label
int64 1
9
| text
stringlengths 113
6.79k
|
|---|---|
9 | solvent the preferred mixture is about 5 25 parts of catalyst f or dupont rc 803 curing agent to 100 parts of morton adcote 503a or dupont 49001 polyester resins with cyclohexanone solvent desmodur n 100 an aliphatic isocyanate resin manufactured by mobay chemical corporation pittsburgh pa 15205 may be used as the catalyst or activating agent instead of morton chemicals catalyst f or dupont rc 803 but in which case a smaller amount should be used in the order of two parts of desmodur n 100 to 100 parts of rasin by weight the coating 20 may be applied to the base 15 by any suitable means including the use of a mayer rod a mayer rod is a wire wound doctor rod as known in the art for after the application of an excess of the coating from an applicator roll its use is known in industries to produce recording tapes and reproductive papers blade coating offset coating and fountain coating techniques as well known in the photographic film and paper coating art may similarly be used as well as screen coating in fact one of the most practical arrangements by which el panels can be fabricated consists of screen coating the coatings to be applied should have relatively high viscosities and the evaporation rate of the thinner must be at least an order of magnitudes slower than the thinner in the commercially available resin mix methyl ethyl ketone mek toluene and acetone are thinners which normally could be applied to the resin for silk screening while the evaporative rates of such thinners are too high for practical use it has been found that when cyclohexanone is used as a thinner it permits sufficient working time to coat and prolong screen life in order. |
8 | the process jumps to step 480 and determines whether another video needs to be processed or not if the video had not been processed previously at least based on its identifier the system then downloads or receives the full video file from the video provider for further processing step 415 as part of step 415 the video file is converted to mp4 mpeg 4 format if it is not already in such format and a hash or u201c video signature u201d of the mp4 version of the video is created based on this video signature it is possible to determine whether this particular video had been previously processed even if the video identifier did not match a previously known identifier step 420 if the video had already been processed previously the database storing such time coded metadata files is updated and cross referenced with the additional identifier and video signature if necessary step 430 then the process jumps to step 480 and determines whether another video needs to be processed or not if the video had not been processed previously it is then submitted to an audio processor step 440 for audio capture and separation and speech recognition among other things and a video processor step 450 for classification and analysis among other things the resulting metadata is compiled tied to or associated with the underlying timecode of the video program and stored in the metadata database step 470 the process then determines whether there is another video to be processed step 480 if so the process 400 starts over if not the process 400 ends generally when a video program is received or. |
2 | stray light and cladding mode light the rough surface can be created in a variety of ways including for example sanding with a fine sand paper sandblasting chemical etching and laser treatment a first photodetector 36 facing the bare fiber portion 10 i detects the intensity of the light scattered off the bare fiber portion a second photodetector 37 facing the input fiber end detects the intensity of back reflected cladding mode light the output signals of the photodetectors 36 37 are provided to a control unit 38 which can control a laser control device 39 to disable or remove the laser beam 31 from the system the laser control device 39 can be a laser shutter or the like in an exemplary embodiment when the magnitude of one or more of the signals from the photodetectors 36 37 exceeds a predetermined threshold the control unit triggers the laser control device 39 to disable the laser beam 31 a second set of photodetectors 46 47 and a further control unit 48 can optionally be provided for the fiber output port similarly to the input port an portion 10 o of the fiber 10 proximate to the output port is bare with a rough surface and is held by a second glass ferule 43 photodetector 46 which faces the bare fiber portion 10 o detects the intensity of the back reflected light scattered off the bare fiber portion photodetector 47 which faces the output fiber end detects the intensity of the forward propagating cladding mode light the further controller 48 can control a further laser control device 49 e g a laser shutter or the like to disable or remove the laser beam from the system or it can control the laser control device 39 in conjunction with the controller. |
2 | with at least one of the end nozzles being spaced from one of the end cross bars 44 by 2 75 inches additionally the nozzles 50 have a u00bd u2033 27 pipe thread for being coupled to the i shaped torso 40 also as shown in fig5 in a preferred embodiment each of the nozzles 50 is a brass flat fan spray nozzle with an orifice of 0 057 inches and spray angle 87 of 50 degrees fig6 depicts a spray pattern that can be achieved using the device 5 in accordance with the preferred embodiments in fig3 b 4a 4 b and 5 given a height of the top side 85 of the i shaped torso 40 of 4 inches which is about half of the generally accepted height of an average sedan e g 8 inches fluid emanating from the three nozzles 50 covers continuously a wide area 100 of the underbody that is 4 inches above the nozzles if the device is provided under a larger vehicle such as a sport utility vehicle suv having generally an underbody height of 11 inches off of the ground a larger area 105 is continuously impacted by fluid from the nozzles 50 if the device is provided under a smaller vehicle such as a compact car having generally an underbody height of 7 inches off of the ground a smaller area 110. |
8 | and the oxidation gas inlet port 24 c of the second separator 24 form a supply passage r 1 for supplying oxidation gas to each power generating cell 12 the oxidation gas outlet port 23 d of the first separator 23 the oxidation gas outlet port 13 d of the frame 13 the oxidation gas outlet port 14 d of the second frame 14 and the oxidation gas outlet port 24 d of the second separator 24 form a discharge passage r 2 for discharging oxidation off gas to each power generating cell 12 oxidation gas that is supplied to the supply passage r 1 from the outside of the fuel battery passes through the gas passage of the second gas passage forming member 22 and is used for generating electricity thereafter the oxidation gas is drawn to the discharge passage r 2 as oxidation off gas the configuration of important part of the preferred embodiment will now be described as shown in fig1 3 and 5 in the outer peripheral portion of the first gas passage forming member 21 projecting portions 25 are formed in edges on the left right and downstream edges with respect to the flowing direction of the gas passage the projecting portions 25 extend outward beyond the outer periphery of the anode side electrode catalyst layer 17 and are overlapped onto flange portion s 1. |
5 | will be overly and specifically defined as such in this detailed description section fig1 is a schematic perspective view illustrating a tent according to a first embodiment of the present invention referring to fig1 a tent according to the first embodiment of the present invention includes a plurality of poles 2 extending substantially perpendicular to the ground a roof frame 3 fastened to the upper ends of the poles 2 and a tarpaulin 1 attached on the roof frame 3 in this embodiment the number of the poles 2 is four but the prevent invention is not limited thereto in addition a plurality of feet 10 attached on lower ends of the poles 2 may be further provided to increase contact area with the ground at least one of the poles 2 includes an upper pole 21 and a lower pole 22 preferably each of the poles 2 includes an upper pole 21 and a lower pole 22 the lower pole 22 is supported on the ground for example via the foot 10 the roof frame 3 includes a front supporting rod 31 a rear supporting rod 32 and a plurality of guiding rods 33 in this embodiment the number of the guiding rods 33 is three but the present invention is not limited thereto the front supporting rod 31 and the rear supporting rod 32 are disposed to be extended along a first direction which. |
7 | that is the total distance from the sea surface to the subject plus the distance from the subject to the camera should be more than 8 feet and less than 50 feet standard still or movie film balanced for use in daylight should be used the filter can have an in front of the lens format 10 shown in fig2 which is designed for installation upon a camera 11 and lens 12 as shown in fig3 this in front of the lens format 10 includes a ring 15 or other means for securing the filter 10 to the lens 12 here the ring 15 is provided with male threads 16 for mating with female threads 17 on the lens 12 known separate step up or step down rings not shown can be used to attach the filter 10 to the lens 12 if the camera is of the direct immersion non housed type the space 13 between the filter 10 and the lens front element 14 should be flooded that is the filter 10 should be attached to the lens 12 when both filter 10 and lens 12 are underwater this procedure will avoid the imbalance of water pressure only on the outside of the filter 10 such underwater pressures on the filter can easily exceed 25 psig if not balanced these pressures can break deform or otherwise damage the filter or camera less preferably flooding grooves not shown can be produced in the ring 15 to automatically admit water to the space 13. |
5 | application over standard sized wells which presently come in sizes such as 42 u2033 50 u2033 67 u2033 and the like cover 100 is most preferably slightly resilient to accommodate dimensions that deviate slightly from the standard dimensions as will be further understood herein below domed or elevated body member 110 comprises the majority of surface area and is designed to allow standard casement window 220 to operate freely when cover 100 is in operative position as shown in fig1 consequently in the event of an emergency an occupant may fully open casement window 220 and then enter into the well area defined by well wall 240 cover 100 and building foundation 200 furthermore using the preferred embodiment cover 100 the orientation of hinges on casement window 220 such as whether the hinges are left or right handed is irrelevant body member 110 includes top body member 120 which is generally trapezoidal in shape while generally planar in preferred embodiment cover 100 top body member 120 will most preferably be slightly domed from the edges to the center this slight dome shape ensures drainage of moisture rather than pooling or puddling and also adds to the total load bearing capability of top body member 120 in addition to being slightly domed top body member 120 will most preferably exhibit a slight or gentle slope away from foundation 200 to help direct moisture away from siding 210 and foundation 200 supporting top body member 120 are sides 130 132 134 each which extend in a generally vertical direction sides 130 and 134 have a trapezium geometry while side 134 has the shape of. |
1 | 310 having a transducer 320 located at or near one end of the wand the wand 310 is preferably made of a rigid or semi rigid biocompatible material such as for example plastic or thermoplastic the transducer 320 may be either mounted at the end of the wand 310 or within a cavity not shown in the wand 310 while a single transducer 320 is illustrated in fig5 it is understood that the transducer 320 may be comprised of multiple transducers that are stacked or otherwise incorporated on or within the wand 310 the transducer 320 may be any type of transducer suitable for converting electrical energy into vibrational and or acoustical energy such as a resonance type ultrasonic sonic or supersonic transducer these transducers produce high intensity waves or energy by for example applying the output of an electronic oscillator to a thin wafer of piezoelectric material e g lead zirconate titanate pdzrti or pzt or barium titanate batio 3 which acts as a vibration element if the transducer 320 is mounted at the end of the wand 310 it should be preferably coated with a protective biocompatible coating such as for example teflon that seals and electrically insulates the transducer and provides a smooth surface for applying the transducer to a patient 39 s teeth gums or other tissue alternatively if the transducer 320 is located within a cavity in the wand 310 then the end of the wand 310 where the transducer 320 is located should preferably be smooth to provide a comfortable surface for applying the end of the wand to. |
5 | members 32 which also typically take the form of tubes or tube like structures the horizontal and vertical members are connected at predetermined distances to achieve a desired slope in accordance with at least some embodiments the scaffolding or scaffold assembly 24 provides for or permits attachment or connection of a horizontal scaffold tube 30 to a vertical scaffold post 32 every 21 inches vertically and this is indicated by diagram a in accordance with at least some embodiments using the scaffold system noted above a horizontal bearer e g a 3 foot sbr3 safway systems scaffold horizontal bearer can be combined with or connected to the vertical posts e g a safway systems scaffold vertical post to create the necessary slope the scaffold assembly 24 includes primary bracket or connector mechanisms 34 to connect the horizontal and vertical scaffold members 30 and 32 respectively the scaffold assembly 24 further includes additional connector mechanisms 36 only shown in fig1 and brace assemblies 38 again only shown in fig1 which typically include a plurality of brace mechanisms and which are used to connect and support the horizontal and vertical scaffold members 30 and 32 respectively over a longer span more specifically such additional bracing is typically included to provide for added support and. |
9 | embodiment of fig4 location information is obtained with reference to one or more of wlan access points the format of fig4 includes a unit id field 401 which contains an identifier for the wireless unit it can be in the form of identifier such as a telephone number the format of fig4 includes a time field 403 which indicates the time period during which the mobile game unit will be available for game play in the embodiment of fig4 the time period is specified as a number of minutes following the sending time of the session ready message in other embodiments the time available for play could be specified in terms of an end time in other embodiments the time may be indefinite in which case the player is maintained in the list of available players until the player logs out the message format of fig4 includes a service set identifier ssid field 405 ssid field 405 contains a unique identifier for each wifi access point within range of the mobile game unit finally the format of fig4 includes a signal strength field 407 which contains the signal strength measured by the mobile game unit for each wlan access point within range of the mobile game unit fig5 illustrates a session ready message format according to another embodiment of the present invention the message format. |
3 | 500 ml of test solution containing 10 mg u00b7 l u2212 1 of antiscalant dry basis 240 mg u00b7 l u2212 1 of ca 2 and 732 mg u00b7 l u2212 1 of hco 3 u2212 was prepared by adding calculated volume antiscalant stock solution calcium stock solution bicarbonate stock solution and double distilled water respectively to a glass bottle the ph of each test solution was adjusted to 9 0 by using borate buffer solution the bottles were incubated in a water bath for 18 hour at 80 u00b0 c after cooling an aliquot quantity was filtered through 0 22 u03bcm filter paper and then the calcium concentration in the filtrate was measured using the standard edta titration method meanwhile the control test in the absence of antiscalant was conducted static inhibition efficiency test for calcium sulfate was performed similar to the static calcium carbonate inhibition efficiency the 500 ml of test solution contained 5 mg u00b7 l u2212 1 of antiscalant dry basis 2500 mg u00b7 l u2212 1 of ca 2 and 7350 mg u00b7 l u2212 1 of so 4 2 u2212 it was adjusted to 7 00 u00b1 0 1 by the addition of hcl and or naoh solution 10 the bottles were incubated in a water bath for 18 hour at 80. |
3 | pharmaceutical for neuriatria caused by unbalanced nervous system or abnormal exasperation of muscular pulse further the alkylenediamine derivative is of value as agricultural chemical particularly as insecticide because it is effective to block the transmission at neuromuscular junctions of insects in which glutamic acid serves as excitatory transmitter at their neuromuscular junctions whereby decreasing actions of insects it has been further confirmed that the alkylene diamine derivative of the invention is low both in acute toxicity and subacute toxicity in the aforementioned formulae i and ii the aliphatic hydrocarbon group may be either saturated or unsaturated hydrocarbon group however saturated hydrocarbon group is preferred each of r 1 and r 6 preferably is a straight or branched chain alkyl group having 3 8 carbon atoms such as propoyl isopropyl butyl isobutyl pentyl isopentyl hexyl heptyl octyl or 2 ethylhexyl or phenyl each of r 2 and r 7 preferably is a straight or branched chain alkyl group having 4 8 carbon atoms such as butyl isobutyl pentyl isopentyl hexyl heptyl octyl or 2 ethylhexyl otherwise r 2 preferably is a straight or branched chain alkoxy group having 4 8 carbon atoms such as butoxy isobutoxy pentyloxy isopentyloxy hexyloxy heptyloxy octyloxy or 2 ethylhexyloxy further each of r 2 and r 7 preferably is a straight or branched chain aliphatic hydrocarbon group containing an ester bonding and 4 8 carbon atoms such as butyryloxypropyl isobutyryloxyethyl valeryloxyethyl isovaleryloxyethyl caproyloxyethyl or isocaproyloxyethyl furthermore each of r 2 and r 7 preferably is an aliphatic hydrocarbon group containing an ether bonding and 4 8 carbon atoms such as isoproboxyethyl isobutyloxy ether isoproboxypropyl pentyloxypropyl or ixopentyloxyether or phenyl. |
