Datasets:
Maxscha
/
structured-instructions-schema

Dataset card Data Studio Files Community
1
input
stringlengths
159
2.05k
output
stringlengths
5
10.3k
task
stringclasses
1 value
schema
stringlengths
100
1.99k
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"parent": {"type": "string"}, "textures": {"type": "object", "properties": {"bottom": {"type": "string"}, "top": {"type": "string"}, "side": {"type": "string"}}, "required": ["bottom", "top", "side"]}}, "required": ["parent", "textures"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"parent" : "block/outer_stairs", "textures" : {"bottom" : "conquest:block/2_advanced_refined/2_metal/rusted_red_painted_metal_plating", "top" : "conquest:block/2_advanced_refined/2_metal/rusted_red_painted_metal_plating", "side" : "conquest:block/2_advanced_refined/2_metal/rusted_red_painted_metal_plating"}}
json_instruct
{"type": "object", "properties": {"parent": {"type": "string"}, "textures": {"type": "object", "properties": {"bottom": {"type": "string"}, "top": {"type": "string"}, "side": {"type": "string"}}, "required": ["bottom", "top", "side"]}}, "required": ["parent", "textures"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
[["210112018001", "\u65b0\u5854\u793e\u533a", "111", "0"], ["210112018002", "\u4ed9\u5854\u793e\u533a", "111", "0"], ["210112018003", "\u4e0a\u6df1\u793e\u533a", "111", "0"], ["210112018004", "\u4e0b\u6df1\u793e\u533a", "111", "0"], ["210112018005", "\u9e21\u51a0\u793e\u533a", "111", "0"], ["210112018006", "\u5854\u4e1c\u793e\u533a", "112", "0"], ["210112018007", "\u5854\u5317\u793e\u533a", "112", "0"], ["210112018008", "\u767d\u5854\u793e\u533a", "112", "0"], ["210112018009", "\u706b\u77f3\u793e\u533a", "112", "0"], ["210112018010", "\u5854\u5357\u793e\u533a", "111", "0"], ["210112018011", "\u9752\u5806\u5b50\u793e\u533a", "220", "0"], ["210112018012", "\u9ad8\u4e09\u5bb6\u5b50\u793e\u533a", "111", "0"], ["210112018013", "\u82cf\u5bb6\u5c97\u5b50\u793e\u533a", "112", "0"], ["210112018014", "\u5c0f\u7f8a\u5b89\u793e\u533a", "112", "0"], ["210112018015", "\u5927\u5f20\u5c14\u793e\u533a", "112", "0"], ["210112018016", "\u5c0f\u5f20\u5c14\u793e\u533a", "220", "0"], ["210112018017", "\u6be1\u5320\u5821\u793e\u533a", "220", "0"], ["210112018018", "\u5927\u7f8a\u5b89\u793e\u533a", "111", "0"], ["210112018019", "\u4e0a\u9752\u793e\u533a", "111", "0"], ["210112018020", "\u4e3d\u666f\u793e\u533a", "111", "0"], ["210112018021", "\u4e3d\u57ce\u793e\u533a", "111", "0"], ["210112018022", "\u5eca\u6865\u793e\u533a", "111", "0"], ["210112018023", "\u767e\u8377\u793e\u533a", "111", "0"], ["210112018024", "\u9686\u6cb3\u8c37\u793e\u533a", "111", "0"], ["210112018025", "\u7406\u60f3\u65b0\u57ce\u793e\u533a", "111", "0"], ["210112018026", "\u90e1\u539f\u793e\u533a", "111", "0"], ["210112018027", "\u5168\u8fd0\u6751\u793e\u533a", "220", "0"], ["210112018028", "\u83ab\u5b50\u5c71\u793e\u533a", "220", "0"], ["210112018029", "\u4e8e\u5c71\u793e\u533a", "220", "0"], ["210112018030", "\u8317\u5c45\u793e\u533a", "111", "0"], ["210112018031", "\u53cc\u6df1\u793e\u533a", "111", "0"], ["210112018032", "\u53cc\u7f8a\u793e\u533a", "111", "0"], ["210112018033", "\u5e9c\u57ce\u793e\u533a", "111", "0"]]
json_instruct
{"type": "array", "items": {"type": "array", "items": {"type": "string"}}, "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"parent" : "ordanas_inferno:block/polished_limestone_brick_stairs"}
json_instruct
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"body" : "WHEREBY IT APPEARS, THAT TO THE MEASURING THE DURATION OF ANY THING BY TIME,", "next" : "https://raw.githubusercontent.com/CAPSELOCKE/CAPSELOCKE/master/tweets/3013.json"}
json_instruct
{"type": "object", "properties": {"body": {"type": "string"}, "next": {"type": "string"}}, "required": ["body", "next"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ast" : null, "code" : "export { Trans } from './Trans';\nexport { useTranslation } from './useTranslation';\nexport { withTranslation } from './withTranslation';\nexport { Translation } from './Translation';\nexport { I18nextProvider } from './I18nextProvider';\nexport { withSSR } from './withSSR';\nexport { useSSR } from './useSSR';\nexport { I18nContext, initReactI18next, setDefaults, getDefaults, setI18n, getI18n, composeInitialProps, getInitialProps } from './context';", "map" : {"version" : 3, "sources" : ["/home/mohamed/Desktop/projects/oxycare/node_modules/react-i18next/dist/es/index.js"], "names" : ["Trans", "useTranslation", "withTranslation", "Translation", "I18nextProvider", "withSSR", "useSSR", "I18nContext", "initReactI18next", "setDefaults", "getDefaults", "setI18n", "getI18n", "composeInitialProps", "getInitialProps"], "mappings" : "AAAA,SAASA,KAAT,QAAsB,SAAtB;AACA,SAASC,cAAT,QAA+B,kBAA/B;AACA,SAASC,eAAT,QAAgC,mBAAhC;AACA,SAASC,WAAT,QAA4B,eAA5B;AACA,SAASC,eAAT,QAAgC,mBAAhC;AACA,SAASC,OAAT,QAAwB,WAAxB;AACA,SAASC,MAAT,QAAuB,UAAvB;AACA,SAASC,WAAT,EAAsBC,gBAAtB,EAAwCC,WAAxC,EAAqDC,WAArD,EAAkEC,OAAlE,EAA2EC,OAA3E,EAAoFC,mBAApF,EAAyGC,eAAzG,QAAgI,WAAhI", "sourcesContent" : ["export { Trans } from './Trans';\nexport { useTranslation } from './useTranslation';\nexport { withTranslation } from './withTranslation';\nexport { Translation } from './Translation';\nexport { I18nextProvider } from './I18nextProvider';\nexport { withSSR } from './withSSR';\nexport { useSSR } from './useSSR';\nexport { I18nContext, initReactI18next, setDefaults, getDefaults, setI18n, getI18n, composeInitialProps, getInitialProps } from './context';"]}, "metadata" : {}, "sourceType" : "module"}
json_instruct
{"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"id": {"type": "integer"}, "group": {"type": "string"}, "joblink": {"type": "boolean"}, "name": {"type": "string"}, "potential": {"type": "integer"}, "skills": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "skill": {"type": "string"}, "replaceable": {"type": "boolean"}}, "required": ["id", "skill", "replaceable"]}}}, "required": ["id", "group", "joblink", "name", "potential", "skills"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 59219, "group" : "72304105", "joblink" : true, "name" : "Betriebswirt/in (Hochschule) - Steuern und Pr\u00fcfungswesen", "potential" : 67, "skills" : [{"id" : 60777, "skill" : "Gutachter-, Sachverst\u00e4ndigent\u00e4tigkeit", "replaceable" : false}, {"id" : 62220, "skill" : "Buchf\u00fchrung, Buchhaltung", "replaceable" : true}, {"id" : 62234, "skill" : "Kosten- und Leistungsrechnung", "replaceable" : true}, {"id" : 62252, "skill" : "Kalkulation", "replaceable" : true}, {"id" : 62288, "skill" : "Controlling", "replaceable" : false}, {"id" : 62303, "skill" : "Personalwesen", "replaceable" : false}, {"id" : 62403, "skill" : "Abgabenordnung", "replaceable" : true}, {"id" : 62484, "skill" : "Steuerrecht", "replaceable" : true}, {"id" : 62531, "skill" : "Gewerbesteuer", "replaceable" : true}, {"id" : 62535, "skill" : "Jahresabschluss", "replaceable" : true}, {"id" : 62536, "skill" : "K\u00f6rperschaftssteuer", "replaceable" : true}, {"id" : 62537, "skill" : "Lohn-, Einkommensteuer", "replaceable" : true}, {"id" : 62541, "skill" : "Steuerbescheide pr\u00fcfen", "replaceable" : true}, {"id" : 62542, "skill" : "Steuererkl\u00e4rungen anfertigen", "replaceable" : true}, {"id" : 62543, "skill" : "Steuergestaltung", "replaceable" : false}, {"id" : 62548, "skill" : "Umsatzsteuer", "replaceable" : true}, {"id" : 64043, "skill" : "Betriebswirtschaftslehre", "replaceable" : false}, {"id" : 64044, "skill" : "Finanzwirtschaft", "replaceable" : false}]}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "group": {"type": "string"}, "joblink": {"type": "boolean"}, "name": {"type": "string"}, "potential": {"type": "integer"}, "skills": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "skill": {"type": "string"}, "replaceable": {"type": "boolean"}}, "required": ["id", "skill", "replaceable"]}}}, "required": ["id", "group", "joblink", "name", "potential", "skills"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "9471020008", "district_id" : "9471020", "name" : "AWIYO"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"url": {"type": "string"}, "sha1": {"type": "string"}}, "required": ["url", "sha1"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"url" : "https://static.wikia.nocookie.net/griftlands_gamepedia_en/images/e/e8/Steven_portrait.png/revision/latest?cb=20210709142243", "sha1" : "010f33717cd4ddd133bc123dd473896a883628fc"}
json_instruct
{"type": "object", "properties": {"url": {"type": "string"}, "sha1": {"type": "string"}}, "required": ["url", "sha1"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "properties" : {"type" : "barangay", "level" : "4", "label" : "Poblacion IV, Pozzorubio, Pangasinan, Ilocos Region (Region I), PH", "locale" : "ph.ilocos-region-region-i.pangasinan.pozzorubio.poblacion-iv", "country_id" : 177, "country_reference" : 177, "country_name" : "Philippines", "region_id" : "11", "region_reference" : "1", "region_name" : "Ilocos Region (Region I)", "province_id" : "61", "province_reference" : "61", "province_name" : "Pangasinan", "city_id" : "1055", "city_reference" : "1268", "city_name" : "Pozzorubio", "barangay_id" : "30111", "barangay_reference" : "32827", "barangay_name" : "Poblacion IV"}, "geometry" : {"type" : "MultiPolygon", "coordinates" : [[[[120.54734, 16.117399], [120.547279, 16.116449], [120.547287, 16.116261], [120.546173, 16.11537], [120.545128, 16.11418], [120.54483, 16.11282], [120.544647, 16.11199], [120.544273, 16.111231], [120.543297, 16.11042], [120.54261, 16.10985], [120.54232, 16.1096], [120.541298, 16.109631], [120.54071, 16.11006], [120.537987, 16.11186], [120.537956, 16.115339], [120.537987, 16.11705], [120.543327, 16.117201], [120.54734, 16.117399]]]]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"type": {"type": "string"}, "level": {"type": "string"}, "label": {"type": "string"}, "locale": {"type": "string"}, "country_id": {"type": "integer"}, "country_reference": {"type": "integer"}, "country_name": {"type": "string"}, "region_id": {"type": "string"}, "region_reference": {"type": "string"}, "region_name": {"type": "string"}, "province_id": {"type": "string"}, "province_reference": {"type": "string"}, "province_name": {"type": "string"}, "city_id": {"type": "string"}, "city_reference": {"type": "string"}, "city_name": {"type": "string"}, "barangay_id": {"type": "string"}, "barangay_reference": {"type": "string"}, "barangay_name": {"type": "string"}}, "required": ["type", "level", "label", "locale", "country_id", "country_reference", "country_name", "region_id", "region_reference", "region_name", "province_id", "province_reference", "province_name", "city_id", "city_reference", "city_name", "barangay_id", "barangay_reference", "barangay_name"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"private": {"type": "boolean"}, "workspaces": {"type": "array", "items": {"type": "string"}}, "scripts": {"type": "object", "properties": {"build:v2": {"type": "string"}, "build:v3": {"type": "string"}, "lint": {"type": "string"}, "test:v2": {"type": "string"}, "test": {"type": "string"}, "clean": {"type": "string"}}, "required": ["build:v2", "build:v3", "lint", "test:v2", "test", "clean"]}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@tabianco/eslint-config-typescript": {"type": "string"}, "eslint": {"type": "string"}, "rimraf": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@tabianco/eslint-config-typescript", "eslint", "rimraf", "typescript"]}}, "required": ["private", "workspaces", "scripts", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"private" : true, "workspaces" : ["packages/*"], "scripts" : {"build:v2" : "tsc -p packages/v2", "build:v3" : "tsc -p packages/v3", "lint" : "eslint --ext .ts --ignore-path .gitignore .", "test:v2" : "cd packages/v2 && npm run test", "test" : "npm run lint && npm run test:v2 && npm run build:v2", "clean" : "rimraf packages/*/dist packages/*/types"}, "license" : "MIT", "devDependencies" : {"@tabianco/eslint-config-typescript" : "^1.1.0", "eslint" : "^7.30.0", "rimraf" : "^3.0.2", "typescript" : "^4.3.5"}}
json_instruct
{"type": "object", "properties": {"private": {"type": "boolean"}, "workspaces": {"type": "array", "items": {"type": "string"}}, "scripts": {"type": "object", "properties": {"build:v2": {"type": "string"}, "build:v3": {"type": "string"}, "lint": {"type": "string"}, "test:v2": {"type": "string"}, "test": {"type": "string"}, "clean": {"type": "string"}}, "required": ["build:v2", "build:v3", "lint", "test:v2", "test", "clean"]}, "license": {"type": "string"}, "devDependencies": {"type": "object", "properties": {"@tabianco/eslint-config-typescript": {"type": "string"}, "eslint": {"type": "string"}, "rimraf": {"type": "string"}, "typescript": {"type": "string"}}, "required": ["@tabianco/eslint-config-typescript", "eslint", "rimraf", "typescript"]}}, "required": ["private", "workspaces", "scripts", "license", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "license": {"type": "string"}, "description": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}, "aliases": {"type": "object", "properties": {}, "required": []}}, "required": ["providers", "aliases"]}}, "required": ["laravel"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"App\\Home\\": {"type": "string"}}, "required": ["App\\Home\\"]}}, "required": ["psr-4"]}}, "required": ["name", "license", "description", "authors", "extra", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "app/home", "license" : "", "description" : "", "authors" : [{"name" : "", "email" : "[email protected]"}], "extra" : {"laravel" : {"providers" : ["App\\Home\\Providers\\HomeServiceProvider"], "aliases" : {}}}, "autoload" : {"psr-4" : {"App\\Home\\" : "src/"}}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "license": {"type": "string"}, "description": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}}, "extra": {"type": "object", "properties": {"laravel": {"type": "object", "properties": {"providers": {"type": "array", "items": {"type": "string"}}, "aliases": {"type": "object", "properties": {}, "required": []}}, "required": ["providers", "aliases"]}}, "required": ["laravel"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"App\\Home\\": {"type": "string"}}, "required": ["App\\Home\\"]}}, "required": ["psr-4"]}}, "required": ["name", "license", "description", "authors", "extra", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"word" : "Gin", "definitions" : ["A clear alcoholic spirit distilled from grain or malt and flavoured with juniper berries.", "A form of the card game rummy in which a player holding cards totalling ten or less may terminate play."], "parts-of-speech" : "Noun"}
json_instruct
{"type": "object", "properties": {"word": {"type": "string"}, "definitions": {"type": "array", "items": {"type": "string"}}, "parts-of-speech": {"type": "string"}}, "required": ["word", "definitions", "parts-of-speech"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"deviceNum": {"type": "integer"}, "deviceId": {"type": "integer"}, "shardConfig": {"type": "string"}, "shuffle": {"type": "string"}, "seed": {"type": "integer"}, "epoch": {"type": "integer"}}, "required": ["deviceNum", "deviceId", "shardConfig", "shuffle", "seed", "epoch"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"deviceNum" : 3, "deviceId" : 1, "shardConfig" : "ALL", "shuffle" : "ON", "seed" : 0, "epoch" : 2}
json_instruct
{"type": "object", "properties": {"deviceNum": {"type": "integer"}, "deviceId": {"type": "integer"}, "shardConfig": {"type": "string"}, "shuffle": {"type": "string"}, "seed": {"type": "integer"}, "epoch": {"type": "integer"}}, "required": ["deviceNum", "deviceId", "shardConfig", "shuffle", "seed", "epoch"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "values": {"type": "array", "items": {"type": "object", "properties": {"key": {"type": "string"}, "value": {"type": "string"}, "enabled": {"type": "boolean"}}, "required": ["key", "value", "enabled"]}}, "_postman_variable_scope": {"type": "string"}, "_postman_exported_at": {"type": "string"}, "_postman_exported_using": {"type": "string"}}, "required": ["id", "name", "values", "_postman_variable_scope", "_postman_exported_at", "_postman_exported_using"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "705a3e59-8ea4-4afe-9a55-e7a19d7405a3", "name" : "Sunioj dev environment", "values" : [{"key" : "baseUrl", "value" : "https://localhost:5001/api", "enabled" : true}, {"key" : "accessToken", "value" : "", "enabled" : true}, {"key" : "authUserId", "value" : "", "enabled" : true}], "_postman_variable_scope" : "environment", "_postman_exported_at" : "2021-02-27T15:34:52.610Z", "_postman_exported_using" : "Postman/8.0.6"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}, "values": {"type": "array", "items": {"type": "object", "properties": {"key": {"type": "string"}, "value": {"type": "string"}, "enabled": {"type": "boolean"}}, "required": ["key", "value", "enabled"]}}, "_postman_variable_scope": {"type": "string"}, "_postman_exported_at": {"type": "string"}, "_postman_exported_using": {"type": "string"}}, "required": ["id", "name", "values", "_postman_variable_scope", "_postman_exported_at", "_postman_exported_using"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@babel/cli": {"type": "string"}, "@babel/core": {"type": "string"}, "@babel/plugin-proposal-class-properties": {"type": "string"}, "@babel/plugin-proposal-export-default-from": {"type": "string"}, "@babel/plugin-proposal-export-namespace-from": {"type": "string"}, "@babel/plugin-transform-react-jsx-source": {"type": "string"}, "@babel/plugin-transform-typescript": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/preset-react": {"type": "string"}, "@babel/preset-typescript": {"type": "string"}, "babel-plugin-lodash": {"type": "string"}, "babel-plugin-material-ui": {"type": "string"}, "babel-plugin-relay": {"type": "string"}, "babel-plugin-styled-components": {"type": "string"}, "babel-plugin-transform-remove-console": {"type": "string"}}, "required": ["@babel/cli", "@babel/core", "@babel/plugin-proposal-class-properties", "@babel/plugin-proposal-export-default-from", "@babel/plugin-proposal-export-namespace-from", "@babel/plugin-transform-react-jsx-source", "@babel/plugin-transform-typescript", "@babel/preset-env", "@babel/preset-react", "@babel/preset-typescript", "babel-plugin-lodash", "babel-plugin-material-ui", "babel-plugin-relay", "babel-plugin-styled-components", "babel-plugin-transform-remove-console"]}}, "required": ["name", "version", "main", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "@entria/babel", "version" : "0.0.1", "main" : "index.js", "license" : "MIT", "dependencies" : {"@babel/cli" : "^7.4.4", "@babel/core" : "^7.4.4", "@babel/plugin-proposal-class-properties" : "^7.4.4", "@babel/plugin-proposal-export-default-from" : "^7.2.0", "@babel/plugin-proposal-export-namespace-from" : "^7.2.0", "@babel/plugin-transform-react-jsx-source" : "^7.0.0", "@babel/plugin-transform-typescript" : "^7.4.4", "@babel/preset-env" : "^7.4.4", "@babel/preset-react" : "^7.0.0", "@babel/preset-typescript" : "^7.3.3", "babel-plugin-lodash" : "^3.3.4", "babel-plugin-material-ui" : "^0.3.1", "babel-plugin-relay" : "^5.0.0", "babel-plugin-styled-components" : "^1.8.0", "babel-plugin-transform-remove-console" : "6.9.4"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@babel/cli": {"type": "string"}, "@babel/core": {"type": "string"}, "@babel/plugin-proposal-class-properties": {"type": "string"}, "@babel/plugin-proposal-export-default-from": {"type": "string"}, "@babel/plugin-proposal-export-namespace-from": {"type": "string"}, "@babel/plugin-transform-react-jsx-source": {"type": "string"}, "@babel/plugin-transform-typescript": {"type": "string"}, "@babel/preset-env": {"type": "string"}, "@babel/preset-react": {"type": "string"}, "@babel/preset-typescript": {"type": "string"}, "babel-plugin-lodash": {"type": "string"}, "babel-plugin-material-ui": {"type": "string"}, "babel-plugin-relay": {"type": "string"}, "babel-plugin-styled-components": {"type": "string"}, "babel-plugin-transform-remove-console": {"type": "string"}}, "required": ["@babel/cli", "@babel/core", "@babel/plugin-proposal-class-properties", "@babel/plugin-proposal-export-default-from", "@babel/plugin-proposal-export-namespace-from", "@babel/plugin-transform-react-jsx-source", "@babel/plugin-transform-typescript", "@babel/preset-env", "@babel/preset-react", "@babel/preset-typescript", "babel-plugin-lodash", "babel-plugin-material-ui", "babel-plugin-relay", "babel-plugin-styled-components", "babel-plugin-transform-remove-console"]}}, "required": ["name", "version", "main", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "ignore": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"jquery": {"type": "string"}}, "required": ["jquery"]}}, "required": ["name", "version", "description", "main", "ignore", "keywords", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "w3csspag", "version" : "0.0.1", "description" : "w3csspag - dynamic pagination jQuery plugin. Works well with W3css or standalone.", "main" : "lib/jquery.w3csspag.min.js", "ignore" : [".jshintrc", "**/*.txt"], "keywords" : ["pagination", "W3css", "jquery-plugin", "ecosystem:jquery"], "dependencies" : {"jquery" : ">=1.6"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "ignore": {"type": "array", "items": {"type": "string"}}, "keywords": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "object", "properties": {"jquery": {"type": "string"}}, "required": ["jquery"]}}, "required": ["name", "version", "description", "main", "ignore", "keywords", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[129.125, 24.083333333333332], [129.125, 24.166666666666668], [129.25, 24.166666666666668], [129.25, 24.083333333333332], [129.125, 24.083333333333332]]]}, "properties" : {"code" : 362911, "url" : "http://madefor.github.io/0410/api/v1/362911.geojson", "view" : "https://github.com/madefor/0410/blob/gh-pages/api/v1/362911.geojson"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"pools": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "entries": {"type": "array", "items": {"type": "object", "properties": {"entryName": {"type": "string"}, "weight": {"type": "integer"}, "quality": {"type": "integer"}, "type": {"type": "string"}, "name": {"type": "string"}}, "required": ["entryName", "weight", "quality", "type", "name"]}}, "rolls": {"type": "number"}}, "required": ["name", "entries", "rolls"]}}}, "required": ["pools"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"pools" : [{"name" : "fishing_swamp", "entries" : [{"entryName" : "advanced-fishing:gameplay/fishing/tier_1", "weight" : 50, "quality" : 4, "type" : "loot_table", "name" : "advanced-fishing:gameplay/fishing/tier_1"}, {"entryName" : "advanced-fishing:gameplay/fishing/swamp/tier_2", "weight" : 30, "quality" : 7, "type" : "loot_table", "name" : "advanced-fishing:gameplay/fishing/swamp/tier_2"}, {"entryName" : "advanced-fishing:gameplay/fishing/swamp/tier_3", "weight" : 15, "quality" : 8, "type" : "loot_table", "name" : "advanced-fishing:gameplay/fishing/swamp/tier_3"}, {"entryName" : "advanced-fishing:gameplay/fishing/swamp/tier_4", "weight" : 5, "quality" : 6, "type" : "loot_table", "name" : "advanced-fishing:gameplay/fishing/swamp/tier_4"}], "rolls" : 1.0}]}
