label
int64 1
9
| text
stringlengths 113
6.79k
|
|---|---|
3 | on between the surface of the paper layers or one plastic layers before the compressing step is performed on the semi finished product the preferred high adhesion material is the adhesive material for example epoxy adhesive cyanoacrylate adhesive etc having high cross linking density property after curing wherein the cyanoacrylate adhesive and epoxy adhesive has high and rapid cross linking properties the adhesive tape having a circular or non circular shape is then compressed into flat adhesive tape 260 with flat shape furthermore a layer of interfacial layer having high adhesion for example a stiff interfacial layer 226 coated by a layer of high adhesion material 224 can also be placed on the symmetric plane of adhesive tape 260 before the compressing step is performed the flat adhesive tape 270 as shown in fig 7 is formed after the compressing step is performed the interfacial layer 226 without coating with high adhesion material can be used instead of the interfacial layer coating with high adhesion material the interfacial layer 226 can extend and flatten the adhesive tape along the plane of symmetry this makes the adhesive tape become the flat adhesive tape 280 wherein the interfacial layer 226 has a length longer than or equal to the half length of the innermost circumference of the adhesive tape as shown in. |
2 | first embodiment fig3 shows a partially cut away side view of one ball screw actuator 70 in either the first or second embodiments in each embodiment there will actually be a second identical ball screw actuator present for each flap 30 in order to have a back up actuator in case the first should fail the ball screw actuator 70 comprises ball bearings 71 which fit into two sets of channels 72 formed between two internally threaded portions 67 a of the outermost rod section 62 and the externally threaded portion 67 b of the intermediate rod section 63 the ball bearings 71 fill up the two sets of channels and cause the intermediate rod section 63 to move in relation to the outermost rod section 62 fig4 shows a perspective view of the linkage system 80 90 100 in either the first or second embodiments the linkage system comprises three components an a link 80 a support bracket 90 and an i link 100 the a link 80 comprises an a frame 81 the a frame 81 is provided with two foot portions 82 83 extending behind the u201c a u201d shape from the bottom of the two legs of the u201c a u201d shape each foot portion 82 83 is provided with a hole 84 85 a pin 88 is located through bushes in the two holes 84 85 so that the pin 88 is parallel to but behind the bottom of the u201c a u201d shape the pin 88 is fixed between a pair of adjacent ribs 22 a 22 b at the leading edge of the aircraft wing 510 the a frame 81 can pivot around the pin 88 and so can pivot with respect to. |
7 | computes the relative distance by multiplying the velocity of light by one half the time difference between the time of the emission module 222 emitting the pulse signal and the time of the receiving module 224 receiving the reflected signal the digital signal 401 for example when the signal level u201c 1 u201d first shows up might be the reflected signal from the target if 3 clock signal cycles have passed between emitting the signal and receiving the reflected signal and the clock signal cycle is 0 11 microseconds then the signal cycle is 0 11 u00d7 3 0 33 microseconds the time for the laser light to travel to the target and back one time therefore the distance is time 0 33 2 0 167 microsecond multiplied by the velocity of light 3 u00d7 108 meters per second which is 50 meters all the possible distance of the targets of the digital signals 401 402 and 403 can be derived in the same way if the x axis denotes the distance and the y axis denotes the accumulated showing up times then the distribution will be as shown in fig5 according to the ratio of the strength of the target signal i e the strength of the signal 100 meter far to the strength of the noise in every distance and in the form of logarithm db a s n chart in which the x. |
9 | projection 220 corresponds approximately to the contour shape of the closure plate 219 or that of the inner side of the filter frame 213 receiving the closure plate 219 and plate 221 this means that the actuation arm 225 has approximately the same width as the plate 221 at its free end the actuation arm 225 carries an actuation nose 216 slightly displaced off centre which nose moves a closure member v of a mounting plate 201 for the dust filter bag 208 along with the nose in the manner described above the mounting of the actuation projection 220 on the plate 221 is explained in more detail with reference to fig2 to 26 the plate 221 has perpendicularly extending shanks 230 231 on which the the actuation projection 220 is mounted at its sides the shanks being connected at their free ends by means of a bar 232 at the opposite end from the axis 227 the actuation arm 225 of the actuation projection 220 is guided between the underside 235 of the plate 221 and the bar 232 a retaining nose 236 abuts against the bar 232 on extension of the springs 228 229 and prevents the arm from being withdrawn the springs. |
3 | u00b0 c for 30 seconds and annealing and extension at 70 u00b0 c for 3 minutes and 25 cycles of denaturation at 94 u00b0 c for 30 seconds and annealing and extension at 68 u00b0 c for 3 minutes amplified products were used as templates in a nested pcr reaction using the previously described cycling parameters the reamplified products were then analyzed by southern blotting using oligonucleotide probes specific for p110 u03b4 probes 100 ng each were end labelled with 32 p u03b3atp and hybridized and washed under standard conditions frisch and sambrook the sequences of the two probes were gatgcggaacggctgctccaggg seq id no 11 and ccagggaccacagggacacagag seq id no 12 the specific 5 39 race pcr products identified in this manner were gel purified and subcloned into the ta vector pcrii invitrogen san diego calif according to the manufacturer 39 s instructions three independent clones were sequenced to ensure the veracity of the 5 39 sequence a full length cdna for p110 u03b4 was assembled from clones 249 m 928 and the 5 39 race pcr products the 5 39 race product was used as a template in pcr using the 5 39 primer agttacggatccggcaccatg gactacaaggacgacgatgacaag ccccctggggtgga ctgccc seq id no 13 and the 3 39 primer ccacatgtagaggcagcgttcc seq id no 14 the 5 39 primer includes a bam hi site underlined and sequences that encode the flag peptide sequence dykddddk seq id no 15 shown in parenthesis which is recognized by the m2 anti flag monoclonal antibody kodak scientific imaging systems new haven conn the resulting pcr product was digested with bam hi and afl ii and was ligated along with an afl ii pvu i fragment derived from the clone m 928 and a pvu. |
2 | carried out throughout the entire region in which the flow of air moves and a function of aromatic substances antibacterial agents and dehumidifying agents is added and the replacement interval for aromatic substances etc is easily and effectively measured fig1 shows the installed filter assembly in the context of one embodiment example of the present invention fig2 shows the overall design of the filter assembly shown in fig1 fig3 shows the installed filter assembly in the context of another embodiment example of the present invention fig4 and fig5 show the installed filter assembly in the context of additional embodiment examples of the present invention fig6 a shows a cross section of the first pleated part and the second pleated part of the filter assembly shown in fig1 fig6 b and fig6 c show a cross section of the first pleated part and the second pleated part of the filter assembly shown in fig3 fig6 d shows a cross section of the first pleated part and the second pleated part of the filter assembly shown in fig4 fig7 a and fig7 b show a cross section of the diffusion member of the filter assembly shown in fig1 fig8 shows the state in which the filter assembly shown in fig1 is installed in the filter channel and fig9 is a diagram showing a filtering system which comprises a filter assembly according to a further embodiment example of the present invention as is clear from fig1 and fig2 the filter assembly 1 according to the present invention consists of a first pleated part 10 a second pleated part 20 an end strip 30 and a diffusion member 40 in the specification of the filter assembly 1 according to the present invention the upper. |
2 | be appreciated that a piece of an event used object may be shaped to resemble a miniature version of the original object for example if the memorabilia item is a piece of a baseball bat the piece itself may be shaped in the form of a miniature baseball bat the above list is meant only to illustrate a few possible items that may serve as a memorabilia item and the definition of memorabilia item is not intended to be limited to an item on the list the scope of possible memorabilia items must be construed to extend to any possible memorabilia item associated with the field of sports celebrity or historic memorabilia accordingly the general concept provided in the disclosure of the present invention is as follows 1 provide a line of carrier items with a predetermined display location thereon 2 select a portion of the carrier items within the line to which an authentic memorabilia item is affixed in the display location 3 affix an optional decoy memorabilia item that is identical in shape and size to the authentic memorabilia item to the display location on the remaining portion of carrier items 4 conceal the authentic and decoy memorabilia items with memorabilia seal comprising a tamper proof concealing means 5 optionally attach a memorabilia shield to the carrier item that serves to protect the memorabilia seal and further conceal the memorabilia item turning now to the fig1 and 2 the present invention is illustrated in the context of a pair of athletic shoes 10 the athletic shoes 10 in this example are the carrier item 10. |
7 | hard surface and uniform electrical properties necessary for the transfer of toner from the print head 14 to the compliant receiver 18 in addition the overcoat layer facilitates efficient toner transfer to the print media 20 the blanket layer 30 is between 0 5 mm and 30 mm thick and preferably between 2 mm and 10 mm its young 39 s modulus should be less than 10 mpa and preferably between 0 5 mpa and 5 mpa the resistivity of the blanket layer should be less than 10 9 ohms cm preferable less than 10 7 ohms cm suitable materials for this blanket layer are polyurethanes silicone rubbers and silicone foams properties of the overcoat layer 32 arc a thickness less than 100 u03bcm and preferably between 5 and 30 u03bcm with a young 39 s modulus greater than 100 mpa its resistivity should be greater than 10 10 ohms cm suitable materials include fluoropolymers sol gels ceramers and polycarbonates preferably this overcoat layer is made of materials having a low force of adhesion to the toner a compliant receiver according to the present invention was constructed by providing a cylindrical aluminum drum 9 5 cm diameter and 7 cm inches long a compliant blanket layer of 6 mm thick polyurethane doped with ferric chloride antistat so that the bulk electrical resistivity was 2 u00d7 10 8 ohm cm and having a young 39 s modulus of 4 83 mpa was cast on the core the blanket layer was then cured in an oven at 150 u00b0 c for 8 hours after curing the blanket layer was. |
9 | from the railing bolt 44 nondetachably fixes the rail to post 22 and said bolt cannot be removed when post 22 is capped by said cap 12 fig4 d depicts cap 12 welded onto post 22 such that nut 46 cannot be removed from carriage bolt 44 cap 12 also known as concealment plate 12 is l shaped and completes the top and side of channel shaped post 22 the horizontal truncate part of concealment plate 12 completes the top of the post and the elongate vertical part completes the side channel post 22 has two small sections of angles welded to each side of the post for the cover plate to slide through trapping concealment plate 12 on each side and the horizontal top of concealment plate 12 is secured by self tapping screws so that no welding is needed upper and lower rail assembly 40 circled in fig4 c is easy to assemble in the field and requires modest levels of experience or training if fasteners are precast into a concrete structure the installation of mounting plates 42 onto the fasteners merely requires insertion of pad 52 such as a neoprene pad and shimming to plumb on level surfaces and gentle grades either an edge shim or beveled shim plates may be used for shimming to plumb for example once mounting plates 42 are shimmed and fastened to the pavement the remaining steps quickly erect segments of the railing lower rail 26 is fastened to posts 22 pickets 23 are then respectively inserted into pre cut holes 15 in each insert 24 of lower rail 26 upper rail 26 which may be identical to the lower rail is fitted onto pickets. |
1 | the discharge previously without the addition of this handle 16 an elderly user would struggle trying to grasp one side of the tailpiece 14 as invariably he would pinch both sides the handle 16 is located on the tailpiece 14 such that it does not interfere when the end of the tailpiece 14 is folded and closed by a removable clip assembly not shown the body 12 includes a mouth rim means 30 joined to the front wall 12a of the ostomy bag 10 the mouth rim means 30 is attachable to a stoma flange not shown secured on a patient above the mouth rim means 30 and on the end of the ostomy bag 10 opposite the tailpiece 14 is a cylindrical hollow extension piece 0 with external threads 21 thereon the extension piece 20 in the preferred embodiment is located at the seam of the ostomy bag 10 between front and rear walls 12a and 12b the extension piece 20 includes an opening which serves as an entry port 19 for cleaning fluids i e a combination of soap and water extension piece 20 is sufficiently rigid in order to maintain the upper portion of walls 12a and. |
2 | the gas phase though it is not limited to the capture of this material and is seen as a useful new method for metal vapor capture the synthesis procedures used is described and detailed characterization data are reported the substrate used in this study is silica gel grade 62 with a mesh size of 60 200 and an average pore size of 150 u00e5 davison chemical maryland usa nitric acid sulfuric acid hydrochloric acid dichloromethane potassium chloride and toluene were purchased from fisher scientific pittsburgh pa dichloromethane 3 aminopropyltriethoxysilane apts disodium hydrogen phosphate glutaraldehyde 50 wt in water cysteine hydrochloride monohydrate anhydrous borax sodium borohydride and 6 aminocaproic acid 6 aa were purchased from sigma aldrich inc milwaukee wis the molten salt methylpolyoxyethylene 15 octadecanammonium chloride mec was a gift from akzo nobel chemicals mccook ill all chemicals were used as received except toluene was dried with 4 u00e5 molecular sieves fisher scientific pittsburgh pa prior to use five grams of silica gel were dried overnight in a vacuum oven at 170 u00b0 c the silica was then hydroxylated under total reflux in a mixture of 25 ml of 6 m nitric acid and 25 ml of 6 m sulfuric acid at 100 u00b0 c for 12 h the residue was washed with distilled water by decantation until a neutral ph was achieved and then dried overnight in a vacuum oven at 110 u00b0 c cysteine was selected as the chelating agent and bonded in a self. |
6 | back wall of the main housing 120 or in other configurations can behind the back wall of the main housing 120 or in yet other configurations can stick out behind the back of the main housing 120 for example fig5 a shows an exemplary configuration of the exemplary refrigerator where the fan can be seen outside fig5 b shows an exemplary configuration of the exemplary refrigerator where the can is integrated within the housing and cannot be seen from the outside the exemplary refrigerator can also include feet 146 on a bottom surface that can grip to a surface e g a countertop surface which can prevent the unit from sliding the feet 146 can be made of rubber silicon or other suitable material that prevents the unit from sliding fig6 illustrates one exemplary embodiment of the feet 146 with a set of exemplary dimensions for example the feet 146 shown in fig6 can have a generally oval shape and in some configurations can have a radius 186 of approximately 0 08 inches the exemplary feet 146 can be positioned at a distance 188 of 0 670 inches from one edge as shown in fig6 and at a distance 190 of 0 220 inches from a second edge the exemplary feet 146 can in one configuration be positioned at a distance 192 of approximately 3 700 inches from the center of the exemplary fridge the exemplary feet 146 can have a length 194 of approximately 0 540 inches it is appreciated that in other configurations the feet 146 can have other configurations shapes and dimensions according to further exemplary embodiments of the present disclosure the exemplary refrigerator can have. |
9 | u201d around until they are incident upon the microwave absorbing material 24 the channels 12 and 14 are further configured to guide the microwaves to the microwave absorbing material 24 the temperature of the particulate trap 10 may be regulated by the properties and location of the microwave absorbing materials and by controlling the application of the microwave energy fig4 and 5 illustrate end plug heating in a particulate trap 10 of the present invention the end plug 18 in fig4 is comprised of a microwave absorbing material the diesel exhaust is filled with particulates 34 and flows through the honeycomb ceramic walls 20 depositing soot 16 upon the upstream walls 20 of the particulate trap 10 microwaves incident upon the microwave absorbing plug 18 heat the plug 18 and the heated plug 18 initiates the burn off of the soot 16 to clear the walls 20 of the particulate trap 10 as seen by waves 17 that represent the flame front of the particulate burn off in an end plug heating configuration of the present invention the burn off will initially occur where the particulate mass or soot 16 is the highest at the end of the closed end channel 14 and propagate to the rest of the closed end channel 14 the exotherm of a relatively small amount of particulates that are ignited by the end plug 18 will be leveraged to burn a relatively large amount of soot fig5 illustrates the performance of the particulate trap shown in fig4 the exhaust gas velocity will decrease as a function of the distance of the closed end channel 14 the heat generated by the particulate heat release will initially be localized near the end plug 18 and then propagate as a. |