8 | apply additional services fig7 illustrates a messaging service in an example of the invention communication system 100 now includes message server 108 message server 108 could support a short message service sms or some other form of messaging service when message server 108 receives a message for wireless telephone 101 message server 108 forwards the message to wireless telephone 101 over a messaging channel u2014 typically a signaling link through wireless service node 103 and network 102 message server 107 also forwards the message to platform 107 platform 107 transfers the message to packet network appliance 105 thus messages for the user of wireless telephone 101 that are received into message server 108 are transferred to both wireless telephone 101 and packet network appliance 105 alternatively when message server 108 receives a message for wireless telephone 101 or packet network appliance 105 message server 108 forwards the message to platform 107 in response platform 107 transfers the message through wireless service node 103 to wireless telephone 101 and platform 107 also transfers the message to packet network appliance 105 if desired platform 107 can discard messages for appliance 105 if appliance 105 is not logged in to platform 107 if desired platform 107 can discard messages for wireless telephone 101 if telephone 101 is not on alternatively the. |
6 | and temperature are useful adsorbents to increase the mass of natural gas within a tank a further selection of these carbons is based on their particle size which should be a size that is easily conveyed pneumatically in a stream of an inert gas for example nitrogen in exemplary implementations a particle size range of between about 150 to about 400 mesh is useful these carbons are very flammable and thus they are normally stored wet to reduce the danger of fire or explosion during handling and shipping prior to be placing in a tank the carbons are dried in an oven or air heating and drying system at 110 u00b0 c with or without a vacuum and immediately conveyed into storage tanks preferably the transfer of the carbon is pneumatically in an inert gas atmosphere zeolites mofs and carbon are all considered toxic hazardous materials for respiratory inhalation it is critical to keep these materials contained within the system after the storage tank is filled under a minimal pressure for example about 30 psia with the carrier gas the tank is allowed to equilibrate at atmospheric pressure a special valve fitting is installed with a supported membrane or fine filter between the tank itself and the regulator in exemplary implementations the pore size of the filter in between about 0 1 and 0 3 micrometers in one aspect the membrane or filter is supported on both sides with mesh to allow both high pressure filling of the tank and. |
3 | contain less than 0 10 percent of 2 methyl 2 methylsulfinyl propionaldehyde o methylcarbamoyl oxime sulfoxide by product apparatus the apparatus consisted of 500 ml four necked flask equipped with a thermometer stirrer adapter with two drip tip tubes and a dry ice condenser the two drip tip tubes were connected to separate pumps which regulated the feedrates of the solution and the aqueous peracetic acid solution the reactor was also equipped with a side arm overflow tubing through which the reaction product could be drained as desired into a receiver the reaction temperature in the reactor was maintained at 40 u00b0 41 u00b0 c by a warm temperature bath procedure the 2 methyl 2 methylthio propionaldehyde o methylcarbamoyl oxime solution 29 30 in methylene chloride and 35 aqueous peracetic acid solution were introduced into the reactor at rates of 45 ml hr and 56 ml hr respectively after about 2 hours the accumulated reaction product was allowed to overflow into the receiver kept at 5 u00b0 c through the side drain at 15 minute intervals to maintain a constant volume in the reactor the process was continued in this manner for about 6 hours the sulfone product in the receiver. |
8 | generally at 300 a stacked microstrip line 305 and slotline configuration 310 of one embodiment of the present invention the parallel stacked microstrip lines 305 couple by way of magnetic field lines encircling both strips similarly parallel stacked slotlines 310 couple by way of electric field lines encircling both slots in the case of a conducting strip crossing over a slotline 320 in the ground plane the slotline blocks the ground plane currents generated by the transverse electromagnetic tem wave propagating along the microstrip line this creates a charge build up across the slotline which launches a tem wave propagating in both directions along the slotline this form of slot strip coupling is very strong and is widely used in microwave circuits a stacked pair of reduced size patches of similar shape creates conditions similar to the parallel coupled microstrip or slotlines which explains why the coupling is weak turning now to fig3 a at 301 shows two variations of an embodiment of the present invention where electromagnetic coupling in slot strip coupling regions 311 between two stacked patches upper patch 303 and lower patch 307 are increased greatly due to the fact that strip like parts 302 of one patch lower patch 307 in this exemplary embodiment cross over slot like parts 304 of the other patch upper patch. |
1 | 5 1 50 5010 1 66 6615 1 75 7520 1 90 9025 2 0 10030 2 10 110______________________________________ table d______________________________________time initial dry finish inc inminutes wt grams wt grams wt ______________________________________ 5 48 59 63 36 30 410 50 53 69 54 37 615 49 12 70 48 45 520 49 55 74 57 50 525 51 05 79 56 55 830 51 95 83 01 59 8______________________________________ with regard to the texture and taste of the grains cooked in accordance with example ii the grains cooked for 10 to 30 minutes had good flavor and texture and those cooked for 5 minutes were too hard to chew comfortably the grains cooked for 10 to 25 minutes had better texture than those cooked for 30 minutes and the grains cooked for 15 minutes provided the best texture and flavor some bursting of the grains was notice when the grains were cooked for 30 minutes but the bursting was minimal and acceptable fifty grains in each of the batches cooked for 10 15 20 25 and 30 minutes to determine increase in weight in example ii were sliced in half with a razor blade and a white center count was made with respect to the foregoing cooking times white centers were found respectively in 100 100 90 80 and 60 of the cooked grains in comparing the results of examples i and ii it will be noted with respect to texture and flavor that. |
7 | that it will not change until another input is recorded by the device or until a new audio track is loaded which sets the playback speed to the default value for that track when the pitch control mode switch button 18 is pressed the rotational input device 14 is used to control the playback speed of the tracks by rotating the rotational input clockwise the playback speed may be increased and by rotating the rotational input counter clockwise the playback speed may be decreased also when the pitch control mode switch button 18 is pressed the display 13 displays a special screen showing the current playback speed value of the currently played audio track of the selected channel when the disc jockey changes the playback speed value the display 13 is updated with the new value to give feedback to the disc jockey the button 18 is preferably located on the upper left side of the housing 12 to make it easy for the disc jockey to activate the playback speed manipulation functionality by using the left hand thumb or in the case of a left handed disc jockey with the fingers of the right hand to activate the cross fade function for the lineout output that is the transition from the track of the first channel to the track of the second channel the disc jockey may use the cross fade input 16 on the front side of the device located just below the input device 14 by sliding the finger all the way to the left or right the disc jockey sets the audio output to be either the first channel or the second channel. |
8 | power the sgbdr laser elements may be controlled separately from the amplifier to tune the laser frequency and otherwise control the input to the optical amplifier by this arrangement of elements power amplification and tuning functions are substantially uncoupled in the embodiment of fig1 a optical amplifier 190 has an active section and a passive section the active section amplifier gain section 110 is substantially straight the passive section of waveguide 105 is curved and intersects output facet 195 at an oblique angle both waveguide curvature and the oblique intersection with the output facet act to prevent reflections at the output facet from coupling back into the optical amplifier 190 and laser 180 fig1 b shows a longitudinal cross section of a laser assembly 100 of fig1 a in fig1 b laser assembly 100 waveguide 105 amplifier gain section 110 front resonator mirror 120 laser gain section 130 laser phase control section 140 back mirror 150 and electrical contact 160 epitaxial structure 170 laser 180 optical amplifier 190 output facet 195 p type semiconductor layer 125 n type semiconductor layer 115 mirror sampling period 135 offset quantum wells 145 and stop etch layer 155 are shown in fig1 b waveguide 105 is formed between p type and n type semiconductor layers 125 and 115 respectively mirrors 120 and 150 are formed by sample gratings etched in waveguide 105 with sampling period. |
1 | solid line left by adjacent leveler discs d 1 d 2 working in opposite directions is quickly broken down by the weather and the troughs 111 left by the chisel plows are filled with loosened soil indicated by solid line mounds 103 104 in fig6 the leveler discs are set to operate at an elevation dashed horizontal line 113 in fig6 slightly above the original soil level h by an inch or two staggering the discs fore and aft of each pair of leveler discs has the advantage of avoiding compacting the narrow band or ridge of soil left by the gap between the discs this staggered arrangement also has the advantage of reducing any tendency of residue or soil clumps to plug between the convex non working surfaces of a disc pair moreover it will be observed that the concave working surfaces of adjacent leveler discs such as the end disc of assembly 130 a and the left side disc of disc assembly 130 b are also offset or staggered along the direction of travel this further facilitates the passage and handling of residue if the working surfaces of adjacent discs were in lateral alignment each would be heaping residue on the other and this would decrease the ability of the implement to handle residue the disc leveler may be adjusted in height relative to the transverse support frame 14 it will be recalled that the chisel toolbar 15 is rigidly attached to the transverse frame 14 and is raised and lowered with the transverse support frame 14 as it is elevated. |
3 | hydrogen then passes through conduit 41 which connects with duct 34 where the hydrogen will be diluted below its explosive limit by the large volume of air swept across the electrolyte the hydrogen is thus scrubbed before it is diluted with air which means that a smaller volume of gas requires treatment furthermore as hydrogen is about 7 as dense as air the de mister is more efficient than if air were mixed with hydrogen before de misting the cell is provided with a feed solution inlet 42 which is illustrated as communicating with the cooling and concentration chamber 18 but which could be located at either chamber there is also an acid feed line 43 for the purpose of adding sufficient acid to maintain a constant ph the product of the electrolysis is removed through drain 44 in operation the electrolytic solution circulates in the direction shown by the arrows in fig1 and 2 due to the gas lift effect of the hydrogen evolved in the electrolysis the heat generated during electrolysis is removed by the combined effect of the air sweep passing countercurrent to the direction of flow of the electrolyte as described above together with the auxiliary cooling coils 38 at the same time the air causes evaporation and consequent concentration of the electrolytic solution fig4 illustrates a further embodiment of the invention in which the cell chamber 50 is entirely separate from cooling and concentration chamber 51 the electrolyte flows through line 52 from chamber 50 to 51 and returns through line 53 the hydrogen gas generated. |
2 | the trough 12 and at the other end to brackets 38 carried respectively by the anchor block 30 and base member 18 a plurality of springs 64 are mounted between cross braces 52 on the base 18 and mounting brackets 66 carried by the underportion of the trough 12 each spring 64 has an axis lying generally parallel to the direction of the vibratory movement of the conveyor as will be described more fully hereinafter a drive system generally designated 72 is provided for imparting vibratory movement to the material carrying member or trough 12 which system includes an electric motor 74 carried by the base 18 and connected by a belt 76 to drive a shaft 78 carried by the base 18 and to which shaft 78 eccentric weights 80 are drivingly connected the shaft 78 is drivingly connected to connecting rods 82 which in turn are connected to brackets 84 carried by the trough 12 so as to provide vibratory conveying motion to the trough 12 the particular form of vibration imparting system is not a part of the present invention and thus such vibrating means will not be further described herein an example of a typical vibrating system 72 is shown in musschoot u s pat no 3 750 866 assigned to the common assignee of the present application the apparatus hereinabove described when operated will produce vibrations in the trough generally along the line a in fig1 thereby to produce the movement of the conveyor and to create the throw and catch of the material along the trough the present invention contemplates particularly a relatively steep inclined angle for the trough 12 and a v shaped configuration in. |
4 | 13 the only significant fact is the production of a closed drive and not the number of wheel discs 12 and 13 of this drive it is quite conceivable to operate instead of with only two wheel discs as in the embodiment with a drive which includes four wheel discs in which then each wheel disc causes a turn of only about 90 u00b0 such a structural configuration of the manufacturing apparatus may be advantageous for reasons of friction now the drive of wheel disc 12 is turned on in the direction of arrow 14 this causes a twisted strand of yarn 8 formed from filaments 7 drawn from bobbin table 1 to be pulled through the pushed together length sections 3 and 4 of the future protective tube 5 each full revolution of knot 23 indicates that a further strand of yarn has been pulled through the two pushed together length sections 3 and 4 of the future protective tube 5 consequently the number of revolutions of knot 23 corresponds to the number of turns of yarn 8 in the future skein of yarn 2 to be disposed within the two length sections 3 and 4 after the desired number of revolutions of knot 23 has been reached the drive for wheel disc 12 is turned off which may be effected by means of an automatic control device then the rear end 26 of strand of yarn 8 is cut from the intake side of filaments 7 thereafter the skein 2 composed of a plurality of wound strands of yarn is removed from wheel discs 12 and 13 supporting elements 11 are. |
5 | attached to the square tube end caps which will keep the rainfly fabric taut in order to keep the rainfly support rods in the proper location a series of loops which are sewn welded or heat seamed are added to the underside of the rainfly at the highest point so that the fiberglass rods can be inserted into the loop directly above the square support tubes once this has been done for each of the fiberglass rods each rod can then be inserted into the rainfly support receivers on the rainfly support square tube on either end the rainfly can then be centered over the arched rods and attached to the square tubes fig1 depicts and alternative design where instead of specialized caps the flexible rods are inserted into holes further to increase the flexibility of the rods in rolling flexible rod connectors can be included so that each rod comprises two connected shorter rods spanning the rain fly the rainfly should now be attached to the square tube s using 8 u00d7 u00bc u2033 phillips truss head stainless steel screws starting at the middle of the cover the rainfly fabric will be centered from side to side on top of the fiberglass support rods and fastened onto one of the center square tube s with a u215cth u2033 stainless steel washer to help spread out the pressure of the screw on a larger area of fabric now on the opposite end of the same center square tube the fabric will be pulled taut and fastened to the support with a. |