json_instruct
{"type": "object", "properties": {"pools": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "entries": {"type": "array", "items": {"type": "object", "properties": {"entryName": {"type": "string"}, "weight": {"type": "integer"}, "quality": {"type": "integer"}, "type": {"type": "string"}, "name": {"type": "string"}}, "required": ["entryName", "weight", "quality", "type", "name"]}}, "rolls": {"type": "number"}}, "required": ["name", "entries", "rolls"]}}}, "required": ["pools"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"project_name": {"type": "string"}, "lang": {"type": "string"}, "meta": {"type": "array", "items": {}}, "link": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "array", "items": {}}, "template": {"type": "string"}}, "required": ["project_name", "lang", "meta", "link", "dependencies", "template"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"project_name" : "Priori Bootstrap", "lang" : "en", "meta" : [], "link" : ["<link href=\"css/bootstrap.min.css\" rel=\"stylesheet\">", "<link href=\"bootstrap-datepicker/css/bootstrap-datepicker3.css\" rel=\"stylesheet\">", "<script type=\"text/javascript\" src=\"bootstrap-datepicker/js/bootstrap-datepicker.js\"></script>", "<script type=\"text/javascript\" src=\"bootstrap-datepicker/locales/bootstrap-datepicker.en-GB.min.js\"></script>", "<script type=\"text/javascript\" src=\"js/bootstrap.min.js\"></script>"], "dependencies" : [], "template" : "template"}
json_instruct
{"type": "object", "properties": {"project_name": {"type": "string"}, "lang": {"type": "string"}, "meta": {"type": "array", "items": {}}, "link": {"type": "array", "items": {"type": "string"}}, "dependencies": {"type": "array", "items": {}}, "template": {"type": "string"}}, "required": ["project_name", "lang", "meta", "link", "dependencies", "template"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"n_dim" : 8, "n_trials" : 210, "objective" : "markowitz_skew_on_cube", "white" : "optuna_random", "black" : "platypus_cmaes", "traceback" : ["passing", "passing"], "best_val" : [0.8954944899093732, 1.0883498214408776], "best_x" : [[0.011715608713822045, 0.20923134328835302, 0.4665754491601768, 0.1485303626773572, 0.16374883987368616, 0.19077523285506615, 0.5172436873426078, 0.2460696934759531], [0.40830736058057865, 0.005512678076948996, 0.53508559154796, 0.36719353233052926, 0.04890621575279286, 0.4868370267690212, 0.012397571189660617, 0.2879367035864072]], "feval_count" : [210, 200], "n_trials_instructed" : [210, 178], "passing" : [true, true], "completed" : true, "points" : 1.0, "winner" : "optuna_random", "loser" : "platypus_cmaes"}
json_instruct
{"type": "object", "properties": {"n_dim": {"type": "integer"}, "n_trials": {"type": "integer"}, "objective": {"type": "string"}, "white": {"type": "string"}, "black": {"type": "string"}, "traceback": {"type": "array", "items": {"type": "string"}}, "best_val": {"type": "array", "items": {"type": "number"}}, "best_x": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}, "feval_count": {"type": "array", "items": {"type": "integer"}}, "n_trials_instructed": {"type": "array", "items": {"type": "integer"}}, "passing": {"type": "array", "items": {"type": "boolean"}}, "completed": {"type": "boolean"}, "points": {"type": "number"}, "winner": {"type": "string"}, "loser": {"type": "string"}}, "required": ["n_dim", "n_trials", "objective", "white", "black", "traceback", "best_val", "best_x", "feval_count", "n_trials_instructed", "passing", "completed", "points", "winner", "loser"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"home": {"type": "object", "properties": {"title": {"type": "string"}, "subtitle": {"type": "string"}, "logged": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}, "question": {"type": "string"}, "link": {"type": "object", "properties": {"homepage": {"type": "string"}, "stackoverflow": {"type": "string"}, "bugtracker": {"type": "string"}, "github": {"type": "string"}, "chat": {"type": "string"}, "follow": {"type": "string"}}, "required": ["homepage", "stackoverflow", "bugtracker", "github", "chat", "follow"]}, "like": {"type": "string"}, "github": {"type": "string"}}, "required": ["title", "subtitle", "logged", "question", "link", "like", "github"]}}, "required": ["home"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"home" : {"title" : "Welcome, Fellow Traveller!", "subtitle" : "This is your homepage", "logged" : {"message" : "You are logged in as user \"{{name1}} {{name2}}\"."}, "question" : "Check out the neighborhood ...", "link" : {"homepage" : "TiMaFe on Tour Blog", "stackoverflow" : "JHipster on Stack Overflow", "bugtracker" : "JHipster bug tracker", "github" : "Letsgo2 on github", "chat" : "JHipster public chat room", "follow" : "follow @jhipster on Twitter"}, "like" : "If you like Letsgo2, don't forget to give us a star on", "github" : "GitHub"}}
json_instruct
{"type": "object", "properties": {"home": {"type": "object", "properties": {"title": {"type": "string"}, "subtitle": {"type": "string"}, "logged": {"type": "object", "properties": {"message": {"type": "string"}}, "required": ["message"]}, "question": {"type": "string"}, "link": {"type": "object", "properties": {"homepage": {"type": "string"}, "stackoverflow": {"type": "string"}, "bugtracker": {"type": "string"}, "github": {"type": "string"}, "chat": {"type": "string"}, "follow": {"type": "string"}}, "required": ["homepage", "stackoverflow", "bugtracker", "github", "chat", "follow"]}, "like": {"type": "string"}, "github": {"type": "string"}}, "required": ["title", "subtitle", "logged", "question", "link", "like", "github"]}}, "required": ["home"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"type": {"type": "string"}, "group": {"type": "string"}, "pattern": {"type": "array", "items": {"type": "string"}}, "key": {"type": "object", "properties": {"S": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}, "W": {"type": "object", "properties": {"tag": {"type": "string"}}, "required": ["tag"]}}, "required": ["S", "W"]}, "result": {"type": "object", "properties": {"count": {"type": "integer"}, "item": {"type": "string"}}, "required": ["count", "item"]}}, "required": ["type", "group", "pattern", "key", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "crafting_shaped", "group" : "engination_landing_pad", "pattern" : ["SWS", "SWS", "SSS"], "key" : {"S" : {"item" : "stone"}, "W" : {"tag" : "wool"}}, "result" : {"count" : 6, "item" : "engination:landing_pad"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "group": {"type": "string"}, "pattern": {"type": "array", "items": {"type": "string"}}, "key": {"type": "object", "properties": {"S": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}, "W": {"type": "object", "properties": {"tag": {"type": "string"}}, "required": ["tag"]}}, "required": ["S", "W"]}, "result": {"type": "object", "properties": {"count": {"type": "integer"}, "item": {"type": "string"}}, "required": ["count", "item"]}}, "required": ["type", "group", "pattern", "key", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"usage": {"type": "string"}, "description": {"type": "array", "items": {"type": "string"}}, "params": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "array", "items": {"type": "string"}}, "optional": {"type": "boolean"}}, "required": ["name", "type", "description", "optional"]}}, "example": {"type": "array", "items": {"type": "string"}}}, "required": ["usage", "description", "params", "example"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"usage" : "<entity> setTurningAbility(<turning ability>)", "description" : ["If this is higher, helicopters can make sharper turns to match goal positions better."], "params" : [{"name" : "turning ability", "type" : "float", "description" : ["Between 0.001 and 1.0. Defaults to 0.5."], "optional" : false}], "example" : ["self setTurningAbility(0.9);"]}
json_instruct
{"type": "object", "properties": {"usage": {"type": "string"}, "description": {"type": "array", "items": {"type": "string"}}, "params": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "description": {"type": "array", "items": {"type": "string"}}, "optional": {"type": "boolean"}}, "required": ["name", "type", "description", "optional"]}}, "example": {"type": "array", "items": {"type": "string"}}}, "required": ["usage", "description", "params", "example"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"Name": {"type": "string"}, "Author": {"type": "string"}, "Version": {"type": "string"}, "Description": {"type": "string"}, "UniqueID": {"type": "string"}, "EntryDll": {"type": "string"}, "MinimumApiVersion": {"type": "string"}, "UpdateKeys": {"type": "array", "items": {}}}, "required": ["Name", "Author", "Version", "Description", "UniqueID", "EntryDll", "MinimumApiVersion", "UpdateKeys"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Name" : "The Daily Paper", "Author" : "Neat", "Version" : "1.0.0", "Description" : "Delivers a daily newspaper to the users front door containing information typically found on the TV.", "UniqueID" : "neat.newspaper", "EntryDll" : "Newspaper.dll", "MinimumApiVersion" : "3.0.0", "UpdateKeys" : []}
json_instruct
{"type": "object", "properties": {"Name": {"type": "string"}, "Author": {"type": "string"}, "Version": {"type": "string"}, "Description": {"type": "string"}, "UniqueID": {"type": "string"}, "EntryDll": {"type": "string"}, "MinimumApiVersion": {"type": "string"}, "UpdateKeys": {"type": "array", "items": {}}}, "required": ["Name", "Author", "Version", "Description", "UniqueID", "EntryDll", "MinimumApiVersion", "UpdateKeys"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "integer"}, "help": {"type": "object", "properties": {"de": {"type": "string"}, "en": {"type": "string"}, "fr": {"type": "string"}, "jp": {"type": "string"}}, "required": ["de", "en", "fr", "jp"]}, "img": {"type": "string"}, "xivdb": {"type": "string"}}, "required": ["id", "help", "img", "xivdb"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 536, "help" : {"de" : "100.000 Ordenstaler verdient.", "en" : "Earn 100,000 Serpent Seals.", "fr" : "Gagner 100 000 sceaux de compagnie gridaniens.", "jp" : "\u53cc\u86c7\u515a\u3067\u8ecd\u7968\u3092100,000\u7372\u5f97"}, "img" : "/i/062000/062952.png", "xivdb" : "/achievement/536"}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "help": {"type": "object", "properties": {"de": {"type": "string"}, "en": {"type": "string"}, "fr": {"type": "string"}, "jp": {"type": "string"}}, "required": ["de", "en", "fr", "jp"]}, "img": {"type": "string"}, "xivdb": {"type": "string"}}, "required": ["id", "help", "img", "xivdb"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"site-address": {"type": "string"}, "name": {"type": "string"}, "notes": {"type": "string"}, "ownership-status": {"type": "string"}, "point": {"type": "string"}, "minimum-net-dwellings": {"type": "string"}, "site-plan-url": {"type": "string"}, "maximum-net-dwellings": {"type": "string"}, "start-date": {"type": "string"}, "planning-permission-status": {"type": "string"}, "site": {"type": "string"}, "hectares": {"type": "string"}, "organisation": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}}, "required": ["site-address", "name", "notes", "ownership-status", "point", "minimum-net-dwellings", "site-plan-url", "maximum-net-dwellings", "start-date", "planning-permission-status", "site", "hectares", "organisation", "slug", "entity", "entry-date"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Point", "coordinates" : [-0.578807, 51.517713]}, "properties" : {"site-address" : "237-261 Wexham Road & 3-9 Grasmere Parade", "name" : "br93", "notes" : "PreApp/1069. Additional third floor of accommodation (flats); construct new 2 storey warehouse.", "ownership-status" : "not owned by a public authority", "point" : "POINT(-0.578807 51.517713)", "minimum-net-dwellings" : "0", "site-plan-url" : "http://www.slough.gov.uk/connect/analyst/mobile/#/main?mapcfg=public_brownfield_register", "maximum-net-dwellings" : "0", "start-date" : "2019-12-06", "planning-permission-status" : "not permissioned", "site" : "br93", "hectares" : "0.13", "organisation" : "local-authority-eng:SLG", "slug" : "/brownfield-land/local-authority-eng/SLG/br93", "entity" : 494058, "entry-date" : "2019-12-06"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "number"}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"site-address": {"type": "string"}, "name": {"type": "string"}, "notes": {"type": "string"}, "ownership-status": {"type": "string"}, "point": {"type": "string"}, "minimum-net-dwellings": {"type": "string"}, "site-plan-url": {"type": "string"}, "maximum-net-dwellings": {"type": "string"}, "start-date": {"type": "string"}, "planning-permission-status": {"type": "string"}, "site": {"type": "string"}, "hectares": {"type": "string"}, "organisation": {"type": "string"}, "slug": {"type": "string"}, "entity": {"type": "integer"}, "entry-date": {"type": "string"}}, "required": ["site-address", "name", "notes", "ownership-status", "point", "minimum-net-dwellings", "site-plan-url", "maximum-net-dwellings", "start-date", "planning-permission-status", "site", "hectares", "organisation", "slug", "entity", "entry-date"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"metadata": {"type": "object", "properties": {"width": {"type": "integer"}, "height": {"type": "integer"}, "name": {"type": "string"}, "projectId": {"type": "integer"}, "isPredicted": {"type": "boolean"}, "status": {"type": "string"}, "pinned": {"type": "boolean"}, "annotatorEmail": {"type": "null"}, "qaEmail": {"type": "null"}}, "required": ["width", "height", "name", "projectId", "isPredicted", "status", "pinned", "annotatorEmail", "qaEmail"]}, "comments": {"type": "array", "items": {}}, "tags": {"type": "array", "items": {}}, "instances": {"type": "array", "items": {}}}, "required": ["metadata", "comments", "tags", "instances"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"metadata" : {"width" : 1024, "height" : 768, "name" : "12_city.jpg", "projectId" : 53211, "isPredicted" : false, "status" : "NotStarted", "pinned" : false, "annotatorEmail" : null, "qaEmail" : null}, "comments" : [], "tags" : [], "instances" : []}
json_instruct
{"type": "object", "properties": {"metadata": {"type": "object", "properties": {"width": {"type": "integer"}, "height": {"type": "integer"}, "name": {"type": "string"}, "projectId": {"type": "integer"}, "isPredicted": {"type": "boolean"}, "status": {"type": "string"}, "pinned": {"type": "boolean"}, "annotatorEmail": {"type": "null"}, "qaEmail": {"type": "null"}}, "required": ["width", "height", "name", "projectId", "isPredicted", "status", "pinned", "annotatorEmail", "qaEmail"]}, "comments": {"type": "array", "items": {}}, "tags": {"type": "array", "items": {}}, "instances": {"type": "array", "items": {}}}, "required": ["metadata", "comments", "tags", "instances"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"oid": {"type": "string"}, "hafta": {"type": "integer"}, "buyukIkramiyeKazananIl": {"type": "string"}, "cekilisTarihi": {"type": "string"}, "cekilisTuru": {"type": "string"}, "rakamlar": {"type": "string"}, "rakamlarNumaraSirasi": {"type": "string"}, "devretti": {"type": "boolean"}, "devirSayisi": {"type": "integer"}, "bilenKisiler": {"type": "array", "items": {"type": "object", "properties": {"oid": {"type": "string"}, "kisiBasinaDusenIkramiye": {"type": "number"}, "kisiSayisi": {"type": "integer"}, "tur": {"type": "string"}}, "required": ["oid", "kisiBasinaDusenIkramiye", "kisiSayisi", "tur"]}}, "buyukIkrKazananIlIlceler": {"type": "array", "items": {}}}, "required": ["oid", "hafta", "buyukIkramiyeKazananIl", "cekilisTarihi", "cekilisTuru", "rakamlar", "rakamlarNumaraSirasi", "devretti", "devirSayisi", "bilenKisiler", "buyukIkrKazananIlIlceler"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"oid" : "sl_2005-10-29", "hafta" : 468, "buyukIkramiyeKazananIl" : "", "cekilisTarihi" : "29/10/2005", "cekilisTuru" : "SAYISAL_LOTO", "rakamlar" : "06#11#20#38#42#47", "rakamlarNumaraSirasi" : "6 - 11 - 20 - 38 - 42 - 47", "devretti" : true, "devirSayisi" : 0, "bilenKisiler" : [{"oid" : "sl_2005-10-29_6", "kisiBasinaDusenIkramiye" : 1059832.77, "kisiSayisi" : 0, "tur" : "$6_BILEN"}, {"oid" : "sl_2005-10-29_5", "kisiBasinaDusenIkramiye" : 1681.5, "kisiSayisi" : 347, "tur" : "$5_BILEN"}, {"oid" : "sl_2005-10-29_4", "kisiBasinaDusenIkramiye" : 12.25, "kisiSayisi" : 21675, "tur" : "$4_BILEN"}, {"oid" : "sl_2005-10-29_3", "kisiBasinaDusenIkramiye" : 2.7, "kisiSayisi" : 274341, "tur" : "$3_BILEN"}], "buyukIkrKazananIlIlceler" : []}
json_instruct
