Datasets:

---

acmc

/

beamit-annotated_full_texts_dataset

like 0

[ "Aged", "Infant", "Child", "Humans", "Longitudinal Studies", "National Health Programs", "Food Hypersensitivity", "Australia", "Health Care Costs", "Hospitals" ]

[ "Study design and sample", "Ethical conduct in human research", "Costs", "Definitions", "Statistical analysis", "AUTHOR CONTRIBUTIONS", "FUNDING INFORMATION", "PEER REVIEW", "PEER REVIEW" ]

[ "The HealthNuts study is a single‐centre, multi‐wave, population‐based, longitudinal food allergy study undertaken in Melbourne, Australia. Detailed study methods have been published previously.\n12\n In brief, infants were recruited between September 2007 and August 2011 when presenting for their routine scheduled 12‐month vaccinations at immunization clinics. They were invited to undertake SPT screening to 4 common food allergens: egg, peanut, sesame, and either cow's milk or shrimp. Any infant with a detectable SPT wheal (≥1 mm) to egg, peanut, or sesame was invited for a food challenge, repeat SPT, and blood test to measure serum‐specific IgE at Melbourne's Royal Children's Hospital. As described previously, food challenges were not undertaken for cow's milk or shrimp (Supplementary material S1).\n2\n, \n3\n\n\nThe cohort was followed up at age 4 years. Parents completed a mailed questionnaire or short telephone questionnaire to capture information on their child's current allergy status.\nChildren born after 1st June 2007 (the earliest date for available healthcare cost data linkage), with a valid linkage to healthcare cost data, with nonmissing food allergy information at year 1 were included in this study as the health economics sample. Healthcare service utilization and costs from 1 June 2007 till 1 December 2011 were collected.", "Approval to conduct the HealthNuts study was obtained from the Victorian State Government Office for Children (reference no. CDF/07/492), the Victorian State Government Department of Human Services (reference no. 10/07), and the Royal Children's Hospital Human Research Ethics Committee (reference no. 27047). Parents provided written informed consent for study participation, and separate written informed consent to access their child's Medicare data for use in this study.", "We investigated direct healthcare costs from a healthcare sector perspective. Out‐of‐hospital healthcare costs were collected through data linkage to the Medicare data, which covers study children's Medicare records from birth till December 2011. Medicare is Australia's universal health insurance scheme, which guarantees all Australians access to a wide range of health services at low or no cost. It has two components: the Medicare Benefits Schedule (MBS), which covers medical services (visits to health professionals, diagnostic and pathology services) mainly outside the hospital setting, and the Pharmaceutical Benefits Scheme (PBS), which covers prescription medications. All out‐of‐hospital MBS and PBS services were covered in the analysis, with MBS costs categorized into general practitioner (GP) visits, specialist visits (including visits to pediatricians and all other types of specialists), tests and all others, and PBS costs categorized into adrenaline autoinjectors, nutrition products (including infant formula), dermatologic medicines (e.g., emollients, antihistamines, corticosteroids, etc.) and all others. Details of the included services and prescription medicines and codes used to identify these categories are provided in Supplementary material S2. Costs were inflated to 2019/20 Australian dollars using the total health price index constructed by the Australian Institute of Health and Welfare.\n13\n The 2020 Purchasing power parities were used to exchange the Australian dollars into euros.", "We identified children with food allergy and other allergic diseases using the HealthNuts data: Food allergy at age 1 was defined as an oral food challenge‐confirmed allergy to egg, peanut, or sesame, in the context of an SPT ≥ 2 mm or specific IgE ≥ 0.35 kU/L to that food. Food‐allergic children were further classified as having peanut allergy alone, egg allergy alone, or peanut and other food allergy (with co‐existing egg or sesame food allergy). These classifications were selected to reflect the differences in the natural history of peanut vs egg allergy.\n14\n We were not able to separate out sesame allergy for analysis in this study due to the small sample size with this food allergy type.\nSince food allergy often co‐exists with other allergic diseases such as eczema and asthma, which may contribute to higher healthcare costs among children with food allergy, we also identified eczema and asthma in the analysis. These allergic diseases were defined as a patient‐report history of doctor‐diagnosed eczema or asthma at any time in the first 4 years of life.", "We compared characteristics of children included and not included in the health economic sample, with differences tested using Chi‐square. Inverse probability weights were generated using logistic regression to adjust for potential bias caused by differences in child sex, socioeconomic status, and parents' country of birth between the health economic sample and the whole HealthNuts sample. We compared the MBS and PBS costs by age between children with and without food allergy, and across food‐allergic children from different socioeconomic groups. Only a proportion of study children had a full follow‐up for 4 years when the data linkage closed (1st December 2011). As a result, costs were aggregated into half‐year intervals by age in the calculation. Annual and total four‐year MBS and PBS costs were estimated by summing over the half‐year interval costs with confidence interval (CI) generated using nonparametric bootstrapping with 1000 replications. Two‐part model, a frequently used model to analyze cost data with a logistic regression part to estimate the likelihood of having any cost and a linear part to estimate costs when positive costs were predicted, was used to test whether the cost differences would vary after controlling for potential confounders (child sex, socioeconomic status, and parents' country of birth).\n15\n To understand the source of the cost differences, we decomposed the total four‐year MBS and PBS costs into different types of services, and compared them between children with and without food allergy and across children with different types of food allergy. To understand how other allergic diseases may contribute to children's food allergy costs, we compared the MBS and PBS costs between children with and without food allergy among those with or without asthma and eczema, respectively.\nBased on age‐specific population size in 2020,\n16\n food allergy prevalence in Australia estimated in previous studies,\n14\n, \n17\n and the cost differences and uncertainties estimated between children with and without food allergy in this study, total extra Medicare out‐of‐hospital costs caused by food allergy among 0‐ to 4‐year‐old children were projected for Victoria and Australia through simulation with 1000 replications (Supplementary material S3). Based on Osborne 2012,\n17\n a lower food allergy prevalence was assumed in North Australia compared with South and Central Australia in the calculation (Supplementary material S3).", "Xinyang Hua: Conceptualization; Methodology; Formal analysis; Writing—original draft; Writing—review & editing; Project administration. Kim Dalziel: Conceptualization; Methodology; Supervision; Writing—review & editing; Writing—original draft; Formal analysis. Tim Brettig: Conceptualization; Methodology; Writing—review & editing. Shyamali C Dharmage: Conceptualization; Methodology; Writing—review & editing; Funding acquisition; Investigation. Adrian Lowe: Conceptualization; Methodology; Writing—review & editing. Kirsten P Perrett: Conceptualization; Methodology; Funding acquisition; Investigation; Writing—review & editing. Rachel L Peters: Conceptualization; Methodology; Investigation; Funding acquisition; Writing—review & editing. Anne‐Louise Ponsonby: Conceptualization; Methodology; Writing—review & editing. Mimi LK Tang: Conceptualization; Methodology; Investigation; Funding acquisition; Writing—review & editing. Jennifer Koplin: Conceptualization; Methodology; Investigation; Funding acquisition; Writing—review & editing; Writing—original draft; Data curation; Supervision.", "Xinyang Hua is an Australian National Health and Medical Research Council (NHMRC) Emerging Leadership Fellow (GN 2009253). Tim Brettig is supported by a PhD scholarship from the NHMRC‐funded Centre for Food and Allergy Research (CFAR, GNT1134812). Kirsten Perrett is supported by an NHMRC Investigator grant (GNT2008911) and a Melbourne Children's Clinician–Scientist Fellowship. Rachel Peters is supported by an NHMRC Early Career Fellowship and an NHMRC Clinical Trials and Cohort Studies Grant. Anne‐Louise Ponsonby is supported by an NHMRC Senior Research Fellowship (APP1110200). Jennifer Koplin is supported by NHMRC fellowship GNT1158699. Research at Murdoch Children's Research Institute is supported by the Victorian Government's Operational Infrastructure Support Program.", " PEER REVIEW The peer review history for this article is available at https://publons.com/publon/10.1111/pai.13883.\nThe peer review history for this article is available at https://publons.com/publon/10.1111/pai.13883.", "The peer review history for this article is available at https://publons.com/publon/10.1111/pai.13883." ]

[ null, null, null, null, null, null, null, null, null ]

[ "BACKGROUND", "METHODS", "Study design and sample", "Ethical conduct in human research", "Costs", "Definitions", "Statistical analysis", "RESULTS", "DISCUSSION", "AUTHOR CONTRIBUTIONS", "FUNDING INFORMATION", "CONFLICT OF INTEREST", "PEER REVIEW", "PEER REVIEW", "Supporting information" ]

[ "The prevalence of hospital presentations for food‐related anaphylaxis in children has increased rapidly in the last few decades, making it a growing public health concern worldwide.\n1\n Australia has one of the highest prevalence of childhood food allergy in the world, with the condition affecting more than 10% of infants.\n2\n, \n3\n It has been reported that in Australia, compared with the overall population, 0 to 4‐year‐old children had the highest rates of hospital admissions for anaphylaxis caused by food allergy,\n4\n, \n5\n as well as the highest rates of adrenaline autoinjector prescription.\n6\n\n\nWith this magnitude of childhood food allergy, it is important to understand its cost implication on the healthcare system to inform resource allocation and policies. A few studies have investigated the economic burden of childhood food allergy in the US\n7\n and in some European countries\n8\n, \n9\n, \n10\n and reported significant direct medical costs for the healthcare system. Despite food allergy representing one of the most common chronic health conditions in children,\n11\n no such study has been conducted in Australia.\nIn this study, using a longitudinal population‐based cohort of infants with challenge‐confirmed IgE‐mediated food allergy outcomes (the HealthNuts study),\n12\n linked with administrative health data, we estimated the out‐of‐hospital health care costs for childhood food allergy in Australia. The aim is to understand the out‐of‐hospital costs for children with food allergy and with different types of food allergy from birth to 4 years old and to estimate the relevant economic burden in Australia at the population level.", " Study design and sample The HealthNuts study is a single‐centre, multi‐wave, population‐based, longitudinal food allergy study undertaken in Melbourne, Australia. Detailed study methods have been published previously.\n12\n In brief, infants were recruited between September 2007 and August 2011 when presenting for their routine scheduled 12‐month vaccinations at immunization clinics. They were invited to undertake SPT screening to 4 common food allergens: egg, peanut, sesame, and either cow's milk or shrimp. Any infant with a detectable SPT wheal (≥1 mm) to egg, peanut, or sesame was invited for a food challenge, repeat SPT, and blood test to measure serum‐specific IgE at Melbourne's Royal Children's Hospital. As described previously, food challenges were not undertaken for cow's milk or shrimp (Supplementary material S1).\n2\n, \n3\n\n\nThe cohort was followed up at age 4 years. Parents completed a mailed questionnaire or short telephone questionnaire to capture information on their child's current allergy status.\nChildren born after 1st June 2007 (the earliest date for available healthcare cost data linkage), with a valid linkage to healthcare cost data, with nonmissing food allergy information at year 1 were included in this study as the health economics sample. Healthcare service utilization and costs from 1 June 2007 till 1 December 2011 were collected.\nThe HealthNuts study is a single‐centre, multi‐wave, population‐based, longitudinal food allergy study undertaken in Melbourne, Australia. Detailed study methods have been published previously.\n12\n In brief, infants were recruited between September 2007 and August 2011 when presenting for their routine scheduled 12‐month vaccinations at immunization clinics. They were invited to undertake SPT screening to 4 common food allergens: egg, peanut, sesame, and either cow's milk or shrimp. Any infant with a detectable SPT wheal (≥1 mm) to egg, peanut, or sesame was invited for a food challenge, repeat SPT, and blood test to measure serum‐specific IgE at Melbourne's Royal Children's Hospital. As described previously, food challenges were not undertaken for cow's milk or shrimp (Supplementary material S1).\n2\n, \n3\n\n\nThe cohort was followed up at age 4 years. Parents completed a mailed questionnaire or short telephone questionnaire to capture information on their child's current allergy status.\nChildren born after 1st June 2007 (the earliest date for available healthcare cost data linkage), with a valid linkage to healthcare cost data, with nonmissing food allergy information at year 1 were included in this study as the health economics sample. Healthcare service utilization and costs from 1 June 2007 till 1 December 2011 were collected.\n Ethical conduct in human research Approval to conduct the HealthNuts study was obtained from the Victorian State Government Office for Children (reference no. CDF/07/492), the Victorian State Government Department of Human Services (reference no. 10/07), and the Royal Children's Hospital Human Research Ethics Committee (reference no. 27047). Parents provided written informed consent for study participation, and separate written informed consent to access their child's Medicare data for use in this study.\nApproval to conduct the HealthNuts study was obtained from the Victorian State Government Office for Children (reference no. CDF/07/492), the Victorian State Government Department of Human Services (reference no. 10/07), and the Royal Children's Hospital Human Research Ethics Committee (reference no. 27047). Parents provided written informed consent for study participation, and separate written informed consent to access their child's Medicare data for use in this study.\n Costs We investigated direct healthcare costs from a healthcare sector perspective. Out‐of‐hospital healthcare costs were collected through data linkage to the Medicare data, which covers study children's Medicare records from birth till December 2011. Medicare is Australia's universal health insurance scheme, which guarantees all Australians access to a wide range of health services at low or no cost. It has two components: the Medicare Benefits Schedule (MBS), which covers medical services (visits to health professionals, diagnostic and pathology services) mainly outside the hospital setting, and the Pharmaceutical Benefits Scheme (PBS), which covers prescription medications. All out‐of‐hospital MBS and PBS services were covered in the analysis, with MBS costs categorized into general practitioner (GP) visits, specialist visits (including visits to pediatricians and all other types of specialists), tests and all others, and PBS costs categorized into adrenaline autoinjectors, nutrition products (including infant formula), dermatologic medicines (e.g., emollients, antihistamines, corticosteroids, etc.) and all others. Details of the included services and prescription medicines and codes used to identify these categories are provided in Supplementary material S2. Costs were inflated to 2019/20 Australian dollars using the total health price index constructed by the Australian Institute of Health and Welfare.\n13\n The 2020 Purchasing power parities were used to exchange the Australian dollars into euros.\nWe investigated direct healthcare costs from a healthcare sector perspective. Out‐of‐hospital healthcare costs were collected through data linkage to the Medicare data, which covers study children's Medicare records from birth till December 2011. Medicare is Australia's universal health insurance scheme, which guarantees all Australians access to a wide range of health services at low or no cost. It has two components: the Medicare Benefits Schedule (MBS), which covers medical services (visits to health professionals, diagnostic and pathology services) mainly outside the hospital setting, and the Pharmaceutical Benefits Scheme (PBS), which covers prescription medications. All out‐of‐hospital MBS and PBS services were covered in the analysis, with MBS costs categorized into general practitioner (GP) visits, specialist visits (including visits to pediatricians and all other types of specialists), tests and all others, and PBS costs categorized into adrenaline autoinjectors, nutrition products (including infant formula), dermatologic medicines (e.g., emollients, antihistamines, corticosteroids, etc.) and all others. Details of the included services and prescription medicines and codes used to identify these categories are provided in Supplementary material S2. Costs were inflated to 2019/20 Australian dollars using the total health price index constructed by the Australian Institute of Health and Welfare.\n13\n The 2020 Purchasing power parities were used to exchange the Australian dollars into euros.\n Definitions We identified children with food allergy and other allergic diseases using the HealthNuts data: Food allergy at age 1 was defined as an oral food challenge‐confirmed allergy to egg, peanut, or sesame, in the context of an SPT ≥ 2 mm or specific IgE ≥ 0.35 kU/L to that food. Food‐allergic children were further classified as having peanut allergy alone, egg allergy alone, or peanut and other food allergy (with co‐existing egg or sesame food allergy). These classifications were selected to reflect the differences in the natural history of peanut vs egg allergy.\n14\n We were not able to separate out sesame allergy for analysis in this study due to the small sample size with this food allergy type.\nSince food allergy often co‐exists with other allergic diseases such as eczema and asthma, which may contribute to higher healthcare costs among children with food allergy, we also identified eczema and asthma in the analysis. These allergic diseases were defined as a patient‐report history of doctor‐diagnosed eczema or asthma at any time in the first 4 years of life.\nWe identified children with food allergy and other allergic diseases using the HealthNuts data: Food allergy at age 1 was defined as an oral food challenge‐confirmed allergy to egg, peanut, or sesame, in the context of an SPT ≥ 2 mm or specific IgE ≥ 0.35 kU/L to that food. Food‐allergic children were further classified as having peanut allergy alone, egg allergy alone, or peanut and other food allergy (with co‐existing egg or sesame food allergy). These classifications were selected to reflect the differences in the natural history of peanut vs egg allergy.\n14\n We were not able to separate out sesame allergy for analysis in this study due to the small sample size with this food allergy type.\nSince food allergy often co‐exists with other allergic diseases such as eczema and asthma, which may contribute to higher healthcare costs among children with food allergy, we also identified eczema and asthma in the analysis. These allergic diseases were defined as a patient‐report history of doctor‐diagnosed eczema or asthma at any time in the first 4 years of life.\n Statistical analysis We compared characteristics of children included and not included in the health economic sample, with differences tested using Chi‐square. Inverse probability weights were generated using logistic regression to adjust for potential bias caused by differences in child sex, socioeconomic status, and parents' country of birth between the health economic sample and the whole HealthNuts sample. We compared the MBS and PBS costs by age between children with and without food allergy, and across food‐allergic children from different socioeconomic groups. Only a proportion of study children had a full follow‐up for 4 years when the data linkage closed (1st December 2011). As a result, costs were aggregated into half‐year intervals by age in the calculation. Annual and total four‐year MBS and PBS costs were estimated by summing over the half‐year interval costs with confidence interval (CI) generated using nonparametric bootstrapping with 1000 replications. Two‐part model, a frequently used model to analyze cost data with a logistic regression part to estimate the likelihood of having any cost and a linear part to estimate costs when positive costs were predicted, was used to test whether the cost differences would vary after controlling for potential confounders (child sex, socioeconomic status, and parents' country of birth).\n15\n To understand the source of the cost differences, we decomposed the total four‐year MBS and PBS costs into different types of services, and compared them between children with and without food allergy and across children with different types of food allergy. To understand how other allergic diseases may contribute to children's food allergy costs, we compared the MBS and PBS costs between children with and without food allergy among those with or without asthma and eczema, respectively.\nBased on age‐specific population size in 2020,\n16\n food allergy prevalence in Australia estimated in previous studies,\n14\n, \n17\n and the cost differences and uncertainties estimated between children with and without food allergy in this study, total extra Medicare out‐of‐hospital costs caused by food allergy among 0‐ to 4‐year‐old children were projected for Victoria and Australia through simulation with 1000 replications (Supplementary material S3). Based on Osborne 2012,\n17\n a lower food allergy prevalence was assumed in North Australia compared with South and Central Australia in the calculation (Supplementary material S3).\nWe compared characteristics of children included and not included in the health economic sample, with differences tested using Chi‐square. Inverse probability weights were generated using logistic regression to adjust for potential bias caused by differences in child sex, socioeconomic status, and parents' country of birth between the health economic sample and the whole HealthNuts sample. We compared the MBS and PBS costs by age between children with and without food allergy, and across food‐allergic children from different socioeconomic groups. Only a proportion of study children had a full follow‐up for 4 years when the data linkage closed (1st December 2011). As a result, costs were aggregated into half‐year intervals by age in the calculation. Annual and total four‐year MBS and PBS costs were estimated by summing over the half‐year interval costs with confidence interval (CI) generated using nonparametric bootstrapping with 1000 replications. Two‐part model, a frequently used model to analyze cost data with a logistic regression part to estimate the likelihood of having any cost and a linear part to estimate costs when positive costs were predicted, was used to test whether the cost differences would vary after controlling for potential confounders (child sex, socioeconomic status, and parents' country of birth).\n15\n To understand the source of the cost differences, we decomposed the total four‐year MBS and PBS costs into different types of services, and compared them between children with and without food allergy and across children with different types of food allergy. To understand how other allergic diseases may contribute to children's food allergy costs, we compared the MBS and PBS costs between children with and without food allergy among those with or without asthma and eczema, respectively.\nBased on age‐specific population size in 2020,\n16\n food allergy prevalence in Australia estimated in previous studies,\n14\n, \n17\n and the cost differences and uncertainties estimated between children with and without food allergy in this study, total extra Medicare out‐of‐hospital costs caused by food allergy among 0‐ to 4‐year‐old children were projected for Victoria and Australia through simulation with 1000 replications (Supplementary material S3). Based on Osborne 2012,\n17\n a lower food allergy prevalence was assumed in North Australia compared with South and Central Australia in the calculation (Supplementary material S3).", "The HealthNuts study is a single‐centre, multi‐wave, population‐based, longitudinal food allergy study undertaken in Melbourne, Australia. Detailed study methods have been published previously.\n12\n In brief, infants were recruited between September 2007 and August 2011 when presenting for their routine scheduled 12‐month vaccinations at immunization clinics. They were invited to undertake SPT screening to 4 common food allergens: egg, peanut, sesame, and either cow's milk or shrimp. Any infant with a detectable SPT wheal (≥1 mm) to egg, peanut, or sesame was invited for a food challenge, repeat SPT, and blood test to measure serum‐specific IgE at Melbourne's Royal Children's Hospital. As described previously, food challenges were not undertaken for cow's milk or shrimp (Supplementary material S1).\n2\n, \n3\n\n\nThe cohort was followed up at age 4 years. Parents completed a mailed questionnaire or short telephone questionnaire to capture information on their child's current allergy status.\nChildren born after 1st June 2007 (the earliest date for available healthcare cost data linkage), with a valid linkage to healthcare cost data, with nonmissing food allergy information at year 1 were included in this study as the health economics sample. Healthcare service utilization and costs from 1 June 2007 till 1 December 2011 were collected.", "Approval to conduct the HealthNuts study was obtained from the Victorian State Government Office for Children (reference no. CDF/07/492), the Victorian State Government Department of Human Services (reference no. 10/07), and the Royal Children's Hospital Human Research Ethics Committee (reference no. 27047). Parents provided written informed consent for study participation, and separate written informed consent to access their child's Medicare data for use in this study.", "We investigated direct healthcare costs from a healthcare sector perspective. Out‐of‐hospital healthcare costs were collected through data linkage to the Medicare data, which covers study children's Medicare records from birth till December 2011. Medicare is Australia's universal health insurance scheme, which guarantees all Australians access to a wide range of health services at low or no cost. It has two components: the Medicare Benefits Schedule (MBS), which covers medical services (visits to health professionals, diagnostic and pathology services) mainly outside the hospital setting, and the Pharmaceutical Benefits Scheme (PBS), which covers prescription medications. All out‐of‐hospital MBS and PBS services were covered in the analysis, with MBS costs categorized into general practitioner (GP) visits, specialist visits (including visits to pediatricians and all other types of specialists), tests and all others, and PBS costs categorized into adrenaline autoinjectors, nutrition products (including infant formula), dermatologic medicines (e.g., emollients, antihistamines, corticosteroids, etc.) and all others. Details of the included services and prescription medicines and codes used to identify these categories are provided in Supplementary material S2. Costs were inflated to 2019/20 Australian dollars using the total health price index constructed by the Australian Institute of Health and Welfare.\n13\n The 2020 Purchasing power parities were used to exchange the Australian dollars into euros.", "We identified children with food allergy and other allergic diseases using the HealthNuts data: Food allergy at age 1 was defined as an oral food challenge‐confirmed allergy to egg, peanut, or sesame, in the context of an SPT ≥ 2 mm or specific IgE ≥ 0.35 kU/L to that food. Food‐allergic children were further classified as having peanut allergy alone, egg allergy alone, or peanut and other food allergy (with co‐existing egg or sesame food allergy). These classifications were selected to reflect the differences in the natural history of peanut vs egg allergy.\n14\n We were not able to separate out sesame allergy for analysis in this study due to the small sample size with this food allergy type.\nSince food allergy often co‐exists with other allergic diseases such as eczema and asthma, which may contribute to higher healthcare costs among children with food allergy, we also identified eczema and asthma in the analysis. These allergic diseases were defined as a patient‐report history of doctor‐diagnosed eczema or asthma at any time in the first 4 years of life.", "We compared characteristics of children included and not included in the health economic sample, with differences tested using Chi‐square. Inverse probability weights were generated using logistic regression to adjust for potential bias caused by differences in child sex, socioeconomic status, and parents' country of birth between the health economic sample and the whole HealthNuts sample. We compared the MBS and PBS costs by age between children with and without food allergy, and across food‐allergic children from different socioeconomic groups. Only a proportion of study children had a full follow‐up for 4 years when the data linkage closed (1st December 2011). As a result, costs were aggregated into half‐year intervals by age in the calculation. Annual and total four‐year MBS and PBS costs were estimated by summing over the half‐year interval costs with confidence interval (CI) generated using nonparametric bootstrapping with 1000 replications. Two‐part model, a frequently used model to analyze cost data with a logistic regression part to estimate the likelihood of having any cost and a linear part to estimate costs when positive costs were predicted, was used to test whether the cost differences would vary after controlling for potential confounders (child sex, socioeconomic status, and parents' country of birth).\n15\n To understand the source of the cost differences, we decomposed the total four‐year MBS and PBS costs into different types of services, and compared them between children with and without food allergy and across children with different types of food allergy. To understand how other allergic diseases may contribute to children's food allergy costs, we compared the MBS and PBS costs between children with and without food allergy among those with or without asthma and eczema, respectively.\nBased on age‐specific population size in 2020,\n16\n food allergy prevalence in Australia estimated in previous studies,\n14\n, \n17\n and the cost differences and uncertainties estimated between children with and without food allergy in this study, total extra Medicare out‐of‐hospital costs caused by food allergy among 0‐ to 4‐year‐old children were projected for Victoria and Australia through simulation with 1000 replications (Supplementary material S3). Based on Osborne 2012,\n17\n a lower food allergy prevalence was assumed in North Australia compared with South and Central Australia in the calculation (Supplementary material S3).", "In total 2919 children were included in this study, with 390 (13.4%) having challenge‐confirmed allergy at year 1. Compared with children who participated in the HealthNuts study but were not included in the current analysis, the health economics study sample included more males, less families from the lowest and highest socioeconomics quintiles, more families with both parents born in Australia, and more children with challenge‐confirmed food allergy at year 1 (Table 1).\nCharacteristics of children included and not included in the health economics analysis sample\nChildren born after 1 June 2007 (the earliest date for available healthcare cost data linkage), with a valid linkage to healthcare cost data, with nonmissing food allergy information at year 1 were included in this study as the health economics sample.\nSocio‐Economic Indexes for Areas (SEIFA) is a product developed by the Australian Bureau Statistics that ranks areas in Australia according to relative socioeconomic advantage and disadvantage. The indexes are based on information from the five‐yearly Census.\nAfter adjusting for potential selection bias using inverse probability weights, compared to children without food allergy at age 1, children with food allergy had significantly higher costs for MBS medical services from the second year after birth, and significantly higher costs for PBS prescriptions from birth up to age four years, with the adjusted results similar to the observed ones (Table 2). The total healthcare costs associated with food allergy from age 1 to age 4 years were estimated to be AUD$586.3 (95%CI: $305.2–$855.0) or €270.9 (95%CI: €141.0–€395.0) for MBS services, AUD$303.4 (95%CI: $194.5–$420.2) or €140.2 (95%CI: €89.9–€194.1) for PBS services, and AUD$889.7 (95%CI: $566.1–$1188.3) or €411.0 (95% CI €261.5–€549.0) for all Medicare out‐of‐hospital services. There was no significant difference detected in total MBS costs and PBS costs among children with food allergy across different socioeconomic groups (Supplementary material S4).\nOut‐of‐hospital Medicare Benefits Schedule (MBS, medical services) and Pharmaceutical Benefits Scheme (PBS, prescriptions) cost for children with and without challenge‐confirmed food allergy at year 1 (2020 AUD$), by year after birth\n\nNote: Results were inverse probability weighted.\nAmong which 79 children had patient‐reported history of doctor‐diagnosed asthma, 237 had patient‐reported history of doctor‐diagnosed eczema in the first 4 years of life.\nAdjusted by child's sex, socioeconomic status, and parents' country of birth using the two‐part model.\nCosts by category of services for children with and without food allergy and with different types of food allergy are presented in Figure 1. Compared to children without food allergy, children with food allergy incurred significantly more healthcare costs for GP visits (difference = AUD$151.1 or €69.8), specialist visits (difference = AUD$242.9 or €112.2), tests (difference = AUD$127.4 or €58.9), as well as on adrenaline autoinjectors (difference = AUD$148.3 or €68.5), nutrition products (difference = AUD$109.3 or €50.5), and dermatological medications (difference = AUD$27.7 or €12.8) in the first four years of life (Figure 1A,B). The cost differences across different food allergy groups mainly come from adrenaline autoinjectors, with children only allergic to peanut incurring AUD$144.5 or €66.8 more on adrenaline autoinjectors than children with egg allergy only (who incurred AUD$66.6 or €30.8 on adrenaline autoinjectors), and children with multiple food allergy (peanut co‐existing with other) incurring another AUD$148.1 or €68.4 compared with children only allergic to peanut (Figure 1D).\nTotal four‐year out‐of‐hospital MBS (for medical services) and PBS (for prescriptions) costs for children without and with challenge‐confirmed food allergy at year 1, and for children with different types of food allergy, by category of services (2020 AUD$). Results were inverse probability weighted. The error bar represents the 95% confidence interval of the estimation. GP, general practitioner; MBS, Medicare Benefits Schedule; PBS, Pharmaceutical Benefits Scheme\nThe comparisons of healthcare costs between children with food allergy and with other allergic diseases are presented in Figure 2. Children with food allergy alone tended to incur slightly lower costs for MBS medical services compared to children with asthma alone, and higher costs for PBS prescriptions compared to children with asthma or eczema. Having food allergy co‐existing with other allergic diseases tended to increase children's healthcare costs more than a purely additive way. This effect was more significant for PBS costs and for children co‐existing with asthma.\nOut‐of‐hospital MBS (for medical services) and PBS (for prescriptions) costs for children with challenge‐confirmed food allergy at year 1 and with other allergic diseases, by year after birth (2020 AUD$). Results were inverse probability weighted. The error bar represents the 95% confidence interval of the estimation. FA, food allergy; MBS, Medicare Benefits Schedule; PBS, Pharmaceutical Benefits Scheme\nBased on the age‐specific MBS and PBS cost differences and uncertainties estimated between children with and without food allergy (Table 2), it was estimated that in 2020 the total economic burden on Medicare out‐of‐hospital services caused by food allergy among children 0–4 years old was AUD$7.7 million (95% CI $5.8–$9.9 million) or €3.6 (95% CI €2.7–€4.6 million) in Victoria and AUD$26.1 million (95% CI $20.1–$32.3 million) or €12.1 (95% CI €9.3–€14.9 million) in Australia, with around two‐thirds of the total economic burden coming from MBS medical services and one‐third from PBS prescriptions (Table 3).\nTotal economic burden on Medicare out‐of‐hospital services caused by food allergy among children 0–4 years old in Victoria and Australia in 2020 (2020 AUD$/Euro€)\nAbbreviations: MBS, Medicare Benefits Schedule; PBS, Pharmaceutical Benefits Scheme.", "In this study, we estimated the Medicare out‐of‐hospital healthcare costs for food allergy among children 0–4 years old in Australia using a longitudinal cohort linked to administrative health data. We found that compared to children without challenge‐confirmed food allergy, children with food allergy had significantly higher costs for GP visits, specialist visits, tests as well as on prescriptions. Children with peanut allergy tended to incur higher costs for adrenaline autoinjectors compared to children with egg allergy. This has translated into considerable Medicare costs for out‐of‐hospital services in Australia, estimated to be AUD$26.1 million or €12.1 million among 0‐ to 4‐year‐old children in 2020.\nWe found no significant difference in out‐of‐hospital costs for childhood food allergy across different socioeconomic groups. This is different from what was found in a US study, which identified disparities in the economic effect of food allergy based on socioeconomic status.\n18\n It is worth noting that children in the HealthNuts cohort were all recruited from immunization clinics in greater metropolitan Melbourne.\n12\n This suggests that any inequality between families from the remote and the metropolitan area will not be captured in this study. Regarding different types of food allergy, we found a higher cost associated with the prescription of adrenaline autoinjectors among children with peanut allergy and higher prescription costs among children with food allergy co‐existing with asthma. This is consistent with clinical guidelines at the time of the study, which specifically suggested considering the prescription of adrenaline autoinjectors for children with food allergies to peanuts, tree nuts, and seafood, as well as those with a history of anaphylaxis or asthma.\n19\n\n\nThis is the first study in Australia estimating the costs of childhood food allergy and projecting its economic burden at the population level. The results show that although infant food allergy in many cases resolves in the first few years of life, it causes high costs to the health system including out‐of‐hospital services. This is consistent with a few other studies in the United States and Finland, which have also separated out primary care, specialist visits, and examinations in the analysis.\n20\n Our estimated costs of specialist consultations and tests due to childhood allergy were significantly lower compared with the US study (US$212 or AUD$311 annually, 2018 price). This may be due to the GP‐centred primary care services for children with food allergy in Australia. In Australia, primary care stands for the “gateway” to the wider health system including secondary specialist and tertiary hospital services.\n21\n It will be useful to strengthen the role of primary care in the management of childhood food allergy, e.g., to advise on foods to avoid and deal with nonurgent food allergy reactions. This may help reduce referrals to specialists and avoid the more expensive hospital admissions and emergency department presentations.\nThis study represents good baseline cost data for childhood food allergy in Australia. With the ongoing effort on monitoring and reducing the incidence of childhood food allergy in Australia through primary prevention strategies such as the timely introduction of allergenic foods,\n22\n results in this study can be useful to conduct future projections on the economic burden of childhood food allergy and guide policy decisions.\nThe strength of this study is the use of a longitudinal cohort with the challenge‐confirmed diagnosis of childhood food allergy and linkage to administrative health data, which allows for accurate identification of the food allergy sample and the utilization of health services. The limitation is that we were not able to measure hospital admission and emergency presentation costs for children with food allergy in this study, which could represent more than half of the total healthcare costs.\n7\n It will be useful for future studies with a good hospital data linkage to investigate this further. We were not able to measure any cost of items that are not covered by Medicare, for example, over‐the‐counter medicines and formulas that can be purchased without a prescription. This suggests that our cost estimates should be viewed as conservative.\nIn conclusion, in this study using a population‐based longitudinal study linked to administrative health records, we quantified the out‐of‐hospital healthcare costs for children with food allergy from birth to 4 years of age in Australia. The findings can help anticipate the financial impact on the health care system associated with childhood food allergy, and act as a useful costing resource for future evaluations focusing on preventive and treatment strategies for children with food allergy.", "Xinyang Hua: Conceptualization; Methodology; Formal analysis; Writing—original draft; Writing—review & editing; Project administration. Kim Dalziel: Conceptualization; Methodology; Supervision; Writing—review & editing; Writing—original draft; Formal analysis. Tim Brettig: Conceptualization; Methodology; Writing—review & editing. Shyamali C Dharmage: Conceptualization; Methodology; Writing—review & editing; Funding acquisition; Investigation. Adrian Lowe: Conceptualization; Methodology; Writing—review & editing. Kirsten P Perrett: Conceptualization; Methodology; Funding acquisition; Investigation; Writing—review & editing. Rachel L Peters: Conceptualization; Methodology; Investigation; Funding acquisition; Writing—review & editing. Anne‐Louise Ponsonby: Conceptualization; Methodology; Writing—review & editing. Mimi LK Tang: Conceptualization; Methodology; Investigation; Funding acquisition; Writing—review & editing. Jennifer Koplin: Conceptualization; Methodology; Investigation; Funding acquisition; Writing—review & editing; Writing—original draft; Data curation; Supervision.", "Xinyang Hua is an Australian National Health and Medical Research Council (NHMRC) Emerging Leadership Fellow (GN 2009253). Tim Brettig is supported by a PhD scholarship from the NHMRC‐funded Centre for Food and Allergy Research (CFAR, GNT1134812). Kirsten Perrett is supported by an NHMRC Investigator grant (GNT2008911) and a Melbourne Children's Clinician–Scientist Fellowship. Rachel Peters is supported by an NHMRC Early Career Fellowship and an NHMRC Clinical Trials and Cohort Studies Grant. Anne‐Louise Ponsonby is supported by an NHMRC Senior Research Fellowship (APP1110200). Jennifer Koplin is supported by NHMRC fellowship GNT1158699. Research at Murdoch Children's Research Institute is supported by the Victorian Government's Operational Infrastructure Support Program.", "Kirsten Perrett is Chair of the scientific advisory board for AllergyPal. Her institution has received research grants from the National Health and Medical Research Council, Immune Tolerance Network, DBV Technologies, and Novartis and consultant fees from Aravax; outside the submitted work. Other authors declare no conflict of interest. S.C.D. and A.J.L. declare they have received research funds from GSK’s competitively awarded Investigator Sponsored Studies programme, for unrelated research. A.J.L. has also received donations of interventional product (EpiCeram) from Primus Pharmaceuticals for unrelated research.", " PEER REVIEW The peer review history for this article is available at https://publons.com/publon/10.1111/pai.13883.\nThe peer review history for this article is available at https://publons.com/publon/10.1111/pai.13883.", "The peer review history for this article is available at https://publons.com/publon/10.1111/pai.13883.", "\nAppendix S1\n\nClick here for additional data file." ]