9 | the fact that the shank has an offset 132a so that the hook 133 may be aligned with the latch bar 126 although the loop 134 is recessed in the framework of the door the hook support 150 comprises an angle member having a fastening web 151 and an upright web 152 in which there is formed an upwardly open notch 153 and as seen in fig7 the hook support 150 is so located with reference to the hook mounting bracket 117 that the portion of the hook shank 132 which is immediately adjacent the hook 133 rests in the notch 153 reference to fig8 shows that the bights of the camming lever 119 permit enough angular displacement of the hook member 118 relative to the plane of the door for the shank 132 to be received in the notch 153 the support 150 is entirely recessed forward of the inner face of the intermediate frame member 114 so that substantially the entire hook member 118 is also positioned above the intermediate frame member 114 when the hook member is in the idle position illustrated in broken lines in fig7 consequently the hook member does not interfere with fully opening the door 112 because as seen in fig2 and 3 there is enough clearance between a door and the. |
3 | this method is performed similarly to the sequence shown in scheme 8 except that 2 3 bromo phenyl ethylamine is used as the starting material scheme 9 above depicts a method for the synthesis of dihydro 1 u2032 h 1 2 u2032 biisoquinolinyl compounds according to this method in what is known as palladium catalyzed amination reaction 1 chloro 6 7 dimethoxy isoquinoline is heated with the appropriate substituted tetrahydroisoquinoline in the presence of palladium acetate and an appropriate ligand such as binap suitable solvents include but are not limited to benzene toluene and xylene and effective temperatures range from room temperature to 160 u00b0 c with 80 u00b0 c to 120 u00b0 c being particularly effective this amination reaction can be accomplished through a variety of other coupling methods hartwig j f palladium catalyzed amination of aryl halides mechanism and rational catalyst design synlett 1996 p 329 340 substituted tetrahydroisoquinolines can be prepared several well known methods three of these methods are shown in schemes 10 11 and 12 scheme 10 illustrates a method for their formation via catalytic hydrogenation of the corresponding substituted isoquinoline the hydrogenation reaction is commonly known to those skilled in the art scheme 11 illustrates another literature route to substituted tetrahydroisoquinolines 1 according to this method a benzylic aldehyde or ketone is combined with an alpha amino acid ester in a well known reductive amination reaction the resultant benzylamine is induced to cyclize via treatment with a strong acid such as trifluoromethanesulfonic or sulfuric acid to give a substituted tetrahydroisoquinoline product possessing a 4 oxo substituent this oxo substituent can be retained or may be reduced to the corresponding hydroxyl compound via hydrogenation catalyzed by. |
1 | resultant yellowish clear solution collected the hydrolysate was analyzed for uronic acid using the carbazole calorimetric assay hydrolysate was shown to contain between 0 1 0 3 ha since eggshell membrane samples were diluted approximately 1 10 ha content was between 1 3 ha the insoluble residue was collected and analyzed for collagen glucosamine and chondroitin concentrations the residue was high in hydroxyproline indicating a high concentration of collagen the clear supernatant was stored at refrigerated temperatures the following example relates to the preparation and evaluation of capsules for nutraceutical therapeutic treatments in humans eggshell membrane was separated from eggshell by a mechanical method the separated eggshell membrane was partially dehydrated and powdered using a pulverization mill the powder was sized to produce powder from approximately 100 microns to approximately 500 microns this powder was heat treated and placed in size u201c 0 u201d gelatin capsules containing about 500 mg of eggshell membrane powder an individual experiencing chronic joint pain volunteered to take one capsule per day after approximately 3 days the individual reported a significant reduction in joint pain the pain returned when the individual stopped taking the capsules the following example relates to examination of the preparation using a novel multi analyte immunoassay profile of 60 acute phase reactants cytokines growth factors and hormones using the rules based medicine technology at charles river laboratories eggshell membrane isolates prepared as in example 3 were filtered through 0 2. |
2 | in fig2 in order to press the uniting band 40 against the adjacent portion of the running ribbon 15 and to thus form a splice which causes the ribbon 14 to advance with and at the speed of the expiring ribbon 15 at the same time the splicing member 19 or a separate device severs the ribbon 15 behind the splice and the brake shoe 17b is caused to engage the spindle 2a in order to prevent further unwinding of the remnant of ribbon 15 off the reel 2 the brakes including the levers 16 and 17 are responsive to tension of the respective ribbons and are designed to insure that the tension remains within a predetermined range the ribbon 15 passes through the nip of two continuously driven advancing rolls 20 21 which transport the ribbon in the direction indicated by arrow b toward and around a dancer roll 22 which is movable up and down between two pairs of upright guide rails 23 25 and 24 26 the dancer roll 22 serves to tension the ribbon 15 i e to compensate for deviations of the rate of intermittent transport or feeding of ribbon downstream of the continuously driven rolls 20 21 from the rate at which the rolls 20 21 advance the ribbon toward the dancer roll 22 the ribbon 15 thereupon passes around a further guide roll 11 and past a suitable sensor 27. |
3 | signaling alliance facility at ut southwestern medical center dallas tex according to standard procedures phapi open reading frame orf was amplified by pcr from image clone aa488559 incyte genomics inc palo alto calif using primers cggcagatctctggatccatggagatgggcagacggattc seq id no 1 and cgccgtcgacttagtcatcatcttctccctc seq id no 2 the amplified product was subcloned into bamhi sali sites of pet 28a vector novagen milwaukee wis the plasmid was used to express recombinant his tagged phapi in bl21 de3 strain and the protein was purified using nta agarose qiagen valencia calif followed by q sepharose chromatography prot orf was amplified by pcr from image clone b315161 incyte using primers ccggcatatgtcagacgcagccgtagac seq id no 3 and ccggctcgaggtcatcctcgtcggtcttctg seq id no 4 the amplified product was subcloned into ndei xhoi sites of pet 21b vector novagen the plasmid was used to express recombinant his tagged prot in bl21 de3 strain and the protein was purified using nta agarose qiagen valencia calif followed by q sepharose chromatography double strand sirna ucaccaccaaggacuuaaa seq id no 5 corresponding to a region of prot mrna with dtdt overhead in 3 u2032 ends was synthesized by dharmacon lafayette colo to disrupt prot mrna in hela cells double stranded sirna gcagcacgacuucuucaagu seq id no 6 3 u2032 end dtdt overheads corresponding to a region. |
7 | processed by the geometry engine 335 and rasterizer 340 and passed to the shader core 350 the shader core 350 provides data to the texture cache subsystem 360 and shader backend 370 the shader core and shader backend textures the primitives for example according to a shader program that is preloaded by a driver more details on shaders and their programs are available in u s patent application ser no 09 885 242 titled programmable pixel shading architecture filed jun 19 2001 and u s application ser no 09 885 382 titled system method and computer program product for a programmable pixel processing model with instruction set filed jun 19 2001 both of which are incorporated by reference in a specific embodiment of the present invention the texture cache subsystem inspects the next several lines of the shader program to determine which textures will be needed the texture cache subsystem retrieves the corresponding texture descriptors from the graphics memory 310 using the frame buffer interface 320 the corresponding texture descriptors retrieved from the graphics memory 310 contain information such as location stride filtering height width and other parameters necessary for the retrieval of the textures themselves from the graphics memory the texture cache subsystem 360 is then able to retrieve the textures from the graphics memory 310 via the frame buffer interface 320 the textures may then be cached in the texture cache subsystem 360 specific examples of how this may be done may be found in u s pat no 6 629 188 titled circuit amp method for prefetching data for a texture cache by. |
1 | one or more pressure switches 44 in the illustrated embodiment valve 24 comprises a deluge valve which includes a priming chamber 46 as is known in the art trim manifold assembly 22 controls the pressure in priming chamber 46 and communicates with valve 24 and fire suppressant supply 26 through conduits 48 50 respectively conduits 48 50 by way of non limiting example may be flex hoses trim manifold assembly 22 also communicates with a control panel 52 via wiring indicated by dotted lines in fig1 which provides actuating signals to or monitors signals from components within trim manifold assembly 22 and also components located exteriorly of trim manifold assembly 22 to control the opening of valve 24 in response to low pressure signals from pressure switch 44 and in response to fire condition signals from detector 54 detector 54 by way of non limiting example may be a heat detector or alternatively a smoke detector referring to fig2 12 details of trim manifold assembly 22 are shown trim manifold assembly 22 may include a solid one piece manifold 60 with a plurality of fluid passages therein to allow trim manifold assembly 22 to control the operation of valve 24 as described below manifold 60 may be metal and the passages therein may be formed by machining the passages into a solid manifold block manifold 60 may have a top surface 55 a front surface 56 a. |
5 | measurement sensors the said data is transmitted in real time in order to be used in the underreaming and drilling operations 56 or physically downloaded by removing said card when the tool is retrieved from the well the tool is provided with a built in link to the telemetry system 56 which also serves to monitor performance of the under reaming operation position of expansion blocks 62 and data recorded by the caliper for measuring the underreamed wellbore diameter 66 or 76 as well as data from the fluid properties sensor one or more acoustic sensors 64 or 76 are placed within the tool body 52 in order to emit a number of sound waves during a given time period which are reflected back by the wellbore wall fig3 22 and picked up by the receiver sensors 66 or 76 the processor 68 calculates the distance using transit time and calibrates transit time with data from the fluid properties sensors to establish the speed of return of the acoustic waves and wellbore diameter the processor compares the measured wellbore diameter to the programmed desired diameter if the two measurements match given user defined tolerances the tool continues to operate to the total depth of the wellbore section to be underreamed where the measurements do not match the processor automatically activates a series of logic steps to troubleshoot the fault as further shown in fig2 a keyway 74 provides a channel for wiring of the acoustic pulsers or transmitters 64 or 76 and the acoustic sensor receivers 66 or 76 to the processor 68 and. |
3 | hydrophobic monomer can be e g styrene or divinylbenzene a preferred copolymer is a poly divinylbenzene co n vinylpyrrolidone a preferred porous resin is a compound of formula i and salts thereof described supra preferably the porous resin is a sulfonated poly divinylbenzene co n vinylpyrrolidone in preferred embodiments the porous resin comprises at least about 12 mole percent n vinylpyrrolidone in preferred embodiments the porous resin comprises less than about 30 mole percent n vinylpyrrolidone by mole percent is meant the mole fraction expressed as a percent of the monomer of interest relative to the total moles of the various two or more monomers which compose the copolymer of the porous resin preferably the porous resin has solid phase extraction capability the porous resin can be in the form of e g beads pellets or any other form desirable for use the porous resin particles can have e g a spherical shape a regular shape or an irregular shape preferably the particles are beads having a diameter in the range from about 3 to about 500 u03bcm preferably from about 20 to about 200 u03bcm preferably the porous resin has a specific surface area in the range from about 50 to about 850 square meters per gram and pores having a diameter ranging from about 0 5 nm to about 100 nm in certain embodiments the porous resin is incorporated in a matrix in certain embodiments more than one type of functionalized porous resin can be used in the columns cartridges and the like of the present invention the solute can be e g any molecule having a hydrophobic hydrophilic or. |
6 | and has a smaller diameter than the second gear wheel 32 the third gear wheel 34 meshes with a fourth gear wheel 36 which has a larger diameter than the third gear wheel 34 the fourth gear wheel 36 is solidly joined to a fifth gear wheel 38 which has a smaller diameter than the fourth gear wheel 36 the fifth gear wheel 38 meshes with a curved rack 40 whose course will be explained in further detail hereinafter the rack 40 is integral with a brake lining mounting 42 on whose side toward the brake disk 16 the friction brake lining 12 is mounted the brake lining mounting 42 is pivotable about an axis of rotation not shown of the brake disk 16 and is also movable in the direction of the brake disk 16 that is axially to it a second friction brake lining not shown is disposed on an opposite side of the brake disk 16 in a manner known per se it rests in a brake caliper also not shown that is embodied as a floating caliper or in other words is displaceable transversely to the brake disk 16 if the friction brake lining 12 shown is pressed for braking against the brake disk 16 the effect in a manner known per se is a transverse displacement of the caliper which as a result presses the friction brake lining not shown against the other side of the brake disk 16 so that the brake disk 16 is braked the first and second gear wheels 30 32 the third and fourth gear wheels 34 36 and the fifth gear wheel 38 and the. |
3 | then stop heating cool to u2212 5 u00b0 c drop 200 ml tetrahydrofuran solution of 133 g 0 334 mol 1 0 eq n methoxyl n methyl 1 trityl 1h imidazole 4 formamide while the inner temperature is controlled to not exceed 25 u00b0 c after the dropping is complete continue to stir for 12 hrs at room temperature and then reaction ends add 50 g ammonium chloride which is dissolved in 150 ml water to quenching the reaction while controlling the inner temperature not exceeds 15 u00b0 c after dropping is complete add 500 ml dichloromethane stir for 1 hr at 10 u02dc 20 u00b0 c filter to remove insoluble substances the filtrate is separated into layers collect the organic phases extract the water phase by 3 u00d7 100 ml dichloromethane combine the organic phases and wash it by 2 u00d7 100 ml water concentrate the organic phase the residue is recrystallized in the solvents of 200 ml dichloromethane and 800 ml n hexane obtain 80 g 2 3 dimethyl phenyl 1 trityl 1h imidazole 4 ketone which is a light yellow solid with a yield of 54 and a purity of 84 hplc add 100 g 0 714 mol. |
9 | spring 70 push it out the pin moves back into its first rest position 150 via the two remaining straight sections during this return stroke the cam shaped cut on retention lever 62 is moved by the follower area 112 of the lock lever resulting in the retraction of the stop without the stop in place the spring 70 can push the cartridge out of the magazine by about five eighths of an inch toward the end of the return stroke the front end 67 of the slot 63 in the plate 66 pushes the tab 78 of the shutter 64 thus pulling the flag into the empty cell position it should be noted that the shutter 64 includes a notched hole 80 fig1 which restricts the flag to one of three definite positions it is important that the loader not be interacting with the magazine when it is removed from the receiver as can be seen in fig1 this condition is satisfied by providing an automated receiver opening mechanism that is actuated when the loader cartridge transfer mechanism 168 is in a docked position and out of the way of the cartridges and the magazine at the lowermost position the transfer mechanism presses forward against the first bar 170 of the release linkage 118 this causes the second bar 172 to pull on the third bar 174 rotating the fluted shaft 114 rotation of this fluted shaft causes the attached resilient pawls 116 to be pulled from their locked positions in the catches 120 a first spring 122 causes the receiver to rotate into an open position this spring may be a coil spring as shown in fig1 or it may be a leaf spring mounted under the receiver if a. |
