hash
stringlengths 40
40
| diff
stringlengths 131
114k
| message
stringlengths 7
980
| project
stringlengths 5
67
| split
stringclasses 1
value |
|---|---|---|---|---|
7643d87cdd030cf92c3d35194089f3157e32af79 | diff --git a/src/main/java/org/odlabs/wiquery/core/commons/WiQueryCoreHeaderContributor.java b/src/main/java/org/odlabs/wiquery/core/commons/WiQueryCoreHeaderContributor.java
index <HASH>..<HASH> 100644
--- a/src/main/java/org/odlabs/wiquery/core/commons/WiQueryCoreHeaderContributor.java
+++ b/src/main/java/org/odlabs/wiquery/core/commons/WiQueryCoreHeaderContributor.java
@@ -178,11 +178,11 @@ public class WiQueryCoreHeaderContributor implements Serializable,
for (WiQueryPluginRenderingListener listener : pluginRenderingListeners) {
listener.onRender(plugin, manager, headerResponse);
}
-
+
plugin.contribute(manager);
}
- initializeResourceManager( headerResponse, manager );
+ initializeResourceManager(headerResponse, manager);
mergeResources(response, settings, wiQueryHeaderResponse);
@@ -193,8 +193,8 @@ public class WiQueryCoreHeaderContributor implements Serializable,
}
private void initializeResourceManager( IHeaderResponse headerResponse, WiQueryResourceManager manager ) {
- if(WiQuerySettings.get().isEnableWiqueryResourceManagement()){
- manager.initialize(headerResponse);
+ if(WiQuerySettings.get().isEnableWiqueryResourceManagement()) {
+ manager.initialize(headerResponse);
}
}
@@ -225,8 +225,8 @@ public class WiQueryCoreHeaderContributor implements Serializable,
}
}
}
-
- initializeResourceManager( wiQueryHeaderResponse, manager );
+
+ initializeResourceManager(headerResponse, manager);
mergeResources(response, settings, wiQueryHeaderResponse);
} | fix on r<I>. the wrong variable was used, this breaks all ajax requests targets.
svn path=/trunk/; revision=<I> | WiQuery_wiquery | train |
18b96068b13ab2c7b296194ad55734f654197449 | diff --git a/README.md b/README.md
index <HASH>..<HASH> 100644
--- a/README.md
+++ b/README.md
@@ -184,10 +184,11 @@ about.)
For more on Alan Kay, go to youtube and vimeo. His 30+ min lectures are heavenly.
+
The End
-------
-... for now.
+... for now. (Todo: async and css).
diff --git a/lib/json_applet.js b/lib/json_applet.js
index <HASH>..<HASH> 100644
--- a/lib/json_applet.js
+++ b/lib/json_applet.js
@@ -183,7 +183,7 @@ Applet.prototype.run = function (source) {
func_meta = me.funcs[token];
if (!func_meta)
- return me.save_error( new Error("Func not found: " + token) );
+ return me.save_error( new Error("Function not found: " + token) );
curr = {
prev: prev,
diff --git a/lib/sanitize.js b/lib/sanitize.js
index <HASH>..<HASH> 100644
--- a/lib/sanitize.js
+++ b/lib/sanitize.js
@@ -84,8 +84,9 @@ E.string_in_array = function (unk, name) {
var temp = null;
E.attr_funcs = [];
for (temp in E) {
- if (_.isFunction(E[temp]))
+ if (_.isFunction(E[temp])) {
E.attr_funcs.push(temp);
+ }
}
E.opt = function (func, name) {
@@ -94,7 +95,11 @@ E.opt = function (func, name) {
return null;
return func(v, name);
};
-}
+};
+
+_.each(E.attr_funcs, function (name, i) {
+ E["opt_" + name] = E.opt(E[name], name);
+});
// ****************************************************************
// ****************** End of Sanitize Attr Checkers ***************
diff --git a/lib/www_applet.js b/lib/www_applet.js
index <HASH>..<HASH> 100644
--- a/lib/www_applet.js
+++ b/lib/www_applet.js
@@ -43,7 +43,29 @@ OK.new = function (source, multi_def) {
return app;
};
-OK.tag_run = function () {
+OK.tag_run = function (run, args, content) {
+ var tag_meta = run.app.data.tags[run.name];
+
+ // Unknown attrs.
+ var unk = _.compact(_.map(args, function (v, k) {
+ if (!tag_meta.args[k])
+ return k;
+ return null;
+ }));
+
+ if (unk.length)
+ return run.error(new Error('Unknown attributes: ' + unk.join(', ')));
+
+ // Sanitize attrs.
+ var clean_attrs = {};
+ for (var name in tag_meta.args) {
+ var valid = tag_meta.args[name](args[name]);
+ if (valid && valid.message)
+ return run.error(valid);
+ clean_attrs[name] = valid;
+ }
+
+ // conso.log(clean_attrs[id].toString())
NOT_READY();
return OK.Element.new(tag, args, content);
};
@@ -80,7 +102,7 @@ OK.tags = {
]
, 'a' : [
- {hre: S.href},
+ {id: S.opt_id, href: S.href},
S.string,
function (meta, attrs, content) {
return element('a', [args, 'href', {ok_type:'link'}], content);
diff --git a/test/www_applet_html.js b/test/www_applet_html.js
index <HASH>..<HASH> 100644
--- a/test/www_applet_html.js
+++ b/test/www_applet_html.js
@@ -32,7 +32,7 @@ describe( 'ok_slang', function () {
'a', {id: 'my name'}, [ "enter wrong name" ]
];
- assert.equal(run(html).error.message, "Invalid chars in text_input id: my name");
+ assert.equal(run(html).error.message, "id: invalid characters: \"my name\"");
});
it( 'returns error if unknown element', function () {
@@ -40,7 +40,7 @@ describe( 'ok_slang', function () {
'text_inputy', {}, ["enter name"]
];
- assert.equal(run(slang).error.message, "Unknown element: text_inputy");
+ assert.equal(run(slang).error.message, "Function not found: text_inputy");
});
}); // === end desc | Implemented: attrs are run through sanitizer. | da99_www_app | train |
23143bb7d132c0b67a70029af66abe643d664f5e | diff --git a/acceptancetests/jujupy/exceptions.py b/acceptancetests/jujupy/exceptions.py
index <HASH>..<HASH> 100644
--- a/acceptancetests/jujupy/exceptions.py
+++ b/acceptancetests/jujupy/exceptions.py
@@ -28,9 +28,6 @@ class StatusTimeout(Exception):
class ControllersTimeout(Exception):
"""Raised when 'juju show-controller' timed out."""
-class BackupTimeout(Exception):
- """Raised when 'juju create-backup' timed out."""
-
class SoftDeadlineExceeded(Exception):
"""Raised when an overall client operation takes too long.""" | Remove BackupTimeout as it's no longer required | juju_juju | train |
57f576bbf1e1ec85520b3b1a5d981cf166554e6a | diff --git a/rpcserver.go b/rpcserver.go
index <HASH>..<HASH> 100644
--- a/rpcserver.go
+++ b/rpcserver.go
@@ -951,6 +951,8 @@ func (r *rpcServer) PendingChannels(ctx context.Context,
},
)
+ resp.TotalLimboBalance += channel.LocalBalance
+
// If the channel was force closed, then we'll need to query
// the utxoNursery for additional information.
case channeldb.ForceClose: | rpc: include pending close channels in total limbo balance | lightningnetwork_lnd | train |
483308b165313541541e8436c0460d22e437fb3b | diff --git a/skorch/helper.py b/skorch/helper.py
index <HASH>..<HASH> 100644
--- a/skorch/helper.py
+++ b/skorch/helper.py
@@ -5,6 +5,7 @@ They should not be used in skorch directly.
"""
from functools import partial
from skorch.utils import _make_split
+from skorch.utils import _make_optimizer
class SliceDict(dict):
@@ -112,8 +113,7 @@ def filtered_optimizer(optimizer, filter_fn):
it to ``optimizer``.
"""
- from skorch.utils import make_optimizer
- return partial(make_optimizer, optimizer=optimizer, filter_fn=filter_fn)
+ return partial(_make_optimizer, optimizer=optimizer, filter_fn=filter_fn)
def predefined_split(dataset):
diff --git a/skorch/utils.py b/skorch/utils.py
index <HASH>..<HASH> 100644
--- a/skorch/utils.py
+++ b/skorch/utils.py
@@ -417,7 +417,7 @@ class FirstStepAccumulator:
return self.step
-def make_optimizer(pgroups, optimizer, filter_fn, **kwargs):
+def _make_optimizer(pgroups, optimizer, filter_fn, **kwargs):
"""Used by ``skorch.helper.filtered_optimizer`` to allow for pickling"""
return optimizer(filter_fn(pgroups), **kwargs) | RFC: Converts make_optimizer to a private func (#<I>) | skorch-dev_skorch | train |
07e3b9315c3d87205ef5ac890767c277f29d9068 | diff --git a/core/src/main/java/io/undertow/util/DateUtils.java b/core/src/main/java/io/undertow/util/DateUtils.java
index <HASH>..<HASH> 100644
--- a/core/src/main/java/io/undertow/util/DateUtils.java
+++ b/core/src/main/java/io/undertow/util/DateUtils.java
@@ -23,6 +23,7 @@ import java.text.SimpleDateFormat;
import java.util.Date;
import java.util.Locale;
import java.util.TimeZone;
+import java.util.concurrent.TimeUnit;
import io.undertow.UndertowOptions;
import io.undertow.server.HttpServerExchange;
@@ -41,7 +42,6 @@ public class DateUtils {
private static final String RFC1123_PATTERN = "EEE, dd MMM yyyy HH:mm:ss z";
private static volatile String cachedDateString;
- private static volatile long nextUpdateTime = -1;
/**
* Thread local cache of this date format. This is technically a small memory leak, however
@@ -58,6 +58,16 @@ public class DateUtils {
}
};
+ /**
+ * Invalidates the current date
+ */
+ private static final Runnable INVALIDATE_TASK = new Runnable() {
+ @Override
+ public void run() {
+ cachedDateString = null;
+ }
+ };
+
private static final String RFC1036_PATTERN = "EEEEEEEEE, dd-MMM-yy HH:mm:ss z";
private static final String ASCITIME_PATTERN = "EEE MMM d HH:mm:ss yyyyy";
@@ -238,14 +248,19 @@ public class DateUtils {
public static void addDateHeaderIfRequired(HttpServerExchange exchange) {
HeaderMap responseHeaders = exchange.getResponseHeaders();
if(exchange.getConnection().getUndertowOptions().get(UndertowOptions.ALWAYS_SET_DATE, true) && !responseHeaders.contains(Headers.DATE)) {
- long time = System.nanoTime();
- if(time < nextUpdateTime) {
- responseHeaders.put(Headers.DATE, cachedDateString);
+ String dateString = cachedDateString;
+ if(dateString != null) {
+ responseHeaders.put(Headers.DATE, dateString);
} else {
+ //set the time and register a timer to invalidate it
+ //note that this is racey, it does not matter if multiple threads do this
+ //the perf cost of synchronizing would be more than the perf cost of multiple threads running it
long realTime = System.currentTimeMillis();
- String dateString = DateUtils.toDateString(new Date(realTime));
+ long mod = realTime % 1000;
+ long toGo = 1000 - mod;
+ dateString = DateUtils.toDateString(new Date(realTime));
cachedDateString = dateString;
- nextUpdateTime = time + 1000000000;
+ exchange.getConnection().getIoThread().executeAfter(INVALIDATE_TASK, toGo, TimeUnit.MILLISECONDS);
responseHeaders.put(Headers.DATE, dateString);
}
}
@@ -254,4 +269,5 @@ public class DateUtils {
private DateUtils() {
}
+
} | Change to using a timer to invalidate the date rather than calling nanoTime each request | undertow-io_undertow | train |
426f30a9620f3a3a3f75f9e3f663c3348218ce85 | diff --git a/lib/query.js b/lib/query.js
index <HASH>..<HASH> 100644
--- a/lib/query.js
+++ b/lib/query.js
@@ -12,6 +12,9 @@ var Query = function(config) {
//set or used until a rowDescription message comes in
this.rowDescription = null;
this.callback = config.callback;
+ this._fieldNames = [];
+ this._fieldConverters = [];
+ this._result = new Result();
EventEmitter.call(this);
};
@@ -27,41 +30,69 @@ var noParse = function(val) {
return val;
};
-//creates datarow metatdata from the supplied
-//data row information
-var buildDataRowMetadata = function(msg, converters, names) {
+//associates row metadata from the supplied
+//message with this query object
+//metadata used when parsing row results
+p.handleRowDescription = function(msg) {
+ this._fieldNames = [];
+ this._fieldConverters = [];
var len = msg.fields.length;
for(var i = 0; i < len; i++) {
var field = msg.fields[i];
var dataTypeId = field.dataTypeID;
- names[i] = field.name;
+ this._fieldNames[i] = field.name;
switch(dataTypeId) {
case 20:
case 21:
case 23:
case 26:
- converters[i] = parseInt;
+ this._fieldConverters[i] = parseInt;
break;
case 1700:
case 700:
case 701:
- converters[i] = parseFloat;
+ this._fieldConverters[i] = parseFloat;
break;
case 16:
- converters[i] = function(val) {
+ this._fieldConverters[i] = function(val) {
return val === 't';
};
break;
case 1114:
case 1184:
- converters[i] = dateParser;
+ this._fieldConverters[i] = dateParser;
break;
default:
- converters[i] = dataTypeParsers[dataTypeId] || noParse;
+ this._fieldConverters[i] = dataTypeParsers[dataTypeId] || noParse;
break;
}
};
-}
+};
+
+p.handleDataRow = function(msg) {
+ var self = this;
+ var row = {};
+ for(var i = 0; i < msg.fields.length; i++) {
+ var rawValue = msg.fields[i];
+ if(rawValue === null) {
+ //leave null values alone
+ row[self._fieldNames[i]] = null;
+ } else {
+ //convert value to javascript
+ row[self._fieldNames[i]] = self._fieldConverters[i](rawValue);
+ }
+ }
+ self.emit('row', row);
+
+ //if there is a callback collect rows
+ if(self.callback) {
+ self._result.addRow(row);
+ }
+};
+
+p.handleCommandComplete = function(msg) {
+ this._result.addCommandComplete(msg);
+};
p.submit = function(connection) {
var self = this;
@@ -71,30 +102,12 @@ p.submit = function(connection) {
connection.query(this.text);
}
- var converters = [];
- var names = [];
- var handleRowDescription = function(msg) {
- buildDataRowMetadata(msg, converters, names);
- };
-
- var result = new Result();
-
- var handleDatarow = function(msg) {
- var row = {};
- for(var i = 0; i < msg.fields.length; i++) {
- var rawValue = msg.fields[i];
- row[names[i]] = rawValue === null ? null : converters[i](rawValue);
- }
- self.emit('row', row);
-
- //if there is a callback collect rows
+ var onReadyForQuery = function() {
+ removeListeners();
if(self.callback) {
- result.addRow(row);
+ self.callback(null, self._result);
}
- };
-
- var onCommandComplete = function(msg) {
- result.addCommandComplete(msg);
+ self.emit('end', self._result);
};
var onError = function(err) {
@@ -108,25 +121,21 @@ p.submit = function(connection) {
self.emit('end');
};
- var onReadyForQuery = function() {
- removeListeners();
- if(self.callback) {
- self.callback(null, result);
- }
- self.emit('end', result);
- };
+ var onRowDescription = this.handleRowDescription.bind(this);
+ var onDataRow = this.handleDataRow.bind(this);
+ var onCommandComplete = this.handleCommandComplete.bind(this);
var removeListeners = function() {
//remove all listeners
- connection.removeListener('rowDescription', handleRowDescription);
- connection.removeListener('dataRow', handleDatarow);
+ connection.removeListener('rowDescription', onRowDescription);
+ connection.removeListener('dataRow', onDataRow);
connection.removeListener('readyForQuery', onReadyForQuery);
connection.removeListener('commandComplete', onCommandComplete);
connection.removeListener('error', onError);
};
- connection.on('rowDescription', handleRowDescription);
- connection.on('dataRow', handleDatarow);
+ connection.on('rowDescription', onRowDescription);
+ connection.on('dataRow', onDataRow);
connection.on('readyForQuery', onReadyForQuery);
connection.on('commandComplete', onCommandComplete);
connection.on('error', onError);
@@ -185,7 +194,6 @@ p.prepare = function(connection) {
};
connection.on('portalSuspended', getRows);
-
connection.on('commandComplete', onCommandComplete);
connection.on('error', onCommandComplete);
}; | started making listeners non-closure based | brianc_node-postgres | train |
340017153e4ebea134bba5bd7cfb33600617e924 | diff --git a/keanu-python/tests/test_gradient_optimization.py b/keanu-python/tests/test_gradient_optimization.py
index <HASH>..<HASH> 100644
--- a/keanu-python/tests/test_gradient_optimization.py
+++ b/keanu-python/tests/test_gradient_optimization.py
@@ -22,7 +22,7 @@ def test_gradient_op_bayes_net(model):
def test_gradient_op_vertex(model):
gradient_optimizer = kn.GradientOptimizer(model.temperature)
- assert len(gradient_optimizer.net.getLatentVertices()) == 1
+ assert gradient_optimizer.net.getLatentVertices().size() == 1
def test_gradient_op_throws_with_invalid_net_param():
@@ -56,4 +56,4 @@ def test_thermometers_max_likelihood_gradient(model):
assert logProb < 0.
temperature = model.temperature.getValue().scalar()
- assert 20.995 < temperature < 21.005
\ No newline at end of file
+ assert 20.995 < temperature < 21.005
diff --git a/keanu-python/tests/test_non_gradient_optimization.py b/keanu-python/tests/test_non_gradient_optimization.py
index <HASH>..<HASH> 100644
--- a/keanu-python/tests/test_non_gradient_optimization.py
+++ b/keanu-python/tests/test_non_gradient_optimization.py
@@ -24,7 +24,7 @@ def test_non_gradient_op_bayes_net(model):
def test_non_gradient_op_vertex(model):
non_gradient_optimizer = kn.NonGradientOptimizer(model.a)
- assert len(non_gradient_optimizer.net.getLatentVertices()) == 2
+ assert non_gradient_optimizer.net.getLatentVertices().size() == 2
def test_non_gradient_op_throws_with_invalid_net_param(): | Use size instead of len on Java lists. | improbable-research_keanu | train |
7d8e12dfb3d92049c496c6388972326425b34dec | diff --git a/test/vector-test.js b/test/vector-test.js
index <HASH>..<HASH> 100644
--- a/test/vector-test.js
+++ b/test/vector-test.js
@@ -605,6 +605,24 @@ describe("vector", function () {
[(7*4)+(8*5)+(9*6)]]);
assertVectorsExactlyEqual(r, expected);
});
+ it("should multiply [m,n] * [n,1] with m > n", function () {
+ let v1 = new Vector(
+ [[1,2,3],
+ [4,5,6],
+ [7,8,9],
+ [1,2,3]]);
+ let v2 = new Vector([4,5,6]).transpose();
+ let r = doBoth(
+ () => Vector.matrixMultiply(v1, v2),
+ () => v1.matrixMultiply(v2),
+ assertVectorsExactlyEqual);
+ let expected = new Vector(
+ [[(1*4)+(2*5)+(3*6)],
+ [(4*4)+(5*5)+(6*6)],
+ [(7*4)+(8*5)+(9*6)],
+ [(1*4)+(2*5)+(3*6)]]);
+ assertVectorsExactlyEqual(r, expected);
+ });
it("should multiply [n,n] * [n,n]", function () {
let v1 = new Vector(
[[1,2,3],
diff --git a/vector.js b/vector.js
index <HASH>..<HASH> 100644
--- a/vector.js
+++ b/vector.js
@@ -288,12 +288,12 @@ function checkMatrixMultiplyDimensions(s1, s2){
//a=b=c=n, d=1
//b=c=n, a=d=1
//a=d=n, b=c=1
+ //
+ // [4,3]*[3,1] this is OK!
+ // a=4, b=3, c=3, d=1
let a = s1[0];let b = s1[1];let c = s2[0];let d = s2[1];
// Fail if a != d (unless d is 1 and a = b) or b != c
if(b !== c) throw new Error(`Matrix size mismatch: ${s1} * ${s2}`);
- if(a !== d){
- if(a !== b || d !== 1) throw new Error(`Matrix size mismatch: ${s1} * ${s2}`);
- }
}
function getStringRec(v1){ | Fix size check for matrix multiplication. | benmosheron_ben-loves-vectors | train |
b30fe7de05afcb8a3675c79314bb2fabf4d7782c | diff --git a/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeComparator.java b/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeComparator.java
index <HASH>..<HASH> 100644
--- a/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeComparator.java
+++ b/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeComparator.java
@@ -22,6 +22,7 @@
*/
package org.arakhne.afc.attrs.attr;
+import java.io.Serializable;
import java.util.Comparator;
@@ -34,9 +35,11 @@ import java.util.Comparator;
* @mavengroupid $GroupId$
* @mavenartifactid $ArtifactId$
*/
-public class AttributeComparator implements Comparator<Attribute> {
+public class AttributeComparator implements Comparator<Attribute>, Serializable {
- /**
+ private static final long serialVersionUID = -5930539797174658160L;
+
+ /**
* Compares its two arguments for order. Returns a negative integer,
* zero, or a positive integer as the first argument is less than, equal
* to, or greater than the second.<p>
diff --git a/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeNameComparator.java b/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeNameComparator.java
index <HASH>..<HASH> 100644
--- a/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeNameComparator.java
+++ b/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeNameComparator.java
@@ -22,6 +22,7 @@
*/
package org.arakhne.afc.attrs.attr;
+import java.io.Serializable;
import java.util.Comparator;
@@ -34,7 +35,9 @@ import java.util.Comparator;
* @mavengroupid $GroupId$
* @mavenartifactid $ArtifactId$
*/
-public class AttributeNameComparator implements Comparator<Attribute> {
+public class AttributeNameComparator implements Comparator<Attribute>, Serializable {
+
+ private static final long serialVersionUID = -2416416144079568908L;
/** {@inheritDoc}
*/
diff --git a/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeValueComparator.java b/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeValueComparator.java
index <HASH>..<HASH> 100644
--- a/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeValueComparator.java
+++ b/advanced/attributes/src/main/java/org/arakhne/afc/attrs/attr/AttributeValueComparator.java
@@ -22,6 +22,7 @@
*/
package org.arakhne.afc.attrs.attr;
+import java.io.Serializable;
import java.util.Comparator;
@@ -34,9 +35,11 @@ import java.util.Comparator;
* @mavengroupid $GroupId$
* @mavenartifactid $ArtifactId$
*/
-public class AttributeValueComparator implements Comparator<AttributeValue> {
+public class AttributeValueComparator implements Comparator<AttributeValue>, Serializable {
- /**
+ private static final long serialVersionUID = 3633022581453456195L;
+
+ /**
* Compares its two arguments for order. Returns a negative integer,
* zero, or a positive integer as the first argument is less than, equal
* to, or greater than the second.<p> | Add the missed dependencies in the maven tool module. | gallandarakhneorg_afc | train |
1ac0f18a91bfccff7b809c23cf64ab2520d59d8f | diff --git a/languagetool-core/src/main/java/org/languagetool/tagging/disambiguation/rules/DisambiguationPatternRuleReplacer.java b/languagetool-core/src/main/java/org/languagetool/tagging/disambiguation/rules/DisambiguationPatternRuleReplacer.java
index <HASH>..<HASH> 100644
--- a/languagetool-core/src/main/java/org/languagetool/tagging/disambiguation/rules/DisambiguationPatternRuleReplacer.java
+++ b/languagetool-core/src/main/java/org/languagetool/tagging/disambiguation/rules/DisambiguationPatternRuleReplacer.java
@@ -202,7 +202,7 @@ class DisambiguationPatternRuleReplacer extends AbstractPatternRulePerformer {
null, Match.CaseConversion.NONE, false, false,
Match.IncludeRange.NONE);
- MatchState matchState = tmpMatchToken.createState(rule.getLanguage().getSynthesizer(), whTokens[fromPos]);
+ MatchState matchState = tmpMatchToken.createState(rule.getLanguage().getSynthesizer(), whTokens[position]);
final String prevValue = whTokens[position].toString();
final String prevAnot = whTokens[position]
.getHistoricalAnnotations(); | corrected the token that is passed when creating a new MatchState | languagetool-org_languagetool | train |
9e5f12f8b4cdb7e1b0c39f0f9e6fc5678454cbf7 | diff --git a/command/helpers_test.go b/command/helpers_test.go
index <HASH>..<HASH> 100644
--- a/command/helpers_test.go
+++ b/command/helpers_test.go
@@ -312,8 +312,9 @@ func TestPrettyTimeDiff(t *testing.T) {
{-20460 * time.Hour, "2y4mo ago"},
}
for _, tc := range test_cases {
- t2 := time.Now().Add(tc.d)
- out := prettyTimeDiff(t2, time.Now())
+ now := time.Now()
+ t2 := now.Add(tc.d)
+ out := prettyTimeDiff(t2, now)
if out != tc.exp {
t.Fatalf("expected :%v but got :%v", tc.exp, out)
} | Declare time.Now once to prevent flakiness | hashicorp_nomad | train |
c3130ce81159d227ea13b56c7db23fb9bbd41cbf | diff --git a/core/common/src/main/java/alluxio/cli/CommandUtils.java b/core/common/src/main/java/alluxio/cli/CommandUtils.java
index <HASH>..<HASH> 100644
--- a/core/common/src/main/java/alluxio/cli/CommandUtils.java
+++ b/core/common/src/main/java/alluxio/cli/CommandUtils.java
@@ -13,7 +13,6 @@ package alluxio.cli;
import alluxio.util.CommonUtils;
-import com.google.common.base.Throwables;
import org.reflections.Reflections;
import java.lang.reflect.Modifier;
@@ -50,7 +49,7 @@ public final class CommandUtils {
try {
cmd = CommonUtils.createNewClassInstance(cls, classArgs, objectArgs);
} catch (Exception e) {
- throw Throwables.propagate(e);
+ throw new RuntimeException(e);
}
commandsMap.put(cmd.getCommandName(), cmd);
} | Deprecate Throwables.propagate with RuntimeException in CommandUtils.java | Alluxio_alluxio | train |
ad234f225f7ccd79114cba997bc2d318b1f0b90c | diff --git a/moto/batch/models.py b/moto/batch/models.py
index <HASH>..<HASH> 100644
--- a/moto/batch/models.py
+++ b/moto/batch/models.py
@@ -815,8 +815,10 @@ class BatchBackend(BaseBackend):
raise InvalidParameterValueException(
"computeResources must contain {0}".format(param)
)
-
- if self.iam_backend.get_role_by_arn(cr["instanceRole"]) is None:
+ for profile in self.iam_backend.get_instance_profiles():
+ if profile.arn == cr["instanceRole"]:
+ break
+ else:
raise InvalidParameterValueException(
"could not find instanceRole {0}".format(cr["instanceRole"])
) | Batch: computeResources.instanceRole is an instance profile
It's not an IAM role (the API parameter name in Batch is a misnomer).
Validation by matching against known role ARNs will always fail.