[ "background", "methods", null, null, null, null, null, "results", "discussion", null, null, "COI-statement", null, null, "supplementary-material" ]

[ "burden", "child", "food allergy", "health care costs" ]

[ 250, 82, 254, 206, 426, 190, 129, 29, 12 ]

[ "allergy", "food", "food allergy", "children", "costs", "study", "health", "services", "children food", "children food allergy" ]

[ "food allergy costs", "food allergy australia", "allergy prevalence australia", "anaphylaxis children increased", "food allergic children" ]

[ "Adolescent", "Anticonvulsants", "Cannabidiol", "Caregivers", "Child", "Child, Preschool", "Electroencephalography", "Epilepsies, Myoclonic", "Epilepsy", "Female", "Humans", "Infant", "Lennox Gastaut Syndrome", "Male", "Patient Safety", "Republic of Korea", "Retrospective Studies", "Treatment Outcome" ]

[ "Patients and study design", "Assessment of efficacy", "Assessment of safety", "Analyses", "Ethics statement", "Study population", "Efficacy in LGS", "Efficacy in DS", "Safety" ]

[ "Patients who initiated CBD treatment from March 2019 to October 2019 and who were between the ages of 2 and 18 years and diagnosed with of DS or LGS were included in this study. All patients diagnosed with DS met the clinical diagnostic criteria, including an early onset of febrile or vaccination related seizures, developmental regression in relation to the seizures, and drug-resistant epilepsy. All had pathogenic SCN1A (sodium channel, voltage-gated, type I, alpha subunit) mutations. All patients diagnosed with LGS exhibited impaired intellectual function and multiple mixed-type seizures, as well as characteristic electroencephalography (EEG) patterns showing generalized sharp and slow waves (GSSW) or generalized paroxysmal fast activities (PFA). This study was conducted retrospectively and evaluated the medication efficacy and safety through outpatient visits at 3 and 6 months based on caregiver reporting. Patients received Epidiolex®, manufactured by GW Pharmaceuticals, which contained CBD (100 mg/mL). CBD was administered orally at a starting dose of 5 mg/kg/day, in addition to baseline antiepileptic drug therapy. After 1 week, the dosage was up-titrated by 5 mg/kg/day and was maintained at 10 mg/kg/day (Fig. 1).\nCBD = cannabidiol, EEG = electroencephalogram.", "The efficacy of CBD was evaluated by comparing the mean frequency of motor seizures experienced per month, defined by the tonic, clonic, and atonic components, before and after the administration of medication. The change in the seizure frequency was expressed as a percentage that was calculated as [(seizure frequency per month) − (seizure frequency at baseline)]/(seizure frequency at baseline) × 100. Each patient's response to CBD was categorized as one of the following 4 responses: 1) the patient became seizure-free, 2) the frequency of seizures was reduced by more than 50%, 3) the frequency of seizures was reduced by less than 50%, or 4) there was no effect. A good outcome was defined as the seizure frequency being reduced by more than 50%, including being seizure-free.\nThe additional effect of CBD was evaluated based on comparisons of the EEGs performed during each period, and each assessment was performed for 30 minutes or more. Each scalp electrode was placed in accordance with an international 10–20 system. The diagnosis was based on the characteristic interictal and ictal patterns of the EEG.15 In the LGS group, we evaluated whether the EEG improved at the 3- and 6-month visits, and the criteria were based on the persistence of the EEG characteristics of LGS or the prevalence of the epileptiform pattern.16", "All safety results in this report were evaluated over the entire follow-up period. Patients or caregivers documented the adverse events at each visit. Safety was assessed through laboratory studies, including complete blood counts, liver function tests, and vital signs at baseline and at the time of the outpatient clinic visits. The appearance of adverse events was resolved by dose reduction or discontinuation of treatment.", "An intention-to-treat analysis was conducted to assess CBD efficacy. Data processing and analysis were performed with Statistical Package for the Social Sciences version 25 (IBM Co., Armonk, NY, USA). P values < 0.05 were regarded as statistically significant. All numbers were rounded to 2 decimal places. The statistical analyses included the independent paired-sample t-test and Fisher's exact test, and Pearson's χ2 test to compare the variables and prognosis.", "This study was approved by the Institutional Review Board of Severance Hospital (approval No.: 4-2020-0120). Informed consent was waived due to the retrospective nature of the study.", "During the study period, 44 patients were managed with CBD, 34 of whom were in the LGS group and 10 of whom were in the DS group. One patient from the LGS group was excluded due to follow-up loss. One patient from the DS group was excluded due to the occurrence of an adverse event before the 3-month evaluation. After the 3-month evaluation, 6 patients in the LGS group were excluded from the study due to dissatisfaction with the treatment effect, and 3 patients were excluded because of the development of adverse events. In the DS group, 1 patient was excluded due to adverse events and 2 were excluded due to financial constraints (Fig. 2).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nThe ages of the patients included in this study ranged from 1.2 to 15.8 years (mean age = 5.1 years), with 28 males (63.6%) and 16 females (36.4%). There were 5 patients (11.4%) undergoing diet therapy. The most frequently used antiepileptic drug at the time of the study was valproic acid (VPA) at an average dose of 22.2 mg/kg/day, followed by levetiracetam at an average dose of 20.3 mg/kg/day. Stiripentol was used only in DS patients. Patient characteristics are shown in Table 1.\nData are presented as median (range) or number (%) unless otherwise indicated.\nCBD = cannabidiol, IQR = interquartile range, EEG = electroencephalogram, MRI = magnetic resonance imaging.\naAll diet therapies used in this study were the modified Atkins diet; bAll used deflazacort.", "When outcomes were observed in the LGS group, a reduction in seizure frequency was observed in 52.9% of the patients at 3 months and in 29.4% at 6 months. Eight patients (23.5%) were seizure-free at the 3-month evaluation, 3 patients (8.8%) had a reduction in seizure frequency of more than 50%, and 7 patients (20.6%) showed a reduction in seizure frequency of less than 50%. It can be stated that the result was good in 32.3% of patients. At the 6-month evaluation, 4 patients (11.8%) were seizure-free and 3 patients (8.8%) showed more than a 50% reduction in seizure frequency; thus, 20.6% of the patients had good outcomes (Fig. 3A).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nWhen evaluating the initial EEGs of LGS patients, 16 cases showed GSSW or PFA, characteristic of LGS. The outcomes at the 3- and 6-month evaluations were investigated. At the 3-month evaluation, good outcomes were observed as there were more cases with an initial EEG that did not show the PFA, but at the 6-month evaluation, the opposite was observed. In the case of the GSSW pattern, good outcomes were obtained, with no cases showing the pattern at either the 3- or the 6-month evaluations; however, there was no statistically significant change in EEG activity after the administration of CBD.\nWhen compared with the baseline EEG, most of the patients who showed no improvement at the 3-month evaluation (P value = 0.017) and the 6-month evaluation (P value = 0.009) were determined to have had a “no effect” outcome.", "In the DS group, the “no effect” outcome was observed at a higher frequency at both the 3- and 6-month evaluations than it was in the LGS group. At the 3-month evaluation, 1 patient (10.0%) was seizure-free, 2 patients (20.0%) showed a more than 50% reduction in seizure frequency, and 60.0% of the enrolled patients experienced no effect. None of the patients were “seizure-free” at the 6-month evaluation, and only 2 (20.0%) showed a reduction in seizure frequency of 50% or more. At the 6-month evaluation, a “no effect” outcome was observed in 66.7% of patients (Fig. 3B).", "No life-threatening adverse event was reported in the LGS and DS groups during the observation period. However, adverse events were reported in 16 (36.3%) of the enrolled patients, and GI problems were the most frequent adverse event in 7 cases (15.9%); among them, mild liver enzyme elevation was observed in 1 case, whereas most included vomiting or diarrhea. Five cases (11.4%) experienced behavioral changes, such as irritability, hyperactivity, excessive alertness, and sleep disturbances (Table 2). In the DS group, 2 cases had increased seizure frequency, which warranted the discontinuation of the medication. The other adverse events necessitating the cessation of the drug were as follows: 1 case of drowsiness, 1 case of GI problems with acute pancreatitis, and 1 case of behavioral changes.\nValues are presented as number (%).\nAED = antiepileptic drug, CBD = cannabidiol." ]

[ null, null, null, null, null, null, null, null, null ]

[ "INTRODUCTION", "METHODS", "Patients and study design", "Assessment of efficacy", "Assessment of safety", "Analyses", "Ethics statement", "RESULTS", "Study population", "Efficacy in LGS", "Efficacy in DS", "Safety", "DISCUSSION" ]

