label
int64 1
9
| text
stringlengths 113
6.79k
|
|---|---|
7 | a flange thereon rotation of spool 54 by shaft 38 will cause lifting of barrier member 22 by either cable 56 being unwrapped from spool 54 whilst cable 58 is wrapped onto spool 54 or vice versa spool 54 is located very close to circular arcuate section 30 and under tension to ensure that cables 56 58 do not lift from their peripheral contact therewith and maximize the mechanical advantage obtained from this positioning fig6 shows a similar embodiment to that of fig5 but there is only one cable 64 which is secured at each end of circular arcuate section 30 and to spool 54 rotation of spool 54 will lengthen or shorten the opposing sides of cable 64 from spool 54 depending on the direction of rotation fig7 shows a similar embodiment to that of fig5 but there is only one cable 66 which is secured at each end of circular arcuate section 30 cable 66 is looped around spool 54 under tension for a couple of turns to provide sufficient frictional force to avoid slippage of cable 66 on spool 54 fig8 shows a similar embodiment to that of fig7 except that spool 54 is replaced by a pulley 68 which is driven by. |
9 | in table 6 cut material round bar composed of jis scm440 in which four longitudinal grooves are formed at equal intervals in the direction of length similar to the dry high speed intermittent cutting test using alloy steel the amount of wear of the flank of the cutting edge or the service life of the cutting edge was measured the cut material and test conditions used are indicated below the results are shown in table 6 cut material round bar composed of jis s45c in which four longitudinal grooves are formed at equal intervals in the direction of length similar to these tests the amount of wear of the flank of the cutting edge or the service life of the cutting edge was measured the cut material and test conditions used are indicated below the results are shown in table 6 cut material round bar composed of jis fc300 in which four longitudinal grooves are formed at equal intervals in the direction of length moreover the coated cermet cutting tools of examples 8 13 and 18 20 and the coated cermet cutting tools of comparative examples 8 13 and 18 20 were bolted to the end of the tool steel cutting bit followed by performing the cutting. |
8 | of yig filter 11 will be increased significantly from about 1 to about 50 ohms and most of the signals from step recovery diode 18 will be reflected back into the yig sphere in addition as a secondary effect it will appear as if there is more series resistance between step recovery diode 18 and ground reducing the current flow through and therefore the generation of harmonics by the diode thus by simply changing the bias on pin diode 26 the signal appearing on output terminal 24 can be switched from a harmonic of high frequency swept source 20 to the output of low frequency swept source 28 however at some frequencies the isolation between the high and low frequency swept sources may not be as high as would be desired this isolation can be increased by reducing or shutting off the signal from one of the sources while the signal from the other is being passed through yig filter 11 for example when pin diode 26 is forward biased the signal from low frequency swept source 28 can be reduced in amplitude by several orders of magnitude through the use of modulator 5 typically such a modulator uses one or more pin diodes connected in shunt across the output of fixed oscillator 3 when those pin diodes are forward biased the output of fixed oscillator 3 will be effectively shut off in addition amplifier 9 or leveler 13 can be shut off to reduce the amplitude of the low frequency swept signal likewise. |
5 | 832 567 referred to hereinabove adjacent to the upper end of the device 1 but spaced downwardly therefrom is a pair of mounting wings 6 and 7 having pivot pins 8 and 9 extending therethrough pivotally connecting arms 10 and 11 thereto arms 10 and 11 are connected to a dust collection device generally indicated at 12 actually as will be hereinafter described the members 11 and 10 consist of an inner wall 13 of the collection device the collection device 12 consists of two symmetrically positioned members consisting of an outer wall 14 and an inner wall 13 that extends upwardly to form a cup member the inner wall 13 extends at an approximate 45 u00b0 angle through the cup member and forms an opening 16 at the central portion thereof to receive the drill rod not shown the bottom wall 17 of the cup member 12 is provided with an opening 15 which is connected to a nipple 21 that is also connected to a hose 22 by clamp 23 the hose 22 is connected to a y member not shown which is in turn connected to a single hose which conducts air to the bottom portion of the member 12 to provide a suction or negative pressure therein each half of the mechanism. |
2 | pressure container the user can actuate the closure device by pressing on the upper frontal wall 72 of the cap top wall 41 with the tip of the finger lying in recess 71 thereby the outlet valve of the pressure container 67 is depressed and thus moved out of the closed position shown in fig1 into the discharge position of fig1 thereby the product preferably in form of a foam or optionally of a paste is expelled by the pressure in container 67 into the discharge duct 43 on penetrating into the region 43c of the latter duct the product assisted optionally by a portion of propellant discharged ahead of it raises the elastically flexible wall zone 46 so that the contact edge of this zone lifts off from the orifice edge 45a of the rigid wall zone while simultaneously lifting the lip 47c and tensioning the elastically flexible arm 47b of the beak member 47 whereby the flexible wall zone 46 snaps out of the convex contact position along the rigid contact edge 45a into its opposite concave position with a correspondingly chosen material e g polyethylene no upsetting deformation of the elastically flexible zone edge occurs during the transition but rather an s shaped deformation as a transitional stage to the concave position as soon as the finger of the user releases the cap top wall 41 the latter returns under the pressure of a return spring member not shown always provided in the valve of the pressure container out of the open position of fig1 back into the closed position of fig1 thereby the excess pressure prevailing in the discharge duct 43 drops immediately and the lip 47c of the arm 47b of the beak member 47 presses the elastically flexible wall zone 46 at. |
1 | producedby coating the mold surface with talcum powder before pouring in the foam material applicant finds that the outside of the earplug has a relativelylow friction against the skin which facilitates its removal from the ear and is substantially smooth and rejects the instrusion of dirt therein the flanged or flared rear end 14 of the earplug limits the depth of insertion of the earplug into the ear and also provides a region to be grasped to remove the earplug from the ear canal because of the flange users tend to roll only the bullet shaped or largely cylindrical body 12 while leaving the flanged end 14 at its full size this reduces the possibility of deep insertion of the compressed earplug into the ear and it reduces the difficulty of removing the earplug the main body portion of length l is of substantially uniform width u00b1 10 of the width d at the middle along a distance m which is most of the length of the main portion to facilitate grasping of the flanged rear end applicant includes a recess 40 in the rear of the earplug along the axis 20 to provide a thinner outer region 42 to facilitate grasping of this region topull out the earplug the recess 40 also avoids bulging of the rear end when the main body portion is compressed such bulging resisting full insertion of the main body portion in the ear canal fig7 and 8 illustrate another ear sound blocking member in the form of an earmuff portion or earmuff 50 which is formed of the same pressure molded slow recovery resilient foam plastic material as the earplug described above the earmuff 50 comprises at least a. |
8 | ports to which the set top box or other devices are connected with the address of a tv channel at step 46 the ont determines whether the requested tv channel is already available to it as the ont may already be providing that tv channel to other subscriber ports e g another person in the same house may already be watching that tv channel on another device if the ont is already providing the requested tv channel to another user port then at step 48 the ont provides the tv channel locally to the subscriber if the ont is not already providing the requested tv channel to another user port then at step 50 the ont forwards the request for the tv channel to the olt 10 at step 52 the olt consults the table of fig6 and selects an available virtual channel at step 54 the olt associates the selected virtual channel with the requested virtual channel by updating the table of fig6 to associate the address of the requested tv channel with the selected virtual channel at step 56 the olt 10 transmits a physical layer operation administration and maintenance ploam message to the requesting ont to set up the selected. |
9 | comprising the active domain the active peptide may have any number of amino acids added to the n terminus and or c terminus of the active domain as long as the active domain has the activities described above such amino acids may be amino acids naturally adjacent to the active domain or may be amino acids that are not naturally adjacent to the active domain the protein u201c bil3 brz insensitive long hypocotyl 3 u201d is encoded by arabidopsis thaliana bil3 gene bil3 is an extracellular secretion type protein that has a full length of 63 amino acids represented by seq id no 8 ncbi id no at1g49500 and has an n terminal extracellular transport signal secretory signal positions 1 to 32 of seq id no 8 a c terminal active domain see fig2 positions 53 to 61 of seq id no 8 that is highly conserved across species and a cleavage site positions 48 to 49 of seq id no 8 therebetween see fig1 bil3 is cleaved at the cleavage site after translation to remove the extracellular transport signal peptide the active domain undergoes n terminal processing and c terminal processing and is then extracellularly secreted as a peptide hormone similar processing of active peptides has been reported as to for example arabidopsis thaliana psy1 amano y et al 2007 proc natl acad sci usa 46 18333 18338 thus the active domain of bil3 is presumably composed of the sequence of 9 amino acids represented by seq id no 1 bil3 has three arabidopsis thaliana paralogs ncbi id no at3g19030 ncbi id no. |
6 | work passages 46 and 48 while preferably walls 54 are slightly 34 underlapped 34 relative to the size of the openings for purposes of stability as is well known equal minimal fluid flow in and out of chamber 16 occurs in this position of control member 50 to hold piston 18 at rest upon energizing actuator 58 in one manner control member 50 is pivoted such that the cup elements 52 shift laterally relatively leftwardly to the position illustrated in fig1 in this second position the work passage 48 is in open communication with internal cavity 36 while the other work passage 46 communicates with exhaust passage 44 via both fluid transfer zones 56 pressure fluid from inlet port 24 enters the right hand chamber 16 to shift piston 18 leftwardly the fluid displaced from the left hand chamber 16 returning to reservoir 12 through the fluid transfer zones 56 in this position it will be apparent that the work passage 46 and return passage 44 constitute a pair of fluid passages which are selectively interconnected via fluid transfer zones 56 similarly upon opposite operation of actuator 58 control member 50 may be shifted oppositely from its neutral fig3 position so as to interconnect the pair of passages 44 and 48 through fluid transfer zones. |
6 | detects the current value of actff representing the actual fuel flow magnitude a block 52 then calculates a value deltaff equal to the difference between the values maxff and actff the value deltaff represents the amount by which the actual fuel flow magnitude differs from the current maximum fuel flow limit as established by the maximum fuel schedule a block 54 then checks the value of deltaff to determine whether it is less than a value level1 if deltaff is less than level1 then the actual fuel flow magnitude is sufficiently close to the maximum fuel limit to conclude that an overload condition has arisen and control passes to a block 56 which sets an overload condition flag or otherwise develops an indication that the overload condition is present a block 57 then resets a flag called a reset condition flag indicating that the system is not currently in a reset condition thereafter control passes to a block 58 which checks the status of the overload condition flag if the overload condition flag is set control passes to a block 60 which decrements the value of acceleration setpoint setpt by a certain amount in a specific example the value of setpt may be decremented by 1 of rotational speed per second it should be noted that the decrement value of the block 60 is preferably empirically determined to optimize an operating condition for example to minimize losses in the clutch 16 further by adding suitable programming. |
9 | cutting steps while the flooring planks described above are manufactured with a backing layer it is contemplated that various core materials may permit the manufacture of flooring planks without the need for the inclusion of a backing layer where such panels are formed in accordance with the present invention the substrate thereof may be formed with structural ribbing designed to add structural stability to the final panel structural ribbing may also be included in panels having a backing layer although it is believed the inclusion of structural ribbing would find more wide spread applications in instances where the backing layer is not formed with the decorative laminate panel by compound injection molding the decorative flooring planks in accordance with the present invention many shortcomings of prior art line processing techniques are overcome for example limited tooling is required for injection molding the decorative laminate flooring planks in addition virtually the entire line now used to manufacture decorative laminate flooring planks could be replaced by a cutting assembly for the decorative laminate wear surface a cutting assembly for the backing layer a preliminary conditioning station for the wear surface and backing layer a plurality of injection molding dies and final processing machinery providing a substantial savings in both space and tooling the result of such a process is a reduction in the tooling required for the processing of decorative laminate flooring planks and a limited number of stations which might break down in fact if the decorative laminate wear surface and the backing layer are cut apart from the injection molding step only the preconditioning step precedes the injection molding of the decorative laminate flooring planks in addition by using multiple injection molding cavities a shutdown of a single cavity slows. |
5 | 16 of the rod 15 is hinged by a pin 17 to the first longitudinal end 18 of a fork 19 whose second longitudinal end 20 is hinged to the lever 7 by a pin 21 positioned near the above mentioned pin 8 the pin 17 is slidably constrained to two guide and end of stroke slots 22 made in the sides of the second element 6 and extending in a prevalent direction of extension parallel with the direction b the position of the pin 21 which is closer to the axis b than the pin 8 and the pre compression of the spring 13 guarantee an elastic action which tends to continuously push and hold the door 3 in its closed position only when the closed position is almost reached from and towards the closed position overlapping with the above mentioned elastic action of the spring 13 there is the action of another pre compressed helical spring 23 designed to operate in conjunction with a cam 24 made on a second arm 9 b of the rocker lever 7 through a rod 25 acting on a cam follower 26 to give the door 3 a spring to closing movement and to define a door stable semi open position specifically the follower 26 is supported by a pin 27 slidably constrained to two guide and end of stroke slots 28 made in the sides of the second element 6 and extending in a prevalent direction of extension parallel with the direction b the follower 26 is pushed towards the cam 24 by a race made on one end of the rod 25 and the latter is pushed by the spring 23 which is stopped in contact with a transversal separator 29 in the second element. |
6 | the combustion gas that would otherwise be wasted by cylinder blow down when an exhaust valve opens on an engine operating according to the conventional four stroke cycle in this embodiment the two isentropic expansion half strokes in the expansion cylinder 14 from 90 degrees to 180 degrees and from 450 degrees to 540 degrees together comprise a volume equal to the displacement of the power cylinder 5 which effects a doubling of the engine expansion ratio as compared to an equivalent conventional four stroke cycle engine fig7 shows the timing of the engine valves effected by the profile of the valve cams 6 7 25 28 29 30 and 31 for the fig1 two cylinder engine embodiment fig7 shows that at 180 degrees there is no opening position overlap between the fig1 power cylinder intake valve cam 6 and power cylinder exhaust valve cams 7 when compound mode is selected this is required during compound mode operation because if both the power cylinder intake valve 42 and the power cylinder exhaust valves 33 were to be open at the same time some of the compressed exhaust gas charge could be lost by reverse flow through the power cylinder exhaust valves 33 through the power cylinder 5 and out the port for the power cylinder intake valve 42 if valve overlap is desired to enhance power output for high engine speed wide open throttle operation while compound mode is de selected a conventional camshaft phase shifting mechanism or a conventional variable cam lift mechanism may be added to modify the timing of the power cylinder intake valve 42 or power cylinder exhaust valves 33 such that power. |
