label
int64 1
9
| text
stringlengths 113
6.79k
|
|---|---|
4 | is not shown in detail in fig2 a a three layer neural network in designated by 20 and for example comprises input neurons en 1 to en 7 and further neurons zn 1 to zn 5 and an associated output neuron an 1 using the neural network 20 the spectrum from the first spectrometer 10 is evaluated the backscatter intensities i 1 to i n from preferred wavelengths u03bb i of the schematic diagram in fig2 b are used as inputs for the neural network 20 statements about the quality of the paper to be produced may be obtained from the wavelength intensities i i with i 1 n the statements of the paper quality of output an 1 can be used on the one hand for the feedback control in the stock preparation and on the other hand for feedforward control in the paper machine 1 itself shown in fig3 is another three layer neural network 30 which has input neurons en 8 to en 12 and further neurons zn 6 to zn 9 and an output neuron an 2 using this second neural network 30 data from the spectrometers 10 u2032 and 10 u2033 are evaluated in a similar manner to that in fig2 a it is also advisable to use the moisture 31 of the paper web 110 as a measured variable as a further input variable hence statements about the product quality of the finished paper or board may be obtained on output an 2 furthermore mechanical parameters such as the so called cmt factor the breaking length and the burst pressure can also be obtained it is also possible to provide for the two further spectrometers 10 u2032 and 10 u2033 one dedicated partial neural network each the neural networks according to fig2 and 3. |
8 | diagrammatic side view section in fig2 of a high density plasma flood system is taken through a beamline and magnetic flood system according to the prior art in this case the beam 2 is surrounded by a wall 3 called a u2018 guide tube u2019 which is not a functionally descriptive name that serves to mount a set of linked magnets 10 the beam direction in fig2 would be into or out of the drawing plane in the present commercial product the guide tube magnets are equal size guide tube magnets are equal size and magnetically linked the two magnets nearest the arc chamber have the opposite polarity facing the source magnet this links magnetic flux to the source magnetic field and increases electron emission current the remaining guide tube magnets serve to distribute emission electrons around the beam cross section while minimizing the magnetic flux across the beam 2 the magnetic system includes the source magnet 7 and guide tube magnets 9 as well as a source magnetic yoke 8 the cold plasma magnetic filter effect described in u s pat no 5 545 257 is achieved by design of the source magnet and the primary electrons power source in this case a cathode filament my earlier u s pat no 5 545 257 describes additional detail and it is herewith incorporated by reference in its entirety fig2 illustrates a basic diagram of the distribution of a source magnet 7 a source magnetic yoke 8 and. |
9 | color or a slow flash rate as will be understood the administrator or manager may designate the significance to be attached to the network communication with the user being instructed in the appropriate response to the signals which arrive the greater the degree of urgency the quicker the user should respond by selective activation of the away button to signal through the network interface the initiation of an interval of non use of the system fig2 and 4 illustrate implementations comparable to that described to this point in a notebook system a handheld system and a cell phone respectively in each view an away button is shown at 25 35 and 45 respectively fig5 shows a display such as may be generated by any of the systems of fig1 through 5 here the away button is implemented by software which drives the display of an element 55 displayed visibly to a user on the display 51 the away button may be selectively activated by the user by using a pointing device to move a cursor over the element 55 or where a touch screen is employed as the display by touching the button element with a stylus or finger with the display implementation signaling from the administrator or manager may cause a change in. |
3 | on samples having high enough wet strength to measure are recorded in table vi table vi______________________________________water by weight ofwood pulp plus tensile strength tensile strengthswater with grain kg cm sup 2 against grain kg cm sup 2______________________________________0 208 1686 5 182 15016 1 136 9520 9 101 5527 3 55 5132 0 31 2837 1 14 943 0 2 5 2______________________________________ when the same fiber is treated with process oil at 22 by weight of the fiber plus oil the tensile strength with the grain is 157 kg cm 2 fiber compositions which are about 40 water mixed at 6 minutes in the br banbury at slow speed are the optimum for all of the fiber this corresponds to a work input of 0 53 kilowatt hours per kilogram with less mixing dispersion is poorer and with more mixing there is loss of physical properties however there is little difference in the dispersability of the pulp types despite substantial variations in the initial pulp sheet tensile strengths the degree of dispersion continues to improve as water is added up to about 40 of the wet fiber weight then at higher water levels dispersion and tensile properties diminish tensile properties are subject to considerable scatter due to variable bonding but are relatively insensitive to fiber dispersion it is preferred to dry the compositions either. |
3 | and a radiation dose of 3 u00d7 10 5 gy to obtain a treated starch object then the treated starch object is placed in a fermentation processor such as a fermentation tank into which a predetermined amount of water is added where a ratio of the treated starch object and the water is 1 10 by weight and is dissolved in the water through mechanical stirring in the fermentation processor to form a dissolved starch object then an acidity ph value of the dissolved starch object is adjusted to 4 u02dc 4 5 to form a pretreated starch object which is then arranged for saccharification by adding an enzyme for saccharification such as glucoamylase in the amount of 20 u02dc 30 iu where a treatment time for saccharification is 1 hour and a treatment temperature for saccharification is 60 u00b0 c to obtain a saccharized product the saccharized product obtained from the above process which is in the form of sugar paste contains approximately 10 reducing sugar which can be used directly for fermentation in other words it is unnecessary to use different equipments such as saccharization tank and fermentation tank for liquefaction saccharification and fermentation and hence eliminating any possible waste of materials during transfer between different containers and equipment in addition the treated starch object is dry easy to handle and manipulate which increases the ease of handling and accuracy making the present invention highly effective and efficient for use in industrial production one skilled in the art will understand that the embodiment of the present invention as shown in the drawings and described above is exemplary only and not intended to be limiting it will thus be seen that the objects of the present invention have. |
9 | on top of a roof or landscape applications may be tapped into the catchment system 100 this technology may create a substantial reduction in utility bills with respect to potable water and heating and cooling of a building fig2 is a view illustrating a portion of the catchment system 100 in a wall of the building 10 as shown a plurality of storage units 125 is disposed within a wall of the building 10 the storage units 125 are attached and supported to the existing wall components such as steel beams or studs the storage units 125 are interconnected by at least one connection line 120 in one embodiment the storage units 125 are pvc pipe in between the storage units 125 and the frame construction insulation may be blown or laid building architecture may include water holding capacity for a 2 year 100 year or 500 year design storm fig3 6 illustrate the storage unit 125 in the various frame structures of the building 10 for instance fig3 illustrates the storage unit 125 in a structural column 130 typically the structural column 130 is an insulated waterproofed wall member with a structural reinforcing bar the structural column 130 may be cast in place or poured in place as shown in fig3 the storage unit 125 may be connected to an interior tap 135 for use with interior water components such as a washing machine and or a water heater in. |
5 | be easily inserted to facilitate the extraction of the panel from concrete thus overcoming the suction effect the plane surface pl is provided with holes pff that serve to house a threaded bar for the purpose of counteracting the concrete thrust produced when the latter is cast into the formwork fig2 a d show a rectangular modular panel where the ribs pnb pnl are made with one type of material for example nylon polyamide while the plane surface pl is made with another type of material for example polypropylene fig3 a d show a rectangular modular panel u2014 presented as one among many possible applications u2014 provided with one or more metal cores am inserted in the ribs pnb pnl and one or more fiber cores af inserted in the plane side pl fig4 a d show a rectangular modular panel u2014 presented as one among many possible applications u2014 provided with some cavities ca designed to serve as structural lightening or stiffening elements and obtained through the injection of gas in the connection points between the ribs pnb pnl and the plane side pl fig5 a d show a rectangular modular panel where by way of example the ribs pnb pnl are lightened and stiffened by cavities cs filled with foamed polymers fig6 a d show a rectangular modular panel where by way of example the ribs pnl are stiffened and strengthened by a metal. |
2 | blade and nib and their performance on different target material can produce different useful results this makes this tool quite useful and able to adapt to different target material and to perform many useful functions the following descriptions show some of the many ways the relationship between the protrusion of the blade and nib from or into the device and the relationship between the blade and nib can be used to create some of the many combinations of features this device can perform these drawings are not meant to be limiting but simply meant to show examples of several of the almost infinite possible combinations of the blade nib and device relationship fig2 shows the blade 100 and nib 101 in a position that allows the user to cut and decorate simultaneously the handles 102 allow the user to engage or disengage the blade and or nib a spring 103 helps to tension the blade and nib and the incremental movement position fins 106 work with ridges inside the case to cause the blade and nib to click as they are moved and also biases them to stay in the position they are set in by placing more ridges inside the case the user has more ability to determine the incremental distance in the relationship between the blade and the nib and the blade and nib 39 s protrusion or insertion. |
1 | in the lower channels 20 of the pack section while the warmest portion of the fluid to be outputted from the upper channels 20 of the pack section 12 reinforces the coolest portion of the fluid initially inputted into the lower channels 20 of the pack section 11 thereby substantially equalizing or at least tending to equalize the temperature over the entire exterior surface area 14 of the lower pack section 11 the method of making the therapeutic thermal pack unit 10 of the present invention contemplates the steps of forming first and second half sections which are substantial mirror images of one another each having a header portion and a plurality of elongated generally parallel channels therein and then placing a separator sheet atop the channels so that one end of the sheet forms an outer boundary of the header portion while the opposite end of the sheet terminates a predetermined distance from the ends of the channels the other half section is then placed over the first half section with the separator sheet disposed therein so that the sheet assumes a similar position with respect to the second half section the two sections are then secured together such that their channeled interiors are facing one another and the separator sheet is sandwiched therebetween to form a fluid type seal at the header ends. |
7 | waves in the 23a are again refracted by the first face 12a of the second plate into ray 24a which is reflected from the second face 12d as the ray 24b and thereafter recombines with the wave 24 to degrade its polarization purity this comes about because the s type polarization which was reflected in ray 22a is transmitted through 22c 23a 24a and 24b to recombine with ray 24 furthermore the device is easily affected by temperature and the extinction ratio is not fixed placing the wire grid polarizer on the surface 14a of plate 14 which as shown is perpendicular to ray 25 rejects the dominant s polarization in wave 23a 24a 24b 24 and finally 25 by reflection this is indicated in the drawing by the dashed line rays 35 34 33 32 31 and their related rays for clarity of illustration these rays have been shown displaced from the single solid line incoming ray 25 but it will be undstood that in fact for each ray such as 25 there is a superposed reflected ray such as 35 ordinarily any reflection from a wire grid polarizer would pass back to the laser unless the polarizer was tilted however in this invention the reflected wave loses part of its energy at each. |
1 | in width on average stipules u2014 adnate pectinate and narrow petioles u2014 upper surface near yellow green group 143a under surface near yellow green group 143a texture u2014 slightly glandular on the under surface and without prickles on the upper surface length approximately 2 4 cm on average rachis u2014 upper surface with slight pubescence and near yellow green group 143a under surface smooth and near yellow green group 143a in coloration leaflets u2014 number 3 and most often 5 and 7 shape elliptic with a pointed tip and an obtuse base serration single and regular as illustrated texture firm rather thick and semi glossy general appearance dense and dark green size terminal leaflets commonly measure approximately 5 5 cm in length and approximately 3 4 cm in width color young foliage upper surface near yellow green 146a with some reddish coloration of greyed orange group 176a under surface near yellow green group 146b with some reddish coloration of greyed orange group 176a color adult foliage upper surface near yellow green group 147a under surface near yellow green group 147b number of flowers u2014 commonly one to three flowers per stem peduncle u2014 pubescent firm and well sustains the flowers near yellow green group 144a in coloration approximately 2 5 to 3 cm in length on average and approximately 0 5 cm in diameter on average sepals u2014 upper surface smooth and near green group 137a in coloration under surface tomentose and near green group 138b in coloration length approximately 3 8 cm on average width approximately 1 cm on average buds u2014 shape generally globular size large. |
8 | the inside thereof a peltier element that is provided inside the chamber and that cools the ccd a flexible substrate that is provided to be across over an inside and an outside of the chamber and that connects the ccd to an electronic circuit which is outside the chamber at least both sides of a portion of the flexible substrate which portion is outside the chamber being covered with an aluminum foil application_number US 201213431089 A description an example of an image capturing device relating to the present invention is described hereinafter by using the drawings as shown in fig1 through fig3 an image capturing device 1 of the exemplary embodiment has a ccd 11 serving as an example of an image capturing element a chamber 12 that accommodates the ccd 11 a flexible substrate 13 that is an example of a substrate and that connects the ccd 11 and an external circuit 50 that is positioned at the exterior of the chamber 12 a peltier element 14 that is accommodated together with the ccd 11 in the chamber 12 in order to cool the ccd 11 a cooling plate 15 that is positioned between the ccd 11 and the peltier element 14 and to which the ccd 11 is fixed heat dissipating fins a fin portion 16 that are. |
