label
int64 1
9
| text
stringlengths 113
6.79k
|
|---|---|
4 | 1 and 20 2 for example may be used each of which engage with a supporting arm 22 1 and 22 2 which are connected in a permanent manner to the forming head 3 in fig1 the actuators 20 1 and 20 2 as well as the support arms 22 1 and 22 2 are depicted by means of a broken line it is thus possible to expand the sealing of the forming zone 6 in the case of greater spacings between the forming outlet 4 and the deposit belt 8 in an advantageous manner by means of additional sealing walls on all sides of the forming zone 6 in order to optimize the forming zone in particular with the entry of the secondary air flow at the entry end another embodiment example of the device according to the invention is shown in fig3 in a top view of the forming zone 6 this embodiment is substantially identical to the embodiment example according to fig1 and fig2 such that in the following only the differences shall be explained and otherwise reference is made to the aforementioned description as such this embodiment is identical in the cross section view to the embodiment example according to fig1 with the embodiment depicted in fig3 the sealing means 12 3 and 12 4 on the longitudinal surfaces of the forming zone 6 are likewise formed by sealing walls 15 1 and 15 2 the sealing walls 15 1 and 15 2 each include adjustable wall ends 29 1 and 29 2 opposite the entry end 10 the wall ends 29 1 and 29 2 can be adjusted in an. |
8 | one of the syndromes s py and s qy is not zero for the y direction subblock in question it is deemed that the two data words each having the bit 34 1 34 error flag are actually in error the decision step 8 12 is thus followed by the step 8 14 to correct these errors on the basis of the syndromes s py and s qy in accordance with equations 9 and 10 with the error locations i and j represented by the particular two words in the procedure described with reference to fig3 the flag bits for all the data and error check words of the subblock are neither reset to 34 0 34 s nor set to 34 1 34 s by the imaginary step 3 15 and are to be set or reset depending upon the results of the subsequent x direction error detection procedure c of the flowchart of fig2 if it happens that the subblock in question includes errors which have not been detected by the initial x direction error detection procedure a then false correction is made by the step 8 14 for the two actually correct words and as a consequence the particular subblock will have three erred words including the two falsely corrected words thus making it impossible to correct the initial erred word in the y direction error correction procedure b shown in fig6 the flag bits of all the words in the subblock are either set to 34 1 34 s or neither set to 34 1 34 s nor reset to 34 0 34 s depending upon. |
7 | exclusive or operation carried out by error corrector 50 leaves data bits d i intact alternatively correction inhibit signals can operate directly on the output from decoder 92 to provide a set of zero corrector bits e 1 to corrector 50 in preferred embodiments of the present invention the signal to set the syndrome to an all zero value is derived from on chip control logic 60 in this way on chip means are provided for disabling the on chip error correction circuitry the disablement of the on chip error correcting circuitry actually enables the double complement algorithm to be carried out at the system level and furthermore allows diagnostic mapping of the memory to be done this functionality is very desirable during memory test operations when it is desirable to be able to determine the presence of faulty memory locations more importantly this provides the ability to reproduce hard errors a property which is necessary for the proper operation of the complement recomplement method employed for error correction of hard hard errors at the system level in this way when the memory unit modifications shown in fig2 is employed in a fault tolerant memory system greater system reliability is achievable without the memory unit modification whenever there is a double error at the system level the data is not recoverable with the memory unit modification all hard hard and hard soft errors at the system level are correctable from the above it should be appreciated that the present invention provides a mechanism for enhanced fault tolerant capabilities in memory. |
5 | and arranged to be installed on the keeper bars once the embodiment is properly installed on keeper bars and locked access to the container is prohibited an alternate embodiment may be permanently installed on the interior of the container such as the doors or similar enclosure fig1 shows a preferred embodiment of the invention when fully assembled front cover assembly 2 back plate assembly 4 and locking bar assembly 6 are the three major sub assemblies involved the locking bar 6 which may be a j shaped bar or referred to as a j bar is inserted by slidable engagement with the lock and retained in the lock that is present within the back plate assembly a j bar assist handle 7 may be attached to the j bar to ease j bar operation user interface 8 is present on the housing the back plate of this embodiment has a u shaped member 10 or u bar that is opposite the j bar fig2 shows an alternate embodiment of the invention that includes all of the elements of the embodiment of fig1 this embodiment further includes a keypad user interface 12 which may be used to enter an access code to unlock the device fig3 shows a rear isometric view of an embodiment of the invention when fully assembled the u bar 10 which may be formed as an extension of the back plate 4 is installed on one keeper bar of the container the sliding j bar 6 is installed on the other keeper bar the j bar may be positioned as required to ensure a snug fit between the device and the keeper bars fig6 fig4 shows a top view of an embodiment of the device with the front cover assembly removed mounting. |
3 | do this therefore most biaxial orientation processes use apparatus which stretches the films sequentially first in one direction and then in the other preferably in the md first and then in the td a discussion of high biaxial orientation of polyethylene films is provided in u s pat no 5 885 721 the present films may for example be stretched in the md from about 5 1 to about 8 1 and in the td from about 6 1 to about 15 1 the present films may be in the form of monolayer cavitated films or multilayer films including at least one cavitated layer the present film may have more than one cavitated layer for example such a three layer film may have a cavitated surface layer a cavitated core layer and a noncavitated i e void free thermoplastic skin layer other examples of multilayer films include those with both skin layers being cavitated optionally including one or more core layers which may or may not be cavitated one or more cavitated layers may also be included within skin layers which are both not cavitated any of the layers of the present film whether cavitated or not cavitated may optionally include various additives such additives include but are not limited to anti. |
1 | halepensewild oats avena fatuacotton gossypium hirsutumrape brassica napussoybeans glycine maxsugarbeet beta vulgariswheat triticum aestivum______________________________________ __________________________________________________________________________postemergent control of plant species str25 compound tested dosage in ppmx y z plant species 125 62 5 31 25 15 6 7 8 3 9__________________________________________________________________________cf sub 3 f oh cotton 0 0 0 0 0 0 rape 0 0 0 0 0 0 soybean 0 0 0 0 0 0 sugarbeet 0 0 0 0 0 0 barnyardgrass 100 100 100 80 30 0 crabgrass 100 100 100 90 80 15 yellow foxtail 100 100 100 65 20 0 johnson grass 100 100 100 100 50 0 wild oats 100 100 80 40 0 0 wheat 100 100 90 40 0 ntcl f och sub 3 cotton 0 0 0 0 0 0 rape 0 0 0 0 0 0 soybean 0 0 0 0 0 0 sugarbeet 0 0 0 0 0 0 barnyardgrass 100 100 100 95 10 0 crabgrass 100 100 100 100 100 60 yellow foxtail 100 100 100 90 0 nt johnson grass 100 100 100 100 100 20 wild oats 100 100 20 0 0 nt wheat 30 0 0 0 0 ntbr f oh cotton 0 0 0 0 0 0 rape 0 0 0 0 0 0 soybean 0 0 0 0 0 0 sugarbeets 0 0 0 0 0 0 barnyardgrass 100 100 100 100 10 0 crabgrass 100 100 100 100 100 0 yellow foxtail 100. |
5 | 13 column and the bottom of the tube 25 makes full contacts at the upper surface of the planar ring plate 37 a the pile 3 outer surface and the sleeve 4 inner surface little bulging of the tube 25 is formed at the minimum gap 42 referring now to fig1 d the grout seal assembly illustrated in fig1 a is activated with a driven pile 3 and with a maximum pile 3 offset at one side to cause a maximum gap width 35 at the other side between the pile 3 outer surface and the cone shape ring plate 37 a inner edge 39 grout 13 passes through the holes between strips 24 to fill the sealed annulus room below and to form a grout 13 column the resilient tube 25 bottom is pulled downward by the gravity load of the grout 13 column and the bottom of the tube 25 makes full contact at the upper surface of the cone shape ring plate 37 a the pile 3 outer surface and the sleeve 4 inner surface a maximum bulged section of the tube 25 is formed over the maximum annular gap 35 with a plunged action into the gap 35 to form a grout 13 sealing function and with the annular bandage tube 25 c on top in one embodiment as illustrated in fig1 e the annular bandage tube 25 c wall thickness plus the bonded annular resilient tube 25 section wall thickness together is equal or larger than the half width of the maximum annular gap 35 which is the distance between the pile 3 outer surface and the inner edge 39 of the cone shape ring plate 37 a. |
7 | node 29 equals v we i r fb the second differential amplifier da 2 comprises an operational amplifier a 4 with its non inverting input 40 connected to the first terminal of the fifth impedance load 32 and the first terminal of the sixth impedance load 36 the second terminal of the fifth impedance load 32 is connected to node 34 that forms the non inverting input of the operational amplifier oa 1 the second terminal of the sixth impedance load 36 is connected to the system ground 38 the inverting input 44 of the operational amplifier a 4 is connected to the first terminal of the seventh impedance load 30 and the first terminal of the eighth impedance load 42 the second terminal of the seventh impedance load 30 is connected to node 29 that forms the output of the operational amplifier oa 1 the second terminal of the eighth impedance load 42 connects to the output of the operational amplifier a 4 it is preferable to provide all impedance loads equal in value and obtain an output voltage at the operational amplifier a 4 equal to i r fb the implementation of da 1 and da 2 are not limited to the example embodiment shown in fig6 both differential amplifiers da 1 and da 2 are required to provide an output equal to the difference of their inputs with unity gain the differential amplifier da 1 is required to draw minimal current from the reference electrode re and the differential amplifier da 2 is required to provide sufficient output current for the subsequent stage to simplify the design da 1 consists of da 2 with additional. |
7 | and typically will use an etch gas of carbon tetra fluoride cf 4 having a gas flow rate of about between 20 to 75 sccm preferably 75 sccm the rf power of the etching process is selected to be between about 50 300 watts preferably 300 watts and the frequency of the power supplied is about 13 56 mhz but could of course vary from this frequency the temperature of the chamber is maintained at between about 5 u00b0 30 u00b0 c and preferably at about 7 u00b0 c during the process the surface of wafer 14 is continuously monitored about every 0 15 seconds by ellipsometer 18a and 18b to determine the thickness of the residual silicon dioxide layer 30 39 until the silicon dioxide layer 30 is completely removed referring now to fig4 there is a plot of actual results showing the thickness of the silicon dioxide layer 30 39 versus etching time obtained in real time and using the in situ ellipsometer for etching 6 147 u00e5 or 615 nanometers as shown initially the measured thickness remains constant as shown by reference number 34 as the etching gases are turned on and the chamber pressure rises to its necessary operating level the rf power is then turned on and the thickness immediately begins to decrease as shown by reference number 36 in the example shown in fig4 all of the film is removed and overetching of the next layer or substrate would commence at reference point 38 however as can be seen because of the extreme predictability of the curve instead of completely removing. |
2 | smallest chip thickness which usually occurs at the end lacuna of different size in addition the chip thickness is affected both by the feed of the milling cutter in the x direction and by the speed of rotation of the workpiece in order to achieve an average chip thickness h mitt which is as uniform as possible and as a second optimization target to achieve the desired optimally high cutting speed which is primarily effected by the rotation of the milling cutter it is usually necessary during machining of the web side face for both the rotational speed of the workpiece and also the feed of the milling cutter in the x direction and also the rotational speed of the milling cutter to be constantly adjusted in the case of a web cutting tip as shown in fig1 a the extent of the tip in the radial direction of the body of the milling cutter is referred to as the length of the cutting tip the extent in the tangential direction of the disc like body of the tool is referred to as the width and the extent in the direction of the cutting bit closest to the axial direction is referred to as the thickness fig1 b shows in the same direction. |
6 | 2 04 0 21 0 07 0 06 bal 1050 u00b0 c u00d7 2 hoqdisk ance 520 u00b0 c u00d7 5 hac 590 u00b0 c u00d7 5__________________________________________________________________________ hac table 5__________________________________________________________________________ impact 10 sup 5 h creepexampletensile 0 2 yield elonga reduction strength rupture strengthkind ofstrength strength tion of area ve sub 20 kgf mm sup 2 steel kgf mm sup 2 kgf mm sup 2 kgf m cm sup 2 450 u00b0 c __________________________________________________________________________1 112 0 79 3 19 8 60 1 8 7 51 12 111 7 79 5 20 1 59 3 8 3 52 33 114 3 81 2 19 5 62 5 7 2 51 34 115 7 82 6 22 3 63 4 8 7 52 75 86 4 26 7 68 8 7 5 35 26 86 8 77 1 26 9 69 1 18 2 237 111 5 20 3 63 5 8 1 55 3__________________________________________________________________________ as can be seen in table 5 the materials 1 to 4 and 7 12 chromium steel of this embodiment exhibited a 450 u00b0 c 10 5 h creep rupture strength of not less than 51 kgf mm 2 and a 20 u00b0 c v notched charpy impact strength of not less than 7 kgf m cm 2 so that it was confirmed that the materials had strength sufficient to be used as the materials for a high temperature gas turbine although the materials low alloy steel to be used as the material for the stubshaft exhibited a low 450 u00b0 c creep rupture strength they showed a tensile strength of not less than 86 kgf mm 2 and a 20 u00b0. |
9 | ph of a 20 by weight plaster suspension in exchanged water was 8 2 the plaster was introduced into a plough type mixer designated lodige followed if necessary by mixing therein the waterproofing agent the water required to set the plaster was then added to the mixer by means of an atomized spray following attainment of a homogeneous mixture the wet powder was poured into a mold and the compacting pressure necessary to obtain the desired density was applied a plurality of specimens were prepared and subjected to the tests described hereinabove the test conditions and the results obtained are compiled in table iii table iii__________________________________________________________________________ water hours on a bedtest excess proofing control of moist sandnumberplaster water agent density p c f s c s r c f h c h__________________________________________________________________________1 55 2 0 1 65 190 50 189 21 lt 5 lt 152 55 8 0 1 63 210 73 148 22 lt 5 lt 153 55 2 0 5 1 61 80 50 100 20 8 154 55 2 1 1 61 80 48 105 20 8 205 55 2 1 5 1 59 84 46 95 20 6 256 55 8 0 5 1 59 110 40 120 18 lt 5 lt 157 55 8 1 0 1 59 93 38 100 18 lt 5 lt 158 55 8 1 5 1 58 141 39 60 18 lt 5 lt 15__________________________________________________________________________ a series of tests was performed according to the operating procedure described in example 4 but utilizing a phosphogypsum and a phosphoplaster derived from moroccan phosphate rock the gypsum utilized was a phosphogypsum derived from moroccan phosphate. |
1 | 3 is a dog 9 overhanging longitudinally from the blade toward the rear of the latter and having a circular arc profile shape substantially mating the profile shape of the recess 8 into which it is adapted to engage in press fit relationship as explained hereinafter the support 2 is provided at its heel end with a seat 10 which opens both into the groove 7 and inwardly of the hollow heel portion 5 of said support said seat 10 also has a width dimension adapted to receive in press fit relationship a trailing portion 3c of the blade 3 defined on this trailing portion 3c is a dog 11 jutting out toward the toe portion of the blade 3 and having a semicircular profile shape a plate like lever 12 is housed within the heel portion 5 of the support 2 being pivoted therein about a pivot pin 13 which is carried on said portion and extends across the seat 10 the top end of said lever 12 is journalled on a peg 14 carried on the head 15 of a screw 16 which is supported rotatably on the heel portion 5 the screw 16 can be rotated by means of a knurled wheel 17. |