2 | supplied as a gas having at least about 90 weight percent preferably at least about 95 weight percent more preferably at least about 99 weight percent carbon monoxide suitable carbon monoxide containing gases are commercially available from for example air products suitable catalyst include those comprising iron copper nickel cobalt zinc ruthenium rhodium palladium silver cadmium rhenium osmium iridium platinum gold mercury and the like and combinations comprising at least one of the foregoing metals preferred catalysts may comprise copper a highly preferred catalyst comprises copper and chloride ion in a molar ratio of about 0 5 to about 1 5 within this range a molar ratio of at least about 0 8 may be preferred also within this range a molar ratio of up to about 1 2 may be preferred highly preferred catalysts include cuprous chloride cucl and cupric chloride cucl 2 with cuprous chloride being more highly preferred during operation of the process a suitable chloride ion concentration may be maintained by the addition of hydrochloric acid hcl fig1 illustrates a dialkyl carbonate plant 10 having linked reaction section 20 separation section 30 and purification section 40 with reference to fig1 the catalyzed reaction of alkanol oxygen and carbon monoxide may be performed in. |
8 | battery assembly 100 are shown installed in respective charging positions the charging unit 40 includes a pair of jaws 46 which snugly grip the head 28 of the flashlight 20 the gripping action of the jaws 46 is adapted to securely hold the flashlight 20 and to allow the charging unit 40 be mounted in any desired orientation without the flashlight separating from the charging unit the gripping action of the jaws 46 further allows the charging unit 40 to be mounted upon surfaces subject to vibration such as occurs within an automobile or other vehicle the auxiliary battery charger 41 includes an upper contact portion 43 a longitudinal rib portion 45 and a lower stop portion 47 the longitudinal rib portion 45 extends along the longitudinal axis of the auxiliary battery charger 41 in parallel with the longitudinal axis of the battery assembly 100 and joins with the upper contact portion 43 and the lower stop portion 47 at respective ends thereof in fig2 the flashlight charging unit 40 and the auxiliary battery charger 41 are shown with the flashlight 20 and the auxiliary battery 100 removed within the upper contact portion 43 of the auxiliary battery charger 41 there. |
2 | mates with a female quick disconnect fitting 165 a c disposed in the drawer 108 when a new fluid container 160 is added to the system 100 the male quick disconnect valve 161 of the fluid container 160 is snapped into the female quick disconnect fitting 165 a c in the drawer 108 the vent 162 on the fluid container 160 can then be opened to equalize the air pressure inside the fluid container 160 allowing fluid to flow freely fig7 is a perspective view of the inside of the drawer 108 containing three fluid pumps 113 a c positioned below the female quick disconnect fittings 165 a c the first pump 113 a is configured to pump the solution held in the first fluid container 160 a along a fluid flow path f 1 through the hose assembly 116 to the hvlp nozzle assemblies 106 a b the second pump 113 b is configured to pump the solution held in the second fluid container 160 b along a fluid flow path f 2 through the hose assembly 116 to the hvlp nozzle assemblies 106 a b the third pump 113 c is configured to pump the solution held in the second fluid container 160 c along a fluid flow path f 3 through the hose assembly 116 to the hvlp nozzle assemblies 106 a b in one embodiment the pumps 130 a b c are positive displacement pumps any other type of fluid pump may suffice it will be appreciated however that one or more of the pumps 113 a b c can be positioned anywhere in the drawer 108 fig8 illustrates a simplified perspective view of the interior of the spray column 102 fig9 is a close up view of fig8 showing the hvlp. |
6 | acceleration based upon the plurality of rpm readings the processing module also determines an appropriate shift time based upon the rpm acceleration and estimated shift reaction time and a shift indicator that communicates the appropriate shift time in certain embodiments the appropriate shift time includes shifting within a range of maximum engine power in some embodiments the shift indicator comprises a shift indicator light or an audible signal generator application_number US 34202906 A description some of the functional units described in this specification have been explicitly labeled as modules while others are assumed to be modules in order to emphasize their embodiment independence for example a module may be implemented as a hardware circuit comprising custom vlsi circuits or gate arrays off the shelf semiconductors such as logic chips transistors or other discrete components a module may also be implemented in programmable hardware devices such as field programmable gate arrays programmable array logic programmable logic devices or the like modules may also be implemented in software for execution by various types of processors an identified module of executable code may for instance comprise one or more physical or logical blocks of computer instructions which may for instance be organized as an object procedure or function nevertheless the executables of an identified module need not be physically located together but may comprise disparate instructions stored in different locations which when joined logically together comprise the module and achieve the stated purpose for the module indeed a module of executable code may be a single instruction or many instructions and may. |
5 | and the tube 65 are held in position relative to one another by the use of a collar 67 and pin 69 secured with clip 69 u2032 the tube 65 is provided with a striker 70 which locates between the stops 61 62 for a purpose to be explained hereinafter in operation the plough 2 is mounted to the motor vehicle 1 at its near side 4 and on the near side front 34 thereof as previously described the mountings at both locations allowing articulation of the plough 2 from a parked position relatively closely adjacent the near side 4 to an operational position extending outwardly from the near side to assume a ploughing mode to remove material for example snow in its path as the vehicle is driven along a roadway for example by virtue of the primary mounting means 40 the elevation and descent of the plough 2 at its leading end are effected by the lifting means 30 and through the agency of the sector shaped elements 41 42 which afford a range of movement approximating to 30 u00b0 the sliding movement and frictional engagement as between the elements 41 42 provides the load bearing capacity of the primary mounting means thus removing substantially any stress that would otherwise be placed upon the pin 43 the elements 41 42 also permit some limited movement in the plane of their engagement in the event that an obstacle is encountered by way of impact or otherwise the limited movement allowing the plough to override the obstacle thus reducing the likelihood of damage to the plough and its. |
3 | a standard alcor fouling test is carried out for 180 minutes the total fouling as measured by the total reduction in outlet liquid temperature is referred to as u03b4t180 or dt180 fig1 and fig2 illustrate the impact that the presence of particulates in a crude oil has on fouling of a refinery component or unit there is an increase in fouling in the presence of iron oxide fe 2 o 3 particles when compared to similar crude oils that do not contain particulates the present invention will be described in connection with the use of a low sulfur low asphaltene or lsla whole crude oil and a high sulfur high asphaltene or hsha crude oil blend as base crude oil examples these oils were selected as being representative of certain classifications of crude oil the lsla crude oil represents a low s bn high reactive sulfur and low asphaltenes crude oil the hsha blend crude oil represents a crude oil that is both high in asphaltenes and reactive sulfur the use of these crude oils is for illustrative purposes only the present invention is not intended to be limited to application only with lsla crude oil and hsha crude oil it is intended that the present invention has application with all whole and blended crude oils and formulations of the same that experience and or produce fouling in refinery components including but not limited to heat exchangers the presence of fouling reduces the heat transfer of the heating tubes or rods contained within a heat exchanger as described above the presence of fouling has an adverse impact of heat exchanger performance and efficiency the present inventors have found that the addition of a crude oil having a high tan and high. |
3 | the coating composition preferably further comprises a carboxy functional acrylic ester polymer it appears that in order to obtain the right amount of wettability e g aqueous ink receptivity with just the olefin copolymer having pendant acid groups and the 2 oxazoline polymer in the dried coating it is necessary to use a large amount of the 2 oxazoline polymer e g at least 20 to 50 percent by weight of the coating composition said weight percents being based on the weight of the 2 oxazoline polymer and the olefin copolymer unfortunately this large quantity of the 2 oxazaline polymer may cause the coating to be able to be washed off with water since a carboxy functional acrylic ester polymer will b1end with the olefin copolymer to make the coating more wettable by adding the carboxy functional acrylic ester polymer to the aqueous coating composition preferably in the form of a latex a lesser amount of the 2 oxazoline polymer needs to be used in order to obtain the right wetting properties even though the carboxy functional acrylic ester polymer similar to the 2 oxazoline copolymer blends with the olefin copolymer to make it more wettable once the coating is dried the carboxy functional acrylic ester polymer will not go into solution with water and thus a. |
8 | may be combined in any suitable manner in one or more embodiments the headings provided herein are for convenience only and do not interpret the scope or meaning of the embodiments the word u201c exemplary u201d is used herein to mean u201c serving as an example instance or illustration u201d any embodiment or design described herein as u201c exemplary u201d is not necessarily to be construed as preferred or advantageous over other embodiments or designs in various embodiments the inventor has observed that in arrangements such as the one shown in fig1 and in similar or equivalent topologies when during the dimming action the dimmer cuts the input voltage and as a consequence the supply on line 21 beyond a certain level the stage which supplies the driver and the processor is fed insufficiently and in turn can no longer feed the supply voltage to the driver and to the processor as a result in the lamp supply flickering or flashing effects appear which are clearly perceivable the most unfavourable conditions occur in the case of u201c leading edge u201d dimmers which perform the cutting function on the rising edge of the supply wave form so that the supply voltage drop to the driver and to the processing unit takes place at the very moment when the power stage is to be activated the inventor has therefore realised that electronic transformers controlled by a commercially available device such as a microcontroller cannot operate satisfactorily with u201c phase cut u201d dimmers when the dimming level increases i e when the lighting intensity is reduced below a certain level the control processing unit and. |
4 | a to be clear or transparent enough to enable the printing 50 u2032 to be read however if there is any contrasting color printing 50 u2033 that contrasting color printing 50 u2033 still needs to be seen so the adhesive a needs to be sufficiently transparent it should be noted that the printing of fixed and variable information can be performed by various printing techniques although the printing techniques of screen printing for printing the fixed information and hot stamp printing for printing the variable information are preferred other usable techniques include thermal transfer printing having a print head with a line of closely spaced heating elements used with a thermal transfer ribbon ink jet printing flexographic printing laser printing and so on the ink i 1 can have the same characteristics following printing as the ink in the printed information in zones 21 t through 29 t applied by the equipment 31 and likewise the adhesive a applied from ribbons 60 60 u2033 hsb and hsw can have the same characteristics as the adhesive a applied by the equipment 31 when a hot stamp process is used the ink is embossed or is driven into the adhesive a to provide hot stamped embossments in accordance with the raised indicia 50 on the printing plate 48 so even if the essentially transparent adhesive a would present a very slight diminution of visibility or readability of the printing the hot stamp process makes the printing even more vibrant and visible than in the event certain other techniques for printing on the adhesive a are used in the event it is desired to produce a transfer medium web w w u2032 or. |
2 | be understood that if desired the spring member 24 could be full width for the entire length thereof and the dogs 32 could be adapted for movement away from the spring member 24 as illustrated by the double headed arrows in fig6 to release the spring member and provide the 34 whip 34 action desired for impacting the bottom sheet in the stack one of the significant advantages of the impact sheet feeder with air floatation is that positive control is exercised over the inter sheet frictional forces due to the air lubrication provided between sheets by the air floatation tray therefore the problem of mechanical coupling of the sheets during impact is eliminated specifically this means that the driving force on the second sheet in the stack is very small since the coefficient of friction is greatly reduced on a top feeding impact type device the coefficient of friction between sheets u03bc pp typically may average 0 55 with the device disclosed it has been found that the coefficient of friction is greatly reduced i e u03bc pp may typically average 0 02 0 10 further it has been found that with air floatation the inter sheet frictional coefficients are monotonically increasing i e u03bc pp between sheets 1 and. |
7 | control circuitry an infrared transmitter a battery set and a holding stand the keyboard set is pressed to generate signals to the control circuitry that converts the signals and transmits keyboard data to pdas with infrared transmitter the existing pdas infrared receiver can receive data accordingly the direction of the infrared transmitter on the keyboard can be adjusted to fit all the pdas with different specifications application_number US 23341202 A description referring to fig1 and fig2 the present invention is composed of a keyboard set 10 a control circuitry 20 an infrared transmitter 30 a battery set 40 and a holding stand 50 a pda 60 with an infrared receiver 61 can be placed on the holding stand 50 as shown in fig3 the battery set 40 offers the keyboard set 10 power when the keyboard set 10 is pressed and generates signals the control circuitry 20 processes those signals and transmits out the processed signals through the infrared transmitter 30 wirelessly to the pda 60 such scheme can input characters to a pda 60 the infrared transmitter 30 is installed inside a side housing 52 of a revolving arm 51 on the back of the holding stand 50 by adjusting the direction of the revolving arm 51 the infrared transmitter 30 faces the corresponding infrared receiver 61 of the pda 60 with the best angle based on the structure described. |
6 | in a computer storage drive the hub 124 typically features a constant diameter outer mounting surface 136 to securely locate the storage disks not shown in a radial direction the retaining clamp groove 128 is adapted to receive a retainer not shown to securely hold the disk stack not shown against the flange 132 the rotating oil filled bearing 116 generally comprises an upper bearing plate 140 a lower bearing plate 144 and a spacer 148 the upper 140 and lower 144 bearing plates are generally annular in shape and are fixed to the hub 124 annular spacer 148 is interposed between the upper 140 and lower 144 bearing plates to maintain space 152 between the bearing plates 140 and 144 a number of bearing components are fixed or interconnected to the base plate 156 these include a spindle 160 an air bearing element 164 an oil filled bearing thrust plate 168 and a stator assembly 172 the spindle 160 is affixed to the base 156 at a first end and may also be secured to the top of the disk drive enclosure not shown at a second end using a fastener not shown inserted into a threaded hole 176 or by other means of attachment known in the art support of the shaft 160 on both ends is desirable because it increases the overall stiffness of the disk drive assembly the stationary air bearing element 164 is concentric to the spindle 160 and may be formed from a separate piece of material or may be integral to the spindle 160 the air bearing. |