1 | source 14 of medicinal fluid b are both coupled in fluid communication with a proximal end 16 of a cassette 15 the flow of medicinal fluid a into the cassette is selectively controlled by a supply valve 20 and the flow of medicinal fluid b is selectively controlled by a supply valve 18 if cassette 15 is to be used to pump only one of these two medicinal fluid at a time only the appropriate supply valve 18 or 20 is opened to select the medicinal fluid to be pumped the selected medicinal fluid or fluids then flow s through an air sensor 22 and into a mixing chamber 26 the air sensor and mixing chamber are common features of cassette type infusion pumps the purpose of the air sensor is to detect air bubbles that may be entrained in medicinal fluid a and or b before the fluid is passed on into the pumping chamber and to the patient excess air bubbles entering a patient 39 s bloodstream can cause an air embolism with potentially harmful consequences a proximal or inlet pressure sensor 24 is disposed within mixing chamber 26 the selected medicinal fluid or fluids exit the mixing chamber through an inlet valve 28 when the inlet valve is in its open position and into a. |
2 | payload toward a selected azimuth direction in fig2 the the monoprop embodiment of the lander 10 is shown to scale 36 in feet with other notable lunar artifacts such as the surveyor lander 38 an apollo moonwalking astronaut 40 the lunar roving vehicle 42 and lunar excursion module 44 it is especially poignant to compare the relative size of the spinning lander to surveyor demonstrating how efficient the spinning lander architecture can be since the functionality of the two systems on the lunar surface is comparable again a key feature of the present invention is that landing legs have been added to the despun section of the lander in fig3 the top end of the spinning section 12 is shown as a rotor mechanically connected to the despun section 14 via the despin motor bearing assembly 48 a triaxial rf antenna 50 essentially of the same design as the syncom geosynchronous satellite from the early 1960s is shown rigidly attached the spinning section aligned with its spin axis not all details of this antenna design are drawn all communications with the lander u2014 telemetry command and wideband data from the moon u2014 are via this antenna and the communication system on the spinning section of the lander the despun section structure consists of a despun shelf structure 46 which overlays and protects the spinning rotor below it the landing legs 20 1 or more and microwave transparent antenna mast 16 the separately rotatable despun payload module 18 is shown at the top of the antenna mast affixed to the payload module pan platform 54 with its. |
9 | and hexafloropropylene fep and or the like the ph adjuster can be comprised of any number of materials including but not limited to any suitable base that will not poison the mea upon integration into the pem fuel cell a second sample was prepared in accordance with the example set forth above but without the ammonium carbonate the ph of this sample before addition of the ptfe was measured to be 4 9 the data points for the same can be seen plotted in fig2 as fig2 illustrates the dispersion samples are very stable and appear to exhibit favorable high current density characteristics to confirm this the formulation of the first sample prepared in accordance with the example set forth above was mimicked except that was substituted in various quantities for the ammonium carbonate to show a ph trend with performance the ph values of the dispersion samples are set forth in table i below in order to confirm dispersion instability the a dispersion sample was adjusted with an acid i e sulfuric acid h 2 so 4 the ph value for the same set forth in table ii below the data points for the various dispersion samples described above can be seen plotted in fig2 as fig2 illustrates as ph is increased in the samples it does aid in the high current density performance or. |
7 | 1 5 inches at a speed of approximately 3 3 cycles per second the speed and distance of travel are selected so that the samples never experience negative gravitational loading and therefore never cavitate for a 0 75 inch spacing between the axis of drive wheel 61 and cam 63 the maximum speed of wheel 61 at which cavitation is avoided is 216 rpm this provides a maximum acceleration to the cuvettes of 32 ft sec 2 and a reciprocation rate of 3 6 cycles per second to provide synchronization signals for the demodulation circuitry utilized in conjunction with the spectroflourometer for demodulating the alternate time multiplexed sample measurements into a single differential output signal the sample positioning assembly 40 includes a pair of position transducers 80 and 81 which are actuated by an arm 82 carried on the cuvette carrier drive arm 60 these position transducers which may be conventional optical type transducers having their own light source for detecting the proximity of arm 82 are preferably adjustable along the axis of reciprocation to allow a close correspondence to be obtained between the cuvettes being in position and the presence of a synchronizing signal referring to fig8 the output of position detector 80 representing positioning of the lower cuvette 43. |
2 | the printing form cylinders 4 5 the printing form cylinders 12 are inked by the ink applicator rolls 16 an ink applicator roll 16 in each case inking a printing film 12 in that during one revolution of a printing form cylinder 4 5 it is thrown cyclically onto the relevant printing film 12 and lifted off again during printing the transfer cylinders 2 3 and the printing form cylinders 4 5 rotate synchronously and continuously with an approximately equal circumferential speed ink being transferred from the printing films 12 to the covers 11 fig2 1 shows the satellite offset press at a machine angle of 0 degrees a sheet 9 has been transferred into the gripper system of the segment e of the impression cylinder 1 the impression cylinder 1 has the same circumferential speed as the adjacent transfer cylinders 2 3 when the impression cylinder 1 the transfer cylinders 2 3 and the printing form cylinders 4 5 rotate synchronously onward then the sheet is printed with the color black the segments a e of the transfer cylinder 2 and of the impression cylinder 1 roll on one another which is shown at a machine angle of 90 degrees in fig2 2 in fig2 3 at a machine angle of 180 degrees it is shown that a second sheet 9 has been transferred into the gripper system 8 of the segment f of the impression cylinder 1 during synchronous onward rotation of the impression cylinder 1 and of the adjacent transfer cylinders 2 3 as shown in fig2 4 at a machine angle of 270 degrees the second partial image is printed on the sheet 9 in the color cyan on the second segment e and. |
4 | the radii r 1 and r 3 intersect at the centre point m of the cylinder 4 reference numeral 19 denotes the side screen the card flat bars 14 are extruded hollow profiles made of aluminium having an internal cavity 14 c fig3 a and 3 b show a first embodiment of card flat bar according to the invention the card flat clothing 24 consists of clothing tips 18 wire hooks and a supporting element 25 support layer made of a textile material the wire hooks 18 are approximately u shaped and punched through the surface 25 u2032 are fixed in the supporting element 25 the turn regions 18 u2032 see fig4 of the wire hooks 18 project beyond the surface 25 u2032 the ends of the wire hooks 18 the clothing tips are free the wire hooks 18 consist of steel wire two ribs 14 d 14 e are provided laterally on the card flat foot 14 a in the longitudinal direction so that in the region of the foot face there is a recess 14 f by means of which the card flat clothing 24 is held protected and embedded in the recess 14 f there is arranged a magnetic element 29 for example a magnetic tape magnetic strip magnetic bar or the like which is attached to the foot face by means of an adhesive layer 30 the magnetic element can also be formed on the card flat bar by casting compression moulding or the like for example magnetic powder with a curable resin the magnetic element. |
2 | rotate with the pump impeller 5 fig3 illustrates the impeller end of the drive shaft 6 which has been machined to receive the preloader device 8 the machining process is performed such that the preloader device 8 may be placed the desired distance from in front of the eye of the marine jet drive impeller thus for a drive shaft 6 having a first land 10 with a keyway 11 for receiving an impeller 5 and threaded 12 to receive a keeper nut and or spinner a second land 13 to receive the preloader device 8 is machined upstream from the first land 10 and a keyway 14 is machined to accept a key to secure the preloader device 8 to the drive shaft 6 the length of the second land 13 and its distance from the shoulder 15 of the first land 10 are determined by the depth of the preloader device 8 and the desired spacing upstream from the impeller 5 a distance of one inch between the preloader device 8 and the marine drive impeller 5 has been found effective however the distance between the two elements may vary according to the desired load or the space constraints of the marine jet drive housing if necessary a spacer 16 which fits in a snug fashion over the marine jet drive shaft 6 is used to keep the desired distance between the preloader device 8 and the impeller 5 when the machine work is complete the marine jet drive shaft 6 together with the preloader device 8 the key the spacer 16 if needed and the primary jet drive impeller 5 are installed into the jet drive unit and the nut not shown which originally. |
3 | by the following examples which are intended to be exemplary a binder solution was formed by dissolving ethyl cellulose in octerpineol at a cellulose terpineol weight ratio of between 1 10 and 1 12 the mixture was allowed to stand until the ethyl cellulose was substantially wet the mixture was then passed through a 3 roll mill to further mix and homogenize the solution silver and palladium particles 70 30 weight ratio and ferrite particles the metal particles having average diameters of about 1 u03bcm were mixed with ethanol in an amount approximately half the total weight of the metal particles and 0 5 wt oleic acid was then added the amount of each type of metal was determined based on the desired ferrite loading the mixture was then ultrasonicated for about 5 minutes after several hours of settling of the metal particle mixture about 60 wt solvent was extracted the metal powder however was not allowed to dry the amount of binder solution needed to provide about 1 8 wt ethyl cellulose based on the weight of the total ink metal ferrite binder and solvent was determined and that determined amount was added to the metal powder the mixture was manually mixed and placed onto a slow roller mill for homogenization the mixture was placed onto a 3 roll mill to evaporate the ethanol and obtain a desired viscosity if necessary additional u03b1 terpineol was added to adjust the viscosity as prepared the ink contained 74 u00b1 2 wt metal powders and 1 8 u00b1 0 1 wt ethyl cellulose based on the weight of the overall. |
8 | ground terminal in fig4 c except command inputs from an external beam controller 440 to identify the beam positions and associated nulls for multiple beams concurrently pointed to different satellites in accordance with the present invention the command pointing is depicted in the 440 and 441 blocks based on 1 where the terminal is located and how it is oriented and 2 time of the date to derive satellite positions in inclined orbits the external beam controller 440 calculates the pointing directions toward desired satellites and nulls against undesired satellites in inclined orbits in terms of local azimuth and elevation or equivalent the information for a beam position and associated nulls is captured by the updated bwv stored in a buffer 420 in a rx dbf processor 430 fig5 a depicts a schematic view of an embodiment of a parabolic antenna in accordance with the present invention the reflector 502 has a paraboloid surface and is illuminated by a linear feed array 504 comprising four feed element aligned in the local elevation north south direction the beam from the satellite is indicated schematically at 506 by switching the transmit drive signal to various elements of the feed 504 as described previously the beam can be made to scan in the elevation direction as indicated at 508 in another embodiment in accordance with the present invention and illustrated in fig5 b the reflector has a parabolic toroidal surface that is parabolic in the elevation direction and circular in the azimuth direction the feed 530 of this embodiment comprises four independent four element linear arrays e g 522 and 524 each of the four element arrays is positioned in the focal plane. |
1 | a handle 110 consisting of two portions 111 and 112 which may be connected by appropriate fastening means such as screws 113 the handle 110 may be connected to the two sets 80 and 81 of fig5 for handcarrying them by respective flexible straps 82 and 82 39 from the respective sets 80 and 81 in this case the handle 110 may be disposed parallel to the housing side walls 46 47 fig1 illustrates two sets of housings and drawers 80 and 81 each set 80 and 81 consist of two housings and drawers and the two sets are disposed adjacent to each other the flexible straps 82 interconnect housings 11 and 11 39 of set 80 and the straps 82 39 interconnect housings 11a and 11a 39 of set 81 to each other both straps 82 82 39 are jointly clamped between portions 102 and 103 this will prevent housings 11 and 11 39 from separating as well as housings 11a and 11a 39 the alignment tabs such as 51 again lock housings 11 and 11 39 as well as housings 11a and 11a 39 so that they cannot move relative to assemblies 80 and 81 finally push pins or rivets 115 extending between housings 11 and 11a prevent housings 11 and 11a from moving respectively to. |
1 | ribbon conductors overlap wound over the dielectric material 88 so as to compress the dielectric material and so as to provide a flexible outer conductor which makes the transmitter cable easier to manipulate and pass along narrow and tortuous passageways in arteries and the like as shown most clearly in fig7 the outer conductor can be considered to be overlap wound in two directions the first or lower layer being wrapped in overlapping layers toward the right as shown in fig7 and the upper or outer layer being wrapped in overlapping layers progressing to the left as shown in fig7 fig7 depicts the outer conductor overlap windings as they would be formed about the proximal end of the transmitter cable the first winding 92 being placed flat against the dielectric material 88 subsequent windings extending to the right over the dielectric material 88 overlap a respective immediately preceding winding and compress the dielectric material the last winding on the lower layer also contacts the dielectric material after which subsequent windings progressing in the opposite direction to the left as shown in fig7 overlap the respective immediately preceding winding and also cover the immediately underlying windings on the first layer the windings on the second layer continue until the first winding 92 is reached at which point the windings in the second layer are terminated and fixed to prevent unwinding of the outer conductor the outer conductor 90 is preferably formed approximately 0 005 inches by 0 0015 inches the use of this coil material for the outer conductor arranged in the described manner provides a thin flexible and appropriately. |
8 | at this pixel average beam power at this pixel total number of times this pixel has been scanned average number of times this pixel has been scanned time when this pixel was first scanned by the beam time when this pixel was last scanned by the beam pulse width experienced at this pixel and maximum power allowed at this pixel the u201c total accumulated beam power at this pixel u201d is computed by simply adding the instantaneous beam power to the current value stored in the u201c total accumulated beam power at this pixel u201d this value may be used to monitor and visualize the total power delivered in each area of the audience this data element may also consist of separate data elements for red green and blue beam power if it is desired to monitor and attenuate these separately the u201c average beam power at this pixel u201d is related to the u201c total accumulated beam power at this pixel u201d in that it represents a beam power that is accumulated over time and it is calculated using the instantaneous beam power as an input however the u201c average beam power at this pixel u201d requires an additional level of computation in order to produce a value that represents an average over time this may be. |