Scan the known instance profile ARNs instead. | spulec_moto | train |
3fdc01e477bf61480ef07ec4639a87eb3c827e44 | diff --git a/sonar-server/src/main/webapp/WEB-INF/app/controllers/dashboards_controller.rb b/sonar-server/src/main/webapp/WEB-INF/app/controllers/dashboards_controller.rb
index <HASH>..<HASH> 100644
--- a/sonar-server/src/main/webapp/WEB-INF/app/controllers/dashboards_controller.rb
+++ b/sonar-server/src/main/webapp/WEB-INF/app/controllers/dashboards_controller.rb
@@ -76,7 +76,7 @@ class DashboardsController < ApplicationController
if @dashboard.editable_by?(current_user)
render :partial => 'edit_form', :resource => params[:resource]
else
- redirect_to :action => 'index', :resource => params[:resource]
+ redirect_to :action => 'index', :resource => params[:resource], :status => 401
end
end
@@ -91,8 +91,7 @@ class DashboardsController < ApplicationController
render :partial => 'dashboards/edit_form', :status => 400, :resource => params[:resource]
end
else
- # TODO - notify error ?
- render :text => @dashboard.id.to_s, :resource => params[:resource], :status => 200
+ render :text => @dashboard.id.to_s, :resource => params[:resource], :status => 401
end
end | SONAR-<I> Return proper response codes on unauthorized operation | SonarSource_sonarqube | train |
f63bfc6b51ac5ae2eb0eda200d22d8181e875733 | diff --git a/service_configuration_lib/__init__.py b/service_configuration_lib/__init__.py
index <HASH>..<HASH> 100644
--- a/service_configuration_lib/__init__.py
+++ b/service_configuration_lib/__init__.py
@@ -141,12 +141,19 @@ def services_deployed_on(hostname, service_configuration=None):
running_services = services_that_run_on(hostname, service_configuration)
# Deployed services are a superset of running ones
deployed_services = running_services
+
for service in service_configuration:
- if 'deployed_to' in service_configuration[service] and \
- service_configuration[service]['deployed_to'] and \
- hostname in service_configuration[service]['deployed_to'] and \
- service not in running_services :
+ if (
+ 'deployed_to' in service_configuration[service] and
+ service_configuration[service]['deployed_to'] and
+ (
+ service_configuration[service]['deployed_to'] is True or
+ hostname in service_configuration[service]['deployed_to']
+ ) and
+ service not in running_services
+ ):
deployed_services.append(service)
+
return deployed_services
def services_needing_puppet_help_here():
diff --git a/tests/test_service_configuration_lib.py b/tests/test_service_configuration_lib.py
index <HASH>..<HASH> 100755
--- a/tests/test_service_configuration_lib.py
+++ b/tests/test_service_configuration_lib.py
@@ -39,7 +39,16 @@ class ServiceConfigurationLibTestCase(T.TestCase):
},
'needs_puppet_help': True,
'ssl': True,
- 'vip': 'fakevip3'}
+ 'vip': 'fakevip3',
+ },
+ 'fake_service4': { 'deployed_to': True,
+ 'runs_on': [],
+ 'needs_puppet_help': True,
+ },
+ 'fake_service5': { 'deployed_to': [],
+ 'runs_on': [],
+ 'needs_puppet_help': True,
+ },
}
def test_generate_service_info_should_have_all_keys(self):
@@ -98,14 +107,14 @@ class ServiceConfigurationLibTestCase(T.TestCase):
T.assert_equal(expected, actual)
def test_services_deployed_to_should_return_deployed_and_running_services(self):
- expected = ['fake_service1', 'fake_service2', 'fake_service3']
+ expected = ['fake_service1', 'fake_service2', 'fake_service3', 'fake_service4']
fake_hostname = 'fake_hostname3'
fake_service_configuration = self.fake_service_configuration
actual = service_configuration_lib.services_deployed_on(fake_hostname, fake_service_configuration)
T.assert_equal(expected, actual)
def test_services_needing_puppet_help_on_should_properly_read_configuration(self):
- expected = [ 'fake_service3' ]
+ expected = [ 'fake_service3', 'fake_service4' ]
fake_hostname = 'fake_hostname4'
fake_service_configuration = self.fake_service_configuration
actual = service_configuration_lib.services_needing_puppet_help_on(fake_hostname, fake_service_configuration) | Make it so that deployed_to: True causes a service to be deployed everywhere | Yelp_service_configuration_lib | train |
634f4479ff12654870dc3416c872dd092d449a20 | diff --git a/karma.saucelabs.conf.js b/karma.saucelabs.conf.js
index <HASH>..<HASH> 100644
--- a/karma.saucelabs.conf.js
+++ b/karma.saucelabs.conf.js
@@ -1,6 +1,16 @@
'use strict'
var customLaunchers = {
+ win10chrome: {
+ base: 'SauceLabs',
+ browserName: 'chrome',
+ platform: 'Windows 10'
+ },
+ win10firefox: {
+ base: 'SauceLabs',
+ browserName: 'firefox',
+ platform: 'Windows 10'
+ },
osxSafari: {
base: 'SauceLabs',
browserName: 'safari',
@@ -10,6 +20,16 @@ var customLaunchers = {
base: 'SauceLabs',
browserName: 'iphone',
platform: 'OS X 12.1.4'
+ },
+ win10edge: {
+ base: 'SauceLabs',
+ browserName: 'MicrosoftEdge',
+ platform: 'Windows 10'
+ },
+ win10ie11: {
+ base: 'SauceLabs',
+ browserName: 'internet explorer',
+ platform: 'Windows 10'
}
}
diff --git a/karma.saucelabs.ie.conf.js b/karma.saucelabs.ie.conf.js
index <HASH>..<HASH> 100644
--- a/karma.saucelabs.ie.conf.js
+++ b/karma.saucelabs.ie.conf.js
@@ -1,17 +1,11 @@
'use strict'
var customLaunchers = {
- win7ie8: {
+ win10ie11: {
base: 'SauceLabs',
browserName: 'internet explorer',
- platform: 'Windows XP',
- version: '8.0'
- },
- win7ie7: {
- base: 'SauceLabs',
- browserName: 'internet explorer',
- platform: 'Windows XP',
- version: '7.0'
+ platform: 'Windows 10',
+ version: '11.0'
}
} | Moving to available browsers in saucelabs | holidayextras_barometer | train |
0130e9c194735be7514f1d420e7fdba595e21d4d | diff --git a/lib/utils/format_utils.js b/lib/utils/format_utils.js
index <HASH>..<HASH> 100644
--- a/lib/utils/format_utils.js
+++ b/lib/utils/format_utils.js
@@ -19,7 +19,13 @@ function formatComment(comment) {
return parts[0];
}
return parts.reduce(function(previousValue, currentValue) {
- return previousValue.concat(currentValue.trim().replace(/[*]*\s*/, ''));
+ // newlines in the middle of the comment should stay to achieve:
+ // multiline comments entered by user drive unchanged from JDL studio to generated domain class
+ var delimiter = '';
+ if (previousValue !== '') {
+ delimiter = '\n';
+ }
+ return previousValue.concat(delimiter, currentValue.trim().replace(/[*]*\s*/, ''));
}, '');
}
diff --git a/test/spec/parser/entity_parser_test.js b/test/spec/parser/entity_parser_test.js
index <HASH>..<HASH> 100644
--- a/test/spec/parser/entity_parser_test.js
+++ b/test/spec/parser/entity_parser_test.js
@@ -56,7 +56,7 @@ describe('::convert', function () {
expect(content.Department.relationships[1].javadoc).to.eq('A relationship');
expect(content.Department.fields.length).to.eq(2);
expect(content.Department.entityTableName).to.eq('department');
- expect(content.Employee.javadoc).to.eq('The Employee entity.');
+ expect(content.Employee.javadoc).to.eq('The Employee entity.\nSecond line in javadoc.');
expect(content.Employee.pagination).to.eq('infinite-scroll');
expect(content.Employee.relationships[3].javadoc).to.eq('Another side of the same relationship');
expect(content.Job.relationships[0].otherEntityRelationshipName).to.eq('job');
diff --git a/test/spec/utils/format_utils_test.js b/test/spec/utils/format_utils_test.js
index <HASH>..<HASH> 100644
--- a/test/spec/utils/format_utils_test.js
+++ b/test/spec/utils/format_utils_test.js
@@ -47,9 +47,9 @@ describe('FormatUtils', function() {
var multiLineComment1 = '\n* <p>first line of comment</p><br/>\n*<p>second line</p>\n';
var multiLineComment2 = '*** <p>first line of comment</p><br/>\n* *<p>second line</p>\n\n';
var multiLineComment3 = '\n * abcde\n * fghij\n * nothing\n';
- var expectedResult1 = '<p>first line of comment</p><br/><p>second line</p>';
- var expectedResult2 = '<p>first line of comment</p><br/>*<p>second line</p>';
- var expectedResult3 = 'abcdefghijnothing';
+ var expectedResult1 = '<p>first line of comment</p><br/>\n<p>second line</p>';
+ var expectedResult2 = '<p>first line of comment</p><br/>\n*<p>second line</p>';
+ var expectedResult3 = 'abcde\nfghij\nnothing';
describe(buildTestTitle(multiLineComment1), function() {
it('returns ' + buildTestTitle(expectedResult1), function() {
diff --git a/test/test_files/complex_jdl.jdl b/test/test_files/complex_jdl.jdl
index <HASH>..<HASH> 100644
--- a/test/test_files/complex_jdl.jdl
+++ b/test/test_files/complex_jdl.jdl
@@ -30,6 +30,7 @@ entity Job {
/**
* The Employee entity.
+ * Second line in javadoc.
*/
entity Employee {
employeeId Long, | drive multiline javadoc unchanged from JDL Studio to generated domain class
this change is tested with PR jhipster/generator-jhipster#<I>
advisable is merge this PR after jhipster/generator-jhipster#<I> is merged
fix jhipster/jhipster-core#<I> | jhipster_jhipster-core | train |
56b2e1ae7ae2335f7292d740a3004901fae7293f | diff --git a/src/Composer/Installer.php b/src/Composer/Installer.php
index <HASH>..<HASH> 100644
--- a/src/Composer/Installer.php
+++ b/src/Composer/Installer.php
@@ -35,6 +35,7 @@ use Composer\Installer\NoopInstaller;
use Composer\Installer\SuggestedPackagesReporter;
use Composer\IO\IOInterface;
use Composer\Package\AliasPackage;
+use Composer\Package\RootAliasPackage;
use Composer\Package\BasePackage;
use Composer\Package\CompletePackage;
use Composer\Package\Link;
@@ -779,6 +780,9 @@ class Installer
$request = new Request($lockedRepository);
$request->fixPackage($rootPackage, false);
+ if ($rootPackage instanceof RootAliasPackage) {
+ $request->fixPackage($rootPackage->getAliasOf(), false);
+ }
$fixedPackages = $platformRepo->getPackages();
if ($this->additionalFixedRepository) { | Allow installing an aliased root package | composer_composer | train |
3bbc312ec1cd35b5c8c00d78353cc0fdfe8bddfd | diff --git a/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/Util.java b/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/Util.java
index <HASH>..<HASH> 100644
--- a/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/Util.java
+++ b/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/Util.java
@@ -62,7 +62,7 @@ public final class Util {
public static String translateClassification(final NerClassification nerClas, final NerClassification previous) {
if (nerClas == null) return NOTHING;
- // If there is a previous classificationfrom a different phrase of the same type, then indicate a new
+ // If there is a previous classification from a different phrase of the same type, then indicate a new
// classification using 'B-' prefix, otherwise it is the same phrase and we use the regular 'I-' prefix.
final String prefix = previous != null
&& previous.phraseStartIndex != nerClas.phraseStartIndex
@@ -79,7 +79,7 @@ public final class Util {
case UNKNOWN:
return prefix + "MISC";
- // DATE and anything else new we do should return nothing found, since CoNLL only do the 4 types above
+ // DATE and any other new classes we add should return nothing found, since CoNLL only do the 4 types above
case DATE:
default:
return NOTHING;
diff --git a/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/cmdline/Main.java b/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/cmdline/Main.java
index <HASH>..<HASH> 100644
--- a/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/cmdline/Main.java
+++ b/conll2003-evaluation/src/main/java/org/t3as/ner/conll2003/cmdline/Main.java
@@ -43,6 +43,12 @@ public final class Main {
private Main() {}
+ /**
+ * Parse the CoNLL 2003 test data into sentences, use NICTA t3as NER to analyse the text, and print out the results
+ * so that they can be checked by the 'conlleval' tool. See here for more info:
+ *
+ * http://www.cnts.ua.ac.be/conll2003/ner/
+ */
@SuppressWarnings("MethodNamesDifferingOnlyByCase")
public static void main(final String[] args) throws IOException {
final Options opts = getOptions(args);
@@ -51,22 +57,26 @@ public final class Main {
try (final ConllReader r = new ConllReader(opts.file.get(0))) {
while (r.hasNext()) {
- System.out.println("-DOCSTART- -X- O O O");
- System.out.println();
+ // each section in the test results data starts with a DOCSTART
+ System.out.println("-DOCSTART- -X- O O O\n");
final Collection<Sentence> sentences = r.next();
+
for (final Sentence conllSentence : sentences) {
final NerResultSet nerResultSet = nea.process(conllSentence.sentence);
final Map<Integer, NerClassification> phraseMap = Util.positionClassificationMap(nerResultSet);
+
ConllToken previousToken = null;
- for (int i = 0; i < conllSentence.tokens.size(); i++) {
- final ConllToken conllToken = conllSentence.tokens.get(i);
+ for (final ConllToken conllToken : conllSentence.tokens) {
final NerClassification nerClas = phraseMap.get(conllToken.startIndex);
final NerClassification previousClas = previousToken == null
? null : phraseMap.get(previousToken.startIndex);
final String clas = Util.translateClassification(nerClas, previousClas);
+
+ // print out the token, the test annotations, and our classification of the token
System.out.printf("%s %s %s\n", conllToken.token, conllToken.classifiers, clas);
previousToken = conllToken;
}
+ // finish each sentence with a newline
System.out.println();
}
} | Added some comments to the code. | NICTA_nicta-ner | train |
fbe27e61d41a145226dd246b9bcc0b7d8be7f3cb | diff --git a/commands/system/download.js b/commands/system/download.js
index <HASH>..<HASH> 100644
--- a/commands/system/download.js
+++ b/commands/system/download.js
@@ -1,57 +1,76 @@
const request = require("superagent");
const vm = require("vm");
-var fs = require("fs");
+var fs = require("fs-extra");
exports.run = (client, msg, [url]) => {
request.get(url, (err, res) => {
if (err) console.log(err);
+ // Load Command Data
+ var mod = {
+ exports: {}
+ };
+ try {
+ vm.runInNewContext(res.text, { module: mod, exports: mod.exports }, {timeout: 500});
+ } catch (e) {
+ msg.reply(`URL command not valid: ${e}`);
+ return;
+ }
+
+ let name = mod.exports.help.name;
+ let description = mod.exports.help.description;
+
+ if (client.commands.has(name)) {
+ msg.reply(`The command \`${name}\` already exists in the bot!`);
+ return;
+ }
+
+ msg.channel.sendMessage(`Are you sure you want to load the following command into your bot?
+\`\`\`asciidoc
+=== NAME ===
+${name}
+
+=== DESCRIPTION ===
+${description}
+\`\`\``);
+
const collector = msg.channel.createCollector(m => m.author === msg.author, {
- time: 10000
- });
- msg.channel.sendMessage("Are you sure you want to add the following command to your bot?").then(() => {
- msg.channel.sendCode("js", res.text);
+ time: 5000
});
+
collector.on("message", m => {
- if (m.content === "no") collector.stop("aborted");
- if (m.content === "yes") collector.stop("success");
+ if (m.content.toLowerCase() === "no") collector.stop("aborted");
+ if (m.content.toLowerCase() === "yes") collector.stop("success");
});
+
collector.on("end", (collected, reason) => {
- if (reason === "time") return msg.channel.sendMessage("Timed out: Maybe you should review the code before trying to add it?");
- if (reason === "aborted") return msg.channel.sendMessage("Canceled: The script **has not** been added.");
+ if (reason === "time") return msg.channel.sendMessage(":timer: 5s timeout. Can you read a bit faster?");
+ if (reason === "aborted") return msg.channel.sendMessage(":no_mobile_phones: Load Aborted. Command not installed.");
if (reason === "success") {
- msg.channel.sendMessage("Adding to Commands...")
- .then((m) => {
- var mod = {
- exports: {}
- };
- try {
- vm.runInNewContext(res.text, { module: mod, exports: mod.exports }, {});
- } catch (e) {
- m.edit(`Command not valid: ${e}`);
- return;
- }
- let name = mod.exports.help.name;
- let description = mod.exports.help.description;
- let dir = client.clientBaseDir + "commands/downloaded/";
- client.funcs.log(`New Command: ${name} / ${description}`);
- if (!fs.existsSync(dir)) {
- fs.mkdirSync(dir);
+ msg.channel.sendMessage(":inbox_tray: `Loading Command...`").then(m => {
+ let category = mod.exports.help.category ? mod.exports.help.category : "Downloaded";
+ let dir = require("path").resolve(`${client.clientBaseDir}/commands/${category}/`);
+ client.funcs.log(dir);
+ m.edit(`:inbox_tray: \`Loading Command into ${dir}/${name}.js...\``);
+
+ fs.ensureDir(dir, err => {
+ if (err) {
+ fs.mkDirSync(dir);
}
- fs.writeFile(`${dir}${name}.js`, res.text, (err) => {
+ fs.writeFile(`${dir}/${name}.js`, res.text, (err) => {
if(err) console.error(err);
- client.funcs.loadNewCommand(client, client.clientBaseDir + "commands/downloaded/" + `${name}.js`)
+ let relativePath = require("path").relative(client.clientBasePath, dir);
+ client.funcs.loadNewCommand(client, `${relativePath}/${name}.js`)
.then(() => {
- m.edit(`Successfully Loaded: ${name}`);
+ m.edit(`:inbox_tray: Successfully Loaded: ${name}`);
})
.catch(e => {
- m.edit(`Command load failed: ${name}\n\`\`\`${e.stack}\`\`\``);
+ m.edit(`:no_mobile_phones: Command load failed: ${name}\n\`\`\`${e.stack}\`\`\``);
+ fs.unlink(`${dir}/${name}.js`);
});
});
- })
- .catch(e => {
- console.error(e);
});
+ });
}
});
}); | Fix Download Command
Using new paths. Downloaded commands go in client. | dirigeants_komada | train |
3fdc481a5eba4a8059d2dd7945d4e9e1d5b1d1c2 | diff --git a/lib/codemirror.js b/lib/codemirror.js
index <HASH>..<HASH> 100644
--- a/lib/codemirror.js
+++ b/lib/codemirror.js
@@ -4767,11 +4767,11 @@ window.CodeMirror = (function() {
if (extend) extendSelection(this, pos);
else setSelection(this, pos, pos);
}),
- setSelection: docOperation(function(anchor, head) {
- setSelection(this, clipPos(this, anchor), clipPos(this, head || anchor));
+ setSelection: docOperation(function(anchor, head, bias) {
+ setSelection(this, clipPos(this, anchor), clipPos(this, head || anchor), bias);
}),
- extendSelection: docOperation(function(from, to) {
- extendSelection(this, clipPos(this, from), to && clipPos(this, to));
+ extendSelection: docOperation(function(from, to, bias) {
+ extendSelection(this, clipPos(this, from), to && clipPos(this, to), bias);
}),
getSelection: function(lineSep) {return this.getRange(this.sel.from, this.sel.to, lineSep);}, | Add (undocumented, not yet final) extra argument to setSelection and extendSelection
Issue #<I> | codemirror_CodeMirror | train |
7c81513dac23aa65f723ced72f266b234922c3a9 | diff --git a/validator/file.php b/validator/file.php
index <HASH>..<HASH> 100644
--- a/validator/file.php
+++ b/validator/file.php
@@ -210,6 +210,7 @@ class file
}
else
{
+ // @todo: stylesheet.css have yet to be fixed for 3.1
$this->messages->push('debug', $this->user->lang('FILE_NOT_VALIDATED', $origin_file));
}
}
diff --git a/validator/key.php b/validator/key.php
index <HASH>..<HASH> 100644
--- a/validator/key.php
+++ b/validator/key.php
@@ -174,36 +174,34 @@ class key
{
$this->validate_dateformats($file, $key, $against_language, $validate_language);
}
- else if ($key === 'datetime')
+ else if (
+ $key === 'datetime' ||
+ $key === 'timezones' ||
+ $key === 'tokens' ||
+ $key === 'report_reasons' ||
+ $key === 'PM_ACTION' ||
+ $key === 'PM_CHECK' ||
+ $key === 'PM_RULE'
+ )
{
- #$this->validate_dateformats($file, $key, $against_language, $validate_language);
- }
- else if ($key === 'timezones')
- {
- #$this->validate_dateformats($file, $key, $against_language, $validate_language);
- }
- else if ($key === 'tokens')
- {
- #$this->validate_array_key($file, $key, $against_language, $validate_language);
- }
- else if ($key === 'report_reasons')
- {
- #$this->validate_array_key($file, $key, $against_language, $validate_language);
- }
- else if ($key === 'PM_ACTION')
- {
- #$this->validate_array_key($file, $key, $against_language, $validate_language);
+ $this->validate_array_key($file, $key, $against_language, $validate_language);
}
- else if ($key === 'PM_CHECK')
+ // ACL array in 3.0, removed in 3.1
+ else if ($this->phpbb_version === '3.0' && strpos($key, 'acl_') === 0)
{
- #$this->validate_array_key($file, $key, $against_language, $validate_language);
+ $this->validate_acl($file, $key, $against_language, $validate_language);
}
- else if ($key === 'PM_RULE')
+ // Some special arrays in 3.0, removed in 3.1
+ else if ($this->phpbb_version === '3.0' && (
+ $key === 'permission_cat' ||
+ $key === 'permission_type' ||
+ $key === 'tz' ||
+ $key === 'tz_zones'))
{
- #$this->validate_array_key($file, $key, $against_language, $validate_language);
+ $this->validate_array_key($file, $key, $against_language, $validate_language);
}
- // Fix for 3.1 - Plurals are normal there...
- else if ($key === 'NUM_POSTS_IN_QUEUE' || $key === 'USER_LAST_REMINDED')
+ // Some special plurals in 3.0
+ else if ($this->phpbb_version === '3.0' && ($key === 'NUM_POSTS_IN_QUEUE' || $key === 'USER_LAST_REMINDED'))
{
$this->validate_array_key($file, $key, $against_language, $validate_language);
}
@@ -227,13 +225,24 @@ class key
{
$this->validate_array_key($file, $key, $against_language, $validate_language);
}
- else if (isset($key_types['integer']))
+ else if ($this->phpbb_version !== '3.0' && isset($key_types['integer']))
{
- // Plurals?!
+ // @todo: Plurals have yet to be fixed for 3.1
$this->messages->push('debug', $this->user->lang('LANG_ARRAY_UNSUPPORTED', $file, $key));
$this->validate_array_key($file, $key, $against_language, $validate_language);
return;
}
+ else if ($this->phpbb_version === '3.0' && isset($key_types['integer']))
+ {
+ // For 3.0 this should not happen
+ $this->messages->push('debug', $this->user->lang('LANG_ARRAY_UNSUPPORTED', $file, $key));
+ return;
+ }
+ else
+ {
+ $this->messages->push('debug', $this->user->lang('LANG_ARRAY_MIXED', $file, $key, implode(', ', array_keys($key_types))));
+ return;
+ }
}
else
{ | Add validation of <I> into <I> | phpbb_phpbb-translation-validator | train |
587f013159eaa31ebd70dc52a990081231c2af59 | diff --git a/public/js/omega.js b/public/js/omega.js
index <HASH>..<HASH> 100644
--- a/public/js/omega.js
+++ b/public/js/omega.js
@@ -139,7 +139,8 @@ var OmegaIssueTracker = {};
});
this.socket.on('issue prioritized', function (updater, id, props) {
- that.handleMessage(updater + ' marked ' + id + ' as critical.');
+ var maybeNot = props.critical ? '' : ' not';
+ that.handleMessage(updater + ' marked ' + id + ' as' + maybeNot + ' critical.');
that.refreshIssue(id, props);
});
};
diff --git a/server.js b/server.js
index <HASH>..<HASH> 100644
--- a/server.js
+++ b/server.js
@@ -84,9 +84,9 @@ io.sockets.on('connection', function(socket) {
});
socket.on('prioritize issue', function(id) {
- issues[id-1].critical = true;
+ issues[id-1].critical = !issues[id-1].critical;
issueDb.write(issues);
- io.sockets.emit('issue prioritized', socket.nickname, id, {critical: true});
+ io.sockets.emit('issue prioritized', socket.nickname, id, {critical: issues[id-1].critical});
});
socket.on('reset issues', function() {
diff --git a/tests/omega-spec.js b/tests/omega-spec.js
index <HASH>..<HASH> 100644
--- a/tests/omega-spec.js
+++ b/tests/omega-spec.js
@@ -1,3 +1,18 @@
+var sock = {
+ on: function () {},
+ emit: function () {}
+};
+var messages = {};
+var name = {};
+var message = {};
+var form = {
+ submit: function () {}
+};
+
+var tracker = new OmegaIssueTracker.Tracker(messages, name, message, form, sock);
+tracker.user("elbow");
+tracker.loggedIn(true);
+
describe("omega", function () {
describe("displays html links", function () {
@@ -31,26 +46,20 @@ describe("omega", function () {
});
});
- describe("parses arguments", function () {
+ describe("prioritizes issues", function () {
+ it ("can prioritize", function () {
+ message.val = function () { return ":star 5"; };
- it("can assign multi-digit issues", function () {
- var sock = {
- on: function () {},
- emit: function () {}
- },
- messages = {},
- name = {},
- message = {
- val: function () { return ":assign 50"; }
- },
- form = {
- submit: function () {}
- };
+ spyOn(tracker, 'prioritizeIssue');
+ tracker.handleInput();
+ expect(tracker.prioritizeIssue).toHaveBeenCalledWith(5);
+ });
+ });
- var tracker = new OmegaIssueTracker.Tracker(messages, name, message, form, sock);
- tracker.user("elbow");
- tracker.loggedIn(true);
-
+ describe("parses arguments", function () {
+ it("can assign multi-digit issues", function () {
+ message.val = function () { return ":assign 50"; };
+
spyOn(tracker, 'assignIssue');
tracker.handleInput();
expect(tracker.assignIssue).toHaveBeenCalledWith(50, undefined); | Can now toggle issues as critical. Added a quick test... need node tests. | wachunga_omega | train |
f5f4e316b81016ca005f74af4c25e52850171013 | diff --git a/test/helpers/utils.go b/test/helpers/utils.go
index <HASH>..<HASH> 100644
--- a/test/helpers/utils.go
+++ b/test/helpers/utils.go
@@ -338,3 +338,21 @@ func ManifestGet(manifestFilename string) string {
}
return filepath.Join(BasePath, "k8sT", "manifests", manifestFilename)
}
+
+// WriteOrAppendToFile writes data to a file named by filename.
