query_id
stringlengths 3
6
| question
stringlengths 1
299
| goldenAnswer
stringlengths 3
35k
| doc_id
stringlengths 36
36
|
|---|---|---|---|
1nboa8 | Why do your eyes start to sting when you're tired? | It's both. Your eyes only have so much power. | 030b6a21-efb2-4d17-b256-4d91c51e27a6 |
1rr43c | Why is that James Bond movie called 'Quantum of Solace?' | It is also a term meaning "extremely small".
The idea is that Bond is getting an "extremely small" amount of solace (comfort) by hunting down and killing the people responsible for Vesper's death.
Also the bad guy's are called "Quantum" so there is that too. | 8902cb4e-c2f4-42f8-8a0c-36361710a09f |
7i1qem | What is actually happening to metal in a microwave? | As microwaves hit the metal, electrons build up on the surface. Depending on the shape of the metal, this may result in an electric potential which eventually arcs, creating a spark. This spark can be enough to ignite paper, starting a fire in the oven. | 5d12fbe2-346c-430d-9ee9-1502ab0d23b0 |
4y51e2 | How does facebook avoid paying its fair share in tax | I'm not going to talk specifically about Facebook or Ireland but this is how profit shifting usually works.
Country A has 30% company tax and 300 million people and all sorts of publicly funded programs to create a huge Internet market, including skilled staff.
Country B has 1% tax and sweet fuck all in population, no publicly funded innovation and no skilled staff.
Internet Co sets up in Country A because that's where the market is and the skills are. Internet Co does well and is worth billions raking in $30 billion in revenue with $10 billion in profit before tax. Internet Co doesn't like paying $3 billion in tax (30% of $10 billion profit).
Internet Co sets up a new company in Country B called Internet B Co. It makes it the head company and assigns all IP rights to the name "Internet Co" to Internet B Co. Internet Co still operates in Country A because that's where all the skills are etc.
New Internet B Co charges Internet Co $10 billion in IP licence fees to use the name. All of a sudden Internet Co makes zero profit and pays zero income tax to Country A.
All of a sudden Internet B Co is making $10 billion profit (less minor admin costs). But Internet B Co is in Country B where tax is only 1% which is only $100 million tax. Internet Co Group companies has lowered its tax by $9.9 billion. CEO and CFO get $100 million bonus.
Country B gets a $100 million tax windfall by doing sweet fuck all other than having low tax. | bed84254-0231-4576-99a0-23e89a85d7fb |
818xoi | How do scientist determine how many animals are left of a certain endangered species? | Depends on the species. For larger animals like elephants you can do aerial surveys to count the number of family groups. Mammals are also very easy to keep track of via radio collar or transmitter.
For harder and more elusive species all we can really do is calculate habitat area, calculate how much area is needed for an individual (which varies depending on home range size and how territorial they are) and if that area is cut down (say due to land use change) then the individuals are out of habitat.
Keeping an accurate estimate of population sizes requires a knowledge of the animal involved, which is why studies relating to population dynamics of a species are actually really important to conservation. | 402e2b36-de00-43a0-a5ae-66f11f37118a |
2aj2p6 | What is Blu Ray? Why is it significant? | It's essentially the same tech as a cd or a dvd, but it uses a laser which is in the blue spectrum rather than the red spectrum, which means it has a wavelength that is considerably shorter than that of the previous formats and allows you to write the data closer together on the disk, which means you can get far greater data density. | 2302533c-06eb-4a6a-8d8c-29d0a42d7869 |
4b0kdg | Can we help who we are aroused by? | There's many possible meanings of this question. If you're talking about homosexuality then no, you can't, but do mean things like sexual fetishes or sexual disorders like pedophilia? Most fetishes develop over time and are not considered harmful, so people don't usually try to change. Pedophilia, however, can be treated with various therapies like aversion therapy.
Aversion therapy teaches you to associate something pleasurable with something very unpleasurable. It happens naturally, like when you eat something that makes you sick, you don't ever want to eat that again. With pedophilia you can teach people to associate their sexual desires with extremely disgusting visualizations.
Or you just be talking about preferences, like ass vs boobies, for example. Then yeah, those evolve over time. | 911130f9-f04c-4014-998b-b54e5c4f9f0d |
6gmss4 | Why do cities in China still have such high pollution when they have so many bike users? | Most Chinese pollution is particulate based. Mainly from the burning of coal (although dust produced from lots of construction work adds to the effect).
Chinese emission regulations are actually stricter than in the US from a design perspective however they seem to be much, much more lenient / not enforced when in operation.
In the West however pollution is more chemical based such as NOx and SOx from vehicles. | 16485da8-4144-4987-a5d1-21ffd661b1a5 |
1jg5xu | How do giant cruise ships float? | The mass of the volume of water that they displace while sitting in the water, is greater than their mass. So, even though it's an enormous pile of metal, it's still "lighter" than the water it's displacing. | 8d095278-2817-4dc7-9c88-baf19951aebb |
y3wnl | Why we still use electoral votes. | Simply put: because the system exists to avoid allowing someone to win the presidency by sweeping a few large states. By making a 50.1% victory in California worth the same as a 90% victory there, it encourages candidates to campaign nationally, and speak to the issues important even to the smaller states.
Because it's a winner-take-all system in every state, more states (and thus more people) become important to both candidates. In our current system if the Democrat and Republican are both polling at about 49% in Colorado, they'll spend a lot of time here. If we had a pure popular vote, they'd never set foot here. The extra 1% of people they could persuade through spending time speaking to important issues to the people who live here wouldn't be worth it.
It'd only be worth it to go to the huge population states. | f4bb57be-858e-47cf-b0be-e9663f0270d3 |
3xhxt8 | Can someone help me sort out all the worldwide soccer leagues? | UEFA is the governing body for football in Europe. (Side note: "Europe" as defined for footballing purposes, which doesn't always match up with other definitions. It includes Israel, Kazakhstan etc)
They organise various competitions.
- Euro 2016 is like the World Cup, i.e. knockout tournament between national teams (Spain, Italy etc), but only UEFA nations.
- Champions League and Europa League are club competitions (Real Madrid, Bayern Munich, Juventus, etc)
Each member country within UEFA has their own national leagues. England has the (Barclays) Premier League. (Sidenote: has also included a few Welsh clubs, just to complicate things). Other top leagues include:
- Germany - Bundesliga.
- Spain - La Liga.
- Italy - Serie A.
- France - Ligue 1
- Portugal - Primeira Liga
etc. Note I'm just listing the top level leagues, but each country has one or [shitloads](_URL_0_) of lower leagues generally in a pyramid structure.
In parallel to the League, each country usually has a cup competition (or several). England: FA Cup. Germany: DfB Pokal. Spain: Copa del Rey. etc.
("Cup competition" is distinguished from a league competition by being knock-out format, basically.)
Anyway, the most successful teams from each country get to join the two UEFA club contests mentioned above. The very best clubs from each country each year go into the Champions League, and the 'next best' clubs go into the Europa League.
I use the rather vague 'very best' and 'next best' because a comprehensive answer gets too complicated to fit in a comment, tbh. Generally speaking if you win your national league you go into the Champions League, but you can also sometimes gain entry by winning your primary national Cup. The number of entrants from each country varies according to the strength of that country's team's performance in UEFA contests over previous years, called the [coefficient](_URL_1_). So for example England, Spain and Germany send 4 teams to the CL, because they're the strongest leagues, while Norway and Bulgaria only send 1, because they're weaker. You also get situations where if the same team wins national league and cup they effectively qualify "twice", so their place gets shifted onto the next runner-up, etc. Like I said, it gets complicated, but hopefully you get the general gist without needing to go into every special case.
Generally speaking the CL is the most prestigious thing a club can win, followed by their national league. Europa League and national cup contests vary quite widely in how prestigious they are considered. e.g. the FA Cup in England is quite prestigious but in some other countries their national cups are not taken very seriously. | 8a2be479-5900-4e20-ab0e-15b7c72c60e5 |
2vil0c | Being caught for piracy. | For direct downloads from a server, they have to either seize the logs of the server, or work with ISPs or other men in the middle to figure out who is downloading what.
For bittorrent and similar peer to peer systems, it's pretty trivial. Find a torrent you want to monitor, join the downloaders, log the IPs of the peers. There is dedicated software for this and companies which do this for film studios/distributors, lawyers etc.
Once you have the IPs, subpoena the ISPs owning the IPs to reveal who the person at that end is. Then take that person to court.
As to how they decide who to go after, no idea. I guess it's a mix of going after the biggest infringers, "setting examples" and doing what's directly profitable (e.g. sue everyone who downloaded a particular movie in a jurisdiction where they are likely to win). | ace3bb3e-e9cd-4380-90ff-f3f2495fe0fe |
3hwq4q | Is there a reason why "hold music" when you call businesses has to be so obnoxious? | The quality of phone calls have to be able to transmit voices acceptably. Music requires much, much more data and so no matter what music you put on there is going to sound like shit.