5 | internal framing any sort of door or window or other opening can be accommodated without lintels double headers or cripple studs an enlarged view of the shoe 30 is shown in fig3 holes 36 for screws are provided in the web of shoe 30 whereby the shoe may be attached to lower chord or cross member 26 of truss 10 and to heel member 16 two legs 40 of shoe 30 locate the truss on the wall panel longitudinally two tabs 42 are punched out of the central area of the shoe and project downwards as prongs the gap between these prongs receives the central web of a wall panel connector which is aligned with the joint between panels and which will be described further hereafter this serves to locate the truss laterally so the combined action of the four downward projections legs 40 and prongs 42 from the shoe 30 serves to align the truss precisely and automatically over the centre of the joint between the vertical frame members 18 the punched opening 44 of the prongs 42 takes up most of the width of the web of the shoe 30 leaving intact two relatively narrow strips 46 which reduces the cross sectional area available for heat transfer helping to retain the thermal integrity of the building envelope the wall sections 12 may be easily erected on either a wooden or concrete floor platform 14 simply by abutting one edge of one panel to an edge of another panel thermal breaks which will be described in more detail hereinafter are provided in the thickness of. |
9 | on a control or comparison sample in some embodiments of the present invention the well 10 comprises at least one ligand or anti ligand in yet other embodiments the well 10 comprises reactive chemical groups grafted thereto techniques for grafting such groups on plastic are well known to those skilled in the art the well may also comprise a chromogen or a species which emits light or fluoresces under the conditions of the assay in a preferred embodiment of the present invention shown in fig1 4 the projections 20 extending upward from the well bottom 25 are pyramidal however the projections may be of any shape which will increase the surface area of the well 10 without creating areas that are hard to wash e g crevices and capillaries according to preferred embodiments of the present invention the projections are pyramidal columnar conical rectangular cylindrical or dome shaped the projections are spaced to form interconnecting channels therebetween to enable the sample and reagents to spread over the well bottom 25 devices according to the present invention offer advantages with respect to increased surface area for binding of the ligand or anti ligand and reproducibility it is desirable to increase the surface area of the well bottom 25 so as to maximize formation of reaction product such as in assays of substances. |
7 | to the diffraction effect of the exposure light rounded patterned is resulted for the photoresist layer 230 assuming that the length and pitch in x direction are the same as the width and pitch in y direction for both the photoresist layers 220 and 230 and each block of the photoresist layer 230 overlying the center four neighboring blocks of the photoresist layer 220 openings 240 are formed without rounded comers as shown in fig1 b this is because that the width of the blocks is larger than the pitch and the openings 240 defined by the pitches of the superposing photoresist layers 220 230 have width and length smaller than the blocks the rounded comers of the photoreist layers 220 and 230 overlap with each other can are thus eliminated with each other 0022 fig2 c shows a cross sectional view of the openings 240 along the cutting line ii ii u2032 of fig2 b using the photoresist layers 220 and 230 the insulation layer 210 is etched to form the contact hole via holes 250 as the openings 240 are defined by the straight lines of the sides of four staggering neighboring blocks of the photoresist layers 220 and 230 the openings 240 are thus formed with rectangular shapes without rounded comers in this embodiment two photoresist layers with patterns of blocks are formed though the blocks are. |
1 | the backrest frame with the board 42 being generally horizontal and resting on the upper end 50 of the frame 46 of the backrest 20 or project upwards supported from the rear by the board 42 with the board being uplifted to a generally vertical on edge orientation due to relative pantographic expansion of the rear pantographic link assemblies 44 from a retracted condition the link assemblies 44 are caused to expand as the chair moves from its fully erect position fig2 to its tv position fig3 the expanded condition remains so long as the chair is in its tv position fig3 and if the chair is moved to and from its fully reclined position fig4 and does not reassume its retracted position resulting in tilting down of the headrest 54 unless and until the chair is moved from its tv position fig3 to its fully erect position fig2 although it is easily conceivable that reclining chair mechanism designers and manufacturers given the drawings of this document and the information that has been provided so far would easily be able to construct and successfully operate for its intended purpose a reclining chair having a pop up headrest in accordance with the principles of the present invention in the remainder of this detailed description some further details of the preferred embodiment. |
1 | at the center of toothbrush handle body 11 to make the water therein jet out from the suction and jet pipe 19 thru nozzle 192 to wash the said channel 111 and pipe 19 the front end of said squeeze bulb 15 is tightly installed on the funnel shaped adapter 17 extending from the distal end 112 of toothbrush handle body 11 and be removed from said adapter 17 with some effort two or four elastic spring leaves 16 on the inner wall of squeeze bulb 15 are extended from the inner side of convex ring 172 holding the said bulb 15 so that after the said bulb 15 is pressed these leaves 16 can help the said bulb 15 restore its original shape as shown in fig3 and 6 thru 9 a holding edge 170 with a long hole 171 on one side of said adapter 17 at the distal end 112 of said handle body 11 is designed to hold a push button or switch 2 so as to install a tooth picking flexible member 3 in the partially enclosed channel 113 on the back side of said handle body 11 and make the tooth picking member 31 penetrate the front end of bristle section body 12 so that the tooth picking member point 32 can penetrate the convex seat 194 on one side of the suction and jet pipe body 191 a slot 21 with a movable fastener 22 is located on the upper side of seat body 20 of push button or switch so that the tooth picking member 3 can be fastened on and removed from the push button 2 thru the said movable fastener 22 meantime pushing the said. |
4 | the drier and may be subjected to further operations which do not form part of the present invention such as being cut or trimmed to size or combined with other elements in the manufacture of a final product incorporating the mat as an element a forming screen of the type conventionally employed in the manufacture of wet laid fibrous products is a woven wire mesh screen which is sufficiently flexible to be trained about its guide rolls as is well known in the art the wires are spaced to allow water in a fibrous slurry fed to the screen to drain through the screen while retaining the fibers on the upper surface of the screen in accordance with the invention discrete areas of the screen are formed or treated so as to restrict drainage through those areas compared to the drainage through adjacent untreated areas as shown in fig2 the screen 14 contains areas 34 which are slower draining than the main body of the screen as noted above when a fibrous slurry stock is introduced to the moving screen or wire at a relatively slow rate compared to the speed of the wire the fibers become oriented in the machine direction and when. |
6 | its core and the coil is connected to a power supply which is controlled by a controller 26 so that the current through the coils 24 can be varied the controller 26 is arranged to control the current in each of the coils 24 so as to control the strength of the magnetic field generated by each of the electromagnets 22 the controller 26 is also arranged to control the other parameters of the thruster such as the voltage of the cathode and anode and the supply of propellant when the thruster is used to control the orientation of a probe or satellite the controller 26 is arranged to receive a demand for thrust from a main controller and to control the current in each of the coils 24 so as to produce the demanded thrust referring to fig3 in which the magnets 22 are shown but not the chamber walls 12 if all of the electromagnets are generating an equal magnetic field that field has four cusps 30 each of which is located at a pair of adjacent and opposite poles of two of the adjacent electromagnets 22 and a further central cusp 32 at the centre of the chamber 10 on the z axis simulations show that this magnetic field pattern is reasonably constant along the length of the chamber 10 and diverges gradually at the ends of the of the chamber in operation the anode 18 and cathode 20 set up an electric field approximately axially along the length of the chamber 10 in the z direction and electrons from the cathode 20 are therefore accelerated through the chamber 10 towards the anode 18 as krypton propellant is introduced into the chamber 10 the accelerated electrons ionize the krypton. |
6 | air cooler 116 connected to the turbocharger 114 furthermore a condensate drain 162 may be defined in a bottom of a vertical wall or on the bottom surface relative to the ground of the charge air cooler 116 a condensate reservoir 150 may define a condensate inlet 166 a condensate outlet 168 and a charge air recirculation outlet 196 a condensate supply tube 158 may have a first end that is directly connected to the condensate drain 162 of the charge air cooler 116 and a second end that is directly connected to the condensate inlet 166 of the condensate reservoir 150 to provide fluid communication therebetween a condensate dispersion tube 170 may be directly connected to the condensate outlet 168 of the condensate reservoir 150 and have an inner surface and an outer surface that define a circumferential wall of the tube 170 the circumferential wall may define a plurality of apertures 184 in communication with the inner and the outer surfaces a plurality of nozzles 186 may be directly attached over each of the plurality of apertures 184 that is one nozzle 186 per aperture 184 the plurality of nozzles 186 may each define an opening to the atmosphere. |
8 | and the torque produced by the pmg 101 one embodiment of a pmg 101 is a general dynamics gd part number 1209 pmg the gd part number 1209 pmg 101 is a brushless and bearingless machine further the part number 1209 pmg 101 is designed in accordance with the fault tolerant architecture described herein and is constructed with windings that are electrically isolated from machine structure and from the other windings of the pmg 101 one embodiment of a pcu 102 is a general dynamics gd part number 1208 pcu and is described below the gd part number 1208 pcu 102 includes three converter modules 104 105 106 each converter module is connected a single phase of the pmg 101 through a single pair of wires the converter modules each include a transformer which is connected to an output filter 107 the output filter 107 attenuates high frequency components of the voltage that leaves the pcu 102 and is provided to the aircraft loads the voltage that leaves the part number 1208 pcu 102 is regulated to 28 5 vdc but other generator mode output voltages are possible the part number 1208 pcu 102 also includes a connection for the 28 5vdc output return current that is isolated from the pcu 102 chassis the converter modules each operate as a bidirectional converter and each provide an electrically isolated interface to the pmg 101 when the starter generator subsystem is operated as a generator the converter modules 104 105 106 convert the ac voltage from the pmg 101 to a dc voltage of the desired form when the starter generator subsystem is operated as a starter the converter. |
6 | interface 54 and the female recess 106 males steps 108 may provide for the proper axial and radial alignment of the first stage singlet 122 during installation the first stage singlet 122 then may be fixed into place between the horizontal extension 21 and the outer rings 20 by using the low heat input type weld 109 at the downstream edge of the female recess 106 males steps 108 interface and the low heat input type weld 59 at male female interface 54 in the manner described above alternatively though not illustrated in alternative embodiment the attachment systems of the inner sidewall 44 and outer sidewall 46 as depicted in fig6 may be interchanged accordingly the interface between the outer sidewall 46 and the outer ring 20 may have the female recess 106 male steps 108 as described previously for the inner sidewall 44 and the interface between the inner band 44 and the horizontal extension 21 may have the radial male female interface 54 as described previously for the outer sidewall 46 in such an embodiment except for taking into account the switching of the attachment systems the assembly may proceed as described above referring now to fig7 there is illustrated an alternative embodiment to the present invention a first stage nozzle assembly 150 that utilizes a first stage singlet 152 at the outer sidewall 46 this embodiment demonstrates how the current concepts also may be used with band ring construction which may include a solid band or ring 156 fitted within an outer carrier ring 157 band ring construction may include an interface between the. |
7 | heater 23 a desk 24 and an air conditioning unit 25 are also located in the room 20 these objects include stands to hold objects of interest 17 a rack 21 since the racks 21 may be positioned or oriented at different angles to the detection device of the present invention the orientation of the racks 21 may further complicate its detection the present invention is not limited to the detection of objects of interest that are located behind walls 18 the present invention is applicable to virtually all types of obscurants or visual impediments referring now to fig3 a chart illustrates the various applications 40 in which the present invention can be implemented the chart of fig3 makes it clear that there are environments of increasing difficulty the least difficult environment is the u201c through the walls u201d application and the crowd control application 41 the next more difficult environment is the faa homeland security application 42 the most difficult environment is the foliage penetration application 43 the u201c through the walls u201d application and the crowd control application 41 can be implemented using ground vehicles 44 handheld fixed sites 45 helicopter mounted applications 46 or automatic robotic applications 47 the faa homeland security environment 42 would typically include airport baggage screening 48 and it would include fixed site applications 49 including nuclear power plants large gathering places etc the difficult foliage penetration environment 43 would include large aircraft mounted sources for smart munitions 50 and unmanned combat aviation vehicles u201c ucav u201d 51 referring now to fig4 a diagram illustrates a timing simulation associated with the apparatus and method of the present invention. |
4 | 35 u00b0 and 55 u00b0 being in a solution in the proportion of between 34 and 70 g of sulfuric acid at 66 u00b0 be and 30 60 g of oxalic acid per liter accompanied by an energetic dispersing agent of the same features as that which appears in the reducing method the process is then finished with the same washing finishing and drying processes as were stated in the reducing method by increasing the concentrations of acid in the paste and the temperature in the drying installation the initial strength to the fibers or yarns making up the fabrics can be changed this strength may be kept the same by merely reducing the temperature and the acid concentration to the level stated to adjust the fastness to washing of the coloring effects obtained the conditions of setting must be changed especially the temperature and the moisture content in the vaporizer if we vary these we can also vary and control the fastness which will increase when the temperature and moisture contents are increased and vice versa the textile stock dyed with indigo blue and then discharge printed using the procedure described herein not only has a visible very attractive high quality finish but also a gentle feel the same as the stock had previous to being treated in this manner this is not what occurs with stock dyed with indigo blue which are overprinted in which the feel is much worse as in the printed areas the. |
6 | 12 it can be seen that the camshaft torques have an approximately sinusoidal profile as a function of the rotational position of the camshaft at fixed angular positions in each case advance torques arise which alternate with retardation torques this is now utilized in a targeted manner for the adjustment of the camshaft in fig5 a switching position for the adjustment of the camshaft is schematically plotted such that the orifice cover 51 of the valve piston 27 is illustrated in a developed view in a plane the first cover part 51 a thus yields a rectangular profile with the inner edge pb and a straight outer edge bt illustrated opposite then is the second cover part 51 b with the inner edge pa and the outer edge at at the outer edge at the valve piston 27 is connected to the restoring spring 31 which presses the valve piston 27 against a magnet 21 not illustrated here also schematically illustrated are the first orifices 41 and the second orifices 43 as they are arranged relative to the orifice cover 51 corresponding to the axial position and rotational position of the valve housing 29 relative to the valve piston 27 the first orifices 41 correspond to a second chamber part b and the second orifices 43 correspond to a first chamber part a the chamber parts a b are divided by a vane 67 which forms an adjustment means 67 and which divides a pressure chamber 69 into the chamber parts a b. |