[ "Epilepsy is associated with cognitive dysfunction and behavioral disorders. Uncontrolled seizures often affect one's quality of life, especially when they occur at a young age.12345 In particular, in epileptic encephalopathies such as Lennox-Gastaut syndrome (LGS) and Dravet syndrome (DS), epileptic activity causes severe cognitive and behavioral disorders to worsen over time.6\nPurified cannabidiol (CBD) (Epidiolex®; GW Pharmaceuticals, Cambridge, UK) is a new drug that can be used to treat drug-resistant epilepsy,7 as its administration can reduce seizure frequency. Mild adverse events such as somnolence and gastrointestinal (GI) symptoms have been reported.78910 After randomized trials assessing CBD use in LGS and DS were conducted, the United States Food and Drug Administration approved the prescription of CBD for both epileptic encephalopathies in 2018.1112\nCBD exerts anti-seizure effects, while another component of cannabis, Δ9-tetrahydrocannabinol (THC), has psychoactive functions.1314 In Korea, due to the addictive nature of THC, even CBD was considered an illegal drug until March 2019. The efforts of the media, patient groups, and non-governmental organizations informed the public that CBD medication contained a very small amount of THC, with a very low potential for addiction and psychoactive effects. These acts led to the approval of CBD by the Ministry of Food and Drug Safety for the treatment of DS or LGS in those over two years of age.\nThis study was performed to evaluate the tolerability and efficacy of CBD in children with LGS or DS for the first time in Korea.", " Patients and study design Patients who initiated CBD treatment from March 2019 to October 2019 and who were between the ages of 2 and 18 years and diagnosed with of DS or LGS were included in this study. All patients diagnosed with DS met the clinical diagnostic criteria, including an early onset of febrile or vaccination related seizures, developmental regression in relation to the seizures, and drug-resistant epilepsy. All had pathogenic SCN1A (sodium channel, voltage-gated, type I, alpha subunit) mutations. All patients diagnosed with LGS exhibited impaired intellectual function and multiple mixed-type seizures, as well as characteristic electroencephalography (EEG) patterns showing generalized sharp and slow waves (GSSW) or generalized paroxysmal fast activities (PFA). This study was conducted retrospectively and evaluated the medication efficacy and safety through outpatient visits at 3 and 6 months based on caregiver reporting. Patients received Epidiolex®, manufactured by GW Pharmaceuticals, which contained CBD (100 mg/mL). CBD was administered orally at a starting dose of 5 mg/kg/day, in addition to baseline antiepileptic drug therapy. After 1 week, the dosage was up-titrated by 5 mg/kg/day and was maintained at 10 mg/kg/day (Fig. 1).\nCBD = cannabidiol, EEG = electroencephalogram.\nPatients who initiated CBD treatment from March 2019 to October 2019 and who were between the ages of 2 and 18 years and diagnosed with of DS or LGS were included in this study. All patients diagnosed with DS met the clinical diagnostic criteria, including an early onset of febrile or vaccination related seizures, developmental regression in relation to the seizures, and drug-resistant epilepsy. All had pathogenic SCN1A (sodium channel, voltage-gated, type I, alpha subunit) mutations. All patients diagnosed with LGS exhibited impaired intellectual function and multiple mixed-type seizures, as well as characteristic electroencephalography (EEG) patterns showing generalized sharp and slow waves (GSSW) or generalized paroxysmal fast activities (PFA). This study was conducted retrospectively and evaluated the medication efficacy and safety through outpatient visits at 3 and 6 months based on caregiver reporting. Patients received Epidiolex®, manufactured by GW Pharmaceuticals, which contained CBD (100 mg/mL). CBD was administered orally at a starting dose of 5 mg/kg/day, in addition to baseline antiepileptic drug therapy. After 1 week, the dosage was up-titrated by 5 mg/kg/day and was maintained at 10 mg/kg/day (Fig. 1).\nCBD = cannabidiol, EEG = electroencephalogram.\n Assessment of efficacy The efficacy of CBD was evaluated by comparing the mean frequency of motor seizures experienced per month, defined by the tonic, clonic, and atonic components, before and after the administration of medication. The change in the seizure frequency was expressed as a percentage that was calculated as [(seizure frequency per month) − (seizure frequency at baseline)]/(seizure frequency at baseline) × 100. Each patient's response to CBD was categorized as one of the following 4 responses: 1) the patient became seizure-free, 2) the frequency of seizures was reduced by more than 50%, 3) the frequency of seizures was reduced by less than 50%, or 4) there was no effect. A good outcome was defined as the seizure frequency being reduced by more than 50%, including being seizure-free.\nThe additional effect of CBD was evaluated based on comparisons of the EEGs performed during each period, and each assessment was performed for 30 minutes or more. Each scalp electrode was placed in accordance with an international 10–20 system. The diagnosis was based on the characteristic interictal and ictal patterns of the EEG.15 In the LGS group, we evaluated whether the EEG improved at the 3- and 6-month visits, and the criteria were based on the persistence of the EEG characteristics of LGS or the prevalence of the epileptiform pattern.16\nThe efficacy of CBD was evaluated by comparing the mean frequency of motor seizures experienced per month, defined by the tonic, clonic, and atonic components, before and after the administration of medication. The change in the seizure frequency was expressed as a percentage that was calculated as [(seizure frequency per month) − (seizure frequency at baseline)]/(seizure frequency at baseline) × 100. Each patient's response to CBD was categorized as one of the following 4 responses: 1) the patient became seizure-free, 2) the frequency of seizures was reduced by more than 50%, 3) the frequency of seizures was reduced by less than 50%, or 4) there was no effect. A good outcome was defined as the seizure frequency being reduced by more than 50%, including being seizure-free.\nThe additional effect of CBD was evaluated based on comparisons of the EEGs performed during each period, and each assessment was performed for 30 minutes or more. Each scalp electrode was placed in accordance with an international 10–20 system. The diagnosis was based on the characteristic interictal and ictal patterns of the EEG.15 In the LGS group, we evaluated whether the EEG improved at the 3- and 6-month visits, and the criteria were based on the persistence of the EEG characteristics of LGS or the prevalence of the epileptiform pattern.16\n Assessment of safety All safety results in this report were evaluated over the entire follow-up period. Patients or caregivers documented the adverse events at each visit. Safety was assessed through laboratory studies, including complete blood counts, liver function tests, and vital signs at baseline and at the time of the outpatient clinic visits. The appearance of adverse events was resolved by dose reduction or discontinuation of treatment.\nAll safety results in this report were evaluated over the entire follow-up period. Patients or caregivers documented the adverse events at each visit. Safety was assessed through laboratory studies, including complete blood counts, liver function tests, and vital signs at baseline and at the time of the outpatient clinic visits. The appearance of adverse events was resolved by dose reduction or discontinuation of treatment.\n Analyses An intention-to-treat analysis was conducted to assess CBD efficacy. Data processing and analysis were performed with Statistical Package for the Social Sciences version 25 (IBM Co., Armonk, NY, USA). P values < 0.05 were regarded as statistically significant. All numbers were rounded to 2 decimal places. The statistical analyses included the independent paired-sample t-test and Fisher's exact test, and Pearson's χ2 test to compare the variables and prognosis.\nAn intention-to-treat analysis was conducted to assess CBD efficacy. Data processing and analysis were performed with Statistical Package for the Social Sciences version 25 (IBM Co., Armonk, NY, USA). P values < 0.05 were regarded as statistically significant. All numbers were rounded to 2 decimal places. The statistical analyses included the independent paired-sample t-test and Fisher's exact test, and Pearson's χ2 test to compare the variables and prognosis.\n Ethics statement This study was approved by the Institutional Review Board of Severance Hospital (approval No.: 4-2020-0120). Informed consent was waived due to the retrospective nature of the study.\nThis study was approved by the Institutional Review Board of Severance Hospital (approval No.: 4-2020-0120). Informed consent was waived due to the retrospective nature of the study.", "Patients who initiated CBD treatment from March 2019 to October 2019 and who were between the ages of 2 and 18 years and diagnosed with of DS or LGS were included in this study. All patients diagnosed with DS met the clinical diagnostic criteria, including an early onset of febrile or vaccination related seizures, developmental regression in relation to the seizures, and drug-resistant epilepsy. All had pathogenic SCN1A (sodium channel, voltage-gated, type I, alpha subunit) mutations. All patients diagnosed with LGS exhibited impaired intellectual function and multiple mixed-type seizures, as well as characteristic electroencephalography (EEG) patterns showing generalized sharp and slow waves (GSSW) or generalized paroxysmal fast activities (PFA). This study was conducted retrospectively and evaluated the medication efficacy and safety through outpatient visits at 3 and 6 months based on caregiver reporting. Patients received Epidiolex®, manufactured by GW Pharmaceuticals, which contained CBD (100 mg/mL). CBD was administered orally at a starting dose of 5 mg/kg/day, in addition to baseline antiepileptic drug therapy. After 1 week, the dosage was up-titrated by 5 mg/kg/day and was maintained at 10 mg/kg/day (Fig. 1).\nCBD = cannabidiol, EEG = electroencephalogram.", "The efficacy of CBD was evaluated by comparing the mean frequency of motor seizures experienced per month, defined by the tonic, clonic, and atonic components, before and after the administration of medication. The change in the seizure frequency was expressed as a percentage that was calculated as [(seizure frequency per month) − (seizure frequency at baseline)]/(seizure frequency at baseline) × 100. Each patient's response to CBD was categorized as one of the following 4 responses: 1) the patient became seizure-free, 2) the frequency of seizures was reduced by more than 50%, 3) the frequency of seizures was reduced by less than 50%, or 4) there was no effect. A good outcome was defined as the seizure frequency being reduced by more than 50%, including being seizure-free.\nThe additional effect of CBD was evaluated based on comparisons of the EEGs performed during each period, and each assessment was performed for 30 minutes or more. Each scalp electrode was placed in accordance with an international 10–20 system. The diagnosis was based on the characteristic interictal and ictal patterns of the EEG.15 In the LGS group, we evaluated whether the EEG improved at the 3- and 6-month visits, and the criteria were based on the persistence of the EEG characteristics of LGS or the prevalence of the epileptiform pattern.16", "All safety results in this report were evaluated over the entire follow-up period. Patients or caregivers documented the adverse events at each visit. Safety was assessed through laboratory studies, including complete blood counts, liver function tests, and vital signs at baseline and at the time of the outpatient clinic visits. The appearance of adverse events was resolved by dose reduction or discontinuation of treatment.", "An intention-to-treat analysis was conducted to assess CBD efficacy. Data processing and analysis were performed with Statistical Package for the Social Sciences version 25 (IBM Co., Armonk, NY, USA). P values < 0.05 were regarded as statistically significant. All numbers were rounded to 2 decimal places. The statistical analyses included the independent paired-sample t-test and Fisher's exact test, and Pearson's χ2 test to compare the variables and prognosis.", "This study was approved by the Institutional Review Board of Severance Hospital (approval No.: 4-2020-0120). Informed consent was waived due to the retrospective nature of the study.", " Study population During the study period, 44 patients were managed with CBD, 34 of whom were in the LGS group and 10 of whom were in the DS group. One patient from the LGS group was excluded due to follow-up loss. One patient from the DS group was excluded due to the occurrence of an adverse event before the 3-month evaluation. After the 3-month evaluation, 6 patients in the LGS group were excluded from the study due to dissatisfaction with the treatment effect, and 3 patients were excluded because of the development of adverse events. In the DS group, 1 patient was excluded due to adverse events and 2 were excluded due to financial constraints (Fig. 2).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nThe ages of the patients included in this study ranged from 1.2 to 15.8 years (mean age = 5.1 years), with 28 males (63.6%) and 16 females (36.4%). There were 5 patients (11.4%) undergoing diet therapy. The most frequently used antiepileptic drug at the time of the study was valproic acid (VPA) at an average dose of 22.2 mg/kg/day, followed by levetiracetam at an average dose of 20.3 mg/kg/day. Stiripentol was used only in DS patients. Patient characteristics are shown in Table 1.\nData are presented as median (range) or number (%) unless otherwise indicated.\nCBD = cannabidiol, IQR = interquartile range, EEG = electroencephalogram, MRI = magnetic resonance imaging.\naAll diet therapies used in this study were the modified Atkins diet; bAll used deflazacort.\nDuring the study period, 44 patients were managed with CBD, 34 of whom were in the LGS group and 10 of whom were in the DS group. One patient from the LGS group was excluded due to follow-up loss. One patient from the DS group was excluded due to the occurrence of an adverse event before the 3-month evaluation. After the 3-month evaluation, 6 patients in the LGS group were excluded from the study due to dissatisfaction with the treatment effect, and 3 patients were excluded because of the development of adverse events. In the DS group, 1 patient was excluded due to adverse events and 2 were excluded due to financial constraints (Fig. 2).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nThe ages of the patients included in this study ranged from 1.2 to 15.8 years (mean age = 5.1 years), with 28 males (63.6%) and 16 females (36.4%). There were 5 patients (11.4%) undergoing diet therapy. The most frequently used antiepileptic drug at the time of the study was valproic acid (VPA) at an average dose of 22.2 mg/kg/day, followed by levetiracetam at an average dose of 20.3 mg/kg/day. Stiripentol was used only in DS patients. Patient characteristics are shown in Table 1.\nData are presented as median (range) or number (%) unless otherwise indicated.\nCBD = cannabidiol, IQR = interquartile range, EEG = electroencephalogram, MRI = magnetic resonance imaging.\naAll diet therapies used in this study were the modified Atkins diet; bAll used deflazacort.\n Efficacy in LGS When outcomes were observed in the LGS group, a reduction in seizure frequency was observed in 52.9% of the patients at 3 months and in 29.4% at 6 months. Eight patients (23.5%) were seizure-free at the 3-month evaluation, 3 patients (8.8%) had a reduction in seizure frequency of more than 50%, and 7 patients (20.6%) showed a reduction in seizure frequency of less than 50%. It can be stated that the result was good in 32.3% of patients. At the 6-month evaluation, 4 patients (11.8%) were seizure-free and 3 patients (8.8%) showed more than a 50% reduction in seizure frequency; thus, 20.6% of the patients had good outcomes (Fig. 3A).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nWhen evaluating the initial EEGs of LGS patients, 16 cases showed GSSW or PFA, characteristic of LGS. The outcomes at the 3- and 6-month evaluations were investigated. At the 3-month evaluation, good outcomes were observed as there were more cases with an initial EEG that did not show the PFA, but at the 6-month evaluation, the opposite was observed. In the case of the GSSW pattern, good outcomes were obtained, with no cases showing the pattern at either the 3- or the 6-month evaluations; however, there was no statistically significant change in EEG activity after the administration of CBD.\nWhen compared with the baseline EEG, most of the patients who showed no improvement at the 3-month evaluation (P value = 0.017) and the 6-month evaluation (P value = 0.009) were determined to have had a “no effect” outcome.\nWhen outcomes were observed in the LGS group, a reduction in seizure frequency was observed in 52.9% of the patients at 3 months and in 29.4% at 6 months. Eight patients (23.5%) were seizure-free at the 3-month evaluation, 3 patients (8.8%) had a reduction in seizure frequency of more than 50%, and 7 patients (20.6%) showed a reduction in seizure frequency of less than 50%. It can be stated that the result was good in 32.3% of patients. At the 6-month evaluation, 4 patients (11.8%) were seizure-free and 3 patients (8.8%) showed more than a 50% reduction in seizure frequency; thus, 20.6% of the patients had good outcomes (Fig. 3A).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nWhen evaluating the initial EEGs of LGS patients, 16 cases showed GSSW or PFA, characteristic of LGS. The outcomes at the 3- and 6-month evaluations were investigated. At the 3-month evaluation, good outcomes were observed as there were more cases with an initial EEG that did not show the PFA, but at the 6-month evaluation, the opposite was observed. In the case of the GSSW pattern, good outcomes were obtained, with no cases showing the pattern at either the 3- or the 6-month evaluations; however, there was no statistically significant change in EEG activity after the administration of CBD.\nWhen compared with the baseline EEG, most of the patients who showed no improvement at the 3-month evaluation (P value = 0.017) and the 6-month evaluation (P value = 0.009) were determined to have had a “no effect” outcome.\n Efficacy in DS In the DS group, the “no effect” outcome was observed at a higher frequency at both the 3- and 6-month evaluations than it was in the LGS group. At the 3-month evaluation, 1 patient (10.0%) was seizure-free, 2 patients (20.0%) showed a more than 50% reduction in seizure frequency, and 60.0% of the enrolled patients experienced no effect. None of the patients were “seizure-free” at the 6-month evaluation, and only 2 (20.0%) showed a reduction in seizure frequency of 50% or more. At the 6-month evaluation, a “no effect” outcome was observed in 66.7% of patients (Fig. 3B).\nIn the DS group, the “no effect” outcome was observed at a higher frequency at both the 3- and 6-month evaluations than it was in the LGS group. At the 3-month evaluation, 1 patient (10.0%) was seizure-free, 2 patients (20.0%) showed a more than 50% reduction in seizure frequency, and 60.0% of the enrolled patients experienced no effect. None of the patients were “seizure-free” at the 6-month evaluation, and only 2 (20.0%) showed a reduction in seizure frequency of 50% or more. At the 6-month evaluation, a “no effect” outcome was observed in 66.7% of patients (Fig. 3B).\n Safety No life-threatening adverse event was reported in the LGS and DS groups during the observation period. However, adverse events were reported in 16 (36.3%) of the enrolled patients, and GI problems were the most frequent adverse event in 7 cases (15.9%); among them, mild liver enzyme elevation was observed in 1 case, whereas most included vomiting or diarrhea. Five cases (11.4%) experienced behavioral changes, such as irritability, hyperactivity, excessive alertness, and sleep disturbances (Table 2). In the DS group, 2 cases had increased seizure frequency, which warranted the discontinuation of the medication. The other adverse events necessitating the cessation of the drug were as follows: 1 case of drowsiness, 1 case of GI problems with acute pancreatitis, and 1 case of behavioral changes.\nValues are presented as number (%).\nAED = antiepileptic drug, CBD = cannabidiol.\nNo life-threatening adverse event was reported in the LGS and DS groups during the observation period. However, adverse events were reported in 16 (36.3%) of the enrolled patients, and GI problems were the most frequent adverse event in 7 cases (15.9%); among them, mild liver enzyme elevation was observed in 1 case, whereas most included vomiting or diarrhea. Five cases (11.4%) experienced behavioral changes, such as irritability, hyperactivity, excessive alertness, and sleep disturbances (Table 2). In the DS group, 2 cases had increased seizure frequency, which warranted the discontinuation of the medication. The other adverse events necessitating the cessation of the drug were as follows: 1 case of drowsiness, 1 case of GI problems with acute pancreatitis, and 1 case of behavioral changes.\nValues are presented as number (%).\nAED = antiepileptic drug, CBD = cannabidiol.", "During the study period, 44 patients were managed with CBD, 34 of whom were in the LGS group and 10 of whom were in the DS group. One patient from the LGS group was excluded due to follow-up loss. One patient from the DS group was excluded due to the occurrence of an adverse event before the 3-month evaluation. After the 3-month evaluation, 6 patients in the LGS group were excluded from the study due to dissatisfaction with the treatment effect, and 3 patients were excluded because of the development of adverse events. In the DS group, 1 patient was excluded due to adverse events and 2 were excluded due to financial constraints (Fig. 2).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nThe ages of the patients included in this study ranged from 1.2 to 15.8 years (mean age = 5.1 years), with 28 males (63.6%) and 16 females (36.4%). There were 5 patients (11.4%) undergoing diet therapy. The most frequently used antiepileptic drug at the time of the study was valproic acid (VPA) at an average dose of 22.2 mg/kg/day, followed by levetiracetam at an average dose of 20.3 mg/kg/day. Stiripentol was used only in DS patients. Patient characteristics are shown in Table 1.\nData are presented as median (range) or number (%) unless otherwise indicated.\nCBD = cannabidiol, IQR = interquartile range, EEG = electroencephalogram, MRI = magnetic resonance imaging.\naAll diet therapies used in this study were the modified Atkins diet; bAll used deflazacort.", "When outcomes were observed in the LGS group, a reduction in seizure frequency was observed in 52.9% of the patients at 3 months and in 29.4% at 6 months. Eight patients (23.5%) were seizure-free at the 3-month evaluation, 3 patients (8.8%) had a reduction in seizure frequency of more than 50%, and 7 patients (20.6%) showed a reduction in seizure frequency of less than 50%. It can be stated that the result was good in 32.3% of patients. At the 6-month evaluation, 4 patients (11.8%) were seizure-free and 3 patients (8.8%) showed more than a 50% reduction in seizure frequency; thus, 20.6% of the patients had good outcomes (Fig. 3A).\nLGS = Lennox-Gastaut syndrome, DS = Dravet syndrome.\nWhen evaluating the initial EEGs of LGS patients, 16 cases showed GSSW or PFA, characteristic of LGS. The outcomes at the 3- and 6-month evaluations were investigated. At the 3-month evaluation, good outcomes were observed as there were more cases with an initial EEG that did not show the PFA, but at the 6-month evaluation, the opposite was observed. In the case of the GSSW pattern, good outcomes were obtained, with no cases showing the pattern at either the 3- or the 6-month evaluations; however, there was no statistically significant change in EEG activity after the administration of CBD.\nWhen compared with the baseline EEG, most of the patients who showed no improvement at the 3-month evaluation (P value = 0.017) and the 6-month evaluation (P value = 0.009) were determined to have had a “no effect” outcome.", "In the DS group, the “no effect” outcome was observed at a higher frequency at both the 3- and 6-month evaluations than it was in the LGS group. At the 3-month evaluation, 1 patient (10.0%) was seizure-free, 2 patients (20.0%) showed a more than 50% reduction in seizure frequency, and 60.0% of the enrolled patients experienced no effect. None of the patients were “seizure-free” at the 6-month evaluation, and only 2 (20.0%) showed a reduction in seizure frequency of 50% or more. At the 6-month evaluation, a “no effect” outcome was observed in 66.7% of patients (Fig. 3B).", "No life-threatening adverse event was reported in the LGS and DS groups during the observation period. However, adverse events were reported in 16 (36.3%) of the enrolled patients, and GI problems were the most frequent adverse event in 7 cases (15.9%); among them, mild liver enzyme elevation was observed in 1 case, whereas most included vomiting or diarrhea. Five cases (11.4%) experienced behavioral changes, such as irritability, hyperactivity, excessive alertness, and sleep disturbances (Table 2). In the DS group, 2 cases had increased seizure frequency, which warranted the discontinuation of the medication. The other adverse events necessitating the cessation of the drug were as follows: 1 case of drowsiness, 1 case of GI problems with acute pancreatitis, and 1 case of behavioral changes.\nValues are presented as number (%).\nAED = antiepileptic drug, CBD = cannabidiol.", "This study evaluated the efficacy and safety of CBD administration for treating LGS and DS for the first time in Korea. A good treatment outcome was observed in 31.8% of patients at the 3-month evaluation and in 20.5% at the 6-month evaluation, including both the LGS and DS groups. This positive response was lower than the 36%–57% positive response within 6 months shown previously by studies that did not distinguish between the patient groups.7817\nAmong the LGS patients, a good outcome was observed in 32.4% of cases at the 3-month evaluation and in 20.6% at the 6-month evaluation, which was similar to the percentage of all patients who showed good treatment outcomes overall. When comparing the effects of CBD treatment over a similar period in other studies that assessed LGS patients, good outcomes were noted in 33%–44% of cases.1118 In our study, the percentage of good outcomes was slightly lower; however, it was within a similar range. According to a study by Thiele et al.11 conducted in 2018, when comparing the LGS group using CBD and a patient group receiving a placebo, the monthly frequency of drop attacks decreased by 43.9% in those receiving CBD, compared to a reduction of only 21.8% in the placebo group. The total monthly seizure frequency decreased by 41.2% in the CBD group compared to a 13.7% decrease in the placebo group. Moreover, Thiele et al.11 documented that caregivers reported an improved condition in the CBD group that was 24% more than that of the placebo group. From these results, it appears that the use of CBD in LGS patients can reduce the frequency of seizures, including drop attacks, which can be a major obstacle in everyday life; thus, CBD treatment provides the opportunity for a good treatment outcome by reducing the seizure frequency by more than 50% in LGS patients.\nIn the case of the DS group, as the number of patients enrolled was small, an accurate evaluation was difficult. Upon reviewing previous studies, the reduction in seizure frequency by more than 50% was found to be about 43%,1219 whereas, in our research, it was 30.0% at the 3-month evaluation. We evaluated the EEG changes and outcomes as we did with the LGS, but the changes do not seem to be relevant. Devinsky et al.12 reported that the monthly frequency of motor seizures experienced by the DS group using CBD decreased by a median of 6.5%, compared to a reduction of 0.8% in the placebo group. However, patients with LGS improved not only in terms of motor seizures but also in terms of seizures of other types, whereas DS patients showed no significant improvement in seizures overall, except for motor seizures.12\nAccording to a recently published study that conducted a comparison of outcomes and CBD dosages in a DS patient group, the number of cases experiencing a reduction in seizure frequency of at least 50% was higher in the CBD 20 group (20 mg/kg/day) than in the CBD 10 group (10 mg/kg/day). On the contrary, more individuals experienced a reduction in seizure frequency of more than 75% in the CBD 10 group than in the CBD 20 group.19 In a study related to LGS treatment with CBD published in 2018, a reduction in the frequency of seizures by more than 50% during the research period was observed for 36% of patients in the CBD 10 group and 39% of patients in the CBD 20 group. Moreover, the median percent reduction in monthly seizure frequency tended to decrease further at a higher dosage of CBD, except for non-drop attacks.18\nUsually, adverse events related to CBD administration are mild, and the most common adverse events are drowsiness and GI problems such as diarrhea. In rare cases, serious adverse events occur that may require hospital admission for treatment, such as status epilepticus or extrapyramidal symptoms.7820 However, in the case of status epilepticus, the causal relationship with CBD is unclear because most enrolled patients were those with refractory epilepsy, such as LGS or DS. In our study, similar to others, the adverse events reported included high rates of GI problems, such as diarrhea and inadequate appetite, which can be expected, as the current formulation of CBD in use is in the form of an oil.\nDrowsiness and other adverse events, such as elevated liver enzymes, that have been reported in some studies7 were thought to be essential for confirming the interaction between CBD and antiepileptic drugs such as VPA and clobazam (CLB) through further research; the reason for this is that the metabolism of CBD by the liver can inhibit cytochrome P450. This affects the metabolism of some antiepileptic drugs; in the case of CLB, it can increase the serum level of N-desmethylclobazam, which is an active metabolite of CLB.821222324\nThere were some limitations in this study. For example, this study was performed with a small number of enrolled patients from a single institution; primary data collection was performed through the assessment of caregivers' reports; and adverse events were investigated retrospectively and may not have been accurate. In addition, there may have been a selection bias.\nHowever, this study is still meaningful, as it is the first pilot study to be conducted in Korea, showing that CBD can be used effectively and safely at a dose of 10 mg/kg/day for treating children of Asian ethnicity. In the future, we plan to conduct a well-designed, randomized, controlled clinical trial to evaluate CBD efficacy, safety, and drug interactions." ]

[ "intro", "methods", null, null, null, null, null, "results", null, null, null, null, "discussion" ]

[ "Cannabidiol", "Lennox Gastaut Syndrome", "Dravet Syndrome" ]

[ 245, 254, 73, 89, 37, 315, 339, 142, 175 ]

[ "patients", "cbd", "seizure", "frequency", "lgs", "month", "group", "ds", "seizure frequency", "study" ]

[ "cbd cannabidiol study", "cbd antiepileptic drugs", "cbd cannabidiol eeg", "cbd epileptic encephalopathies", "cannabidiol cbd epidiolex" ]

[ "Humans", "Diet, Healthy", "Diet", "Renal Dialysis", "Diet Records", "Muscles", "Nutritional Status" ]

[ "2. Materials and Methods", "2.1. Study Design and Participants", "2.2. Nutrition Education Booklet and Education Program", "2.3. Data Collection and Measurements", "2.3.1. Demographic Data", "2.3.2. Anthropometry and Body Composition", "2.3.3. Dietary Intake", "2.3.4. Dietary Knowledge", "2.3.5. Physical Activity", "2.4. Statistical Analysis", "3.2. Comparison of Changes in Dietary Knowledge among the Groups", "3.3. Comparison of Changes in HEI-HD among the Groups", "3.4. Comparison of Changes in Skeletal Muscle Mass among the Groups" ]