6 | considering the error on the cumulation over a whole cycle implies that this sequence that is the cycle is significant for this calculation hence indivisible in fact a zero mean error can be obtained on the whole sequence by underestimating the cumulation over one part of the cycle and by overestimating it on another yet while these parts can be repeated independently the cumulative error will be high for example if the cycle contains city driving at low speed where the model overestimates the emissions and freeway driving for which the model underestimates the emissions a wide difference is accordingly accumulated between the prediction and reality by traveling exclusively in conditions specific to one of the parts if only city driving applies the emissions are always overestimated and never compensated for by a freeway underestimation on the contrary if these two parts were acceleration and deceleration this problem would not arise because the number would not vary despite the driving conditions the cumulation criterion on a sliding window is an intermediate criterion between these two extremes it consists in using the maximum absolute error of the cumulative quantity over a certain distance for example 1 km fig1 shows the general architecture of a system for estimating quantities of pollutant compounds emitted in the exhaust gases of a diesel engine according to the invention the system comprises one or more neural networks 1 receiving input data 2 and supplying the estimated quantities 3 at the output the system further comprises means 4 for cumulating the estimated quantities to give cumulative quantities 5 the system also comprises means 6 for resetting the estimated quantities of pollutant compounds independently of each other these means 6 are. |
6 | a result of the reduced pump displacement due to the forcing of lead screw 36 u2032 to the left the opposite result can be achieved by interchanging the positions shown in fig4 of cam positioning motor arrangement 36 and return force arrangement 47 of fig2 and 3 with respect to cam ring 44 this arrangement is shown in a schematic representation of a pump control system 30 u2032 u2033 in the cross section view of fig5 with vane pump 31 and the positionally interchanged cam positioning motor 36 and return force arrangement 47 here if return force arrangement 47 cannot force lead screw 36 u2032 through cam ring 44 to the right in a system failure that leaves drive shaft 33 continuing to rotate pump rotor 41 at the same angular rate such a failure again will result in no change in the flow rate of fuel pumped by pump 31 to outlet 34 thereof if alternatively return force arrangement 47 can force lead screw 36 u2032 to the right in a system failure that leaves drive shaft 33 continuing to rotate pump rotor 41 at the same angular rate such a failure will nevertheless result in a significantly increased rate of flow of fuel pumped by pump 31 to outlet 34 thereof as a result of the increased pump displacement due to the forcing of lead screw 36 u2032 to the right. |
7 | as make it execute the processing according to the present invention note that the program of the present invention may be received from another computer and held furthermore in fig2 the accumulated operating time of each pc measured since the initiation of the operation t 0 by the operating time measuring means 3 of the administrative server s is shown in a graph the axis of abscissa represents an leased or rented operating time time t from the initiation of the operation t 0 to the expiry of the operation time and the axis of ordinate represents the accumulated operating time of each pc the administrative server s determines combinations of candidates for rotation among the pc 1 to pc 5 at time tx after a certain time of time t 0 has elapsed within the leased or rented operation time time t when the operating times of the respective pcs needs to be averaged based on their accumulated operating times during the certain time of time t 0 this decision is made through a statistical process at the control means 1 of the administrative server s and the utilization tendency within the certain time time t 0 the magnitude of the accumulated operation time at the time tx a future utilization plan and the like are taken into consideration for example to look at the pc 1 the accumulated operating time becomes long to some extent at the time tx the utilization time drastically. |
5 | 10 of the drawings the drive shaft 30 has a corresponding retainment flange 30 a in retaining registration with the hereinbefore described flange end 31 of the drive shaft housing 29 the drive shaft 30 has an area of reduced transverse dimension 34 extending from the flange end 31 of the drive shaft housing 29 registering within the shaft receiving cavity 21 of the button 16 a spring 35 in the spring seat 20 extends about a portion of the drive shaft extension 34 and against the drive shaft 30 imparting a resilient action to the button 16 during use referring now to fig1 of the drawings the handle housing 15 can be seen having an interior annular stepped configuration corresponding to an exterior stepped surface of the button 16 and with the drive lock fitting 22 aligning same to afford selective button gear teeth 18 a and drive lock fitting 22 gear teeth 27 for selective engagement indicated by directional arrows a upon button 16 displacement within the handle housing portion 15 when in assembly as shown in fig1 of the drawings the handle housing 14 rotatably supports the drive shaft housing 29 drive shaft 30 therein and threaded engagement lock nut 33 as assembled a handle spacer 36 and spacer lock retaining nut 36 a are. |
8 | to devices 102 with the correct credentials network gateway 108 may be integrated into the hardware of network 104 or may be a separate system connected to network 104 credentials may include one or more than one element and may consist of for example a telephone number network address or link local address the range of allowed credentials may change over time and the determination of whether credentials are valid may be static or dynamic for example static credentials may be fixed or dynamic credentials may be determined based upon a pre determined formula as discussed below credentials may be permanent or may be temporary network 104 may allow a device or devices 102 with credentials in a subset of a valid range access only to a subset of the network for example to management server 106 credentials may also be used to determine other aspects of a device 39 s access to network 104 or systems connected to network 104 such as indicating subscription level examples of using credentials to indicate subscription level would include programming network gateway 108 or other systems connected to network 104 to allow credentials within different subsets of the valid range to access different areas of the network or to be given a faster connection speed or have access to specific systems connected to network 104 network gateway 108 may direct communications that are initiated by devices 102 that have temporary credentials for example within a certain range to a destination connected to gateway 104 for example to management server 106 regardless of the destination specified by. |
9 | between the emitter and the base is a little bit positive for example 0 7 volt the transistor of carbon nanotube of the present invention can provide a good performance only when the voltage v eb between the emitter and the base is a little bit negative because as an energy gap in the base is actually approximately u201c 0 u201d the little bit negative voltage v eb should be applied to the emitter and the base for setting up an energy level positively when holes enter into the base in this instance a slight reduction of an absolute value of the voltage v eb between the emitter and the base which has a negative value has an effect identical to a slight increase of a voltage v eb of an orderly direction between an emitter and a base in the background art transistor when the absolute value of the voltage v eb between the emitter and the base which has a negative value is reduced slightly a number of holes in the base is reduced slightly this is identical to a slight provision of electrons to the base through a terminal connected to the base with a consequential attraction of holes in the emitter toward the base which produces a current gain alike the background art transistor a strong reverse bias is applied between the base and the collector if this is taken for a case when the emitter and the base are. |
5 | spectrum is the most temperature sensitive with the intensity of the spectrum varying with temperature although brillouin scattering and in certain cases rayleigh scattering are also temperature sensitive generally in one embodiment pulses of light at a fixed wavelength are transmitted from the light source in acquisition unit 28 down the optical fiber 26 at every measurement point in the optical fiber 26 light is back scattered and returns to the acquisition unit 28 knowing the speed of light and the moment of arrival of the return signal enables its point of origin along the optical fiber 26 to be determined temperature stimulates the energy levels of molecules of the silica and of other index modifying additives such as germania present in the optical fiber 26 the back scattered light contains upshifted and downshifted wavebands such as the stokes raman and anti stokes raman portions of the back scattered spectrum which can be analyzed to determine the temperature at origin in this way the temperature of each of the responding measurement points in the optical fiber 26 can be calculated by the acquisition unit 28 providing a complete temperature profile along the length of the optical fiber 26 in one embodiment the optical fiber 26 is disposed in a u shape along the wellbore 12 providing greater resolution to the temperature measurement fig2 shows a graph of the geothermal temperature profile 29 of a generic horizontal wellbore this profile shows at 30 a gradual increase in temperature as the depth of the well increases until at 32 a stable temperature is reached along the horizontal section of the wellbore the geothermal temperature profile is the temperature profile existing in the wellbore without external factors such as injection after injection or other external factors end the wellbore will gradually change in. |
7 | states x i t the number of states x i t and the number of weighting factors is incremented with each iteration in order to have a consistent set of weighting factors the weighting factors are recalculated in each iteration for all respectively for a set of selected states by fitting u03c1 j in the state space it is possible to use all the information of formula and o for the states x i t generated so far the fitting step allows to use different fitting strategies for example the fitting can bias the sampling away from areas where intensive sampling has been done in the preceding iterations or the sampling can be directed along local gradients respectively towards local minima or maxima of one or several weighted properties in each of the iterations the sampling distribution function is fitted in a way to improve the overall sampling of the state space the method supports multi objective optimisations state space integrals can be solved it reduces the probability that the system is trapped the invention is general it can be used with different sampling methods in particular with monte carlo sampling metropolis monte carlo sampling or dynamic simulations it can be combined with the concepts of simulated annealing and multicanonical sampling it provides a general framework that can be adapted to the system and the observables of interest application_number US 52419106 A description exploration of the state space proceeds in a series of steps shown in fig1 in a first step 1 an initial sampling distribution function u03c1 1 x is selected if necessary other starting parameters are. |
1 | in particular the limb attachment mechanism 430 is coupled to the parallel rods 420 via linear glide bushings these bushings allow the limb attachment mechanism 430 to slide along the parallel rods 420 thereby varying the radial distance from the drive shaft 400 to the limb attachment mechanism 430 it may be desirable to vary the distance between the drive shaft 400 and the limb attachment mechanism 430 to better accommodate the attachment of a patient 39 s limb to the joint exerciser apparatus 200 fig2 for example the patient is able to slide the limb attachment mechanism 430 until the limb attachment mechanism 430 is at a comfortable location on the leg further because the drive shaft is not centered in relationship to the patient 39 s knee the radial distance from the drive shaft to the limb attachment mechanism varies as the patient 39 s limb is moved through the flexion and extension cycle the leg support assembly 220 includes a locking mechanism 435 coupled to the limb attachment mechanism 430 for securing the limb attachment mechanism 430 in the proper position while the patient is mounting the machine the limb attachment mechanism 430 also includes strap mounts 440 the strap mounts 440 are configured to allow straps not shown to be mounted thereto the straps may then be used to secure the lower part of a patient 39 s leg to be attached to the limb attachment mechanism 430 when the lower. |
8 | y of the present invention is sealed with a silane sealant curve e its initial voltage drop is relatively low of the order of 50 millivolts and it decreases with service use thus it has been found that unlike the prior art tamping composition the shunt connection strength when employing the novel tamping composition y did not degrade after extended exposure to the current cycle test whether or not sealed when sealed with polyaryl sulfone it exhibited a high initial strength as well as final strength however the initial voltage drop was relatively high composition y when sealed with the silane sealant developed approximately the same high strength as when sealed with polyaryl sulfone while exhibiting low electrical resistance throughout specifically it was found that the connection strength for the brushes sealed with the silane curve e of fig2 remained substantially constant over the test period the millivolt drop measurement fig3 indicated a change from an initial value of 50 mv to a final value of 30 mv these are regarded as superior characteristics in that the final strength is high equal indeed to composition y with the polyaryl sulfone solvent and further the final millivolt drop is low being equal to or. |
4 | paa solution at a molar ratio bpda oda ppda bia 6 1 3 2 three diamine monomers oda p pda and bia are put in a three necked flask at first then measured solvent dmac is added oda p pda and bia are mechanically stirred at 50 u00b0 c under the protection of nitrogen and are fully dissolved then bpda is added in batches and stirred to ensure its solid content is 25 then under the protection of nitrogen it is stirred 10 h at 50 u00b0 c and 5 h at u2212 10 u00b0 c to obtain a viscous paa solution with intrinsic viscosity of 3 1 dl g preparation of pi fiber after the paa solution is filtered and defoamed it is spun by a wet process after the spinning solution is pumped out by a metering pump it passes the spinneret plate number of bores 500 bore diameter 0 55 mm and enters a coagulating bath it comprises water and dmac with a volume ratio of 1 1 to form paa fiber after it is washed in a washing bath comprising water and ethanol with a volume ratio of 3 1 it directly enters the four stage heat furnaces in turn the temperature of the heat furnaces is 160 u00b0 c 270 u00b0 c 350 u00b0 c and 500 u00b0 c respectively and the draw ratio is 2 1 5 1 1 and 5 5 respectively in the end the yarn is wound into a. |
3 | recorded and rated as 0 to 5 using the ratings criteria as defined herein versus a control made from 100 windshield edge trim in the following table 5 after the pulling test the entire set up was put back in a vacuum oven under nitrogen at 36 u2013 41 u00b0 c overnight after cooling the same pulling procedures were repeated and the difficulty easiness of the pulling was rated and recorded in table 5 all the procedures were repeated for the third time but the vacuum oven temperature was set at 46 to 50 u00b0 c overnight the toughener was melt blended together with nylon 6 ultramid b 3 available commercially from basf corp and glass fiber ppg 3660 available commercially from ppg industries the additives are all commercially available or described herein the free flowing toughener described above as sample c was used during the operation for melt blending the ingredients were primarily fed through individually controlled loss in weight feeders however for ease and control of feeding the nylon and the low percentage additive ingredients were first dry blended by tumbling in a drum the mixture was then compounded by melt blending in a 40 mm werner amp pfleiderer co rotating twin screw extruder with a barrel temperature about 240 u00b0 c and a die temperature of about 250 u00b0 c all the ingredients were fed into the first barrel section except the glass fiber which was fed into the sixth barrel section by use of a sidefeeder extrusion was carried out with a port under vacuum the screw speed was 250 rpm and the total extruder feed rate was 150 pounds per hour the resulting strand was quenched in water cut into pellets and sparged with nitrogen until. |
8 | deterioration of battery performance the present invention employs a material that can form an sei film on a surface of the negative electrode during initial charging without gas generation and deterioration of the battery performance such a material hereinafter referred to as an u201c additive u201d may include a compound with s or p or a carbonate based compound the compound with s or p includes a s u2550 o bond or a p u2550 o bond in its molecular structure examples of the compound with s or p include vinyl sulfone so 2 gas and 1 3 propanesultone and an example of the carbonate based compound is vinylene carbonate alternatively a compound containing the sei film components may be used the additive when added to a negative active material composition prevents the reaction between the surface of the negative electrode and the electrolyte at initial charging thereby inhibiting gas generation which results in the prevention of an increase in thickness of the battery and a decrease in capacity the negative active material composition of the present invention includes one or more carbonaceous materials which are known as negative active materials that is any compound that advances an electrochemical redox reaction and in which intercalation and deintercalation of lithium ions reversibly occurs may be used examples of which include amorphous carbon and crystalline carbon the amorphous carbon may be soft carbon hard carbon a mesophase pitch carbonized material or coke the. |
