label
int64 1
9
| text
stringlengths 113
6.79k
|
|---|---|
2 | well as additional items the terms u201c mounted u201d u201c connected u201d and u201c coupled u201d are used broadly and encompass both direct and indirect mounting connecting and coupling further u201c connected u201d and u201c coupled u201d are not restricted to physical or mechanical connections or couplings and can include electrical connections or couplings whether direct or indirect finally as described in subsequent paragraphs the specific mechanical configurations illustrated in the drawings are intended to exemplify embodiments of the invention accordingly other alternative mechanical configurations are possible and fall within the spirit and scope of the present invention fig1 4 show a variety of views of a container 10 coupled to a closure 12 embodying aspects of the invention the closure 12 has many improvements over the prior art specifically european patent no 1 180 343 which will be discussed in detail below first the sealing arrangement 14 between the closure 12 and the container 10 substantially eliminates the wear caused by the prior art further the exterior of the closure has an enlarged grip area 16 with a tapered profiled to allow many different hand sizes to easily grasp and rotate the closure 12 finally the closure 12 is provided with an improved venting system 18 with reference to fig1 3 the container 10 and closure 12 is adapted to maintain pressurize and deliver a pressurized cleaning or treating solution specifically the container 10 is a generally cylindrical body having a top 20 and bottom 22 in most normal operations the top 20 is provided with threads 24 to allow the closure 12 to engage the container 10 the bottom 22 includes a wall or surface having a having a selectively. |
1 | inc of minnetonka minn the system disclosed in the 39 100 reissue patent includes a controller accessing a soil map indicating a soil characteristic for each portion of the field field locations and status maps indicating current crop input level at various locations in a field to be treated are monitored by a control system a crop input map is updated after a dispensing pass to provide a status record typical position locators for the machine in the field may include 34 dead reckoning 34 gps loran systems and the like u s pat no 5 355 815 discloses another closed loop variable rate applicator system the system operates by determining a soil prescription in near real time and dispenses crop inputs to the soil scene as a fraction of the soil prescription the 39 815 patent is also assigned to ag chem equipment company inc still another system is disclosed in u s pat no 5 453 924 issued sep 26 1995 to monson et al entitled mobile control system responsive to land area maps this system expands on earlier known applicator machine control systems by incorporating a network which links a host controller positioned within the operator cab to multiple controllers located at various points on the machine external to the operator cab it shall be understood that the control systems referenced herein describe systems which when properly configured with suitable algorithmic software can be easily adapted to monitor and control the speed and direction of the present inventive conveyor belt drive chain apparatus 100 with continued. |
3 | not only individually but also as mixtures of various emulsifiers which are useful in preparing aqueous emulsions of organopolysiloxanes when emulsifiers are optionally used in emulsions of the present invention they are preferably used in amounts of from 5 to 40 parts by weight and more preferably 5 to 20 parts by weight all based on 100 parts by weight of siloxane copolymers i the siloxane copolymers of the present invention can be varied via the choice of stoichiometry as being water soluble or as being self emulsifying so called self emulsifying systems i e they require no further auxiliaries for emulsification the siloxane copolymers can be used for treating textile fabrics textile fibers and leather as additives in coatings and paints as ingredients in cosmetic formulations and as surface active agents they have more particularly outstanding properties as textile softeners 340 g of a dried random copolymer formed from equimolar amounts of ethylene oxide and propylene oxide and having an oh number of 44 3 m n 2530 an oh number of 56 1 is to be understood as meaning 1 milliequivalent of oh g of polyether i e oh number 44 3 is 0 79 milliequivalent of oh g of polyether are initially charged under a protective gas n 2 and reacted with 38 0 g of chlorosulfonyl isocyanate while cooling the u2014 oh u2014 nco ratio is 1 00 the spontaneous exothermic reaction ends on completing the metered addition of. |
9 | optional blocking layer 12 were each inspected by one or more of the methods described above photoluminescence measurements were used to quantify band edge luminescence hall effect measurements to quantify electron mobility and concentration and x ray diffraction xrd to qualitatively assess the microstructure band edge luminescence and xrd were used to estimate band gap energy and lattice constants photoconductivity spectra measurements from visible to uv via methods understood in the art were used to reveal defect states within band gaps and surface recombinations contacts 9 a and 9 b were provided on first conducting layer 4 and second conducting layer 8 respectively to facilitate ohmic contact between the mentioned layers and leads 11 a and 11 b the surface of both first conducting layer 4 and second conducting layer 8 were etched using reactive ion etching in a chlorine plasma a method known within the art to expose the underlying n type gan layer a conductive metal preferably a double layer gold titanium film was thereafter deposited onto the exposed surface via evaporation also a method understood in the art contacts 9 a and 9 b may be annealed after deposition to improve their contact properties the etch process may include photoresist methods understood in the art for example a photoresist mask may be applied onto selected surface regions of the second conductive layer 8 thereafter a chlorine based plasma is used to etch the unmasked regions of the gan to expose an. |
6 | conventional example 2 in which a pin having a surface layer of chromium carbide was used however as shown in fig2 in oxidized deteriorated oil the elongation of the roller chain of the invention was about u2154 the elongation of the chain of conventional example 2 furthermore as shown in fig4 the elongation properties of the roller chain of the invention are superior to those of conventional examples 1 and 2 in soot containing oil these test results lead to the conclusion that in the roller chain of the invention wear resistance in oxidized deteriorated oil is significantly improved since vanadium carbide has corrosion resistance superior to that of chromium carbide in the deteriorated oil environment furthermore since the roller chain pins having a vanadium carbide layer are harder than those subjected to carburization heat treatment and also harder than those having a chromium carbide layer the wear resistance properties of the roller chain in accordance with the invention are superior in soot containing oil heretofore surface treatment by the formation of a vanadium carbide layer was not recognized to be significantly advantageous as compared with other surface treatments such as carburization heat treatment and the formation of chromium carbide layer however vanadium carbide has proven to be highly superior as a coating material for the pins of a roller chain used under severe conditions such as in oxidized deteriorated oil or in soot containing oil the vanadium. |
7 | necessary which is connected to receive transfer signal tr1 from the appropriate signal source in addition write erase loops 12 and 13 may be connected to suitable generators g1 and g2 respectively generators g1 and g2 may be any suitable generator such as but not limited to loop generators which are known in the art in this arrangement loops 12 and 13 can be used to write information into storage loops 1 l through m l and 1 r through m r via transfer switches 19 and 20 respectively as will be discussed hereinafter this arrangement provides an alternative input system for the memory device transfer replicate switches 17 and 18 are coupled to access loops 10 and 11 respectively access transfer loop 11 includes a suitable generator g1 39 of any suitable configuration such as a loop generator a similar generator g2 39 is associated with access loop 10 while the conductor loops of generators g1 39 and g2 39 are shown connected separately they can be connected in series with each other and arranged to receive a common signal from an appropriate source wherein bubbles can be generated in a known fashion the ends of access loops 10 and 11 are connected to detectors d1 and d2 respectively detectors d1 and d2 shown schematically can be any suitable type of stretcher detector many of which are known in the art detectors d1 and d2 are preferably but not necessarily connected together in a common bridge network not shown wherein the full data output of the memory device is retrieved in the particular system described herein it is important that the arrangements between the respective generators. |
9 | detection means to detect an unloading completion is provided and as the power source is made off an unloading completion signal can be obtained from said detection means so that an unloading is automatically made thus its handling and operation can be made very easily further such arrangement is employed that power supply to circuits related to a loading is maintained even if the power source is made off until said unloading is completed and the power supply is automatically stopped by a completion of an unloading therefore a handling characteristic is further improved and power saving can be made without any particular efforts also in a video system of the present invention a vtr which is combined to a video camera for making a photographing is made of parts containing a recording mode only therefore a camera and a vtr is integrally made thus a reduction in size and weight can be achieved further since a vtr is made to have as small size as possible for having the minimum function needed solely for a recording when the vtr is combined with a video camera a burden on a user at a time of photographing can be reduced to the minimum thus a handling characteristic is further improved and it will be easy to carry the same around further as the camera is removed from the vtr the vtr is automatically changed over to a reproduction mode and it is combined with a reproduction unit so that a function in a reproduction mode can be obtained without delay thus it is a very convenient device as a simple video system also a vtr in. |
7 | is approximately 3 32 inches thick and extends approximately 7 u215b inches from abutment wall 38 inside surface base 32 is approximately 1 u00bd inches wide at distal end 54 and continues at that width until it intersects a 3 inch arc with a center at inside corner of abutment wall 38 on front face 52 parallel to and approximately u00bc inch inboard from front face 52 first stiffening rib 45 runs from inside wall 50 to distal end of linear scale 28 first stiffening rib 45 is approximately u215b inch thick and depends from the top surface of top wall 14 to bottom surface of base 32 first stiffening rib 45 connects perpendicularly to second stiffening rib 46 that runs across distal end 54 of linear scale 28 approximately u00be inch in length stiffening rib 46 connects perpendicularly to third stiffening rib 47 that runs parallel to first stiffening rib 45 and whose outer edge is approximately u00be inch from front face 52 third stiffening rib 47 runs from second stiffening rib 46 back toward abutment wall 38 until it intersects a 3 inch radius centered at the intersection of front face 52 and the inside edge of abutment wall 38 and then angles back to inside wall 50 at a 45 degree outgoing angle an opening through base 32 has a proximal. |
1 | explosions generate mechanical disruptive forces the disruptive forces when applied to the biological target result in a cutting effect on the surface of the target the laser energy 102 is at a wavelength and energy level sufficient to excite micro explosions in water molecules but not at levels sufficient to damage biological tissue in the example system typical values for total laser energy energy emitted by all fibers per laser pulse may range from about 0 05 j to about 2 0 j and the energy may be generated with a wavelength ranging from about 2 75 u03bcm to about 3 00 u03bcm the fluid particles injected into the interaction zone perform a number of purposes some of the fluid particles absorb beams of light explode and impart a mechanical disruptive force to the target remaining portions of the fluid particles reduce the temperature surrounding the explosion so that living cells adjacent the target area will not be exposed to the extreme heat resulting in cell necrosis and death very efficient tissue cutting without adjacent cells necrosis can be achieved using this technology in the example system individual beams are arranged parallel to each other in the same plane creating a linear segment of beams at a target that are sequential fired this reduces the likelihood of a manual sweeping action being used to cut through tissue resulting in an efficient and accurately. |
8 | in the environment of hdtv systems therefore without limiting the applicability of the invention to hdtv systems the invention will be described in such an environment such an hdtv system is described in co pending u s patent applications ser no 60 295 616 entitled packet identification mechanism at the transmitter and the receiver for an enhanced atsc 8 vsb system 60 301 559 entitled proposal for a potential revision of the atsc dtv standard using enhanced coding schemes 60 324 482 entitled key elements for the newly proposed atsc standard 60 280 782 entitled proposal for an improved atsc dtv standard the entire disclosures and content of which are incorporated herein by their reference a preferred implementation of the current invention will support a flexible payload data rate in preferably a 6 mhz channel and with a flexible cnr in one aspect of this invention as shown in fig3 combined robust and standard bit streams x u2032 1 and x u2032 2 are input to enhanced coding block 305 which comprises a first trellis encoder device described in detail with respect to fig4 fig4 illustrates the enhanced coding block 305 which comprises a trellis encoder providing an upper coding scheme to achieve 2 vsb mapping or enhanced 8 vsb encoding with a 16 state rate 1 3 trellis encoder to achieve a rate 1 4 or 1 2 robust stream encoding it should be understood that this encoder may additionally be converted to a 32 state or higher state to provide even greater error correction capability as shown in fig4 the x u2032 1 bit stream is input to the 1 2 input of a first stage multiplexer 410 the contents of two twelve symbol delay registers d 405 comprising historical values of the bit stream are combined with. |
3 | 1 h nmr cdcl 3 u03b4 3 82 3 h s 3 96 3 h s 4 03 3 h s 6 34 1 h s 7 45 7 48 3 h m 7 67 2 h d j 9 3 hz 8 06 2 h d j 15 5 hz 8 33 2 h d j 15 5 hz ir kbr cm u2212 1 3419 1608 ms m z 315 mh a mixture of chalcone 1 7 2 g 23 mmol and iodine 200 mg in dmso 25 ml was refluxed for 2 h and then carefully poured onto crushed ice 200 g the precipitate was filtered and washed with 20 na 2 so 3 purification by flash column chromatography sio 2 hexane etoac 3 1 yielded 6 3 g 87 of flavone 2 and 0 8 g 2 5 of recovered chalcone 1 mp 146 147 u00b0 c lit 164 165 u00b0 c 1 h nmr dmso d 6 u03b4 3 93 3 h s 3 97 3 h s 3 99 3 h s 6 72 1 h s 6 83 1 h s 7 50 3 h m 7 88 2 h d j 8 7 hz ir kbr cm u2212 1 1633 ms m z 313 mh a solution of flavone 2 0 20 g 0 64 mmol in 47 hbr 5 ml and glacial acetic acid 10 ml was refluxed for 2 h and then carefully poured onto crushed ice 200 g the resulting yellow precipitate was filtered and collected. |
4 | to advance from the first sewing station 40 through the folding station 42 and then through the second sewing station 43 the head and foot edge portions 26 and 27 of each are folded at the folding station 42 into overlying relationship so as to form the head and foot skirts 14 and 15 which overlie the next adjacent edge portions 44 and 45 of the main body portion 11 the main body portion 11 as well as the head and foot edge portions 26 and 27 move through a 90 degree angle from a horizontal direction of movement to a vertical direction of movement as indicated by arrow 48 the main body portion 11 then moves through a 180 degree turn as indicated by arrows 49 so as to begin a downward movement in the meantime as the central body portion 11 approaches its u turn the head and foot edge portions 26 and 27 each progress through a 90 degree turn 50 and 51 so as to be turned laterally inwardly toward the main body portion 11 as the main body portion moves downwardly away from the u turn the head and foot edge portions each turn through a second 90 degree turn 53 and 54 so as to begin a downward movement with the main body portion 11 this causes the head and foot edge portions 26 and 27 to become folded in overlying relationship with respect to the main body portion 11 thereby forming the head and foot skirts 14 and 15 after the head and foot skirts 14 and 15 have been formed the main body portion. |
4 | to have a greater degree of air permeability and to have openings or to be provided with nozzles the fan 9 is connected to the side cavities 1 through an air channel 10 that leads from the bottom part 11 into the framework 8 divides up at the bottom of the framework 8 and has two air outlets 17 which each project through the two side parts of the framework 8 the side cavities 1 each have air inlets at the bottom which are connected to the air outlets 17 of the air channel 10 and air outlets at the top which are connected to the air inlets 15 of the air supply device 12 during operation it is thus only the side cavities 1 that are inflated directly with heated air by the fan 9 the air flowing from the side cavities 1 on one hand through the air permeable enclosure 2 into the inflatable body 18 and on the other hand through the top openings into the air supply device 12 from the inflatable body 18 the heated air flows through the air permeable enclosure 4 to the shirt to dry the shirt the air directed into the air supply device 12 is discharged again through the air outlets 16 the quantity of air that flows through the air supply device 12 being influenced by the flow resistance of the air outlets 16 and or other restricting devices within the air supply devices 12 the air flows from the fan 9 virtually without resistance into the side cavities 1 and from there on one hand counter to. |