[ "2.1. Study Design and Participants A quasi-experimental study was conducted from May 2019 to April 2021 at HD centers of four hospitals in northern Taiwan. This study was approved by the Taipei Medical University Joint Institutional Review Board (no. N201801034) for Taipei Medical University Hospital, Taipei Medical University-Wan Fang Hospital, Taipei Medical University-Shuang Ho Hospital, and approved by the institutional Ethics Committee of Cathay General Hospital (no. CGH-OP108007) for Cathay General Hospital. All participants were fully informed and signed informed consent forms before their participation.\nPatients included were those aged 20–75 years, received HD treatment thrice a week for at least 3 months, the education level of junior high school and higher, and Kt/V > 1.2. Patients with obvious edema, pregnancy, amputation, hyperthyroidism, hypothyroidism, malignancy, liver failure or cancer, mental disorders, tube feeding, hospitalization and plan to surgery, loss to measure body composition, and percentage body fat < 4% were excluded.\nThe study recruited 141 patients who met the criteria. All study subjects received a nutritional education booklet. The subjects were divided into four groups according to the hospital. Those were no courses for patients and nurses (Non-C) group (only provided education booklet); courses for nurses (CN) group (provided nutrition course for nurses); courses for patients (CP) group (provided nutrition course for HD patients); and courses for patients and nurses (CPN) group (provided nutrition course for nurses and HD patients). This study period was divided into baseline (T0), intervention (T1), and follow-up (T2).\nA quasi-experimental study was conducted from May 2019 to April 2021 at HD centers of four hospitals in northern Taiwan. This study was approved by the Taipei Medical University Joint Institutional Review Board (no. N201801034) for Taipei Medical University Hospital, Taipei Medical University-Wan Fang Hospital, Taipei Medical University-Shuang Ho Hospital, and approved by the institutional Ethics Committee of Cathay General Hospital (no. CGH-OP108007) for Cathay General Hospital. All participants were fully informed and signed informed consent forms before their participation.\nPatients included were those aged 20–75 years, received HD treatment thrice a week for at least 3 months, the education level of junior high school and higher, and Kt/V > 1.2. Patients with obvious edema, pregnancy, amputation, hyperthyroidism, hypothyroidism, malignancy, liver failure or cancer, mental disorders, tube feeding, hospitalization and plan to surgery, loss to measure body composition, and percentage body fat < 4% were excluded.\nThe study recruited 141 patients who met the criteria. All study subjects received a nutritional education booklet. The subjects were divided into four groups according to the hospital. Those were no courses for patients and nurses (Non-C) group (only provided education booklet); courses for nurses (CN) group (provided nutrition course for nurses); courses for patients (CP) group (provided nutrition course for HD patients); and courses for patients and nurses (CPN) group (provided nutrition course for nurses and HD patients). This study period was divided into baseline (T0), intervention (T1), and follow-up (T2).\n2.2. Nutrition Education Booklet and Education Program All participants received a nutritional education booklet. The nutritional education booklet was developed based on the HEI-HD to increase patient knowledge, promote positive attitudes, and change eating behaviors. The contents of the educational booklet were corrected by both six renal dietitians and three nephrologists. Table 1 shows the 9 chapters and the contents of the educational booklet. Nutrition education was offered at T1. A dietitian provided one-on-one, 15–20 min/week personalized nutrition education at the patient’s bedside in the first month and a 15–20 min/month personalized nutrition education with a special focus on skills to improve the low-scoring dietary items to achieve higher score in the second month. A 10-min group nutritional education session was provided by a dietitian to nurses at the beginning of T1 to address the incorrect answers to the dietary knowledge questionnaire.\nAll participants received a nutritional education booklet. The nutritional education booklet was developed based on the HEI-HD to increase patient knowledge, promote positive attitudes, and change eating behaviors. The contents of the educational booklet were corrected by both six renal dietitians and three nephrologists. Table 1 shows the 9 chapters and the contents of the educational booklet. Nutrition education was offered at T1. A dietitian provided one-on-one, 15–20 min/week personalized nutrition education at the patient’s bedside in the first month and a 15–20 min/month personalized nutrition education with a special focus on skills to improve the low-scoring dietary items to achieve higher score in the second month. A 10-min group nutritional education session was provided by a dietitian to nurses at the beginning of T1 to address the incorrect answers to the dietary knowledge questionnaire.\n2.3. Data Collection and Measurements For patients at T0, socio-demographic factors, anthropometric and body composition, dietary records, and questionnaires were collected. At T1 and T2, the data collected were the same as those at T0, except for socio-demographic factors. For the nurses, only a dietary knowledge questionnaire was collected at T0, T1, and T2.\n2.3.1. Demographic Data The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\nThe basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\n2.3.2. Anthropometry and Body Composition Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\nHeight and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\n2.3.3. Dietary Intake The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\nThe patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\n2.3.4. Dietary Knowledge We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\nWe used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\n2.3.5. Physical Activity Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nPhysical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nFor patients at T0, socio-demographic factors, anthropometric and body composition, dietary records, and questionnaires were collected. At T1 and T2, the data collected were the same as those at T0, except for socio-demographic factors. For the nurses, only a dietary knowledge questionnaire was collected at T0, T1, and T2.\n2.3.1. Demographic Data The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\nThe basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\n2.3.2. Anthropometry and Body Composition Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\nHeight and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\n2.3.3. Dietary Intake The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\nThe patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\n2.3.4. Dietary Knowledge We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\nWe used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\n2.3.5. Physical Activity Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nPhysical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\n2.4. Statistical Analysis Data were shown as mean with standard deviation (SD) for continuous variables and number (n) with percentage (%) for categorical variables. A Shapiro–Wilk test or Kolmogorov–Smirnov test was used to verify the normal distribution assumption for continuous variables. One-way ANOVA with post hoc Bonferroni’s test was used to compare demographics, changes in the dietary knowledge, and HEI-HD. Changes in the skeletal muscle mass was compared using the ANCOVA by adjusting for gender and age, followed by Bonferroni’s test. Kruskal–Wallis test was used to compare non-normal distribution data between multiple groups. The Chi-square test was used to compare categorical variables. Paired t-test was used to compare continuous variables within groups. All statistical analyses were used by SAS version 9.4. A p-value < 0.05 was considered statistical significance, and 0.05 < p < 0.1 indicated marginal significant differences.\nData were shown as mean with standard deviation (SD) for continuous variables and number (n) with percentage (%) for categorical variables. A Shapiro–Wilk test or Kolmogorov–Smirnov test was used to verify the normal distribution assumption for continuous variables. One-way ANOVA with post hoc Bonferroni’s test was used to compare demographics, changes in the dietary knowledge, and HEI-HD. Changes in the skeletal muscle mass was compared using the ANCOVA by adjusting for gender and age, followed by Bonferroni’s test. Kruskal–Wallis test was used to compare non-normal distribution data between multiple groups. The Chi-square test was used to compare categorical variables. Paired t-test was used to compare continuous variables within groups. All statistical analyses were used by SAS version 9.4. A p-value < 0.05 was considered statistical significance, and 0.05 < p < 0.1 indicated marginal significant differences.", "A quasi-experimental study was conducted from May 2019 to April 2021 at HD centers of four hospitals in northern Taiwan. This study was approved by the Taipei Medical University Joint Institutional Review Board (no. N201801034) for Taipei Medical University Hospital, Taipei Medical University-Wan Fang Hospital, Taipei Medical University-Shuang Ho Hospital, and approved by the institutional Ethics Committee of Cathay General Hospital (no. CGH-OP108007) for Cathay General Hospital. All participants were fully informed and signed informed consent forms before their participation.\nPatients included were those aged 20–75 years, received HD treatment thrice a week for at least 3 months, the education level of junior high school and higher, and Kt/V > 1.2. Patients with obvious edema, pregnancy, amputation, hyperthyroidism, hypothyroidism, malignancy, liver failure or cancer, mental disorders, tube feeding, hospitalization and plan to surgery, loss to measure body composition, and percentage body fat < 4% were excluded.\nThe study recruited 141 patients who met the criteria. All study subjects received a nutritional education booklet. The subjects were divided into four groups according to the hospital. Those were no courses for patients and nurses (Non-C) group (only provided education booklet); courses for nurses (CN) group (provided nutrition course for nurses); courses for patients (CP) group (provided nutrition course for HD patients); and courses for patients and nurses (CPN) group (provided nutrition course for nurses and HD patients). This study period was divided into baseline (T0), intervention (T1), and follow-up (T2).", "All participants received a nutritional education booklet. The nutritional education booklet was developed based on the HEI-HD to increase patient knowledge, promote positive attitudes, and change eating behaviors. The contents of the educational booklet were corrected by both six renal dietitians and three nephrologists. Table 1 shows the 9 chapters and the contents of the educational booklet. Nutrition education was offered at T1. A dietitian provided one-on-one, 15–20 min/week personalized nutrition education at the patient’s bedside in the first month and a 15–20 min/month personalized nutrition education with a special focus on skills to improve the low-scoring dietary items to achieve higher score in the second month. A 10-min group nutritional education session was provided by a dietitian to nurses at the beginning of T1 to address the incorrect answers to the dietary knowledge questionnaire.", "For patients at T0, socio-demographic factors, anthropometric and body composition, dietary records, and questionnaires were collected. At T1 and T2, the data collected were the same as those at T0, except for socio-demographic factors. For the nurses, only a dietary knowledge questionnaire was collected at T0, T1, and T2.\n2.3.1. Demographic Data The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\nThe basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\n2.3.2. Anthropometry and Body Composition Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\nHeight and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\n2.3.3. Dietary Intake The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\nThe patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\n2.3.4. Dietary Knowledge We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\nWe used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\n2.3.5. Physical Activity Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nPhysical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.", "The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.", "Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.", "The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].", "We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].", "Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.", "Data were shown as mean with standard deviation (SD) for continuous variables and number (n) with percentage (%) for categorical variables. A Shapiro–Wilk test or Kolmogorov–Smirnov test was used to verify the normal distribution assumption for continuous variables. One-way ANOVA with post hoc Bonferroni’s test was used to compare demographics, changes in the dietary knowledge, and HEI-HD. Changes in the skeletal muscle mass was compared using the ANCOVA by adjusting for gender and age, followed by Bonferroni’s test. Kruskal–Wallis test was used to compare non-normal distribution data between multiple groups. The Chi-square test was used to compare categorical variables. Paired t-test was used to compare continuous variables within groups. All statistical analyses were used by SAS version 9.4. A p-value < 0.05 was considered statistical significance, and 0.05 < p < 0.1 indicated marginal significant differences.", "The dietary knowledge score in the Non-C group at T2 was significantly higher than at T1 (Table 3).", "After two months of intervention, there was a significant increase in vegetable scores in the CPN group and the CP group but not in the Non-C group. The ratio of white to red meat score changes in the CPN group was significantly increased. In comparison with T0, at the end of T2, the vegetable scores change in the CP group were significantly higher than the Non-C group, the ratio of white to red meat scores of the CPN group was significantly higher than the CP group, and the total HEI-HD scores of the CPN group was significantly higher than the Non-C group. There was no significant difference among the four groups in T2 to T1 period (Table 4).", "There was no significant difference in muscle mass among the four groups. To compare with T0, all patients’ SMM, SMMHt2, and SMMWt were significantly decreased at T1. The SMM and SMMHt2 of the Non-C group at T1 were also significantly lower than T0. At T2, all patients’ SMM, SMMHt2, and SMMWt were significantly higher than T1, but only SMM of the Non-C group and the CN group were significantly better than T1 with or without adjusted (Table 5)." ]

[ null, "subjects", null, null, null, null, null, null, null, null, null, null, null ]

[ "1. Introduction", "2. Materials and Methods", "2.1. Study Design and Participants", "2.2. Nutrition Education Booklet and Education Program", "2.3. Data Collection and Measurements", "2.3.1. Demographic Data", "2.3.2. Anthropometry and Body Composition", "2.3.3. Dietary Intake", "2.3.4. Dietary Knowledge", "2.3.5. Physical Activity", "2.4. Statistical Analysis", "3. Results", "3.1. Characteristics of Participants", "3.2. Comparison of Changes in Dietary Knowledge among the Groups", "3.3. Comparison of Changes in HEI-HD among the Groups", "3.4. Comparison of Changes in Skeletal Muscle Mass among the Groups", "4. Discussion", "5. Conclusions" ]

[ "End-stage renal disease (ESRD) has been a public issue of global concern, with 90% of countries using hemodialysis (HD) as a treatment modality [1]. Most HD patients have difficulty maintaining a dietary compliance due to the stress of dietary restrictions, eventually leads to malnutrition [2]. Malnutrition in patients with chronic kidney disease is called protein-energy wasting (PEW), caused by marked reduction in storage of protein and energy in body. Muscle wasting is the most direct and valid criterion for PEW [3]. Muscle wasting is one of the direct criteria of PEW [3]. Skeletal muscle accounts for 30–40% of the whole body and maintains basal energy metabolism [4], physical activity, and daily life [5]. However, HD patients often gradually lose muscle mass with age, treatment, hormonal changes, and disease progression [6], resulting in frailty, decreased quality of life, falls, and even fractures, which increase the risk of death in the long run [7,8].\nDietary quality considers whether the individual’s diet complies with dietary recommendations and healthy diet principles [9]. The Dietary Quality Index is an index developed following national dietary guidelines or specific disease recommendations, that reflects patients’ compliance with dietary recommendations and dietary changes [10]. The Healthy Eating Index for HemoDialysis patients (HEI-HD) was developed in 2014 [11]. It was constructed based on the healthy eating pattern of HD patients [12,13,14,15,16,17,18,19,20,21]. HEI-HD contains 16 diet items. The total score of HEU-HD ranged between 0 and 100. The higher the score, the better the dietary quality, with a 4% reduction in the risk of death in HD patients [19].\nThe dietary principles of kidney disease are too complex to make patients have difficulty with dietary compliance [22]. Previous studies proposed that patients are reluctant to follow dietary principles because they do not have sufficient knowledge or lack of skills to self-manage their diet [23]. Therefore, appropriate education and reinforcement of knowledge concepts enhance the understanding of the HD diet principles to encourage diet compliance [24]. The Health Belief Model (HBM), as a guiding framework for educational interventions, is the most widely applied theory of health education, which describes changes in health-related behaviors depending on the personal beliefs or attitudes toward disease [25]. Shariatjafari et al. (2012) showed that the nutritional education based on HBM was effective in promoting the adherence to dietary guidelines in the participants [26].\nIn the routine medical care of HD centers, nurses are the most frequent contact with HD patients and often help patients to adapt to their problems by providing information [27]. Therefore, nutrition education offered by dietitians could be more helpful for HD patients. In addition, the low ratio of dietitians to patients in HD centers and nutrition care are not included in the regular care process under the health insurance system [28]. Therefore, we conducted a quasi-experimental study to examine the effects of HEI-HD-based nutritional education models on dietary quality and muscle mass in HD patients.", "2.1. Study Design and Participants A quasi-experimental study was conducted from May 2019 to April 2021 at HD centers of four hospitals in northern Taiwan. This study was approved by the Taipei Medical University Joint Institutional Review Board (no. N201801034) for Taipei Medical University Hospital, Taipei Medical University-Wan Fang Hospital, Taipei Medical University-Shuang Ho Hospital, and approved by the institutional Ethics Committee of Cathay General Hospital (no. CGH-OP108007) for Cathay General Hospital. All participants were fully informed and signed informed consent forms before their participation.\nPatients included were those aged 20–75 years, received HD treatment thrice a week for at least 3 months, the education level of junior high school and higher, and Kt/V > 1.2. Patients with obvious edema, pregnancy, amputation, hyperthyroidism, hypothyroidism, malignancy, liver failure or cancer, mental disorders, tube feeding, hospitalization and plan to surgery, loss to measure body composition, and percentage body fat < 4% were excluded.\nThe study recruited 141 patients who met the criteria. All study subjects received a nutritional education booklet. The subjects were divided into four groups according to the hospital. Those were no courses for patients and nurses (Non-C) group (only provided education booklet); courses for nurses (CN) group (provided nutrition course for nurses); courses for patients (CP) group (provided nutrition course for HD patients); and courses for patients and nurses (CPN) group (provided nutrition course for nurses and HD patients). This study period was divided into baseline (T0), intervention (T1), and follow-up (T2).\nA quasi-experimental study was conducted from May 2019 to April 2021 at HD centers of four hospitals in northern Taiwan. This study was approved by the Taipei Medical University Joint Institutional Review Board (no. N201801034) for Taipei Medical University Hospital, Taipei Medical University-Wan Fang Hospital, Taipei Medical University-Shuang Ho Hospital, and approved by the institutional Ethics Committee of Cathay General Hospital (no. CGH-OP108007) for Cathay General Hospital. All participants were fully informed and signed informed consent forms before their participation.\nPatients included were those aged 20–75 years, received HD treatment thrice a week for at least 3 months, the education level of junior high school and higher, and Kt/V > 1.2. Patients with obvious edema, pregnancy, amputation, hyperthyroidism, hypothyroidism, malignancy, liver failure or cancer, mental disorders, tube feeding, hospitalization and plan to surgery, loss to measure body composition, and percentage body fat < 4% were excluded.\nThe study recruited 141 patients who met the criteria. All study subjects received a nutritional education booklet. The subjects were divided into four groups according to the hospital. Those were no courses for patients and nurses (Non-C) group (only provided education booklet); courses for nurses (CN) group (provided nutrition course for nurses); courses for patients (CP) group (provided nutrition course for HD patients); and courses for patients and nurses (CPN) group (provided nutrition course for nurses and HD patients). This study period was divided into baseline (T0), intervention (T1), and follow-up (T2).\n2.2. Nutrition Education Booklet and Education Program All participants received a nutritional education booklet. The nutritional education booklet was developed based on the HEI-HD to increase patient knowledge, promote positive attitudes, and change eating behaviors. The contents of the educational booklet were corrected by both six renal dietitians and three nephrologists. Table 1 shows the 9 chapters and the contents of the educational booklet. Nutrition education was offered at T1. A dietitian provided one-on-one, 15–20 min/week personalized nutrition education at the patient’s bedside in the first month and a 15–20 min/month personalized nutrition education with a special focus on skills to improve the low-scoring dietary items to achieve higher score in the second month. A 10-min group nutritional education session was provided by a dietitian to nurses at the beginning of T1 to address the incorrect answers to the dietary knowledge questionnaire.\nAll participants received a nutritional education booklet. The nutritional education booklet was developed based on the HEI-HD to increase patient knowledge, promote positive attitudes, and change eating behaviors. The contents of the educational booklet were corrected by both six renal dietitians and three nephrologists. Table 1 shows the 9 chapters and the contents of the educational booklet. Nutrition education was offered at T1. A dietitian provided one-on-one, 15–20 min/week personalized nutrition education at the patient’s bedside in the first month and a 15–20 min/month personalized nutrition education with a special focus on skills to improve the low-scoring dietary items to achieve higher score in the second month. A 10-min group nutritional education session was provided by a dietitian to nurses at the beginning of T1 to address the incorrect answers to the dietary knowledge questionnaire.\n2.3. Data Collection and Measurements For patients at T0, socio-demographic factors, anthropometric and body composition, dietary records, and questionnaires were collected. At T1 and T2, the data collected were the same as those at T0, except for socio-demographic factors. For the nurses, only a dietary knowledge questionnaire was collected at T0, T1, and T2.\n2.3.1. Demographic Data The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\nThe basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\n2.3.2. Anthropometry and Body Composition Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\nHeight and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\n2.3.3. Dietary Intake The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\nThe patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\n2.3.4. Dietary Knowledge We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\nWe used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\n2.3.5. Physical Activity Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nPhysical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nFor patients at T0, socio-demographic factors, anthropometric and body composition, dietary records, and questionnaires were collected. At T1 and T2, the data collected were the same as those at T0, except for socio-demographic factors. For the nurses, only a dietary knowledge questionnaire was collected at T0, T1, and T2.\n2.3.1. Demographic Data The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\nThe basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\n2.3.2. Anthropometry and Body Composition Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\nHeight and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\n2.3.3. Dietary Intake The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\nThe patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\n2.3.4. Dietary Knowledge We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\nWe used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\n2.3.5. Physical Activity Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nPhysical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\n2.4. Statistical Analysis Data were shown as mean with standard deviation (SD) for continuous variables and number (n) with percentage (%) for categorical variables. A Shapiro–Wilk test or Kolmogorov–Smirnov test was used to verify the normal distribution assumption for continuous variables. One-way ANOVA with post hoc Bonferroni’s test was used to compare demographics, changes in the dietary knowledge, and HEI-HD. Changes in the skeletal muscle mass was compared using the ANCOVA by adjusting for gender and age, followed by Bonferroni’s test. Kruskal–Wallis test was used to compare non-normal distribution data between multiple groups. The Chi-square test was used to compare categorical variables. Paired t-test was used to compare continuous variables within groups. All statistical analyses were used by SAS version 9.4. A p-value < 0.05 was considered statistical significance, and 0.05 < p < 0.1 indicated marginal significant differences.\nData were shown as mean with standard deviation (SD) for continuous variables and number (n) with percentage (%) for categorical variables. A Shapiro–Wilk test or Kolmogorov–Smirnov test was used to verify the normal distribution assumption for continuous variables. One-way ANOVA with post hoc Bonferroni’s test was used to compare demographics, changes in the dietary knowledge, and HEI-HD. Changes in the skeletal muscle mass was compared using the ANCOVA by adjusting for gender and age, followed by Bonferroni’s test. Kruskal–Wallis test was used to compare non-normal distribution data between multiple groups. The Chi-square test was used to compare categorical variables. Paired t-test was used to compare continuous variables within groups. All statistical analyses were used by SAS version 9.4. A p-value < 0.05 was considered statistical significance, and 0.05 < p < 0.1 indicated marginal significant differences.", "A quasi-experimental study was conducted from May 2019 to April 2021 at HD centers of four hospitals in northern Taiwan. This study was approved by the Taipei Medical University Joint Institutional Review Board (no. N201801034) for Taipei Medical University Hospital, Taipei Medical University-Wan Fang Hospital, Taipei Medical University-Shuang Ho Hospital, and approved by the institutional Ethics Committee of Cathay General Hospital (no. CGH-OP108007) for Cathay General Hospital. All participants were fully informed and signed informed consent forms before their participation.\nPatients included were those aged 20–75 years, received HD treatment thrice a week for at least 3 months, the education level of junior high school and higher, and Kt/V > 1.2. Patients with obvious edema, pregnancy, amputation, hyperthyroidism, hypothyroidism, malignancy, liver failure or cancer, mental disorders, tube feeding, hospitalization and plan to surgery, loss to measure body composition, and percentage body fat < 4% were excluded.\nThe study recruited 141 patients who met the criteria. All study subjects received a nutritional education booklet. The subjects were divided into four groups according to the hospital. Those were no courses for patients and nurses (Non-C) group (only provided education booklet); courses for nurses (CN) group (provided nutrition course for nurses); courses for patients (CP) group (provided nutrition course for HD patients); and courses for patients and nurses (CPN) group (provided nutrition course for nurses and HD patients). This study period was divided into baseline (T0), intervention (T1), and follow-up (T2).", "All participants received a nutritional education booklet. The nutritional education booklet was developed based on the HEI-HD to increase patient knowledge, promote positive attitudes, and change eating behaviors. The contents of the educational booklet were corrected by both six renal dietitians and three nephrologists. Table 1 shows the 9 chapters and the contents of the educational booklet. Nutrition education was offered at T1. A dietitian provided one-on-one, 15–20 min/week personalized nutrition education at the patient’s bedside in the first month and a 15–20 min/month personalized nutrition education with a special focus on skills to improve the low-scoring dietary items to achieve higher score in the second month. A 10-min group nutritional education session was provided by a dietitian to nurses at the beginning of T1 to address the incorrect answers to the dietary knowledge questionnaire.", "For patients at T0, socio-demographic factors, anthropometric and body composition, dietary records, and questionnaires were collected. At T1 and T2, the data collected were the same as those at T0, except for socio-demographic factors. For the nurses, only a dietary knowledge questionnaire was collected at T0, T1, and T2.\n2.3.1. Demographic Data The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\nThe basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.\n2.3.2. Anthropometry and Body Composition Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\nHeight and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.\n2.3.3. Dietary Intake The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\nThe patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].\n2.3.4. Dietary Knowledge We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\nWe used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].\n2.3.5. Physical Activity Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.\nPhysical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.", "The basic information of the patients was collected by chart review, including age, gender, dialysis vintage, and comorbidity, and was calculated using the Charlson comorbidity index (CCI). In addition, the occupation, economic status, marital status, living conditions, smoking, nutrition education, and consultation status were collected using questionnaires.", "Height and dry weight after dialysis were collected from the chart review to calculate body mass index (BMI). Skeletal muscle mass (SMM) and body fat were measured by using the bioelectrical impedance analysis (InBody S10, Biospace, Seoul, Korea) after the hemodialysis session (sitting position) [21]. The SMM was adjusted for height (SMMHt2 (kg/m2)) and weight (SMMWt (%)) which were indicators of muscle mass.", "The patients recorded three days of dietary intake during the week before and after the monthly examination, including one dialysis day, one non-dialysis day, and one non-dialysis weekend day [11]. To confirm dietary records, we used 24-h dietary recall by well-trained dietitians to interview patients. Dietary intake was analyzed using nutrients analysis software (Cofit pro, Taipei, Taiwan), which is based on the 2018 Taiwan Food Nutrient Database. The components of the HEI-HD score include total grains, total protein foods, total vegetable, whole fruits, oils, high biological value proteins, the ratio of white to red meat, processed meat, fish and seafood, saturated fatty acids rich oils, sugar-sweetened beverages and fruit juice, alcohol, whole grains, nuts, taste, and milk and dairy products. Total HEI-HD score is in the range of 0–100 [19].", "We used Ryu’s questionnaire to assess the dietary knowledge of HD patients and nurses. It consists of 10 questions to ask patients about knowledge related to protein, potassium, phosphorus, sodium, and water. The score of the questionnaire ranged from 0 to 10; the higher the score, the better the knowledge of diet [29].", "Physical activity was collected by using the short version of the International Physical Activity Questionnaire (IPAQ-SF) [30]. Patients recorded the number of days and time spent on exercise (vigorous, moderate, walking exercise, and sleep) during the last 7 days. The level of physical activity was indicated by the metabolic equivalent (MET) value.", "Data were shown as mean with standard deviation (SD) for continuous variables and number (n) with percentage (%) for categorical variables. A Shapiro–Wilk test or Kolmogorov–Smirnov test was used to verify the normal distribution assumption for continuous variables. One-way ANOVA with post hoc Bonferroni’s test was used to compare demographics, changes in the dietary knowledge, and HEI-HD. Changes in the skeletal muscle mass was compared using the ANCOVA by adjusting for gender and age, followed by Bonferroni’s test. Kruskal–Wallis test was used to compare non-normal distribution data between multiple groups. The Chi-square test was used to compare categorical variables. Paired t-test was used to compare continuous variables within groups. All statistical analyses were used by SAS version 9.4. A p-value < 0.05 was considered statistical significance, and 0.05 < p < 0.1 indicated marginal significant differences.", "3.1. Characteristics of Participants Ninety-four HD patients’ data were analyzed (Figure 1). The mean age of the HD patients was 58.3 ± 10.1 years, 64.9% were men. The means of total HEI-HD score, SMM were 65.6 ± 8.3, 26.3 ± 5.7 kg, respectively. There was a statistically significant difference of marital status existed among the four groups (Table 2).\nNinety-four HD patients’ data were analyzed (Figure 1). The mean age of the HD patients was 58.3 ± 10.1 years, 64.9% were men. The means of total HEI-HD score, SMM were 65.6 ± 8.3, 26.3 ± 5.7 kg, respectively. There was a statistically significant difference of marital status existed among the four groups (Table 2).\n3.2. Comparison of Changes in Dietary Knowledge among the Groups The dietary knowledge score in the Non-C group at T2 was significantly higher than at T1 (Table 3).\nThe dietary knowledge score in the Non-C group at T2 was significantly higher than at T1 (Table 3).\n3.3. Comparison of Changes in HEI-HD among the Groups After two months of intervention, there was a significant increase in vegetable scores in the CPN group and the CP group but not in the Non-C group. The ratio of white to red meat score changes in the CPN group was significantly increased. In comparison with T0, at the end of T2, the vegetable scores change in the CP group were significantly higher than the Non-C group, the ratio of white to red meat scores of the CPN group was significantly higher than the CP group, and the total HEI-HD scores of the CPN group was significantly higher than the Non-C group. There was no significant difference among the four groups in T2 to T1 period (Table 4).\nAfter two months of intervention, there was a significant increase in vegetable scores in the CPN group and the CP group but not in the Non-C group. The ratio of white to red meat score changes in the CPN group was significantly increased. In comparison with T0, at the end of T2, the vegetable scores change in the CP group were significantly higher than the Non-C group, the ratio of white to red meat scores of the CPN group was significantly higher than the CP group, and the total HEI-HD scores of the CPN group was significantly higher than the Non-C group. There was no significant difference among the four groups in T2 to T1 period (Table 4).\n3.4. Comparison of Changes in Skeletal Muscle Mass among the Groups There was no significant difference in muscle mass among the four groups. To compare with T0, all patients’ SMM, SMMHt2, and SMMWt were significantly decreased at T1. The SMM and SMMHt2 of the Non-C group at T1 were also significantly lower than T0. At T2, all patients’ SMM, SMMHt2, and SMMWt were significantly higher than T1, but only SMM of the Non-C group and the CN group were significantly better than T1 with or without adjusted (Table 5).\nThere was no significant difference in muscle mass among the four groups. To compare with T0, all patients’ SMM, SMMHt2, and SMMWt were significantly decreased at T1. The SMM and SMMHt2 of the Non-C group at T1 were also significantly lower than T0. At T2, all patients’ SMM, SMMHt2, and SMMWt were significantly higher than T1, but only SMM of the Non-C group and the CN group were significantly better than T1 with or without adjusted (Table 5).", "Ninety-four HD patients’ data were analyzed (Figure 1). The mean age of the HD patients was 58.3 ± 10.1 years, 64.9% were men. The means of total HEI-HD score, SMM were 65.6 ± 8.3, 26.3 ± 5.7 kg, respectively. There was a statistically significant difference of marital status existed among the four groups (Table 2).", "The dietary knowledge score in the Non-C group at T2 was significantly higher than at T1 (Table 3).", "After two months of intervention, there was a significant increase in vegetable scores in the CPN group and the CP group but not in the Non-C group. The ratio of white to red meat score changes in the CPN group was significantly increased. In comparison with T0, at the end of T2, the vegetable scores change in the CP group were significantly higher than the Non-C group, the ratio of white to red meat scores of the CPN group was significantly higher than the CP group, and the total HEI-HD scores of the CPN group was significantly higher than the Non-C group. There was no significant difference among the four groups in T2 to T1 period (Table 4).", "There was no significant difference in muscle mass among the four groups. To compare with T0, all patients’ SMM, SMMHt2, and SMMWt were significantly decreased at T1. The SMM and SMMHt2 of the Non-C group at T1 were also significantly lower than T0. At T2, all patients’ SMM, SMMHt2, and SMMWt were significantly higher than T1, but only SMM of the Non-C group and the CN group were significantly better than T1 with or without adjusted (Table 5).", "This was the first study to assess the effects of dietitians providing nutritional education for nurses and patients alone and in combination based on HEI-HD on dietary quality and muscle mass of HD patients. This study showed that nutritional education for the CPN group, both patients and nurses by dietitians, based on HEI-HD was more effective than other groups. The dietitians provided nutritional education and increased the scores of vegetable, the ratio of white to red meat, and total HEI-HD, but no significant change in SMM, SMMHt2, and SMMWt.\nFord et al. (2004) showed that giving nutrition education for 20–30 min per month to HD patients could improve patients’ dietary knowledge [24]. Abd et al. (2015) used small group combined educational booklets for nutrition education for the study groups. Their results reported dietary knowledge would be improved [31]. In this present study, the dietary knowledge of HD patients improved at T2, which compared to T0, the Non-C group had a higher dietary knowledge score at T2 than T1, indicating that only providing the HEI-HD booklet could help patients’ dietary knowledge improvement.\nVegetables are rich in vitamins C and E and antioxidant phytochemicals [32]. Saglimbene et al. (2019) reported that only 4% HD patients achieved vegetable recommendations, which was far below the recommendations for preventing chronic diseases [33]. Wagner et al. (2016) showed that nutrition courses given by dietitians could enhance the vegetable intake of obese adults [34], which was similar to the results of our study, indicating that nutrition education by dietitians could increase the vegetable intake of patients and increase the dietary vegetable scores.\nThe ratio of white to red meat scores improved. Increasing white meat intake daily could reduce 33% mortality [19]. HD patients often have excessive red meat consumption problems. Red meat, such as pork, beef, and lamb, which are rich in phosphorus and saturated fat, could increase the risk of cardiovascular disease [35]. McCullough et al. (2002) recommended that the ratio of white and red meat is 4:1 to prevent cardiovascular disease [36]. The ratio of white to red meat scores of the CPN group was better than the others in this study, which means that the nutrition education given to both patients and nurses by dietitians could significantly increase HD patients’ dietary ratio of white and red meat.\nThis present study showed that the total HEI-HD scores of the CPN group were significantly higher than others due to the increase in vegetable scores and the ratio of white to red meat scores. Previous studies have shown that people who have received nutrition education have better dietary quality. Nutrition education by dietitians could improve the dietary quality of diabetes patients [37,38]. Our study shows that nutritional education by dietitians to patients and nurses had the best effect on improving the dietary quality of HD patients.\nPrevious studies have shown that increased dietary quality could maintain muscle mass [39,40]. Rondanelli et al. (2015) reported that the intake of white meat increased combined with the intake of red meat maintained or decreased, which was able to prevent the occurrence of sarcopenia [41], similar to our study in which no significant decrease in muscle mass was observed in the CPN group with enhanced dietary quality. In contrast, the total HEI-HD score of the Non-C group was slightly lower, and their SMM and SMMHt2 were significantly reduced at T1. In addition, previous studies showed that higher educated people are more willing to exercise [42], and unmarried people and blue-collar workers also have high physical activity [43]. Our study results showed that the higher education level in the Non-C group and more unmarried, more blue-collar workers in the CN group tend to have relatively high levels of activity, which might affect muscle mass. Our study’s strengths: (1) this was a multi-center study, which could reduce the sampling bias compared to a single center; (2) this was the first nutrition education study that utilizes four educational models; and (3) this was the first nutrition education study using the HEI-HD, a simple and validated dietary index scale that could quickly assess patients’ dietary status. There are some limitations in this study as follows: (1) only 4 months of the study were monitored, which is relatively short and it may not be possible to see the increase in muscle mass; (2) the effects of diet on muscle mass were limited, so physical activities, exercise and nutrition supplementation should be considered to be included in the future study; (3) the subjects were all voluntary participants with high health awareness, so the nutrition education may be more effective; (4) no adequate information was provided regarding the frequency and content of nurse education for patient [44], so future studies should monitor the frequency and how long for nurse education; and (5) it should be noted that the present study is a multi-center study and was conducted only in northern Taiwan urban with high literacy population. Therefore, the results obtained may not be appropriate to apply to patients in Taiwan rural areas or other countries.", "The HEI-HD-based nutritional education was effective in improving patients’ dietary quality, and the dietitians’ model educating both patients and nurses was the most effective in improving dietary quality and maintaining skeletal muscle mass in HD patients." ]