8 | the wafer holder 220 has a central hole 222 through which a laser beam is irradiated on the camera screen 290 from a laser 130 to measure a marking position by the camera screen 290 the camera screen 290 is positioned at the front of the camera 140 by actuating the motor 292 next an x y stage 150 is actuated to move the camera 140 and the camera screen 290 to a predetermined position and then a laser beam is irradiated onto the camera screen 290 then the irradiated beam point is measured by the camera 140 and the position information of the beam point is input to a controller 170 fig8 is a partially cutaway perspective view of another embodiment of a screen according to the present invention here the screen is made by attaching a semi translucent layer 284 to a round frame 282 the semi translucent layer 284 may be formed of tracing paper for example such a semi translucent layer 284 indicates a point where the laser beam is irradiated as described above in a method and apparatus for calibrating a marking position in a chip scale marker according to the present invention a marking position is measured and the direction of a laser beam is calibrated before marking characters and or numbers on a wafer during a marking process the position of a laser beam can be easily adjusted by irradiating the laser beam on a semi translucent layer formed at the edge of a wafer holder measuring the irradiated laser beam point and calibrating a marking position further since the calibration of a marking position is performed directly on a beam point irradiated on a screen the marking position can be precisely calibrated thereby performing a marking process at the desired position. |
2 | product from entering the air supply line 74 to any significant extent another check valve 80 in the discharge line 60 downstream from the pump 48 prevents air from the supply pump 72 from entering the discharge pump 48 the air from pump 72 can also be utilized to dry out the discharge line 60 and the augmentation chamber 70 after each batch of product has been prepared and distributed preferably the entire system is flushed prior to such drying action by simply allowing the appropriate liquid carrier 34 or 42 to pass through the chamber 16 pump 48 and discharge conduit 60 without the introduction of any additive or foaming agent from the supply hoppers 10 12 respectively when the truck 68 arrives at the dispensing station as illustrated in the drawing the contents of the container 66 may be weighed using a scale 82 that inputs the resulting information to a computer 84 such that when the weight of the contents is known the computer 84 can then appropriately signal the rest of the system to release only the appropriate amount of additive from hopper 10 and foaming agent from hopper 12 for the particular job thus for each truck that arrives the system has the ability to adjust itself to supply a batch of additive in accordance with a pre established concentration schedule and accordingly adjust itself to supply the amount of foaming agent necessary to achieve appropriate. |
2 | the cup there is located the head k containing the delivery mechanism of the dispenser a pump element consisting of a flexible bellows 5 which extends in dome like fashion over a pump chamber 6 and is fastened in a cover 7 of the dome forms a part of the delivery mechanism the cover 7 in the present embodiment is part of an insert 8 an inlet valve v1 and an outlet valve v2 are furthermore a part of the pump element the inlet valve v1 is seated in the central region 7 39 0 of the cover 7 this central region is arranged slightly lowered with respect to the rest of the peripheral annular section of the cover 7 in the direction of the supply chamber 9 which is formed by the housing 1 and contains the pasty composition m from this there results a well defined insertion trough for the cylindrical wall region 10 of the bellows 5 which is tapered on the front side beyond the lowered region the transition place between the central region 7 39 and the remaining peripheral region forms an annular groove 11 inserted into this the wall region 10 produces a practically double sided seal i e on the outside and on the inside the outer sealing region continues up to the height of the curvature zone of the bellows 5 it is an annular wall 12 the latter extends from the top of the cover 7 and passes into an inwardly directed projection 13 this projection is gripped under by an oppositely projecting annular rib 14 of the bellows 5 the. |
7 | control section 110 judges whether the magnetic head has arrived at the sector before the certain number of sectors from the target sector by obtaining information on position of the magnetic head from the svc 116 then the process shifts to step s 108 in step s 108 the control section 110 supplies the current to the heater 126 h of the magnetic head based on the table specifically the control section 110 passes information of the current to be supplied to the heater control circuit 121 a at first then based on the information the heater control circuit 121 a supplies the current to the heater 126 h via the heater driver 121 h the process then shifts to step s 109 in step s 109 the control section 110 judges whether or not the magnetic head has arrived at the target sector by comparing information related to the request from the host unit stored in the ram 114 and the information on the position of the magnetic head obtained from the svc 116 when the magnetic head has arrived at the target sector the process shifts to step s 110 in step s 110 the control section 110 executes the read or write operation based on the information on the request from the host unit stored in the ram 114 then the process ends thus it is possible to expand the magnetic head in a sector whose error rate is high on the same track therefore it. |
3 | cells to exit from the cell cycle would have useful applications in gene therapy of proliferative disorders such as cancer or psoriasis because human and mouse p53 proteins form complexes in cells the construct containing mouse p53as cdna is claimed for the purposes of gene expression in mammalian cells and nonmammalian cells for research purposes including human cells and for gene therapy in humans in addition a purified plasmid construct containing the human p53as homologue of mouse p53as defined by insertion of human intron 10 sequences into a sequence containing wt p53 dna as defined in original patent application ser no 08 100 486 is claimed for research purposes in mammalian and nonmammalian cells and for gene therapy in humans table 1 shows reactivities of antibodies against p53 proteins mouse p53 has 390 amino acids human p53 393 amino acids all antibodies are mouse monoclonals commercially available from oncogene science cambridge mass except apas rabbit polyclonal specific for p53as protein which was made in dr kulesz martin 39 s laboratory rpci sources oncogene science catalogue p 8 1992 vajtesek et al j of immunolog methods 151 237 244 1992 a wade evans a and jenkins j r embo j 4 699 706 1985. |
7 |
{"publication_number": "US-6077305-A", "abstract": "a system and method are provided for selectively inferring latch elements in a circuit design from an event - driven hardware description language file to an event - independent format . the method includes modeling the file as a plurality of data flow equations , analyzing the plurality of equations for uninitialized variables , and placing a latch at any utilized , uninitialized variable . control signal information for an inferred latch is also derived during the data flow analysis .", "application_number": "US-21564598-A", "description": "referring first to fig1 data flow analysis provides a perspective on circuit design necessary for the latch inference method and system of the present invention . data flow analysis is a set of techniques for collecting information regarding how data values are modified and accessed across basic circuit blocks ( wherein a basic block is a linear sequence of simple statements free of pauses and branches except at the end ). data flow information is collected by setting up and solving a system of data - flow equations of the form shown in fig1 which can be read as , &# 34 ; the information available at the end of a statement s ( out [ s ]) equals the information generated in s ( gen [ s ]) plus the information available at the beginning of s ( in [ s ]) excluding the information killed in s ( kill [ s ]).&# 34 ; referring next to fig2 we find an example of data flow analysis leading to latch inference . we assume that out [ s 1 ]={ a , b , c |
4 | shown to be useful to use a material for the elastomeric component 20 or the coating 27 of the extension 15 which is of greater hardness than the folding bellows 7 this ensures greater structural stability and abrasion resistance and in turn a constant gap dimension s over the entire life of the washing machine in these embodiments a covering ring of chromium steel may be placed on the upper end 16 of the extension 15 not shown in the variant shown in fig3 the elastomeric component of the extension is molded onto the folding bellows this component is provided with a receiving slot 30 in which an angled support ring 17 see fig1 is supported it is thus possible after aligning the extension 15 to attach the extension 15 and the folding bellows with but one clamping ring 10 this requires accepting the disadvantage of the extension 15 also consisting of the material of lower hardness which must be used for manufacturing the folding bellows 7 fig4 depicts an embodiment in which the extension 15 a is unitary with the folding bellows 7 a the extension 15 a consisting of a hard material and the folding bellows 7 a consisting of a soft material e g of a soft elastomeric material it may be fabricated for instance in a two component injection molding process. |
5 | or more screws 16 connect the wall panels 12 together in one embodiment these screws 16 are high tech 2 000 lb shear strength screws measuring u00bc u2033 u00d7 1 u00bd u2033 fig4 shows a roof to wall connector 30 that may be composed of 16 gauge red iron or other material the position of the roof to wall connector 30 can be seen in relation to the wall panels 12 and roof panels 14 in fig2 roof to wall connector 30 sits on the top of the wall panel 12 and connects the wall panel 12 to the roof panel 14 the roof to wall connector 30 may run the total length of the wall panel 12 or a portion of the length of the wall panel 12 the top linear portion of the roof to wall connector 30 is bent at an angle that facilitates the desired roof pitch of the building the connector is made of 16 ga red iron it sits on the top of the wall and connects the wall to the roof panel the connector usually comes in 16 feet lengths and runs the total length of wall the 5 u2033 side is bent at the angle depending on what the roof pitch is there are u00bc u2033 u00d7 1 u00bd u2033 tech screws that are screwed through the multiply of the panel the screws go through 4 layers of the tongue and groove at the point where the panels slide together the footer connector 20 in fig5 forms an u201c l u201d shape and may be made of 16 gauge red iron. |
4 | includes diester of rosin acid and propyleneglycol representative of formula iv the peak d includes the compounds expressed by the above formula i formula xi and formula xii it seems clear by comparing fig4 with fig5 that the production states of the peak c d and e are different particularly the peak area of c and d is large and the ratio of rosin acid part peak a is small in synthesis example 4 fig4 this suggests that the esterification to obtain the desired compounds proceeds effectively on the other hands in the view of the fact that the peaks of c and d are small and the detection start time of the peak e is before 1 40 10 minutes in the comparative synthesis example fig5 it is found that the expansion toward the higher molecular compounds is large and entirely different compounds are produced depending on the reaction conditions therefore diresinate of dihydric alcohol rosin and maleopimaric acid expressed by formula xi or formula xii is contained at the effective amount about more than 20 by weight in the neutral papermaking in synthesis example 4 but they do not reach the effective amount in comparative synthesis example 10 parts of ammonium salt of arylnonylphenol eo 9 mol added sulfate 45 parts of methacrylic acid 15 parts of n butylmethacrylate 25 parts of styrene 5 parts of u03b1 methylstyrene 2 parts of dodecylmercaptan 7 parts of sodium dodecylbenzenesulfate 350 parts of ion exchange water 10 parts of 10 of ammonium persulfate aqueous solution were mixed and agitated in the four neck flask for 1000 cc provided with an agitator a thermometer a reflux condenser and a tap funnel and they were kept at 85 u00b0 c for 5 hours and cooled to 50 u00b0 c then. |
7 | way of illustration only and not by way of limitation various substitutions modifications additions and or rearrangements within the spirit and or scope of the underlying inventive concept will become apparent to those skilled in the art from this disclosure software implementing embodiments disclosed herein may be implemented in suitable computer executable instructions that may reside on one or more computer readable storage media within this disclosure the term u201c computer readable storage media u201d encompasses all types of data storage media that can be read by a processor examples of computer readable storage media can include random access memories read only memories hard drives data cartridges magnetic tapes floppy diskettes flash memory drives optical data storage devices compact disc read only memories and other appropriate computer memories and data storage devices as used herein the terms u201c comprises u201d u201c comprising u201d u201c includes u201d u201c including u201d u201c has u201d u201c having u201d or any other variation thereof are intended to cover a non exclusive inclusion for example a process product article or apparatus that comprises a list of elements is not necessarily limited only those elements but may include other elements not expressly listed or inherent to such process product article or apparatus further unless expressly stated to. |
7 | shape of the tensor defines the type of information captured point curve or surface element and its size represents the saliency by saliency the perceived importance or confidence of the probable structures such as surfaces curves junctions and regions are determined for instance a point on a smooth surface is represented by a tensor in the shape of an elongated ellipsoid stick tensor with its major axis along the surface normal the input tokens are first encoded as tensors a point is encoded as a 3 d ball tensor for the purpose of coherent feature extraction a saliency field can be computed using the tensor voting procedure at any given point votes are casted by all other data points using voting fields derived from the fundamental 2 d stick voting kernel developed by medioni et al the magnitude of the vote decays with distance and curvature according to the following equation where d is the distance along the smooth path arc length u03c1 is the curvature of the path and u03c3 is the scale of the voting field that essentially controls the size of the voting neighborhood and the strength of the votes vote accumulation is performed by tensor addition or equivalently by addition of 3 u00d7 3 matrices in the 3 d case therefore it is computationally inexpensive surfaces are extracted. |
3 | afford the n protected symmetric biphenyl peptides 6a c boc protecting groups are removed by treating 6a c with acid the crude product can be subsequently reacted with various alkyl or aryl acetyl chlorides to produce the final acylated products 7a c an alternative synthetic route as shown in scheme 2 below can be used to obtain symmetric dithiazolylbiphenyl analogs 7a c in this synthetic route the essential intermediate 4 4 u2032 bis 2 s pyrrolidin 2 yl thiazol 5 yl biphenyls compounds 5a c can be prepared in a similar manner as shown in scheme 1 subsequent coupling of 5a c with compound 8 affords analogues 7a c modification of the synthetic routes shown in schemes 1 and 2 leads to preparation of certain compounds of this invention for example various multi heteroaryl moieties of the compounds of this invention can be synthesized by coupling heteroaryl bromides e g 12a u02dc c 16a u02dc c or 21a u02dc c shown in schemes 3 6 below with arylboronic ester derivatives e g 13a u02dc c 20a u02dc c or 22a u02dc c also shown in schemes 3 6 below as shown in scheme 3 below a simple method can be utilized to directly convert commercially available n boc l proline 9a u02dc c into primary amide 10a u02dc c in good yield by using ammonium carbonate. |
8 | the switch to the board by means of a fastener and wave soldering the at least one terminal to the printed circuit board after the connecting step application_number US 73349091 A description as shown in fig1 the apparatus 10 according to the invention generally includes a printed circuit board 12 a device 14 which is preferably a switch 16 mounted on the board 12 and fastening structure 18 for connecting the device 14 such as the switch 16 to the board 12 the circuit board 12 fig1 comprises a conventionally constructed substantially flat substrate 20 made of a resin impregnated plastic material such as fiberglass which includes opposed surfaces 22 and a plurality of edges 24 one of which is shown in addition the board 12 includes at least one and preferably a plurality of first apertures 26 which are formed in the substrate 20 at predetermined locations so as to extend between the surfaces 22 the board 12 also includes a like number of generally cylindrically shaped electric current conductive annulets 28 which are plated bonded or otherwise conventionally connected to each of the apertures 26 so as to extend between the surfaces 22 further the board 12 includes a like number of elongate electric current conductive leads 30 each of which are also plated bonded or otherwise conventionally connected to either of the opposed substrate surfaces 22 so as to extend from a different one of the annulets 28 and to form therewith. |