3 | or p selectin together with the constant region of a human immunoglobulin of subclass igg1 were used the genetic construct u201c elam rg u201d described by walz et al science 250 1132 1135 1990 was used to prepare soluble l selectin igg1 fusion protein briefly plasmid dna was transfected into cos 7 cells atcc using deae dextran by standard methods see ausubel et al current protocols in molecular biology john wiley new york 1990 seven days after transfection the culture supernatant was centrifuged to remove cells and cell fragments and adjusted to 25 mm hepes ph 7 0 0 3 mm pmsf and 0 02 sodium azide and stored at 4 u00b0 c the genetic construct u201c cd62rg u201d described by aruffo et al cell 67 35 1991 was used to prepare the soluble p selectin igg1 fusion protein the subsequent procedure corresponds to the preparation of l selectin igg1 described above at section a1 the genetic construct u201c cd4 igg1 hinge u201d described by zettlemeissl et al dna and cell biology 9 347 1990 was used to prepare the soluble cd4 igg1 fusion protein the subsequent procedure corresponds to the preparation of l selectin igg1 described above at section a1 a4 procedure for the hl60 cell adhesion assay for recombinant soluble adhesion molecules 1 96 well microliter assay plates nunc maxisorb were incubated with 100 u03bcl of a goat anti human igg antibody sigma diluted 1 100. |
9 | will recognize that the basic polyurethane formulation provides a dense tough elastomeric material the small amount of catalyst indicates that the formulation will require a long time to cure without the application of additional energy further it has been found that the diamine further retards the curing of the polyurethane material so that external heat is a virtual necessity to the curing of the material in the context of the systems discussed in conjunction with the drawings the lack of catalyzed curing is advantageous this fact allows the secondary coating to be applied and manipulated as described only after all preliminary steps have been completed is the substrate with the coatings passed through a curing oven thus the application and curing of the backings can be carefully controlled for the desired end product the product of the present invention can be a carpet having a precoat to lock in the yarns and having a secondary coat that provides a nonskid characteristic the carpet can therefore be used as a car mat wherein the mat must remain in place under the driver 39 s feet or can be used as an entry mat wherein the mat must remain in place through heavy traffic other uses will suggest themselves to those skilled in the art the method of the present invention provides means for producing a carpet or the like wherein two separate coatings can be applied to a substrate though it should be realized that the nonskid coating can be applied to a secondary backing the precoat will normally be a smooth coating and the nonskid coatings will normally be in stripes areas or other. |
6 | in partially embedded relation within a wall segment 32 defining an outer wall of a fluid containment unit such as an oil pan or the like in the illustrated arrangement the threaded segment 22 projects outwardly away from an exterior surface 34 of the wall segment 32 to engage the filter 30 the knurled ring segment 12 is disposed at a position below the exterior surface 34 such that the knurled ring segment 12 engages at least a portion of the thickness dimension in the wall segment 32 and is held in clamped relation by the surrounding wall segment as will be appreciated the contoured surface of the knurled ring segment 12 substantially limits rotation of the connection element 10 thereby facilitating a tight threaded relation between the connection element 10 and the filter 30 or other displaceable member accordingly torque applied to the filter 30 does not translate to rotation in the connection element 10 moreover the presence of the connection element 10 within the wall segment 32 may provide enhanced stability to the wall segment 32 by way of example only insert molding may be used to achieve the desired orientation of the connection element 10 within the wall segment 32 to achieve secure engagement such insert molding may be carried out by first forming the connection element 10 and thereafter molding the wall segment 32 around a portion of the knurled ring segment 12 and the collar segment 14 such that a portion of the material forming the. |
1 | fresh pack indicates potatoes which meet conventional standards set by groceries for the grade of potatoes sold as baking potatoes tubers exhibiting sprout peeping wherein tissue swelling is detected and free tissue is evident but no sprouts are measured are suitable for fresh pack tubers having sprouts which on average are greater than 1 mm are generally unacceptable for fresh pack data obtained from evaluation of the potatoes at 125 days after treatment is summarized in table i table i______________________________________ 125 days after treatment suitable for unsuitabletreatment level fresh pack for fresh pack______________________________________control 0 ppm 2 98 control 0 ppm 3 97 cipc 16 6 ppm 52 48 cipc 16 6 ppm 59 41 cipc 16 6 ppm 21 79 benzothiazole 16 6 ppm 5 95 benzothiazole 16 6 ppm 72 28 cipc 16 6 ppmcarvone 16 6 ppm 0 100 carvone 16 6 ppm 57 43 cipc 16 6 ppmcineole 16 6 ppm 7 93 cineole 16 6 ppm 39 61 cipc 16 6 ppmcinnamaldehyde 16 6 ppm 0 100 cinnamaldehyde 16 6 ppm 2 98 cipc 16 6 ppmdihydroxybenzoic 16 6 ppm 2 98 dihydroxybenzoic 16 6 ppm 3 97 cipc 16 6 ppmethylene 16 6 ppm 3 97 ethylene 16 6 ppm 10 90 cipc 16 6 ppmlimonene 16 6 ppm 3 97 limonene 16 6 ppm 0 100 cipc 16 6 ppmjasmone 16 6 ppm 1 99 jasmone 16 6 ppm 17 83 cipc 16 6 ppm______________________________________ as is summarized in table i above at 125 days after treatment on average 43 i e 51 58 21 3 of the tubers treated with cipc alone at a 16 6 ppm residue level exhibited no. |
2 | 10 as shown in trace 18 vehicle brakes are applied at a time t 1 and remain applied until removed at a time t 5 of course those skilled in the art will appreciate that the driver of vehicle 10 in response to driving conditions controls the application and removal of brakes thus the sequence shown in trace 18 depicts only one of numerous possible braking scenarios in addition trace 18 indicates the application and removal of brakes from the driver 39 s perspective those skilled in the art will appreciate that the actual application of braking forces to vehicle 10 may be pulsed or otherwise varied in accordance with automatic braking systems while brakes are applied as indicated in trace 18 as shown in trace 20 lower brake lights 14 16 are continuously activated in accordance with the application of vehicle brakes specifically both of the lower lights 14 16 are activated at time t 1 and remain continuously activated until time t 8 at time t 8 lights 14 16 are deactivated thus whenever vehicle brakes are applied lower lights 14 16 are activated whenever vehicle brakes are not applied lower lights 14 16 are not activated turn indicators notwithstanding traces 22 illustrate the operation of chmsl 12 chmsl 12 operates in a different manner than lower lights 14 16 whenever vehicle brakes are not applied chmsl 12 is deactivated in an identical manner to the lower brake lights 14 16 however when vehicle brakes are initially applied as shown at time t 1 chmsl 12 begins operation in a flashing mode in particular chmsl 12 is activated from time t 1 to a time t 2 deactivated from time t 2 to a time t 3 and so on. |
2 | 6 bolster spring 30 is known in the art and is preferably of the type distributed under the trade name hmx bolster spring kit by hendrickson international truck suspension systems located in woodridge ill but other similarly constructed bolster springs could also be used mounting bracket 32 includes anchor plate 27 which is adapted to be clamped over leaf spring 14 with u bolts 26 end 29 of mounting bracket 34 is adapted to be attached to frame member 16 with bolts 44 as best shown in fig2 mounting brackets 32 34 are adapted such that bolster assembly 28 may be mounted over axle 12 between frame member 16 and leaf spring 14 with separator plates 38 positioned essentially vertically and bolster spring 30 extending toward mounting bracket 18 and upwardly from axle 12 or generally diagonally between mounting bracket 32 and mounting bracket 34 the angle of separator plates 38 with respect to vertical affects the resulting ride and jounce control of the vehicle as the plates approach the vertical the ride becomes smoother but jounce is controlled less and the carrying capacity decreases as the plates deviate from the vertical jounce is controlled more and carrying capacity increases but the ride becomes less smooth in the preferred embodiment for a class 7 chassis plates 38 are positioned between approximately 5 u00b0 and 25 u00b0 from the. |
8 | the plan view of the front side 2 a in this case the vertex of the minimum angle u03c6 0 is given by the center m of curvature assigned to the smallest radius of curvature that occurs in the edge portion in the case where an edge portion includes the smallest radius of curvature at a plurality of locations a minimum angle u03c6 over which the recess 9 at least extends may be assigned to each of the centers m of curvature assigned to said locations the criteria described in fig2 using the example of an outer corner 2 c of the connecting area 2 b may be applied in the same way to any desired edge location or to any desired edge portion of the connecting area 2 b to the region of inner corners 2 d as illustrated by way of example in fig1 to 15 17 18 and 20 fig2 illustrates a plan view of a portion of a baseplate 2 of a power semiconductor module according to an embodiment which includes a connecting area 2 b a fixing location 3 spaced distant from the latter and also a recess 9 arranged between the connecting area 2 b and the fixing location 3 a radius r of curvature and a center m of curvature may be assigned to each edge point of the connecting area 2 b proceeding from said. |
8 | that the relative positions of the terminals 128 136 and 140 have been rotated for clarity between fig6 and 7 while pin and socket type connectors are illustrated in fig6 and 7 understand that other types of connectors such as board edge connectors could also be used to accomplish the same purpose of supporting the daughter circuit board 108 and electrically connecting the daughter circuit board to the backplane 100 within the transceiver chip 106 is one or preferably several transceiver circuits 150 as shown in fig8 the transceiver circuit 150 includes a receiver 152 coupled between the bus line 110 and the backplane connector 104 with the input terminal of the receiver connected to the second terminal 136 of the transceiver chip 106 and with the output terminal of the receiver connected to the first terminal 128 of the transceiver chip also coupled between the bus line 110 and the backplane connector 104 and in parallel with the receiver 152 is an open collector driver 154 with the input terminal of the driver connected to the first terminal 128 of the transceiver chip 106 and with the collector of the driver connected through a diode 156 to the second. |
3 | in journal of the american chemical society 60 1938 pp 309 316 high surface area carriers in particular when they are u03b1 alumina carriers optionally comprising in addition silica alkali metal and or alkaline earth metal components provide improved performance and stability of operation the water absorption of the carrier is typically in the range of from 0 2 to 0 8 g g preferably in the range of from 0 3 to 0 7 g g a higher water absorption may be in favor in view of a more efficient deposition of silver and further elements if any on the carrier by impregnation however at a higher water absorption the carrier or the catalyst made therefrom may have lower crush strength as used herein water absorption is deemed to have been measured in accordance with astm c20 and water absorption is expressed as the weight of the water that can be absorbed into the pores of the carrier relative to the weight of the carrier the carrier is typically a calcined i e sintered carrier preferably in the form of formed bodies the size of which is in general determined by the internal diameter of the elongated tube in which the catalyst particles are included in the catalyst bed in general the skilled person will be able to determine an appropriate size of the formed bodies it is found very convenient to use formed bodies in the form of trapezoidal bodies cylinders saddles spheres doughnuts and the like the catalyst. |
5 | said housing extends the full height of the doorway an opening or slot 17 wherein the interior of said housing 3 is opened to its exterior traverses the full length of said housing 3 a bottom frame 18 with an aperture 19 thereon partially encloses the lower end of said housing 3 while maintaining the continuity of said slot 17 extending through the lower end of said housing 3 projections 20 on the inner or aft side of said housing 3 serve both as structural stiffeners for said housing 3 and as handles for manual operation of said barrier 1 traversing the full length of and circumscribed by said housing 3 is a hollow cylindrical shaped spool 21 said spool 21 is rotatably attached to said member 4 by means of a vertical shaft 22 within the upper end of said spool 21 and projecting through an opening on a horizontal plate 24 within said member 4 a bearing 23 attached to the plate 24 radially secures said shaft 22 thereto a disk cap 38 fastened to the upper end of and larger in diameter than said shaft 22 prevents any downward axial travel of said shaft 22 a vertical attachment means 25 on the lower end of said shaft 22 and within the upper most end of said spool 21 pivotably and rotationally secures said spool 21 to said shaft 22 said means 25 as illustrated comprises. |
5 | are provided with caps 46 to prevent grout from pouring into such voids this method of assembly provides a horizontal and a vertical reinforcement to the structure the number of passageways being used to allow reinforcing rods and grout in any given construction will be determined by the calculations made by structural engineers fig1 to 18 illustrate another embodiment of an insulating core 112 all of the numerals corresponding to similar components in the embodiment described in fig1 to 10 have been raised by 100 referring now to fig1 and 12 the insulating core 112 is shown having a front or outside wall defining the surface 120 while a plane 122 delimits the top wall surface the front wall is identical to the wall defining the wall surface 20 of the insulating core 12 shown in fig3 to 7 a pair of projections 160 and 162 extends at right angles to the rear of the wall the projections 160 and 162 are identical and each defines a male member 136 a and 136 c with portions of the inside wall in plane 118 being defined by the ends of the projections 160 and 162 the face shells 114 and 116 are the same as the face shells 14 and 16 shown fig2 fig1 to 17 show a partially assembled wall made up of blocks 110 as shown in fig1 outside cladding made up of individual face shells 114 are engaged on the male members 136 a 136 b and 136 c of outside wall surface 120 defined by the base likewise face shells 116 engage male members 136 a and. |
5 | panic bar 90 an actuating mechanism 210 consists of an l shaped primary lever 212 having a long leg 214 with a distal end 216 and a short leg 218 with a distal end 220 the legs joining at junction 222 rollers 224 and 226 are attached between side arms 228 230 of the l shaped lever 212 at the distal end 216 of the long leg 214 by pins 232 233 placed in holes 234 236 of the lever with the rollers contacting an underside face 238 of control arm 54 a roller 240 is attached in similar fashion at the junction 222 and contacts an actuator lever 242 primary lever 212 is attached with a vertically oriented pin 244 through holes 246 in the lever near the distal end 220 of the short leg 218 and holes 248 in a primary lever bracket 250 thus allowing for pivotal motion of primary lever 212 primary lever bracket 250 rests on a mounting plate 252 and is attached to the mounting base 52 through holes in the mounting plate another function of primary lever bracket 250 is to support and provide a pivotal bearing means for an end of a dogging pin 254 this bearing means is provided by a tab 256 with hole 258 for the dogging pin 254 the tab 256 also has a projecting member 260 for hooking one end 262 of a dogging pin spring 264 the actuator lever 242 is a right angle 34 l 34 shaped part with two arms 266 268 extending one of which 268 has a convex shape at a distal end. |
1 | for a gal obtained from alexis biochemicals san diego usa tissue samples 2 cm width were sutured to a aluminium gauze using 4 0 prolene sutures purchased from southern syringes ltd this was placed inside a 250 ml glass beaker filled with ice cold pbs kept on ice various ultrasonication regimens high intensity ultrasonication processor 600 watts model 601 progen scientific mexborough south yorkshire were applied to the tissue samples via positioning the tissue sample directly under the probe with the pbs being changed after every treatment on completion the tissue was removed and subjected to remaining decellularisation procedure the pulse regimen was 1 second on 1 second off for 10 mins before changing pbs and repeating indentation apparatus was used to analyse the deformation under load of fresh and decellularised porcine menisci the rig consisted of a shaft with a detachable 3 mm cylindrical rigid flat indenter at one end and the other end connected to a linear variable differential transformer lvdt for monitoring the displacement of the shaft weights were placed under the lvdt and the shaft movement was initiated by a manual release mechanism the lvdt was calibrated using step heights and the calibration factor acquired the lvdt had a resolution of 0 001 inches the speed of the shaft was controlled by an oil filled dashpot samples n 3 were firstly cut using a 6 mm diameter cutter to remove cylindrical shaped plugs a section measuring 3 mm was removed from the centre of the original plugs samples were fixed to the base of the sample holder using double sided sticky tape. |