8 | point is calculated according to a received signal y r at the transmission frequency point in the embodiment the channel response u0125 r can be calculated according to a formula y r h r s r n r in step s 307 a channel response h i at the non transmission frequency point is calculated according to the channel response u0125 r at the transmission frequency point and the interrelation between channel responses at the transmission frequency point and at the non transmission frequency point in the embodiment the channel response u0125 i u03c8 i u0125 r at the non transmission frequency point can be calculated according to the u0125 r calculated in step s 306 and the interrelation between channel responses at the transmission frequency point and at the non transmission frequency point calculated in step s 304 where i 1 2 m and m is an amount of frequency points at which no reference signal is transmitted in step s 308 channel responses in all time domain and frequency domain are estimated by performing interpolation separately or simultaneously in frequency domain and time domain a diagram of a process of acquiring channel responses of a self interference channel via a small amount of reference signals provided in the first embodiment of the invention is shown in fig5 in the embodiment reference signals are transmitted at a small amount of frequency points and then channel responses at all frequency points can be calculated according to the reference signals transmitted at the small amount of frequency points therefore reference signal resource for self interference channel estimation is saved compared with a condition in conventional technology fig6 is a flow chart of. |
6 | couplings are especially applicable to wheel driveshafts of motor vehicles application_number US 57391195 A description fig1 shows a first embodiment of an elastic flexible shaft coupling c according to the present invention this shaft coupling c comprises four anchoring plates 1 2 and 3 4 the diametrically opposite anchoring plates 1 and 2 form a first coupling component the diametrically opposite anchoring plates 3 and 4 form a second coupling component all anchoring plates 1 2 and 3 4 are wholly independent units and are essentially identical essentially the anchoring plates 1 2 and 3 4 have the shapes of parallelipipeds and together define four radially outward circumferential surfaces 5 6 and 7 8 and two outer mounting surfaces 70 71 depicted in fig2 each anchoring plate 1 2 and 3 4 comprises at its respective radially outward circumferential surface a pair of an anchoring pins 9 9a 10 10a 11 11a and 12 12a for a total of eight pins each anchoring pin 9 9a 10 10a 11 11a and 12 12a points radially outward with each pair extending at right angles relative to the other in the assembled condition depicted in fig1 adjacent pin sets 9a and 10. |
8 | since it has at least a ten fold lower solubility in copper next to form a copper conductor the method fills trench 20 as fig5 shows by depositing a 975 nanometer thick copper layer 24 on layer 22 and inside trench 20 in some embodiments another 10 nanometer thick adhesion layer is formed atop copper layer 24 to inhibit copper oxidation during later processing particularly during curing of subsequent polymeric layers to reduce copper oxidation one embodiment performs the adhesion material and the copper deposition at temperatures less than 450 u00b0 c another embodiment at temperatures between about 250 and 350 u00b0 c and another at around 300 u00b0 c in the 250 350 u00b0 c range a thin layer of cu 5 zr or beta tends to initially form at the interface of the copper and zirconium layers inhibiting diffusion of zirconium into the copper and preventing it from significantly increasing resistance of the copper a similar effect may be achieved by electroplating the copper and heat treating the zirconium and copper layers at 250 350 u00b0 c for one to two hours before curing the polymer inhibiting the diffusion of zirconium into the copper ultimately yields a copper conductor with a conductivity greater than 95 percent of iacs or international annealed copper standard the international annealed copper standard iacs is 1 7241 microhm centimeters at 20 c or 17 241 nanaohm meters thus the exemplary copper conductor has a conductivity greater than about 16 4 nanaohm meters however in other embodiments the conductor is in the range of 14 nanohm meters or greater afterwards excess copper and zirconium on the surface are then removed using a chemical mechanical polishing technique fig6 shows the resulting metal conductor 24. |
3 | to the above mother liquor 2 each organic solvent within the scope of the present invention was added to obtain the compositions having the concentration shown in table 8 and the mixture was mixed well to obtain sample liquors for evaluating coating properties the sample liquors were applied to glass substrates having transparent electrodes of ito as described examples 9 12 the coated substrates were dried and heated and the repellant properties and lack of uniformity were evaluated as described above the results are shown in table 8 table 8______________________________________ composition of organic solvents by weight lack ofexample compound name dmi repellant uniformity______________________________________24 n butyl lactate 60 33 6 no no25 pgb 50 44 no no26 mmb 50 44 no no27 pgb mmb 25 25 44 no no______________________________________ the same procedure as in examples 9 13 was repeated except that the compositions were applied by a printing machine and the drying temprature after coating was 80 u00b0 c to form a coating film on substrates and treat the substrates by heating the repellant properties and lack of uniformity were evaluated as described above the results are shown in table 9 table 9______________________________________ composition of organic solvents by weight lack of compound name dmi repellant uniformity______________________________________example pgb eca 30 50 15 no no28compar bc 80 15 no foundativeexample16______________________________________ in addition the composition of comparative example 16 precipitated a polymer in a freezer of 5 u00b0 c and the polymer was not easily dissolved on standing at room temperature on the other hand the composition of example 28 did not precipitate a polymer in a freezer at 40 u00b0 c in each of the examples nmp or dmi was used as component a not. |
1 | the vertical carrier 102 continues moving down the link 116 pressed by the pressing plate 112 of the vertical carrier 102 moves down along the vertical slit 114 the protruding arm 117 connected with the link 116 pivots with the downward movement of the link 116 and the golf ball guide member 108 pushes the golf ball 1 thereby the golf ball 1 can be held on the tee member 109 thereafter when the process described above is reversed as the motor 103 rotates backward the vertical carrier 102 is moved up by the first rod 104 and the second rod 105 and the golf ball 1 is prepared to be hit fig8 is a rear perspective view showing an automatic golf ball supply device 100 according to another preferred embodiment of the present invention fig9 is a rear perspective view of fig8 fig1 to 12 are views sequentially showing the operation of the automatic golf ball supply device 100 of fig8 fig1 is a picture of the front of the automatic golf ball supply device 100 of fig8 and fig1 is a picture of the rear of the automatic golf ball supply device 100 of fig9 as shown in fig8 and 9 a rotary lever 214 having one end hinged to. |
2 | first filling state fig1 a 1 b and a second filling state fig1 c 1 d each in a side view fig1 a 1 c and a frontal view fig1 b 1 d a receptacle 2 for a head airbag 1 is implemented in a roof area of the vehicle behind an interior panel not shown in particular an upper area of a vehicle body side a lateral edge spar of the vehicle roof or the like is referred to as the roof area in the inactivated state the head airbag 1 is received folded in the receptacle 2 and concealed by the interior panel in case of a side impact or a rollover a controller not shown activates a gas generator 3 this gas generator generates a filling gas which flows through a gas inlet connection into a gas channel 1 1 of the head airbag 1 which is received still folded in the receptacle 2 at this point in time the gas channel 1 1 is implemented integrally with an airbag 1 2 which extends above the gas channel 1 1 when the head airbag 1 is completely filled fig1 c 1 d by corresponding hinges which may. |
1 | animals were injected with su5416 20 mg kg sugen inc followed by 3 weeks hypoxia then followed by 2 10 weeks normoxia the peptide administered was a 7 amino acid variant to the car peptide used in previous examples this variant cark consisted of the following sequence carsknk seq id no 2 in these experiments cark was administered at a dose of 3 mg kg and fasudil administered at 1 mg kg to measure the acute effects of fasudil with and cark administration on the right and left ventricular systolic pressure or systolic aortic pressure blood pressure measurements were performed on catheterized su5w hypoxia normoxia exposed rats with pah similar to car cark co administration enhanced the blood pressure lowering effect of fasudil on rvsp with only a minor reduction in sap fig2 and lvsp fig2 as compared to fasudil alone interestingly administration of 10 mg kg of fasudil 30 minutes after cessation of cark infusion still resulted in a sustained pulmonary specific effect fig2 severe occlusive pah rat model was used animals were injected with su5416 20 mg kg sugen inc followed by 3 weeks hypoxia then followed by 2 10 weeks normoxia the peptide administered was car carsknkdc seq id no 1 in this experiment car was administered at a dose of 3 mg kg and imatinib administered at 10 mg kg to measure the acute effects of imatinib with car administration on the right and left ventricular systolic pressure blood pressure measurements were performed on catheterized su5w hypoxia normoxia exposed rats with pah similar to fasudil car co administration. |
2 | the shroud interior and ducts 162 a filter 118 or pre filter may be placed within the shroud 120 fig1 show a cross section of the brake dust collection shroud on a drum brake mounted within a tire rim 117 brake drum systems are commonly used in the rear axles 91 of trucks these trucks can have multiple axles 91 with each axle having a drum on each tire in this figure the axle 91 mounted on a drum 113 with the brake pad s 115 exerting braking forces on the interior of the brake drum 113 air is moved or drawn through the drum 113 around the brake pad s or shoe s 115 and brake shoes or pads where the air moves brake dust through the shroud 120 and into the duct 162 for collection fig1 illustrates a control scheme which can be used in the operation of the invention in one aspect of this control scheme when the braking action of the disc brake assembly 110 is initiated electrical power flowing to the vehicle 39 s brake lights 167 also provides power to blowers or fans 95 as shown and described in fig8 also as indicated in fig1 a water sensor 168 can be used to automatically shut off power to the blower or fan 95 when moisture is detected within the housing 128 and or 120 and to indicate same to the motor vehicle operator. |
7 | shown in fig1 the system 10 may be utilized to interface with one or more computing devices 12 and one or more data storage servers 14 through a communication network 16 an embodiment of the system 10 broadly comprises an agricultural machine 18 and a software application 20 that is executed on a mobile electronic device 22 the computing device 12 as seen in fig1 and 2 is generally utilized by a user such as a farmer a farm manager a farm consultant or contractor an agronomist and so forth to create work order files the computing device 12 may be embodied by workstation computers desktop computers laptop computers palmtop computers notebook computers or the like and may include at least a communication element 24 a memory element 26 and a processing element 28 the communication element 24 generally allows communication with external systems or devices the communication element 24 may include signal or data transmitting and receiving circuits such as antennas amplifiers filters mixers oscillators digital signal processors dsps and the like the communication element 24 may establish communication wirelessly by utilizing radio frequency rf signals and or data that comply with communication standards such as cellular 2g 3g or 4g institute of electrical and electronics engineers ieee 802 11 standards such as wifi ieee 802 16 standard such as wimax bluetooth u2122 or combinations thereof alternatively or in addition the communication element 24 may establish communication through connectors or couplers that receive metal conductor wires or cables which are compatible with networking technologies such as ethernet in certain embodiments the communication element 24 may also couple. |
7 | obtained from the image processing device 120 and extracts lines of the parcel the feature point extraction unit 132 finds intersections of the extracted lines and extracts crossing points such feature extraction units compensate blurring effect and deterioration caused by shape distortion of the parcel the volume measure device 140 acquires matched junction from the two stereo images resulted from the feature extraction unit generates three dimensional model repeats error minimizing process and measure volume of the object the volume measure device 140 integrates two images obtained by the two ccd cameras and calculates volume of the parcel the volume measure device 140 includes matched junction acquiring unit 141 three dimensional model generating unit 142 error minimizing unit 143 and volume calculating unit 144 and calculated volume data is stored at the volume save device 150 the matched junction acquiring unit 141 utilizes epipolar geometry and feature points obtained by the feature extraction device 130 and acquires matched junctions of the two stereo images the three dimensional model generating unit 142 utilizes the matched junctions of the two stereo images estimates relative position of the parcel 111 and generates a three dimensional model the three dimensional model is repeatedly applied to the error minimizing unit 143 and a precise three dimensional may be obtained through these processes the volume calculating unit 144 utilizes the compensated three dimensional model and calculates exact volume of the parcel fig4 is a flow diagram illustrating parcel image recognition step of of the automatic parcel volume capture system in accordance with an embodiment of the present invention the input image device 110 detects parcel image using two ccd cameras which is indicated by. |
1 | lower closer to the exerciser when positioned further away from the user raising and lowering of ones body is more difficult and sufficiently more lower arm and wrist exertion is required when positioned closer to the user raising and lowering ones body is easier but more upper arm and shoulder exertion is required as shown in fig2 the gripping means such as handles 35 and 37 may suitably be adjusted in height over beam 11 by moving the lower portion of the gripping means 53 within slot 55 in beam 11 and securing the gripping means in the desired location by a securing means such as nut 57 and threaded connection 58 fig3 illustrates an alternative embodiment wherein the gripping means consists of a continuous bar 41 crossing above beam 11 in such embodiment bar 41 suitably has a tubular grip such as 43 rotatably mounted thereon areas designated as hand grip locations for the exerciser may be denoted by markings such as 42 and 44 fig3 also illustrates an alternative embodiment wherein foot supports 49 and 51 suitably extentions from the lower portion of beam 11 are provided to enable the exerciser to utilize leg strength to move or help move his body up and down beam 11 in this mode the device may also be utilized to perform static isometric or isotonic contraction exercises by the user bracing his feet against supports 49 and 51 and using his leg strength to exert an upward force while at the same time holding hand gripping means and using the muscles in his upper body to exert a counteracting downward force while the present. |
9 | two structural members together in fig1 for example attachment 10 connects a header 58 with a jamb 60 turning to a detailed discussion of the attachment 10 the same includes a plate indicated generally by the numeral 12 plate 12 is of a rectangular or square design and includes a front face 14 and a back 16 back 16 in the case of the design shown in fig2 5 will fit flush against the building members that the attachment 10 connects formed in the plate 12 is a pair of reinforcing ribs 11 plate 12 includes a series of edges that surround the same more particularly as shown in fig2 the edges include edge 18 a edge 18 b edge 18 c and edge 18 d projecting from the plate 12 is a bracket 22 although the bracket may assume various configurations in the case of the present embodiments bracket 22 assumes a generally l shape l shaped bracket 22 includes a first tab or leg 24 and a second tab or leg 26 a transition line or juncture 28 extends between the tabs 24 and 26 the angle formed by tabs 24 and 26 can vary in this embodiment tabs 24 and 26 form a generally right angle formed in the attachment 10 in both the plate and the tabs 24 and 26 are a series of fastener openings 30 fastener openings 30 receive screws that effectively connect attachment 10 to adjacent building members attachment 10 can be constructed in various ways utilizing various processes in one embodiment it is contemplated that attachment. |
