos Island 330 127 53 29 16 9 40.33 0.13 0.05 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated16.6 6.35 23.1 ---0.2 Balistoides viridescens Scomberoides tol Pomadasys argenteus Moolgarda seheli Alite Reef Alite Reef Alite Reef West Kwara'ae Langalanga Lagoon 324 122 53 28 Scolopsis monogramma Chaetodontidae Istiophoridae Terapontidae Aprion virescens Chlorurus microrhinos Pterocaesio tile Epinephelus maculatus 16 Carangoides bajad 8 Cephalopholis boenak 4 0.32 0.12 0.05 0.03 0.02 0.01 0.00 Reef associated Reef associated Reef associated Reef associated 3 388 58.45 0.6 16.26 -2.6 0.1 Balistoides viridescens Scomberoides tol Pomadasys argenteus Moolgarda seheli Alite Reef Alite Reef Alite Reef West Kwara'ae Langalanga Lagoon 324 122 53 28 Scolopsis monogramma Chaetodontidae Istiophoridae Terapontidae Aprion virescens Chlorurus microrhinos Pterocaesio tile Epinephelus maculatus 16 Carangoides bajad 8 Cephalopholis boenak 40.32 0.12 0.05 0.03 0.02 0.01 0.00Reef associated Reef associated Reef associated Reef associated 3388 58.45 0.6 16.26 -2.6 0.1 Macolor macularis Lutjanus rufolineatus Caranx melampygus Acanthurus maculiceps Mugil cephalus Epinephelus tauvina Iniistius aneitensis Canthidermis maculata Selar boops Mugil cephalus Nggela Langalanga Lagoon Nggela Lau Lagoon 319 122 52 28 15 8 4 0.32 0.12 0.05 0.03 0.01 0.01 0.00 Reef associated Reef associated Reef associated 102.45 20.9 46.4 5.2 2.4 1.8 - Macolor macularis Lutjanus rufolineatus Caranx melampygus Acanthurus maculiceps Mugil cephalus Epinephelus tauvina Iniistius aneitensisCanthidermis maculata Selar boops Mugil cephalus Nggela Langalanga Lagoon Nggela Lau Lagoon 319 122 52 28 15 8 40.32 0.12 0.05 0.03 0.01 0.01 0.00Reef associated Reef associated Reef associated102.45 20.9 46.4 5.2 2.4 1.8 -   51 52 54   51 52 54  "}],"sieverID":"8d5d9e49-e64d-484b-a340-1ccf59281844","abstract":"Cover photo: Auki fish market, with Lilisiana in the background Back cover: Sailfish (Istiophorus platypterus)"}