label
int64 1
9
| text
stringlengths 113
6.79k
|
|---|---|
6 | 21 retains the part 15 against relative longitudinal displacement while at the same time permitting axial rotation of the part 15 within the annular bearing surface provided by the flange or collar 21 the part 15 can be of any desired symmetry or shape but is here shown as consisting of two opposed cones 23 and 24 separated by the annular groove 22 the rearward cone 24 terminates in an apex or point 25 which is pivotally accomodated in a conical depression or recess 26 central of the closed end 19 of part 14 this arrangement provides a supplementary stabilizing point for the axial rotation of the portion 15 the forward cone 23 has a forward apex or peak 27 from which its surface 28 diverges conically rearwardly toward the groove 22 depending on the desired shape of the part 23 there could be one or more of such diverging surfaces a conventional cleaning pellet or slug not shown sized to snugly fit the bore to be cleaned and conventionally made of compressible felted or matted fibrous material is used for the actual cleaning operation the cleaning pellet is placed in the breech end of the gun ahead of the cleaning rod or implement 10 the pointed pusher piece 13 is then used to start the slug into the bore the tubular body bends easily to accomodate to the entry angle required for insertion into the breech end of the gun the body 11 of the cleaning rod is grasped with one hand closely adjacent to its entry point into the bore as it is slowly pushed into the gun barrel at the same time. |
1 | simplicity identical or very similar parts in comparison with the clamping connector 16 are given the same reference numerals modified parts or elements of the clamping connector are explicitly described and given their own reference numerals a second embodiment of a clamping connector provided altogether with the reference numeral 120 is illustrated in fig6 and 7 a tensioning member provided altogether with the reference numeral 122 differs from the tensioning member 50 due to the fact that instead of the two thread sections 64 and 68 adjacent to the bearing section 62 and the cylindrical section 66 respectively a respective cylindrical section 124 and 126 respectively is provided arranged eccentrically in relation to the longitudinal axis 60 in addition in comparison with the clamping connector 16 a hollow cylindrical section 128 is provided instead of the conical actuating surface section 44 and an outer surface of the cylindrical section 124 slides on this hollow cylindrical section as a result of rotation of the tensioning member 122 and can move the offset bridge 130 provided altogether with the reference numeral 130 in the direction towards the bar 14 the clamping member 86 with its actuating surface 88 a can be displaced in an analogous way by means of the cylindrical section 126 in the direction towards the clamping section 84 whereby the bar 14 can be held in a clamping manner in the bar receiving means 82 therefore interacting actuating and slide on surfaces are also provided in the case of the clamping connector 120 wherein these are not inclined relative to the longitudinal axis 60 slide on movement is brought about on account of the eccentricity of the cylindrical sections 124 and 126 wherein this eccentricity is apparent. |
8 | flashlight is not in a battery charging mode the tailcap may be used as an alternate flashlight switch to turn the flashlight on or off while maintaining a certain predetermined focus for the light beam as shown in greater detail in fig1 the tailcap switch assembly 94 is in the 34 charge 34 position for charging and in the 34 off 34 position for normal flashlight operation in the tailcap position shown with the head of the flashlight rotated to be in the 34 on 34 position as described previously the circuit is broken between switch contact 71 and ground contact 72 at the region of scallop 74 in this position the forward ends of the switch contact 71 extend up through the scallop holes 74 cut in the ground contact 72 but do not touch any part of ground contact 72 the scallops are also shown in fig1 thus the circuit from the barrel to ground contact 72 is broken at 74 as shown the remainder of the circuit after the break is from switch contact 71 to battery spring 73 to the electrode of the rearmost battery and thereafter to and through the head assembly as previously described when the switch knob 67 is rotated. |
8 | mah kg a third test was also conducted two cells were assembled each having a pbo 2 cathode a zinc anode and an electrolyte comprising emihso 4 pva these two cells which as shown above each separately provide about 1 80 volts were linked in series and found to create a 3 6 v 10 ma power source sufficient to power a relatively large led while not considered necessary to enablement of the current invention the electrochemical half cell reactions are as follows with m representing manganese or lead m 4 o u2212 2 2 2hso 4 u2212 2 e u2212 u2192 m 2 oh u2212 2 2so 4 u2212 2 zn 0 so 4 u2212 2 u2192 zn 2 so 4 u2212 2 2 e u2212 m 4 o u2212 2 2 2hso 4 u2212 2zn 0 u2192 m 2 oh u2212 2 2zn 2 so 4 u2212 2 2 e u2212 the various cells described above were constructed as follows a liquid cell was created using a zinc strip as the anode the cathode was made by coating a gold metal strip with a thin polymer coating the coating being composed of about 70 wt mno 2 about. |
8 | on the other hand if the data usage exceeds the 0 35 mb s threshold during the dp the 2g 3g network can be selected for the mobile terminal 206 in some aspects of the subject disclosure mediation component 220 can employ a signaling interface 222 to obtain subscriber information and or preferences for mobile terminal 206 from an hlr 224 thus for instance where a subscriber profile indicates that data services or high data usage is preferred mediation component 220 can employ the high data usage preference in the network selection thus for instance even though data usage for the mobile terminal 206 is below a threshold for 2g 3g network selection mediation component 220 can select the 2g 3g network based on the subscriber profile preference in addition to the foregoing mediation component 220 can initiate a re evaluation period rp after selecting a network for the mobile terminal 206 during the rp analysis component 218 tracks usage characteristics of the terminal 206 the rp usage characteristics can be forwarded to mediation component 220 for further determination based on such determination the mediation component 220 can maintain the selected network as a default for mobile terminal 206 or select a different network to continue the foregoing example if the data usage exceeds the 0 35 mb s threshold during the rp and a subscriber profile does not indicate a preference for 2g networks mediation component 220 can switch the default network to a 2g 3g network once the default network is switched a second rp can be initiated to further monitor terminal data usage upon expiration of the rp a further determination can be made as described above fig3 depicts a block diagram of an example system. |
1 | outer dimension 132 of the dilating element 112 is greater than the inner diameter of the sealing trocar the advancement 412 of the cannula 100 may then be conducted under gas insufflation to improve visualization of the previously formed surgical cavity fig5 a illustrates an embodiment of cannula 100 with a locking mechanism 150 for a detachable dilating element 112 as shown in fig5 b locking mechanism 150 includes a length of screw threads disposed on the surface or outer housing of the cannula 100 at a position near the distal end of the cannula that allows the locked dilating element 112 to be located in a position on the cannula 100 as described previously herein with reference to fig1 3 fig5 c illustrates a cross section of the dilating element 112 having a mating lock or set of screw threads 162 which couples to locking mechanism 150 of fig5 a a bore hole 154 is formed along the horizontal axis of the dilating element 112 and the screw threads are disposed along a portion of the bore hole 154 as a mating lock 162 the dimension 158 of the bore hole 154 is wider than the diameter 136 of the cannula 100 but is small enough to ensure a tight coupling upon inserting the dilating element 112 into the locking mechanism 150 thus in this configuration the dilating element 112 is. |
8 | be realized that other process parameters may be changed and the present invention is not limited by the above referenced process parameters which are provided as some examples also profile engineering in any situation deposition etching or none may be performed for high surface concentration or a deep profile tail an initial deposition may be performed to reduce channeling open and closed loop control may be utilized for bias ramping in situ and ex situ deposition measurements may be used in these control loops as shown in fig4 the bias voltage increases during plasma implantation as indicated by the arrow length the energy gain for each ion is equivalent to energy loss through the deposition layer so that ion distribution within the substrate remains largely the same as described above the increase of bias voltage can be linear or non linear with time depending on the deposition rate which can also be linear or non linear with time accordingly the retained dose is maximized without a deep dopant profile fig5 a 5 b and 5 c illustrate bias ramping combined with duty cycle ramping for achieving a higher duty cycle at lower ramping bias for improving wafer throughput and photo resist conditioning of the wafers the bias voltage is applied only during the u201c on u201d period as shown in fig5 a however the amplitude of the bias voltage may be controlled separated by the controller 50 also the bias voltage may start with a lower duty cycle as shown in fig5 b and end with a higher duty cycle as shown in fig5 c or the bias. |
7 | the single pulse generated by the transmitting transducer d it is therefore important to identify each individual echo since these echoes may emanate from totally different directions i e different objects once the true start time and amplitude of the first echo has been determined it can be subtracted from the digitized signal utilizing a single echo pulse train captured during the calibration cycle the pulse train is scaled down prior to storage to u00bd the maximum amplitude of the a d converter 16 and then scaled up to the identified echo prior to subtraction once subtracted the start of the second echo is revealed and the process is continued the sample rate of the a d converter 16 is ideally two hundred fifty six times the transmission frequency therefore the time between samples is 360 u00b0 u00f7 256 1 40625 u00b0 if the frequency of transmission is approximately 68 5 khz then the time between samples is 1 u00f7 68500 u00f7 256 57 nanoseconds this degree of resolution is desired to minimize the possibility of a blind spot directly below the transducer assembly this is due to the small difference in travel time between objects and the receiving transducers referring to fig4 the true start of the echo is determined as the difference between the u201c offset u201d and the time for the pulse to reach the first sample y which is the first sample above zero value the offset may in turn be derived from the following. |
3 | pat no 3 965 016 which is herein incorporated by reference the following examples are provided to further illustrate the present invention in which the antimony thioantimonate and molybdenum disulfide or graphite synergistic mixtures were prepared and tested as lubricant mixtures with greases and oils of lubricating viscosity a silica grease derived from a synthetic polyalphaolefin base fluid thickened with silica was separately blended with different mixtures of sbsbs 4 and mos 2 as shown in table i below the blended greases were evaluated by means of shell four ball ep and wear testers the experimental results are recorded in table i the wear scar diameters load wear indexes and weld points of the greases containing different ratios of sbsbs 4 and mos 2 are superior to those of the greases containing either sbsbs 4 or mos 2 alone table i______________________________________shell four ball lubricating properties ofsilica grease sup 1 containing various additivesexample no 1 2 3 4 5 6 7______________________________________sb sub 2 s sub 4 0 10 7 5 6 7 5 0 3 3 0mos sub 2 sup 3 0 0 2 5 3 3 5 0 6 7 10scar dia mm sup 2 0 81 0 72 0 56 0 52 0 53 0 52 0 63weld pt kg 126 400 500 500 500 400 250load wear index 33 100 111 111 113 107 35______________________________________ sup 1 polyalphaolefin oil thickened with silica sup 2 1200 rpm 40 kg and 167 u00b0 f for one hour aisi 52100 steel balls sup 3 technical fine grade using the same procedure as described in example 1 7 silica grease was separately blended with different. |
7 | other hand physical names for the storage device slots are defined by a hardware configuration in one or more embodiments of the invention a logical to physical topological location mapping software searches device path for each storage device slot from the operating system to the physical device level and stores correlations of the physical names for the storage device slots and the logical names assigned by the operating system in a data structure fig3 shows a wysiwyg representation of logical to physical name topology for a multi controller storage device system in one or more embodiments of the invention the multi controller storage device system includes six storage device controllers 304 306 308 310 312 and 314 and each storage device controller contains eight storage device slots for example a first storage device controller 304 has a physical name i e controller 1 and an assigned logical name i e logical name a physical names for each storage device slot is defined by a hardware configuration in one or more embodiments of the invention the physical names for the storage device slots are defined sequentially from a bottom left storage device slot to a bottom right storage device slot i. |
7 | shaft portion 136 of lower mandrel tool body 140 substantially in alignment with longitudinal bore 130 of bar string 7 thereby allowing the flow of test fluid therethrough lower fluid flow passage 150 corresponds to upper fluid flow passage 98 of piston portion 92 of upper mandrel tool body 90 sufficient background has now been afforded for a description of the improvements of this invention over the prior art the improvements are as follows a a transverse bore 192 or lower filling jet 192 provided through bottom portion 138 of piston portion 144 of lower mandrel tool body 140 lower filling jet 192 communicating with lower fluid flow passage 150 and a transverse bore 83 or upper filling jet 83 through the topmost portion 94 of piston portion 92 of upper mandrel tool body 90 upper filling jet 83 communicating with upper fluid flow passage 98 b upper filling jet 83 and lower filling jet 192 as above described except that upper filling jet 83 and lower filling jet 192 are disposed at an approximately 45 u00b0 angle to upper fluid flow passage 98 and lower fluid flow passage 150 respectively d o rings 110 111 mounted to the machine threaded part of the shaft portion 106 of upper mandrel tool body 90 the prior art teaches of filling jets which are provided in the shaft portion rather than the piston portion of the mandrel tool bodies this dispositon of filling jets causes a weakening of the shaft portion of. |
1 | the plant tissue and the podophyllotoxin retained therein is recovered by conventional means such as crystallization or solvent evaporation due to ease of separation from the hydrous plant material a solvent lacking miscibility in water would typically be preferred an alternate embodiment within the scope of the instant invention includes the use of a single step to simultaneously deglycosylate and extract the podophyllotoxin from the ground or disrupted plant material in this case the water and solvent are simultaneously made available to and admixed with the plant material subsequently the solvent with its entrained podophyllotoxin is then separated by conventional means this approach is preferentially limited to those solvents lacking miscibility in water so as to minimize inhibitory effects by the solvent upon the endogenous deglycosylation reaction the following examples are intended only to further illustrate the invention and are not intended to limit the scope of the invention which is defined by the claims plant material specimens of podophyllum peltatum were harvested from wild accessions shortly after harvest leaves and rhizomes were separated dried at 40 u00b0 c and ground to a fine powder using a ksm 2b grinder braun lynnfield mass the powdered plant material was stored at room temperature protected from light and moisture in tightly closed glass or plastic bottles dried rhizomes of podophyllum emodii originating from two localities in. |