8 | 121 in response to the request from the server apparatus 100 the client b notifies the server apparatus 100 and the client a as to whether the user b accepts that the facial image of the user b is set as the sharing condition the client a notifies the user a of the result of the setting of the sharing condition for sharing the facial image of the user b step s 104 when a user other than the user b is identified by mistake in step s 113 the user identified by mistake receives a notification that the user a is going to set the user as the sharing condition however when the user who owns the image data sets the sharing range by setting permission and prohibition of the sharing erroneous distribution can be prevented when the user b accepts the setting of the sharing condition for sharing the facial image of the user b the server apparatus 100 writes the sharing condition set by the client a shared person information and the acceptance information permission given by the client b to the sharing condition database 105 step s 115 on the contrary when the user b rejects the sharing the shared. |
8 | 33 and then rotated slightly so that the ears 34 thereof engage notches 36 in the wedges to retain the spade in a fastening position in case 14 shown in fig1 two such spades are held simultaneously in side by side relationship to engage two spade receiving members when the locking device is assembled as will be more fully described hereinafter referring again to fig1 insert 16 includes top wall 38 bottom wall 39 and opposed sidewalls 42 thereby defining a rectangular box 44 of slightly smaller outer dimensions than the inside dimensions of box 30 so that box 44 may be telescopically received therewithin the insert 16 further includes inwardly projecting detents 46 integral with the top wall 38 which engage the edges of retainers 48 on spade receiving member 12 the detents function to hold spade receiving member 12 in position within insert 16 in spade receiving relationship to the spades in case means 14 fig2 shows detent 46 more clearly wherein it can be seen that head 50 includes a hook 52 which is engageable with crimps 54 to prevent the spade receiving member from being either withdrawn from or extended further once inserted through first end opening 56 into insert 16 thus spade receiving member 12 cannot be either forced forwardly completely through insert 16 nor can it be withdrawn once inserted therein but rather it is. |
2 | 0 032 34 to 0 078 34 it has been found that blades of different desired widths may be easily formed simply by laminating together the desired number of blades such as by welding together two 0 012 34 layers are laminated together as shown in fig4 with sides 56 39 adjoining or affixed to one another however the blade is modified in fig4 in that the leading edges 54 39 of the blade are split and sprung or flared apart to a spacing of approximately 1 8 34 in the modified form the blade cuts efficiently in desired different widths due to the spring tension exerted against the edge of the slot by the leading ends 54 39 the releasable clamping screw 70 as described will accommodate increases in thickness of the blade and the corresponding slot 45 to 48 for a given width blade is advanced into position simply by rotating the anvil 40 to advance the desired slot into alignment with the blade 42 however in the modified form of blade shown in fig4 the leading end of the blade is flared apart to provide efficient cutting in slots of various widths as illustrated in fig2 the straight edge 57 of the blade is disposed in facing relation to the path of paper. |
4 | a limit signal application_number US 68848291 A description a tensioning device 2 for the needle thread coming from a thread reserve not shown is arranged on the stand 1 of the double thread chainstitch sewing machine shown in fig1 a transducer 3 which is fastened to the sewing machine via a damping element 4 fig2 made of e g rubber is provided behind the tensioning device 2 in the direction of thread pull the transducer 3 has a bending bar 5 whose width is reduced toward the free end beginning from the clamping point at its free end the bending bar 5 is designed on the underside with a needle thread receiving eye 6 on it wire strain gauge elements hereinafter called wsg elements 7 are provided to receive the tension of the needle thread a first wsg element 7 is fastened on the top side and a second wsg element 8 on the underside of the bending bar 5 close to the point of clamping of the bending bar the wsg elements 7 and 8 are connected to a power source fig3 and are connected to form a half bridge 9 which is connected to an amplifier 10 the output of the amplifier 10 is connected to a voltmeter 11 with a display unit 12 and to a comparator 13 with an adjusting device 14 serving to set its switching threshold the output of the comparator 13 is connected to one input of and elements 15 and 16 each whose second input is connected to a position transmitter 18 that counts the revolutions of the main shaft 17 this position. |
6 | 4 and the brake plate 5 and effectively lock thereby transferring the frictional forces to the tensioner arm 1 adjusting the rate of taper of the bearing raceway 22 and the mating bearing raceway 23 thus effectively adjusts the rate of application of asymmetric frictional damping applied to the tensioner 21 during wind up the bearing raceway 22 and mating bearing raceway 23 shown in fig2 a in the first embodiment has a relatively shallower slope meaning the rate of change of the position of the bearing 3 changes more slowly than in the case of a shorter arc length bearing raceway 22 and mating bearing raceway 23 shown in the second embodiment in fig2 b the shorter arc length of the second embodiment shown in fig2 b means that for a given displacement of the tensioner arm 1 away from the belt being tensioned the rotating bearing plate 2 and brake bearing plate 4 will separate further than the first embodiment shown in fig2 a the resulting increase in separation increases the frictional damping applied to the tensioner 21 to prevent wind up the total number of bearings 3 and bearing raceways 22 and mating bearing raceways 23 collectively raceways are determined by the length of the raceways the taper of the raceways the size of the bearings 3 the number of bearings 3 is also dictated by the need for the bearing 3 elements to adequately support and separate the rotating bearing plate 2 and the brake bearing plate 4 the smallest number of bearing 3 elements for the design is three and. |
6 | means positioned below or underneath the base plate 12 is an electric module 14 in electrical communication with the replaceable led bulb 15 positioned above the led bulb 15 is an optic or intermediate reflector 20 the optic 20 illustrated is a molded and metallized faceted depending in part on desired beam spread optic having an outer reflective surface 20 a facing the light source 15 for directing the light beam from the led towards for example a main reflector in a desired beam pattern the optic 20 is shown supported on base plate 12 by a pair of vertically depending spaced posts 18 18 u2032 displaced sufficiently from the led bulb 15 so as not to interfere with the light beam emanating therefrom preferably the posts 18 18 u2032 insert into the plate 12 with a plurality of metal barbs to lock them in place alternatively one or more light transmissive walls screws rivets heat stake pins or other fastening means could be used to properly orient the intermediate reflector 20 relative to the bulb 15 the reflector 20 also could be centrally mounted such as with a central post 118 fig6 particularly suited for the embodiment with multiple led light sources those skilled in the art will appreciate that the reflector 20 can be convex or concave 0019 fig2. |
1 | color is 144a second year stems have a diameter of about 8 mm or more and are n199d in color vegetative buds u2014 arrangement opposite shape ovoid size about 4 5 mm in length about 3 mm in width color 144b at the base gradually changing to 183b at the apex size u2014 about 16 6 cm in length and about 9 cm in width shape ovate with acuminate apex cuneate base and serrate margin texture thick and leathery color emerging leaves are 143a on the upper surface and 138b on the lower surface mature leaves on the upper surface are n137a and 138a on the lower surface venation u2014 pinnate veins are 151c on the upper surface and 145c on the lower surfaces petiole u2014 about 2 2 cm in length and about 4 mm in diameter glabrous texture and n144d in color inflorescence bloom period u2014 early summer to first frost in fall an inflorescence contains about 88 individual fertile flowers an inflorescence contains about 349 individual sterile florets inflorescence shape and size mophead about 10 3 cm in height and about 17 8 cm in diameter the inflorescence is effective for about 8 weeks the peduncle is about 8 8 cm in length is finely pubescent and is 144a in color the pedicels are about 2 2 cm in length finely pubescent and 76a in color flower bud size u2014 about 3 mm in length about 3 5 mm in diameter flower bud shape round color 97a sterile florets are about 3 7 cm in diameter each floret contains 4 sepals about 1 8 cm in length and about 1 8 cm in width sterile floret shape ovoid with obtuse apex acute base and entire margin texture smooth with. |
5 | any of the pumps identified or described herein may by used in this aspect of the invention in some embodiments of the invention the vacuum pump is a pump on a vacuum truck for example vacuum trucks suitable for use with the invention include gapvax u00ae hydro excavator trucks having container capacities as high as 1 600 gallons and pumps that produce vacuum as great as 28 u2033 hg pipe or flexible hose such as hose made of a rubber and metal composite may be used to connect the vacuum pump 51 to the well head 2 flow meters and densitometers may also be used to monitor flow rates and the density of the cement composition flowing into the annulus or the circulation fluid flowing out of the id of the casing 3 valves may also be included in the system to stop or restrict cement composition and or circulation fluid flow also a tail pipe or macaroni string coiled tubing may be inserted down the id of the casing 3 and attached to the vacuum pump 51 submersible pumps may also be inserted into the inner diameter of the casing to a certain depth below the surface to pump the circulation fluid out of the inner diameter of the casing suitable submersible pumps include those manufactured by mono pump and flight itt a vacuum pump may also be used to initiate circulation in the conventional direction and to deposit a cement composition in the casing id for later high pressure pumping into the annulus the vacuum pump is simply connected to the annulus and. |
1 | times in another experiment immunoglobulin production igg igm iga ige from isolated human b lymphocytes was assayed after pre incubation of cells with mastic oil it was found that the agent does not modify at least at the dilutions used the production of immunoglobulins indicative of its anti inflamatory action in a final experiment we have assayed the activation of different cell populations and its possible modification by mastic oil we show that pre incubation of cells with mastic oil decreased the activation of different cell populations especially t and b lymphocytes indicative of a protective effect of the agent against inflammatory processes in contrast after long incubation times an activation of nk cells is observed additional explanations of the invention are given in the following examples which are not to be regarded as limiting the protection provided by the claims pure mastic oil was diluted in absolute ethanol 1 100 v v dilution 10 u2212 2 and subsequently in culture medium the human epithelial cell lines t47d from breast cancer hormone sensitive lncap and du145 from prostate cancer hormone sensitive and resistant respectively and hepg2 from hepatocellular carcinoma were tested all these cell lines represent early stages of the corresponding diseases retaining the majority of characteristics of their corresponding normal counterparts the effect of mastic oil was assayed after two cell cycles our results are presented in fig1 as shown the agent differentially affects the proliferative capacity of each cell line in breast and prostate cell lines. |
1 | membrane sheet 20 for example by grasping two opposing corners 23 25 of sheet 20 with forceps and pulling placental membrane sheet 20 outwardly the distance between the edges of the slits 22 moves apart to expand the width of sheet 20 as the sheet expands slits 22 of placental membrane sheet 20 widen due to lateral and or vertical movement of slit edges relative to one another thus expanding slits 22 created by the mesher into openings 25 in this manner the sizes of the openings can be increased preferably slits 22 are dispersed over the entire surface of sheet 20 in order to maximize expandability of the material however is anticipated that there may be applications where expandability or porosity of sheet 20 may be desired for only certain portions of the material in those instances slits 22 may be provided in only a fraction of the material or limited only to certain areas of the material such as around the perimeter of the material in a central portion of the material or within a top bottom left or right half of the material for posterolateral spinal fusion applications it is anticipated that slits 22 will be formed only at the ends of the placental membrane sheet 20 that will contact bone surfaces of the transverse processes while the central section of sheet 20 remains essentially impermeable or non porous as indicated above the osteoconductive implants of the invention can include a growth promoting protein the protein can be dispersed in the osteoconductive material or applied. |
2 | embodiments may be practiced without some of these specific details the following description and drawings provide examples for illustration but are not intended in a limiting sense and are not intended to provide an exhaustive treatment of all possible implementations it should be noted that references to u201c an embodiment u201d or u201c one embodiment u201d in this disclosure are not necessarily to the same embodiment and such references may contemplate more than one embodiment further the terms u201c bus u201d and u201c buss u201d are used interchangeably throughout the specification and in the drawings further references made to actuation of a switch may include opening or closing of a switch it is understood that embodiments demonstrating a circuit having a switch in a first state may also be reconfigured to a circuit having a switch in a second state without departing from the scope of the present subject matter thus an embodiment having a normally closed switch may be realized in an embodiment having a normally open switch without departing from the present subject matter those of skill in the art upon reading and understanding the present application will appreciate that differences in configuration and components may be employed without departing from the scope of the present teachings fig1 a illustrates a block diagram of one embodiment of an aircraft security system 100 including block 71 including an aircraft battery block 72 including an aircraft master switch and an electrical buss block 73 including an anti theft system block 74 including one or more aircraft starter switches for single and multiple engines and block 75 including. |
9 | here the conductive tube 170 is separated from the lower wire 120 having the lower insulating layer 130 in between the contact plug 160 and the conductive tube 160 may be made of any one of tungsten w copper cu aluminum al and other similar materials but not limited to those mentioned materials the upper insulating layer 180 formed over the middle insulating layer 150 may be made of any one of an oxide film nitride film usg psg bpsg teos and other similar materials but not limited to those mentioned materials the upper wire 190 may be formed over the upper insulating layer 180 and may be connected to the contact plug 160 thus the upper wire 190 and the lower wire 120 may be electrically connected through the contact plug 160 in addition the upper wire 190 and the conductive tube 170 may be separated by the upper insulating layer 180 that is the lower part of the conductive tube 170 may be separated from the lower wire 120 by the lower insulating layer 130 and the upper part of the conductive tube 170 may be separated from the upper wire 190 by the upper insulating layer 180 therefore the length of the conductive tube 170 may be shorter than that of the contact plug 160 the thickness of the lower insulating layer 130 and the upper insulating layer 180 may be less than that of the middle insulating layer 150 in the. |