6 | and a velocity input which varies with the velocity of tool assembly 19 tool velocity is preferably determined by means of a position encoder 56 which produces an output 58 that varies with the position of voice coil assembly 17 and a tachometer circuit 60 which monitors the position output with respect to time to generate an output signal 61 which varies with tool velocity current i 1 is preferably amplified with amplifier 62 to produce the drive signal for voice coil assembly 17 the present system also includes the weight 39 s voice coil assembly 30 which is driven with a signal 64 provided by a u201c reaction force reduction u201d rfr preamplifier 66 signal 64 is preferably amplified with an amplifier 65 to produce the drive signal for voice coil 30 in order to produce a drive signal which can counter the reaction forces induced by tool assembly 19 rfe preamp 66 receives current i 1 at an input and is arranged to vary signal 64 with i 1 however as noted above when the tool assembly and weight assembly masses are different a drive signal derived solely from i 1 cannot completely counter vibration attributable to the tool assembly 39 s eddy current drag forces countering these drag forces requires that preamp 66 also receive velocity signal 61 at a second input and deriving drive signal 64 from both i 1 and velocity signal 61 when velocity signal 61 and current i 1 are combined in the proper proportions both the reaction force induced vibration of machine frame 10 and the vibration that arises. |
7 | jacket 100 with an attached distress signal transmitter 101 when submerged in water the buoyant force on the buoy 201 detaches the two detachable connecters 215 216 from the clip 211 so that the buoy 201 can be separated from the clip 211 fig2 b illustrates one example of the preferred embodiments of the present invention when the buoy 201 is detached from the clip and is floating in water 221 the structure of the device is similar to that of fig2 a except that the antenna 202 is now fully extended the buoy 201 would be floating on the surface of the water 221 as shown in fig3 in this way the antenna 202 can stay above the surface of the water to emit clear distress signals the buoy 201 is still connected to the clip 211 through a string 219 so that it will not drift too far away from the person 301 an s o s distress signal is then sent when the buoy 201 is detached from the clip 211 the distress signal also includes the location of the device determined by a g p s so that rescue parties will be able to pinpoint where the signal is coming from the distress signal also can include an identification id code which can help the rescue party know how many people are in danger in addition the device in this example also comprises a water sensor 206 that detects water this water sensor 206 provides a way for the transmitter 101 to differentiate whether a person is truly in distress or whether the signal was sent by accident if the signal were to be sent by accident the transmitter 101 can send a cancel signal to notify that the distress. |
5 | a pliable sheet of a hardfacing matrix material the pliable sheet of hardfacing material has a nickel and chromium matrix combined with a first element the first element is selected from a group consisting of spherical sintered tungsten carbide spherical cast tungsten carbide and metallic glass the hardfacing matrix material sheet is placed on a preselected surface of the drill bit the hardfacing matrix material sheet is then fusion bonded to the drill bit application_number US 56014806 A description referring to fig1 bit assembly 11 has a body 13 on a lower end body 13 has a face 15 on its lower end a plurality of blades 17 are formed on and protrude from face 15 with six blades 17 being shown in the drawings blades 17 lead outward from a central portion of face 15 to a gage area at the periphery of body 13 blades 17 are separated from each other defining junk slots 19 between them for the passage of drilling fluid and cuttings each blade 17 contains a row of conventional cutters typically polycrystalline diamond pcd nozzles 23 discharge drilling fluid which flows through junk slots 19 and back up the borehole along with the cuttings while bit assembly 11 is illustrated as a u201c drag bit u201d or steel bodied bit it should be readily apparent to those skilled. |
4 | or more components in successive measurements within the garment produces the bar code and comparison with the known and genuine data for an authentic garment provides the means of authentication it should be appreciated that the bar code incorporated in the garment may indicate various types of information including for instance the date and time of manufacture of the fabric the product owner and the manufacturer any garment can be readily checked to see if it carries the information which is appropriate for the genuine articles the codes may be changed frequently and as a result it is impossible for a would be copier to know which bar codes to apply to a batch of garments even if he were able to incorporate appropriate components into the yarns which he uses in another embodiment of the present invention textile material for instance woven or knitted fabric is treated in bulk after the formation of the textile or as part of secondary or subsequent treatment of the fabric known as u201c finishing u201d in such post formation treatments the textile has applied to it sufficient of one or more components so as to cause the alteration of the response of the textile to incident electromagnetic radiation the or each component may be applied in such a way as to result in the inclusion of the component in the textile so as to give a response to incident electromagnetic radiation which is characteristic of the presence of the component at specific points within the textile accordingly the presence of the component in the appropriate sequence is the indicator of the authenticity of the. |
9 | generally at 100 in fig5 and 6 the seal assembly 100 includes a seal ring 102 and an elastomer energizer 104 the seal ring 102 is the same as the seal ring 12 shown in fig1 4 however the elastomer energizer 104 is a single element energizer instead of the dual element energizer 14 and 16 shown in the first embodiment preferably the elastomer energizer 104 is of the type disclosed in u s pat no 4 448 429 however other dual lobe elastomer energizers are suitable so long as they provide downward bias for the excluder portion 106 and seal portion 108 of the seal ring 102 in fig6 the seal ring 100 is shown in position for sealing a first member 110 and a second member 112 in the same manner as the first embodiment a third preferred exemplary embodiment is shown generally at 120 in fig7 and 8 the seal assembly 120 also includes a seal ring 122 and an elastomer energizer 124 the seal ring 122 is the same as the seal rings used in the first two embodiments except that the bottom edge 126 of the seal ring 122 is shaped to receive the lobes of elastomer ring 124 the elastomer ring 124 has a cross sectional shape having four lobes 128 130 132 and 134 as was the case with the prior two embodiments the four lobed elastomer energizer 124 is designed to provide directed bias to the excluder portion 136 and seal portion 138 of the seal ring the elastomer rings 104 and 124 are made from the same elastomeric materials. |
2 | cap in both a vertical and horizontal orientation and prevent the discharge of liquid from the nozzle cap in cap positions between the horizontal and vertical orientations application_number US 48425206 A description fig1 shows the nozzle assembly 10 of the invention assembled to a trigger sprayer 12 represented in dashed lines with the nozzle assembly 10 communicating with the liquid discharge passage 14 of the trigger sprayer the trigger sprayer 12 is shown in dashed lines in fig1 because the nozzle assembly 10 of the invention is designed to be used with essentially any type of manually held and operated trigger sprayer fig2 shows a perspective view of the nozzle assembly 10 disassembled from the trigger sprayer 12 the nozzle assembly 10 is comprised of only two component parts a nozzle housing 16 and a nozzle cap 18 the nozzle cap 18 is mounted on the nozzle housing 16 for free rotation of the cap 18 on the housing 16 thus the cap 18 can be rotated in opposite directions on the housing 16 and can be rotated more than one complete rotation on the housing both the nozzle housing 16 and nozzle cap 18 are constructed of plastic materials that are typically used in the construction of trigger sprayers fig3 6 show the nozzle housing 16 of fig2 with the nozzle cap 18 dissembled from the nozzle housing the construction of the nozzle housing 16 can also be seen in the cross sections of the housing shown in fig1 and 12 the nozzle housing 16 has a discharge tube 20 with a cylindrical interior surface 22 that defines an upstream portion of. |
6 | head 92 carried on the end 93 of shaft 24 exterior of processing vessel 18 piston head 92 is disposed within a pressure cylinder 94 with head 92 separating cylinder 94 into a first pressure chamber 95 and a second pressure chamber 97 first and second fluid actuated motors 96 and 96 39 respectively are provided motors 96 96 39 are provided with fluid inlets 98 98 39 and fluid outlets 100 100 39 motors 96 96 39 form no part of this invention per se and are well known in the art motor 96 is preferably a negative pressure motor such that a suction on outlet 100 draws a fluid through inlet 98 which drives motor 96 conversely motor 96 39 is a positive pressure motor such that the admission of a fluid under pressure to inlet 98 39 passes through motor 96 39 in route to outlet 100 39 the fluid passing from inlet 98 39 to outlet 100 39 drives motor 96 39 outlet 100 is connected to first pressure chamber 95 by a first outlet motor conduit 102 a second outlet motor conduit 104 connects outlet 100 with the second pressure chamber 97 a first motor inlet conduit 106 connects an inlet 98 39 of motor 96 39 with the first high pressure chamber 95 a second inlet motor conduit 108 connects inlet 98 39 with the second pressure chamber 97 flow direction control valves 101 preferably check valves are disposed in each of lines 102 104 106 and 108 the valves 101 in. |
4 | position of retaining grooves 54 respectively and the corresponding dimensioning of the sheet metal caps are such that the sheet metal caps secure the yarn guides in the axial direction the yarn guides 32 consist of materials commonly used for this purpose such as silicon titanium or aluminum oxides or of nitrided or chromium plated steel or the like preferably in the region in which they project from recess slot 30 the yarn guides 32 are conically beveled on their ends facing away from the base portion 16 as is indicated at 34 as a result the yarn guides 32 successively arranged in opposite walls 18 and 20 or 22 and 20 form in the cross sectional direction of the heating apparatus 10 respectively a v shaped groove 36 fig2 a which permits a yarn 38 to be guided in its stretched condition between yarn guides 32 without any special auxiliary measures or arrangements between successive yarn guides 32 in a movement substantially perpendicular with respect to base 16 there the yarn resting against the contact surfaces forms then a zigzagged yarn path as seen in fig3 as noted above the embodiment of the heating apparatus 10 as illustrated in fig1 consists of two rail segments 14a and 14b one following the other in direction of the advancing yarn while these segments differ in length they have otherwise the same cross sectional shape the purpose of such a bipartite arrangement may lie in the different. |
2 | 80 prevents heating of the cool mould inserts 50 as illustrated in fig1 the centring body 80 which is all in all rotationally symmetrical with respect to the longitudinal axis l comprises a broad flanged edge 81 and a narrow cylindrical collar portion 82 the latter is inserted into the melt channel 30 and in the nozzle mouthpiece 40 respectively from the bottom side and reciprocates in them in longitudinal direction at its end facing the mould cavity the centring body 80 forms a cylindrical end section 84 which engages in a longitudinally displaceable manner into a cylindrical seat 54 said centring seat 54 formed by the mould inserts 50 is concentrical with respect to the gate 51 and may have a slightly conical form in an upper section 55 in order to facilitate the introduction of the centring body 80 with its end section 84 during assembly its outer diameter is selected so as to provide a pressure tight connection and to prevent the melt from entering the air chamber 22 simultaneously longitudinal movements of the centring body 80 in the seat 54 are possible so that thermally induced changes in length of the needle valve nozzle 10 can be compensated if necessary the end face 85 of the end section 84 is preferably flat just as the bottom surface not specified of the centring seat 54 so as to provide an accurate fit it will be noted that the melt channel 30 is continued through the. |
7 | shown as being representative of the fact that device 12 can have several low side terminals 54 and that the apparatus 10 is capable of handling this plurality of low side terminals 54 further it will be seen that the current limiter 58 is connected via a line 60 to current monitor 22 a voltage monitor 62 is connected via a line 64 to the device 12 and is provided for accurate sensing of load voltages on the device 12 more specifically the voltage monitor 62 is attached at an appropriate high side terminal 18 39 to minimize or eliminate substantial errors which could otherwise be introduced by the impedance in major current carrying leads for purposes of the present invention voltage monitor 62 can be of a type well known in the art such as a kelvin terminal it is to be appreciated that the voltage monitor 62 need not be operated continuously instead voltage monitor 62 can be controlled by processor 26 and selectively activated according to the particular desires of the operator and the requirements of the test regime a key aspect of the apparatus 10 of the present invention is that the processor 26 is able to control all of the components as mentioned above processor 26 is directly connected to power source 14 via the line connector 24 additionally processor 26 is directly connected to i the current limiters 58 via line connector 66 ii the voltage monitors 62 via line connector 68 and iii the current monitors 22 via line connector 70 for purposes. |
9 | membranes may not have a thickness compatible with these dimensions and can be skived planed slit or microtomed to meet a desired dimension this process also offers the surgeon the control options for the type of tissue to be used to form the aty in most cases the membrane and tissues that can be harvested have a multi layer structure it may be desirable to use only some of these layers and not use others in the formation of aty other cutting or fiber formation methods such a straight line slitting laser cutting water jet cutting or helical slitting are all candidate methods for formation of aty the aty need not be monofilament in nature it can be multifilament or it can be multifilament with twist as in a staple fiber formation which will be readily understood by those in the textile arts yarn sizes and vessel wall thickness must be related for very small structures such as 1 or 2 mm diameter veins the wall thickness must be equally thin in this case the available autologous tissue membrane may require not only thin sectioning into tapes or strips but also reduction in thickness this processing can be done both before and after the initial sectioning has been done and can include both mechanical rolling or drawing and cutting or skiving techniques the imperfections in the aty in very thin. |
4 | formed in the next u2018 d3 u2019 course with left ward yarn feeding to the rear needle bed u2018 b u2019 stitches for the part 42 a of the gusset 42 are formed on the knitting needles of the positions u2018 z u2019 u2018 x u2019 in the next u2018 d4 u2019 course with right ward yarn feeding to the rear needle bed u2018 b u2019 a tuck is made on the knitting needle of the position u2018 x u2019 and a stitch for the part 42 a of the gusset 42 is formed on the knitting needle of the position u2018 z u2019 in the next u2018 d5 u2019 course with left ward yarn feeding including knitting needles of the positions u2018 i u2019 u2018 g u2019 a row of stitches for the outward side of the heel 32 and the stitches for the part 42 a of the gusset 42 are formed in the next u2018 d6 u2019 course with left ward yarn feeding to the front needle bed u2018 f u2019 a hanging stitch for linking left side is formed on the knitting needle of the position u2018 g u2019 and the row of stitches for the outward side of the heel 32 on the knitting needles. |
3 | or without the use of a catalyst in another embodiment the intermediate is water soluble in one embodiment the curing agent of the invention is prepared in accordance to the following generic reaction scheme in the above reaction scheme it is understood that the water molecule in the u201c intermediate product u201d is part of the 8 member ring by hydrogen bonding in one embodiment the curing compositions of the invention may be included in resin systems used in a wide variety of applications for example in one embodiment the curing compositions of the invention may be included in resin systems used in the manufacture of structural composites for example in the automotive marine and aerospace industries in another embodiment the curing compositions of the invention may be included in resin systems used in the manufacture of electrical laminates such as used in printed circuit boards in another embodiment the curing compositions of the invention may be included in resin systems used in the manufacture of coating compositions in another embodiment the curing compositions of the invention may be included in resin systems used in the manufacture of friction materials in order to provide a better understanding of the present invention including representative advantages thereof the following examples are offered it is understood that the examples are for illustrative purposes and should not be regarded. |