+// If the file does not exist, WriteFile creates it with permissions perm;
+// otherwise WriteFile appends the data to the file
+func WriteOrAppendToFile(filename string, data []byte, perm os.FileMode) error {
+ f, err := os.OpenFile(filename, os.O_APPEND|os.O_WRONLY|os.O_CREATE, perm)
+ if err != nil {
+ return err
+ }
+ n, err := f.Write(data)
+ if err == nil && n < len(data) {
+ err = io.ErrShortWrite
+ }
+ if err1 := f.Close(); err == nil {
+ err = err1
+ }
+ return err
+} | Test: added WriteOrAppendToFile helper function
Added `WriteOrAppendToFile` helper function to be able to append data to
any other file. | cilium_cilium | train |
3be1b53532d234122009b07ef570828a746c3c40 | diff --git a/src/species/toucher.js b/src/species/toucher.js
index <HASH>..<HASH> 100644
--- a/src/species/toucher.js
+++ b/src/species/toucher.js
@@ -190,21 +190,25 @@ define(function(require) {
event = document.createEvent('Event');
event.initEvent('touch' + type, true, true);
- // just like the mobile browsers, on touchend we dont include a touchlist
- if(type != 'end') {
- touches.forEach(function(touch, i) {
- touchlist.push({
- pageX: touch.x,
- pageY: touch.y,
- clientX: touch.x,
- clientY: touch.y,
- target: element,
- identifier: i
- })
- });
- }
+ touchlist.identifiedTouch = touchlist.item = function(index) {
+ return this[index] || {}
+ };
+
+ touches.forEach(function(touch, i) {
+ touchlist.push({
+ pageX: touch.x,
+ pageY: touch.y,
+ clientX: touch.x,
+ clientY: touch.y,
+ screenX: touch.x,
+ screenY: touch.y,
+ target: element,
+ identifier: i
+ })
+ });
- event.touches = touchlist;
+ event.touches = (type == 'end') ? [] : touchlist;
+ event.targetTouches = (type == 'end') ? [] : touchlist;
event.changedTouches = touchlist;
element.dispatchEvent(event); | added touch methods/properies, as described by w3c | marmelab_gremlins.js | train |
8c8ec7d516128bdabc5ec7891b9a4154af77bb6d | diff --git a/CHANGELOG.rdoc b/CHANGELOG.rdoc
index <HASH>..<HASH> 100644
--- a/CHANGELOG.rdoc
+++ b/CHANGELOG.rdoc
@@ -2,6 +2,7 @@
* Fixed error where default session class does not exist.
* Fixed human_name for the model to use its own human name and not delegate to the associated model. Translation should be under authlogic.models.user_session (or whatever the name of your session is).
+* Fixed human_attribute_name to use Authlogic keys for translation instead of ActiveRecord: authlogic.attributes.user_session.login.
== 2.0.2 released 2009-3-24
diff --git a/lib/authlogic/i18n.rb b/lib/authlogic/i18n.rb
index <HASH>..<HASH> 100644
--- a/lib/authlogic/i18n.rb
+++ b/lib/authlogic/i18n.rb
@@ -39,6 +39,14 @@ module Authlogic
# not_confirmed: Your account is not confirmed
# not_approved: Your account is not approved
# no_authentication_details: You did not provide any details for authentication.
+ # models:
+ # user_session: UserSession (or whatever name you are using)
+ # attributes:
+ # user_session: (or whatever name you are using)
+ # login: login
+ # email: email
+ # passwword: password
+ # remember_me: remember me
class I18n
class << self
# All message translation is passed to this method. The first argument is the key for the message. The second is options, see the rails I18n library for a list of options used.
@@ -49,6 +57,7 @@ module Authlogic
options[:default]
end
end
+ alias_method :translate, :t
end
end
end
\ No newline at end of file
diff --git a/lib/authlogic/session/active_record_trickery.rb b/lib/authlogic/session/active_record_trickery.rb
index <HASH>..<HASH> 100644
--- a/lib/authlogic/session/active_record_trickery.rb
+++ b/lib/authlogic/session/active_record_trickery.rb
@@ -11,8 +11,10 @@ module Authlogic
end
module ClassMethods
- def human_attribute_name(*args)
- klass.human_attribute_name(*args)
+ def human_attribute_name(attribute_key_name, options = {})
+ options[:count] ||= 1
+ options[:default] ||= attribute_key_name.humanize
+ I18n.t("attributes.#{name.underscore}.#{attribute_key_name}", options)
end
def human_name(*args) | Fixed human_attribute_name to use Authlogic keys for translation instead of ActiveRecord | binarylogic_authlogic | train |
7d2bbb6ca4d5c3edd576def3f042e6c39549bb57 | diff --git a/actionpack/test/controller/render_test.rb b/actionpack/test/controller/render_test.rb
index <HASH>..<HASH> 100644
--- a/actionpack/test/controller/render_test.rb
+++ b/actionpack/test/controller/render_test.rb
@@ -102,12 +102,12 @@ class TestController < ActionController::Base
end
def conditional_hello_with_expires_in_with_public_with_more_keys
- expires_in 1.minute, :public => true, 'max-stale' => 5.hours
+ expires_in 1.minute, :public => true, 's-maxage' => 5.hours
render :action => 'hello_world'
end
def conditional_hello_with_expires_in_with_public_with_more_keys_old_syntax
- expires_in 1.minute, :public => true, :private => nil, 'max-stale' => 5.hours
+ expires_in 1.minute, :public => true, :private => nil, 's-maxage' => 5.hours
render :action => 'hello_world'
end
@@ -1421,12 +1421,12 @@ class ExpiresInRenderTest < ActionController::TestCase
def test_expires_in_header_with_additional_headers
get :conditional_hello_with_expires_in_with_public_with_more_keys
- assert_equal "max-age=60, public, max-stale=18000", @response.headers["Cache-Control"]
+ assert_equal "max-age=60, public, s-maxage=18000", @response.headers["Cache-Control"]
end
def test_expires_in_old_syntax
get :conditional_hello_with_expires_in_with_public_with_more_keys_old_syntax
- assert_equal "max-age=60, public, max-stale=18000", @response.headers["Cache-Control"]
+ assert_equal "max-age=60, public, s-maxage=18000", @response.headers["Cache-Control"]
end
def test_expires_now | Removed max-stale from the tests since it's a request cache-control directive, just for clarity sake. | rails_rails | train |
5e827318a1dd6a55969709b9e9609513905d450d | diff --git a/archive.go b/archive.go
index <HASH>..<HASH> 100644
--- a/archive.go
+++ b/archive.go
@@ -226,8 +226,16 @@ func (v *volume) nextVolName() {
func (v *volume) next() (*fileBlockHeader, error) {
for {
+ var atEOF bool
+
h, err := v.fileBlockReader.next()
- if err != errArchiveContinues {
+ switch err {
+ case errArchiveContinues:
+ case io.EOF:
+ // Read all of volume without finding an end block. The only way
+ // to tell if the archive continues is to try to open the next volume.
+ atEOF = true
+ default:
return h, err
}
@@ -235,6 +243,10 @@ func (v *volume) next() (*fileBlockHeader, error) {
v.nextVolName()
v.f, err = os.Open(v.dir + v.file) // Open next volume file
if err != nil {
+ if atEOF && os.IsNotExist(err) {
+ // volume not found so assume that the archive has ended
+ return nil, io.EOF
+ }
return nil, err
}
v.num++ | Allow multi volume files to not have end blocks.
Some older multi volume files may not have end blocks. If there is no
end block, just try and open the next volume. If it doesnt exist, assume
the archive ends. If the next volume file is invalid and the archive
really should have ended there will be errors. | nwaples_rardecode | train |
df91466adc1c4a2bf01533b40a022a4bc0249c42 | diff --git a/pypet/tests/unittests/utils_test.py b/pypet/tests/unittests/utils_test.py
index <HASH>..<HASH> 100644
--- a/pypet/tests/unittests/utils_test.py
+++ b/pypet/tests/unittests/utils_test.py
@@ -3,7 +3,10 @@ __author__ = 'Robert Meyer'
import time
import sys
import pickle
-from collections import Set, Sequence, Mapping
+try:
+ from collections import Set, Sequence, Mapping
+except ImportError:
+ from collections.abc import Set, Sequence, Mapping
import pandas as pd
import numpy as np
diff --git a/pypet/utils/comparisons.py b/pypet/utils/comparisons.py
index <HASH>..<HASH> 100644
--- a/pypet/utils/comparisons.py
+++ b/pypet/utils/comparisons.py
@@ -2,7 +2,10 @@
__author__ = 'Robert Meyer'
-from collections import Sequence, Mapping
+try:
+ from collections import Sequence, Mapping
+except ImportError:
+ from collections.abc import Sequence, Mapping
import numpy as np
import pandas as pd | fix(py<I>): correct collections related imports | SmokinCaterpillar_pypet | train |
c48b7648a7ad7790a2dfc42a8b59a7f3cdeceb45 | diff --git a/code/pages/ExtensibleSearchPage.php b/code/pages/ExtensibleSearchPage.php
index <HASH>..<HASH> 100644
--- a/code/pages/ExtensibleSearchPage.php
+++ b/code/pages/ExtensibleSearchPage.php
@@ -687,7 +687,7 @@ class ExtensibleSearchPage_Controller extends Page_Controller {
// Determine whether the search parameters have been passed through.
if(!isset($data['Search'])) {
- $data['Search'] = null;
+ $data['Search'] = '';
}
if(!isset($data['SortBy'])) {
$data['SortBy'] = $page->SortBy;
@@ -695,8 +695,9 @@ class ExtensibleSearchPage_Controller extends Page_Controller {
if(!isset($data['SortDirection'])) {
$data['SortDirection'] = $page->SortDirection;
}
+ $request = $this->getRequest();
if(!isset($form)) {
- $this->getForm($this->getRequest());
+ $this->getForm($request);
}
// Instantiate some default templates.
@@ -755,7 +756,7 @@ class ExtensibleSearchPage_Controller extends Page_Controller {
// The paginated list needs to be manipulated, as sorting and filtering is not possible otherwise.
- $start = isset($_GET['start']) ? (int)$_GET['start'] : 0;
+ $start = $request->getVar('start') ? (int)$request->getVar('start') : 0;
$_GET['start'] = 0;
// Determine the full-text search results. | Cleaning up the extensible search page results definition. | nglasl_silverstripe-extensible-search | train |
aa2c1dcee06b3aa5cbbf87574a0940c5a1cfbf2f | diff --git a/tests/test_ipuz.py b/tests/test_ipuz.py
index <HASH>..<HASH> 100644
--- a/tests/test_ipuz.py
+++ b/tests/test_ipuz.py
@@ -456,7 +456,7 @@ class IPUZWriteTestCase(IPUZBaseTestCase):
class IPUZRoundTripTestCase(IPUZBaseTestCase):
- def test_first_ipuz_file(self):
+ def test_first_ipuz_file_with_json(self):
with open("fixtures/first.ipuz") as f:
data = f.read()
@@ -464,3 +464,12 @@ class IPUZRoundTripTestCase(IPUZBaseTestCase):
output_string = ipuz.write(output, json_only=True)
second_output = ipuz.read(output_string)
self.assertEqual(output, second_output)
+
+ def test_first_ipuz_file_with_jsonp(self):
+ with open("fixtures/first.ipuz") as f:
+ data = f.read()
+
+ output = ipuz.read(data)
+ output_string = ipuz.write(output)
+ second_output = ipuz.read(output_string)
+ self.assertEqual(output, second_output) | Added test case for JSONP round trip | svisser_ipuz | train |
72c7bd2311594a896386b9a7789f709748e9d1cc | diff --git a/src/Properties/HigherOrderCollectionProxyPropertyExtension.php b/src/Properties/HigherOrderCollectionProxyPropertyExtension.php
index <HASH>..<HASH> 100644
--- a/src/Properties/HigherOrderCollectionProxyPropertyExtension.php
+++ b/src/Properties/HigherOrderCollectionProxyPropertyExtension.php
@@ -12,7 +12,7 @@ use PHPStan\Reflection\PropertyReflection;
use PHPStan\TrinaryLogic;
use PHPStan\Type;
-class HigherOrderCollectionProxyPropertyExtension implements PropertiesClassReflectionExtension
+final class HigherOrderCollectionProxyPropertyExtension implements PropertiesClassReflectionExtension
{
public function hasProperty(ClassReflection $classReflection, string $propertyName): bool
{
@@ -35,23 +35,22 @@ class HigherOrderCollectionProxyPropertyExtension implements PropertiesClassRefl
$returnType = HigherOrderCollectionProxyHelper::determineReturnType($methodType->getValue(), $modelType, $propertyType);
- return new class($modelType, $returnType) implements PropertyReflection {
- /** @var Type\ObjectType */
- private $modelType;
+ return new class($classReflection, $returnType) implements PropertyReflection {
+ /** @var ClassReflection */
+ private $classReflection;
/** @var Type\Type */
private $returnType;
- public function __construct(Type\ObjectType $modelType, Type\Type $returnType)
+ public function __construct(ClassReflection $classReflection, Type\Type $returnType)
{
- $this->modelType = $modelType;
+ $this->classReflection = $classReflection;
$this->returnType = $returnType;
}
public function getDeclaringClass(): \PHPStan\Reflection\ClassReflection
{
- /** @phpstan-ignore-next-line */
- return $this->modelType->getClassReflection();
+ return $this->classReflection;
}
public function isStatic(): bool | fix: use original class reflection to avoid type issues | nunomaduro_larastan | train |
5a5baec719ea1fc55da62779dd19e1e9a749e033 | diff --git a/insteonplm/plm.py b/insteonplm/plm.py
index <HASH>..<HASH> 100644
--- a/insteonplm/plm.py
+++ b/insteonplm/plm.py
@@ -58,6 +58,7 @@ class PLM(asyncio.Protocol, DeviceBase):
self._write_transport_lock = asyncio.Lock(loop=self._loop)
self._message_callbacks = MessageCallback()
self._saved_device_info = []
+ self._cb_load_all_link_db_done = []
self._address = None
self._cat = None
@@ -163,6 +164,12 @@ class PLM(asyncio.Protocol, DeviceBase):
"""Register a callback for when a matching new device is seen."""
self.devices.add_device_callback(callback)
+ def add_all_link_done_callback(self, callback):
+ """Register a callback to be invoked when a all link database is done."""
+ self.log.debug('Added new callback %s ',
+ callback)
+ self._cb_load_all_link_db_done.append(callback)
+
def poll_devices(self):
"""Request status updates from each device."""
for addr in self.devices:
@@ -376,7 +383,10 @@ class PLM(asyncio.Protocol, DeviceBase):
self._handle_get_next_all_link_record_nak,
None)
else:
- self._save_device_info()
+ self._save_device_info()
+ while len(self._cb_load_all_link_db_done) > 0:
+ callback = self._cb_load_all_link_db_done.pop()
+ callback()
self._loop.call_soon(self.poll_devices)
self.log.debug('Ending _handle_get_next_all_link_record_nak') | Update for all-link complete callback | nugget_python-insteonplm | train |
219aaa06eb16a77de61d1e675761aa6b0a0e95b7 | diff --git a/lib/cuporter/node/html.rb b/lib/cuporter/node/html.rb
index <HASH>..<HASH> 100644
--- a/lib/cuporter/node/html.rb
+++ b/lib/cuporter/node/html.rb
@@ -6,7 +6,7 @@ module Cuporter
class Parent < NodeBase
def build
- super('div')
+ super(node_name)
self << ul
end
@@ -15,7 +15,7 @@ module Cuporter
end
def add_child(node)
- if node['class'] == 'name'
+ if node['class'] == 'cuke_name'
super(node)
else
ul << node
@@ -48,7 +48,16 @@ module Cuporter
end
def file_name
- file.split(/\//).last
+ path = delete('file').value.split(File::SEPARATOR)
+ name = html_node(:span)
+ name.content = "/#{path.pop}"
+ parent = html_node(:em)
+ parent.content = "/#{path.pop}"
+ div = html_node('div', :class => 'file')
+ div.children = path.join('/')
+ div << parent
+ div << name
+ div
end
# sort on: file path, name, substring of name after any ':'
@@ -67,6 +76,13 @@ module Cuporter
super(other)
end
+ def build
+ super do
+ self << file_name
+ self << ul
+ end
+ end
+
end
# The set of examples in a scenario outline
@@ -75,10 +91,11 @@ module Cuporter
HTML_TAG = :li
def build
- super('div')
- table << thead
- table << tbody
- self << table
+ super('div') do
+ table << thead
+ table << tbody
+ self << table
+ end
end
def table
@@ -127,6 +144,7 @@ module Cuporter
HTML_TAG = :li
include Leaf
include Tagged
+
end
class Example < NodeBase
diff --git a/lib/cuporter/node/node_base.rb b/lib/cuporter/node/node_base.rb
index <HASH>..<HASH> 100644
--- a/lib/cuporter/node/node_base.rb
+++ b/lib/cuporter/node/node_base.rb
@@ -121,15 +121,30 @@ module Cuporter
NodeBase = Nokogiri::XML::Node
module Html
+ def html_node(node_name, attributes = {})
+ n = NodeBase.new(node_name.to_s, document)
+ attributes.each do |attr, value|
+ value = value.is_a?(Array) ? value.join(",") : value.to_s.strip
+ n[attr.to_s] = value unless value.empty?
+ end
+ n
+ end
+
+ def cuke_name
+ unless @cuke_name
+ if self['cuke_name']
+ @cuke_name = html_node('div', 'class' => 'cuke_name')
+ @cuke_name.children = delete('cuke_name').value
+ @cuke_name['alt'] = delete('tags').value if self['tags']
+ end
+ end
+ @cuke_name
+ end
+
# this gets mixed in to NodeBase/Nokogiri::XML::Node
def build(node_name = 'span')
- #self.content = parse("<div class='cuke_name'>#{delete('cuke_name').value}</div>") if self['cuke_name']
- if self['cuke_name']
- cuke_name = NodeBase.new(node_name, document)
- cuke_name['class'] = 'name'
- cuke_name.children = delete('cuke_name').value
- self.children = cuke_name
- end
+ self.children = cuke_name if cuke_name
+ yield if block_given?
end
end
end
@@ -144,9 +159,9 @@ module Cuporter
end
def copy_attrs(node, attributes)
- attributes.each do | attr, value |
+ attributes.each do |attr, value|
value = value.is_a?(Array) ? value.join(",") : value.to_s.strip
- node[attr.to_s] = value unless value.empty?
+ node[attr.to_s] = value unless value.empty?
end
node
end | pretty doc structure for feature view, tag view broken | twcamper_cuporter | train |
5b36e4f908ed1f39773777ed5e22447f5d65029c | diff --git a/lib/collection/property.js b/lib/collection/property.js
index <HASH>..<HASH> 100644
--- a/lib/collection/property.js
+++ b/lib/collection/property.js
@@ -103,13 +103,14 @@ _.extend(Property.prototype, /** @lends Property.prototype */ {
* @private
* @draft
*
- * @param {VariableList=} [variables] - One can specifically provide a VariableList for doing the substitution. In
+ * @param {?VariableList=} [variables] - One can specifically provide a VariableList for doing the substitution. In
* the event one is not provided, the variables are taken from this object or one from the parent tree.
+ * @param {Array<Object>} overrides - additional objects to lookup for variable values
* @returns {Object|undefined}
*
* @throws {Error} If `variables` cannot be resolved up the parent chain.
*/
- toObjectResolved: function (variables) {
+ toObjectResolved: function (variables, overrides) {
var variableSourceObj = this;
// We see if variables can be found in this object itself.
@@ -124,7 +125,7 @@ _.extend(Property.prototype, /** @lends Property.prototype */ {
throw Error('Unable to resolve variables. Require a List type property for variable auto resolution.');
}
- return variables ? variables.substitute(this.toJSON()) : undefined;
+ return variables ? variables.substitute(this.toJSON(), overrides) : undefined;
}
}); | Updated Property.toObjectResolved to accept and forward an additional `overrides` parameter to the substitution function of variable replacement | postmanlabs_postman-collection | train |
b5f7ab4c6ab48eeeecd01640a057bb092597c0bb | diff --git a/gocode.go b/gocode.go
index <HASH>..<HASH> 100644
--- a/gocode.go
+++ b/gocode.go
@@ -16,6 +16,7 @@ var (
server = flag.Bool("s", false, "run a server instead of a client")
format = flag.String("f", "nice", "output format (vim | emacs | nice)")
input = flag.String("in", "", "use this file instead of stdin input")
+ debug = flag.Bool("debug", false, "turn on additional debug messages")
)
type Formatter interface {
@@ -140,6 +141,9 @@ func serverFunc() int {
rpcremote := new(RPCRemote)
rpc.Register(rpcremote)
+ if *debug {
+ daemon.ctx.debuglog = os.Stdout
+ }
daemon.acr.Loop()
return 0
}
diff --git a/gocodelib.go b/gocodelib.go
index <HASH>..<HASH> 100644
--- a/gocodelib.go
+++ b/gocodelib.go
@@ -508,9 +508,7 @@ func (self *AutoCompleteContext) processPackageData(filename, uniquename, pkgnam
file.addPackageAlias(pkgname, uniquename)
}
- if self.debuglog != nil {
- fmt.Fprintf(self.debuglog, "parsing package '%s'...\n", pkgname)
- }
+ self.debugLog("parsing package '%s'...\n", pkgname)
s = s[i+1:]
internalPackages := make(map[string]*bytes.Buffer)
@@ -550,15 +548,15 @@ func (self *AutoCompleteContext) processPackageData(filename, uniquename, pkgnam
if err != nil {
panic(fmt.Sprintf("failure in:\n%s\n%s\n", value, err.String()))
} else {
- if self.debuglog != nil {
- fmt.Fprintf(self.debuglog, "\t%s: OK (ndecls: %d)\n", key, len(decls))
- }
f := new(ast.File) // fake file
f.Decls = decls
ast.FileExports(f)
localname := ""
if key == uniquename {
localname = self.genForeignPackageAlias(pkgname, uniquename)
+ self.debugLog("\t!%s: OK (ndecls: %d)\n", key, len(decls))
+ } else {
+ self.debugLog("\t%s: OK (ndecls: %d)\n", key, len(decls))
}
self.addToPackage(key, localname, f.Decls)
}
@@ -1221,6 +1219,12 @@ func NewAutoCompleteContext() *AutoCompleteContext {
return self
}
+func (self *AutoCompleteContext) debugLog(f string, a ...interface{}) {
+ if self.debuglog != nil {
+ fmt.Fprintf(self.debuglog, f, a)
+ }
+}
+
func (self *AutoCompleteContext) addToPackage(globalname, localname string, decls []ast.Decl) {
if self.m[globalname] == nil {
self.m[globalname] = NewDecl(localname, DECL_MODULE, self.current) | Reorganize debug output mechanism. | nsf_gocode | train |
11af585101a2af98891b47101c045a457f2ac1dc | diff --git a/core/core.js b/core/core.js
index <HASH>..<HASH> 100644
--- a/core/core.js
+++ b/core/core.js
@@ -1698,7 +1698,7 @@ exports._bootstrap = function(self, name) {
break;
case 'core.Image':
self.element.remove();
- self.element = $('<img/>');
+ self.element = $('<div/>');
self.parent.element.append(self.element);
self.element.on('load', self._onLoad.bind(self));
self.element.on('error', self._onError.bind(self)); | Image is not img anymore (fix annoying image borders). | pureqml_qmlcore | train |
aa8c33270b7304fb1a5310d205c22ad9fdd88645 | diff --git a/README.md b/README.md
index <HASH>..<HASH> 100644
--- a/README.md
+++ b/README.md
@@ -19,10 +19,14 @@ Have a look at the [examples](example/).
### Basic Authentication Flow
```php
-$provider = new \Alcohol\OAuth2\Client\Provider\EveOnline([
+$provider = new Alcohol\OAuth2\Client\Provider\EveOnline([
'clientId' => '{client-id}',
'clientSecret' => '{client-secret}',
'redirectUri' => 'https://example.com/callback-url',
+ // the following are optional and displayed here with their default values
+ 'urlAuthorize' => 'https://login.eveonline.com/oauth/authorize',
+ 'urlAccessToken' => 'https://login.eveonline.com/oauth/token',
+ 'urlResourceOwnerDetails' => 'https://login.eveonline.com/oauth/verify',
]);
// If we don't have an authorization code then get one
@@ -68,7 +72,7 @@ if (!isset($_GET['code'])) {
var_export($resourceOwner->toArray());
- } catch (\League\OAuth2\Client\Provider\Exception\IdentityProviderException $e) {
+ } catch (League\OAuth2\Client\Provider\Exception\IdentityProviderException $e) {
// Failed to get the access token or user details.
exit($e->getMessage());
@@ -88,7 +92,7 @@ $request = $provider->getAuthenticatedRequest(
$accessToken
);
-$client = new \GuzzleHttp\Client();
+$client = new GuzzleHttp\Client();
$response = $client->send($request);
print $response->getBody();
@@ -112,7 +116,7 @@ if ($existingAccessToken->hasExpired()) {
## Testing
-> Sorry, I got lazy. Just don't break the example.
+> Sorry, I got lazy. Just don't break the examples.
## Contributing
diff --git a/example/basic.php b/example/basic.php
index <HASH>..<HASH> 100644
--- a/example/basic.php
+++ b/example/basic.php
@@ -15,6 +15,10 @@ $provider = new Alcohol\OAuth2\Client\Provider\EveOnline([
'clientId' => '{client-id}',
'clientSecret' => '{client-secret}',
'redirectUri' => 'https://example.com/callback-url',
+ // the following are optional and displayed here with their default values
+ 'urlAuthorize' => 'https://login.eveonline.com/oauth/authorize',
+ 'urlAccessToken' => 'https://login.eveonline.com/oauth/token',
+ 'urlResourceOwnerDetails' => 'https://login.eveonline.com/oauth/verify',
]);
// If we don't have an authorization code then get one
diff --git a/example/scoped.php b/example/scoped.php
index <HASH>..<HASH> 100644
--- a/example/scoped.php
+++ b/example/scoped.php
@@ -15,6 +15,10 @@ $provider = new Alcohol\OAuth2\Client\Provider\EveOnline([
'clientId' => '{client-id}',
'clientSecret' => '{client-secret}',
'redirectUri' => 'https://example.com/callback-url',
+ // the following are optional and displayed here with their default values
+ 'urlAuthorize' => 'https://login.eveonline.com/oauth/authorize',
+ 'urlAccessToken' => 'https://login.eveonline.com/oauth/token',
+ 'urlResourceOwnerDetails' => 'https://login.eveonline.com/oauth/verify',
]);
// If we don't have an authorization code then get one
diff --git a/src/EveOnline.php b/src/EveOnline.php
index <HASH>..<HASH> 100644
--- a/src/EveOnline.php
+++ b/src/EveOnline.php
@@ -20,11 +20,25 @@ class EveOnline extends AbstractProvider
use BearerAuthorizationTrait;
/**
- * Whether or not to issue calls against the test server (Sisi).
+ * The base URL for authorizing a client.
*
- * @var bool
+ * @var string
*/
- protected $useSisi = false;
+ protected $urlAuthorize = 'https://login.eveonline.com/oauth/authorize';
+
+ /**
+ * The base URL for requesting an access token.
+ *
+ * @var string
+ */
+ protected $urlAccessToken = 'https://login.eveonline.com/oauth/token';
+
+ /**
+ * The URL for requesting the resource owner's details.
+ *
+ * @var string
+ */
+ protected $urlResourceOwnerDetails = 'https://login.eveonline.com/oauth/verify';
/**
* Get authorization url to begin OAuth flow.
@@ -35,7 +49,7 @@ class EveOnline extends AbstractProvider
*/
public function getBaseAuthorizationUrl(): string
{
- return sprintf('%s/oauth/authorize', $this->getDomain());
+ return $this->urlAuthorize;
}
/**
@@ -49,7 +63,7 @@ class EveOnline extends AbstractProvider
*/
public function getBaseAccessTokenUrl(array $params): string
{
- return sprintf('%s/oauth/token', $this->getDomain());
+ return $this->urlAccessToken;
}
/**
@@ -63,21 +77,7 @@ class EveOnline extends AbstractProvider
*/
public function getResourceOwnerDetailsUrl(AccessToken $token): string
{
- return sprintf('%s/oauth/verify', $this->getDomain());
- }
-
- /**
- * Get the base domain to use in each request (test or production).