[ "intro", null, "subjects", null, null, null, null, null, null, null, null, "results", "subjects", null, null, null, "discussion", "conclusions" ]

[ "hemodialysis", "skeletal muscle", "dietitian", "nutritional education", "dietary quality" ]

[ 3373, 315, 160, 1021, 63, 89, 177, 65, 68, 175, 23, 137, 97 ]

[ "patients", "dietary", "hd", "group", "education", "knowledge", "score", "non", "nutrition", "hei" ]

[ "patients dietary quality", "protein energy wasting", "quality maintain muscle", "dietary principles kidney", "eating index hemodialysis" ]

[ "Adolescent", "Child", "Child, Preschool", "Female", "Humans", "Incidence", "Infant", "Infant, Newborn", "Insurance, Health", "Male", "Mexico", "Neoplasms", "Prevalence", "Public Health Surveillance", "Registries" ]

[ "Background" ]

[ "Of the biggest problems in developing nations is the high incidence of childhood cancer is the high incidence and the limited financial resources to develop a solid national program for early diagnosis and management of these patients. We believe that pediatric cancer should now be considered a global child health priority [1].\nA worldwide childhood cancer survey in 2012 estimates a higher incidence in developing countries (147,000 cancers/year) than in developed nations [2]. It is expected that this disease will continue growing because the populations in these countries are younger and expanding.\nSince 2010 in Mexico, cancer is the second leading cause of mortality among children between 4 to 15 years old [3]. This represents a current national health problem. There is a need to expand, fortify and improve early diagnosis and treatment. As we have previously documented in developing countries including Mexico, there is increasing evidence that the mortality rate is higher than in developed countries [4]. This might be related to a late referral to expert institutions for diagnosis and early multidisciplinary treatment.\nClose to half of the Mexican-children and adults-are under a medical socialized program. This system contains large hospitals and clinics nationwide and has been run by the Federal Government Socialized Medicine Program for more than 50 years. Formal, salaried sector workers and their families had been able to access pooled-prepayment options through public social security programs.\nMeanwhile the other half (n: 51,823,314) of Mexicans, including children and adults (2011) [4] has been progressively incorporating into a national health insurance program. This universal health coverage is described as “Popular Medical Insurance” (PMI) [5]. This program was developed to provide access to a package of comprehensive health services-including childhood cancer treatment with financial protection. This is done through a national medical network from primary care clinics to specialized medical hospitals certified by the Federal Government. The program officially started in January 2005. However, it was not until 2007 that the full coverage was issued for all childhood cancers [6].\nA referral system has been progressively developed among this network to diagnose, treat and follow all of these children. Currently 55 accredited medical institutions nationwide with departments of pediatric hem/oncology are working fulltime. In each institution, there is at least one certified pediatric hem/oncologist. The population enrolled in this program belongs to the lowest socio-economic levels, and their parents are mostly non-salaried workers, rural residents and the unemployed.\nThe National Pediatric Cancer Registry under the auspices of the Mexican Federal Government was started in 2006 but it was not until January 2007 that a national registry appeared [7]. This registry includes all Mexican children with cancer regardless of the medical system to which they belong.\nThe purpose of this report is to present the prevalence, incidence, mortality, and rate of abandonment in the PMI program between 2007 and 2012." ]

[ null ]

[ "Background", "Methods", "Results", "Discussion", "Conclusion" ]

[ "Of the biggest problems in developing nations is the high incidence of childhood cancer is the high incidence and the limited financial resources to develop a solid national program for early diagnosis and management of these patients. We believe that pediatric cancer should now be considered a global child health priority [1].\nA worldwide childhood cancer survey in 2012 estimates a higher incidence in developing countries (147,000 cancers/year) than in developed nations [2]. It is expected that this disease will continue growing because the populations in these countries are younger and expanding.\nSince 2010 in Mexico, cancer is the second leading cause of mortality among children between 4 to 15 years old [3]. This represents a current national health problem. There is a need to expand, fortify and improve early diagnosis and treatment. As we have previously documented in developing countries including Mexico, there is increasing evidence that the mortality rate is higher than in developed countries [4]. This might be related to a late referral to expert institutions for diagnosis and early multidisciplinary treatment.\nClose to half of the Mexican-children and adults-are under a medical socialized program. This system contains large hospitals and clinics nationwide and has been run by the Federal Government Socialized Medicine Program for more than 50 years. Formal, salaried sector workers and their families had been able to access pooled-prepayment options through public social security programs.\nMeanwhile the other half (n: 51,823,314) of Mexicans, including children and adults (2011) [4] has been progressively incorporating into a national health insurance program. This universal health coverage is described as “Popular Medical Insurance” (PMI) [5]. This program was developed to provide access to a package of comprehensive health services-including childhood cancer treatment with financial protection. This is done through a national medical network from primary care clinics to specialized medical hospitals certified by the Federal Government. The program officially started in January 2005. However, it was not until 2007 that the full coverage was issued for all childhood cancers [6].\nA referral system has been progressively developed among this network to diagnose, treat and follow all of these children. Currently 55 accredited medical institutions nationwide with departments of pediatric hem/oncology are working fulltime. In each institution, there is at least one certified pediatric hem/oncologist. The population enrolled in this program belongs to the lowest socio-economic levels, and their parents are mostly non-salaried workers, rural residents and the unemployed.\nThe National Pediatric Cancer Registry under the auspices of the Mexican Federal Government was started in 2006 but it was not until January 2007 that a national registry appeared [7]. This registry includes all Mexican children with cancer regardless of the medical system to which they belong.\nThe purpose of this report is to present the prevalence, incidence, mortality, and rate of abandonment in the PMI program between 2007 and 2012.", "An analysis was performed from 2007 to 2012 on all the children from 0 to 18 years diagnosed with cancer registered at the PMI program from all of the accredited institutions.\nThe diagnosis of leukemia was determined through bone marrow aspiration for cytomorphology analysis, immunophenotype, DNA index and cytogenetic. The diagnosis of lymphomas and malignant solid tumors was performed through biopsy and/or surgical resection for pathology diagnosis. All institutional pathologic reports were classified under the International Classification of Childhood Cancer (ICCC-3) [8].\nThe medical data on each patient was obtained from the National Commission on Health Social Protection (PMI) which is the financial component of the program and from the National Council for the Prevention and Treatment of Childhood Cancer (CENSIA) headquarters which is the technical and normative entity. Both strategies are under the Federal Department of Health, and they work together collaboratively and exchange all of the patient information. This data managing collaboration occurs through an on-line process. The current work is a retrospective, descriptive study at a national level and the data presented was analyzed from the data base program, no approval from the Ethics Committee was required.\nThe variables obtained included in each patient’s hospital registration: location of the treatment center, name, address, date of birth, age, gender, diagnosis, stage of the disease, follow up during treatment or under clinical surveillance for more than 3 months, date of death and/or abandonment. Only patients registered in this program were included. Patients were subjected to standardized treatment protocol regimens according to their respective diagnosis, and stage. All protocols were evaluated previously by the National Council of Health [9] follow by CENSIA [10]. The chemotherapy treatment protocols were developed through a panel of experts that designated a national coordinator and associate coordinators. Development of this protocols took place from 2004 to 2006. All of the treatment regimens were developed on the basis of international cancer treatment protocols that demonstrated solid therapeutic results. The scope of the current study is to analyze exclusively the epidemiological aspects of this population.\nThis descriptive work comprises patients from 55 accredited institutions registered from January 2007 to December 2012. The institutional accreditation criteria were applied through a methodical evaluation from the Office of Medical Innovation and Medical Quality of the National Health Department and medical personnel trained for this type of task.\nFrom a strategic standpoint, Mexico was divided into 6 geographical areas so as to have a physician supervising each area. The role of this specialist is to organize, assist and solve all the problems connected to treatment regimens and local institutional problems related to the children with cancer.\nPrevalence was defined as the number of children who have been diagnosed with a type of cancer, at a given year and expressed as the percentage of the disease in Mexican children between 0 to 18 years and registered in the period of time of the study [2]. The incidence rate was defined as the total number of newly diagnosed cases per year/the total population under 18 years who were-registered with a Medical Policy at the PMI by 1 million population/year (Table 1) [2]. Age-specific incidence was defined as the total number of cases of a specific age group/the total population registered in that age group by 1,000,000 population/year. The overall mortality rate was determined as an absolute number of deceased patients/ 100,000 persons/year [2].Table 1\nAbsolute number of children (0–18 years) registered with a popular medical insurance health policy and newly diagnosed children with cancer/year\nYear of registrationPopulation registered with a PMI health policy (yearly increment)New cases/year200715,106,1002,017200815,281,3752,229200915,497,8312,287201015,986,1502,403201116,146,0112,571201217,014,3212,671\n\nAbsolute number of children (0–18 years) registered with a popular medical insurance health policy and newly diagnosed children with cancer/year\n\nAll patients presented in this work study had a pathological diagnosis of cancer, and were treated with a minimal follow-up of 48 months at registered pediatric oncology units.\nThe program started on January 5th 2005 [10], and the number of original participating institutions was 16. At the beginning only acute leukemia was introduced into this program. However all childhood cancers were progressively included, until January 2007 after which all types of childhood cancers were registered and treated under the national protocols. Therefore, the current work includes only cases collected from January 2007 to December 2012. Descriptive statistical analysis was performed using GraphPad Instant version 3.0.", "From January 2007 to 2012 there were 14,178 patients registered with cancer (Table 2). The most common cancer was leukemia (49.8%), followed by lymphoma (9.9%) and central nervous system tumors (9.4%).When the total cohort of children were grouped by age, it showed that the highest incidence was in children between 0–4 years and the lowest was 15 to 18 years through these 6 years (Figure 1). In terms of gender, males were predominately affected [7868 (55.5%)], while the frequency was slightly lower in females [6310 (44.5%)], with a ratio M: F of 1.2:1. Depending upon the type of childhood malignancy males accounted for 54.4% of patients with acute leukemia, 54.2% with brain tumors and 64% of the lymphoma cases (both Hodgkin’s and non-Hodgkin’s subtypes).Table 2\nPrevalence of PMI childhood and adolescent cancers 2007–2012\nDiagnosisCases n (%) year 2007Cases n (%) year 2008Cases n (%) year 2009Cases n (%) year 2010Cases n (%) year 2011Cases n (%) year 2012Prevalence 2007–2012 Total n (%)Leukemia1,056 (52.4)1,122 (50.3)1,133 (49.5)1,204 (50.1)1,222 (47.5)1329 (49.7)7,066 (49.8)Lymphomas207 (10.3)206 (9.2)244 (10.7)247 (10.3)255 (9.9)258 (9.6)1,417 (9.9)Intracranial neoplasm’s188 (9.3)198 (8.9)198 (8.7)228 (9.5)254 (9.9)277 (10.3)1,343 (9.4)Germ cell tumors53 (2.6)91 (4.1)118 (5.2)146 (6.1)153 (6.0)152 (5.6)713 (5.0)Soft tissue sarcomas108 (5.4)110 (4.9)95 (4.2)79 (3.3)120 (4.7)112 (4.1)624 (4.4)Osteosarcoma92 (4.6)104 (4.7)126 (5.5)74 (3.1)94 (3.7)77 (2.8)567 (3.9)Retinoblastoma75 (3.7)97 (4.4)70 (3.1)93 (3.9)104 (4.0)100 (3.7)539 (3.8)Renal tumors80 (4.0)84 (3.8)67 (2.9)89 (3.7)80 (3.1)87 (3.2)487 (3.4)Miscellaneous reticular neoplasm’s40 (2.0)47 (2.1)58 (2.5)63 (2.6)79 (3.1)95 (3.5)382 (2.6)Hepatic tumors30 (1.5)44 (2.0)35 (1.5)51 (2.1)67 (2.6)48 (1.7)275 (1.9)Neuroblastoma39 (1.9)46 (2.1)54 (2.4)38 (1.6)51 (2.0)46 (1.7)274 (1.9)Ewing tumor and related sarcomas of bone17 (0.8)31 (1.4)35 (1.5)47 (2.0)38 (1.5)24 (0.8)192 (1.3)Other solid tumors32 (1.6.)49 (2.2)54 (2.4)44 (1.8)54 (2.1)66 (2.4)299 (2.1)Total n cases2,0172,2292,2872,4032,5712,67114,178International Classification of Childhood Cancers (ICCC-3)(7).Figure 1\nIncidence by age group during 6 years of the study.\n\n\nPrevalence of PMI childhood and adolescent cancers 2007–2012\n\nInternational Classification of Childhood Cancers (ICCC-3)(7).\n\nIncidence by age group during 6 years of the study.\n\nThe national childhood cancer incidence rate in the PMI program over the six years of this study has been increasing (Table 3). In 2012 the incidence was 156.9/million. It was taken into account that the population of Mexico increased from 106,900,000 in 2007 to 113,336,538 in 2012 [3].Table 3\nIncidence* of PMI childhood and adolescent cancers\nDiagnosis200720082009201020112012Leukemia\n69.9\n\n73.4\n\n73.1\n\n75.3\n75.6\n78.1\nLymphomas13.713.415.715.415.715.1Intracranial neoplasm’s12.412.912.714.215.716.2Germ cell tumors3.55.97.69.19.48.9Soft tissue sarcomas7.17.16.14.64.96.5Osteosarcoma6.06.88.14.76.24.5Retinoblastoma4.96.34.55.86.55.8Renal tumors5.25.44.35.55.05.1Miscellaneous reticular neoplasm’s2.63.03.73.94.95.5Hepatic tumors1.92.82.22.33.12.8Neuroblastoma2.53.03.43.14.12.7Ewing tumor and related sarcomas of bone\n1.1\n\n2.0\n\n2.2\n\n2.9\n2.3\n1.4\nOther solid tumors2.13.23.42.73.33.8Total incidence/year133.5145.8146.2150.3159.2156.9*Incidence: total number of newly diagnosed cases per year/total population under 18 years by 1,000,000 population/year.\n\nIncidence* of PMI childhood and adolescent cancers\n\n*Incidence: total number of newly diagnosed cases per year/total population under 18 years by 1,000,000 population/year.\nIn 2012 the national population census reported 32,972,300 Mexicans between 0 to 18 years (37%). However, only 17,014,321 of the eligible population under 18 years was registered at the PMI program. In the process of tumor classification, Langerhans-cell histiocytosis was included as miscellaneous reticular neoplasm-following the ICCC-3 pathologic classification.\nThe incidence of leukemia was 78.1/1,000,000/year (2012). The prevalence of leukemia over the six years of the current analysis was 49.8%. The predominance of acute lymphoblastic leukemia was documented in all age groups; (Table 4) in comparison with acute and chronic non-lymphoblastic leukemia. Lymphomas were documented in 1417 patients of which 52.2% had non-Hodgkin’s lymphoma and 47.8% of children presented with Hodgkin’s lymphoma; this difference was not statistically significant.Table 4\nPrevalence of 7066 leukemia’s by age groups registered in the PMI from 2007-2012\nType of leukemia0-45-910-1415-18Totalnnnnn(%)(%)(%)(%)(%)Acute lymphoblastic leukemia2,346(40)2,170(37)762(13)586(10)5,864(83)Acute myelogenous leukemia278(30)195(21)185(20)269(29)927(13.1)Chronic myelocytic leukemia45(23)54(27)55(28)44(22)198(2.8)Myelodysplastic syndromes8(10)22(28)24(32)23(30)77(1.0)Total number2,6772,4411,0269227,066\n\nPrevalence of 7066 leukemia’s by age groups registered in the PMI from 2007-2012\n\nThis trend clearly indicates that the participation of the PMI accredited institutions and their respective regional coordinators had a beneficial effect on treatment compliance. The national mortality rate/state of residence was from 5.8 in 2007, to 5.3 in 2012/100,000/year. In this last year the lowest rate was in the group under 1 year at 2.5 and was the highest in the group of adolescents between 15 to 18 with a rate of 8.6 (Table 5).Table 5\n*Mortality rate by geographical location and by age groups in accredited pediatric cancer institutions in 2012\n\nState-rate\n\n<1\n\n1-4\n\n5-9\n\n10-14\n\n15-18\n\nNORTHWEST STATES\n\n5.0\n\n1. Baja California\n5.45.13.33.85.710.0\n2. Baja California South\n6.70.01.911.87.72.6\n3. Chihuahua\n5.54.05.44.82.911.6\n4. Durango\n3.16.02.21.23.44.9\n5. Nayarit\n3.74.64.40.94.64.6\n6. Sinaloa\n4.51.93.34.04.76.1\n7. Sonora\n6.61.96.15.54.112.9\nNORTH EAST STATES\n\n4.7\n\n8. Coahuila\n5.13.76.52.64.76.9\n9. Nuevo León\n4.73.55.73.44.15.5\n10. San Luis Potosí\n4.43.81.92.25.18.7\n11. Tamaulipas\n4.90.05.24.72.29.3\nCENTRAL STATES\n\n5.4\n\n12. Aguascalientes\n4.60.03.93.13.110.8\n13. Colima\n7.17.88.04.83.213.2\n14. Guanajuato\n5.53.54.24.55.18.4\n15. Jalisco\n6.34.85.14.65.211.1\n16. Michoacán\n4.85.64.24.12.97.8\n17. Querétaro\n5.32.73.45.84.28.0\n18. Zacatecas\n4.23.39.01.91.94.4\nCENTRAL METROPOLITAN\n\n5.1\n\n19. Hidalgo\n4.85.53.24.82.29.4\n20. México\n4.71.64.23.84.07.6\n21. Mexico City\n5.90.84.85.44.89.6\n22. Tlaxcala\n5.24.03.04.84.88.3\nSOUTHERN STATES\n\n5.4\n\n23. Morelos\n5.25.91.55.36.45.7\n24. Oaxaca\n5.43.75.94.24.67.1\n25. Puebla\n5.50.83.84.45.59.3\n26. Veracruz\n5.71.43.45.04.311.9\nSOUTHEAST STATES\n\n5.7\n\n27. Campeche\n6.16.13.02.412.34.0\n28. Chiapas\n5.71.87.83.53.89.1\n29. Guerrero\n3.94.14.42.43.15.8\n30. Quintana Roo\n5.70.07.75.04.56.2\n31. Tabasco\n7.72.28.88.84.98.2\n32. Yucatán\n5.10.04.64.93.28.7\nNATIONAL RATE\n\n5.3\n\n2.5\n\n4.7\n\n4.2\n\n4.3\n\n8.6\n*mortality rate by 100,000 children/year.\n\n*Mortality rate by geographical location and by age groups in accredited pediatric cancer institutions in 2012\n\n*mortality rate by 100,000 children/year.\nThe percentage of patients who abandoned treatment was 4.7%/year, the range was from 4.5% in 2012 to 5.2% in 2007.", "The incidence of cancer in children under 18 is increasing especially in developing countries including Mexico [11–14]. To address this problem, several key initiatives have been established by the Mexican Federal Government, including the development of the PMI which applies a diagonal approach to health insurance. Horizontal, population-based coverage is provided for all public and community health services. A package of essential health services is managed at the state-level for all those enrolled with the PMI [5].\nThe initiatives of this program involve supporting hospital accreditation and providing financial assistance to each institution for the treatment of qualifying children with cancer. These initiatives [14] also include the endorsement of treatment protocols/guidelines, the supply of hospital equipment to pediatric oncology units, technical and financial support for pediatric oncology training programs [13]. By 2011, only 92/150 (61.3%) pediatric hem/oncologists in Mexico were working in accredited hospitals under the PMI program. Rigorous evaluation processes have been underway since the PMI was established, and the results are encouraging for childhood cancer. Adherence to treatment prior to the PMI program was 48% in 2007 and by 2012 rose to 95%.\nThere were 35,591 children treated for cancer among the 55 PMI accredited Mexican institutions during the period of analysis, which included new patients (14,178) plus 21,413 follow-up patients by the end of 2012. That being said, a pediatric oncologist in the PMI program treated an average of 392 patients in 6 years. In institutions that have one pediatric oncologist for an entire state, the burden of the patient load increases significantly with the imperative to provide a continuously high standard patient care. However, few institutions in Mexico have as many as 8 pediatric oncologists on their full-time staff. This national patient load is obviously higher than recommended for develop countries.\nIn our current study, we report the findings from a larger number of patients from the Mexican PMI program than the previous study [4]. This represents approximately more than half from the national cancer registry including socialized medicine with their hospitals and in the other side the PMI program. The number of children with cancer registered in the PMI program is very substantial and merits further analysis, especially if these children belong to the lowest socioeconomically deprived bracket of Mexicans. The national childhood cancer incidence [7] in Mexico in the year 2010 from the PMI patients plus those registered in socialized public healthcare systems accounted for 4653 patients with an incidence of 145.5/million/year. The previously published SEER data from the United States [15] has indicated an incidence of childhood cancer (0–19 years) of 173.4/million person/year. In our current study, we have found a higher incidence in childhood cancers than previously published [4] which indicate the need for a more vigorous national public health program for this disease [1]. The active participation of the federal government, which could include providing additional funds to develop better equipped medical institutions and promoting the training of certified pediatricians to enroll in pediatric oncology fellowship programs, is required.\nAs outline before [2] the high prevalence of leukemia deserves further research especially with the prevalent and constant exposure of particular groups of children in Mexico and elsewhere to organophosphate-based pesticides [16]. Other factors need to be taken into account, including paternal smoking [17], fertilizers and proximity to oil fields [18] especially around the time of conception. Exposure to early infections constitutes another constant factor that is considered in the possible etiology of acute leukemia of childhood especially in the very young [19]. Another factor that might contribute to the etiology of childhood leukemia is in-vitro fertilization, which is reported to be associated with increased risk of early onset of acute lymphoblastic leukemia in the offspring [20].\nAccording to the Mexican national statistics [3] from 112 million inhabitants, there are 50 million that live below the poverty line. This fact, from the public health point of view, should direct attention to the triangle of poverty, malnutrition and early infections that most likely play a very important role in the etiology and incidence of childhood cancer in the PMI population. Recent studies [21] have suggested that the incidence of cancer among children living in poverty is much higher than in more affluent populations. This deficiency might be a factor that can account for the higher incidence of acute lymphoblastic leukemia in comparison to those children treated by the socialized healthcare systems in Mexico, in which the socioeconomic and cultural level is much higher.\nDue to the improvement of national public health measures, the incidence of perinatal diseases, malnutrition, gastroenteritis and pneumonia have decreased the pediatric mortality rate in Mexico very significantly, allowing for children to reach an age which childhood cancer is more common. It is ironic that the improved survival rates in children with these diseases may be a factor in the increased incidence rates of cancer. However, incidence and mortality rate are not necessarily correlated in Mexico, as has been outlined [22], but the standard of medical care is constantly improving and the PMI program has had a very beneficial impact on the prognosis for low-income pediatric cancer patients.\nIn 2004, the National Council of Health from the Federal Health Department and a group of pediatric hem/oncologists produced technical protocols for treating the most commonly occurring childhood malignancies experienced in Mexico. We formulate 26 treatment protocols based on international treatment guidelines [9], which included multidisciplinary treatment approaches for all childhood cancers. One of the principal achievements of this program is the progressive improvement of the overall survival. We were able to identify 11 states in Mexico that had an overall survival for all childhood malignancies beyond 72% versus 10 states in which the overall survival was less than 65%. The possible explanation for this later finding is multifactorial and includes, limited number of pediatric hem/oncologist in these areas, advanced and complicated disease at diagnosis, some with small, space-restricted units, low number of pediatric oncology nurses, and a lack of full-time pediatric specialists available for the multidisciplinary approach including surgeons, intensive care specialists, and radiotherapists. Those institutions that had the best survival rates are affiliated with university hospitals and at least a residency program in pediatrics and a training program in childhood cancer for the nursing personnel.\nRegarding mortality, we have been able to maintain a similar rate from 2007 to 2012. However when compared to other developing countries we need to work harder to decrease the mortality even further [23–25]. A very important finding is the high mortality rate in 2012 among adolescents from 15 to 18 years old. One of the observations we have documented in this respect is that more than half of these patients were very advanced or had unfavorable prognostic signs when they arrived for medical care of their cancer. There are multiple possible explanations for these findings and they deserve to be investigated and reported in future scientific publication.\nThe need to continue monitoring the treatment protocols and avoiding violation of these regimens could eventually lead to better results and a decrease in the mortality rate. On a collegiate basis the protocols are revised every 6 months among all participating institutions and the Council of General Health of Mexico. Proper modifications are performed in those instances where there is a high rate of relapse and/or complications.\nChatenoud, et al. [26] reported a standardized mortality rate (per 100,000/year) of 6.45 and 5.42 among boys and girls respectively in Mexico in the period from 2005–2006. However, in 2012 we documented a standardized overall mortality rate of 5.3 without a significant difference between genders. We recognize that our mortality rate is higher compared with other Latin-American countries [27–29] in spite of the PMI program. Mexican children (<18 years) with cancer had an average lifespan of 10.8 years and therefore impede living on an average of 59.2 years [6], while in develop countries, the survival rate in childhood cancer is higher and better [30]. It is important to direct our attention to pediatric oncology in developing nations. In most of our Latin-American countries there is a failure to make an early diagnoses and, to a lack of treatments regimens-clinical trials and inadequate health care systems [31, 32]. Another point that deserves to be mentioned is the continuous low rate of abandonment that has been maintained during the six years of this study and up to the present time, consistent with observations that international studies have eradicated this problem [32].", "The national childhood cancer registration in the PMI program denotes a high prevalence and incidence among Mexican children. The current experience demonstrates that the creation of a cooperative treatment group for childhood cancer in a developing nation can be accomplished through the efforts of a multidisciplinary approach. The combination of horizontal coverage of personal health services with a catastrophic fund makes it possible to offer financial protection for childhood cancer, as well as investing in early detection and survivorship care. Our future goal is to continue improving the treatment program and therefore the outcome for these children. We believe that children with cancer worldwide deserve a stronger focus on their needs than they are currently receiving, especially in resource-poor settings." ]