Music that is very "full" and uses a large range of frequencies at once will sound even worse. Very simply solo piano or something can be OK. | 702cba7d-d770-449a-a2c3-463b37dd1e0c |
63fyc9 | Galaxies that are further away are moving away from us at an increasing rate. The further away we look, the further we go "back in time". Why can't we correlate the statements prove that the observations are evidence of acceleration from the big bang? | I'm confused by what you are asking exactly. The recession of distant galaxies, and that it is faster at greater distance *is* one of, if not the most significant pieces of evidence for the big bang theory. | a4059514-0719-4c6a-8b62-1445c0ec11ef |
259vql | Why does Pakistan apparently has no problem with the odd civilian casualty of US drone attacks? | To the contrary, there is a huge problem! This has been a huge and controversial issue in the US and Pakistan. You just don't hear the Paksitani side on the news. The government itself is being paid off in terms of monetary and technological and militaristic aid by the US to use Pakistani roads for supplies, to use their airports and ports, to fly over their country, etc. But the citizenry is not, which leads to the Pakistani central government occasionally giving condemnations against the US government. They ordered a review of American proceedings after the raid that killed OBL. If you search Asif Ali Zardari, Raza Gillani, and Nawaz Sharif, they have often met Obama, Hilary Clinton, then Secretary of State, John Kerry, the current Secretary. Drone attacks are a frequently discussed topic.
Not much can be done because often the US drones strike from the Afghan borders, without ever having crossed into the Pakistani borders and the Pakistani casualities are just collaterals or "oops" upon which the US issues apologizes. In addition, Pakistan doesn't have the military or political means to press the US to task over drone attacks. There have been official protestations by the Pakistani government in the UN and such. A little Pakistani girl whose family died in drone attacks came to the US in winter to testify in front Congress over the drone attack hearings. There was little coverage by the US news outlets and I think something like 4 Senators came to hear her speak.
By their inherent nature, the drone attacks are covered by impunity and lack of transparency, I don't remember hearing of any victims offered reparations by the US.
Another issue is the "out of sight, out of mind". Drone attacks for the American people are a topic du jour. I think many Americans think of people of poor countries like Pakistan as illiterate, hidebound savage cavepeople. They look different from us, they breed terrorists, they worship a different God, they speak different languages, and frankly, they're half a world away. | 4fdf098c-7403-4a22-b2f4-5be309804024 |
2piqwt | How would a compete collapse of Russia's economy affect the rest of the world? Which countries would suffer the most? | With my basic understanding of economies and greater knowledge of energy markets, Russia's current troubles won't have too much of an effect on the rest of the world. Most of their money comes from energy exports and with their issues in Ukraine earlier this year, many of their customers (countries) had already turned to other sources.
Russia, unless the price of oil goes up soon, will be forced to pull of Ukraine and get the restrictions lifted as they are in a free fall. Putin being who he is, I don't see this happening so I think that Russia will be the country that suffers the most with most other countries feeling a slight effect but not much. | fe58ced4-242e-4916-907a-9f826d0a4cc3 |
44osp6 | Beastie Boys "No Sleep Till Brooklyn" on TNMT movie commercial? Despite statement that no song will be used for commercials?? | Sabotage was in Star Trek (and Star Trek Beyond). I think that films are OK with the Beasties, including commercials for the movies.
I think the no commercial clause was actually worded as not used to sell commercial products, like Coke Zero or Tampax. That cheapens the music. Film is another form of art, that they probably respected. To be a part of that, they likely feel honored by. | c9af4d9c-18d9-485c-a913-db1d22e49b17 |
4ou24s | how are movies that were recorded in a lower definition able to be released in higher definitions? | They were recorded on film, which isn't limited to an amount of pixels- for the most part.
Remember that they were broadcast on a huge screen.
As long as you can get the original print you can re-release the movie as HD. | 0a7498f0-0233-458e-a590-d623678a7417 |
2tava6 | Why is Skype file-transfer so slow, while I can see and talk to people around the world in HD? | This may not be the complete reason, but it's part of it.
Streaming media and transferring files are done differently because they're trying to achieve different goals. If you're transferring a file, especially something like a text file, you probably want the received file to be *exactly* the same as the one you sent. On the other hand, if you're streaming video, you probably want to receive a video that looks good and lags as little as possible. Thus, these videos are transferred using different protocols.
Let's imagine that sending data over the internet is like the mail system. You can take a message, put it in an envelope, drop it in the mailbox, and some time later it will end up in your recipient's mailbox. However, the mail system kinda sucks. Most of the time your recipient will receive your envelopes, but sometimes the mail system will just lose them, sometimes they'll deliver them out-of-order, sometimes they'll open them and change it a little bit (data corruption), they'll only take a certain number of envelopes per day, and you can only put one page in each envelope.
Now, if I want to send my recipient a video, I'll print out each frame, put each one in an envelope, and send them. They will take them in the order they're delivered, put them into a flip-book, and start flipping through. It may take a few days for them to get there, some of them will be out of order or missing, and some of them might have a few random dots drawn on them, but overall the flip-book will be pretty much right and it got there about as fast as it could.
On the other hand, suppose you want to send a long legal document. It's fewer pages than the flip-book, but it's really important that they get the whole thing in order and that it's unchanged. First, you need to send a letter saying you want to send them the document. They need to send a letter saying they got your letter, so you know they're ready. If you don't get that letter, you wait a while and send it again, repeatedly, until you get one of their responses. Then, you start sending your document page-by-page. You need to number them so they can rearrange them into the right order on the other side. You need to use the last line to write fancy math stuff that will make sure they know if a page got changed and to throw it out if it was. Then, they need to send you letters back saying which pages they got, so you can resend the ones they didn't get. (You also need to keep resending pages if they don't respond at all). This whole system allows you to get the whole document there in a way that they can reconstruct it perfectly, but the whole thing takes a lot longer because there's a lot of back-and-forth, resent data, and you can't fit *quite* as much info per page. Even though the document has fewer pages than the video, if the mail system is particularly bad to you, it can take a lot longer. | 1f0e89ca-92e4-49b7-a36c-4a4cf0ec1789 |
3sodq3 | Why do some electronics have lights to indicate that they are off? | Electronics don't have lights to indicate they're off. If they are off then by definition there's no power to run the lights.
However, some electronics *do* have lights to tell you they're on standby or low power mode. This is important because you need to know whether certain devices are still powered to ensure they can function. For example, your DVR needs to be on standby/low power so it can still boot up to record your shows. | 4074f129-d7cd-49b8-a8a4-20102f00c585 |
15l5mt | Why does it seem that more men snore than women? | It may just be the case that it's louder (and therefore more noticeable) when men snore because men as a rule have larger lung capacities than women. | cbb8470e-0b34-457d-8336-9f9c08348eba |
30016l | How is powerful acid stored without eating away its container? | Highly inert materials are used. Frequently glass or a dense polymer.
"powerful acid" simply describes a highly reactive solution that reacts in a certain manner. You simply have to pick a material that resists the particular chemical reaction the solution favors. | d38050ee-db86-4fd1-b6da-b8173a9b80a6 |
163tir | Why do so many celebrities go broke? | Several factors, and I'd highly recommend watching the ESPN documentary called "Broke" if you're interested in more.
**Bad decisions**
First and foremost you can't ignore the fact that some of these guys just spend portions of their money on stupid stuff. Stuff like:
* Going to a strip club and making it rain
* Buying so many expensive cars that they don't even have time to drive
* Buying a 20 bedroom mansion for their family of three
* Child support payments for all the girls they knocked up while fooling around and taking advantage of their fame.
* Hiring and paying for a massive entourage of people that usually starts with just a small circle of friends and grows into friends of friends of friends they don't even know all looking to be a part of the famous guy's crew.
* Blowing the money on an expensive drug habit (both drugs for themselves and for their entourage)
* Running a dogfighting ring or doing other really dumb stuff to get yourself into prison
Of course most of us would rather blame all of it on the above stuff, but that's far too simplistic. Turns out these guys have quite a few problems that people like you or I don't have to deal with.
**Taxes and Other Costs**
Keep in mind that these people are in the top tax brackets so they do pay a good chunk of their income to taxes. On top of that, they have to pay state income taxes in every state where they earn money. So for athletes and musicians, this is a lot of states, because they do a lot of traveling to perform. Not to try to make it sound like all their money gets sucked up by the government, but how much money they get to keep is a substantial bit less than they "earn". It's still much more than a lot of us will ever make in our lifetimes, but a $5 million contract isn't going to net them the full $5 million.
That's a lot to handle, so it helps to pay for an accountant to take care of all that. There goes some of your income. It also helps to have an agent to negotiate on your behalf so you don't have to handle all your business negotiations yourself. There goes another chunk of your income. If you're a musician, you have to travel a lot, so it makes sense to hire someone to take care of all those arrangements. That's a lot of money, not even including the costs of the actual traveling.
**Handouts to Friends and Family**
Nobody will fault you for buying your parents a new house. Then your brothers and sisters and you close cousins and friends. Some of them probably get cars too. But imagine if you all of a sudden became rich, how many distant cousins will now be calling you up on the phone acting like they're a lot closer to you than they really are? How many family members and friends start coming up to you telling you about their great new business idea that they just need $20,000 to get started on? How many people come up to you with "great" investment ideas?