- *
- * @return string
- */
- protected function getDomain(): string
- {
- if ($this->useSisi) {
- return 'https://sisilogin.testeveonline.com';
- }
-
- return 'https://login.eveonline.com';
+ return $this->urlResourceOwnerDetails;
}
/** | adjust readme, examples and configuration of provider | alcohol_oauth2-eveonline | train |
d23c4ab462930f410ebdd4a4dfa007b1fbe36944 | diff --git a/source/application/controllers/admin/article_stock.php b/source/application/controllers/admin/article_stock.php
index <HASH>..<HASH> 100644
--- a/source/application/controllers/admin/article_stock.php
+++ b/source/application/controllers/admin/article_stock.php
@@ -16,7 +16,7 @@
* along with OXID eShop Community Edition. If not, see <http://www.gnu.org/licenses/>.
*
* @link http://www.oxid-esales.com
- * @copyright (C) OXID eSales AG 2003-2015
+ * @copyright (C) OXID eSales AG 2003-2016
* @version OXID eShop CE
*/
@@ -62,6 +62,10 @@ class Article_Stock extends oxAdminDetails
$this->_aViewData["otherlang"][$id] = clone $oLang;
}
+ if ($oArticle->isDerived()) {
+ $this->_aViewData['readonly'] = true;
+ }
+
// variant handling
if ($oArticle->oxarticles__oxparentid->value) {
$oParentArticle = oxNew("oxArticle");
@@ -99,10 +103,6 @@ class Article_Stock extends oxAdminDetails
$soxId = $this->getEditObjectId();
$aParams = oxRegistry::getConfig()->getRequestParameter("editval");
- // shopid
- $sShopID = oxRegistry::getSession()->getVariable("actshop");
- $aParams['oxarticles__oxshopid'] = $sShopID;
-
$oArticle = oxNew("oxArticle");
$oArticle->loadInLang($this->_iEditLang, $soxId);
@@ -141,8 +141,7 @@ class Article_Stock extends oxAdminDetails
$this->resetContentCache();
$sOxArtId = $this->getEditObjectId();
-
-
+ $this->onArticleAmountPriceChange($sOxArtId);
$aParams = oxRegistry::getConfig()->getRequestParameter("editval");
@@ -215,13 +214,15 @@ class Article_Stock extends oxAdminDetails
*/
public function updateprices()
{
-
$aParams = oxRegistry::getConfig()->getRequestParameter("updateval");
if (is_array($aParams)) {
foreach ($aParams as $soxId => $aStockParams) {
$this->addprice($soxId, $aStockParams);
}
}
+
+ $sOxArtId = $this->getEditObjectId();
+ $this->onArticleAmountPriceChange($sOxArtId);
}
@@ -234,7 +235,19 @@ class Article_Stock extends oxAdminDetails
$oDb = oxDb::getDb();
$sPriceId = $oDb->quote(oxRegistry::getConfig()->getRequestParameter("priceid"));
- $sId = $oDb->quote($this->getEditObjectId());
+ $articleId = $this->getEditObjectId();
+ $sId = $oDb->quote($articleId);
$oDb->execute("delete from oxprice2article where oxid = {$sPriceId} and oxartid = {$sId}");
+
+ $this->onArticleAmountPriceChange($articleId);
+ }
+
+ /**
+ * Method is used to bind to article amount price change.
+ *
+ * @param string $articleId
+ */
+ protected function onArticleAmountPriceChange($articleId)
+ {
}
}
diff --git a/tests/unit/admin/articlestockTest.php b/tests/unit/admin/articlestockTest.php
index <HASH>..<HASH> 100644
--- a/tests/unit/admin/articlestockTest.php
+++ b/tests/unit/admin/articlestockTest.php
@@ -16,7 +16,7 @@
* along with OXID eShop Community Edition. If not, see <http://www.gnu.org/licenses/>.
*
* @link http://www.oxid-esales.com
- * @copyright (C) OXID eSales AG 2003-2015
+ * @copyright (C) OXID eSales AG 2003-2016
* @version OXID eShop CE
*/
@@ -246,7 +246,7 @@ class Unit_Admin_ArticleStockTest extends OxidTestCase
$sOXID = "_testId";
//expected shop id
- $sShopId = "oxbaseshop";
+ $sShopId = $this->getTestConfig()->getShopEdition() == 'EE' ? '2' : 'oxbaseshop';
$oConfig = $this->getMock("oxConfig", array("getShopId"));
$oConfig->expects($this->any())->method('getShopId')->will($this->returnValue($sShopId)); | ESDEV-<I> Remove edition based code from article_stock | OXID-eSales_oxideshop_ce | train |
1c26fe427df0422467dfa8de73929feb1eba2890 | diff --git a/core/src/main/java/org/infinispan/notifications/cachelistener/CacheNotifierImpl.java b/core/src/main/java/org/infinispan/notifications/cachelistener/CacheNotifierImpl.java
index <HASH>..<HASH> 100644
--- a/core/src/main/java/org/infinispan/notifications/cachelistener/CacheNotifierImpl.java
+++ b/core/src/main/java/org/infinispan/notifications/cachelistener/CacheNotifierImpl.java
@@ -68,7 +68,6 @@ import org.infinispan.filter.CacheFilters;
import org.infinispan.filter.KeyFilter;
import org.infinispan.interceptors.AsyncInterceptorChain;
import org.infinispan.interceptors.locking.ClusteringDependentLogic;
-import org.infinispan.manager.EmbeddedCacheManager;
import org.infinispan.metadata.Metadata;
import org.infinispan.notifications.Listener;
import org.infinispan.notifications.cachelistener.annotation.CacheEntriesEvicted;
@@ -835,10 +834,15 @@ public final class CacheNotifierImpl<K, V> extends AbstractListenerImpl<Event<K,
throw new UnsupportedOperationException("Cluster listeners cannot be used with Invalidation Caches!");
} else if (cacheMode.isDistributed() || cacheMode.isScattered()) {
clusterListenerIDs.put(listener, generatedId);
- EmbeddedCacheManager manager = cache.getCacheManager();
- Address ourAddress = manager.getAddress();
+ RpcManager rpcManager = cache.getAdvancedCache().getRpcManager();
+ Address ourAddress = null;
+ List<Address> members = null;
+
+ if (rpcManager != null) {
+ ourAddress = rpcManager.getAddress();
+ members = rpcManager.getMembers();
+ }
- List<Address> members = manager.getMembers();
// If we are the only member don't even worry about sending listeners
if (members != null && members.size() > 1) {
DistributedExecutionCompletionService decs = new DistributedExecutionCompletionService(distExecutorService);
@@ -874,7 +878,7 @@ public final class CacheNotifierImpl<K, V> extends AbstractListenerImpl<Event<K,
int extraCount = 0;
// If anyone else joined since we sent these we have to send the listeners again, since they may have queried
// before the other nodes got the new listener
- List<Address> membersAfter = manager.getMembers();
+ List<Address> membersAfter = rpcManager.getMembers(); //at this point, the rpcManager is never null.
for (Address member : membersAfter) {
if (!members.contains(member) && !member.equals(ourAddress)) {
if (trace) { | ISPN-<I> CacheNotifier should use the cache member and not the view members | infinispan_infinispan | train |
2bb3199da718be4e3150b5555bbf12364c3987be | diff --git a/src/core/vdom/patch.js b/src/core/vdom/patch.js
index <HASH>..<HASH> 100644
--- a/src/core/vdom/patch.js
+++ b/src/core/vdom/patch.js
@@ -550,6 +550,9 @@ export function createPatchFunction (backend) {
if (isDef(oldCh) && isDef(ch)) {
if (oldCh !== ch) updateChildren(elm, oldCh, ch, insertedVnodeQueue, removeOnly)
} else if (isDef(ch)) {
+ if (process.env.NODE_ENV !== 'production') {
+ checkDuplicateKeys(ch)
+ }
if (isDef(oldVnode.text)) nodeOps.setTextContent(elm, '')
addVnodes(elm, null, ch, 0, ch.length - 1, insertedVnodeQueue)
} else if (isDef(oldCh)) {
diff --git a/test/unit/modules/vdom/patch/children.spec.js b/test/unit/modules/vdom/patch/children.spec.js
index <HASH>..<HASH> 100644
--- a/test/unit/modules/vdom/patch/children.spec.js
+++ b/test/unit/modules/vdom/patch/children.spec.js
@@ -530,4 +530,16 @@ describe('vdom patch: children', () => {
patch(vnode2, vnode3)
expect(`Duplicate keys detected: 'b'`).toHaveBeenWarned()
})
+
+ it('should warn with duplicate keys: patchVnode with empty oldVnode', () => {
+ function makeNode (key) {
+ return new VNode('li', { key: key })
+ }
+
+ const vnode1 = new VNode('div')
+ const vnode2 = new VNode('div', undefined, ['1', '2', '3', '4', '4'].map(makeNode))
+
+ patch(vnode1, vnode2)
+ expect(`Duplicate keys detected: '4'`).toHaveBeenWarned()
+ })
}) | polish: warn duplicate keys when patching children into empty node (#<I>)
close #<I> | kaola-fed_megalo | train |
ff4e72d20e901d0ae9e011328c0bae137d309f7e | diff --git a/azure-storage-blob/azure/storage/blob/_upload_chunking.py b/azure-storage-blob/azure/storage/blob/_upload_chunking.py
index <HASH>..<HASH> 100644
--- a/azure-storage-blob/azure/storage/blob/_upload_chunking.py
+++ b/azure-storage-blob/azure/storage/blob/_upload_chunking.py
@@ -290,17 +290,12 @@ class _BlockBlobChunkUploader(_BlobChunkUploader):
class _PageBlobChunkUploader(_BlobChunkUploader):
- EMPTY_PAGE = bytearray(512)
-
def _is_chunk_empty(self, chunk_data):
- # read until non-zero data is encountered
+ # read until non-zero byte is encountered
# if reached the end without returning, then chunk_data is all 0's
- data = BytesIO(chunk_data)
- page = data.read(512)
- while page != b'':
- if page != self.EMPTY_PAGE:
+ for each_byte in chunk_data:
+ if each_byte != 0:
return False
- page = data.read(512)
return True
def _upload_chunk(self, chunk_start, chunk_data): | Minor improvement to page blob upload optimization | Azure_azure-storage-python | train |
4f7cd5b8e4a7a585bef2f991de8c31ae2459daf3 | diff --git a/libtelemetry/src/main/java/com/mapbox/android/telemetry/ChinaCertificatePins.java b/libtelemetry/src/main/java/com/mapbox/android/telemetry/ChinaCertificatePins.java
index <HASH>..<HASH> 100644
--- a/libtelemetry/src/main/java/com/mapbox/android/telemetry/ChinaCertificatePins.java
+++ b/libtelemetry/src/main/java/com/mapbox/android/telemetry/ChinaCertificatePins.java
@@ -12,9 +12,20 @@ class ChinaCertificatePins {
{
put("events.mapbox.cn", new ArrayList<String>() {
{
+ //old certificates
add("sha256/gakY+fylqW6kp6piqnaQNLZFzT8HlhzP5lsGJk5WguE=");
add("sha256/5kJvNEMw0KjrCAu7eXY5HZdvyCS13BbA0VJG1RSP91w=");
add("sha256/r/mIkG3eEpVdm+u/ko/cwxzOMo1bk4TyHIlByibiA5E=");
+
+ //new digicert certificates
+ add("sha256/3coVlMAEAYhOEJHgXwloiPDGaF+ZfxHZbVoK8AYYWVg=");
+ add("sha256/5kJvNEMw0KjrCAu7eXY5HZdvyCS13BbA0VJG1RSP91w=");
+ add("sha256/r/mIkG3eEpVdm+u/ko/cwxzOMo1bk4TyHIlByibiA5E=");
+
+ //new GeoTrust Certs
+ add("sha256/+O+QJCmvoB/FkTd0/5FvmMSvFbMqjYU+Txrw1lyGkUQ=");
+ add("sha256/zUIraRNo+4JoAYA7ROeWjARtIoN4rIEbCpfCRQT6N6A=");
+ add("sha256/r/mIkG3eEpVdm+u/ko/cwxzOMo1bk4TyHIlByibiA5E=");
}
});
} | Add new China Certificate Hashes (#<I>)
* New Digicert Hashes
- generated new digicerts hashes
* Geotrust certs
- added new geotrust hashes | mapbox_mapbox-events-android | train |
50cdbe7f917a06004120b0568ed1ab06737684dd | diff --git a/vendor/assets/javascripts/perspectives.js b/vendor/assets/javascripts/perspectives.js
index <HASH>..<HASH> 100644
--- a/vendor/assets/javascripts/perspectives.js
+++ b/vendor/assets/javascripts/perspectives.js
@@ -42,21 +42,21 @@
}).attr('content')
}
- var renderPerspectivesResponse = function(href, container, json, status, xhr) {
- var $container = $(container)
+ var renderPerspectivesResponse = function(options) {
+ var $container = $(options.container)
console.time('perspectives rendering')
var version = perspectivesVersion() || ''
if (version.length && version !== xhr.getResponseHeader('X-Perspectives-Version')) {
- locationReplace(href)
+ locationReplace(options.href)
return false
}
- var $rendered = $(renderTemplateData(json))
+ var $rendered = $(renderTemplateData(options.json))
$container.html($rendered)
- $(document).trigger('perspectives:load', xhr)
+ $(document).trigger('perspectives:load', options.xhr)
console.timeEnd('perspectives rendering')
}
@@ -68,20 +68,34 @@
var replaceContainer = $this.attr('data-perspectives-replace') ? $this.attr('data-perspectives-replace') : container
$.getJSON(fetchHref, function(json, status, xhr) {
- var args = Array.prototype.slice.call(arguments)
- args.unshift(href, replaceContainer)
+ $this.trigger('perspectives:response', [renderPerspectivesResponse, {
+ json: json,
+ status: status,
+ xhr: xhr,
+ href: href,
+ container: replaceContainer
+ }])
- renderPerspectivesResponse.apply(this, args)
window.history.pushState({container: container}, href, href)
})
return false
}
+ $(document).on('perspectives:response', function(e, defaultRender, options) { defaultRender(options) })
+
$(window).on('popstate.perspectives', function(event) {
var originalEvent = event.originalEvent
if(originalEvent && originalEvent.state && originalEvent.state.container) {
- $.getJSON(window.location.href, renderPerspectivesResponse.bind(null, window.location.href, originalEvent.state.container))
+ $.getJSON(window.location.href, function(json, status, xhr) {
+ renderPerspectivesResponse({
+ json: json,
+ status: status,
+ xhr: xhr,
+ href: window.location.href,
+ container: originalEvent.state.container
+ })
+ })
}
}) | Prefer event delegation
- Allow users to listen to response events on a link they want to
listen to, and do whatever they want with the response data | Genius_perspectives | train |
8c651d59a7cf9a335cb5afb44ee7b564be934b4d | diff --git a/docs/source/conf.py b/docs/source/conf.py
index <HASH>..<HASH> 100644
--- a/docs/source/conf.py
+++ b/docs/source/conf.py
@@ -31,6 +31,9 @@
# Add any Sphinx extension module names here, as strings. They can be
# extensions coming with Sphinx (named 'sphinx.ext.*') or your custom
# ones.
+# namingpath = r'B:\write\code\git\naming'
+# import sys
+# sys.path.append(namingpath)
extensions = ['sphinx.ext.autodoc',
'sphinx.ext.doctest',
'sphinx.ext.intersphinx',
diff --git a/naming/base.py b/naming/base.py
index <HASH>..<HASH> 100644
--- a/naming/base.py
+++ b/naming/base.py
@@ -18,6 +18,8 @@ def _field_property(field_name: str) -> property:
return self._values.get(field_name)
def setter(self, value):
+ if value and str(value) == self._values.get(field_name):
+ return
new_name = self.get_name(**{field_name: value})
self.set_name(new_name)
return property(getter, setter)
@@ -124,6 +126,7 @@ class _BaseName(metaclass=_ABCName):
:param name: The name to be set on this object.
:raises NameError: If an invalid string is provided.
+ :returns: Reference to self.
"""
match = self.__regex.match(name)
if not match:
@@ -132,6 +135,7 @@ class _BaseName(metaclass=_ABCName):
raise NameError(msg)
self.__set_name(name)
self.__values.update(match.groupdict())
+ return self
@property
def _values(self) -> typing.Dict[str, str]:
diff --git a/naming/tests/__init__.py b/naming/tests/__init__.py
index <HASH>..<HASH> 100644
--- a/naming/tests/__init__.py
+++ b/naming/tests/__init__.py
@@ -29,6 +29,8 @@ class TestName(unittest.TestCase):
n = Name()
n.set_name('setname')
self.assertEqual('setname', n.get_name())
+ self.assertEqual(n, n.set_name('setname'))
+ self.assertTrue(isinstance(n.set_name('setname'), n.__class__))
class TestEasyName(unittest.TestCase):
@@ -52,6 +54,8 @@ class TestEasyName(unittest.TestCase):
pf = ProjectFile('this_is_my_base_name_2017_christianl_constant_iamlast.base.17.abc')
self.assertEqual('this_is_my_base_name_2017_christianl_constant_iamlast', pf.nice_name)
self.assertEqual('this_is_my_base_name_2017_christianl_constant_iamlast.base.17', pf.pipe_name)
+ # setting same fields should be returning early
+ pf.year = 2017
self.assertEqual('2017', pf.year)
self.assertEqual('iamlast', pf.lastfield)
self.assertEqual('abc', pf.extension)
diff --git a/setup.py b/setup.py
index <HASH>..<HASH> 100644
--- a/setup.py
+++ b/setup.py
@@ -12,5 +12,5 @@ setup(
url='https://github.com/chrizzFTD/naming',
download_url='https://github.com/chrizzFTD/naming/releases/tag/0.1.3',
classifiers=['Programming Language :: Python :: 3.6'],
- extras_require={'docs': ['sphinx_autodoc_typehints']}
+ extras_require={'docs': ['sphinx_autodoc_typehints', 'sphinx_rtd_theme']}
) | dev - Set Name Optimized (#8)
Added setting values optimisation, returning self reference on set_name method. | chrizzFTD_naming | train |
e7451c455da449d023360d6dd9977f2697ffc3c9 | diff --git a/src/Column/ResolvedColumnType.php b/src/Column/ResolvedColumnType.php
index <HASH>..<HASH> 100644
--- a/src/Column/ResolvedColumnType.php
+++ b/src/Column/ResolvedColumnType.php
@@ -229,7 +229,7 @@ class ResolvedColumnType implements ResolvedColumnTypeInterface
$values = [];
- foreach ($column->getOption('field_mapping') as $field) {
+ foreach ($column->getOption('field_mapping') as $mappingName => $field) {
// Ignore null and boolean as these fields-names are always illegal
// CompoundColumnType sometimes has one key with a boolean value
@@ -237,7 +237,7 @@ class ResolvedColumnType implements ResolvedColumnTypeInterface
continue;
}
- $values[$field] = $dataMapper->getData($field, $object);
+ $values[is_int($mappingName) ? $field : $mappingName] = $dataMapper->getData($field, $object);
}
if ($useTransformers) {
diff --git a/tests/Extension/Core/ColumnType/BaseTypeTest.php b/tests/Extension/Core/ColumnType/BaseTypeTest.php
index <HASH>..<HASH> 100644
--- a/tests/Extension/Core/ColumnType/BaseTypeTest.php
+++ b/tests/Extension/Core/ColumnType/BaseTypeTest.php
@@ -17,7 +17,7 @@ abstract class BaseTypeTest extends ColumnTypeTestCase
{
public function testPassLabelToView()
{
- $column = $this->factory->createColumn('id', $this->getTestedType(), $this->datagrid, ['label' => 'My label', 'field_mapping' => ['key']]);
+ $column = $this->factory->createColumn('id', $this->getTestedType(), $this->datagrid, ['label' => 'My label', 'field_mapping' => ['id' => 'key']]);
$object = new \stdClass();
$object->key = ' foo ';
diff --git a/tests/Extension/Core/ColumnType/TextTypeTest.php b/tests/Extension/Core/ColumnType/TextTypeTest.php
index <HASH>..<HASH> 100644
--- a/tests/Extension/Core/ColumnType/TextTypeTest.php
+++ b/tests/Extension/Core/ColumnType/TextTypeTest.php
@@ -41,7 +41,7 @@ class TextTypeTest extends BaseTypeTest
$data = [1 => $object];
$options = [
- 'field_mapping' => ['key', 'key2'],
+ 'field_mapping' => ['foo' => 'key', 'key2'],
'value_format' => ' - %s - ',
'value_glue' => ',',
]; | provide field_mapping values as assoc array | rollerworks-graveyard_datagrid | train |
a7fce6d9176cf3662d153af54270f345eb0bec8d | diff --git a/examples/run_squad.py b/examples/run_squad.py
index <HASH>..<HASH> 100644
--- a/examples/run_squad.py
+++ b/examples/run_squad.py
@@ -241,7 +241,10 @@ def evaluate(args, model, tokenizer, prefix=""):
# Compute predictions
output_prediction_file = os.path.join(args.output_dir, "predictions_{}.json".format(prefix))
output_nbest_file = os.path.join(args.output_dir, "nbest_predictions_{}.json".format(prefix))
- output_null_log_odds_file = os.path.join(args.output_dir, "null_odds_{}.json".format(prefix))
+ if args.version_2_with_negative:
+ output_null_log_odds_file = os.path.join(args.output_dir, "null_odds_{}.json".format(prefix))
+ else:
+ output_null_log_odds_file = None
if args.model_type in ['xlnet', 'xlm']:
# XLNet uses a more complex post-processing procedure | fix squad v1 error (na_prob_file should be None) | huggingface_pytorch-pretrained-BERT | train |
4cb2e1e07be7ca308d624f459f96774e00493519 | diff --git a/routing/dht/dht_test.go b/routing/dht/dht_test.go
index <HASH>..<HASH> 100644
--- a/routing/dht/dht_test.go
+++ b/routing/dht/dht_test.go
@@ -208,7 +208,7 @@ func TestProvides(t *testing.T) {
func TestLayeredGet(t *testing.T) {
u.Debug = false
- addrs,_,dhts := setupDHTS(4, t)
+ addrs, _, dhts := setupDHTS(4, t)
_, err := dhts[0].Connect(addrs[1])
if err != nil {
@@ -254,7 +254,7 @@ func TestLayeredGet(t *testing.T) {
func TestFindPeer(t *testing.T) {
u.Debug = false
- addrs,peers,dhts := setupDHTS(4, t)
+ addrs, peers, dhts := setupDHTS(4, t)
_, err := dhts[0].Connect(addrs[1])
if err != nil {
diff --git a/routing/dht/ext_test.go b/routing/dht/ext_test.go
index <HASH>..<HASH> 100644
--- a/routing/dht/ext_test.go
+++ b/routing/dht/ext_test.go
@@ -3,12 +3,13 @@ package dht
import (
"testing"
+ "code.google.com/p/goprotobuf/proto"
+
peer "github.com/jbenet/go-ipfs/peer"
- u "github.com/jbenet/go-ipfs/util"
swarm "github.com/jbenet/go-ipfs/swarm"
- //ma "github.com/jbenet/go-multiaddr"
+ u "github.com/jbenet/go-ipfs/util"
+ ma "github.com/jbenet/go-multiaddr"
- "fmt"
"time"
)
@@ -36,7 +37,7 @@ func (f *fauxNet) Listen() error {
for {
select {
case in := <-f.Chan.Outgoing:
- for _,h := range f.handlers {
+ for _, h := range f.handlers {
reply := h(in)
if reply != nil {
f.Chan.Incoming <- reply
@@ -54,24 +55,69 @@ func (f *fauxNet) AddHandler(fn func(*swarm.Message) *swarm.Message) {
}
func (f *fauxNet) Send(mes *swarm.Message) {
+ f.Chan.Outgoing <- mes
+}
+func (f *fauxNet) GetChan() *swarm.Chan {
+ return f.Chan
}
-func TestGetFailure(t *testing.T) {
+func (f *fauxNet) Connect(addr *ma.Multiaddr) (*peer.Peer, error) {
+ return nil, nil
+}
+
+func TestGetFailures(t *testing.T) {
fn := newFauxNet()
fn.Listen()
local := new(peer.Peer)
- local.ID = peer.ID([]byte("test_peer"))
+ local.ID = peer.ID("test_peer")
d := NewDHT(local, fn)
+ other := &peer.Peer{ID: peer.ID("other_peer")}
+
d.Start()
- b, err := d.GetValue(u.Key("test"), time.Second)
+ d.Update(other)
+
+ // This one should time out
+ _, err := d.GetValue(u.Key("test"), time.Millisecond*5)
if err != nil {
- t.Fatal(err)
+ nerr, ok := err.(*u.IpfsError)
+ if !ok {
+ t.Fatal("Got different error than we expected.")
+ }
+ if nerr.Inner != u.ErrTimeout {
+ t.Fatal("Got different error than we expected.")
+ }
+ } else {
+ t.Fatal("Did not get expected error!")
}
- fmt.Println(b)
+ fn.AddHandler(func(mes *swarm.Message) *swarm.Message {
+ pmes := new(PBDHTMessage)
+ err := proto.Unmarshal(mes.Data, pmes)
+ if err != nil {
+ t.Fatal(err)
+ }
+
+ resp := DHTMessage{
+ Type: pmes.GetType(),
+ Id: pmes.GetId(),
+ Response: true,
+ Success: false,
+ }
+ return swarm.NewMessage(mes.Peer, resp.ToProtobuf())
+ })
+
+ // This one should fail with NotFound
+ _, err = d.GetValue(u.Key("test"), time.Millisecond*5)
+ if err != nil {
+ if err != u.ErrNotFound {
+ t.Fatal("Expected ErrNotFound, got: %s", err)
+ }
+ } else {
+ t.Fatal("expected error, got none.")