[ null, "methods", "results", "discussion", "conclusions" ]

[ "Childhood cancer", "Incidence", "Prevalence", "Mortality", "Mexican children" ]

[ 563 ]

[ "cancer", "children", "childhood", "program", "pmi", "year", "incidence", "national", "rate", "years" ]

[ "rate childhood cancer", "cancer incidence mexico", "children cancer initiatives", "worldwide childhood cancer", "mexico pediatric oncologists" ]

[ "Animals", "Demyelinating Diseases", "Disease Models, Animal", "Female", "Interleukin-1beta", "Mice", "Mice, 129 Strain", "Mice, Inbred C57BL", "Mice, Knockout", "Multiple Sclerosis", "Poliomyelitis", "Signal Transduction", "Theilovirus" ]

[ "Introduction", "Animals", "Synthetic peptides and antibodies", "Virus", "Viral infection of mice and assessment of clinical signs", "Reverse-transcriptase PCR and real-time PCR", "Isolation of CNS-infiltrating mononuclear cells (MNCs)", "Flow cytometry", "Intracellular staining of cytokine production", "T cell proliferation assay", "Histopathological analyses", "ELISA", "Statistical analysis", "Administration of IL-1β promotes a Th17 response to TMEV to exacerbate the pathogenicity of demyelinating disease", "IL-1R KO mice are susceptible to TMEV-induced demyelinating disease and display high cellular infiltration to the CNS", "IL-1R KO mice show widely spread mild demyelinating lesions accompanied by patchy axon damage", "Cytokine gene expression is transentily higher in the CNS of IL-1R KO mice during early viral infection", "Anti-viral CD4+ T cell responses in the CNS, of virus-infected IL-1R KO mice are lower during the early stage of infection", "Levels of TMEV-specific CD8+ T cell responses in the CNS are comparable between IL-1R KO and WT B6 mice", "Cytokine production by Th cells stimulated with macrophages from IL-1R KO mice is reduced", "Abbreviations", "Competing interests", "Authors’ contribution" ]

[ "Toll-like receptors (TLRs) and interleukin-1 receptors (IL-1Rs) are involved in the production of various cytokines that are associated with the innate immune response against many different infectious agents. TLRs and IL-1Rs share many structural similarities and utilize common downstream adaptive molecules after activation by their ligands. In general, these innate immune responses induced by TLRs and IL-1Rs are known to play a protective role against various microbes [1]. However, several recent studies have indicated that these signals may also play a pathogenic role in viral infections [2-4]. In addition to TLRs, IL-1Rs are also considered to be important innate receptors because IL-1β, in particular, is a prominent cytokine that appears in the early stage of microbial infections [3]. The IL-1R family contains six receptors, including IL-1RI, which recognizes the principal inflammatory cytokine IL-1β and the less inflammatory cytokine IL-1α [1,5]. IL-1β is generated from the cleavage of pro-IL-1β by caspase-1 in inflammasomes after infections, and the downstream signaling cascade of the IL-1β-IL-1R interaction leads to the induction of various proinflammatory cytokines and the activation of lymphocytes [6]. IL-1β-deficient mice show broad host susceptibility to various infections [7,8]. Moreover, IL-1RI-deficient mice are susceptible to certain pathogens, including Listeria monocytogenes[1]. Therefore, these responses to IL-1β are apparently critical for protection from many types of viruses and microbes. However, the level of IL-1β has also been linked to many different inflammatory autoimmune diseases, including diabetes, lupus, arthritis, and multiple sclerosis (MS) [1,4].\nTheiler’s murine encephalomyelitis virus (TMEV) is a positive-stranded RNA virus in the Picornaviridae family [9]. TMEV establishes a persistent CNS infection in susceptible mouse strains that results in the development of chronic demyelinating disease, and the system has been studied as a relevant viral model for human multiple sclerosis [10-12]. Cells infected with TMEV produce various proinflammatory cytokines, including type I IFNs, IL-6 and IL-1β [13]. TLR3 and TLR2 are involved in the production of these cytokines following infection with TMEV [14,15]. In addition, melanoma differentiation-associated gene 5 and dsRNA-activated protein kinase R are known to contribute to the production of proinflammatory cytokines [14,16]. These pathways also induce activation of caspase-1, leading to the generation of IL-1β and IL-1α, which contribute to further cytokine production, such as IL-6 promoting the development of pathogenic Th17 cells. Because IL-1β signals are associated with both host protection from viral infections and pathogenesis of inflammatory immune-mediated diseases, we here investigated the role of IL-1β-mediated signals in the development of TMEV-induced demyelinating disease.\nWe have previously reported that Th17 cells preferentially develop in an IL-6-dependent manner after TMEV infection, and that Th17 cells promote persistent viral infection and induce the pathogenesis of chronic demyelinating disease [17]. In addition, our earlier studies indicated that administration of either lipopolysaccharide (LPS) or IL-1β, thereby inducing high levels of IL-6 production, into resistant C57BL/6 (B6) mice renders the mice susceptible to the development of TMEV-induced demyelinating disease [18]. These results suggest that an excessive level of IL-1β is harmful to TMEV-induced demyelinating disease by generating high levels of pathogenic Th17 cells [19]. In this study, we confirmed the role of excessive IL-1β in the generation of a high level of Th17 cells in resistant B6 mice, supporting the pathogenic mechanisms of IL-1β. Furthermore, we have also utilized IL-1R-deficient mice to investigate the role of IL-1β-mediated signaling in the development of TMEV-induced demyelinating disease. Our results indicate that the lack of IL-1 signaling in resistant B6 mice also induced TMEV-induced demyelinating disease. The initial deficiencies in T cell function, including cytokine production and high viral persistence in the late stage of viral infection, were found in IL-1R-deficient mice. Therefore, the presence of an excessive amount of IL-1 plays a pathogenic role by elevating pathogenic Th17 responses, whereas the lack of IL-1 signals promotes viral persistence in the spinal cord, leading to chronic immune-mediated inflammatory disease.", "Female C57BL/6 mice were purchased from the Charles River Laboratories (Charles River, MA, USA) through the National Cancer Institute (Frederick, MD). Female B6.129S7-Il1r1tm1Imx/J mice (IL-1R knockout (KO)) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). These mice were housed in the Animal Care Facility of Northwestern University. Experimental procedures that were approved by the Animal Care and Use Committee (ACUC) of Northwestern University in accordance with NIH animal care guidelines were used in this study.", "All peptides used were purchased from GeneMed (GeneMed Synthesis Inc, CA, USA) and used as described previously [20]. All antibodies used were purchased from BD Pharmingen (San Diego, CA, USA).", "The BeAn strain of TMEV was generated, propagated, and titered in BHK-21 cells grown in Dulbecco’s modified Eagle medium supplemented with 7.5% donor calf serum as previously described [21]. Viral titer was determined by plaque assays on BHK cell monolayers.", "For intracerebral (i.c.) infection, 30 μl virus solution, containing 1×106 pfu, was injected into the right cerebral hemisphere of 6 to 8 week-old mice (n = 10 per group) anesthetized with isoflurane. Clinical symptoms of disease were assessed weekly on the following grading scale: grade 0 = no clinical signs; grade 1 = mild waddling gait; grade 2 = severe waddling gait; grade 3 = moderate hind limb paralysis; grade 4 = severe hind limb paralysis and loss of righting reflex.", "Total cellular RNA from the brain and spinal cord of infected SJL/J mice was isolated using Trizol® Reagent (Invitrogen, CA, USA). First-strand cDNA was synthesized from 1 μg total RNA utilizing SuperScript® III First-Strand Synthesis Supermix or M-MLV (Invitrogen). The cDNAs were amplified with specific primer sets using the SYBR Green Supermix (Bio-Rad) on an iCycler (Bio-Rad). Primers for control GAPDH and cytokine genes were purchased from Integrated DNA Technologies. GAPDH: forward primer, AACTTTGGCATTGTGGAAGG and reverse primer, ACACATTGGGGGTAGGAACA; VP-1: TGACTAAGCAGGACTA-TGCCTTCC and CAACGAGCCACATATGCGGATTAC; IFN-α: (5’-ACCTCCTCT-GACCCAGGAAG-3’ and 5’-GGCTCTCCAGACTTCTGCTC-3’); IFN-β: CCCTAT-GGAGATGACGGAGA and CTGTCTGCTGGTGGAGTTCA; CXCL10: (5’-AAGT-GCTGCCGTCATTTTCT-3’ and 5’-GTGGCAATGATCTCAACACG-3’); IL-10: GCCAAGCCTTATCGGAAATGATCC and AGACACCTTGGTCTTGGAGCTT; IFN-γ: ACTGGCAAAAGGATGGTGAC and TGA GCTCATTGAATGCTTGG; IL-17A: CTCCAGAAGGCCCTCAGACTAC and AGCTTTCCCTCCGCATTGACACAG; IL-6: AGTTGCCTTCTTGGGACTGA and TCCACGATTTCCCAGAGAAC; TNF-α: GGTCACTGTCCCAGCATCTT and CTGTGAAGGGAATGGGTGTT.", "Mice were perfused with sterile Hank’s balanced salt solution (HBSS), and excised brains and spinal cords of 3 mice per group were homogenized. CNS-infiltrating MNCs were then enriched in the one third bottom fraction of a continuous Percoll (Pharmacia, Piscataway, NJ, USA) gradient after centrifugation for 30 minutes at 27,000 g as described previously [22].", "CNS-infiltrating lymphocytes were isolated, and Fc receptors were blocked using 100 μL of 2.4G2 hybridoma (ATCC) supernatant by incubating at 4°C for 30 minutes. Cells were stained with anti-CD8 (clone 53–6.7), anti-CD4 (clone GK1.5), anti-CD11b (clone M1/70), anti-NK1.1 (clone PK136), anti-GR-1 (clone RB6-8C5) and anti-CD45 (clone 30-F11) antibodies. All antibodies used for flow cytometry were purchased from BD Pharmingen (San Diego, CA). Cells were analyzed using a Becton Dickinson LSRII flow cytometer.", "Freshly isolated CNS-infiltrating MNCs from three mice per group were cultured in 96-well round-bottom plates in the presence of the relevant or control peptide as previously described [23]. Allophycocyanin-conjugated anti-CD8 (clone Ly2) or anti-CD4 (clone L3T4) antibodies and a PE-labeled rat monoclonal anti-IFN-γ (XMG1.2) antibody were used for intracellular cytokine staining. Cells were analyzed on a Becton Dickinson FACS Calibur or LSRII cytometer. Live cells were gated based on light scattering properties.", "Splenocytes from TMEV-infected mice, CD4+ T cells from spleens of OTII mice stimulated with specific epitope peptide, or in vitro TMEV-infected peritoneal macrophages in the presence of 2 μM ovalbumin (OVA)-specific peptides or 100 μg OVA protein were used. Cultures were incubated in 96-well flat-bottomed microtiter plates for 72 h and then pulsed with 1.0 μCi [3H]TdR and harvested 18 h later. [3H]TdR uptake by the cells was determined in triplicate using a scintillation counter and expressed as net counts per minute (Δcpm) ± standard error of the mean (SEM) after subtraction of the background count of cultures with PBS instead of stimulators.", "At 70 days post-infection, mice were anesthetized and perfused via intracardiac puncture with 50 mL of PBS. Brain and spinal cords from IL-1R KO and B6 control mice were dissected and fixed in 4% formalin in PBS for 24 h. Anterior cortex (bregma: 3.0 to 2.0 mm), subventricular zone (bregma: 1.7 to 0.48), hippocampus (bregma: -1.0 to −2.5 mm), and cerebellum (bregma: -5.6 to −7.0 mm) were investigated. In addition, cervical, thoracic, and lumbar regions of the spinal cord were also examined. The tissues were embedded in paraffin for sectioning and staining. Paraffin-processed brains and spinal cords were sectioned at 6 μm. Adjacent sets of three sections from each animal were deparaffinized, rehydrated, and evaluated by H & E staining for inflammatory infiltrates, Luxol Fast Blue (LFB) staining for axonal demyelination, and Bielschowsky silver staining for axon loss. Slides were examined using a Leica DMR light microscope, and images were captured using an AxioCam MRc camera and AxioVision imaging software. The inflammatory infiltrates were evaluated by the presence or absence of the monocytes/lymphocytes based on the H & E staining and immunofluorescent staining of CD45+ cells. Histologic white matter demyelination was graded as: 1) normal myelination, 2) mild or minor demyelination (> 50% myelin staining preserved), or 3) moderate to severe demyelination (< 50% myelin staining preserved).", "Cytokine levels produced by splenocytes from TMEV-infected mice or CD4+ T cells from spleens of OTII mice were determined after stimulation with specific epitope peptides (2 μM each), or in vitro TMEV-infected peritoneal macrophages in the presence of OVA-specific peptide (2 μM) for 72 h, respectively. IFN-γ (OPTEIA kit; BD Pharmingen), IL-17 (R&D Systems, Minneapolis, MN, USA) levels were assessed. Plates were read using a Spectra MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA, USA) at a 450 nm wavelength.", "Data were presented as mean ± SD of either two to three independent experiments or one representative of at least three separate experiments. The significance of differences in the mean values was determined by Student’s t-test. Clinical scores were analyzed by Mann–Whitney U-test. P values < 0.05 were considered statistically significant.", "We have previously demonstrated that administration of LPS or IL-1β causes resistant C57BL/6 mice to develop demyelinating disease [18]. It has recently been shown that LPS treatment promotes this pathogenesis by elevating the induction of the pathogenic Th17 response [17]. However, it is unknown how IL-1β promotes this pathogenesis. To understand the mechanism, we compared the levels of Th1 and Th17 in the CNS of B6 mice treated with either LPS or IL-1β, along with control mice treated with PBS, following infection with TMEV at 8 days post-infection (Figure 1). The results clearly indicated that the levels of IL-17A-producing Th17 cells in mice treated with either LPS or IL-1β were significantly elevated compared to PBS-treated control mice (Figure 1A and B). In contrast, the levels of IFN-γ-producing Th1 cells were not different. It is interesting to note that IL-1β-treated mice exceeded the Th17 level of LPS-treated mice. However, the levels of IL-17-producing CD8+ T cells were minimal (not shown), and the levels of IFN-γ-producing CD8+ T cells were also similar among the groups (Figure 1C). These results strongly suggest that IL-1β can promote the pathogenesis of TMEV-induced demyelinating disease by enhancing the induction of pathogenic Th17 cells rather than altering the Th1 response.\nEffects of IL-1β administration on Th17 and Th1 responses in TMEV-infected B6 mice. (A) Levels of IFN-γ- and IL-17-producing CD4+ T cells in B6 mice intraperitoneally treated with PBS, lipopolysaccharide (LPS), or IL-1β during the early stage (−1 and 3 days post-infection (dpi)) of Theiler’s murine encephalitis virus (TMEV) infection (three mice per group) were analyzed using flow cytometry of the pooled central nervous system (CNS) cells at 8 dpi after stimulation with either PBS or anti-CD3/CD28 antibodies. (B) The overall numbers of IL-17-producing cells in the CNS of the above treated B6 mice (three mice per group) were shown. (C) Levels of IFN-γ-producing CD8+ T cells in the CNS of these groups of mice were also similarly analyzed. ***P < 0.001.", "Although administration of IL-1β promotes the pathogenesis of TMEV-induced demyelinating disease, the IL-1β produced via NLRP3 proteosome activation upon viral infection is considered to be a protective mechanism against microbial infections by promoting the apoptosis of infected cells [24]. To further investigate the potential role of IL-1β-mediated signaling in the development of TMEV-induced demyelinating disease, we compared the development of TMEV-induced demyelinating disease in IL-1R KO mice with a B6 background and control B6 mice (Figure 2A). Every IL-1R KO mouse developed demyelinating disease while none of the control B6 mice showed clinical signs at 35 days post-infection (dpi). The results clearly indicated that B6 mice with the deficiency in IL-1 signaling became susceptible to the TMEV-induced disease. This is somewhat unexpected because our previous study indicated that administration of IL-1β to B6 mice renders the mice susceptible to the disease, suggesting a pathogenic role for IL-1β in disease development.\nThe course of TMEV-induced demyelinating disease development, viral persistence levels and CNS-infiltrating mononuclear cells in TMEV-infected in B6 and IL-1R KO mice. (A) Frequency and severity of demyelinating disease in B6 (n = 10) and IL-1R knockout (KO) (n = 10) mice were monitored for 70 days after Theiler’s murine encephalitis virus (TMEV) infection. (B) Viral persistence levels in the pooled brains (BR) and spinal cords (SC) of infected mice (three mice per group) at 8, 21 and 70 days post-infection (dpi) were determined by quantitative PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicate experiments. Statistically significant differences are indicated with asterisks;*P < 0.05, **P < 0.01, ***P < 0.001. (C) Levels of T cells (CD4+ and CD8+), macrophages (CD11b+CD45high), microglia (CD11b+CD45int), NK cells (NK1.1+CD45+) and granulocytes (Ly6G/6C+CD45+) were assessed using flow cytometry in central nervous system (CNS)-infiltrating mononuclear cells from TMEV-infected C57BL/6 and IL-1R KO mice at 3 and 8 dpi. Numbers in FACS plots represent percentages in the CNS. Data are representative of three experiments using three mice per group.\nTo correlate the disease susceptibility of IL-1R KO mice with viral persistence in the CNS, the relative viral message levels in the CNS of wild type (WT) B6 and IL-1R KO mice were compared at days 8, 21 and 70 post-infection with TMEV (Figure 2B). The results showed that the level of viral load in the spinal cord, but not in the brain, is consistently higher in IL-1R KO mice compared to control B6 mice. These results strongly suggest that IL-1 signaling plays an important role in controlling viral persistence in the spinal cord during the course of TMEV infection. However, it was previously shown that the viral load level alone is not sufficient for the pathogenesis of TMEV-induced demyelinating disease [25]. Thus, we further assessed the levels of cellular infiltration to the CNS of these mice during the early stages (3 and 8 dpi) of viral infection (Figure 2C). The results indicated that infiltration into the CNS of granulocytes, NK cells, macrophages and CD8+ T cells but not CD4+ T cells was elevated, particularly at the early stage of viral infection. These results collectively suggest that high viral loads and cellular infiltration into the CNS in resistant B6 mice in the absence of IL-1 signaling leads to the elevated development of TMEV-induced demyelinating disease.", "At 70 days post-infection, the histopathology of TMEV-infected IL-1R KO and B6 mice was compared to correlate the disease development with the histopathology of the CNS (Figure 3). Series of histopathological examinations of the spinal cords from both KO and WT mice were conducted after H & E, LFB, and Bielschowsky silver staining. The H & E staining was used for evaluating the evidence of active inflammation and lymphocyte infiltration. LFB specifically stains axonal myelin sheath, and this was used to evaluate the axonal demyelination. Bielschowsky silver staining stains axons dark brown and was used to evaluate axonal integrity. Lymphocyte infiltration, minor demyelination and axon loss were detected in the CNS, including the brain and spinal cord, in IL-1R KO mice but not in WT B6 mice. Compared to control B6 mice (Figure 3A a-b), IL-1R KO mice (Figure 3A c-d) showed more lymphocyte infiltration in the white matter of the lumbar spinal cord when examined by H & E staining. LFB staining of the adjacent sections showed irregular vacuoles and demyelination in the white matter of the spinal cord in IL-1R KO mice (Figure 3A g-h) and in brain regions including the cerebellum and medulla (not shown). In contrast, myelin that appeared normal and little histopathological change were observed in the control B6 mice (Figure 3A e-f). Bielschowsky silver staining of the adjacent sections also showed irregular vacuolation and mild axon loss in the demyelinated regions of the spinal cord from IL-1R KO mice (Figure 3A k-l) but not in the sections from the WT control mice (Figure 3A i-j). To further compare the cellular infiltration levels in the CNS of these mice, we examined the levels of CD45+ cells in the CNS which largely represents infiltrating cells (Figure 3B). Our results clearly displayed that the level of CD45+ cells (Figure 3B d), many of which overlap with H & E staining Figure 3B c), was higher in the CNS of IL-1R KO mice compared to that of the control B6 mice (Figure 3B a-b).\nHistopathology of the spinal cord in IL-1R KO and wild-type mice. (A) H & E staining of the spinal cord showed infiltration of inflammatory cells in knockout (KO) mice (c, d) and little infiltration in wild-type (WT) mice (a, b). Luxol Fast Blue (LFB) staining of adjacent sections showed irregular vacuolation and minor demyelination in the white matter of KO mice (g, h) but no loss of myelin in WT mice (e, f). Bielschowsky silver staining of the same area shows the presence of irregular vacuolation and minor axonal loss in KO mice (k, l) but not in WT mice (i, j). Magnification, ×10 and ×40. Black arrows indicate regions of lymphocyte infiltrates, demyelination, or axon loss; thin black squares indicate the areas from the lumbar spinal cord region, which are shown in high magnification (b, f, and j for B6 mice and d, h, and l for IL-1R KO mice). (B) H & E staining of spinal cords of control (a) and IL-1R KO mice (c) are shown. The adjacent sections (b and d, respectively) were stained with anti-CD45 antibody (red) for infiltrating cells and counterstained with 4',6-diamidino-2-phenylindole (DAPI) (blue) for nuclei.", "To understand the susceptibility to TMEV-induced demyelinating disease in IL-1R KO mice, we analyzed various cytokine message levels expressed in the CNS of virus-infected control and IL-1R KO mice during the early stages (3, 5, and 8 dpi) of viral infection using real-time PCR (Figure 4). The levels of IFN-α and IFN-β gene expression in IL-1R KO mice were significantly higher than those in B6 mice at 3 dpi, although the levels became similar at 5 and 8 dpi. The expression levels of CXCL-10 that were associated with T cell infiltration and IL-10 that was associated with viral persistence were higher at 5 dpi, and this trend was maintained at 8 dpi. However, the expression level of IL-6 in IL-1R KO mice was transiently lower at 5 dpi, while no differences in TNF-α expression were noted. Similarly, the production of a pathogenic T cell cytokine, IL-17 was largely unchanged. However, viral RNA and the production of IFN-γ were transiently higher at 3 and 8 dpi. These results suggest that the lack of IL-1 signaling differentially affects viral replication and the expression of various innate and immune cytokines depending on the stage of TMEV infection.\nExpression level of cytokine genes in the CNS of TMEV infected B6 and IL-1R knockout (KO) mice at 3, 5 and 8 days post-infection (dpi). The relative expression levels of the indicated mRNAs in the central nervous system (CNS) of Theiler’s murine encephalitis virus (TMEV)-infected C57BL/6 and IL-1R KO mice at 3, 5 and 8 dpi were assessed by real-time PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001).", "To compare CD4+ T cell responses specific to viral determinants in the CNS of IL-1R KO and WT mice, infiltration levels of CD4+ T cells specific to the predominant CD4+ T cell epitopes were assessed (Figure 5A and B). The levels of IFN-γ-producing CD4+ T cells in response to pan-T cell stimulation (either PMA plus ionomycin or anti-CD3 and anti-CD28 antibodies) were similar between IL-1R KO and control WT B6 mice. However, such CD4+ T cell responses to viral epitopes were proportionally lower in the CNS of virus-infected IL-1R KO mice compared to B6 mice, although the overall levels in the CNS were similar. This discrepancy may be due to the high levels of CXCL-10 expression (Figure 4), which promotes infiltration of T cells, in the CNS of IL-1R KO mice. The levels of IL-17-producing CD4+ T cells in either TMEV-infected IL-1R KO or B6 mice were undetectable. To further determine whether the pattern of CD4+ T cell responses is unique in the CNS of virus-infected mice, we also assessed the T cell responses in the periphery of TMEV-infected IL-1R KO and control B6 mice at 8 and 21 dpi (Figure 5C). Again, the levels of T cell proliferation and the production of key T cell cytokines (IFN-γ and IL-17) against viral epitopes (for both CD4+ and CD8+ T cells) were not drasticaly different between the splenic T cells from IL-1R KO and control B6 mice. Despite the similar low levels of IL-17 production in response to viral epitopes, the IL-17 level was significantly lower in IL-1R KO mice compared to WT B6 mice after robust stimulation with anti-CD3/CD28 antibodies. These results are consistent with the role of IL-1 signaling in promoting IL-17 production [26,27].\nVirus-specific CD4+T cell responses in the CNS and the periphery of TMEV-infected B6 and IL-1R knockout (KO) mice. (A) Levels of Th1 and Th17 cells in the central nervous system (CNS) of virus-infected B6 and IL-1R KO mice were assessed using flow cytometry at 8 days post-infection (dpi) after stimulation with PBS, PMA/ionomycin, anti-CD3/CD28 antibodies, or viral epitope peptides (Pep: mixture of 2 μM VP2203-220 and 2 μM VP425-38). The flow cytometric plots show gated CD4+ T cells. (B) The numbers of CNS-infiltrating IFN-γ-producing CD4+ T cells reactive to either viral epitope peptides (CD4: equal mixture of VP2203-220 and VP425-38) or anti-CD3/CD28 antibodies in virus-infected B6 and IL-1R KO mice (three mice each) at 8 and 21 dpi. A representative result from two to three similar experiments is shown here. (C) Levels of proliferation and cytokine production by splenic T cells in response to viral epitopes by CD4+ T cells (CD4 Mix: equal mixture of VP2203-220 and VP425-38), CD8+ T cells (VP2-121–130), or both CD4+ and CD8+ T cells (anti-CD3/CD28 antibodies) were assessed at 8 and 21 dpi. Values are expressed as the mean of triplicate samples (mean ± SD) from a representative of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001.", "To further determine whether the susceptibility of IL-1R KO mice to TMEV-induced demyelinating disease is associated with a compromised anti-viral CD8+ T cell response, we also analyzed the T cell responses in the CNS of TMEV-infected IL-1R KO and control B6 mice (Figure 6). Virus-specific CD8+ T cells reactive to the predominant epitope (VP2121-130), determined using the VP2121-H-2Db tetramer, indicated that the proportions of virus-specific CD8+ T cells in the CNS of virus-infected WT B6 and IL-1R KO mice are similar (Figure 6A). To further determine whether the functions of the virus-reactive CD8+ T cells are different, we assessed the abilities of the cells to produce IFN-γ in response to specific and non-specific stimulations (Figure 6B). The results clearly indicated that their ability to produce IFN-γ is also similar in both proportion (Figure 6B) and number in the CNS of TMEV-infected B6 and IL-1R KO mice (Figure 6C). These results strongly suggest that there are no significant differences in the CD8+ T cell responses to the viral determinants, unlike those of CD4+ T cell responses, in the CNS of virus-infected WT B6 and IL-1R KO mice.\nLevels of virus-specific CD8+T cell responses in the CNS of virus-infected B6 and IL-1R KO mice. (A) Levels of H-2Db-VP2-121–130-tetramer reactive CD8+ T cells in the central nervous system (CNS) of B6 and IL-1R knockout (KO) mice at 8 days post-infection (dpi). (B) Proportions of CNS-infiltrating CD8+ T cells reactive to viral epitopes, anti-CD3/CD28 antibodies and PMA/ionomycin were assessed using flow cytometry following intracellular cytokine staining at 8 dpi. (C) The overall numbers of virus-specific and anti-CD3/CD28 reactive CD8+ T cells in the CNS of virus-infected B6 and IL-1R KO mice are shown at 8 and 21 dpi. A representative result from two to three similar experiments is shown here.", "To compare the function of CD4+ T cells stimulated by macrophages from B6 and IL-1R KO mice, T cells from naïve OT-II mice, which carry T cell receptor (TCR) transgenes specific for OVA323-339, were stimulated with peritoneal macrophages infected in vitro for 24 h with TMEV (10 MOI) in the presence of OVA323-339 peptide (Figure 7A) or OVA protein (not shown). Viral infection did not significantly alter the levels of T cell stimulation by these macrophages. However, proliferation of CD4+ T cells in response to the cognate peptide or protein was higher when stimulated with IL-1R KO macrophages compared to the proliferation stimulated with B6 macrophages. In contrast, IFN-γ and IL-17 production by the T cells stimulated with IL-1R KO macrophages were significantly lower than the production stimulated with control B6 macrophages. These results indicated that antigen-presenting cells display altered T cell stimulating function in the absence of IL-1R-mediated signaling.\nCytokine reduction of CD4+T cells with stimulation of IL-1R KO macrophages. (A) Isolated CD4+ T cells (1 × 105) from the spleen of OT-II mice were cultured with in vitro 10 MOI Theiler’s murine encephalitis virus (TMEV)-infected peritoneal macrophages (1 × 104) from either C57BL/6 or IL-1R knockout (KO) mice for 3 days in the presence of 2 μM OVA epitope peptides. T cell proliferative responses were analyzed using [3H]TdR uptake, and cytokine production (IFN-γ and IL-17) of the cultures were analyzed using specific ELISAs. (B) Isolated CD4+ T cells (1 × 105) from the spleen of B6 mice infected with TMEV at 8 days post-infection (dpi) were cultured with in vitro TMEV-infected (10 MOI for 24 h) peritoneal macrophages (1 × 104) from either naïve C57BL/6 or IL-1R KO mice for 3 days in the presence of viral epitope peptides. Message levels of the indicated genes were then analyzed by real-time PCR. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level was used as an internal control. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001. Data shown are the representation of three independent experiments. (C) Peritoneal CD11b+ cells from naïve B6 and IL-1R KO mice infected with TMEV in vitro for 24 h were analyzed for the expression of PDL-1 and TIM-3 T cell inhibitory molecules. A representative flow cytometry plot of three similar results is shown here.\nTo further understand the potential mechanisms underlying the altered T cell stimulation by IL-1R KO macrophages, we examined the potential contribution of IL-1 signaling to the induction of cytokines in TMEV-infected macrophages (Figure 7B). After TMEV infection in vitro for 24 h, levels of viral RNA as well as IFN-α and IFN-β messages were similar between macrophages from WT B6 and IL-1R KO mice. However, the expression of the IL-6 message was extremely compromised in IL-1R KO macrophages compared to B6 macrophages. In contrast, the expression level of TNF-α message was more highly upregulated in IL-1R KO macrophages after TMEV infection. Interestingly however, the expression of TGF-β in uninfected IL-1R KO macrophages was higher than the expression in B6 macrophages but reduced to a similar level after viral infection. These results suggest that the cytokine production profile of macrophages and perhaps other antigen-presenting cells is altered in the absence of IL-1 signaling, which may affect the initial development and/or function of T cells following viral infection.\nTo further understand the underlying mechanisms associated with altered CD4+ T cell development in the absence of IL-1 signaling, the levels of co-stimulatory molecules and key inhibitory molecules were studied in a representative macrophage antigen-presenting cell (APC) population (Figure 7C). The levels of CD80, CD86 and CD40 in B6 and IL-1R1 KO mice were not significantly different (not shown). However, PDL-1 and Tim-3 were significantly elevated in the absence of IL-1 signaling. These molecules are known to negatively affect the function of T cells [28] and/or promote inflammatory responses through its expression by innate immune cells, such as microglia [29]. It was interesting to note that the expression of PDL-1 was upregulated upon viral infection in B6 macrophages, whereas the expression in IL-1R-deficient macrophages was constitutively upregulated even in the absence of viral infection. In contrast, the expression of Tim-3 was constitutively upregulated in IL-1R-deficient macrophages to the level (approximately 5%) of upregulation seen after viral infection in B6 macrophages, but it was further upregulated in IL-1R KO macrophages after TMEV infection. These results strongly suggest that these increases in the inhibitory molecules may participate in the altered T cell development and/or function.", "APC: antigen-presenting cell; CNS: central nervous system; Dpi: days post-infection; EAE: experimental autoimmune encephalomyelitis; ELISA: enzyme-linked immunosorbent assay; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; H & E: hematoxylin and eosin; IL-1R: interleukin-1 receptor; LFB: Luxol Fast Blue; LPS: lipopolysaccharide; MNC: mononuclear cell; MS: multiple sclerosis; OVA: ovalbumin; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; PFU: plaque-forming unit; SEM: standard error of the mean; TLR: toll-like receptor; TMEV: Theiler’s murine encephalomyelitis virus; TMEV-IDD: TMEV-induced demyelinating disease.", "The authors declare that they have no competing interests.", "BSK directed experiments, interpreted the results and wrote the manuscript. YHJ conducted immunological experiments and helped writing. LM conducted histological experiments and wrote the corresponding portions. HSK performed some molecular analyses. WH and HSP conducted the initial immunological experiments. CSK contributed for the interpretation of results and direction of the study. All authors read and approved the final manuscript." ]