1 | extending between its proximal end and distal end relative to the amputated limb by providing one of the invented side located u201c proximally located u201d attachment systems such rotation is limited or prevented this is because strap extends from a fixed anchor location on the side of the liner limb to a fixed anchor location on the side of the socket thus connecting those two fixed locations together at substantially a fixed distance apart thereby not allowing the anchor location on the socket to rotate any significant distance away from the anchor location on the liner although one of the invented attachment systems is preferred more than one may possibly be used for example at two positions around the side of the limb socket as described below in the especially preferred embodiment section other benefits of the attachment system include comfort and ease of use the preferred attachment system is simple to use each to reach and requires a minimum of dexterity the externally mounted lock mechanism eliminates the jamming of conventional distal locks often caused by a sock worn over the roll on liner while a ratchet style buckle and strap combination is preferred other releasable attachments and fasteners may be used for example extension members other than a flat strap with detents may be used such as a cord s loop s tab s or other rigid or flexible extension members latch mechanisms other than a. |
2 | the level of the contour of revolution 49 the guide plates 45 46 are connected to the holder 34 1 35 1 through webs 50 51 and bars 52 53 as a sheet 22 is pulled off the sheet supporting surfaces of the holders 34 or 35 by the tongs type gripper system 21 of the turning drum 15 the respective guide surface 47 48 prevents the end of the sheet from entering into the channel 30 or 31 fig3 shows guide plates 54 55 which are each fixed to a bar 56 57 connected to the holders 34 2 35 2 the guide surfaces 47 48 formed with the guide plates 54 55 likewise rise from the interior of the channels 30 31 to the level of the contour of revolution 49 in a variant according to fig4 guide devices each including a pair of interacting guide plates 56 1 56 2 and 57 1 57 2 are provided the guide plates 56 1 56 2 and 57 1 57 2 are fixed to the holders 35 2 34 1 and 34 2 35 1 by respective bars 58 61 if during a format setting the holders 34 1 34. |
7 | of all individual tasks in real time including the files each coder selects to either edit or to view for a particular task the file view edit information is then leveraged to collect the following task pair properties note properties may vary for different software systems within same file within same platform within same operating system number of slsms number of als within same software requirement within same software requirement functional area within same software requirement technical area these properties are all known at the time work begins on each task and can be captured real time as work progresses therefore by monitoring these metrics or others that may better define a specific software system critical potential coordination requirements can be identified in a timely manner these potential coordination requirements can then be evaluated against a baseline set of u201c known parameters u201d to determine if the potential coordination requirement is sufficiently critical to alert the coders of the involved tasks requiring coordination thus the coders are able to resolve the coordination requirement and prevent future rework or errors in the final software system svm machine learning the properties decided upon for each software system are then used to create a baseline u201c region u201d of critical coordination requirements in a machine learning environment this region is a multi dimensioned space that correlates to the task pair properties that define a task pair as requiring or not requiring coordination the system uses a support vector machine svm classification technique an svm is a supervised machine learning classification algorithm given a training set it produces a model that can be used to predict the classification of unknown instances given a set of known parameters of those unknown instances the known parameters are historical task pair properties with known coordination requirements discussed. |
1 | is quickly shut off and cold media from the cryotherapy unit 12 is immediately applied to the target area cold therapy produces vasoconstriction which slows blood circulation reducing inflammation muscle spasm and pain more importantly the prompt hold cold comparison initiates the human body 39 s self organizing potentials and has the muscles and nerves reorganized to a normal condition fig2 a is a schematic diagram illustrating a therapy head 20 and its application to a target area 30 of a human arm the therapy head 20 is connected to the device body 50 through an adjustable arm 40 the adjustable arm 40 includes electrical wires and a conduit for conveying cold media fig2 b is a schematic diagram illustrating an exemplary structure of the therapy head 20 the therapy head 20 includes a parabolic dish 21 which provides heat a number of sensors 22 which fixed on the dish and facing the target area and a number of outlets 23 which provide cold media the sensors 22 are electronically connected to one or processors in the controlling unit 11 in a typical embodiment the parabolic dish 21 has a heat source 24 which locates at its focal point the heat source 24 can be an array of electrical bulbs or leds which provides ir or visible light in a typical embodiment the cold media is contained in a replaceable container installed in the device body 50 the release or dispensation of cold media is electronically controlled by the controlling unit 11 in application the user adjusts the therapy head 20 to the proper position facing. |
7 | and a value of 9 in the current state register in state t9 2 the table entry data host pto is received and retained by the translator the host pto is added to the px portion of the host virtual address and the resulting address is provided to tile storage access element 105 which is instructed to access and return the requested table entry data the translator then transitions to state t10 2 which is a wait state in state t10 2 the translator waits for the table data valid indication from the storage access element 105 the table data valid indication causes the translator to sequence to state t11 2 state t11 2 corresponds to a value to 2 in the pushed state register and a value of 11 in the current state register in state t11 2 the table entry data host pfra is received and retained by the translator the host pfra is concatenated with the bx portion of the host virtual address and the resulting address is provided to the storage access element 105 which is instructed to access and return the requested table entry data the translator then transitions to back to state t2 in state t2 the translator waits for the table data valid indication from the storage access element 105 the table data valid indication causes the translator to sequence to state t3 state t3 corresponds to a value to 3 in the pushed state register and a value of 0. |
4 | ink is deposited on the support step 217 a corresponds to the end of the traditional process in step 209 b the uv curing silk screen printing ink as described above is spread on the frame by exerting with the doctor blade the pressure required to push it across the die in step 211 b the ink is deposited on the support step 213 b includes the occurrence of the curing step into a uv drying unit the uv rays react with the photoinitiators thus generating the complex radicals or cations which in turn react with the liquid binder achieving the three dimensional crosslinking of monomers and oligomers which leads to the fixing of the solid film in step 215 b the compound alters the structure of the paper fibers which become thinner and take a greater compactness thus generating a transparency effect compared to untreated fibers step 217 b corresponds to the end of the non traditional process and thus to the making of the u201c chemical watermark u201d using the fixative with the above described features a final effect of light variable light and shade is obtained which is very similar to that obtained with the traditional watermarking methods the effect of increased transparency is due to a greater compactness of the fibers which become thinner compared to those not treated just like in the traditional watermarking methods obviously such a method has considerably lower costs than the traditional methods of producing watermarks and therefore it makes it advantageous to use the chemical watermark. |
2 | of a base fiber with a strength determining the contour in the headrest 7 hardness regions may be adjusted in the production process by inserts having very different properties the passage of air to the air conditioning part may be achieved by an arrangement of tubes in individual cavities by a separate fan 8 or a plurality of separate fans 8 in the composite structure or the cavity thereof or even by central fans the fans 8 produce an air flow 9 for air conditioning the headrest 7 and or generally the cushion element for producing a cushion element 11 it is provided that fibers 10 are provided with a binding agent u2014 in particular latex u2014 and scattered directly by means of a distribution head into preform receivers and or into dies polyurethane a polyurethane dispersion is considered as an alternative binding agent u2014 instead of latex the cushion cover according to the invention and or the cushion element 11 according to the invention consisting of the fiber composite material 1 with the insert material 2 3 has the advantage that different hardness regions u2014 in particular in the comfort zones u2014 are produced by the fiber inserts 2 3 of variable flexibility and or the insert material 2 3 the base body 1 and or the fiber composite material 1 comprise in this case in particular a base fiber having a strength determining the contour and a binding agent in the cover and or in the insert material 2 3 it is possible for different hardness regions of. |
9 | are placed in hopper 11 and lid 12 closed a grind setting from fine to coarse is selected and timer 15 is set to a desired grinding time a single serve fillable cup 40 is placed in loading cartridge 24 on switch 14 left is pressed and the grinding proceeds should it be desired to stop the grinding for any reason off switch 14 right would be pressed as the grinding proceeds coffee grounds are expelled into chute 25 with distributor 28 dropping the grounds into single serve filter 40 subsequently a full single use fillable cup 40 is removed and ready for use in a single serve brewing machine the present invention also provided methods apparatus and products for modifying certain grinders to fill single serve filter cups referring now to fig5 there is shown a grinder 70 that is very similar to the grinder of fig1 4 except that this grinder 70 includes a discharge bin 29 for collecting ground coffee as it is discharged from the grinder this discharge bin 29 is slideably removeable from grinder 70 and has a lid for access to the ground contents this discharge bin also have a chute opening for receiving ground coffee discharged from the grinder the problem with the discharge bin is that ground coffee must now to transferred to a filter system or to a single serve filter cup interchangeable with this discharge bin 29 is loading cartridge 24 see arrow 55 grinder 70. |
8 | qsn has been normalized to the most significant bit of the bit depth of the digital symbols as a result the effect of a given qp is essentially independent of bit depth a particular qp value has a standard effect on image quality regardless of bit depth the invention is useful for example in encoding and decoding at different bit depths to generate compatible bitstreams having different bit depths and to allow different bit depths for different components of a video signal by compressing each with the same fidelity application_number US 201715625192 A description in a preferred embodiment a quantization parameter qp determines the quantization step size qs in order to achieve qp invariance as bit depth changes it is necessary to normalize qs with respect to the most significant bit of the input data sample bit depth if a given qp maps to a quantization step size qs 8 for 8 bit samples then the resulting quantization step size for n bit samples is note that the implementation of these changes simply requires additional shift operations with respect to the operations on 8 bit data although equations 7 through 11 may be expressed more generally they are expressed with respect to an 8 bit reference because 8 bit bit depths have been common heretofore fig6 shows schematically a generic quantization and dequantization system in accordance with aspects of the present invention the quantization parameter qp is applied to a first mapping function 22 that generates a quantization step size qs n in accordance with predetermined qp to qs mapping relationships and a bit depth n the quantization step size qs n is determined. |
5 | cased wellbore a crossover tool secured to the lower end of the length of tubing a length of wash pipe secured to the lower end of the crossover tool a disc valve assembly secured to the wash pipe and positioned to a lower circulation position in the well bore a disc valve secured in a bore of the assembly in the upper portion of the assembly for shearing off the connection between the wash pipe and the disc valve assembly when the disc valve assembly is in an upper position providing to prevent fluid from flowing into the formation below the disc valve and to prevent production flow to the surface and a to rupture the disc valve at a predetermined time so that the production within the formation is allowed to flow through the assembly bore to the surface application_number US 1643393 A description the apparatus of the present invention referred to as a travelling disc valve is illustrated in the figures by the numeral 10 as best seen in the drawings the entire assembly housing the travelling disc valve assembly during lower circulation is shown in fig1 a through 1g the upper section of the assembly is illustrated in fig1 a through 1d and the lower section of the. |
9 | this specification furthermore the present invention is described with reference to its preferred embodiment alternative embodiments which may be conceived by one of ordinary skill in the art are considered within the scope of the claims set forth below as illustrated in fig1 a computer system of the present invention generally comprises a bus 100 for communicating information a processor 101 coupled to the bus 100 for processing instructions and a main memory 102 coupled to the bus 100 for storing data and instructions for the processor 101 on chip l1 cache memory 103 is shown coupled to the bus 100 for temporarily storing frequently accessed instructions and data for the processor 101 information is retrieved from the main memory 102 for the processor 101 and stored in the l1 cache memory 103 memory controller 104 is also shown coupled to the bus 100 for controlling access to the main memory 102 and the l2 cache memory 106 l2 cache memory 106 is coupled to the bus 100 for holding copies of data stored in the l1 cache memory 103 and also the main memory 102 the computer system also includes a display device 110 such as a cathode ray tube or liquid crystal display coupled to the bus 100 for displaying information to the computer user an alphanumeric input device 112 such as a keyboard including alphanumeric and other keys coupled to the bus 100 for communicating information and command selections to the processor 101 and a cursor control device 115 such as a trackball or stylus is coupled to the bus 100 for cursor movement certain implementations and uses of the computer system of the present invention may not require nor include all of the above components for example in certain implementations a keyboard. |
5 | portion 231 and a stop edge 233 defined between the upper crossed hole portion 232 and the lower flat hole portion 231 further after installation of the bottom screw rod 71 of the finial 7 in the top through hole 25 of the top pivot holder 2 a gap g is left between the finial 7 and the flat top end wall 24 of the top pivot holder 2 allowing free rotation of the top pivot holder 2 relative to the retractable flagpole 1 see fig3 the end block 3 comprises a hanging lug 31 formed integral with the periphery thereof for the fastening of a lower hook member of the flag 8 see fig2 and an axial through hole 32 extending through opposing top and bottom ends thereof the axial through hole 32 comprises a lower crossed hole portion 322 an upper flat hole portion 321 and a stop edge 323 defined between the lower crossed hole portion 322 and the upper flat hole portion 321 the link 4 is coupled between the top pivot holder 2 and the end block 3 comprising a flat top end portion 41 and a flat bottom end portion 42 see fig2 the flat top end portion 41 and flat bottom end portion 42 of the link 4 are disposed on the same plane the flat top end portion 41 of the link 4. |
1 | acoustic link as used in the simrad trawleye system in the latter case the transmitter of the trawl gauge mechanism drives an electroacoustic transducer being directed from the trawl towards the trawler onboard the vessel the sonar transducer used for fish search or a separate transducer assigned to the trawl gauge may be utilized for receiving the signals from the trawl this transducer feeds the received signals to the receiver 5 fig1 if the sonar transducer is used the sonar associated receiver may of course preferably be used for detecting information from the trawl gauge the pulse trains emitted from the trawl may easily be identified acoustically by the sonar loudspeaker and visually on the sonar recorder when a separate transducer for the gauge is used the signal received may still be fed to the sonar or the echo sounder receiver by suitable switching between the corresponding transducers if the echo sounding receiver is used the gauge transducer may be switched to the echo sounder receiver when the pen of the echo recorder is not touching the paper and a loudspeaker output may then be utilized the trawl gauge will then only provide acoustic indications evidently a separate receiver may alternatively be employed for the trawl gauge and including separate displays which may be acoustic or optical or both if the trawl gauge is connected with the simrad trawleye system the use of displays included in the system will be natural fig7 shows. |