5 | and the system does not present a fire hazard the use of this transformer makes the system of the present invention exempt from certain wiring nec rules as current is limited with such low wattage current is only independently provided to one tank of the series of tanks 10 at a time at least one embodiment of the present invention is designed for use with freestanding or wall mounted sinks it is an in wall installation and fits between studs in conventional 2 u00d7 4 wall construction other embodiments of the present invention are designed for use in vanity or cabinet installations where the location inside the cabinet under the sink is most appropriate all embodiments of the present invention are envisioned to operate on low voltage output from a class ii transformer and only draws a maximum of 40 watts other wattages may become available in low voltage systems similar to class ii it is envisioned that a switch available to the user to set the specified design temperature for use the switch preferably enables the target design temperature to be set to 110 120 125 or other values the microprocessor 120 is configured to raise the temperature of the water within the highest priority tank first and preferably overheats the water slightly such that it may be allowed to cool slightly as power is subsequently diverted to the heating coil 60 of the next priority tank temperature ranges are preferably used in lieu of a specific target temperature the temperature of the tanks is preferably detected externally via the temperature sensors 70 as the tanks of the series of tanks 10 are preferably made of stainless steel heat is. |
6 | regulation device 17 and the second subsidiary regulation device 27 regulates the friction ring of the second subsidiary transmission 24 by way of the second servomotor 30 as well as the second regulation device 25 in terms of its axial position in such a manner that only the second reference variable 28 is used for generating the second control variable 29 in this embodiment the reference variable 28 in turn consists of a regulation variable of the first subsidiary transmission 11 made available by the first regulation variable detection 20 and a regulation variable of the second subsidiary transmission 21 made available by the second regulation variable detection 30 in this connection the reference variable 28 evaluated by the subsidiary regulation device is formed by the difference in the speed of rotation of the friction rings 14 24 whereby here too an axial position of the first friction ring 14 for example can be used possibly with the inclusion of a position offset characteristic field to take a calibration measurement into consideration in deviation from the measurement devices of the regulation variable detections 20 30 described in fig1 in this embodiment a speed of rotation measurement of the friction rings at the small guide wheels 5 of the adjustment devices 15 25 is provided in that the speed of rotation of the small guide wheels 5 themselves is detected it is immediately evident that slip can occur between a small guide wheel 5 and a friction ring as well and therefore the measurement of the speed of rotation of the friction ring can be subject. |
5 | this force the pyramid is first tipped up side down step 11 thus applying a force f e that preserves the locations of all the pins and then tipped as shown in step 12 finally the pyramid may be uprighted as shown in step 13 this applies a force f g which moves locking rod 58 39 back to the bottom of its channel 58 thus unlocking the bottom portion of the drawer 52 the upper portion remains unlocked because locking pin 56 39 is blocked from falling into its locking position by blocking pin 60 39 the location of all the pins is now as shown in fig4 a 4b and 4c and the drawer may be pulled or extended from the pyramid as shown in fig2 to lock the drawer all that need be done is to close the drawer tilt the pyramid back as in step 4 of fig5 so that a force f cd will move blocking rod 60 39 back to the rear of its tunnel thereby allowing locking pin 56 39 to fall back into its locking position when the pyramid is uprighted fig6 depicts a perspective view of a different embodiment of the present invention used to lock a pair of plug and receptacle type objects together in fig6 the objects are shown as cylindrical in shape but any geometrical shape could be used a first object 70 is adapted to interface with a second object 72 the first object 70 includes at least one large finger like extension 74 that is inserted into a corresponding cavity section 76 of the second object 72 a keying flange 78 and corresponding keying grove 80 are. |
5 | for providing a good engaging effect of course the plurality of flanges 12 as shown in fig9 can be partitioned and installed in the same direction or a whole piece is installed in the same direction to achieve the advantages of a good reinforced structure and a good engaging effect from the description above the steel wire 4 among the plates 11 is passed through the plurality of through holes 13 disposed on the flange 12 or a plurality of screw bolts 14 disposed on both sides of the plate 11 and the steel wire 4 is passed through the plurality of screw bolts 14 as shown in fig1 to substitute the flanges 12 by a simpler method in addition to the foregoing embodiments the steel body 1 also can be made of a steel bar b as shown in fig1 and 14 instead of a steel 10 brace a ad the steel body 1 is woven by the steel wire 4 into a mesh shape similarly an external steel plate frame 2 is covered onto the exterior of the steel body 1 and a gap is formed between the external steel plate frame 2 and the steel body 1 further a connecting wire 5 is provided for connecting the external steel plate frame 2 and the steel body 1 and the concrete 3 is filled up into the external steel plate frame 2 and engaged with the steel body 1 the steel wire 4 and the external steel plate frame 2 to form a structure of tightly connecting the steel body 1 the external steel plate frame 2. |
7 | to and retrieves output test data from the chip functional circuitry via the chip in and chip out lines the scan out line for any particular pad scan circuit 14 is also the scan in line for the next pad scan circuit 14 in the ring a test access bus 20 comprising three conductors is also illustrated in fig1 connected to each of the pad scan circuits 14 the test access bus 20 carries control data controlling the operation of each pad scan circuit 14 as will be more fully explained in conjunction with the discussion of fig2 as will be more fully appreciated after the discussion of fig2 test data can be entered into the chip via any of the i o pads 12 and the results taken off chip for analysis via any of the i o pads 12 thus it is not necessary to have an i o pad and corresponding integrated circuit pins dedicated for providing test data to the chip or retrieving test results from the chip however the present invention does not pre empt the use of dedicated pins for input and output test data if so desired the use of the pad scan circuits 14 for each i o pad allows complete testing of two paths overlooked in prior art test techniques in the prior art designs after the chip is inserted into a system the signal path from each pad to the first scanning test register cannot be tested completely without the aid of external devices this is due to the loss of access to individual chip pads once a chip leaves its test environment the present invention allows test data to be serially clocked into each or any. |
5 | alternatively referring to fig3 if neither the use of slots 332 or 432 or the bottom edge 344 of the lowest rows of apertures 326 and 426 extend below plane 442 to allow water to drain into gutter 302 another embodiment of this invention is shown an inherent opening 771 is formed between the trough 330 and 430 of covers 300 and 400 the adjacent edges of 334 and 434 of both covers form flaps from the overlapping of the troughs 330 and 430 which because the angles of the front walls 334 and 434 are different and inherent space 771 is formed between them which serves to deliver any water in trough 430 into the gutter 302 during rain fall conditions temperatures outside the gutter 302 and covers 300 and 400 are cooler than temperatures inside the gutter 302 and cover 300 and 400 this difference in temperatures creates a minor pressure difference such that the pressure inside the gutter 302 and covers 300 and 400 is lower pressure than the pressures outside the gutter 302 and covers 300 and 400 the combination of this pressure differential and surface adhesion causes any water in the trough to be drawn through the inherent opening 771 the opening is sufficiently small enough to keep debris from entering the gutter 302 fig4 depicts a third embodiment of the present invention fig4 depicts a cover 500 installed under the roofing shingles 504 of a building 506 typically the building 506. |
8 | or may be implemented in various combinations of hardware and software furthermore for use in a modular architecture of an elmc the sspc unit 300 a may be grouped with sspcs for a plurality of loads on a single card of a load management module furthermore additional elements may be included with the physical implementation of the sspc unit 300 a illustrated in fig2 and or certain elements may be removed 0019 fig3 illustrates an alternative embodiment for power switching and arc fault protection in accordance with principles of the present invention in the alternative embodiment illustrated in fig3 an sspc unit 300 b comprises the power switching device 310 and a switching control and protection device 320 b as compared to the switching control and protection device 320 a for the embodiment of the present invention shown in fig2 the switching control and protection device 320 b shown in fig3 does not include an arc fault protection unit i e there is no one to one correspondence between sspc unit and arc fault detector instead a dedicated arc fault protection unit 160 connected to the data bus 150 via an input 161 monitors the total load current supplied to a plurality of load channels 1 to n more specifically the dedicated arc fault protection unit 160 measures the total load current passed to the plurality of channels. |
2 | an open space on the upstream end of the conveyor 1 any time that the sensor x1b and x1a is blocked the second buffer conveyor 2 does not run consequently there is always a space available on the upstream end of conveyor 1 to enable the operator to 34 split 34 overlapped articles as shown in fig6 there are two overlapped articles 61 and 62 for example two luggage bags which have arrived at the coding station the leading end of the article 61 has actuated the sensor x1 and so conveyor 1 has stopped the coding operator notes the overlapped articles and as shown by arrow 63 manually slides the article 62 backward to a separated position shown dotted at 62 39 the coding operator notes the destination of the article 61 and presses the appropriate destination button on the coding panel 31 the conveyor 1 then runs for a predetermined time to transfer the article 61 onto the take away conveyor 40 there is a predetermined take away count which lasts for approximately 250 milliseconds to provide sufficient time for the longest typical article to be transferred from conveyor 1 onto the take away conveyor 40 the article 61 is transferred onto the take away conveyor during this take away count if the second article now at 62 39 does not quite reach the sensor x1 during the take away count then the conveyor 1 continues to run until the sensor x1 is actuated thereby stopping conveyor 1 the purpose of. |
9 | exception conditions which may have occurred during the execution of an activator eg abnormal table end and provides output data status information for example number of rows processed and any per table data eg row counts the operation of the exemplary relational database co processor rdcp 40 will now be described in detail at any given time the rdcp 40 may be dormant or active for each transaction ie each 34 packet 34 of work passed from the host processor the rdcp enters an active state passing through three modes of operation activation execution and termination with reference to fig1 there is shown an exemplary format of an activator program 150 a header portion 152 contains addresses of the next activator and input output areas and is loaded into the interface and stream control unit 42 fig3 a classifier portion 154 defines the nature of the transaction and the lengths of the four parts of the activator which follow this is loaded into the database engine control unit 140 a field descriptions portion 156 lists the type size specifications for relevant fields and gaps and is loaded into the relevant field selection unit 70 as per row layout a relational primitives portion 158 lists the compare type instructions used to load the comparand identification unit 80 and compare cells 90 a logic primitives portion 160 lists the logic connectives with their input selection masks and is loaded into logic processing unit 100 and a output selection portion 162 includes the qualification mask code plus between one and four output selection codes to be loaded into the corresponding register and store in the output selection unit 110 in operation a dormant rdcp. |
5 | the element 1 is rising the heat in the building interior is flowing out through the wall 6 and assembly to the exterior atmosphere heat flowing from the interior provides the heat to raise the temperature level of the wall 6 as a result of the escalating temperature level of the element 1 within the assembly the rate of heat flow from the interior to the exterior is reducing as a result of the declining thermal gradient between the interior and the element 1 when the temperature of the wall 6 the inner layer 4 and the element 1 equalise with the temperature of the building interior a neutral thermal gradient is produced as a result of the neutralisation of the thermal gradient between the interior and the element 1 the outflow of heat from the interior of the building through the wall 6 and into the inner layer 4 of the assembly is prevented likewise heat from the element 1 is prevented from flowing through the inner layer 4 to the wall 6 and thus the electrical energy being supplied to the element 1 provides no heating through the wall 6 to the building interior heat is flowing from the element 1 and the thermal conductor 2 and out through the outer layer 5 and cladding 7 to atmosphere whenever the heat of the element 1 and conductor 2 is influenced by a negative thermal gradient to the exterior atmosphere in this way a. |
7 | of the see files 260 c sub menu item can result in a rendering of all files accessed by the selected application considering next the source 230 b sub menu item upon activation a source application listing 250 can be provided the source application listing can include the source application for the selected file or directory 210 in addition to all other files and directories created by the source application as in the case of the usage 230 a sub menu item an un install 270 sub menu item can be provided for initiating the un installation of the source application for the selected file or directory 210 instead of proceeding directly to the un installation of the source application a yet further set of sub menu items can be provided the sub menu items can include an un install files 280 a sub menu item indicating a desire to un install the files of the source application and an un install configuration data 280 b sub menu item indicating a desire to un install configuration data for the source application such as one or more associated registry entries importantly in order to integrate the un installation operations of fig2 as virtually or actually part of the file system file requests must be captured. |
1 | of the epidermal layer of skin and the penetration depth of the incident light the stratum corneum hydration measurement is therefore suitable for further spectral analysis and the quantification of biological and chemical compounds such as blood analytes application_number US 16119702 A description the system for quantifying the stratum corneum hydration non invasively provides an apparatus for measuring the near infrared absorption by tissue irradiated with near infrared energy and a procedure for determining hydration of the stratum corneum although the invented apparatus and procedure are described herein with respect to quantifying hydration of the stratum corneum one skilled in the art will recognize that the invention has application in quantifying hydration of other forms of tissue the apparatus includes an energy source 11 one or more sensor elements an interface 12 to the subject 10 a wavelength selection device and an analyzer the source generates and transmits near infrared energy in the wavelength range 700 2500 nanometers and consists of a device such as an led array 11 or a quartz halogen lamp the sensing elements are detectors 14 which are responsive to the targeted wavelengths the method of wavelength separation includes a monochromator an interferometer or successive illumination through the elements of an led array 11 the interface to the subject comprises a means of transmitting energy from the source 11 to the target. |