{"type": "object", "properties": {"oid": {"type": "string"}, "hafta": {"type": "integer"}, "buyukIkramiyeKazananIl": {"type": "string"}, "cekilisTarihi": {"type": "string"}, "cekilisTuru": {"type": "string"}, "rakamlar": {"type": "string"}, "rakamlarNumaraSirasi": {"type": "string"}, "devretti": {"type": "boolean"}, "devirSayisi": {"type": "integer"}, "bilenKisiler": {"type": "array", "items": {"type": "object", "properties": {"oid": {"type": "string"}, "kisiBasinaDusenIkramiye": {"type": "number"}, "kisiSayisi": {"type": "integer"}, "tur": {"type": "string"}}, "required": ["oid", "kisiBasinaDusenIkramiye", "kisiSayisi", "tur"]}}, "buyukIkrKazananIlIlceler": {"type": "array", "items": {}}}, "required": ["oid", "hafta", "buyukIkramiyeKazananIl", "cekilisTarihi", "cekilisTuru", "rakamlar", "rakamlarNumaraSirasi", "devretti", "devirSayisi", "bilenKisiler", "buyukIkrKazananIlIlceler"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country": {"type": "string"}, "region": {"type": "string"}, "identifiers": {"type": "object", "properties": {"wmo": {"type": "string"}, "icao": {"type": "string"}, "ghcn": {"type": "string"}, "usaf": {"type": "string"}}, "required": ["wmo", "icao", "ghcn", "usaf"]}, "location": {"type": "object", "properties": {"latitude": {"type": "number"}, "longitude": {"type": "number"}, "elevation": {"type": "integer"}}, "required": ["latitude", "longitude", "elevation"]}, "timezone": {"type": "string"}}, "required": ["id", "name", "country", "region", "identifiers", "location", "timezone"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "87648", "name" : {"en" : "Dolores Aerodrome"}, "country" : "AR", "region" : "B", "identifiers" : {"wmo" : "87648", "icao" : "SAZD", "ghcn" : "ARM00087648", "usaf" : "876480"}, "location" : {"latitude" : -36.35, "longitude" : -57.7333, "elevation" : 10}, "timezone" : "America/Argentina/Buenos_Aires"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "object", "properties": {"en": {"type": "string"}}, "required": ["en"]}, "country": {"type": "string"}, "region": {"type": "string"}, "identifiers": {"type": "object", "properties": {"wmo": {"type": "string"}, "icao": {"type": "string"}, "ghcn": {"type": "string"}, "usaf": {"type": "string"}}, "required": ["wmo", "icao", "ghcn", "usaf"]}, "location": {"type": "object", "properties": {"latitude": {"type": "number"}, "longitude": {"type": "number"}, "elevation": {"type": "integer"}}, "required": ["latitude", "longitude", "elevation"]}, "timezone": {"type": "string"}}, "required": ["id", "name", "country", "region", "identifiers", "location", "timezone"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "title": {"type": "string"}, "icon": {"type": "string"}}, "required": ["name", "title", "icon"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"name" : "form.json", "title" : "\u7a7a\u767d\u8868\u5355", "icon" : "form.png"}, {"name" : "form_publish_edit.json", "title" : "\u53d1\u5e03\u7c7b\u7f16\u8f91\u8868\u5355", "icon" : "form_publish_edit.png"}, {"name" : "form_publish_read.json", "title" : "\u53d1\u5e03\u7c7b\u9605\u8bfb\u8868\u5355", "icon" : "form_publish_read.png"}, {"name" : "form_input.json", "title" : "\u6570\u636e\u5f55\u5165\u7c7b\u8868\u5355", "icon" : "form_input.png"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "title": {"type": "string"}, "icon": {"type": "string"}}, "required": ["name", "title", "icon"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"title": {"type": "string"}, "explanation": {"type": "string"}, "date": {"type": "string"}, "hdurl": {"type": "string"}, "service_version": {"type": "string"}, "copyright": {"type": "string"}, "media_type": {"type": "string"}, "url": {"type": "string"}}, "required": ["title", "explanation", "date", "hdurl", "service_version", "copyright", "media_type", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"title" : "Red Moon, Green Beam", "explanation" : "This is not a scene from a sci-fi special effects movie. The green beam of light and red lunar disk are real enough, captured in the early morning hours of April 15. Of course, the reddened lunar disk is easy to explain as the image was taken during this week's total lunar eclipse. Immersed in shadow, the eclipsed Moon reflects the dimmed reddened light of all the sunsets and sunrises filtering around the edges of planet Earth, seen in silhouette from a lunar perspective. But the green beam of light really is a laser. Shot from the 3.5-meter telescope at Apache Point Observatory in southern New Mexico, the beam's path is revealed as Earth's atmosphere scatters some of the intense laser light. The laser's target is the Apollo 15 retroreflector, left on the Moon by the astronauts in 1971. By determining the light travel time delay of the returning laser pulse, the experimental team from UC San Diego is able to measure the Earth-Moon distance to millimeter precision and provide a test of General Relativity, Einstein's theory of gravity. Conducting the lunar laser ranging experiment during a total eclipse uses the Earth like a cosmic light switch. With direct sunlight blocked, the reflector's performance is improved over performance when illuminated by sunlight during a normal Full Moon, an effect known as the real Full Moon Curse.", "date" : "2014-04-18", "hdurl" : "https://apod.nasa.gov/apod/image/1404/D140414_47_ApolloEclipse_AFCc_16f.jpg", "service_version" : "v1", "copyright" : "Dan Long (Apache Point Observatory) - Courtesy: Tom Murphy (UC San Diego)", "media_type" : "image", "url" : "https://apod.nasa.gov/apod/image/1404/D140414_47_ApolloEclipse_AFCc_16f_950.jpg"}
json_instruct
{"type": "object", "properties": {"title": {"type": "string"}, "explanation": {"type": "string"}, "date": {"type": "string"}, "hdurl": {"type": "string"}, "service_version": {"type": "string"}, "copyright": {"type": "string"}, "media_type": {"type": "string"}, "url": {"type": "string"}}, "required": ["title", "explanation", "date", "hdurl", "service_version", "copyright", "media_type", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"states": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "label": {"type": "string"}}, "required": ["name", "type", "label"]}}}, "required": ["states"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"states" : [{"name" : "unset", "type" : "regular", "label" : "alarm not set"}]}
json_instruct
{"type": "object", "properties": {"states": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "type": {"type": "string"}, "label": {"type": "string"}}, "required": ["name", "type", "label"]}}}, "required": ["states"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"id": {"type": "string"}, "expression": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}}, "required": ["id", "expression"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "http://data.doremus.org/performance/6f3392f5-2aa8-32fa-99cf-81f2195f9baa", "expression" : [{"id" : "http://data.doremus.org/expression/5dce2f3c-6afd-39db-8318-57b0a717fb0e"}, {"id" : "http://data.doremus.org/expression/194770f9-c7ba-31bb-a45d-0b485dc813e6"}, {"id" : "http://data.doremus.org/expression/1d276d96-3c22-34b8-85d4-029b57a17f1e"}, {"id" : "http://data.doremus.org/expression/3561579e-fc56-3b65-bba5-9e4b64e8f4e4"}, {"id" : "http://data.doremus.org/expression/be96643e-8547-322c-923c-b192c3a43056"}, {"id" : "http://data.doremus.org/expression/c9089915-766e-3b8c-8322-8fd95bfc2836"}, {"id" : "http://data.doremus.org/expression/b1b76eb6-d427-3aa8-af1c-b2817008aab3"}, {"id" : "http://data.doremus.org/expression/c95a68b0-c96e-31c5-ae7c-53b3212e22d0"}, {"id" : "http://data.doremus.org/expression/0a19f00b-5338-3c36-97a1-1db323688333"}]}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "expression": {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}}, "required": ["id"]}}}, "required": ["id", "expression"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"throws": {"type": "string"}}, "required": ["throws"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"throws" : "Escape sequence in keyword import (1:40)"}
json_instruct
{"type": "object", "properties": {"throws": {"type": "string"}}, "required": ["throws"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "5101021005", "district_id" : "5101021", "name" : "SANGKARAGUNG"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "object", "properties": {"key": {"type": "string"}, "name": {"type": "string"}, "spdx_id": {"type": "string"}, "url": {"type": "string"}}, "required": ["key", "name", "spdx_id", "url"]}, "starNum": {"type": "integer"}, "folkNum": {"type": "integer"}, "watchNum": {"type": "integer"}, "topic": {"type": "array", "items": {}}}, "required": ["name", "description", "license", "starNum", "folkNum", "watchNum", "topic"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "BiblioPixel", "description" : "A pure Python 3 library for programming light animations: Please direct questions and support requests to the Google Group: https://groups.google.com/d/forum/maniacal-labs-users - The Issues list here should be reserved for actual bugs.", "license" : {"key" : "mit", "name" : "MIT License", "spdx_id" : "MIT", "url" : "https://api.github.com/licenses/mit"}, "starNum" : 183, "folkNum" : 33, "watchNum" : 183, "topic" : []}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "object", "properties": {"key": {"type": "string"}, "name": {"type": "string"}, "spdx_id": {"type": "string"}, "url": {"type": "string"}}, "required": ["key", "name", "spdx_id", "url"]}, "starNum": {"type": "integer"}, "folkNum": {"type": "integer"}, "watchNum": {"type": "integer"}, "topic": {"type": "array", "items": {}}}, "required": ["name", "description", "license", "starNum", "folkNum", "watchNum", "topic"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 404403259, "type" : "Feature", "properties" : {"src:alt_label" : "quattroshapes", "src:geom" : "quattroshapes", "wof:geomhash" : "9f81e94039ad7d1bcf88de536b86450e", "wof:id" : 404403259, "wof:repo" : "whosonfirst-data-admin-fr"}, "bbox" : [0.28961521298177, 48.50583007975815, 0.34578234980804, 48.54215683004934], "geometry" : {"coordinates" : [[[0.34578234980804, 48.51916782326922], [0.31621026573346, 48.50583007975815], [0.30354688065662, 48.51053890165941], [0.29283415414003, 48.51730711740051], [0.28961521298177, 48.53004222215352], [0.31337423064236, 48.54215683004934], [0.31933585845766, 48.53293055476987], [0.33705532049528, 48.52746937024311], [0.34578234980804, 48.51916782326922]]], "type" : "Polygon"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "type": {"type": "string"}, "properties": {"type": "object", "properties": {"src:alt_label": {"type": "string"}, "src:geom": {"type": "string"}, "wof:geomhash": {"type": "string"}, "wof:id": {"type": "integer"}, "wof:repo": {"type": "string"}}, "required": ["src:alt_label", "src:geom", "wof:geomhash", "wof:id", "wof:repo"]}, "bbox": {"type": "array", "items": {"type": "number"}}, "geometry": {"type": "object", "properties": {"coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}, "type": {"type": "string"}}, "required": ["coordinates", "type"]}}, "required": ["id", "type", "properties", "bbox", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"Steam_searchbar": {"type": "object", "properties": {"confidence": {"type": "number"}, "path": {"type": "string"}, "source": {"type": "null"}, "type": {"type": "string"}}, "required": ["confidence", "path", "source", "type"]}}, "required": ["Steam_searchbar"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Steam_searchbar" : {"confidence" : 62.0, "path" : ".images\\steam_searchbar-path.png", "source" : null, "type" : "image"}}
json_instruct
{"type": "object", "properties": {"Steam_searchbar": {"type": "object", "properties": {"confidence": {"type": "number"}, "path": {"type": "string"}, "source": {"type": "null"}, "type": {"type": "string"}}, "required": ["confidence", "path", "source", "type"]}}, "required": ["Steam_searchbar"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"nom" : "Bournoncle-Saint-Pierre", "circ" : "2\u00e8me circonscription", "dpt" : "Haute-Loire", "inscrits" : 749, "abs" : 369, "votants" : 380, "blancs" : 7, "nuls" : 1, "exp" : 372, "res" : [{"nuance" : "LR", "nom" : "M. Jean-Pierre VIGIER", "voix" : 132}, {"nuance" : "REM", "nom" : "M. Pierre ETEOCLE", "voix" : 110}, {"nuance" : "FI", "nom" : "M. Lionel BOUTON", "voix" : 46}, {"nuance" : "SOC", "nom" : "Mme Josiane MIALON", "voix" : 31}, {"nuance" : "FN", "nom" : "Mme Aurore ARNAUD", "voix" : 30}, {"nuance" : "ECO", "nom" : "Mme Marie-Laure BUSSELOT", "voix" : 9}, {"nuance" : "COM", "nom" : "Mme Michelle CHAUMET", "voix" : 5}, {"nuance" : "EXG", "nom" : "M. Georges FRIDLENDER", "voix" : 3}, {"nuance" : "DVD", "nom" : "M. Alexis MONJAUZE", "voix" : 2}, {"nuance" : "EXD", "nom" : "M. Renaud MAUCHET", "voix" : 2}, {"nuance" : "DIV", "nom" : "Mme Fran\u00e7oise SARRET", "voix" : 2}]}
json_instruct
{"type": "object", "properties": {"nom": {"type": "string"}, "circ": {"type": "string"}, "dpt": {"type": "string"}, "inscrits": {"type": "integer"}, "abs": {"type": "integer"}, "votants": {"type": "integer"}, "blancs": {"type": "integer"}, "nuls": {"type": "integer"}, "exp": {"type": "integer"}, "res": {"type": "array", "items": {"type": "object", "properties": {"nuance": {"type": "string"}, "nom": {"type": "string"}, "voix": {"type": "integer"}}, "required": ["nuance", "nom", "voix"]}}}, "required": ["nom", "circ", "dpt", "inscrits", "abs", "votants", "blancs", "nuls", "exp", "res"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "ignore": {"type": "array", "items": {"type": "string"}}, "devDependencies": {"type": "object", "properties": {"jquery": {"type": "string"}, "requirejs": {"type": "string"}, "requirejs-text": {"type": "string"}, "mocha": {"type": "string"}, "chai": {"type": "string"}, "sinon-chai": {"type": "string"}, "blanket": {"type": "string"}, "sinonjs": {"type": "string"}, "marionette": {"type": "string"}, "handlebars": {"type": "string"}, "jquery-mockjax": {"type": "string"}}, "required": ["jquery", "requirejs", "requirejs-text", "mocha", "chai", "sinon-chai", "blanket", "sinonjs", "marionette", "handlebars", "jquery-mockjax"]}, "dependencies": {"type": "object", "properties": {"backbone": {"type": "string"}, "underscore": {"type": "string"}}, "required": ["backbone", "underscore"]}}, "required": ["name", "description", "homepage", "version", "main", "keywords", "author", "ignore", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "backbone.geppetto", "description" : "Bring your Backbone applications to life with an event-driven Command framework.", "homepage" : "https://github.com/ModelN/backbone.geppetto", "version" : "0.7.1", "main" : "backbone.geppetto.js", "keywords" : ["backbone", "plugin", "command", "mvc"], "author" : {"name" : "Dave Cadwallader", "email" : "[email protected]"}, "ignore" : ["**/.*", "node_modules", "components", "examples", "Gruntfile.js", ".gitignore", "travis.yml", "beautify.json", "documentup.min.js", "index.html", "version.json"], "devDependencies" : {"jquery" : "~2.0.3", "requirejs" : "~2.1.9", "requirejs-text" : "~2.0.10", "mocha" : "~1.12.1", "chai" : "~1.8.1", "sinon-chai" : "~2.4.0", "blanket" : "~1.1.5", "sinonjs" : "~1.7.3", "marionette" : "~1.4.1", "handlebars" : "1.3.0", "jquery-mockjax" : "1.5.3"}, "dependencies" : {"backbone" : "~1.1.0", "underscore" : "~1.5.2"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}}, "required": ["name", "email"]}, "ignore": {"type": "array", "items": {"type": "string"}}, "devDependencies": {"type": "object", "properties": {"jquery": {"type": "string"}, "requirejs": {"type": "string"}, "requirejs-text": {"type": "string"}, "mocha": {"type": "string"}, "chai": {"type": "string"}, "sinon-chai": {"type": "string"}, "blanket": {"type": "string"}, "sinonjs": {"type": "string"}, "marionette": {"type": "string"}, "handlebars": {"type": "string"}, "jquery-mockjax": {"type": "string"}}, "required": ["jquery", "requirejs", "requirejs-text", "mocha", "chai", "sinon-chai", "blanket", "sinonjs", "marionette", "handlebars", "jquery-mockjax"]}, "dependencies": {"type": "object", "properties": {"backbone": {"type": "string"}, "underscore": {"type": "string"}}, "required": ["backbone", "underscore"]}}, "required": ["name", "description", "homepage", "version", "main", "keywords", "author", "ignore", "devDependencies", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"contacts": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "designation": {"type": "string"}, "mobile": {"type": "array", "items": {}}}, "required": ["name", "email", "designation", "mobile"]}}, "guideStarURL": {"type": "string"}, "name": {"type": "string"}, "primaryEmail": {"type": "string"}, "website": {"type": "string"}, "organisationType": {"type": "array", "items": {"type": "string"}}, "telephone": {"type": "array", "items": {"type": "string"}}, "mainAddrress": {"type": "object", "properties": {"state": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}}, "required": ["state", "address"]}}, "required": ["contacts", "guideStarURL", "name", "primaryEmail", "website", "organisationType", "telephone", "mainAddrress"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"contacts" : [{"name" : "Mr.Pramod Kumar", "email" : "", "designation" : "", "mobile" : []}], "guideStarURL" : "http://www.guidestarindia.org/Summary.aspx?CCReg=7495", "name" : "(VICAS) VOLUNTARY INSTITUTE FOR COMMUNITY APPLIED SCIENCE", "primaryEmail" : "[email protected]", "website" : "www.vicas.india.org", "organisationType" : ["Direct Service", "Support"], "telephone" : ["919450961953"], "mainAddrress" : {"state" : "Uttar Pradesh", "address" : ["HD-86", "ADA, NAINI", "Allahabad", "Uttar Pradesh", "211008"]}}
json_instruct
{"type": "object", "properties": {"contacts": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "designation": {"type": "string"}, "mobile": {"type": "array", "items": {}}}, "required": ["name", "email", "designation", "mobile"]}}, "guideStarURL": {"type": "string"}, "name": {"type": "string"}, "primaryEmail": {"type": "string"}, "website": {"type": "string"}, "organisationType": {"type": "array", "items": {"type": "string"}}, "telephone": {"type": "array", "items": {"type": "string"}}, "mainAddrress": {"type": "object", "properties": {"state": {"type": "string"}, "address": {"type": "array", "items": {"type": "string"}}}, "required": ["state", "address"]}}, "required": ["contacts", "guideStarURL", "name", "primaryEmail", "website", "organisationType", "telephone", "mainAddrress"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "http-dev": {"type": "string"}, "https-dev": {"type": "string"}}, "required": ["start", "http-dev", "https-dev"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@microsoft/microsoft-graph-client": {"type": "string"}, "body-parser": {"type": "string"}, "cookie-parser": {"type": "string"}, "dotenv": {"type": "string"}, "express": {"type": "string"}, "jsonwebtoken": {"type": "string"}, "md5": {"type": "string"}, "pug": {"type": "string"}, "simple-oauth2": {"type": "string"}}, "required": ["@microsoft/microsoft-graph-client", "body-parser", "cookie-parser", "dotenv", "express", "jsonwebtoken", "md5", "pug", "simple-oauth2"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "swigger-archer", "version" : "1.0.0", "description" : "a web app for managing one's outlook.com events", "main" : "app.js", "scripts" : {"start" : "export NODE_ENV=production; node app.js", "http-dev" : "export NODE_ENV=development; node app.js", "https-dev" : "export NODE_ENV=development; export _SECURE_HTTP=1; node app.js"}, "repository" : {"type" : "git", "url" : "https://github.com/astriskit/swigger-archer.git"}, "keywords" : [], "author" : "", "license" : "MIT", "dependencies" : {"@microsoft/microsoft-graph-client" : "^1.7.0", "body-parser" : "^1.19.0", "cookie-parser" : "^1.4.4", "dotenv" : "^8.0.0", "express" : "^4.17.1", "jsonwebtoken" : "^8.5.1", "md5" : "^2.2.1", "pug" : "^2.0.4", "simple-oauth2" : "^2.2.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "http-dev": {"type": "string"}, "https-dev": {"type": "string"}}, "required": ["start", "http-dev", "https-dev"]}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "keywords": {"type": "array", "items": {}}, "author": {"type": "string"}, "license": {"type": "string"}, "dependencies": {"type": "object", "properties": {"@microsoft/microsoft-graph-client": {"type": "string"}, "body-parser": {"type": "string"}, "cookie-parser": {"type": "string"}, "dotenv": {"type": "string"}, "express": {"type": "string"}, "jsonwebtoken": {"type": "string"}, "md5": {"type": "string"}, "pug": {"type": "string"}, "simple-oauth2": {"type": "string"}}, "required": ["@microsoft/microsoft-graph-client", "body-parser", "cookie-parser", "dotenv", "express", "jsonwebtoken", "md5", "pug", "simple-oauth2"]}}, "required": ["name", "version", "description", "main", "scripts", "repository", "keywords", "author", "license", "dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "size": {"type": "integer"}, "link": {"type": "string"}, "created_at": {"type": "string"}, "downloads": {"type": "integer"}, "linkid": {"type": "string"}, "convert": {"type": "string"}, "achorname": {"type": "string"}, "subscribe": {"type": "string"}, "avatar-img": {"type": "string"}, "folderName": {"type": "string"}, "thumbUrl": {"type": "string"}}, "required": ["name", "size", "link", "created_at", "downloads", "linkid", "convert", "achorname", "subscribe", "avatar-img", "folderName", "thumbUrl"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"name" : "\u4e03\u5929\u6781\u54c1\u63a2\u82b1\u9ec4\u5148\u751f\u7ea6\u4e86\u4e2a\u725b\u4ed4\u88e4\u767d\u8863\u59b9\u5b50\uff0c\u9ad8\u8ddf\u978b\u62a4\u58eb\u60c5\u8da3\u88c5\u8214\u903c\u4e0a\u4f4d\u9a91\u5750\u731b\u64cd", "size" : 136954148, "link" : "https://streamtape.com/e/JDXLmX9jPLTZoV", "created_at" : "2022\u5e7403\u670814\u65e5 04:43:17", "downloads" : 0, "linkid" : "JDXLmX9jPLTZoV", "convert" : "converted", "achorname" : "\u4e38\u5b50\u5466", "subscribe" : "0\u4f4d\u8ba2\u9605\u8005", "avatar-img" : "https://huyaimg.msstatic.com/avatar/1022/07/ec5fef7c7662720286fbbb12395390_180_135.jpg?1628178596?458648", "folderName" : "\u4e03\u5929\u6781\u54c1\u63a2\u82b1\u9ec4\u5148\u751f\u7ea6\u4e86\u4e2a\u725b\u4ed4\u88e4\u767d\u8863\u59b9\u5b50\uff0c\u9ad8\u8ddf\u978b\u62a4\u58eb\u60c5\u8da3\u88c5\u8214\u903c\u4e0a\u4f4d\u9a91\u5750\u731b\u64cd", "thumbUrl" : "https://thumb.tapecontent.net/thumb/JDXLmX9jPLTZoV/Jew1KBYAWkCJQx.jpg"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "size": {"type": "integer"}, "link": {"type": "string"}, "created_at": {"type": "string"}, "downloads": {"type": "integer"}, "linkid": {"type": "string"}, "convert": {"type": "string"}, "achorname": {"type": "string"}, "subscribe": {"type": "string"}, "avatar-img": {"type": "string"}, "folderName": {"type": "string"}, "thumbUrl": {"type": "string"}}, "required": ["name", "size", "link", "created_at", "downloads", "linkid", "convert", "achorname", "subscribe", "avatar-img", "folderName", "thumbUrl"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"bl": {"type": "number"}, "cms": {"type": "number"}, "fs": {"type": "number"}, "le": {"type": "number"}, "mms": {"type": "number"}, "model": {"type": "string"}, "pe": {"type": "number"}, "qes": {"type": "number"}, "qms": {"type": "number"}, "qts": {"type": "number"}, "re": {"type": "number"}, "rms": {"type": "number"}, "sd": {"type": "number"}, "vas": {"type": "number"}, "vendor": {"type": "string"}, "xmax": {"type": "number"}}, "required": ["bl", "cms", "fs", "le", "mms", "model", "pe", "qes", "qms", "qts", "re", "rms", "sd", "vas", "vendor", "xmax"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"bl" : 7.48, "cms" : 0.000715, "fs" : 47.0, "le" : 0.0, "mms" : 0.016, "model" : "W6-1674", "pe" : 60.0, "qes" : 0.5, "qms" : 4.72, "qts" : 0.45, "re" : 5.9, "rms" : 1.004, "sd" : 0.0133, "vas" : 0.0177, "vendor" : "TangBand", "xmax" : 0.0035}