More importantly how do you say no? You're rich. They're poor. This bit of money your "friend" is asking for is a small fraction of what you make in a year. Surely you can spare that to help them out. Otherwise you just look greedy and callous and unappreciative of everything this person has ever done for you and supported you through. Fine. You'll invest in this one thing for Uncle Bobby. Then Uncle John comes and asks you for the same amount of money for his idea. What? You don't want to give more? You gave Uncle Bobby money! You like Uncle Bobby more than you like Uncle John? Sure you don't. Or at least you don't want to tell Uncle John that to his face. So you give him the money he wants to appease him.
Something around 75% of startups fail. That's no different for the investments these people make. And they don't make just one, because they have a lot of distant friends and family coming out of the woodwork to ask for them. Some examples:
* Record labels
* Clothing lines
* Restaurants
* As-seen-on-tv-esque inventions
* Hot new speculative stocks
When you have a lot of money, the pressure to sink some of it into something like that is enormous, regardless of how smart the business ideas are.
**Failing to Plan for Retirement**
Not only do these people spend big, their families spend big. Even if they watch their spending enough to stay afloat while they're working, a lot of them don't take into account what's going to happen when they don't have the same level of income. A lot of their families can't handle that transition as well, because they're accustomed to living the lifestyle of a family with a lot of money coming in. A lot of athletes, especially in the NFL, only get to play for a few years. That's a lot of money for a short period of time. Some of them aren't very good players, but some are good players that get injured. So once they're out of the game due to injury and jobless, they still have a lot of medical costs to take care of all on their own while still supporting their families. Nobody thinks they're only going to play for a few years and have their career cut short. These guys are rich and famous celebrities. They feel invincible.
Also worth noting is that before they became rich, these people grew up with backgrounds like ours. A lot were poor. Some were middle-class. Some aren't very well educated, especially when it comes to money matters. You probably know a few people that aren't very smart with the way they handle money. Imagine what would happen if they were suddenly given large amounts of money for an indeterminate period of time. Financial literacy is not something that gets taught very well in school. Being a pro athlete or musician doesn't make you any smarter about this stuff. In fact, the only people who get rich and are well versed at money matters are businessmen, and that's because they study it very heavily.
That's only a few examples. ESPN's Broke documentary does a very good job of breaking this stuff down as well as interviewing a few athletes that have undergone the embarrassment of blowing extremely large sums of money so you can see it from their perspective. There's also [this Sports Illustrated article](_URL_0_). | 98705d65-262c-45f4-9ab6-37409675bc3e |
5p9u02 | If some letters are silent in certain words then why include then at all? | Often just tradition. When they began printing books in English, there weren't many typesetters in England, so they imported Dutch typesetters who often spelled English words in a Dutch way. So that's how we got the 'h' in 'ghost' and 'ghastly.'
Other times the silent letter actually serves a purpose. The difference between 'can' and 'cane' is the silent letter 'e.' That 'e' lets the reader know that they should pronounce the 'a' as a long vowel.
Edit:
[A much more eloquent source](_URL_0_) | 83cc1656-710b-4d04-af77-7e61ed8de2e1 |
4vom1y | Why do historians talk about civilizations being more advanced who had "the concept of zero," and why was that concept so hard to develop? | Creating a "concept of zero" is the first step towards using math for something more complicated than counting cows in a herd, or a weight in gold. Once you are at that point, it's possible to move on to more complicated math, which leads to basic engineering and architecture.
Zero is the first mental jump from "numbers are good for counting things," to "we can use numbers to build things so that they won't fall down!" | 74ca2913-1ab7-4b68-ae2f-994b66a0dd93 |
64ev6h | Why did older CRT monitors for computers typically work in a black background with green text? | [Green P1 phosphors ](_URL_0_) had long persistence (decay time). Amber P3 was medium persistence. White P4 was faster. Longer persistence meant your video could be at a lower frame rate without flicker. Nobody was watching videos or playing fast games, so it didn't really matter. | 65b868c9-f4f0-4145-830a-3f38d2895003 |
1imbg9 | Google made 3bn USD profit, but wall street is not happy, eli5 me why?? | Because they expected more.
Like you're 5: imagine I promise you 20 sweets next week. But when next week comes around, I only have 15 sweets to give you. You wouldn't be happy, right?
But that doesn't fully explain it.
Imagine I promise you 20 sweets next week if you give me your pocket money. But Johnny's dad says that if you give *him* your pocket money, you can have 18 sweets next week.
Of course you give your pocket money to me. But now, when I give you only 15 sweets, you're *really* mad, because if you'd known that you'd only get 15 sweets from me, you'd have given your money to Johnny's dad and not to me! | 9e0b7599-d6d5-42c9-b03e-b598d5a72d0c |
2rbefe | Difference between 'fiscal' and 'financial' | To put it in simple terms fiscal just has to do with government spending & revenue. You may hear or read the term 'fiscally conservative' which is the view on how the government should spend their money, which generally means reducing the government spending and basically reducing the national debt.
Fiscal conservatives believe in limited government spending, free market, & less min. wage. To be fiscally liberal is the belief that government intervention is the best way to bring economic equality & stability, & to be in favor of a progressive income tax to just name a few. You should definitely watch gubernatorial or presidential debates between Democrats & Republicans and you should observe on their economic & social policies they believe in.
'Financial' is more of a broad term that can be applied to a single person or a corporation. "He is financially responsible". "Sony is financially a stronger corporation" | 57177927-971d-4415-a784-425f96aec7be |
33j9q2 | What are sister cities? Do they actually have any relationship benefits or is it just a gimmick? | People in city government get to take free tourist trips to other places to "foster communication" and "gather ideas". | fe1578ca-27b9-4bbb-9ae0-ec61e50a84d7 |
8psnxl | Why do busses not have enough seatbelts? | Busses have a very large mass compared to anything they hit. In almost every collision a bus is involved in, it does not decelerate quickly enough to do serious harm to the passengers.
Large mass means a lot of momentum and most things that get hit by busses just move out of the way. | 9b0d1299-45bb-40fb-bc15-683c15c8e4dc |
5l7zhe | Data limits. Why were pioneer plans offering unlimited data and now we're seeing caps on not only cell service, but even at-home ISPs? | ISPs can no longer increase revenue by adding subscribers. Nearly everyone that wants and can afford broadband already has it. This leaves them looking for new revenue streams.
It is also a way to limit cord cutting. | 9b43a8ca-c20a-4750-84c0-603025b13695 |
tqo7l | The Difference Between Different Programming Languages | Different languages are designed to best do different things. Asking if one is better than another is like asking if a metal hammer or rubber mallet is better, and asking why so many exist is like asking why there isn't only one tool that hits things. | cc35872d-5e90-4adf-bca6-c6db16fb74a5 |
22hokz | Why do some people never get sick with colds or flu when everyone else does? | As a non-expert, I would assume it's due to two primary factors.
1) Genetics
2) Prior exposure in a small amount to an illness that allowed the body to build up an immunity.
I have no medical proof to back it up, but the people I know who are sick most often are the ones continuously using hand sanitizer. I believe it's because they never expose themselves to small amounts of viruses.
Then again... we could get into that whole correlation vs. causation thing. Perhaps they started using sanitizer because they got sick all the time? | 945364d4-544c-46e6-b107-668b063a6393 |
31728o | If I pour one cup (~600) of bees into the dryer and run it (without heat) for a couple minutes, could they just fly around in the middle without issue? | There's only one way to find out. Be sure to take a video, you're going to need it for the TIFU. | a414c485-7787-4126-9b7c-e4cc30e4a82f |
3zu19m | Why exactly wasn't Netflix offered to those 130 countries before today? | Varying laws and rights holders is the intuitive answer, but if you think about it, that doesn't explain why the 130 countries were added at the same time as opposed to gradually as Netflix worked through legal issues.
The truth is it's a numbers game. A common clause in media (movie, TV show, music, etc) rights contracts limits the number of countries a given media may be sold to *as a function of the decade*. This practice was instituted after World War II, when it became apparent that the number of nations will very rarely shrink (due to the small power of conquering nations relative to the international community that would oppose them), and more often grow, leading to an upward trend in the number of nations. The idea is that the contract will maintain a roughly consistent share of the global market, reducing the rate at which it devalues over time. Since the practice became common in 1946, it is customary for such contracts to begin the decade on January 1 of each year ending in 6. | 1b5f17e1-9183-4988-938a-28583af09575 |
6owimf | Why do episodes of TV shows air months apart in different countries even though they still air in the same language? | I'm pretty sure this has to do with licensing & intellectual property laws and getting them sorted out globally. | 00ed7223-ecaf-4c0d-9704-ed4290888bbd |
3ctd2c | If wood pallets are in such demand, why are stores giving them away? | There are two types of wood pallet: hardwood and softwood. The hardwood ones are in true demand, and are reusable. These are generally painted. The softwood ones are, for the most part, considered disposable and those are the ones you will find for free.