+ }
} | add fauxNet to stand in for Swarm in tests to reproduce various network conditions | ipfs_go-ipfs | train |
8a545a3534f1ac6ab335a9726058bc75811cd232 | diff --git a/config/routes.rb b/config/routes.rb
index <HASH>..<HASH> 100644
--- a/config/routes.rb
+++ b/config/routes.rb
@@ -1,7 +1,3 @@
Rails.application.routes.draw do
- namespace :outpost do
- resources :sessions, only: [:create, :destroy]
- get 'login' => "sessions#new", as: :login
- get 'logout' => "sessions#destroy", as: :logout
- end
+
end
diff --git a/spec/internal/config/routes.rb b/spec/internal/config/routes.rb
index <HASH>..<HASH> 100644
--- a/spec/internal/config/routes.rb
+++ b/spec/internal/config/routes.rb
@@ -3,5 +3,8 @@ Rails.application.routes.draw do
namespace :outpost do
root to: 'home#index'
+ resources :sessions, only: [:create, :destroy]
+ get 'login' => "sessions#new", as: :login
+ get 'logout' => "sessions#destroy", as: :logout
end
end | Move routes out of outpost for now | SCPR_outpost | train |
cb7198523333a7abf80babed78dfcbc929babf49 | diff --git a/examples/simple.js b/examples/simple.js
index <HASH>..<HASH> 100644
--- a/examples/simple.js
+++ b/examples/simple.js
@@ -3,8 +3,8 @@ var rna = require("drawrnajs");
var app = rna.vis;
//initalize input boxes with example structure
-document.getElementById('SEQ_BOX').value = "CAGCACGACACUAGCAGUCAGUGUCAGACUGCARACAGCACGACACUAGCAGUCAGUGUCAGACUGCARACAGCACGACACUAGCAGUCAGUGUCAGACUGCARA";
-document.getElementById('DOTBR_BOX').value = "..(((((...(((((...(((((...(((((.....)))))...))))).....(((((...(((((.....)))))...))))).....)))))...)))))..";
+document.getElementById('SEQ_BOX').value = "CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG";
+document.getElementById('DOTBR_BOX').value = "(((((((((...((((((.........))))))........((((((.......))))))..)))))))))";
//init colors
$("#acolor").spectrum({ color: "#64F73F" });
$("#ccolor").spectrum({ color: "#FFB340" });
@@ -25,11 +25,11 @@ app({graph: struct, el: cy, doc: document, win: window});
var runButton = document.getElementById('PERFORM_VIS');
runButton.readOnly = true;
-runButton.addEventListener('click', function(){
+runButton.addEventListener('click', function(){
document.getElementById('ALERT').value = "";
var input = rna.io.getInputSequences();
if(rna.io.checkConditions(input)){
struct = rna.t.transformDotBracket(input[0], input[1]);
app({graph: struct, el: cy, doc: document, win: window});
}
-}, false);
\ No newline at end of file
+}, false); | fixed bug in .getCoordinates | bene200_drawrnajs | train |
a99f845c45d6702da4d3c0af61df2e52080c9257 | diff --git a/internal/pkg/platform/platform_matcher_test.go b/internal/pkg/platform/platform_matcher_test.go
index <HASH>..<HASH> 100644
--- a/internal/pkg/platform/platform_matcher_test.go
+++ b/internal/pkg/platform/platform_matcher_test.go
@@ -1,6 +1,7 @@
package platform
import (
+ "fmt"
"testing"
"github.com/containers/image/v5/types"
@@ -8,29 +9,28 @@ import (
"github.com/stretchr/testify/assert"
)
-func TestWantedPlatformsCompatibility(t *testing.T) {
- ctx := &types.SystemContext{
- ArchitectureChoice: "arm",
- OSChoice: "linux",
- VariantChoice: "v6",
+func TestWantedPlatforms(t *testing.T) {
+ for _, c := range []struct {
+ ctx types.SystemContext
+ expected []imgspecv1.Platform
+ }{
+ { // ARM
+ types.SystemContext{ArchitectureChoice: "arm", OSChoice: "linux", VariantChoice: "v6"},
+ []imgspecv1.Platform{
+ {OS: "linux", Architecture: "arm", Variant: "v6"},
+ {OS: "linux", Architecture: "arm", Variant: "v5"},
+ },
+ },
+ { // Custom (completely unrecognized data)
+ types.SystemContext{ArchitectureChoice: "armel", OSChoice: "freeBSD", VariantChoice: "custom"},
+ []imgspecv1.Platform{
+ {OS: "freeBSD", Architecture: "armel", Variant: "custom"},
+ },
+ },
+ } {
+ testName := fmt.Sprintf("%q/%q/%q", c.ctx.ArchitectureChoice, c.ctx.OSChoice, c.ctx.VariantChoice)
+ platforms, err := WantedPlatforms(&c.ctx)
+ assert.Nil(t, err, testName)
+ assert.Equal(t, c.expected, platforms, testName)
}
- platforms, err := WantedPlatforms(ctx)
- assert.Nil(t, err)
- assert.Equal(t, []imgspecv1.Platform{
- {OS: ctx.OSChoice, Architecture: ctx.ArchitectureChoice, Variant: "v6"},
- {OS: ctx.OSChoice, Architecture: ctx.ArchitectureChoice, Variant: "v5"},
- }, platforms)
-}
-
-func TestWantedPlatformsCustom(t *testing.T) {
- ctx := &types.SystemContext{
- ArchitectureChoice: "armel",
- OSChoice: "freeBSD",
- VariantChoice: "custom",
- }
- platforms, err := WantedPlatforms(ctx)
- assert.Nil(t, err)
- assert.Equal(t, []imgspecv1.Platform{
- {OS: ctx.OSChoice, Architecture: ctx.ArchitectureChoice, Variant: ctx.VariantChoice},
- }, platforms)
} | Combine the two TestWantedPlatforms* tests
... and make them table-driven.
Does not change the test contents. | containers_image | train |
fba679410bd85b64313a3e93aec68992342876b1 | diff --git a/test_reporter.py b/test_reporter.py
index <HASH>..<HASH> 100644
--- a/test_reporter.py
+++ b/test_reporter.py
@@ -1,8 +1,14 @@
+import sys
from mock import patch
import moban.reporter as reporter
-from StringIO import StringIO
from nose.tools import eq_
+PY2 = sys.info[0] == 2
+if PY2:
+ from StringIO import StringIO
+else:
+ from io import StringIO
+
def test_partial_run():
patcher = patch('sys.stdout', new_callable=StringIO) | :bug: fix python 3 problem with stringio | moremoban_moban-handlebars | train |
1b4113843f328171e4884ca9dfbffebe04078246 | diff --git a/meshcut.py b/meshcut.py
index <HASH>..<HASH> 100644
--- a/meshcut.py
+++ b/meshcut.py
@@ -322,7 +322,6 @@ def merge_close_vertices(verts, faces, close_epsilon=1e-5):
# Compute a mapping from old to new : for each input vert, store the index
# of the new vert it will be merged into
- close_epsilon = 1e-5
old2new = np.zeros(D.shape[0], dtype=np.int)
# A mask indicating if a vertex has already been merged into another
merged_verts = np.zeros(D.shape[0], dtype=np.bool) | Removed redefined close_epsilon | julienr_meshcut | train |
1ef60fae643fddd4712c1db21aac135bcee0a75f | diff --git a/extensions/featured-header.php b/extensions/featured-header.php
index <HASH>..<HASH> 100644
--- a/extensions/featured-header.php
+++ b/extensions/featured-header.php
@@ -16,7 +16,7 @@
* even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.
*
* @package FeaturedHeader
- * @version 0.1.0 - Alpha
+ * @version 0.1.0
* @author Justin Tadlock <[email protected]>
* @copyright Copyright (c) 2012, Justin Tadlock
* @link http://justintadlock.com | Featured Header <I>. | justintadlock_hybrid-core | train |
2026dbc635c461daf62da09a3c588f61f3db2f5f | diff --git a/src/serve.js b/src/serve.js
index <HASH>..<HASH> 100644
--- a/src/serve.js
+++ b/src/serve.js
@@ -13,7 +13,7 @@ program
function serve(inputPath, options) {
const Server = require('./services/Server');
- let server = new Server({watch: options.watch});
+ let server = new Server({watch: options.watch, cwd: process.cwd()});
if (options.logging) {
server.on('request', (req, err) => {
if (err) {
diff --git a/src/services/Server.js b/src/services/Server.js
index <HASH>..<HASH> 100644
--- a/src/services/Server.js
+++ b/src/services/Server.js
@@ -1,5 +1,5 @@
const os = require('os');
-const {basename, join} = require('path');
+const {relative, join} = require('path');
const EventEmitter = require('events');
const {readJsonSync, existsSync, lstat} = require('fs-extra');
const ecstatic = require('ecstatic');
@@ -12,9 +12,10 @@ const MAX_PORT = 65535;
module.exports = class Server extends EventEmitter {
- constructor({watch = false} = {}) {
+ constructor({cwd, watch = false}) {
super();
this._watch = watch;
+ this._cwd = cwd;
}
static get externalAddresses() {
@@ -64,11 +65,11 @@ module.exports = class Server extends EventEmitter {
_serveFile(appPath) {
let servePackageJson = (req, res, next) => {
if (req.url === '/package.json') {
- return res.json({main: basename(appPath)});
+ return res.json({main: relative(this._cwd, appPath)});
}
next();
};
- return this._startServer(join(appPath, '..'), [servePackageJson]);
+ return this._startServer(this._cwd, [servePackageJson]);
}
_startServer(appPath, middlewares = []) {
diff --git a/test/Server.test.js b/test/Server.test.js
index <HASH>..<HASH> 100644
--- a/test/Server.test.js
+++ b/test/Server.test.js
@@ -1,4 +1,4 @@
-const {join, basename} = require('path');
+const {join, relative, basename} = require('path');
const {writeFileSync} = require('fs-extra');
const temp = require('temp').track();
const portscanner = require('portscanner');
@@ -13,8 +13,8 @@ describe('Server', function() {
let server, path;
beforeEach(function() {
- server = new Server();
path = temp.mkdirSync('foo');
+ server = new Server({cwd: path});
stub(proc, 'execSync');
stub(proc, 'exec');
});
@@ -82,7 +82,7 @@ describe('Server', function() {
});
it('runs watch script when watch option given', function() {
- server = new Server({watch: true});
+ server = new Server({cwd: path, watch: true});
writeFileSync(join(path, 'package.json'), '{"main": "foo.js"}');
return server.serve(path)
.then(() => {
@@ -102,7 +102,7 @@ describe('Server', function() {
it('uses next unused port', function() {
writeFileSync(join(path, 'package.json'), '{"main": "foo.js"}');
- let server2 = new Server();
+ let server2 = new Server({cwd: path});
return server.serve(path).then(() => {
return server2.serve(path).then(() => {
expect(server.port).to.be.ok;
@@ -126,6 +126,7 @@ describe('Server', function() {
it('delivers a synthetic package.json for a file', function() {
let file = join(path, 'foo.js');
writeFileSync(file, 'content');
+ server = new Server({cwd: path});
return server.serve(file)
.then(() => fetch(`http://127.0.0.1:${server.port}/package.json`))
.then(response => response.json())
@@ -134,6 +135,18 @@ describe('Server', function() {
});
});
+ it('delivers a synthetic package.json for a file relative to given directory', function() {
+ let file = join(path, 'foo.js');
+ writeFileSync(file, 'content');
+ server = new Server({cwd: join(path, '..')});
+ return server.serve(file)
+ .then(() => fetch(`http://127.0.0.1:${server.port}/package.json`))
+ .then(response => response.json())
+ .then(json => {
+ expect(json.main).to.equal(relative(join(path, '..'), file));
+ });
+ });
+
});
}); | Fix serving snippets from subdirectories of the cwd
Previously, only serving snippets from the current working directory of the
serve command was supported.
Support serving a snippet, which is in a directory descendant of the
current working directory. In this case, files in the current working
directory will be served along.
Change-Id: I4b7a<I>e7c<I>c3f<I>f1b<I>d<I>f<I>a<I>caa | eclipsesource_tabris-js-cli | train |
1e47457f7d80eb586be83ee3d46547656d179d99 | diff --git a/metpy/plots/tests/test_skewt.py b/metpy/plots/tests/test_skewt.py
index <HASH>..<HASH> 100644
--- a/metpy/plots/tests/test_skewt.py
+++ b/metpy/plots/tests/test_skewt.py
@@ -3,6 +3,7 @@
# SPDX-License-Identifier: BSD-3-Clause
"""Tests for the `skewt` module."""
+import matplotlib
from matplotlib.gridspec import GridSpec
import matplotlib.pyplot as plt
import numpy as np
@@ -13,6 +14,8 @@ from metpy.plots import Hodograph, SkewT
from metpy.testing import patch_round, set_agg_backend # noqa: F401
from metpy.units import units
+MPL_VERSION = matplotlib.__version__[:3]
+
@pytest.mark.mpl_image_compare(tolerance=0.021, remove_text=True)
def test_skewt_api():
@@ -66,7 +69,7 @@ def test_profile():
return np.linspace(1000, 100, 10), np.linspace(20, -20, 10), np.linspace(25, -30, 10)
[email protected]_image_compare(tolerance=0, remove_text=True)
[email protected]_image_compare(tolerance={'1.4': 1.71}.get(MPL_VERSION, 0.), remove_text=True)
def test_skewt_shade_cape_cin(test_profile):
"""Test shading CAPE and CIN on a SkewT plot."""
p, t, tp = test_profile
@@ -79,7 +82,7 @@ def test_skewt_shade_cape_cin(test_profile):
return fig
[email protected]_image_compare(tolerance=0, remove_text=True)
[email protected]_image_compare(tolerance={'1.4': 1.70}.get(MPL_VERSION, 0.), remove_text=True)
def test_skewt_shade_area(test_profile):
"""Test shading areas on a SkewT plot."""
p, t, tp = test_profile
@@ -102,7 +105,7 @@ def test_skewt_shade_area_invalid(test_profile):
skew.shade_area(p, t, tp, which='positve')
[email protected]_image_compare(tolerance=0, remove_text=True)
[email protected]_image_compare(tolerance={'1.4': 1.75}.get(MPL_VERSION, 0.), remove_text=True)
def test_skewt_shade_area_kwargs(test_profile):
"""Test shading areas on a SkewT plot with kwargs."""
p, t, tp = test_profile | MNT: Increase threshold for new tests on matplotlib <I>
These pass fine on <I> without it, so I'm just going to blame <I>
cruftiness. | Unidata_MetPy | train |
476fb565cecb483f7506f4dceb438d506464194d | diff --git a/consensus/clique/clique.go b/consensus/clique/clique.go
index <HASH>..<HASH> 100644
--- a/consensus/clique/clique.go
+++ b/consensus/clique/clique.go
@@ -600,8 +600,7 @@ func (c *Clique) Seal(chain consensus.ChainHeaderReader, block *types.Block, res
}
// For 0-period chains, refuse to seal empty blocks (no reward but would spin sealing)
if c.config.Period == 0 && len(block.Transactions()) == 0 {
- log.Info("Sealing paused, waiting for transactions")
- return nil
+ return errors.New("sealing paused while waiting for transactions")
}
// Don't hold the signer fields for the entire sealing procedure
c.lock.RLock()
@@ -621,8 +620,7 @@ func (c *Clique) Seal(chain consensus.ChainHeaderReader, block *types.Block, res
if recent == signer {
// Signer is among recents, only wait if the current block doesn't shift it out
if limit := uint64(len(snap.Signers)/2 + 1); number < limit || seen > number-limit {
- log.Info("Signed recently, must wait for others")
- return nil
+ return errors.New("signed recently, must wait for others")
}
}
}
diff --git a/miner/worker.go b/miner/worker.go
index <HASH>..<HASH> 100644
--- a/miner/worker.go
+++ b/miner/worker.go
@@ -593,6 +593,9 @@ func (w *worker) taskLoop() {
if err := w.engine.Seal(w.chain, task.block, w.resultCh, stopCh); err != nil {
log.Warn("Block sealing failed", "err", err)
+ w.pendingMu.Lock()
+ delete(w.pendingTasks, sealHash)
+ w.pendingMu.Unlock()
}
case <-w.exitCh:
interrupt() | miner, consensus/clique: avoid memory leak during block stasis (#<I>)
This PR fixes a problem which arises on clique networks when there is a network stall. Previously, the worker packages were tracked, even if the sealing engine decided not to seal the block (due to clique rules about recent signing). These tracked-but-not-sealed blocks kept building up in memory.
This PR changes the situation so the sealing engine instead returns an error, and the worker can thus un-track the package. | ethereum_go-ethereum | train |
aed3ff36311d997690666134a3dcf6188ef72289 | diff --git a/build.py b/build.py
index <HASH>..<HASH> 100644
--- a/build.py
+++ b/build.py
@@ -11,6 +11,8 @@ import sys
import os
import re
import hashlib
+import urllib2
+import shutil
try:
import __builtin__ as builtin
@@ -636,16 +638,46 @@ def preprocess(xidl, target):
# Where it all begins...
#
###########################################################
-XIDL = """\
-http://www.virtualbox.org/svn/vbox/trunk/src/VBox/Main/idl/VirtualBox.xidl"""
-def main(virtualbox_xidl):
+def download_master():
+ "Download the master xidl"
+ xidl = "http://www.virtualbox.org/svn/vbox/trunk/src/VBox/Main/idl/VirtualBox.xidl"
+ if 0 != os.system('wget %s' % xidl):
+ assert 0 == os.system('curl %s > VirtualBox.xidl' % xidl)
+
+def download_stable():
+ "Download latest tarball for stable release then unpack xidl"
+ url = urllib2.urlopen('https://www.virtualbox.org/wiki/Downloads')
+ page = url.read()
+ match = re.search("http://download.virtualbox.org/virtualbox/"
+ "([0-9\.]+)/VirtualBox-([0-9\.]+).tar.bz2"
+ , page)
+ if not match:
+ raise Exception("Failed to find source tarball url")
+ sourceurl = page[match.start():match.end()]
+ bzname = sourceurl.split('/')[-1]
+ tarname = os.path.splitext(bzname)[0]
+ if not os.path.exists(tarname):
+ print("Download stable code %s > %s" % (sourceurl, bzname) )
+ if 0 != os.system('wget %s' % sourceurl):
+ assert 0 == os.system('curl -L %s > %s' % (sourceurl, bzname) )
+ assert os.path.exists(bzname), "failed to download %s" % sourceurl
+ assert 0 == os.system('bunzip2 %s' % bzname), "failed to bunzip2 %s" % bzname
+ assert os.path.exists(tarname), "failed bunzip %s" % tarname
+ assert 0 == os.system('tar xf %s' % tarname), "failed to tar xf %s" % tarname
+ source_dir = os.path.splitext(tarname)[0]
+ path = './%s/src/VBox/Main/idl/VirtualBox.xidl' % source_dir
+ assert os.path.exists(path), "VirtualBox.xidl was not at %s" % path
+ shutil.copy(path, 'VirtualBox.xidl')
+
+def main(virtualbox_xidl, use_master=False):
if not os.path.exists(virtualbox_xidl):
- if 0 != os.system('wget %s' % XIDL):
- assert 0 == os.system('curl %s > VirtualBox.xidl' % XIDL)
+ if use_master:
+ download_master()
+ else:
+ download_stable()
virtualbox_xidl = 'VirtualBox.xidl'
- assert os.path.exists(virtualbox_xidl), "failed to download %s" % XIDL
-
+ assert os.path.exists(virtualbox_xidl)
print("Create new virtualbox/library.py")
xidl = open(virtualbox_xidl, 'rb').read() | Now using the stable release VirtualBox.xidl in the library.py build process | sethmlarson_virtualbox-python | train |
7a9f53a0b2fb9a006322d376c7dca841b598ed56 | diff --git a/packages/widget-message-meet/Gruntfile.js b/packages/widget-message-meet/Gruntfile.js
index <HASH>..<HASH> 100644
--- a/packages/widget-message-meet/Gruntfile.js
+++ b/packages/widget-message-meet/Gruntfile.js
@@ -10,16 +10,15 @@
var path = require('path');
module.exports = function configGrunt(grunt) {
- grunt.config('webpack',
+ grunt.config('shell',
{
- options: require('./webpack/webpack.prod'),
+ options: {
+ execOptions: {
+ cwd: __dirname
+ }
+ },
build: {
- hot: false,
- inline: false,
- keepalive: false,
- progress: false,
- watch: false,
- debug: false
+ command: 'npm run build'
}
});
grunt.config('webpack-dev-server',
@@ -38,11 +37,11 @@ module.exports = function configGrunt(grunt) {
grunt.registerTask('build', [
'clean:dist',
- 'webpack:build'
+ 'shell:build'
]);
grunt.registerTask('test', ['jest']);
grunt.registerTask('test-clean', ['clean:snapshots', 'jest']);
- grunt.registerTask('start', ['webpack-dev-server:start']);
- grunt.registerTask('default', ['start']);
+ grunt.registerTask('serve', ['webpack-dev-server:start']);
+ grunt.registerTask('default', ['server']);
};
diff --git a/packages/widget-message-meet/package.json b/packages/widget-message-meet/package.json
index <HASH>..<HASH> 100644
--- a/packages/widget-message-meet/package.json
+++ b/packages/widget-message-meet/package.json
@@ -11,6 +11,7 @@
"start": "webpack-dev-server --history-api-fallback --hot --inline --port 8000 --colors",
"test": "jest",
"build": "NODE_ENV=production webpack --config webpack/webpack.prod.js",
+ "build:dev": "NODE_ENV=development webpack --config webpack/webpack.dev.js",
"storybook": "start-storybook -p 6006",
"build-storybook": "build-storybook"
},
diff --git a/packages/widget-message-meet/webpack/webpack.dev.js b/packages/widget-message-meet/webpack/webpack.dev.js
index <HASH>..<HASH> 100644
--- a/packages/widget-message-meet/webpack/webpack.dev.js
+++ b/packages/widget-message-meet/webpack/webpack.dev.js
@@ -16,7 +16,7 @@ module.exports = require(`./webpack.base`)({
chunkFilename: `[name].chunk.js`
},
plugins,
- devtools: `eval`,
+ devtools: `cheap-module-eval-source-map`,
postcss: [postcssReporter],
debug: true
}); | refactor(widget-message-meet): Switch to grunt-shell to bypass grunt-webpack bug | webex_spark-js-sdk | train |
1e91f997cbc571d45b7c3e88a55936fa56eb3036 | diff --git a/findschemes.py b/findschemes.py
index <HASH>..<HASH> 100755
--- a/findschemes.py
+++ b/findschemes.py
@@ -146,9 +146,8 @@ def e_unnorm_post(t_table, words, stanzas, schemes, rprobs):
scheme_indices = schemes.get_schemes_for_len(len(stanza))
for scheme_index in scheme_indices:
scheme = schemes.scheme_list[scheme_index]
- # TODO Multiply with rprobs column-wise
- posterior_prob = rprobs[scheme_index] * post_prob_scheme(t_table, words, stanza, scheme)
- probs[i, scheme_index] = posterior_prob
+ probs[i, scheme_index] = post_prob_scheme(t_table, words, stanza, scheme)
+ probs = numpy.dot(probs, numpy.diag(rprobs))
return probs | Multiply probs with rprobs column-wise | jvamvas_rhymediscovery | train |
fcbcab7be1f9241f9e56edbdff4ee92261f4f204 | diff --git a/src/com/google/javascript/jscomp/Es6RewriteModules.java b/src/com/google/javascript/jscomp/Es6RewriteModules.java
index <HASH>..<HASH> 100644
--- a/src/com/google/javascript/jscomp/Es6RewriteModules.java
+++ b/src/com/google/javascript/jscomp/Es6RewriteModules.java
@@ -146,11 +146,12 @@ public final class Es6RewriteModules extends AbstractPostOrderCallback
*/
public Es6RewriteModules(
AbstractCompiler compiler,
+ ModuleMetadataMap moduleMetadataMap,
@Nullable PreprocessorSymbolTable preprocessorSymbolTable) {
+ checkNotNull(moduleMetadataMap);
this.compiler = compiler;
+ this.moduleMetadataMap = moduleMetadataMap;
this.preprocessorSymbolTable = preprocessorSymbolTable;
- this.moduleMetadataMap = compiler.getModuleMetadataMap();
- checkNotNull(this.moduleMetadataMap);
}
/**
diff --git a/src/com/google/javascript/jscomp/TranspilationPasses.java b/src/com/google/javascript/jscomp/TranspilationPasses.java
index <HASH>..<HASH> 100644
--- a/src/com/google/javascript/jscomp/TranspilationPasses.java
+++ b/src/com/google/javascript/jscomp/TranspilationPasses.java
@@ -48,6 +48,7 @@ public class TranspilationPasses {
preprocessorTableFactory.maybeInitialize(compiler);
return new Es6RewriteModules(
compiler,
+ compiler.getModuleMetadataMap(),
preprocessorTableFactory.getInstanceOrNull());
}
diff --git a/test/com/google/javascript/jscomp/Es6RewriteModulesTest.java b/test/com/google/javascript/jscomp/Es6RewriteModulesTest.java
index <HASH>..<HASH> 100644
--- a/test/com/google/javascript/jscomp/Es6RewriteModulesTest.java
+++ b/test/com/google/javascript/jscomp/Es6RewriteModulesTest.java
@@ -61,7 +61,9 @@ public final class Es6RewriteModulesTest extends CompilerTestCase {
new GatherModuleMetadata(
compiler, /* processCommonJsModules= */ false, ResolutionMode.BROWSER)
.process(externs, root);
- new Es6RewriteModules(compiler, /* preprocessorSymbolTable= */ null).process(externs, root);
+ new Es6RewriteModules(
+ compiler, compiler.getModuleMetadataMap(), /* preprocessorSymbolTable= */ null)
+ .process(externs, root);
};
}
diff --git a/test/com/google/javascript/jscomp/Es6RewriteModulesWithGoogInteropTest.java b/test/com/google/javascript/jscomp/Es6RewriteModulesWithGoogInteropTest.java
index <HASH>..<HASH> 100644
--- a/test/com/google/javascript/jscomp/Es6RewriteModulesWithGoogInteropTest.java
+++ b/test/com/google/javascript/jscomp/Es6RewriteModulesWithGoogInteropTest.java
@@ -70,9 +70,11 @@ public final class Es6RewriteModulesWithGoogInteropTest extends CompilerTestCase
protected CompilerPass getProcessor(Compiler compiler) {
return (externs, root) -> {
new GatherModuleMetadata(
- compiler, /* processCommonJsModules= */ false, ResolutionMode.BROWSER)
+ compiler, /* processCommonJsModules= */ false, ResolutionMode.BROWSER)
+ .process(externs, root);
+ new Es6RewriteModules(
+ compiler, compiler.getModuleMetadataMap(), /* preprocessorSymbolTable= */ null)
.process(externs, root);
- new Es6RewriteModules(compiler, /* preprocessorSymbolTable= */ null).process(externs, root);
};
} | Inject Es6RewriteModules with a ModuleMetadataMap to make the dependency clearer.
-------------
Created by MOE: <URL> | google_closure-compiler | train |
9d89cb04ac330c8600949a3df9411533b1f6a1de | diff --git a/vine-core/src/main/java/com/blankstyle/vine/eventbus/root/RootVerticle.java b/vine-core/src/main/java/com/blankstyle/vine/eventbus/root/RootVerticle.java
index <HASH>..<HASH> 100644
--- a/vine-core/src/main/java/com/blankstyle/vine/eventbus/root/RootVerticle.java
+++ b/vine-core/src/main/java/com/blankstyle/vine/eventbus/root/RootVerticle.java
@@ -162,7 +162,7 @@ public class RootVerticle extends BusModBase implements Handler<Message<JsonObje
}
});
registerStem(stemContext);
- message.reply(heartbeatAddress);
+ message.reply(new JsonObject().putString("address", heartbeatAddress));
}
/** | Refactor stem verticle to use heartbeats if a root address is provided. | kuujo_vertigo | train |
ea109c8d04109f02bc8a202f991dd7330bc8a947 | diff --git a/pywws/WeatherStation.py b/pywws/WeatherStation.py
index <HASH>..<HASH> 100755
--- a/pywws/WeatherStation.py
+++ b/pywws/WeatherStation.py
@@ -382,21 +382,26 @@ class weather_station:
self.devh.controlMsg(usb.TYPE_CLASS + usb.RECIP_INTERFACE, 9,
[0xA1, buf_1, buf_2, 0x20, 0xA1, buf_1, buf_2, 0x20],
value=0x200, timeout=1000)
- new_block = self.devh.interruptRead(0x81, 0x20, 1000)
- if len(new_block) == 0x20:
- if new_block == old_block:
- break
- if old_block != None:
- self.logger.debug('_read_block changing %06x', ptr)
- old_block = new_block
+ try:
+ new_block = self.devh.interruptRead(0x81, 0x20, 1000)
+ if len(new_block) == 0x20:
+ if new_block == old_block:
+ break
+ if old_block != None:
+ self.logger.debug('_read_block changing %06x', ptr)
+ old_block = new_block
+ except usb.USBError, ex:
+ if ex.args != ('No error',):
+ raise
return new_block
def _read_fixed_block(self, hi=0x0100):
result = []
for mempos in range(0x0000, hi, 0x0020):
result += self._read_block(mempos)
# check 'magic number'
- if result[0:2] not in ([0x55, 0xAA], [0xFF, 0xFF]):
- raise IOError("Invalid data from weather station")
+ if result[:2] not in ([0x55, 0xAA], [0xFF, 0xFF], [0x55, 0x55]):
+ raise IOError(
+ "Unrecognised 'magic number' %02x %02x", result[0], result[1])
return result
def _write_byte(self, ptr, value):
buf_1 = (ptr / 256) & 0xFF
@@ -404,16 +409,32 @@ class weather_station:
self.devh.controlMsg(usb.TYPE_CLASS + usb.RECIP_INTERFACE, 9,
[0xA2, buf_1, buf_2, 0x20, 0xA2, value, 0, 0x20],
value=0x200, timeout=1000)
- result = self.devh.interruptRead(0x81, 0x08, 1000)
- for byte in result:
- if byte != 0xA5:
- raise IOError('_write_byte failed')
+ while True:
+ try:
+ result = self.devh.interruptRead(0x81, 0x08, 1000)
+ for byte in result:
+ if byte != 0xA5:
+ raise IOError('_write_byte failed')
+ break
+ except usb.USBError, ex:
+ if ex.args != ('No error',):
+ raise
def write_data(self, data):
"""Write a set of single bytes to the weather station. Data must be an
array of (ptr, value) pairs."""