8 | 410 u00b7 r 318 v ref u00b7 u03b1 u00b7 r 318 r 410 2 offset voltage v n generated from the current i n between both ends of the resistor 324 of the n channel driving circuit 308 is represented by equation 3 as follows v n i n u00b7 r n u03b1i 1 u00b7 r 324 u03b1 ue8a0 v ref r 410 u00b7 r 324 u03b1 u00b7 v ref u00b7 r 324 r 410 3 once the resistors 318 and 324 have the same resistance a prescribed offset voltage is generated because v n v p 0044 fig6 a is a diagram that shows a circuit for operational characteristics of the preferred embodiment of the comparator according to the present invention when a common voltage is lower than vdd 2 fig6 b is a diagram that shows a graph of voltage characteristics of the preferred embodiment of the comparator according to the present invention when a common voltage is lower than vdd 2 as shown in fig6 a and fig6 b operations of the preferred embodiment of the input stage circuit when a level of common voltage v com ranges 0 v to vdd 2 will now be described the common voltage detection signal s com outputted from the common voltage detector 500 becomes low level since v com lt v lt thus the pmos transistor 314 of the p channel. |
8 | a central part can be envisioned as providing extreme anchoring capabilities fig2 d shows a top view of anchor 26 of fig2 a more clearly highlighting the location of the anchor 26 of mold compound with respect to both the substrate 22 and the applied mold cap 24 the anchor 26 extends out as shown in fig2 b parallel to the plane of the substrate 22 from the body of the mold compound over the semiconductor device the mold cap 24 to the opening 28 this assures that the mold compound of the anchor 26 penetrates perpendicular to the plane of the substrate 22 into the opening 28 created through the substrate 22 with the basic concept of the invention in mind that is providing an anchor that forms a solid interconnection between the supporting substrate and the overlying mold cap it is clear that a number of variations of this concept can be used some of these variations are highlighted using fig3 a through 3 d for this purpose referring first specifically to the cross section that is shown in fig3 a there is shown a cross section 32 of a top cavity bar a cross section 30 of a bottom cavity bar a substrate 34 with copper interconnect traces 35 provided over the surface thereof anchor opening 37 has been provided through each of the four corners of substrate 34 by modifying the contours of the top and bottom cavity bars 32 30 where these cavity bars are aligned with the anchor opening 37 the contours of the applied mold compound can be controlled in the example that is shown in the cross section of fig3 a a top cavity relief 36 has been indicated that extends over a distance of substrate 34 allowing additional. |
1 | and stable in a planar layer to facilitate the surgeon 39 s ability to secure the planar mesh member and thereby repair the damaged hernia area at the same time the resilient member protects the protruding bowels from stabbing while the planar mesh member is being fixed in place the use of the device according to this invention allows the attenuated fascia to overlap the planar mesh member and to be sutured to the upper layer of the planar mesh member towards both center and the periphery as a result the planar mesh member can be securely aligned in place with the bowel being protected from needle stabbing a device according to the present invention may contain an unobstructed outer border area that can be used by a surgeon for placing sutures or staples to repair the damaged surrounding tissue each embodiment of the invention described herein may be covered or impregnated with one or more antimicrobial agents although embodiments of the device according to the present invention are described to have planar mesh members the same invention may be implemented with planar members made of various currently known and future woven and non woven materials some of such materials that are currently available are polypropylene polyethylene nylon and polytetrafluroethylene and other materials the resilient members according to the present invention may be made of rubber as well as any of the many currently available and future resilient materials such as various silicone based materials other features of the present invention will become apparent from the following detail description of the invention when taken in connection with the accompanying drawings it is understood that the drawings are designed for the purpose of illustration and are not. |
2 | a second valve seat 162 again of a truncated conical nature is formed as part and parcel of the intermediate cap 156 as shown and operates as the seat for an outlet valve as will become apparent below an annular recess or cavity 164 is provided about the interior wall surface of the cap 156 to provide a ring like passage between an aperture 166 provided through the wall of the cap 156 and the aperture 168 provided through the wall of the collar 150 accordingly there is a passage for communication between the air chamber cavity 132 and the liquid chamber cavity 158 through the apertures 146 166 and 168 by means of the annular recess or passage 164 as can be seen with respect to fig3 and fig4 apertures 168 are in fluid communication with the atmosphere fig3 when the refill unit is not mated with the air compressor portion 118 and are in fluid communication with compressor 118 fig2 when the refill unit and liquid pump 116 are mated together a nozzle 120 is received by and closes the end of the intermediate cap 156 as shown in fig4 a cavity 170 is thus defined between the nozzle 120 and the intermediate cap 156 this outlet chamber or cavity 170 receives an appropriate sponge screen mesh assembly or. |
4 | day whereafter the samples were thinned with hot water and pulped defibered sheets were then produced at mutually different ph values in accordance with the network strength sheet method described above the ph of the pulp was adjusted to ph values of between 2 and 11 prior to and optionally subsequent to the wet pulping process this procedure provided many measuring points which improves the reliability of the process and which also illustrates the effect of the ph value on the fluff properties subsequent to conditioning the sheets the sheets were pulped in a braun kitchen mixer for 30 seconds the following results were obtained __________________________________________________________________________ph before reference pulp lipase treated pulpsheet abs abs fract dcm abs abs fract dcming ph bulk nvs vol time cap rest extr ph bulk nsv vol time cap rest extr __________________________________________________________________________2 3 4 18 8 3 3 16 3 274 6 11 1 0 47 3 4 20 2 4 7 16 6 12 4 11 2 0 473 4 5 18 4 3 2 15 4 102 8 11 7 0 36 4 7 19 6 4 6 16 6 11 6 10 9 0 334 5 4 18 4 2 8 15 8 114 7 11 7 0 36 5 6 19 6 4 1 17 0 12 1 11 2 0 355 6 7 18 8 3 1 15 8 93 2 11 2 0 32 6 4 19 6 3 9 16 9 10 6 11 0 0 186 7 6 19 2 3 1 15. |
7 | below the surfaces used u2014 although one is not dealing properly speaking with u201c intermediate u201d surfaces additionally in the flowchart of fig3 the process is explained with a pillar by pillar calculation it is possible to change the order of the calculations proposed for example commencing with the search over the top surface for the points of transit of the pillars followed by searching for the points on the bottom surface and finally the interpolation of the pillars step 6 of the flowchart of fig3 also assumes that the pillar is a straight line in so far as the pillar is not a straight line it is possible to consider the projection of the points n 0 g h 1 and n 0 g h n on the surfaces s 0 1 and s 0 n in the same way as for the calculations relating to the top and to the bottom as described in step 8 and not the intersection proposed in step 6 of fig3 this consideration applies naturally in respect of fault surfaces which are not necessarily ruled surfaces in any event one obtains the points i 0 g h 1 and i 0 g h n of the straight line passing through these two points with the surfaces s 0 1 and s 0 n as in the case of the flowchart of fig3 it is possible to change the order of the steps of the flow chart of the other figures in particular as regards the sweeping of the surfaces and the irregular points it is not indispensable to implement the solution of fig9 in the absence. |
5 | shaped shield once the door sections have been assembled into the sectional door specifically both the bottom of the foot of the l shaped shield and the top edge of the lower door section carry a strip of double face adhesive tape so that once the door sections have been assembled into the sectional door the covering over both of these double face adhesive tapes is removed and the sectional door is closed to bring these two adhesive strips together advantageously the placement of two strips of double face adhesive tapes means that the mounting of the l shaped shield can be accomplished in inclement weather under dusty conditions or the like since each strip of adhesive is protected from contamination until the final assembly step the vertical leg of the l shaped shield is then released from the upper door section in this manner the l shaped shield is securely fastened to the top edge of the lower door section in a position so that the vertical leg at all times shields the gap between the adjacent edges of the upper door section and the lower door section this is especially important in that it prevents fingers from being either intentionally or inadvertently inserted between these two sections as the garage door is lowered the inner shield is installed after the sectional door has been assembled this is accomplished by simply exposing an adhesive surface along one edge of the plastic strip and aligning this adhesive surface with the bottom edge of the upper door section prior to pressing the. |
3 | ether phthalate and di tripropylene glycol monoethyl ether phthalate examples of trimellitates include tri diethylene glycol monomethyl ether trimellitate di triethylene glycol monomethyl ether trimellitate di diethylene glycol monoethyl ether trimellitate di triethylene glycol monoethyl ether trimellitate di dipropylene glycol monoethyl ether trimellitate and di tripropylene glycol monoethyl ether trimellitate the preferred stabilizers are ethers and esters of peg and ppg because many are commercially available polyethylene glycol and polypropylene glycol ethers and esters that are not commercially available are easily made by for example condensing polyethylene glycol or polypropylene glycol with an alcohol to make an ether or with an acid chloride to make an ester as is well known in the art of the above compounds the peg and ppg ethers silyl ethers and esters are well known phthalates such as dimethyl glycol phthalate diethyl glycol phthalate dibutyl glycol phthalate di 2 2 methoxyethoxy ethyl phthalate di 2 2 ethoxyethoxy ethyl phthalate di 2 2 butoxyethoxy ethyl phthalate di 2 2 hexyloxyethoxy ethyl phthalate bis 2 2 2 ethoxyethoxy ethoxy ethyl phthalate are also known the known trimellitates include tris 2 methoxyethyl trimellitates and tris 2 2 methoxyethoxy ethyl trimellitates the known phosphorous compounds include tris 2 methoxyethyl phosphite tris2 2 methoxyethoxy ethyl phosphite tris 2 methoxyethyl phosphate tris 2 2 methoxyethoxy ethyl phosphate tris 2 2 2 methoxyethoxy ethoxy ethyl phosphate the tin compounds some of the phosphites phosphates phthalates and trimellitates are believed to be novel compounds in particular compounds having the general formula r q sn u2014 mr u2033 u2014 och 2 u2014 r u2032 ch m u2014 ot 4 q p u2014 och 2 u2014 r u2032 ch m u2014 ot 3 where each. |
5 | the linkage to the position shown in fig4 wherein the short links 60 and 60 39 are in straight line relation with the connecting links 63 and 63 39 whereby the weight of an observer on the seat 40 acts directly on the straight line relation and the weight results in a pull on the linkage the seat can be maintained in operative position by a retractable latch pin 115 on the side rail 17 engaging within an opening in the short link when the short link is in the position shown in fig4 the stand is then erected in position against a tree with the tree engaging means 90 in engagement with the tree and the ladder at an angle whereby the firm support provided by the wide spacing of the side rails 15 and 16 together with the tree engaging means 90 provides a firm support for the observation stand the shroud is then opened to permit access to the observation station by operation of the zipper 111 and the foot support panel member 49 is folded back to the position shown in broken line in fig4 an observer then climbs the ladder and easily enters the observer 39 s station because of the nonobstructing relation of the foot support member and also because of the location of the seat 40 rearwardly of the ladder side rails also this enables the observer to. |
7 | on website entitled u201c mayors com u201d and u201c news com u201d jane doe is also listed as a politically exposed person by virtue of having a relationship with husband john doe and father tom smith although not an officeholder jane doe is mentioned in her capacity as being a family member of officeholders on the websites entitled mayors gov and news com richard roe is also listed as a mayor of a u s city by the source mayors gov but is not listed as having any relationships tom smith is listed as a senator in the u s and as having four relationships john and jane doe his daughter and son in law and dick and harry smith his two brothers this information was found on two websites senate gov and news com finally dick and harry smith are listed as peps due to their relationship to their brother a senator and in the fraud category due to criminal convictions as mentioned in the justice gov source fig2 5 are graphical representations of the relationships contained in fig1 fig2 4 represent individual graphs that correspond to the three types of graphs described above note in fig4 that the information sources mayor. |
6 | operation the interior area of diaphragm 72 surrounded by rib 73 is uniformly thick in cross section and sized to tautly cover opening 58 when diaphragm 72 is secured to bottom panel 57 when properly secured diaphragm 72 completely covers opening 58 to provide an airtight seal so as to not allow any products of combustion to escape through opening 58 the tautness of the instant diaphragm is believed to provide better sound and vibration transmitting properties than a diaphragm which is loosely disposed or in other words disposed with excess folds or flaps of materials over an opening rib 73 is circular in cross section and centered within the thickness or depth of diaphragm 72 a pair of opposing frustoconical projections 75 which positively locate diaphragm 72 in relation to plate 78 are disposed on the side of diaphragm 72 facing plate 78 referring now to fig5 and 6 pressure port plate 78 is designed to substantially cover and thereby protect diaphragm 72 which vibrates inward and outward during furnace operation plate 78 prevents a person from contacting and accidentally tearing or puncturing diaphragm 72 which may allow combustion gases to escape into the furnace room plate 78 also prevents an object from being placed directly against or too close to diaphragm 72 which could hinder vibratory motion of the diaphragm and thereby frustrate its sound transmitting function plate 78 is. |
5 | hooks 68 of lock base 14 and bolt slot 95 is arranged to receive latch bolt 18 as shown in fig4 7 lock housing 12 and keeper 22 and their respective components and structures can be constructed of a variety materials including plastics metals and other known materials fig1 21 depict various operational configurations for the components of lock mechanism 10 in use lock mechanism 10 is mounted on a window assembly 25 that can include sliding sash 26 and other sash 27 lock housing 12 is mounted on sliding sash 26 opposite keeper 22 via fastening apertures 70 with keeper 22 mounted on stationary sash 27 via fastening apertures 96 when sliding sash 26 is open lock housing 12 and keeper 22 are disengaged as shown in fig1 and 20 in this configuration lock mechanism 10 is in the unlocked position whereby pull 76 is pulled back such that bolt 18 is retracted back into the lock base 14 and out of bolt slot 95 of keeper 22 accordingly sliding sash 26 can be slid away from stationary sash 27 and hooks 68 of lock base 14 can disengage from hook slots 94 of keeper 22 when the sliding sash 26 is moved into a closed position lock housing 12 engages keeper 22 as depicted in fig1 15 and 18 19 in this position bolt 18 is initially in the retracted position within lock base 14 and at least the front end portion 30 of trigger 16 extends out from front wall 72 of lock base 14 trigger pivots 36 abut portions of respective base guides 64 in addition bolt catch 50 is captured by trigger catch 39. |