3 | trifluoromethylsulhonyl halogenide or an isocyanate or thioisocyanate of the formula r 16 u2014 n u2550 c u2550 o or r 16 u2014 n u2550 c u2550 s wherein r 16 is as previously defined h alkylating a dihydroindole derivative of the formula x with an alkylating derivative of the formula xi wherein r 2 r 8 x y a n m w and the dotted line are as previously defined and l is a leaving group such as eg halogen mesylate or tosylate or wherein r 2 r 8 x y a n w and the dotted line are as previously defined and m is 1 2 3 4 or 5 whereupon the compound of formula i is isolated as the free base or a pharmaceutically acceptable acid addition salt thereof the reaction in methods f and g are conveniently performed at low temperature eg below room temperature in an inert solvent such as acetone dichloromethane tetrahydrofuran or dimethoxyethane when reactive carboxylic acid chlorides isocyanates or isothiocyanates are used formylated amines are prepared from the corresponding amines by reaction in formic acid with esters of formic acid or by reaction with mixed formic acid anhydride prepared in situ generally reaction temperatures are between 0 u00b0 c and the boiling point of the formyl precursor compounds the alkylations according to methods a and h are generally performed by refluxing in a suitable solvent such as acetone methyl isobutyl ketone tetrahydrofuran dioxane ethanol or 2 propanol in the presence of a base such as triethylamine or potassium carbonate the reductions of double bonds according to methods d and e are generally performed by catalytic hydrogenation at low pressure lt 3 atm. |
5 | member 40 and the rods 52 and 54 inhibits relative movement between the wall member 32 and the grid member 40 fig5 illustrates a third example grid profile 84 in which the first rod 52 and the second rod 54 extend through the loop passageway 70 in the third example grid profile 84 the example grid member 40 and in particular end portions of the longitudinal members 42 of the grid member 40 are extended under the first rod 52 over the second rod 54 down along the rear face 60 of the wall member 32 and back substantially parallel to and under the buried portion of the grid member 40 the rods 52 and 54 engage the wall loop 34 such that when the grid member 40 is placed under tension friction between the grid member 40 and the rods 52 and 54 inhibits relative movement between the wall member 32 and the grid member 40 in this third example grid profile 84 placing the grid member 40 in tension will further pull the first and second rods 52 and 54 together effectively clamping the grid member 40 therebetween fig6 illustrates a fourth example grid profile 88 in which the first rod 52 and the second rod 54. |
9 | the removal of loosely bound oxygen on the swnt surface that provides p type doping of the semiconducting swnts in air in contrast the swnt pt 0 8 u03bcmol film exhibits a substantial 44 current increase which likely results from doping induced by platinum catalyzed atomic hydrogen the relative resistance drop for the swnt pt nanocomposites increases with platinum content fig5 b the electrocatalytic activity of the swnt pt nanocomposites are tested by cyclic voltammetry fig7 for potentials exceeding 0 4 v the peaks involving hydroxyl reactions show similar performance for both the swnt and swnt pt nanocomposite films while the double layer current rises for the swnt pt nanocomposite presumably due to the increase of film thickness in contrast the peak near u2212 0 1 v that describes hydrogen adsorption rises with the addition of platinum the active surface area of the platinum can be calculated by comparing the charge involved during hydrogen reaction shaded area in fig7 to the known charge per unit area for platinum 210 u03bcc cm 2 from this calculation the electrochemically active surface area for the swnt pt 0 8 u03bcmols nanocomposite is 23 6 m 2 g which is much larger than the value for bulk platinum 2 8 m 2 g and comparable to previous reports for carbon supported platinum 10 taking into account the average platinum nanoparticle diameter and the total platinum surface area 8 75 cm 2 42 of the platinum nanoparticle surface area is catalytically active use of platinum cnt nanocomposites as a cathode in dye sensitized solar cells in another embodiment of the present invention the film of nanocomposites of cnts and pt nanoparticles made by the method described in example 1 or a method similar to it 39 was tested. |
4 | plate comprises two side by side vertically directed sections which are positioned near the floor next to the creel with the yarn being guided serially along the two sections and then upwardly to the cooling plate which extends across and above the service aisle application_number US 15085088 A description the embodiment of the yarn false twist crimping machine illustrated in cross section in fig1 includes a central machine frame 1 which is cut longitudinally along a central plane of symmetry indicated by the dash dot line 19 all machine parts described on this half of the machine frame are also present in a mirror inverted manner on the other side of the plane of symmetry 19 the machine central frame 1 has a longitudinal front which extends parallel to the plane of symmetry 19 distributed in spaced apart relationship along this longitudinal front are adjacent yarn processing stations including parts to be described with all of the spaced apart yarn processing stations corresponding to the cross sectional plane illustrated in fig1 the crimping machine also includes a side frame 5 which extends in parallel relationship and laterally spaced from the longitudinal machine front to provide a service aisle 18 therebetween the side frame 5 includes a yarn creel 2 which is illustrated as an elongate frame in fig1 but it is to be understood that the creel may be in the form of individual tower like rotatable frames such as disclosed in u s pat no 4 572 458 a number of yarn take off supply packages 3 are supported on the creel 2 and from which the yarns to be processed are unwound the. |
2 | a compressed air regulating valve 34 the control unit 20 contains a first functional block 41 to ascertain the exhaust gas speed vabg a second functional block 42 to ascertain the exhaust gas pressure pabg a third functional block 43 to ascertain a calculated exhaust gas temperature tabgr and a fourth functional block 44 to ascertain a torque md the control unit 20 additionally contains a reagent substance pressure set point setting 50 which emits a reagent substance pressure set point preasw to a reagent substance pump trigger activation 51 which supplies the reagent substance pump activation signal 31 and also contains a compressed air pressure set point setting 52 which emits a compressed air set point pdlsw to a compressed air regulating valve trigger activation 53 which supplies the compressed air regulating valve activation signal 33 the reagent substance temperature sensor 23 records the temperature of a reagent substance stored in a reagent substance container 60 the compressed air regulating valve 34 adjusts the compressed air set point pdlsw of a compressed air which is available in a compressed air container 61 the compressed air passes through a super critical choke 62 and a check valve 63 and moves thereafter into a mixer 64 which mixes the compressed air with the reagent substance introduced by the metering valve 30 the mixer 64 is connected to the spray device 13 the catalytic converter 15 which is disposed in the exhaust area of the internal combustion engine 10 is preferably a scr catalytic converter which reduced the nitrogen oxides no and no 2 contained in the exhaust gas to nitrogen the scr catalytic converter 15 needs ammonia for the reduction reaction the ammonia can be obtained from a urea water solution. |
6 | the chamfered surfaces 42 45 define a guide passage 46 which extends along the circumference of each piston 26 the cross sectional area of the guide passage 46 increases toward the discharge port 32 the maximum width of the chamfered surface 45 is slightly greater than the width for example 0 5 to 1 0 mm of the chamfered surfaces 41 42 of the embodiment of fig1 to 4 the volume of the space when the piston 26 is at the top dead center position or the volume of the dead space is smaller than that of the embodiment of fig1 to 4 in addition to the advantages of the embodiment of fig1 to 4 the embodiment of fig7 and 8 has the following advantages the width of the chamfered surface 45 decreases at locations that are farther away from the discharge port 32 thus compared to the embodiment of fig1 to 4 the compressor of fig7 and 8 has a smaller dead space which improves the compression efficiency the guide passage does not need to be formed along the circumference of the end face of the pistons 26 for example as shown in fig9 and 10 a groove 48 may be formed on the piston end face to define a central guide passage 49 to conduct gas in the compression chamber 36 to the discharge port 32 in the embodiment of fig9 and 10 the ports 31 32 are radially inside the wall of the cylinder bore 25 the groove 48 extends along a diametral line connecting the. |
3 | weight dibasic ester and about 5 percent by weight propylene glycol mono n butyl ether the invention also relates to a composition for improving performance of an internal combustion engine in exemplary embodiments the composition can be a solid state material for example a tablet a powder or granules or granular material the composition can include an active ingredient that can include an iron containing composition and at least one synergistic carrier the iron containing compound can be ferric octoate ferric 2 ethylhexanoate ferric stearate ferric naphthenate ferric salicylate ferric carbonate diborylated ferrocene n butyl ferrocene 1 1 u2032 dimethyl ferrocene benzoyl ferrocene iron iii oxide fe2o3 iron ii iii oxide fe3o4 or combinations thereof the at least one synergistic carrier can be adamantane biphenyl also known as diphenyl phenylbenzene 1 1 u2032 biphenyl and lemonene naphthalene camphor camphene e 1 2 diphenylethene adamantanone acenaphthene or dicyclopentadiene preferred range of the active material e g ferrocene is about 1 100 by weight more preferred is about 4 25 by weight and most preferred is about 5 10 by weight preferred ingredient combinations for the composition are ferrocene and biphenyl more preferred are ferrocene and adamantane and most preferred are ferrocene and e 1 2 diphenylethene preferred are combinations of the actives are about 25 cerium containing compound and about 75 iron containing compound more. |
6 | for instance in the rotatable connection of the first arm 100 to the support arm extension 52 the frictional disk 106 is placed between the first arm 100 and the support arm extension 52 first arm 100 and support arm extension 52 have openings aligned with the openings in the components of the frictional disk 106 to receive bolt 114 bolt 114 is passed through these openings and secured with the self securing nut in addition to providing freedom of movement to the support arm 12 the coupling means provide added strength for the support arm the size of the frictional disks can be varied depending on the weight of the optical device to be supported in one embodiment the frictional disks 106 are 2 0 inches in diameter and manufactured from u215b inch thick aluminum bar the support arm 12 equipped with frictional disks 106 as described above can receive optical devices of at least 12 pounds in weight without significant deflection when the support arm is in the fully extended configuration such as when attached to a standard tree stand 60 illustrated in fig2 the support 10 can be designed with frictional disks that are either larger or smaller than described above the support for optical devices described herein is useful in a variety of situations without limiting the use of the support of the present disclosure the support is especially useful in outdoor environments where the circumstances of use may render currently available systems to support an optical device impractical for example a game hunter may wish to use the support of the present disclosure to capture video images of a game animal he is hunting or studying the hunter carries the support to a given area. |
9 | a 150 watt lamp typically operates at 100 volts i lamp lamp current is 1 5 amps and v r sense voltage across sense resistor 30 is 100 divided by 1 ratio of voltage divider is vd 1 volt vd 1 volt plus i lamp 1 5 totals to 2 5 volts which is set as to equal the internal reference voltage 2 5 volts of ic 16 in other words the voltage divider ratio is selected by the circuit designer so that at proper operation the composite feedback signal to fb equals the reference voltage of ic 16 the lamp is an aged s 56 hps lamp in which the electrodes are worn the v lamp is 150 volts much higher than in example 1 above vc across capacitor 32 is 150 volts v r sense across sense resistor 30 is therefore adjusted by the feedback to be 1 volt i lamp 1 amp so that f b 1 5 1 2 5v the lamp is operated at 150 volts and 1 amp to provide 150 watts of power consumption the lamp is a s 55 lamp which by error replaces a s 56 lamp the s 55 has a nominal 55 volt operating voltage but would likely operate at about 60 volts because. |
2 | member or casing is much stronger for the weight of the member and is less expensive to manufacture as for aging only metal is more age resistant but metal is more expensive more difficult to machine and is heavier aeroballistics requires light weight therefore fiber wound tubular members are the only members capable of maintaining the requisite gas pressure within the weight limits and my improved fiber wound tubular members with attachment openings are the only members that are capable of withstanding the requisite longitudinal loads a number of different types of tubes have been made up and have been tested for the amount of force capable of being transmitted through the attachment section of one fiber wound tubular member to another fiber wound tubular member or to a metal member the following is a tabulation of the results 2 for bonded structures assuming an average bond strength of 2 000 psi in a joint length of 1 inch 3 for integrally threaded structure assuming 3 000 psi for 0 75 inch length along axis 4 for drilled holes it was only possible to estimate the loading which appeared to be approximately one half the load of the integrally wound holes or in summary the forces transmitted using bonded structures integral threaded structures and drilled holes of approximately 14 000 16 000 and 12 500 are not considered sufficient for a. |
8 | particular embodiment shown in fig1 20 fig2 23 depict yet another embodiment of the present invention comprising a cap 4 a main body portion 6 and a corner feature 100 disposed generally in a corner of the main body portion 6 the corner feature 100 comprises an extruded or extended portion of the main body portion 6 and at least one female threaded aperture 102 for receiving at least one fastener fig2 is a top perspective view fig2 is a bottom perspective view and fig2 is a detailed top perspective view in various embodiments a corner feature 100 of the present invention comprises a threaded female member 102 within which a fastener may be placed in certain embodiments particularly those where the corner feature 100 is comprised of a concrete material the corner feature 100 comprises an aperture 102 within which a threaded insert or sleeve may be provided in one particular embodiment the corner feature 100 comprises a mass of concrete that provides structural support or a region within which a threaded sleeve may be inserted the threaded sleeve adapted to receive a fastener for securing a lid thus in various embodiments a main body portion may be formed with a protrusion or extension of concrete capable of withstanding various loads such as loads provided by the application of force to the threaded sleeve via a fastener and connected lid while fig1 23 generally depict a subgrade vault 2 comprising a corner feature 100 for securing one or more fasteners it will be expressly recognized that the present invention is not limited to an extrusion or extension disposed in a corner of the vault 2 indeed it is contemplated that such features or extensions may be provided at a variety of locations including. |
4 | the perforations are sized to retain the wood pulp between intermediate and internal passageways 40 and 42 while admitting oxygen into the wood pulp the oxygen is introduced as an oxygen containing gas into gas inlet 48 of body portion 36 the oxygen containing gas passes into external passageway 38 through the perforations of intermediate passageway 40 and then into the wood pulp the oxygen containing gas travels in an inward radial direction of the passageways to internal passageway 42 excess oxygen containing gas not reacted with the wood pulp is then discharged from a gas outlet 50 of body portion 36 in communication with internal passageway 42 it is understood that reactor 28 as described above if appropriately sized could serve other purposes for instance a wood pulp mixer in accordance with the present invention could be used to mix steam with the wood pulp or in place of a static mixer to mix a gas with wood pulp in order to conserve oxygen in apparatus 10 oxygen containing gas is pumped from gas outlet 50 back into gas outlet 48 for recycling back into the wood pulp this is effectuated by means of an eductor 60 eductor 60 has a low pressure inlet 62 and a high pressure inlet 64 high pressure motive fluid pumped through high pressure inlet 64 creates a low pressure region in eductor 60 to draw the oxygen containing gas and entrain it with the motive fluid being pumped through inlet. |