5 | first wall section 104 a and ballast box 112 b counterbalances effectively the second wall section 104 b the platforms 104 a b are asymmetrical with respect to the longitudinal axis a accordingly the weights of the ballast boxes can be greater than the weights of the wall sections to counter balanced the asymmetrical portion of the platforms the loading of the trailer shown in fig1 e thus serves to balance the weight of the various trailer components with respect to the longitudinal axis a referring now to fig2 a the trailer 100 is shown in its unloaded or deployed configuration as can be seen in fig2 a the wall sections 108 a c have been removed from their loaded positions on top of the platforms 104 a b and connected between the platforms 104 a b to form a protective barrier 200 this is accomplished by removing the wall sections 108 a c such as for example through the use of cranes or a forklift and then disconnecting the two platforms 104 a b from each other after the platforms 104 a b have been disconnected the platforms 104 a b are spatially separated and the wall sections 108 a c are then inserted there between as can be seen in fig2 a the two ballast boxes 112 a b remain in place on top of the platforms 104 a b the ballast boxes provide a counter balance to the weight of the wall sections 108 a c which are disposed on the opposite side of the platforms 104 a b fig2 a shows a view of the. |
6 | turbines may be selected for analysis of the angle of attack these may be the ones having the worst measured vibration in this way the analysis can be applied only to those having a vibration beyond a predetermined set value to avoid analyzing all of the blades of all of the rotors fig1 shows a symbolized view in a picture taken to assess blade angles deviation thereof or absolute angles of attack thereof a deviation between each blade can be described with a positive or negative angle the direction u201c u201d or u201c u2212 u201d may vary and might be specified in the pitch control system the same angles cannot only be used for comparison to each blade but also in reference to an objects which has a known geometric alignment to the rotor plane to determine the absolute angle of attack those objects are usually part of the nacelle 11 or a visible piece of main shaft 9 while the camera c is standing still the objects in fig1 will not be at identical positions during a set of pictures within the picture due to movement of the turbines tower and head section and therefore the use of the outer limits of the picture frame have proven to be insufficient as reference for angle measurements fig2 shows the general setup for a camera to go through the calibration process the camera c is mounted on a suitable mount like a tri pod t and is lined up with the optical axis to the center of a grid made g of squares both the. |
6 | from the female portion further a sleeve is slideably placed about the male portion and adapted to capture the clip compressed within the annular groove application_number US 21775105 A description referring to fig1 a preferred embodiment of this quick connect coupling 1 of the instant invention includes female portion or port 10 and hose stem 12 the female portion or port 10 is illustrated as part of an adapter 14 having threads 16 and formed with wrenching flats 18 as one contemplated embodiment and for convenience of illustration commonly port 10 is expected to be machined into the body of a fixture machine or equipment not depicted for those instances where port 10 is formed into an adapter 14 adapter 14 provides the base for port 10 for those instances where port 10 is formed into a fixture machine or equipment these provide the base port 10 has an interior surface 20 defining an inlet opening 22 an outlet opening 24 a fluid passage 26 a first frustoconical ramp 28 a first cylinder 30 annular wall 32 second frustoconical ramp 36 and optionally second cylinder 34 first frustoconical ramp 28 is a dual function ramp serving functions in both the connection and disconnection operations to be described later second frustoconical ramp 36 is a lead in ramp significant to connection operation described later still referring to fig1 hose stem 12 includes shaft 38 with a bore 40 having. |
8 | a front pin end 18 and a rear idc end 19 each idc end 19 includes a slot 21 having an open flared end 22 and a closed end 23 an apertured disk 24 of insulating material such as plastic includes a plurality of rectangular slots 26 which are arranged in a pattern corresponding to the pattern of the insulation displacement contact ends 19 the insulating disk 24 additionally includes a central aperture 27 which allows passage of an electrical cable 28 comprising a plurality of individual wires 29 each wire 29 includes a central conductor 30 the circular connector also comprises a removable backshell 31 having internal threads 32 and a circular shoulder 33 best seen in fig2 the backshell includes a central aperture 34 for passage of the electrical cable 28 fig3 shows the circular connector of fig1 and 2 in the fully assembled state the conductor 30 in each of the wires 29 has been forced to the closed end 23 of the slot 21 by the insulating disk 24 in use the cable 28 is passed through the apertures 34 and 27 in the backshell 27 and the insulating disk 24 respectively and the individual wires 29 are splayed from the cable end in order to be closely adjacent the flared end. |
4 | ligament 5 can be seen to encircle the wrist the wrist brace 7 of the invention is shown in phantom form as it would appear on the hand and wrist the wrist brace 7 comprises a sleeve defining elastic body 9 the body 9 has an outer edge 11 near the fingers indicated at 13 and an inner edge 15 below the wrist on the wearer 39 s arm shown generally at 17 the body 9 also has a thumb opening 19 allowing the thumb indicated at 21 to move freely the brace 7 maintains the hand in a slightly angled position approximately 32 u00b0 as shown by lines 23 and 25 as is known in the art this angled position is preferred for proper healing fig1 a shows the single piece of non fray elastic fabric as cut with fold marks b the top fold mark is brought down to a position on the lower mark with an angled fold at each edge of the cut fabric when attached along the fold lines at top and bottom as shown in fig1 b the upper portion of the brace when closed as worn on the hand forms a 32 u00b0 angle at the same time producing three times the elastic power of the original fabric in the area 39 fig2 is a detailed view of the wrist brace 7 closed but without the hand the body 9 is unlike prior art devices generally manufactured from a single piece of two way uniformly elastic fabric such a fabric is shown in copending application ser no 07 117 756 and ser no 07 387 706 a fold 29 is formed by folding and sewing the fabric such that the area on the wrist adjacent the fold which. |
4 | the cloud point pressure however foam fibers may be obtained rather than plexifilaments even at spinning pressures slightly below the cloud point pressure of the solution spin agents and co spin agents are the same as those noted above for the plexifilamentary film fibril materials nucleating agents such as fumed silica and kaolin can be added to the spin mixture to facilitate spin agent flashing and to obtain uniform small sized cells foams can be obtained in a collapsed form or in a fully or partially inflated form for many polymer solvent systems foams tend to collapse after exiting the spinning orifice as the solvent vapor condenses inside the cells and or diffuses out of the cells to obtain low density inflated foams inflating agents having low boiling temperatures are usually added to the spin fluid suitable inflating agents that can be used include partially halogenated hydrocarbons such as hydrochlorofluorocarbons and hydrofluorocarbons perfluorocarbons and hydrofluoroethers other organic solvents and gases having low boiling temperatures can be used when very low density foams 0 0005 0 1 g cm 3 are desired as spun foams can be post inflated using the procedures described in blades parrish and bonner foam fibers are normally spun from a round cross section spin orifice however an annular die similar to the ones used for blown films can be used to make foam sheets it should be noted that the 2gt 3gt and 4gt polymers herein are intended to include copolymers. |
2 | of tubular steel may be used with any type of engine application_number US 84713377 A description in fig1 the engine repair stand of this invention of right frame 10 and left frame 11 are shown fully supporting engine 12 frame 10 and 11 are separate units and are connected only through the engine through mounting bracket system 13 for right frame 10 and mounting bracket 14 hidden for left frame 11 as is typical the regular motor mount position 15 is toward the front 16 of engine 12 with the center of gravity c g of engine approximately in the center of engine 12 as shown the rear end 17 of engine 12 is further from mounting bracket 13 thus creating significant torque in a downward direction from rear end 17 on bracket 13 as illustrated there is only a short distance between the bottom 18 of engine 12 and the bottom of frames 10 and 11 in the same fashion the top heads 19 of engine 12 are only a short distance from the top of frame 10 and 11 engine repair stand 10 and 11 is fully capable of holding and handling automobile engines such as the chevrolet 350 cubic inch engine which weighs about 450 pounds and even the cadillac or oldsmobile v 8 engines which weigh approximately 860 pounds the invention provides that by grasping frames 10 and 11 toward the front of the engine it may be easily lifted and turned completely upside down by hand right frame 10 is pictured in fig2 and is completely constructed of one inch structural steel tubing. |
6 | fig1 b an alternative embodiment is illustrated that in addition to the components already described in connection with fig1 a has additionally a conduit 24 and a controllable flap 23 which is arranged in this conduit 24 through this line 24 if available hot air or hot exhaust gases of an upstream process can be passed directly into the storage module 29 so that the sensible heat contained therein can be stored in the storage module 29 according to the invention without the u201c detour u201d through an air air heat exchanger since the conduit 24 opens downstream of the blower 4 into the second feed line 19 the blower 4 is not loaded with the high temperatures of the air or exhaust gases flowing through the conduit 24 the conduit 24 enables thus coupling of sensible heat of a gaseous medium air or exhaust gases at lower temperatures than in the heat exchanger 3 fig2 shows schematically discharging of the high temperature heat storage system according to fig1 a according to the invention discharging of the high temperature heat exchanger system according to the invention according to fig1 b is realized in the same way with closed flap 23 so that a separate description is not needed for discharging by means of blower 4 cold air from the environment at a temperature of less than approximately 50 u00b0 c is sucked in and supplied through the second feed line 19 and the open flap 10 to the storage module 29 the flap 11 is closed during discharging by means of perforated metal plates 7 or lances the cold air is distributed within the housing 16 and passed through the storage medium 6 where it absorbs the heat the heated air exits then the store via. |
6 | to junction 51 base 69 is connected from junction 51 feedback to the amplifier is provided through a capacitor 71 and a capacitor 72 capacitor 71 is connected between junctions 51 and 52 capacitor 72 is connected between junctions 50 and 53 a conventional darlington circuit 73 is provided including a transistor 74 and a transistor 75 transistor 74 has a collector 76 connected from junction 52 transistor 74 has a base 77 connected to junction 53 transistor 74 has an emitter 78 connected to a base 79 of transistor 75 transistor 75 also includes a collector 80 connected from junction 52 and an emitter 81 a resistor 82 is connected from emitter 81 to junction 21 a resistor 83 is connected between junctions 49 and 52 resistors 84 and 84 39 are connected between junctions 53 53 39 and 53 39 54 respectively a resistor 85 is connected between junctions 31 39 and 55 a zener diode 86 is connected between junctions 22 and 55 a capacitor 87 is connected between junctions 56 and 49 junctions 55 56 and 57 are connected together a resistor 122 is connected between junctions 53 and 23 a resistor 128 is connected between junctions 126 and 127 junctions 51 and 126 being connected together and to base 69 a resistor 89 is connected between junctions 57 and 60 a resistor 90 is connected between junctions 24 and 60 a capacitor 91 is connected between junctions 25 and 60 a silicon controlled rectifier scr is provided at 92 including an anode 93 a cathode 94 and a gate 95. |
2 | clamps 35a may be bolted to support tube 34 by bolts 36a there is also shown in fig5 a header or manifold 40 for support tube 34 which convey liquid waste through opposed conduits 39 to each side of curtain 16 adjacent flange 33 this may be by way of drip feed or by use of jets or nozzles as required the arrows in full outline in fig5 indicate the downward passage of the liquid waste having regard to each curtain 16 there is also included waste collection trough 42a and associated transfer conduit 43a there is also shown in fig6 opposed conduits 38 for conveying warm humidified pressurised air to each side of curtain 16 adjacent flange 33 each conduit 38 communicates with air manifold 37 the air feed means is omitted from fig5 for the sake of clarity and convenience fig7 shows a detailed view of support rods 24 supporting flanges 33 of each curtain 16 whereby rods 24 engage in notches 41 in the ends of flanges 33a there is also shown crane attachment location 27 in fig8 9 there is shown a modified assembly to that described in fig5 6 in this assembly curtains 16 and associated top flanges 33a are attached to support rods 24 as already shown in fig7 waste feed conduits 34a transport liquid waste via opposed conduits 39a and air jets 38a are attached to an associate air feed conduit 37a which communicates. |
7 | the fig1 fig5 shows a schematic diagram of an alternative arrangement of the comprehensive two dimensional gas chromatography switching valve modulation system of the present invention this modulation system accomplishes modulation by two valve switching at the same time in a modulation period the detailed modulation process is explained exactly as that for the modulator valve system in fig1 however this modulation system reverses the switching between the valves in position x and y to accomplish the comprehensive two dimensional gas chromatography the difference between the fig5 design and the fig1 design is that in fig1 the valve connects the end of first column to the second column and in fig5 the valve connects the end of first column to the second column flow in fig1 design the connection to the end of the first column and the connection to the second column are in the same valve however in the fig5 design the connection to the end of the first column and the connection to the second column are in the different valve the modulation system can also be built on two valves with more than four ports however because of extra loops and ports involved it will not perform as simple and as good as four port valves the modulation system can also be built on one valve with at least twelve ports fig6 shows a schematic diagram. |
2 | moves around roller 64 at velocity v 2 in the direction d indicated in fig1 v 2 is less then v 1 at least when belt 22 presses signature 50 against outer surface 34 tucking blade 70 from a transfer cylinder 72 for example the transfer cylinder disclosed in u s pat no 6 923 753 hereby incorporated by reference herein tucks a signature 50 into jaw gap 46 movable jaw 44 pushes against signature 50 to place folded edge 51 in jaw gap 46 in between movable jaw 44 and stationary part 42 fig2 gripping device 40 holds signature 50 as signature 50 travels around jaw cylinder 30 at velocity v 1 when jaw cylinder 30 reaches a point a in the jaw cylinder rotation cam cam follower interaction may for example cause movable jaw 44 to release signature 50 at a point beyond point a belt 22 presses signature 50 against jaw cylinder 30 belt 22 moving at slower velocity v 2 guides signature 50 along a segment of jaw cylinder 30 between point a and a point b thus due to the difference between v 2 and v 1 folded edge 51 slides out of gripping device 40 after point b belt 22 continues to carry signature 50 away from jaw cylinder 30 at velocity v 2 stationary stripper 90 rests partially in circumferentially extending grooves of jaw cylinder 30 and is positioned to intercept signature 50 as signature 50 travels along outer surface 34 signature 50 slides along stationary stripper 90 to a gap 66 located between belt 22 and belt 62 belt 22 and belt 62 move at velocity v 2 and transport signature 50 along for further processing fig2 shows an enlarged view of gripping device 40 gripping device 40. |
9 | thermal degradation of the photosensitizer in general one desires to minimize the concentration of solvents and thus this first temperature treatment is conducted until substantially all of the solvents have evaporated and a thin coating of photoresist composition on the order of a micron in thickness remains on the substrate this treatment is normally conducted at temperatures in the range of from about 20 u00b0 c to about 100 u00b0 c in a preferred embodiment the temperature is conducted at from about 50 u00b0 c to about 90 u00b0 c a more preferred range is from about 70 u00b0 c to about 90 u00b0 c this treatment is conducted until the rate of change of solvent removal becomes relatively insignificant the temperature and time selection depends on the resist properties desired by the user as well as equipment used and commercially desired coating times commercially acceptable treatment times for hot plate treatment are those up to about 3 minutes more preferably up to about 1 minute in one example a 30 second treatment at 90 u00b0 is useful the coating substrate can then be exposed to actinic radiation especially ultraviolet radiation in any desired pattern produced by use of suitable. |