2 | combination with the application of a powdered coating material to the element using electrostatic fluidized bed dip coating methods in conventional processes elements having pores or gaps have to be coated several times for example 3 to 10 times with the necessity of using very thin coatings due to the need for overcoming poor pickup and pinhole formation in contrast the process of the present invention is capable of providing virtually pinhole free uniform coating within a limited time and is therefore valuable for improving industrial productivity the following examples are presented to illustrate and explain more particularly the present invention but it should be understood that the present invention is not limited thereby the 34 parts 34 and 34 percentages 34 indicated in the specification and claims are by weight unless otherwise specified tab type polyester film capacitors were coated with a thermoplastic resin a liquid hardener free epoxy resin epicote 828 shell chemical as an undercoat and then the wet elements were coated with an epoxy resin powdered coating material sumiliteresin pr 52121 sumitomo durez for 10 seconds by electrostatic fluidized bed dip coating after elimination of the powdered coating material deposited on the unnecessary parts by means of a vacuum cleaner the coatings thus obtained were cured at 130 u00b0 c for 1 hour however the completed coating showed ooze of liquid epoxy resin and pinhole formation in 48 elements out of the 50 elements treated in total and moisture protection was insufficient for practical purpose tab type polyester film capacitors were first coated with a mixture of 100 parts of a liquid epoxy resin epicote 828 shell chemical. |
3 | fragments were prepared in a mixture of porcine mucosal heparin 50 mg ml and purified heparinase heparin lyase ec 4 2 2 7 derived from flavobacterium heparinum 5u mg 1 u 1 u03bcmol bonds cleaved min both in buffer consisting of 0 25 m sodium acetate and 0 0025 m calcium acetate at ph 7 this mixture was shaken at 30 u00b0 c until the reaction reached completion the ph of the mixture was then adjusted to ph 4 and the enzyme was removed by passage over a column containing sp sephadex c 50 the eluent containing the polysaccharide mixture was adjusted to ph 7 and freeze dried the polysaccharide mixture obtained as described in example i was dissolved in water 500 mg in 2 ml and was loaded onto a column packed with fractogel tsk f40 80 u00d7 2 5 cm and eluted with 1 m ammonium bicarbonate buffer at 0 3 ml min the eluent was diluted with water and its absorbance was measured at 232 nm fig1 six distinct peaks were observed representing from last to first eluted disaccharide mixed tetrasaccharide fragments mixed hexasaccharide fragments mixed octasaccharide fragments mixed decasaccharide fragments and mixed higher oligosaccharide fragments these peaks were identified on the basis of elution volume as compared to heparin and chondroitin derived standards of known molecular weight and by their absorbence at 232 nm based on a reported molar absorptivity of 5 2 u00d7 10 3 m 1 each sized fragment mixture 1 mg in 0 01 ml was then applied to a strong anion exchange high performance liquid chromatography column and eluted using 180 ml linear gradient y 1 5 u00d7 10 4 m sec u00d7 0 2 m sodium. |
5 | ridges of the wall in the positions shown before the wall is fastened in place the precise position for adhering each block 126 will be determined by spacing the horizontal rows of blocks 126 at the vertical positions of each horizontally extending girt see fig2 this enables the user with all of the blocks 126 adhered to place the panel 112 over the draped insulation 118 and hold the panel 112 in place then each fastener 116 e g self tapping screw can be screwed through the panel 112 outside of where each block 126 exists through the block and bite into the girt outer flange 124 once all of the fasteners 116 have been installed the panel block assembly will be secured to the building but significant open space will be created by the distance between the panel 112 and the girt 114 the blocks 126 create this space this space created not only allows for more fluffing of the insulation 118 between the girts 114 but also allows for the fluffing into the spaces created between the blocks along the girt flange fluffed blanket insulation is considerably more effective as a heat barrier than insulation that is matted down thus a much higher percentage of the wall panel 112 is. |
7 | of the i o module itself is not provided by the software address 83 memory 64 also includes an i o map table 84 shown as a five column multi row table where elements in each row are linked together each software address 83 including all of its extensions associated with a particular i o module starts a separate row of the i o map table 84 thus the i o map table 84 links software addresses 83 identifying a particular i o module 20 to information about the i o module 20 the first piece of information after the software address in each row of the i o map table 84 is the physical address 85 of the i o module 20 providing the interface between the control point 23 and the industrial control system 10 identified by the software address 83 referring to fig3 and 4 the determination of the physical addresses 85 will be described with respect to a more complex control system incorporating a central controller 26 in a rack 12a having three i o modules 20 at slots 3 4 and 5 of an 8 slot rack these slot numbers provide part of the physical address of the i o modules 20 which for clarity will be assumed to equal the slot number although in practice the address of the first slot is normally zero at slot 8 of rack 12a a 34 bridge 34 communication module 24 connects the rack to a communications link 27. |
6 | trough deformation during grouting process the culvert being repaired should be cleaned prior to installing the rib and trough system of the invention any obstruction s such as any that protrude more than u215b u2033 from the inner surface of the culvert any loose pipe pieces and any solid objects should be removed if the host pipe 1 has become oval or weakened because of structural deformation it should be repaired before the rib and trough installation is begun as shown in fig1 temporary supports 2 can be used to secure the culvert under repair troughs should be laid out before the ribs are installed also if the bottom of the host pipe is damaged sufficiently it might be necessary to add cementitious grout or other filling material to the hot pipe as indicated schematically by reference numeral 8 in fig8 the troughs can have lengths of four or eight feet and can be cut for shortening as needed and can be abutted end to end to accommodate the length of the culvert that is host pipe in need of repair in the case of a culvert in the form of corrugated metal pipe cmp supports from closed celled polyethylene foam foam sealer should be placed in the pipe under the curved edges of the troughs as would be done as shown in fig2 such foam sealer can be adhered to the crest of the cmp as a close loop the rib can then be transported into the pipe in some cases the ribs are disassembled for easy access the repair. |
5 | oriented bolts is a lock 108 which is tightly fixed at each of its ends to the bolts via attachment members that are seen clearly in fig3 and that will be described below as a consequence of this tight fixing the substantially axial displacement of the bolt from the locked to the unlocked position is accompanied by a contraction of lock 108 and the opposite displacement of the bolts is accompanied by an extension of the lock the lock 108 is linked to a control mechanism shown schematically as box 110 the control mechanism may be a separate unit linked to the lock by wire or wireless link and may also by some examples be integral with the lock the control mechanism is adapted to receive an access control signal which may be a knocks based access control signal of the kind disclosed in pct publication no wo 98 39539 in which case the control mechanism may include an acoustic pick up sensor of the kind disclosed in pct publication no wo 01 59238 it should further be noted that the invention is not limited to a control mechanism housing an acoustic sensor picking up a code encoded as a series of knocks and may be designed for picking up codes transmitted through other means such as visible or infrared light in which case the sensor should have a line of sight to the exterior bluetooth radio waves and other communication links the control mechanism by some examples may also be linked to an external socket accessible to an operator and the code may then be. |
5 | referred to as a sand removing tank 24 or setting pit from this setting pit 24 the compound is pumped by means of the second vane pump 25 through a sand removing unit 26 which may comprise one or more hydrocyclones 27 preferably a plurality of hydrocyclones in parallel and also a classifying unit for instance implemented as an optional vibrating screen 28 from the bottom of the hydrocyclones 27 wet particles 29 having a relatively large but not classified size fall out while water including very small particles of the crushed drill cuttings dispersed or emulsified therein shall flow out from the top of the hydrocyclones this dispersion comprising the small drill cuttings and water is led up into a third container which may be referred to as an output tank 30 and from this the dispersion is pumped further by means of the third vane pump 31 to the last tank 32 which may be referred to as an injection tank the pump 31 used at this stage may also preferably be a so called agricultural pump if the output tank 30 is overfilled the overflow shall be guided backwards arrow 33 to the setting pit 24 as long as the injection tank 32 comprises a redundant amount of liquid this redundant amount will flow backwards via the feedback tube 34 to the output tank 30 the dispersion therefore shall circulate in the plant all the time and it will be thickend steadily more as more solid matters 20 are added considering the particles falling out from below the hydrocyclones 27 these particles will fall down into a gathering pan after having passed through the meshes in an. |
3 | res 55 179 stappenbeck t s hooper l v amp gordon j i 2002 proc natl acad sci usa 99 15451 15455 this assay employs confocal laser scanning microscopy of 120 u03bcm thick sections of intestine harvested from mice that have been subjected to ventricular perfusion with a solution of either fluroescein conjugated high molecular weight dextran or rhodamine b labeled gelatin two sets of comparisons may be made a adult germ free fvb n cr2 tox176 transgenic versus normal littermates i e animals without and with paneth cells in jejunal crypts respectively b adult germ free nmri mice versus age and gender matched ex germ free animals colonized for 10 and 35 d with an unfractionated ileal cecal microbiota purified angiogenin 4 can be assayed for bactericidal activity using conventional methods for instance it can be incubated with members of the normal intestinal flora e g e coli b thetaiotaomicron clostridium spp lactobacillus spp various intestinal pathogens e g s typhimurium shigella flexneri campylobacter jejuni a rnase with known bactericidal activity is suitably used as a positive control human eosinophil cationic protein lehrer r i et al 1989 j immunol 142 4428 4434 purified angiogenin 4 obtained as described in example 2 was assayed for bactericidal activity against several gram positive and gram negative intestinal pathogens and commensals the percentage of colony forming units cfus remaining after exposure to increasing concentrations of purified ang4 was determined and is shown in fig1 a bacteria were grown to mid log phase and resuspended in 10 mm sodium phosphate buffer ph 7 2 initial bacterial concentrations ranged from 10 5 to 10 6 cfu ml after incubation. |
6 | damage signals to the central monitoring facility application_number US 99971401 A description fig1 illustrates a pipeline monitoring system 10 according to a preferred embodiment of the invention as shown in fig3 the pipeline p being monitored may include a plurality of pipe sections which are land based and underwater the wide variety of environmental conditions which the pipeline may be exposed are known to those skilled in the art positioned along the pipeline are plurality of monitoring stations 20 with one such station being shown in fig1 the number of monitoring stations will depend on the length of the pipeline being monitored and literally hundreds or thousands of monitoring stations may be monitored according to the system of the present invention each monitoring stations communicates with a central monitoring facility 50 as discussed below each monitoring station 20 serves as a data collection unit a data transmission unit 22 which may include an antenna and related communication circuitry such as that offered by quake global communications forwards the sensed data via satellite 60 to the central facility 50 a magnetic pig position detector 24 is positioned close enough to the pipeline so that the magnetic field developed within the pipe by the pig is detected thereby signaling pig position the monitoring stations 20 may be installed when the pipeline is first laid or may be a retrofit to an existing pipeline the monitoring stations may be conveniently positioned at pipeline warning signs typically positioned at road or waterway crossings referring still to. |
9 | 10 u2033 to case ground 12 on each of the brush leads 13 14 16 to eliminate noise generated by arcing caused by commutation of the brushes components such as inductor 20 and capacitor 22 form a low pass filter to reduce eliminate noise generated by a low speed brush 18 inductor 24 and capacitor 26 form a filter to reduce eliminate the noise generated by a high speed brush 28 while inductor 30 and capacitor 32 form a filter to reduce eliminate the noise generated by common brush 34 capacitor 38 represents the parasitic capacitance that exists between the motor case 40 and the armature 42 the ac sources 43 next to each brush 18 28 34 are intended to represent conceptually the noise generated by the brush arcing filters 10 10 u2032 10 u2033 work by shunting the noise as indicated by paths p 1 p 2 generated by brushes 18 28 and 34 back to the motor 39 as shown in fig2 prior art filters 10 10 u2032 and 10 u2033 are most effective if placed close to the source of the noise in this case the motor brushes 18 28 and 34 thus the loop area available to radiate electromagnetic interference is kept small for this. |
6 | valid application_number US 201314387375 A description a muffler illustrated in fig1 has a muffler housing 1 2 with a housing wall 1 1 the housing wall 1 1 defines an interior space 6 in which an inlet pipe 2 with the outflow openings 2 1 2 2 and two outlet pipes 4 1 4 2 are shown each with an inlet opening 4 5 4 6 the inlet pipe 2 and the outlet pipe 4 1 4 2 discharge via the outflow opening 2 1 2 2 or respectively via the inlet pipe 4 5 4 6 into the coupling chamber 3 a 3 b the coupling chamber 3 a 3 b together with the inlet pipe 2 and the respective outlet pipe 4 1 4 2 forms a flow channel 3 3 3 4 of the outflow opening 2 1 2 2 of the inlet pipe 2 to the inlet opening 4 5 4 6 of the outlet pipe the inlet pipe 2 is guided in the axial direction to a centre axis 1 5 of the muffler housing 1 2 through the housing wall 1 1 and mounted with an open end 2 6 within the housing wall 1 1 the inlet pipe 2 has four outflow openings 2 1 2 4 which are designed as perforation zones with the space of all outflow openings 2 1 2 4 whereby the space of all outflow openings 2 1 2 4 i e the opening cross section ai of the perforation zones 2 1 2 4 within a coupling chamber 3 a 3 b. |
6 | end the frictional lining 4 which may be made of organic material for example of paper fibers and appropriate strengthening components such as resin or glue is of porous structure so that a flow volume of the cooling oil can flow in the direction of arrow 9 from the pressurized chamber 7 into a chamber 8 with lower pressure at a defined pressure differential and with the defined geometric dimensions the flow volume can be optimized by specifying the porosity to increase the flow volume for improved cooling without increasing the pressure the invention proposes that at least one cut out be provided in the friction lining which promises improved distribution of the cooling oil in the cross section of the friction lining in this case cut out 10 is not compressed more severely in a pressing process than the rest of the friction lining which would result in occupancy of supporting part 6 over the entire friction lining surface instead the cut out is removed from friction lining 4 in this way an additional open area 11 appears on supporting part 6 which can be cooled in addition to the corresponding open area 12 by the cooling oil this is beneficial in particular when wet clutch 1 is operated with little slippage for example at low revolutions per minute so that with the slow relative rotation of wet clutch 1 while otherwise wet clutch 1 is engaged the free areas slowly shift and as a result are exposed to the cooling by the cooling oil fig2 shows a partial view of an advantageous embodiment of a friction lining 4 according to the invention as it can be employed. |