Be careful where you get your pallets. Many are loaded with various chemicals or bacteria that could potentially harm you. | b02c94dc-7b04-492d-aebd-0f073220c58e |
57e0ic | How do NFC Credit cards work? Do they store the credit card number? How are card numbers not stolen by people with NFC readers? | Firstly, there are no NFC cards, they are RFID. The distinction comes from power. When using NFC payment on phones, the phone transmits the signal, costing some battery life. On RFID cards, you obviously don't charge them, the card reader actually sends a tiny amount of power to them so they are able to transmit the signal back to the reader with your payment info.
On to security, these cards use something called tokenization. What this means is that instead of just transmitting your actual card number like a swipe card, they transmit a single use security code, which the card reader sends to either the processing company and/or the bank (it depends), and verifies that it is a correct security code.
Now, I am unsure if your actual card number is also sent. With Apple Pay, the iPhone sends the token and a DAN (Device Account Number), which is a verified number specific to your Apple Device (iPhone, Apple Watch, etc.) that has been verified by your bank when you set it up. I would assume when using RFID, the card also sends a DAN equivalent instead of the actual card number.
This method is the same for chip cards, except it's not wireless.
Now, where chip/RFID is less secure than Apple Pay and other NFC payments (that use a DAN), the card number is still on your card. Since swipe readers can still accept chip cards, a thief can steal your card (such as a waiter) and can copy the card number to a new card and swipe it at any reader not set up for chip (a chip card inserted to a chip-enabled reader won't allow it to be swiped).
However, the US had RFID cards about 10 years ago, but I guess they actually transmitted the actual number instead of a DAN equivalent, because you can find news stories on YouTube that show the news people going around a mall and copying people's cards wirelessly (with their consent), loading it onto a hotel room keycard, and using it at McDonalds (one that accepted contactless, so it allowed it to be swiped). I am 99% sure that they now use the current method I described with Apple Pay. | dbed6c17-b05c-4038-978c-5c66120882c6 |
1vz4jf | Why are none of the major news websites reporting on the Ukraine riots? | I feel the Ukraine riots is well coverd in the media, but I have not visited many international news-sites.
But the main reason for this is simply money. News-sites base their content on what "news" gets the most clicks on their website. The more clicks equal more advertisement money since each click on a article opens a new page with new advertisement.
So the articles you see on many news-sites is simply a representation of what the people on the website wants to read about. The fact that Justin Bieber has more coverage that the Ukraine riots is because people find it more interesting (sadly enough).
Justin Bieber articles may have 5000 clicks, while the Ukraine riots have 500 clicks, so then its natural for the news-site (who wants to make money) to make more stuff about Bieber and highlight his stuff insted of the Ukraine riots. | 688a3e6b-af7d-4c2d-b713-d4535f588793 |
6b1zmd | Why are carbon and oxygen so ubiquitous in living organisms | To be useful for life atoms need two somewhat opposite characteristics;
they need to be reactive enough to be readily changed when needed, but not so reactive they degrade by themselves e.g with moisture.
Carbon fills that role perfectly. Carbon based molecules will on average hang about a long time, but when called upon can be manipulated by say enzymes to change. Lead based compounds could stand in for carbon in some instances, but the bonds with other atoms are too weak and wouldnt last for the time needed.
Carbon forms strong bonds with hydrogen, oxygen, and nitrogen, which is why they are also widely found in life. | e118cee5-150d-425a-97bf-39a4d2b9497f |
6nvhh4 | If most money is just numbers in a database, how come we don't hear of hackers who break in and just increase their account balance? | Accounting and balance sheets. Every debit has to have a credit, and every credit a debit...or it will show up as out of balance. If there were to be a balancing entry in the respective offset account, then maybe it would go undetected...but nonetheless it would still show up as an entry that someone is eventually responsible for reconciling. | b14d7be3-d68b-4402-a965-34fbd4ab74ad |
70iil4 | How does a lightning strike crumble buildings even when they are made of meters and meters of non-conductive materials? | The amperage and voltage difference between the ground and clouds are so large that it doesn't really matter what the thing is made of. If the path is connected, the electricity flows. Resistance causes a big chunk of that energy to turn into heat, which spells out a thin cord-like volume that briefly reaches temperatures over 4000°. This is what makes things blow up or catch fire. | 4efa6309-2b49-43e4-9ab1-52fb9da0840b |
3gc1u6 | Why does faraway smoke look like it's staying still? | The same reason airplanes look very slow. A plane flying 400 mph looks like its crawling along because its so far away. Smoke rising a mile away is only going, I dunno, ten miles per hour, so it looks completely still because of the same principle. | 52c43c72-4f78-4bd2-86d8-af2a34639769 |
3euyxi | What shape is the Big Red Spot? | It's... storm-shaped :)
It's more of a fat oval, but vertically, it's quite thin. It's a storm about 15,000 by 35,000 kilometers in size, and about 100 kilometers or so in thickness. [This wiki entry](_URL_0_) has some great info on it.
So yeah, it's more or less a circle (it's actually becoming more circular than it used to be, over the years, according to observations). | ece65d0c-6dd9-409d-825b-99c2a3666231 |
57p7yi | How does a headbutt work? Wouldn't it hurt you just as much? Is there any practical reason to utilize it? | You use your relatively strong forehead to strike in a less strong part of the head, ideally the bridge of the nose.
Also, even if it does hurt you, you are expecting it, and can use that surprise to your advantage. | 6ad82d5c-dd80-4fbb-ac05-defbd2daed33 |
1f3rej | Mitosis | In mitosis, cells divide into what's called [diploid cells](_URL_0_) - meaning they still have a pair of each chromosome. This means the daughter cells each have a total of 46 chromosomes. | 522b47c1-415d-4588-ae2d-c1fe8e400995 |
5zzl7e | Is intermittent fasting healthy? | There is some evidence that intermittent fasting is beneficial in humans (e.g. improved insulin sensitivity), but the bulk of the work has been done in animals. The idea is that the longer your body is in a "starvation" state, the better.
Valter Longo at USC has done a lot of work in this area, using what he calls the fasting-mimicking diet, which is a bit more intense than just intermittent fasting (in humans, the equivalent is eating 50% of normal for 5 days every month). You can Google some of his research pretty easily. | b323c936-c568-4cb0-9575-3f4b31a2bb79 |
6fahd7 | How do federal housing programs like FHA/USDA loans work and why do they exist? | A typical non-FHA/USDA loan usually requires 20% downpayment because the lender doesn't want to be too exposed in the event of a foreclosure. The government loans tend to be more forgiving in regards to credit.
The two houses we've bought over the years have been FHA because we didn't have 800+ credit scores and 20% down. FHA loans generally require only 3-5% down and you can sometimes get a downpayment assistance program that will help you with that 3%. We bought our two houses with about $500 out of pocket per house. | 04412a3c-9cc0-4bcf-8e2c-414476aec381 |
3b8g9g | Why is it the vast majority of rainbow flags do not have violet in them? | Newton was the one to popularize the division of colors in the rainbow thanks to his work with prisms. And Newton was very religious and superstitious, and saw a great significance in the number 7. So he decided that there should be 7 colors in the rainbow, which led to him breaking the blue end of the rainbow into extra, unnecessary colors. | f46fc014-d2e9-486e-b29d-d5fe7415403d |
8nw24x | Mortgage interest. | Compound Interest
It's not 4.5% of what you borrowed over the 30 years of the loan, it's 4.5% interest per year based on how much you still owe.
So let's say your mortgage is $100,000 and you make month payments of $500, just for the sake of simplicity.
The way the bank calculates the payment is as follows:
In January of the first year you owe $100,000
$100,000 x 4.5% = 4500 / 12 months = $375
So your first payment is $500 ($375 interest + $125 principal)
February rolls around and you now owe $100,000 - $125 = $99875
99875 x 4.5% = $4494.38 / 12 months = $374.53
So your second payment is $500 ($374.53 interest + $125.47 principal)
So as the months go by, even though you are paying the same "convenient" monthly amount, the amount of your payment that's interest vs principal is constantly changing in your favor.
This is why people say that you pay more interest at the start of your loan than at the end. As you owe less money on the total money borrowed the actual interest you pay is less and the principal is more so you pay off your house more quickly. | 90286b5e-2360-45ce-a945-d5be4fb633c1 |
2a7gd6 | How do people who are shown using drugs in documentaries / TV shows not get arrested? | Two answers: One of legality, and one of practicality.
**Legal answer:** To convict a defendant in a criminal trial, the standard of evidence used is "beyond a reasonable doubt." This means that if the jury (or judge, as the case may be) is **98%** sure that the defendant committed the offense, the defendant gets to go home. 98% isn't good enough.
In a simple drug possession case, reasonable doubt is usually overcome via law enforcement testimony and, perhaps more importantly in our [CSI Effect](_URL_0_) era, forensic testing of the drugs. Without those critical pieces of evidence, there's nobody to say that the defendant wasn't faking. Yeah, he or she probably was not. But are you sure beyond a reasonable doubt? Probably not worth the prosecutor's time to find out. Which brings me to the...