[ null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null ]

[ "Introduction", "Materials and methods", "Animals", "Synthetic peptides and antibodies", "Virus", "Viral infection of mice and assessment of clinical signs", "Reverse-transcriptase PCR and real-time PCR", "Isolation of CNS-infiltrating mononuclear cells (MNCs)", "Flow cytometry", "Intracellular staining of cytokine production", "T cell proliferation assay", "Histopathological analyses", "ELISA", "Statistical analysis", "Results", "Administration of IL-1β promotes a Th17 response to TMEV to exacerbate the pathogenicity of demyelinating disease", "IL-1R KO mice are susceptible to TMEV-induced demyelinating disease and display high cellular infiltration to the CNS", "IL-1R KO mice show widely spread mild demyelinating lesions accompanied by patchy axon damage", "Cytokine gene expression is transentily higher in the CNS of IL-1R KO mice during early viral infection", "Anti-viral CD4+ T cell responses in the CNS, of virus-infected IL-1R KO mice are lower during the early stage of infection", "Levels of TMEV-specific CD8+ T cell responses in the CNS are comparable between IL-1R KO and WT B6 mice", "Cytokine production by Th cells stimulated with macrophages from IL-1R KO mice is reduced", "Discussion", "Conclusions", "Abbreviations", "Competing interests", "Authors’ contribution" ]