9 | stop 312 terminates beam 302 u03b1 particles emitted from bpsg sample 550 000 hr as observed by the detector equ2 alpha flux 5 5 u00d7 10 8 u03b1 hr cm 2 a neutron flux of 3 6 u00d7 10 12 neutrons cm 2 hr therefore under the natural cosmic ray neutron flux of 0 02 sec u02dc 72 hr cm 2 equ3 this result is in close agreement with the theoretical calculation that indicated 0 031 u03b1 hr cm 2 for a bpsg film 11 000 u00e5 thick from the theoretical and experimental calculations it is clear that replacing regular boron with the 11 b isotope e g removing 10 b will have a very profound impact on reducing alpha flux in semiconductor devices or any other devices using 34 natural 34 boron compounds this work shows that by using 11 b in all processes that usually incorporate boron the alpha flux due to the 10 b n u03b1 7 li reaction induced by cosmic neutron flux can be eliminated this is especially crucial for charge sensitive circuit elements such as the memory cells of drams using separated or enriched 11 b in place of normal boron can reduce package level alpha flux by at least 1000 times the disclosed embodiment can be modified and varied while remaining within the scope of the following claims while the claimed invention has been explained in connection with the embodiment of a dram the claimed invention also finds utility in other electronic devices having charge sensitive circuit elements such as charge coupled devices ccds and static random access memories srams further while a. |
6 | bullet 120 in which as is known the casing 110 remains with the weapon at shooting and the bullet 120 becomes the projectile not shown are the primer and explosive which are inserted into the casing 110 also illustrated is a hole 130 that is drilled into the bullet 120 illustrated separately are a memory device 200 and a plug 150 the cartridge 100 is conventional and can be for use in any size of a weapon though the preferred embodiment is specifically directed to ammunition used in personal firearms whether handguns or longguns it is also noted that the present invention in its preferable form does not require any type of database to be maintained as the identification information on the bullet that is stored on the memory enhanced ammunition cartridge 100 is private to the retail purchaser as such that privacy is maintained at the point of purchase alternative embodiments are envisioned however in which a database could be maintained or a database that keeps information on the purchases from certain types of individuals certain classes of persons such as excluded groups referenced hereinafter or for certain classes of firearms u2014 memory enhanced ammunition cartridges 100 for semiautomatic weapons for instance the bullet 120 is also of essentially conventional manufacture other than the alterations described herein which is essentially that it has the hole 130 drilled or originally formed in it which allows for insertion of the memory device 200 therein which is then held in place with a combination of tension forces as well as the plug 150 with respect to the size of the hole 130 this size is primarily dictated by the size of the memory device 200. |
3 | preparation 210 comprises placing a nanotube sample directly into quartz tube 120 for insertion into a microwave cavity in yet another embodiment nanotube sample preparation 210 comprises placing a plurality of nanotube samples in treatment vessels for insertion into a microwave cavity in an embodiment the prepared nanotube sample is composed of a mixture of metallic type carbon swnts and semiconducting type carbon swnts the nanotube sample may be of any size that is convenient for processing within the microwave cavity in an embodiment the prepared nanotube sample weighs approximately 100 mg in another embodiment the prepared nanotube sample weighs between about 10 milligrams and 10 grams in an embodiment the prepared carbon nanotube sample can contain additional materials formed during synthesis of the carbon nanotubes such as amorphous carbon created as a reaction byproduct during synthesis of carbon nanotubes by cvd or laser vaporization in another embodiment the prepared nanotube sample can contain materials added to facilitate carbon nanotube synthesis such as metal nanoparticles used as a growth catalyst in still another embodiment the prepared carbon nanotube sample may contain low levels of additional materials such as trace levels of metals or other impurities in another embodiment nanotube sample preparation 210 optionally includes treating the nanotube sample to remove additional conductive or ferromagnetic materials for. |
3 | manufacturing process control difficult because of the sharp change in the decalin soluble with a slight process control variation in the amount of the donor concentration to achieve the desired balance of melting point and decalin soluble 10 mole of mcms mixed with the teos the number 4 ranked crystallinity as shown in table 1 the resulting plot of the polymer property with the donor blend concentration is shown in fig2 data for which is in table 3 as evident in fig2 the melting point of the resultant polypropylene using the donor blend decreased compared to the use of 100 mcms while the decalin soluble capability increased the decalin solubles increased by about 80 in the mcms teos mixture relative to the mcms alone to further improve the melting point decalin soluble balance some ptms donor was combined with both mcms and teos at a mole ration of 80 15 5 teos ptms mcms hereinafter a mole ratio may be expressed in terms of the relative mole percentages the percentages adding to 100 mole this donor blend further improved the melting point capability to a desirable range of 163 163 5 u00b0 c while achieving a decalin soluble of around 4 0 as shown in fig3 data for which is in table 3 the decalin solubles are about 100 greater for the teos ptms mcms blend relative to mcms alone as well as most of the electron donors in table 1 as is evident in fig3 the slope or profile of the decalin soluble vs donor concentration is not as. |
5 | detail hereinafter the central equipment mounting assembly 14 best seen in fig1 and 6 of the drawings has a pair of vertically spaced transverse frame members 17 and 18 with reinforcing plates 19 and 20 extending therebetween in abutting relationship to said respective vertical bucket arm sections 15 a and 15 b openings are provided for hydraulic fluid lines l which extend along the respective outside surfaces s of the arm supports 12 and 13 to the aforedescribed piston and cylinder assemblies 16 a and 16 b thereon it will be noted that each of the extending arm portions 12 a and 13 b have an area of reduced cross sectional dimension at 19 a to provide mounting space for the piston and cylinder assemblies 16 a and 16 b which are pivotally secured to the respective arm portions 12 a and 13 a at the reduced transition vertical dimension point tp referring now to fig1 2 and 4 of the drawings a material load bucket 20 can be seen pivotally attached to the hereinbefore described arm portions 12 a and 12 b of the main support frame 11 the bucket 20 has oppositely disposed spaced parallel sidewalls 21 and 22 interconnected with a back wall 23 and reinforcing top plate 24 thereacross each of the sidewalls 21 and 22 has an elongated frame receiving pocket channel 25 extending from a base bucket bottom plate 26 interconnecting the respective sidewalls 21 and 22 and back wall 23. |
7 | the preferred program code randomly generates the virtual designations and any additional virtual designations although the virtual designation generation step need not be purely random also each mapping table 30 is stored in storage device 24 associated with computer 20 in a manner in which no one including the game operator has knowledge of the mapped virtual designations 32 and additional virtual designations 33 prior to the time the respective virtual designation and any additional virtual designation is announced or otherwise used in the play of the game once all physical designations 16 to be mapped are mapped to the respective virtual designations 32 and any additional virtual designations 33 and the relationship is stored the game preferably proceeds with the physical object draw or other physical designation generation at step 34 in fig2 this step may be accomplished using object draw device 11 and a pool 14 of objects 12 shown in fig1 when an object 12 is drawn operator 17 reads the physical designation 16 associated with the drawn object and enters that physical designation 16 into computer 20 through operator input 22 if the particular physical designation 16 entered has been mapped to a virtual designation 32 the invention includes converting the entered physical designation 16 to the mapped virtual designation 32 as indicated at step 36 in fig2 this virtual designation 32 is then used in the play the game as shown at step 37 computer 20 announces or communicates virtual designations 32 to the network player terminals 21 through network interface 25 hardware shown in fig1 using the mapping table 30 shown in fig3 as an example assume that the particular object 12 bearing physical designation u201c 1 u201d is drawn at random. |
9 | pump 2 configured so as to be capable of sustaining a pressure of about 250 psi this insures that it is no longer necessary to use a conventional feed pump as is done in the prior art the feed pressure pump 2 actually performs the function normally done with two pumps feed pump and pressure pumps in prior art systems hence the higher pressure at this stage in order to keep costs low for the small entrepreneur the maple sap reverse osmosis device 20 uses the most economical components for example the feed pressure pump 2 is a low cost 120 volts highly efficient rotary vane pump the pump has the advantage of not warming up the sap since a warm sap could cause the proliferation of bacteria and thus be harmful to the resulting maple syrup 39 s quality the prior art uses a 4 in membrane capable of a capacity of 150 gph at 500 psi in a preferred embodiment the osmosis membrane 3 is used at a rate of 100 gph at 250 psi this lower pressure allows for the use of the low cost feed pressure pump 2 described hereinabove and which is typically able of a maximum capacity of 250 psi the advantage of using a lower 250 psi over the more conventional 500 psi is that the osmosis membrane 3 has a lesser tendency to foul at the lower pressure the other advantage the use of low pressure membrane housing reduces the cost of this one significantly up to 4 times the. |
9 | a filter output ni_fil which is a change component by generation of transmission torque of an engaged side clutch is thus provided when this filter output ni_fil falls to less than a first threshold value of u2212 ref1 and thereafter becomes less than a second threshold value of u2212 ref2 without recovering to be equal to or higher than the first threshold value of u2212 ref1 it is determined to be the start of the torque phase application_number US 45071899 A description referring to fig8 15 an explanation will be given of an embodiment embodying the present invention the flowchart of fig8 shows a flowchart associated with the learning control with regard to a release awaiting time period tr of a released side instruction value and an initial value ci of an engaged side instruction value in power on up shift from the forward first speed stage to the forward second speed stage the control is executed by a microcomputer in the electric control apparatus 40 shown in fig1 and is executed at every operation period of a main routine of the microcomputer control programs of the microcomputer are mounted with a control program which functions as a secondary butterworth high pass filter having a cutoff frequency of 1 0 hz according to the learning control as shown in fig8 at step 201 the up shift control is started based on speed shift start instruction then at step 202 it is determined whether learning is permitted and the operation proceeds to step 203 when learning control is permitted at step 203 the speed shift. |
1 | a serrate surface see fig1 any conventional adhesive may be applied to the peripheral margins 90 of exposed layer 20 and bottom plate 40 to provide means to secure the two layer members to each other the flex plate 30 is freely suspended between exposed layer 20 and bottom plate 40 flex plate 30 may be attached to bottom plate 40 at the heel portion 80 by way of adhesive similar to that used on the peripheral margins 90 or by other suitable connecting means while the flex plate bottom surface 32 rests on the bottom plate top surface 41 it should be noted that the two surfaces 32 and 41 are not in constant contact referring to fig3 a small cavity 50 is formed between surfaces 32 and 41 when the sole liner rests in a neutral position with no force exerted on exposed layer 20 the cavity 50 is in constant flux during striding as illustrated in fig4 and 5 referring to fig4 when the heel of a foot not shown exerts force 60 on the heel portion 80 of sole liner 10 the cavity 50 is displaced toward the toe end 70 of the sole liner 10 as seen. |
8 | and a second groove 98 on the second end 62 of the contact arm 56 the second end 94 of the first torsion spring 86 may engage with groove 96 of the contact arm 56 and the second end 94 of the second torsion spring 88 may engage with the groove 98 of the contact arm 56 the engagement between the torsion springs and the grooves may include a straight portion 100 of the second end 94 lying flush with a surface of the grooves 96 98 alternatively the second end 94 may hook onto or otherwise engage with the grooves 96 98 thus a rotor assembly 50 has been described that is capable of u201c top down u201d assembly a procedure that is capable of top down assembly will show a reduction in assembly time of a product and may also be manufactured using an automated system fig4 u2013 9 demonstrate how the rotor assembly 50 may be assembled using such a top down assembly process fig4 shows the first rotor half 52 positioned such that protrusion 78 extends outwardly and recess 84 is made available fig5 shows the first torsion spring 86 inserted within the recess 84 such that the first end 90. |
6 | mechanism 4 is generally designed as a chain or as a belt if a chain is used gearwheels are employed as wheels to ensure a secure revolution of traction mechanism 4 it has proven to be advantageous to tension traction mechanism 4 for this purpose a tensioning rail 2 as illustrated in fig2 through 4 is pressed against continuously revolving traction mechanism 4 until traction mechanism 4 reaches the desired pretension tensioning rail 2 generally presses with a front side of a base wall 6 on slack span 42 of traction mechanism 4 so that traction mechanism 4 slides across tensioning rail 2 during operation it has proven to be advantageous if tensioning rail 2 or base wall 6 is arched in longitudinal direction l in other words the front side of base wall 6 has a convex design thus it is not possible for traction mechanism 4 to jam in tensioning rail 2 or in base wall 6 in addition a fairly large contact surface for traction mechanism 4 is achieved on the front side it may advantageously also be provided that tensioning rail 2 or base wall 6 has an arched configuration and or design in the transverse direction on the front side facing traction mechanism 4 this ensures a particularly problem free operation base wall 6 of tensioning rail 2 is advantageously planar so that a longitudinal extension and or a transverse extension of base wall 6 in. |
1 | echinacea purpurea the compound was administered every 8 hours group iii 5 patients 2 women and 3 men were administered every 8 hours a dose of a composition containing myrciaria dubia extract as active ingredient group i patients treated with a composition containing as active ingredient such extracts i of echinacea purpurea and myrciaria dubia according to the invention in a period of about 3 days in 12 patients was observed an interruption of the classic symptomatology in patients of group ii who were treated with a composition of echinacea purpurea was observed that the flu infection lasted about 7 days for group iii patients treated with a composition of myrciaria dubia the flu infection lasted about 5 days alternatively the composition according to the invention was administrated to people who were in family relationship with affected persons the total number of people to whom the product was administrated have not been infected by the viral pathology were further analyzed 10 volunteer patients with an average age of 30 years old without any concomitant pathology 4 patients did not receive any medical treatment and 6 patients were treated with conventional anti viral or anti flu drugs for 4 patients 3 men and 1 woman who did not receive any medical treatment the period of duration of the flu infection was approximately 15 days for patients who were medicated with conventional anti flu drugs the duration of the flu infection was between 10 and 12 days and for those who were treated with antiviral the flu lasted for a period of about 6 days according to this study the reference time of lasting for a classic flu infection and. |
4 | stir the slurry for at least 4 hours then filter the slurry use the wetcake in stage 2 in a large beaker add water and hydrochloric acid add the wetcake of naphthionic acid from stage 1 agitate slurry for at least 2 hours in a separate beaker prepare a solution of sodium nitrate in water and add it slowly to the naphthionic acid slurry stir for 15 minutes checking acidity with congo paper and adding hydrochloric acid as needed check nitrite value using ki starch paper adding sodium nitrite as needed when both acidity and nitrite values are adjusted stir for 3 hours regularly checking both values stage 3 coupling of polyethoxylated aniline ethox ana 50 with naphthionic acid diazonium salt in a large beaker add preheated liquid ethox ana 50 liquid slowly transfer the naphthionic acid diazonium salt from stage 2 to the beaker containing the liquid ana 50 and agitate the mixture for about 30 minutes neutralize the reaction mass with triethanolamine to ph 7 5 7 8 agitate the reaction mass for at least 5 hours the process of formulating rinsable violet dye according to the present invention comprises five stages 1 condensation 2 first oxidation 3 second oxidation 4 neutralization and dilution and 5 filtration in a large flask add polyethoxylated aniline s10 800 g formaldehyde 61 g as 37 and sulfuric acid 13 g as 96 heat the reaction mass to 125 u00b0 c and maintain that temperature with agitation for 20 hours cool the material from stage 1 down to 85 u00b0 90 u00b0 c then add polyethoxylated aniline s10 400 g and sodium iodate 50 g as 98 heat the mixture to 125 u00b0. |