3 | relative to the solid component the titania nanoparticles manufactured according to the present invention described above have a monodisperse spherical form with nearly identical size the surfaces of these monodisperse spherical particles is coated with a hydrophobic substance thereby enabling effective use as a external toner additive the size of titania nanoparticles of the present invention thus manufactured can be adjusted at will when used as an external toner additive the size should be from 30 to 200 nm as needed the spheres may have a median diameter of 30 nm 50 nm 100 nm 150 nm or 200 nm in addition the titania nanoparticles of the present invention show a contact angle of 100 u00b0 or greater with respect to water in the case of the contact angle with water the measured limit value was 170 u00b0 but in theory it could be up to 180 u00b0 if said contact angle with water is less than 100 u00b0 hydrophobicity will suffer and when used as an external toner additive the print quality of the toner may suffer due to either the adsorption of airborne moisture or the formation of aggregates in addition it is preferable that the specific surface area of the titania nanoparticles be between 20 and 100 m2 g if said specific surface area is less than 20 m2 g the aggregation of particles may be severe because this makes it difficult for the final coating of the toner with external additive to be uniform it may cause a problematic deterioration in toner print quality if it exceeds 100 m2 g this indicates that the initial particles will be very small which also makes the hydrophobic coating of individual. |
8 | means that can be engaged with corresponding pre locking means of the electrical connector assembly to lock the first shell to the electrical connector assembly in a pre assembled condition a method of assembling such a conduit adapter system is also presented application_number US 201615011970 A description fig1 shows a non limiting example of the conduit adapter system 1 in an assembled condition wherein the conduit adapter 200 is mounted to an electrical connector assembly 100 in the assembled condition the conduit adapter 200 is mounted to the electrical connector assembly 100 and the first shell 210 of the conduit adapter 200 is fixed to the second shell 220 by fixing elements the fixing elements 211 212 of the first shell 210 are formed as latching elements and in particular as latching noses the fixing elements 221 and 222 of the second shell 220 are formed as corresponding fixing elements namely latching elements and in particular as latching hooks formed in a u shape the first front end 10 of the first shell 210 is oriented opposite to the electrical connector assembly 100 the second front end 20 of the second shell 220 points in the same direction as the first front and 10 in the assembled condition as shown thus both the first and the second front ends 10 20 form an opening that guides the cables 300 of the electrical connector assembly 100 the first shell 210 and the second shell 220 are connected via a hinge 230 that is formed as a flexible web and arranged between the first front end 10 and the second front end. |
2 | s formed portion 18a in the embodiment of fig5 and 6 the sensor 16 is placed above the end 12a of the tube the sensor 39 s abutment stud 16a projects somewhat above the end of the tube and can be operated by an end piece 18 which as in the foregoing embodiment is pivotally connected with the end of the tube via an s formed part 18a due to the fact that the arrangement of the end piece 18 is such that it has a significant extension in a plane extending crosswise and to a greater extent perpendicular with respect to the sensor 39 s abutment stud 16a a widened field of operation is obtained fig7 shows a schematic view of one example of how the vehicle 39 s door 21 can be formed in order to transfer the deformation forces from a vehicle 22 coming in from the side through the door via a cellular plastic block 23 to the end piece 18 and the sensors 16 mounted in the seat 39 s stable tube frame 12 the collision force from the colliding vehicle is lead quickly through the door via the stiff cellular plastic block 23 and the door panel to the sensor in the seat frame the door can alternatively be equipped with an inner plate or sheet structure 24 as shown in fig8 the plate structure comprises longitudinal and lateral plates 24a and 24b respectively in the door interior said plates bridging the space between the strengthening member 25 in the door and a. |
6 | a canister assembly 200 according to an exemplary embodiment in which solenoid valve 6 has been placed on plug enclosure 2 instead of on manifold port 19 in this embodiment plunger 15 of male fitting 14 of solenoid valve 6 may interface with manifold port 21 shown in fig7 b o ring seal 5 on male fitting 14 would provide a tight seal with manifold port 21 manifold port 21 may include for example a recessed manifold inlet 22 having an electrical connection 23 that connects to solenoid valve 6 and activates plunger 15 as shown in fig7 a a check valve 20 may also be present to prevent the back flow of gas the valve arrangements of fig1 and 2 would provide a redundant fuel shut off system hydrogen gas would be prevented from entering manifold port 19 21 or leaving canister 1 unless an electronic control device not shown has activated delivery valve mechanism 4 gas could not flow backwards out of manifold port 19 21 due to the action of a check valve 20 shown in fig7 a likewise gas could not enter manifold port 19 21 unless a canister 1 is properly placed in connection to manifold port 19 21 solenoid valve 6 should be properly aligned and activated by control. |
7 | chloride7 bromideunlabeled peak carbonate______________________________________ ce separation of a mixture of anions by slowed down electroosmotic flow using diaminononane as the electroosmotic flow modifying reagent the separation of a mixture of anions by slowed down electroosmotic flow was carried out according to the following general procedure and conditions the detection anion was chromate and the electroosmotic flow modifying reagent was 0 5 mm 1 9 diaminononane the polarity of the end of the capillary in which the sample was injected was negative indirect uv visible detection was carried out at 254 nm the anions were separated and detected by the procedure in less than ten minutes as shown in fig7 ______________________________________ anion ppm______________________________________1 bromide 42 chloride 23 sulfate 44 nitrite 45 nitrate 46 fluoride 1 and phosphate 4______________________________________ ce separation of a mixture of five anions by slowed down electroosmotic flow using 3 n n dimethylpalmitylammonia propanesulfonate as the electroosmotic flow modifying reagent the separation of a mixture of five anions by slowed down electroosmotic flow was carried out according to the general procedure and conditions described in example 9 except that 3 n n dimethylpalmitylammonia propanesulfonate was the electroosmotic flow modifying reagent the five anions were separated and detected by the procedure in less than ten minutes as shown in fig8 ______________________________________ anions ppm______________________________________1 bromide 42 chloride 23 sulfate 44 nitrite 45 nitrate 4______________________________________ ce separation of a mixture. |
6 | the journal 14 has a boss 15 having an outside circumferential surface formed with a threaded portion 16 the swash plate 17 has a threaded hole 18 the swash plate 17 is fixed to the journal 14 with the threaded portion 16 screwed into the threaded hole 18 of the swash plate 17 the journal 14 is linked with the drive plate 11 by a hinge mechanism 19 a hinge arm 20 projects from the drive plate 11 rearwards toward the journal 14 the hinge arm 20 is formed with an arched elongate hole 22 extending curvedly in an arc a hinge arm 21 projects forwards from the journal 14 toward the drive plate 11 the hinge arm 20 is linked with the hinge arm 21 by a pin 23 received in the elongate hole 22 the pin 23 the elongate hole 22 and the hinge arms 20 and 21 constitute the hinge mechanism 19 the arched elongate hole 22 limits swing motion of the journal 14 the drive shaft 10 passes through a center hole formed in a front end wall 4b of the front housing 4 and a center hole formed in the cylinder block 2 the drive shaft 10 is supported by the front housing 4 through a front shaft bearing or radial bearing 24b disposed in the center hole of the front housing 4 and by the cylinder block 2 through a rear shaft bearing or radial bearing 24a disposed in the center hole of the cylinder block 2 a thrust bearing 25 is interposed between the drive plate. |
9 | media a magnetic head 23 and its driver 24 and a read write signal processor 25 fig3 is a schematic diagram of the structure of a magnetic head for use in this magnetic storage apparatus this magnetic head is a read write separate head which combines an electromagnetic inductive head for use in recording which is formed on a magnetic head slider substrate 37 and a magnetoresistive head for use in read back the recording magnetic head is an inductive type thin film magnetic head which is comprised of a pair of recording magnetic poles 31 32 and interlinkage coils 33 disposed therebetween wherein a thickness of a gap layer between the pair of recording poles is preferably set at approximately 0 3 u03bcm pole 32 about 1 u03bcm thick for example also serves as a magnetic shield for the read back magnetic head in combination with a magnetic shield layer 36 about 1 u03bcm for example and a gap between these shield layers is preferably approximately 0 25 u03bcm the read back magnetic head is a magnetoresistive head which includes a magnetoresistive sensor 34 and conducting layers 35 serving as electrodes by way of example in the drawing of fig3 a gap layer between recording magnetic poles and a shield layer has been omitted fig4 shows a longitudinal cross section of the magnetoresistive sensor 34 of fig3 a signal detection region 41 of the magnetoresistive sensor includes a lateral bias layer 43 formed on a gap layer 42 of aluminum oxide a separating layer 44 formed on the lateral bias layer 43 and a magnetoresistive ferromagnetic layer 45 formed. |
7 | u201c autoconfig frap u201d in the embodiment of fig7 the system allows the control of the pre modification phase modification phase post modification phase and analysis phase as described in relation to fig5 the parameters used at each stage are those that permit an exploration of the possible parameters of the sample so as to quickly and efficiently determine the hardware settings laser power modification duration etc by an iterative process and these settings are passed to knowledge base mentioned in connection with fig3 with the appropriate filter sets the system may be able to image during the modification phase for example during a bleach process to monitor the parameters of the modification in a further embodiment the sample contains one or more photo switchable labels so that the activating light beam is able to activate quench or switch the label as described above in order to observe the labelled component over short fast moving components medium or long time scales rare events or configurations the labels may comprise a naturally occurring fluorescent molecule such as nadh a calcium probe such as u201c fura u201d and or an antibody tagged with a fluorescent molecule and bound to a selected species the labels may comprise a pair of fluorescent molecules with overlapping emission excitation spectra of the types used in fluorescence resonant energy transfer u201c fret u201d and the activating light beam may be set to photo bleach the acceptor molecule in a region of the sample. |
7 | 100 positions the heads 112 adjacent the landing zones 118 this serves to place the actuator 110 in a parked position while data transfer operations are suspended during a period of inactivity preferably the apparatus 120 is formed using a suitable injection molding operation from a durable polymer such as a polycarbonate resin but may be formed from other moldable rigid polymers or materials such as engineered ceramics fig2 also shows the outer filter retention member 140 provides an outer filter retention channel 152 and the inner filter retention member 142 provides an inner filter retention channel 154 wherein fluidic currents developed by rotation of the disc 108 of fig1 of the dsd 100 are substantially sealed from migration around the secondary filter 128 of fig1 and passed through the secondary filter 128 fig3 shows a disc stack assembly 156 formed from a number of discs 108 stacked on the spindle motor 106 and clamped thereto by a disc clamp 158 the disc stack assembly 156 and the actuator 110 in combination collectively form mechanically active components mac 160 of the dsd 100 during data exchange operations of the dsd 100 the mac 160 generates sub micron particles and dislodges sub micron particles from other components internal to the dsd. |
4 | with a nip pressure of 40 psi and percent wet pick up of approximately 120 the pre dye finish composition formulation by weight percent of bath was as follows water 73 6 y30 0 1 tween 20 0 2 rhoplex tr934hs 15 0 tr934hs is an acrylic copolymer emulsion registered to rhom amp haas co of delaware rhoplex tr407 10 0 tr407 is an acrylic copolymer emulsion ammonia 0 1 sancure 861 1 0 sancure is a water based urethane resin registered to sanncor industries inc of massachusetts the following benchmarks have been established in connection with nonwoven fabrics which exhibit the desired combination of durability softness abrasion resistance etc for certain apparel and home use applications thermal shrinkage is determined by initially cutting 11 inch by 11 inch square samples of the test fabric the samples being taken at a minimum of 4 inches from the edge of the fabric roll indelible reference markings are directly indicated on the sample at a 1 inch increment from each corner a 9 inch span being centrally located on each edge of the sample resulting the samples are then placed in an operating convention style oven of which has obtained and is maintaining a 350 u00b0 f temperature the samples are incubated for 30 minutes at the conclusion of the incubation period the samples are removed and allowed to cool on a flat surface until the samples reach ambient temperature samples are remeasured against the said reference markings the difference between the final measure and the initial measure is presented in the form of a percent change the test data in table 1. |
3 | flows up through pipe 17 and adaptor 18 into the venturi injector 19 inside the injector the water is forced into a small port as the water exits the port the water enters a large chamber this causes a vacuum to form in the larger chamber the brine is then sucked into the injection port 20 the meter tips that are screwed into the injector port 20 sets the concentration of brine to water the brine and water mix now called saline travels out the injector 19 and into the u00bc inch pipe 21 and the u00bc inch elbow 22 and the u00bc inch barb fitting 23 fig1 shows the operator interface the power indicator 1 shows power is on the run indicator 2 shows the unit is generating fluid or in standby when the check water indicator 3 is on it indicates that there is no fresh water to the system when the low salt indicator 4 is on the salt is low in the system when the service indicator 5 is flashing it indicates a problem with the unit one flash indicates the unit is shut down due to low salt two flashes indicates the unit is shut down due to a ph problem three flashes indicates the unit is shut down due to an over current condition the ph numeric display 6 shows the ph of the output of the system it may be adjusted by pressing the up and down arrow keys fig6 a shows the construction of the hocl generator the chassis is formed by plate 1 bent at a right angle to form the back and bottom two vertical plates 2 form the three. |
7 | mems mirror device in one embodiment of the invention this mirror device is similar to mirror device 100 fig1 a but for the following referring to fig5 layer 402 is similar to layer 102 except that mirror 104 is replaced with a mirror 404 like mirror 104 mirror 404 is connected by torsional hinge 106 to a first end of rotating frame 108 along rotational axis 110 however mirror 404 further defines an opening 406 to accommodate a bonding pad 410 bonding pad 410 is connected by a torsional hinge 412 to mirror 404 along rotational axis 110 referring to fig6 layer 502 is similar to layer 202 except that additional anchoring pads 510 a and 510 b are formed in lower layer 502 to support bonding pad 410 as described above mirror 404 is connected by torsional hinge 106 to rotating frame 108 and by torsional hinge 412 to bonding pad 410 the stiffnesses of hinges 106 and 412 are adjusted to control the rotational amplitude of mirror 404 for example to amplify the rotational amplitude of mirror 404 relative to the rotational amplitude of rotating frame 108 the stiffness of hinge 412 should be reduced and the stiffness of hinge 106 should be made relatively larger conversely to dampen the rotational amplitude of mirror 404 relative to the rotational amplitude of rotating frame 108 the stiffness of hinge 412 should be increased and. |
3 | food products oils and fats application_number US 22650981 A description in accordance with one embodiment of this invention isoflavones having the structure str7 wherein the dashed lines may be carbon carbon single bonds or carbon carbon double bonds and wherein x may be two hydrogen atoms or oxygen and further wherein r r 39 and r 34 may be a methyl or ethyl group or hydrogen have been found to be useul as antioxidants and as components of antioxidant compositions certain of these compounds namely those having the structure str8 are natural products which may be recovered from tempeh an indonesian foodstuff by fermentation of soybeans with a fungus e g either rhizopus oligosporus atcc no 22959 or rhizopus oryzae atcc no 9363 compounds ii are typically present as a mixture in tempeh and are most readily recovered therefrom in the form of a mixture from which the individual compounds can subsequently be isolated compounds encompassed within structure ii as well as within the other structures herein may include stereoisomers and optical isomers for purposes of this disclosure no distinction will be made among such isomers so that it is to be understood that the disclosure and claims set forth hereinafter embrace all of the isomers encompassed within the structural formulas indicated certain of compounds ii are known compounds such as for example texasin 6 7 dihydroxy 4 39 methoxyisoflavone genistein 5 7 4 39 trihydroxy isoflavone daidzein 7 4 39 dihydroxyisoflavone glycitein 6 methoxy 7 4 39 dihydroxyisoflavone and the so called 34. |