7 | of lut 1 to lut n corresponding to the latest print medium type a and or print quality b when the display screen transits from the hierarchy of the print setting screen for the print medium type a and or print quality b to the hierarchy of the print instruction screen where the print instruction is made if at least one of the print medium type a and the print quality b is newly set on the print setting screen the print controller 4035 does not newly perform the initialization of the halftoning processor if the latest settings of the print medium type a and or print quality b are identical to the settings of the print medium type a and or print quality b at the previous initialization of the halftoning processor 4037 and if the halftoning processor 4037 is already initialized based on the lookup table corresponding to the print medium type a and or print quality b when the print instruction is made thereby the load of the cpu mounted on the printer 4003 is relieved and there is no drawback that it takes a long time period since the print start button sb is pressed till the first print is performed the print controller 4035 performs the following processing when the count value of the time counter 4033 indicates the elapse of predetermined time or when the display on the display transits from the print setting screen 4311 at the lower hierarchy to the print instruction screen 4310 at the upper hierarchy if at least one of the print medium type a and the print quality b is set on the print setting screen 4311 that is the initialization of the halftoning processor 4037 is already performed and it is determined whether or not the. |
9 | qrs complex in the defined segment of the signal curve fig 2 application_number US 80367901 A description as is apparent from fig1 an idealized qrs complex consists of a relatively high amplitude oscillation that initially guides the ecg signal in the q spike away from the zero line 1 in a negative direction afterwards the ecg signal is guided in the r spike into the positive range with a steep rise and with a subsequent steep drop back into the negative range while forming the s spike in reality the ecg signal is accompanied by a certain level of noisiness as indicated in fig1 by the dashed signal curve if this noisy signal is now sampled and converted into discrete signal values in chronological order the sign of each signal value can be determined and a check can be performed as to whether a zero crossing of the ecg signal though the zero line 1 has taken place between these signal values outside the qrs complex a high number of zero crossings occurs in a defined segment n 1 whereas a much lower number of zero crossings is detected during sampling of a segment n 2 in the qrs complex the count of the number of zero crossings may thus be used to detect a qrs complex the ecg signal is sampled and converted into discrete signal values x n in chronological order the sampling rate may be f 360 hz for example i e the ecg signal is converted into a sequence of 360 measuring values per second the detailed sequence of the inventive evaluation method will now be explained. |
9 | roller 97 is equal to the diameter 2r of the roller 96 the depth d of the groove is at least equal to the maximum diameter of the optical waveguide for example approximately 2 mm the embodiment shown in fig1 and 17 is particularly suitable for use as an extension line in this embodiment a 1 piece molded element 130 has a plurality of molded disks 132 133 134 135 136 and 137 thereon arranged in two columns and three rows at the edge of the element 130 are recesses at which clamping devices 138 139 140 141 142 and 143 are located the optical waveguide is mounted at one of these clamping devices at the respective entry and exit points of the element 130 the clamping devices 138 and 143 are centrally disposed along the narrower edges of the element 130 with a recess extending therebetween esentially dividing the element 130 in half the clamping devices 139 and 141 are disposed on opposite sides of the element 130 as are the clamping devices 140 and 142 with recesses extending between those respective pairs of clamping devices bounded on each side by one of the disks between any two oppositely disposed clamping means therefore a path for the waveguide exists and between any two adjacent disks there exists a region at which the guide grooves intersect after the waveguide has been inserted in the guide grooves and wound around as many of the disks as needed the unit may be covered by a cover plate 131. |
3 | the part there can also be a gauge to measure the pressure differential between the room and the inside of the chamber the main components inside a sample chamber in accordance with the present invention with the exception of the sample are the translation stages and the chuck the chuck can be a relatively simple vacuum system which can be mounted to the rotary stage and connected to a pump such as a carbon vane pump through a rotary or other appropriate connection the chuck can be smaller than or equal in size to the size of the part if the chuck protrudes past the part a small amount of chuck material may deposit on the edge or surface devices such as rotometers and mass flow controllers can be used to meter gas flow a system can for example use mass flow controllers with piezoelectric transducers to monitor gas flow on all lines except the auxiliary a power source and control panel can be rack mounted this can be a commercial unit useful for low pressure capacitively coupled discharges the rack can also contain the stage controller and the electronics for the mass flow controllers the introduction of reactive gas into the plasma can be controlled by a mass flow controller over a range for example of 2000 ml of cf 4 per minute to 0 05 ml per minute with an accuracy that may be in the range of u2212 2 0 with such a system it may be possible to go from for example 40 l min of cf 4 by using cf 4 in the main body of the plasma to 0 01 ml min using dilution there can be. |
2 | vertically respectively the vertical sides 10 of the rectangle pass through the square transport plane 5 at its four corners the entire clear passage cross section at right angles to the direction of transport of the apparatus 1 is therefore determined in the vertical direction by the vertical length of the rectangle sides projecting upwards above the transport plane 5 and in the horizontal direction by the horizontal distance between the vertical rectangle sides 10 appertaining to the strap guide frame 3 on the one hand and to the strap guide frames 3 39 on the other hand the strap guide frames 3 3 39 are each provided on their side pointing inwards in relation to the clear frame opening with a strap guide channel 11 which is also shown only schematically in fig2 and 3 as is known this strap guide channel 11 is actually constructed in such a manner that when the strap is pulled together it is opened for example with the aid of hinged parts as it also known however it may also be open at the side in which case arrangements are made to eject the strap laterally from the channel after a closed loop has been formed but before it is pulled together below the transport plane 5 there is disposed in the table 6 a device by which the straps 12 can be inserted into the strap guide channels 11 described above by way of example. |
6 | the spacer 15 is preferably stacked and concentric to the reed plate 11 which is preferably stacked and concentric to the rotor 1 when the device is in use in a preferred embodiment the reed plate 11 is approximately 0 3 mm thick the thickness of the spacer 15 depends on the thickness of the grooves or worm trails in a preferred embodiment the grooves are approximately 4 mm deep and the spacer is approximately 10 15 mm thick oil comes through the cam shaft into the rotor 1 a make up oil hole 2 also receives oil from the cam a hole 4 for phasing provides oil to passageways 6 which lead to a first fluid chamber a second hole 5 for phasing provides oil to passageways 7 which leads to a second fluid chamber a pin 10 is preferably located on the rotor 1 to orient the camshaft the chamber reed valves 13 and 14 are aligned with the recesses 8 and 9 the chamber reed valves 13 and 14 on the reed plate 11 are preferably tabs or flapper valves which work as check valves when the system is pressurized forward it pushes the chamber reed valves 13 and 14 down when the system is less pressurized the chamber reed valves 13 and 14 close the chamber reed valves 13 and 14 act as check valves for the system fasteners for example bolts 3 preferably fasten the rotor 1 the reed plate 11 and the spacer 15 together the spacer 15 includes a cavity 16 where oil is fed through the camshaft and make up oil is fed through. |
4 | which the washing liquid is removed from the machine and a spinning or extraction operation in which the clothes are centrifuged to remove more liquid from the fabric a tub 24 has a concentric perforate basket 26 therein for receiving clothes to be washed a tub ring 28 is provided to prevent splash from the washing action from flowing over the top of the tub the tub ring 28 is provided with an opening 30 through which clothes are received into the basket 26 an agitator 32 is provided within the basket 26 to impart a washing action to the clothes the tub 24 is supported by a base plate 34 which is suspended from the cabinet 10 by three suspension rods rod 36 being the only such rod illustrated the rod 36 is connected to the base plate 34 by a resilient member 38 and to the cabinet 10 by a resilient member 40 a motor 42 and a transmission 44 are suspended from the base plate 34 and provide a means of driving the agitator 32 and the basket 26 a valve pump 46 is provided to circulate the washing liquid during the washing operation and to remove the liquid from the tub 24 during the draining and spinning operations a clutch and brake assembly indicated at 48 allows for engagement of the agitator. |
5 | plus a drop which is at least six inches long the drop may then be used in subsequent planks in a preferred embodiment however the forming process is continuous rather than requiring an individual to separately form each plank a plurality of individual boards are joined together as described above to produce a long continuous plank this long plank may be of any length greater than a single desired plank but is generally preferred to be at least twice the desired plank length it is particularly preferred that the long uncut plank be formed to provide an integral number of the desired planks for instance if a uniform 5 foot long plank is desired boards can be joined to form a single long plank of 10 15 or 20 feet this long plank may then be cut into 2 3 or 4 individual planks respectively the saw cutting the long plank into individual planks is desirably a travelling saw which is known in the art and need not be discussed further here such a saw may be fed with a continuous supply of long planks or a single very long plank and will automatically produce planks of uniform length this automated process will further reduce labor costs the present process produces planks of reproducible and uniform length these planks may then be easily assembled into sets for uniform packaging each set having the. |
3 | ml the mixture was stirred at reflux for 24 h and extracted with ethyl acetate 3 u00d7 150 ml the combined organic extracts were washed with brine and dried na 2 so 4 after removing the solvent under reduced pressure flash chromatography 1 1 diethyl ether hexane of the residue gave 14 20 g 66 over two steps of the title compound as a yellow oil 1 h nmr 250 mhz cdcl 3 d 7 09 d 1h 6 82 6 72 m 2h 4 27 t 2h 3 75 t 3h 3 71 s 3h to a solution of 2 bromo 1 2 chloroethoxy 4 methoxybenzene 1 38 g 5 22 mmol in thf was added 190 mg 7 82 mmol of mg and mei 3 ml the mixture was sonicated for 2 h and stirred at room temperature for additional 20 h the reaction was quenched with 3n hcl 50 ml and extracted with 1 1 hexane ethyl acetate 3 u00d7 50 ml the combined organic extracts were washed with saturated nahco 3 brine and dried na 2 so 4 after removing the solvent under reduced pressure flash chromatography 3 1 hexane ethyl acetate of the residue gave 0 66 g 85 of the title compound as a colorless liquid 1 h nmr 400 mhz cdcl 3 d 6 80 d 1h 6 70 d 1h 6 65 dd 1h. |
2 | the panel 12 is slid into a u shaped section such as the section 31 of the corner member 16 as shown in fig3 then the panel 15 is slid into the u section 30 the panels 13 14 and the corner member 18 are assembled in the same manner then the panels 12 and 13 are joined by the corner member 17 and the panels 14 and 15 are joined by the corner member 19 the stand assembly is now complete alternatively the panels may be inserted into the corner members by pushing a panel laterally into a u shaped section the inner arms 30 39 41 39 of the u sections preferably are made longer than the outer arms to aid in guiding the panels during such insertion the stand may be collapsed to the flat configuration shown in fig2 and stored or placed in a vehicle for transport when ready for installation the stand is opened from the flat configuration of fig2 to the open configuration of fig1 in some applications the stand is now ready for use however if desired some additional member may be utilized to maintain the stand is the desired open configuration this could be an item positioned within the stand such as the reservoir 22 alternatively it could be. |
5 | surface may be provided on only the exterior side of the poured concrete wall such as to facilitate use of flange 34 of retainer 22 to attach exterior siding to the wall insulating panels can be provided only on the interior side of the wall with flange portion 34 of retaining strip 22 used for attaching interior drywall paneling or the like when the wall system and method of this invention is used for insulating both sides of a poured concrete wall the retaining strips on the exterior side of the wall can be used for securing exterior siding to the wall and the retaining strips on the interior side of the wall can be used for securing drywall or the like in fig7 there is shown an alternative embodiment of the retaining strip 122 retaining strip 122 includes a segmented web portion including a web portion segment 130 a extending between an exterior flange 134 and a parallel interior flange 135 and a second web portion segment 130 b extending from interior flange 152 to an enlarged anchor portion 132 depending on the dimensions of retaining strip 122 and the dimensions of insulating panel 18 insulating panel 18 may be retained between flanges 134 and 152 or flanges 134 and 152 may engage parallel grooves in the edges of adjacent panels 18 as another alternative one or the other of flanges 134 and 152 may be engaged in a groove formed in the edge of an insulating panel 18 while the other flange engages one. |
7 | a vt below vss the output is pulled down through transistor 89 to vss during program the output of a corresponding control circuit 80 for a deselected row is 5v the input is at 0v causing transistor 88 to be on and transistor 89 to be off since signal line 96 is at 5v the output is pulled up to 5v through transistor 88 vdd 5v with signal line 96 at 5v transistor 89 is off and the charge pump is off during read the output of a corresponding control circuit 80 for a selected row should be at 2v the control circuit 80 for the row has vdd at 2v vss at 2v vrr at 3v and clock input inactive to select the row the input is at 0v which causes transistor 88 to be on and transistor 89 to be off signal line 96 is pulled high to 2v transistor 87 is a very weak transistor and will be on providing a current path between vrr and vdd through transistor 83 and inverter 90 but by sizing the transistors 87 and 83 and by making the source of vrr strong this current can be sustained and the voltage on signal line 96 can be held close to 2v turning transistor 89 off therefore the output is at 2v. |
3 | olefinically unsaturated amides such as acrylamide n methyl acrylamide n t butyl acrylamide n cyclohexyl acrylamide diacetone acrylamide methacrylamide and n ethyl methacrylamide u03b1 u03b2 olefinically unsaturated n alkylol amides having the structural formula str1 wherein r is a hydrogen or an alkyl group containing from 1 to 4 carbon atoms and x is a number from 1 to 4 such as n methylol acrylamide n ethylol acrylamide n propylol acrylamide n methylol methacrylamide and n ethylol methacrylamide polyfunctional compounds such as methylene bis acrylamide ethylene glycol dimethacrylate diethylene glycol diacrylate allyl pentaerythritol and divinyl benzene u03b1 u03b2 olefinically unsaturated carboxylic acid monomers containing from 3 to 10 carbon atoms such as acrylic acid methacrylic acid crotonic acid u03b2 acryloxy propionic acid hydrosorbic acid sorbic acid u03b1 chlorosorbic acid cinnamic acid u03b2 styrlacrylic acid itaconic acid citraconic acid maleic acid fumaric acid mesaconic acid glutaconic acid aconitic acid and the like the preferred acid monomers are the u03b1 u03b2 monoolefinically unsaturated monocarboxylic acids such as acrylic acid and methacrylic acid and the like as are known to those skilled in the art mixtures of one or more of the above mentioned monomers may be employed if desired generally the butadiene or alkyl acrylate polymers will contain about 50 to 70 by weight butadiene or alkyl acrylate wherein the alkyl group contain 1 to 8 carbon atoms 20 to 45 of acrylonitrile and up to about 20 by weight of other polymerizable vinylidene comonomers interpolymerized the polymer latices may be prepared using any of the conventional polymerization techniques the emulsifier may be charged at the outset of the polymerization or may be added incrementally or by proportioning throughout the run any of the general. |