7 | proportional to the speed of rotation of the position transmitter the method described herein has the advantage that auxiliary voltage v z is composed of voltage waveform blocks of sum voltage v s and difference voltage v d which are in the relatively linear portion of an approximately sinusoidal waveform curve differentiated voltage v di is therefore composed of approximate square wave pulses each such square wave pulse having relatively little ripple if differentiated voltage v di is rectified a dc voltage having a relatively small ripple is obtained as an output voltage v a which is proportional to the speed of rotation of the speed transmitter in order that the polarity of output signal v a correspond to the direction of rotation of the position transmitter controlled rectification is required so as to produce a controlled combination of the positive and negative pulses of differentiator voltage v di this is achieved by using the inverted differentiated voltage v di for forming output voltage v a as long as the polarities of transmitter voltages v e1 and v e2 are equal and the noninverted differentiated voltage v di is used as long as the polarities of the two transmitter voltages are different from each other in the illustrative example of fig1 which describes a positive direction of rotation output signal v a is also positive fig2 shows a plurality of waveforms arranged on a common time scale the waveforms being similar to those described hereinabove with respect to fig1 except that the direction of rotation of the speed transmitter is negative in fig2 therefore transmitter voltage v e2 fig2 b does not lag transmitter voltage v e1 fig2 a by 90 u00b0. |
7 | a first terminal electrically connected to the electric circuit a photosensitive drum and a developer cartridge comprising a developing roller developing frame having a pressed portion memory unit and second terminal the front cover may include a pressing portion configured to press the pressed portion of the developing frame in a direction from the developing roller toward the photosensitive drum and wherein the second terminal faces to the front cover when the front cover is in the closed position application_number US 201715429405 A description hereinafter an embodiment of the invention will be described in detail with reference to the attached drawings in the drawings fig1 is a side cross sectional view illustrating an image forming device and fig2 is a perspective view illustrating a photoconductor cartridge and a developer cartridge in the following description the right side in fig1 is defined as a front and the left side is defined as a rear also regarding directions of a process cartridge 30 a photoconductor cartridge 31 and a developer cartridge 33 which will be described later the following description refers to directions in a state where they are attached to an image forming device see fig1 as shown in fig1 an image forming device 1 includes a feeder unit 4 that feeds a sheet 3 into a main casing 2 main body and an image forming unit 5 that forms an image on the fed sheet 3 a front cover 11 opening and closing member that can be freely opened and closed is disposed at a front portion of the main casing 2. |
6 | are adjusted to move the function upward to 705 thereby reducing u03b4tcl based on tcl and t cl fig8 is a logic flow diagram of a method for controlling a transmission clutch using the updated adapted transfer function as described with reference to fig6 and 7 the clutch control event may include vehicle launch transmission upshifting downshifting or any other drivability control actions clutch control starts at 801 where all the relevant powertrain and transmission variables are initialized at 802 clutch operating conditions xk are determined based on measured data available in the transmission system 2 at 803 a target clutch torque profile ttar is determined for current clutch operating conditions xk for a given drivability control event at step 804 based on the inverse of the clutch transfer function f u2212 1 stored at step 610 control signal profile ucom is determined to realize the target magnitude of clutch torque ttar for the current operating conditions xk at step 805 ttar is corrected based on u03b4t as a feedback signal where g is a control gain note that u03b4t is set to 0 for i 0 at step 806 ucom is commanded for clutch control at step 807 t cl is computed based on tin and tout at step 808 a clutch torque error u03b4t is computed if end of clutch control is reached then the. |
1 | a preferred embodiment struts 32 are comprised of an alloy of titanium and nickel known in the art as nitinol the shape memory material construction of struts 32 enable struts 32 to change shape in response to a change in temperature at about body temperature struts 32 assume an extended shape as shown in fig1 at a selected temperature other than body temperature struts 32 assume a contracted shape as shown in fig2 in fig2 struts 32 have partially contracted inside apertures 30 of body portion 24 as a result of the contraction of struts 32 anchors 52 have retracted from walls 23 of blood vessel 22 various techniques can be used to alter the temperature of struts 32 suitable techniques for warming struts 32 include applying electromagnetic energy to body portion 24 e g laser light delivered by an optical fiber and applying electrical energy to thrombosis filter 20 e g inducing a current through struts 32 a process which may be used to remove thrombosis filter 20 from lumen 21 of blood vessel 22 is illustrated in fig3 a removal catheter 110 with a lumen 112 and a distal end 114 is disposed in lumen 21 of blood vessel 22 removal catheter 110 enters the patients vascular system at a point which is readily accessible to the physician once in the vascular system. |
9 | extracorporeal signal the diagnostic apparatus is advantageously additionally provided with an apparatus for storing the measurement signals which can then be called up as required a preferred embodiment of the measurement chamber is illustrated in fig2 a plurality of said measurement chambers are advantageously combined to form a diagnostic apparatus the number of individual measurement chambers preferably being from 20 to 50 the number as such is non critical if one determination per week is assumed then a number of 50 u00b1 10 appears to be particularly advantageous since one exchange per year is sufficient in this case the inventive method and device can be furished both for flow rate measurements and for individual determinations the possibility of contactless signal transmission means that it can advantageously be used both for in and outpatients without additionally restricting the patients 39 mobility the signal transmission methods are known per se to a person skilled in the art the structure of one embodiment of the device is illustrated in fig1 the structure of a specific measurement chamber is illustrated in fig2 a the production of sufficiently small measurement chambers is possible by the methods which are known per se to a person skilled in the art the closure of the measurement chambers is especially important magnetically actuable closure flaps which can assume two fixed states flip flops can advantageously be used. |
3 | kidney adrenal intestine 11 3 weeks foetal brain 10 6 weeks and foetal eye 16 5 weeks data not shown ish analysis of colorectal liver metastasis biopsies showed that expression of ecsm4 was restricted to vascular endothelial cells of the tumour vessels only fig1 and 18 no expression was detected in the surrounding normal tissue furthermore the enhanced expression in the vicinity of the necrotic tissues fig1 necrotic tissue is indicated by the bright signal labelled is indicative and consistent with induction of ecsm4 expression by hypoxia as such ecsm4 may be a novel hypoxia regulated gene the highly restricted expression pattern of ecsm4 in angiogenic vessels in normal and tumour tissues in adult is entirely consistent with the endothelial cell selective pattern of expression determined by the in silico analysis described in example 1 blocks of formalin fixed paraffin embedded tissues and tumours were obtained from the archives of the imperial cancer research fund breast pathology group at guys hospital london uk an antisense riboprobe to ecsm4 cdna was prepared for specific localisation of the ecsm4 mrna by in situ hybridisation the methods for pretreatment hybridisation washing and dipping of slides in ilford k 5 for autoradiography has been described previously poulsom r longcroft j m jeffrey r e rogers l and steel j h 1998 eur j histochem 42 121 132 films were exposed for 7 to 15 days before developing in kodak d19 and. |
7 | is incorporated herein by reference for the sake of convenience the basics of such a system and method are illustrated herein and reviewed as follows fig1 depicts an exemplary set up for doing dubbing work numeral 1 denotes a recording sound motion picture film projector numeral 2 its projection objective numerals 3 and 4 the film reels and numeral 5 the sound motion picture film the projector 1 has a control panel 6 subdivided into a mixing panel 7 and a command panel 8 mixing panel 7 is used for manual control of the recording and playback amplifier of the projector e g to set the recording level for different audio sources feeding into the projector the command panel 8 is provided with a set of user activated operation switches commanding the performance of certain operations the vertical housing wall directly above the command panel 8 includes a recording level indicator 9 a window 10 in which is positioned a frame count indicator a reset 34 zero 34 button 11 for the frame film increment counter of the projector and a selector switch 12 for selecting different types of recording transition effects the frontmost vertical surface of the projector housing is provided with three input sockets 13 14 15 into which can be plugged the jacks of recording cables 16 and 17 and a microphone cable 18 these cables can be connected to a magnetic tape audio playback machine 19 tr a phonograph record playback machine 20 and a microphone 21 fig2 depicts the internal components of the projector 1 these include a projector motor 22 pm for film transport a projector lamp 23 a central switching and control unit 24 for changing the settings of mechanical projector components such as the film loop former the film guide plate at. |
1 | headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed invention the following description relates generally to a device for cleaning the sole of an athletic shoe and enhancing the traction between the sole and an athletic playing surface such as a basketball court tennis court volleyball court or the like fig1 shows one particular embodiment of a traction enhancing device 10 and an athletic shoe 12 having a sole 14 the shoe 12 is depicted as a basketball shoe 12 but it is understood that the shoe 12 may be any suitable type of shoe the sole 14 is typically made from a rubber or rubber like material and generally has a fairly non aggressive tread pattern e g generally smooth with only small ridges and bumps to achieve a large amount of surface area fig2 shows the traction enhancing device 10 having a handle 16 a frame 18 and a roller 20 rotationally coupleable to the frame the handle 16 can be made from a soft over molded thermoplastic elastomer such as santoprene u00ae available from the monsanto corporation or tekbond u00ae available from the teknor apex corporation or other suitable materials the durometer range of the illustrated handle 16 is about 20 100 shore a and preferably in the range of about 40 60 shore a this range permits the handle 16 to have some amount of resiliency and be easily gripped the handle 16 can have a number of recessed regions 22 each being adjacent to a raised region 24 and these regions can be configured to make the handle generally conform to a human hand in addition the recessed and raised regions 22 24 can help keep the handle 16 from slipping in. |
8 | g4 is arranged to receive an input vertical synchronizing signal by being connected to the third input terminal 3 it is assumed that only the composite synchronizing signals are input in this time since a vertical synchronizing signal is not input from the third input terminal 3 and only the vertical synchronizing signal separated from the composite synchronizing signal is output to the second output terminal 5 via the fourth exclusive or gate g4 as a second case an account of the instance is given in which a horizontal synchronizing h sync signal is input to the second input terminal 2 without an input of a composite synchronizing signal and of a vertical synchronizing signal is input separately to the third input terminal 3 the second exclusive or gate g2 with its one terminal connected to the second input terminal 2 generates an output synchronizing signal according to the input signal from the second input terminal 2 due to grounding of the other terminal of the exclusive or gate g2 when a horizontal synchronizing signal is input to the second input terminal 2 to attain a logic high level an output in logic high level is generated from the second exclusive or gate g2 according to the operating characteristics of the exclusive or as stated above and applied to the base of the fifth transistor q5 through resistance r12 at this juncture the fifth transistor q5 will not operate because the base potential level is logic high and the emitter stays at a logic high level owing to supply voltage vcc so collector voltage in logic high level. |
1 | of 20 cc of sterile air inflation of the pouches was maintained by re injection of sterile air every other day until the pouches were ready to use on day 7 suspensions of cultured glioma cells total number 1 u00d7 10 7 cells were injected into the air pouches the air pouches were re inflated with sterile air every other day for the first seven days after inoculation with tumor cells by the seventh day sufficient tumor growth had occurred and sterile air injection was stopped by day 14 the tumors had reached sufficient size for experiments with the proposed treatment with an average tumor weight of about 70 gm and overall individual rat weight of about 250 gm plap with phospholipase a 2 activation activity is described in 34 tumour necrosis factor cachectin induces phospholipase a 2 activity and synthesis of a phospholipase a 2 activating protein in endothelial cells 34 by mike a clark mann jy chen stanley t crooke and john s bomalaski biochem j vol 250 pp 125 132 1988 synthetic plap peptides have been described in 34 cloning of a phospholipase a 2 activating protein 34 by mike a clark lynne e ozg ur theresa m conway janice dispoto stanley t crooke. |
5 | the u201c shelter configuration u201d in the shelter configuration the mobile shelter 100 provides a living space sufficient for a human adult to lie down in several embodiments the shelter can accommodate 2 3 individuals as illustrated in the embodiment shown in fig2 the first frame 110 hinges relative to the chassis 106 such that the first wall 140 serves as an extension of the base 109 in several embodiments the first and second frame may optionally be positioned in a similar manner in the shelter configuration e g both positioned substantially co planar with the base 109 as illustrated in fig2 in some embodiments the second frame 115 is moved about the hinges 113 to allow the second wall 142 to further extend the sleeping area available for the occupant alternatively one frame may be positioned substantially co planar with the base 109 while the other is maintained in a position perpendicular to the base 109 in the embodiment illustrated in fig2 compartments 146 148 function as supports for the first and second frames 110 115 and the compartments 146 148 are sized such that the first and second frames 110 115 are substantially co planar with the chassis 106 and such that the first and second walls 140 142 are substantially co planar with the base 109 a variety of mechanisms can be used to support the first and second frames 110 115 when the mobile shelter 100 is in its shelter configuration to provide a sleeping surface which comprises the base 109 and optionally the front wall. |
9 | first mode the speed of rotation of the impeller is in the order of 750 rpm but can be up to about 1000 rpm this will cause the material inside the vessel 202 to rotate forming a vortex at this speed the liquid or semi liquid material located at or near the walls in the process vessel in the region below the guide collar 212 will be drawn upwards and into the impeller 300 the collar cone 310 by virtue of its cone shape will support the flow into the impeller to render the transport more efficient the guide collar 212 will effectively function as a partition wall between the upper and lower part of the process vessel thereby preventing material that has been treated inside the impeller to mix too rapidly with untreated material below the collar 212 eventually of course the material will in some sense be u201c homogeneous u201d and only when new material is fed into the system an inhomogeneous situation occurs and the process of oxygenation will become operative due to the construction of the impeller 300 with its truncated cone configuration there will be created a suction due to the formation of a vortex inside the lower compartment 301 b of the impeller 300 thereby air from the environment will be sucked in through the hollow shaft and also liquid will be sucked in through the. |