3 | polyamine in effect cross links the copolymer through the carboxyl groups in the form of diamine or polyamine salts in a more random and less crystalline form this cross linking is reversible so that the ionomer sheet when heated to the melting point becomes formable and processible and can be used in a laminate or substrate or even used alone without any additional substrate some amount of irreversible cross linking can be accomplished if desired by heating the ionomer resin film to 325 u00b0 400 u00b0 f for varying lengths of time under vacuum to cause the amine salts to convert to amides str6 the conversion to the amides may range from 10 100 conversion depending on the length of time of the heating this high temperature cross linking of the finished article provides some cross linking and heat set and thereby can increase the melting point of the ionomer sheet in the final article if desired in addition to adding toughness to the sheet material the primary aliphatic or alicyclic diamines or polyamines containing the ch 2 nh 2 group can form the strongest bonds with the carboxyl group and therefore form the amino salt bond at the highest possible temperature of all the diamines or polyamines if there is too great a distance between the nh 2 groups and the chain is not rigid too much flexibility occurs and the cross linking effect becomes diminished and the diamine or polyamine may not. |
2 | information to and from each other in a wireless mode when more than one bolt detector 26 u2032 and more than one mobile transmitter receiver 40 are used all thickness detector assemblies can be interrogated in sequence or at different time intervals or under different frequencies or by other unique identification codes in use the interrogation of a single thickness detector assembly 26 u2032 40 is initiated by the computer 50 a first signal is sent to the mobile transmitter receiver 40 which in turn sends signals to all wire loops 36 the mobile transmitter receiver 40 reads the condition of each loop 36 and sends this information to the base transmitter receiver 44 in a wireless mode the base transmitter receiver 44 relays this information to the computer 50 wherein the information is interpreted and displayed on the computer screen as an indication of the actual thickness of a wear plate 24 inside the mill when the thickness of the wear plate reaches a specific measurement the mill can be scheduled for preventive maintenance and replacement of all the wear plates inside the mill the mobile transmitter receiver 40 and the base transmitted receiver 44 are explained herein by their functions rather than by their specific structure the structure of these devices is known to those skilled in the art of communication devices and therefore. |
2 | triggering release of the pedal from the pedal mounting arrangement application_number US 35016609 A description the following detailed description is merely exemplary in nature and is not intended to limit application and uses furthermore there is no intention to be bound by any theory presented in the preceding background and summary or the following detailed description fig1 a is a side view disclosing the safety pedal system according to one embodiment of the present invention in particular it discloses a section of the triggering device in the safety pedal system before release of a pedal from a pedal mounting arrangement fig1 b is a side view disclosing the safety pedal system according to one embodiment of the present invention in particular it discloses a section of the triggering device in the safety pedal system after or during release of a pedal from a pedal mounting arrangement in the event of a collision the pedal 2 is at least partly released from the pedal mounting arrangement 3 in a presently preferred embodiment of the safety pedal system according to the present invention this is accomplished as follows a sensor 4 detects a collision event and causes a collision event signal in response to the detection of the collision event a control unit 6 is arranged in a signal path from the sensor 4 to a triggering device 5 the control unit 6 is adapted for receiving the collision event signal caused by the sensor 4 calculating the severity of the collision event based on information contained in the collision event signal in the event of a severe collision the control unit 6 transmits the collision event signal to the triggering device 5 the triggering device 5 is adapted to. |
6 | in the art to practice the invention and it is to be understood that other embodiments may be utilized and that structural logical and electrical changes may be made without departing from the scope of the present invention the following description is therefore not to be taken in a limited sense and the scope of the present invention is defined by the appended claims fig1 shows a cross section of a fire extinguishing assembly indicated generally at 100 the fire extinguishing assembly comprises a canister 110 for coupling with an ignition unit 115 the canister 110 includes a container 120 that may be lined with a desired material 122 such as ceramic paper or insulative material such as cardboard ceramic paper may produce fewer toxic gases such as co and unwanted odors as compared to other materials container 120 contains a bottom piece 125 with exit ports 127 a sealant 128 such as a poly sealant may be used over the bottom piece 125 to provide an almost hermetic seal for contents inside container 120 a cross member spacer 130 formed of mild steel in one embodiment is positioned within the container 120 between the bottom piece 125 a first screen 133 is positioned adjacent the cross. |
1 | kornecook t j and quirion r 2001 application of in vivo microdialysis to the study of cholinergic systems methods 23 21 39 denk w strickler j h and webb w w 1990 two photon laser scanning microscopy science 248 73 76 fillenz m 2005 in vivo neurochemical monitoring and the study of behaviour neuroscience and biobehavioral reviews 20 949 962 gage f h wolff j a rosenberg m b xu l yee j k shults c and friedmann t 1987 grafting genetically modified cells to the brain possibilities for the future neurosci 23 795 807 grill r murai k blesch a gage f h and tuszynski m h 1997 cellular delivery of neurotrophin 3 promotes corticospinal axonal growth and partial functional recovery after spinal cord injury j neurosci 17 5560 5572 grynkiewicz g poenie m and tsien r y 1985 a new generation of ca2 indicators with greatly improved fluorescence properties j biol chem 260 3440 3450 heim n and griesbeck o 2004 genetically encoded indicators of cellular calcium dynamics based on troponin c and green fluorescent protein j biol chem 279 14280 14286 helmchen f fee m s tank d w denk w 2001 a miniature head mounted two photon microscope high resolution brain imaging in freely moving animals neuron 31 903 912 himmelheber a m fadel j sarter m and bruno j p 1998 effects of local cholinesterase inhibition on acetylcholine release assessed simultaneously in prefrontal and frontoparietal cortex neurosci 86 949 957 huang c j harootunian a maher m p quan c raj c d mccormack k numann r negulescu p a gonzalez j e 2006 characterization of voltage gated sodium channel blockers by electrical stimulation and fluorescence detection of membrane potential nat biotechnol 24 439 446 jimenez capdeville m e and dykes r w 1996 changes. |
6 | of the cable as the cable is pressed into these guides 350 352 these guides then permit one or more cables to be retained readily upon clamp body 340 thereby avoiding loose cables and the potential risks and endangerment that would otherwise be associated therewith fig7 illustrates a preferred embodiment clamp 220 from an end view once again an over center clamp is illustrated using similar or like components 322 324 and 226 228 229 it should be noted herein that these components may be identical or different in final dimension or even geometry but are numbered identically herein to illustrate like function similarly and upon a review of the present disclosure others of a myriad of hardware assemblies will be recognized as suitable in substitute for these components nevertheless and in accord with the requirements of the statutes these are illustrated herein to enable an understanding of the present inventive concept in the case of clamp 220 a clamp body 240 most preferably has been extruded through an extrusion die thereby ensuring a substantially consistent cross section taken transverse to the longitudinal axis of clamp body 240 for the purposes of the present disclosure it will be understood herein that u201c substantially consistent u201d includes the subsequent drilling of holes to permit the insertion. |
2 | the goods used in service and to thereby prevent them from sliding and slipping over the surface of the tray during use or movement of the cart one manner of providing such recesses is shown in fig2 wherein said recesses are defined by one or more suitably sized and shaped depressions 22 a formed in the floor 21 a of principal service tray 20 a the depth of said depressions 22 a required for any particular service will in general be obvious to those of skill in art and can vary from say about u00bc inch to about 3 inches in the case of a principal service tray 20 a formed of sheet metal said depressions can be formed by deep drawing in the case of a principal service tray 20 a formed of a thermoplastic such as abs the depressions can be formed by any of several molding techniques such as injection molding drape molding vacuum forming and the like an alternative scheme for providing such recesses is shown in fig3 in this case the principal service tray 20 b is provided with lid 25 b which when assembled to the service tray defines a space between the floor 21 b of service tray 20 b and the lid 25 b said lid 25 b is provided with one or more suitably sized and shaped apertures 26 b thereby to define the container receiving recesses the service cart of the invention may also comprise additional elements which can contribute to its utility in service referring once again to fig1 such additional elements are generally affixed to. |
8 | such as gan algan alingan or other iii v group compounds or cdte zno zns or other ii vi group compounds as shown in fig1 the epitaxial substrate 1 according to the invention includes a crystalline substrate 10 the crystalline substrate 10 has an epitaxial surface 102 different from the prior arts the epitaxial surface 102 of the crystalline substrate 10 is nano rugged and non patterned it is noted that similar to the epitaxial substrates with patterned surfaces of the prior arts the epitaxial substrate 1 according to the invention can also benefit the compound semiconductor material in lateral epitaxy in one embodiment the epitaxial surface 102 of the crystalline substrate 10 has an average surface roughness ra in a range from 100 nm to 400 nm in one embodiment the epitaxial surface 102 of the crystalline substrate 10 has a mean peak to valley height rz in a range from 50 nm to 350 nm in practical application the crystalline substrate 10 can be formed of sapphire sic gan gaas zno si scalmgo 4 srcu 2 o 2 ysz yttria stabilized zirconia lialo 2 ligao 2 li 2 sio 3 ligeo 3 naalo 2 nagao 2 na 2 geo 3 na 2 sio 3 li 3 po 4 li 3 asa 4 li 3 vo 4 li 2 mggeo 4 li 2 zngeo 4 li 2 cdgeo 4 li 2 mgsio 4 li 2 znsio 4 li 2 cdsio 4 na 2 mggeo 4 na 2 zngeo 4 na 2 znsio 4 or other commercial materials provided for epitaxy referring to fig2 a through 2c and. |
2 | pad cell size application_number US 47460595 A description the invention will be described in conjunction with pad conditioning for chemical mechanical polishing cmp the major emphasis of cmp today is for planarizing interlevel dielectrics on a semiconductor wafer however other uses are also possible such as selectively removing metals and planarizing bare silicon wafers the invention is equally applicable to these uses cmp involves both chemical and mechanical abrasion chemical abrasion is accomplished using a slurry to chemically weaken the surface of a wafer mechanical abrasion is accomplished using a polishing pad against which a wafer surface is pressed both the polishing pad and the wafer are rotated to cause the removal of surface material the removed material is then washed over the edges of the polishing pads and into a drain by adding additional slurry cmp planarization produces a smooth damage free surface for subsequent device processing it requires fewer steps than a deposition etchback planarization and has good removal selectivity and rate control for silicon dioxide removal rates on the order of 60 80 rim rain for a thermal oxide and 100 150 nm min for an lpcvd low pressure chemical vapor deposition oxide can be achieved the preferred embodiment the invention is shown in fig2 cmp machine 100 contains a polishing pad 114 secured to a platen 112 polishing pad 114 typically comprises polyurethane however it will be apparent to those skilled in the art that other materials such as those used to make pads for glass polishing may be used in addition the hardness of polishing pads 114 may vary depending on the application platen 112 is operable to rotate during polishing rotating carrier 118 is operable to position wafer 116 on polishing pad 114. |
6 | illustrated as 100 the reducer 100 has a primary length of spiral tube and a secondary length of spiral tube the primary spiral tube operates identically to the embodiment as illustrated in fig1 the discharge from the gland or stuffing box is directed into pipe 102 and fed back into the secondary spiral tube of reducer 100 which is then connected to pipe 104 for discharge into drain 106 referring now to fig6 the housing of the reducer 100 is identical to that of the first preferred embodiment reducer 10 the primary circuit is identical to the primary circuit of reducer 10 with the exception that the coils are spaced to allow secondary coil 108 to be nested within coil 40 on the primary side the secondary inlet barb 110 is mounted on outlet end cap 30 secondary inlet tube 112 is connected to secondary inlet barb 110 secondary inlet tube extends substantially along the length of the tubular housing 26 the tubing is then wound closely to form a spiral nested within spiral tube portion 40 the end of the spiral tube portion 108 is connected to secondary outlet tube 114 which extends along the length of the tubular housing 26 until it connects with secondary outlet barb 116 using this arrangement it is possible to control both the inlet. |
9 | triglyceride extracted from the plant is identical to the triglyceride used to prepare the extraction solvent i e the fatty acid alkyl ester as a result if the extracted triglyceride is subsequently used to prepare the fatty acid alkyl ester via a transesterification reaction the fatty acid alkyl ester in an extraction solution can be used as a solvent for the reaction and therefore needs not to be separated from the extracted triglyceride after the extraction process the fatty acid alkyl ester can be optionally separated from the extracted triglyceride by partially or completely removal from an extraction solution the removal step can be carried out by distillation using a vacuum column a short path vacuum distillation unit or any other suitable device known in the art whether to remove the fatty acid alkyl ester partially or completely from an extraction solution or to remove it at all depends on various factors such as the ratio between the fatty acid alkyl ester and the extracted triglyceride and the end use of the extracted triglyceride the extracted triglyceride can be further processed for use in the food and pharmaceutical industries it can also be used as a raw material for preparing fatty acid alkyl esters or fatty alcohols fatty acid alkyl esters are useful as diesel fuels lubricant oils or chemical intermediates fatty alcohols are useful as surfactants in detergent industry the specific examples below are to be construed as merely illustrative and not limitative of the remainder of the disclosure in any way whatsoever without further elaboration it is believed that one skilled in the art can based on the description herein utilize the present invention to its fullest extent all of the publications cited herein including patents are hereby incorporated by reference in their entirety. |