json_instruct
{"type": "object", "properties": {"bl": {"type": "number"}, "cms": {"type": "number"}, "fs": {"type": "number"}, "le": {"type": "number"}, "mms": {"type": "number"}, "model": {"type": "string"}, "pe": {"type": "number"}, "qes": {"type": "number"}, "qms": {"type": "number"}, "qts": {"type": "number"}, "re": {"type": "number"}, "rms": {"type": "number"}, "sd": {"type": "number"}, "vas": {"type": "number"}, "vendor": {"type": "string"}, "xmax": {"type": "number"}}, "required": ["bl", "cms", "fs", "le", "mms", "model", "pe", "qes", "qms", "qts", "re", "rms", "sd", "vas", "vendor", "xmax"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"generated_at": {"type": "string"}, "required_by": {"type": "array", "items": {"type": "string"}}, "requires": {"type": "array", "items": {"type": "string"}}, "package": {"type": "string"}}, "required": ["generated_at", "required_by", "requires", "package"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"generated_at" : "2017-01-27T09:37:35.337807", "required_by" : ["clipsync", "array_to_latex", "passotp", "zenhest"], "requires" : ["pyperclip"], "package" : "clipboard"}
json_instruct
{"type": "object", "properties": {"generated_at": {"type": "string"}, "required_by": {"type": "array", "items": {"type": "string"}}, "requires": {"type": "array", "items": {"type": "string"}}, "package": {"type": "string"}}, "required": ["generated_at", "required_by", "requires", "package"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "array", "items": {"type": "object", "properties": {"interactType": {"type": "string"}, "interactTitle": {"type": "string"}, "words": {"type": "array", "items": {"type": "object", "properties": {"word": {"type": "string"}, "china": {"type": "string"}}, "required": ["word", "china"]}}, "videoTitle": {"type": "string"}, "practiceTitle": {"type": "string"}}, "required": ["interactType", "interactTitle", "words", "videoTitle", "practiceTitle"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"interactType" : "wordBegin", "interactTitle" : "\u5355\u8bcd", "words" : [{"word" : "t41g44s57", "china" : "\u5c18\u571f"}, {"word" : "t41g17", "china" : "\u6570\u5b57"}, {"word" : "j41b14g14h57", "china" : "\u6298\u78e8"}, {"word" : "s41q34g14h57", "china" : "\u4f7f\u5403\u60ca"}, {"word" : "h41r34y18", "china" : "\u9662\u5b50"}], "videoTitle" : "\u5355\u8bcd", "practiceTitle" : "\u5355\u8bcd\u7ec3\u4e60"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"interactType": {"type": "string"}, "interactTitle": {"type": "string"}, "words": {"type": "array", "items": {"type": "object", "properties": {"word": {"type": "string"}, "china": {"type": "string"}}, "required": ["word", "china"]}}, "videoTitle": {"type": "string"}, "practiceTitle": {"type": "string"}}, "required": ["interactType", "interactTitle", "words", "videoTitle", "practiceTitle"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"Time": {"type": "string"}, "Temp": {"type": "number"}, "RelHum": {"type": "integer"}, "WindSpeed": {"type": "integer"}, "WindDir": {"type": "integer"}}, "required": ["Time", "Temp", "RelHum", "WindSpeed", "WindDir"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Time" : "2021-10-17T02:00:00Z", "Temp" : 16.4, "RelHum" : 60, "WindSpeed" : 2, "WindDir" : 106}
json_instruct
{"type": "object", "properties": {"Time": {"type": "string"}, "Temp": {"type": "number"}, "RelHum": {"type": "integer"}, "WindSpeed": {"type": "integer"}, "WindDir": {"type": "integer"}}, "required": ["Time", "Temp", "RelHum", "WindSpeed", "WindDir"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "body": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "start": {"type": "integer"}, "end": {"type": "integer"}, "snapshot": {"type": "string"}, "state": {"type": "string"}, "author": {"type": "string"}, "space": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "votes": {"type": "integer"}, "votes_data": {"type": "array", "items": {}}}, "required": ["id", "title", "body", "choices", "start", "end", "snapshot", "state", "author", "space", "votes", "votes_data"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "0x5b913de53f180b080baa0489d44acea772f6adec178b326f1bacda35402c3f7c", "title" : "Predict ftm price", "body" : "When will the FTM price break through $5", "choices" : ["one month later", "never", "dont care"], "start" : 1636257600, "end" : 1636344000, "snapshot" : "21310908", "state" : "closed", "author" : "0xCF04f9e6fc622447c25EF04Bb63b5310C9723F83", "space" : {"id" : "fantomecosystem.eth", "name" : "Fantom"}, "votes" : 0, "votes_data" : []}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "body": {"type": "string"}, "choices": {"type": "array", "items": {"type": "string"}}, "start": {"type": "integer"}, "end": {"type": "integer"}, "snapshot": {"type": "string"}, "state": {"type": "string"}, "author": {"type": "string"}, "space": {"type": "object", "properties": {"id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "name"]}, "votes": {"type": "integer"}, "votes_data": {"type": "array", "items": {}}}, "required": ["id", "title", "body", "choices", "start", "end", "snapshot", "state", "author", "space", "votes", "votes_data"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : "411330105200", "text" : "\u5ce1\u5c71\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105201", "text" : "\u77f3\u4f5b\u5bfa\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105202", "text" : "\u9ec4\u5e84\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105203", "text" : "\u4e0a\u6cb3\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105204", "text" : "\u7bad\u6746\u51b2\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105205", "text" : "\u571f\u95e8\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105206", "text" : "\u6cc9\u6c34\u6e7e\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105207", "text" : "\u6c5f\u5e84\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105208", "text" : "\u674e\u6c9f\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105209", "text" : "\u516d\u91cc\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105210", "text" : "\u5c16\u5c71\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105211", "text" : "\u7530\u53e3\u6751\u6c11\u59d4\u5458\u4f1a"}, {"id" : "411330105212", "text" : "\u7af9\u56ed\u6751\u6c11\u59d4\u5458\u4f1a"}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "string"}, "text": {"type": "string"}}, "required": ["id", "text"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"other_ids" : [], "mRNA_sequence" : [{"index" : 0, "type" : "five_prime_UTR", "sequence" : "CTTGCGCTTTTCAAAGATATATGAGCTTTGTTTAATTAGTTTTAGCTGATTGCTTAATCAAATAAAAGATTGTCTATCTTAACACCATTCGTTTTCTAATCCCGGCATTTGTCTGTGAAATTTTTAAAAATTAATTGGAATTACTCTACAAGCAACTTATTCAAAGAAGGAATAAATAGATAATAATCATTACTAGACAGAAGACTAATCGC"}, {"index" : 1, "type" : "CDS", "sequence" : "ATGGAACGTTTAGCTACTCGATCGAGCCATGATGATCCATATTCGAGGTCTTCCCTTCCAACTTCGAATGCCATTAATAGCAACCATGAGTCAAATGGTTCTACTTTTTCTTACGTACAGAGTTTACGCCGTGCAAAGGCGACTGTCTGGAGTGATATAGGCCGTGTGGCTCCTTTACACTCTAGCCCATCAATCAAAAGTTCATCACAAAATGGGAAGTCTTCCAGCAAAGGCTTAGGAGGCATGCGCTCAAGGGTATTTTCTAGCCAGCATCATGGTGTTTATCACACCCGTCCTGCTTCGCTTCATTCACGTACAATGGCTCCTCAGCACACCATTCTTACTCCACGATTATCTGCTACCGAAGGTAAGGATGACGATGAGGACGAATTGGTAATTTCGACATCGAATACTGCACCAACATATATCTCAATGATTGAGTCTTCACGTGCCAGCTCAACCCATAGTGGGACTGCACCTTCCATTATGGGAATGTCAATACATTCAAGAGCAGACTCCAGAGCCGAAACTACTCAATCAGACGGCTTTGAATCTCGTAGCGGATCACCTACTCATGATATTCAATCTTATCTTGTCAATCGACGAAGCAGCAGTTCTGAATCTTCAGACGAGGACAGTGCTGAAGAAGGAATGAAACGTCTAGTAATCACAAATATGGGGGACAATGATGAATTCGATAGCGATTAG"}, {"index" : 2, "type" : "three_prime_UTR", "sequence" : "TGCAGTTATTTTTCCATCGATATCTGATAAAGTATTATTATTTATTATGGTGCTATTCCCTCACCTAGTTTAATTGCTTTAATTCGTTTACTTTTATTCGCATTCTTTGGCATAATCAAGCATTCCTTCCCCTTTCTGTTCTATTACGTATTTCTTTCATTTAAAACCCGGCATTGTCAGCTAGTCTCACATCTTTAATCAAAACATGAAATAAACTATATCAATATTATCATCATTCTATTTTTATTCATTTGAAAGCTATTCGGTGCTTCCTGTTTTAATGTAACATGAATATCAATAACATTTTAATTATAGAACC"}], "other_names" : [], "id" : "SPCC16C4.17", "name" : "mug123"}
json_instruct
{"type": "object", "properties": {"other_ids": {"type": "array", "items": {}}, "mRNA_sequence": {"type": "array", "items": {"type": "object", "properties": {"index": {"type": "integer"}, "type": {"type": "string"}, "sequence": {"type": "string"}}, "required": ["index", "type", "sequence"]}}, "other_names": {"type": "array", "items": {}}, "id": {"type": "string"}, "name": {"type": "string"}}, "required": ["other_ids", "mRNA_sequence", "other_names", "id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "year": {"type": "integer"}, "type": {"type": "string"}, "sortkey": {"type": "integer"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"affiliation": {"type": "string"}, "name": {"type": "string"}}, "required": ["affiliation", "name"]}}, "url": {"type": "string"}, "peer-reviewed": {"type": "boolean"}, "abstract": {"type": "string"}}, "required": ["id", "title", "year", "type", "sortkey", "authors", "url", "peer-reviewed", "abstract"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "moinet2017blockchain", "title" : "Blockchain Based Trust \\& Authentication For Decentralized Sensor Networks", "year" : 2017, "type" : "article", "sortkey" : 20170610, "authors" : [{"affiliation" : "FRE CNRS", "name" : "Axel Moinet"}, {"affiliation" : "FRE CNRS", "name" : "Beno\u00ect Darties"}, {"affiliation" : "FRE CNRS", "name" : "Jean-Luc Baril"}], "url" : "https://arxiv.org/pdf/1706.01730", "peer-reviewed" : false, "abstract" : "Sensor networks and Wireless Sensor Networks (WSN) are key components for the development of the Internet of Things. These networks are subject of two kinds of constraints. Adaptability by the mean of mutability and evolutivity, and constrained node resources such as energy consumption, computational complexity or memory usage. In this context, none of the existing protocols and models allows reliable peer authentication and trust level management. In the field of virtual economic transactions, Bitcoin has proposed a new decentralized and evolutive way to model and acknowledge trust and data validity in a peer network by the mean of the blockchain. We propose a new security model and its protocol based on the blockchain technology to ensure validity and integrity of cryptographic authentication data and associate peer trust level, from the beginning to the end of the sensor network lifetime."}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "title": {"type": "string"}, "year": {"type": "integer"}, "type": {"type": "string"}, "sortkey": {"type": "integer"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"affiliation": {"type": "string"}, "name": {"type": "string"}}, "required": ["affiliation", "name"]}}, "url": {"type": "string"}, "peer-reviewed": {"type": "boolean"}, "abstract": {"type": "string"}}, "required": ["id", "title", "year", "type", "sortkey", "authors", "url", "peer-reviewed", "abstract"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"free_trial": {"type": "object", "properties": {"heading": {"type": "string"}, "description": {"type": "string"}, "email_label": {"type": "string"}, "email_placeholder": {"type": "string"}, "action": {"type": "string"}}, "required": ["heading", "description", "email_label", "email_placeholder", "action"]}, "enterprise": {"type": "object", "properties": {"heading": {"type": "string"}, "description": {"type": "string"}, "action": {"type": "string"}}, "required": ["heading", "description", "action"]}}, "required": ["free_trial", "enterprise"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"free_trial" : {"heading" : "NEWSLETTER", "description" : "Para recibir noticias de Vertike", "email_label" : "Email address", "email_placeholder" : "Tu correo electronico", "action" : "Subscribite"}, "enterprise" : {"heading" : "Queres so\u00f1ar alto?", "description" : "VERTIKE es tu lugar.", "action" : "Contacte a nuestro team"}}
json_instruct
{"type": "object", "properties": {"free_trial": {"type": "object", "properties": {"heading": {"type": "string"}, "description": {"type": "string"}, "email_label": {"type": "string"}, "email_placeholder": {"type": "string"}, "action": {"type": "string"}}, "required": ["heading", "description", "email_label", "email_placeholder", "action"]}, "enterprise": {"type": "object", "properties": {"heading": {"type": "string"}, "description": {"type": "string"}, "action": {"type": "string"}}, "required": ["heading", "description", "action"]}}, "required": ["free_trial", "enterprise"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"extensionTitle": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extensionDesc": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extensionCommand": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "fixThisLink": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "fixAllLinks": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "parsingPlaceholder": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "columnSeparator": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}}, "required": ["extensionTitle", "extensionDesc", "extensionCommand", "fixThisLink", "fixAllLinks", "parsingPlaceholder", "columnSeparator"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"extensionTitle" : {"message" : "Acc\u00e8s et nettoyage facile des liens au clavier", "description" : "Titre de l'extension"}, "extensionDesc" : {"message" : "Facilite la navigation au clavier via des \u00e9tiquettes ajout\u00e9s aux liens, tout en prot\u00e9geant un peu mieux votre vie priv\u00e9e.", "description" : "Description de l'extension"}, "extensionCommand" : {"message" : "Raccourcis clavier pour afficher ou cacher les \u00e9tiquettes des liens", "description" : "Description of the command to use to toggle links hints"}, "fixThisLink" : {"message" : "Nettoyer ce lien", "description" : "Titre d'un \u00e9l\u00e9ment du menu contextuel"}, "fixAllLinks" : {"message" : "Nettoyer tous les liens", "description" : "Titre d'un \u00e9l\u00e9ment du menu contextuel"}, "parsingPlaceholder" : {"message" : "nettoyage de l'URL\u2026", "description" : "Message bref affich\u00e9 lorsqu'un lien est en train d'\u00eatre \u00e9tendu ou nettoy\u00e9"}, "columnSeparator" : {"message" : "\u00a0: ", "description" : "Espaces \u00e0 utiliser de part et d'autre des deux points"}}
json_instruct
{"type": "object", "properties": {"extensionTitle": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extensionDesc": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "extensionCommand": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "fixThisLink": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "fixAllLinks": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "parsingPlaceholder": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}, "columnSeparator": {"type": "object", "properties": {"message": {"type": "string"}, "description": {"type": "string"}}, "required": ["message", "description"]}}, "required": ["extensionTitle", "extensionDesc", "extensionCommand", "fixThisLink", "fixAllLinks", "parsingPlaceholder", "columnSeparator"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"948511370455": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "948511370473": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "948511370552": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "948511370905": {"type": "object", "properties": {"type": {"type": "string"}, "pageCount": {"type": "integer"}}, "required": ["type", "pageCount"]}, "948511371196": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "948511371227": {"type": "object", "properties": {"type": {"type": "string"}, "linkname": {"type": "string"}}, "required": ["type", "linkname"]}, "948511371233": {"type": "object", "properties": {"type": {"type": "string"}, "linkname": {"type": "string"}}, "required": ["type", "linkname"]}}, "required": ["948511370455", "948511370473", "948511370552", "948511370905", "948511371196", "948511371227", "948511371233"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"948511370455" : {"type" : "bo", "bookName" : "Lesson%2019", "subjectName" : "Hatua%202", "fName" : "users/Mi0vYW5kcm9pZF9hc3NldC93d3cvc2Nob29sL1Vzb21hamklMjBuYSUyMFVhbmRpc2hpL0hhdHVhJTIwMi9MZXNzb24lMjAxOS9pbmRleC5odG1sLWFuYWx5dGljcy05NDg1MTEzNzAzMDk=.json"}, "948511370473" : {"type" : "bo", "bookName" : "Lesson%2019", "subjectName" : "Hatua%202", "fName" : "users/Mi0vYW5kcm9pZF9hc3NldC93d3cvc2Nob29sL1Vzb21hamklMjBuYSUyMFVhbmRpc2hpL0hhdHVhJTIwMi9MZXNzb24lMjAxOS9pbmRleC5odG1sLWFuYWx5dGljcy05NDg1MTEzNzAzMDk=.json"}, "948511370552" : {"type" : "xl"}, "948511370905" : {"type" : "xp", "pageCount" : 16}, "948511371196" : {"type" : "fl"}, "948511371227" : {"type" : "st", "linkname" : "Page"}, "948511371233" : {"type" : "ss", "linkname" : "Page"}}
json_instruct
{"type": "object", "properties": {"948511370455": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "948511370473": {"type": "object", "properties": {"type": {"type": "string"}, "bookName": {"type": "string"}, "subjectName": {"type": "string"}, "fName": {"type": "string"}}, "required": ["type", "bookName", "subjectName", "fName"]}, "948511370552": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "948511370905": {"type": "object", "properties": {"type": {"type": "string"}, "pageCount": {"type": "integer"}}, "required": ["type", "pageCount"]}, "948511371196": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}, "948511371227": {"type": "object", "properties": {"type": {"type": "string"}, "linkname": {"type": "string"}}, "required": ["type", "linkname"]}, "948511371233": {"type": "object", "properties": {"type": {"type": "string"}, "linkname": {"type": "string"}}, "required": ["type", "linkname"]}}, "required": ["948511370455", "948511370473", "948511370552", "948511370905", "948511371196", "948511371227", "948511371233"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"up board": {"type": "string"}, "cbse": {"type": "string"}, "icse": {"type": "string"}, "other": {"type": "string"}}, "required": ["up board", "cbse", "icse", "other"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"up board" : "1", "cbse" : "2", "icse" : "3", "other" : "4"}
json_instruct
{"type": "object", "properties": {"up board": {"type": "string"}, "cbse": {"type": "string"}, "icse": {"type": "string"}, "other": {"type": "string"}}, "required": ["up board", "cbse", "icse", "other"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"$schema": {"type": "string"}, "dest": {"type": "string"}, "lib": {"type": "object", "properties": {"entryFile": {"type": "string"}}, "required": ["entryFile"]}, "whitelistedNonPeerDependencies": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "dest", "lib", "whitelistedNonPeerDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"$schema" : "../../node_modules/ng-packagr/ng-package.schema.json", "dest" : "../../dist/ngx-material-opiniated", "lib" : {"entryFile" : "src/public_api.ts"}, "whitelistedNonPeerDependencies" : ["@fortawesome/angular-fontawesome", "@fortawesome/fontawesome-svg-core", "@fortawesome/free-solid-svg-icons", "@oguimbal/utilities", "ng-pick-datetime-ex", "@oguimbal/ngx-contextmenu"]}
json_instruct