7 | a shape in which the mass body 180 may be inserted therein that is the mass body 180 cover may include a bottom plate 172 and an installation plate 173 supporting the bottom surface of the mass body 180 and a support plate 175 extended from the bottom plate 172 and the installation plate 173 toward the side surface of the mass body 180 the support plate 175 may be configured of front and rear support plates 176 and 177 supporting the front and rear surfaces of the mass body 180 and an end support plate 178 supporting the end portion thereof here the end support plate 178 may protrude from end portions of the front and rear support plates 176 and 177 in the length direction toward the end surface of the mass body 180 meanwhile the cover seat part 189 of the mass body 180 may be positioned on the installation plate 173 in addition although the bottom plate 172 and the installation plate 173 are discontinuously shown in the length direction in fig8 the present invention is not limited thereto the bottom plate 172 and the installation plate 173 may be provided integrally with each other to be continuously provided in the length direction fig9 is a perspective view illustrating a circuit board of the vibrator according to the embodiment of the present invention referring to fig9 the circuit board 200 may be connected to the piezo element 160 see fig1 and vibrated integrally with the elastic member 140 to this. |
6 | the heat shields 15 have perforations to direct an outflow flow of cooling air 16 to enter the combustor 7 the outflow of cooling air 16 mixes with the fuel air mixture in the combustor 7 and immediately on exit also forms a cooling air film to cool and protect the heat shields 15 from heat and combustion gases the intermediate chamber 14 has a higher internal pressure than the combustor 7 and the heat shields 15 have rails 17 along their external edges to seal the intermediate chamber 14 against the surface of the combustor shield 13 the combustor shell 13 is generally manufactured by machining of a metal alloy with a high heat resistance or more recently by direct metal laser sintering dmls additive manufacturing the heat shields 15 are generally cast of ceramic or metal alloy and can be produced by the metal injection molding mim process due to manufacturing dimensional tolerances and fitting of two parts with mating surfaces the assembly will always result in a gap 18 through which some compressed air leakage 19 occurs shown as dashed arrows some degree of air leakage 19 is beneficial since outward air flow purges hot combustion gases that would otherwise be trapped in eddies within the edge joint area of the heat shields 15 however leakage through the gap 18 that is uncontrolled or excessive is detrimental since leakage 19 can decrease engine efficiency through increased use of compressed cooling air and dilution of combustion gases leakage. |
4 | abstract a rotary clothes hoist which is foldable and may also function as a sun umbrella is described the hoist has a plurality of extending arms which are held in position by tensioning members and each arm has a clothes line attached the hoist is arranged for adjustable and removable insertion in a socket thereby facilitating its removal and allowing utilization of the area for other activities application_number US 75106376 A description now having regard to the drawings numeral 1 represents a tension member for an arm 2 member 1 may be attached to a ring 5 fixed to the post 6 close to the top thereof and detachably connected to the side of arm 2 in any suitable way the clothes line 4 which may be of a plastics material is fixed to a lower ring 11 secured to the post 6 and is adapted to be fitted into the end of arm 2 by an end connecting member 3 if desired the member 3 may be permanently fixed to the arm 2 by e g welding the length of the line 4 is such that when operating is taut and properly tensioned arm 2 is preferably attached to post 6 by a hinge 10 which enables it to move freely in a vertical plane when tension member 1 is detached in fig7 and 8 the tension member is indicated as 101 and is adapted to fold down over an arm 2 when released from the distal end of 2 it is shown attached onto a flanged member 105 which fits into the support post 6 as shown member 105 is secured in position by a. |
1 | from donor and recipient archival blood samples in the hla lab would be used for sequencing sirp u03b1 using standard sequencing facilities the donor recipient frozen blood sample pairs would be given a unique anonymous id lacking any diagnosis or any outcome details particular attention would be paid to sequence exon 3 of this gene which encodes the igv domain that is critical to ligand binding and function and also to sequence two additional exons that encode the intracellular regions of the gene which include important amino acid residue for conveyance of signals emanating from sirp u03b1 one would create a sirp u03b1 sequence database of these individuals stripped of any patient identifiers and perform statistical analysis for association between sirp u03b1 variations and bone marrow engraftment outcomes in the donor host pairs referring to fig9 three snp assays given ds notations were established to detect variable nucleotides underlying several non synonymous coding polymorphisms we detected among the human hapmap samples polymerase chain reaction pcr amplification primers and detection probes were designed based on applied biosystems taqman system the discrimination between sirp u03b1 variants v1 v2 etc is shown at bottom of the table in fig9 fig9 shows the validation of the discrimination power of each snp assay by independent sequencing of the sirp u03b1 igv domain pcr amplified from each of the human hapmap samples shown at the left side of the table the extent of normal human polymorphism in sirp u03b1 igv domain sequence is to be determined and use of both snp assays and sequencing for use in clinical studies is to be optimized the methods and data employed are widely accessible and known by those of ordinary skill in the art see for example the international hapmap project fig1 a is a. |
2 | 40 sec tube 14 inlet pressure p4 0 30 psig 0 30 psig 0 30 psig mpsd 16 processing time in lt 15 sec lt 15 sec lt 15 sec mpsd 16 pressure p5 30 60 psig 75 95 psig 75 95 psig expansion volume 22 refiner feeder 30 and casing 28 dwell time in lt 10 sec lt 10 sec lt 10 sec expansion volume 22 refiner feeder 30 and casing 28 fig2 a and b are schematics of a macerating pressurized screw 16 with dilution injection feature suitable for use with the present invention according to the embodiment of fig2 a chip material 32 is shown in the central dewatering portion of working section 20 where the diameters of the perforated tubular wall 34 rotatable coaxial shaft 36 and flights 38 are constant a chip plug 40 is formed in the plug portion of the working section immediately following the dewatering portion where the wall is imperforate and the shaft has no flights but the shaft diameter increases substantially producing a narrowed flow cross section and thus a high back pressure that enhances the extrusion of liquid from the chips through the drain holes formed in the wall of the central portion the constricted flow and macerating effect may be further enhanced or adjusted by use of a tubular constriction insert not shown within. |
1 | in both the distal and proximal directions near its proximal end the lumen 50 widens at a neck 52 to take on a larger diameter cross section proximal of the neck 52 correspondingly the everting tube 48 widens to form a stub 54 disposed within the larger diameter portion of the lumen 50 the neck 52 coacts with the stub 54 to limit the travel of the everting tube 48 in the distal direction 0043 fig7 and 8 show the proximal end 28 of the sheath 24 in detail note that fig7 and 8 are oriented 90 u00b0 with respect to one another so that fig7 may be considered a side view and fig8 a top view a longitudinal slot 56 is formed in the wall of the cannula 40 near the proximal end 28 the slot 56 permits an allen screw 58 to extend from a threaded hole 60 in the stub 54 beyond the external wall of the cannula 40 and into a space 62 formed by a radial groove 64 in the everting knob 26 between distal and proximal walls 66 68 with the screw 58 in place one can cause the everting tube 48 to move in either the distal or proximal direction by manipulating the everting knob 26 if the everting knob 26 is rotated so as to advance in the distal direction the proximal wall 68 of the radial groove 64 bears on the screw 58 as the everting knob advances distally causing the everting tube 48 to move distally within the lumen 50 similarly if the everting knob 26 is rotated so as to advance in the proximal direction the distal wall 66 of the radial groove. |
7 | the slider near the leading end the bonding process creates a displacement force upon the slider to effect the shift an alternative approach reshapes a row of sliders prior to rail shaping e g by sand or bead blasting application_number US 66062996 A description according to known methods a wafer of substrate 11 such as the one shown in fig1 a is deposited with a matrix 12 of transducers the wafer surface is scribed to define a plurality of transducer bearing sliders and rows of sliders are sliced from the wafer 11 for further processing fig1 b shows a section of a row 13 sliced from the wafer of fig1 a the row includes a plurality of sliders 14 each having at least one transducer 15 deposited thereon the transducers 15 are located at the trailing ends of the sliders 14 during row processing a surface 16 of the row is lapped to form the air bearing surfaces of the sliders 14 and to attain desired transducer dimensions e g the desired throat height of an inductive head or the desired stripe thickness of a magnetoresistive mr head additional processing may be performed such as rail etching before individual sliders are separated from the row in storage devices such as magnetic disk drives a slider 21 such as the one in fig2 a is mounted to the flexible portion 26 of a suspension which. |
7 | the shutter using the shutter mechanism winding the film by the film winding mechanism and ending this sequence of operations in s 1300 the decision unit 30 stops the calculation of variance values by the variance value calculation unit and the target value calculation unit 35 stops the calculation of target values in s 1400 the angular velocity sensor 10 is turned off in s 1000 when it has been determined that the half depression timer 90 is off the electrical power supply unit 130 simultaneously with the off operation of the half depression timer 90 stops the supply of electrical power to the angular velocity sensor 10 in s 1500 the timing of the half depression timer 90 stops the half depression timer 90 stops timing simultaneously with the off operation of the half depression switch 90 and the operation of the sequence ends the processing flow of calculations of the decision unit in the vibration motion detection device according to the first mode of embodiment of the present invention will next be described fig3 is a flow chart which illustrates the processing flow of calculations of the decision unit in the vibration motion detection device according to the first preferred embodiment of the present invention fig3 gives a detailed description of s. |
9 | conforms to the contours of the user 39 s head when cured by cooling the liner assumes a rigid construction that by custom fitting repeatably aligns the helmet shell to the head of the user and is crushable to absorb energy application_number US 53477990 A description turning now to the figures and in particular fig1 there is illustrated a helmet system utilizing a helmet liner constructed according to the teachings of the present invention designated generally with the reference numeral 10 the helmet system 10 is shown as comprising a helmet shell 12 which would normally be fabricated from multiple laminations of a composite material such as sold those fabricated from a product sold under the trademark kevlar and or similar composite materials while a principal function of the shell is to protect the wearer 39 s head it can also operate as a mounting point for such devices as for example precision optics systems not shown that require accurate alignment of the shell and the mounted optics with the wearer 39 s eyes mounted within the helmet shell 12 for placement between the interior surface of the helmet shell 12 and a wearer 39 s head not shown is a liner combination 14 illustrated in phantom in fig1 as perhaps better illustrated in the partial sectional view of the helmet system 10 in fig3 the liner combination comprises an energy absorbing liner 14a located adjacent the interior surface of the helmet shell 10 and an inner comfort liner 14b located to be positioned next to the head not shown of the wearer the energy absorbing liner 14a is mounted to and held in place in the helmet shell 12 by a removable adhesive system such. |
8 | shown in line vi if an incoming byte has 8 bits then there should be no change in the contents of buffer 105 to cause oscillator 109 to be adjusted however if an input byte has 9 bits this is detected at 107 and the controller 108 would interpret this as a justification bit in the absence of a signal on line 117 so that oscillator 109 is adjusted at the appropriate rate for bit justification as determined by the operating rules for the transmission system referring to fig4 byte justification information is combined with raw sdh clock signal in a summing device 11 and the result is used as the write clock for a byte elastic store 12 thus justification bytes are blocked from entering the store the byte justification information is also made available to a byte filter coefficient block 13 and a signal therefrom is combined with elastic store 12 fill status information in summing device 14 the elastic store fill status information is a measure of the difference in the rates at which data is read into and out of the store 12 summing device 11 byte elastic store 12 first filter coefficient generator 13 and summing device 14 form. |
7 | in two step immunochromatography commercial oil based ink correction fluid made by zebra co ltd is applied in various patterns around the reaction site on the aforesaid chromatography strips a see fig2 and after drying the same mixtures of liquid specimen and colloidal gold marker antibodies as in 9 above are allowed to impregnate the strips and after 5 minutes of development the 34 34 or 34 34 indicators in the reaction sites are compared visually the results of the indicator appearances and shapes are illustrated in fig2 11 study of notches for 34 34 and 34 34 indicators in one step immunochromatography various notches are cut as in 9 above on the aforesaid immunochromatography strips b see fig3 and 500 u03bcl portions of each of the hcg containing specimens as in 9 above or a blank of pbs containing 0 1 wt bsa in test tubes are allowed to impregnate only the lower 5 mm of the strips and after 5 minutes of development the 34 34 or 34 34 indicators in the reaction sites are compared visually the results of the indicator appearances and shapes are illustrated fig3 12 study of applying oil based ink for 34 34 and 34 34 indicators in one step immunochromatography commercial oil based ink is. |
1 | distributor 102 the wireless transmitter 103 and the plurality of needles probes collectively or integrally form an internal part unit of the system the radio frequency rf antenna transducer 101 the controller optimizer 106 and the wireless receiver 105 collectively form an external part unit of the system the internal part unit of the system is implanted at the target location of the patient 39 s body the external part unit of the system is placed outside the patient 39 s body and is under supervision of a physician according to one embodiment herein the system comprises the plurality of needles probes plates rods which are inserted and implanted at the target area in the patient 39 s body the implanting of needle probe at the target location eliminates the need to re insert the needle probe for plurality of times or several times thereby potentially decreasing the risk of infection bleeding and the discomfort from the insertion of the needle the radio frequency radiation generates heat at the needle or probe the target area for radio frequency ablation is typically identified using a decision making process that includes imaging studies like x rays ct scans and mris physical examination of the patient response to previous treatment modalities and diagnostic local anesthetic injections in order to confirm that the target is actually involved in a pain generating process once the target is identified the wire type probes are inserted percutaneously using a needle under the guidance of fluoroscopy or ct scan the larger probes and rods are placed surgically under direct vision and secured at the target location according to one embodiment herein the miniaturized thermometer 104 of the system is configured to measure a temperature of a nerve or disk. |