**Practical answer:** Prisons are overcrowded. Prosecutors and cops are overworked. Many jurisdictions don't even bother prosecuting people on simple possession charges, pursuing only cases where an intent to distribute is implicated (i.e. they go after the dealers, not the users). MTV also wants to keep having volunteers for its shows, so the network would be incentivized to volunteer its vast resources and contribute top-notch legal defense in the event that anybody actually is charged. There's simply very little motive for any prosecutor to open that can of worms. There's enough crime to go around. | 161dc55e-6234-45ad-8565-90267e98943e |
7tv2jj | How are street address numbers decided upon, if they apparently don't refer to an agreed upon distance unit? | In US cities, some central intersection is designated as 0. The first east-west cross street north of that is 100N. The first block south is 100S.
So if your address is 6407 N State Street, you're on State street 64 major cross streets North from the 0-0 intersection, and the seventh house north from the 6400 cross street.
In heavily gridded cities like Chicago these are pretty straightforward, but some curvier roads in curvier cities get sloppy. | f4c6d563-1cc9-4219-9f42-06298d9fbc6f |
8dn8qr | The Irish Border situation? | When the Republic of Ireland got it's independence from the United Kingdom, the UK decided to keep a part of the island of Ireland as part of the UK which became known as Northern Ireland. This meant that the UK now had a land border with a foreign country.
However, to avoid a hard border, both countries agreed to cooperate on immigration and trade, creating a zone known as the Common Travel Area. The customs part of the CTA was superseded when both countries joined the EEC, which became the EU.
Now the UK wants to leave the EU, this makes maintaining the CTA look untenable, since Ireland will have one set of customs and immigration rules, and the UK will have another.
Further complicating the issue is the Good Friday peace agreement which commits both countries to cross border cooperation, which many feel will be broken if border controls are introduced.
Another factor is the weakness of the current UK government which depends on the support of a prominent Northern Irish party - the DUP. The DUP support Brexit but want no controls between the north and south, but also no controls between NI and the UK. This stance is incompatible with most of the compromise solutions suggested by the UK and EU | e3ee7f15-686f-4a83-8ea8-b4806229841a |
4cnqzs | Plea deals in the US - why are they used so much and how do they work? | Trials cost money, both for the accused and for the people who are represented by the prosecution. Meanwhile juries can be fickle creatures, and you really cannot count on them to reach the right conclusion (look at OJ Simpson, 99.9999% chance he did it, but walked away with an innocent verdict).
Better to skip the expense of a trial, secure a guilty verdict, and enforce even a fraction of the prescribed punishment, then to waste a fortune and risk that the perpetrator walks.
It's a fucked up a system, but that's how it works. To paint it simpler terms, better to be guaranteed that your boss thinks that you're a good employee, than to risk a 50/50 "you're great" vs. "you suck".
Source: Life long American, degree in Criminal Justice | 1f48f8b5-40f7-4c91-8539-00f1c97affc3 |
1qjogk | What does "HTTP 2.0 to be HTTPS only" mean and what are the implications of this? | HTTPS means that the web page and the requests for the web page are encrypted in transit, meaning that people listening in on your computer (or the remote servers) traffic can't analyze them and steal personal information.
Standard traffic is done over HTTP which isn't encrypted and people can intercept these communications, HTTP 2.0 won't have HTTP and HTTPS, there will only be HTTP which will use the encryption protocol of HTTPS by default. | 0e5b797d-cdaf-4b84-ab10-57e731780c71 |
1umpv9 | How does taste and flavour work? | There are five basic tastes:
* Sweet, usually caused by the presence of sugars, though there are other types of compounds that will active the receptors for sweetness.
* Saltiness, caused by sodium ions. Potassium and lithium ions have very similar tastes, rubidium and cesium ions do have a salty taste, but also have a metallic or burning taste. Calcium, magnesium and ammonium ions also have a salty taste, but are also bitter.
* Sourness is the taste of acidity. Hydrogen ions cause a source taste.
* Bitterness, alkaloids like caffeine tend to have a bitter taste, though there is a broad range of substances that taste bitter.
* Umami, a savory or meaty taste. caused by the presence of gultamate.
Smell is responsible for all other flavors. There are hundreds of different receptors in the nose and a thorough description of them could fill an entire book. I can give a brief overview on a few classes of compounds.
* Sulfur containing compounds will usually either taste/smell horrible or like garlic.
* Esters tend to have fruity tastes/smells.
* Ketones, aldehydes and terpenes are also responsible for a number of tastes/smells.
> what is different among foods that give them varying tastes?
Different amounts of various chemical compounds.
> why do some things taste better than others?
Sweet, salty, umami and fatty foods tend to be the ones that taste the best. Salt will cover up bitter tastes and works very well with umami.
Genetics play a role in the taste of certain things. Cilantro is an example, some people find that it tastes fresh with citrus overtone, while others find that it tastes like soap or has a disgusting smell. Phenylthiocarbamine is a compound that either tastes bitter or is tasteless, depending on your genes.
Acquired tastes are another element in whether something tastes good or not. | a32d1aee-1c4a-43c8-9247-4d365515d69a |
3fcqfb | Why do deep burps sometimes sting the nostrils? | Because you've been drinking something carbonated.
The CO2 gas from the carbonation continues to be released in your stomach, and actually speeds up its release since there are a lot of nucleation sites, which the glass/plastic didn't have. (Side note, nucleation sites is fancy talk for an irregular shape that gives the gas a helping had at becoming un-dissolved in the liquid.)
When the pressure from the CO2 gas gets up there, your stomach releases the pressure, usually as a belch.
But CO2 is fairly dissolvable in water, so as it passes over your wet tissues, some of it will convert back into carbonic acid.
If that happens on extremely sensitive tissue like the inside of your nose, you can feel the acidic sting. If you get the same concentration of CO2 gas around your eyes you can feel the same kind of effect. | cda71e6a-2cd5-4b11-8af0-9b4262051ef4 |
5dwk78 | What about a base-10 numbering system makes it so good? | It really is as simple as how many fingers you have. Different cultures had some different bases, but 10 was common in a lot of cultures, because before they had a formal number system, they were used to just counting on fingers.
As for why it's better, well, it isn't really. There are a lot of proponents of moving to a base 12, or dozenal, system. The advantage there is that 12 has a lot more factors, so dealing with thirds or quarters is easier than it is in base 10. If you work with computers, you probably also use a base 16, or hexadecimal, system. The advantage here is that it simplifies binary(which is base 2). Any four binary digits will map to one hexadecimal digit, so if you see a hexadecimal number, it's really easy to get the binary equivalent. Base 8 also works well for simplifying binary and I've heard a theory that if we had used a base 8 system, we might have invented computers a lot sooner.
If we ran across aliens, unless they also had 10 fingers, I wouldn't expect them to use a base 10 system. I would expect them to use either base 12 or base 16 or something based on however many fingers they do have. | 90e61b25-ddbb-407b-9d02-32ffa3863bff |
1wwijh | Why is Atomic Bomb testing in the ocean allowed? | At the time it was done, it was not prohibited by any treaty. Today it is prohibited by the Limited Test Ban Treaty. As a result the USA, USSR/Russia, and UK have not tested underwater weapons since the 1960s. (France and China did not sign the LTBT until much later; I don't know if they did any underwater tests after that period.) India, Pakistan, and North Korea have only tested their weapons underground.
As for the radiation, much of it gets absorbed into the water, which does get highly radioactive. However the ocean is very large and so that diffuses to non-harmful levels in a relatively short amount of time. As for killing lots of animals, sure — that happens all the time.
In many ways it is better than detonating them on land, because that produces long-range, harmful radioactive fallout when the dirt mixes with the radioactive fireball. Underwater testing actually produces very little fallout outside of the immediate area of the test.
It is worth distinguishing between true underwater tests and those which are on coral atolls. Atolls are a terrible place to set off nuclear weapons from a fallout concern; actual underwater tests are not so bad. | f15e67c3-0b6b-40dd-9e67-0f8fa2dcc30b |
1fvcym | Why do we have the electoral college? | When the Constitution was written, nobody *wanted* an easy and clear reflection of voter's opinions. The common attitude was that the average voter was just too poor and uninformed; they would never be able to make a good decision about who should run the country. So the average voter would send an Electoral College representative to decide who gets to be President, in the same way that the average voter sends a Congressional representative to decide what gets to be the law. | fc1bdff4-32ee-4695-a5f6-527d0b65b34b |
3e3f19 | How do air bubbles in a needle kill you if you don't get them all out before injecting? | I think that's mostly a Hollywood invention. A large amount of air injected into a vein can kill you, but a little bit won't. Imagine my surprise when I was in the hospital and saw a few air bubbles go into my vein. I freaked out and thought I was going to die, but absolutely nothing happened. | 6248a2a1-781c-49a5-a2b6-7e303ed8276f |
1hsgrk | From 1954 to Blu ray | It's kinda a strange concept, but since old movies were taken on real film, the film itself is basically HD (It's not that hard to realize either, if you look at some film, it's very very high quality picture) As long as you have the old film, it'll be convertible into HD into at least the near future (Past the time that say, movies taken in 2000 will be directly convertible).
