File size: 11,459 Bytes
3aa8183 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 |
```markdown
# Goal/Experiment:
Assay for determination of functional concentration of Tn5 transposase
## Assay for determination of functional concentration of Tn5 transposase
**Adrian Mcnairn**
*Cornell University*
## Abstract
Tn5 is used by multiple labs worldwide for its ability to introduce DNA oligos and barcode sequences into libraries and for genomic assays. In many instances, labs produce their own Tn5 enzyme in-house rather than from commercial sources. Our method provides a means of determining the functional concentration of Tn5 in preparations by qPCR to standardize amounts of Tn5 used in assays and identify batch/lot variability. The current standard for assaying in-house produced Tn5 is a plasmid smear. Purified Tn5 is loaded with oligonucleotides and mixed with a plasmid substrate. The plasmid is then run on an agarose gel and checked for smearing, indicating the DNA was cut by the Tn5. The amount of Tn5 is standardized by measuring protein concentration using a protein assay or absorbance at 280nm which provides an approximation based on total protein present, not the functional concentration. This method is modified from Rykalina et al. to evaluate and empirically determine the functional concentration of Tn5 transposomes in homemade enzyme preps by qPCR.
The principle is based on decreased Cp (or Cq) values correlating with increased fragmentation caused by the transposome. The change in Cp values functions as a measurement of the activity of the Tn5 at that concentration of oligonucleotide (the greater the number of cycles required to produce a product correlates with the increased cleavage of the plasmid substrate by Tn5) as plasmids with transposomes insertions (cleaved regions) will not amplify. The change in Cp values is then plotted against the oligonucleotide concentration in a line graph, and a plateau will appear at the concentration at which the Tn5 is saturated by oligo. The first point in the plateau is the functional concentration.
This method may also be applied to testing the efficiency of changing DNA sequences in oligos used to assemble transposomes as the activity of the transposase is dependent upon the binding sequences contained within the oligo as well as secondary structure formed by the oligo. This property enables testing of oligo variations and barcode efficiencies in our assay. For instance, oligos containing different lengths or different barcodes sequences can be assembled in transposomes and tested in comparison to standard oligos.
## Materials
| Reagent | Vendor | Catalog Number |
|-------------------------------------|-----------------|------------------|
| HEPES, pH 7.2 (1M) | FisherScientific| AAJ16924K2 |
| NaCl (5M) | Invitrogen | AM9760G |
| EDTA (0.5M) | Invitrogen | AM9260G |
| Triton X-100 (10%) | VWR | 97063-864 |
| DTT (1M) | Krackeler | 45-43816-50ML |
| Glycerol (100%) | VWR | MK509202 |
| Nuclease-free water | Invitrogen | AM9932 |
| Tn5 or TDE1 | homemade or Illumina | 20034197 |
| SDS (10%) | Invitrogen | 15553027 |
| pUC19 | NEB | N3041S |
| EcoRI | NEB | R3101S |
| Zymo Research Clean and Concentrate-5| Zymo | D4014 |
| LUNA 2x qPCR master mix | NEB | M3003S |
| Qubit 1X dsDNA HS Assay Kit | Invitrogen | Q33231 |
### Equipment:
- Eppendorf Thermomixer
- qPCR thermocycler
- Qubit
### Primers:
**Transposome Primers**
| A | B |
|-------------------------------------|------------------------------------------------|
| Tn5ME_Rev | /5Phos/CTGTCTCTTATACACATCT |
| Tn5ME-A (Illumina FC-121-1030) | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
| Tn5ME-B (Illumina FC-121-1031) | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG |
**qPCR Primers**
| A | B | C |
|----------------------|----------------------------------|-----------------|
| Name | Sequence | pUC19 location(bp) |
| 591bp_pUC19_Tn5_F | GCTCACTCAAAGGCGTAAT | 748-1319 |
| 591bp_pUC19_Tn5_R | CTTCAGCAGAGCGAGATAC | |
| 602bp_pUC19_Tn5_F | CTTTCCACAGCGTTTTGGG | 2396-248 |
| 602bp_pUC19_Tn5_R | GCTGCGTAATAGCGAAGAG | |
| 610bp_pUC19_Tn5_F | CCTATCTCAGCGATCTGTTATTTC | 1651-2241 |
| 610bp_pUC19_Tn5_R | GCGCGGTATTATCCCGTATT | |
## Transposome preparation and assembly
1. **Prepare ME A/Rev or ME-B/rev oligos by annealing equal concentrations of primers.** Typically target 40uM stocks.
Example: 40uL 100uM Tn5-ME-A + 40uL 100uM Tn5-ME-B + 20uL nuclease-free water or 0.1x TE (can be scaled as needed).
Thermocycler program: 95°C for 2min, slow cool to 25deg at 0.1°C/sec, total time ~22 minutes.