7 | 109 is mounted outside enclosure 99 and controls valve 101 through signal line 95 in the event of fire thermostat 109 detects rising temperature and closes valve 101 as a result coolant no longer circulates and therefore cannot carry thermal energy from a fire to heatsink 107 which might overheat components of data storage system 111 if thermostat 113 senses a change in coolant temperature it adjusts valve 101 to compensate for the temperature change those with skill in the art will recognize that a temperature controller for cooling fluid is old in the art and that this portion of the present invention may be implemented with little difficulty by those with skill using well known equipment and techniques it will be apparent to those with skill in the art that there will be many alterations that might be made in the embodiments of the invention described herein without departing from the spirit and scope of the invention fig5 is a schematic representation of internal elements of a computer system according to the present invention comprising a password diverter computer 121 comprises but is not limited to a cpu 131 a main computer bus 127 a keyboard 139 a password diverter 137 a keyboard interpreter 135 a disk controller 133 a local hard disk 141 a disk operating system 125 and a boot rom 129 in the event a snooping routine is planted in the computer system it will typically be designed to read keyboard entries from main computer bus 127 during at least the time frame that a password might be sought by execution of a boot routine and to store the result in memory space typically little used memory space for later retrieval to intercept and divert keyboard entries during at. |
3 | without the presence of a primer they can also be applied to other suitably treated substrates such as cellulosics leather ceramics glass and plastics they can be applied by any conventional method of application such as spray dip roll or brush coating or by electrostatic methods in this latter case high resistivity of the coating composition is an important factor as discussed above the coating composition of this invention are useful as general industrial coatings for example in the appliance industry and provide coatings having excellent solvent and stain resistance resistance to weathering and corrosive conditions forward and reverse impact hardness high gloss etc in the following examples illustrating the invention all parts are by weight unless otherwise indicated epoxy resin having an epoxy equivalent of 875 1000 and a gardner holdt viscosity of a 40 solution in butyl dioxitol at 25 u00b0 c of q u 1800 g is dissolved in a mixture of 600 g of xylene and 600 g of methyl ethyl ketone to 625 g of this solution is added with stirring 86 g of a 40 ptsa solution in isopropanol an exothermic reaction ensues which subsides in 2 min mixing is continued for 6 hr to reach a constant acid number of 6 9 a pigment dispersion is prepared from the following ingredients by sand milling ______________________________________hexamethoxymethylmelamine 463 0 g acrylic rheology control agent at 60 solids composition butyl acrylate styrene hydroxyethyl acrylate acrylic acid 38 50 8 4 solvent composition cellosolve acetate n butanol aliphatic hydro carbon 61 8 31 234 9 g dispersant at 48 solids an isocyanate modified methyl methacrylate 2 ethylhexyl acrylate 63 37 polymer capped with mercaptosuccinic acid described. |
3 | u02dc 3 a suitable process for preparing the pt u2014 ru metal oxide catalyst of the present invention comprises the following steps a impregnating a metal oxide in an aqueous solution containing pt ions and ru ions having an amount so that said mixture oxide is subjected to an incipient wetness impregnation and b heating the resulting impregnated mixture oxide from step a so that substantially only pt and ru ions in said aqueous solution are deposited on said metal oxide preferably the amount of said aqueous solution in step a enables said metal oxide to be impregnated with 0 1 5 0 of pt ions and 0 1 5 0 of ru ions based on the weight of said metal oxide said incipient wetness impregnation comprises measuring the moisture content ml g of said metal oxide prior to said impregnating and preparing a suitable volume of an aqueous solution of pt metal salt and ru metal salt while under mixing said aqueous solution is dripped into said metal oxide in a container which is immediately absorbed by said carrier upon completion of addition of all aqueous solution said metal oxide is still in the form of a powder but with slightly wetted surfaces preferably said heating in step b comprises drying said incipient wetness impregnated metal oxide at 100 150 u00b0 c and calcining said dried metal oxide at 400 1000 u00b0 c preferably at 800 950 u00b0 c another suitable process for preparing the pt u2014 ru metal oxide catalyst of the present invention comprises the following steps a immersing a metal oxide in an aqueous solution containing pt ions and ru ions b adjusting ph value of said aqueous solution so that pt ions and ru ions are adsorbed on surfaces of said metal oxide and. |
8 | peripheral hood footprint 64 and die attach paddle 14 should be carefully considered with the pressure balance of the system to provide for adequate fluid flow past leadframe 12 fig4 shows a cam 70 and linkage structure 72 attached to the hood 18 and vacuum system 20 to open and close the adhesive application apparatus 10 the linkage structure 72 is comprised of an l shaped member 74 linking the hood 18 to the cam 70 and an l shaped member 76 linking the vacuum system 20 to the cam 70 between the cam 70 and the hood 18 the l shaped member 74 is translatably attached to elongate support members 78 and 80 by pins 82 and 84 respectively likewise between the cam 70 and the hood 18 the l shaped member 76 is translatably attached to elongate support members 78 and 80 by pins or bushings 86 and 88 respectively at their proximal ends 92 and 94 the l shaped members 74 and 76 are attached to rollers 96 and 98 respectively in addition the l shaped members 74 and 76 are biased by springs 90 the spring 90 biases the l shaped members 74 and 76 toward each other cam 70 may be driven between two positions as shown by a pneumatic hydraulic or electric linear motor cylinder 93 through a rod and pivot linkage 95 as shown the cam 70 may also be driven by a rotary electric motor or a pneumatic or hydraulic drive system that is capable of varying speeds and or incremental rotation in either such arrangement as the cam 70 rotates depending on the position of the cam 70 relative to the rollers 96 and 98 the hood 18 and the vacuum system plenum 21 are either in a. |
8 | point is within the e c e requirements in case the discharge lamp was operated by means of a dc current with a substantially constant amplitude the amplitude of the dc current was 10 15 and 20 ma and the corresponding colour points are indicated as dc 10 dc 15 and dc 20 respectively in case the discharge lamp was operated with a ac current having an rms value of 10 15 and 20 ma respectively the obtained colour points ac 10 ac 15 and ac 20 are outside the region corresponding to the e c e requirements in fig6 b the luminous flux u03c6 of this discharge lamp for both dc and ac operation is plotted as a function of the rms value of the lamp current it can be seen that the luminous flux obtained by dc operation is substantially higher than the luminous flux obtained by ac operation it can therefore be concluded that dc operation offers substantial advantages over ac operation both in terms of luminous flux as well as in terms of the position of the colour point furthermore dc operation can be realized using relatively simple means and causes no or only a very small amount of electromagnetic interference in fig7 fig7 a is a front elevation of a lighting unit according to the invention fig7 b is a side elevation of the same lighting unit la is a discharge lamp bent in a plane and provided with a gas filling consisting of neon the discharge lamp wall is provided with a luminescent layer lu h is a housing with a rectangular aperture a mirroring reflector r is provided in the housing forming the reflecting surface in this embodiment the rectangular aperture of. |
1 | polymer preferably selected from methacrylic acid copolymers type a and b in one embodiment the second layer comprises from about 10 to about 85 wt of the enteric coating polymer and from about 15 to about 75 wt of the water insoluble polymer the core may comprise a saccharide such as saccharose starch cellulose and a cellulose derivative preferably microcrystalline cellulose an inert pellet core a first layer being an active ingredient layer comprising pramipexole or a pharmaceutically acceptable salt thereof and optionally one or more wet binders and further excipients and a second layer provided on the first layer the second layer being an extended release coating comprising a at least one water insoluble polymer and optionally a pore former the resulting pellet having a ph independent in vitro release characteristic or b a mixture of a ph dependent enteric coating polymer and a ph indenpendently water swelling polymer the resulting pellet having a close to zero order in vitro release characteristic at acidic ph values up to ph 6 8 an accelerated release above ph 6 8 and a more accelerated release above ph 7 3 the inert pellet core may comprise polysaccharides cellulose a cellulose derivative starch and or waxes the inert pellet core further may comprise saccharose and or microcrystalline cellulose preferably microcrystalline cellulose such an extended release pellet. |
1 | preferred silicone source is a cyclopentasiloxane and dimethiconol solution 1 alkenyl or alkyl esters of fatty adds having 10 to 20 carbon atoms like isopropyl palmitate isopropyl isostearate isononyl isonanonoate oleyl myristate isopropyl myristate oleyl stearate and oleyl oleate 3 polyhydric alcohol esters such as ethylene glycol mono and di fatty acid esters diethylene glycol mono and di fatty acid esters polyethylene glycol 200 6000 mono and di fatty acid esters propylene glycol mono and di fatty acid esters polypropylene glycol 2000 monooleate polypropylene glycol 2000 monostearate ethoxylated propylene glycol monostearate glyceryl mono and di fatty acid esters polyglycerol poly fatty esters ethoxylated glyceryl monostearate 1 3 butylene glycol monostearate 1 3 butylene glycol distearate polyoxyethylene polyol fatty acid ester sorbitan fatty acid esters and polyoxyethylene sorbitan fatty acid esters 4 wax esters such as beeswax spermaceti myristyl myristate stearyl stearate and 5 sterol esters of which soya sterol and cholesterol fatty acid esters are examples thereof emulsifiers may be present in the composition for moisturizing skin of the present invention total concentration of the emulsifier may range from about 0 1 to about 40 and preferably from about 1 to about 20 and most preferably from about 1 to about 5 by weight of the composition including all ranges subsumed therein the emulsifier may be selected from the group consisting of anionic nonionic cationic and amphoteric actives particularly preferred nonionic actives are those with a c 10 c 20 fatty alcohol or acid hydrophobe condensed with from about 2 to about 100 moles of ethylene oxide or propylene oxide per mole of hydrophobe c 2 c 10 alkyl phenols condensed. |
6 | 60 for the next engine intake phase intake valve 18 behaves as described above it can be noted that for some engine operating ranges such as engine cold operation it may be necessary to reintroduce to the intake exhaust gas that has not been cooled during the intake phase that follows the exhaust phase of fig1 valves 16 and 18 are therefore open throughout the phase the hot exhaust gas contained in pipe 20 and in intake exhaust distributor 36 is fed into combustion chamber 60 through intake valve 16 and the fresh air circulating in circuit c 2 from fresh air supply pipe 46 is fed into this chamber through intake valve 18 thus at the end of the intake phase a stratified mixture of fresh air and of recirculated exhaust gas is present in the chamber by means of the invention it is possible to do without or at least to simplify the conventional egr circuit furthermore it is no longer necessary to bypass the cooler if warm exhaust gas is to be reintroduced to the intake notably for the cold operating range of the engine furthermore when the engine runs without exhaust gas recirculation and with supply air circulation both in pipe 40 and in pipe 42 valve 54 can be used as a swirl control valve so as to feed into the combustion chamber the fresh air in such a way that it is subjected to a rotating motion or swirl around the vertical general axis of the cylinder moreover the double flow cooler allows to avoid or to limit condensation of the steam present in the exhaust gas when the gas flows through this cooler the heat carrying fluid used for cooling the exhaust gas reaches the part of this cooler concerned. |
8 | for the output sequence of the filter ys t y s t x s t h k 2 h k in equation 2 represents the pulse response of the filter while k corresponds to the filter length the output signal ys t results therefore from the convolution of the input signal xs t with the pulse response h k of the high pass filter 16 in the rise detector 20 the energy ef t of the segment which is present at that moment which is also called the current segment is first calculated from the filtered input data ys t via a scalar product a comparison with the energy ef t 1 of the segment preceding the current segment and with the energy ef t 2 of the next to last preceding segment then supplies the criterion for the energy rise in the discrete time audio signal from one segment to the next the expression for the first criterion or krita thus reads as follows krita e f t gt k 1 u00b7 e f t 2 lt e f t gt k 2 u00b7 e f krita t 2 gt f t gt e min f 3 in accordance with the usual notation u201c v u201d denotes a logical or operation while u201c u201d denotes a logical and operation the last term. |
9 | compositions are orange 3g red 2b and blue 4r disperse dye components are likewise well known to those skilled in the art and are water insoluble nonionic species containing one or more organic chromophore moieties disperse dyes are either provided in paste form in combination with a dispersing agent or in powder form different disperse dyes can be used in combinations to arrive at a precisely defined color choice depending on process conditions such as the use rate of each selected disperse dye component the specific dispersing agent or agents employed and the residence time of the substrate in the dyeing zone examples of suitable disperse dye compositions are disperse red 60 disperse yellow 86 and disperse violet 33 anti stain components for use in the disclosed stain blocker compositions have a component bearing an acidic moiety which associates with polymer amine end groups and protects them from staining by acidic dye stains the general category of chemicals suitable to the process of the instant invention can comprise any chemical that blocks positively charged dye sites stain blockers are available in various forms such as syntans sulfonated novolacs sulfonated aromatic aldehyde condensation products sacs and or reaction products of formaldehyde phenolics substituted phenolics thiophenolics sulfones substituted sulfones polymers or copolymers of olefins branched olefins cyclic olefins. |
8 | support the free end of the inner tube for example in the region of the getter tube between the inner tube and the outer tube with a suitable means for example an appropriately sized holding disk in order not to impair the exchange of discharge medium and consequently the getter effect the holding disk does need to have corresponding openings for example bores slits or the like however the invention will be explained in more detail below with reference to an exemplary embodiment in the figures fig1 a shows a longitudinal sectional illustration of a dielectric barrier discharge lamp according to the invention fig1 b shows a cross sectional illustration of the lamp shown in fig1 a along the section line ab identical or functionally identical elements have been provided with the same reference symbols in the figures fig1 a and 1 b show a very schematized illustration of a longitudinal section and respectively a cross section along the section line ab of an exemplary embodiment of the dielectric barrier discharge lamp 1 according to the invention the elongate discharge vessel of the lamp 1 comprises an outer tube 2 and an inner tube 3 with a coaxial double tube arrangement as a result of which the longitudinal axis l of the discharge vessel is defined the. |
2 | a value determined based on observation or experimentation the summing node 69 determines the difference of the two inputs 64 and 72 and outputs a value 74 indicating the amount of front axle slip error the rear axle slip value 68 is sent to summing node 70 summing node 70 receives a second input 71 that represents a predetermined or target value for allowable slip at the rear axle which like the input 72 is an empirical value the summing node 70 determines the difference between the two inputs 68 and 71 and outputs a value 75 indicating the amount of rear axle slip error the rear axle slip error 75 is sent to a rear axle controller 76 the rear axle controller 76 generates a command signal 77 that includes a target torque value for the rear axle in fig3 the label msoh_ctcs is used to identify the signal 77 the front axle slip error 74 is provided to a front axle controller 78 the front axle controller 78 uses the front axle slip error 74 to determine an amount of torque to apply to the wheels connected to the front axle note that a large in relative terms value for the front axle slip error 74 is indicative. |