6 | inject a quantity of the reducing agent into the exhaust gas flow in a process sometimes referred to as dosing the amount of reducing agent introduced can be dependent upon the no x load of the exhaust gasses the mixing duct 254 uniformly intermixes the reductant agent with the exhaust gasses before they enter the downstream scr catalysts disposed at the end of the mixing duct 254 proximate the rearward second wall 228 can be a diffuser 256 that redirects the exhaust gas reductant agent mixture toward the third and fourth sidewalls 230 232 of the after treatment system 220 the third and fourth sidewalls 230 232 can redirect the exhaust gas reductant agent mixture generally back towards the forward first wall 226 to perform the scr reaction process the exhaust after treatment system 220 can include a first scr module 260 disposed proximate the third sidewall 230 and a second scr module 262 disposed toward the fourth sidewall 232 the first and second scr modules 260 262 may be oriented to receive the redirected exhaust gas reducing agent mixture the first and second scr modules 260 262 can accommodate one or more scr catalysts 264 sometimes referred to as after treatment bricks the term after treatment brick however may refer to a variety of exhaust after treatment devices which scr catalysts are a subset of moreover in different aspects the scr modules 260 262 may be configured to accommodate any different number of after treatment bricks that may be in different shapes sizes and or configurations and that may operate. |
8 | when contact hole etching is performed is deposited on the entire surface to have a film thickness of e g about 80 u00e5 by lp cvd furthermore a dielectric interlayer 28 made of bpsg is deposited and planarized by cmp contact holes are then formed by photolithography and rie in the peripheral circuit region a contact 25 is formed by burying a metal material such as titanium titanium nitride tungsten in the memory cell array region a memory cell bit line contact 24 is formed after that aluminum or the like is deposited on the entire surface and photolithography and rie are used to form a wiring layer 26 such as a bit line in the memory cell array region and a peripheral circuit wiring layer 27 in the peripheral circuit region a dram is completed by forming a stacked capacitor 34 including a plate electrode 35 capacitor dielectric film 36 and storage node electrode 37 in this embodiment as in the first second and third embodiments described above the gate electrode sidewall film thickness is small in the memory cell array region and large in the peripheral circuit region this improves the data holding characteristic in the memory cell array region and at the same time increases the operating speed in the peripheral circuit region by forming the source drain structure as a shallow junction also as in the first and second embodiments a self alignment contact formation process can be applied when the gate electrodes are formed this achieves high applicability to a device having a high integration degree such as a general purpose dram memory cell in this. |
7 | string 5 between frets 10 formed on the surface of the fingerboard 9 in a string taut direction is depressed and urged against the surface of the fingerboard 9 a corresponding fret switch fsw is turned on string trigger switches tsw are housed in the string trigger switch unit 7 and the strings 5 are connected to the string trigger switches tsw when the string 5 is picked or finger plucked a corresponding string trigger switch tsw is turned on thereby generating a musical tone the fret switches fsw embedded in the fingerboard 9 at portions between the frets 10 are arranged as shown in fig2 that is the fret switch fsw comprises a printed circuit board 12 and a rubber sheet 13 fitted in a recess portion 11 formed in the upper surface of the neck 3 i e the fingerboard 9 the rubber sheet 13 is stacked and adhered on the printed circuit board 12 both ends of the rubber sheet 13 are bent in a u shape to hold both ends of the circuit board 12 thereby fixing the circuit board 12 contact recess portions 14 are formed at a position corresponding to each string 5 on the lower surface of the rubber sheet 13 in contact with the upper surface of the circuit board 12 in this case as shown in fig3 n arrays if the number of strings is six as in a guitar the total number of fret arrays is 6n of the contact recess. |
5 | 1 to n are fully off the meandrous current profile is schematically shown in fig2 by the line s in this case as in the case of the exemplary embodiment shown in fig1 the first external connection l 1 is connected to the first touch sensor module a 1 and the second external connection l 2 is connected to the second touch sensor module a 2 in this case too this kind of arrangement of the external connections l 1 l 2 is produced by virtue of the external connections l 1 l 2 being respectively assigned to a pushbutton switch 1 or n which is at a maximum distance from the associated electric assembly b 1 or b n this means that when there is an even number of series connected pushbutton switches 1 to n the two external connections l 1 and l 2 are respectively associated with different actuating modules a 1 and a 2 accordingly it is thus assumed in fig2 that n is an even number by contrast with an uneven number of pushbutton switches and accordingly an uneven number of controllable electric functions the two external connections l 1 and l 2 are respectively associated with the same actuating module fig3 shows another generalization of the exemplary embodiment from fig2 in which an arbitrary number of parallel connected actuating modules a 1 a 2 a m u2212 1 a m having a respective arbitrary number of pushbutton switches 1 2 n u2212 1 n is provided in this case. |
1 | the slope underside 65 it pulls the plate 61 from which the bridge like structures 65 extend in turn causing the plate 61 to pull the central portion 68 of the suction pad 60 away from the counter while the outer portion 69 of the suction pad 60 remains in contact with the counter as the central portion 68 of the suction pad 60 is pulled away from the surface the air pressure between the central portion 68 of the suction pad 60 and the counter decreases creating a partial vacuum under the central portion 68 of the suction pad 60 which in turn causes the outer portion 69 of the suction pad 60 which is still in contact with the counter to adhere to the counter movement of the handle 62 in the opposite direction in the slot 59 relaxes the central portion 68 of the suction pad 60 causes the central portion of the suction pad 60 to move toward the counter increases the pressure under the central portion 68 of the suction pad 60 dispels the partial vacuum and allows the suction pad 60 to be easily removed from the surface to which it is was formerly mated the food spinner 1 is placed in a desirable location on a work surface or counter in this position the outer portion 69 of the suction pad 60 is in contact with the countertop the handle 62 of the suction device 39 is moved in the elongated slot 59 as the handle 62 moves in the slot 59 the central portion 68 of the suction pad 60 is raised upward creating a partial vacuum under the central portion 68 of the suction pad 60 while the outer portion of the 69 of the. |
6 | fuel to motor 24 alternator 3 feeds into microprocessor 34 which controls valve 6a causes its opening and provides the ignition pulse of motor 24 gyroscope 19 triggered by hydraulic pressure goes into operation and through microprocessor 34 acts on the electrically controlled slide valves of hydraulic actuators 20 21 which react to pitching and possible bankings of the unit in flight when it has been released this nay cause motor 24 to be misaligned which motor with its jet corrects by reaction the flight of the unit spiraled part 33 of the motor feed line assisted by the reaction of hydraulic actuators 14 15 brings the motor and its jet back to the correct and pre established course the liquid oxygen contained in tank 12 12a after overcoming the blockage of diaphragmed valve 31 through line 32 provides for cooling of the ejector nozzle and then cooling of the combustion chamber of motor 24 the air which by aerodynamic effect penetrates into front mouth or air intake 35 by a space provided between the shell of tanks 12 and its housing provides for warming of the tank and the contained liquid oxygen by pressurizing it the flight of the unit lasts until the pre established target is reached on which a is released one of the characteristics of the unit described derives from the absence of avionic interface between the aircraft and the munition other characteristics reside in the fact that following the launching direction and altitude of flight which initially were provided by the carrier are preserved by the automatic functioning of the on board systems comprising a gyroscope variometer and swiveling motor another but not final characteristic derives from the inexpensiveness of the unit and its versatility particularly in. |
4 | ratio with 15 alkali and 25 sulfidity charge the alkali was sourced from sodium hydroxide 70 and sodium sulfide 30 weak black liquor u02dc 20 solids was used to makeup liquid digester additives lipohydrophilic glycerol based polymers were added to the black liquor which was mixed well and then combined with the white liquor all cooks began at 55 u00b0 c and the temperature was quickly ramped to 170 u00b0 c for a total cooking time of 3 hours after that the cooking capsules were placed under cold miming water for approximately 10 minutes the contents were then transferred to cheesecloth and squeezed under warm water to remove the majority of cooking liquor the pulp was then diluted with warm tap water to 800 ml and disintegrated in waring blender for 30 seconds the resulting slurry was transferred to cheesecloth and washed three times with 800 ml of warm tap water the pulp was broken down by hand into small pieces and all rejects were removed the resulting pulp was oven dried overnight and weighted the pulp was allowed to dry in the cth room for 4 days to an average consistency of 92 kappa numbers were determined using tappi test method t 236 samples were prepared of lipohydrophilic polyglycerols and were compared with a. |
7 | the calculation of the values tf ts tm and th are the same as the above described equations 26 to 32 and therefore the description is not repeated the calculation of the values tf ts tm and th are the same as the equation 33 to 37 so that the description is not repeated although conversion between the smpte ebu film time code and the digital audio interface time code by sample by sample has been described in the foregoing equations for conversion may be provided in the similar manner for other types of time codes based on the idea of the seventh embodiment the smpte ebu film time code recorded in the dat may be converted into the digital audio interface time code transmitted by the channel status data for professional use to be outputted the reverse operation is also possible an eighth embodiment will be described in which user data of the digital audio interface are all recorded by using a plurality of packs and pack number indicating the order are added thereto fig5 is a schematic block diagram of the eighth embodiment the structure of the embodiment shown in fig5 is the same as that of the prior art shown in fig5 except a user data pack generating circuit 150 a user data dividing circuit 151. |
7 | portion 42 is unjacketed to the core and treated to form a chemical sensor a reactive chemical such as 3 aminopropyltrimethoxysilane can be used as an adhesion promotor that bonds derivatized pah 39 s i e sulfonated perylene to the optical fiber a preferred method of bonding the pah 39 s to the optical fiber is through an entrapment mechanism a polymer solvent mixture is used to solubilize and entrap pah compounds then used as a coating on the optical fiber to form the chemical sensor the fluorescence of the chemical sensor is excited by light transmitted through the fiber and subsequently detected by light monitoring means such as a spectrometer through window 32 as in fig2 when the particular explosive molecules enter the chamber 20 the airborne explosive molecules interact with the pah and reduce the fluorescence the reduced fluorescence on the tip 42 is detected by the light sensing means the relative decrease in fluorescence can be extrapolated into a relative quantity of explosive mixture molecules in the airstream directed through chamber 20 in fig3 a quenching plot of the chemical sensor optical fiber due to tnt exposure is shown in this plot the fluorescent intensity of the encapsulated pah coating is plotted as a function of time a baseline fluorescent intensity is established in the region indicated by a at point b the sensor is exposed to tnt vapor in the region indicated by c the fluorescent intensity decreases as a result of interaction of the tnt with the encapsulated pah coating at point d tnt. |
2 | quantity to inflate the air bag 34 causing the air bag to break out of the cover 42 and expand into the passenger compartment one of the features of the present invention is a safety interlock arrangement which prevents the rollers 76 and 78 from moving inadvertently when the safety unit is not in use the interlock is automatically released when the safety unit is mounted in position on the steering wheel as shown in fig2 the safety interlock includes a generally l shaped lever 90 one leg of which extends along the outside of the sensor housing 50 and terminates in a projecting pin 92 which extends through an opening 94 in the housing the pin 92 is sufficiently long to project into an opening 95 extending through the center of the roller 78 the outer leg of the l shaped safety lever terminates in a projection 96 which is positioned to engage the hub portion of the steering wheel when the safety system is properly mounted the l shaped lever 90 is pivotally supported by a pin 98 so that a pressure against the projection 96 causes the lever to pivot in a direction to withdraw the pin 92 from the hole 95 in the roller 78 a wire coil spring 100 wrapped around the pivot pin 98 normally urges the pin 92 down into the hole 95 to lock the roller 78 when the safety unit is in position against the hub of the steering wheel the action of the spring 100 is overcome and the pin 92 is automatically withdrawn freeing the rollers 76 and 78 to move in the manner described above when the unit is dismounted the pin 92 automatically locks the roller 78 again the sensor element as described. |
4 | pump p 20 the line a 2 on the pressure side of the pump p 20 is connected to the hydrocyclone plant 20 to form the feed of its first centrifugal cleaning step 20 a 1 in the embodiment of fig2 b the hydrocyclone plant 20 situated in the short circulation of the paper machine includes centrifugal cleaning steps 20 a 1 20 a 2 and 20 a 3 an accept line a 3 leads further from the first hydrocyclone i e the centrifugal cleaning step 20 a 1 of the hydrocyclone plant 20 into connection with a stock line b 1 of a second stock chest 10 a 2 in the embodiment wire water from the paper machine is passed to a wire pit 110 through a line d 1 which wire pit 110 in this embodiment is formed by a planar wire pit structure a so called flume which comprises a horizontal flow path for wire water said wire pit 110 removes effectively air in bubble form from the wire water and pre deaeration of the wire water is accomplished by means of said wire pit type the wire water is passed from the wire pit 110 through a discharge line d 2 and a pump p 30 to a deaeration tank 13 a 3 from which there is further a discharge line f 3 leading into connection with the line b of the stock m 2 of the second stock chest 10 a 2 via a mixing device 12 the line f 4 leads further from the discharge line f 3 of the deaeration tank 13 a 3 into connection with the line a 1 of the stock m 1 of the. |