6 | first pass through the process and the engine is not at a potential stall condition and the injectors are enabled the error signal n_error controller 308 is to terminal c of switch sw 3 thus controller 308 provides the proportional plus integral action of the feedback control system therefore in such condition the output of controller 308 produces the control signal tqe_rpm for the engine torque controller 22 if this is the not the first pass through the process and the engine is not at a potential stall condition and the injectors are disabled but became enabled the error signal n_error controller 310 is to terminal d of switch sw 3 thus controller 310 provides the proportion plus integral action of the feedback control system provides the proportional plus integral action of the feedback control system it is noted that as described above the integrator portion of such controller 310 uses as its initial value when the injectors become enabled the transmission load torque tq_tx thus in such condition the output of controller 310 produces the control signal tqe_rpm for the engine torque controller 22 referring now again to fig2 the flow diagram for the logic 22 fig1 is shown thus at step 202 the error signal n 13 error is calculated as described above in connection with fig1 if n 13 error gt ctl_n_lim_cl step 204 where ctl_n_lim_cl is as noted above in connection with fig3 a calibratible scalar the current engine speed n is well below the allowed engine speed limit in such case the proportional controller 302 fig3 in the logic provides the controller for the feedback control system fig3 and indicated torque tq_int is assigned the current indicated engine torque step 206 thus in. |
8 | of the housing 11 in a manner that the while contact piece portion 34 is permitted to extend convexly outward it is subjected to a slight inward bias this establishes an initial pressure which causes the turned back piece portion 36 to be positioned between the projection 21 and the circuit protective wall portion 50 while being engaged with the projection 21 accordingly initial pressure is applied at 2 places viz the base holding groove 41 and the projection 21 at this time the initial pressure to the contact 13 is fully established the deflection quantity of the contact 13 when plugging and unplugging the connector plug 10 to the socket 24 is reduced whereby the elasticity lowering is maximally suppressed and therefore the initial pressure can be maintained for a long period of time since the part of the contact piece portion 34 which extends out in the external direction is pegged by the projection 21 the bending portion between the contact piece portion 34 and the turned back piece portion 36 is always positioned in the window 12 thus even it is inserted into the socket 24 of small diameter in particular it is such that the plug 10 can be smoothly inserted into the socket 24 after the printed circuit board 27 is fixed on the lower housing 11b the upper housing 11a is fixed in place by screws after upper and lower housings 11a and 11b are secured together the cap 17 inserting the head terminal 18 is screwed on at the tip. |
7 | this would make a subsequent buy out subject to claims by creditors of llc an advantage of the insurance choice is that during the term of the method the individual may borrow money as a function of the cash value of the insurance policy contract without taxation at the time of the borrowing other choices include a rabbi trust 29 via 28 real estate 32 via 31 securities 34 e g stocks bonds etc via 33 or other items of real or personal property 36 via 35 very importantly individual has the absolute right for all of the choices to buy out from plc the entire 95 ownership of plc in llc this is indicated in the drawing by step 38 via 37 for the insurance choice 38 the buy out is at a cost equal to the net book value of llc plus a 5 irrevocable assignment to plc of death benefit of the aforesaid insurance contract policy the 5 fee represents income for plc likewise for the other choices the buy out is at a cost equal to the net book value of the asset plus 5 any choice involving the utilization of a rabbi trust results in the pay out being secondary to claims if any of creditors of the llc the bottom line result of the invention is depicted at 40 linked via 39 to 38 as the creation of a method for the deferral of compensation for an individual with the associated deferral of payment of income tax which depending on circumstances can be extremely beneficial for the taxpayer it will be understood. |
5 | that they are resistant to mildew aging and abrasion so they will therefore maintain the positions of the surrounding stones 32 furthermore the synthetic resins 34 are virtually nonbiodegradable such that the user will not be concerned with repeating the steps of dispensing the synthetic resin 34 in the central core 28 after a period of time additionally the block elements 20 described herein may be produced in a block molding machine not illustrated as is well known preferably the mold not illustrated is loaded with a selected mix of concrete or cement and the mixture is set to form two block elements 20 simultaneously in a u201c siamese u201d pattern once the mixture has formed and cured the block elements 20 may be split along the joined major faces 22 to form two trapezoidal split face block elements 20 likewise the block elements 20 may be formed from suitable plastic materials such as abs or pvc by extrusion or molding decorative aluminum castings suitable for use as block elements 20 may be made by the lost foam casting method as is well known it should further be noted that the positive connection created through the use of the anchoring stones 32 synthetic resin 34 and mesh grid 9 reduces problems commonly found in conventional retaining walls for example. |
7 | between the support plates 120 121 for angular movement about its own axis extending parallel to the shaft 34 the shaft 123 is located remotely from the electrostatic recording head 21 with the shaft 34 interposed therebetween a pair of cams 84 85 are secured to the shaft 123 at its end portions respectively for contact with lower surfaces of the bearings 80 81 respectively an attachment wheel 86 is mounted on one end of the shaft 123 outside of the support plate 121 and has an eccentric pin 87 projecting parallel to the axis of the shaft 123 to the eccentric pin 87 there is pivotably attached an actuator bar 88 coupled to a plunger 90 of a solenoid operated plunger unit 89 the actuator bar 88 is connected at a distal end thereof to a tension spring 91 for normally biasing the actuator bar 88 in a direction away from the solenoid operated plunger unit 89 when a solenoid 92 of the solenoid operated plunger unit 89 is energized the plunger 90 and hence the actuator bar 88 are axially displaced against the biasing force of the tension spring 91 to the right as illustrated in fig6 and 9 then the cams 84 85 are angularly moved into engagement with the bearings 80 81 respectively to displace the latter toward the electrostatic recording head 21 when the solenoid 92 is de energized the plunger 90 and the actuator bar 88 are forced by the tension spring 91 to return to the left fig6 and 9 thereby turning the cams 84 85 out of engagement with the bearings 80 81 which are then allowed to descend by gravity along the slots 82 83 respectively the shaft 34 and hence the roller 22 are now lowered. |
5 | at an appropriate distance from the sea bed via a pair of cables 12 13 one cable extending from each side of a lifting means 14 on the mother vessel 10 and there is provided a further cable 16 from adjacent the bow of the vessel 10 as illustrated in fig2 the wing dredger has a hydrofoil cross section and is rectangular in plan it is constructed as a casing comprising vertical end walls 17 connected by laterally extending wall 18 which provide lower angled faces 19 to provide a downward component of force when acted on by tidal flow providing as stability the upper wall 21 is generally flat referring to fig3 it will seen that the wing dredger 11 is constructed of three units a front unit 11a and mid unit 11b and a rear unit 11c connected together so that the wing dredger can be split into three sections for ease of transportation each of the three units 11a 11b and 11c are of steel skin construction and units 11a and 11c are hollow closed boxes the hollow closed boxes are divided into compartments by suitable bulkheads it will be seen from fig3 that the wing dredger is symmetrical about its lateral axis so that it can be used in either direction with the respective end wall 18 leading the dredger 11 is provided with two closed vertical bores 22 which. |
1 | and a second transition sleeve 4 connector legs 2 are adapted to electrically couple electrodes 15 16 19 and 20 and sensor 17 to an imd in a manner well known to those skilled in the art insulated electrical conductors not shown coupling each electrode 15 16 19 and 20 and sensor 17 to connector legs 2 extend within lead body 11 arrangements of the conductors within lead body 11 include coaxial positioning at least up to the sensor capsule 17 non coaxial positioning and a combination thereof according to one exemplary embodiment lead body 11 is formed in part by a silicone or polyurethane multilumen tube wherein each lumen carries one or more conductors fig6 is a cross sectional view of a coaxial conductive lead body 11 adapted for operative coupling proximal of a sensor capsule taken along the line 6 6 of fig5 b according to the invention in fig6 an inner conductor 50 is spaced from an outer conductor 52 with an insulative material 54 disposed therebetween the exterior of the biocompatible outer insulation 56 of the lead body 11 shields the conductors 50 52 from contact with conductive body fluid one aspect of the instant invention involves failure of the outer insulation. |
7 | the outer edge or through rotation snaps into the cut outs and can thus be moved closer to the cap fig1 shows a cartridge system according to the invention having a cartridge in a connecting system at the upper end all parts of the system are attached to the column or cartridge in the lower part they are for better clarity shown coordinated loosely to the column the cap 3 consists of two parts a threaded part 3 a with passage which is screwed onto the column consisting of sorbent 1 and cladding 2 a distribution element 3 b is placed against the threaded part the spacer ring 4 is connected to the cap 3 via a locking mechanism such as for example a snap in mechanism if it is not required the lock can be released and the spacer ring slid away to the column centre for use without pre column as shown in fig1 the divided supporting screw 5 a 5 b is placed against the spacer ring 4 this is carried out via a shoulder provided in the lower part of the supporting screw for connection of eluent feed and discharge the end piece 6 is screwed onto the supporting screw 5 a 5 b the end piece 6 consists of two parts the connector 6 a and a. |
6 | exchanger 150 referring now to fig1 b illustrated is an end view of the vestibule panel 111 with the burner assembly 140 of fig1 a removed and showing one insert 130 of course it is understood that for maximum efficiency each combustion tube 120 a 120 g would have a similar insert 130 in this view it can be seen that the insert 130 comprises three sides 131 133 and a tab 134 the insert 130 is coupled to and supported by the tab 134 that is coupled to the frame 110 in any conventional manner in one embodiment the tab 134 is captured between the vestibule panel 111 and the corbel plate 112 referring now to fig2 illustrated is a sectional view of the heat exchanger 150 along plane a a of fig1 b with the burner 113 a shown and an inset of the insert 130 a in relation to the combustion tube 120 a and primary combustion zone 231 in this particular view the insert is specifically insert 130 a in this sectional view it can be seen that the tab 134 is captured between the vestibule panel 111 and the corbel plate 112 thereby supporting the insert sides 131 133 side 132 not visible above the inside bottom and below the inside top of the combustion tube 120 a therefore only the tab 134 contacts any part of the frame 110 or. |
7 | ground terminal 412 is less than one half of power supply voltage vdd this increased voltage advantageously decreases standby power of the memory circuit as previously discussed upon a transition to active mode such as a read or write operation address signals ra x0 n and ra y0 for example are applied to the row decode circuits of block 400 the common virtual ground terminal of memory block 400 is quickly discharged to reference voltage vss virtual ground terminals of other unselected memory blocks 402 404 remain at their saturation voltages a product of the discharge current of block 400 and metal resistance induces a brief voltage spike on the power supply reference voltage lines 422 such a voltage spike is often referred to as array noise and may capacitively couple to signal lines such as adjacent bitlines and create a data error the present invention however advantageously minimizes the magnitude of this voltage spike by activating only one of the memory blocks corresponding to a respective predecoded address signal moreover due to the relatively small magnitude of the voltage spike no significant time delay is required before a read operation of a selected memory cell may be performed referring now to fig5 there is a single memory block 500 showing another embodiment of the present invention as with the example of fig4 memory block 500 is preferably one of m memory blocks in a memory array memory block 500 includes n rows of segmented wordlines each segmented wordline includes a global wordline for example global wordline 504 and wordline segments 508 and 512 memory block 500 is selected from. |
2 | of opposing side walls 11 and opposing end walls 13 sometimes referred to as a basket the housing is mounted on springs 12 as shown in fig2 mounted to one of the opposing side walls 11 is a gear set including gears 14 16 and 18 the gears being in meshed relation opposing each of the gears on the opposite wall 11 is a wheel 15 shafts 21 extend through the assembly 10 and interconnect each of the gears with its opposing wheel 15 a motor 19 drives gear 14 e g via a drive belt and shiv arrangement indicated at 23 in a manner well known to the art gear 14 drives gear 16 which drives gear 18 and though connecting shafts 21 similarly drives wheels 15 mounted to each gear of gear sets 14 16 and 18 and opposing wheels 15 are weights 20 which will be more specifically described hereafter the gear wheels and attached weights are mounted on the outer sides of wall 11 as shown and a closed box 22 on the outer side of each wall 11 surrounds the gears or wheels and their weights 20 to provide lubrication of the gears and wheels a pool of low viscosity oil 24 is deposited in the box 22 at a level just below the bottom of the gears and wheels see fig2 a as indicated by the directional arrows the center gear 16 rotate opposite the side gears 18 20 the weights 20 are strategically. |
8 | in any given u201c bit time u201d defined here as that period of time between the rising edge of p n and the falling edge of p n 1 either a n or b n will pulse high depending on the state of d n while all the other ax and bx x u2260 n remain low the and gates 62 and 64 can be straightforward cmos logic implementations or can be more elaborate constructions in reference also to fig1 biasni and biasn 2 are controlled such that the pulses on nets a 0 2 and b 0 2 in fig1 are all the same width the u201c duty cycle control u201d circuit 43 controls biasp such that the duty cycle at p 2 and by extension at p 0 and p 1 is substantially equal to 50 fig2 is a circuit diagram 44 c illustrating one exemplary embodiment of feedback circuit c according to the present invention the loop dominant pole is set by c f 70 other methods of compensation are possible this feedback circuit 39 s stable operating point is when the time averaged currents i 0 i 1 and i 2 are all equal when equal this means that the signal pulse widths on an and bn n 0 1 2 are all equal this is the desired condition by including cascade transistors 72 and 74 connecting to biasnc and biaspc systematic current mirror gain which can result in phase errors in p 0 2 is reduced the voltage on biasnc and biaspc is nominally vdd 2 but other voltages can be used with good results it will be apparent to one skilled in the art after reading the present application that circuits other than. |