5 | threaded hole 180 a second threaded hole 182 and a third threaded hole 184 the threaded holes on the pile cap 112 are spaced to match the spacing of the lifting rods spaced across the support bar 148 the releasable connection between the threaded holes and the lifting rods is made by mating the threads of the lifting rods with the appropriate threaded hole of the pile cap 112 the load bearing surface 186 is adapted to support new pre cast concrete bridge spans which in turn support the existing elevated rail assembly the pile cap 112 can further include three additional threaded holes located between the center threaded hole 176 and the inboard threaded hole 174 so that the pile cap 112 is symmetrical about the center past attempts of providing the lifting points or threaded holes in the pile cap 112 involved welding threaded steel nuts to reinforcing steel that was then cast in the material of the cap it has been found that the heavy load of the pile cap striped the threads of the welded nuts thus as best shown in fig2 b the threaded holes 174 176 178 180 182 and 184 according to the present invention are preferably formed from cut lengths of oil well drilling pipe 190 the pipes 190 are attached to reinforcing steel 188 and then cast into the concrete when the cap 112 is formed the oil well drilling pipe 190 is internally threaded and is flush with the load bearing surface 186 of the cap 112 the flush ends of the pipe 190 will not interfere with the new pre cast concrete spans to be supported on the load bearing surface 186 the threaded holes 174 176 178 180 182 and 184 are tapered to provide automatic. |
5 | and or relief vents the deployment set is shown in more detail in fig1 a each set comprises a hose or other conducting means 32 an inflatable floating device 30 a source of compressed air 31 for the inflatable floating device and clamping means 33 to connect to receiving storage facilities the hose terminal that is proximal to the apparatus is connected to the output pipes or relief vents whereas the distal terminal of the hose is attached to the inflatable floating device source of compressed air and clamps robotic arms 7 are attached to the outside of the housing and include a tool hold 27 with tools that can be used to replace and or repair components of the device a sliding door 26 gives access to the robotic arm chamber embodiments of the invention that are used offshore may also include propulsion means for changing the position of the device relative to a target area such an embodiment is shown in fig1 in which the propulsion means is constructed as propeller 34 referring to fig1 again reference numeral 4 indicates a compartment in which lights cameras sensors and power lines can be accommodated reference numeral 5 indicates the area that includes the compartment 4 and the regulatory circuit 18 the embodiment shown in fig1 also includes doors 9 providing access to the robotic arm fig1 shows an example of a method to. |
5 | impeller alternatively the rib 16 could be replaced with an interior channel not shown by means of well known forces associated with rotating bodies the fluid rises in the increasing diameter of the impeller tube 4 near its top the impeller shape rapidly increases in diameter forming a large diameter disk portion 18 the fluid in the rotating impeller rises to the level of this disk then accelerates in a radially outward direction as it spreads out onto the disk portion subsequently as the fluid continues in a radial direction it is flung from the outer edge of the disk portion of the impeller which comprises an outlet of the recirculating pump 51 spraying in all directions out from the vertical axis of the impeller in a circular pattern covering 360 u00b0 fluid thus sprayed from the outlet of the pump 51 strikes the interior bowl surface 9 providing the dispersion and cleaning effects previously mentioned as will be apparent to one skilled in the art other types of recirculating pumps 51 could be employed other means of spraying the interior bowl surfaces 9 could be used in combination with a recirculating pump one of the advantages of the presently preferred type of recirculating pump described herein is that pumping and spraying action are combined in the function of the impeller. |
7 | of film transparencies 11 the holder 2 is fabricated of an opaque plastic material preferably dark in color it should be observed that the combined holder and viewer forms a unitary package that is utilized for both transit and storage purposes the viewer 1 is of a rectangular configuration with an open front and rear and is provided with web portions 3 which as seen in fig3 are reduced in cross section toward the open rear of the viewer as seen in fig1 and 3 gussets 5 are shown spaced at locations about the open front of the viewer 1 in this manner the transparency mat 6 for the film transparency 11 is prevented from moving forward in the viewer since the gussets serve as backstops for the individual film transparencies referring to fig2 it will be seen that the rear holder portion 2 is provided with four tabs 4 that are spaced from each other and project from the body of the holder 2 the inside surfaces of the tabs 4 are designed to hold stacks of film transparencies 11 by engaging their peripheral mats 6 the buttons or pimples 7 are spaced on each of the tabs 4 so as to hold film transparency for example lots of 20 or 36 which are the usual amounts processed from each roll of film as seen in fig3 the rear portion or holder for the stack of film transparencies 11 is inserted within the rear of the front portion 1. |
2 | of case travel in this example the first case a and the second case b are touching one another but it is possible for there to be initially some gap between the cases in fig1 b the turning device 200 has collided with a first end of the first case a causing the speed of the first end of case a in the direction of case travel to be reduced a second end of case a is permitted to continue its movement in the direction of case travel at a speed greater than the first end thus causing the case a to turn about an axis normal to the direction of case travel because of its contact with the case a case b also begins to turn in fig1 c case a has completed most of its turn and case b has completed most of its turn in fig1 d case a is no longer in contact with the turning device 200 and case a and case b have each completed their simultaneous turn and have been reoriented 90 degrees relative to the direction of case travel as previously stated the cases are turned by a turning device 200 the turning device 200 could be an arm which moves laterally relative to the direction of case travel from a first lateral position or rest position outside of the path of the cases. |
1 | exon1 and exon2 of insulin gene were fused to provide enhanced downstream gene function in plasmids at the transcriptional level fusion of insulin mrna upregulated downstream gene expression to such a high level that they mimicked normal insulin mrna level in normal islet beta cells utmd was then used to deliver the insulin gene fusion plasmid under control of the rat insulin promoter driving to intact islets of adult living animals thereby providing a safe tissue specific highly efficient and regulated gene expression for diabetic gene therapy materials and methods rat insulin promoters and plasmids constructs rat insulin gene 1 promoter fragments rip2 1 u2212 412 to u2212 303 rip1 1 u2212 412 to u2212 1 rip4 1 u2212 412 to 43 rip3 1 u2212 412 to 165 genbank accession no j00747 which is defined herein as seq id no 1 and genbank accession no nc 000011 for the human insulin promoter u2014 defined as seq id no 2 both incorporated herein by reference were amplified from sprague dawley sd rat dna using pcr rip forward primers 5 u2032 g ctg agc taa gaa tcc a 3 u2032 seq id no 3 rip2 1 reverse primer 5 u2032 ctgagc attttccacc 3 u2032 seq id no 4 rip1 1 reverse primer 5 u2032 gggagttactgggtctcca 3 u2032 seq id no 5 rip4 1 reverse primer 5 u2032 gcagaattcctgcttgctgatggtcta 3 u2032 seq id no 6 rip3 1 reverse primer 5 u2032 gttggaacaatgacctgga 3 u2032 seq id no 7 and reverse primer 5 ggcagaaggacagtgatct 3 seq id no 8 containing a kpni and xho1 restriction site respectively the sequences of these primers. |
2 | exerted by tool segment 16 works portion b to provide local thickness reduction as metal moves outward from the worked surface area and toward the walls of the die cavity the stroke length of tool segment 16 is predetermined so that when it reaches a fully extended position the worked surface area along portion b is reduced to a desired thickness for the product bottom mandrel 15 is sequentially operated so that the second tool segment 17 is activated to extend along the first tool segment 16 after tool segment 16 is set into motion and the second tool segment 17 may be activated while tool segment 16 is working material along the product bottom or after tool segment 16 has reached its fully extended position in any event as clearly shown in fig3 c tool segment 17 extends along tool segment 16 to engage portion b proximate and outward from the surface area worked by tool segment 16 because portions s and r of blank 14 remain fixed against die surface 19 as illustrated at position d the force exerted by tool segment 17 against blank 14 reduces the product bottom thickness by working the remaining excess material outward from the tool segment and toward the wall of die cavity 12 where the excess material becomes part of the product sidewall as shown in fig3. |
8 | connected via respective pulling up resistors pr11 pr1n with respective voltage sources vcc for respectively supplying voltage vcc in this embodiment vcc 5 u00b1 0 25 v the voltage vcc corresponds to a logical level h diodes da1 dan are respectively connected between the respective drains of the fets 11 1n and the signal line ll in these connections the forward directions of the diodes da1 dan are respectively those from the signal line ll to the respective fets 11 1n further the devices dv1 dvn respectively have receiver units the receiver units are respectively used for inputting data rd1 rdn from the signal line ll the receiver units of the devices dv1 dvn respectively comprise inverters iv1 ivn each of the inverters iv1 ivn comprises two combined fets as shown in fig1 each two combined fets comprise a p channel complementary metal oxide semiconductor p channel cmos transistor the source and substrate of which are respectively connected to the voltage source vcc and an n channel complementary metal oxide semiconductor n channel cmos transistor the source and substrate of which are respectively grounded both the drains of each two combined fets are connected with each other and provide received data rd1 the input ends of the inverters iv1 ivn are respectively connected via. |
9 | the collapsible mold segments in the extended position the part shown will be more fully understood upon reference to fig6 8 to be subsequently described the operation of both collapsible core assemblies is identical and is symetrical on both sides of the parting line between core assemblies 24 and 26 for this reason fig3 illustrates only the operating mechanism for right hand core element 26 collapsible core assembly 26 is mounted upon rod 27 which is connected to conventional hydraulic cylinder 28 for movement in a reciprocating manner when so moving the core section rides upon slides 29 and 31 slides 29 and 31 are mounted respectively on supports 32 and 33 which in turn are fastened to base plate 34 of the molding machine fig5 shows a plan view on line 5 5 of fig3 showing the molding apparatus of this invention and in particular the end view of collapsible core 24 except for this collapsible core the features shown are conventional and include the lower outer mold form 36 and the upper mold 37 plastic supply conduit 38 is connected to gate 39 through which the plastic is injected into the mold conventional ejector pins 40 and 41 are provided to eject the part from the mold upon upward movement of mold section 37 the above description sets forth the major components used to produce the part with the 360 u00b0 recess and attention is now directed to fig6 and 8 which most clearly illustrate the novel features of my invention fig6 and 7 show the collapsible assembly core with a plurality of retractable mold segments in the extended or molding position the mold segments comprise small segments 42 43 and 44 and large segments 45 46 and 47 these retractable mold segments are positioned between a. |
2 | numeral 10 will be described fig1 illustrates a prior art liner structure 1 wherein a foam medially positioned pad 2 is mounted to a floor of a polymeric liner 3 for existing within a container in a manner as presented in u s pat no 4 186 845 fig2 illustrates a cargo vehicle 4 mounting a polymeric liner 5 therewithin of multipart construction in a manner as presented in u s pat no 4 893 862 more specifically the hopper and liner apparatus 10 of the instant invention essentially comprises a vehicle member 11 including a rectangular planar platform 12 mounting orthogonally thereto a support column 13 in each corner of the platform directed upwardly thereof with a wheel member 14 positioned underlying the platform adjacent each corner of the platform an inverted trapezoidal hopper 15 is mounted and secured to the vehicle member 11 with the hopper floor 27 see fig5 fixedly mounted to the top surface of the platform 12 and the actuate upper perimeter edge 15b of the hopper receiving the support columns 13 thereunder in an integral relationship to fixedly secure the hopper relative to the vehicle member 11 the hopper 15 includes trapezoidal downwardly sloping walls 15a with an opening 16 directed through a forward wall of the hopper 15 adjacent to and contiguous with the floor 27 of the hopper an axis door 17 is pivotally mounted by way of a door hinge 20 to overlie the opening 16 with a latch 18. |
6 | to return the plunger 120 to the non depressed position in one embodiment as shown in fig2 d when the plunger 120 is depressed such that the reduced diameter section 131 aligns with the ball bearing 124 the ball bearing 124 no longer rests tightly against the bearing end 132 and thus may leave the notch 133 in the ball lock 125 allowing the outer leg to be rotated at this time to lock the outer leg the plunger 120 is released so that it returns to a non depressed condition as shown in fig2 c this allows plunger 120 to establish contact with the ball bearing 124 by transitioning from the reduced diameter section 131 to the beveled edge 143 and onto the bearing end 132 in one embodiment as shown in fig2 a and 2b limiting pins 127 are attached to the center swivel 111 and lie within the limiting grooves 135 of the ball lock 125 and serve to limit the range of motion of the outer legs as shown in fig5 a the outer leg 215 is hollow and allows inner leg 216 to axially slide within it in one embodiment of the invention the outer leg 215 is oval in shape and each inner leg 216. |
1 | and vacuum generating device 26 is turned on the vacuum generating device will exhaust air through air exit port 32 drawing the air from inner area 21 through filter unit 36 and suction unit 28 the vacuum created within area 21 by device 26 is transmitted through hose 70 and draws ashes embers and the like through the hose and into inner area 21 where the large inner area in comparison to the hose permits the ashes embers and the like to fall into inner container 14 filter unit 36 prevents dust and ash from passing through suction unit 28 and air exit port 32 into the room the vacuum created by generating device 26 will rapidly suck the ashes from the fireplace thereby substantially reducing the time required to clean the fireplace and will suck up the fine ash and dust which are normally difficult to pick up with scoops shovels or brooms hence the fireplace is cleaned more thoroughly with the present device than by previous methods the heat resistant material of which hose 70 and container 14 are constructed enables hot ash embers and coals to be evacuated from the fireplace into the present fireplace cleaner without causing heat related damage to the cleaner when the ash in the fireplace has been completely removed therefrom vacuum generating device 26 is turned off and cord 31 is disconnected from the electrical supply outlet hose 70 may be detached from annular flange 33 and stored for future use the remaining assembly of dolly 16 inner container 14 and outer housing 12 can be transported on casters 58 to a suitable location for disposal of the ash latching devices 64 are detached. |
8 | 17 in the subsequent step s 82 it is determined whether a frame process corresponding to the set photo taking mode is to be performed or not if the result of the determination in step s 82 is u201c no u201d the flow immediately proceeds to step s 85 if the result of the determination in step s 82 is u201c yes u201d the image data written in the main memory 19 is read out using the memory control circuit 17 and the image processing circuit 21 as required then the image data is sequentially subjected to a vertical addition process step s 83 and a coloring process step s 84 after that the processed picked up image data is written into the main memory 19 again then in the next step s 85 the picked up image data is read out from the main memory 19 and image data for display is transferred to the image display memory 18 through the main control circuit 17 then the flow returns to the main routine in fig4 fig7 is a flow chart of the routine for the recording process which is performed in step s 35 in fig4 first in step s 91 the picked up image data written in the main memory 19 is read out and the exposure evaluation value the white balance evaluation value and the distance measurement evaluation value which have been stored in the internal memory of the system control circuit 27 or the system memory 34. |