2 | the level to which some negative photoresists can become hardened can be in direct relation to the dose of light radiation the photoresist is exposed to this principle can generally be exploited to build micro structural elements of varying complexity as described herein an interface gel dose d i g can be the critical dose of light radiation to start a molecular cross linking process of a negative photoresist d 0 g can be the dose required to fully cross link the photoresist in general for a dose d x g larger than d i g and less than d 0 g a portion of the photoresist monomers may become cross linked and therefore hardened referring to fig2 a b and without wishing to be bound by theory it can be possible to selectably cross link i e harden a thickness t within the total thickness t 0 of a deposited layer of photoresist by controlling the light exposure dose of the unexposed photoresist fig2 b generally shows the relationship between exposure dose and photoresist thickness after development in general the dose can be expressed by d p u00d7 u03b4t where d is the dose in mj cm 2 p is the power density of a lamp in mw cm 2 and u2212 t is the exposure time in seconds in general the structure illustrated in fig1 can be created using one photoresist material and exposing certain areas of the photoresist to a dose d of light for an appropriate time. |
9 | by the signal 21 and previously indicated in fig1 and 2 as 19 is made up of a triac in this way when the signal 21 is high this triac 19 comes into operation and the motor is supplied with full power when the signal 21 is low however the triac 19 is cut off and the motor is supplied with a partial wave as described above it will be clear to a technician how the divider r6 r7 acts as the reference generator illustrated by 24 in fig1 in fact the reference voltage at point 36 provides a threshold for the operation of the dual state control circuit 10 39 if the current absorbed by the motor is lower than a certain value which is best selected barely higher than the no load current of the motor the voltage at point 30 will be higher than the threshold in this way the motor when it is load free is supplied with partial power thus preventing overspeed if the current absorbed by the motor is higher than the aforementioned certain value the voltage at point 30 will be higher than the threshold so that the motor is supplied with full power in this way as soon as the motor is loaded and there is therefore no risk of overspeed the motor is supplied with its normal operating power a further. |
1 | inverted u shape distal leg 14 of anvil 12 is provided with a recess 57 a tag t located within the tag receiving area formed by anvil 12 is so located that the panel p is curved with the end of the panel having opening o being located in recess 57 the other end of panel p is located in a recess 59 slidably mounted in applicator member 16 thus the stem and conical head h projects from the applicator member 16 as shown and is disposed substantially opposite opening o thus as the applicator lever 13 is 34 closed 34 applicator member 16 slides toward leg 14 thereby applying a force to the base of the stem which forces head h through the animal 39 s ear which is located within the confines of anvil 12 so that the head passes through the animal 39 s ear and snap locks see fig3 through opening o in a conventional manner located atop the applicator body 10 is a guide 17 and disposed adjacent thereto is a magazine 18 this magazine 18 is formed by a substantially cylindrical housing 19 and a flat portion 20 there being an opening in the form of a gap 21 between the terminal edge of the housing 19 and flat plate 20 disposed adjacent the rearward edge of plate 20 is a. |
3 | and 1 5 ma cm 2 respectively for each run total pressure was 0 4 pa during tpo with argon and oxygen partial pressures of 0 28 and 0 12 pa respectively sputter cleaning and plasma heating were also carried out prior to pulsed tpo as elucidated in example 1 instead of keeping the oxygen flow constantly on throughout the treatment its flow was periodically pulsed whilst the argon flow was kept constant the duration of this pulsed tpo treatment was 165 minutes then a plasma heat step at 700 u00b0 c was performed immediately after tpo for 75 minutes similarly to tpo plasma heating can be carried out at a total pressure range of of 0 1 to 1 0 pa preferably 0 4 pa workpiece bias voltages during plasma heating may vary from u2212 100 to u2212 1000 v preferably u2212 200 v to minimize surface roughening filament heater current is periodically adjusted to keep a constant current density in the workpiece current density should be set in the range of 0 1 to 4 0 ma cm 2 preferably 1 5 ma cm 2 radiant heaters may be required to achieve treatment temperature if plasma heating is to be performed at. |
5 | alignment with the slot c in the aft end of the hull the drilling slot c has its open end at the periphery of the barge hull and is of such area as to substantially match the size of the derrick floor this assures that any type of usual operation may be carried out through the slot the drive motors 15 which control the movement of the cantilever structure are disposed in a position inwardly of the end of the drilling slot c whereby such motors will not interfere with drilling operations when such operations are being carried out through the drilling slot c it is also preferable to locate the hold down clamps 20 inwardly of the motors to assure that said clamps will be engaged with the inboard end of the cantilever structure when such structure is in its fully extended position as shown in fig4 thus the hold down clamp will assure that there will be no overbalancing of the cantilever structure when it is working in its extended position from the foregoing the advantages and operation of the combination drilling rig heretofore described are obvious when the barge hull is under tow the legs b are of course raised and at this time the cantilever structure d is in its retracted position fig1 if it is desired to drill through the slot which would be determined primarily by whether or not severe weather conditions may. |
3 | so as to provide 0 9 to 1 1 moles of si u2014 h bonds on the compound of formula 2 per mole of the compound of formula 1 a reaction solvent is not always necessary especially when both the reaction substrates 1 and 2 are liquid the reaction can proceed in a solventless system of course a solvent may be used for the reaction to take place suitable solvents include hydrocarbon solvents such as hexane isooctane benzene toluene and xylene and halogenated hydrocarbon solvents such as dichloromethane and dichloroethane a polymerization inhibitor is optionally added during the reaction suitable polymerization inhibitors if used are hindered phenols such as 2 6 di tert butyl 4 methylphenol bht and 1 3 5 tris 3 5 di tert butyl 4 hydroxybenzyl 2 4 6 trimethylbenzene by the process in the first embodiment of the invention described above the silyl ketene acetals of the following general formula 3 are obtainable in formula 3 r 1 r 2 r 3 r 4 r a r b and r c are as defined above in the second embodiment of the invention disilyl ketene acetals are prepared using u03b1 u03b2 unsaturated carboxylic acid esters of the general formula 4 as the starting material in formula 4 each of r 5 r 6 and r 7 is independently hydrogen or a substituted or unsubstituted monovalent hydrocarbon group of 1 to 60 carbon atoms preferably 1 to 20 carbon atoms preferred unsubstituted monovalent hydrocarbon groups are those of 1 to 20 carbon atoms the substituted monovalent hydrocarbon groups correspond to the unsubstituted monovalent hydrocarbon groups in which some or all of the hydrogen atoms bonded to carbon atoms are substituted with substituent groups suitable substituent groups include halogen atoms alkoxy groups of 1 to 20 carbon atoms. |
5 | on the first attachment element via a first bearing element the hinge is characterized in that the articulated lever is arranged in a rotationally fixed manner on the first bearing element application_number US 201615283542 A description a hinge 1 according to the present invention comprises an attachment element which is formed as hinge arm 2 a further attachment element which is formed as housing 3 consisting of a hinge cup 4 and a panel element 5 arranged on the hinge cup 4 and articulated levers 6 7 which form parts of a four bar linkage and connect the hinge arm 2 and the housing 3 in an articulated manner via bearing elements 8 11 fig1 4 on an outer face 12 of the housing 3 in particular of the hinge cup 4 an eccentric member 13 is arranged on the extended bearing element 10 the eccentric member 13 is connected rigidly to the bearing element 10 particularly in a rotationally fixed manner the bearing element 10 is preferably configured as a shaft and is mounted rotatably on the hinge cup 4 moreover the bearing element 10 is connected to the articulated lever 6 in a rotationally fixed manner the bearing element 11 is configured for example as a bolt or shaft and is pinned in a rotationally fixed manner to the hinge cup 4 the articulated lever 7 is mounted rotatably on the bearing element 11 moreover a damping element 14 comprising a. |
9 | 36 leading to condenser 37 where the vapors are condensed to a liquid which is withdrawn through line 41 as the desired product condenser 37 is cooled by cold water entering via line 39 and leaving as warm water via line 40 preheater 28 is connected to line 36 at 38 through line 31 to equilibrate pressure in the preheater 28 and the column section 33 spent cooling water in line 40 distilled mash in line 35 and condensate from 30 are rejected for further treatment and or disposal as waste the details of column section 33 may be seen in fig2 4 column 33 is comprised of a zigzag ribbon channel 10 which is totally enclosed except for entrances and exits at the top 43 and at the bottom 42 at the top 43 there is an exit 18 for vapors leaving channel 10 and an entrance 19 for mash to be fed into channel 10 at bottom 42 there is an entrance 17 for steam to be fed into channel 10 and an exit 20 for mash to leave channel 10 as shown in fig3 and 4 the top manifold 14 is a passageway to accommodate lines 18 and 19 and connect them to channel 10 similarly bottom manifold 15 is a passageway to connect channel 10 to lines 17 and 20 channel 10 between manifolds 14 and 15 is formed by joining a plurality of angle beams having an. |
3 | ml 4 06 mmoles of tbdms triflate at 0 u00b0 c was added the reaction mixture was stirred at room temperature for 30 min the reaction mixture was taken in 20 ml of dichloromethane washed with saturated nahco 3 solution 1 u00d7 20 ml water 2 u00d7 20 ml and brine 1 u00d7 20 ml the non aqueous solvent was finally dried with anhydrous na 2 so 4 and dried in vacuum column chromatographic purification using 60 120 mesh silica gel and 2 ethyl acetate in hexane as eluting solvent mixture of the dried residue afforded a 1 as a white solid 1 01 g 71 yield r f 0 4 in 10 ethyl acetate in hexane 1 h nmr 300 mhz cdcl 3 u03b4 0 19 s 6h si c h 3 2 0 9 s 3h 18 c h 3 1 0 s 9h sic c h 3 3 1 4 1 7 and 1 9 2 55 m 13h cyclopentane and cyclohexane ring protons 2 85 m 2h 6 c h 2 6 52 d j 2 2 hz 1h 4 c h 6 57 dd j1 2 6 hz and j2 8 4 hz 1h 2 c h 7. |
2 | structure is deposited and patterned referring to fig6 j a photoresist layer 69 such as az4620 is coated on the structure and patterned by a conventional photolithography method thus an upper photoresist pattern of comb structure 69 u2032 and metal layer 69 are formed as shown in fig6 j when the first substrate 61 is etched by the icprie process a separation region 73 between the frame 80 and the scanning mirror 66 u2033 is penetrated furthermore the torsion bars 61 u2032 extended from the second substrate 63 are formed so that the structure as shown in fig6 k is completed since an anodic bonding structure and a fabricating method thereof according to the present invention anodic bonds a glass substrate with a dielectric or a dielectric with a metal layer micro electromechanical systems mems structures such as condensers cantilevers sensors and inductors of novel type can be manufactured and eventually applied to a packaging process in a method of manufacturing an upper structure of an optical scanner by using an anodic bonding structure and a fabricating method thereof an optical scanner is stably manufactured and driven as a result the overall performance of the optical scanner can be improved it is noted that the present invention is not limited to the preferred embodiments described above and it is. |
8 | the sleeve 30 where the radially outer margin of the membrane spring 60 contacts and is optionally connected there with material continuity to the sleeve 30 in the example likewise shown in partial section in fig5 compressive forces and pulling forces are likewise applied mechanically a cut out 11 is also made as a blind hole here a ring shaped element 90 is connected to the holding element 1 by a weld connection 100 b with material continuity at the rear side 6 of the holding element 1 and surrounds the outer margin of the rear side opening of the cut out 11 the mechanically acting element is formed as the actuator 20 with two ceramic or metallic sleeve elements 80 and 80 which are e g connected to one another by a weld connection 100 c with material continuity in this example the two sleeve elements 80 and 81 are made almost the same in geometry and dimensioning an internal thread 31 into which the screw 32 is introduced is likewise formed at the sleeve element 81 which is arranged in the interior of the cut out 11 an aperture 39 through which the screw 32 is guided in a clearance fit is present in the outer end wall region of the outer sleeve element 80 in this respect the screw head is supported at the outer end margin of the outer sleeve element 80 two check nuts 33 are fastened to the screw 32 here this fixing can however also be achieved differently with an element rigidly fastened to the screw 32 there both sleeve elements 80 and 81 are connected with material continuity to the ring shaped element 90 if the screw 32 is now rotated and the two sleeve elements 80 and 81 are thereby pressed. |
3 | refrigerated overnight during which time trapped air escapes prior to the assay the meal is removed from the refrigerator and allowed to warm to room temperature mature 170 to 204 g male sprague dawley rats are deprived of food for 24 hours with water ad libitum on the morning of the study each animal is weighed and randomly assigned to treatment groups consisting of ten animals per group each rat receives either vehicle test compound or the reference standard metoclopramide by intraperitoneal injection at 0 5 hours post injection 3 0 ml of test meal is orally administered to each rat with a 5 0 ml disposable syringe five test meal samples are weighed on an analytical balance and these weights are averaged to find a mean test meal weight at 1 5 hours post injection each rat is sacrificed by carbon dioxide asphyxiation and the stomach is removed by opening the abdomen and carefully clamping and cutting the esophagus just below the pyloric sphincter taking care not to lose any of the its contents each stomach is placed on a small pre weighed and correspondingly labeled 7 ml weigh boat and immediately weighed on an analytical balance each stomach is then cut open along the lesser curvature rinsed with tap water gently blotted dry to remove excess moisture and weighed the amount of test meal remaining in the stomach is represented by the difference between the weight of the full stomach and the weight of the stomach empty the difference between the. |
8 | a long term private key d of the correspondent 12 in an elliptic curve cryptosystem ecc with know parameters including a generating point p of order n the correspondent 12 randomly generates a ephemeral private key k and computes a corresponding ephemeral public kp which represents a point with coordinates x y to compute a first component r of the signature the first co ordinate of the ephemeral public key kp is converted into an integer the first component is itself random as it is determined from the random private key k a second component s of the signature is generated by solving the signing equation ks h i dr mod n for the second component s of the signature where h is an appropriate cryptographic hash function such as sha1 the information and signature is assembled as a data stream 26 containing i r s in defined locations and is then transmitted as the signed message 28 through the link 16 upon reception of the signed message 28 at the correspondent 14 the cryptographic processor 20 proceeds to authenticate the signature the authentication normally proceeds as follows initially the ephemeral public key kp is computed by calculating s u2212 1 h i p ra where a is the long term public key of the correspondent 12 after recovery of kp the first co ordinate of kp is converted into an integer following the same procedure as used by the correspondent 12 the integer obtained should correspond to the number r contained in the transmission and if so the signature is accepted if it does not the signature is not verified and so is rejected to inhibit a replay attack a subject f r of the number r is. |
2 | new pump control cycle namely door sensor 40 showing an open door brake sensor 28 showing that the brakes are on and vss 76 at 0 kph if these conditions are met the pump motor 90 is shut off until the door sensor 40 shows that the door is closed while the vehicle is underway a traffic light detector 134 may be used in conjunction with brake 28 amp speed 76 sensors to detect that the vehicle is stopped for a light during which time the pump motor 90 is turned off once the traffic light turns green as signaled to the system controller 12 by the traffic light detector 134 the pump motor 90 is turned back on fig3 is a graphical plot showing how much time a transit bus is stationary during its route by plotting speed mph against time mins fig4 is a comparative chart showing a range of accessory loads 136 in kilowatts kw for two representative vehicle masses and also shows the power consumption rates in kilowatt hours kw h without load shedding control 138 and with load shedding control 140 the preferred embodiment of the electric vehicle power steering pump control system amp method will now be described in detail the disclosed power amp charging control system needs to shed the pump motor 90 load at the appropriate times and durations for efficient vehicle opportunity charging and so needs specific triggers to start and end the pump motor control cycle see fig2 two methods include but are not limited to door control method and traffic light detection table 1 below lists characteristic parameters of the passport transit bus duty cycle data. |