3 | that do not present the accumulation for example cells expressing high levels of nucleolin on the plasma membrane of the cell may be selected due changes in the stiffness and deformability of the cell as used herein u201c selectively kill or induce apoptosis u201d means that more of the cells which are the target of the killing or inducing apoptosis are so affected as compared to other cell subject to the same exposure ultrasound devices can be used according to practices well known to those skilled in the art to destroy cells by vibrational techniques for example u s pat no 5 601 526 1997 and international publication no wo2009 143411 2009 ultrasound parameters such as frequency power and pulsation can be screened for effectiveness in selectively destroying the targeted cells differential destruction or inducement of apoptosis may be by selection of the stiffer cells or by selection of the cells by their resonant frequencies ultrasound as described above can be applied to a subject with monitoring to determine that inflammatory responses such as fever or swelling do not exceed limits well known to be safe this process can be repeated at intervals to maintain a level of therapeutic benefit evaluation of improvement or maintenance of a desired result can be used to direct the frequency of reapplication of ultrasound according to the present invention the application. |
5 | mounting locations associated with each of the end connected support arms 28 and 30 see apertures 36 and 38 in fig2 through which are inserted connecting knobs with threaded shafts at 40 and 42 to assemble and secure together the beam 26 and support arms 28 and 30 this allows the platform to be broken down for improved storage or transport such as into and out of a wooded area additionally providing a more compact design improves both manufacturing and packaging aspects of the invention a pair of adjustable clamps see at 44 and 46 are seated within extending and end disposed channels 48 and 50 defined in the main cross over beam 26 a further pair of underside engaged and interiorly threaded nuts see knob shaped articles at 52 and 54 are provided and are selectively tightened in a rotated fashion with portions of the clamps 44 and 46 which extend through the linear channels 48 and 50 this in order to reposition laterally inward outward the locations of the upper hook shaped ends of the clamps 44 and 46 in order to secure such as side locations of the ladder platform 18 which is overlapping supported upon the main assembleable platform 14 the configuration of the laterally adjustable clamps provides adaptability between multiple sized tree stand or ladder stand platforms the invention contemplates an upper hook shaped portion associated with each clamp. |
8 | received at physically diverse locations and which have been converted from radio frequency to intermediate frequency each of the signals is checked for signal strength and for amplitude versus frequency dispersion each signal is run through a separate amplitude slope equalizer which removes amplitude slope each signal is then run through a separate squelch circuit which either attenuates the signal or passes it on undiminished the squelch circuits are controlled by a control circuit which selectively activates one or neither of the squelch circuits based on the difference in signal strength between the two received signals and the signal dispersion of each of the signals the outputs of the squelching circuits are then combined to create a composite signal which is comprised of one or both of the equalized signals application_number US 10041393 A description fig1 depicts a radio receiving system with a frequency down converter andan intermediate frequency combiner in such a system two antennas are located at physically diverse locations each of which is intended to receive the same signal the purpose of the separation is to overcome multipath fading effects in fig1 the two antennas 2 and 4 receive a signal and send it to frequency down converters 10 and 12 for the purposes of this description the signal received by antenna 2 is to be called signal a and the signal received by antenna 4 is to be called signal b the single oscillator 6 provides a signal to a signal splitter 8 which splits the signal and provides it to the two frequency down converters 10 and 12 the frequency down converter for signal. |
9 | oppositely spaced on body portion 64 to receive and retain retaining cams 60 and 62 when bifurcated end 32 is located within cavity 66 in a preferred embodiment the retaining cams 60 and 62 are located diametrically opposed from one another the locking window 70 and 72 are similarly located to correspond to the location of retaining cams 60 and 62 as best shown in fig3 the locking windows may be of a shoe shape or u201c l u201d configuration each having a longitudinally extending entry slot 74 that terminates in a laterally or circumferentially extending slot 76 to retain retaining cams 60 and 62 as illustrated in fig5 in its preferred embodiment strain relief cap 26 is a cylindrical cup shaped member having axially extending entry slots opening into the open end of the cap wire slots 78 and 80 have been positioned diametrically opposed from one another to receive wire 28 it should be appreciated that only one wire slot 78 is needed if it is chosen to terminate center portion 40 within cavity 66 of strain relief cap 26 wire slots 78 and 80 may be configured similar to locking windows 70 and 72 further although bifurcated end 32 may extend upwardly from a side surface of contact 22 it is preferred to bend it in a know matter relative to the side surface toward the axis of cylindrical portion 30 and then upwardly along the axis to center the bifurcated end 32 relative to cylindrical portion 30 as illustrated in fig3 in this manner a cylindrical cap 26 can. |
4 | numbers from figure to figure fig1 and 2 illustrate a steam ironing appliance with a base 1 housing in a manner known per se a steam generator connected by a steam cord 2 to a crease removing head 3 the base 1 having two wheels allowing the appliance to be moved easily by tilting the base and a removable tank 1 a equipped with a handle for facilitating the removal thereof more particularly according to the invention the appliance has a device for hanging a garment comprising a single pole 4 extending vertically from the base 1 wherein the pole advantageously has four telescopic segments and extends to a height of around 1 2 m when it is fully deployed the pole 4 is advantageously fastened onto the edge of one of the lateral faces of the base 1 and bears a top rod 5 and a bottom rod 6 having a length of around 40 cm the top 5 and bottom 6 rods being capable of occupying a work position illustrated in fig1 through 3 in which position they extend horizontally above the base 1 the top rod 5 has two elastically deformable clips 51 disposed on either side of a suspension tab 50 fastened in the middle of the top rod 5 wherein the tab 50 and the two clips 51 are advantageously fastened onto the top rod 5 by means of clamping jaws which allow their positioning on the top rod 5 to be changed the suspension tab 50 preferably has a half moon shape on which can be positioned a hook of a clothes hanger 7 the half moon shape ensuring that the hanger 7 is held in the plane of the top rod 5 as illustrated in fig1. |
9 | 34 t 34 shaped tie clip the clip is designed to be used in conjunction with the tie loop commonly found on the rear surface of one of the tie ends the top portion of the clip grippingly engages the shirt and the bottom portion of the clip extends into the tie loop application_number US 43332689 A description referring to fig1 the instant invention is a tie clip 1 that is preferably in the form of a 34 t 34 the top portion 2 comprises an inner portion 4 side portion 6 and outer portion 8 extending downwardly and perpendicularly from the outer portion is bottom portion 10 fig2 is a cross sectional view of the device shown in fig1 in this figure one can readily see that the top portion 2 of the device is shaped like a bobby pin type of hair pin the top portion has a gripping function and the material from which it is fashioned has a degree of resiliency the inner portion 4 can be manually spread apart from the outer portion 8 and a material can be placed between the two portions when the portions are released they tend to spring back toward the shape shown in this figure and thereby grip the sandwiched material fig3 shows an example of the starting material from which the clip is fashioned portion 4 is bent 180 degrees to lie approximately directly in front. |
9 | activates and the pressure pumping apparatus is removed with full pressure remaining in the assembly where setting paste is used as the charging medium it will cure rapidly preventing any leakage and subsequent loss of tensile load on bolts 120 when a particulate solid is used as the charging medium it will retain the tensile load indefinitely as it is already at a high density fig7 illustrates a third embodiment of the present invention where a standard form of hydraulic nut 210 is charged with charging medium 250 using media exchanger 260 in the same manner described with reference to fig3 to 7 in this case the pressure of the charging medium is not required to be maintained since the force generated is maintained by locking ring 216 which is screwed into nut 211 and engaged with piston 217 which cooperates with nut 211 to form annular chamber 230 when this type of hydraulic nut needs to be removed intact at a later time the charging medium used will be of a fluid nature in order to assist with re pressurisation for loosening lock ring 216 owing to the nature of the charge medium used the sealing capacity of fasteners 10 210 of tensioning devices 110 need only be rudimentary as illustrated in fig8 and 9 the leading edges of components and sliding engagement may be altered in order to enhance the sealing ability when viscous materials are used as the charging media the use of charging media 50 150 250 and in particular the use of solid injectable media such as graphite and of particulate solids of a granular nature such as steel balls wilt allow the hydraulic tensioning fasteners and hydraulic tensioning. |
6 | which leads to the formation of a corresponding rib shaped projection in the barrel the advantages of the polygonal barrel are not impaired and thus through the preferred inventive measure of remaining outside of the caliber circle the gas seal and thus the muzzle velocity of the projectile as well as the higher life expectancy in comparison to barrels with the grooves and lands are not reduced and the easier cleaning of the interior of the barrel is also maintained the invention shall be explained in greater detail below through the use of the drawing figures in an exemplary embodiment of fig1 the cross section of polygonal barrel 1 with six linear polygonal segments 2 is depicted the inscribed circle 3 of which preferably the caliber circle corresponds to the caliber measurement the areas that lie outside of the caliber circle or the arched segments 4 offset the entire surface of the barrel cross section without the consideration of the ribs 5 on the entire cross section of the projectile in each of the six arched segments 4 is centrally located a rib 5 that extends radially inward their depth t of which is so small that neither the lateral walls of the rib 5 nor its end wall cuts the inscribed circle 3 and with this implementation the rib 5 lies completely outside the caliber circle or on the caliber circle fig3 and 4 depict an alternative exemplary embodiment with a triangular form of the ribs 5 and with an arrangement of the ribs 5 in the transition between the polygonal segments 2 and the arched segments 4 and consequently twelve ribs 5 are provided here as well their depth t is chosen in such a way as with the first. |
4 | mechanical pumps of the type shown in u s applications ser no 11 496 143 and ser no 11 769 521 are suitable to use in steam appliances 11 311 411 and 711 tubular pumps of the type shown in u s application ser no 12 421 261 are also suitable for use the contents of these applications are incorporated wherein by reference in their entirety steam appliances 11 111 211 311 411 611 and 711 provide many advantages for ease of use because they utilize either an electrical or mechanical water pump with an automatic on off switch to activate the water pump in all the appliances displacement of actuator 26 126 226 326 426 626 or 726 allows the user control over when water is to be discharged into the boiler since the amount of water routed to the boiler is controlled the boiler can create steam in a short amount of time in each case a fabric steam pad frame is typically placed over steam frame 16 116 216 316 416 616 or 716 for effective steam cleaning it will thus be seen that the objects set forth above among those made apparent from the preceding description are efficiently attained and since certain changes may be made in the above product. |
3 | were discarded and only those ssdna which were not bound to the bacteria were collected and amplified to be used for a subsequent selection process the finally obtained ssdna was amplified via pcr by using primer pairs and cloned by using a cloning kit topo ta cloning kit plasmids were isolated from each colony and nucleotide sequences of the ssdna were analyzed and as a result a total of 25 different nucleotide sequences were obtained table 1 below shows the selected 25 different nucleotide sequences of the ssdna selected by the selex process table 1 nucleotide sequences name in random regions k1 5 u2032 gagtcggtggtgttcccagatgg aagccgcagtaatagtgcagct 3 u2032 seq id no 1 k2 5 u2032 aatcaggctcagcatggagttgc gaggccaatatccggttaagcg 3 u2032 seq id no 2 k3 5 u2032 tgtccttcagacccctgatttga ttaatattcttaaagtcttcag 3 u2032 seq id no 3 k4 5 u2032 ctttataacactgttactatcgc ctgttagaggtaatgagttctt 3 u2032 seq id no 4 k5 5 u2032 ataccgcatggatgaggtgttgt acttgggtgctgggggggtctg 3 u2032 seq id no 5 k6 5 u2032 ttttacagctaaaccggtgtaat gtccttgttcttcatacataca 3 u2032 seq id no 6 k8 5 u2032 tcttttagggagtccctattaag tattgtaaccttaggactgaat 3 u2032 seq id no 7 k9 5 u2032 cttaactagttgcatgggtcctg ctcgagggatcgtgggtgatgg 3 u2032 seq id no 8 k10 5 u2032 atgactcattggtgcttcgcatt ttactgcatctcctaatattgg 3 u2032 seq id no 9 k11 5 u2032 tcttttagggagtccctattaag tattgtaaccttaggactgaat 3 u2032 seq id no 10 k13 5 u2032 gggtgcgcgggttaatagatttt ataaaaagttgtgcctgtcgtt 3 u2032 seq. |
2 | 35a 35b as will be described later when inputted with the analog signal u03b2 the not circuit 62a outputs a digital signal u03c5 as a result the signal u03c5 from the not circuit 62a is outputted to one terminal of the nand circuit 62b the distinction signal u03b1 outputted from the gate array circuit 42 is also inputted to the other terminal of the nand circuit 62b via the line 70 the nand circuit 62b outputs a signal u03b4 to the rank signal terminal 58 of the cpu 43 depending on the state of the distinction signal u03b1 and the signal u03c5 next while referring to the waveform charts shown in fig7 and 9 an explanation will be provided for changes in the waveforms of the analog signal u03b2 and the signals u03c5 and u03b4 resulting from different connection conditions of the switching points 35a 35b fig7 shows waveforms of signals produced when both the switching points 35a 35b provided to the cob 27 are left open fig8 shows waveforms of signals produced when the switching point 35a only is closed fig9 shows waveforms of signals produced when the switching point 35b only is closed when a print head 2 with known rank characteristic is mounted in the printer 1 a distinction signal u03b1 is outputted from the gate array 43 to the driver ic 26 over the print data signal line 59 it should be noted that when the distinction signal u03b1 is outputted over the print data signal line 59 and not over a signal line exclusively for the distinction signal u03b1 other signals such as for driving the print head 2 must not be outputted over the print data signal line 59 at this time resultant current will flow from the. |
2 | h in the figure by means of the pulse motor 14 39 at the tip of the spindle 15 is fixed the second machining head 16 which drives the machining electrode 18 in the direction shown by arrow h in the figure by the pulse motor 16 39 via the electrode mounting jig 17 as the operation of the second machining head 16 will be described later the description here is based on the assumption that the second machining head is in a still state the movement of the spindle 15 in the direction h by the pulse motor 14 39 of the first machining head 14 is controlled in such a manner that the gap between the machining electrode 18 and the work 13 can be maintained constant with the progress of machining in accordance with predetermined machining conditions such as electrode voltage discharge current etc hereinafter referred to as automatic servo drive in place of the pulse motors 14 39 and 16 39 for driving the first and second machining heads 14 and 16 a hydraulic servo drive unit and other appropriate automatic servo drive units may be used the electrodischarge machining equipment for use in this invention as shown in fig4 a and 4b is capable of setting the angle of the first machining head 14. |