However, it's worth noting that, even if this wasn't the case, you can still convert a very low-res movie into HD, that's what happens when you watch a non-HD movie or non-HD TV channel on an HD TV (basically). You probably wouldn't call it HD though just because it doesn't look very good compared to things which were made in HD. When converting in this way, as long as the producers are willing to put a little money into it, you can touch-up the quality a bit so it looks much more like it was made in HD rather then converted. | d0bdd6c1-aca7-4882-b2fc-b0dd67ff8ee6 |
1ohw8e | the difference between DNA, genes, chromosomes, RNA | Right, so the easiest way to probably look at this is by starting with the DNA. DNA (deoxyribonucleic acid) is what contains all the information to create pretty much any part of every cell in the body It's made up for four different 'bases' (A, T, G and C), which together make up the code that the cell 'reads' to make all the different proteins that it needs. DNA has two strands which run in opposite directions to each other, but are complimentary to each other; each base of DNA will only normally pair with one other base (A always pairs with T, and C always pairs with G) so you end up with two (very very long) strands what would look something like this:
TAGTCGATGCTTAGGAAATGCTGAATC
|||||||||||||||||||||||||||||||||||||||||
ATCAGCTACGAATCCTTTACGACTTAG
Each cell in your body (apart from your red blood cells which don't have any DNA) have around 3,000,000,000 base pairs (bp) of DNA, although these are all wrapped up into your 23 pairs of chromosomes.
Chromosomes are essentially big bundles of DNA wound round proteins called histones so they can be packed very tightly into cells (the only time chromosomes actually look like the traditional X shapes are when the cells are dividing, normally they're usually all partially unwound as the cell is reading the genes (the 'recipes') for making different proteins).
Genes are chunks of DNA which contain the recipe for making a single protein which the cell might need. Humans have around 20,000 genes (so recipes for 20,000 proteins) in their DNA which only accounts for around 2% of the entire DNA (the other 98% is a mixture of sequences which help regulate the behaviour of the cell, which genes are used and when, and 'evolutionary rubbish' left over from thousands of years ago. The cell uses the genes by creating RNA complimentary the gene code which can then be translated into proteins. Some genes are very long (e.g. dystrophin which is 2,200,000 bp long and some are rather small such as p16 which is the gene i work on which is 818 bp).
RNA (ribonucleic acid) is very similar to DNA except for 2 reasons:
1. The sugar in the part of the nucleic acid which connects the bases together is ribose instead of deoxyribose (read: has one more oxygen atom in each sugar).
2. The T base is replaced with a U, so A always pairs with U instead of T.
The first step in expressing a gene (creating a protein) is to transcribe the DNA into RNA, so using the same DNA sequence as earlier:
TAGTCGATGCTTAGGAAATGCTGAATC
||||||||||||||||||||||||||||||||||||||||||
AUCAGCUACGAAUCCUUUGCGACUUAG
(Sorry it doesn't align the Us are a bit bigger than Ts)
Once the cell has the RNA it can be translated into the protein which will actually do something within the cell. Proteins are made up of 20 different amino acids, placed in different orders (a bit like the DNA code) which will then do something once they have formed, which will depend on the length and sequence of the protein. Each amino acid is represented by three RNA bases (a codon) which the cell recognises, so as the protein assembling proteins move along the RNA they're essentially reading the instructions and adding the relevant amino acid onto the end of the chain in order until they reach a stop codon, which signifies the end of the protein sequence. for example the RNA sequence earlier would create a protein with the sequence (where a comma denotes start/end of a codon):
AUC,AGC,UAC,GAA,UCC,UUU,GCG,ACU,UAG
Isoleucine,Serine,Tyrosine,Glutamate,Serine,Phenylalanine,Alanine,Threonine,STOP
So in summary; chromosomes are collections of genes and junk DNA, genes are groups of DNA that can be made into proteins, and RNA is what the cell uses to help 'read' the DNA so it can be turned into proteins.
Hope that helps, it's reasonably easy to understand and that it's not too complicated, I've missed out a ridiculous amount of information but that's the basics.
Source: I'm a biochemist
Edited: formatting | 5dd35ad6-cd01-4e1e-b071-4f31a4516b77 |
6mu75r | Why do I see a sudden flash of light when I sneeze with my eyes closed? | Everyone sneezes with their eyes closed. Some people (all?) have a nerve that causes your pupils to widen or shrink connected to the same nerve that causes the sneezing reflex so it may be possible it acts as a stimulus when you sneeze. I may be wrong though but if you have ACHOO syndrome this may be the answer | b71c2b6e-b9b7-4a66-a459-3403e6e8bdc9 |
1jz7rh | People who understand NSA stuff: why don't they have a better lead on Jim Dimaggio? (California Amber Alert) | IF he was trying to flee, he would have taken a different car, or disabled his GPS Nav system, and from that point he would stay off the grid.
|
They do use it for the domestic good, remember the Boston Marathon manhunt? | 6381ec3a-ea95-4738-83cb-01708c3510cc |
3o2bx8 | How do you prove the title of this post is the same as always? | ELI5:
We can't prove anything we know is true, we can only decide for ourselves based on what we see and experience. For many facts, we simply must either trust that whoever told it to us is telling the truth, or seek the truth ourselves by checking other sources or through experimentation.
Slightly less ELI5:
If you want an interesting read that deals largely with this exact issue, try reading George Orwell's 1984.
In the book, many "facts" are simply made up by the government. Nobody knows any better because all their information is from that one source. The worlds history has been largely rewritten, and very few people are any the wiser. Anyone with knowledge of the real history, or it's rewriting are being killed off.
The fact is, we don't know if anything we've been told is true. This is why conspiracy theories are so prevalent and intriguing. Obviously fantastical stories can be ignored, but conspiracy theories with a basis in truth that can explain events that don't otherwise make sense is simply a healthy dose of skepticism from the public. As the saying goes, "history is written by the victor". The loser of a war usually becomes the demon or evil entity in the history books, and the winner is often allowed to justify it's own horrible actions by using the loser as a scapegoat. | 6d2a306e-09c3-4679-b9ad-fb4c17423037 |
211pap | After time in the sun, why does my hair get lighter but my skin gets darker? | Your skin can react to a stimulus. It adds more pigments to protect you. Your hair is mostly dead cells and thus cannot react, so it gets bleached in the sun just like paint or plastic. | 7a4f1ce8-c128-4503-bed1-a920e5d8508b |
5rj7km | Inflation target is roughly 2-3%, is any lower than this bad? If so, why? | Moderate inflation provides incentives for people who have money to lend it out to borrowers. These borrowers generally spend this money in the short term, which fuels economic activity and all that comes with it (higher production, lower unemployment, etc.). In short, money is put to work rather than just sitting around.
If the inflation rate is zero or near-zero, you can sit on your money and it won't lose value. Even worse, if inflation is negative (also known as deflation), you can actually profit from sitting on your money. In that scenario, you can end up with a lot of money sitting around without being used to drive economic activity. | d86de7d8-540f-40ae-b729-3ef280d386cf |
5bpbcx | If i deposit 1 dollar into a bank, what are all the options of where that 1 dollar could end up? | Do you mean the idea of the dollar or the physical currency?
The dollar becomes two entities on the banks balance sheet: one dollar on deposit that they owe you (a liability) and one dollar in cash. They can then use their cash to buy securities (short and long term), as funding for a loan, to pay a depositors withdrawl, pay an expense (like rent or wages), or it can be deposited with the Federal Reserve (which is sort of like a wholesale bank or a bank's bank).
The physical currency will likely be returned to depositors or sent back to the Fed (if it's for a reserve deposit or if it's damaged). | 9c1224c9-1185-40d6-bb3c-45bbdc207c4b |
1dq1cj | why people from the United States love to have guns that aren't just hunting rifles. | So what you're asking is why affections seem to have shifted from the traditional hunting rifles to the newer types that are made to look like combat rifles. I assume you're talking about variants of the Armalite or AR rifles?
If these are the ones you're talking about they are mostly chambered in .223 Remington which is based off an old Deer hunting round from 1950. Some are chambered in .308 both of which are considerably less powerful than say 30-06, and much less powerful than big game rounds like .375 H & H, .458 win mag, or the Nitro Express rounds.
Bolt actions (like the old hunting rifles you are thinking of) are much stronger mechanically and can be built to fire these. Armalite platforms cannot be made to handle a 'high power' round.
Think of it like this, .223 would have the power of fast moving smart car, 30-06 a truck going the speed limit, and .458 Winmag a runaway cement mixer.
So if they're delicate and underpowered why are they popular?
From a practical standpoint they are usually less than half the weight of a comparable hunting rifle. They have negligible recoil, because of the smaller caliber, and because of the gas system. They are modular, (think legos) you can break them down into their component parts, mix and match, build whatever fits you best.