9 | abstract to eliminate interference with radio reception static electricity generated by a vehicle tire during operation can be dissipated by the retrofit attachment of one end of a spring wire to the wheel hub with insertion of the other end through a vent opening in the wheel bearing cap to contact the end face of the wheel mounting spindle to provide a conductive path to the vehicle frame without dismantling of the bearing seal application_number US 37756089 A description in fig1 automotive wheel hub 11 is partially shown in assembly with wheel bearing 12 and axle spindle 13 of a non driven axle washer 17 and nut 15 secure bearing 12 on spindle 13 and cotter pin 16 is disposed in radial keyway 18 of nut 15 with the cotter pin passing through an opening extending diametrically through threaded end portion 19 of spindle 13 the tail end extremities 16 39 of cotter pin 16 are wrapped over a side face of nut 15 to prevent inadvertent removal of cotter pin 16 from spindle 13 gasket 21 together with hub cap 22 are operably placed on the end face of hub 11 with cap screw 23 positioned to be inserted in tapped blind hole 24 in hub 11 to secure hub cap 22 and gasket 21 on hub. |
9 | transfer of heat between the stator body 62 which accommodates the stator coils of the stator 36 and the spindle drum 14 in the region of the stator receptacle 60 the spindle tube 38 is in addition supported on the spindle drum 14 via a rear bearing receptacle 70 wherein a bearing ring 72 engages for example in the rear bearing receptacle 70 and accommodates a rear spindle mounting 74 which mounts the spindle tube 38 at a rear end area 76 so as to be rotatable as illustrated in fig3 to 7 the spindle drum 14 is built up at least in the region of the stator receptacle 60 from a plurality of segments 80 a 80 b and 80 c which are cut out from flat material for example from steel plates and stacked in a stacking direction 82 parallel to the spindle drum axis 16 and are connected to one another in a materially joined manner for example by way of soldering in particular hard soldering to form a coherent body the individual segments 80 preferably have plane parallel surfaces 84 and 86 and extend in stacking planes 88 which are at right angles to the stacking direction 82 as also described for example in the european patent application ep 1 414 615 for the purpose of forming the spindle motor receptacle 30 the segments 80 are provided with receiving cutouts 90 which together form the spindle motor receptacle 30 in the direction. |
6 | rotor 106 and front cover locking pin interface 115 in front cover 110 the locking contour may also be in the sprocket cover 101 locking pin cartridge 105 maintains only a slipping or loose interface with locking pin interface 113 on sprocket cover 101 as during operation and rotation of rotor 106 there is relative movement between sprocket cover 101 and locking pin cartridge 105 locking pin 103 is inserted through the rotor 106 in order to fix the position of the rotor 106 relative to the housing 109 particularly during engine startup when the cam phaser 100 has no oil pressure supply for it to operate leaf springs 108 are inserted into sealing lips 107 which are then inserted into corresponding sealing lip grooves 116 in corresponding vanes 118 of rotor 106 when rotor 106 is assembled into housing 109 sealing lips 107 contact housing inner surface wall 117 of housing 109 preventing pressurized fluid such as engine oil from moving between pressurized chambers formed by space between vanes 118 and corresponding housing protrusions 119 sprocket cover 101 and front side cover 110 are then placed in contact with either side of the assembled rotor 106 and housing 109 and assembly bolts 102 are fixedly assembled through sprocket cover holes 120 in sprocket cover 101 housing holes 121 in housing 109 and side cover holes 122 in front side cover 110 in turn drive screws 112 are inserted through sensor wheel 111 and into drive screw bores 128 in rotor 106 in order to fix the position of the sensor wheel 111 relative to rotor 106 at least during transportation of cam phaser. |
6 | this line from its usual return pressure 17 value to supply pressure 16 the signal of the state line 29 may be used as a criteria to initiate the control transfer sequence from this main servo actuation system to a back up servo actuation system this transfer must be accomplished by elements of the global servo actuation system which are not the subject of this invention the transfer may be 1 partial keeping piston 3 and position transducer 4 as part of the backup servo actuation system i e disconnecting control lines 18 19 from the piston 3 in points 31 32 and connecting those points to the control lines of the back up servo actuation system 2 total where the back up servo actuation system has its own piston and position transducer should this be the case the control transfer should be made between the outlet functions of both pistons the type of transfer made will be greatly dependent upon the reliability of the piston used if the potential of this invention needs to be used to override e g possible piston seizures the use of the type of transfer indicated in point 2 is recommended b system with four way servovalves 1 and 2 fig3 and 4 this type of system is designed for the actuation of a piston subjected to any loading and will be able to detect and self compensate for any single failure in the feedback position control loop or any servovalve the principle of operation of this system is very similar to that of three way servovalves 1 2 in fig1 and 2 and as such the description made in section a is most applicable the description. |
3 | or cn c 1 3 alkyl c 1 3 alkoxy hydroxyl c 1 3 fluoroalkyl or c 1 3 fluoroalkoxy groups r 3 represents a hydrogen atom or a c 1 6 alkyl group optionally substituted with a c 3 7 cycloalkyl group r 4 represents a hydrogen atom or a c 1 6 alkyl group r 5 and r 5 u2032 represent independently of each other a hydrogen or halogen atom a hydroxyl or c 1 3 alkyl group or r 5 and r 5 u2032 form together an oxo or oxime group such as where r 7 represents a hydrogen atom or a c 1 3 alkyl n represents an integer ranging from 0 to 3 and r 6 represents independently of each other when n 2 or 3 a hydrogen or halogen atom a hydroxyl c 1 3 alkyl c 1 3 alkoxy c 1 3 fluoroalkyl or c 1 3 fluoroalkoxy group among the compounds of general formula i a sub group of preferred compounds consists of the compounds for which x represents an oxygen or sulfur atom and or r 1 represents a c 1 5 alkyl group preferably a methyl ethyl 1 methylethyl 1 1 dimethylethyl propyl 1 methylpropyl 2 methylpropyl 1 ethylpropyl optionally substituted with a phenyl a thienyl or r 1 represents a c 3 7 cycloalkyl group preferably a cyclohexyl a thienyl or pyridinyl group the thienyl groups being optionally substituted with one or two c 1 3 alkyl groups preferably a methyl. |
4 | each of the tanks 45 and 47 the wash cylinder 95 in fig5 should be understood to have both of its end open and therefore there are two discharge spaces 112 provided in tank 45 the discharge spaces are in direct flow communication with the interiors of the associated wash cylinders via the open ends of the cylinders the discharge spaces 112 are of course separated from the wash spaces 109 by the seal members 107 connected in communication within the tank 45 is outlet conduit 115 which functions to withdraw liquid from discharge space 112 pipe 117 is connected between the wash space 109 of tank 45 and the discharge space 112 of tank 47 to provide liquid flow therebetween referring to fig4 the outlet conduit 115 associated with the discharge space 112 in the first tank 45 is connected so that liquid drawn from the interior of the first wash cylinder 104 is carried to discharge the outlet conduit 117 connected to the discharge space 112 in the second tank 47 is also connected to the wash space 109 of tank 45 so that liquid drawn from the interior of the second wash cylinder 105 is conveyed into the first tank 45 the operation of the machine in fig4 can now be understood with reference for example to wash cylinder 105 located in tank 47 conduit 111 carries liquid into the wash space 109 of tank 47 simultaneously a pulp mat is carried between the endless belts 83 and 85 into the tank 47 and with the belts passes under the wash cylinder 105 from the wash space 109 in tank 47 liquid flows through the pulp mat into the wash. |
3 | in dichromic acid and circulating distilled water the crystals were then washed in dilute hcl re rinsed in circulating distilled water and air dried in a dust free laminar flow hood prior to cleaning a small hole was drilled 0 020 inch through the plane surfaces of each crystal near the rim to enable suspension by a thin pt wire optically transparent fully dense 8 65 35 plzt was prepared by gravimetric liquid phase sintering and by 34 hot pressing 34 as obtained commercially from honeywell inc the sintered samples were formed as discs 0 350 inch diameter and optically polished the commercial 34 hot pressed 34 samples were formed as discs 0 750 u00d7 0 030 inch and optically polished the discs were drilled and cleaned in the same manner used to drill and clean the linbo 3 discs thermogravimetric apparatus is used in conjunction with the slotted camp crucibles the single phase crystalline members were suspended from a cahn r 100 recording electrobalance by means of a pt wire such that they could be centered within the slotted crucible cavity an outer platinum muffel crucible was utilized to prolong the life of the plzt crucibles proper alignment of the single crystal linbo 3 samples within crucible cavities was complicated by a strong surface charge that caused their attraction to the cavity walls this surface charge was neutralized at room temperature by pre treating the sample and the crucible in gc spectrophotometric quality isopropyl alcohol and air drying in a dust free laminar flow hood although initial heating caused vaporization of the alcohol instant return of the surface charge and re attraction to the cavity walls heating above 600 u00b0 c neutralized the surface charge once again thermally neutralized sample alignment was restored and accurate u00b1 5. |
6 | lower half of the pump the other end of bore 74 terminates at the motor end in a radially extending port 88 that is similar in configuration to port 87 port 88 is in communication with the chambers formed within cylinders 78 when said cylinders and associated pistons are moving in the lower half of the motor a passageway 89 communicates at one end to bore 57 and then passes through spacer housing 14 and its central portion 22 and continues axially through pintle shaft 23 passageway 89 extends through the end of pintle shaft 23 and abuts the end of output shaft 24 externally connected to housing 11 is a combination shuttle and high pressure relief valve such as that described in the patent application entitled 34 combination shuttle and high pressure relief valve 34 being filed concurrently herewith and having the same inventor as the present application such valve structure communicates with both passages 73 and 74 through ports not shown as well as with sump chamber 42 in addition external controls may be provided to hydraulically position race 51 within housing pump 12 in order to regulate the pumping output of the pump the motor has its race 82 permanently positioned in eccentric relation to motor rotor 76 whereby its speed and direction are directly determined by the output of the pump the pump and motor operate in the conventional manner of such hydrostatic systems specifically the housing 11 and associated controls and valving mechanisms are filled with hydraulic fluid input shaft 31 is powered by an extended motor to rotate the. |
1 | on the partitioning device and a radially expandable reinforcing frame 13 is secured to the proximal or pressure side of the frame 13 as shown in fig1 the ribs 14 have distal ends 15 which are secured to the hub 12 and free proximal ends 16 which are configured to curve or flare away from a center line axis radial expansion of the free proximal ends 16 unfurls the membrane 11 secured to the frame 13 so that the membrane presents a pressure receiving surface 17 which defines in part the productive portion of the patient 39 s partitioned heart chamber the peripheral edge 18 of the membrane 11 may be serrated as shown a continuous expansive strand 19 extends around the periphery of the membrane 11 on the pressure side thereof to apply pressure to the pressure side of the flexible material of the membrane to effectively seal the periphery of the membrane against the wall of the ventricular chamber the ends 20 and 21 of the expansive strand 19 are shown extending away from the partitioning device in fig2 and 3 the ends 20 and 21 may be left unattached or may be secured together e g by a suitable adhesive or the membrane 11 itself while not shown in detail the membrane 11 has a proximal layer secured to the proximal faces of the ribs 14 and a distal layer secured to the distal faces of the ribs in a manner described in co pending application ser. |
6 | plurality of flat increments 14a and top section 12 may comprise or include a plurality of flat increments 12a so long as the overall transition duct is a generally flared so as to gradually diverge this insures that the height of outlet 22 is always greater than the height of inlet 20 air inlet 20 is formed by the four edges of top section 12 side section 16 bottom section 14 and side section 18 at one longitudinal side of duct 10 air outlet 22 usually is formed by the four edges of top section 12 side section 16 bottom section 14 and side section 18 at the other longitudinal side of duct 10 the overall height of outlet 22 always is greater than the height of inlet 20 accordingly the height of end sections 16 and 18 at outlet 22 is greater than their height at inlet 20 end sections 16 and 18 are preferably curved outwardly sideways toward outlet 22 such that the overall width of outlet 22 is also usually greater than the width of inlet 20 bottom section 14 is of a greater longitudinal length than top section 12 imaginary planes contacting the edges of inlet 20 and outlet 22 when extended above duct 10 form an angle a of between 1 u00b0 and 60 u00b0. |
5 | 40 thereby biasing the lower sash 14 toward the open position one aspect of the present disclosure is an air and debris dam 200 200 u2032 300 400 shown in fig2 9 the air and debris dam 200 200 u2032 300 400 primarily serves to obstruct airflow through the jamb channel and provide a barrier to inhibit the proliferation of debris in the jamb channel the air and debris dam 200 200 u2032 300 400 is preferably formed from a light weight cellular foam type material that is flexible and or elastically deformable yet resilient in this respect the air and debris dam 200 200 u2032 300 400 can be deformed for installation through the slot 36 in the jamb channel 26 of an assembled window 10 and then return to its original size and shape once positioned in the jamb channel 26 the cellular foam material resists the flow of air and can capture debris 50 as shown in fig6 the air and debris dam 200 200 u2032 300 400 is sized and shaped to fit generally snugly within the jamb channel 26 of the window jamb 16 several exemplary embodiments of an air and debris dam 200 200 u2032 300 400 are shown in fig2 9 referring now to fig4 air and debris dams having various geometries are illustrated a first exemplary air and debris dam 200 includes a base portion 202 having a generally rectangular prism geometry the width w and depth d of the base portion 202 substantially correspond to the width w and depth d of the jamb channel 26 as such when the air and debris dam 200 is installed in. |
4 | vera which can serve as an emollient aloe vera extract is available in the form of a concentrated powder from the rita corporation of woodstock ill further latherants may be incorporated within the lightweight wipe non limiting examples of anionic lathering surfactants useful in the compositions of the present invention are disclosed in mccutcheon 39 s detergents and emulsifiers north american edition 1986 published by allured publishing corporation mccutcheon 39 s functional materials north american edition 1992 and u s pat no 3 929 678 to laughlin et al issued dec 30 1975 all of which are incorporated by reference herein in their entirety a wide variety of anionic lathering surfactants are useful herein non limiting examples of anionic lathering surfactants include those selected from the group consisting of sarcosinates sulfates isethionates taurates phosphates lactylates glutamates and mixtures thereof non limiting examples of nonionic lathering surfactants and amphoteric surfactants for use in the compositions of the present invention are disclosed in mccutcheon 39 s detergents and emulsifiers north american edition 1986 published by allured publishing corporation and mccutcheon 39 s functional materials north american edition 1992 both of which are incorporated by reference herein in their entirety nonionic lathering surfactants useful herein include those selected from the group consisting of alkyl glucosides alkyl polyglucosides polyhydroxy fatty acid amides alkoxylated fatty acid esters lathering sucrose esters amine oxides and mixtures thereof the term u201c amphoteric lathering surfactant u201d as used herein is also intended to encompass zwitterionic surfactants which are well known to formulators skilled in the art as a subset of amphoteric surfactants a wide variety of amphoteric lathering surfactants can be used in the compositions of. |
3 | and an osmotic device osmet int j pharm 1984 21 331 340 7 devereux j e newton j m short m b the influence of density on the gastrointestinal transit of pellets j pharm pharmacol 1990 42 500 501 8 dew m j hughes p j lee m g et al an oral preparation to release drugs in the human colon br j clin pharmacol 1982 14 405 408 9 evans d f pye g bramley r et al measurement of gastrointestinal ph profiles in normal ambulant human subjects gut 1988 29 1035 1041 10 finegold s m sutter v l mathisen g e normal indigenous intestinal flora in hentges d j editor human intestinal flora in health and disease new york academic press 1983 3 13 11 gibson st mcfarlane c hay s et al significance of microflora in proteolysis in colon appl environ microbiol 1989 55 679 683 12 hu z p mawatari s shibata n et al application of a biomagnetic measurement system bms to the evaluation of gastrointestinal transit of intestinal pressure controlled colon delivery capsules pcdcs in human subjects pharm res 2000 7 160 167 13 hu z p mawatari s shimokawa t et al colon delivery efficiencies of intestinal. |