6 | contactor 61 may be connected to wet mateable connector 68 if compartment 62 is placed after deployment conductor 66 may be attached to wet mateable connector 68 therefore power may be supplied through mid line connectors to pipe 11 of a segment to be heated using the apparatus and methods described above since the power for electrical readiness may be rarely needed it is a significant advantage that one work boat such as shown in fig1 may support a large number of flowlines spreading the cost of the umbilical the generator and other ancillary equipment over many flowlines instead of requiring installation of this equipment for each flowline fig7 illustrates application of electrical readiness to heating a segment of a single heated insulated pipe with electrical current flow from the first end of the segment to the second end pipe 11 is covered with insulation 11 a between electrical connectors 74 and 76 connectors 22 a are attached to pipeline connector 74 and 76 connectors 22 a may be either dry mateable or wet mateable if dry mateable they must be installed before pipeline 11 is deployed subsea power cable 21 connects to wet mateable connectors 22 buoyancy module 24 may be used to support power cable 21 seawater electrode 77 is shown attached to one of the wet mateable connectors 22 in one mode of. |
4 | and secured with nuts not shown the guide roll 14 is fixedly secured and may be located in any desired eccentric position to allow adjustment of tension of the apron 4 the eccentric guide roll 14 may be enclosed by a freely rotatable cylinder so as to minimize resistance to the rotating movement of the apron 4 the stands 7 7 pivoted on front lower sections of the side frames 15 15 are respectively provided with screwed steps 7a of an adjustable height and pivots 7b received within holes 7c so that the stands 7 are inclined somewhat backward as shown in fig1 slits 22 22 are formed in front lower sections of the vertical walls of the opposite side walls 15 15 to hold a reciprocating lever 20 of a device for picking off the fly carried by the clearer as indicated in fig3 the apron 4 is stretched between the guide roll 14 and the apron driving roll 13 within the frame assembly 6 and driven by the latter roll 13 while the apron driving roll 13 is supported by the shaft 5 the shaft 5 is reciprocated but is operative to move the apron 4 in only. |
6 | performance another optional feature that can be implemented in the tgt is a flow control valve 119 this valve can be controlled by a control system or manually without the valve the tgt will transfer heat from the hot air stream 105 to the cold air stream 107 the valve can be open and allow this heat to be transferred closed to stop the circulation of refrigerant and thus stop the heat transfer or somewhere in between to allow for a specific amount of heat to be transferred one application where flow control on the tgt is useful is on a heat recovery unit around an evaporator coil 121 of a vapor compression vc refrigeration cycle as shown in fig1 in this configuration the tgt condenser 101 both reheats the coil air leaving the vc evaporator 121 and uses that heat to cool the air entering 124 the vc evaporator 121 through the tgt evaporator 100 the tgt in this configuration can lower the sensible heat ratio shr of the vapor compression cycle which allows it to remove more latent heat humidity from the air relative to the total heat removed than without the heat recovery unit since the tgt can be implemented in a single loop the tgt control valve 119 can be used to regulate the amount of heat recovered the ability to control the amount of heat recovered enabling dynamic control of the shr in cases where dehumidification is more important than temperature control heat recovery can significantly reduce the amount of power consumed by the compressor 122 it can also lead to a lower condenser temperature. |
2 | of material are flexible under thermoforming conditions but within a temperature range in which the polymeric glue continues to perform as an adhesive so that the sealed laminated surfaces do not separate a polymeric glue is used because it can secure the laminated layers of material together during manufacture of the footwear and continue to perform as an adhesive during heating and cooling of the laminated layers of material in a custom molded condition application_number US 30601189 A description in describing a preferred embodiment of the invention illustrated in the drawings specific terminology will be used for the sake of clarity however the invention is not intended to be limited to the specific terms selected and it is to be understood that each specific term includes all technical equivalents which operate in a similar manner to accomplish a similar purpose with reference to the drawings in general and to fig1 3 in particular a hockey skate embodying the teachings of the present invention is generally designated as 10 a hockey skate is used for illustrative purposes and is intended to represent practicing of the invention on all multi layer footwear which require gluing of their component layers ice skates cross country ski boots orthopedic shoes as well as other footwear having glued laminated layers are envisioned as being included in the invention. |
8 | strip 18 is clamped between the wall of the bore 30 and the rivet 48 transmission of tensile forces no longer acts on the contact strip 18 the contact strip 18 is directly contacted with the electric connection 42 and as clearly shown in fig3 c the bore is closed the electric conductivity of the bolt or blind rivet is thereby not important in contrast to the alternative shown in fig2 this solution has the advantage that mounting of the rivet 48 is possible after assembly of the insulating glazing the bores 30 may at the same time serve as gas filling opening of the insulating glazing alternatively two bores may be provided in the structure of fig1 wherein the contact strip 18 is led out of the space 20 between the panes via a first bore 30 wherein the bore 30 completely penetrates through the spacer 22 and is closed by a stopper when the contact strip 18 has been guided through and a second bore is provided next to it which is formed in particular as a blind hole from the outer side of the spacer the strip 18 can be fixed in this second bore see fig4 to facilitate contact. |
8 | the high voltage input 10 can be controlled by the gate voltage of protection fet 30 which means the lower the gate voltage is the earlier the transistor turns off whilst the input voltage is rising 3 the digital u201c low voltage u201d input of the schmitt trigger 70 sees the input voltages at the high voltage input port 10 as long as they don 39 t exceed said input range when the maximum of said range is exceeded and the transistor is turned off this input needs to stick at a defined level which then indicates that the input level is high this level is provided by the pull up circuit 40 4 the enable circuit 60 switches the pull up circuit 40 and the schmitt trigger 70 on or off the gate voltage can either be controlled separately by block gate voltage 20 as in the schematic diagram fig1 in order to switch off the transistor 30 when the low voltage circuit is disabled or the gate voltage can be set up by controlling it via a combined enable and control block 5 the u201c low voltage u201d input follows the high voltage input for voltages below values u2018 gate voltage minus threshold voltage u2019 v gate u2212 v th the digital u201c. |
6 | in that the aperture segment 10 ends up being of the same thickness as the neighbouring tower rings 22 above and beneath the sharpening 11 on the top and bottom edges could advantageously be made before the aperture segment 10 is rolled into the circular shape in another embodiment of the invention the sharpening 11 could be non linear e g having the shape of a part of an ellipse and or the edge between the sharpening 11 and full material thickness of the aperture segment 10 could be rounded fig4 illustrates the tower part 6 comprising a wall segment 9 and an aperture segment 10 with a door aperture 7 and a door 8 in a horizontal cross section through the middle of the door aperture 7 in an embodiment of the invention all four edges on both the concave and the convex side of the aperture segment 10 are provided with a sharpening 11 in an embodiment of the invention the sharpening 11 on the side edges of the aperture segment 10 results in the aperture segment 10 ends up being of the same thickness as wall segment 6 because of the way a traditional rolling machine known in the art functions the sharpening 11 on the side edges. |
1 | concentrated milk products or a fraction of the milk containing the biologically active factor such as the acid whey fraction by the term 34 whey 34 is intended for the purpose of this invention milk from which cream and caseinaceous material has been separated the milk of the invention can be provided in any amount which affects the decrease of hypertensive conditions in animals daily amounts equivalent to 1 ml to 10 liters of whole fluid milk can be provided depending on the particular circumstances of the hypertension and the animal species the preferred dose is 0 5 1 0 g of skim milk powder per kg of body weight the fat free milk can of course be incorporated into any food product as long as the food product is not treated at a temperature which is too elevated and would inactivate the anti hypertensive properties of the product a temperature lower than 140 u00b0 c is preferred for example puddings or yogurt may be prepared with anti hypertensive milk further when the fat free milk is treated with rennet and the casein is separated after precipitation thereof it is found that the sweet whey supernatant fraction contains the anti hypertensive factor this sweet whey factor may also be added to syrups ice cream mixes candy beverages cattle feeds or the like see kozakowski supra at 446 the process of producing the hyperimmune milk containing supranormal levels of anti hypertensive factor is as follows in summary one process of producing the hyperimmune milk containing supranormal levels of anti hypertensive factor. |
3 | kk h mk h and km h cell lines to similar final levels similar results were obtained in k562 i s9 cells expressing human pgp fig9 a through 9e and a comparison of uic2 fig1 a and mrk16 fig1 b binding of kk l cells expressing the wildtype human pgp is shown in fig1 a and 10b thus these results support the conclusion that atp depleting agents have the same effect on uic2 mab reactivity as mutagenesis of both nucleotide binding sites of pgp hematopoietic stem cells were isolated from bone marrow and umbilical cord blood using the methods of the invention fig1 bone marrow and 12 cord blood show the results of 3 color flow cytometry by facs vantage bdis analysis of human bone marrow and umbilical cord blood samples the cells were stained with 1 pe conjugated uic2 2 fitc conjugated anti cd38 mab and 3 allophycocyanin apc conjugated anti cd34 mab in the presence or absence of vinblastine the enhanced up to 10 fold binding of uic2 mab to bone marrow and cord blood stem cells was observed in the presence of vinblastine proving that the described phenomenon can be used for improved labeling of stem cells with ulc2 and their consequent purification by conventional separation techniques it should be understood that the foregoing disclosure emphasizes certain specific embodiments of the invention and that all modifications or alternatives equivalent thereto are within the spirit and scope of the invention as set forth in the appended claims __________________________________________________________________________ sequence listing 1 general information iii number of sequences 2 2 information for seq id no 1 i sequence characteristics a length 4669. |
1 | placed horizontally and configured as above would suspend an article placed there between when the spacing is such as to bias the pegs apart a wide end 35 of the skirt 31 at the same time provides a stand off from the blister 13 and causes the sideways pressure to be applied at a point distant from the t shaped key because the t shaped key operates as a fulcrum in this circumstance the stand off results in a mechanical leverage being applied to the peg 13 the wide end 35 additionally functions to space the article 2 away from the board 10 in circumstances where the blister 13 and or the flared skirt 31 are is opaque and therefore inter positioning is blind it is useful to provide a means for orienting the peg 20 to the preferred and locked position 27 in the preferred embodiment a means for orienting 53 is comprised of a flat surface 54 on the ball 51 fig6 the flat surface 54 preferably has a surface normal in alignment with the longitudinal direction of the t shaped key 24 the flat surface 54 can be any of the lesser cross sections of ball 51 but that cross section in tangency with the peg is one preferred the flat surface 54 additionally provides a means for grasping the peg 20 and applying a twisting motion thereto the preferred cross section maximizes that grasp and twist leverage the board 10 and the peg 20 are preferably fabricated by molding technologies where precision tolerances can be met the peg 20 is preferably injection molded the board 10 can be injection molded or thermoformed from sheet or roll film stock the key material properties are toughness and. |
4 | this type according to the present invention conform to the general formula iba t 1 is nitro t 3 is hydrogen cyano chlorine or bromine t 4 is hydrogen cyano nitro chlorine bromine or trifluoromethyl r 1 is hydrogen hydroxyl methyl acetylamino or propionylamino r 2 is hydrogen chlorine methyl or methoxy r 3 is hydrogen methyl ethyl butyl or allyl the dyes of the general formula i according to the present invention can be prepared by methods known to one skilled in the art for instance a compound of the general formula iii where d is as defined above is diazotized and coupled onto a compound of the general formula iv where r 1 to r 6 x m and n are each as defined above the compounds of the general formula iii are generally diazotized in a known manner for example with sodium nitrite in an acidic aqueous medium for example in an aqueous medium rendered acidic with hydrochloric acid or sulfuric acid or with nitrosylsulfuric acid in dilute sulfuric acid phosphoric acid or a mixture of acetic and propionic acids the preferred temperature range is between 0 u00b0 c and 15 u00b0 c the diazotized compounds are generally likewise coupled onto the compounds of the general formula iv in a known manner for example in an acidic aqueous aqueous organic or organic medium with particular advantage at temperatures below 10 u00b0 c acids used are in particular sulfuric acid acetic acid or propionic acid the compounds of the general formulae iii and iv are known and can be prepared by known methods the dyes of the. |
6 | preheater 4 39 composed of four cyclone stages 1 39 2 39 3 39 and 43 as well as with a separate calcinator combustion chamber 44 a tertiary air line 45 bridges across the rotary kiln 8 and entirely independent of the latter on the gas side is supplied with hot combustion air recovered through the cooler 42 the calcinator 44 is equipped with a fuel supply device 46 and in accordance with the present invention has an independent start up burner 47 at the entry end of the tertiary air line 45 into the calcinator 44 the tertiary air line 45 itself is likewise equipped with a start up burner 48 which in the start up state can be driven at full capacity or at partial capacity in the operating state at the discharge end 49 of the tube cooler 42 there is provided a separate and independent heater in the form of a burner 50 the rotary kiln 8 as in the previously described forms is provided with a primary burner 18 in the case of the system illustrated in fig3 upon starting up from the cold state the burners 18 50 48 and 47 are ignited at substantially the same time and slowly brought up to temperature the system in accordance with conventional practice is equipped at several locations with temperature monitors and when the various stages have. |
7 | detecting circuit a base emitter voltage vbe of a transistor increases according to an increase in a collector current from this viewpoint the current detecting circuit constituted by the transistor q 3 can be observed as functioning in the following manner a bias current an amount of which corresponds to the current of transistor q 1 which is detected by the transistor q 3 is supplied to the reference voltage supplying circuit 7 or 4 in the circuit shown in fig2 b by supplying such bias current the base emitter voltage vbe q 2 is equalized to the base emitter voltage vbe q 1 and the output voltage vout coincides with the zener voltage vz with high accuracy a constant voltage supplying circuit 11 as a second embodiment of the present invention is shown in fig3 in this embodiment a constant current supplying circuit 12 is additionally connected between the power source line 1 and a cathode of the zener diode d 2 other structures are the same as those of the first embodiment an amount of current i 2 of the constant current supplying circuit 12 is set to an amount that is sufficiently high to establish a stable zener voltage vz in the zener diode d 2 in this second embodiment even if the current i 1 from the current outputting circuit. |