5 | gas is brought to the surface the controlled rate of gas could flow through the riser boost line if the annular preventer is closed during a well control event in the main borehole small amounts of gas in the riser 108 can be mitigated with a riser gas handler below the slip joint and or with a diverter at surface which can give sufficient back pressure to control the flowrate should the gas surface it may do so rapidly and at a high rate with little warning without early detection of the gas if there is gas in the riser 108 and a significant amount of gas in the main wellbore simultaneous riser and well killing is performed in one embodiment this is a complex procedure and can split the attention of the operations personnel leading to oversight or error when done manually automation of the riser gas handling reduces such a risk by focusing attention on well established primary well control techniques for the main wellbore in a process controlled by the icis 204 international association of drilling contractors iadc well control procedures for deep water recommend that personnel be minimized on the rig floor when there is gas in the riser due to the severity of the risk methane gas detection and rig automation is another way of ensuring minimum risk of exposure of rig personnel to hazardous situations a number of variations and modifications of the disclosed embodiments can also. |
1 | bar 11 if 1 player 39 s piece hits any other player 39 s piece but 2 39 s secondary opponent then that piece goes back to the first available playing point when playing with three players all bumps go back to the dividing bar 11 because all three are primary opponents the dividing bar 11 is the middle strip that separates the inner and outer tables and bisects the board widthwise once one of a player 39 s pieces has been placed on the bar he must throw the dice when his turn occurs and must 34 enter 34 into his primary opponent 39 s inner table before he may move any of his other pieces entering is accomplished by moving the piece on the dividing bar 11 to the playing point indicated on either one of the die thrown as long as that point is not blocked if he cannot enter because both playing points indicated are blocked the turn passes to his opponent when all playing points within the primary opponent 39 s inner table are blocked a closed board or shutout occurs bearing off means removing a player 39 s pieces from the playing board by the roll of the dice a player cannot start bearing off until all 10 of its pieces are in his inner table he may then either bear off pieces from. |
8 | in the circuit of fig2 an inductor 32 is connected in parallel with the ntc resistor the capacitor resistor pair form a series damping filter for suppressing the conducted emissions using switching frequencies of the order of 600 hz 16 khz emissions are generated by the power electronic circuits as described the ntc resistor in the filter is self protecting as the current flowing to earth through the filtering capacitor increases the ntc resistor heats up and the resistance of the ntc resistor decreases thereby enabling it to stay within its power rating as the magnitude of the noise currents and emissions increases the equivalent fixed resistor in the current circuit would have to be much larger and therefore more expensive if it is to be sufficient to cope with the anticipated power the inductance is small u2014 of the order of micro henrys u2014 across the ntc resistor it acts as a shunt to divert high frequency current to reduce the power dissipation in the ntc resistor this does not directly affect the conducted emissions but it does assist by damping the resonance when using an ntc resistor with a lower current rating and or power rating this enables the ntc resistor to be smaller in size and cost than would otherwise be the case fig3 6 illustrate alternative locations for the ntc damped filter circuit as can be seen from fig3 it can be installed on either of the dc rails it can also be installed on the ac side of the rectifier shown in fig4 6 in each case the ntc resistor is preferably connected in series with at least one capacitor per rail to which the ntc is connected in the circuit of fig4 the supply. |
4 | deflection compensated roll is generally designated with reference numeral 110 and it comprises a stationary roll shaft 111 upon which is rotatably fitted a roll shell 112 which is supported on the roll shaft by means of hydraulic loading elements 117 the hydraulic loading elements 117 work in the direction of a nip plane and enable an adjustment of the roll shell 112 regarding its contour and a control of the roll regarding its axial nip profile the roll 110 has its bearing system implemented by means of slide bearing elements whereof the slide bearing elements acting in the direction of loading in the case of a roll shown in fig1 and 2 in the direction of a nip plane are designated with reference numerals 114 and 114 a the first slide bearing elements 114 work in the direction of a nip i e against loading and the second slide bearing elements 114 a work in the opposite direction the exemplary embodiment of fig1 and 2 further shows that the roll 110 is also provided with slide bearing elements 115 115 a working laterally relative to the loading direction and acting in opposite directions the roll 110 is a roll totally furnished with slide bearings which is also provided with slide bearing elements 116 116 a acting in directions axially opposite to each other and abutting against roll ends 113 113 a through the intermediary of an oil film as shown in fig1 and 2 the radially acting slide bearing elements 114 115 114 a 115 a abut against the inner surface of the roll shell 112 through the intermediary of. |
6 | as to provide a very small amount of forward flow a typical forward pressure is one atmosphere u00b1 1 2 inch of water therefore in order to maintain this constant pressure in the reactor waste gases must flow into tube 18 at essentially the same pressure in order to avoid back pressure upstream in order to assure a uniform mixture fuel gases in laminar flow through take 18 are mixed with turbulently flowing air which enters through opening 4 it has been found that when high velocity air flowing through pipe 2 reaches inlet 8 it meets with low velocity gases in pipe 2 a portion of the air therefore enters inlet 8 hits the side wall of pipe 10 at point 26 and centrifugally swirls in the direction of arrow 28 in a preferred embodiment the gases which flow through tubes 18 are at least combustible and are usually pyrophoric since pyrophoric gases ignite spontaneously when contacted by air a separate ignition source might not normally seem necessary however to assure combustion the invention provides ignition means 16 as added reliability for the apparatus furthermore when merely combustible gases such as hydrogen are used an ignition source certainly is desired if not necessary to add further reliability to the apparatus the ignition spark plug 16 may be provided with a platinum tip to catalyze ignition when hydrogen. |
4 | to 1 wt preferably 0 5 to 1 wt based on the fabric to increase the strength optionally a binder is present in an amount of 0 01 to 5 wt preferably 0 1 to 0 5 wt based on the fabric preferably in form of an acrylic resin or epichlorohydrin based resin such as polyamide polyamine epichlorohydrin resins or polyamide epichlorohydrin resins other examples for suited binders are polyethylenimine resins and aminoplast resins any type of pulps are suited especially softwood pulps hardwood pulps or a pulp made from plants like abaca or bamboo the dispersible nonwoven fabric according to the invention has a wet tensile strength in machine direction of 2 to 20 n 5 cm preferably 3 to 13 n 5 cm and most preferably 3 to 7 n 5 cm based on a basis weight of 60 g m2 and in cross direction 1 to 10 n 5 cm preferably 1 to 7 n 5 cm and most preferably 1 to 3 n 5 cm the wet tensile strength has been measured according to the edana method wsp 110 4 09 u201c standard test method for breaking force and elongation of nonwoven materials strip method u201d one standardized test method for testing the properties of disposable wipes is known from u201c edana guidance document for assessing the flushability of nonwoven consumer products u201d this test is used to assess the dispersibility or physical breakup of a flushable product during its transport through household and. |
1 | is not tightened a passage is formed for the shaft of the anchoring screw 62 over the length of the elongated hole 61 with this arrangement the diaphyseal anchor 4 can optionally be fixed in three catch positions that determine its height at the diaphysis 72 in the embodiment of fig2 to 4 the screw head is seated in the central catch seat each catch seat protects the fixed diaphyseal anchor 4 in a simple manner against movement directed away from the epiphysis 71 along the diaphysis 72 at the desired height particularly effective support in a direction transversely to the shaft of the anchoring screw 62 is obtained other suitable catch connections or similar locking connections which adjust the height of support can be set up in this case the connecting anchoring elements are designed and dimensioned in such a way that the arrangement at the diaphysis 72 corresponding to the flat dimension of the flat web 41 remains particularly flat the fixation pins 3 as can be seen from fig1 to 4 are designed as screws with a thread extending over its length full thread appropriately as cannulated banjo screws these are in each case passed through internally threaded transverse through bores 24 which are provided exclusively in the main body 21 of the supporting body 2 this being in such a way that the screws 3 come to lie in a crossing arrangement each screw each fixation pin 3 is attached by means of the screw connection at a fixed angle to the. |
7 | fig1 for the articulation of the ribs 5 in the bearing body 7 instead of the radial slots it is also possible to provide bores arranged in a circle on or in the bearing body especially through bores in the bearing body 7 that are elongate in the radial direction which bores provide a connection between the side of the bearing body 7 facing the canopy 3 of the reflector 1 and the side of the bearing body 7 remote from or opposite the canopy 3 of the reflector 1 in principle however there are also other possible ways of effecting articulation of the ribs 5 on the bearing body 7 in such a way that the ribs 5 are able to pivot into their open position and vice versa in the embodiment of the invention shown in fig1 a force effect is exerted on the projecting portions 9 of the ribs 5 by a pressure plate and especially by a pressure ring 11 which in this case by way of example has substantially the same outer diameter as the bearing body 7 the pressure ring 11 is arranged substantially parallel to the bearing body 7 more specifically on the side of the bearing body 7 opposite the canopy 3 furthermore the pressure ring 11 is joined to the bearing body 7 by way of a plurality of guide bolts 13 the bearing body 7 and the pressure ring 11 are movable relative to one another so that the spacing between them can therefore be altered displacement of the pressure ring 11 can. |
2 | the process environment and adversely affect the material or device being polished referring now to fig2 which shows an isometric view of one embodiment of the retaining ring of the present invention retaining ring 201 has a generally annular body having an upper portion 203 a lower portion 204 an inner portion 205 and an outer portion 206 retaining ring 201 may be made of any plastic material known in the art such as polycarbonate polyethylene terpthalate polyethersulphone polyetheretherketone polyphenelynesulfide and others the diameter of retaining ring 201 may be any diameter commonly known in the art the upper portion 203 of retaining ring 201 is configured with a plurality of rigid inserts 202 inserts 202 may be made from stainless steel or other materials either metallic or non metallic that are more rigid than the material of retaining ring 201 in some embodiments inserts 202 have parallel sides and semi circular ends as further described below inserts 202 are positioned in the upper portion 203 of retaining ring 201 such that the upper portion 203 of retaining ring 201 is substantially flat and may be readily affixed to a chemical mechanical polishing carrier head in addition the location of inserts 202 is such that when the retaining ring 201 is affixed to a carrier head inserts 202 do not come into contact with the. |
5 | in the longitudinal direction by means of a spring pin terminating at the transmitter housing 13 is a rod linkage 15 which is bolted thereto on the other end of the transmitter housing 13 the transmitter housing 13 has a collector space 10 in which a pressure sensor 1 can be housed the pressure sensor 1 can be designed as one unit with a locating probe and a transmitter for wireless transmission of the measured or determined values of the pressure sensor 1 there are longitudinal slots 14 in the area of the collector space 10 in the transmitter housing 13 for wireless transmission by the transmitter the pressure sensor 1 is separated from the drilling fluid intended for flushing which is routed to the drill head 4 via a drilling fluid feed line 3 by means of a seal 2 the collector space 10 and thus the pressure sensor 1 has a fluid connection with the exterior compartment u2014 the drilling channel 6 via a bore 5 the fluid in the drilling channel 6 can thus enter the transmitter housing 13 via the bore 5 and a pressure sensor 1 is in contact with the fluid in the drilling channel 6 in order to measure that same pressure the bore 5 extends transversely with respect to the longitudinal direction of the transmitter housing 13 a filter 7 disposed between the bore 5 and the. |
4 | rejects for both cooks was 0 10 the viscosity of the cooking medium with the additive was 12 62 sec ced and without the cooking additive was 11 45 sec ced the viscosity noted for examples 11 and 12 above provides a measurement of the cellulosic fiber length in normal cooks without using the present inventive additive viscosity rises and falls with a rise and fall in the kappa numbers higher viscosity numbers indicate the presence of longer fibers which result in stronger paper as indicated in examples 11 and 12 a drop in kappa numbers did not necessarily indicate a drop in the viscosity when the present composition was employed the esterified product of the polyoxyalkene glycols is produced by way of example only as follows the following components are added in the following percents by weight to a clean dry reactor ______________________________________carbowax peg 1000 polyoxyethylene 35 7 glycol molecular weight of 1000 carbowax peg 4600 polyoxyethylene 26 1 glycol molecular weight of 4600 pluracol p2000 polyoxypropylene 11 2 glycol molecular weight of 2000 oleic acid 27 0 hypophosphorous acid color stabilizer 0 25 methanesulfonic acid catalyst 0 25 0 50 ______________________________________ the mixture is then heated at a temperature of between about 190 and 200 degrees celsius with a. |
5 | bitumen heavy oil or another oil and extracting them from a reservoir 110 fig1 illustrates a configuration of the preferred embodiment of the system that generates a syngas with a rather high temperature and pressure that is injected into an injection well while it may not be practical to inject syngas with such high temperatures and pressures this figure is useful for understanding some of the novelty of the invention after fig1 is discussed other figures that implement more detailed and more practical systems and methods such as those which reduce the temperature of the syngas before it is injected into a well are discussed further in fig1 fuel is input to a high pressure gasifier 102 through a feed line 101 along with oxygen from line 120 and steam from line 121 the fuel is partially burned in the gasifier with the oxygen and steam to generate a high temperature high pressure syngas the high temperature and high pressure syngas includes primarily hydrogen and carbon monoxide in this configuration of preferred embodiment the ratio of hydrogen to carbon monoxide in the syngas is in the range of 2 to 3 1 the high pressure gasifier 102 that generates the syngas can be a market available high pressure gasifier such as the zeep zero emissions energy plant gasifier developed by pratt and whitney rocketdyne u s pat no 7 547 423 describes other aspects of a high pressure gasifier the contents of which are incorporated herein by reference the system 100 injects the syngas at a controlled temperature into the reservoir 110 to heat crack hydrogenate and upgrade heavy oil insitu cracking the heavy oil in the presence of hydrogen can. |
7 | 14 are apparently self excited and predominantly at the natural frequency and the first and second overtones of the control rod all frequencies less than 20 hz for a typical control rod these vibrations are believed to be the result of guide tube flow effects caused by driving forces related to the periodic interaction near the guide post exit 36 of the axial vortices 38 with the diffuser vortex 40 as described above a variety of proposed improvements were tested in a flow loop wherein the dimensions and flow rates were similar to typical reactor operating conditions most of the tested guide posts had very little effect in reducing the vibration of the control rod in the guide tube 14 but the present invention was effective in reducing vibration fig3 shows the preferred embodiment of the invention and fig2 shows the conventional structure which it replaces the control rod 28 being shown in the inserted position as in fig1 the cross section shown in fig2 and 3 is taken along the shoulder portion 46 of the guide post 20 shown in fig1 the prior art guide tube 14 and post 20 shown in fig1 and centered control rod 28 shown in fig2 a typically have a tube inner diameter of about 0 90 inches and a control rod outer diameter of 0 86 inches during full power flow conditions typically about 9 gallons per minute gpm the control rod was found to vibrate with an acceleration of about 0 20 g 39 s the. |