+ # send data
for ptr, value in data:
self._write_byte(ptr, value)
- self._write_byte(0x1A, 0xAA)
+ # set 'data changed'
+ self._write_byte(self.fixed_format['data_changed'][0], 0xAA)
+ # wait for station to clear 'data changed'
+ while True:
+ ack = _decode(
+ self._read_fixed_block(0x0020), self.fixed_format['data_changed'])
+ if ack == 0:
+ break
+ self.logger.debug('write_data waiting for ack')
+ time.sleep(6)
# Tables of "meanings" for raw weather station data. Each key
# specifies an (offset, type, multiplier) tuple that is understood
# by _decode.
@@ -442,6 +463,7 @@ class weather_station:
fixed_format = {
'read_period' : (16, 'ub', None),
'timezone' : (24, 'sb', None),
+ 'data_changed' : (26, 'ub', None),
'data_count' : (27, 'us', None),
'current_pos' : (30, 'us', None),
'rel_pressure' : (32, 'us', 0.1), | Improved reliability of reading & writing weather station data.
Added new 'magic number' to list of recognised ones. | jim-easterbrook_pywws | train |
6ac204d625c70fe01b59c13cfd2d1f55f3051a4f | diff --git a/spec/support/mock_spec_helper.rb b/spec/support/mock_spec_helper.rb
index <HASH>..<HASH> 100644
--- a/spec/support/mock_spec_helper.rb
+++ b/spec/support/mock_spec_helper.rb
@@ -1,12 +1,12 @@
-
module MockSpecHelper
def mock_rest_client
@api_version = RightApi::Client::API_VERSION
+ @test_account_id = '1'
@rest_client = RestClient::Resource.new(RightApi::Client::DEFAULT_API_URL)
flexmock(RestClient::Resource).should_receive(:new).and_return(@rest_client)
@session = flexmock(:cookies => {})
- @header = {'X_API_VERSION' => @api_version, :cookies => {}, :accept => :json}
+ @header = {'X_API_VERSION' => @api_version, 'X_ACCOUNT' => @test_account_id, :cookies => {}, :accept => :json}
end
def given_user_facing_client
@@ -15,7 +15,7 @@ module MockSpecHelper
{'email' => 'email', 'password' => 'password', 'account_href' => '/api/accounts/1'},
{'X_API_VERSION' => @api_version}, Proc).and_return(@session)
flexmock(@rest_client).should_receive(:get).with(@header, Proc).and_return(['', '{}'])
- @client = RightApi::Client.new(:email => 'email', :password => 'password', :account_id => '1')
+ @client = RightApi::Client.new(:email => 'email', :password => 'password', :account_id => @test_account_id)
end
def given_instance_facing_client
@@ -28,7 +28,7 @@ module MockSpecHelper
"href": "/api/clouds/1/instances/1",
"rel": "self"
}]}'])
- @client = RightApi::Client.new(:instance_token => 'instance_token', :account_id => '1')
+ @client = RightApi::Client.new(:instance_token => 'instance_token', :account_id => @test_account_id)
end
end | acu<I> Fixing broken stubs to get specs green | rightscale_right_api_client | train |
f49052837799bb6826271d028e2e8a681ef4d9e1 | diff --git a/pandas/core/frame.py b/pandas/core/frame.py
index <HASH>..<HASH> 100644
--- a/pandas/core/frame.py
+++ b/pandas/core/frame.py
@@ -3395,7 +3395,7 @@ class DataFrame(NDFrame):
Parameters
----------
- other : DataFrame
+ other : DataFrame, or object coercible into a DataFrame
join : {'left', 'right', 'outer', 'inner'}, default 'left'
overwrite : boolean, default True
If True then overwrite values for common keys in the calling frame
@@ -3409,7 +3409,11 @@ class DataFrame(NDFrame):
if join != 'left':
raise NotImplementedError
+ if not isinstance(other, DataFrame):
+ other = DataFrame(other)
+
other = other.reindex_like(self)
+
for col in self.columns:
this = self[col].values
that = other[col].values
diff --git a/pandas/tests/test_frame.py b/pandas/tests/test_frame.py
index <HASH>..<HASH> 100644
--- a/pandas/tests/test_frame.py
+++ b/pandas/tests/test_frame.py
@@ -5784,6 +5784,11 @@ class TestDataFrame(unittest.TestCase, CheckIndexing,
[1.5, nan, 7.]])
assert_frame_equal(df, expected)
+
+
+
+
+
def test_update_nooverwrite(self):
df = DataFrame([[1.5, nan, 3.],
[1.5, nan, 3.],
@@ -5830,6 +5835,27 @@ class TestDataFrame(unittest.TestCase, CheckIndexing,
np.testing.assert_raises(Exception, df.update, *(other,),
**{'raise_conflict' : True})
+ def test_update_from_non_df(self):
+ d = {'a': Series([1, 2, 3, 4]), 'b': Series([5, 6, 7, 8])}
+ df = DataFrame(d)
+
+ d['a'] = Series([5, 6, 7, 8])
+ df.update(d)
+
+ expected = DataFrame(d)
+
+ assert_frame_equal(df, expected)
+
+ d = {'a': [1, 2, 3, 4], 'b': [5, 6, 7, 8]}
+ df = DataFrame(d)
+
+ d['a'] = [5, 6, 7, 8]
+ df.update(d)
+
+ expected = DataFrame(d)
+
+ assert_frame_equal(df, expected)
+
def test_combineAdd(self):
# trivial
comb = self.frame.combineAdd(self.frame) | Allow DataFrame.update to accept non DataFrame object and attempt to coerce. | pandas-dev_pandas | train |
3718c74fe17f67d9f8bdfa56b9e1bf612a2b9b3b | diff --git a/openquake/calculators/base.py b/openquake/calculators/base.py
index <HASH>..<HASH> 100644
--- a/openquake/calculators/base.py
+++ b/openquake/calculators/base.py
@@ -903,11 +903,10 @@ def save_gmfs(calculator):
oq = calculator.oqparam
logging.info('Reading gmfs from file')
if oq.inputs['gmfs'].endswith('.csv'):
- # TODO: check if import_gmfs can be removed
eids = import_gmfs(
dstore, oq.inputs['gmfs'], calculator.sitecol.complete.sids)
else: # XML
- eids, gmfs = readinput.eids, readinput.gmfs
+ raise NotImplementedError('Cannot import %s' % oq.inputs['gmfs'])
E = len(eids)
events = numpy.zeros(E, rupture.events_dt)
events['id'] = eids
@@ -919,10 +918,9 @@ def save_gmfs(calculator):
(oq.number_of_ground_motion_fields, E))
else: # set the number of GMFs from the file
oq.number_of_ground_motion_fields = E
- # NB: save_gmfs redefine oq.sites in case of GMFs from XML or CSV
- if oq.inputs['gmfs'].endswith('.xml'):
+ # NB: save_gmfs redefine oq.sites in case of GMFs from XML
+ if oq.inputs['gmfs'].endswith('.csv'):
haz_sitecol = readinput.get_site_collection(oq)
- N, E, M = gmfs.shape
save_gmf_data(dstore, haz_sitecol, gmfs[haz_sitecol.sids],
oq.imtls, events) | Worked on the GMFs importer [skip hazardlib] | gem_oq-engine | train |
df987b98782f527d023437343b41a3f0478177ea | diff --git a/grails-web-common/src/main/groovy/org/codehaus/groovy/grails/web/servlet/DefaultGrailsApplicationAttributes.java b/grails-web-common/src/main/groovy/org/codehaus/groovy/grails/web/servlet/DefaultGrailsApplicationAttributes.java
index <HASH>..<HASH> 100644
--- a/grails-web-common/src/main/groovy/org/codehaus/groovy/grails/web/servlet/DefaultGrailsApplicationAttributes.java
+++ b/grails-web-common/src/main/groovy/org/codehaus/groovy/grails/web/servlet/DefaultGrailsApplicationAttributes.java
@@ -74,33 +74,30 @@ public class DefaultGrailsApplicationAttributes implements GrailsApplicationAttr
if (context != null) {
appContext = (ApplicationContext)context.getAttribute(APPLICATION_CONTEXT);
}
- initBeans();
}
public ApplicationContext getApplicationContext() {
return appContext;
}
- private void initBeans() {
- if (appContext != null) {
- pagesTemplateEngine = fetchBeanFromAppCtx(ResourceAwareTemplateEngine.BEAN_ID);
+ private GrailsPluginManager getPluginManager() {
+ if(pluginManager==null) {
pluginManager = fetchBeanFromAppCtx(GrailsPluginManager.BEAN_NAME);
- grailsApplication = fetchBeanFromAppCtx(GrailsApplication.APPLICATION_ID);
- groovyPagesUriService = fetchBeanFromAppCtx(GroovyPagesUriService.BEAN_ID);
- messageSource = fetchBeanFromAppCtx("messageSource");
- }
- else {
- LOG.warn("ApplicationContext not found in " + APPLICATION_CONTEXT + " attribute of servlet context.");
- }
- if (groovyPagesUriService == null) {
- groovyPagesUriService = new DefaultGroovyPagesUriService();
}
+ return pluginManager;
}
@SuppressWarnings("unchecked")
private <T> T fetchBeanFromAppCtx(String name) {
+ if(appContext==null) {
+ return null;
+ }
try {
- return (T)appContext.getBean(name);
+ if(appContext.containsBean(name)) {
+ return (T)appContext.getBean(name);
+ } else {
+ return null;
+ }
}
catch(BeansException e) {
LOG.warn("Bean named '" + name + "' is missing.");
@@ -110,8 +107,8 @@ public class DefaultGrailsApplicationAttributes implements GrailsApplicationAttr
public String getPluginContextPath(HttpServletRequest request) {
GroovyObject controller = getController(request);
- if (controller != null) {
- String path = pluginManager.getPluginPathForInstance(controller);
+ if (controller != null && getPluginManager() != null) {
+ String path = getPluginManager().getPluginPathForInstance(controller);
return path == null ? "" : path;
}
@@ -191,12 +188,12 @@ public class DefaultGrailsApplicationAttributes implements GrailsApplicationAttr
public String getTemplateUri(CharSequence templateName, ServletRequest request) {
Assert.notNull(templateName, "Argument [template] cannot be null");
- return groovyPagesUriService.getTemplateURI(getControllerName(request), templateName.toString());
+ return getGroovyPagesUriService().getTemplateURI(getControllerName(request), templateName.toString());
}
public String getViewUri(String viewName, HttpServletRequest request) {
Assert.notNull(viewName, "Argument [view] cannot be null");
- return groovyPagesUriService.getDeployedViewURI(getControllerName(request), viewName);
+ return getGroovyPagesUriService().getDeployedViewURI(getControllerName(request), viewName);
}
public String getControllerActionUri(ServletRequest request) {
@@ -209,16 +206,19 @@ public class DefaultGrailsApplicationAttributes implements GrailsApplicationAttr
}
public ResourceAwareTemplateEngine getPagesTemplateEngine() {
- if (pagesTemplateEngine != null) {
- return pagesTemplateEngine;
+ if (pagesTemplateEngine == null) {
+ pagesTemplateEngine = fetchBeanFromAppCtx(ResourceAwareTemplateEngine.BEAN_ID);
}
- if (LOG.isWarnEnabled()) {
+ if (pagesTemplateEngine == null && LOG.isWarnEnabled()) {
LOG.warn("No bean named [" + ResourceAwareTemplateEngine.BEAN_ID + "] defined in Spring application context!");
}
- return null;
+ return pagesTemplateEngine;
}
public GrailsApplication getGrailsApplication() {
+ if(grailsApplication==null) {
+ grailsApplication = fetchBeanFromAppCtx(GrailsApplication.APPLICATION_ID);
+ }
return grailsApplication;
}
@@ -248,18 +248,27 @@ public class DefaultGrailsApplicationAttributes implements GrailsApplicationAttr
}
public String getNoSuffixViewURI(GroovyObject controller, String viewName) {
- return groovyPagesUriService.getNoSuffixViewURI(controller, viewName);
+ return getGroovyPagesUriService().getNoSuffixViewURI(controller, viewName);
}
public String getTemplateURI(GroovyObject controller, String templateName) {
- return groovyPagesUriService.getTemplateURI(controller, templateName);
+ return getGroovyPagesUriService().getTemplateURI(controller, templateName);
}
public GroovyPagesUriService getGroovyPagesUriService() {
+ if (groovyPagesUriService == null) {
+ groovyPagesUriService = fetchBeanFromAppCtx(GroovyPagesUriService.BEAN_ID);
+ if (groovyPagesUriService == null) {
+ groovyPagesUriService = new DefaultGroovyPagesUriService();
+ }
+ }
return groovyPagesUriService;
}
public MessageSource getMessageSource() {
+ if(messageSource==null) {
+ messageSource = fetchBeanFromAppCtx("messageSource");
+ }
return messageSource;
}
} | resolve beans lazily in DefaultGrailsApplicationAttributes | grails_grails-core | train |
717d1f8b5c0ce050ddb97224c8f01c6ca6029669 | diff --git a/plugins/rate_limit.js b/plugins/rate_limit.js
index <HASH>..<HASH> 100644
--- a/plugins/rate_limit.js
+++ b/plugins/rate_limit.js
@@ -186,7 +186,13 @@ exports.rate_limit = function (connection, key, value, cb) {
plugin.db.setex(key, ttl, 1, check_limits);
}
else { // old key
- plugin.db.incr(key, check_limits);
+ plugin.db.incr(key, function (err3, result) {
+ if (result === 1) {
+ plugin.db.expire(key, ttl);
+ }
+ check_limits(err3, result);
+ }
+ );
}
});
}; | Updated logic to address case where Redis deletes record between get and incr. If incr creates a new record, make sure it also has a TTL. (#<I>) | haraka_Haraka | train |
fc589e4e83e6fb176aca5e42a5b338d0be23fc39 | diff --git a/.toys/ci.rb b/.toys/ci.rb
index <HASH>..<HASH> 100644
--- a/.toys/ci.rb
+++ b/.toys/ci.rb
@@ -265,7 +265,14 @@ def find_changed_directories files
dirs = Set.new
files.each do |file|
if file =~ %r{^([^/]+)/.+$}
- dirs << Regexp.last_match[1]
+ dir = Regexp.last_match[1]
+ dirs << dir
+ if dir =~ %r{^(.+)-v\d[^-]*$}
+ wrapper_dir = Regexp.last_match[1]
+ if Dir.exists? wrapper_dir
+ dirs << wrapper_dir
+ end
+ end
end
end
filter_gem_dirs dirs.to_a | chore: run tests for wrappers when child directories have changed | googleapis_google-cloud-ruby | train |
d92beeee3dad366352379fc95dc40f387dd4cb9f | diff --git a/docs/sources/http_api/snapshot.md b/docs/sources/http_api/snapshot.md
index <HASH>..<HASH> 100644
--- a/docs/sources/http_api/snapshot.md
+++ b/docs/sources/http_api/snapshot.md
@@ -68,7 +68,8 @@ JSON Body schema:
"deleteKey":"XXXXXXX",
"deleteUrl":"myurl/api/snapshots-delete/XXXXXXX",
"key":"YYYYYYY",
- "url":"myurl/dashboard/snapshot/YYYYYYY"
+ "url":"myurl/dashboard/snapshot/YYYYYYY",
+ "id": 1,
}
```
@@ -192,7 +193,7 @@ Authorization: Bearer eyJrIjoiT0tTcG1pUlY2RnVKZTFVaDFsNFZXdE9ZWmNrMkZYbk
HTTP/1.1 200
Content-Type: application/json
-{"message":"Snapshot deleted. It might take an hour before it's cleared from any CDN caches."}
+{"message":"Snapshot deleted. It might take an hour before it's cleared from any CDN caches.", "id": 1}
```
## Delete Snapshot by deleteKey
@@ -214,5 +215,5 @@ Accept: application/json
HTTP/1.1 200
Content-Type: application/json
-{"message":"Snapshot deleted. It might take an hour before it's cleared from any CDN caches."}
-```
\ No newline at end of file
+{"message":"Snapshot deleted. It might take an hour before it's cleared from any CDN caches.", "id": 1}
+```
diff --git a/pkg/api/dashboard_snapshot.go b/pkg/api/dashboard_snapshot.go
index <HASH>..<HASH> 100644
--- a/pkg/api/dashboard_snapshot.go
+++ b/pkg/api/dashboard_snapshot.go
@@ -132,6 +132,7 @@ func CreateDashboardSnapshot(c *models.ReqContext, cmd models.CreateDashboardSna
"deleteKey": cmd.DeleteKey,
"url": url,
"deleteUrl": setting.ToAbsUrl("api/snapshots-delete/" + cmd.DeleteKey),
+ "id": cmd.Result.Id,
})
}
@@ -223,7 +224,10 @@ func DeleteDashboardSnapshotByDeleteKey(c *models.ReqContext) Response {
return Error(500, "Failed to delete dashboard snapshot", err)
}
- return JSON(200, util.DynMap{"message": "Snapshot deleted. It might take an hour before it's cleared from any CDN caches."})
+ return JSON(200, util.DynMap{
+ "message": "Snapshot deleted. It might take an hour before it's cleared from any CDN caches.",
+ "id": query.Result.Id,
+ })
}
// DELETE /api/snapshots/:key
@@ -269,7 +273,10 @@ func DeleteDashboardSnapshot(c *models.ReqContext) Response {
return Error(500, "Failed to delete dashboard snapshot", err)
}
- return JSON(200, util.DynMap{"message": "Snapshot deleted. It might take an hour before it's cleared from any CDN caches."})
+ return JSON(200, util.DynMap{
+ "message": "Snapshot deleted. It might take an hour before it's cleared from any CDN caches.",
+ "id": query.Result.Id,
+ })
}
// GET /api/dashboard/snapshots
diff --git a/pkg/api/dashboard_snapshot_test.go b/pkg/api/dashboard_snapshot_test.go
index <HASH>..<HASH> 100644
--- a/pkg/api/dashboard_snapshot_test.go
+++ b/pkg/api/dashboard_snapshot_test.go
@@ -109,6 +109,7 @@ func TestDashboardSnapshotAPIEndpoint_singleSnapshot(t *testing.T) {
require.NoError(t, err)
assert.True(t, strings.HasPrefix(respJSON.Get("message").MustString(), "Snapshot deleted"))
+ assert.Equal(t, 1, respJSON.Get("id").MustInt())
assert.Equal(t, http.MethodGet, externalRequest.Method)
assert.Equal(t, ts.URL, fmt.Sprintf("http://%s", externalRequest.Host))
@@ -141,6 +142,7 @@ func TestDashboardSnapshotAPIEndpoint_singleSnapshot(t *testing.T) {
require.NoError(t, err)
assert.True(t, strings.HasPrefix(respJSON.Get("message").MustString(), "Snapshot deleted"))
+ assert.Equal(t, 1, respJSON.Get("id").MustInt())
assert.Equal(t, ts.URL, fmt.Sprintf("http://%s", externalRequest.Host))
assert.Equal(t, "/", externalRequest.URL.EscapedPath())
})
@@ -163,6 +165,7 @@ func TestDashboardSnapshotAPIEndpoint_singleSnapshot(t *testing.T) {
require.NoError(t, err)
assert.True(t, strings.HasPrefix(respJSON.Get("message").MustString(), "Snapshot deleted"))
+ assert.Equal(t, 1, respJSON.Get("id").MustInt())
})
})
@@ -186,6 +189,11 @@ func TestDashboardSnapshotAPIEndpoint_singleSnapshot(t *testing.T) {
require.NoError(t, writeErr)
assert.Equal(t, 200, sc.resp.Code)
+ respJSON, err := simplejson.NewJson(sc.resp.Body.Bytes())
+ require.NoError(t, err)
+
+ assert.True(t, strings.HasPrefix(respJSON.Get("message").MustString(), "Snapshot deleted"))
+ assert.Equal(t, 1, respJSON.Get("id").MustInt())
})
loggedInUserScenarioWithRole(t, | API: add ID to snapshot API responses (#<I>)
* API: add ID to snapshot API responses
* API: update snapshot tests | grafana_grafana | train |
667882fa81b647a5d060ef03ee8656302d945f28 | diff --git a/penaltymodel_core/penaltymodel/core/classes/specification.py b/penaltymodel_core/penaltymodel/core/classes/specification.py
index <HASH>..<HASH> 100644
--- a/penaltymodel_core/penaltymodel/core/classes/specification.py
+++ b/penaltymodel_core/penaltymodel/core/classes/specification.py
@@ -117,6 +117,9 @@ class Specification(object):
u and v are variables in the desired penalty model and u, v have an
interaction - there is an edge between nodes u, v in `graph`.
+ min_classical_gap (float): The minimum energy gap between the highest feasible state and
+ the lowest infeasible state. Default value is 2.
+
"""
@dimod.decorators.vartype_argument('vartype')
def __init__(self, graph, decision_variables, feasible_configurations, vartype,
diff --git a/penaltymodel_lp/penaltymodel/lp/generation.py b/penaltymodel_lp/penaltymodel/lp/generation.py
index <HASH>..<HASH> 100644
--- a/penaltymodel_lp/penaltymodel/lp/generation.py
+++ b/penaltymodel_lp/penaltymodel/lp/generation.py
@@ -75,7 +75,19 @@ def _get_lp_matrix(spin_states, nodes, edges, offset_weight, gap_weight):
#TODO: Check if len(table.keys()[0]) == len(decision_variables)
def generate_bqm(graph, table, decision_variables,
linear_energy_ranges=None, quadratic_energy_ranges=None, min_classical_gap=2):
-
+ """
+ Args:
+ graph: A networkx.Graph
+ table: An iterable of valid spin configurations. Each configuration is a tuple of
+ variable assignments ordered by `decision`.
+ decision_variables: An ordered iterable of the variables in the binary quadratic model.
+ linear_energy_ranges: Dictionary of the form {v: (min, max), ...} where min and
+ max are the range of values allowed to v. The default range is [-2, 2].
+ quadratic_energy_ranges: Dict of the form {(u, v): (min, max), ...} where min and max are
+ the range of values allowed to (u, v). The default range is [-1, 1].
+ min_classical_gap: A float. The minimum energy gap between the highest feasible state and
+ the lowest infeasible state.
+ """
# Check for auxiliary variables in the graph
if len(graph) != len(decision_variables):
raise ValueError('Penaltymodel-lp does not handle problems with auxiliary variables')
diff --git a/penaltymodel_maxgap/penaltymodel/maxgap/generation.py b/penaltymodel_maxgap/penaltymodel/maxgap/generation.py
index <HASH>..<HASH> 100644
--- a/penaltymodel_maxgap/penaltymodel/maxgap/generation.py
+++ b/penaltymodel_maxgap/penaltymodel/maxgap/generation.py
@@ -36,6 +36,8 @@ def generate_ising(graph, feasible_configurations, decision_variables,
quadratic_energy_ranges (dict): A dict of the form
{(u, v): (min, max), ...} where min and max are the range
of values allowed to (u, v).
+ min_classical_gap (float): The minimum energy gap between the highest feasible state and the
+ lowest infeasible state.
smt_solver_name (str/None): The name of the smt solver. Must
be a solver available to pysmt. If None, uses the pysmt default.
diff --git a/penaltymodel_mip/penaltymodel/mip/generation.py b/penaltymodel_mip/penaltymodel/mip/generation.py
index <HASH>..<HASH> 100644
--- a/penaltymodel_mip/penaltymodel/mip/generation.py
+++ b/penaltymodel_mip/penaltymodel/mip/generation.py
@@ -36,6 +36,10 @@ def generate_bqm(graph, table, decision,
Dict of the form {(u, v): (min, max), ...} where min and max are the range of values
allowed to (u, v). The default range is [-1, 1].
+ min_classical_gap (float):
+ The minimum energy gap between the highest feasible state and the lowest infeasible
+ state.
+
precision (int, optional, default=7):
Values returned by the optimization solver are rounded to `precision` digits of
precision. | Add min_classical_gap to docstrings | dwavesystems_penaltymodel | train |
921904c726e70527721dfe59b16fcb2900bb5d9d | diff --git a/pymatgen/analysis/substrate_analyzer.py b/pymatgen/analysis/substrate_analyzer.py
index <HASH>..<HASH> 100644
--- a/pymatgen/analysis/substrate_analyzer.py
+++ b/pymatgen/analysis/substrate_analyzer.py
@@ -317,12 +317,16 @@ class SubstrateAnalyzer:
if elasticity_tensor is None:
return 9999
+ # Get the appropriate surface structure
+ struc = SlabGenerator(self.film, match['film_miller'], 20, 15,
+ primitive=False).get_slab().oriented_unit_cell
+
# Generate 3D lattice vectors for film super lattice
film_matrix = list(match['film_sl_vecs'])
film_matrix.append(np.cross(film_matrix[0], film_matrix[1]))
# Generate 3D lattice vectors for substrate super lattice
- # Out of place substrate super lattice has to be same length as
+ # Out of plane substrate super lattice has to be same length as
# Film out of plane vector to ensure no extra deformation in that
# direction
substrate_matrix = list(match['sub_sl_vecs'])
@@ -335,7 +339,7 @@ class SubstrateAnalyzer:
dfm = Deformation(transform_matrix)
- strain = dfm.green_lagrange_strain.von_mises_strain
+ strain = dfm.green_lagrange_strain.von_mises_strain.convert_to_ieee(struc,initial_fit=False)
energy_density = elasticity_tensor.energy_density(
dfm.green_lagrange_strain) | Convert strain to IEEE to match with elastic tensor | materialsproject_pymatgen | train |
bda08da60249cd9278d5354fd22e097d0b3d635f | diff --git a/pub/js/lib/swiping_container.js b/pub/js/lib/swiping_container.js
index <HASH>..<HASH> 100644
--- a/pub/js/lib/swiping_container.js
+++ b/pub/js/lib/swiping_container.js
@@ -28,6 +28,10 @@ define(['lib/bind'], function (bind) {
scrollPosition = outerContainer.scrollLeft,
innerContainer = outerContainer.querySelector(innerContainerSelector);
+ if (null === innerContainer) {
+ return;
+ }
+
bind(outerContainer, 'scroll', function () {
toggleSwipingArrows(outerContainerSelector, 'ul');
});
@@ -36,4 +40,4 @@ define(['lib/bind'], function (bind) {
nextArr.style.opacity = innerContainer.offsetWidth - document.body.clientWidth > scrollPosition ? 1 : 0;
});
}
-});
\ No newline at end of file
+}); | Issue #<I>: Fix empty swiping blocks rendering | lizards-and-pumpkins_catalog | train |
212b9f2e67b203d428cda70940112bdb6c290d86 | diff --git a/lib/alias.js b/lib/alias.js
index <HASH>..<HASH> 100644
--- a/lib/alias.js
+++ b/lib/alias.js
@@ -1,7 +1,9 @@
import retry from 'async-retry';
import Now from '../lib';
+import toHost from './to-host';
export default class Alias extends Now {
+
async ls () {
return retry(async (bail) => {
const res = await this._fetch('/now/aliases');
@@ -34,25 +36,27 @@ export default class Alias extends Now {
}));
}
- async set (url, aliases) {
- console.log('set', url, aliases);
- const deploymentId = url; // TODO get from API
- return retry(async (bail) => {
- const res = await this._fetch(`/now/aliases/${deploymentId}/`, {
- method: 'POST',
- body: {
- aliases: aliases
- }
- });
+ async set (deployment, alias) {
+ const list = await this.list();
+ let key, val;
- if (200 !== res.status && (400 <= res.status || 500 > res.status)) {
- if (this._debug) console.log('> [debug] bailing on creating due to %s', res.status);
- return bail(responseError(res));
- }
+ if (~deployment.indexOf('.')) {
+ val = toHost(deployment);
+ key = 'url';
+ } else {
+ val = deployment;
+ key = 'uid';
+ }
- return await res.json();
- }, { retries: 3, minTimeout: 2500, onRetry: this._onRetry });
+ const id = list.find((d) => d[key] === val);
+
+ if (!id) {
+ const err = new Error(`Deployment not found by ${key} "${deployment}"`);
+ err.userError = true;
+ throw err;
+ }
}
+
}
function responseError (res) { | alias: implement uid / host search | zeit_now-cli | train |
c675d781f89f2057c8e5e0e53896adf468cfbac1 | diff --git a/setuptools/command/build.py b/setuptools/command/build.py
index <HASH>..<HASH> 100644
--- a/setuptools/command/build.py
+++ b/setuptools/command/build.py
@@ -65,6 +65,11 @@ class SubCommand(Protocol):
of ``get_output_mapping()``. Alternatively, ``setuptools`` **MAY** attempt to use
:doc:`import hooks <python:reference/import>` to redirect any attempt to import
to the directory with the original source code and other files built in place.