4 | cleaner dryer units 60 and 65 one for the lighter garments 60 and the other for the darker garments 65 the improvement in consistent cleaning performance would alone merit the cost of an additional cleaner dryer unit however the savings from eliminating the filtration unit and the pump plus the savings from lower perc usage would more than offset the cost of as extra cleaner dryer unit another anticipated advantage of the design of fig4 is the ability to operate the two cleaner dryer units 60 and 65 in unison the current practice in dry cleaning industry is to initially separate the daily workload into groups of light and dark garments before the work can begin and then clean each load in succession in my design the two cleaners 60 and 65 can operate concurrently effectively reducing the work time in half a single heat source 70 commonly a boiler can dry the clothes of both light and dark garment cleaners and this can be achieved with a simple valving solution indicated by reference numeral 75 most of the heat generated for the dryer is lost to the surroundings rather than used to evaporate perc from clothes because the proposed design runs for half the time compared to machines currently available there is a significant amount of anticipated savings in energy cost for the heat source this is intuitive since the same amount of heat would dry a greater quantity of clothes as shown in the drawings the most apparent elements missing from the disclosed zero emission machine compared to dry amp dry machine are the filtration unit the filter pump and optionally the refrigeration unit however a refrigeration unit as shown in fig2 may be substituted for or used in conjunction. |
8 | hand a first passivation layer 129 made of an insulating material particularly silicon oxide sio 2 or silicon nitride sinx which is an inorganic insulating material is formed on the active area a a of the substrate including the second electrode 127 the first passivation layer 129 is formed since moisture infiltration into the organic light emitting layer 125 cannot be blocked only with the second electrode 127 and thus the first passivation layer 129 performing a protective role is formed on the second electrode 127 to minimize moisture infiltration into the organic light emitting layer 125 furthermore the gip thin film transistor tr 2 on the gip area g a has a similar layer structure to that of the driving thin film transistor tr 1 on the active area a a from the semiconductor layer 103 to the first passivation layer 129 but has a structure in which the first and the second electrode 121 127 and organic light emitting layer 125 are omitted on the contrary the bending area b a has a difference in that the gate insulating layer 105 interlayer insulating layer 109 planarization layer 115 and the like excluding the auxiliary line 120 as well as the foregoing thin film transistors tr 1 tr 2 are not formed thereon on the other hand an organic layer 141 made of a polymeric organic material such as a polymer is formed on the first passivation layer 129 of the active area a a here an olefin based polymer polyethylene polypropylene polyethylene terephthalate pet epoxy resin fluororesin polysiloxane and the like may be used for a polymer layer constituting an organic layer 131 furthermore in order to block moisture. |
4 | a blowing gland 56 is positioned adjacent to and downstream of the vacuum gland 40 the blowing gland 56 is also a fixed duct connected to a separate source of blowing air which creates a blowing region extending from a location adjacent to the vacuum region 46 to a position on the roll at a level with the reel tube threader 54 in operation a tail 30 is blown by air jets not shown through a tube threader 50 toward the vacuum region 46 of the sheave 32 on the roll 24 the vacuum gland 40 draws air through the holes 36 which causes the tail 30 to adhere to the surface 60 of the roll 24 the engaged tail 30 transits the nip 28 between the upper roll 26 and the lower roll 24 where it is conducted to a position 52 spaced from the threading tube 54 the tail 30 is then blown by air indicated by arrows 62 which passes through the blowing gland 56 and is thus blown away from the surface 60 of the roll 24 and into the inlet 64 of the tube threader 54 where air jets not shown propel the tail 30 to the reel not shown the threading apparatus 20 threads a closed calender 22 once the calender 22 is threaded the tail is removed from threading tubes 50 54 through the open bottom slot 66 the tail is then widened until the entire web is fed through the calender 22 the sheave 32 will be run only intermittently used only when threading a start up of a new parent roll or after a sheet break the suction gland 40 is supplied with negative air pressure through a manifold 68 the blowing air is supplied through a manifold 70. |
8 | 24400 628 800 u00d7 600 105660 hz 20677 806 1024 u00d7 768 134460 hz 15631 1066 1280 u00d7 1024 1696______________________________________ thus for exemplary values of 31778 50mhz clocks in twenty lines and 525 lines per frame the look up table determines a resolution of 640 u00d7 480 with a number n of pixel clocks per line of 800 the expected width in pixels of the active video region 11 see fig1 d is initially set at the horizontal component of the resolution e g 640 it is to be understood that such number n is an initial guess and that a range of initial n values will work due to the iterative corrective nature of the present invention accordingly n may be determined in other ways such as by multiplying the horizontal resolution by a constant slightly larger than 1 0 it is also to be understood that the preferred look up table will cover modes from 640 u00d7 480 to 1600 u00d7 1200 resolution and from 60 hz to 100 hz frame refresh rates moreover other ways of determining the resolution are possible such as by using the number of lines per frame to determine the vertical and horizontal resolution digitization of the analog video data signals occurs based on the n pixel clocks per line referring to the pll 20 the vco 50 generates the pixel clock signal and the microcontroller 16 sets the counter 22 to generate a feedback pulse i e line advance signal once. |
8 | portions 210 a of the pad oxide layer 210 remain after the hardmask pullback following the pullback etch the photoresist layer 225 and the barc layer 220 are preferably removed in the same plasma tool using a conventional plasma etch after the hardmask pullback step and the removal of the photoresist and barc layers 225 and 220 a conventional plasma etch is conducted to form a trench 230 in the substrate 205 as shown in fig2 f in one particular embodiment the plasma etch is a silicon plasma etch that may be conducted at a source power ranging from about 250 watts to about 450 watts a bias power of ranging from about 100 watts to about 200 watts and by using an etching gas comprising gases like cl 2 o 2 n 2 etc wherein a flow rate of each of these gases ranges from about 25 sccm to about 180 sccm subsequent to the formation of the trench 230 the semiconductor device 200 is in an advantageous embodiment moved from the plasma tool to a furnace an oxide liner 235 which is also shown in fig2 f is conventionally grown and is followed by an oxide liner anneal. |
8 | r i x for each bit of a maximum bit length n 1 of input data so when n is large for example when n 10 000 there is a problem in that the remainder memory 11 becomes large therefore in a second embodiment of the invention the size of the remainder memory 11 can be reduced by storing a remainder value in the remainder memory 11 after every p bits with p taken to be an arbitrary constant then as shown in fig4 i which indicates the bit position is decomposed as in equation 7 where p 2 s here the necessary remainder value r i x is the remainder obtained by dividing x i by the generator polynomial g x when the quotient polynomial obtained by dividing x pn by the generator polynomial g x is expressed as q pn x and the remainder polynomial is expressed as r pn x then x i is given by the following equation so the remainder value r i x becomes equal to the remainder obtained by dividing r pn x u00b7 x k by g x therefore as shown in fig5 r pn x are correlated to a bit position n every p bits and stored as a table and a remainder is found by finding r pn x that. |
1 | a safety feature can be built into the system wherein when a users grip on the user interface is relaxed the first and second valves on the resistance system close reducing the load to the user thus reducing the chance of injury referring to fig2 user interface 6 is depicted is a straight rod shaped bar however user interface 6 could take many forms it could be a handle a curved or bent bar a flat padded surface a curved or circular padded surface or any other piece capable of engaging a portion of the body user interface 6 can move on a track such as one described in the co pending applications or in free space user interface 6 can be attached to any cable pulley chain rope elastic band flexible member based fitness machine by using an eyelet such as a clevis 3 a user can enter data into the user interface 6 using keypad sensor 15 keypad sensor is coupled to microprocessor 11 and user data can be stored in microprocessor 11 the user can also enter data regarding which body part he she will be using to move the user interface 6 and what type of motion or what exercise is desired user recognition can also be done through other means such as a scrolling device or a fingerprint. |
5 | to disaggregation when a pressure drop is applied or flow passes through due to draft from fluid or gas this drag causes the sand to become detached and flow into the perforations by perforating a poorly consolidated formation with reactive shaped charges an overall reduction in the risks associated with sand production and of sand control equipment failure can be achieved one skilled in the art will recognize whether a well comprises failure prone formations that tend to produce sand for example in one embodiment the potential for sand production can be determined through observation of the performance of nearby offset wells in other embodiments determination of whether a formation has such a potential can be made by acquiring certain knowledge of the formation including without limitation the strength of the rock formation and any in situ earth stresses in the rock fig3 a contains a flow chart of the general method of the present invention which can be applied once it is determined that a formation has stability issues the method for perforation of a failure prone formation shown in fig3 b comprises loading a plurality of reactive shaped charges 34 into a charge carrier 38 of a perforation gun and positioning charge carrier 38 down a wellbore adjacent. |
9 | which rotatably receives the eccentric 130 by a bearing 130a and a second portion 136 hinged to the portion 134 by a pin 137 the other end of the portion 136 is pivotally connected to a clevis 139 which receives and is fixed to a reduced diameter end portion 140 of the upper movable blade 20a during rotation of the shaft 78 the eccentrics 84 impart movement to the upper and lower blade members in directions generally perpendicular to their cutting edges simultaneously the eccentric 130 imparts a movement to the upper blade in directions along its cutting edge as will be explained in greater detail the eccentricity of the eccentric 130 is such that the blade is moved back and forth through a total distance slightly exceeding or in one instance corresponding to its edge one half tooth spacing so that precise one half tooth spacing is attained between cuts this produces the distinctive standard metal cut shown in fig1 it has been found that the phase angle relationship between the eccentrics 84 and the eccentric 130 is important this will subsequently be discussed in some detail the lower blade is similarly driven from the shaft 78 to move it in directions along its cutting edge the drive connection includes a bevel gear 150 which is connected to the lower end of the vertically. |
6 | an end cap at both ends if the end cap is inserted from the opposite end the end 124 of tube 122 is first formed into a driving configuration by swaging the end 124 to expand the diameter thereof and forming at least one transverse aperture 123 therein preferably 2 or more apertures 123 are formed in the end 124 as is apparent to those skilled in the art the apertures 123 can be formed by any conventional process such as piercing lancing drilling laser cutting etc either before or after the swaging step a cup shaped cap 130 is inserted from the near or swaged end 124 into the tube 122 the rim 132 of the cap 130 has an outer diameter that is less than the diameter of end 124 but greater than the original diameter 128 of tube 122 the rim 132 will frictionally engage the inside surface of the tube 122 preferably at the transition between diameters to seal the end of the tube 122 once inserted the cap 130 closes the end of the tube 122 and the yoke structure 140 can be cast thereon the cap 130 limits the extent to which the yoke structure 140 extends into the end 124 as is apparent the cast material will flow between the inside and outside of the tube 122 through aperture 123 once solidified the yoke structure 140 will have a dowel structure to provide a driving connection with the tube 122 while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment it is understood that the invention is not limited to. |
7 | i and likewise for uf i and uf 512 for different values of n and i requiring different numbers of passes to accomplish the division note that of i and uf i are sampled only in pass 2 the reciprocal correction step and the quotient generation step fig6 shows structures which may be used together with the structures in fig1 to permit the division of 60 bit integers using the same technique as described earlier for floating point numbers the shifter 624 is used to convert the original integer dividend and divisor to binary fractions and to convert the final quotient from binary fraction form to integer form the shift counts replace the characteristics or exponents used with floating point numbers it will be assumed that no room remains in the storage registers 110 for these shift counts so separate storage is provided by the count reg 612 two passes through the shifter 624 are required to convert the dividend and divisor both to fractional form each of these passes will now be described in detail in the first pass the integer divisor b is presented to input in 610 this input is applied to both a normalize count generator 614 and the shifter 624 the norm count gen 614 produces a normalize count whose value is equal to the number of left shifts required to normalize in 610 this count may be between 0 and 59 inclusive inputs of zero will cause a final result of zero or division by zero and may safely produce an arbitrary normalize count field 0 for each of selectors 618 620 and 622 is selected the shifter 624 is in leftshift mode adder 628 is in subtract a. |
5 | 66 of the laval nozzle 42 through the passages 64 defined within the nozzle 42 a mixture of gas 98 and atomized water 100 is pushed by the gas pressure through the nozzle second diffuser cone 82 and up to the well surface the device 40 advantageously provides for an efficient method to remove waste water which condenses or is transported by the inner surface 76 of the tube 58 fig2 represents the use of a wire line truck 106 to insert the well device 40 as can be seen a wire line 104 is coupled to the removable locking mechanism 94 the wire line 104 is used to lower the device and in combination with gravity to insert the device within the landing nipple weights are then used to impact the locking mechanism 94 to drive the device 40 into the landing nipple after setting the device the wire line 104 and removable locking device 94 have been removed from the well the well is u201c swabbed u201d to remove unwanted water in this regard it is envisioned that high pressure gas would be used to force water from the system through the device 40 into the well bottom alternatively water can be removed from the system prior to the insertion of the well device 40 once the water is removed the hydrocarbon well products move through the central throughbore 60 and are retrievable from the well the device can similarly be removed from the well using the locking device 40 it will be understood that each of the elements described above or two or more together may also find a useful application in other types of constructions differing from the types described above while the invention has been illustrated and described. |
8 | format where mapping type is a parameter indicating a mapping algorithm to be used and where sp 1 represents the address of a first service platform and sp n represents the address of an n th service platform it should be noted however that the generic placeholder address is not limited to representing addresses of a fixed number of service platforms as will be described further below the generic placeholder address thus identifies addresses of one or more specific service platforms the mapping type parameter may be omitted if a default mapping algorithm is to be used each hlr 204 a and 204 b further include a mapping module 208 a and 208 b respectively in one embodiment the mapping modules 208 a and 208 b may implemented through appropriate computer programming instructions or processing logic executing on the computer on which their respective hlrs are running when a camel subscriber attempts to register in an appropriate functional entity of a mobile network such as in an msc 102 the msc 102 sends a registration request to the hlr with which the subscriber is associated the registration request includes an identifier of the subscriber for example if the subscriber u2018 b u2019 attempts. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.