8 | is vapor deposited on the p ingaas layer 101 in association with the opening 323 defined by above etching afterwards the mask 150 is removed as shown in fig4 a 12 and 4 b 12 finally a bonding pad 330 and a wiring portion 331 provided between the electrode 324 and the bonding pad 330 are formed on the second passivation film 144 and part of the electrode 324 from the electrode 324 to the polyimide filler body 301 by vapor deposition as shown in fig4 a 13 and 4 b 13 the concave portion 280 formed by etching the semiconductor layer structure for the under electrode and the channel shaped trenches 121 and 282 provided on the sides of the mesa stripe 124 are isolated from and become independent of each other as described above thus the present embodiment can be designed so that the protruding comers described as the drawback of the conventional example will not appear in the shapes of the two trenches 121 and 282 owing to the above design the present embodiment results in a structure wherein the overhang extended with the ingaas p contact layer 101 employed in the conventional example as the mask is not formed either the overhang does not definitely appear in an actually formed device and hence an extremely uniform wafer process can be implemented discussion was made even to the influence of the trench dividing semiconductor layer 281. |
7 | sinusoidal grating 28 the distance from the valley grating 30 to a peak 32 of the grating surface is defined in this example as a value x dotted line 34 illustrates a situation where signal generator controller 22 has increased the voltage supplied to the patterned electrodes of electrode configuration 20 in this situation the valley 36 to peak 38 difference is x a controller 22 may also decrease the voltage applied to electrodes of electrode configuration 20 in this situation the valley to peak difference is decreased 0038 fig1 a and 1c illustrate that deformable layer 16 will form into a surface relief pattern dependent upon the patterned electrode configuration 20 and as a varying signal is applied to the electrode configuration 20 the height of the peaks formed in the deformable layer will vary when no variable voltage is supplied from controller 22 reflective surface 18 acts as a mirror and displacement of an impinging light is at substantially zero displacement as the voltage to electrode configuration 20 is increased by the controller 22 displacement or diffraction of the light is increased when the surface reliefpattern is displaced by a quarter wavelength the light reflected from the two surfaces is 180 u00b0 out of phase and destructive interference occurs at this point the light is totally diffracted and none is reflected therefore by the described design analog control of the light e g from a zero state. |
8 | to average power ratio associated with the data using data scrambling logic 46 a cyclic redundancy check crc for the scrambled data is determined and appended to the scrambled data using crc adding logic 48 next channel coding is performed using channel encoder logic 50 to effectively add redundancy to the data to facilitate recovery and error correction at the mobile terminal 16 again the channel coding for a particular mobile terminal 16 is based on the cqi in some implementations the channel encoder logic 50 uses known turbo encoding techniques the encoded data is then processed by rate matching logic 52 to compensate for the data expansion associated with encoding bit interleaver logic 54 systematically reorders the bits in the encoded data to minimize the loss of consecutive data bits the resultant data bits are systematically mapped into corresponding symbols depending on the chosen baseband modulation by mapping logic 56 preferably quadrature amplitude modulation qam or quadrature phase shift key qpsk modulation is used the degree of modulation is preferably chosen based on the cqi for the particular mobile terminal the symbols may be systematically reordered to further bolster the immunity of the transmitted signal to periodic data loss caused by frequency selective fading using symbol interleaver logic 58 at this point groups of bits have been mapped into symbols representing locations in an amplitude and phase constellation when spatial diversity is desired blocks of symbols are then processed by space time block code stc encoder logic 60 which modifies the symbols in a fashion making the transmitted signals more resistant to interference and more readily decoded at a mobile terminal 16 the stc encoder logic 60 will process the incoming symbols and provide u201c n u201d outputs corresponding to the number of transmit antennas 28 for. |
7 | logic 22 and the analog input output i o circuitry interface such as the module 60 is significantly improved as compared to conventional memory interfaces the module 60 contains data bit transmitters 80 one exemplary data bit transmitter 80 being depicted in detail in fig2 each of which is associated with a data bit line of the memory bus 24 and each of which receives an associated set of data bit signals called u201c ss_data 0 3 u201d from the hsio logic 50 each data bit transmitter 80 generates via an output driver 83 its data bit signal on one of the external data bit pad terminals of the module 60 which is connected to a corresponding data bit line or trace of the memory bus 24 each of the data bit transmitters 80 also receives the ss_clock signal from the hsio logic 50 the module 60 also includes a clock transmitter 84 which has the same general design as the data bit transmitter 80 with like reference numerals being used to depict similar components the clock transmitter 84 receives clock data indicative of the clock signal to accompany the data on the memory bus 24 from the hsio 50 as well as the ss_clock signal the clock transmitter 84 generates an outgoing clock signal via the output driver 83 that appears on the external clock pad terminal which is connected to a corresponding clock line of the memory bus 24 in general each transmitter 80 84 has a relatively small fifo 82 a fifo having a depth of two for example which stores the incoming data from the hsio logic 50 as described below clock signals that control the communication of data from the fifos 82 to the memory bus 24 are adjusted for purposes of de skewing. |
7 | vertical movement of the pushrod 107 and thus the resonant frequency of the lc resonant circuit 122 is altered in the above described configuration of the present embodiment the weight of the solution container 3 with the developing solution therein is proportional to the resonant frequency of the current output from the lc resonant circuit 122 that is the weight of the solution container 3 including the developing solution can be obtained from the resonant frequency of the current from the lc resonant circuit 122 as described above the toner density of the developing solution in the solution container 3 is maintained to be substantially constant therefore with a specific gravity corresponding to the density of the developing solution and the weight of the developing solution in the solution container 3 obtained by subtracting weight of the solution container 3 from the total weight of the solution container 3 including the developing solution the amount i e a volume of the developing solution in the solution container 3 can be detected it should be noted that the weight sensor unit is not limited to a sensor unit with an lc resonant circuit as described above but may be any weight sensor unit for example using a strain gauge as long as the weight sensor unit is capable of holding and measuring weight of the solution container 3 it should be noted that in the measuring unit with the weight sensor unit 105 as described above the weight sensor unit 105 is prevented. |
3 | was observed with respect to the non lead frits of table i thus curve 6 based on blend 6 with the fine alumina addition is much steeper than curves 5 and 7 these curves represent blends 5 and 7 which contain the same amount of alumina as blend 6 but having a coarser particle size table ii______________________________________blend 5 6 7______________________________________lead base frit 96 96 96 alumina 0 5 u03bc 0 4 0 alumina 6 8 u03bc 2 0 4 alumina 4 6 u03bc 1 0 0 alumina 10 15 u03bc 1 0 0______________________________________ table iii sets forth in weight percent a further series of sealing glass paste blends in this table blends 8 and 9 contain additions of zirconia while blends 10 and 11 contain comparable additions of alumina the frit employed had the tin zinc phosphate composition shown in blend 1 of table i table iii______________________________________blend 8 9 10 11______________________________________frit 70 70 70 70 beta eucryptite 10 10 10 10 zircon 15 15 15 15 zirconia 0 5 u03bc 5 0 0 0 zirconia 6 8 u03bc 0 5 0 0 alumina 0 5 u03bc 0 0 5 0 alumina 6 8 u03bc 0 0 0 5______________________________________ it will be observed that blends 8 and 10 contain very fine particle size 0 5 u03bc zirconia and alumina respectively likewise blends 9 and 11 contain larger particle size 6 8 u03bc zirconia and alumina respectively these blends were. |
5 | in the back region of back portion 112 of casing 108 see fig2 and 6 holes 126 are offset from the longitudinal axis of central passageway 122 and are located beyond o ring gland 118 inner surface 128 of the end of back portion 112 of casing 108 is bevelled drain channel 130 is located circumferentially in the outer surface of back portion 112 of casing 108 inwardly of o ring gland 118 two drain holes 132 are located diametrically opposite of each other in the bottom wall of drain channel 130 this 180 u00b0 location to each other is preferred also the use of three or four equally spaced drain holes 132 is preferred drain holes 132 provide communication between drain channel 130 and central passageway 122 the preferred embodiment of transition portion 134 between front portion 110 and back portion 112 of casing 108 is best seen in fig8 transition portion 134 is of slanted shape between front portion 110 and back portion 112 the inside of transition portion 134 has slanted portion 136 which extends to about the end of back portion 112 of casing 108 the inside of transition portion 134 continues with vertical wall 138 which. |
7 | been said the system is modular and can consist of two or more devices 20 with valve bodies 22 connected parallel as drawing 2 clearly illustrates accordingly the aforesaid holes 10 simplify the assembly of several devices 20 creating a compact distribution system that is rapidly stacked a plurality of contacts 10 b will act as a supply bridge to enable the entire distribution system to be supplied connecting a sole device 20 to the electric source in order to control the temperature on the mixed outlet 9 a temperature control probe 6 is located inside the said conduit the probe 6 is connected to the control electronics 1 that can thus precisely adjust the pin 3 control motors to adjust and stabilise the outlet temperature a pressure sensor indicated overall by the reference 7 is provided to control the pressure on the mixed outlet 9 the said pressure sensor comprising a piston 7 a with magnet a magnet field sensor 7 c a spring 7 b the piston 7 a if it is driven by pressure on the outlet approaches the sensor 7 c which will detect the presence of the associated magnet if the outlet pressure fails the spring 7 b positions the piston 7 a with magnet in the rest position the point in which the sensor 7 c is unable to detect the presence thereof said sensor 7 c is connected to the control electronics 1 and provides the system with a precise. |
6 | used each 2 m long resulting in l 9 6 u00d7 10 6 kg m 4 and l 3 6 u00d7 10 7 kg m 4 respectively data for each are presented in fig9 a and 9b in each case the small section of tubing required when connecting valve r p to the compliance has sufficient nuisance inertance to overwhelm the large compliance which was sized for the earlier experiments shown in fig7 accordingly impedance data denoted as 34 rs closed 34 have positive imaginary z as evident in fig9 a and 9b a variety of phase angles and powers delivered to the load are available using appropriate adjustments of the valves r p and r s indeed it appears that all impedances between the triangles and the circles are accessible by suitable adjustment of r p and r s fig9 b shows that the phase of z can be near 70 u00b0 even for scale powers as low as 2 w equivalent to an operating power of 32 w in a full scale helium ptr further showing the usefulness of inertance for improving the efficiency of ptrs further use of inertial effects to improve ptr efficiency is illustrated in fig4 where an acoustic transmission line 34 recovers power that would otherwise be dissipated in an orifice in previous ptrs back to volume 36 for input to compressor 14 acoustic transmission line 34 is analogous to an electric transmission line its nature is most simply appreciated by a lumped lc impedance approximation an acoustic transmission line can transmit acoustic power while changing the relative. |
3 | tube and increases in relation to the heat conducted to a maximum at the top of the quartz tube with the ratios prevailing between liquid and gas at the top of the tube unit the flow speed i e the gas speed at which flooding can take place with 25 mm packings is 2 5 3 0 m sec with 40 mm packings 3 4 m sec and with 50 mm packings 4 5 m sec in the present case the gas speed is calculated to be approx 2 5 m sec at the top of the tube unit 13 at total evaporation of the liquid fed in however the gas speed may increase to twice this speed however total evaporation takes place only in exceptional cases in case packings are to be placed in the entire quartz tube in the embodiment mentioned above the packings at the top should not have a diameter of less than 40 mm up to half of the height of the quartz tubes packings with a diameter of 25 mm can be used in certain embodiments it is also possible to limit the height of the packing layer so that at the top of the packing layer a maximum gas speed of 1 5 to 2 0 m sec will be obtained the liquid is then sprayed against the walls of the quartz tube with the aid of the spreading device 26 in the top of the quartz tube water. |
3 | position substituents being selected from certain ester polyether and alkanoyl groups the latter having components which bind to biological substrates these specific derivatives are effective as spin traps for different types of free radicals to form persistent nitroxide adducts of extended half life these adducts can be characterized by esr spectrometry technique and provide information e g concerning the identification of free radicals application_number US 4672793 A description the pyrroline n oxide spin traps function by having a charge distribution and steric configuration between the n oxide and the 2 position favourable for attracting and retaining various free radicals as adducts substituents in the 3 and 5 positions serve the function of bestowing a limited increase in adduct lifetime but have no effect on the selectivity recent tests have indicated that substituents in the 4 position have a further effect on adduct formation and stability as well as on the selectivity in the course of investigating this further effect we have prepared various 4 substituted derivatives the first type of compound investigated was one having a carboxylic acid ester group spaced from the pyrroline c 4 ring carbon by at least two carbon atoms it was found possible to prepare this type by starting with the 4. |
8 | buffer in an appropriate format to be fed to the fec unit 63 the fec unit 63 applies a forward error correction algorithm to the data using a known error correction technique such as reed solomon turbo codes or other codes the transceiver 66 in this instance using it as a transmitter spreads the resulting data by the pn sequence modulates the pn spread data with appropriate channel coding per the assigned sub channels 31 and the up converts the result to the desired radio frequency on the receive side of the reverse link that is at the service provider 40 side the transceiver 44 performs a receiver function in this instance the rf down converter 71 feeds multiple receiving units that each include an equalizer 72 a pn code despreader 73 and demodulator 74 each demodulated output is provided to a protocol converter block that includes an fec decoder 75 an inverse segment framer 76 and buffer 77 a controller 78 may be used to control and or implement each of the protocol converter functions as described in further detail below in the preferred embodiment the fec decoder 75 makes use of a so called trellis decoder because a trellis decoder is a type of decoder which compares multiple bits in groups to arrive at an estimate of the correct received bits. |
4 | long straight wire with a small gripping or pinching hook at its lower end as described for example in u s pat no 3 574 273 as illustrated in diagrammatic form in fig3 and its right side elevation fig4 the s twist tool 10 of the invention typically comprises an unbroken length of fine gauge wire having an elongated handle segment or leg 12 and an acute angle bend 14 separating said handle segment from a shorter segment or leg 16 terminating in a substantially u shaped hook 18 this hook preferably lies in a plane substantially perpendicular to the plane of bend 14 and its short leg 20 lies to the right of center when leg 16 is oriented vertically in front of leg 12 as in fig3 the dimensions of each tool are largely dictated by the dimensions and location of each type of spindle to be threaded it is particularly essential that the tool be small enough to permit both its two legs and three cross sections of yarn to be pulled simultaneously through one of the two openings between the pin and the wall of the spindle top a stiff but still moderately springy material such as music wire is the most suitable material of construction actual dimensions of a tool for a specific spindle are given hereinafter although best suited to spindles with the pin located at. |