+
+ Please note that custom sub-commands **SHOULD NOT** rely on ``run()`` being
+ executed (or not) to provide correct return values for ``get_outputs()``,
+ ``get_output_mapping()`` or ``get_source_files()``. The ``get_*`` methods should
+ work independently of ``run()``.
"""
editable_mode: bool = False
@@ -106,6 +111,17 @@ class SubCommand(Protocol):
def run(self):
"""(Required by the original :class:`setuptools.Command` interface)"""
+ def get_source_files(self) -> List[str]:
+ """
+ Return a list of all files that are used by the command to create the expected
+ outputs.
+ For example, if your build command transpiles Java files into Python, you should
+ list here all the Java files.
+ The primary purpose of this function is to help populating the ``sdist``
+ with all the files necessary to build the distribution.
+ All files should be strings relative to the project root directory.
+ """
+
def get_outputs(self) -> List[str]:
"""
Return a list of files intended for distribution as they would have been
diff --git a/setuptools/command/sdist.py b/setuptools/command/sdist.py
index <HASH>..<HASH> 100644
--- a/setuptools/command/sdist.py
+++ b/setuptools/command/sdist.py
@@ -4,10 +4,12 @@ import os
import sys
import io
import contextlib
+from itertools import chain
from .py36compat import sdist_add_defaults
from .._importlib import metadata
+from .build import _ORIGINAL_SUBCOMMANDS
_default_revctrl = list
@@ -100,6 +102,10 @@ class sdist(sdist_add_defaults, orig.sdist):
if orig_val is not NoValue:
setattr(os, 'link', orig_val)
+ def add_defaults(self):
+ super().add_defaults()
+ self._add_defaults_build_sub_commands()
+
def _add_defaults_optional(self):
super()._add_defaults_optional()
if os.path.isfile('pyproject.toml'):
@@ -112,6 +118,14 @@ class sdist(sdist_add_defaults, orig.sdist):
self.filelist.extend(build_py.get_source_files())
self._add_data_files(self._safe_data_files(build_py))
+ def _add_defaults_build_sub_commands(self):
+ build = self.get_finalized_command("build")
+ missing_cmds = set(build.get_sub_commands()) - _ORIGINAL_SUBCOMMANDS
+ # ^-- the original built-in sub-commands are already handled by default.
+ cmds = (self.get_finalized_command(c) for c in missing_cmds)
+ files = (c.get_source_files() for c in cmds if hasattr(c, "get_source_files"))
+ self.filelist.extend(chain.from_iterable(files))
+
def _safe_data_files(self, build_py):
"""
Since the ``sdist`` class is also used to compute the MANIFEST
diff --git a/setuptools/tests/test_sdist.py b/setuptools/tests/test_sdist.py
index <HASH>..<HASH> 100644
--- a/setuptools/tests/test_sdist.py
+++ b/setuptools/tests/test_sdist.py
@@ -10,6 +10,7 @@ from unittest import mock
import pytest
+from setuptools import Command
from setuptools._importlib import metadata
from setuptools import SetuptoolsDeprecationWarning
from setuptools.command.sdist import sdist
@@ -517,6 +518,46 @@ class TestSdistTest:
manifest = cmd.filelist.files
assert 'pyproject.toml' not in manifest
+ def test_build_subcommand_source_files(self, tmpdir):
+ touch(tmpdir / '.myfile~')
+
+ # Sanity check: without custom commands file list should not be affected
+ dist = Distribution({**SETUP_ATTRS, "script_name": "setup.py"})
+ cmd = sdist(dist)
+ cmd.ensure_finalized()
+ with quiet():
+ cmd.run()
+ manifest = cmd.filelist.files
+ assert '.myfile~' not in manifest
+
+ # Test: custom command should be able to augment file list
+ dist = Distribution({**SETUP_ATTRS, "script_name": "setup.py"})
+ build = dist.get_command_obj("build")
+ build.sub_commands = [*build.sub_commands, ("build_custom", None)]
+
+ class build_custom(Command):
+ def initialize_options(self):
+ ...
+
+ def finalize_options(self):
+ ...
+
+ def run(self):
+ ...
+
+ def get_source_files(self):
+ return ['.myfile~']
+
+ dist.cmdclass.update(build_custom=build_custom)
+
+ cmd = sdist(dist)
+ cmd.use_defaults = True
+ cmd.ensure_finalized()
+ with quiet():
+ cmd.run()
+ manifest = cmd.filelist.files
+ assert '.myfile~' in manifest
+
def test_default_revctrl():
""" | sdist: Add files from build subcommands (get_source_files) | pypa_setuptools | train |
c254f4bfa8615b3191462bc386474d58996c20bf | diff --git a/src/main/resources/META-INF/resources/primefaces/menu/menu.js b/src/main/resources/META-INF/resources/primefaces/menu/menu.js
index <HASH>..<HASH> 100644
--- a/src/main/resources/META-INF/resources/primefaces/menu/menu.js
+++ b/src/main/resources/META-INF/resources/primefaces/menu/menu.js
@@ -686,12 +686,12 @@ PrimeFaces.widget.ContextMenu = PrimeFaces.widget.TieredMenu.extend({
},
bindTree: function() {
- var rowSelector = this.jqTargetId + ' ' + (this.cfg.nodeType ? 'li.' + this.cfg.nodeType + ' .ui-tree-selectable-node': '.ui-tree-selectable-node'),
+ var nodeSelector = this.jqTargetId + ' ' + (this.cfg.nodeType ? 'li.' + this.cfg.nodeType + ' .ui-tree-selectable': '.ui-tree-selectable'),
event = this.cfg.event + '.tree',
_self = this;
- $(document).off(event, rowSelector)
- .on(event, rowSelector, null, function(e) {
+ $(document).off(event, nodeSelector)
+ .on(event, nodeSelector, null, function(e) {
window[_self.cfg.targetWidgetVar].nodeClick(e, $(this));
_self.show(e);
e.preventDefault(); | Restored contextmenu support for new tree widget | primefaces_primefaces | train |
97c61370a1843588e460feff72a5bb34ebbad51d | diff --git a/pymatgen/io/qchem/inputs.py b/pymatgen/io/qchem/inputs.py
index <HASH>..<HASH> 100644
--- a/pymatgen/io/qchem/inputs.py
+++ b/pymatgen/io/qchem/inputs.py
@@ -496,7 +496,7 @@ class QCInput(MSONable):
Returns:
List of sections.
"""
- patterns = {"sections": r"^\s*?\$([a-z]+)", "multiple_jobs": r"(@@@)"}
+ patterns = {"sections": r"^\s*?\$([a-z_]+)", "multiple_jobs": r"(@@@)"}
matches = read_pattern(string, patterns)
# list of the sections present
sections = [val[0] for val in matches["sections"]]
@@ -509,6 +509,7 @@ class QCInput(MSONable):
raise ValueError("Output file does not contain a molecule section")
if "rem" not in sections:
raise ValueError("Output file does not contain a rem section")
+ print(sections)
return sections
@staticmethod
@@ -666,10 +667,11 @@ class QCInput(MSONable):
print("No valid vdW inputs found. Note that there should be no '=' chracters in vdW input lines.")
return "", {}
- if vdw_table[0][0][0] == 1:
- mode = "atomic"
- elif vdw_table[0][0][0] == 2:
+ if vdw_table[0][0][0] == 2:
mode = "sequential"
+ else:
+ mode = "atomic"
+
return mode, dict(vdw_table[0][1:]) | bugfix to detect underscore in van_der_waals | materialsproject_pymatgen | train |
6379fed5d25b1e15a229df5896b306babdaf3ee2 | diff --git a/workflows/recipe/__init__.py b/workflows/recipe/__init__.py
index <HASH>..<HASH> 100644
--- a/workflows/recipe/__init__.py
+++ b/workflows/recipe/__init__.py
@@ -25,6 +25,7 @@ def _wrap_subscription(transport_layer, subscription_call, channel, callback,
to connect all messages originating from the same
recipe, then the information will be passed to this
function, which must be a context manager factory.
+ :return: Return value of call to subscription_call.
'''
allow_non_recipe_messages = kwargs.pop('allow_non_recipe_messages', False)
@@ -53,7 +54,7 @@ def _wrap_subscription(transport_layer, subscription_call, channel, callback,
# str(header)[:1000], str(message)[:1000])
transport_layer.nack(header)
- subscription_call(channel, unwrap_recipe, *args, **kwargs)
+ return subscription_call(channel, unwrap_recipe, *args, **kwargs)
def wrap_subscribe(transport_layer, channel, callback, *args, **kwargs):
'''Listen to a queue on the transport layer, similar to the subscribe call in
@@ -66,10 +67,11 @@ def wrap_subscribe(transport_layer, channel, callback, *args, **kwargs):
The callback will pass three arguments,
a RecipeWrapper object (details below), the header as
a dictionary structure, and the message.
+ :return: A unique subscription ID
'''
- _wrap_subscription(transport_layer, transport_layer.subscribe,
- channel, callback, *args, **kwargs)
+ return _wrap_subscription(transport_layer, transport_layer.subscribe,
+ channel, callback, *args, **kwargs)
def wrap_subscribe_broadcast(transport_layer, channel, callback, *args, **kwargs):
'''Listen to a topic on the transport layer, similar to the
@@ -82,7 +84,13 @@ def wrap_subscribe_broadcast(transport_layer, channel, callback, *args, **kwargs
The callback will pass three arguments,
a RecipeWrapper object (details below), the header as
a dictionary structure, and the message.
+ :return: A unique subscription ID
'''
- _wrap_subscription(transport_layer, transport_layer.subscribe_broadcast,
- channel, callback, *args, **kwargs)
+ return _wrap_subscription(
+ transport_layer,
+ transport_layer.subscribe_broadcast,
+ channel,
+ callback,
+ *args, **kwargs
+ )
diff --git a/workflows/recipe/test_wrap_subscription.py b/workflows/recipe/test_wrap_subscription.py
index <HASH>..<HASH> 100644
--- a/workflows/recipe/test_wrap_subscription.py
+++ b/workflows/recipe/test_wrap_subscription.py
@@ -60,7 +60,7 @@ def test_wrapping_a_subscription(rw_mock):
'''Test queue subscription with recipe wrapper.'''
transport, recipient = mock.Mock(), mock.Mock()
- workflows.recipe.wrap_subscribe(transport, mock.sentinel.channel, recipient,
+ sid = workflows.recipe.wrap_subscribe(transport, mock.sentinel.channel, recipient,
mock.sentinel.irrelevant_extra_arg, keyword=mock.sentinel.keyword_arg)
# Channel and any extra arguments must be passed on to transport layer.
@@ -69,6 +69,7 @@ def test_wrapping_a_subscription(rw_mock):
mock.sentinel.irrelevant_extra_arg, keyword=mock.sentinel.keyword_arg)
callback = transport.subscribe.call_args[0][1]
assert callback != recipient
+ assert sid == transport.subscribe.return_value
# Part II: Message handling via unwrapper
check_message_handling_via_unwrapper(callback, recipient, transport, rw_mock, False)
@@ -78,12 +79,13 @@ def test_wrapping_a_subscription_allowing_non_recipe_messages(rw_mock):
'''Test queue subscription with recipe wrapper allowing non-recipe messages to pass through.'''
transport, recipient = mock.Mock(), mock.Mock()
- workflows.recipe.wrap_subscribe(transport, mock.sentinel.channel, recipient,
+ sid = workflows.recipe.wrap_subscribe(transport, mock.sentinel.channel, recipient,
mock.sentinel.irrelevant_extra_arg, keyword=mock.sentinel.keyword_arg,
allow_non_recipe_messages=True)
transport.subscribe.assert_called_once()
callback = transport.subscribe.call_args[0][1]
+ assert sid == transport.subscribe.return_value
# Part II: Message handling via unwrapper
check_message_handling_via_unwrapper(callback, recipient, transport, rw_mock, True)
@@ -93,7 +95,7 @@ def test_wrapping_a_broadcast_subscription(rw_mock):
'''Test topic subscription with recipe wrapper.'''
transport, recipient = mock.Mock(), mock.Mock()
- workflows.recipe.wrap_subscribe_broadcast(transport, mock.sentinel.channel, recipient,
+ sid = workflows.recipe.wrap_subscribe_broadcast(transport, mock.sentinel.channel, recipient,
mock.sentinel.irrelevant_extra_arg, keyword=mock.sentinel.keyword_arg)
# Channel and any extra arguments must be passed on to transport layer.
@@ -102,6 +104,7 @@ def test_wrapping_a_broadcast_subscription(rw_mock):
mock.sentinel.irrelevant_extra_arg, keyword=mock.sentinel.keyword_arg)
callback = transport.subscribe_broadcast.call_args[0][1]
assert callback != recipient
+ assert sid == transport.subscribe_broadcast.return_value
# Part II: Message handling via unwrapper
check_message_handling_via_unwrapper(callback, recipient, transport, rw_mock, False)
@@ -124,7 +127,7 @@ def test_wrapping_a_subscription_with_log_extension():
lext.exit.assert_not_called()
lext.recipient()
- workflows.recipe.wrap_subscribe(transport, mock.sentinel.channel, recipient,
+ sid = workflows.recipe.wrap_subscribe(transport, mock.sentinel.channel, recipient,
log_extender=lext)
# Channel and any extra arguments must be passed on to transport layer.
@@ -132,6 +135,7 @@ def test_wrapping_a_subscription_with_log_extension():
transport.subscribe.assert_called_once_with(mock.sentinel.channel, mock.ANY)
callback = transport.subscribe.call_args[0][1]
assert callback != recipient
+ assert sid == transport.subscribe.return_value
# Part II: Message handling | Return subscription IDs for wrapped subscriptions
That way subscriptions created via the recipe wrapper can be
unsubscribed again. Fixes #<I>. | DiamondLightSource_python-workflows | train |
4b625ced123e3ee8b8d8adba61603ac13f6207a2 | diff --git a/lib/provider.js b/lib/provider.js
index <HASH>..<HASH> 100644
--- a/lib/provider.js
+++ b/lib/provider.js
@@ -26,7 +26,7 @@ function Provider(options) {
this.options = Object.assign({}, defaultOptions, options);
- var gethApiDouble = new GethApiDouble(Object.assign({}, options, { _provider: self }));
+ var gethApiDouble = new GethApiDouble(Object.assign({}, this.options, { _provider: self }));
this.engine = new ProviderEngine({
blockTracker: new BlockTracker({ blockchain: gethApiDouble.state.blockchain }) | Revert bug which causes us to log by default | trufflesuite_ganache-core | train |
98b96ab1e6ef94f283377b40efe71c4abfe7e5ea | diff --git a/test/codemirror.spec.js b/test/codemirror.spec.js
index <HASH>..<HASH> 100644
--- a/test/codemirror.spec.js
+++ b/test/codemirror.spec.js
@@ -71,7 +71,7 @@ describe('uiCodemirror', function () {
$compile('<div ui-codemirror></div>')(scope);
expect(CodeMirror.callCount).toEqual(1);
- expect(CodeMirror).toHaveBeenCalledWith(jasmine.any(Function));
+ expect(CodeMirror).toHaveBeenCalledWith(jasmine.any(Function), jasmine.any(Object));
expect(codemirror).toBeDefined();
});
diff --git a/ui-codemirror.js b/ui-codemirror.js
index <HASH>..<HASH> 100644
--- a/ui-codemirror.js
+++ b/ui-codemirror.js
@@ -18,6 +18,7 @@ angular.module('ui.codemirror', [])
// Create a codemirror instance with
// - the function that will to place the editor into the document.
+ // - the initial content of the editor.
// see http://codemirror.net/doc/manual.html#api_constructor
var value = tElement.text();
var codeMirror = new CodeMirror(function (cm_el) {
@@ -36,7 +37,7 @@ angular.module('ui.codemirror', [])
}
tElement.replaceWith(cm_el);
- });
+ }, {value: value});
return function postLink(scope, iElement, iAttrs, ngModel) { | chore: Initialise the editor value with the element content | angular-ui_ui-codemirror | train |
bcb0a1ad505fc52afd800d829f363de8e76336c0 | diff --git a/core/roboconf-messaging-rabbitmq/src/main/java/net/roboconf/messaging/rabbitmq/internal/RabbitMqClientAgent.java b/core/roboconf-messaging-rabbitmq/src/main/java/net/roboconf/messaging/rabbitmq/internal/RabbitMqClientAgent.java
index <HASH>..<HASH> 100644
--- a/core/roboconf-messaging-rabbitmq/src/main/java/net/roboconf/messaging/rabbitmq/internal/RabbitMqClientAgent.java
+++ b/core/roboconf-messaging-rabbitmq/src/main/java/net/roboconf/messaging/rabbitmq/internal/RabbitMqClientAgent.java
@@ -28,18 +28,19 @@ package net.roboconf.messaging.rabbitmq.internal;
import java.io.IOException;
import java.util.HashMap;
import java.util.Map;
+import java.util.Set;
import net.roboconf.core.model.beans.Instance;
import net.roboconf.core.model.helpers.InstanceHelpers;
import net.roboconf.core.model.helpers.VariableHelpers;
import net.roboconf.core.utils.Utils;
import net.roboconf.messaging.api.client.IAgentClient;
-import net.roboconf.messaging.api.reconfigurables.ReconfigurableClientAgent;
-import net.roboconf.messaging.api.utils.SerializationUtils;
import net.roboconf.messaging.api.messages.Message;
import net.roboconf.messaging.api.messages.from_agent_to_agent.MsgCmdAddImport;
import net.roboconf.messaging.api.messages.from_agent_to_agent.MsgCmdRemoveImport;
import net.roboconf.messaging.api.messages.from_agent_to_agent.MsgCmdRequestImport;
+import net.roboconf.messaging.api.reconfigurables.ReconfigurableClientAgent;
+import net.roboconf.messaging.api.utils.SerializationUtils;
import com.rabbitmq.client.ConnectionFactory;
import com.rabbitmq.client.QueueingConsumer;
@@ -158,12 +159,16 @@ public class RabbitMqClientAgent extends RabbitMqClient implements IAgentClient
*/
@Override
public void publishExports( Instance instance ) throws IOException {
- this.logger.fine( "Agent '" + getAgentId() + "' is publishing its exports." );
// For all the exported variables...
// ... find the component or facet name...
- for( String facetOrComponentName : VariableHelpers.findPrefixesForExportedVariables( instance ))
+ Set<String> names = VariableHelpers.findPrefixesForExportedVariables( instance );
+ if( names.isEmpty())
+ this.logger.fine( "Agent '" + getAgentId() + "' is publishing its exports." );
+
+ else for( String facetOrComponentName : names ) {
publishExports( instance, facetOrComponentName );
+ }
}
@@ -211,6 +216,9 @@ public class RabbitMqClientAgent extends RabbitMqClient implements IAgentClient
// ... find the component or facet name...
for( String facetOrComponentName : VariableHelpers.findPrefixesForExportedVariables( instance )) {
+ // Log here, for debug
+ this.logger.fine( "Agent '" + getAgentId() + "' is un-publishing its exports (" + facetOrComponentName + ")." );
+
// Publish them
MsgCmdRemoveImport message = new MsgCmdRemoveImport(
facetOrComponentName,
@@ -243,11 +251,11 @@ public class RabbitMqClientAgent extends RabbitMqClient implements IAgentClient
String exchangeName = RabbitMqUtils.buildExchangeName( this.applicationName, false );
if( command == ListenerCommand.START ) {
- this.logger.fine( "Agent '" + getAgentId() + "' starts listening requests from other agents." );
+ this.logger.fine( "Agent '" + getAgentId() + "' starts listening requests from other agents (" + facetOrComponentName + ")." );
this.channel.queueBind( queueName, exchangeName, routingKey );
} else {
- this.logger.fine( "Agent '" + getAgentId() + "' stops listening requests from other agents." );
+ this.logger.fine( "Agent '" + getAgentId() + "' stops listening requests from other agents (" + facetOrComponentName + ")." );
this.channel.queueUnbind( queueName, exchangeName, routingKey );
}
}
@@ -266,6 +274,9 @@ public class RabbitMqClientAgent extends RabbitMqClient implements IAgentClient
// ... find the component or facet name...
for( String facetOrComponentName : VariableHelpers.findPrefixesForImportedVariables( instance )) {
+ // Log here, for debug
+ this.logger.fine( "Agent '" + getAgentId() + "' is requesting exports from other agents (" + facetOrComponentName + ")." );
+
// ... and ask to publish them.
// Grouping variable requests by prefix reduces the number of messages.