{"type": "object", "properties": {"$schema": {"type": "string"}, "dest": {"type": "string"}, "lib": {"type": "object", "properties": {"entryFile": {"type": "string"}}, "required": ["entryFile"]}, "whitelistedNonPeerDependencies": {"type": "array", "items": {"type": "string"}}}, "required": ["$schema", "dest", "lib", "whitelistedNonPeerDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"COVID-ARTIC-V3": {"type": "string"}, "COVID-ARTIC-V4": {"type": "string"}, "COVID-MIDNIGHT-1200": {"type": "string"}, "COVID-AMPLISEQ-V1": {"type": "string"}}, "required": ["COVID-ARTIC-V3", "COVID-ARTIC-V4", "COVID-MIDNIGHT-1200", "COVID-AMPLISEQ-V1"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"COVID-ARTIC-V3" : "covid-artic-v3.vwf.tsv", "COVID-ARTIC-V4" : "covid-artic-v4.vwf.tsv", "COVID-MIDNIGHT-1200" : "covid-midnight-1200.vwf.tsv", "COVID-AMPLISEQ-V1" : "covid-ampliseq-v1.vwf.tsv"}
json_instruct
{"type": "object", "properties": {"COVID-ARTIC-V3": {"type": "string"}, "COVID-ARTIC-V4": {"type": "string"}, "COVID-MIDNIGHT-1200": {"type": "string"}, "COVID-AMPLISEQ-V1": {"type": "string"}}, "required": ["COVID-ARTIC-V3", "COVID-ARTIC-V4", "COVID-MIDNIGHT-1200", "COVID-AMPLISEQ-V1"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"PREVALENCE_BY_GENDER_AGE_YEAR": {"type": "object", "properties": {"TRELLIS_NAME": {"type": "array", "items": {}}, "SERIES_NAME": {"type": "array", "items": {}}, "X_CALENDAR_YEAR": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["TRELLIS_NAME", "SERIES_NAME", "X_CALENDAR_YEAR", "Y_PREVALENCE_1000PP"]}, "PREVALENCE_BY_MONTH": {"type": "object", "properties": {"X_CALENDAR_MONTH": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["X_CALENDAR_MONTH", "Y_PREVALENCE_1000PP"]}, "LENGTH_OF_ERA": {"type": "object", "properties": {"CATEGORY": {"type": "string"}, "MIN_VALUE": {"type": "integer"}, "P10_VALUE": {"type": "integer"}, "P25_VALUE": {"type": "integer"}, "MEDIAN_VALUE": {"type": "integer"}, "P75_VALUE": {"type": "integer"}, "P90_VALUE": {"type": "integer"}, "MAX_VALUE": {"type": "integer"}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}, "AGE_AT_FIRST_DIAGNOSIS": {"type": "object", "properties": {"CATEGORY": {"type": "array", "items": {"type": "string"}}, "MIN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P10_VALUE": {"type": "array", "items": {"type": "integer"}}, "P25_VALUE": {"type": "array", "items": {"type": "integer"}}, "MEDIAN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P75_VALUE": {"type": "array", "items": {"type": "integer"}}, "P90_VALUE": {"type": "array", "items": {"type": "integer"}}, "MAX_VALUE": {"type": "array", "items": {"type": "integer"}}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}}, "required": ["PREVALENCE_BY_GENDER_AGE_YEAR", "PREVALENCE_BY_MONTH", "LENGTH_OF_ERA", "AGE_AT_FIRST_DIAGNOSIS"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"PREVALENCE_BY_GENDER_AGE_YEAR" : {"TRELLIS_NAME" : [], "SERIES_NAME" : [], "X_CALENDAR_YEAR" : [], "Y_PREVALENCE_1000PP" : []}, "PREVALENCE_BY_MONTH" : {"X_CALENDAR_MONTH" : [], "Y_PREVALENCE_1000PP" : []}, "LENGTH_OF_ERA" : {"CATEGORY" : "Length of era", "MIN_VALUE" : 1, "P10_VALUE" : 1, "P25_VALUE" : 1, "MEDIAN_VALUE" : 1, "P75_VALUE" : 1, "P90_VALUE" : 1, "MAX_VALUE" : 31}, "AGE_AT_FIRST_DIAGNOSIS" : {"CATEGORY" : ["MALE", "FEMALE"], "MIN_VALUE" : [16, 9], "P10_VALUE" : [29, 26], "P25_VALUE" : [40, 37], "MEDIAN_VALUE" : [50, 47], "P75_VALUE" : [61, 61], "P90_VALUE" : [72, 74], "MAX_VALUE" : [82, 93]}}
json_instruct
{"type": "object", "properties": {"PREVALENCE_BY_GENDER_AGE_YEAR": {"type": "object", "properties": {"TRELLIS_NAME": {"type": "array", "items": {}}, "SERIES_NAME": {"type": "array", "items": {}}, "X_CALENDAR_YEAR": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["TRELLIS_NAME", "SERIES_NAME", "X_CALENDAR_YEAR", "Y_PREVALENCE_1000PP"]}, "PREVALENCE_BY_MONTH": {"type": "object", "properties": {"X_CALENDAR_MONTH": {"type": "array", "items": {}}, "Y_PREVALENCE_1000PP": {"type": "array", "items": {}}}, "required": ["X_CALENDAR_MONTH", "Y_PREVALENCE_1000PP"]}, "LENGTH_OF_ERA": {"type": "object", "properties": {"CATEGORY": {"type": "string"}, "MIN_VALUE": {"type": "integer"}, "P10_VALUE": {"type": "integer"}, "P25_VALUE": {"type": "integer"}, "MEDIAN_VALUE": {"type": "integer"}, "P75_VALUE": {"type": "integer"}, "P90_VALUE": {"type": "integer"}, "MAX_VALUE": {"type": "integer"}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}, "AGE_AT_FIRST_DIAGNOSIS": {"type": "object", "properties": {"CATEGORY": {"type": "array", "items": {"type": "string"}}, "MIN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P10_VALUE": {"type": "array", "items": {"type": "integer"}}, "P25_VALUE": {"type": "array", "items": {"type": "integer"}}, "MEDIAN_VALUE": {"type": "array", "items": {"type": "integer"}}, "P75_VALUE": {"type": "array", "items": {"type": "integer"}}, "P90_VALUE": {"type": "array", "items": {"type": "integer"}}, "MAX_VALUE": {"type": "array", "items": {"type": "integer"}}}, "required": ["CATEGORY", "MIN_VALUE", "P10_VALUE", "P25_VALUE", "MEDIAN_VALUE", "P75_VALUE", "P90_VALUE", "MAX_VALUE"]}}, "required": ["PREVALENCE_BY_GENDER_AGE_YEAR", "PREVALENCE_BY_MONTH", "LENGTH_OF_ERA", "AGE_AT_FIRST_DIAGNOSIS"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "licenses": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}}, "required": ["chalk"]}, "devDependencies": {"type": "object", "properties": {"gulp": {"type": "string"}, "gulp-jshint": {"type": "string"}}, "required": ["gulp", "gulp-jshint"]}}, "required": ["name", "version", "description", "homepage", "repository", "keywords", "licenses", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "gulp-bg", "version" : "0.0.9", "description" : "Spawn a process in the background", "homepage" : "https://github.com/litek/gulp-bg", "repository" : "https://github.com/litek/gulp-bg.git", "keywords" : ["gulpplugin"], "licenses" : [{"type" : "MIT"}], "dependencies" : {"chalk" : "~0.4.0"}, "devDependencies" : {"gulp" : "^3.6.0", "gulp-jshint" : "~1.5.0"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "homepage": {"type": "string"}, "repository": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "licenses": {"type": "array", "items": {"type": "object", "properties": {"type": {"type": "string"}}, "required": ["type"]}}, "dependencies": {"type": "object", "properties": {"chalk": {"type": "string"}}, "required": ["chalk"]}, "devDependencies": {"type": "object", "properties": {"gulp": {"type": "string"}, "gulp-jshint": {"type": "string"}}, "required": ["gulp", "gulp-jshint"]}}, "required": ["name", "version", "description", "homepage", "repository", "keywords", "licenses", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"readmore.js": {"type": "string"}, "readmore.min.js": {"type": "string"}}, "required": ["readmore.js", "readmore.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"readmore.js" : "sha256-z1/vlISXhYG3VIbQVWOhGMcjMREpewnJcJnUcJGUPpM=", "readmore.min.js" : "sha256-mF86yZ+je9n+pax9wq4HwJ3Q2imRKdWkuukEGl8BfRk="}
json_instruct
{"type": "object", "properties": {"readmore.js": {"type": "string"}, "readmore.min.js": {"type": "string"}}, "required": ["readmore.js", "readmore.min.js"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "string"}, "type": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require-dev": {"type": "object", "properties": {"phpspec/phpspec": {"type": "string"}}, "required": ["phpspec/phpspec"]}, "config": {"type": "object", "properties": {"bin-dir": {"type": "string"}}, "required": ["bin-dir"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Documer\\": {"type": "string"}}, "required": ["Documer\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "license", "type", "keywords", "homepage", "authors", "require-dev", "config", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "kbariotis/documer", "description" : "Bayes algorithm implementation in PHP for auto document classification.", "license" : "MIT", "type" : "library", "keywords" : ["classification", "bayes", "machine learning"], "homepage" : "http://github.com/kbariotis/documer", "authors" : [{"name" : "Kostas Bariotis", "email" : "[email protected]", "homepage" : "http://kostasbariotis.com"}], "require-dev" : {"phpspec/phpspec" : "~2.0"}, "config" : {"bin-dir" : "bin"}, "autoload" : {"psr-4" : {"Documer\\" : "src/"}}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "license": {"type": "string"}, "type": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}, "homepage": {"type": "string"}, "authors": {"type": "array", "items": {"type": "object", "properties": {"name": {"type": "string"}, "email": {"type": "string"}, "homepage": {"type": "string"}}, "required": ["name", "email", "homepage"]}}, "require-dev": {"type": "object", "properties": {"phpspec/phpspec": {"type": "string"}}, "required": ["phpspec/phpspec"]}, "config": {"type": "object", "properties": {"bin-dir": {"type": "string"}}, "required": ["bin-dir"]}, "autoload": {"type": "object", "properties": {"psr-4": {"type": "object", "properties": {"Documer\\": {"type": "string"}}, "required": ["Documer\\"]}}, "required": ["psr-4"]}}, "required": ["name", "description", "license", "type", "keywords", "homepage", "authors", "require-dev", "config", "autoload"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
["hops", "skypager", "skypager-project-bundler", "skypager-webpack", "webpack-es6-builder"]
json_instruct
{"type": "array", "items": {"type": "string"}, "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "6103030008", "district_id" : "6103030", "name" : "AMBOYO SELATAN"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "district_id": {"type": "string"}, "name": {"type": "string"}}, "required": ["id", "district_id", "name"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "data": {"type": "object", "properties": {}, "required": []}, "start": {"type": "string"}, "end": {"type": "string"}}, "required": ["id", "type", "data", "start", "end"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : "loc2segfasttravloc103s1i72-9", "type" : "FAST_TRAVEL", "data" : {}, "start" : "loc103", "end" : "s1i72-9"}
json_instruct
{"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "data": {"type": "object", "properties": {}, "required": []}, "start": {"type": "string"}, "end": {"type": "string"}}, "required": ["id", "type", "data", "start", "end"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"hash" : "0x4475aba6403911c0e84dbc7b636a994e11be885892328182723915ccbf4d7da1", "parentHash" : "0x7c02b8dcec55bee6d4d84d8fe7681d0bcae20463ded18e460428e7bbbdc818d4", "number" : 20089, "timestamp" : 1438490340, "nonce" : "0xa16359826f98f1fb", "difficulty" : 976353036387, "gasLimit" : {"_hex" : "0x1388"}, "gasUsed" : {"_hex" : "0x0"}, "miner" : "0xf927a40C8B7F6E07c5af7FA2155B4864a4112B13", "extraData" : "0x476574682f76312e302e302f6c696e75782f676f312e342e32", "transactions" : []}
json_instruct
{"type": "object", "properties": {"hash": {"type": "string"}, "parentHash": {"type": "string"}, "number": {"type": "integer"}, "timestamp": {"type": "integer"}, "nonce": {"type": "string"}, "difficulty": {"type": "integer"}, "gasLimit": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "gasUsed": {"type": "object", "properties": {"_hex": {"type": "string"}}, "required": ["_hex"]}, "miner": {"type": "string"}, "extraData": {"type": "string"}, "transactions": {"type": "array", "items": {}}}, "required": ["hash", "parentHash", "number", "timestamp", "nonce", "difficulty", "gasLimit", "gasUsed", "miner", "extraData", "transactions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"directions": {"type": "array", "items": {"type": "string"}}, "ingredients": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "source": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["directions", "ingredients", "language", "source", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"directions" : ["Place rice in strainer. Rinse under cold water until water runs clear. Drain well. Transfer rice to heavy medium saucepan. Add 3 cups cold water. Stir in ginger. Bring water to boil over high heat. Reduce heat to low, cover, and cook until rice is tender, about 12 minutes. Remove from heat. Sprinkle peas over rice (do not stir into rice). Cover and let stand 5 minutes. Gently stir peas into rice. Season rice lightly with salt. Transfer to bowl and serve."], "ingredients" : ["1 1/2 cups uncooked medium-grain white rice", "3 cups cold water", "1 tablespoon minced fresh ginger", "1 cup frozen petite peas"], "language" : "en-US", "source" : "www.epicurious.com", "tags" : ["Ginger", "Rice", "Side", "Quick & Easy", "Pea", "Boil", "Fat Free", "Sugar Conscious", "Kidney Friendly", "Vegan", "Vegetarian", "Pescatarian", "Dairy Free", "Wheat/Gluten-Free", "Peanut Free", "Tree Nut Free", "Soy Free", "No Sugar Added", "Kosher"], "title" : "Sticky Ginger Rice with Peas", "url" : "http://www.epicurious.com/recipes/food/views/sticky-ginger-rice-with-peas-107876"}
json_instruct
{"type": "object", "properties": {"directions": {"type": "array", "items": {"type": "string"}}, "ingredients": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "source": {"type": "string"}, "tags": {"type": "array", "items": {"type": "string"}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["directions", "ingredients", "language", "source", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"homepage": {"type": "string"}, "version": {"type": "string"}, "license": {"type": "string"}, "url": {"type": "string"}, "hash": {"type": "string"}, "extract_dir": {"type": "string"}, "bin": {"type": "string"}}, "required": ["homepage", "version", "license", "url", "hash", "extract_dir", "bin"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"homepage" : "http://optipng.sourceforge.net/", "version" : "0.7.5", "license" : "zlib", "url" : "http://downloads.sourceforge.net/project/optipng/OptiPNG/optipng-0.7.5/optipng-0.7.5-win32.zip", "hash" : "51c47db11c2c28b603e051408f56f7e599aabde6280bdcbee524a53e2fa40e4d", "extract_dir" : "optipng-0.7.5-win32", "bin" : "optipng.exe"}
json_instruct
{"type": "object", "properties": {"homepage": {"type": "string"}, "version": {"type": "string"}, "license": {"type": "string"}, "url": {"type": "string"}, "hash": {"type": "string"}, "extract_dir": {"type": "string"}, "bin": {"type": "string"}}, "required": ["homepage", "version", "license", "url", "hash", "extract_dir", "bin"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"\u5de5\u5ee0\u540d\u7a31" : "\u548c\u8ed2\u80a1\u4efd\u6709\u9650\u516c\u53f8\u4e00\u5ee0", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f" : "99717947", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f" : "", "\u5de5\u5ee0\u5730\u5740" : "\u6843\u5712\u5e02\u5e73\u93ae\u5340\u5e73\u5357\u91cc\u4e2d\u8c50\u8def\u5357\u52e2\u4e8c\u6bb5\uff14\uff16\uff10\u5df7\uff11\uff11\uff16\u4e4b\uff16\u865f", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc" : "\u6843\u5712\u5e02\u5e73\u93ae\u5340", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d" : "\u5f35\u96ea\u6885", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f" : "23546828", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b" : "\u80a1\u4efd\u6709\u9650\u516c\u53f8", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f" : "", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f" : "0981214", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b" : "\u751f\u7522\u4e2d", "\u7522\u696d\u985e\u5225" : ["29\u6a5f\u68b0\u8a2d\u5099\u88fd\u9020\u696d"], "\u4e3b\u8981\u7522\u54c1" : ["293\u901a\u7528\u6a5f\u68b0\u8a2d\u5099"]}
json_instruct
{"type": "object", "properties": {"\u5de5\u5ee0\u540d\u7a31": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f": {"type": "string"}, "\u5de5\u5ee0\u5730\u5740": {"type": "string"}, "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc": {"type": "string"}, "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d": {"type": "string"}, "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f": {"type": "string"}, "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b": {"type": "string"}, "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f": {"type": "string"}, "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b": {"type": "string"}, "\u7522\u696d\u985e\u5225": {"type": "array", "items": {"type": "string"}}, "\u4e3b\u8981\u7522\u54c1": {"type": "array", "items": {"type": "string"}}}, "required": ["\u5de5\u5ee0\u540d\u7a31", "\u5de5\u5ee0\u767b\u8a18\u7de8\u865f", "\u5de5\u5ee0\u8a2d\u7acb\u8a31\u53ef\u6848\u865f", "\u5de5\u5ee0\u5730\u5740", "\u5de5\u5ee0\u5e02\u93ae\u9109\u6751\u91cc", "\u5de5\u5ee0\u8ca0\u8cac\u4eba\u59d3\u540d", "\u71df\u5229\u4e8b\u696d\u7d71\u4e00\u7de8\u865f", "\u5de5\u5ee0\u7d44\u7e54\u578b\u614b", "\u5de5\u5ee0\u8a2d\u7acb\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u6838\u51c6\u65e5\u671f", "\u5de5\u5ee0\u767b\u8a18\u72c0\u614b", "\u7522\u696d\u985e\u5225", "\u4e3b\u8981\u7522\u54c1"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"category": {"type": "string"}, "dependencies": {"type": "array", "items": {}}, "description": {"type": "string"}, "id": {"type": "string"}, "name": {"type": "string"}, "priority": {"type": "string"}, "spec": {"type": "string"}, "type": {"type": "string"}}, "required": ["category", "dependencies", "description", "id", "name", "priority", "spec", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"category" : "security", "dependencies" : [], "description" : ". Objectives Satisfied: O.APPLICATION-TOOLS, O.NETWORK", "id" : "SEC.7.3", "name" : "Process Quotas", "priority" : "P1", "spec" : "CGL", "type" : ""}
json_instruct
{"type": "object", "properties": {"category": {"type": "string"}, "dependencies": {"type": "array", "items": {}}, "description": {"type": "string"}, "id": {"type": "string"}, "name": {"type": "string"}, "priority": {"type": "string"}, "spec": {"type": "string"}, "type": {"type": "string"}}, "required": ["category", "dependencies", "description", "id", "name", "priority", "spec", "type"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"template": {"type": "object", "properties": {"small": {"type": "string"}, "medium": {"type": "string"}, "large": {"type": "string"}}, "required": ["small", "medium", "large"]}, "channels": {"type": "object", "properties": {"xolliegamerz": {"type": "object", "properties": {"title": {"type": "string"}, "channel_id": {"type": "integer"}, "link": {"type": "string"}, "desc": {"type": "null"}, "id": {"type": "string"}, "first_seen": {"type": "null"}, "badge": {"type": "string"}, "badge_starting": {"type": "string"}, "badge_3m": {"type": "null"}, "badge_6m": {"type": "null"}, "badge_12m": {"type": "null"}, "badge_24m": {"type": "null"}, "cheermote1": {"type": "null"}, "cheermote100": {"type": "null"}, "cheermote1000": {"type": "null"}, "cheermote5000": {"type": "null"}, "cheermote10000": {"type": "null"}, "set": {"type": "integer"}, "emotes": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "image_id": {"type": "integer"}}, "required": ["code", "image_id"]}}}, "required": ["title", "channel_id", "link", "desc", "id", "first_seen", "badge", "badge_starting", "badge_3m", "badge_6m", "badge_12m", "badge_24m", "cheermote1", "cheermote100", "cheermote1000", "cheermote5000", "cheermote10000", "set", "emotes"]}}, "required": ["xolliegamerz"]}}, "required": ["template", "channels"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"template" : {"small" : "https://static-cdn.jtvnw.net/emoticons/v1/{image_id}/1.0", "medium" : "https://static-cdn.jtvnw.net/emoticons/v1/{image_id}/2.0", "large" : "https://static-cdn.jtvnw.net/emoticons/v1/{image_id}/3.0"}, "channels" : {"xolliegamerz" : {"title" : "xOllieGamerz", "channel_id" : 51870280, "link" : "http://twitch.tv/xolliegamerz", "desc" : null, "id" : "xolliegamerz", "first_seen" : null, "badge" : "https://static-cdn.jtvnw.net/badges/v1/cd9547c6-4b68-4b1a-bf40-41ac472fb97f/1", "badge_starting" : "https://static-cdn.jtvnw.net/badges/v1/cd9547c6-4b68-4b1a-bf40-41ac472fb97f/3", "badge_3m" : null, "badge_6m" : null, "badge_12m" : null, "badge_24m" : null, "cheermote1" : null, "cheermote100" : null, "cheermote1000" : null, "cheermote5000" : null, "cheermote10000" : null, "set" : 10499, "emotes" : [{"code" : "ollieSWAG", "image_id" : 55882}, {"code" : "ollieAGARIO", "image_id" : 55884}, {"code" : "ollieGG", "image_id" : 54220}]}}}
json_instruct