3 | the present invention is obtained by introducing a glycerate moiety between a vancomycin derivative and a liposoluble modification group and has reduced liposolubility and improved water solubility thereby reducing a side effect in the cardiovascular aspect application_number US 201414912573 A description the compound of formula 1 of the present invention or a clinically acceptable salt thereof is intended to be used for treatment of gram positive bacteria or vancomycin resistant bacteria infection cases to verify the activity a group of the compounds of the present invention were preferably subjected to in vitro activity assay table 1 in vitro activity assay was performed according to microbiological identification of antibiotics appendix xia volume ii chinese pharmacopoeia 2010 vancomycin sensitive staphylococcus aureus strains newman and mu 50 were selected as the test strains and trypticase soy broth was selected as the culture medium the assay for minimum inhibitory concentration mic was performed as follows the compound to be tested was dissolved in n n dimethylformamide to prepare a stock solution at 1 28 mg ml the stock solution was diluted with the culture medium to a initial concentration of 1 28 u03bcg ml which was subsequently half diluted to prepare test solutions at 64 u03bcg ml 0 125 u03bcg ml and the assay was performed according to cup plate. |
2 | extended beyond the upper end of the inclined surface 28 then the infant might be injured by this headlong movement into the wall because the front pair of legs 36 extend forwardly the forward motion of the infant crawler 10 is halted at a distance sufficiently far from the wall that the infant cannot contact his head to the wall similarly the inclination outwardly and rearwardly also prevents impact against large immovable objects a bumper means may also be provided in the infant crawler 10 to protect the infant from additional types of impact injuries as an example and referring to fig3 a post or piece of furniture might be of sufficiently small dimension that the infant could propel the infant crawler 10 against the object without ever touching either of the front pair of legs 36 in the circumstances previously described the infant 39 s head could then conceivably be injured by impact against the object to minimize the possibility of such injury the bumper means extends the safety zone to include objects having sufficiently small dimensions to pass between the legs 36 and 38 of the infant crawler 10 preferably the bumper means is a bumper line 40 which extends between the two legs of the front pair of legs 36 the two legs of the back pair of legs 38 and between the adjacent one of the front pair of legs 36 and back pair of legs 38 on each side of the infant crawler 10 that is the bumper line 40 extends completely around the perimeter defined by the outermost extent of the four legs of the infant crawler 10 the bumper line 40 is preferably made of string or rope but could be made of wire or a rigid. |
4 | c emulsification was conducted in the same manner as in example 1 except for changing the sizing ingredients 3 and 4 in example 1 a to those given in the following table to measure the amount of precipitated particles of the emulsions table 1______________________________________ run no no 1 no 2______________________________________compound 3 used in 10 parts 0 partexample 1compound 4 used in 0 part 10 partsexample 1amount of precipitated 9 92 emulsion particles______________________________________ further carbon fibers were treated with the composition of run no 1 in the same manner as in example 1 b and a cfrp bar was prepared therefrom this cfrp bar showed an ilss value of 9 8 kg mm 2 at room temperature and 6 8 kg mm 2 in 80 u00b0 c air from these results it is seen that sizing agents not containing either of the compounds i or ii formed a large amount of an emulsion particle precipitate thus lacking emulsion stability leading to low ilss of cfrp and adversely affecting physical properties of cfrp emulsions and cfrp bars were prepared in the same manner as in example 1 except for changing the sizing agent ingredients 3 and 4 to a popularly known surfactant noigen ea 190 trade name of polyethylene glycol adduct of 25 moles of ethylene oxide lauryl ether made by dai ichi kogyo seiyaku co ltd these were tested in the same manner as in example 1 with respect to the same items to obtain the results shown in table 2 from the results given in table 2 it is seen that the use of the conventionally used surfactant provided inferior results to those in example 1 with. |
5 | in fig3 to allow viewing of the receiver 112 laterally directed round bars 92 94 extend on opposite sides of the base assembly 67 on a bottom thereof fig2 a as illustrated in fig3 the base assembly 67 includes cylindrical bosses 102 104 located substantially above the round bars 92 94 and extending laterally on opposite sides of the base the mounting structure 42 a includes hooks or seats 106 108 open upwardly and located on opposite lateral sides of the rear portion of the chassis 42 of the utility vehicle the seats 106 108 are sized to receive the round bars 92 94 therein the mounting structure 42 a further includes semicylindrical receivers 112 114 that are sized and shaped to receive the bosses 102 104 therein and guide the bosses into a mounting position the receivers 112 114 are open horizontally toward the backhoe attachment fig2 illustrates in an enlarged view the partial engagement of the base assembly 67 of the backhoe attachment 24 to the mounting structure 42 a the round rods 92 94 are already fit into the seats 106 108 the bosses 102 104 are being rotated upwardly about the rods 92 94 to engage the receivers 112 114 in a tangential direction the receivers 112 114 include. |
8 | publication_number US 5787180 A abstract an apparatus and method for voice privacy for cellular phones includes generic connection points to make it universal for most cellular phones the connection points include the speaker and microphone and the microphone input and speaker output of the cellular phone a scrambling or encryption circuit or process is used to secure the audio before it is transmitted over the network and the unsecured audio once received side tone added by the cellular phone and network echo of the scrambled audio to be transmitted is removed by for example adaptive echo cancellation and unscrambled side tone is presented to the speaker the apparatus can be implemented in a digital signal processor application_number US 82608397 A description to assist in a better understanding of the invention a description of one embodiment or form the invention can take will now be set forth in detail frequent reference will be taken to the drawings reference numbers will sometimes be utilized to indicate certain parts or locations in the drawings the same reference numbers will be used to indicate the same parts and locations throughout the drawings unless otherwise indicated in this description a single cellular telephone circuit with an add on circuit according to the present invention will be shown however the description will be in the context of course of two way duplexed voice communications between two cellular telephones in a conventional cellular telephone system in this example one phone will be discussed as if it were being used by the reader the other will be used by a second person at a remote location in the cellular network therefore to distinguish between the. |
9 | protective box 18 enclosing a flexible bag 20 of liquid soap a flexible dispensing tube 22 is opened to the interior of the bag 20 and extends downward from a lower portion of the bag the dispensing tube 22 extends through an opening 24 in the enclosing box 18 and has a flanked spout 26 for shipping purposes the box 18 is originally fully enclosed but a section not shown defined by a perforation is removed to define the opening 24 in the box 18 the dispensing tube 22 can be pulled out from a folded condition within the box 18 prior to placing the box in the mounting plate 12 when installed the box 18 is supported by the shelf 14 below the upper support 16 the dispensing tube 22 depends downwardly so that the flanked spout 26 is inserted between clips 28 at a lower portion of the mounting plate 12 the cover 30 for the dual dispenser 10 includes an actuating plate 32 pivotably attached at a lower front portion more particularly and with reference to fig2 the actuating plate 32 includes a pair of brackets or ears 34 having throughholes for mounting on a rod or pair of rod stubs 36 formed on the inner surface of the cover 30 and generally aligned transversely across the cover. |
6 | may be affixed in a conventional manner the larger portion 44 of the body 40 includes a coupling member 46 that is rigidly retained by the larger portion 44 of the body 40 in a conventional manner slidably retained in the coupling member 46 is a plunger 48 which is urged towards its most outwardly extending position by a spring 50 plunger 48 is provided with a plurality of apertures 52 and the wall thereof thereby permitting the fluid to flow through the opening 54 provided therein through the apertures and through the other hollow portion of the housing or body 40 where it can exit as shown via the arrow 34 34 a fluid connector 60 according to the principles of the instant invention is shown in elevation in fig3 the connector disclosed therein overcomes the shortcomings found in the devices heretofore utilized the major shortcoming of the male connector 36 when inserted into the female connector 10 is its susceptibility to lateral forces that is forces exerted inadvertently or purposefully transverse to the axis of the connector will dislodge the male connector from the female connector 10 in addition female connector 10 requires a cover 12 in order to protect the fluid flow path from debris or dust entering therein the instant connector 60 overcomes these shortcomings as will be explained hereinafter the fluid connector 60 is provided with a body having a relatively larger first portion 62 and. |
9 | the turbine 30 via brackets 15 18 a beam 20 supporting the rail structure 1 is attached to a first bracket 18 via a pivotable joint two chains 16 span from a second bracket 15 attached to the wall of the turbine 30 above the first bracket 18 to the rail structure and hold the beam 20 in a defined angle relative to the turbine 30 the tilt angle of the beam 20 can be adjusted by adjusting the length of the chain 16 e g with the help of a chain block the angle of the beam 20 relative to a horizontal plane is typically equal to the direction of the main axis of the turbine component 7 respectively axis of the opening in the turbine 30 for receiving the turbine component 7 when aligned to the axis of the opening the turbine component 7 can easily be mounted or dismounted by the traveller 10 which can move along the rail structure 1 with the tilt angle of the beam 20 the traveller 10 can be moved along the rail structure 1 with the help of a jack screw system 21 fig4 shows an example with an overhead mounted rail structure 1 the rail structure is attached to an overhead wall of the turbine 30 via brackets 13 14 a beam 20 supporting the rail structure is attached to a first. |
9 | comprise a solid acid such as a zeolite examples of suitable zeolites include zsa 5 mordenite beta ferrierite and zeolite y additionally the catalyst may comprise a super acid examples of suitable super acids include sulfonated phosphated or fluorinated forms of zirconia titania alumina silica alumina and or clays in another embodiment the catalyst may comprise a solid base examples of suitable solid bases include metal oxides metal hydroxides and or metal carbonates in particular the oxides hydroxides and carbonates of alkali metals alkaline earth metals transition metals and or rare earth metals are suitable other suitable solid bases are layered double hydroxides mixed metal oxides hydrotalcite clays and or combinations thereof in yet another embodiment the catalyst can also comprise an alumina such as alpha alumina it should be noted that solid biomass materials generally contain minerals it is recognized that some of these minerals such as potassium carbonate can have catalytic activity in the conversion of the biomass material even though these minerals are typically present during the chemical conversion taking place in the biomass conversion reactor 16 they are not considered catalysts the biomass feed system 14 introduces the biomass feedstock into a biomass conversion reactor 16 in the biomass conversion reactor 16 biomass is subjected to a thermochemical conversion reaction that produces bio oil the reactor 16 can be any system or device capable of thermochemically converting biomass to bio oil the biomass conversion reactor 16 can be for example a fluidized bed reactor a cyclone reactor an ablative reactor or a riser reactor in one embodiment the biomass conversion reactor. |
8 | as a closed system for internal corporate and law enforcement use the law enforcement utilization shall employ the wireless communications and database in conjunction with the 700 mhz frequency spectrum as a primary claim under this submission fig4 5 6 and 7 represent the notional and operational diagram rendering of the embodiment of the portable multi modal emergency situation anomaly detection and response systems sensor fusion of composite signatures which include the data models which are collected analyzed modeled and configured for alert both locally to the individual subscriber device and onto the global information grids network centric enterprise services common operational picture as offered in its operational detectable component and conditions configuration witch is the embodiment of the inventions methodology which is used to monitor and access the conditions of the subscriber vehicle and is designed to support the invention the anomaly detection and response system is designed to identify and report non obvious relationships and events that are precursors to a significant event of interest which has been modeled or defined in rules the specific physics or environmental based signature will allow appropriate alert or in the case of inclement whether counter measures to be taken to alert prevent or moderate the previously defined behavior the device and its secure network centric enterprise services global information grid web services subscribers and publishers includes an enterprise application which reduce analytic and information dissemination time by off loading anomaly detection and analysis tasks from humans while providing increased situational awareness and visibility of the common operating picture within the complete structured vehicle collaboration space the first activity of the anomaly detection and reporting system analysis is to perform the following a identify individual vehicle make and. |
5 | force would have to be higher for the striker box assembly to fail as compared to conventional strike plates shown in fig2 and 3 in other words with the boxes 50 and 150 secured by a jack flange 61 to the side of the jack stud 31 the box 50 is better prevented from rolling or rotating in the cutout while the door d is being forced open after the boxes 50 and 150 are attached to the jack stud 31 by primary screws 81 and jack screws 82 cover plate 40 is attached to the boxes by machine screws 83 a third way of attaching the boxes 50 and 150 along with the cover plate 40 to the jack stud 31 is with secondary screws 85 that extend through screw holes 45 in the cover plate 40 and screw holes 75 in the box 50 and then through the jack stud 31 and into king stud 32 the screw holes 45 and 75 align such that the screws 85 hold the cover plate 40 and the box 50 together while attaching to the jack stud 31 and king stud 32 it should be noted that the screw holes 75 are off center relative to the box 50 as identified by centerline 51 in fig5 and 6 and especially with respect to the main openings 43 and 143 in the cover plate 40 so that the secondary screws 85 will be positioned closer to the center of the jack stud 31 and further. |
6 | lever 82 in one direction around the reference line c with respect to the reference line c which is the axis of the driving side sprocket 43 that is the spacer 84 while allowing the rotation in the other direction around the reference line c that is by rotating the other end portion 82 b of the rotating lever 82 around the reference line c to reciprocate several times in one direction the other direction one direction and the like the driving side sprocket 43 can be rotated in only one direction around the reference line c accordingly the rotation of the driving side sprocket 43 is transmitted and the rotor 14 is rotated to match the phase of the rotor 14 in this example the rotating lever 82 is formed in a bar shape and is rotated on a plane parallel to the reference plane s the rotating lever 82 and the above mentioned fitting and detaching lever 64 are rotated in a direction along the reference line c on the same side with respect to the chain cover 49 in the turning device 80 configured as described above when the operation of the steam turbine is stopped and the control unit 52 is not operated or the like an operator q can operate the rotating lever 82 to rotate the rotor 14 or can operate the fitting and detaching lever 64 to control the position of the pinion gear 46 as described above according to the turning device 80 of this embodiment the coupling guard 70 is prevented from interfering with the chain cover 49 when the coupling guard 70 is attached and detached since. |