9 | u00b1 13 166 7 u00b1 12 231 5 u00b1 57dose mg u00b7 kg sup 1 90 90 90 100 100 80 availability 100 89 2 82 7 87 2 89 2 154 8__________________________________________________________________________ sup a practical auc was calculated using the trapezoidal method the remaining area after the last observation was calculated according to wagner using ctn kel sup 1 area 24h sup b theoretical auc was evaluated on the fitted curve by the equations auc a u03b1 b u03b2 for the intravenous administration auc co ke for the extravascular administration table 5__________________________________________________________________________extent of availability of alclofenac after different routes ofadministration usingintravenous administration as reference __________________________________________________________________________ auc o u2192 4h i v p o acid p o lysine f lys vs acid__________________________________________________________________________practical aucmcg u00b7 min u00b7 l sup 1 u00b1 s e m 55 85 u00b1 2 3 23 69 u00b1 1 5 32 45 u00b1 2 dose mg u00b7 kg sup 1 90 90 90 availability 100 42 4 58 12 lt 0 01__________________________________________________________________________ auc o u2192 2h i v rectal acid rectal lys f lys vs acid__________________________________________________________________________practical aucmcg u00b7 min u00b7 l sup 1 u00b1 s e m 33 15 u00b1 1 30 6 u00b1 1 7 35 23 u00b1 2 6 dose mg u00b7 kg sup 1 90 100 100 availability 100 83 24 95 65 ns__________________________________________________________________________ taking into account also the chemical physical characteristics of alclofenac lysine salt it is be considered to be appropriate for preparations intended for intravenous use its appropriateness for forms to be administered per os. |
2 | guide pin 22 positioned between the vertical plate 11 and the adjusting plate 20 the plate clamping unit includes a back plate 14 fixedly mounted between the upper supporting plate and the lower supporting plate a pair of pressure plates 15 which are symmetrically disposed and a cylinder supporting frame for a cylinder 16 are respectively mounted on both sides of the back plate 14 and guidably fixed via guide bolts 18 the upper part and the lower part of the back plate 14 are respectively provided with four slidable guide bolts 18 the inner ends of the guide bolts 18 are fixed to the pressure plates 15 the outer ends of the guide bolts 18 are fixedly connected to the cylinder supporting frame the piston rod of the cylinder 16 passes through the cylinder supporting frame and can extend to the back plate 14 the two pressure plates 15 respectively correspond to the upper end and the lower end of the back plate 14 the two pressure plates 15 and the upper part and the lower part of the back plate 14 are correspondingly provided with counterbores in which springs 17 are fixedly mounted to enable the pressure plates 15 and the hack plate 14 to form a plate passage between thereof and the guide bolts 18 pass through the springs 17 when the cylinder 16 is inflated the piston rod of the cylinder acts on the back plate 14 and then the pressure plates 15 comes close to the hack plate 14 along the lower supporting plate 3 to clamp a plate referring to fig6 and fig7 the arc curving unit includes guide rollers 9 fixedly mounted between the upper supporting plate and the lower supporting plate the guide rollers 9 provide. |
1 | a drive gear 23 a with a larger diameter than the screw gear and a higher tooth count this drive gear 23 a receives the drive chain 24 that delivers the power from the motor 39 s drive sprocket 25 the hydraulic motor secures to the leg 3 a and the left bottom 6 a as shown the enclosure rests upon the other legs 3 and the base 2 fig8 a provides an alternate embodiment of the driving mechanism where the left mixer connects to its sprocket 20 and the right mixer to its sprocket 21 outwardly of the front panel 17 the two sprockets have the largest diameter as shown the sprockets rotate by the action of the chain 22 or other flexible elongated member in opposite directions the opposite rotation occurs as the chain 22 passes upon a first idler pulley 26 located upon the front panel between two shelves 17 a towards the left side panel 15 above the left sprocket 20 and outwardly from the center of the left sprocket also keeping tension in the chain or other flexible elongated member a second idler pulley 27 has its position upon the front panel beneath the left sprocket 20 inwardly from the center of the left sprocket and the first sprocket the chain continues to a third idler pulley 27 a partially shown in this figure behind drive gear 23 of the conveyor the three idler pulleys have sufficient biasing strength maintaining the chain 22 taut during initial mixing of material. |
9 | it serves as a medium for the buoyancy effect produced on the inverted cups 21 by the circulating gas 29 gas 29 is injected into column 11 from a pair of nozzles 31 located just below a juxtapositioned pair of cups 21 at a point near the lower left of wheel 24 where the cups 21 are achieving their inverted position during their travel along the endless path beginning at the point of discharge from nozzle 31 a quantity of gas 29 is discharged into each passing pair of cups 21 as they assume their inverted position the gas producing a buoyant upward force on cups 21 and driving them upwardly until they reach the top surface 32 of fluid 28 then as the cups rotate to an upright position the gas is spilled into the open space above the surface 32 of fluid 28 where it flows around a baffle plate 33 and upward through a pipe 34 which carries it down into condenser 15 condenser 15 is similar to a truck radiator where the gas flows through finned tubes around which cool air is blown to remove excess heat that was not converted to mechanical energy as it drove the cups upward inside column 11 in one embodiment of the closed cycle system of the invention gas 29 may be but is not limited to hexane c 6 h 14 formed from its liquid hydrocarbon state which. |
3 | and compounded comb copolymers are non newtonian and exhibit shear thinning characteristics as a result melt viscosity data is supplied from a rheometrics mechanical spectrometer 800 using parallel plates at 10 sec 1 and 100 sec 1 for both acrylic comb polymers and compounds the higher shear rate of 100 sec 1 is regarded to be below the operational shear rates typically encountered in high speed hot melt coating the acrylic comb copolymer compounds prepared in accordance with the present invention are easily coated upon suitable flexible backing materials by conventional coating techniques to produce coated sheet materials the adhesive compounds of the present invention can be applied to the flexible backing material as a solution and the solvent subsequently removed to leave a tacky coating on the backing material however the preferred adhesives can be applied from the melt directly to the backing allowing a single step coating operation flexible backing material may be any material conventionally used as tape backing or any other flexible backing flexible backings which can be used for the present adhesive compositions include paper and thermoplastic films of polymers such as polyethylene polypropylene polyvinyl chloride polyesters i e polyethylene terephthalate cellulose acetate and ethyl cellulose backings may also be prepared of silicon release liner cloth fabric metal metalized polymer films or ceramic sheet. |
4 | on the sides of the machine usually as shown in the arrangements in fig1 and 2 a vertical post 42 44 is disposed laterally of either end of a roll or press arrangement at each end of the roll at each side of the papermaking machine thus while the discussion of the preferred embodiment of the quick release post of this invention will only be with regard to one such vertical post it is to be understood that such an arrangement could be in one or more of the posts in a press section framework as shown in fig3 a and 4b the structural vertical posts which include the quick release apparatus in the press framework of this invention include upper and lower post members 54 56 which are aligned vertically in longitudinally extending end abutting array and have opposed load ends 58 60 fig4 b with reference to fig3 and 4b the upper post member 54 has a link 62 pivotally mounted near the center of the post to rotate substantially in a vertical plane about a substantially horizontally disposed pin 64 mounted in the post member walls and which extends across a centered slot 69 in the end of the upper post member extending from one end of the link is an arm 66 on which a counterweight 68 is secured and capable of being adjusted longitudinally along the length of the arm the link 62 extends from the pivot pin 64 in a direction opposite to that of the arm at the distal end of the link is a rod 70 which extends laterally from. |
7 | a leader section l of the filmstrip f projects from a plush lined light trapping slit 11 in a throat 13 of the cartridge c and has a forward end portion whose width is approximately one half of the width of the remainder of the filmstrip the 35 mm camera includes a number of known elements such as a loading chamber 15 for receiving the cartridge c a flash ready lamp 17 for a built in electronic flash now shown a low light warning lamp 19 a viewfinder window 21 a pair of substantially parallel film rails 23 and 25 a film exposure window 27 an objective lens 29 a film take up chamber 31 housing a film take up spool 33 or drum a manually operable latch 35 for securing the back door 3 closed a pressure plate 37 spring supported on the inside of the back door for holding successive frames on the filmstrip f flat on the pair of film rails 23 and 25 during film exposure at the exposure window 27 and a shutter release button 39 manually depressible to initiate film exposure to load the 35 mm camera 1 the film cartridge c is inserted in the loading chamber 15 then an intermediate portion of the film leader l is placed over a metering sprocket 41 to position one or more of the perforations p in the leader in engagement with respective teeth 43 on the sprocket in addition the forward end portion of the leader l is placed over the take up spool 33 to position one or more of the perforations p 39 in the leader in engagement with respective teeth 45 on the spool an initial film. |
2 | of the trash bag is slipped over the top flange 52 of a clip 48 nearest that closure strap the closure straps are then pulled down into elbow 54 of the hook of the clip 48 into which that closure strap was inserted the apparatus is then placed on the ground resting on the flat side 8 of the housing 1 leaves and other debris are raked into the larger open end 2 of the housing 1 when the housing 1 has been filled with debris the housing 1 is tilted by raising the larger open end 2 of the housing above the smaller open end of the housing 4 using the handle 12 gravity causes debris to slide through the channel 6 into the trash bag attached to the smaller end of the housing 4 the operation of filling the housing 1 and emptying it into the trash bag may be repeated until the trash bag is full the closure straps of the trash bag are then slipped off of the clips 14 on the housing 1 and the bag is slipped off of the apparatus and sealed using the trash bag 39 s closure straps the form of housing 1 is designed and constructed such that the housing circumference is smaller moving along the 34 34 u2032 axis in. |
1 | group 147a texture smooth bloom period u2014 typically year round under subtropical and tropical conditions flower arrangement u2014 arranged singly at terminal leaf axils free flowering with 3 to 4 flower buds and or open flowers per terminal apex flowers face upright and slightly outward flower appearance u2014 ruffled flower with a red center transitioning to orange with yellow edges metallic silvery veining is evident in the red to orange zones flowers are open for about two days before closing flowers persistent flower diameter u2014 approximately 16 cm flower depth u2014 when placed on a horizontal plane the flower extends 6 cm above the surface with the ruffled petals extending 1 5 cm above the plane buds just prior to showing color u2014 rate of opening approximately 1 or 2 days depending on temperature shape elliptic length approximately 3 5 cm diameter approximately 2 cm color near yellow green group 146b fragrance u2014 none noted petals u2014 number arrangement corolla consists of 5 overlapping petals shape spatulate with rounded apex size approximately 8 cm long and 8 cm wide margin entire but ruffled texture smooth base descriptor oblique color upper surface the eye or throat is near 53a and transitions outward to a mixture of n25b amp c ending in 6b on the edges the metallic vein color is near n155a lower surface majority of the lower surface is near 6c fading to near 6d at the base of the petal sepals u2014 number arrangement 5 sepals. |
2 | in this illustrated embodiment a plurality of pipings for injecting an aqueous phase 6 as droplets each connected to a distributor 7 connected to a supply of aqueous phase 8 as this may be seen in fig1 a or 1b each piping 6 of the plurality of injection pipings is located around the mineral compound injection piping 2 in a space outside the latter called here a peripheral space 9 each aqueous phase injection piping 6 further comprises a valve 10 located between the distributor 7 and the aqueous phase outlet 11 of each aqueous phase injection piping 6 the exit of an aqueous phase 11 as droplets from each aqueous phase injection piping is practically and advantageously achieved by an aqueous phase outlet orifice in the form of a slot of planar spray by means of a nozzle not shown by means of the valves 10 it is possible to not supply some of the pipings 6 and for example only supply those located immediately downstream from the injection point of the mineral compound relatively to the flow direction g of the flue gases in the flue gas conduit 3 the distributor 7 is connected to a pressurized aqueous phase supply 8 in an alternative of the device a pressurizing means 12 gives the possibility of imparting the intended pressure to the water entering via the water supply 8 the pressure of the aqueous phase supply 8 is typically comprised between 2 and 150 bars in one alternative this pressure will rather be comprised between 2 and 20 bars preferably between 3 and 15 bars and still more preferentially of about 8 bars in another alternative. |
5 | thermal and hydrostatic effects in this closed system of interconnected reservoirs are fully compensated by a piston 62 that can be biased by belleville washers 64 for example or any other device that is comparable those skilled in the art will appreciate the benefit of such compensation on the structure of the device especially when it is deployed at great depths and or high temperature applications fig4 illustrates this execution of a compensation feature fig2 b best illustrates other features of this reservoir system there is a flow restrictor 66 that regulates the flow rate from reservoir 58 into reservoir 56 there is a check valve 68 that permits a bypass of restrictor 66 when the fluid is flowing in the opposite direction from reservoir 56 to reservoir 58 a pressure relief device 70 is in line with the restrictor 66 so that when fluid is urged in a direction from reservoir 58 to reservoir 56 there will have to be a rise in the driving pressure to cause such flow to a predetermined level before any flow begins broadly stated the fluid system is operative to create a delay as the dogs 24 are in the desired location and a force is applied to the mandrel 10 to create a surface signal for such engagement prior to the release of the dogs 24 from the locating groove not shown the system serves to allow a reduction of the applied pulling force before release to reduce the slingshot effect from release when used with the optional pressure relief device 70 the tool can be inverted and can be used to apply a load in a predetermined range on a bha without concern for premature release such as an offshore drilling application where a heave compensator. |
7 | by lowering his eyes the screens 13 14 are positioned in relation to the mirrors 15 16 so that when the user looks straight ahead the upper boundary 17 of this vertical field is practically tangential to the lower edges of these screens and to the upper edges of the mirrors 15 16 see fig3 the devices 6 7 are devices of a type known per se with lenses enabling the projection on the mirrors 11 12 of the images conveyed by the fibers 3 4 when as shown in the drawings the devices 8 and 9 are two channel devices the fibers 3 and 4 are doubled as are the devices 6 and 7 and the mirrors 11 12 the images formed by the devices 6 7 on the mirrors 11 12 are sent on by these mirrors 11 12 to the screens 13 14 thus in looking at the mirrors 15 16 the user 5 may see the images formed on the screens 13 14 naturally the image generator and the projectors are made so as to provide for the perfect superimposition of the images seen by the right eye and the left eye in the zone where the visual fields of these two eyes overlap the mirrors 15 and 16 are semi reflective to enable the user to see the instruments of the instrument panel 18 through them the device 10 in sensing the motions of the user 39 s head sends information to the image generator 1 this information can be used in a manner known per se to. |
5 | lateral surface of the same said lateral surface conically expanding toward the cutting edges the openings of the channels are placed in the area of concave recesses of the lateral surface of the drill bit in such a manner that they are recessed with regard to the periphery of the face of the drill bit application_number US 47800703 A description in the embodiment shown in fig1 to 8 the drill bit 1 on its face has three cutters 2 which are curved with the same radius of curvature and in the same direction with cutting edges 3 which run toward the middle of the face and which meet one another in the middle i e in the axis 4 of the drill bit 1 in the drill bit 1 there is a blind hole 5 which emerges from the end of the drill bit 1 opposite the face surface and which has an inside thread so that the drill bit 1 can be screwed onto an anchor rod which has an external thread as is used for injection drill anchors from the blind hole 5 in the illustrated embodiment three channels 10 emerge which are tilted to the axis 4 of the drill bit 1 at an acute angle for example an angle of 30 u00b0 compare fig6 the channels 10 are aligned in the drill bit 1 such that their mouths 11 discharge on the side surface of the drill bit 1 in the area between two adjacent cutters 2 the discharges 11 of the channels 10 as is shown for example in fig1 to 4 and especially the section from fig6 lie in the area of concavely curved surfaces 12 which are roughly normal to the plane which is defined by the cutting edges 3 therefore essentially. |