7 | to the separation recovery of signals in this case the architecture is not introducing additional constraints on the network note that h in the forward path of the network may in general represent a matrix in the simplest case or a transfer function of a dynamic model furthermore in the event that m n h may be chosen to be the identity matrix the elements of the procedure and its advantages are now apparent further generalizations of the procedures for developing the architectures can also account for non minimum phase mixing environments these steps are straightforward application of the above procedure and hence will not be elaborated upon an important generalization is to include nonlinearity as part of the architecture u2014 explicitly one model is to include nonlinearity as a static mapping of the measurement variable m t in this event the adaptive network needs to include a compensating nonlinearity at its input stage thus the input must include an u201c inverse type u201d nonlinearity to counter act the measurement prior to further processing this type of mixing environment is encountered in wireless applications that include satellite platforms the dynamic architecture defined in this proper way ensures that a solution to the blind signal separation does exist we now move to the next step of defining the proper adaptive procedure algorithm which would enable the network to converge to one of its possible solutions consequently after convergence the network will retain the variable for signal processing recovery discrete state space representation and specialization to discrete time iir and fir filters the mutual information of a random vector y is a measure of dependence among its components and is defined as follows in the continuous case l ue8a0 y u222b y u2208 y ue89e p 1 ue8a0 y. |
3 | equivalents of mg clo 9 2 are added after 30 min 0 95 equivalents of n chlorosuccinimide are added in 2 h at the end of the addition the resulting mixture is stirred for 1 hour at room temperature then the solid formed is eliminated the clear solution is transferred into a separating funnel after diluting with other 350 ml of ethyl acetate the organic phase is washed with brine h 2 o and dried on na 2 so 4 the solvent is evaporated obtaining 34 g of crude chlorine derivative hplc purity 79 40 u03bb 280 nm which is used in the subsequent reaction without further purification 34 g of crude chloro u03b2 keto ester r are refluxed with hcooh 100 ml ch 3 cooh 120 ml and h 2 o 30 ml after 1 5 h a control by hplc highlights the end of the reaction the mixture is then evaporated under reduced pressure taken up with ethyl acetate and the organic phase is washed with brine saturated nahco 3 h 2 o and dried on na 2 so 4 then the solvent is evaporated under reduced pressure obtaining 21 g of u03b1 chloro ketone hplc purity 60 u03bb 280 nm as an oil that is used tel quel for the next step without further purification 21 g of the oil obtained from the preceding reaction are dissolved in 15 volumes of meoh to this solution 2 0 equivalents of nabh ococh 3 3 are added with a spatula and it is kept under magnetic stirring at room temperature. |
8 | transistor is connected in current mirror fashion to the gate and drain of transistor 46 which has its source connected to the drain of transistor 48 the source of transistor 48 is connected to ground and its gate is connected to node outa at the source of high side driver transistor 30a the gate of switching transistor 44 is also connected to the drain of cascode transistor 50 which has its gate biased to v cc the source of cascode transistor 52 is connected to the drain of transistor 52 which has its source biased to ground and its gate receiving the output of inverter 41 the gate and drain of transistor 46 and thus the drain of transistor 50 and the gate of switching transistor 44 are connected to the collector of p n p mirror transistor 54 which has its emitter biased to a voltage v that is significantly higher than v cc e g on the order of five volts higher the base of mirror transistor 54 is connected in current mirror fashion to the base and collector of p n p mirror transistor 56 that also has its emitter biased to v the collector of transistor 56 is connected via the source drain path of cascode transistor 57 which has its gate biased to v cc to the drain of transistor 58 transistor 58 has its source drain path connected in series with the source drain path of current source transistor 55 between the collector of transistor 56 and ground the gate of transistor 58 is connected to line bts a and the gate of transistor 55 is connected to line bias to conduct the specified current therethrough when transistor 58 is turned on. |
2 | engine the steering system and the brakes of the vehicle that are jointly referred to as the drive system 10 in order to autonomously plan and control a parking maneuver in response to a command by a user the control unit 9 is connected to the detection device 12 via the evaluation unit 11 the detection device 12 should be arranged outside the vehicle body 2 because its interior is essentially field free the detection device 12 is preferably arranged underneath the vehicle body 2 because the electrostatic field is in the case of a static charge of the vehicle body 2 most intense between the vehicle body and the ground 4 the detection device 12 illustrated in the figure includes a generally known double pointer electroscope 13 a double pointer 14 is fixed on a rod 15 that is conductively connected to the vehicle body 2 rotatably namely about an axis extending almost through its center of gravity such that an electrostatic charge of the vehicle body 2 also propagates to the electroscope 13 and the repulsion between the charges of the same sign distributed over the double pointer 14 and the rod 15 deflects the double pointer 14 relative to the rod 15 a contactless sensor preferably an optical sensor 16 is provided for detecting the position of the double pointer 14 instead of using an electroscope 13 it would also be possible to provide a detection device 12 in the form of an electric field meter that is also referred to as a field mill such a field mill. |
6 | air flow passageways 86 defined by the flanges 27 and lips 28 exiting through the holes 38 in the cover 18 the sizing and positioning of the ventilation apertures 16 and the cover holes 38 are such that large pieces of ash and or debris are substantially prevented from leaving the burning chamber 13 while a substantial amount of air flow is maintained through the burning chamber 13 when the refuse has completely burnt and the container 10 has cooled the stakes can be removed from the base assembly 15 and the cylindrical portion 12 and semi circular base portions 50 can be lifted or rolled away from the base plate 74 leaving a pile of burnt refuse on the base plate 74 the base plate handle apertures can then be used to carry the base plate and the pile of burnt refuse to an appropriate refuse container where the burnt refuse can be disposed of fig1 illustrates an alternative embodiment of the container 110 features and components of the container 110 that are the same or similar to features and components of the container 10 have been given like reference numerals increased by one hundred the container 110 is similar to the container 10 however the flanges 127 of the panels 122 extend radially outwardly as opposed to radially inwardly the lips 128 extend circumferentially from the ends of the flanges 127 and are coupled to an adjacent panel 122 the air flow passageways 186 of the container 110 extend. |
4 | line comprising 3 fibering machines 1 2 3 placed in the same row these fibering machines 1 2 3 consist for example of centrifuges rotating at great speed provided at their periphery with a large number of orifices by which the molten material preferably glass escapes in the form of filaments which then are drawn into fibers by a concentric gas stream parallel to the axis of the centrifuge emitted at high temperature and speed by an annular burner optionally other fibering devices well known in the art can be used which all make possible the forming of a core of fibers centered on an axis cores formed by the drawing gases and especially the gases induced in a very large amount the reception of fibers intended to separate the latter from the gases is obtained by a gas permeable endless belt 4 given continuously a hood 5 laterally delimits the collecting zone of the fibers the suction of the gases is obtained by independent boxes 6 under partial vacuum a box 6 is joined here to each fibering machine 1 hood 5 is closed in as airtight a way as possible and for this purpose is provided at the output with a press roller 7 optionally assuring a certain traction on the felt to help extract it from the hood according to the invention a collecting zone zi delimited below by endless belt 4 corresponds to each fibering machine 34 i 34 i 1 2 3 these zones zi are increasing with their index and therefore are all the larger as they are close to the output a reception has been proposed comprising as many. |
4 | pressure in the mixer for transport of the pulp to or to and through alkaline reactor 70 fig4 illustrates yet another embodiment of the invention which provides relatively fine pressure tuning capability for the bleaching system by incorporating gas separator 200 the quantity of gas purged can be more accurately controlled the prior art system of fig1 has gas separation in the ozone pulp contactor 40 as a consequence of its operating characteristics and substantially all of the residual gas is removed the embodiment of fig3 takes advantage of the gas separation which tends to occur naturally in a gas liquid system this allows a portion of the gas pressure to be purged as already described but such purging is limited so that a desirable quantity of gas carries forward with the pulp to the subsequent bleaching stage in most cases even though fig1 4 show either upflow or downflow through the vessels flow may be in either direction according to conduit arrangements which are determined by desired operating conditions clearly downflow of the pulp is aided by gravity while upflow requires a driving pressure to overcome gravity accordingly the pressure regulation of the present invention provides a degree of versatility which is not normally available without the use of pumps it is also clear that due to the thermal balance in the system it may be desirable to have an additional mixer to heat the pulp usually using steam in the scheme of fig4 a pressure reduction device 190 is interposed between ozone pulp contactor 140 and gas separator 200 the pulp from the gas separator flows into mixer 160 in which the temperature is increased by heating and alkaline chemicals are blended with the. |
4 | an air blowing assembly 10 consisting of a housing enclosing an internal fan or blower see fig3 a rechargeable battery 40 a battery charging power supply see fig3 an ozone generator see fig3 the various switches needed for controlling the system 60 70 80 90 and ports 20 30 for the electrical power required by the system and a separate attachment consisting of a manifold 110 with attached hoses 120 and attached to the distal end of the hoses 120 ultraviolet light emitting diodes uv led for anti bacterial effect 135 and spring activated clamping clips 130 the housing may be constructed of metal or plastic or other appropriate material referring to fig3 the housing includes an air intake opening 50 which may include a screening or filtering device intended to keep out debris such as vegetation pollen sand and insects connected internally to the air intake opening is a plenum 90 that directs the flow of air across and through heat sinks 170 that are associated with the battery 40 and power supply battery charging system 180 through the anti bacterial ozone generator 160 through the fan 150 or blower and out of the housing through a port 100 which has normally attached to it a manifold see fig1 separating the airflow into five flexible conduit hoses see fig1 still referring to fig3 the invention may be operated with the anti bacterial ozone generation unit 160 either on or off the invention includes a rechargeable battery 40 capable of powering the blower 150 the ozone generator 160 and the uv led 39 s see fig1 the invention further includes an preferably. |
1 | a defined amount of oxygen in its headspace and product portion whereby products packaged in the same are stable in the absence of oxygen scavengers application_number US 18761408 A description the only limitation with respect to the flexible material used to make the packaged product of the present invention is that the material employed is suitable for use with consumable products and able to yield a headspace permeation rate f and a product portion permeation rate f whereby f f does not exceed 0 03 and preferably is between from about 0 01 to about 0 02 illustrative and non limiting examples of the type of flexible material suitable for use in this invention include those comprising polypropylene nylon ethylvinyl alcohol polyethylene polyethylene terephthalate polycarbonate and polyvinylchloride as well as blends and co polymers thereof the flexible material suitable for use may also be a combination of polymeric films including a combination of polymeric films that have as a film layer and preferably a middle film layer a metal foil such as one comprising aluminum such materials may be purchased from suppliers like united states plastic corp valeron strength films plastic film corporation and curwood inc in a preferred embodiment the material comprises polypropylene metal foil and polyethylene terephthalate in yet another preferred embodiment the flexible material and product are substantially free of radical scavengers i e less than 0 2 by weight based on total weight of the flexible material and less than 0 2 by weight based on total weight of the product and preferably free of radical scavengers when preparing or assembling the packaged product of the present invention the flexible material may be heat sealed and or sealed with food grade adhesives like retortable adhesives a product filling device which may. |
2 | 35 is located at a downstream end 46 of each of the holes 36 with the holes extending with the parallel upper and lower edges to an upstream end 47 just beyond the mouth of the duct 13 thus the material flowing onto the accelerator plate 35 and its nose 42 is halted at that location thus causing the material to flow outwardly through the holes 36 a and 36 b as the material begins to flow outwardly it is engaged by the surfaces 40 and 41 as best shown in fig3 the surfaces are symmetrical so that only one of the surfaces will be described thus the surface 40 includes an end 40 a commencing at the trailing edge 39 b and from that end 40 a it is flat extending to approximately a mid point 40 c from that mid point it is curved rearwardly toward a rearward most point 40 b from that point 40 b the surface 40 curves forwardly to a point 40 d after which it reaches the plane p 1 thus it will be noted that each of a series of lines 40 d 40 e 40 f are angularly retarded relative to points p 3 p 4 p 5 lying in the plane p 2 it will be appreciated that all of these points or lines are purely imaginary and are used merely for explanation of the shape of the surface thus the point p 3 lies at a common radial distance from the center 19 a with the point 40 d with each of. |
8 | image s are then supplied to the display driver device 24 that renders an output image on the display apparatus like lcd panel the display control device 22 has a codec device 220 that automatically compresses raw image s or other reference image s into the buffer apparatus 26 also the codec device 220 provides decompressed data to be used by one or more manipulating device s of the display control device 22 fig3 b illustrates a more detailed diagram of the display control device 22 that has a control unit 22 a de interlacer 224 a scaler 226 a memory interface 227 a codec device 220 and an on chip buffer 228 the de interlacer 224 and the scaler 226 are two manipulating devices for adapting the raw image s to be suitable as being displayed on the display apparatus 28 functions of the control unit 222 includes controlling the timings of outputting images to the display driver chip 24 generating control signals for operating the display control chip the memory interface 227 is used for writing data into the buffer apparatus 26 and reading data from the buffer apparatus 26 it is to be noted that fig3 b is used for illustration not to limit the actual design of the display control device 22 for example the scaler 226 de interlacer 224 the control unit 224 and the codec device 220 can be implemented as hardware logic or firmware architecture which processing logic is written as codes to be processed by a processing unit fig4 illustrates an example of a display processing apparatus for the first exemplary implementation the display. |