{"type": "object", "properties": {"template": {"type": "object", "properties": {"small": {"type": "string"}, "medium": {"type": "string"}, "large": {"type": "string"}}, "required": ["small", "medium", "large"]}, "channels": {"type": "object", "properties": {"xolliegamerz": {"type": "object", "properties": {"title": {"type": "string"}, "channel_id": {"type": "integer"}, "link": {"type": "string"}, "desc": {"type": "null"}, "id": {"type": "string"}, "first_seen": {"type": "null"}, "badge": {"type": "string"}, "badge_starting": {"type": "string"}, "badge_3m": {"type": "null"}, "badge_6m": {"type": "null"}, "badge_12m": {"type": "null"}, "badge_24m": {"type": "null"}, "cheermote1": {"type": "null"}, "cheermote100": {"type": "null"}, "cheermote1000": {"type": "null"}, "cheermote5000": {"type": "null"}, "cheermote10000": {"type": "null"}, "set": {"type": "integer"}, "emotes": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "image_id": {"type": "integer"}}, "required": ["code", "image_id"]}}}, "required": ["title", "channel_id", "link", "desc", "id", "first_seen", "badge", "badge_starting", "badge_3m", "badge_6m", "badge_12m", "badge_24m", "cheermote1", "cheermote100", "cheermote1000", "cheermote5000", "cheermote10000", "set", "emotes"]}}, "required": ["xolliegamerz"]}}, "required": ["template", "channels"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"type": {"type": "string"}, "pattern": {"type": "array", "items": {"type": "string"}}, "key": {"type": "object", "properties": {"P": {"type": "object", "properties": {"item": {"type": "string"}, "data": {"type": "integer"}}, "required": ["item", "data"]}, "L": {"type": "object", "properties": {"item": {"type": "string"}, "data": {"type": "integer"}}, "required": ["item", "data"]}, "C": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}}, "required": ["P", "L", "C"]}, "result": {"type": "object", "properties": {"item": {"type": "string"}, "data": {"type": "integer"}}, "required": ["item", "data"]}}, "required": ["type", "pattern", "key", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "minecraft:crafting_shaped", "pattern" : [" P ", "LCL", "PLP"], "key" : {"P" : {"item" : "minecraft:planks", "data" : 0}, "L" : {"item" : "minecraft:log", "data" : 0}, "C" : {"item" : "minecraft:cobblestone"}}, "result" : {"item" : "birdwmod:birdfeeder", "data" : 0}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "pattern": {"type": "array", "items": {"type": "string"}}, "key": {"type": "object", "properties": {"P": {"type": "object", "properties": {"item": {"type": "string"}, "data": {"type": "integer"}}, "required": ["item", "data"]}, "L": {"type": "object", "properties": {"item": {"type": "string"}, "data": {"type": "integer"}}, "required": ["item", "data"]}, "C": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}}, "required": ["P", "L", "C"]}, "result": {"type": "object", "properties": {"item": {"type": "string"}, "data": {"type": "integer"}}, "required": ["item", "data"]}}, "required": ["type", "pattern", "key", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"prepublish": {"type": "string"}, "test": {"type": "string"}}, "required": ["prepublish", "test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "peerDependencies": {"type": "object", "properties": {"react": {"type": "string"}}, "required": ["react"]}, "dependencies": {"type": "object", "properties": {"prop-types": {"type": "string"}, "understyle": {"type": "string"}}, "required": ["prop-types", "understyle"]}, "devDependencies": {"type": "object", "properties": {"babel-cli": {"type": "string"}, "babel-core": {"type": "string"}, "babel-jest": {"type": "string"}, "babel-preset-env": {"type": "string"}, "babel-preset-react": {"type": "string"}, "jest": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}, "standard": {"type": "string"}, "webpack": {"type": "string"}, "webpack-dev-server": {"type": "string"}}, "required": ["babel-cli", "babel-core", "babel-jest", "babel-preset-env", "babel-preset-react", "jest", "react", "react-dom", "standard", "webpack", "webpack-dev-server"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "peerDependencies", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "robox", "version" : "1.0.0-beta.8", "description" : "Higher-order React component for adding style helper props based on understyle", "main" : "dist/Robox.js", "scripts" : {"prepublish" : "mkdir -p dist && babel src --out-dir dist", "test" : "standard && jest"}, "keywords" : ["react", "react-hoc", "style", "css", "css-in-js", "understyle"], "author" : "Brent Jackson", "license" : "MIT", "peerDependencies" : {"react" : "^16.4.2"}, "dependencies" : {"prop-types" : "^15.6.2", "understyle" : "^1.2.0"}, "devDependencies" : {"babel-cli" : "^6.26.0", "babel-core" : "^6.26.3", "babel-jest" : "^23.4.2", "babel-preset-env" : "^1.7.0", "babel-preset-react" : "^6.24.1", "jest" : "^23.5.0", "react" : "^16.4.2", "react-dom" : "^16.4.2", "standard" : "^7.1.2", "webpack" : "^1.13.1", "webpack-dev-server" : "^1.14.1"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "main": {"type": "string"}, "scripts": {"type": "object", "properties": {"prepublish": {"type": "string"}, "test": {"type": "string"}}, "required": ["prepublish", "test"]}, "keywords": {"type": "array", "items": {"type": "string"}}, "author": {"type": "string"}, "license": {"type": "string"}, "peerDependencies": {"type": "object", "properties": {"react": {"type": "string"}}, "required": ["react"]}, "dependencies": {"type": "object", "properties": {"prop-types": {"type": "string"}, "understyle": {"type": "string"}}, "required": ["prop-types", "understyle"]}, "devDependencies": {"type": "object", "properties": {"babel-cli": {"type": "string"}, "babel-core": {"type": "string"}, "babel-jest": {"type": "string"}, "babel-preset-env": {"type": "string"}, "babel-preset-react": {"type": "string"}, "jest": {"type": "string"}, "react": {"type": "string"}, "react-dom": {"type": "string"}, "standard": {"type": "string"}, "webpack": {"type": "string"}, "webpack-dev-server": {"type": "string"}}, "required": ["babel-cli", "babel-core", "babel-jest", "babel-preset-env", "babel-preset-react", "jest", "react", "react-dom", "standard", "webpack", "webpack-dev-server"]}}, "required": ["name", "version", "description", "main", "scripts", "keywords", "author", "license", "peerDependencies", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "properties": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}}, "required": ["id", "type", "name", "code"]}}, "required": ["type", "coordinates", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "MultiPolygon", "coordinates" : [[[[-74.156991, 39.940926], [-74.156321, 39.944475], [-74.156213, 39.945081], [-74.156076, 39.945818], [-74.156026, 39.94609], [-74.155856, 39.947343], [-74.155779, 39.947558], [-74.153716, 39.947517], [-74.15369, 39.947798], [-74.153666, 39.948061], [-74.153627, 39.948487], [-74.151399, 39.948202], [-74.150335, 39.948065], [-74.148992, 39.947892], [-74.1486, 39.950469], [-74.14717, 39.950277], [-74.147263, 39.949671], [-74.147384, 39.948889], [-74.147562, 39.947729], [-74.147622, 39.947382], [-74.147612, 39.947301], [-74.147563, 39.947251], [-74.147573, 39.947175], [-74.145228, 39.94645], [-74.141734, 39.946235], [-74.140081, 39.946137], [-74.138948, 39.946068], [-74.138926, 39.946095], [-74.138812, 39.946095], [-74.13872, 39.946055], [-74.137737, 39.945994], [-74.137744, 39.945766], [-74.137699, 39.945754], [-74.137013, 39.945644], [-74.136726, 39.945611], [-74.136127, 39.945402], [-74.135755, 39.945237], [-74.13554, 39.945105], [-74.135441, 39.945017], [-74.135328, 39.944907], [-74.134984, 39.944863], [-74.134941, 39.944819], [-74.134899, 39.944577], [-74.134828, 39.944522], [-74.134142, 39.944269], [-74.134056, 39.944204], [-74.133942, 39.944094], [-74.133885, 39.943995], [-74.1338, 39.943753], [-74.133756, 39.943555], [-74.133721, 39.943487], [-74.133699, 39.943445], [-74.133599, 39.943203], [-74.133385, 39.942928], [-74.133362, 39.942889], [-74.133329, 39.94283], [-74.133171, 39.942676], [-74.13309, 39.942622], [-74.132349, 39.942046], [-74.132172, 39.941806], [-74.13306, 39.940551], [-74.138483, 39.933969], [-74.138532, 39.933942], [-74.13873, 39.933833], [-74.140385, 39.933804], [-74.144197, 39.935346], [-74.147859, 39.936988], [-74.147914, 39.937013], [-74.147997, 39.937046], [-74.155588, 39.940064], [-74.156055, 39.94025], [-74.156317, 39.940352], [-74.157045, 39.940635], [-74.156991, 39.940926]]]], "properties" : {"id" : "usa-08732-zip", "type" : "zip", "name" : "08732", "code" : "08732"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "properties": {"type": "object", "properties": {"id": {"type": "string"}, "type": {"type": "string"}, "name": {"type": "string"}, "code": {"type": "string"}}, "required": ["id", "type", "name", "code"]}}, "required": ["type", "coordinates", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"type": {"type": "string"}, "name": {"type": "string"}, "summary": {"type": "string"}, "license": {"type": "string"}, "version": {"type": "string"}, "exposed-modules": {"type": "array", "items": {"type": "string"}}, "elm-version": {"type": "string"}, "dependencies": {"type": "object", "properties": {"elm/core": {"type": "string"}}, "required": ["elm/core"]}, "test-dependencies": {"type": "object", "properties": {"elm-explorations/test": {"type": "string"}}, "required": ["elm-explorations/test"]}}, "required": ["type", "name", "summary", "license", "version", "exposed-modules", "elm-version", "dependencies", "test-dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "package", "name" : "elmw/hello-world", "summary" : "A \"Hello, World!\" is an introductory computer program.", "license" : "MIT", "version" : "2.0.3", "exposed-modules" : ["Main"], "elm-version" : "0.19.0 <= v < 0.20.0", "dependencies" : {"elm/core" : "1.0.0 <= v < 2.0.0"}, "test-dependencies" : {"elm-explorations/test" : "1.2.2 <= v < 2.0.0"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "name": {"type": "string"}, "summary": {"type": "string"}, "license": {"type": "string"}, "version": {"type": "string"}, "exposed-modules": {"type": "array", "items": {"type": "string"}}, "elm-version": {"type": "string"}, "dependencies": {"type": "object", "properties": {"elm/core": {"type": "string"}}, "required": ["elm/core"]}, "test-dependencies": {"type": "object", "properties": {"elm-explorations/test": {"type": "string"}}, "required": ["elm-explorations/test"]}}, "required": ["type", "name", "summary", "license", "version", "exposed-modules", "elm-version", "dependencies", "test-dependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"ETag": {"type": "string"}, "Last-Modified": {"type": "string"}, "base": {"type": "object", "properties": {"repo": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["repo"]}, "closed_at": {"type": "string"}, "created_at": {"type": "string"}, "draft": {"type": "boolean"}, "head": {"type": "object", "properties": {"ref": {"type": "string"}}, "required": ["ref"]}, "html_url": {"type": "string"}, "id": {"type": "integer"}, "labels": {"type": "array", "items": {}}, "mergeable": {"type": "boolean"}, "mergeable_state": {"type": "string"}, "merged": {"type": "boolean"}, "merged_at": {"type": "null"}, "number": {"type": "integer"}, "state": {"type": "string"}, "updated_at": {"type": "string"}}, "required": ["ETag", "Last-Modified", "base", "closed_at", "created_at", "draft", "head", "html_url", "id", "labels", "mergeable", "mergeable_state", "merged", "merged_at", "number", "state", "updated_at"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ETag" : "W/\"31f62cdf15c4ed4255d4b176ed875b09\"", "Last-Modified" : "Wed, 10 Jun 2020 17:24:02 GMT", "base" : {"repo" : {"name" : "terraform-provider-panos-feedstock"}}, "closed_at" : "2020-06-10T17:24:02Z", "created_at" : "2019-11-19T17:20:53Z", "draft" : false, "head" : {"ref" : "1.6.1"}, "html_url" : "https://github.com/conda-forge/terraform-provider-panos-feedstock/pull/13", "id" : 342796762, "labels" : [], "mergeable" : false, "mergeable_state" : "dirty", "merged" : false, "merged_at" : null, "number" : 13, "state" : "closed", "updated_at" : "2020-06-10T17:24:02Z"}
json_instruct
{"type": "object", "properties": {"ETag": {"type": "string"}, "Last-Modified": {"type": "string"}, "base": {"type": "object", "properties": {"repo": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["repo"]}, "closed_at": {"type": "string"}, "created_at": {"type": "string"}, "draft": {"type": "boolean"}, "head": {"type": "object", "properties": {"ref": {"type": "string"}}, "required": ["ref"]}, "html_url": {"type": "string"}, "id": {"type": "integer"}, "labels": {"type": "array", "items": {}}, "mergeable": {"type": "boolean"}, "mergeable_state": {"type": "string"}, "merged": {"type": "boolean"}, "merged_at": {"type": "null"}, "number": {"type": "integer"}, "state": {"type": "string"}, "updated_at": {"type": "string"}}, "required": ["ETag", "Last-Modified", "base", "closed_at", "created_at", "draft", "head", "html_url", "id", "labels", "mergeable", "mergeable_state", "merged", "merged_at", "number", "state", "updated_at"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"courseAOS": {"type": "string"}, "courseCode": {"type": "string"}, "courseName": {"type": "string"}, "courseType": {"type": "string"}, "faculty": {"type": "string"}, "teachingPeriods": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "units": {"type": "array", "items": {"type": "string"}}, "year": {"type": "integer"}}, "required": ["code", "units", "year"]}}}, "required": ["courseAOS", "courseCode", "courseName", "courseType", "faculty", "teachingPeriods"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"courseAOS" : "Bachelor of Nutrition and Dietetics (Honours)", "courseCode" : "4530", "courseName" : "Nutrition and Dietetics", "courseType" : "", "faculty" : "Faculty of Medicine, Nursing and Health Sciences", "teachingPeriods" : [{"code" : "S1-01", "units" : ["NUT1001", "NUT1010", "NUT1101"], "year" : 0}, {"code" : "S2-01", "units" : ["NUT1002", "NUT1102", "Elective"], "year" : 0}, {"code" : "S1-01", "units" : ["NUT2001", "NUT2102"], "year" : 1}, {"code" : "S2-01", "units" : ["NUT2002", "NUT2103"], "year" : 1}, {"code" : "S1-01", "units" : ["BND3102", "BND3101"], "year" : 2}, {"code" : "S2-01", "units" : ["BND3202", "BND3302"], "year" : 2}, {"code" : "S1-01", "units" : ["BND4082", "BND4092"], "year" : 3}, {"code" : "S2-01", "units" : ["BND4102", "BND4402"], "year" : 3}]}
json_instruct
{"type": "object", "properties": {"courseAOS": {"type": "string"}, "courseCode": {"type": "string"}, "courseName": {"type": "string"}, "courseType": {"type": "string"}, "faculty": {"type": "string"}, "teachingPeriods": {"type": "array", "items": {"type": "object", "properties": {"code": {"type": "string"}, "units": {"type": "array", "items": {"type": "string"}}, "year": {"type": "integer"}}, "required": ["code", "units", "year"]}}}, "required": ["courseAOS", "courseCode", "courseName", "courseType", "faculty", "teachingPeriods"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"directions": {"type": "array", "items": {"type": "string"}}, "ingredients": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "source": {"type": "string"}, "tags": {"type": "array", "items": {}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["directions", "ingredients", "language", "source", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"directions" : ["Preheat oven to 350 degrees F (175 degrees C).", "In a small bowl, combine corn, crackers and egg. Mix and pour into small baking dish. Bake for 30 minutes. Season with salt and pepper to taste."], "ingredients" : ["2 (14.75 ounce) cans cream-style corn", "1/4 (16 ounce) package saltine crackers", "1 egg, beaten"], "language" : "en-US", "source" : "allrecipes.com", "tags" : [], "title" : "Scalloped Corn II", "url" : "http://allrecipes.com/recipe/13683/scalloped-corn-ii/"}
json_instruct
{"type": "object", "properties": {"directions": {"type": "array", "items": {"type": "string"}}, "ingredients": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "source": {"type": "string"}, "tags": {"type": "array", "items": {}}, "title": {"type": "string"}, "url": {"type": "string"}}, "required": ["directions", "ingredients", "language", "source", "tags", "title", "url"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"body": {"type": "string"}, "attachments": {"type": "array", "items": {}}, "created_by_name": {"type": "string"}, "created_at": {"type": "string"}, "created_by": {"type": "string"}, "parent_id": {"type": "string"}, "id": {"type": "string"}}, "required": ["body", "attachments", "created_by_name", "created_at", "created_by", "parent_id", "id"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"body" : "try -dj 0\nit may be that\nG\n___\n<sup>Automatically generated content from [radiance mailing-list](https://radiance-online.org/pipermail/radiance-general/2014-August/010471.html).</sup>", "attachments" : [], "created_by_name" : "Antonutto", "created_at" : "August 20, 2014 at 01:30PM", "created_by" : "Antonutto", "parent_id" : "radiance-general_010470", "id" : "radiance-general_010471"}
json_instruct
{"type": "object", "properties": {"body": {"type": "string"}, "attachments": {"type": "array", "items": {}}, "created_by_name": {"type": "string"}, "created_at": {"type": "string"}, "created_by": {"type": "string"}, "parent_id": {"type": "string"}, "id": {"type": "string"}}, "required": ["body", "attachments", "created_by_name", "created_at", "created_by", "parent_id", "id"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "dependencies": {"type": "object", "properties": {"tslint-eslint-rules": {"type": "string"}}, "required": ["tslint-eslint-rules"]}, "devDependencies": {"type": "object", "properties": {}, "required": []}, "author": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "required": ["name", "version", "description", "scripts", "dependencies", "devDependencies", "author", "license", "repository"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "subtractiontype.ts", "version" : "1.0.0", "description" : "Subtraction types for TypeScript: e.g. Sub<'a' | 'b', 'a'> and Dissoc<{a: number, b: number}, 'a'>", "scripts" : {"test" : "tslint index.d.ts"}, "dependencies" : {"tslint-eslint-rules" : "^4.1.1"}, "devDependencies" : {}, "author" : "Adrian Leonhard <[email protected]> (https://github.com/NaridaL)", "license" : "MIT", "repository" : {"type" : "git", "url" : "https://github.com/NaridaL/subtractiontype.ts.git"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "version": {"type": "string"}, "description": {"type": "string"}, "scripts": {"type": "object", "properties": {"test": {"type": "string"}}, "required": ["test"]}, "dependencies": {"type": "object", "properties": {"tslint-eslint-rules": {"type": "string"}}, "required": ["tslint-eslint-rules"]}, "devDependencies": {"type": "object", "properties": {}, "required": []}, "author": {"type": "string"}, "license": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}}, "required": ["name", "version", "description", "scripts", "dependencies", "devDependencies", "author", "license", "repository"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate a valid JSON object that conforms to the following schema: {"type": "object", "properties": {"license": {"type": "object", "properties": {"allowlists": {"type": "array", "items": {"type": "object", "properties": {"paths": {"type": "array", "items": {"type": "string"}}, "patterns": {"type": "array", "items": {"type": "string"}}, "notes": {"type": "array", "items": {}}}, "required": ["paths", "patterns", "notes"]}}}, "required": ["allowlists"]}}, "required": ["license"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"license" : {"allowlists" : [{"paths" : ["third_party/boringssl/.*", "third_party/widevine_cdm/third_party/boringssl/.*"], "patterns" : ["cryptsoft.lic"], "notes" : []}]}}
json_instruct
{"type": "object", "properties": {"license": {"type": "object", "properties": {"allowlists": {"type": "array", "items": {"type": "object", "properties": {"paths": {"type": "array", "items": {"type": "string"}}, "patterns": {"type": "array", "items": {"type": "string"}}, "notes": {"type": "array", "items": {}}}, "required": ["paths", "patterns", "notes"]}}}, "required": ["allowlists"]}}, "required": ["license"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "support": {"type": "string"}, "currentVersion": {"type": "string"}, "author": {"type": "string"}, "url": {"type": "string"}, "email": {"type": "string"}, "created": {"type": "string"}, "categories": {"type": "array", "items": {}}, "tags": {"type": "array", "items": {"type": "string"}}, "useCases": {"type": "array", "items": {}}, "keywords": {"type": "array", "items": {}}}, "required": ["name", "description", "support", "currentVersion", "author", "url", "email", "created", "categories", "tags", "useCases", "keywords"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Tidy", "description" : "Tidy integration handle endpoints environment installation.", "support" : "community", "currentVersion" : "1.0.1", "author" : "Hod Alpert & Gal Rabin & Eli Sharf & Bar Levy", "url" : "", "email" : "[email protected]", "created" : "2020-09-29T18:29:50Z", "categories" : [], "tags" : ["IT"], "useCases" : [], "keywords" : []}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "support": {"type": "string"}, "currentVersion": {"type": "string"}, "author": {"type": "string"}, "url": {"type": "string"}, "email": {"type": "string"}, "created": {"type": "string"}, "categories": {"type": "array", "items": {}}, "tags": {"type": "array", "items": {"type": "string"}}, "useCases": {"type": "array", "items": {}}, "keywords": {"type": "array", "items": {}}}, "required": ["name", "description", "support", "currentVersion", "author", "url", "email", "created", "categories", "tags", "useCases", "keywords"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"citations" : [{"textCitation" : "[See usisuhgra on Metamath](http://us.metamath.org/mpegif/usisuhgra.html)"}], "names" : ["usisuhgra"], "language" : "METAMATH_SET_MM", "lookupTerms" : ["#T_cV", "#T_cusg", "#T_cE", "#T_wi", "#T_cV", "#T_cuhg", "#T_cE"], "metaLanguage" : "METAMATH", "remarks" : " An undirected simple graph without loops is an undirected hypergraph. (Contributed by Alexander van der Vekens, 9-Feb-2018.) ", "statement" : "usisuhgra $p |- ( V USGrph E -> V UHGrph E ) $."}