5 | plastic knob main body 36 and support pieces 37 projecting downward from the front and back sides thereof and the support holes 37a of the support pieces 37 are engaged with the support lugs 6a of support pieces 6 whereby the main body of the knob is supported by the case 3 so that it can be swung in the direction of arrow a and in the opposite direction a transparent display plate 38 with characters for example 34 auto 34 is attached to the upper end of the knob main body 36 a light guide 39 composed of acrylic resin is formed integrally with and disposed in the knob main body and is provided with a recessed portion 40 corresponding to the above display plate 38 the light guide 39 has protrusion for pressing projections 41 and 42 formed thereon in correspondence to the above return member 29 and the actuating member 34 as shown in fig1 a regulating lug 43 is defined at the center of the pressing projection 41 the right lower surface 41a of the pressing projection 41 is formed so that it has an angle of u03b8 1 u03b8 2 with respect to the upper surface of the knob stopper 7 about the center of rotation the center of the support lug 6a and the support hole 37a and the left lower surface 41b thereof is formed such that it has an angle u03b8 1 note that in the figure the angle u03b8 1 is set to for example 14 u00b0 and the angle u03b8 2 is set to for example 7 u00b0 in this situation the lower surface of the regulating lug 43 in the knob 35 is. |
6 | a space 57 remains between the bottom of the array 20 and the horizontal section 54 that promotes dissipation of heat from the array 39 s leds 24 and electronic components 26 this helps the light 10 operate without overheating when the led array pcb 20 is installed there is approximately one inch between the leds 24 and the top 53 of the tube 50 the thickness of the tube 12 can vary with a suitable thickness being approximately 0 85 inches the tube 12 can be made from many materials with one of the preferred materials being acrylic the tube can be fabricated to illuminate at various colors and dissipate the emitting light to reduce bright and dark spots below the horizontal section 54 the tube 12 has two opposing tabs 55 56 are provided that run the longitudinal length of the tube lens to form a slot under the horizontal section 54 each tab 55 56 tapers toward the other and at the bottom of each tab there are opposing horizontal sections 58 59 with an opening between the edges of the two the slot formed by the member 54 and opposing tabs 55 56 houses the new mounting button 40 shown in fig4 a and 4 b when mounting the light 10 to a structural feature the buttons 40 are mounted along a line of the structural feature where the light s 40 are to be mounted a preferred mounting method is by a screw. |
6 | of the base at the perimeter of the front face of the electronic device to retain the subject device in a landscape orientation it is slid in from the side between the arms in this case the side edges of the electronic device press against the brackets as seen in fig2 the contact surfaces of the arm 123 that contact the electronic devices edges have a curvature that is the compliment of the curvature of the device edges the four electronic device positions are achieved by the two stand to table options times the two electronic device to stand options in addition the stand can be turned 180 degrees into a hook mode as in the stand positions the electronic device can be inserted into the base in both a portrait and a landscape orientation a first embodiment is seen in fig1 9 this embodiment is mechanically coupled to the electronic device it is sized for by sliding the device in between a back wall and four bracket arms fig1 shows a perspective view of this first embodiment stand 100 holding an electronic device 50 shown on a dashed line the two main parts of the stand are its leg 101 and the base holder 102 the holder has for retaining arms 104 and a front surface 103 and a back surface 105 because of the wide flexibility in use and mounting the u201c upper u201d and u201c lower u201d extremities will be. |
4 | this aspect of the invention will now be described with reference to the accompanying drawings in which like elements are referred to by similar numerals fig1 illustrates the arrangement of three cylinders sometimes referred to as rolls arranged in juxtaposition for a garnetting step according to this aspect of the invention with their axes horizontal showing from the left a main cylinder 11 a doffer 12 and a randomizer 13 rotating in the directions indicated main cylinder and randomizer clockwise with doffer counterclockwise and with their cylindrical surfaces covered with appropriate card clothing with teeth oriented as indicated main cylinder teeth 21 oriented in direction of rotation but doffer teeth 22 and randomizer teeth 23 opposite to directions of rotation thus a carded web 14 is carried by the teeth 21 on main cylinder 11 stripped therefrom by the teeth 22 on doffer 12 and then transferred from the doffer teeth 22 to the randomizer 39 s teeth 23 the randomizer 13 is rotated at a surface speed that is much reduced from the surface speed of the doffer 12 so the parallelized fibers in the web 14 become rearranged in the nip 15 between the doffer 12 and the randomizer 13 and. |
8 | public key is marked as pending a handle is also created in the catalog that points to the location on the key ring where the certificate is to be stored later when a certificate is delivered to the kro the kro performs a three way verification u2014 the public key in the certificate is compared with the public key in the catalog and the public key in the catalog is compared with the public key in the key ring additionally when the public key is stored in the key ring it is verified against the private key summarizing a kro has been described to manage and protect multiple certificates in an electronic business system using public key infrastructure with the kro private keys and certificates can be securely stored and managed in disk files smart cards and pc cards the kro can generate store and select keys for use in signing of digital information or authenticating the end user thereby enabling end user access to a host of secure client server applications the attached appendix 1 entitled u201c key ring organizer language specification krol u201d provides details on messaging between the kro and a client server while the invention has been described in a preferred embodiment various changes may be made without departing from the spirit and scope of the invention as defined in the appended claims in which overview the key ring organizer kro uses a client server interface to receive. |
6 | play free an outside diameter d a of the two plain bearing parts 1 a and 1 b is identical the two plain bearing parts 1 a and 1 b have different heat expansion coefficients u03b1 1 and u03b1 2 k u2212 1 in this case the heat expansion coefficient u03b1 1 of the first plain bearing part 1 a is lower than the heat expansion coefficient u03b1 2 the inside diameter d i1 2 consequently changes differently as a function of the temperature t u00b0 c the result of this is that the first plain bearing part 1 a takes over the guidance and support of the shaft 2 in one specific temperature range u03b4t 1 and the second plain bearing part 1 b takes over the guidance and support of the shaft in the other temperature range u03b4t 2 the temperature dependence of the inside diameter d i1 2 is illustrated in relation to the outside diameter d w of the shaft 2 in fig2 it can be seen that in the temperature range u03b4t 2 below approximately u2212 20 u00b0 c limit temperature with an at least approximately identical expansion coefficient u03b1 1 2 of the two. |
2 | illustrated a further embodiment of a scanning probe adapted for use in the invention herein glass or lucite rollers 96 and 97 are each mounted for rotation about axes 98 and 99 respectively and loaded upward into the surface of palm 100 in a manner which would be obvious to those skilled in the art light sources 101 and 102 illuminate the palm by shining upward through rollers 96 97 the sides of rollers 96 97 are blackened at 103 104 to provide a dark surface for photocells 105 and 106 to focus against when the top inside surface of polished rollers 96 and 97 respectively act as internal reflectors surfaces 96 97 act as reflectors to photocells 105 106 when there is air in contact with them as shown when palm 100 is in contact with the surface of roller 96 photocell 105 34 sees 34 the light from source 101 which is reflected down into photocell 105 on the other hand when the surface of palm 100 is not in contact with roller 97 because of the presence of palm line light from source 102 does not reach photocell 106 because of the internal reflection caused by the air gap between palm 100 and roller 97 consequently photocell 106 sees only the darkened. |
5 | of 18 lbs gal mud such flotation materials are commercailly available for example from emerson amp cuming inc normally the inside diameter of liner 48 is the same as the inside diameter of the last casing run and through which drilling operations are to be continued in fact standard sizes in casing tubing can be used effectively as a wear liner straps 59 are provided about the outer wall of the inserts attention is now directed to fig2 and 3 for means of holding the lightweight insert in the riser pipe at a depth or location along the riser 26 at which it is desired to have the bottom of the inserts there is provided a modified 34 j 34 slot arrangement 108 this can be quite similar to the locking slot arrangement 130 shown in fig9 and 10 a locking spider 124 is provided at the lower end of the insert 47 and is provided with four lugs 112 which are 90 u00b0 apart and can be similar to the locking lugs 132 shown in fig9 and 10 the locking spider 124 is connected to flotation unit 47 by pipe means 114 means will now be discussed as to methods for holding weight 116 to pull the insert 47 down and also means for removing the weight 116 this includes pipe 118 hung inside insert liner 114 and extends downwardly through the spider arm 124 outwardly biased arms 119 pivoted about pivot 120 on pipe 118 are provided so that when they reach cavity 121 within spider 110 they will expand and engage the lower shoulder 122 of cavity 121 at this point the downward force of the weight of weight bar 116 is applied through spider 124 to insert 47 pulling. |
6 | the rotated position of the lever 25 operated by the trigger wire 30 when the number of revolutions of the engine again increases and exceeds a predetermined number of revolutions the vibration sensor 101 again opens and the opening degree of the throttle valve 27 is decreased by the actuator 81 the operation as described above is repeated whereby the speed of the engine is maintained at a level less than a predetermined number of revolutions and the overrunning of the engine is automatically prevented without the need of the operator 39 s control of the trigger wire 30 according to the variation of load in the embodiment shown in fig5 an actuator 181 connected to the upper end wall of the body 35 of the carburetor 24 is actuated by negative pressure applied from a vibrating pump 141 through a vibration sensor 201 members corresponding to those shown in fig4 are indicated by reference numerals to which 100 is added provided in an atmospheric opening 149 of the vibrating pump 141 is a check valve 154 to allow a flow of air from a pressure chamber 146 to the outside on the other hand provided on a passage 152 is a check valve 148 to allow a flow of air from the vibration sensor 201 to the pressure chamber 146 the vibration sensor 201 is designed so that a ball 207 is urged against the end of a passage 152 by means of a spring 204 accommodated in a housing integral with a port. |
1 | then milling the mixture through the milling the triptan compound and saccharin may be obtained as a mixture in a liquid state that is an ionic liquid the milling may be performed for 10 to 100 minutes or 20 to 60 minutes in the present invention a reaction may be performed by adding 500 u03bcl or less 400 u03bcl or less or 300 u03bcl or less of water in order to shorten the time for preparing the ionic liquid in this case the reaction may be performed for 5 to 10 minutes furthermore in an exemplary embodiment an ionic liquid may be prepared by separately dissolving a triptan compound and saccharin in a solvent and then mixing the dissolved triptan compound and saccharin and performing a solvent evaporation method further the ionic liquid may be prepared by dissolving the triptan compound and saccharin together in the solvent and then performing a solvent evaporation method the solvent evaporation method may be performed in the atmospheric state but may be performed under reduced pressure and dry conditions through the solvent evaporation method an ionic liquid is precipitated in this case the solvent may be selected from the group consisting of ethanol and methanol and specifically ethanol may be. |
4 | segment 21 of the lifting lever in order to obtain an appropriate resilient presser foot pressure a tension spring 22 is provided which extends between the pin 14 of the presser bar and a horizontal pin 23 provided on the lifting lever 15 the presser foot pressure can thereby be controlled by means of the lifting lever as will be described in more detail in the following in order to determine the position of the presser bar and the presser foot the arrangement comprises a code disc 24 one end of which is rotatably journalled on the shaft 16 and the other end of which is movably connected to the presser bar by means of an elongated opening 25 through which the pin 14 extends with a close fit by means of a differential gauge comprising optical position sensors 26 attached to the lifting lever 15 and cooperating with a toothed segment 27 of the code disc the mutual positions of the lifting lever and the code disc are determined when the presser foot is in its elevated position and thus not engaging the cloth below no mutual movement of the lifting lever and the code disc takes place when the presser foot is lowered and engages the cloth whereby its descending movement is stopped the continuing downward movement of the lifting lever 15 will result in tensioning the spring 22 and a corresponding increase of presser foot pressure with a knowledge of the spring constant the position. |
4 | adjacent cathodic compartment 3 between the two compartments there is provided a membrane 6 typically a nafion membrane the wall opposite to the membrane 6 of the anodic compartment 2 is given by the anode plate 4 and the wall opposite to the membrane of the cathodic compartment is given by the cathode plate 5 correspondingly the electrical current flows as indicated by the arrow 12 the anodic compartment 2 on its bottom comprises an inlet 7 for the anolyte and on its top it comprises an outlet 8 for the anolyte analogously the cathodic compartment 3 on its bottom comprises an inlet 9 for catholyte and on its top end an outlet 10 for catholyte close to the outlet as well as to the inlet the compartment 3 is provided with grids namely with an upper grid 11 u2032 and a lower grid 11 u2033 since the flow of the liquid is substantially vertical these grids are preferably located substantially horizontally they however need not be flat they may also have a three dimensional structure like for example a zigzag or wavy shape the bed of granules 14 is maintained in the reactor by such non conductive grids set on the top and the bottom of the cell and is in contact with a conductive plate 5 that brings the electrical current into the granular material 14 in the cathodic compartment 3 there is provided a bed in the form of a multitude of granules these granules however not filling up the space between the two grids 11 u2032 11 u2033 completely the situation indicated in fig1 a displays the conditions if the flow of the liquid. |
3 | 6 chromonytmethyl m nitrophenyl 3 5 dimethoxybenzyl 1 methyl 1 3 5 dimethoxyphenyl ethyl o nitrobenzyl u03b1 methylnitropiperonyl 3 4 dimethoxy 6 nitrobenzyl n benzenesulfenyl n o nitrobenzenesulfenyl n 2 4 dinitrobenzenesulfenyl n pentachlorobenzenesulfenyl n 2 nitro 4 methoxybenzenesulfenyl n triphenylmethylsulfenyl n 1 2 2 2 trifluoro 1 1 diphenyl ethylsulfenyl n 3 nitro 2 pyridinesulfenyl n p toluenesulfonyl n benzenesulfonyl n 2 3 6 trimethyl 4 methoxybenzenesulfonyl n 2 4 6 trimethoxybenzene sulfonyl n 2 6 dimethyl 4 methoxybenzenesulfonyl n pentamethyibenzenesulfonyl n 2 3 5 6 tetramethyl 4 methoxybenzenesulfonyl and the like b u2014 c o or 20 where r 20 is selected from alkyl substituted alkyl aryl and more specifically r 20 methyl ethyl 9 fluorenylmethyl 9 2 sulfo fluorenylmethyl 9 2 7 dibromo fluorenylmethyl 17 tetrabenzo a c g i fluorenylmethyl 2 chloro 3 indenylmethyl benz f inden 3 ylmethyl 2 7 di t butyl 9 10 10 dioxo 10 10 10 10 tetrahydrothloxanthyl methyl 1 1 dioxobenzo b thiophene 2 ylmethyl 2 2 2 trichloroethyl 2 trimethylsilylethyl 2 phenylethyl 1 1 adamantyl 1 methylethyl 2 chloroethyl 1 1 dimethyl 2 haloethyl 1 1 dimethyl 2 2 dibromoethyl 1 1 dimethyl 2 2 2 trichloroethyl 1 methyl 1 4 biphenylyl ethyl 1 3 5di tert butylphenyl 1 methylethyl 2 2 u2032 pyridyl ethyl 2 4 u2032 pyridyl ethyl 2 2 bis 4 u2032 nitrophenyl ethyl n 2 pivaloylamino 1 1 dimethylethyl 2 2 nitrophenyl dithio 1 phenylethyl tert butyl 1 adamantyl 2 adamantyl vinyl allyl. |