For a lot of people they are replacing the old bolt actions because not a lot of people need a 30-06, or a .338 Lupa unless they're hunting bear or moose.
From the standpoint of the action itself, they really aren't functionally any different from a 1942 M1 Carbine. They're just made out of a lightweight, durable plastic.
Some people also like the aesthetic. I don't see it myself, some do.
They tend to have accessories because it became popular to put weaver and picitiny rails on every visible surface. Really you can mount flashlights, and lasers, and scopes on anything, it's just become very easy on the new platforms. If you wanted a scope on an old rifle, you'd often have to take it to a smith and have holes drilled and tapped. With rails you just set it on and tighten down some screws.
So to answer your question, it's because they're practical, and some people think they're cool. It's kind of like the mangle. No one uses the mangle anymore because it's outdated, you may not even know what a mangle is, because we all use clothes dryers. Some people see the old traditional stuff as we see the [mangle](_URL_0_). Outdated, and unnecessarily cumbersome.
That's the hunting side of it. | b730a462-a3f2-43c6-8186-46be475fe4c8 |
1sgj9k | How come it feels infinitely more perilous walking down an icy incline than it does walking up one? | My guess, going downhill if you slip you will fall backwards and won't be able to catch yourself and possibly hit your head, going up hill you will fall foreward and be able to use your hands to catch yourself | 3ad9890d-5f7e-493e-90bb-1a8b172af99b |
403hnh | Why can't we artificially inseminate endangered species like pandas and rhinos in order to raise their numbers? | Increasing their numbers doesn't solve any problems. They're being wiped out in the wild, through habitat destruction, poaching, etc. Having 'more to die' doesn't fix the 'to die' part.
Additionally, artificial insemination isn't a surefire mechanism, and once your population is low enough you run into problems with a lack of genetic diversity that you can't overcome with more of the same genes. | 1870a13f-e14d-453e-9042-3c1a6f177ffd |
1nyuts | How does the Nuclear Fusion produce cheap, reliable energy and ELI5 how the new data produced in Livermore, CA help us? | _URL_0_
Original story in which I am inquiring.. | fb6da0db-e254-42d6-81cc-e50adb636b9b |
5gv4nh | Can anyone explain why when you sit for an extended period of time your knee will start to bounce up and down? | This actually doesn't happen to everyone. If it happens all the time and feels like it's out of your conscious control, and really severe, it might be Restless Legs Syndrome (RLS), a neurological disorder which causes a strong urge to move your legs.
It might also simply be a symptom of impatience or boredom or, in the extremes of those cases, a symptom of Attention Deficit Disorder.
Here's a Wikipedia article about RLS:
_URL_0_ | 78e621a0-9747-4af8-8a91-230307638234 |
2gc3e9 | what is going on with Adrian Peterson | He hit his kid with a "switch" (usually thin tree branch with the leaves ripped off) as a way of discipline, but apparently it left some pretty bad marks which makes it look like he went too far with corporal punishment and possibly crossed into abuse.
Hard to say exactly what could happen with his career, but this coming the same week as the Ray Rice domestic abuse issue is probably going to make any suspensions he receives much stiffer. | 574c35e3-6e37-40ed-ab84-03426ae24e98 |
441jeq | What's the deal with the O.J. Simpson trial? | OJ Simpson was put on trial for the murder of two individuals, Nicole Simpson and Ronald Goldman. He was acquitted of those murders. The response to the verdict was very polarized along racial lines, with blacks generally favorable and whites generally unfavorable. | 6c8a2f31-c6e9-4e4c-839f-4585b9e70af2 |
1zvo5x | Given that most students forget most of what they learned very soon after their exams, and there being not much evidence to support the transfer of skills from studying one thing to doing another, why is there a truly incredible amount of emphasis placed on education? | For pre-university education, it's less about what you know and more about how you learn.
I taught grade 2, and many pages had them doing silly things to solve simple equations. for example
> 12 + 15
1. 12 to 20 = 8
2. 15 - 8 = 7
3. 20 + 7 = 27
I always explained that what we practice on paper was a method we would often use in our heads. We were learning the process, not the content if that makes sense.
In our science classes we learned about structures. Now these kids may forget what they learned, but they were then prepared for the next stage of discovery and experimentation in the science classes.
University degrees are either about professional knowledge (namely people continuing the academics) or about proving your abilities | 3623a7a0-dc07-4cf4-bb1b-90a97c053048 |
1qoxjn | How can services like Google Drive offer so much storage for no charge? | Google offer 'free' services to lock people into using Google, this in turns makes people use other services such as search and gmail, where they do make money for people clicking on advertisements.
It's also another way of gathering as much information about people to enable them to target specific types of advertisement to that individual. | 94ab6ff9-371c-448c-9d31-577e4f22161f |
7fnvf7 | The Cheryl’s Birthday Logic Puzzle | Puzzles like this rely on not just the information that each person in the puzzle knows, but what they know about what the *other* person knows.
In this puzzle, Cheryl gives 10 possible dates for her birthday:
||||||||
|:--|:--|:--|:--|:--|:--|:--|
|May||15|16|||19|
|June||||17|18||
|July|14||16||||
|August|14|15||17|||
She tells Albert which Month her birthday is in, and Bernard which day of the month her birthday is.
Albert (who knows the month) says, "I don't know when Cheryl's birthday is, but I know that Bernard doesn't know either."
So how can Alfred know that Bernard doesn't know when Cheryl's birthday is? To answer that, you'd have to know how Bernard (who only knows the day) *could* know when her birthday is if he doesn't know the month. The only way he could know is if the day is one that only appears once in the entire list. So, for instance, if Cheryl's birthday were May 19th or June 18th, Bernard would know exactly when her birthday was just from the date alone. Since Alfred knows that Bernard doesn't know when her birthday is, it must be because her birthday is not in May or June (and thus cannot be the 18th or 19th).
So:
||||||||
|:--|:--|:--|:--|:--|:--|:--|
|~~May~~||~~15~~|~~16~~|||~~19~~|
|~~June~~||||~~17~~|~~18~~||
|July|14||16||||
|August|14|15||17|||
Now Bernard says, "At first I didn't know when Cheryl's birthday was, but I now I do."
For that to happen, there must be a day that only appears once in the remaining months. This means that her birthday can't be on the 14th, because Bernard still wouldn't know which month it was. So it must be the 15th, 16th, or 17th, because Bernard could pick the exact month based only on the day.
So:
||||||||
|:--|:--|:--|:--|:--|:--|:--|
|~~May~~||~~15~~|~~16~~|||~~19~~|
|~~June~~||||~~17~~|~~18~~||
|July|~~14~~||16||||
|August|~~14~~|15||17|||
At this point, Alfred says, "Then I also know when Cheryl's birthday is". The only way he could know that is if there's only one date left in the month that he was told by Cheryl. So her birthday must be July 16th.
Hopefully that makes sense. I'd be happy to clarify any parts that you don't understand. | f864ebb8-6e41-404b-9e6a-74ae8ed2959a |
3tn379 | why do lightbulbs seem to go bad only when being turned on? | The filaments in the bulb get thinner and thinner with more use. At some point they are thin enough that the surge of electricity when turning on the bulb is more than the filament can take. | bab86126-6226-41d1-89c9-05f39984964c |
2rsu7n | Why are most SQL error messages useless? | They're not useless. They give you the exact line the problem has occured on and the nature of the error. It is assumed that you know what you're doing and are competent enough to be aware of which keywords exist. Why did you cut off the rest of the error message you quoted:
ERROR 1064 (42000): You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'NOT NULL,
PRIMARY KEY (userID, tweetID),
FOREIGN KEY (userID) REFERENCES User(' at line 4
References being capitalised is a pretty big clue. I don't mean to be rude but you're stupid. | 9efbc697-d0ca-4064-b170-a8862557a620 |
6ch2ll | Why do large semis shake your car when you drive past them? | [Vortex shedding](_URL_0_)
Because semi's are not very streamlined the air rushing past them ends up in a series of vortices. As these vortices pass you, your car is alternately sucked toward and blown away from--hence the shaking motion. | 639ec176-8c20-4c48-a205-fcb9f3f85e3f |
22eunv | How much repulsive force can two or more magnets produce? | It comes down to their strength, size, shape, and distance between them.
Here is a calculator from a site that sells neodymium magnets, some of the strongest you can find
_URL_0_
The strongest I found was around 3000N between two magnets | ecdb0780-fe1c-40cb-afd5-136d86f03883 |
2ca9y0 | How are cranes on the side if buildings built during construction? How is the last crane disassembled? | A crane can build and disassemble itself. They build what they can on the ground and then let the crane take over.
There is no way I'd be able to explain it better than this video.