2 | kept constant 2 kg of 25 ammonia in water was added the vessel was pressurized with tfe and hfp to 17 bar such that the partial pressure of hfp was 12 5 bar the polymerization was started by adding 1600 g of ammonium persulfate diluted in 5 l deionized water within 10 min the pressure was kept constant by feeding a gaseous mixture of tfe hfp into the reactor the tfe hfp weight ratio was 0 14 after 6 hours the reaction is stopped by interrupting the monomer feed the monomers were vented off the reactor was cooled to room temperature and discharged the solid content of the polymer dispersion was 29 the dispersion was practically free of coagulum the mfi value was 20 g min the hfp content of the copolymer was 13 w the melting point was 255 u00b0 c the copolymer had 660 cooh endgroups per 10 6 carbon atoms mw mn was measured to 1 7 a mw mn value of 1 6 was calculated from the polymerization rate time curve the dispersion was coagulated with a homogenizator and agglomerated with gasoline the agglomerate was washed three times with deionized water and dried for 6 hours at 180 u00b0 c in a tumble drier first by purging with nitrogen and then under vacuum the resulting agglomerate was divided into 2 parts one part was subsequently melt pelletized water treated and dried it had a coffee brown color it was then fluorinated and again water treated to remove residual cof endgroups the discoloration disappeared this sample is called a0 the material had 43 endgroups per million carbon atoms the other part of the agglomerates was first fluorinated melt pelletized and treated with water and dried this sample is. |
9 | the needle tip of the manipulator is repaired as shown in fig1 c the defect correction described above is also effective for tweezers using needles in a pair it is possible to restore the tweezers by applying correction to the respective needles note that a drive system for the tweezers is not specifically designated next an example of a defect repairing method for a tip needle of a manipulator set in a vacuum chamber 1 of an fib device according to the invention will be described an auxiliary needle 6 which can replace a needle portion when a defect occurs in the needle portion during work is created at a corner of a sample surface in advance although the needle 6 has a linear shape for convenience of later work the needle 6 is formed in a slant direction rather than a vertical direction with respect to the sample surface in an example shown in fig2 a the needle 6 is formed by a stacking system according to the cvd with the sample surface as a substrate however in order to grow a shape in the slant direction a method of sequentially shifting a position on which an ion beam is irradiated in one direction is used a slant angle increases as the position shifting speed is lowered a growth direction by the cvd can be set substantially in a directly lateral direction at the maximum but growth in a downward direction is impossible in the invention it is preferable to grow the shape at an angle of about 45 u00b0 in an example shown in fig2 b this growth in the slant direction is realized by a slant of the sample surface rather than. |
4 | organic polymer the following example illustrates the invention in this case specific fluorescent properties in a specific part of the document are used as an example many banknotes are supplied with a number of highly fluorescent fibres which emit different colours of light these fibres are distributed arbitrarily through the document the local fluorescence of various types of fibres at a predetermined location can be coded and digitally stored in the chip optionally in encrypted form at the time the document is produced i e during the paper manufacturing phase or during the document printing phase in the event of verification the area in question is read again using the coordinates and orientation which are stored in the chip and the results are compared with one another followed by rejection or acceptance the said coordinates and orientation will generally differ for each separate banknote with the result that verification is completely unique for the said document since the arbitrary property and coordinates are unique for that document in this way the chip of each separate banknote contains a unique code which as it were represents a fingerprint of a specific part of the banknote in question the code of the intrinsic property may be stored either in encrypted or nonencrypted form as has already been mentioned above the use of the substrate according to the invention is not limited to banknotes for other uses such as passports and identity documents part of a biometric property of the legal owner can be used. |
6 | A description the fig1 to 4 show a measuring device 2 of the system according to a first embodiment of the present invention the measuring device is built by means of a flange 22 into the wall 6 of the operating engine in the present case into the working area 4 of an internal combustion engine the flange 22 comprises a feed line 12 for a gas aerosol mixture which is drawn in from the working area 4 by the pumping action of a convection pump 8 and which is again fed back into the working area 4 by means of a recovery line 20 in the present embodiment the recovery line 20 is arranged close to the feed line 12 and therefore the suction point 12 a and the recovery point 20 a of the gas aerosol mixture are located close to each other the two lines 12 20 u2014 as seen from the suction point and recovery point respectively and starting out from the flange u2014 initially comprise a substantially horizontal section which u2014 after a bent section u2014 leads into the actual convection pump area the latter comprises in the feed line 12 thereof a heating device 42 with a resistive heating element 42 a and a heat exchanger 42 b and in the recovery lines 20 thereof a cooling device 44 with a heat exchanger 44 a in the recovery line and a further heat exchanger 44 b that conducts the heat to the environment by means of the heating device 42 with the resistive heating element 42 a and the heat exchanger 42 b the. |
8 | a1 i a2 i a4 i a5 to the neighbourhood cells and current source i a3 to the same cell such that voltage v y is multiplied by the corresponding matrix a coefficient a k and the input is then taken to the control input of the corresponding voltage controlled current source the coefficients a are called feedback terms and the coefficients b control terms the use of coefficients here refers to the generation of a voltage control to a current source by multiplying the respective common control voltage by the matrix coefficient corresponding to the current source in order to produce the current source specific control voltage when using the positive range high gain model the cell output is limited to a step function in the range 0 1 fig6 shows seven cells 11 12 13 14 15 16 17 of a one dimensional neural network according to the invention and therein a two cell neighbourhood 18 on both sides of the middle cell 14 the neighbourhood cells 12 13 15 16 affect the middle cell 14 in a manner according to matrices a and b and constant i as was described above in conjunction with the description of fig3 in accordance with their functions matrix a is called the feedback term and matrix b the control term the cellular neural network according to the invention operates in mixed mode i e the internal operation of the network is mainly analog but. |
4 | here necessary according to the invention to only insert the roving into its corresponding guide and in particular if there is used the substantially u shaped guide as shown in the drawings then there is only required insertion of the roving from above into the recess forming such related guide continuing in fig5 there has been depicted an exemplary embodiment of holder or holder member 50 which possesses two rod portions or sections 51 and 52 the rod portion 52 carries at its lower end a guide element 55 containing the guides 53 and 54 the shape of which conforms to a certain extent to an eyelet the rod portion 51 is fixedly connected with a hinge or rotatable joint 56 whereas the rod portion 52 is pivotably connected at the hinge or pivot joint 56 this hinge or pivot joint 56 may comprise two oppositely situated pre biased disks 56a between which there is positioned the rod portion 52 by providing appropriate furrows or recesses merely generally indicated by reference character 56b at the faces of the disks 56a which confront one another there can be defined two stable angular positions of the rod portions 51 and 52 with regard to one another one of these positions is constituted by the illustrated extended arrangement of the rod portions 51 and 52 where they are essentially in alignment with one another the other position is depicted by the phantom line showing and specifically wherein the rod portion 51 remains in its original position whereas the other rod portion 52 is angled towards the right of the showing of fig5 into the broken line illustrated. |
7 | 310 are provided on a flexible substrate 410 as exemplary shown in fig7 as shown the flexible substrate 410 has an underwear like shape such that it can be fitted over the lower abdomen of the subject 1 the flexible substrate 410 is one embodiment of the flexible substrate in accordance with the present invention fig8 shows a block diagram of an electrical configuration when the rf coil section 110 is employed both for transmission and reception of rf signals as shown the saddle coils 210 and 310 are connected with a quadrature driving receiving circuit 510 a driving circuit portion in the quadrature driving receiving circuit 510 corresponds to the rf driving section 140 shown in fig1 a receiving circuit portion in the quadrature driving receiving circuit 510 corresponds to part of the data collecting section 150 shown in fig1 in transmitting an rf signal the saddle coils 210 and 310 are quadrature driven by the quadrature driving receiving circuit 510 specifically the saddle coils 210 and 310 are respectively driven by two rf signals having a phase difference of 90 u00b0 the quadrature driving receiving circuit 510 is one embodiment of the driving means in accordance with the present invention it is also one embodiment of the combining means in accordance with the present invention moreover magnetic resonance signals received by the saddle coils 210 and 310. |
8 | dimensions did not change the p contact area extends to the edge of the emitter window forming an external base handle and reducing r sub b 39 both the active base and emitter are then implanted through the same oxide window an arsenic emitter was implanted first at 30 kev and a dose of 3 u00d7 10 15 ions cm 2 after annealing boron was implanted at 60 kev and 1 u00d7 10 13 ions cm 2 the individual transistors were mounted in insulated collector four lead to 18 packages to facilitate tuning out package and bonding pad capacitance for the f t measurements comparative f t measurements for the four geometries of fig1 are shown in fig3 for a diffused run and in fig4 for an ion implanted run the epi layer of the diffused run was 4 u03bc thick and had 0 5 ohm cm resistivity the data of fig3 was taken with zero volts collector base basis at a measurement frequency of 400mhz the results for the diffused emitter q32 suggest the following 1 an optimum has been obtained whereby f t is almost independent of current over the range 20 u03bc a to 1 ma 2 the device capacitance has been reduced by a considerable greater amount than that indicated by the nominal dimensions and mask areas of fig1 the epi layer thickness was 0 8 u03bc and its resistivity for. |
1 | derived as the mean of the second distribution u2212 0 5 coefficient of variation of the second distribution if the peaks of the negative log likelihood of the bimodal fit is less than zero across all time points of the seizure the distribution of phase locked high gamma plhg can be assumed to follow a unimodal gaussian distribution the threshold for recruitment into the seizure core can be calculated at the time point demonstrating the first peak in the negative log likelihood of the unimodal fit that is greater than zero and the threshold can be defined as the mean of the distribution 3 coefficient of variation in the subset of recordings in which the peak of the negative log likelihood is not greater than zero the threshold can be manually determined fig7 shows for the purpose of illustration and not limitation the results of measurements and calculations taken from an epileptogenic brain which received a failed resection surgery fig7 b shows the plhfo time series during a seizure for all the intracranial recording electrodes the electrodes with a corresponding plhfo time series that exceeds the threshold defined using the algorithm described above at 22 8 seconds are colored grey. |
1 | traditional round dog bowl referring to fig1 an exemplary embodiment of the present invention guard device 10 is shown with a conventional round dog feeding bowl 12 the dog feeding bowl 12 is a bowl that has a circular open top of a first internal diameter d 1 the top internal diameter d 1 of the dog feeding bowl 12 is typically between six inches and ten inches if used to feed or water an average dog smaller diameter bowls are for smaller dogs and other smaller pets such as cats many people utilize heavy ceramic or metal bowls to feed or water their pets still other people use old kitchen bowls any such bowl can be used in conjunction with the present invention guard device 10 when a person feeds or give water to their pet they typically fill the feeding bowl at least half full with food or water any food or water that is displaced from the feeding bowl by the pet spills over the edge of the bowl and falls to the floor this dirties the floor thereby requiring that the floor around the dog bowl be cleaned often furthermore food or water often adheres to the hair of the pet on its snout when the pet pauses from feeding or drinking and lifts its head from the feeding bowl it is not uncommon for food or water to drip from the pet 39 s snout and fall to the floor this is particularly prevalent with larger dogs that have. |
2 | by tying by having elasticity or with a closure device for example strap 8 may include closure 9 closure 9 may include any of a velcro u00ae hook and fastener closure a snap closure a tie closure a brace closure a bracket closure a rubber closure and a clasp closure alone or in combination strap 8 may be wrapped around variable sizes and shapes housing extension 7 may be contoured such a contour could complement a shape of a respective support structure a concave contour could be use for a cylindrical support structure in addition as shown in fig2 a a grip and or cushion 11 may be secured on housing extension 7 for gripping and or cushioning against a respective support structure housing extension 7 may also include braces 12 for further complementing a respective support structure braces 12 may be contoured as necessary and desired and may include grips as necessary and desired activation unit 4 activates constant light emission blinking light emission or no light emission independently or in sequence activation unit 4 may include a switch such as a push on activator 4 a or a toggle switch 4 a activation unit 4 is designed to protect against elements as necessary and desired it is possible to include power circuitry in the activation source activation unit 4 may be accompanied by securing element 10 to secure activation unit 4 to a respective support structure such as a handle bar bar or pole securing element 10 may secure to a support structure by tying by having elasticity or with a closure device for example activation unit 4 may be strapped on a user 39 s body or wrist of course there may be the occasion where. |
4 | struts 34 which are spaced apart along the width of the nozzle 30 see fig3 and extend rearwardly beyond the ends of members 31 and 32 struts 34 are unified by a baffle 35 which extends across the entire width of nozzle 30 and serves as a baffle for diffusion of gas being dispensed therefrom note that baffle 35 has a cutaway portion 36 along a central location thereof wall members 22 adjacent nozzle 30 are provided with an adjustment member 24 member 24 is hand actuated by means of jacking and or clamping screws movement of adjustment member 24 inwardly or outwardly will cause a slight deflection of members 31 and 32 that define nozzle throat 37 whereby a predetermined relationship may be established in the nozzle 30 so as to further delineate the type flow pattern of the gas exiting therefrom gas flow from within vessel 20 will not flow directly into the throat 37 of nozzle 30 instead baffle 35 is encountered and the air or other gas flows around baffle 35 between struts 34 as shown by the arrows in fig2 in this fashion the angle of air exiting from nozzle 30 is better controlled insofar as gas impingement on the fabric is concerned it should be pointed out that angular impingement of the gas on the fabric is undesirable to the point that the fabric may be moved away from the treating zone in a direction to the right or left of the longitudinal axis of the nozzle 30 obviously the force of the gas exiting the nozzle 30 will force the fabric directly away from the slot but a lateral or sidewise motion. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.