json_instruct
{"type": "object", "properties": {"citations": {"type": "array", "items": {"type": "object", "properties": {"textCitation": {"type": "string"}}, "required": ["textCitation"]}}, "names": {"type": "array", "items": {"type": "string"}}, "language": {"type": "string"}, "lookupTerms": {"type": "array", "items": {"type": "string"}}, "metaLanguage": {"type": "string"}, "remarks": {"type": "string"}, "statement": {"type": "string"}}, "required": ["citations", "names", "language", "lookupTerms", "metaLanguage", "remarks", "statement"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"name": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}}, "required": ["start", "build"]}, "dependencies": {"type": "object", "properties": {"hyperdom": {"type": "string"}}, "required": ["hyperdom"]}, "devDependencies": {"type": "object", "properties": {"clean-webpack-plugin": {"type": "string"}, "css-loader": {"type": "string"}, "html-webpack-plugin": {"type": "string"}, "style-loader": {"type": "string"}, "ts-loader": {"type": "string"}, "typescript": {"type": "string"}, "webpack": {"type": "string"}, "webpack-cli": {"type": "string"}, "webpack-dev-server": {"type": "string"}}, "required": ["clean-webpack-plugin", "css-loader", "html-webpack-plugin", "style-loader", "ts-loader", "typescript", "webpack", "webpack-cli", "webpack-dev-server"]}}, "required": ["name", "scripts", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "get-started-init-ts", "scripts" : {"start" : "webpack-dev-server", "build" : "webpack"}, "dependencies" : {"hyperdom" : "2.1.0"}, "devDependencies" : {"clean-webpack-plugin" : "latest", "css-loader" : "latest", "html-webpack-plugin" : "latest", "style-loader" : "latest", "ts-loader" : "latest", "typescript" : "latest", "webpack" : "latest", "webpack-cli" : "latest", "webpack-dev-server" : "latest"}}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "scripts": {"type": "object", "properties": {"start": {"type": "string"}, "build": {"type": "string"}}, "required": ["start", "build"]}, "dependencies": {"type": "object", "properties": {"hyperdom": {"type": "string"}}, "required": ["hyperdom"]}, "devDependencies": {"type": "object", "properties": {"clean-webpack-plugin": {"type": "string"}, "css-loader": {"type": "string"}, "html-webpack-plugin": {"type": "string"}, "style-loader": {"type": "string"}, "ts-loader": {"type": "string"}, "typescript": {"type": "string"}, "webpack": {"type": "string"}, "webpack-cli": {"type": "string"}, "webpack-dev-server": {"type": "string"}}, "required": ["clean-webpack-plugin", "css-loader", "html-webpack-plugin", "style-loader", "ts-loader", "typescript", "webpack", "webpack-cli", "webpack-dev-server"]}}, "required": ["name", "scripts", "dependencies", "devDependencies"], "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ast" : null, "code" : "\"use strict\";\n\nObject.defineProperty(exports, \"__esModule\", {\n value: true\n});\nexports.default = schnorrkelKeypairToU8a;\n\nvar _util = require(\"@polkadot/util\"); // Copyright 2017-2020 @polkadot/util-crypto authors & contributors\n// SPDX-License-Identifier: Apache-2.0\n\n\nfunction schnorrkelKeypairToU8a({\n publicKey,\n secretKey\n}) {\n return (0, _util.u8aConcat)(secretKey, publicKey).slice();\n}", "map" : {"version" : 3, "sources" : ["/mnt/c/Users/PC/Documents/PolkadotHelloWorld/PolkadotHelloWorld/Front-End-Project1/substrate-node-template/substrate-front-end-template/node_modules/@polkadot/util-crypto/schnorrkel/keypair/toU8a.js"], "names" : ["Object", "defineProperty", "exports", "value", "default", "schnorrkelKeypairToU8a", "_util", "require", "publicKey", "secretKey", "u8aConcat", "slice"], "mappings" : "AAAA;;AAEAA,MAAM,CAACC,cAAP,CAAsBC,OAAtB,EAA+B,YAA/B,EAA6C;AAC3CC,EAAAA,KAAK,EAAE;AADoC,CAA7C;AAGAD,OAAO,CAACE,OAAR,GAAkBC,sBAAlB;;AAEA,IAAIC,KAAK,GAAGC,OAAO,CAAC,gBAAD,CAAnB,C,CAEA;AACA;;;AACA,SAASF,sBAAT,CAAgC;AAC9BG,EAAAA,SAD8B;AAE9BC,EAAAA;AAF8B,CAAhC,EAGG;AACD,SAAO,CAAC,GAAGH,KAAK,CAACI,SAAV,EAAqBD,SAArB,EAAgCD,SAAhC,EAA2CG,KAA3C,EAAP;AACD", "sourcesContent" : ["\"use strict\";\n\nObject.defineProperty(exports, \"__esModule\", {\n value: true\n});\nexports.default = schnorrkelKeypairToU8a;\n\nvar _util = require(\"@polkadot/util\");\n\n// Copyright 2017-2020 @polkadot/util-crypto authors & contributors\n// SPDX-License-Identifier: Apache-2.0\nfunction schnorrkelKeypairToU8a({\n publicKey,\n secretKey\n}) {\n return (0, _util.u8aConcat)(secretKey, publicKey).slice();\n}"]}, "metadata" : {}, "sourceType" : "script"}
json_instruct
{"type": "object", "properties": {"ast": {"type": "null"}, "code": {"type": "string"}, "map": {"type": "object", "properties": {"version": {"type": "integer"}, "sources": {"type": "array", "items": {"type": "string"}}, "names": {"type": "array", "items": {"type": "string"}}, "mappings": {"type": "string"}, "sourcesContent": {"type": "array", "items": {"type": "string"}}}, "required": ["version", "sources", "names", "mappings", "sourcesContent"]}, "metadata": {"type": "object", "properties": {}, "required": []}, "sourceType": {"type": "string"}}, "required": ["ast", "code", "map", "metadata", "sourceType"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "name_long": {"type": "string"}, "fips": {"type": "string"}, "state_code_int": {"type": "integer"}, "state_code_postal": {"type": "string"}, "state_code_iso": {"type": "string"}, "county_code": {"type": "integer"}, "population": {"type": "integer"}, "countrylevel_id": {"type": "string"}, "census_data": {"type": "object", "properties": {"COUNTYNS": {"type": "string"}, "AFFGEOID": {"type": "string"}, "LSAD": {"type": "string"}, "ALAND": {"type": "integer"}, "AWATER": {"type": "integer"}}, "required": ["COUNTYNS", "AFFGEOID", "LSAD", "ALAND", "AWATER"]}, "center_lat": {"type": "number"}, "center_lon": {"type": "number"}, "area_m2": {"type": "integer"}, "timezone": {"type": "string"}}, "required": ["name", "name_long", "fips", "state_code_int", "state_code_postal", "state_code_iso", "county_code", "population", "countrylevel_id", "census_data", "center_lat", "center_lon", "area_m2", "timezone"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "properties" : {"name" : "Callahan County", "name_long" : "Callahan County, TX", "fips" : "48059", "state_code_int" : 48, "state_code_postal" : "TX", "state_code_iso" : "US-TX", "county_code" : 59, "population" : 13943, "countrylevel_id" : "fips:48059", "census_data" : {"COUNTYNS" : "01383815", "AFFGEOID" : "0500000US48059", "LSAD" : "06", "ALAND" : 2329363242, "AWATER" : 4898783}, "center_lat" : 32.3, "center_lon" : -99.37, "area_m2" : 2334262025, "timezone" : "America/Chicago"}, "geometry" : {"type" : "Polygon", "coordinates" : [[[-99.631, 32.174], [-99.631, 32.228], [-99.631, 32.249], [-99.631, 32.25], [-99.631, 32.257], [-99.631, 32.299], [-99.631, 32.314], [-99.631, 32.329], [-99.631, 32.331], [-99.63, 32.372], [-99.63, 32.437], [-99.63, 32.475], [-99.63, 32.515], [-99.612, 32.515], [-99.595, 32.515], [-99.561, 32.515], [-99.509, 32.515], [-99.458, 32.515], [-99.442, 32.515], [-99.397, 32.515], [-99.341, 32.515], [-99.17, 32.515], [-99.125, 32.515], [-99.124, 32.515], [-99.114, 32.515], [-99.114, 32.5], [-99.115, 32.495], [-99.115, 32.459], [-99.115, 32.427], [-99.116, 32.386], [-99.116, 32.378], [-99.116, 32.375], [-99.116, 32.375], [-99.117, 32.282], [-99.117, 32.278], [-99.118, 32.25], [-99.117, 32.249], [-99.118, 32.185], [-99.118, 32.13], [-99.119, 32.125], [-99.118, 32.125], [-99.119, 32.08], [-99.12, 32.08], [-99.125, 32.079], [-99.148, 32.079], [-99.156, 32.079], [-99.196, 32.079], [-99.211, 32.079], [-99.247, 32.079], [-99.25, 32.08], [-99.311, 32.08], [-99.406, 32.08], [-99.423, 32.08], [-99.457, 32.08], [-99.499, 32.08], [-99.5, 32.08], [-99.631, 32.081], [-99.631, 32.174]]]}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "properties": {"type": "object", "properties": {"name": {"type": "string"}, "name_long": {"type": "string"}, "fips": {"type": "string"}, "state_code_int": {"type": "integer"}, "state_code_postal": {"type": "string"}, "state_code_iso": {"type": "string"}, "county_code": {"type": "integer"}, "population": {"type": "integer"}, "countrylevel_id": {"type": "string"}, "census_data": {"type": "object", "properties": {"COUNTYNS": {"type": "string"}, "AFFGEOID": {"type": "string"}, "LSAD": {"type": "string"}, "ALAND": {"type": "integer"}, "AWATER": {"type": "integer"}}, "required": ["COUNTYNS", "AFFGEOID", "LSAD", "ALAND", "AWATER"]}, "center_lat": {"type": "number"}, "center_lon": {"type": "number"}, "area_m2": {"type": "integer"}, "timezone": {"type": "string"}}, "required": ["name", "name_long", "fips", "state_code_int", "state_code_postal", "state_code_iso", "county_code", "population", "countrylevel_id", "census_data", "center_lat", "center_lon", "area_m2", "timezone"]}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}}, "required": ["type", "properties", "geometry"], "$schema": "http://json-schema.org/draft-07/schema#"}
Generate sample JSON data that conforms to the following schema definition: {"type": "object", "properties": {"aliases": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "images": {"type": "object", "properties": {"background": {"type": "null"}, "thumbnail": {"type": "null"}}, "required": ["background", "thumbnail"]}, "mainColor": {"type": "null"}, "name": {"type": "string"}, "partners": {"type": "array", "items": {}}, "powers": {"type": "array", "items": {}}, "ranking": {"type": "object", "properties": {"comicCount": {"type": "integer"}, "eventCount": {"type": "integer"}, "pageviewCount": {"type": "integer"}, "serieCount": {"type": "integer"}, "storyCount": {"type": "integer"}}, "required": ["comicCount", "eventCount", "pageviewCount", "serieCount", "storyCount"]}, "secretIdentities": {"type": "array", "items": {"type": "string"}}, "species": {"type": "array", "items": {"type": "string"}}, "superName": {"type": "string"}, "teams": {"type": "array", "items": {"type": "string"}}, "urls": {"type": "object", "properties": {"marvel": {"type": "null"}, "wikipedia": {"type": "string"}}, "required": ["marvel", "wikipedia"]}}, "required": ["aliases", "authors", "description", "images", "mainColor", "name", "partners", "powers", "ranking", "secretIdentities", "species", "superName", "teams", "urls"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"aliases" : ["Manikin"], "authors" : ["Bill Mantlo", "Dave Ross"], "description" : "Manikin (Whitman Knapp) is a fictional mutant character featured in the publications of Marvel Comics.", "images" : {"background" : null, "thumbnail" : null}, "mainColor" : null, "name" : "Manikin", "partners" : [], "powers" : [], "ranking" : {"comicCount" : 0, "eventCount" : 0, "pageviewCount" : 212, "serieCount" : 0, "storyCount" : 0}, "secretIdentities" : ["Whitman Knapp"], "species" : ["Mutant"], "superName" : "Manikin", "teams" : ["Alpha Flight", "Beta Flight"], "urls" : {"marvel" : null, "wikipedia" : "https://en.wikipedia.org/wiki/Manikin_(comics)"}}
json_instruct
{"type": "object", "properties": {"aliases": {"type": "array", "items": {"type": "string"}}, "authors": {"type": "array", "items": {"type": "string"}}, "description": {"type": "string"}, "images": {"type": "object", "properties": {"background": {"type": "null"}, "thumbnail": {"type": "null"}}, "required": ["background", "thumbnail"]}, "mainColor": {"type": "null"}, "name": {"type": "string"}, "partners": {"type": "array", "items": {}}, "powers": {"type": "array", "items": {}}, "ranking": {"type": "object", "properties": {"comicCount": {"type": "integer"}, "eventCount": {"type": "integer"}, "pageviewCount": {"type": "integer"}, "serieCount": {"type": "integer"}, "storyCount": {"type": "integer"}}, "required": ["comicCount", "eventCount", "pageviewCount", "serieCount", "storyCount"]}, "secretIdentities": {"type": "array", "items": {"type": "string"}}, "species": {"type": "array", "items": {"type": "string"}}, "superName": {"type": "string"}, "teams": {"type": "array", "items": {"type": "string"}}, "urls": {"type": "object", "properties": {"marvel": {"type": "null"}, "wikipedia": {"type": "string"}}, "required": ["marvel", "wikipedia"]}}, "required": ["aliases", "authors", "description", "images", "mainColor", "name", "partners", "powers", "ranking", "secretIdentities", "species", "superName", "teams", "urls"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "dharmaVerificationStatus": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "dharmaVerificationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "Stabilize Strategy Multi-Seigniorage", "symbol" : "zs-SGR", "address" : "0xfea2468C55E80aB9487f6E6189C79Ce31E1f9Ea7", "decimals" : 18, "dharmaVerificationStatus" : "UNVERIFIED"}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "symbol": {"type": "string"}, "address": {"type": "string"}, "decimals": {"type": "integer"}, "dharmaVerificationStatus": {"type": "string"}}, "required": ["name", "symbol", "address", "decimals", "dharmaVerificationStatus"], "$schema": "http://json-schema.org/draft-07/schema#"}
The schema below describes a JSON structure. Generate a valid example: {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "module": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "version", "main", "module", "repository", "author", "license", "keywords"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"name" : "qimagemagick", "description" : "A wrapper for the ImageMagick CLI", "version" : "0.2.0", "main" : "./src/QImageMagick.js", "module" : "./src/QImageMagick.mjs", "repository" : {"type" : "git", "url" : "https://github.com/raphaelquintao/node-qimagemagick.git"}, "author" : "Raphael Quint\u00e3o <https://github.com/raphaelquintao>", "license" : "MIT", "keywords" : ["imagemagick", "image", "converter"]}
json_instruct
{"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "version": {"type": "string"}, "main": {"type": "string"}, "module": {"type": "string"}, "repository": {"type": "object", "properties": {"type": {"type": "string"}, "url": {"type": "string"}}, "required": ["type", "url"]}, "author": {"type": "string"}, "license": {"type": "string"}, "keywords": {"type": "array", "items": {"type": "string"}}}, "required": ["name", "description", "version", "main", "module", "repository", "author", "license", "keywords"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"type": {"type": "string"}, "pattern": {"type": "array", "items": {"type": "string"}}, "key": {"type": "object", "properties": {"c": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}, "w": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}}, "required": ["c", "w"]}, "result": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}}, "required": ["type", "pattern", "key", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "minecraft:crafting_shaped", "pattern" : ["w", "c", "w"], "key" : {"c" : {"item" : "create:andesite_casing"}, "w" : {"item" : "create:cogwheel"}}, "result" : {"item" : "creategears:simple_gearshift"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "pattern": {"type": "array", "items": {"type": "string"}}, "key": {"type": "object", "properties": {"c": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}, "w": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}}, "required": ["c", "w"]}, "result": {"type": "object", "properties": {"item": {"type": "string"}}, "required": ["item"]}}, "required": ["type", "pattern", "key", "result"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"parent" : "candymod:block/candy_cane/candy_cane_workbench_white_green"}
json_instruct
{"type": "object", "properties": {"parent": {"type": "string"}}, "required": ["parent"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "slug": {"type": "string"}, "powerstats": {"type": "object", "properties": {"intelligence": {"type": "integer"}, "strength": {"type": "integer"}, "speed": {"type": "integer"}, "durability": {"type": "integer"}, "power": {"type": "integer"}, "combat": {"type": "integer"}}, "required": ["intelligence", "strength", "speed", "durability", "power", "combat"]}, "appearance": {"type": "object", "properties": {"gender": {"type": "string"}, "race": {"type": "string"}, "height": {"type": "array", "items": {"type": "string"}}, "weight": {"type": "array", "items": {"type": "string"}}, "eyeColor": {"type": "string"}, "hairColor": {"type": "string"}}, "required": ["gender", "race", "height", "weight", "eyeColor", "hairColor"]}, "biography": {"type": "object", "properties": {"fullName": {"type": "string"}, "alterEgos": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "placeOfBirth": {"type": "string"}, "firstAppearance": {"type": "string"}, "publisher": {"type": "string"}, "alignment": {"type": "string"}}, "required": ["fullName", "alterEgos", "aliases", "placeOfBirth", "firstAppearance", "publisher", "alignment"]}, "work": {"type": "object", "properties": {"occupation": {"type": "string"}, "base": {"type": "string"}}, "required": ["occupation", "base"]}, "connections": {"type": "object", "properties": {"groupAffiliation": {"type": "string"}, "relatives": {"type": "string"}}, "required": ["groupAffiliation", "relatives"]}, "images": {"type": "object", "properties": {"xs": {"type": "string"}, "sm": {"type": "string"}, "md": {"type": "string"}, "lg": {"type": "string"}}, "required": ["xs", "sm", "md", "lg"]}}, "required": ["id", "name", "slug", "powerstats", "appearance", "biography", "work", "connections", "images"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 92, "name" : "Bishop", "slug" : "92-bishop", "powerstats" : {"intelligence" : 63, "strength" : 14, "speed" : 23, "durability" : 75, "power" : 100, "combat" : 65}, "appearance" : {"gender" : "Male", "race" : "Mutant", "height" : ["6'6", "198 cm"], "weight" : ["275 lb", "124 kg"], "eyeColor" : "Brown", "hairColor" : "No Hair"}, "biography" : {"fullName" : "Lucas Bishop", "alterEgos" : "No alter egos found.", "aliases" : ["Archbishop"], "placeOfBirth" : "A mutant relocation camp in an undisclosed location on an alternate 21st Century Earth", "firstAppearance" : "Uncanny X-Men #282 (November, 1991)", "publisher" : "Marvel Comics", "alignment" : "good"}, "work" : {"occupation" : "(current) Adventurer, (former) Commander in the XSE (Xavier's Security Enforcers)", "base" : "Formerly Xavier Institute for Higher Learning, Salem Center, Westchester County, New York"}, "connections" : {"groupAffiliation" : "\"Clean City\"; formerly Stryfe; X-Men; X.S.E. (Storm's team); X-Treme X-Men; X.S.E. (Hecate'e's team); The Twelve", "relatives" : "Burnum Bishop (father, deceased), Kadee Bishop (mother, deceased), Shard (sister, deceased), unnamed grandmother, Gateway (great-grandfather), Aliyah Bishop (alternate reality daughter);"}, "images" : {"xs" : "https://raw.githubusercontent.com/Shaikh-Imran/superhero-api/master/api/images/xs/92-bishop.jpg", "sm" : "https://raw.githubusercontent.com/Shaikh-Imran/superhero-api/master/api/images/sm/92-bishop.jpg", "md" : "https://raw.githubusercontent.com/Shaikh-Imran/superhero-api/master/api/images/md/92-bishop.jpg", "lg" : "https://raw.githubusercontent.com/Shaikh-Imran/superhero-api/master/api/images/lg/92-bishop.jpg"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}, "slug": {"type": "string"}, "powerstats": {"type": "object", "properties": {"intelligence": {"type": "integer"}, "strength": {"type": "integer"}, "speed": {"type": "integer"}, "durability": {"type": "integer"}, "power": {"type": "integer"}, "combat": {"type": "integer"}}, "required": ["intelligence", "strength", "speed", "durability", "power", "combat"]}, "appearance": {"type": "object", "properties": {"gender": {"type": "string"}, "race": {"type": "string"}, "height": {"type": "array", "items": {"type": "string"}}, "weight": {"type": "array", "items": {"type": "string"}}, "eyeColor": {"type": "string"}, "hairColor": {"type": "string"}}, "required": ["gender", "race", "height", "weight", "eyeColor", "hairColor"]}, "biography": {"type": "object", "properties": {"fullName": {"type": "string"}, "alterEgos": {"type": "string"}, "aliases": {"type": "array", "items": {"type": "string"}}, "placeOfBirth": {"type": "string"}, "firstAppearance": {"type": "string"}, "publisher": {"type": "string"}, "alignment": {"type": "string"}}, "required": ["fullName", "alterEgos", "aliases", "placeOfBirth", "firstAppearance", "publisher", "alignment"]}, "work": {"type": "object", "properties": {"occupation": {"type": "string"}, "base": {"type": "string"}}, "required": ["occupation", "base"]}, "connections": {"type": "object", "properties": {"groupAffiliation": {"type": "string"}, "relatives": {"type": "string"}}, "required": ["groupAffiliation", "relatives"]}, "images": {"type": "object", "properties": {"xs": {"type": "string"}, "sm": {"type": "string"}, "md": {"type": "string"}, "lg": {"type": "string"}}, "required": ["xs", "sm", "md", "lg"]}}, "required": ["id", "name", "slug", "powerstats", "appearance", "biography", "work", "connections", "images"], "$schema": "http://json-schema.org/draft-07/schema#"}