2 | as shown in fig2 in schematic view the boundary between the first filter 53a and the second filter 53b the mesh a of the first filter 53b is divided by the mesh b of the second filter 53b which is smaller than the mesh a a part of the mesh b of the second filter 53b is divided by the mesh a of the first filter 53a therefore the leveled value of the size of the mesh at the boundary between the first filter 53a and the second filter 53b becomes smaller than the size of the second filter 53b and then a lot of the dust having the size smaller than the mesh b of the second filter 53b may be caught at the boundary as the result the substantive size of the mesh at the boundary becomes relatively smaller than the size of the mesh b of the second filter 53b the boundary between the final filter the third filter 53c in this embodiment and the filter 53b which is positioned prior to the final filter the substantive size of the mesh is determined according to a number of layers of the filters 53a 53b and 53c and each of the sizes of the meshes a b and c and then a limit diameter of dust. |
6 | the axial left end of inner structural member 50 extends further out or to the left from the axial end of outer structural member 52 such that the entire axial cylinder 76 of outer structural member 52 is axially spaced from radial flange 72 of inner structural member 50 thus at the left side in fig2 outer structural member 52 is axially short of inner structural member 50 and this permits shear hub 66 to act as a cushion during high loads without affecting or causing shear stress in the bond between radial flange 72 of inner structural member 50 and elastomeric body 54 in a similar manner it can be seen that the axial right end of outer structural member 52 extends further out or to the right from the axial end of inner structural member 50 such that the entire axial cylinder 70 of inner structural member 50 is axially spaced from radial flange 78 of outer structural member 52 thus at the right side in fig2 inner structural member 50 is axially short of outer structural member 52 and this permits shear hub 66 to act as a cushion during high loads without affecting or causing shear stress in the bond between radial flange 78 of outer structural member 52 and elastomeric body 54 also as illustrated in fig2 elastomeric body 54 defines a relieved portion 82 disposed adjacent the inner end of radial flange 78 of outer structural member 52 to lower the stress on the bonding section between radial flange 78 and elastomeric body 54 during high loading. |
7 | the example of fig1 in which data is read out of the pallet 2142 at the mpu read access the output data 2037 is delivered by switching between the pallet output data 2028 and the interpolated data 2048 however the pallet which is read out for the mpu read access and the pallet output data to be entered to the selector are not confined to the manner of this embodiment however the circuit arrangement of this embodiment is effective only for monochrome display data and it cannot deal with color display data the seventh embodiment of this invention is the arrangement of the display data selector 34 as shown in fig1 for the display controller of the sixth embodiment the timing chart of fig1 c also shows the display operation based on the display data selector of fig1 the seventh embodiment differs from the sixth embodiment in the display data selector 2034 which is intended for color display data in contrast to that of the preceding embodiment for monochrome display data color display data consists of three color components including red r green g and blue b as shown in fig1 on this account display data interpolation circuits 2047 are provided to deal with the r g and b components independently for a read access to the pallet 2142 during the display period data 2481 2482 and 2483 produced by interpolation for the r g and b components of output data 2029 2027 and 2026 of pallets which are. |
5 | obtained by directing a controlled column of frigid ambient air vertically downward against the surface to be frozen the air temperature should be at least below about minus one degree c in order to effect freezing of sea water as mentioned in the use of spraying techniques the spraying operation in addition to providing for the formation of ice particles by the freezing of water drops results in the formation of a slush ice which is of a salinity greater than the normal salinity of sea water the slush ice is in effect a residue having a salinity somewhat higher than that of the sea water initially frozen from the droplet spray as noted the refreezing of this slush ice is responsible for the development of strength in the formation spray formed ice structures in the case of spay ice construction it is this refreezing which adds to the time of construction and which is needed in order to develop the desired strength of the load bearing ice structure by the present invention an initial ice structure is formed for the purposes of this invention the initial ice structure is that initially formed at the start of the construction and which in effect forms the base upon which the final ice structure is constructed overall the process is cyclical involving spraying freezing and refreezing and spraying etc a cycle that is repeated until the structure is completed by the present invention the freezing and refreezing portion of the cycle is shortened and. |
3 | mixed with base pdms such that the weight ratio between lce and pdms reaches 1 1 sylgard u00ae 184 curing agent dow corning is then added and mixed in 1 30 curing agent to base pdms weight ratio the mixture is put into vacuum to remove any entrapped air using a spatula the mixture is introduced into a glass tube 45 mm in length and 5 mm in diameter with inserted teflon foil that prevents pdms adhesion to the glass surface the tube is then sealed on both sides with teflon tape the sample is inserted into a magnetic field 8 9t with long axis oriented parallel to the field and is left for two hours at 300k during this time the lce particles in the mixture are oriented so that the average nematic director of the particle is pointing in the direction of the magnetic field after two hours the sample is left to cure in the magnet for approximately 12 h at 320k at least 20k under the n i transition temperature of the lce the resulting lce based component has a cylindrical shape determined by the glass tube a thermomechanic response curve typical for pdlce composite prepared according to the above description is shown in fig7 while the invention has been illustrated and described in detail in the drawings and forgoing description such illustration and description are to be considered illustrative or exemplary and not restrictive the invention is not limited to the disclosed embodiments. |
9 | are shown in fig1 according to an advantageous embodiment the drawing table may comprise additionally rolling up and down devices 28 and 30 located respectively at the upper and lower edges of the drawing board by means thereof it is possible to displace in accordance with the arrow a flexible and or transparent sheet 32 for example made from plastic material to which are fixed drawings plans symbols marks etc in drawing tables having a vertical rail such rolling up and down systems can only be positioned along the right hand and left hand edges of the table because the existence of a vertical rail supported on the board by means of a carriage at one end and a roller at the other prevent the vertical unrolling of a sheet the use of a telescopic arm in accordance with the present invention makes it possible to position these members along the upper and lower sides of the board this arrangement provides the drawing table with a considerable advantage because it permits the draughtsman to bring his working plane to the most convenient height and consequently he can work in the seated position fig2 illustrates in greater detail the articulation of the essential members comprising the table according to the invention these members are located either in the lower part of the board or in the upper part thereof this drawing shows the members mentioned with reference to fig1 and namely telescopic arm 8 supporting dividing head 4 and rules 6 carriage 10 moving along rail 12 maintained on board 2 by support 14 the winding up and down device 30 for sheet 32 and locking levers 22 and 26 this drawing also shows the rotation spindle 20 for the telescopic arm and the runners 24 of the carriage. |
4 | 254 0 26 mmd 0 026 0 024 0 029 0 027 0 026 0 027 smd 5 707 5 763 5 809 5 981 5 1623 5 5303 wt 5 561 8 552 6 996 8 519 5 6335 6 4445 lt 0 648 0 687 0 624 0 608 0 5945 0 6605 rt 54 547 51 052 56 124 52 86 60 3395 57 5723 emt 3 394 4 898 4 424 5 525 3 7288 3 8375 comp05 44 809 u2014 41 478 u2014 47 28 u2014 dmin 0 188 u2014 0 219 u2014 0 2005 u2014 dmax 0 34 u2014 0 374 u2014 0 3798 u2014 lc05 0 398 u2014 0 354 u2014 0 3125 u2014 rc 54 897 u2014 53 481 u2014 48 651 u2014 tmin 1 196 u2014 1 029 u2014 1 168 u2014 tdiff 0 536 u2014 0 427 u2014 0 5545 u2014 tmax 0 659 u2014 0 602 u2014 0 6138 u2014 wc 0 532 u2014 0 377 u2014 0 4328 u2014 wc u2032 0 292 u2014 0 201 u2014 0 21 u2014 weight 22 435 u2014 22 525 u2014 23 3 u2014 g m 2 g 0 914 0 819 0 671 0 662 0 654 0 6 2hg05 0 68 0 65 0 773 0 742 0 845 0 706 2hg25 1 686 1 543 1 424 1 41 1 4343 1 2908 2hg50 3 178 3 004 2 541 2 568 2 6265 2 5445 rg05 0 745 0 795 1 154 1 125 1 2945 1 1788 rg25 1 844 1 884 2. |
9 | portion 26 accordingly the valve plug 20 is guided within chamber 18 while at the same time minimizing flow of fluid between portion 26 and the housing 14 this construction insures that the single plug check valve of the present invention may be used at all angle orientations the valve plug 20 further includes openings 28 in the first diameter portion which communicate with an internal passage 30 having a diameter d 4 for communicating fluid which passes through openings 24 in valve seat 12 through the valve body with particular references to fig1 4 the special design of the valve plug of the present invention which guarantees minimum pressure drop across the valve and thus maximum flow through the valve body will be described in order to insure minimum pressure drop across the valve and thus maximum flow through the valve it is a particular feature of the present invention that the first diameter portion 22 of the valve plug 20 define with the valve housing 14 an annular flow area a 2 in fig3 which is substantially at least as large as the flow area a 1 in fig4 defined by the valve seat 12 the annular flow area a 2 is equal to the area defined by the housing 14 minus the area of the first diameter portion 22 of. |
8 | on before recording to long term storage the video may be processed for example a date and time stamp may be applied to the video by processing 114 124 or 134 in another example the video may be re encoded or compressed before being recorded in long term storage 118 128 or 138 in normal operation one or more of nvrs 110 130 stores a portion of the video sent by a video encoder 150 152 in temporary storage 116 126 and 136 respectively for example nvr 110 may temporarily store the last 2 seconds of the video sent by video encoder 151 in temporary storage 116 nvr 120 may temporarily store the last 2 seconds of the video sent by video encoder 152 in temporary storage 126 and so on if keep alive box 160 detects a failure of an nvr 110 120 or 130 it communicates the failure to the master nvr the master nvr is the one of nvrs 110 120 or 130 that has been assigned to trigger itself or another nvr to start recording video that was previously being recorded by the failed nvr in addition the master nvr triggers the triggered nvr to transfer at least a portion of the temporarily stored video to long term storage by transferring temporarily stored video the triggered nvr records to long term storage the portion of video that the failed nvr failed to record because of the failure to illustrate consider a case where 1 nvr 1 110 is assigned to be the master nvr 2 nvr 2 120 is recording the video sent by video encoder 151 to long term storage 128 and 3 nvr n 130 is storing the. |
9 | compensator spool 20 is shown in its middle actuation position in which it partially overlaps the fluid outlets a 1 a 2 leading to the hydraulic consumers v 1 and v 2 the fluid inlets e 1 and e 2 conversely are left open by the spool 20 by radial recesses 96 a permanent fluid connection is between e 1 and a 1 and between e 2 and a 2 the fluid outlets a 1 a 2 respectively are choked by the pressure compensator spool 20 depending on the position of travel of the pressure compensator spool 20 the fundamental switching possibilities for the pressure compensator 16 as shown in fig1 are achieved analogously since this pressure compensator structure is inherently known it will not be described further the embodiment shown in fig4 has been altered compared to the other embodiment shown in fig3 in that the damping orifices 92 are omitted the pressure compensator spool 20 in this embodiment in each of its positions of travel has spool ring surfaces 90 spaced apart from the pressure compensator housing 18 otherwise in terms of surface ratio the spool ring surfaces 90 opposite one another correspond to one another for the embodiments shown in fig3 and 4 for both embodiments the spool 20 is then essentially symmetrical in design in the modified embodiment shown in fig4 the fluid travels via the inlets e 1 e 2 as well as the radial recesses 96 and the respective annular gap 98 to the active spool ring surface 90 the valve block configuration according to fig5 shows that the entire valve device can be combined in one. |
8 | statistics of the received accounting information for each mobile station referring to the flowchart of fig4 a web redirect authentication method in the communication system 100 for managing wifi roaming according to an exemplary embodiment will be described in detail first when in the same subnet the user of the mobile station 110 desires to use a wireless internet service in an area where the wireless ap 120 has been installed the mobile station 110 transmits an association request message to the ap 120 in operation s 110 and the ap 120 transfers the association request message to the ac 150 in operation s 111 the association request message includes the mac address of the mobile station 110 and may further include parameters required for a request for a wireless internet service such as the mac address of the destination such as the ap 120 accordingly the authenticator 151 of the ac 150 determines whether roaming service is available whether an association has already been allowed for the mobile station 110 using the mac address and assigns an ip address if there is no assigned ip address in operation s 120 next the authenticator 151 performs the authentication of the corresponding mobile station e g mac address authentication through communication with the authentication server 140. |
2 | the depression 7 the pivoting movement of the mold cores 9 is achieved by a sloping cam slot control which comprises a drive rod 19 having a control pin 20 which is slidably received into a cam slot 21 on the mold core as shown in fig2 and 5 the drive rod 19 is rectangular in cross section and is slidably supported in bearings 22 on the outer side of the mold so as to be capable of horizontal movement as shown in fig2 a drive rod 19 is mounted on each mold side wall 3 and is drivingly connected to the mold cores 9 on a pertinent mold side wall by individual control pins 20 each drive rod 19 is connected to the inner side of a drive belt 23 which is guided around the mold 1 on deflection rollers 24 mounted on the four corners of the mold 1 the outer side of the drive belt 23 is connected to a piston rod 25 of a double acting hydraulic cylinder 26 which causes the drive belt 23 and thus all four drive rods 19 to move back and forth the stroke of the hydraulic cylinder 26 is so selected that the mold cores 9 are pivoted. |
3 | 5 to 95 ch 3 cn in water containing 0 05 tfa over 10 min the retention times rt and the observed mass which corresponds to m h are listed in table 1 wherein u2014 ch r 1 r 3 and r 2 are as defined in the following table 1 to a cooled solution 0 u00b0 c of p fluoroacetophenone 13 8 g 0 1 mol and s 3 3 diphenyl 1 methyltetrahydro 3h pyrrolo 1 2 c 1 3 2 oxazaborole 30 ml of a 2m solution in toluene in anhydrous thf 400 ml under n 2 was added borane dimethylsulfide 14 ml 0 14 mol the solution was stirred at 0 u00b0 c for 30 min then ch 3 oh 50 ml was added followed by washing with 1 m hcl water saturated nahco 3 and drying over anhydrous na 2 so 4 the solvent was evaporated to give 13 5 g r p fluroro u03b1 methylbenzylalcohol anal data 1 h nmr cdcl 3 u03b4 7 35 d 2h u03b4 7 1 t 2h u03b4 4 9 q 1h u03b4 1 45 d 3h hplc chiralpak as column 10 isopropanol in hexane flow rate 1 ml min 5 68 min r isomer 98 6 10 min s isomer 2 to a cooled solution u2212 15 u00b0 c of the product of step 1 23 5 g 0 168 mol in toluene 300 ml was added diphenylphosporyl azide 55 4 g 0 395 mol followed by dbu 30 4 ml 0 2 mol after stirring overnight the resulting biphasic solution was poured into 500 ml 1. |