MsgCmdRequestImport message = new MsgCmdRequestImport( facetOrComponentName );
@@ -295,11 +306,11 @@ public class RabbitMqClientAgent extends RabbitMqClient implements IAgentClient
String exchangeName = RabbitMqUtils.buildExchangeName( this.applicationName, false );
if( command == ListenerCommand.START ) {
- this.logger.fine( "Agent '" + getAgentId() + "' starts listening exports from other agents." );
+ this.logger.fine( "Agent '" + getAgentId() + "' starts listening exports from other agents (" + facetOrComponentName + ")." );
this.channel.queueBind( queueName, exchangeName, routingKey );
} else {
- this.logger.fine( "Agent '" + getAgentId() + "' stops listening exports from other agents." );
+ this.logger.fine( "Agent '" + getAgentId() + "' stops listening exports from other agents (" + facetOrComponentName + ")." );
this.channel.queueUnbind( queueName, exchangeName, routingKey );
}
} | #<I> Improve log messages in the agent's messaging (RabbitMQ) | roboconf_roboconf-platform | train |
d487f05d51f611e35286205f523a588cfbfa87d9 | diff --git a/spyderlib/widgets/editor.py b/spyderlib/widgets/editor.py
index <HASH>..<HASH> 100644
--- a/spyderlib/widgets/editor.py
+++ b/spyderlib/widgets/editor.py
@@ -1380,7 +1380,8 @@ class EditorStack(QWidget):
if self.inspector is not None and self.inspector.dockwidget.isVisible():
# ObjectInspector widget exists and is visible
self.inspector.set_object_text(qstr)
- self.setFocus()
+ editor = self.get_current_editor()
+ editor.setFocus()
def new(self, filename, encoding, text):
""" | Fixed Issue <I>: after calling object inspector automatically (with 'object inspector link' feature), the editor was loosing focus | spyder-ide_spyder | train |
534395e7ea23109495aff3b0e63762af6d332378 | diff --git a/src/Translation/TranslationFile.php b/src/Translation/TranslationFile.php
index <HASH>..<HASH> 100644
--- a/src/Translation/TranslationFile.php
+++ b/src/Translation/TranslationFile.php
@@ -139,7 +139,6 @@ class TranslationFile
->name('*.php')
->notName('*~')
->exclude(['cache', 'config', 'database', 'resources', 'tests'])
- ->in($this->app['resources']->getPath('apppath'))
->in(__DIR__ . DIRECTORY_SEPARATOR . '..');
foreach ($finder as $file) { | There are no php files (with translatable strings) in app folder. | bolt_bolt | train |
6c12fcb62428b82291412633f2466989b74fe7e3 | diff --git a/components/lib/datatable/BodyCell.js b/components/lib/datatable/BodyCell.js
index <HASH>..<HASH> 100644
--- a/components/lib/datatable/BodyCell.js
+++ b/components/lib/datatable/BodyCell.js
@@ -511,7 +511,7 @@ export class BodyCell extends Component {
const align = this.getColumnProp('align');
const value = this.resolveFieldData();
const cellClassName = ObjectUtils.getPropValue(this.props.cellClassName, value, { props: this.props.tableProps, rowData: this.props.rowData, column: this.props.column });
- const className = classNames(this.getColumnProp('bodyClassName'), this.getColumnProp('class'), cellClassName, {
+ const className = classNames(this.getColumnProp('bodyClassName'), this.getColumnProp('className'), cellClassName, {
'p-selection-column': selectionMode !== null,
'p-editable-column': editor,
'p-cell-editing': editor && this.state.editing, | Fixed #<I> - Body cell is not assigned with the className property of Column | primefaces_primereact | train |
68753db53f3c80f8dbf5cbf3f9163c31778dafcc | diff --git a/ChangeLog.md b/ChangeLog.md
index <HASH>..<HASH> 100644
--- a/ChangeLog.md
+++ b/ChangeLog.md
@@ -1,5 +1,10 @@
# Changelog
+## v2.4.3
+
+- Corrected unneded config in DependencyInjection (04/03/2020)
+- Removed sitch function to reduce Cyclomatic complexity (05/03/2020)
+
## v2.4.2
- Cosmetic changes dur to Codacy review (04/03/2020)
@@ -109,7 +114,6 @@
- Created branch 1.x (30/08/2018)
- Modified files to use own sytem of key-value for config (30/08/2018)
-
## v1.x
## v1.2.2
diff --git a/DependencyInjection/c975LConfigExtension.php b/DependencyInjection/c975LConfigExtension.php
index <HASH>..<HASH> 100644
--- a/DependencyInjection/c975LConfigExtension.php
+++ b/DependencyInjection/c975LConfigExtension.php
@@ -31,8 +31,5 @@ class c975LConfigExtension extends Extension
new FileLocator(__DIR__.'/../Resources/config')
);
$loader->load('services.yml');
-
- $configuration = new Configuration();
- $processedConfig = $this->processConfiguration($configuration, $configs);
}
}
diff --git a/Form/ConfigType.php b/Form/ConfigType.php
index <HASH>..<HASH> 100644
--- a/Form/ConfigType.php
+++ b/Form/ConfigType.php
@@ -27,25 +27,16 @@ class ConfigType extends AbstractType
{
foreach ($options['data'] as $key => $value) {
if ('configDataReserved' !== $key && is_array($value)) {
- switch ($value['type']) {
- case 'bool':
- $classType = 'CheckboxType';
- break;
- case 'date':
- $classType = 'DateType';
- break;
- case 'int':
- $classType = 'IntegerType';
- break;
- case 'float':
- $classType = 'NumberType';
- break;
- case 'array':
- case 'string':
- default:
- $classType = 'TextType';
- break;
- }
+ $classesTypes = array(
+ 'bool' => 'CheckboxType',
+ 'date' => 'DateType',
+ 'int' => 'IntegerType',
+ 'float' => 'NumberType',
+ 'array' => 'TextType',
+ 'string' => 'TextType',
+ );
+
+ $classType = isset($classesTypes[$value['type']]) ? $classesTypes[$value['type']] : 'TextType';
//Defines field options
$fieldOptions = array(
diff --git a/README.md b/README.md
index <HASH>..<HASH> 100644
--- a/README.md
+++ b/README.md
@@ -14,7 +14,6 @@ ConfigBundle does the following:
## Bundle installation
-
### Step 1: Download the Bundle
Use [Composer](https://getcomposer.org) to install the library
diff --git a/Service/ConfigService.php b/Service/ConfigService.php
index <HASH>..<HASH> 100644
--- a/Service/ConfigService.php
+++ b/Service/ConfigService.php
@@ -231,9 +231,9 @@ class ConfigService implements ConfigServiceInterface
*/
public function getConfigFolder()
{
- $rootFolder = $this->container->getParameter('kernel.root_dir');
+ $root = $this->container->getParameter('kernel.root_dir');
- return '4' === substr(Kernel::VERSION, 0, 1) ? $rootFolder . '/../config/' : $rootFolder . '/../app/config/';
+ return '3' === substr(Kernel::VERSION, 0, 1) ? $root . '/../app/config/' : $root . '/../config/';
}
/** | - Corrected unneded config in DependencyInjection (<I>/<I>/<I>)
- Removed sitch function to reduce Cyclomatic complexity (<I>/<I>/<I>) | 975L_ConfigBundle | train |
931fb3d8ddab068d79a7bf7c66b1f989ffdda200 | diff --git a/lib/policies/oauth2-introspect/oauth2-introspect.js b/lib/policies/oauth2-introspect/oauth2-introspect.js
index <HASH>..<HASH> 100644
--- a/lib/policies/oauth2-introspect/oauth2-introspect.js
+++ b/lib/policies/oauth2-introspect/oauth2-introspect.js
@@ -13,7 +13,8 @@ module.exports = function (actionParams) {
const requestedScopes = req.egContext.apiEndpoint.scopes;
const scopeCheck = (tokenData, done) => {
- const avaiableScopes = tokenData.scopes ? tokenData.scopes.split(' ') : [];
+ const tokenDataScopes = tokenData.scope || tokenData.scopes;
+ const avaiableScopes = tokenDataScopes ? tokenDataScopes.split(' ') : [];
if (requestedScopes.every(scope => avaiableScopes.includes(scope))) {
return done(null, tokenData); | Fixed: OAuth2 introspection cannot identify 'scope' claim token implementation
Now OAuth2 introspection can read 'scope' and 'scopes' claims from different OAuth2 Token scopes implementations | ExpressGateway_express-gateway | train |
3c6926cddc59e634d8eaa1c22cba9bf9d6dc0f7d | diff --git a/manager-bundle/src/Composer/ScriptHandler.php b/manager-bundle/src/Composer/ScriptHandler.php
index <HASH>..<HASH> 100644
--- a/manager-bundle/src/Composer/ScriptHandler.php
+++ b/manager-bundle/src/Composer/ScriptHandler.php
@@ -50,27 +50,25 @@ class ScriptHandler
$fs->ensureDirectoryExists($binDir);
$fs->ensureDirectoryExists($varDir);
- $consoleInstalled = static::installContaoConsole(
+ static::installContaoConsole(
static::findContaoConsole($composer),
$binDir . '/console',
$fs->findShortestPath($binDir, $vendorDir, true),
$fs->findShortestPath($binDir, $varDir, true)
);
- if ($consoleInstalled) {
- $event->getIO()->write(' Added the console entry point.', false);
-
- self::executeCommand(
- sprintf(
- '%s/console contao:generate-entry-points --ansi --web-dir=%s --var-dir=%s --vendor-dir=%s --force',
- escapeshellarg($extra['symfony-bin-dir']),
- escapeshellarg($extra['symfony-web-dir']),
- escapeshellarg($extra['symfony-var-dir']),
- escapeshellarg($fs->findShortestPath(getcwd(), $vendorDir, true))
- ),
- $event
- );
- }
+ $event->getIO()->write(' Added the console entry point.', false);
+
+ self::executeCommand(
+ sprintf(
+ '%s/console contao:install-web-dir --ansi --web-dir=%s --var-dir=%s --vendor-dir=%s --force',
+ escapeshellarg($extra['symfony-bin-dir']),
+ escapeshellarg($extra['symfony-web-dir']),
+ escapeshellarg($extra['symfony-var-dir']),
+ escapeshellarg($fs->findShortestPath(getcwd(), $vendorDir, true))
+ ),
+ $event
+ );
}
private static function installContaoConsole($filePath, $installTo, $vendorDir, $kernelRootDir)
@@ -86,12 +84,11 @@ class ScriptHandler
);
if (file_put_contents($installTo, $content) > 0) {
- chmod($installTo, 0755);
-
- return true;
+ @chmod($installTo, 0755);
+ return;
}
- return false;
+ throw new \UnderflowException('Contao console script could not be installed.');
}
private static function findContaoConsole(Composer $composer)
@@ -102,7 +99,7 @@ class ScriptHandler
}
}
- throw new \UnderflowException('Contao console script could not be installed');
+ throw new \UnderflowException('Contao console script was not found.');
}
/** | [Manager] Adjust composer script handler to use new command and throw exceptions on errors | contao_contao | train |
8e01c93577be5ac7cb2545f2292b573434313f77 | diff --git a/lib/api_client_base/request.rb b/lib/api_client_base/request.rb
index <HASH>..<HASH> 100644
--- a/lib/api_client_base/request.rb
+++ b/lib/api_client_base/request.rb
@@ -59,8 +59,12 @@ module APIClientBase
end
def default_uri
- uri = URI(host)
- uri.path = api_client_base_path if !api_client_base_path.nil?
+ uri = if !api_client_base_path.nil?
+ URI.join(host, api_client_base_path)
+ else
+ URI(host)
+ end
+
uri.to_s
end | Use URI.join to support appending a path to hosts that already have a path | bloom-solutions_api_client_base-ruby | train |
df18be74a34afca43accfa98322d53eb27e5ac04 | diff --git a/test/integration/rtpbroadcast.js b/test/integration/rtpbroadcast.js
index <HASH>..<HASH> 100644
--- a/test/integration/rtpbroadcast.js
+++ b/test/integration/rtpbroadcast.js
@@ -66,8 +66,10 @@ describe('Rtpbroadcast tests', function() {
})
.then(function(response) {
var list = response.getData('list');
- assert.equal(list.length, 1);
- assert.equal(list[0]['id'], mountpointId);
+ var createdMountpoint = jQuery.grep(list, function(mountpoint) {
+ return mountpoint.id == mountpointId;
+ });
+ assert.equal(createdMountpoint.length, 1);
return rtpbroadcastPlugin.destroy(mountpointId);
})
.then(function(response) { | Fix rtpbroadcast integration test | cargomedia_janus-gateway-js | train |
8eaf3303c2486a3edc067d81aa34a9645f316c34 | diff --git a/spec/public/lawnchair-spec.js b/spec/public/lawnchair-spec.js
index <HASH>..<HASH> 100644
--- a/spec/public/lawnchair-spec.js
+++ b/spec/public/lawnchair-spec.js
@@ -145,6 +145,14 @@ context('Lawnchair', function(){
});
});
+ should( 'get 10 items in a page.', function() {
+ store.nuke();
+ for (var i = 0; i < 300; i++) {
+ store.save({key: i, value: "test" + i});
+ }
+ store.paged(1,'equals(r.length, 10); start();');
+ });
+
// ---
});
diff --git a/src/Lawnchair.js b/src/Lawnchair.js
index <HASH>..<HASH> 100644
--- a/src/Lawnchair.js
+++ b/src/Lawnchair.js
@@ -22,6 +22,7 @@ Lawnchair.prototype = {
'blackberry':window.BlackBerryPersistentStorageAdaptor
};
this.adaptor = opts.adaptor ? new adaptors[opts.adaptor](opts) : new WebkitSQLiteAdaptor(opts);
+
// Check for native JSON functions.
if (!JSON || !JSON.stringify) throw "Native JSON functions unavailable - please include http://www.json.org/json2.js or run on a decent browser :P";
},
@@ -44,6 +45,9 @@ Lawnchair.prototype = {
// Removes all documents from a store and returns self.
nuke:function(callback) {this.adaptor.nuke(callback);return this},
+ // Returns a page of results based on offset provided by user and perPage option
+ paged:function(page, callback) {this.adaptor.paged(page, callback)},
+
/**
* Iterator that accepts two paramters (methods or eval strings):
*
diff --git a/src/adaptors/WebkitSQLiteAdaptor.js b/src/adaptors/WebkitSQLiteAdaptor.js
index <HASH>..<HASH> 100644
--- a/src/adaptors/WebkitSQLiteAdaptor.js
+++ b/src/adaptors/WebkitSQLiteAdaptor.js
@@ -25,6 +25,7 @@ WebkitSQLiteAdaptor.prototype = {
this.display = merge('shed', opts.display );
this.max = merge(65536, opts.max );
this.db = merge(null, opts.db );
+ this.perPage = merge(10, opts.perPage );
// default sqlite callbacks
this.onError = function(){};
@@ -141,6 +142,29 @@ WebkitSQLiteAdaptor.prototype = {
that.onError);
});
},
+ paged:function(page, callback) {
+ var cb = this.terseToVerboseCallback(callback);
+ var that = this;
+ this.db.transaction(function(t) {
+ var offset = that.perPage * (page - 1); // a little offset math magic so users don't have to be 0-based
+ var sql = "SELECT * FROM " + that.table + " ORDER BY timestamp ASC LIMIT ? OFFSET ?";
+ t.executeSql(sql, [that.perPage, offset], function(tx, results) {
+ if (results.rows.length == 0 ) {
+ cb([]);
+ } else {
+ var r = [];
+ for (var i = 0, l = results.rows.length; i < l; i++) {
+ var raw = results.rows.item(i).value;
+ var obj = that.deserialize(raw);
+ obj.key = results.rows.item(i).id;
+ r.push(obj);
+ }
+ cb(r);
+ }
+ },
+ that.onError);
+ });
+ },
remove:function(keyOrObj, callback) {
var that = this;
if (callback) | Add paging to Lawnchair, at least for Webkit.
The default page size is <I> records but can be modified
via options when initializing the Lawnchair. | brianleroux_lawnchair | train |
7e73d16f0efc904af6ee7cd978f7cc8993d598a9 | diff --git a/setup.py b/setup.py
index <HASH>..<HASH> 100755
--- a/setup.py
+++ b/setup.py
@@ -20,8 +20,8 @@ __requires__ = 'setuptools >= 3.0.0'
try:
from setuptools import setup, Extension, find_packages, __version__ as stools_ver
except:
- print "Looks like your version of setuptools is too old. You should use " \
- "provided ez_setup.py to upgrade your installation."
+ print "Looks like your version (%s) of setuptools is too old. You should use " \
+ "provided ez_setup.py to upgrade your installation." % stools_ver
sys.exit(1)
""" | [setup] print version, if required version is not found. | markovmodel_PyEMMA | train |
42eb640ac73253c869b0eac8707500ff95429e0c | diff --git a/dist/pptxgen.js b/dist/pptxgen.js
index <HASH>..<HASH> 100644
--- a/dist/pptxgen.js
+++ b/dist/pptxgen.js
@@ -52,6 +52,7 @@ Number.isInteger = Number.isInteger || function(value) {
// Detect Node.js (NODEJS is ultimately used to determine how to save: either `fs` or web-based, so using fs-detection is perfect)
var NODEJS = false;
+var APPJS = false;
{
// NOTE: `NODEJS` determines which network library to use, so using fs-detection is apropos.
if ( typeof module !== 'undefined' && module.exports && typeof require === 'function' && typeof window === 'undefined' ) {
@@ -63,11 +64,13 @@ var NODEJS = false;
NODEJS = false;
}
}
+ else if ( typeof module !== 'undefined' && module.exports && typeof require === 'function' && typeof window !== 'undefined') {
+ APPJS = true;
+ }
}
-// [Node.js] <script> includes
-// TODO: Issue #137 (move these to very bottom where other require()s are)
-if ( NODEJS ) {
+// Require [include] colors/shapes for Node/Angular/React, etc.
+if ( NODEJS || APPJS ) {
var gObjPptxColors = require('../dist/pptxgen.colors.js');
var gObjPptxShapes = require('../dist/pptxgen.shapes.js');
}
@@ -75,7 +78,7 @@ if ( NODEJS ) {
var PptxGenJS = function(){
// APP
var APP_VER = "2.5.0-beta";
- var APP_BLD = "20190126";
+ var APP_BLD = "20190204";
// CONSTANTS
var MASTER_OBJECTS = {
@@ -161,7 +164,7 @@ var PptxGenJS = function(){
// A: Create internal pptx object
var gObjPptx = {};
- // B: Set Presentation Property Defaults
+ // B: Set Presentation property defaults
{
// Presentation props/metadata
gObjPptx.author = 'PptxGenJS';
@@ -5592,7 +5595,7 @@ function getUuid(uuidFormat) {
});
}
-// [Node.js] support
+// NodeJS support
if ( NODEJS ) {
var jQuery = null;
var fs = null;
@@ -5612,17 +5615,17 @@ if ( NODEJS ) {
try { JSZip = require("jszip"); } catch(ex){ console.error("Unable to load `jszip`"); throw 'LIB-MISSING-JSZIP'; }
try { sizeOf = require("image-size"); } catch(ex){ console.error("Unable to load `image-size`"); throw 'LIB-MISSING-IMGSIZE'; }
- // C: Export module
+ // LAST: Export module
module.exports = PptxGenJS;
}
-// Angular support
-else if ( typeof module !== 'undefined' && module.exports && typeof require === 'function' && typeof window !== 'undefined') {
+// Angular/React/etc support
+else if ( APPJS ) {
// A: jQuery dependency
try { jQuery = require("jquery"); } catch(ex){ console.error("Unable to load `jquery`!\n"+ex); throw 'LIB-MISSING-JQUERY'; }
// B: Other dependencies
try { JSZip = require("jszip"); } catch(ex){ console.error("Unable to load `jszip`"); throw 'LIB-MISSING-JSZIP'; }
- // C: Export module
+ // LAST: Export module
module.exports = PptxGenJS;
}
diff --git a/examples/nodejs-demo.js b/examples/nodejs-demo.js
index <HASH>..<HASH> 100644
--- a/examples/nodejs-demo.js
+++ b/examples/nodejs-demo.js
@@ -1,7 +1,7 @@
/*
* NAME: nodejs-demo.js
* AUTH: Brent Ely (https://github.com/gitbrent/)
- * DATE: 20181023
+ * DATE: 20190204
* DESC: PptxGenJS feature demos for Node.js
* REQS: npm 4.x + `npm install pptxgenjs`
*
@@ -92,6 +92,8 @@ else {
var pptx = new PptxGenJS();
var slide = pptx.addNewSlide();
slide.addText( 'New Node Presentation', {x:1.5, y:1.5, w:6, h:2, margin:0.1, fill:'FFFCCC'} );
+ // Test that `pptxgen.shapes.js` was loaded/is available
+ slide.addShape(pptx.shapes.OVAL_CALLOUT, { x:6, y:2, w:3, h:2, fill:'00FF00', line:'000000', lineSize:1 });
// **NOTE**: Only uncomment one EXAMPLE at a time | made shapes and colors libraries available to front end apps (Issue #<I>) | gitbrent_PptxGenJS | train |
0b3980a0c18fb3a99f6e8f9a79a0060bf8a19d4d | diff --git a/tests/conftest.py b/tests/conftest.py
index <HASH>..<HASH> 100644
--- a/tests/conftest.py
+++ b/tests/conftest.py
@@ -47,7 +47,8 @@ def UnboundUser(engine):
age = bloop.Column(bloop.Integer)
name = bloop.Column(bloop.String)
email = bloop.Column(bloop.String)
- joined = bloop.Column(bloop.DateTime)
+ # Field with dynamo_name != model_name
+ joined = bloop.Column(bloop.DateTime, name="j")
by_email = bloop.GlobalSecondaryIndex(hash_key="email",
projection="all")
diff --git a/tests/test_filter.py b/tests/test_filter.py
index <HASH>..<HASH> 100644
--- a/tests/test_filter.py
+++ b/tests/test_filter.py
@@ -181,7 +181,7 @@ def test_select_specific(engine, User):
result = q.select([User.email, User.joined]).all()
expected = {"Select": "SPECIFIC_ATTRIBUTES",
- "ExpressionAttributeNames": {"#n0": "email", "#n1": "joined",
+ "ExpressionAttributeNames": {"#n0": "email", "#n1": "j",
"#n2": "id"},
"ScanIndexForward": True,
"ExpressionAttributeValues": {":v3": {"S": str(user_id)}},
diff --git a/tests/test_model.py b/tests/test_model.py
index <HASH>..<HASH> 100644
--- a/tests/test_model.py
+++ b/tests/test_model.py
@@ -1,3 +1,4 @@
+import arrow
import uuid
import bloop.column
import bloop.index
@@ -12,7 +13,7 @@ def test_default_model_init(User):
""" Missing attributes are set to `None` """
user = User(id=uuid.uuid4(), email="[email protected]")
assert user.email == "[email protected]"
- assert user.name is None
+ assert not hasattr(user, "name")
def test_load_default_init(engine, local_bind):
@@ -56,12 +57,15 @@ def test_load_dump(User):
""" _load and _dump should be symmetric """
user_id = uuid.uuid4()
- user = User(id=user_id, name="name", email="[email protected]", age=25)
+ now = arrow.now()
+ user = User(id=user_id, name="name", email="[email protected]", age=25,
+ joined=now)
serialized_user = {
"id": {"S": str(user_id)},
"age": {"N": "25"},
"name": {"S": "name"},
- "email": {"S": "[email protected]"}
+ "email": {"S": "[email protected]"},
+ "j": {"S": now.to("utc").isoformat()}
}
assert User._load(serialized_user) == user | Add field with different dynamo_name to test User | numberoverzero_bloop | train |
ac6c25f7629011c9a51692e684b1e1db3422585d | diff --git a/spacy/_ml.py b/spacy/_ml.py
index <HASH>..<HASH> 100644
--- a/spacy/_ml.py
+++ b/spacy/_ml.py
@@ -381,7 +381,8 @@ def fine_tune(embedding, combine=None):
flat_grad = model.ops.flatten(d_output)
model.d_mix[1] += flat_tokvecs.dot(flat_grad.T).sum()
model.d_mix[0] += flat_vecs.dot(flat_grad.T).sum()
- sgd(model._mem.weights, model._mem.gradient, key=model.id)
+ if sgd is not None:
+ sgd(model._mem.weights, model._mem.gradient, key=model.id)
return d_output
return output, fine_tune_bwd
model = wrap(fine_tune_fwd, embedding) | Check SGD is not None in update | explosion_spaCy | train |
3a773d6fd2e5a4c60ae093c16eedfdc6518ec46c | diff --git a/tests/HigherOrderInput.test.js b/tests/HigherOrderInput.test.js
index <HASH>..<HASH> 100644
--- a/tests/HigherOrderInput.test.js
+++ b/tests/HigherOrderInput.test.js
@@ -64,9 +64,7 @@ describe('ListInput', () => {
const wrapper = mount(
<ListInput ofType={GraphQLString} onChange={() => {}} />
);
- wrapper.find('input[type="button"]').simulate('click');
-
- expect(wrapper.find('input[type="text"]').length).toEqual(2);
+ expect(wrapper.find('input[type="button"]').prop('value')).toEqual('+');
});
it('displays nested button to add item for nested lists', async () => {
@@ -74,11 +72,43 @@ describe('ListInput', () => {
<ListInput ofType={new GraphQLList(GraphQLString)} onChange={() => {}} />
);
wrapper.find('input[type="button"]').forEach(w => w.simulate('click'));
-
expect(wrapper.find('input[type="text"]').length).toEqual(3);
});
- // TODO test add
+ it('does not display remove button for list with one item', () => {
+ const wrapper = mount(
+ <ListInput ofType={GraphQLString} onChange={() => {}} />
+ );
+ expect(wrapper.find('input[type="text"]').length).toEqual(1);
+ });
+
+ it('displays remove button for list with more than one item', () => {
+ const wrapper = mount(
+ <ListInput ofType={GraphQLString} onChange={() => {}} />
+ );
+ wrapper.find('input[type="button"]').simulate('click');
+ expect(wrapper.find('input[type="button"]').length).toEqual(3);
+ });
+
+ it('clicking remove button removes item from list', () => {
+ const wrapper = mount(
+ <ListInput ofType={GraphQLString} onChange={() => {}} />
+ );
+ wrapper.find('input[type="button"]').simulate('click'); // add
+ wrapper
+ .find('input[type="button"]')
+ .first()
+ .simulate('click'); // remove
+ expect(wrapper.find('input[type="text"]').length).toEqual(1);
+ });
+
+ it('clicking add button adds new item to list', () => {
+ const wrapper = mount(
+ <ListInput ofType={GraphQLString} onChange={() => {}} />
+ );
+ wrapper.find('input[type="button"]').simulate('click');
+ expect(wrapper.find('input[type="text"]').length).toEqual(2);
+ });
});
const setInput = 0;
diff --git a/tests/HigherOrderOutput.test.js b/tests/HigherOrderOutput.test.js
index <HASH>..<HASH> 100644
--- a/tests/HigherOrderOutput.test.js
+++ b/tests/HigherOrderOutput.test.js
@@ -158,4 +158,12 @@ describe('ObjectOutput', () => {
));
expect(value.x.selected).toNotExist();
});
+
+ it('field arguments are displayed', () => {
+ const fields = {
+ data: { args: [{ name: 'x', type: GraphQLInt }], type: GraphQLString }
+ };
+ const wrapper = wrap({ name: '', fields });
+ expect(wrapper.find('input[type="number"]').exists()).toExist();
+ });
}); | test(args): Add tests for removing items from lists and displaying arguments | pi-cubed_typed-ui | train |
9d6351fd5a79ea708802279555957e0053930d71 | diff --git a/wffweb/src/main/java/com/webfirmframework/wffweb/css/UrlCss3Value.java b/wffweb/src/main/java/com/webfirmframework/wffweb/css/UrlCss3Value.java
index <HASH>..<HASH> 100644
--- a/wffweb/src/main/java/com/webfirmframework/wffweb/css/UrlCss3Value.java
+++ b/wffweb/src/main/java/com/webfirmframework/wffweb/css/UrlCss3Value.java
@@ -58,10 +58,13 @@ public class UrlCss3Value extends AbstractBean<UrlCss3Value> {
* @since 1.0.0
* @author WFF
*/
- private void extractAndAssign(String urlString) {
- urlString = urlString.trim();
- if (urlString.startsWith("url(") && urlString.contains(")")) {
- final String[] urlStringParts = urlString.split("[)]");
+ private void extractAndAssign(final String urlString) {
+
+ final String urlStringTrimmed = urlString.trim();
+
+ if (urlStringTrimmed.startsWith("url(")
+ && urlStringTrimmed.contains(")")) {
+ final String[] urlStringParts = urlStringTrimmed.split("[)]");
String extractedUrl = urlStringParts[0]
.substring(urlStringParts[0].indexOf('('));
@@ -85,7 +88,7 @@ public class UrlCss3Value extends AbstractBean<UrlCss3Value> {
}
}
} else {
- throw new InvalidValueException(urlString
+ throw new InvalidValueException(urlStringTrimmed
+ " is not a valid url string. It should be in the format of url(\"Test.png\")75 158 or url(\"Testing.png\")");
}
} | Code improvement
Avoided reassigning parameters such as 'urlString' | webfirmframework_wff | train |
bc975100698ed0b1a63efc2f2a9699bb8a738226 | diff --git a/src/Socket.php b/src/Socket.php
index <HASH>..<HASH> 100644
--- a/src/Socket.php
+++ b/src/Socket.php
@@ -479,7 +479,7 @@ class Socket implements Stringable
$return = @socket_import_stream($stream);
if ($return === false || is_null($return)) {
- throw new SocketException($stream);
+ throw new SocketException($stream instanceof Socketresource ? $stream : null);
}
return new self($return);
@@ -802,6 +802,7 @@ class Socket implements Stringable
public function setBlocking(bool $bool): void
{
$this->checkInvalidResourceState();
+
if ($bool) {
@socket_set_block($this->resource);
} else { | Don't pass non-socket resource to SocketException | navarr_Sockets | train |
621b3f70382d283bdd3f40bc845848f5c39d2a2a | diff --git a/lib/networking/voicetransports/VoiceTransportBase.js b/lib/networking/voicetransports/VoiceTransportBase.js
index <HASH>..<HASH> 100644
--- a/lib/networking/voicetransports/VoiceTransportBase.js
+++ b/lib/networking/voicetransports/VoiceTransportBase.js
@@ -139,7 +139,7 @@ class VoiceTransportBase {
const decryptedPacket = new Buffer(packet.length - 16);
header.copy(decryptedPacket);
- for (let i = 0; i < decrypted.length; i++) {
+ for (var i = 0, len = decrypted.length; i < len; i++) {
decryptedPacket[12 + i] = decrypted[i];
}
@@ -172,20 +172,21 @@ class VoiceTransportBase {
const rtpPacket = this.rtpPacket;
this.header.copy(this.rtpPacket, 0, 0, 12);
- for (let i = 0; i < packet.length; i++) {
+ for (var i = 0, len = packet.length; i < len; i++) {
rtpPacket[12 + i] = packet[i];
}
this.sequence++;
this.timestamp += sampleCount;
- this.sequence %= 0xFFFF + 1;
- this.timestamp %= 0xFFFFFFFF + 1;
+ if (this.sequence >= 0xFFFF) this.sequence %= 0xFFFF + 1;
+ if (this.timestamp >= 0xFFFFFFFF) this.timestamp %= 0xFFFFFFFF + 1;
this.packetsSent++;
- this.packetsSent %= 0xFFFFFFFF + 1;
this.bytesMuxed += packetLength;
- this.bytesMuxed %= 0xFFFFFFFF + 1;
+
+ if (this.packetsSent >= 0xFFFFFFFF) this.packetsSent %= 0xFFFFFFFF + 1;
+ if (this.bytesMuxed >= 0xFFFFFFFF) this.bytesMuxed %= 0xFFFFFFFF + 1;
return rtpPacket.slice(0, packet.length + 12);
} | Optimize muxing packet copy loops | qeled_discordie | train |
f27bd985ee1cf5d7e6d7e30bf0ed55487161c1f5 | diff --git a/server.js b/server.js
index <HASH>..<HASH> 100644
--- a/server.js
+++ b/server.js
@@ -291,8 +291,9 @@ function sendMessage(fromDevice, data, fn){
if(!check.error){
if(securityImpl.canSend(fromDevice, check)){
- //to phone, but not from same phone
- if(check.phoneNumber && (clonedMsg.fromPhone !== check.phoneNumber)){
+ // //to phone, but not from same phone
+ // if(check.phoneNumber && (clonedMsg.fromPhone !== check.phoneNumber)){
+ if(check.phoneNumber && check.type == "outboundSMS")){
// SMS handler
console.log("Sending SMS to", check.phoneNumber);
require('./lib/sendSms')(device, JSON.stringify(clonedMsg.payload), function(sms){ | added check for type=outboundSMS to sendMessages check | octoblu_meshblu | train |
Subsets and Splits