_URL_0_ | acca175d-7083-4ebc-b92d-27b547af6e7d |
2xalry | Why does everything you mix together turn brown? | Pigments absorb some colors and reflect others. Mix a bunch of different ones together and it ends up absorbing most of the color and then reflecting some of the light so you get a dark mass of brown | f3dd6943-6d9f-4394-af0a-3bb4903db625 |
3xr91t | Why do we still have court reporters? | Transcripts. Every legal action is based on a transcript, the written word of what happened in court, and also at depositions (witness interviews taken under oath outside the courtroom). So anytime a hearing is at issue or deposition testimony is needed, the court or court of appeals needs a transcript to review what was said. And the easiest way to do that is by reading it. The written transcript is also very easy to reproduce, where an audio recording is not as easy to reference or excerpt in papers.
The reporter actually will record the hearing in audio and use that recording to help correct the transcript, in case there are any errors in the first draft. | ba06eaf4-30bd-4e32-b7e1-b207026b7c78 |
3ek824 | What is the difference between a voxel and a pixel? | A pixel is part of a 2-D image - like all the dots that make up your screen.
A voxel is a 3-D element, like the cubes that make up Minecraft. | 7de20479-59bc-41e5-8eb2-4562464ab1d4 |
51azgk | How can a person break cement blocks with a fist? Surely there is no training that makes bones as tough a concrete? | The dirty secret of concrete is that it's weak in *some* ways. Like natural rock, it's great at withstanding compression. However, it is very poor at withstanding tension (pulling). Which means that it's also poor at handing bending, which imposes compression and tension in different regions at the same time. To make concrete handle bending - e.g. to span a space between columns - you have to reinforce it.
Depending on the composition of the concrete, e.g. the size and quantity of the gravel - it can also be poor at handling shear (slicing). This is the weakness most relevant to martial arts displays: the hand or fist imposes a sharp shear force peak, and the result can be a fracture along a plane. If the blocks are made specifically for the demonstration, I would expect the concrete composition to be suitably weak. | d0a43dcc-cddd-4fcc-9f5a-393fe4711f42 |
76a1tx | Why are college grades so test taking oriented instead of grading us on our ability to work in teams and research information on topics? | > Colleges claim to prepare us for the real world
This is not in fact the objective of advanced colleges and universities. Their job is to teach you how to think and how to learn, and also to to provide you with a large foundation of background knowledge and general skills such as how to express yourself or organize information. Teaching you how to get things done in a practical workplace is not, officially, their main goal. | af46130a-940d-45b0-aad9-8c3e5159726f |
3cefgv | . If I watched 15 minutes from a 90 minute YouTube video, do I get charged data for the entire 90 minute file ? What about the ads . | you don't stream the entire file at once. Youtube doesn't stream the entire thing to you anymore, just sightly ahead of what you watch. They want to save data too, after all.
yes, ads do use data too. they are not magical. | 2afd4617-655c-4dd9-8f04-4968f1c2ea91 |
3zaldq | Clive Bundy and his ranch | The big stand off last year with bundy and the government was over his use of public lands. Ranchers that want to use public lands like the one in question here are expected to pay a fee to the government and in exchange they can graze their cattle on it. Bundy had not paid the fee for (iirc) years and the government finally stopped sending him empty threats and moved to remove his cattle from the public lands. Bundy took advantage of anti-government sentiments to get a group of conservative "militia" to come help him fight the government agents sent to remove him. | ea83ff87-fa8a-49de-85cc-703fb3f24727 |
6itrpu | Why do people have different skins tones, face shapes, body shapes etc from different continents? | Indications are that a lot of those features, the key reason Europeans and Asians are different is because of interbreeding with neanderthals and denisovans. The neanderthals and denisovans had lived in those regions for a long time and had gradually adapted to the environment of the climates, and the interbreeding enabled the people recently emigrated from Africa to draw on this.
The dominance of fair skin, hair and to a lesser extent eyes in Europe is actually a fairly recent event. [As recently as 7-8000 years ago](_URL_0_) - a time when the first cities were rising in the Middle East - there remained groupings of people with more African traits, but blue eyes. There are indications this was still the norm in great parts of southern Europe.
_URL_1_ | 37f81678-ceb8-4f72-9d44-c72ace326f97 |
37uo3v | Why do muslims grow long beards? | This is still a debated topic in Islam. Many scholars say it is Fard while many also say it is only Sunnah. There is no one clear answer to this question.
Fard= mandatory
Sunnah= highly recommended | 58db4069-b1b5-4bdb-a28d-75be82fdc5fa |
1uhpvq | Why does my nose run when it's excessively cold outside? | My guess (I'll look it up to confirm after I type this):
Cold air is warmed by your nose and upper respiratory tract in order to maintain core temperature. When air is excessively cold it requires more blood flow to your sinuses and nasal passageway to warm the air. In order to increase blood flow a local vasodilator is released in the form of histamine and this also increases mucous production.
Now I'll go look it up and see what I can find.
EDIT:
Found a good article on NPR website about it. Apparently I was partly correct. It's about warmth AND moisture. Cold air is usually dry. The fluid production in the nose is to warm and moisturizer the air so that it is conditioned to be gentle in the airways.
Link: _URL_0_
Edit 2: if you're wondering how the nose knows that the air is cold it's a matter of thermal receptors (nerve endings) in the skin of the nasal pathway that can detect temperature. | 4e973896-5c5f-4278-8b58-ccf0b4014e9a |
2wjkof | Why does audio feedback always sound like a high squealing noice? | There are 2 things happening here. In a feedback loop, the microphone is picking up some of the amplified sound (because it "hears" it from the speaker) and sends it back around. This is why it gets very loud, very fast. The high-pitched squeal happens for a different reason. If the microphone and the speaker are at a certain distance and orientation with each other, such that the sound coming out of the speaker hits the microphone at a certain point in time, certain parts of the sound are amplified slightly differently. Microphones, amplifiers and speakers are not perfect...they work better with some frequencies better than others. If the alignment is such that a certain "high sound" gets amplified better than the other sounds, this results in the squeal you hear.
This looping happens very fast, which is why the sound starts a fairly low volume and pitch, then gets very loud and high pitched.
If all microphones, amplifiers and speakers (and room acoustics!) were perfect, this would not happen.
For you techies: One trick that used to be used before modern DSPs (digital signal processors) was to place 2 microphones at every performer. One mic was actually used by the performer, while a second mic was a few inches away, but connect 180 degrees out-of-phase ("reverse the wires"). The performer's mic would capture both the performer's voice AND whatever else (instruments, crowd, etc) was near by. The second mic had the same, but no vocal. Since it was 180 out of phase, you could add this to the other mic (with a special amp...) and almost perfectly cancel out everything but the vocal. A pain in the ass to set up, but you could get some great sound that way.
Edit: Added some cool microphone info | edc2940b-0dde-4ec8-bff8-44643dba14a2 |
5gq5ls | If America has the best colleges in the world and some of the hardest working people in the world, how are foreigners able to take our jobs? | They will work for less money. It's primarily jobs for low skill workers that are leaving the US. A factory worker in China will cost about the equivalent of $1.36 hour. Even if they are slightly less productive, it's still more cost effective, even after shipping the goods to the US. It's about $2000 per shipping container from China to USA. | 44ac4988-e4f7-478d-bc99-829c4566e6f4 |
66d5fv | Every picture we take is a rectangle, so is the sensor inside our digital cameras. So why are the lenses of our cameras round? | It is not the case that every pixel have a single point on the lens collecting its light. Every pixel gets light from all parts of the lens. You can try this yourself by covering up parts of a lens and observe that the light in the other end of the optics only gets darker but not obscured. You can even try this on your eyes by squinting which will cover up parts of your eyelenses. So the shape of the lens does not correspond with the shape of the sensor. There is no part of the lens being wasted by being round. It is just the case that it is easier to make a round lens then a square lens with the same area. This also means it is easier to make the lens rotate to move the lenses when you are changing the focus or the zoom. However pictures, sensors and film is easier to make rectangular as this is the easiest shape you can tile together. | af61a2b8-4218-4b56-8f5c-905a7fb5a193 |
7itke9 | How does my penis know I’m looking at something sexual? | Your brain finds whatever you’re looking at arousing and as a result releases endorphins and sends blood to the penis to make it erect | a8849783-f980-4dab-a033-2dbb7a8344a0 |
1si2nh | Why did the communist structure of the USSR fail while China still continues to grow under the banner of the CCP? | The USSR tried to liberalize their politics without liberalizing their economy.
China is allowing the economy to liberalize into a more capitalist system, but maintaining strict control of the politics.
Freedom of politics tends towards freedom of economy, but freedom of economy doesn't always lead to freedom of politics (or at least hasn't so far) because everyone is happy making money.
Edit: Correcting my own stupid. | 59a72e71-8521-4dea-821f-d41615809b50 |
3q2e2s | How do people taste flavours in cigars and whiskey? | It's an acquired taste and it requires a fair bit of learning before you get it. It's not like normal tastes, it's not like a lemon tasting like lemon. It's really hard to explain, but it amounts to trying to look beyond the first, strong flavor and experiencing the nuances behind it.
The reason it's so hard is because cigars, whisky, wine and the like have very strong "first hand flavors" that easily cover up the nuances, but once you start learning it becomes second nature to ignore that and find the subtle flavors instead. | 801563e8-e5c3-4a6d-88d2-c9103768ff97 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.