3 | il kg35 but with optimal conversion for il kg38 the most compelling results from this data set are obtained using ils kg51 and kg38 using 0 005 g catalyst after 24 h 100 conversion and selectivity were obtained more surprising is the fact that the selectivity was retained up to 48 h thus suggesting that hydrogenolysis of this compound in this il system only occurs with the unsaturated ester more evidence of this fact is observed when the non hydrogenolysed reduced product 12 is further subjected to hydrogenation conditions using an increased amount of catalyst no hydrogenolysis is observed table 14 the significance of this result is based on the fact that il kg51 completely prevents hydrogenolysis of the benzyl ester after the fourth recycle the selectivity remains constant but the conversion decreases slightly to 91 upon recycle 7 only upon recycle 8 is a significant drop in conversion observed 81 varying catalytic amounts were tested for the hydrogenation of benzyl cinnamate using il kg38 table 16 as can be seen from the results displayed in table 16 the increasing amount of catalyst favours hydrogenolysis optimum conditions being observed with 0 005 g catalyst the effect of cation chain length and the number of oxygens in the side chain was investigated to determine whether it was only the cation from ils kg51 and kg38 that gave the best selectivity table 17 it is evident from the results obtained that any difference in the length of the side chain or the number of oxygen atoms in the chain. |
7 | to show how the holographic windows of fig3 a and 3c may be used in hand held portable laser bar code scanners it will be appreciated of course that windows of the type shown in fig3 could also be used in other scanners such as fixed installations fig4 a and 4b illustrate a conventional bar code scanner using a conventional transmissive scan window 13 as may be seen in fig4 b the scanner produces a scanning beam having a beam waist 26 the beam scans across a scan angle 24 providing symbol reading capabilities throughout a working range 22 in front of the working range there is a dead zone 20 within which a bar code symbol is normally too close to the scanner housing to be properly decoded as may be seen in fig4 c the replacement of the conventional window 13 with a suitable holographic window 113 may eliminate the dead zone and may improve the working range to a new value 122 the scan angle 24 may also be improved and widened to a new scan angle 124 this may be achieved by making use of a hologram which has a spatial frequency distribution given by equation 2 in which the focal length f is negative this produces a holographic window which is in many ways equivalent to a negative lens a wide angle scanner of this type is efficient for high density bar code reading fig5 a and 5b show a second application of a holographic window fig5 a. |
9 | 306 to provide greater structural continuity in alternative embodiments a bottom face 308 of the base adheres directly to the exposed surface 304 a of the elastomeric layer 304 the second layer 303 is created by a multilayer structure incorporating a screen and or foil metallic layer 310 such as aluminum a polymer layer 312 such as peek and an adhesive layer 314 supports the elastomeric layer 304 the polymer layer 312 and adhesive layer 314 may be supplied as a portion of the preformed appliqu u00e9 as described with respect to fig9 below or directly deposited on the elastomeric layer 304 the metallic layer 310 provides a conducting material for lightning strike protection in an exemplary aircraft usage of the embodiment the metallic layer polymer and adhesive multilayer structure may be comparable to a current lightning strike appliqu u00e9 lsa employed for composite aircraft structural surfaces the elastomer layer 304 supporting the riblet tips 302 may provide elastic sideways deformation and recovery for the tips 302 when lateral forces are applied thereby further enhancing the durability of the rigid riblet tips additionally the elastomeric layer 304 flexibility may allow greater ability to conform to complex contour shapes fig4 demonstrates a third embodiment for the rigid tipped riblets 112 in fig1 which takes advantage of the structural capability provided by the material from which the riblets 112 are formed to allow a sharper profile of tips 402 for the embodiment shown in each of the tips 402 extends from a base 406 supported in an elastomer layer 404 as with the. |
4 | than 100 kg mm 2 the growth of crack in the cord during the running becomes large and the effect of improving the bes resistance is not obtained in the steel cord according to the invention it is required that the breaking load s satisfies a relationship represented by the following equation because the sufficient internal pressure is first held when the above relationship is satisfied when the steel cord is applied to tires for truck and bus used on bad road under heavy load it is preferable to satisfy the following relationship the above breaking load s of the cord is obtained by drawing high carbon steel having a c content of 0 80 0 90 by weight while the reduction ratio is controlled to a proper value of not less than 94 according to the invention it is required that the steel cords are arranged so that a distance g between the adjoining cords is within a range of 0 6 2 0 mm in the belt layer g is measured from the edge of one cord to the adjacent edge of the next cord when g is less than 0 6 mm cracks produced around adjoining cords are apt to be connected to each other and bes is easy to be caused while when g exceeds 2 0 mm the rigidity of the belt decreases to degrade the steering property of the tire and the wear. |
1 | in combination with this invention fig1 is a partially cut away schematic of one embodiment of the bone screw device 10 of this invention there is the shaft 12 with threads 30 and cutting edge 40 elevation line 42 shows the height of the kerf or cutting edge 40 above the root 44 reference point elevation line 46 illustrates the diameter height of threads 30 in this embodiment it may be appreciated therefore that cutting edge 40 forms an excavated zone above root 44 reference location around the device upon insertion into bone this feature is designed to cut a pathway to allow dispersion of tissue reinforcement material the height shape and angle of the cutting edges of this structure control the direction that the material is dispersed preferably this results in the removed material tissue being directed away from the excavation site and allows for insertion of the reinforcing material in an even distribution to aid in the purchase of the screw in anchoring within weakened bone tissue cut away distal portion u201c a u201d shows an internal lumen 20 and an optional open tip 50 that communicates with the lumen 20 as shown also in fig1 fig2 is a partial cutaway view of another embodiment of the invention where an aperture 60 is positioned on the shaft 112 with nearby cutting edge 140 protruding between threads 130 on device 110 the distal portion u201c a u201d of the device is a cutaway showing aperture 60 in conjunction. |
4 | operation of the circular knitting machine in mind reference can now be made to fig1 3 wherein the particular construction and arrangement of the sinkers and needles for carrying out the present invention is depicted the annularity of the knitting machine and the fact that a plurality of needles and sinkers are intended will be obvious from fig1 although only one set of needles and sinkers are shown each loop forming sinker 10 is associated with a needle 12 which itself is retained in conventional manner within a vertical bed 14 formed by the inwardly extending ribs 16 of a conventional needle cylinder 18 the needle cylinder 18 rotates about a vertical axis x x by the provision of suitable rotating means conventional cams jacks yarn feeding devices etc are also provided although as noted not shown each needle 12 has a hook 20 a latch 22 and a vertical shank 24 each sinker 10 has an elongated linear body terminating in a heel end 26 and a head end 28 the heel 26 is slideably located within an oblique slot 30 formed on the upper edge of a sinker cam ring 32 located within the cylinder 18 while the head end 28 rides in a similarly formed slot 34 aligned along the same oblique path the slot. |
2 | the boat the weight and pull if sufficient create a moment that rotates the upper pontoon 34 over top center as mast 2 pivots relative to the plane of the pontoons 34 to a configuration such as that of fig5 where gravity acting on the out of water pontoon 34 and the force on the righting line returns the boat to the upright position unfortunately and this is the defect of the prior art referred to previously mast 2 can easily become unseated as seen in fig2 and 3 because the restraint on mast base 4 out of mast seat 5 has been removed dismasting usually cannot be corrected in the water even with the help of others with the righting apparatus 40 of the invention a catamaran 30 may be upset as shown in fig4 and a single sailor by actuating righting gear 40 can lengthen the out of water shroud 17 and put a compressive force on mast 2 that retains mast base 4 in mast seat 5 to attain the configuration of fig5 then pulling on a righting line while standing on the in water pontoon 34 will right the boat and the mast will not be unseated the details of the righting gear 40 are seen by reference to fig6 which shows the rig under sailing conditions fig7 which shows the rigging with the mast 2 tilted about 20 degrees which is the preferred maximum and to fig8 which is a schematic of the system a permanent shroud 17 is released as in the prior art and the loose end is retained by a lanyard 18 39 similar to the prior art but. |
3 | and its stroke drive 9 as well as the cable drums 21 for winding the bearing cables 14 and the auxiliary cables 15 and their stroke drive 8 are mounted on a common horizontal platform 19 fig4 the platform 19 is set in rotation about the axis of the pulling cable 6 by the rotation drive 10 the drives 8 and 9 are therefore capable of driving the vertical movement of the pulling cable 6 and the synchronous vertical movement of the cables 14 15 of the supporting device independently of one another since the relief of the thin neck portion 11 is intended to be initiated in a controlled manner after the gripping catches 18 have made contact with the bicone 13 of the single crystal 5 it is possible to insert above the cable drums 7 21 guide rollers 24 25 over which the cables 6 14 15 run and the bearings of which are each connected to load cells so that electronic signals relating to the loading due to the weight of the individual cables are available at any time in order to ensure that all the cables 6 14 15 each run perpendicular to the guide rollers 24 25 it is advantageous for the cable drums to be mounted on their drive shafts 22 23 such that they can be displaced laterally and if appropriate adjusted when the cables are wound on and unwound the movement of the cables 14 15 in relation to one another in order to pivot the gripping catches could be achieved by using in each case one separate. |
1 | changing the color of the symbols the player that chose the combination then gives more feedback so as to further direct and aid the guessing player in making further guesses the guessing and feedback repeats until the guessing player guesses the correct combination or a certain number of guesses which was established previously has elapsed in an alternative embodiment the number of combinations can be reduced based on the age of the players for example if the players were ages six to eight the guessing player may only have to guess the color and position of the tetrahedron face the number of attempts the guessing player receives can be increased or decreased another example is if the players where ages nine to twelve the guessing player may only have to guess the color the position and the symbol type the game can be played on both a structural apparatus to be described later on in the specification or on a computer console or similar electronic device where the computer console or electronic device is one of the two players for example a single player can play the game against the computer where the computer selects a random a u201c chosen combination u201d and provides clues the game can also be played online e g on the internet where one player chooses a combination at a computer terminal located in one geographic location and plays with another player present at a. |
1 | 1 of the embodiment fig1 a illustrates a plan view and fig1 b illustrates a side view the insertion apparatus 1 includes a nozzle body 10 that serves as an apparatus body which is formed with a cross section having a substantially rectangular tube shape so that one side is largely opened hereinafter the largely opened side is referred to as a trailing end 10 b and the other side end is provided with a nozzle portion 15 as a thinly narrowed insertion tube and an obliquely opened leading end 10 a and a plunger 30 which is inserted into the nozzle body 10 so as to move in a reciprocating manner furthermore in the description below the direction directed from the leading end 10 a of the nozzle body 10 toward the trailing end 10 b is set as the front to rear direction the direction perpendicular to the drawing paper of fig1 is set as the up to down direction and the direction perpendicular to the front to rear direction and the up to down direction is set as the left to right direction the vicinity of the trailing end 10 b of the nozzle body 10 is integrally provided with a hold portion 11 which projects in a plate shape and is used for a user to hold the hold portion by fingers when the plunger 30 is pressed toward. |
2 | hatchback lid parts 5 6 take on an almost completely folded up position the two hatchback parts 5 6 are folded up completely at reaching the bottom resting position also when slid downwards shown in fig4 there are appropriate devices not represented provided which can include spring elements dampers or electric motors these support a mutual folding up of the two hatchback parts 5 6 in closing the hatchback opening from the top or bottom resting position it is also ensured that the two hatchback lid parts 5 6 remain in their respective positions when being released by using an appropriate mechanism starting from the top resting position in fig3 a swivelling of the folded up hatchback lid parts 5 6 can additionally be swivelled towards or onto the car roof 2 by using swivel bearings this additional function is indicated in fig3 through the arrows 20 and 21 as can bee seen in fig4 the completely folded up hatchback lid can be additionally used as a trunk sill shelf seat area or similar when in the bottom resting position for this a protective carpet or similar can be provided which could be pulled out from the floor bottom 3 see arrow 24 in fig4 which would protect the top hatchback lid part. |
3 | were added followed 15 minutes later by 0 5 ml 4 05 u00d7 10 3 mole of diisopropenyl ether the reaction was completed after another hour of stirring and the solvent evaporated under reduced pressure the crude liquid was chilled and filtered to remove 0 32 g 2 75 u00d7 10 3 mole of starting diol vacuum distillation at 21 24 mm hg 2 8 3 2 kpa in the presence of diphenyl ether as a high boiling solvent produced 1 93 g 92 percent product and 7 2 percent diphenyl ether boiling point 84 u00b0 c to 85 u00b0 c and 0 31 g 77 percent product and 22 percent diphenyl ether boiling point 88 u00b0 c to 90 u00b0 c of colorless liquid the yield was 1 29 u00d7 10 2 mole 52 percent the product has a boiling point of 92 u00b0 c to 96 u00b0 c at 22 mm hg 2 9 kpa nuclear magnetic resonance and mass spectrum analysis showed the product to have the structure str10 five microliters 6 5 u00d7 10 5 mole of cf 3 cooh were added to a solution of 7 41 g 4 07 u00d7 10 2 mole of d mannitol and 8 0 ml 6 48 u00d7 10 2 mole of diisopropenyl ether in 50 ml of heated dimethylsulfoxide at a constant temperature of 65 u00b0 c after 70 minutes 1 5 ml 1 22 u00d7 10 2 mole of diisopropenyl ether was added forty seven minutes later the dimethylsulfoxide was evaporated at 18 mm hg 2 4. |
7 | be an opened ended wave guide with directionality for simplicity only one receive antenna 312 can be used however in other embodiments multiple receive antennas 312 can be used in certain embodiments one power setting can be used for reading and an elevated power setting can be used for writing since passive rfid needs more power to write then to read having separate power setting for the read and write process can reduce exposure to high power rf fields for the tags for example in one embodiment the system can be configured to rely on tag encode information to determine what power setting to use this can be accomplished for example by writing information into each tag indicting the number of documents present in slot 302 for example when the first document is placed in slot 302 the number 1 can be written into the corresponding tag when a second document is placed into slot 302 then the number 2 can written into each tag the system can the be configured to read this number out of the tags in order to determine a power setting for example if the number 10 is read out of documents 304 then the system knows that 10 documents are present and it can be configured to automatically set the power to the appropriate level for 10 documents by doing this the system can eliminate the possibly of overpowering tags in situation where only 1 exist and under powering when 10 or more exists in another embodiment the transmission power of the interrogator including antenna can operate within a range for example the transmission power can start with the minimum power setting with a. |