3 | microorganisms and cell cultures maschroder weg 1b w3300 braunschweig under the designation dsm 8345 table 1__________________________________________________________________________ seq id nos 24 25 and 41 __________________________________________________________________________cagcgagtcgactacgtacagctggtggagcttgggggaggctttgtgcagcctggaggg60gtcgctcagctgatgcatgtcgaccacctcgaaccccctccgaaacacgtcggacctcccqrvdyvqlvelgggfvqpggtcccggaaactctcctgtgcagcctctggattcactttcagtagctttggaatgcactgg120agggcctttgagaggacacgtcggagacctaagtgaaagtcatcgaaaccttacgtgaccsrklscaasgftfssfgmhwcttcgtcaggctccagagaaggggctggagtgggtcgcatatattagtagtggcagtagt180caagcagtccgaggtctcttccccgacctcacccagcgtatataatcatcaccgtcatcavrqapekglewvayissgssactatctactatgcagacacagtgaagggccgattcaccatctccagagacaatcccaag240tgatagatgatacgtctgtgtcacttcccggctaagtggtagaggtctctgttagggttctiyyadtvkgrftisrdnpkaacaccctgttcctgcagatgaccagtctaaggtctgaggacacggccatgtattactgt300ttgtgggacaaggacgtctactggtcagattccagactcctgtgccggtacataatgacantlflqmtslrsedtamyycgcaagagattacggggcttattggggccaagggaccctggtcacgtctcctcaggtgga360cttctctaatgccccgaataaccccggttccctgggaccagtggcagaggagtccacctardygaywgqgtlvtvssggggcggttcaggcggaggtggctctggcggtggcggatcccaaattgttctcacccagtct420ccgccaagtccgcctccaccgagaccgccaccgcctagggtttaacaagagtgggtcagaggsggggsggggsqivltqsccagcaatcatgtctgcatctccaggggagaaagtcaccatgacctgcagtgccagttca480ggtcgttagtacagacgtagaggtcccctctttcagtggtactggacgtcacggtcaagtpaimsaspgekvtmtcsassagtgtaaggtacatgaactggttccaacagaagtcaggcacctcccccaagcgctggaca540tcacattccatgtacttgaccaaggttgtcttcagtccgtggagggggttcgcgacctgtsvrymnwfqqksgtspkrwttatgacacatccaaactgtcttctggagtccctgctcgcttcagtggcagtgggtctggg600atactgtgtaggtttgacagaagacctcagggacgagcgaagtcaccgtcacccagacccydtsklssgvparfsgsgsgacctcttactctctcacaatcagcagcatggaggctgaagatgctgccacttattactgc660tggagaatgagagagtgttagtcgtcgtacctccgacttctacgacggtcaataatgacgtstsltissmeaedaatyyccagcagtggagtagtaatccactcactttcggtgctgggaccaagcttgaactgaaacgg720gtcgtcacctcatcattcggtgagtgaaagccacgaccctggttcgaacttgactttgccqqwssnpltfgagtklelkrtgataatctagaaccgag738actattagatcttggcgc wherein the amino acid sequence is str8 str9 str10 str11 str12 str13 str14 str15 str16 str17 str18 str19 str20 str21 str22 __________________________________________________________________________ table 2__________________________________________________________________________ seq id nos 26 27 28 and 42 __________________________________________________________________________gcaagagattacggggcttattggggccaagggaccctggtcaccgtctcctcatgataa360 str23 str24 str25 acgcttaagataaagttcctctgtcagtattactttatggataacggatgccgtcggcga str26 ggattgttattactcgctgcccaaccagccatggcccaaattgttctcacccagtctcca480cctaacaataatgagcgacgggttggtcggtaccgggtttaacaagagtgggtcagaggt str27 wherein the amino acid sequence is str28 str29 str30 __________________________________________________________________________ table 3__________________________________________________________________________ seq id nos 29 30 31 and 43 __________________________________________________________________________ str31 str32 str33 str34 str35 str36 str37 str38 str39 str40 str41 str42 str43 str44 wherein the amino acid sequence is str45 str46 str47 str48 str49 str50 str51 ser str52 str53 str54 str55 str56 str57 str58 str59 str60 __________________________________________________________________________ table 4__________________________________________________________________________ seq id nos 32 33 34 and 44 acagtcgacgatatcgttctcacccagtctccagcaatcatgtctgcatctccaggggag60tgtcagctgctatagcaagagtgggtcagaggtcgttagtacagacgtagaggtcccctcivltqspaimsaspgeaaagtcaccatgacctgcagtgccagttcaagtgtaaggtacatgaactggttccaacag120tttcagtggtactggacgtcacggtcaagttcacattccatgtacttgaccaaggttgtckvtmtcsasssvrymnwfqqaagtcaggcacctcccccaagcgctggacatatgacacatccaaactgtcttctggagtc180ttcagtccgtggagggggttcgcgacctgtatactgtgtaggtttgacagaagacctcagksgtspkrwtydtsklssgvcctgctcgcttcagtggcagtgggtctgggacctcttactctctcacaatcagcagcatg240ggacgagcgaagtcaccgtcacccagaccctggagaatgagagagtgttagtcgtcgtacparfsgsgsgtsysltissmgaggctgaagatgctgccacttattactgccagcagtggagtagtaatccactcactttc300ctccgacttctacgacggtgaataatgacggtcgtcacctcatcattaggtgagtgaaageaedaatyycqqwssnpltfggtgctgggaccaagcttgaactgaaacggtgataagaattcatttgtacatggagaaaa360ccacgaccctggttcgaacttgactttgccactattcttaagtaaacatgtacctcttttgagtklelkr taaagtgaaacaaagcactattgcactggcactcttaccgttactgtttacccctgtgac420atttcactttgtttcgtgataacgtgaccgtgagaatggcaatgacaaatggggacactgvkqstialallpllftpvtaaaagccgatgtacagctggtggagcttgggggaggctttgtgcagcctggagggtcccg480ttttcggctacatgtcgaccacctcgaaccccctccgaaacacgtcggacctcccagggckadvqlvelgggfvqpggsrgaaactctcctgtgcagcctctggattcactttcagtagctttggaatgcactgggttcg540ctttgagaggacacgtcggagacctaagtgaaagtcatcgaaaccttacgtgacccaagcklscaasgftfssfgmhwvrtcaggctccagagaaggggctggagtgggtcgcatatattagtagtggcagtagtactat600agtccgaggtctcttccccgacctcacccagcgtatataatcatcaccgtcatcatgataqapekglewvayissgsstictactatgcagacacagtgaagggccgattcaccatctccagagacaatcccaagaacac660gatgatacgtctgtgtcacttcccggctaagtggtagaggtctctgttagggttcttgtgyyadtvkgrftisrdnpkntcctgttcctgcagatgaccagtctaaggtctgaggacacggccatgtattactgtgcaag720ggacaaggacgtctactggtcagattccagactcctgtgccggtacataatgacacgttclflqmtslrsedtamyycaragattacggggcttattggggccaagggaccctggtcaccgtctcctcatgataatctag780tctaatgccccgaataaccccggttccctgggaccagtggcagaggagtactattagatcdygaywgqgtlvtvss attc784taagwherein the amino acid sequence is str61 str62 str63 str64 str65 str66 str67 str68 str69 str70 str71 str72 str73 str74 str75 str76 __________________________________________________________________________ table 5__________________________________________________________________________ seq id nos 35 36 and 45 __________________________________________________________________________ str77 str78 str79 str80 str81 str82 ctgtccctctatgaccctgtaatctacaagcctaatcctgtgttgagttttctctatagcmetpheglyleuglyhisasnserlysgluileser str83 str84 str85 asnthrleuileasplysglyaspserglugluileileargleuglyserasngluser str86 gcttaagaaaccgacgaccgggttgcaggtttgctccactaaagagcgttactaaacgtaargileleutrpleuleualaglnargproasngluvalileserargasnaspleuhis str87 aspphevaltrparggluglnglyphegluvalaspaspserserleuthrglnalaile str88 serthrleuarglysmetleulysaspserthrlysserproglntyrvallysthrval str89 ggcttcgcgccaatggttaactagcgggctcacctttgccaacttcttctctaccgagcg str90 str91 gluasnglualaalahisaspileserglnprogluservalasnglutyralagluser str92 serservalproserseralathrvalvalasnthrproglnproalaasnvalvalala str93 asnlysseralaproasnleuglyasnargleupheileleuilealavalleuleupro str94 str95 str96 str97 str98 __________________________________________________________________________ table 6__________________________________________________________________________ seq id no 4 img121 cgggtcataccgatcccgttatccgaaatgg seq id no 5 img142 cgacggtacctgcagcgttaggggtttaaagctggattg seq id no 6 img166 catctggatatccgttaggggtttaaagc seq id no 23 img167 catctggatatcctaccaatgcttaat. |
4 | may be inserted into a switch hole not shown in the direction of front and rear of the cabinet on the front panel 8 and may be disposed at the front of the front panel 8 the coupler 26 may cover the switch hole the connectors 28 may be formed as ribs that protrude from the switch housing unit 24 toward the coupler 26 the connectors 28 may be evenly spaced apart from one another and thus a space s may be provided between the connectors 28 the spaces s may serve to prevent water from accumulating between the front panel 8 and the switch housing unit 24 by permitting water to flow there between a mounting bracket 34 is installed on the front panel 8 and is coupled to the switch housing unit 24 the mounting bracket 34 has a hole in the middle the hole of the mounting bracket 34 corresponds to the switch hole first and second engaging protrusions 34 a and 34 b are formed on either side of the hole of the mounting bracket 34 the mounting bracket 34 and the switch housing unit 24 may be hook coupled to each other by using a hook 30 and an. |
7 | or other system software is modified the noninvasive implementation is similar to the invasive implementation except that the kernel scheduler 270 is not modified and the enforcement module 260 includes a worker thread that periodically checks client processes to determine whether any client process has consumed its license grant one skilled in the art will appreciate that the worker thread period may be chosen to balance license fairness with cpu occupancy with shorter periods tending to increase fairness at the cost of somewhat lower cpu occupancy for the licensed processes in an embodiment the noninvasive implementation of the enforcement module 260 may estimate a license quantum consumption rate for a client process e g by determining an estimated time in the future at which each client process will use up its license quantum then instead of periodically checking all client processes the enforcement module 260 may schedule a worker thread to wake up just before an estimated time of the earliest estimated license quantum consumption as such the odds of license grant over consumption are reduced and the likelihood of higher cpu occupancy for the licensed processes is increased the global scheduler 240 comprises a global scheduling algorithm that may. |
6 | accordance with the invention an inlet 48 provides an air and fuel mixture to the pressure chamber 46 the air and fuel mixture flows in the direction indicated by arrows c through the inlet 48 into the pressure chamber 46 and through the ports 40 into the interior 42 of the burner 30 according to some embodiments of the invention the inlet 48 and the pressure chamber 46 are pressurized to a positive pressure in order to drive the air and fuel mixture into the burner 30 some embodiments may include a fan or other means for pressurizing the inlet 48 and pressure chamber 46 upstream from the burner 30 other embodiments may include a fan or other pressure inducing device downstream from the burner 30 the burner 30 may be used whether the air and fuel mixture is pushed or pulled through the burner 30 in embodiments where air and fuel mixture is pulled through the burner 30 one skilled in the art will appreciate that the air and fuel mixture may be supplied without a pressurized chamber 46 any suitable means of providing the air and fuel mixture to the burner 30 may be accomplished in accordance with the invention once the air and fuel mixture has flowed in the direction of arrows c through the ports 40 into the interior 42 of the burner 30. |
8 | determined threshold t m then the prepay subscriber is informed by restricted message of the amount of prepaid calling time remaining and can also be warned by restricted message that the call will be disconnected when the remaining prepaid call time expires when the remaining prepaid call time expires the call may then be disconnected the threshold t m is set to a practical value such as 2 minutes to give the prepay subscriber sufficient time to bring the call to a satisfactory conclusion or alternatively to provide the subscriber time to exercise an option to cause a transfer of funds from the subscriber 39 s bank account to the subscriber 39 s prepay account before the expiration of the call the present invention also provides for the convenient purchase by the subscriber of additional prepaid calling time by way of electronic funds transfer eft according to the present invention the subscriber may use an automatic teller machine atm to transfer funds from a bank account of the subscriber to a prepay account of the subscriber the amount transferred to the prepay account is added to the current balance of the prepay account and is automatically translated into an additional amount of prepaid call time available to the consumer thus a service provider of prepaid calling time may enter into an agreement with the bank to provide for the electronic transfer of funds from a bank account of the subscriber to one or more bank accounts of the service provider fig3 shows a functional diagram of a system for implementing electronic funds transfer for the purchase of prepaid calling time according to the methods of the present invention when a prepay subscriber desires to purchase prepaid call time the subscriber selects by. |
4 | where the lower surface of the horizontal part 11 is in abutment with the stopper 14 and the distal end of the holding part 13 is positioned between the stationary blade 40 and the press plate 50 if the upper thread is cut by an automatic thread cutting device 81 installed under a base plate after a sewing operation the first solenoid 20 operates immediately to raise the rod 22 fig2 and the left end of the horizontal part 11 of the holding member 10 thus the holding member 10 rotates about the screw 62 in the clockwise direction and the holding part 13 is moved from the waiting position to the holding position where the holding part 13 is positioned under a needle a the rotation angle of the holding member 10 is limited by the engagement of the inclined plane 11a of the horizontal part 11 with the stopper 27 after this energization of the first solenoid 20 is stopped and the rod 22 is returned to its home position by the expansion force of the spring 25 during this time the driving member 31 of the second solenoid 30 separates from the holding member as shown in fig2 with the above mentioned operation the holding part 13 goes back to the waiting position from the holding position at this time the hook of. |
8 | drive motor 150 according to the present invention which acts a hybrid permanent split capacitor capacitor start single phase motor with more or less drive power being selected by a controller of head unit 102 the motor 150 includes two coils or windings 152 154 in the stator the common connection of the two windings 152 and 154 is connected to ground or a neutral reference voltage terminal capacitor 158 is permanently connected across terminals at the opposite ends of the two windings 152 154 a second capacitor 160 and parallel bleed resistor 162 are series connected with a relay 164 across first capacitor 158 line current is provided through a light relay 166 to a direction relay 168 which selectively passes line current directly to either side of capacitor 158 and one of windings 152 154 in this embodiment providing line current to winding 152 drives the garage door operator in the up direction down relay 170 passes line current to the motor at winding 154 only when the motor is driving the garage door down to close it when the garage door operator is activated to drive the door down e g by pressing a button on a remote the control circuit closes light relay 166 direction relay 168 remains in the position shown of fig2 down relay 170 is closed and higher power relay. |
4 | preserving the fabric 39 s loft and shape during shipment and use the testing also demonstrated that the invented process reduced the amount of false loft in the fabric false loft is indicated by the percent of loft lost between the initial loft and the loft at the applied load as shown in the table 1 the samples performed superior to the control exhibiting less false loft moreover it is noted that the improvements in fabric resiliency and false loft was achieved at substantially higher production rates table 2 is the tensile strength of the control and the three sample fabrics identified in table 1 table 2 illustrates a great disparity between tensile strength in the cross direction and machine direction for the control sample with strength in the machine direction being significantly less than that in the cross direction in comparison tensile strength in machine direction for each of the drafted samples was substantially improved from that of the control specifically sample 1 having the same number of laps as the control provides and increased tensile strength from of load of 1 33 lbs to 2 78 lbs samples 2 and 3 each demonstrate an even more dramatic increase in machine direction tensile strength referring to table 3 a control high loft nonwoven fabric and two sample fabrics are compared wherein each of the fabrics had a weight of 1 0 oz ft 2 and a weight percent blend of 20 4 dpf low melt binder fiber 30 25 dpf pet and 50 15 dpf pet the samples were processed with different number of laps with the control first sample and. |
1 | line 44 and pumped through ultrafiltration membranes 46 to produce a concentrated protein solution as the retentate in line 48 with the permeate being removed by line 50 the concentrated protein solution is passed through a spray dryer 52 to provide further dry flax protein isolate 54 as an alternative the concentrated protein solution in line 48 may be passed by line 56 to mix with the protein micellar mass before the mixture then is dried in spray dryer 40 this example illustrates the recovery of linola protein from linola oil seed linola oil seed was cold pressed and the oil recovered 16 8 kg of crushed meal was added to 335 l of 0 15 m nacl solution 5 w v extraction concentration at 13 u00b0 c and the mixture agitated for 60 mins followed by a 60 min settling period 190 l of extract was decanted and filtered through 20 u03bcm filter pads to provide 180 l of an aqueous protein solution having a protein content of 6 g l the aqueous solution was reduced in volume to 11 l by concentration on an ultrafiltration system using 30 000 daltons molecular weight cut off the resulting concentrated solution had a protein content of 6 g l which represented a yield. |
2 | zero position indicated by the arrow 70 the first flange extending approximately 0 08 inch and the latter two extending 0 1 inch around the inner periphery of a circle having a radius of 0 32 inch recessed adjacent thereto and about 3 64 inch inches below flanges 43a are the annular planes 43c which are centered from the reference point at angular clockwise positions of approximately 50 u00b0 190 u00b0 and 330 u00b0 respectively each extending approximately 0 2 inch around the periphery on a circle having a radius of about 0 31 inch near the centers of each of the lugs 47b is a dimple 72 which is respectively designed to accommodate a small bead 71 just above the clockwise end of adjacent ones of the recessed flanges 43c so that when the cylinderical housing 47 is rotated in a counterclockwise direction lugs 47b engage flanges 43c and the beads 71 are accommodated in dimples 72 firmly locking against rotation when the housing 47 is rotated to open position as shown in fig7 b one of the flange 43a on the clockwise side and bead 71a on the counterclockwise side act as stops engaging lugs 47k to maintain housing 47 in proper operating position stop 71a is overridden when spray housing 47 is turned to locking position 3 another change in the embodiment of fig7 a 7b relative to that of fig2 a is in the shape and thickness of the wall of piston 14 and in the relationship between. |
6 | through the refill hose 16 into the opening 18 at the upper extremity of an overflow tube 20 the ball cock 14 operates in a conventional manner for controlling the flow of water from the water inlet pipe 12 into the flush tank 10 and simultaneously through the refill hose 16 into the overflow tube 20 the specific details of construction of ball cock 14 being fully described in the above cited patents to schoepe et al further in a conventional manner water is discharged from the tank 10 through an opening 32 in the bottom wall thereof opening 32 is controlled by a valve 22 and its associated valve seat 36 actuation of the valve 22 is effected through a linkage which comprises a lever 24 a link 26 and a rod 28 in the usual fashion the linkages enable the unseating of the valve 22 from its seat 36 from the outside of the tank via handle 38 fig1 rod 28 is constrained to move vertically within a guide 30 which is fastened about overflow tube 20 via a connecting ring fastener 34 the ball cock 14 includes an inlet valve 40 which is made operable through a valve operating lever 42 which in the position illustrated in fig2 is off when lowered to the position illustrated in fig4 valve operating lever 42 acts to open valve 40 to admit water to tank 10 via openings 52 a vertically moveable ball cock float 46 includes a guide receiving passage 48 formed therein. |