Please provide a valid JSON object following this schema: {"type": "object", "properties": {"bot": {"type": "object", "properties": {"prefix": {"type": "string"}, "master": {"type": "string"}}, "required": ["prefix", "master"]}, "discord": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["bot", "discord"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"bot" : {"prefix" : "p!", "master" : "YOUR_DISCORD_ID_HERE"}, "discord" : {"name" : "Payday 2 Bot"}}
json_instruct
{"type": "object", "properties": {"bot": {"type": "object", "properties": {"prefix": {"type": "string"}, "master": {"type": "string"}}, "required": ["prefix", "master"]}, "discord": {"type": "object", "properties": {"name": {"type": "string"}}, "required": ["name"]}}, "required": ["bot", "discord"], "$schema": "http://json-schema.org/draft-07/schema#"}
Following the schema specification below, generate a valid JSON instance: {"type": "object", "properties": {"ja394:1.1": {"type": "string"}, "ja394:2.1": {"type": "string"}, "ja394:3.1": {"type": "string"}, "ja394:4.1": {"type": "string"}, "ja394:5.1": {"type": "string"}, "ja394:6.1": {"type": "string"}, "ja394:7.1": {"type": "string"}}, "required": ["ja394:1.1", "ja394:2.1", "ja394:3.1", "ja394:4.1", "ja394:5.1", "ja394:6.1", "ja394:7.1"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"ja394:1.1" : "ms22J_1466, msdiv129, pts-vp-pli3.313, sc1", "ja394:2.1" : "dr27.208, ms22J_1467, msdiv130, sc2", "ja394:3.1" : "ms22J_1468, msdiv131, sc3, sya27.209", "ja394:4.1" : "ms22J_1469, msdiv132, sc4", "ja394:5.1" : "ms22J_1470, msdiv133, sc5", "ja394:6.1" : "ms22J_1471, msdiv134, sc6, vri68.128", "ja394:7.1" : "ms22J_1472, sc7"}
json_instruct
{"type": "object", "properties": {"ja394:1.1": {"type": "string"}, "ja394:2.1": {"type": "string"}, "ja394:3.1": {"type": "string"}, "ja394:4.1": {"type": "string"}, "ja394:5.1": {"type": "string"}, "ja394:6.1": {"type": "string"}, "ja394:7.1": {"type": "string"}}, "required": ["ja394:1.1", "ja394:2.1", "ja394:3.1", "ja394:4.1", "ja394:5.1", "ja394:6.1", "ja394:7.1"], "$schema": "http://json-schema.org/draft-07/schema#"}
Construct a JSON document that adheres to this schema specification: {"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {"1.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.1.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.3": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.5": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["1.1", "1.1.1", "1.3", "1.5"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"latest_version" : ["1.5"], "meta" : {"description" : "Themer is a colorscheme generator and manager for your desktop", "homepage" : "https://github.com/S0lll0s/themer", "license" : "MIT"}, "versions" : {"1.1" : {"sha256" : "4743c4e248ef647d2d4f4fa323a5512ba66afffb68d8f90c6faa2c473ffe53e8", "url" : "https://files.pythonhosted.org/packages/cc/68/f620a3dbf78e22c6703afacad4eef1d26d5b80d789970ac7ce95542221ad/Themer-1.1.tar.gz"}, "1.1.1" : {"sha256" : "de0e5a8e0beb66286e5b49277f173119c56a4a04ea8e1e908fbfe67a33715e49", "url" : "https://files.pythonhosted.org/packages/f1/44/09bc328459b9ee71b7e583053367715965d0a3e099175518a17d69190edd/Themer-1.1.1.tar.gz"}, "1.3" : {"sha256" : "43b1a7ac2cfa7dc3d381d07fd0b8a0653e1fa1d8de8be038b16c143f0010564e", "url" : "https://files.pythonhosted.org/packages/b0/93/ab17011ffec2e5d147c0a6f2f09ad0946720b431738391a4cc4c2e853309/Themer-1.3.tar.gz"}, "1.5" : {"sha256" : "2ace08db0e765c4deb422011e92fc4684f7e3369d53bc05bd720effd2a031b7d", "url" : "https://files.pythonhosted.org/packages/ec/ae/1dcde52b7fe1dbd536a44f472a5e71e3c475c496708b86996ad25b64175d/Themer-1.5.tar.gz"}}}
json_instruct
{"type": "object", "properties": {"latest_version": {"type": "array", "items": {"type": "string"}}, "meta": {"type": "object", "properties": {"description": {"type": "string"}, "homepage": {"type": "string"}, "license": {"type": "string"}}, "required": ["description", "homepage", "license"]}, "versions": {"type": "object", "properties": {"1.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.1.1": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.3": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}, "1.5": {"type": "object", "properties": {"sha256": {"type": "string"}, "url": {"type": "string"}}, "required": ["sha256", "url"]}}, "required": ["1.1", "1.1.1", "1.3", "1.5"]}}, "required": ["latest_version", "meta", "versions"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "object", "properties": {"text": {"type": "string"}, "historical": {"type": "string"}, "credits": {"type": "string"}, "sections": {"type": "array", "items": {}}, "division": {"type": "object", "properties": {"identifier": {"type": "string"}, "text": {"type": "string"}}, "required": ["identifier", "text"]}, "title": {"type": "object", "properties": {"identifier": {"type": "string"}, "text": {"type": "string"}}, "required": ["identifier", "text"]}, "chapter": {"type": "object", "properties": {"identifier": {"type": "string"}, "text": {"type": "string"}}, "required": ["identifier", "text"]}, "heading": {"type": "object", "properties": {"title": {"type": "string"}, "chaptersection": {"type": "string"}, "identifier": {"type": "string"}, "catch_text": {"type": "string"}}, "required": ["title", "chaptersection", "identifier", "catch_text"]}}, "required": ["text", "historical", "credits", "sections", "division", "title", "chapter", "heading"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"text" : "Whenever a deposit, savings account, or share account, which is in form in trust for another, shall be made or held by any person in any bank, trust company, savings and loan association, building association, building and loan association, or federal savings and loan association, doing business in the District of Columbia, and no other or further notice of the existence and terms of a legal and valid trust shall have been given in writing to such bank, trust company, or other association, such deposit, savings account, or share account, or any part thereof, together with the dividends, or interest thereon, may, in the event of the death of the trustee, be paid to the person for whom such deposit, savings account, or share account was made or held, or to his legal representative.", "historical" : "Prior Codifications\n\n1981 Ed., \u00a7 26-204.\n\n1973 Ed., \u00a7 26-204.\n\nDC CODE \u00a7 26-804\n\nCurrent through December 11, 2012", "credits" : "(Apr. 5, 1939, 53 Stat. 567, ch. 37, \u00a7 4; July 19, 1954, 68 Stat. 494, ch. 545, \u00a7 1.)", "sections" : [], "division" : {"identifier" : "V", "text" : "Local Business Affairs"}, "title" : {"identifier" : "26", "text" : "Banks and Other Financial Institutions. (Refs & Annos)"}, "chapter" : {"identifier" : "8", "text" : "Joint Accounts; Adverse Claimants; Trust Accounts. (Refs & Annos)"}, "heading" : {"title" : "26", "chaptersection" : "804", "identifier" : "26-804", "catch_text" : "Payment of trust accounts on death of trustee."}}
json_instruct
{"type": "object", "properties": {"text": {"type": "string"}, "historical": {"type": "string"}, "credits": {"type": "string"}, "sections": {"type": "array", "items": {}}, "division": {"type": "object", "properties": {"identifier": {"type": "string"}, "text": {"type": "string"}}, "required": ["identifier", "text"]}, "title": {"type": "object", "properties": {"identifier": {"type": "string"}, "text": {"type": "string"}}, "required": ["identifier", "text"]}, "chapter": {"type": "object", "properties": {"identifier": {"type": "string"}, "text": {"type": "string"}}, "required": ["identifier", "text"]}, "heading": {"type": "object", "properties": {"title": {"type": "string"}, "chaptersection": {"type": "string"}, "identifier": {"type": "string"}, "catch_text": {"type": "string"}}, "required": ["title", "chaptersection", "identifier", "catch_text"]}}, "required": ["text", "historical", "credits", "sections", "division", "title", "chapter", "heading"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create a JSON structure that matches this schema definition: {"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"type" : "Feature", "geometry" : {"type" : "Polygon", "coordinates" : [[[144.875, 26.0], [144.875, 26.083333333333332], [145.0, 26.083333333333332], [145.0, 26.0], [144.875, 26.0]]]}, "properties" : {"code" : 394407, "url" : "http://madefor.github.io/0410/api/v1/394407.geojson", "view" : "https://github.com/madefor/0410/blob/gh-pages/api/v1/394407.geojson"}}
json_instruct
{"type": "object", "properties": {"type": {"type": "string"}, "geometry": {"type": "object", "properties": {"type": {"type": "string"}, "coordinates": {"type": "array", "items": {"type": "array", "items": {"type": "array", "items": {"type": "number"}}}}}, "required": ["type", "coordinates"]}, "properties": {"type": "object", "properties": {"code": {"type": "integer"}, "url": {"type": "string"}, "view": {"type": "string"}}, "required": ["code", "url", "view"]}}, "required": ["type", "geometry", "properties"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"f": {"type": "string"}}, "required": ["f"]}}}, "required": ["d"]}}, "stem": {"type": "string"}, "t": {"type": "string"}}, "required": ["h", "stem", "t"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"h" : [{"d" : [{"f" : "\u8acb\u7092(\u8c46\u5b50)\u5427\u3002"}, {"f" : "\u7092(\u8c46\u5b50)\u7684\u3002"}]}], "stem" : "ringring", "t" : "piringring"}
json_instruct
{"type": "object", "properties": {"h": {"type": "array", "items": {"type": "object", "properties": {"d": {"type": "array", "items": {"type": "object", "properties": {"f": {"type": "string"}}, "required": ["f"]}}}, "required": ["d"]}}, "stem": {"type": "string"}, "t": {"type": "string"}}, "required": ["h", "stem", "t"], "$schema": "http://json-schema.org/draft-07/schema#"}
Create an example JSON object that satisfies this schema: {"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "gempId": {"type": "string"}, "side": {"type": "string"}, "rarity": {"type": "string"}, "set": {"type": "string"}, "printings": {"type": "array", "items": {"type": "object", "properties": {"set": {"type": "string"}}, "required": ["set"]}}, "front": {"type": "object", "properties": {"title": {"type": "string"}, "imageUrl": {"type": "string"}, "type": {"type": "string"}, "subType": {"type": "string"}, "destiny": {"type": "string"}, "power": {"type": "string"}, "ability": {"type": "string"}, "deploy": {"type": "string"}, "forfeit": {"type": "string"}, "icons": {"type": "array", "items": {"type": "string"}}, "characteristics": {"type": "array", "items": {"type": "string"}}, "gametext": {"type": "string"}, "lore": {"type": "string"}}, "required": ["title", "imageUrl", "type", "subType", "destiny", "power", "ability", "deploy", "forfeit", "icons", "characteristics", "gametext", "lore"]}, "pulledBy": {"type": "array", "items": {"type": "string"}}, "counterpart": {"type": "string"}, "combo": {"type": "array", "items": {"type": "string"}}, "legacy": {"type": "boolean"}}, "required": ["id", "gempId", "side", "rarity", "set", "printings", "front", "pulledBy", "counterpart", "combo", "legacy"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
[{"id" : 436, "gempId" : "5_3", "side" : "Light", "rarity" : "C", "set" : "5", "printings" : [{"set" : "5"}], "front" : {"title" : "Cloud City Trooper", "imageUrl" : "https://res.starwarsccg.org/cards/CloudCity-Light/large/cloudcitytrooper.gif", "type" : "Character", "subType" : "Alien", "destiny" : "3", "power" : "2", "ability" : "1", "deploy" : "2", "forfeit" : "3", "icons" : ["Warrior"], "characteristics" : ["Cloud City trooper", "trooper"], "gametext" : "Deploys only on Cloud City, but may move elsewhere. Power -1 when at a site other than a Cloud City site.", "lore" : "Recently hired members of the Cloud City Wing Guard are less corrupt than those who served under past administrations. Most new recruits despise the Empire."}, "pulledBy" : ["Arleil Schous", "Lando Calrissian (V)", "Nar Shaddaa Wind Chimes", "Nar Shaddaa Wind Chimes & Out Of Somewhere"], "counterpart" : "Cloud City Trooper", "combo" : ["Cloud City Trooper + Lobot + Trooper Utris M'Toc. A force with a high forfeit that deploys for free."], "legacy" : false}]
json_instruct
{"type": "array", "items": {"type": "object", "properties": {"id": {"type": "integer"}, "gempId": {"type": "string"}, "side": {"type": "string"}, "rarity": {"type": "string"}, "set": {"type": "string"}, "printings": {"type": "array", "items": {"type": "object", "properties": {"set": {"type": "string"}}, "required": ["set"]}}, "front": {"type": "object", "properties": {"title": {"type": "string"}, "imageUrl": {"type": "string"}, "type": {"type": "string"}, "subType": {"type": "string"}, "destiny": {"type": "string"}, "power": {"type": "string"}, "ability": {"type": "string"}, "deploy": {"type": "string"}, "forfeit": {"type": "string"}, "icons": {"type": "array", "items": {"type": "string"}}, "characteristics": {"type": "array", "items": {"type": "string"}}, "gametext": {"type": "string"}, "lore": {"type": "string"}}, "required": ["title", "imageUrl", "type", "subType", "destiny", "power", "ability", "deploy", "forfeit", "icons", "characteristics", "gametext", "lore"]}, "pulledBy": {"type": "array", "items": {"type": "string"}}, "counterpart": {"type": "string"}, "combo": {"type": "array", "items": {"type": "string"}}, "legacy": {"type": "boolean"}}, "required": ["id", "gempId", "side", "rarity", "set", "printings", "front", "pulledBy", "counterpart", "combo", "legacy"]}, "$schema": "http://json-schema.org/draft-07/schema#"}
Using the following JSON schema, generate a compatible JSON instance: {"type": "object", "properties": {"Status": {"type": "integer"}, "TimeLimitReached": {"type": "boolean"}, "RunningTime": {"type": "string"}, "StartTimes": {"type": "array", "items": {"type": "object", "properties": {"JobIndex": {"type": "integer"}, "OperationIndex": {"type": "integer"}, "StartTime": {"type": "number"}}, "required": ["JobIndex", "OperationIndex", "StartTime"]}}}, "required": ["Status", "TimeLimitReached", "RunningTime", "StartTimes"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"Status" : 3, "TimeLimitReached" : true, "RunningTime" : "00:05:00.3338890", "StartTimes" : [{"JobIndex" : 0, "OperationIndex" : 0, "StartTime" : 562.0}, {"JobIndex" : 1, "OperationIndex" : 0, "StartTime" : 34.0}, {"JobIndex" : 2, "OperationIndex" : 0, "StartTime" : 101.0}, {"JobIndex" : 3, "OperationIndex" : 0, "StartTime" : 277.0}, {"JobIndex" : 4, "OperationIndex" : 0, "StartTime" : 507.0}, {"JobIndex" : 5, "OperationIndex" : 0, "StartTime" : 324.0}, {"JobIndex" : 6, "OperationIndex" : 0, "StartTime" : 203.0}, {"JobIndex" : 7, "OperationIndex" : 0, "StartTime" : 140.0}, {"JobIndex" : 8, "OperationIndex" : 0, "StartTime" : 468.0}, {"JobIndex" : 9, "OperationIndex" : 0, "StartTime" : 582.0}, {"JobIndex" : 10, "OperationIndex" : 0, "StartTime" : 47.0}, {"JobIndex" : 11, "OperationIndex" : 0, "StartTime" : 357.0}, {"JobIndex" : 12, "OperationIndex" : 0, "StartTime" : 412.0}, {"JobIndex" : 13, "OperationIndex" : 0, "StartTime" : 171.0}, {"JobIndex" : 14, "OperationIndex" : 0, "StartTime" : 0.0}, {"JobIndex" : 15, "OperationIndex" : 0, "StartTime" : 679.0}, {"JobIndex" : 16, "OperationIndex" : 0, "StartTime" : 230.0}, {"JobIndex" : 17, "OperationIndex" : 0, "StartTime" : 60.0}, {"JobIndex" : 18, "OperationIndex" : 0, "StartTime" : 251.0}, {"JobIndex" : 19, "OperationIndex" : 0, "StartTime" : 631.0}, {"JobIndex" : 20, "OperationIndex" : 0, "StartTime" : 599.0}, {"JobIndex" : 21, "OperationIndex" : 0, "StartTime" : 0.0}, {"JobIndex" : 22, "OperationIndex" : 0, "StartTime" : 120.0}, {"JobIndex" : 23, "OperationIndex" : 0, "StartTime" : 194.0}, {"JobIndex" : 24, "OperationIndex" : 0, "StartTime" : 33.0}, {"JobIndex" : 25, "OperationIndex" : 0, "StartTime" : 163.0}, {"JobIndex" : 26, "OperationIndex" : 0, "StartTime" : 37.0}, {"JobIndex" : 27, "OperationIndex" : 0, "StartTime" : 685.0}, {"JobIndex" : 28, "OperationIndex" : 0, "StartTime" : 618.0}, {"JobIndex" : 29, "OperationIndex" : 0, "StartTime" : 300.0}]}
json_instruct
{"type": "object", "properties": {"Status": {"type": "integer"}, "TimeLimitReached": {"type": "boolean"}, "RunningTime": {"type": "string"}, "StartTimes": {"type": "array", "items": {"type": "object", "properties": {"JobIndex": {"type": "integer"}, "OperationIndex": {"type": "integer"}, "StartTime": {"type": "number"}}, "required": ["JobIndex", "OperationIndex", "StartTime"]}}}, "required": ["Status", "TimeLimitReached", "RunningTime", "StartTimes"], "$schema": "http://json-schema.org/draft-07/schema#"}
Based on the schema below, produce a valid JSON object: {"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"}
{"id" : 178597, "info" : {"name" : "Loult Background noel sexy", "description" : "Loult Background noel sexy", "additionalInfo" : null, "format" : "uso", "category" : "loult", "createdAt" : "2019-12-24T12:26:50.000Z", "updatedAt" : "2019-12-24T12:36:01.000Z", "license" : "NO-REDISTRIBUTION", "author" : {"id" : 874820, "name" : "ossabibw"}}, "stats" : {"installs" : {"total" : 31, "weekly" : 0}}, "screenshots" : {"main" : {"name" : "178597_after.png", "archived" : true}}, "discussions" : {"stats" : {"discussionsCount" : 0, "commentsCount" : 0}, "data" : []}, "style" : {"css" : "@-moz-document url-prefix(\"https://loult.family/\")\r\n{\r\n #chat{\r\n background-image: url(\"https://i.imgur.com/9DbVaKf.png\");\r\n background-size: contain;\r\n image-rendering: optimizeQuality;\r\n background-color: rgb(0, 0, 0);\r\n border-radius: 1em!important;\r\n display: flex;\r\n flex-direction: column;\r\n margin: 0.25em;\r\n }\r\n\r\n #chat::-webkit-scrollbar\r\n {\r\n display: none;\r\n }\r\n}"}}
json_instruct
{"type": "object", "properties": {"id": {"type": "integer"}, "info": {"type": "object", "properties": {"name": {"type": "string"}, "description": {"type": "string"}, "additionalInfo": {"type": "null"}, "format": {"type": "string"}, "category": {"type": "string"}, "createdAt": {"type": "string"}, "updatedAt": {"type": "string"}, "license": {"type": "string"}, "author": {"type": "object", "properties": {"id": {"type": "integer"}, "name": {"type": "string"}}, "required": ["id", "name"]}}, "required": ["name", "description", "additionalInfo", "format", "category", "createdAt", "updatedAt", "license", "author"]}, "stats": {"type": "object", "properties": {"installs": {"type": "object", "properties": {"total": {"type": "integer"}, "weekly": {"type": "integer"}}, "required": ["total", "weekly"]}}, "required": ["installs"]}, "screenshots": {"type": "object", "properties": {"main": {"type": "object", "properties": {"name": {"type": "string"}, "archived": {"type": "boolean"}}, "required": ["name", "archived"]}}, "required": ["main"]}, "discussions": {"type": "object", "properties": {"stats": {"type": "object", "properties": {"discussionsCount": {"type": "integer"}, "commentsCount": {"type": "integer"}}, "required": ["discussionsCount", "commentsCount"]}, "data": {"type": "array", "items": {}}}, "required": ["stats", "data"]}, "style": {"type": "object", "properties": {"css": {"type": "string"}}, "required": ["css"]}}, "required": ["id", "info", "stats", "screenshots", "discussions", "style"], "$schema": "http://json-schema.org/draft-07/schema#"}