5 | if concave rollers 31 as shown in fig6 are used the bottom side of the pavement mixture 11 will have a convex shape while the top side will be substantially flat if cylindrical rollers 31 are used both top and bottom sides of pavement mixture 11 will be flat the thickness i e the distance between the top and bottom sides of the pavement mixture will be determined by the spacing between the sets of rollers 31 and 32 the width of the pavement mixture will be determined by the volume flow rate of pavement mixture 11 from dispenser 38 and the rotational velocity of rollers 31 and 32 rollers 32 and flexible belt 34 extend only part way along rollers 31 and belt 33 after being formed to a predetermined size and shape by rollers 31 and 32 as described above the pavement mixture continues along moving rollers 31 and belt 33 an adhesive 13 such as epoxy is applied to the top side of the shaped pavement mixture by a conventional adhesive dispenser 40 the support portion 12 metal or plastic mesh in the preferred embodiment is dispensed from storage roll 41 applied to the top side of the pavement mixture and attached thereto by adhesive 13 the composite pavement mixture and support is fed continuously to cutting means 42 this cutting means may be conventional shears for making straight edges or. |
6 | unit 80 which communicates with a sensor 90 for example for measuring the sealing gap u a fan device 60 is further arranged in the connecting line 40 which is used to produce the flow in the tubing system or at least to support the same the fan device 60 can also be controlled by the control unit 80 moreover a filter unit 50 is arranged upstream of the heating device 70 which especially removes solids from the control medium or the air the air heated by means of the heating device 70 and or the fan device 60 is finally discharged via the outlet 192 after having flowed along the tension rod 14 over virtually its entire length and is preferably supplied to the gas volume flow 4 to be heated not shown the rod bodies 13 and 14 can be subjected to different temperatures with the illustrated arrangement this leads to a good controllability furthermore it is possible to provide an indirect control of a sealing gap depending on the temperature of the gas volume flows and a partial volume flow which is possibly branched off from the same it thus offers the advantage that a flow along the rod bodies 13 and 14 specifically predetermined by the chambers 171 and 172 can be produced so that a defined heat transfer to the rod bodies 13 and 14 is ensured it is thus also possible to easily determine the dependence on the changes in axial length or the flow volume of the air or the control medium and to set the sealing gap u on. |
7 | such a way that the eye 12 must change its accommodation so as to bring the image into focus this causes the field of view of the eye 12 to be fully occupied with an up close image if the cameraman 39 s eye 36 changes to a long view of the scene 32 as explained above the image 54 fig3 fills the screen 28 because the control signal on the line 26 causes the optic 24 to expand the extent to which the screen 28 is filled by imagery at the same time the signal on the line 64 causes the optic 60 to expand the field of view provided for the eye 12 e g by reducing its magnification or increasing its focal length the eye 12 changes its accommodation accordingly in other words when the control signal on the line 26 causes the optic 24 to increase the extent to which the screen 28 is filled by imagery as in fig3 the signal on the line 64 causes the optic 60 to increase the field of view provided for the eye 12 even further e g by decreasing its magnification even more fig6 shows a variation of fig1 where instead of sensing the cameraman 39 s eye the eye of the user is sensed as shown an eye sensor 70 senses an eye of a user for instance by sensing accommodation a control signal having a magnitude indicative thereof is provided on a line 74 to a control 76 which provides it. |
4 | 25 8 11 81 0 nabh sub 4 di 1370 17 4 15 61 0 nabh sub 4 11 2 ppm ca 1030 32 7 26 2______________________________________ di deionized water of all the samples listed in table 1 only those samples showing statistically significant improvement over the untreated unwashed control papers are included in tables 3 and 4 as shown in table 3 all of the samples showing significant improvement in brightness retention had been washed with 11 2 ppm calcium the 1 0 percent nabh 4 treated samples showed significantly greater improvement in brightness retention than that conferred by calcium washing alone as shown in table 4 a 1 0 percent nabh 4 solution treatment followed by 11 2 ppm ca wash shows 25 to 30 times the folding endurance stability of the control and 4 times the stability of a ca wash alone also both 0 1 percent nabh 4 treatment without a wash and a 1 0 percent nabh 4 treatment with a deionized water wash showed significant improvement newsprint paper from a single roll was cut into 8 34 by 10 34 machine long sheets the newsprint was made from about 80 percent groundwood and 20 percent unbleached sulfite pulp newsprint sheets were treated and aged and physical and chemical properties measured as specified in example 1 table 5 lists the initial physical and chemical properties conferred to the experimental newsprint papers by the various treatment and or washing procedures for newsprint the borohydride treatment produced increases in initial handsheet brightness of up to 10 brightness units the decrease in brightness observed on calcium washing is typical of newsprint but the combination of either 0 1 percent or. |
9 | the c 18 c 36 saturated synthetic fatty acid wax will range from about one to about ten percent by weight of the total composition and the hydrophobic silicones will vary from about two to about twenty percent by weight a number of film forming agents polymers and cosmetic resins can be employed in combination with the present base formulation when product design considerations warrant their inclusion such agents polymers and resins include polyvinylpyrrolidone pvp eicosene copolymer vinylpyrrolidone vinyl acetate copolymers in which the monomer ratio ranges from 70 30 to 30 70 vinyl acetate unsaturated carboxylic acid copolymers for example 90 of vinyl acetate and 10 of crotonic acid terpolymers of methyl methacrylate stearyl methacrylate stearyl methacrylate dimethyl aminoethyl methacrylate which have been completely quaternised with dimethyl sulphate the monomers being used particularly in the ratio 20 23 57 a terpolymer of vinyl acetate allyl stearate allyloxyacetic acid especially in the ratio of 80 15 5 maleic anhydride methyl vinyl ether copolymers such as 34 gantrez an 34 and the ethyl isopropyl and butyl esters thereof and maleic anhydride butyl vinyl ether copolymers another unexpected advantage of the present invention occurs when those polymers which are known to produce a sticky or tacky feel in conventional cream bases are used in the present invention they create a smooth and silky composition which is neither tacky nor sticky for pharmaceutical preparations a number of medications may be employed as an active ingredient when uniformly dispersed throughout the cream conditioner of the. |
9 | by means of an electromagnet the detent or stop means described are merely one technical possibility among many others of achieving the same goal fig3 a shows schematically in cross section supplementing fig3 one possibility of connecting the surfaces of the two structural shells or panels 41 for instance by detent or stop means in the end position imparted to them in the pressure housing for an unlimited period of time for this purpose there are welded onto the inner side of the lower structural shell or panel 41 two correspondingly large square pipes 75 detent or stop elements 76 are inserted against the action of compression springs 77 between universal guides 78 in said pipes said detent or stop elements 76 propel and can be pushed in to an extent which is limited by stops they are provided with backwardly extending bevels the distance between the two detent or stop element carriers 75 is such that said elements snap and engage into solid body 79 which is welded to the inside of the opposite structural shell or panel 41 and which is provided with incisions 80 corresponding to the triangular shape of the detent or stop elements 76 and their distances apart from each other under spring pressure 77 upon a corresponding change in position i e reduction of the distance between the structural shells or panels thus they permit further movement up to the end position only in direction towards a reduction of the distance between the structural shells or panels such means which connect the inner surfaces permanently against the inner. |
5 | one aspect of the invention is the utilization of a compression arrangement as described herein in conjunction with the above mentioned wearbushings as described above casing hangers are run together with a wearbushing through the wellhead the wearbushings are disposed to be gripped by a grip mechanism of the invention to lock down the casing hanger during the various wellbore drilling related activities such as pressure testing the next drilling phase etc once the activity is complete the grip mechanism is then released in order to remove the wearbushing before the next casing hanger is installed with reference to fig6 8 the systems illustrated use a grip mechanism such as upper compression system 165 of fig4 to hold and lock each casing hanger through a wearbushing on which it is run the wearbushing stays in place until the next casing hole is drilled bop tests can be performed without having to pull the wearbushing and with drill pipe in the hole such a system eliminates many installation steps in prior art systems rendering the system of the invention not only cost effective to manufacture and implement but which reduces installation time improves safety and provides a much better tubing hanger seal design for maintenance free operation of the well throughout. |
1 | and grouped to substantially conform to the shape of the back of the hand and fingers of a wearer these foam segments 46 47 are generally rectangular in cross section referring to fig5 and 6 the finger segments 47 are preferably formed to curve slightly to imitate a slightly closed position of the wearer 39 s hand and its outer cover 50 preferably includes a split center section 56 to accommodate the curvature as shown in fig1 and 2 a decorative foam segment 57 may be included between the lateral segments and a thumb member of the glove and decorative panels 59 may be included between any of the foam segments 46 47 57 of the glove 10 the thumb member 38 preferably comprises upper and lower substantially rigid portions 58 60 these portions 58 60 are curved to more closely fit partially around and protect the wearer 39 s thumb the upper portion 58 does not require a foam segment and the lower portion 60 preferably includes a thinner foam segment than are used for the back and fingers segments 46 47 of the glove 10 referring to fig2 additional foam segments may be provided at the side of the glove between the index finger and thumb this. |
4 | the pulp dryer paper making mill or the like through a discharge conduit 42 to a white water holding tank 44 it is conventional in the prior art to feed the white water from tank 44 through a conduit 46 to the last washing stage 30 where it is dispensed through nozzles 48 utilization of white water in the last washer stage 30 is said to substantially eliminate effluent from the pulp dryer paper mill or other pulp processing device in this prior art system fresh water alone or fresh water mixed with filtrate from the last washer stage or fresh water with minor amounts of white water from the white water holding tank 44 are utilized in conjunction with the next to last washer stage specifically the water or water mixture is added by way of conduit 50 to dispensing nozzles 52 associated with washer stage 14 as previously stated the above described prior art arrangement eventually leads to corrosion problems in the dryer or other pulp processing apparatus due primarily to the build up of salt pitch and resin concentrations that eventually effect the quality of the final pulp product build up of other substances which are potentially harmful to users of the end product may also occur turning now to fig2 illustrated therein is a schematic diagram of. |
6 | further on the lower surface of the circular plate member 18 is provided a circular groove 14 for housing a vane guide ring 80 described later the radius of the groove 14 is larger than that of the outlet 13 and it extends from the center p of the eccentric shaft 19 the vane guide ring 80 is slidingly fitted in the groove 14 enabling vanes 31 33 to rotate while radially inner ends thereof are situated closely proximate the outer periphery of the roller with a film of oil interposed therebetween any spaces formed between the roller and the vanes are occupied by an oil film as shown in fig3 a pair of diametrically opposite guiding slots 81 83 are formed in the ring 80 through the slots 81 83 are movably fitted respective protrusions 71 73 protruding from rear ends of respective ones of the vanes 31 33 at the skirt of the cylinder 20 is provided a circular plate bearing 120 for rotatably supporting the cylinder 20 a hole 121 disposed at a center of the bearing 120 rotatingly receives the rotation shaft 21 fig4 is a longitudinal sectional view showing the arrangement of components illustrated above the. |
9 | carboxymethylcellulose sodium cmc na there may be used any cellulose ether that is derived by etherifying cellulose to make it water soluble and can be formed into a film by casting an aqueous solution thereof to a certain thickness and then drying it specifically useful alkylcelluloses include for example methylcellulose having 19 to 33 by weight of the methoxyl group and ethylcellulose having 7 to 25 by weight of the ethoxyl group useful hydroxyalkyl alkylcelluloses include for example hydroxypropyl methylcellulose having 19 to 30 by weight of the methoxyl group and 13 to 20 by weight of the hydroxypropoxyl group hydroxyethyl methylcellulose having 19 to 30 by weight of the methoxyl group and 9 to 20 by weight of the hydroxyethoxyl group and hydroxyethyl ethylcellulose having 11 to 21 by weight of the ethoxyl group and 40 to 57 by weight of the hydroxyethoxyl group useful hydroxyalkyl celluloses include for example hydroxypropyl cellulose having 50 to 70 by weight of the hydroxypropoxyl group and hydroxyethyl cellulose having 30 to 60 by weight of the hydroxyethoxyl group a useful example of carboxymethylcellulose sodium cmc na is that having 15 to 53 by weight of the carboxymethoxyl group the contents of the methoxyl ethoxyl hydroxypropoxyl and like groups can be determined according to the methods described in the pharmacopoeia of japan on the other hand the content of the hydroxyethoxyl group can be determined according to the method described in p w morgan eng chem anal ed 1946. |
1 | at approximately the center of each a release button 32 at the handle 26 of the stem 16 allows the runner 30 to move along the stem 16 to collapse the umbrella 10 as mentioned above the embodiments of fig6 29 are differentiated only by the varied use of spars 24 and side riggers 34 for supporting the canopy 12 of umbrella 10 to allow better illustration of the frame 14 in each of the embodiments the canopy has been left out of the drawings of fig6 29 in the embodiment of fig6 12 three spars 24 are used with each spar 24 being attached to an of hinge 22 b the spars 24 do not necessarily connect at the free end and may actually be shorter than those illustrated attachment of the spars 24 to the of hinges 22 b permits the greatest amount of compaction of the folded umbrella to occur the embodiment of fig2 26 includes only a single spar 24 attached to the if hinge 22 a of the stem 16 as a single spar 24 it may be necessary to extend such a distance greater than those of the previous embodiment attachment to the stem hinge creates the necessary u201c head area u201d beneath the canopy 12 slightly different from the previous two embodiments the umbrella 10 of fig1 19 uses side riggers 34 to extend spars 24 into the center of the frame periphery and outward from the frame 14 the side riggers 34 and spars 24 elevate the canopy 12 but not just interior to the frame 14 the spars 24 b allow the canopy to extend beyond the frame 14 for a much larger coverage area as with the previous three spar embodiment the spars. |