**Duration:** 22 min
2. **Prepare working stocks of annealed oligos by serial dilution (1:1):**
- Concentrations: 1.25uM, 2.5uM, 5uM, 10uM, 20uM, 40uM
3. **Prepare Tn5 transposomes by combining 9uL of the Tn5 to be tested with 1uL annealed oligos**
- Final concentrations: 0.125uM, 0.25uM, 0.5uM, 1uM, 2uM, 4uM
| Oligo Concentration (uM)| 1.25 | 2.5 | 5 | 10 | 20 | 40 |
|-------------------------|-----|-----|---|----|----|----|
| Oligo (uL) | 1 | 1 | 1 | 1 | 1 | 1 |
| Tn5 (uL) | 9 | 9 | 9 | 9 | 9 | 9 |
| Final vol (uL) | 10 | 10 | 10| 10 | 10 | 10 |
| Final Conc. (uM) | 0.125 | 0.25 | 0.5 | 1 | 2 | 4 |
4. **Incubate for 21 hours at 25°C with shaking (600rpm) on Eppendorf Thermomixer**
**Note:** Shorter incubation (1 hour) is possible but longer incubation provides more consistent results.
**Duration:** Overnight 21 h
## Template preparation
1. **Digest pUC19 with EcoRI to generate a linear template:**
a. Column purify the plasmid DNA and adjust concentration to 25ng/uL
b. Digest reaction may be scaled to provide a stock of linearized plasmid for future use
**Duration:** 1 h
## Tagmentation
1. **In duplicate, prepare tagmentation master mix and test each concentration of transposome on 25ng linearized pUC19**
a. Include a no Tn5 control for reference (0uM)
b. For no Tn5 control, increase water to 11.5uL/reaction
c. 10X Tango restriction enzyme buffer (ThermoFisher) or 10X CutSmart buffer (NEB) are used to provide the magnesium Tn5 requires for tagmentation.
| Stock | Vol per 25uL rxn (uL) |
|--------------------------------|-----------------------|
| 10X Tango RE Buffer | 2.5 |
| Nuclease-free water | 18 |
| DMF | 2.5 |
| Linearized pUC19 (25ng/uL) | 1 |
| Tn5 | 1 |
**Tagmentation Master Mix:**
2X Tagmentation Buffer
| Stock | Vol for 10mL | Final Conc. | Supplier |
|--------------------------------|--------------|-------------|--------------------------|
| 1M Tris-HCl pH7-8 | 200uL | 20mM | Invitrogen #AM9850G |
| 1M MgCl2 | 100uL | 10mM | Invitrogen #AM5930G |
| Nuclease-free water | 9.7mL | | Invitrogen AM9932 |
2. **Incubate at 37°C for 1 hour at 600rpm**
3. **Stop the reaction by adding 1uL of 2% SDS to each reaction (final conc. 0.08%)**
a. 55°C for 7 minutes to remove transposomes
**Duration:** 7 min
4. **Quench SDS by adding 3uL 10% Triton X-100 to reactions**
5. **Final volume should be 29uL**
6. **Qubit or nanodrop DNA for normalization (~0.86ng/uL)**
a. Quantifying the DNA first enables the assay to be more quantitative
## qPCR
1. **Dilute transposed DNA 1:10 in nuclease-free water for qPCR:**
a. Using too much DNA may lead to difficulty in determining Cp and higher data variability
b. Controls: linearized pUC19 without Tn5 and an NTC control
2. **Setup qPCR reactions using primer pairs (recommend running at least 2 pairs):**
a. Pairs 591, 602, and 610 may be run on the same program
3. **Run qPCR using the following settings:**
a. 95°C for 1 min, followed by 35 (minimum) to 45 cycles of 95°C for 15 sec, 60°C for 20 sec, 72°C for 30 sec, then a melt curve
**Note:** Two-step protocols may also be used alternating 95°C for 15 sec, 60°C for 20 sec
4. **Analyze and graph delta Cp versus concentration:**
a. The no Tn5 control provides the reference value as the plasmid should be intact (i.e., Subtract the Geomean of the no Tn5 replicates from the Cp of the test samples).
b. The higher the delta Cp, the more cleavage of the plasmid, indicating higher Tn5 tagmentation activity
c. The concentration at which the graph plateaus or peaks at is the functional concentration of the Tn5 prep
## Data Analysis Example
| Primer pair: 610 | | | |
|------------------|------------------|------------------|---------|
| Sample | Cp | Ave Cp | delta Cp|
| 0.5 | 8.89 | 8.78 | 8.88 | 0.74 |
| 0.5 | 9.12 | 8.81 | 8.97 | 0.83 |
| 1 | 9.74 | 9.80 | 9.74 | 1.62 |
| 1 | 9.67 | 9.99 | 9.79 | 1.68 |
| 2.2 | 11.36 | 11.34 | 11.49 | 3.26 |
| 2.2 | 11.37 | 11.67 | 11.57 | 3.40 |
| 3.5 | 12.52 | 12.63 | 12.63 | 4.49 |
| 3.5 | 12.70 | 12.74 | 12.86 | 4.63 |
| 5 | 9.83 | 9.94 | 9.92 | 1.76 |
| 5 | 9.79 | 10.05 | 9.97 | 1.80 |
| noTn5 | 8.20 | 8.02 | 8.18 | -0.01|
| noTn5 | 8.25 | 7.97 | 8.21 | 0.00 |
| NTC | 24.04 | 23.92 | 23.96 | 15.81|
| NTC | 24.27 | 24.25 | 24.26 | 16.12|
Example results from qPCR testing of a Tn5 prep
| Primer pair: 610 | | | |
|------------------|------------------|------------------|----------|
| Conc. (uM) | ave delta CP | stdev |
| 0.5uM | 0.79 | 0.06 |
| 1uM | 1.65 | 0.04 |
| 2.2uM | 3.33 | 0.10 |
| 3.5uM | 4.56 | 0.10 |
| 5uM | 1.78 | 0.03 |
![Graph](data:image/png;base64,...)
endofoutput
``` |