6 | inlet process piping into the valve assembly 30 via port 50 into chamber 60 across valve 70 into chamber 62 and out port 52 into a chromatography column product returns from the chromatography column entering the valve assembly 30 through port 56 into chamber 66 across valve 74 into chamber 64 and out to the outlet process piping through port 54 as in the case where the fluid is flowing in a forward direction chambers 60 62 64 and 66 are common to two valves respectively this time 70 and 74 and the fluid being piped through each port 50 52 54 56 will flush and sweep through the chamber preventing stagnation and the opportunity for contaminants or particulates to accumulate and or growth of microorganisms to develop the chromatography column may be bypassed altogether as is depicted in fig4 c according to this process flow liquid enters the valve assembly 30 through port 50 and passes into chamber 60 the fluid then crosses valve 78 and passes into chamber 64 from chamber 64 the fluid exits the valve assembly 30 through port 54 during the column bypassing process valves 70 72 74 and 76 remain closed and fluid remaining in chambers 62 and 66 as well as in the column remains undisturbed in the process the valve assembly 30 described herein is simple and easy to use and represents an improvement over prior art diverter valve assemblies the device is machined out of one block of material and all flow compartments are shared and fully flushed when a flow through valve is opened thereby eliminating dead legs. |
9 | 111 b 111 c made in the internal cylindrical wall 111 of the container 110 is positioned facing a corresponding opening 112 a 112 b 112 c made in the coaxial cylindrical wall 112 positioned outside said wall 111 on the other hand the openings 121 a 121 b 121 c formed in the cylindrical wall 121 of the cover 120 are positioned offset with respect to the openings 122 a 122 b 122 c made in the coaxial cylindrical wall 122 of the cover 120 which wall is situated outside said cylindrical wall 121 with an angular offset of around 60 degrees so that the openings made in one wall are not positioned facing the openings formed in the other successive coaxial wall of the cover thus with such an arrangement when the cover 120 is assembled with the container 110 it is positioned with respect to the latter in such a way that the openings of one pair of cylindrical walls are facing one another so as to put two successive annular chambers into communication the openings of the other pair of cylindrical walls being positioned in an angularly offset manner so that the other two successive annular chambers are isolated from one another furthermore as shown by fig1 to 4 the cover 120 and the container 110 are provided with means of indexed positioning according to the embodiment represented said means of indexed positioning of the cover 120 and of the container 110 comprise on the one hand an opening 123 a extending over an angular sector of the cylindrical wall 123 of the cover 120 which is situated outside the other coaxial cylindrical walls and forms the external peripheral edge of the receptacle and on the other hand a nipple. |
5 | fin 14 u2032 disposed thereon the first centralizer 20 a and a second centralizer 20 b comprise rigid ribs 22 a and 22 b respectively extending radially from the casing string 8 to form the annulus 4 between the casing string 8 and the wall 4 a of the borehole 12 the centralizers 20 a 20 b may comprise set screws 24 a 24 b to facilitate coupling the centralizers 20 a 20 b adjacent to the outer sleeve 10 on the casing string 8 the centralizers 20 a 20 b prevent or limit engagement of the exterior surface 14 or the fin 14 u2032 with the wall 4 a of the borehole 12 in other embodiments the ribs of the centralizers may be pitched at an angle and formed to increase the level of turbulence of the annular flow rotation of the outer sleeve 10 on the casing string 8 moves spiral fin 14 u2032 through the cement slurry 7 within the annulus 4 and the exterior surface 14 of the outer sleeve 10 against the cement slurry in the annulus 4 alternately the outer sleeve 10 may comprise a plurality of generally parallel spiraling fins on the exterior surface 14 it should be understood that these and other embodiments may be useful especially in a horizontal portion 70 of a borehole see fig1 to propel or assist in moving a cement slurry through the annulus 4 and reduce the equivalent circulating density ecd of the cement slurry fig2 is also an enlarged elevation view of the float device 6 sealably engaged with a stinger 36 a on the end of. |
7 | the output of ff in fig1 2 there are and gates g11 g14 of which the gate g13 serves to generate cpy signal which operates a relay k for executing the printing cycle the high voltage source hvt1 hvt2 etc is switched on by the relay k and the delay signal representing the lapse of the time u03c4 2 to be described after the operation of the switches sw1 and sw2 and q signals from ff1 and ff2 are applied as input to set the flip flop ff3 the flip flop ff3 is reset after completion of a predetermined number of prints or by a stop signal although not shown the control circuit 119 is reset into a stand by condition by the print start signal str an example of the voltage control effected by a microcomputer will now be described in connection with the circuit of fig1 and the flow chart of fig1 when power is supplied to the printer and the automatic voltage setting control section 119 the program for flow execution stored in the memory starts to be executed and the limits of the master density are read into the memory 212 from the digital switches set1 and set2 the contents of the memory are revised to the latest set values by set1 and set2 until signal str is supplied from the panel 120 subsequently the signal str is read into the memory and when the master is moved signals ph a and ph b are generated these signals are read into cpu 208 through an. |
5 | means 2 is shown comprising the mobile unit 12 having a wheel 44 and an extractable connecting device 16 the mobile unit 12 comprising a wheel is fixedly attached to the connecting device 16 the connecting device 16 is arranged in such a way that it can be extended for example with a hand turning wheel 48 which is connected to a screw mechanism adapted to enlarge or decrease the length of the connecting device also a pneumatic or hydraulic telescope mechanism can be employed by extending the length of the connecting device 16 the upper part 42 of this device can be safely linked to the connecting clamp 14 only partially depicted which is fixed to the valve 8 the position of the connecting device 16 and the mobile unit 12 can be manually adjusted in a very precise manner in addition as a foot guide for the mobile support means the rails 46 can be placed on top of one or more wooden planks in order to prevent the underlying surface 10 e g of a scaffold from damage in fig5 the assembly according to fig1 can be seen from above two rails 46 are aligned in parallel each rail being besides the valve 8 two mobile support means 2 and 4 are located at the back part 6 of the valve 8 and are attached to opposite sides the mounting rail 22 is centrally located between both rails for the mobile support means however above the valve 8 the length of the mounting rail 22 essentially corresponds to the length of both rails 46 as soon as the valve 8 is removed from the tube system it can be placed on a trolley 50 and. |
9 | material furthermore the workpiece 10 may have a microstructure that is essentially free of nano crystals and may even have a single crystal microstructure while a turning operation is represented other machining operations are also within the scope of the invention including others where relative movement between a workpiece and cutting tool is primarily through movement of the workpiece against a relatively stationary cutting tool as well as linear machining operations in which relative movement between the workpiece and cutting tool is primarily through movement of the cutting tool against a relatively stationary workpiece or vice versa as the tool assembly 12 is plunged into the workpiece 10 at a given feed rate t m rev and the workpiece 10 rotates with a given surface velocity v m s material is cut and extruded from the workpiece 10 producing a long continuous extrusion 26 of width w and thickness t c the rate of production i e the length of plate produced per unit time is the chip velocity v c v c v t t c the cutting tool assembly 12 is represented as including two members 14 and 16 though schematically depicted as being completely separate from each other the members 14 and 16 are preferably physically coupled or attached to each other to enable their positions relative to each other to be accurately maintained during use of. |
6 | body includes a series of piston ring groove and piston ring lands one of which is modified to include drainage notches the skirt portion of the piston body includes a plurality of furrows near the face of the piston a horizontal channel recessed into the surface of the piston skirt and a horizontal groove formed in the outer skirt wall of the piston these structures function individually and in combination to provide multiple means by which excess lubricating oil may be directed away from the oil control rings and back toward the crankcase or oil reservoir within the engine or compressor application_number US 44889203 A description with reference to the figures an exemplary embodiment of the present invention provides a piston for use in compressors or in engines that includes features for reducing the hydrodynamic pressure experienced by certain piston components when the piston is in operation in general the present invention overcomes the problems created by excessive oil pressure build up at the oil control rings and on the piston skirt by providing a number of features including i drainage notches ii drainage furrows iii drainage bores iv channel s and v groove s if lubricating oil begins to accumulate beneath and or behind the piston rings these various features function separately or together to reduce any resulting excessive oil pressure by directing the oil away from the piston rings and back toward the crankcase as shown in fig1 piston body 10 includes a piston crown 12 and a contoured piston skirt 34 piston crown 12 further includes a series of piston rings piston grooves and piston lands situated between the piston rings more specifically as best shown in fig1 and 5 piston crown 12 includes a first piston ring groove 14 a first. |
2 | meaning that an outer locking ring 36 will not be necessary finally the embodiment illustrated in fig7 differs from the versions discussed previously in that the tongues 54 on the back of the plates 40 are round in section these extend radially across the plates and their cross section grows progressively smaller forming the shape of a cone towards one end the direction of taper being dependent on whether the plates are designed to be introduced radially into the grooves provided in the disc 10 from the outside or the inside the tongues are attached to the plates themselves by a narrow neck 56 clearly the invention is not limited to the embodiments illustrated and discussed here but can be varied extremely widely within the framework of the underlying idea thus it would be conceivable to provide the supporting disc with grooves running peripherally and of e g dovetail form into which tongues of equivalent design may be introduced each plate may have more than one cuneiform tongue these having a combined effect and running radially and peripherally at some distance from one another as is apparent in fig1 the supporting disc 10 has an annular zone 58 without grooves 22 28 which is of a depth and radial width sufficient to allow the inner ring of plates 19 each with its tongue 35 to be introduced radially into the wedge. |
5 | surface and a top surface the dry stack unit also has a rear section substantially parallel to the front section having an outer surface an inner surface a bottom surface and a top surface two or more webs coupling the inner surface of the front section to the inner surface of the rear section have a top surface and a bottom surface two or more pairs of lugs may extend above the top surface of the front section and the top surface of the rear section each pair of lugs may have a first lug offset from a second lug in an axis perpendicular to the inner surfaces of the front section and the back section application_number US 25556505 A description a corner wall structure 200 may use a stretcher unit 202 and a corner unit 204 to construct the corner and straight portions of a wall as shown in fig2 the stretcher units 202 have lugs 206 that extend above the top of the stretcher unit 202 the next course of stretcher units is placed on top of the previous layer of stretcher units the lugs 206 of the previous layer of stretcher units extend into the cells of the next course of stretcher units the lugs provide face shell alignment lateral strength and lock together successive layers of units the stretcher units 202 have a front section and a rear section one or more webs or ribs couple the front section to the rear section the one or more webs may extend just below the top surface of the stretcher unit 202 or may extend all the way to the top surface of the stretcher unit 202 the stretcher units 202 also have lugs that extend above the top surface of the stretcher unit 202 the stretcher. |
3 | starts with an eighth treatment layer 240 the eighth treatment layer 240 containing anionic resin 242 below the eighth treatment layer 240 is a ninth treatment layer 244 the ninth treatment layer 244 containing silver carbon 246 below the ninth treatment layer 244 is a tenth treatment layer 248 the tenth treatment layer 248 containing activated carbon 250 below the tenth treatment layer 248 is an eleventh treatment layer 252 the eleventh treatment layer 252 containing a combination of silver carbon and activated carbon 254 below the eleventh treatment layer 252 is a twelfth treatment layer 256 the twelfth treatment layer 256 containing a combination of activated carbon and anionic resin 258 below the twelfth treatment layer 256 is a thirteenth treatment layer 260 the thirteenth treatment layer 260 containing anionic resin followed by a combination of silver carbon and activated carbon 262 below the thirteenth treatment layer 260 is a fourth filtering layer 264 the fourth filtering layer 264 containing filter paper 266 the fourth filtering layer completes the fourth treatment section below the fourth treatment section is a fifth treatment section a u201c ph neutralization and organic removal section u201d the fifth treatment section is housed within the fifth housing portion. |
4 | is regulated by air pressure supplied to cylinder through pipe 20 this pressure is maintained at a low level during draw machine shut down by a preselected setting of transducer 66 governed by the amount of voltage tapped off from potentiometer 54 and fed through amplifier 56 to the transducer when the draw machine is started by actuation of switch 26 the amplifier 56 receives an additional input signal developed across potentiometer 52 which is proportional to the voltage output of tach generator 30 and also to draw machine speed these first signals across potentiometer 52 are combined with a second signal of constant magnitude developed across potentiometer 54 in amplifier 56 to produce third signals at the output of amplifier 56 that increase with increasing speed of the draw machine 12 these increasing signals are lagged upon actuation of the start switch 26 so that the clapper pressure reaches steady state about 2 seconds after the draw machine speed reaches steady state while the capacitor of resistor capacitor circuit 58 60 connected to the input of amplifier 56 is charged each time the draw machine is stopped by opening switch 26 relay 64 operates to connect switch 62 to the capacitor 58 thus discharging it through ground conversely when switch 26 is closed and the draw machine is running relay 64 operates to move switch 62 to the open position the increasing output from amplifier 56 increases the output air pressure of transducer 66 which is increased by a factor of 3 in passing through amplifier 68 before being fed to cylinder 19 to increase the pressure on flap 17 in accordance. |
7 | from the staging area 120 the packetizer 210 builds 316 one or more packets and sends 316 the one or more packets to the drive buffer 124 the method by which the packetizer 210 builds and sends the one or more packets is described below with reference to fig5 12 the drive buffer 124 receives 318 the one or more packets subsequently the write controller 212 controls 320 the storage drive 122 to write 320 the one or more packets from the drive buffer 124 to the storage medium 126 according to a file system the file system is described below with reference to fig1 and 14 fig4 a is a flow diagram illustrating the method by which the determinator 204 determines 306 whether to transfer a file directly to the memory buffer 156 or to the staging area 120 the determinator 204 determines 408 whether the size of the file exceeds a maximum packet size the maximum packet size is predefined and related to system drive buffer and memory constraints for example the maximum packet size may be predefined to be equal to the size of the drive buffer in the preferred embodiment the maximum packet size is related to the size of the drive buffer 124 however in alternate embodiments the maximum packet size is related. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.