9 | and 25 microliters 0 26 mmole of acetic anhydride dissolved in 0 5 ml of methylene chloride and the mixture sonicated on low power following the protocol 20 seconds 34 on 34 and 40 seconds 34 off 34 over a period of 2 hours the reaction vessel is then transferred to the magnetic separation region and the soluble components of the reaction mixture removed by aspiration using one of the liquid robotic arms to the reaction vessel is then added 2 ml of methylene chloride and the mixture is sonicated on low power for 20 seconds the reaction vessel is then moved to the magnetic separation region and the solvent is removed by aspiration this process is then repeated two more times and then the paramagnetic beads are washed with 2 ml of methanol using the same protocol a total of two times finally the paramagnetic beads bearing the reaction product are washed with methylene chloride a total of three times in that order b synthesis of gly ala bound to rink amide linker in this example a n fmoc substituted amino acids are abbreviated fmoc xxx where xxx is the conventional three letter abbreviation for any of the amino acids to the fmoc protected magnetic particles. |
9 | emeshed gear 11 and attached eccentric 7 to rotate on crankpin 5 the rotation of eccentric 7 on crankpin 5 causes connecting rod 10 to be raised and lowered upon crankpin 5 and thus to this degree augments the simple harmonic motion resulting from the rotation of the fixed crank radius of crankpin 5 the relative motion induced by rotation of eccentric 7 on crankpin 5 is transferred through connecting rod 9 to piston 10 and thus influences the normal compression and expansion rates of the working fluid above the piston it is also seen that the crank radius varies in a cyclic manner which also influences the rotative effort in a manner which is proportional to the change in the crank radius moment arm for maximum efficiency the moment arm should be extended during the expansion cycle and retracted during the compression cycle turning now to fig2 eccentric 7 and fixedly attached gear 11 can be remounted on crankpin 5 such that it is now adjacent to gear 16 as shown in fig2 in this arrangement gear 12 and gear 15 are therefore correspondingly mounted at the same end of shaft 13 as shown the synergism is the same as that described for fig1 the only difference between the two systems shown is in the fact that all of the gearing is mounted on one side of connecting rod 9 in fig2 while in fig1 the gearing was mounted on both sides of the connecting rod turning now to fig3 which is a detailed drawing of the idler gears showing. |
3 | 0 0 0 44 18 3933 25 0 0 0 0 0 44 18 44225 18 75 0 0 6 25 0 0 46 28 55618 12 5 0 0 12 5 0 0 46 76 62918 12 5 0 0 12 5 0 0 46 17 55826 6 25 0 0 18 75 0 0 49 71 6102 0 0 0 25 0 0 48 06 5654 0 25 0 0 0 0 43 70 42327 0 18 75 6 25 0 0 0 45 59 4696 0 12 5 12 5 0 0 0 43 80 4006 0 12 5 12 5 0 0 0 44 71 45928 0 6 25 18 75 0 0 0 46 16 4731 0 0 25 0 0 0 44 18 3934 0 25 0 0 0 0 43 70 42329 0 18 75 0 6 25 0 0 45 70 4747 0 12 5 0 12 5 0 0 43 54 44030 0 6 25 0 18 75 0 0 45 s0 5472 0 0 0 25 0 0 48 06 5651 0 0 25 0 0 0 44 18 39331 0 0 18 75 6 25 0 0 45 69 48819 0 0 12 5 12 5 0 0 44 41 49032 0 0 6 25 18 75 0 0 46 98 5042 0 0 0 25 0 0 48 06 56533 0 0. |
1 | with threads that mate with rod 12 at threaded portion 20 plant support nut 16 includes raised portions 26 which support and stabilize plant pot 14 as seen in fig7 raised portions 26 maintain clearance or a spaced relationship 28 between the bottom of plant pot 14 and the upper surface of plant support nut 16 to permit drainage of moisture from pot 14 alternately the raised portions 26 could be replaced with suitably sized and positioned grooves in support nut 16 not shown plant support nut 16 provides rigid support to plant pot 14 and preferably has a plurality of reinforcing members 30 to provide rigidity without undue thickness as shown in fig3 there are 4 reinforcing members 30 which are also used to grasp when threading nut 16 onto rod 12 four reinforcing members 30 are used for example only the number of reinforcing members 30 selected to be used on the present invention may vary such as selecting 3 instead of 4 plant support nut 16 is made of a suitable material such as nylon or polypropylene plant support nut 16 also has a plurality of raised members or support shelve members 32 which are used as will be shown in detail below to attach drip saucer 18 referring now to fig5 and 6 drip saucer 18 which can be any shape is used to catch water and other residue coming from plants which grow in plant pot 14 plant pot 14 must have at least one centrally located aperture 15 and may have a plurality of apertures for drainage not shown drip saucer 18 is made of any suitable water proof material such as. |
9 | which enables the control of the descending speed of the rotary rod as well as the rotation speed of the agitating blades when such an apparatus is used in remediation of contaminated soil the rotary rod 6 is lowered into the soil to excavate and stir the soil with continuous monitoring of the pollutant concentration and when it is judged that the tip of the rotary rod has reached the top of the contaminated region a predetermined amount of the microorganism as well as the inducer and air are introduced into the soil by the measuring and control means 13 at this point the descending movement of the rod 6 may be stopped and the still rotating agitating blades mix the introduced microorganism inducer and air herein after referred to as the treating agents with the soil of the contaminated region this ensures a high probability in contact between the pollutants in the contaminated region and consequently increases the soil remediation efficiency thus one treating cycle comprises lowering the rotary rod with monitoring the pollutant concentration to control the descending speed of the rotary rod and the rotation speed of the agitating blades according to the monitoring results and introducing the treating agents into. |
3 | serums were tested for igg induction against the immunogen mimotope peptide as well as the carrier klh alone by the elisa assay as already shown with mice igg directed specifically against mimotopes could also be achieved in rabbits this is shown by the following example her 2 neu is recognized in the cytomembranes of the cell line skbr3 in elisa by the humanized monoclonal antibody herceptin for the elisa inhibition assay one tries to prevent this bond by preincubation with mimotopes on phages or klh as carrier the wells of a 96 well elisa plate nunc were coated with membrane fractions of the her 2 neu overexpressing cell line skbr3 and as a control for non specific antibody bonds with membrane fractions of the her 2 neu negative cell line htb 132 in pbs overnight herceptin anti her 2 neu antibody was treated likewise overnight by preincubation with different antigens mimotopes control mimotopes or buffers the next day non specific binding sites were blocked by 3 percent bsa in pbs herceptin as well as herceptin after preincubation with relevant and irrelevant phage mimotopes or by mimotopes on klh as well as on klh alone were applied to the coated blocked elisa plate in a repeated test bound herceptin could be detected with a horseradish peroxidase hrp coupled monoclonal anti human igg hrp enters into a. |
9 | of the data packet occurring during transport such as transport over long distances or outside of a partial rf shield the rf devices may be able to intelligently assemble the information in each packet so not to include redundant or unnecessary information within the rf payload a rf device or energy management station 100 may assemble a communication data packet 1000 to be used as a time sync another rf device or energy management station 100 an rf device or energy management station 100 receiving or processing the communication packet 1000 containing the time sync may be able to adjust it 39 s time to correspond to the time sync sent in the communication packet the time syncing process may account for any packet decoding delays and speed of communications the communication packet 1000 may be digitally signed and may use a private key and public key signing system alternatively the communication packet 1000 may be digitally encrypted and may use a private key and public key exchange between two or more rf devices including the energy management station 100 referring now to fig2 an example of a communication diagram is show that depicts radio frequency u201c rf u201d devices communicating on a wireless mesh network the wireless mesh network composed of radio frequency u201c rf u201d devices 200 used to transmit. |
5 | energy source seat 22 the energy source seat 22 is then screwed into the top of the projectile tool body 1 after assembly the tool is in a fire ready mode threadedly attached to a drill string and lowered into a well bore and downhole cavity in a well bore cavity the tool can be partially opened by rotation of the drill string and or by engagement of the end of the blades 2 with the rock bottom of the cavity whereupon by drill string weight applied to the tool against the bottom of the cavity the blades 2 can open to a position perpendicular to the drill string whereby the latch hooks 14 lock the blades 2 in said position ready to fire the tool is then raised or moved to the level desired to fire the projectiles 3 into the formation the electric battery 23 energy source or other trigger mechanism is then released or lowered into the well bore whereby it seats and activates the igniter 10 and explosive 7 which propels the projectiles 3 outward into the rock or subterranean formation upon firing and setting off the explosive 7 the main force is applied to the projectile 3 but a small force is applied to the small drive pin 19 in each blade 2 which pushes the drive pin 19 outward from the blade 2 and against the latch hooks 14 whereby each latch hook. |
1 | the mid to high sixties while the cooled product showed temperatures generally in the mid to low fifties a third seasoning combination on the chip product was also tested for in canister cooing table 5 shows temperatures after sealing for the control group having the third seasoning as in the earlier runs a group of chips of this seasoning were run through the cooling manifold their results are seen in table 6 finally the canisters for a third group of chips having the third seasoning were diverted to run through the cooler twice for a total of ten minutes with the results shown in table 7 significantly average temperatures for the control product were clustered around about seventy degrees the single pass cooled canisters had temperatures clustered around fifty and the double pass containers were around forty five degrees c the information from the various products and treatments in tables 1 7 is summarized in table 8 below using the average temperature for each canister as can be seen from table 8 the product was cooled approximately 18 u00b0 c 30 u00b0 f in a five period under the cooling manifold with a further drop of just over 5 u00b0 c 10 u00b0 f when the. |
7 |
{"publication_number": "US-6775217-B1", "abstract": "the invention provides a method and apparatus for generating delays to shift edges of an efm data stream from an efm modulator for a cd - r and cd - rw write encoder . efm data pulse edges may be delayed in increments of about |
8 | 211 will likewise include four pins data d pin and data d u2212 pin power and ground pins not shown for clarity for exemplary purposes the operation of high speed usb transmitter 210 is described with respect to the generation of half of the differential usb signal e g the d signal however it is understood that complementary usb signal generator circuitry 215 included in usb transmitter 210 can generate complementary signal d u2212 forming the other half of the differential usb signal in a manner substantially similar to that described below with respect to the generation of signal d note further that usb receiver 250 will also include a second resistor to ground not shown that is substantially similar to resistor 260 to receive the complementary d u2212 signal high speed usb transmitter 210 includes a voltage source 220 signaling circuitry 225 and a resistance element 230 voltage source 220 signaling circuitry 225 and resistance element 230 are connected in series between a ground terminal indicated by the inverted triangle and usb port 211 voltage source 220 provides a reference voltage vref which for reasons described in greater detail below is 0 8 v signaling circuitry 225 provides a switching output between voltage vref and. |
1 | hpv16 l2 epitope 14 37 amino acids generated seq id no 5 encoding seq id no 6 when ligated to the 5 u2032 end of hev gene and seq id no 7 encoding seq id no 8 when it was ligated to the 3 u2032 end of the of the hev orf2 pcr fragment the ligation was achieved with a bamh1 site located at either end of the primers for hev or hpv l2 sequence the following primers were used for amplification of 14 37 amino acids of the hpv16 l2 sequence for fusion at the n terminus of the hev orf2 fragment 5 u2032 atgtcgaattcaccatggctgcaactcagttgtataaaac 3 u2032 and 5 u2032 atcgaggatccttgaacctttgggataatgtc 3 u2032 for amplification and fusion at the c terminus of the hev orf2 fragment the following primers were used for hpv16 l2 pcr of the above region 5 u2032 atgtcggatcctctgcaactcagttgtataaaac 3 u2032 and 5 u2032 atcgagcggccgctcattaaccttcaacctttgggataatgtc 3 u2032 pcr primers that were designed to amplify the 5 u2032 ttggttgaagaaacctcctttattgacgctggtgctcca 3 u2032 region of hpv16 l2 gene corresponding to the protein sequence lveetsfidagap also contained a bamh1 site for ligation of the two gene fragments chimeric fusion of the gene fragment encoding lveetsfidagap to the c terminus of hev orf2 resulted in seq id no 9. |
5 | piston guide 65 in conjunction with the o ring 75 and the tapered portion 140 of the valve body 45 helps to create a funnel to minimize turbulent flow from the valve 50 as the valve seats on the tapered portion 140 of the housing 45 thereby minimizing water hammer similarly the tapered portion 225 and the rounded portion 220 of the broach body 70 collectively and individually smooth flow around the piston body also minimizing the effects of water hammer in the valve additionally the neck portion 200 of the broach body 70 allows inlet pressure to be more equally distributed therearound thereby centering the valve more efficiently thereby easing translation of the valve in the piston cap 55 and extending valve life referring now to fig1 5 and 5 a the anti backflow cartridge 30 is shown the cartridge has a tubular housing 250 that slips into the discharge tube 35 the tubular housing has a lip 255 that prevents the housing from slipping down into the discharge tube thereby giving a user easy access to the cartridge if maintenance is required a pair of anti backflow check valves 260 manufactured by neoperl are arranged in series in the tubular housing and each are held therein the tubular housing 250 the anti backflow valves provide enough resistance to minimize backflow while allowing enough flow to maximize the use of the toilet or urinal the o rings 265 also prevent fluid from flowing around each anti backflow check valve back to the valve assembly 10 a flange 280 may depend inwardly at a bottom of said tubular housing 250 in an alternative embodiment shown in fig1 the cartridge 250 is the discharge tube and if the cartridge needs replacement the discharge tube is replaced therewith the discharge tube 35. |
4 | 100 parts of tall oil rosin acid value 167 was molten by heating at 210 u00b0 c and 10 parts of triethanolamine was added drop by drop over a period of 20 minutes cooh oh 1 0 68 while continuing dehydration at constant temperature a reaction was carried out for 5 hours the resulting resin had an acid value of 63 100 parts of tall oil rosin acid value 167 was molten by heating at 210 u00b0 c and 17 6 parts of maleic anhydride was charged in separate additions over a period of 1 hour and this temperature was kept for 2 hours the resulting resin had an acid value of 226 100 parts of tall oil rosin acid value 167 was molten by heating at 210 u00b0 c and 9 4 parts of maleic anhydride was charged in separate additions over a period of 20 minutes followed by a reaction at this temperature for 1 hour then 6 parts of triethanolamine was added drop by drop over a period of 20 minutes the mixture was heated to 230 u00b0 c and kept at this temperature for 3 hours the resulting resin had an acid value of 148 100 parts of tall oil rosin acid value 167 was molten by heating at 250 u00b0 c and 8 parts of glycerol was added drop by drop over a period of 20 minutes while continuing dehydration at a constant temperature a reaction was carried out for 10 hours then the temperature was decreased to 210 u00b0 c and 9 parts of maleic anhydride was carefully added gradually after the completion of the addition of maleic anhydride the mixture was kept at a constant temperature for 90 minutes the resulting resin had an acid value of 78 4 100 parts. |