2 | at the surface of the base part 20 whereby the contract area of blank paper s becomes smaller and consequently the feeding load becomes smaller the driving pulley 7 which is fitted to the driving shaft 2 and turns integrally with the latter is rotatably supported by driving shaft 7 within a hole 25 of the frame proper 10 and a hole 26 of the guide frame 11 the guide shaft 3 is rotatably and slidably received through holes 27 and 28 of frames 10 and 11 respectively and a lock means 40 the presser member 13 has a slit 30 made at the position corresponding to the moving path of the belt 6 carrying pins and also axis parts 31 32 33 34 which engage with engaging holes 14a 15a of the support parts 14 15 or 16 17 of the frame proper 10 axis parts 31 32 33 34 are projected from arm parts 36 37 38 39 in the same direction arm parts 36 39 at the outer side are longer than the arm parts 37 38 at the inner side and top parts as pawl parts 36a 39a engage elastically with concaves 14b 15b and hold the presser member 13 at the specified opened degree the axis parts 31 33 and the axis parts 32 24 project in opposite direction respectively the lock means 40 which fixes the pin tractor 1 to the guide shaft 3 has a tubular fixing member 41 fitted to the guide shaft 3 provided at the frame proper 9 and a lever member 42 fitted movably to said. |
7 | is changeable when a folder object is selected a button for changing the size is displayed at for example the lower right portion of the folder object the file object can be used as a file template by marking the section 34 format 34 of document information a file object of a type in which the section 34 format 34 of document information is not marked is operated such that a file indicated by the pointer is simply opened when a user double clicks the file object on the pie folder however in a case where the section 34 format 34 is marked a new file object and a copy of the entity of the file are created and then the copied file is opened the pointer of the thus produced file object indicates the copied file the entity of a file can be shared with a plurality of users a file object having a path to the entity of the shared file has a sharing mark in the form like a person as displayed in the lower left portion of the file 34 pie proposal mr a 34 shown in fig3 though a file being shared name memo and bitmap data are under management. |
8 | is essential to the invention that the laminations 11 and 12 and the ends 14 and 15 alternate with one another as viewed in the circumferential direction of the commutator 10 so that one group of ends 14 terminate in a first plane 18 perpendicular to the longitudinal axis 13 of the commutator 10 while the other ends 15 of the laminations 12 terminate in a second plane 19 which is likewise disposed perpendicular to the longitudinal axis 13 of the commutator 10 since the two planes 18 and 19 are disposed parallel to one another one plane 18 is spaced apart farther on the winding side of the armature from the windings of the armature than the other plane 19 in fig2 a partly sectional view of the arrangement of laminations 11 and 12 is shown in which it can be seen that these laminations on their inside oriented toward the longitudinal axis 13 each have riblike portions 21 22 which on sides facing away from one another form pockets 23 and 24 the pockets 23 and 24 serve to receive reinforcing rings 25 in particular which serve to stiffen and radially secure the laminations 11 and 12 for the sake of simpler introduction or insertion of the reinforcing rings 25 in the assembly direction indicated by the arrow 26 it is advantageous if the inside circumference of the pockets 23 24 is larger than the outside diameter of the reinforcing rings 25 a structural unit completed to this point comprising. |
3 | reactive with epoxide groups amine curatives having a higher proportion of hydrogen atoms and approaching the upper end of the above recited range tend to effect greater crosslinking than do amine curatives having lesser hydrogen atoms and the resulting epoxide products tend to be more rigid and exhibit lesser levels of elongation than do the polyepoxide resins cured with amine curatives having the lower levels within the middle of the range of amine hydrogen atoms typically the amine curative will have from about 3 to 4 reactive hydrogen atoms and a molecular weight ranging from about 70 to 250 examples of latent amine curatives include dicyandiamide and imidazole derivatives also guanamine powders formed by the reaction of dicyandiamide with nitrites can be used other latent amine curing agents commonly used in the prior art may also be used the range of components based on one hundred parts by weight of resin forming components i e polyglycidyl ether or phenol monofunctional and amine reactive aliphatic ester component is from about 40 to 90 preferably about 50 to 70 parts by weight of polyglycidyl ether of a phenol and 10 to 60 parts of the monofunctional aliphatic ester the level of amine curative component is largely dependent upon the physical properties desired in many cases a stoichiometric level based on the equivalents epoxide in the polyglycidyl ether of a phenol type compound and the monofunctional aliphatic ester component the resin forming components may not be utilized generally. |
1 | fig8 comprises a plate 320 which extends radially of the wand 294 and of the length axes of the barrel 13 and the pump unit 100 the peripheral shape of the plate 320 conforms to the cross sectional shape of the front end of the barrel 13 so that the perimeter of the plate 320 is substantially flush with the outer periphery of the open front end of the barrel 13 and so that the plate 320 effectively covers the open front end of the barrel 13 the peripheral shape of the plate 320 and cross sectional shape of the front end of the barrel 13 in one embodiment is generally d shaped with a generally flat underside and a convexly curved top and sides the plate 320 is not intended to seal the open front end of the barrel 13 and so need not tightly abut same since the peripheral wall 297 of the cup 295 fits easily within the open front end of the barrel 13 the plate 320 extends radially outwardly beyond the cup 295 as seen in fig8 a and 8b the front cover 293 includes an annular flange 322 extending axially rearwardly therefrom radially snugly into the cup 295 of the coupling 292 to bottom rearwardly and sealingly against a resilient gasket 321 which is disposed against the front face of the base wall 296 of the cup 295 respective holes in the gasket 321 loosely surround the front nipple 302 and leave fully open the communication between the interior of the suction nipple 306 and the interior of the cup 295 the front cover 293 further includes a further annular flange 323 extending fixedly and forwardly from the plate 320 in coaxial alignment. |
8 | power control section 522 then applies the scaling factors to the amplitude control circuit and vga attenuator 508 to effect the power level change if the power level increase is so great that it causes a jump over the overlap region i e from within the uncompressed region and into the compressed region a mode switch is performed by retrieving the appropriate scaling factors for the amplitude and phase paths that will set the pa 510 at the new power level in the new mode because the output power level tolerances are wide for these large step sizes no calibration between the two modes is required the situation is different when smaller step sizes are commanded and the power level increase u03b4p results in an output power level that falls within the overlap region when this condition occurs the pal 514 of the polar modulation transmitter 500 is activated to determine whether a mode switch from uncompressed mode to compressed mode is required and what steps must be performed to ensure that the resulting power level change satisfies specified output power level control tolerances as explained above a discontinuity or gap may be observed between the output compressed mode and uncompressed mode power level curves. |
2 | surface 9 and secondly with the outer surface of the mixing roller 12 with which it comes into contact thus the association of the choice of hardness of the wheel and the form of the circumferential surface 9 enables the surface 8 to fit both the sizing cylindrical revolution surface of the roller 12 and the non cylindrical groove bottom surface 8 in the embodiment described above the flexible extended or elongated element 1 comprises two lateral plane surfaces 7 perpendicular to the groove bottom surface 9 and the sizing wheel 2 includes two plane ring shaped surfaces 6 it is also within the scope of this invention to use it when at least one of the plane lateral surfaces 7 is not perpendicular to the axis of the sizing wheel 2 and when it could cooperate at least with one outer circumference of a ring shaped surface 6 either without deformation of the sizing wheel 2 and or the flexible extended or elongated element 1 or with deformation of one and or the other especially when they are elastic thus the plane lateral surfaces 7 of the extended or elongated element 1 might tend to close or open the extended or elongated element 1 thus the lateral surfaces of the element might tend to close the element or open it similarly the ring shaped surface s 6 need not necessarily be planar and could be truncated the top of the cone on which rests the ring shaped surface 6 which is the axis 5 of the. |
7 | the result of some other desired blur tensor b d operating on the physical process calling the desired result d i e d b d p we attempt to estimate d from m by multiplying m by a reconstruction tensor t i e d tm we have discovered that it is possible to solve this multidimensional problem to do so we have developed a way of constructing a reconstruction tensor for such problems moreover if the blur function has particular properties there is a practical way of solving the problem i e it is possible to construct a fast algorithm for solving the problem we have discovered and it can be shown that we can apply much of what is true about statistical operations on matrices to the multidimensional tensors that are defined as described herein that is everything generalizes to these multidimensional objects thus we construct t in such a way as to minimize the expected mean square error between the estimate of d and d itself to do so we construct a performance index j is the expected sum of squares of the reconstruction error a reconstruction tensor t that minimizes j will produce the smallest expected mean squared error of reconstruction hence we elect to solve the problem of minimizing j over t the gradient of j with respect to t will be 0 at a minimum or. |
7 | one or more vocabularies 113 the asr front end 110 produces feature vectors 111 the feature vectors are used by the fmpe engine 120 as described below in further detail to produce enhanced feature vectors 121 which are used in conjunction with the acoustic model language vocabulary 113 by the asr back end 130 to produce recognized speech 131 which in one embodiment is provided in the form of text as part of the speech recognition process the system 100 processes quantized feature vectors 111 using an fmpe engine 120 the fmpe engine 120 includes a de quantization engine 122 a predetermined quantized fmpe matrix 117 and an fmpe transformer 124 which in one embodiment comprises matrix multiply operations the de quantization engine 122 uses the predetermined quantized fmpe matrix 117 to produce full i e dequantized fmpe values 119 the fmpe transformer 124 uses the full fmpe values 119 to produce the enhanced feature vectors 121 which are integrated with an acoustic model to recognize the speech 102 functionality associated with de quantization engine 122 will now be discussed via diagrams pseudo code and flowchart in fig2 through fig5 for purposes of the following discussion the de quantization engine 122 or other appropriate entity performs steps in the flowcharts referring now to fig2 an exemplary de quantization engine 122 includes a vector processor 126 having storage for different data types which can be operated on by the vector processor 126 the storage includes a first set. |
6 | another form a hall effect sensor is coupled to the fuel injector input the output from the hall effect sensor is then used to regulate the pulse width of the wave signal controlling the hydrogen generator 36 at idle the positive portion of the wave sent to the injector will be quite short in duration and when power is applied the engine the positive portion of the wave will be considerably longer the fuel injector signal therefore defines the power control signal sent to the hydrogen generator either directly to the anode cathode or to the control box 52 which in turn powers the hydrogen generator 36 while many common hall effect sensors will not be capable of surviving the heat generated by an internal combustion engine hall effect sensors built for industrial or military use are normally capable of handling such environments in one form the electrolyte stabilization tank 24 contains a chemical solution which is pumped from the water supply outlet 40 through the hydrogen generator 36 to release hho gas the hho gas released by the hydrogen generator 36 and any remaining liquid therein is then returned to the stabilization tank 24 through the supply outlet 58 to the inlet 34 for optimum performance the position of the hho inlet 34 is above the normal operating fluid level in the. |
7 | or other devices for data storage transfer timing and communication of the sensors to the sensor monitoring unit 8 the sensor monitoring unit 8 may also be in communication with a central processing unit 12 in one embodiment information from the sensor monitoring unit 8 is communicated to the central processing unit 12 and stored communication software and or data assessment software may be installed on the sensor monitoring unit 8 and or the central processing unit 12 communications to the central processing unit 12 may be further processed and or stored permanently or temporarily on the central processing unit 12 communications may also be relayed or transferred to a remote location the central processing unit 12 may optionally be interconnected to a number of peripheral devices including without limitation a visual display unit 14 a keyboard or mouse or touch screen a printer and or other suitable peripheral devices for displaying data or calculations or providing input of commands signals etc the sensor monitoring unit 8 central processing unit 12 visual display unit 14 and any peripheral devices may be located together or separately at any suitable location or locations and comprise any suitable computer configuration each first sensor 2 second sensor 4 sensor monitoring unit 8 central processing unit 12 and visual display unit 14 and any peripheral devices may communicate by any number of conventional communication paths for example but not intended to limit the scope of the invention communication paths could be a hardwire communication link such as signal cable and or a wireless path such as a radio link cellular path and or satellite link each first sensor 2 and each second sensor 4 may be any suitable design capable of sensing the passing or proximity of a moving object along a railway 6. |
2 | may be formed from respective pre cut and scored blanks application_number US 201213413237 A description referring now to the drawings like reference numerals designate identical or corresponding features throughout the several views embodiments of a package system for organic product are shown generally at 100 and may include a box element 102 and an insert element 104 the box element 102 is typically formed to include an integral side pocket 200 adapted to snuggly and protectively receive an auxiliary packet such as the one illustrated for example at 198 the auxiliary packet may comprise or contain for example fresh rolling papers a box blank 106 may be provided for forming a box element 102 with integral side pocket 200 the box blank 106 may be made of a foldable material such as for example paperboard or the like the box blank 106 may include decorative and informative printing and fold lines which may be defined by for example scoring of the material of which the blank is substantially made embodiments of a box blank 106 may comprise a first face panel 110 a second face panel 112 a first side panel 114 a second side panel 116 a pocket side panel 118 a first adhesion flap 120 a second adhesion flap 122 a pocket face panel 124 and a pocket closure flap 138 the first face panel 110 may be defined at least in part by a first fold line 148 a second fold line 150 and a third fold line 152 the first and second fold lines may be generally parallel to the third fold line 152 and disposed at. |
9 | inside the string in a variant of the acquisition system a high frequency of measurement transmission is obtained by electric links consisting of cable 5 line 16 and 17 and surface cable 14 certain downhole sensors which require no high frequency sampling can transmit their measurements through other channels by pressure wave or electromagnetic wave for example sub 4 can include the necessary electronics to compact the information provided by at least one drilling signal the characteristic coefficients of signal segments can then be transmitted either through the electric conductor of the device of fig1 or by pressure wave or electromagnetic wave or by any other suitable transmission means sub 4 can also comprise the electronic means of automatic segmentation into homogeneous segments and means for selecting the characteristic segments of a behaviour of the determined drilling a behaviour which will be brought to the operator 39 s attention after transmission of the characteristic coefficients to the surface fig1 b shows a conventional drill rig in which one has inserted in the drill collars a measuring sub 4 which records at least one drilling signal an electronic installation 20 including the signal compaction means an installation 21 for coding and transmitting to the surface the characteristic coefficients of the signal transmission can be achieved by pressure waves in the column of fluid inside the drill string a pressure detector 22 located on the surface injection line 23 transmits the pressure waves to a surface processing installation which decodes the pressure waves to obtain the characteristic coefficients the surface installation can identify the behaviour according to a data base or to particular instructions or reconstruct the signal in order to give the operator for example analog measurements fig2 shows an example. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.