7 | on surface 6 of position resolving photoreceiver 3 swivel arm 8 and thus also deflection mirror 7 are moved far enough in the direction of reception optics 4 to establish a back focal distance s u2032 s1 u2032 s2 u2032 s that corresponds to the encountered object focal distance s if the object focal distance s is shortened as compared to the arrangement shown in fig1 swivel arm 8 and thus also the deflection mirror 7 are moved far enough away from the reception optics 4 until the corresponding now greater back focal distance s u2032 s1 u2032 s2 u2032 has been reached referring to fig3 deflection mirror 7 is mounted on a connecting rod 13 of a four bar linkage the four bar linkage additionally comprises two links 14 and 15 link 14 is connected at one end to a rotary bearing 16 secured in the housing 2 the other end of link 14 is connected to one end of a first upper end of rod 13 with a rotary bearing 17 one end of link 15 is connected to the other lower end of rod 13 with a bearing 18 and a second rotary bearing 19 secures the other end of link. |
8 | may be generated from the sequences of symbols given in table 1 the first sequence of each block being preceded by the symbols a i set to zero constant phase and followed by the information symbols that are unknown a priori whereas the second sequence of each frame is preceded by the symbols that are unknown a priori and followed by the symbols a i set to zero in the receiver illustrated in fig8 the means 11 for detecting synchronisation patterns conduct a search in parallel of the patterns associated with the above sequences depending on the sequence identified signalling information z the detection means 11 issue a command to the demodulator 12 which may operate in a conventional manner using the viterbi algorithm with a simple demodulation trellis 60 where modulation on the tch channel is non coded or with a supertrellis 61 integrating the modulation and convolutional coding states in order to obtain the gain of the coded modulation on the tch or facch the demultiplexer 62 which directs the flow of symbols output by the demodulator 12 either to the units 63 processing the traffic channel tch or to the units 64 processing the signalling channel facch the units 63 processing the traffic channel tch to indicate what the transmission rate is on this channel the radio communication system incorporating the transmitters illustrated in fig7 and the receivers illustrated in fig8 have the advantage of enabling. |
9 | 2 with two lateral wings 230 a 230 b arranged at the end to the core according to an advantageous feature core 200 is provided with means for maintaining connection points of wires 21 22 in their position illustrated in fig1 namely against the core and parallel to its axis these holding means generally include longitudinal notches formed on the centering side surfaces for example the section view of fig1 shows longitudinal slots 253 a 253 b formed in the centering side surfaces 213 a 213 b these notches being intended to respectively apply and maintain the connection wires 21 22 against the core 200 as shown in fig1 connection wire 22 is also maintained by longitudinal slot 252 a of side surface 212 a in order to improve the retention position of the connection wires second centering side surfaces are provided on the core 200 to retain the connection wires 21 22 in the longitudinal slots once they are introduced there as illustrated in fig1 for example the second retaining side surfaces of wire 22 are referenced 261 a 262 a other side surfaces of this type not shown in the drawings are symmetrically present to hold the wire 21 into the corresponding slots according to fig1 conductive annular rings 101 102 103 are then put in place by sliding along the axis of core 200 to get them respectively next to pods 240 to which they must be electrically connected fig1 shows a sectional view of the final disposition of the conductive ring 103 around the core 200 the core 200 equipped with all conductive rings is shown in fig1 rings 101 102 103 are then welded to intermediate pods 240 by laser welding electrical welding or any other suitable technology this can be. |
7 | connection and operation of the zoom lens structure 1 of this preferred embodiment are the same as the first preferred embodiment and thus they will not be described again the camera 3 comprises a zoom lens group 20 a focus lens group 21 an image sensor 30 and a control unit 31 the image sensor 30 can be a charge coupled device ccd or a complementary metal oxide semiconductor cmos sensor for sensing the light of an image of an object to be photographed to form an imaging the control unit 31 can be a microprocessor control unit a central processing unit cpu or a micro processing unit the control unit 31 is electrically coupled to the driving module 14 if the control unit 31 controls the driving module 14 to drive the zooming driving ring 11 and the focus driving ring 13 to rotate clockwise a side of the groove hole 112 of the zooming driving ring 11 abuts the first guiding protrusion 102 of the shifting barrel 10 to move in the first groove 122 and move the shifting barrel 10 to change the distance between the first lens group 201 and the second lens group 202 of the zooming lens group 20 so as to achieve the zooming effect the control unit 31 controls the driving module 14 to drive the zoom driving ring 11 and the focus driving ring 13 to rotate counterclockwise the groove hole 112 of the zoom driving ring 11 has a predetermined width such that the first. |
9 | to receive the diameter of the end of the fastener 112 the fastener 112 is threaded through the longitudinal passage 107 of the connector element 101 and contacts the pin 121 spanning the passage 107 the end of the fastener 112 is contacted on one side by the flange 123 and on the other side by the shaft 117 the sandwiching of the end of the fastener 112 between the flange 123 and the shaft 117 holds the bracket 115 inside the rod 105 and helps to prevent slippage of the bracket 115 out of the rod 105 fig5 shows another embodiment of the curtain rod assembly 500 including a bracket 115 having a shaft 517 of substantially uniform diameter as described with respect to the first embodiment this embodiment includes a connector element 501 that has a longitudinal passage 507 which accommodates the fastener 512 and a transverse passage 508 which aligns to accommodate the shaft 517 the shaft 517 is inserted through the transverse passage 508 of the connector element 501 until the end of the shaft 517 contacts the opposing wall of the connector element 501 in contrast to the first embodiment the shaft 517 of this embodiment is substantially uniform in diameter along its entire length and does not include a flange the end of the shaft 517 is held inside the rod 505 by virtue of the threaded. |
1 | of soft extract with a dry matter content of 42 6 this was dried with the aid of maltodextrin in a ratio of 70 native 30 maltodextrin the extract obtained in this way was tested in the in vivo model described in example 1 the results are given in example 7 10 kg ironwort 50 50 mixture of sideritis scardica l and s euboa l was percolated exhaustively at 50 u00b0 c with 300 liters ethanol 20 v v the eluate was drained off from the drug and liberated from drug residues the percolate was gently evaporated in a partial vacuum and all solvents removed by adding water several times this yielded 3 2 kg of soft extract with a dry matter content of 56 this was dried with the aid of maltodextrin in a ratio of 70 native 30 maltodextrin the extract obtained in this way was tested in the in vivo model described in example 1 the results are given in example 7 the mouse strain examined in example 1 is changed in such a way that the amyloid deposits typical for alzheimer 39 s disease are distinct after approx 100 days of life treatment commenced after 50 days of life the sideritis extracts as in examples 4 6 lower the soluble fraction of the u03b2 amyloid compared with the control treatment with water while s scardica produced a reduction. |
3 | glu leu gln arg met gln glu lys glu arg asn lys gly gln 100 13 23 leu hse 100 3 gly leu hse 170 ser leu hse 90 100 asn leu hse 90 100 ile leu hse 2 8 ser leu hse 90 100 asn leu hse 90 100 ile leu hse 2 11 glu leu hse 110 asp leu hse 100 2 leu leu hse 100 ile leu hse 100 4 leu leu hse 120 val leu hse 100 10 ile leu hse 110 val leu hse 100 1 tyr 100ile 10 5 tyr leu hse 100 ile leu hse 10 7 phe leu hse 100 ile leu hse 10 19 leu glu hse 90 100 leu asp hse 90 100 22 leu arg hse 90 100 leu lys hse 90 100__________________________________________________________________________ it can be found from the results shown in table 1 that an activity can be increased by exchanging one or more amino acid residues although it has been said that the pharmacological active part of the human motilin depends on amino acid sequence near n terminal the following may be said on the relation between the amino acid sequence near n terminal and a degree of the activity a the motilin analogues wherein pro in 3 position and gly in 8 position of the native motilin are exchanged to gly ser or asn residue which can take a turn structure in the polypeptide chain show the activity in the level same with or. |
4 | inches the blanket 50 includes a bevel b 39 along each of the side edges each of which defines a bevel width bw 39 i e the distance between the inwardmost point of the bevel to an imaginary line drawn downwardly from the blanket outer edge and a bevel thickness bt 39 i e the distance into which the bevel extends into the overall blanket thickness t 39 although the bevel is illustrated as being rounded in fig4 it is noted that other bevel shapes can be utilized within the scope of the instant invention including but not limited to planar bevels such as that shown in fig2 and those of mixed geometric or irregular shape for example the inner surface 50b can be beveled gradually at each side edge of the belt to define first and second substantially planar bevels in a preferred form of this embodiment each of the bevels extends at substantially a 45 u00b0 angle relative to the bearing face of the belt in the illustrated embodiment the bevel thickness bt 39 is slightly over one half of the overall blanket thickness t 39 while this thickness ratio has been found to be useful it is to be noted that other ratios and bevel angle slopes are anticipated within. |
2 | in rotation will reflect half cycle contact with insulator 63 an open circuit will reflect point a on the conductor and for the next half cycle contact will be made on the square shaped metal rotation shaft 62 reflecting a grounding with repect to point a thus as the vehicle increases its speed rotation of the rotation shaft 62 will increase in like measure and point a relative to the grounding switch 6 will shift between grounding and open more frequently as a result the discharging frequency of capacitor in the rc circuit will increase in proportion the same effects will be achieved by replacing said square shaped rotation shaft by a cam shaft 72 presumably the grounding frequency of the grounding switch 6 should increase as vehicle speeds increases and that the charging discharging frequency in the rc circuit should be in synchronism with the grounding frequency in practice due to restrictions of the time constant of rc components charging and discharging frequency in the rc circuit will terminates its increase upon reaching a critical saturation condition defined by and as dependent on the particular values of the rc components in use in application this means that the flashing period will not approach zero regardless of the prevailing vehicle speed for instance if the flashing period of a vehicle speed is set at 10 seconds at speeds around 40 km per hour and. |
3 | introduction of an oligonucleotide tgactgactga encoding stop codons in all three frames into the blunt ended clai site at the cdna 3 39 terminus while the bamhi cleavage site at the cdna 5 39 terminus was deleted by filling in using the klenow fragment of e coli dna polymerase i cells transformed with this plasmid psj10 u03b4bam7stop7 and induced with iptg synthesised a mr 27 500 polypeptide but at less than 20 of the level in cells transformed with psj5 a plasmid derived from ptac11 encoding native sj26 smith et al 1987b this difference in expression may be due to the increased gc content and length of the region between the tac ribosome binding site and the atg translation initiation codon in psj10 u03b4bam7stop7 stormo et al 1982 de boer et al 1983b and so the 3 39 terminus of the modified sj26 cdna in psj10 u03b4bam7stop7 containing the multiple cloning sites and termination codons was introduced into psj5 as follows a hindiii ndei fragment of psj5 encoding the tetracycline resistance gene was replaced with a 1 7 kb ecori fragment derived from pmc9 miller et al 1984 containing the laci q allale and a portion of lacz blunt end ligation of purified fragments after treatment with the klenow fragment of e coli dna polymerase i produced a plasmid p4. |
9 | dielectric insulation to insulate the resistor from other components or metallic surfaces it may contact during its actual operation the encapsulating material 62 is applied in any manner which covers only the resistive element materials 28 a liquid high temperature coating material roll coated to both sides of the resistor body is the preferred method the conductive elements 30 32 of each body are left exposed these conductive strips 30 32 of the resistor serve as electrical contact points for the resistor when it is fastened to the printed circuit board by the end user since the ends 30 32 on the resistor are thicker then the resistive element 28 in the center of the resistor the necessary clearance is provided for the encapsulation on the bottom side of the resistor as shown in fig6 a next in the manufacturing process is the application of marking information printing to the encapsulated front surface of the resistor this step is represented by block 64 in fig2 this is accomplished by transfer printing the necessary information on the front surface of the resistor with marking ink the strip is then moved to the separating station represented by block 70 where the individual resistors are cut away from the carrier strip 24 the individual resistors are plated with solder to create a solder coating 68 as shown in fig7 a the individual resistors 10 are then complete and they are attached to a plastic tape 74 at a packaging station represented by the numeral 72 the above process can be accomplished in one continuous operation as illustrated in fig2 or it is possible to do the various operations one at a time on the complete strip for example the attachment and removing steps can. |
5 | motions of the movable roof members 24 and 25 may be performed since the widths as well as the horizontal angles of the movable roof members 24 and 25 are designed to be consistent in this embodiment the central and side movable roof members 24a 24b 25a and 25b simultaneously reach the right most or left most wing if the central movable roof members 24a and 25a are driven at a angular velocity which is double that of the right or left side movable roof members 24b and 25b if the angular velocities of all the roof members 24 and 25 are the same first the relative location of the central and the side roof members 24a and 24b or 25a and 25b are kept as in the closed position when travelling however the side movable roof members 24b and 25b reach the side most wings 52 or 54 before the central movable roof members 24a and 25a then the central movable roof members 24a and 25a travel alone until they reach the side most wings 52 or 54 with the above construction the configuration of the movable roof members 24 and 25 and the travelling mechanisms including the tracks 40 42 44 and 46 and the electrically driven wheels 48 for travelling the members can be simplified and made compact accordingly the costs of constructing the roof members and the travelling mechanisms is decreased in addition since the movable roof members 24 and 25 are stored under the fixed roof members 26 when the roof 20 is open the portion of the opening is broader than that of conventional openable roofs this heightens the sense of openness and freedom experienced by the audience in the stadium 22 additionally since the movable roof. |
5 | pawl to follow a path similar to that described above with respect to the pawl in the first embodiment in this embodiment ring gear 222 only needs to be driven in one direction therefore only one pawl 230 is necessary and the more complex pawl disengagement structure used in the first embodiment is unnecessary in addition the teeth 224 of the ring gear can be formed with an angled configuration rather than the square configuration of the first embodiment as can be appreciated as the shaft is rotated by the turbine the pawl will function to rotate the ring gear in stepwise fashion a separate resilient spring blade not shown can be mounted to engage the teeth of the ring gear to prevent the ring gear from turning in the opposite direction alternatively a ratchet action of the type provided by the tip 73 of stop member 62 in the first embodiment could be used in accordance with this alternate embodiment the under surface of the ring gear is provided with a cam formation 240 as the ring gear rotates the cam formation 240 moves alongside each drive member 210 in turn when the formation 240 reaches a drive member the disc 214 of the drive member rides onto the cam surface 242 of the formation the cam surface 242 urges the disc to move in the direction shown by arrow a in fig1 such that the pin 218 becomes disengaged with the drive member 210 as shown in fig1 once. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.