4 | weaving machine 2 and the dobby 5 operating at slow speed or to stop it so long as the switch lever 27 is maintained in the center position fig5 and 6 illustrate an alternative pick finding mechanism embodying the present invention in which two pivotally supported switch levers 27 and 32 are provided each of which can be switched between only two positions the lever 32 is also supported on a stationary axis with this the uncertainty which exists through the possibility of switching between three positions as in fig4 is avoided the pick finder of fig5 and 6 differs from the already described pick finder in that a gear 210 is axially slidably supported on a cylindrical surface 181 of the sliding sleeve 180 during axial movement of the gear 210 by means of the switch lever 27 which engages the groove 250 the multi tooth coupling 30 and 31 becomes engaged the sliding sleeve 180 remains in its normal position and is moved only when the second switch lever 32 which engages the groove 35 of the sliding sleeve 180 is operated the switch lever 32 which is under the action of a return spring 36 is also fork. |
9 | the pesticide is generally one or more non metabolizable or only slightly metabolizable carbohydrates of relatively low molecular weight resulting from their having fewer than 12 carbon atoms per molecule although there are exceptions which permit larger molecules to be used in the practice of this invention the pests consume the substance because the active ingredient is sweet and attractive or if the active ingredient itself is not sweet a sweetening agent is incorporated into the pesticide the substance which is either not transported poorly transported or not actively diffused across the digestive tract membranes of the pests is generally selected from among low molecular weight carbohydrates with such properties because they remain inside the intestinal tract and are relatively small molecules they create osmotic pressure which can only be equilibrated by the movement of water from the rest of the pest body into the intestinal tract this results in the excretion of large amounts of water and or damage to internal organs with death occurring from dehydration and or structural damage the active substance used in the practice of this invention i e the substance which is either not transported or which is poorly transported across the digestive tract membranes of the pest upon ingestion and which causes an osmotically driven influx of water into the intestines may be a low molecular weight organic compound of low or non metabolizability or a low to moderate molecular weight compound of non or low degradability and non or low transportability across the digestive tract membranes such compounds include all l hexoses except sorbose which occurs naturally. |
8 | the scaling of the approximation the division by 256 the correct scaling value would be 10313 8192 u00d7 256 322 but this would result in a rather cumbersome hardware implementation this leads to a small error in the approximation which in fact is partly cancelled by the fact that a larger error may exist for negative gain changes than for positive gain changes in summary it is preferred to provide two inputs to the filter 38b so as to enable a relatively large step size in the rxagc to be able to cancel fast changes in the input signal level on the other hand the txagc is required to be slower and more accurate if the txagc followed only the rxagc the resolution of the txagc would not be adequate however by introducing the linear power value from block 34a and its equivalently shifted linear power reference value block 39c it becomes possible to increase the accuracy of the txagc to the required level while the above description serves to describe the operation of the invention it should be noted that a number of possible implementations exist for example fig5 illustrates a presently preferred implementation where blocks 38a and 38b are integrated thus enabling a substantial hardware savings the embodiment of fig5 includes a 5 to 1 multiplexer 50 a 1 x scaling. |
1 | and in addition haptic portion 72 omits the use of haptic pistons as in the preceding embodiments optic portion 71 comprises anterior lens element 73 and substrate 74 formed of light transmissive materials substrate 74 includes lens piston 75 having expandable end wall 76 and fluid channels 77 in fluid communication with the interior of lens piston 75 expandable end wall 76 contacts the inner surface of anterior lens element 73 so that deflection of end wall 76 causes anterior lens element 73 to assume a more convex shape as in the preceding embodiments the thickness profile of anterior lens element 73 is tailored to produce a desired degree of accommodation when deflected as previously described channels 77 and space 78 disposed between anterior lens element 73 and substrate 74 are filled with fluid 79 having a matched index of refraction substrate 74 may define a posterior lens surface 80 or may include a separate lens element haptic portion 72 is disposed surrounding the periphery of optic portion 71 and includes transducer 81 transducer 81 comprises diaphragm 82 including elastomeric ring 83 disposed along the midline of the diaphragm that biases the ring to the radially compressed state depicted in fig8 a and 8b this state corresponds to the maximum deflection of lens piston 75 and thus the state of maximum accommodation of lens 70 ring 83 also ensures that diaphragm 82 engages and applies tension to the capsule transducer 81 adjusts the deflection of end. |
7 | in the present embodiment an automatic ticket gate 300 is provided to the boarding station 11 and an automatic ticket gate 200 is provided to the destination station 13 a memory card 100 is a payment processing device which is a contactless memory card with a prepaid card and commuter pass functionalities and which is issued by the railway company the user 10 obtains the memory card 100 from the railway company in an exchange for a predetermined amount of payment the user 10 carries the memory card 100 when taking the train 12 when the user 10 attempts to go through the automatic ticket gate 300 and enter the boarding station 11 in order to take the train 12 the user 10 holds the memory card 100 toward the automatic ticket gate 300 information is transmitted wirelessly between the memory card 100 and the automatic ticket gate 300 and the flap door of the automatic ticket gate 300 opens if the automatic ticket gate 300 judges that the user 10 is allowed to enter based on the transmitted information the user 10 enters the boarding station 11 after the flap door is open the user 10 then takes the. |
8 | 25 b and the transparent insulating layer 24 then an exposure light source 26 is provided in a direction from the second surface 21 d toward the first surface 21 c of the transparent substrate 21 by using the first gate pattern 23 a and the second gate pattern 23 b as a light shielding layer such that the photoresist layer forms a first photoresist pattern 27 a on the first region 251 a of the first polysilicon pattern 25 a and a second photoresist pattern 27 b on the third region 251 c of the second polysilicon pattern 25 b in other words the array substrate 20 of the embodiment of the present invention uses the first gate pattern 23 a and the second gate pattern 23 b which are located below as a light shielding layer such that the first photoresist pattern 27 a and the second photoresist pattern 27 b can be formed without the need of a mask process in one embodiment in a direction of top view or bottom view of the transparent substrate 21 the first region 251 a and the first gate pattern 23 a therefore have an identical first patterned shape and the third region 251 c and the second gate pattern 23 b also have an identical second patterned shape please further refer to fig2 c a first doping step 255 is performed to. |
2 | u201c b u201d is a vertical sectional view thereof at the line a a in the plan view u201c a u201d fig1 is a plan view of the completed ink jet recording head shown in fig1 a and 17b in fig1 the nozzle layer is not shown referring to fig1 a 18 the ink jet recording head manufactured with the use of the ink jet recording head manufacturing method in this embodiment has a substrate 1 on which a plurality of heaters electro thermal transducer elements 110 as ejection pressure generation elements for heating the ink liquid to generate ink liquid ejection pressure by generating bubbles in the ink liquid are formed although there are also formed on the substrate 1 a semiconductor circuit inclusive of transistors or the like for driving the heaters 110 and electrical pads for maintaining electrical connection between the recording head and the main assembly of a recording apparatus these are not shown in order to make the drawings easier to understand the substrate 1 is provided with an ink supply hole 109 which is a through hole the heaters 110 are disposed in two lines along the edges of the ink supply hole 109 on the obverse side of the substrate although only three heaters 110 are shown in the drawings in order to make it easier to understand the drawings the ink jet recording head. |
1 | to assist in organizing the pharmaceuticals one of the drawers 41 has a key lock 42 thereon this drawer 41 is used to contain controlled substances in order to open the drawer an operator must insert a key into the key lock 42 and unlock the drawer another drawer 43 is contained in an insulated portion of the case 35 so that the drawer is thermally insulated on all sides this drawer 43 is used to contain drugs that are maintained at a temperature that is different from the drugs in the other drawers for example 34 refrigerated drugs 34 can be contained in this insulated drawer 43 refrigerated drugs typically are required to be stored at colder temperatures for example 35 50 degrees fahrenheit than room temperature the drawer unit 13 fits inside of the interior case 15 the interior case 15 is dosed on all sides except for a front opening 45 referring to the orientation of fig2 the front opening 45 allows the drawers 37 to be pulled out from the drawer unit 13 the interior case 15 also has openings 47 in the top for heat exchangers the interior case 15 is surrounded on all sides with the exception of the front opening by the insulation 17 the insulation 17 is of the thermal type for example polystyrene foam the exterior case 19 surrounds the top and three sides of the insulation 17 the exterior case is made of a rigid durable material such as high impact plastic the front of the exterior case 19 has an opening 49. |
8 | phone is off hook when the apparatus is in an automatic block code dialing mode the user may override this setting and have his her caller id sent on a per call basis another aspect of the invention is a circuit arrangement which is capable of reducing the speech voice interference to the call waiting caller id alert signal during normal telephone conversation thus improving the chance of a successful caller id data transmission during call waiting application_number US 54053295 A description the general organization of one embodiment of the invention is illustrated in the block diagram of fig1 the apparatus includes a receiving transmitting and dialing circuitry 101 lcd display 102 mpu 103 block key 104 program key 105 code keys 106 delete key 107 tone buzzer 108 and phone line status detector 109 block key 104 is preprogrammed to generate a block code description on the lcd display and to dial the block code when the phone line is in an on hook status it is detected by the phone line status detector 109 pressing block key 104 causes the apparatus to display a blocking prompt e g 34 block 34 and the block code e g 34 67 34 that is lcd screen 102 displays 34 block 67 34 in this embodiment if the phone line is in an off hook status pressing block key 104 causes the device to dial the block code a confirmation message e g 34 block dialed 34 is also shown on lcd display 102 for the user 39 s benefit the device is programmable to operate in a 34 block code dialing prompt 34 mode in the preferred embodiment this mode is entered by pressing block key 104 and an extra code key 106 e g. |
2 | the battery be coated with a waterproof epoxy preventing water from contacting the terminals or bare wires and that all voids be filled with a non compressible liquid thus even though the interior of the central housing is open to the water the water will not contact the battery terminals within the central housing it is preferred that all housing voids containing moving parts be filled with a non conductive oil such as transformer oil or a silicon grease which is non compressible at operational depths this eliminates entrapped air which is compressible with the housing for the motor 22 for example filled with a non compressible non conductive liquid such as transmission fluid the seals between sections of the motor housing will have minimum strain placed upon them because the oil or fluid on the interior of the housing is non compressible and will act internally against the seals to prevent movement if air was entrapped within the housing this would be extremely compressible would not resist movement of the seals and thus would place an enormous strain upon the seals in order to keep the sea water out at operational depths it is also preferred that all voids even in the wires be filled with the non conductive non corrosive liquid to prevent the entry of sea water into those voids an example of this is shown in fig4 in which a typical joys tick switch 34 is illustrated the switch includes a switch assembly 54 having a pair of terminals 54 a and 54 b from which wires 56 a and 56 b extend the switch assembly has a threaded upper portion 57 at the top of which is a movable contact 58 a and a fixed. |
8 | of the target pixel and the two adjacent pixels with the predetermined value when the differences between the gray level of the target pixel and the gray level of the adjacent pixels are greater than the predetermined values k 1 k 2 the comparators 550 560 outputs logic 1 when the difference s between the gray level of the target pixel and the gray level of the adjacent pixels is smaller than predetermined value k 1 k 2 the comparators 550 560 outputs logic 0 the and gate 570 coupled to the outputs of the two comparators 550 560 and the output of xor 540 the accumulation unit 580 coupled to the output of the and gate 570 comprises an adder 582 and a buffer 584 for accumulating the non smooth changes in this embodiment if the difference of the gray level of the target pixel and each gray level of the two adjacent pixels is greater than the predetermined value and if the gray level of the target pixel is either greatest or smallest of the three values the comparator 510 will output logic 1 to the accumulation unit 580 which represents a zigzag exists at the target pixel otherwise the pixel comparator 510 will output the logic 0 to the accumulation unit 580 therefore each pixel of the first field sequentially acts as the target pixel and by comparing with the adjacent pixels of the second field the pixel comparator 510 outputs logic 1 or 0 to the accumulation unit 580 the similarity decision unit 590 is coupled to the output of the accumulation unit 580 when the accumulation result of the accumulation unit 580 is greater than. |
8 | message arrives at the server at time 1 6 seconds then the response message arrives back at the client at time 1 7 seconds and the transaction is completed with the present invention using the same example the transaction is completed much faster specifically in this example at time 0 1 seconds a message from the client arrives at the network adapter and is read in by the server this message is for a lower priority application socket therefore the server queues this message internally at time 0 3 seconds resources become available again so the server begins processing the queued messages the server application sends the response message which arrives at the client at time 0 4 seconds and the transaction is completed in the old model it took 1 7 seconds to complete the transaction and the message had to be sent twice u2014 with the present invention in contrast it only takes 0 4 seconds with the message only sent once as will be readily apparent to those skilled in the art the present invention can be realized in hardware software or a combination of hardware and software any kind of computer server system s u2014 or other apparatus adapted for carrying out the methods described herein u2014 is suited a typical combination of hardware and software could be a general purpose computer system with a computer program that when loaded and executed carries out the respective methods described herein alternatively a specific use computer containing specialized hardware for carrying out one or more of the functional tasks of the invention could be utilized the present invention can also be. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.