4 | of the stops 37 and 38 are located outside the travel path of the counterstops 40 and 42 in this case the appropriate stroke element 21 is not transported but stays in its at rest position b the plate 39 is located sidewards over the stroke element 21 and grips into a groove 43 which guides the stroke element relative to segment 25 fig5 is in the upper half a plan view and in the lower half a cross sectional cut through the entrainment means 20 it is illustrated as an embodiment wherein for the support of the entrainment means 20 there is provided an insert 44 of a material having good supporting qualities set in a groove 45 having tapered walls with a mild v form relative to each other in this situation it is only necessary for end 46 of entrainment means 20 whose pegs 29 protrude somewhat on both sides to be set into the groove the lid 31 prevents the entrainment means 20 from falling out in fig7 and 8 there are illustrated embodiments wherein the corresponding item numbers are raised by 100 the difference is that the group of transducers 119 are displaced rearwardly in the stroke direction relative to the entrainment means 120 thus the displacement of the entrainment means 120 is. |
5 | or lever so that a rear door may be opened from the outside but not opened from the inside the control lever for setting the safety mechanism is generally located on what may be termed the jamb portion of the door near the latch thus being inaccessible to a person from the inside or the outside of a vehicle once the door is closed a typical design consists of a small lever which may be set in either an up or down position when set in the down position the inside door operating mechanism which allows the door to open and free itself from the door jamb latch is disabled currently in order for a person to disable the safety lock on the rear doors of automobiles or to simply open the door he or she must exit the driver 39 s seat get out of the vehicle and manually open the rear door from the outside in order to allow passengers seated in the rear seats to exit this is an inconvenience as can be appreciated by the automobile operator who transports children or others who are deemed to require enchanced safety measures to ensure continuance of their health and welfare the present invention is directed to an electro mechanical door safety lock mechanism operated from the driver 39 s seat for controlling the child safety locking device on the rear doors of automobiles or the doors of other vehicles moreover the left rear door and right rear door safety locks are under the provisions of my invention independently controlled further the vehicle operator is able within the provisions. |
5 | that is tool 4 has regained the position at which its lifting was initiated up down counter 38 will then be blocked and gate 40 39 unblocked so that consuming device 42 will again receive pulses zd the state described above will accordingly commence again fig6 illustrates the different signals that occur during vibrations while diode 13b and phototransistor 14b are at the boundary between an opaque and a transparent zone with diode 13a and phototransistor 14a on the other hand being on different sides of an opaque zone in this case obviously a will equal 0 while b will supply a signal indicating a transition from an opaque to a transparent zone in a device of the known type signal b will mean that disk 10 continues to rotate and tool 4 to drill it will be evident on the other hand that in the device in accordance with the invention the outputs qma1 and qma2 of monostables ma1 and ma 2 will remain at zero so that signals xa 1 and ya 1 will also remain at zero signals zd 1 and zc 1 will then each generate a pulse for each period of b pulses that are out of phase it will then be immediately evident from fig3 that up down counter 38 will oscillate. |
7 | more endurance may be needed in certain situations while more speed may be required in others more dexterity may be needed at times while speed is needed at other times more quiet operation may be needed at times while more powerful operation may be needed at other times and the foregoing alternatives may have inverse relationships such as may be mathematically computed by the processor according to the afore discussed weighting further output signals may comprise multiple outputs such as to various systems or to various components of a system such multi outputs may be provided wired or wirelessly or via combinations thereof for example wireless data communication may be provided between various components of an exoskeleton embodiment based on specific patient needs more particularly for example wireless communication may enhance neural feedback systems among all or some input sensors and or output methods including combined subvariations for instance communication between brain sensors brain stimulators peripheral nerve sensors and peripheral nerve stimulators for a patient whose bionic system makes use of all four elements may be corresponded wirelessly between sensors and with a microprocessor executing the weighting for output discussed throughout by way of non limiting example the interface of a peripheral nerve stimulator to a peripheral neural interface such as a peripheral nerve cuff or piercing intrafascicular electrode may occur wirelessly also a wireless connection may facilitate communication between peripheral nerve sensors and a traditional spinal cord stimulator such as to enhance sensory function whether touch or proprioception functionality or to enhance pain reduction and or to increase blood circulation to the areas distal to nerve lesions the present invention may additionally provide enhanced output control of complex multi limb exoskeleton. |
2 | closed position and maintenance personnel wish to move it to the open position the maintenance personnel must first remove the door bolts 134 coupling the doors 50 to the frame 34 the maintenance personnel then power the actuator cylinder 58 to move the actuator cylinder 58 and thus the guard group 38 into the open position when the guard group 38 is in the open position mechanical components are accessible for maintenance or repairs the guard group 38 may be removed from the machine 10 if a large mechanical component such as the oil pan needs to be removed from the machine 10 the guard group 38 can be accessed for minor service by removing the four door bolts 134 which are fastened to the threaded opening 82 welded to the cross members 74 the guard group 38 can be accessed for major service by removing the bolts 102 which are attached to the frame 34 removing the four bolts 102 will allow the guard group 38 to suspend from the hinge 122 and to move between open and close positions upon actuation of actuator cylinder 58 during which the door bolts 134 should not be removed it will be appreciated that the foregoing description provides examples of the disclosed system and technique however. |
7 | position the control circuit 110 could briefly move the head away from the park position in order to write and read test data to and from the reserved track 28 and could then calculate the ser based on this test data in fig2 if the detected soft error rate ser is found to be below the threshold at block 162 the control circuit 110 essentially shuts down system operation at block 163 alternatively however the control circuit 110 could take some other course of action for example the control circuit 110 could 1 prevent a user from writing data 2 allow a user to write data only in a write with verify mode or 3 initiate recovery activities such as head cleaning in order to improve the error rate performance in blocks 161 163 of fig2 an error condition is generated after checking the soft error rate ser at just one radius of the disk which is the radius associated with track 28 alternatively however when the ser is found to be below the threshold at any radius the ser could be checked again at a different radius and then the error condition would be generated only if the ser was found to be below the threshold at each such radius a further consideration relates to the fact that the blocks 161 and 162 involve evaluation of the soft error rate ser it would alternatively be possible to check for. |
6 | operating range 50 of the hydraulic transformer is chosen such that although the transformer can be used for driving and braking in both directions of rotation four quadrant use the settings of the transformer are asymmetrical so that the driving torque can be higher than the braking torque the oil pressure in the chambers 65 pushes the barrel plate 56 against the swivel block 36 and the rotor 32 against the port plate 30 this is the main axial force except in situations where the oil pressure is very low in that situation the force of the spring 62 presses the rotor 32 and the barrel plate 56 against respective the port plate 30 and the swivel block 36 in order to prevent oil leakage and facilitate starting the forces on the rotor 32 in the axial direction of the rotation axis of the shaft 34 created by the oil pressure in the chambers 65 are necessary for creating a seal in the second axial bearing 59 and are in part balanced by forces of oil pressure in the piston canal 38 and the port 43 in the second axial bearing 59 between the rotor 32 and the port plate 30 the forces on the barrel plate 56 caused by the oil pressure in the chambers 65 and are necessary for creating a seal in the first axial bearing 57 these. |
3 | through a conventional microscope the cells showing the morphology typical of said cell type the same assay was performed but extending its period to 21 days the medium was changed every three days in the same way as in the previous case osteocalcin fig1 c osteonectin fig1 b and aphl fig1 a since they are genes specific for bone tissue and nanog were determined every week the concentration of osteocalcin osteonectin and aphl increases over the weeks mesodermal differentiation being demonstrated the disappearance of the expression of the gene nanog over three weeks of differentiation is also analyzed human bone cdna ambion was used as the positive control and gadph as the loading control hk the primers used in the amplification were the following for aphl seq id no 13 5 u2032 gaaggtgaaggtcggagtca3 u2032 as the forward primer and seq id no 14 5 u2032 tggactccacgacgtactca3 u2032 as the reverse primer for osteocalcin the same as in the previous case seq id no 7 and seq id no 8 and for osteonectin seq id no 15 5 u2032 aggtatctgtgggagctaatc3 u2032 as the forward primer and seq id no 16 5 u2032 attgctgcacaccttctc3 u2032 as the reverse primer for nanog the forward primer was seq id no 5 and the reverse primer was seq id no 6 the rt pcr was performed in cfx96 bio rad using 50 ng of cdna and sybr green. |
5 | production tubing 76 fig4 the engaging base 30 includes a coupling 28 on its lower end configured to mate with an intake coupling not shown disposed on the tubing 76 a lower flex shaft housing 32 connects to the engaging base 30 on an end opposite the coupling 28 as shown the lower flex shaft housing 32 is a generally tubular member having apertures on its outer surface configured to receive wellbore production fluid for delivery to the pump section 38 a mandrel assembly 34 coaxially connects the lower flex shaft housing 32 to the upper flex shaft housing 36 a flex shaft 31 is shown provided within the pumping system 24 extending from the lower to the upper flex shaft housing 32 36 the pump section 38 of fig2 comprises a progressing cavity pump having a rotor 40 and a stator 42 the rotor 40 outer dimensions correspond in shape and profile to the stator 42 the rotor 40 which preferably comprises metal has an exterior helical configuration and splined lower end the rotor 40 is configured to rotate within the stator 42 wherein the stator 42 is preferably formed from an elastomeric material the stator 42 is shown having double helical cavities located along its axis through which the rotor 40 rotates rotation of the rotor 40 therefore progressively urges production fluid axially up within the housing 39. |
2 | treatments are accomplished in a standard box coater using well known vacuum evaporation practices a u2014 the mold is loaded into the standard box coater such as a balzers bak760 and the chamber is pumped to a high vacuum level b u2014 hydrophobic top coat a fluorosilazane shin etsu kp801m is deposited onto the optical surface of the first part of the mold using a thermal evaporation technique to a thickness in the range of 2 15 nm c u2014 the dielectric multilayer anti reflecting ar coating consisting of a stack of high and low index materials is then deposited in reverse of the normal order details of this deposition are as such the first layer is a layer of of sio 2 having a physical thickness of 80 110 nm optical thickness about 100 160 nm the second layer is a layer of zro 2 having an optical thickness of about 160 nm the third layer is a sio 2 layer having an optical thickness of about 30 nm and the fourth layer is a zro 2 layer having an optical thickness of about 55 nm optical thickness are given at a warelength of 550 nm d u2014 at the completion of the deposition of the four layer anti reflecting stack a thin layer of sio 2 having a physical thickness of 1 50 nm is deposited this layer is to promote adhesion. |
6 | actuating arm assembly the roller bearings are positioned at the outermost position or ends within the bore 50 of the actuating arm to provide maximum stable support for the arm the outside ends of the respective roller bearings are spaced from the respective housing wall by a distance d which in a normal embodiment is on the order of about 2 2 millimeters or 0 086 inches the height of each bearing unit raceways are on the order of about 6 millimeters thus the spacing between the end of the bearing and the housing of 2 2 millimeters provides the spacing or clearance available for bearing seal as previously described an annular seal 52 has an inner edge secured by suitable adhesive means 54 to the inner race 44 and adhesive means 56 to the outer raceway 46 this seal member 52 may have any number of physical and structural characteristics as will be described however it is preferably impervious and elastic and secured such that at home or neutral position of the arm assembly there is no torsional stress in the seal member the arm assembly 22 in the typical embodiment swings on the order of about 7 to 10 degrees to each side of the neutral or home position however in. |
4 | 2 and acts on a greater length of the yarn 1 creates a tension force 7 which is equal to the tension force 8 which is created by the oppositely directed greater portion of the jet of gas 3 and which is acting upon the shorter yarn length up to the sharp bend 6 in a variation of the embodiment of fig1 it is also possible that the jet of gas 3 impinge perpendicularly upon the yarn 1 fig3 and 4 show an apparatus intended for the execution the method a yarn guide body 9 having a channel 10 is arranged extending so far into the yarn path that the yarn 1 makes contact with the channel 10 at the base 13 and is deflected from its original path the yarn guide body 9 thereby assumes such a position that the bend 6 is located at the location where the yarn 1 runs onto the yarn guide body 9 and that the base 13 of the channel 10 is directed to the yarn motion direction 2 a nozzle 11 which is connected to a blower which is not illustrated having a diameter corresponding approximately to the width of the channel 10 is arranged such that its outlet opening 12 is directed against the yarn guide body 9 and is arranged exactly opposite to the channel 10 when a jet of gas 3 is directed by means of the nozzle 11 onto the yarn 1 there builds up an air damming zone in the channel 10 having a maximum directly under the jet of gas 3. |
8 | present invention may be practiced without these specific details in other instances well known methods procedures components and circuits have not been described in detail so as not to obscure the present invention although embodiments of the invention are not limited in this regard discussions utilizing terms such as for example u201c processing u201d u201c computing u201d u201c calculating u201d u201c determining u201d u201c establishing u201d u201c analyzing u201d u201c checking u201d or the like may refer to operation s and or process es of a computer a computing platform a computing system or other electronic computing device that manipulate and or transform data represented as physical e g electronic quantities within the computer 39 s registers and or memories into other data similarly represented as physical quantities within the computer 39 s registers and or memories or other information storage medium that may store instructions to perform operations and or processes although embodiments of the invention are not limited in this regard the terms u201c plurality u201d and u201c a plurality u201d as used herein may include for example u201c multiple u201d or u201c two or more u201d the terms u201c plurality u201d or u201c a plurality u201d may be used throughout the specification to describe two or more components devices elements units parameters or the like for example u201c a plurality of stations u201d may include two or more stations although not limited in this respect embodiments of the present invention provide mmwave wpan systems based on the ieee 802 15 3 and ieee 802 15 3b specifications but with the introduction of the support of the beam steerable directional antennas further embodiments of the present invention may provide mmwave wpan systems with omni directional low. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.