[ "Toll-like receptors (TLRs) and interleukin-1 receptors (IL-1Rs) are involved in the production of various cytokines that are associated with the innate immune response against many different infectious agents. TLRs and IL-1Rs share many structural similarities and utilize common downstream adaptive molecules after activation by their ligands. In general, these innate immune responses induced by TLRs and IL-1Rs are known to play a protective role against various microbes [1]. However, several recent studies have indicated that these signals may also play a pathogenic role in viral infections [2-4]. In addition to TLRs, IL-1Rs are also considered to be important innate receptors because IL-1β, in particular, is a prominent cytokine that appears in the early stage of microbial infections [3]. The IL-1R family contains six receptors, including IL-1RI, which recognizes the principal inflammatory cytokine IL-1β and the less inflammatory cytokine IL-1α [1,5]. IL-1β is generated from the cleavage of pro-IL-1β by caspase-1 in inflammasomes after infections, and the downstream signaling cascade of the IL-1β-IL-1R interaction leads to the induction of various proinflammatory cytokines and the activation of lymphocytes [6]. IL-1β-deficient mice show broad host susceptibility to various infections [7,8]. Moreover, IL-1RI-deficient mice are susceptible to certain pathogens, including Listeria monocytogenes[1]. Therefore, these responses to IL-1β are apparently critical for protection from many types of viruses and microbes. However, the level of IL-1β has also been linked to many different inflammatory autoimmune diseases, including diabetes, lupus, arthritis, and multiple sclerosis (MS) [1,4].\nTheiler’s murine encephalomyelitis virus (TMEV) is a positive-stranded RNA virus in the Picornaviridae family [9]. TMEV establishes a persistent CNS infection in susceptible mouse strains that results in the development of chronic demyelinating disease, and the system has been studied as a relevant viral model for human multiple sclerosis [10-12]. Cells infected with TMEV produce various proinflammatory cytokines, including type I IFNs, IL-6 and IL-1β [13]. TLR3 and TLR2 are involved in the production of these cytokines following infection with TMEV [14,15]. In addition, melanoma differentiation-associated gene 5 and dsRNA-activated protein kinase R are known to contribute to the production of proinflammatory cytokines [14,16]. These pathways also induce activation of caspase-1, leading to the generation of IL-1β and IL-1α, which contribute to further cytokine production, such as IL-6 promoting the development of pathogenic Th17 cells. Because IL-1β signals are associated with both host protection from viral infections and pathogenesis of inflammatory immune-mediated diseases, we here investigated the role of IL-1β-mediated signals in the development of TMEV-induced demyelinating disease.\nWe have previously reported that Th17 cells preferentially develop in an IL-6-dependent manner after TMEV infection, and that Th17 cells promote persistent viral infection and induce the pathogenesis of chronic demyelinating disease [17]. In addition, our earlier studies indicated that administration of either lipopolysaccharide (LPS) or IL-1β, thereby inducing high levels of IL-6 production, into resistant C57BL/6 (B6) mice renders the mice susceptible to the development of TMEV-induced demyelinating disease [18]. These results suggest that an excessive level of IL-1β is harmful to TMEV-induced demyelinating disease by generating high levels of pathogenic Th17 cells [19]. In this study, we confirmed the role of excessive IL-1β in the generation of a high level of Th17 cells in resistant B6 mice, supporting the pathogenic mechanisms of IL-1β. Furthermore, we have also utilized IL-1R-deficient mice to investigate the role of IL-1β-mediated signaling in the development of TMEV-induced demyelinating disease. Our results indicate that the lack of IL-1 signaling in resistant B6 mice also induced TMEV-induced demyelinating disease. The initial deficiencies in T cell function, including cytokine production and high viral persistence in the late stage of viral infection, were found in IL-1R-deficient mice. Therefore, the presence of an excessive amount of IL-1 plays a pathogenic role by elevating pathogenic Th17 responses, whereas the lack of IL-1 signals promotes viral persistence in the spinal cord, leading to chronic immune-mediated inflammatory disease.", " Animals Female C57BL/6 mice were purchased from the Charles River Laboratories (Charles River, MA, USA) through the National Cancer Institute (Frederick, MD). Female B6.129S7-Il1r1tm1Imx/J mice (IL-1R knockout (KO)) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). These mice were housed in the Animal Care Facility of Northwestern University. Experimental procedures that were approved by the Animal Care and Use Committee (ACUC) of Northwestern University in accordance with NIH animal care guidelines were used in this study.\nFemale C57BL/6 mice were purchased from the Charles River Laboratories (Charles River, MA, USA) through the National Cancer Institute (Frederick, MD). Female B6.129S7-Il1r1tm1Imx/J mice (IL-1R knockout (KO)) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). These mice were housed in the Animal Care Facility of Northwestern University. Experimental procedures that were approved by the Animal Care and Use Committee (ACUC) of Northwestern University in accordance with NIH animal care guidelines were used in this study.\n Synthetic peptides and antibodies All peptides used were purchased from GeneMed (GeneMed Synthesis Inc, CA, USA) and used as described previously [20]. All antibodies used were purchased from BD Pharmingen (San Diego, CA, USA).\nAll peptides used were purchased from GeneMed (GeneMed Synthesis Inc, CA, USA) and used as described previously [20]. All antibodies used were purchased from BD Pharmingen (San Diego, CA, USA).\n Virus The BeAn strain of TMEV was generated, propagated, and titered in BHK-21 cells grown in Dulbecco’s modified Eagle medium supplemented with 7.5% donor calf serum as previously described [21]. Viral titer was determined by plaque assays on BHK cell monolayers.\nThe BeAn strain of TMEV was generated, propagated, and titered in BHK-21 cells grown in Dulbecco’s modified Eagle medium supplemented with 7.5% donor calf serum as previously described [21]. Viral titer was determined by plaque assays on BHK cell monolayers.\n Viral infection of mice and assessment of clinical signs For intracerebral (i.c.) infection, 30 μl virus solution, containing 1×106 pfu, was injected into the right cerebral hemisphere of 6 to 8 week-old mice (n = 10 per group) anesthetized with isoflurane. Clinical symptoms of disease were assessed weekly on the following grading scale: grade 0 = no clinical signs; grade 1 = mild waddling gait; grade 2 = severe waddling gait; grade 3 = moderate hind limb paralysis; grade 4 = severe hind limb paralysis and loss of righting reflex.\nFor intracerebral (i.c.) infection, 30 μl virus solution, containing 1×106 pfu, was injected into the right cerebral hemisphere of 6 to 8 week-old mice (n = 10 per group) anesthetized with isoflurane. Clinical symptoms of disease were assessed weekly on the following grading scale: grade 0 = no clinical signs; grade 1 = mild waddling gait; grade 2 = severe waddling gait; grade 3 = moderate hind limb paralysis; grade 4 = severe hind limb paralysis and loss of righting reflex.\n Reverse-transcriptase PCR and real-time PCR Total cellular RNA from the brain and spinal cord of infected SJL/J mice was isolated using Trizol® Reagent (Invitrogen, CA, USA). First-strand cDNA was synthesized from 1 μg total RNA utilizing SuperScript® III First-Strand Synthesis Supermix or M-MLV (Invitrogen). The cDNAs were amplified with specific primer sets using the SYBR Green Supermix (Bio-Rad) on an iCycler (Bio-Rad). Primers for control GAPDH and cytokine genes were purchased from Integrated DNA Technologies. GAPDH: forward primer, AACTTTGGCATTGTGGAAGG and reverse primer, ACACATTGGGGGTAGGAACA; VP-1: TGACTAAGCAGGACTA-TGCCTTCC and CAACGAGCCACATATGCGGATTAC; IFN-α: (5’-ACCTCCTCT-GACCCAGGAAG-3’ and 5’-GGCTCTCCAGACTTCTGCTC-3’); IFN-β: CCCTAT-GGAGATGACGGAGA and CTGTCTGCTGGTGGAGTTCA; CXCL10: (5’-AAGT-GCTGCCGTCATTTTCT-3’ and 5’-GTGGCAATGATCTCAACACG-3’); IL-10: GCCAAGCCTTATCGGAAATGATCC and AGACACCTTGGTCTTGGAGCTT; IFN-γ: ACTGGCAAAAGGATGGTGAC and TGA GCTCATTGAATGCTTGG; IL-17A: CTCCAGAAGGCCCTCAGACTAC and AGCTTTCCCTCCGCATTGACACAG; IL-6: AGTTGCCTTCTTGGGACTGA and TCCACGATTTCCCAGAGAAC; TNF-α: GGTCACTGTCCCAGCATCTT and CTGTGAAGGGAATGGGTGTT.\nTotal cellular RNA from the brain and spinal cord of infected SJL/J mice was isolated using Trizol® Reagent (Invitrogen, CA, USA). First-strand cDNA was synthesized from 1 μg total RNA utilizing SuperScript® III First-Strand Synthesis Supermix or M-MLV (Invitrogen). The cDNAs were amplified with specific primer sets using the SYBR Green Supermix (Bio-Rad) on an iCycler (Bio-Rad). Primers for control GAPDH and cytokine genes were purchased from Integrated DNA Technologies. GAPDH: forward primer, AACTTTGGCATTGTGGAAGG and reverse primer, ACACATTGGGGGTAGGAACA; VP-1: TGACTAAGCAGGACTA-TGCCTTCC and CAACGAGCCACATATGCGGATTAC; IFN-α: (5’-ACCTCCTCT-GACCCAGGAAG-3’ and 5’-GGCTCTCCAGACTTCTGCTC-3’); IFN-β: CCCTAT-GGAGATGACGGAGA and CTGTCTGCTGGTGGAGTTCA; CXCL10: (5’-AAGT-GCTGCCGTCATTTTCT-3’ and 5’-GTGGCAATGATCTCAACACG-3’); IL-10: GCCAAGCCTTATCGGAAATGATCC and AGACACCTTGGTCTTGGAGCTT; IFN-γ: ACTGGCAAAAGGATGGTGAC and TGA GCTCATTGAATGCTTGG; IL-17A: CTCCAGAAGGCCCTCAGACTAC and AGCTTTCCCTCCGCATTGACACAG; IL-6: AGTTGCCTTCTTGGGACTGA and TCCACGATTTCCCAGAGAAC; TNF-α: GGTCACTGTCCCAGCATCTT and CTGTGAAGGGAATGGGTGTT.\n Isolation of CNS-infiltrating mononuclear cells (MNCs) Mice were perfused with sterile Hank’s balanced salt solution (HBSS), and excised brains and spinal cords of 3 mice per group were homogenized. CNS-infiltrating MNCs were then enriched in the one third bottom fraction of a continuous Percoll (Pharmacia, Piscataway, NJ, USA) gradient after centrifugation for 30 minutes at 27,000 g as described previously [22].\nMice were perfused with sterile Hank’s balanced salt solution (HBSS), and excised brains and spinal cords of 3 mice per group were homogenized. CNS-infiltrating MNCs were then enriched in the one third bottom fraction of a continuous Percoll (Pharmacia, Piscataway, NJ, USA) gradient after centrifugation for 30 minutes at 27,000 g as described previously [22].\n Flow cytometry CNS-infiltrating lymphocytes were isolated, and Fc receptors were blocked using 100 μL of 2.4G2 hybridoma (ATCC) supernatant by incubating at 4°C for 30 minutes. Cells were stained with anti-CD8 (clone 53–6.7), anti-CD4 (clone GK1.5), anti-CD11b (clone M1/70), anti-NK1.1 (clone PK136), anti-GR-1 (clone RB6-8C5) and anti-CD45 (clone 30-F11) antibodies. All antibodies used for flow cytometry were purchased from BD Pharmingen (San Diego, CA). Cells were analyzed using a Becton Dickinson LSRII flow cytometer.\nCNS-infiltrating lymphocytes were isolated, and Fc receptors were blocked using 100 μL of 2.4G2 hybridoma (ATCC) supernatant by incubating at 4°C for 30 minutes. Cells were stained with anti-CD8 (clone 53–6.7), anti-CD4 (clone GK1.5), anti-CD11b (clone M1/70), anti-NK1.1 (clone PK136), anti-GR-1 (clone RB6-8C5) and anti-CD45 (clone 30-F11) antibodies. All antibodies used for flow cytometry were purchased from BD Pharmingen (San Diego, CA). Cells were analyzed using a Becton Dickinson LSRII flow cytometer.\n Intracellular staining of cytokine production Freshly isolated CNS-infiltrating MNCs from three mice per group were cultured in 96-well round-bottom plates in the presence of the relevant or control peptide as previously described [23]. Allophycocyanin-conjugated anti-CD8 (clone Ly2) or anti-CD4 (clone L3T4) antibodies and a PE-labeled rat monoclonal anti-IFN-γ (XMG1.2) antibody were used for intracellular cytokine staining. Cells were analyzed on a Becton Dickinson FACS Calibur or LSRII cytometer. Live cells were gated based on light scattering properties.\nFreshly isolated CNS-infiltrating MNCs from three mice per group were cultured in 96-well round-bottom plates in the presence of the relevant or control peptide as previously described [23]. Allophycocyanin-conjugated anti-CD8 (clone Ly2) or anti-CD4 (clone L3T4) antibodies and a PE-labeled rat monoclonal anti-IFN-γ (XMG1.2) antibody were used for intracellular cytokine staining. Cells were analyzed on a Becton Dickinson FACS Calibur or LSRII cytometer. Live cells were gated based on light scattering properties.\n T cell proliferation assay Splenocytes from TMEV-infected mice, CD4+ T cells from spleens of OTII mice stimulated with specific epitope peptide, or in vitro TMEV-infected peritoneal macrophages in the presence of 2 μM ovalbumin (OVA)-specific peptides or 100 μg OVA protein were used. Cultures were incubated in 96-well flat-bottomed microtiter plates for 72 h and then pulsed with 1.0 μCi [3H]TdR and harvested 18 h later. [3H]TdR uptake by the cells was determined in triplicate using a scintillation counter and expressed as net counts per minute (Δcpm) ± standard error of the mean (SEM) after subtraction of the background count of cultures with PBS instead of stimulators.\nSplenocytes from TMEV-infected mice, CD4+ T cells from spleens of OTII mice stimulated with specific epitope peptide, or in vitro TMEV-infected peritoneal macrophages in the presence of 2 μM ovalbumin (OVA)-specific peptides or 100 μg OVA protein were used. Cultures were incubated in 96-well flat-bottomed microtiter plates for 72 h and then pulsed with 1.0 μCi [3H]TdR and harvested 18 h later. [3H]TdR uptake by the cells was determined in triplicate using a scintillation counter and expressed as net counts per minute (Δcpm) ± standard error of the mean (SEM) after subtraction of the background count of cultures with PBS instead of stimulators.\n Histopathological analyses At 70 days post-infection, mice were anesthetized and perfused via intracardiac puncture with 50 mL of PBS. Brain and spinal cords from IL-1R KO and B6 control mice were dissected and fixed in 4% formalin in PBS for 24 h. Anterior cortex (bregma: 3.0 to 2.0 mm), subventricular zone (bregma: 1.7 to 0.48), hippocampus (bregma: -1.0 to −2.5 mm), and cerebellum (bregma: -5.6 to −7.0 mm) were investigated. In addition, cervical, thoracic, and lumbar regions of the spinal cord were also examined. The tissues were embedded in paraffin for sectioning and staining. Paraffin-processed brains and spinal cords were sectioned at 6 μm. Adjacent sets of three sections from each animal were deparaffinized, rehydrated, and evaluated by H & E staining for inflammatory infiltrates, Luxol Fast Blue (LFB) staining for axonal demyelination, and Bielschowsky silver staining for axon loss. Slides were examined using a Leica DMR light microscope, and images were captured using an AxioCam MRc camera and AxioVision imaging software. The inflammatory infiltrates were evaluated by the presence or absence of the monocytes/lymphocytes based on the H & E staining and immunofluorescent staining of CD45+ cells. Histologic white matter demyelination was graded as: 1) normal myelination, 2) mild or minor demyelination (> 50% myelin staining preserved), or 3) moderate to severe demyelination (< 50% myelin staining preserved).\nAt 70 days post-infection, mice were anesthetized and perfused via intracardiac puncture with 50 mL of PBS. Brain and spinal cords from IL-1R KO and B6 control mice were dissected and fixed in 4% formalin in PBS for 24 h. Anterior cortex (bregma: 3.0 to 2.0 mm), subventricular zone (bregma: 1.7 to 0.48), hippocampus (bregma: -1.0 to −2.5 mm), and cerebellum (bregma: -5.6 to −7.0 mm) were investigated. In addition, cervical, thoracic, and lumbar regions of the spinal cord were also examined. The tissues were embedded in paraffin for sectioning and staining. Paraffin-processed brains and spinal cords were sectioned at 6 μm. Adjacent sets of three sections from each animal were deparaffinized, rehydrated, and evaluated by H & E staining for inflammatory infiltrates, Luxol Fast Blue (LFB) staining for axonal demyelination, and Bielschowsky silver staining for axon loss. Slides were examined using a Leica DMR light microscope, and images were captured using an AxioCam MRc camera and AxioVision imaging software. The inflammatory infiltrates were evaluated by the presence or absence of the monocytes/lymphocytes based on the H & E staining and immunofluorescent staining of CD45+ cells. Histologic white matter demyelination was graded as: 1) normal myelination, 2) mild or minor demyelination (> 50% myelin staining preserved), or 3) moderate to severe demyelination (< 50% myelin staining preserved).\n ELISA Cytokine levels produced by splenocytes from TMEV-infected mice or CD4+ T cells from spleens of OTII mice were determined after stimulation with specific epitope peptides (2 μM each), or in vitro TMEV-infected peritoneal macrophages in the presence of OVA-specific peptide (2 μM) for 72 h, respectively. IFN-γ (OPTEIA kit; BD Pharmingen), IL-17 (R&D Systems, Minneapolis, MN, USA) levels were assessed. Plates were read using a Spectra MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA, USA) at a 450 nm wavelength.\nCytokine levels produced by splenocytes from TMEV-infected mice or CD4+ T cells from spleens of OTII mice were determined after stimulation with specific epitope peptides (2 μM each), or in vitro TMEV-infected peritoneal macrophages in the presence of OVA-specific peptide (2 μM) for 72 h, respectively. IFN-γ (OPTEIA kit; BD Pharmingen), IL-17 (R&D Systems, Minneapolis, MN, USA) levels were assessed. Plates were read using a Spectra MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA, USA) at a 450 nm wavelength.\n Statistical analysis Data were presented as mean ± SD of either two to three independent experiments or one representative of at least three separate experiments. The significance of differences in the mean values was determined by Student’s t-test. Clinical scores were analyzed by Mann–Whitney U-test. P values < 0.05 were considered statistically significant.\nData were presented as mean ± SD of either two to three independent experiments or one representative of at least three separate experiments. The significance of differences in the mean values was determined by Student’s t-test. Clinical scores were analyzed by Mann–Whitney U-test. P values < 0.05 were considered statistically significant.", "Female C57BL/6 mice were purchased from the Charles River Laboratories (Charles River, MA, USA) through the National Cancer Institute (Frederick, MD). Female B6.129S7-Il1r1tm1Imx/J mice (IL-1R knockout (KO)) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). These mice were housed in the Animal Care Facility of Northwestern University. Experimental procedures that were approved by the Animal Care and Use Committee (ACUC) of Northwestern University in accordance with NIH animal care guidelines were used in this study.", "All peptides used were purchased from GeneMed (GeneMed Synthesis Inc, CA, USA) and used as described previously [20]. All antibodies used were purchased from BD Pharmingen (San Diego, CA, USA).", "The BeAn strain of TMEV was generated, propagated, and titered in BHK-21 cells grown in Dulbecco’s modified Eagle medium supplemented with 7.5% donor calf serum as previously described [21]. Viral titer was determined by plaque assays on BHK cell monolayers.", "For intracerebral (i.c.) infection, 30 μl virus solution, containing 1×106 pfu, was injected into the right cerebral hemisphere of 6 to 8 week-old mice (n = 10 per group) anesthetized with isoflurane. Clinical symptoms of disease were assessed weekly on the following grading scale: grade 0 = no clinical signs; grade 1 = mild waddling gait; grade 2 = severe waddling gait; grade 3 = moderate hind limb paralysis; grade 4 = severe hind limb paralysis and loss of righting reflex.", "Total cellular RNA from the brain and spinal cord of infected SJL/J mice was isolated using Trizol® Reagent (Invitrogen, CA, USA). First-strand cDNA was synthesized from 1 μg total RNA utilizing SuperScript® III First-Strand Synthesis Supermix or M-MLV (Invitrogen). The cDNAs were amplified with specific primer sets using the SYBR Green Supermix (Bio-Rad) on an iCycler (Bio-Rad). Primers for control GAPDH and cytokine genes were purchased from Integrated DNA Technologies. GAPDH: forward primer, AACTTTGGCATTGTGGAAGG and reverse primer, ACACATTGGGGGTAGGAACA; VP-1: TGACTAAGCAGGACTA-TGCCTTCC and CAACGAGCCACATATGCGGATTAC; IFN-α: (5’-ACCTCCTCT-GACCCAGGAAG-3’ and 5’-GGCTCTCCAGACTTCTGCTC-3’); IFN-β: CCCTAT-GGAGATGACGGAGA and CTGTCTGCTGGTGGAGTTCA; CXCL10: (5’-AAGT-GCTGCCGTCATTTTCT-3’ and 5’-GTGGCAATGATCTCAACACG-3’); IL-10: GCCAAGCCTTATCGGAAATGATCC and AGACACCTTGGTCTTGGAGCTT; IFN-γ: ACTGGCAAAAGGATGGTGAC and TGA GCTCATTGAATGCTTGG; IL-17A: CTCCAGAAGGCCCTCAGACTAC and AGCTTTCCCTCCGCATTGACACAG; IL-6: AGTTGCCTTCTTGGGACTGA and TCCACGATTTCCCAGAGAAC; TNF-α: GGTCACTGTCCCAGCATCTT and CTGTGAAGGGAATGGGTGTT.", "Mice were perfused with sterile Hank’s balanced salt solution (HBSS), and excised brains and spinal cords of 3 mice per group were homogenized. CNS-infiltrating MNCs were then enriched in the one third bottom fraction of a continuous Percoll (Pharmacia, Piscataway, NJ, USA) gradient after centrifugation for 30 minutes at 27,000 g as described previously [22].", "CNS-infiltrating lymphocytes were isolated, and Fc receptors were blocked using 100 μL of 2.4G2 hybridoma (ATCC) supernatant by incubating at 4°C for 30 minutes. Cells were stained with anti-CD8 (clone 53–6.7), anti-CD4 (clone GK1.5), anti-CD11b (clone M1/70), anti-NK1.1 (clone PK136), anti-GR-1 (clone RB6-8C5) and anti-CD45 (clone 30-F11) antibodies. All antibodies used for flow cytometry were purchased from BD Pharmingen (San Diego, CA). Cells were analyzed using a Becton Dickinson LSRII flow cytometer.", "Freshly isolated CNS-infiltrating MNCs from three mice per group were cultured in 96-well round-bottom plates in the presence of the relevant or control peptide as previously described [23]. Allophycocyanin-conjugated anti-CD8 (clone Ly2) or anti-CD4 (clone L3T4) antibodies and a PE-labeled rat monoclonal anti-IFN-γ (XMG1.2) antibody were used for intracellular cytokine staining. Cells were analyzed on a Becton Dickinson FACS Calibur or LSRII cytometer. Live cells were gated based on light scattering properties.", "Splenocytes from TMEV-infected mice, CD4+ T cells from spleens of OTII mice stimulated with specific epitope peptide, or in vitro TMEV-infected peritoneal macrophages in the presence of 2 μM ovalbumin (OVA)-specific peptides or 100 μg OVA protein were used. Cultures were incubated in 96-well flat-bottomed microtiter plates for 72 h and then pulsed with 1.0 μCi [3H]TdR and harvested 18 h later. [3H]TdR uptake by the cells was determined in triplicate using a scintillation counter and expressed as net counts per minute (Δcpm) ± standard error of the mean (SEM) after subtraction of the background count of cultures with PBS instead of stimulators.", "At 70 days post-infection, mice were anesthetized and perfused via intracardiac puncture with 50 mL of PBS. Brain and spinal cords from IL-1R KO and B6 control mice were dissected and fixed in 4% formalin in PBS for 24 h. Anterior cortex (bregma: 3.0 to 2.0 mm), subventricular zone (bregma: 1.7 to 0.48), hippocampus (bregma: -1.0 to −2.5 mm), and cerebellum (bregma: -5.6 to −7.0 mm) were investigated. In addition, cervical, thoracic, and lumbar regions of the spinal cord were also examined. The tissues were embedded in paraffin for sectioning and staining. Paraffin-processed brains and spinal cords were sectioned at 6 μm. Adjacent sets of three sections from each animal were deparaffinized, rehydrated, and evaluated by H & E staining for inflammatory infiltrates, Luxol Fast Blue (LFB) staining for axonal demyelination, and Bielschowsky silver staining for axon loss. Slides were examined using a Leica DMR light microscope, and images were captured using an AxioCam MRc camera and AxioVision imaging software. The inflammatory infiltrates were evaluated by the presence or absence of the monocytes/lymphocytes based on the H & E staining and immunofluorescent staining of CD45+ cells. Histologic white matter demyelination was graded as: 1) normal myelination, 2) mild or minor demyelination (> 50% myelin staining preserved), or 3) moderate to severe demyelination (< 50% myelin staining preserved).", "Cytokine levels produced by splenocytes from TMEV-infected mice or CD4+ T cells from spleens of OTII mice were determined after stimulation with specific epitope peptides (2 μM each), or in vitro TMEV-infected peritoneal macrophages in the presence of OVA-specific peptide (2 μM) for 72 h, respectively. IFN-γ (OPTEIA kit; BD Pharmingen), IL-17 (R&D Systems, Minneapolis, MN, USA) levels were assessed. Plates were read using a Spectra MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA, USA) at a 450 nm wavelength.", "Data were presented as mean ± SD of either two to three independent experiments or one representative of at least three separate experiments. The significance of differences in the mean values was determined by Student’s t-test. Clinical scores were analyzed by Mann–Whitney U-test. P values < 0.05 were considered statistically significant.", " Administration of IL-1β promotes a Th17 response to TMEV to exacerbate the pathogenicity of demyelinating disease We have previously demonstrated that administration of LPS or IL-1β causes resistant C57BL/6 mice to develop demyelinating disease [18]. It has recently been shown that LPS treatment promotes this pathogenesis by elevating the induction of the pathogenic Th17 response [17]. However, it is unknown how IL-1β promotes this pathogenesis. To understand the mechanism, we compared the levels of Th1 and Th17 in the CNS of B6 mice treated with either LPS or IL-1β, along with control mice treated with PBS, following infection with TMEV at 8 days post-infection (Figure 1). The results clearly indicated that the levels of IL-17A-producing Th17 cells in mice treated with either LPS or IL-1β were significantly elevated compared to PBS-treated control mice (Figure 1A and B). In contrast, the levels of IFN-γ-producing Th1 cells were not different. It is interesting to note that IL-1β-treated mice exceeded the Th17 level of LPS-treated mice. However, the levels of IL-17-producing CD8+ T cells were minimal (not shown), and the levels of IFN-γ-producing CD8+ T cells were also similar among the groups (Figure 1C). These results strongly suggest that IL-1β can promote the pathogenesis of TMEV-induced demyelinating disease by enhancing the induction of pathogenic Th17 cells rather than altering the Th1 response.\nEffects of IL-1β administration on Th17 and Th1 responses in TMEV-infected B6 mice. (A) Levels of IFN-γ- and IL-17-producing CD4+ T cells in B6 mice intraperitoneally treated with PBS, lipopolysaccharide (LPS), or IL-1β during the early stage (−1 and 3 days post-infection (dpi)) of Theiler’s murine encephalitis virus (TMEV) infection (three mice per group) were analyzed using flow cytometry of the pooled central nervous system (CNS) cells at 8 dpi after stimulation with either PBS or anti-CD3/CD28 antibodies. (B) The overall numbers of IL-17-producing cells in the CNS of the above treated B6 mice (three mice per group) were shown. (C) Levels of IFN-γ-producing CD8+ T cells in the CNS of these groups of mice were also similarly analyzed. ***P < 0.001.\nWe have previously demonstrated that administration of LPS or IL-1β causes resistant C57BL/6 mice to develop demyelinating disease [18]. It has recently been shown that LPS treatment promotes this pathogenesis by elevating the induction of the pathogenic Th17 response [17]. However, it is unknown how IL-1β promotes this pathogenesis. To understand the mechanism, we compared the levels of Th1 and Th17 in the CNS of B6 mice treated with either LPS or IL-1β, along with control mice treated with PBS, following infection with TMEV at 8 days post-infection (Figure 1). The results clearly indicated that the levels of IL-17A-producing Th17 cells in mice treated with either LPS or IL-1β were significantly elevated compared to PBS-treated control mice (Figure 1A and B). In contrast, the levels of IFN-γ-producing Th1 cells were not different. It is interesting to note that IL-1β-treated mice exceeded the Th17 level of LPS-treated mice. However, the levels of IL-17-producing CD8+ T cells were minimal (not shown), and the levels of IFN-γ-producing CD8+ T cells were also similar among the groups (Figure 1C). These results strongly suggest that IL-1β can promote the pathogenesis of TMEV-induced demyelinating disease by enhancing the induction of pathogenic Th17 cells rather than altering the Th1 response.\nEffects of IL-1β administration on Th17 and Th1 responses in TMEV-infected B6 mice. (A) Levels of IFN-γ- and IL-17-producing CD4+ T cells in B6 mice intraperitoneally treated with PBS, lipopolysaccharide (LPS), or IL-1β during the early stage (−1 and 3 days post-infection (dpi)) of Theiler’s murine encephalitis virus (TMEV) infection (three mice per group) were analyzed using flow cytometry of the pooled central nervous system (CNS) cells at 8 dpi after stimulation with either PBS or anti-CD3/CD28 antibodies. (B) The overall numbers of IL-17-producing cells in the CNS of the above treated B6 mice (three mice per group) were shown. (C) Levels of IFN-γ-producing CD8+ T cells in the CNS of these groups of mice were also similarly analyzed. ***P < 0.001.\n IL-1R KO mice are susceptible to TMEV-induced demyelinating disease and display high cellular infiltration to the CNS Although administration of IL-1β promotes the pathogenesis of TMEV-induced demyelinating disease, the IL-1β produced via NLRP3 proteosome activation upon viral infection is considered to be a protective mechanism against microbial infections by promoting the apoptosis of infected cells [24]. To further investigate the potential role of IL-1β-mediated signaling in the development of TMEV-induced demyelinating disease, we compared the development of TMEV-induced demyelinating disease in IL-1R KO mice with a B6 background and control B6 mice (Figure 2A). Every IL-1R KO mouse developed demyelinating disease while none of the control B6 mice showed clinical signs at 35 days post-infection (dpi). The results clearly indicated that B6 mice with the deficiency in IL-1 signaling became susceptible to the TMEV-induced disease. This is somewhat unexpected because our previous study indicated that administration of IL-1β to B6 mice renders the mice susceptible to the disease, suggesting a pathogenic role for IL-1β in disease development.\nThe course of TMEV-induced demyelinating disease development, viral persistence levels and CNS-infiltrating mononuclear cells in TMEV-infected in B6 and IL-1R KO mice. (A) Frequency and severity of demyelinating disease in B6 (n = 10) and IL-1R knockout (KO) (n = 10) mice were monitored for 70 days after Theiler’s murine encephalitis virus (TMEV) infection. (B) Viral persistence levels in the pooled brains (BR) and spinal cords (SC) of infected mice (three mice per group) at 8, 21 and 70 days post-infection (dpi) were determined by quantitative PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicate experiments. Statistically significant differences are indicated with asterisks;*P < 0.05, **P < 0.01, ***P < 0.001. (C) Levels of T cells (CD4+ and CD8+), macrophages (CD11b+CD45high), microglia (CD11b+CD45int), NK cells (NK1.1+CD45+) and granulocytes (Ly6G/6C+CD45+) were assessed using flow cytometry in central nervous system (CNS)-infiltrating mononuclear cells from TMEV-infected C57BL/6 and IL-1R KO mice at 3 and 8 dpi. Numbers in FACS plots represent percentages in the CNS. Data are representative of three experiments using three mice per group.\nTo correlate the disease susceptibility of IL-1R KO mice with viral persistence in the CNS, the relative viral message levels in the CNS of wild type (WT) B6 and IL-1R KO mice were compared at days 8, 21 and 70 post-infection with TMEV (Figure 2B). The results showed that the level of viral load in the spinal cord, but not in the brain, is consistently higher in IL-1R KO mice compared to control B6 mice. These results strongly suggest that IL-1 signaling plays an important role in controlling viral persistence in the spinal cord during the course of TMEV infection. However, it was previously shown that the viral load level alone is not sufficient for the pathogenesis of TMEV-induced demyelinating disease [25]. Thus, we further assessed the levels of cellular infiltration to the CNS of these mice during the early stages (3 and 8 dpi) of viral infection (Figure 2C). The results indicated that infiltration into the CNS of granulocytes, NK cells, macrophages and CD8+ T cells but not CD4+ T cells was elevated, particularly at the early stage of viral infection. These results collectively suggest that high viral loads and cellular infiltration into the CNS in resistant B6 mice in the absence of IL-1 signaling leads to the elevated development of TMEV-induced demyelinating disease.\nAlthough administration of IL-1β promotes the pathogenesis of TMEV-induced demyelinating disease, the IL-1β produced via NLRP3 proteosome activation upon viral infection is considered to be a protective mechanism against microbial infections by promoting the apoptosis of infected cells [24]. To further investigate the potential role of IL-1β-mediated signaling in the development of TMEV-induced demyelinating disease, we compared the development of TMEV-induced demyelinating disease in IL-1R KO mice with a B6 background and control B6 mice (Figure 2A). Every IL-1R KO mouse developed demyelinating disease while none of the control B6 mice showed clinical signs at 35 days post-infection (dpi). The results clearly indicated that B6 mice with the deficiency in IL-1 signaling became susceptible to the TMEV-induced disease. This is somewhat unexpected because our previous study indicated that administration of IL-1β to B6 mice renders the mice susceptible to the disease, suggesting a pathogenic role for IL-1β in disease development.\nThe course of TMEV-induced demyelinating disease development, viral persistence levels and CNS-infiltrating mononuclear cells in TMEV-infected in B6 and IL-1R KO mice. (A) Frequency and severity of demyelinating disease in B6 (n = 10) and IL-1R knockout (KO) (n = 10) mice were monitored for 70 days after Theiler’s murine encephalitis virus (TMEV) infection. (B) Viral persistence levels in the pooled brains (BR) and spinal cords (SC) of infected mice (three mice per group) at 8, 21 and 70 days post-infection (dpi) were determined by quantitative PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicate experiments. Statistically significant differences are indicated with asterisks;*P < 0.05, **P < 0.01, ***P < 0.001. (C) Levels of T cells (CD4+ and CD8+), macrophages (CD11b+CD45high), microglia (CD11b+CD45int), NK cells (NK1.1+CD45+) and granulocytes (Ly6G/6C+CD45+) were assessed using flow cytometry in central nervous system (CNS)-infiltrating mononuclear cells from TMEV-infected C57BL/6 and IL-1R KO mice at 3 and 8 dpi. Numbers in FACS plots represent percentages in the CNS. Data are representative of three experiments using three mice per group.\nTo correlate the disease susceptibility of IL-1R KO mice with viral persistence in the CNS, the relative viral message levels in the CNS of wild type (WT) B6 and IL-1R KO mice were compared at days 8, 21 and 70 post-infection with TMEV (Figure 2B). The results showed that the level of viral load in the spinal cord, but not in the brain, is consistently higher in IL-1R KO mice compared to control B6 mice. These results strongly suggest that IL-1 signaling plays an important role in controlling viral persistence in the spinal cord during the course of TMEV infection. However, it was previously shown that the viral load level alone is not sufficient for the pathogenesis of TMEV-induced demyelinating disease [25]. Thus, we further assessed the levels of cellular infiltration to the CNS of these mice during the early stages (3 and 8 dpi) of viral infection (Figure 2C). The results indicated that infiltration into the CNS of granulocytes, NK cells, macrophages and CD8+ T cells but not CD4+ T cells was elevated, particularly at the early stage of viral infection. These results collectively suggest that high viral loads and cellular infiltration into the CNS in resistant B6 mice in the absence of IL-1 signaling leads to the elevated development of TMEV-induced demyelinating disease.\n IL-1R KO mice show widely spread mild demyelinating lesions accompanied by patchy axon damage At 70 days post-infection, the histopathology of TMEV-infected IL-1R KO and B6 mice was compared to correlate the disease development with the histopathology of the CNS (Figure 3). Series of histopathological examinations of the spinal cords from both KO and WT mice were conducted after H & E, LFB, and Bielschowsky silver staining. The H & E staining was used for evaluating the evidence of active inflammation and lymphocyte infiltration. LFB specifically stains axonal myelin sheath, and this was used to evaluate the axonal demyelination. Bielschowsky silver staining stains axons dark brown and was used to evaluate axonal integrity. Lymphocyte infiltration, minor demyelination and axon loss were detected in the CNS, including the brain and spinal cord, in IL-1R KO mice but not in WT B6 mice. Compared to control B6 mice (Figure 3A a-b), IL-1R KO mice (Figure 3A c-d) showed more lymphocyte infiltration in the white matter of the lumbar spinal cord when examined by H & E staining. LFB staining of the adjacent sections showed irregular vacuoles and demyelination in the white matter of the spinal cord in IL-1R KO mice (Figure 3A g-h) and in brain regions including the cerebellum and medulla (not shown). In contrast, myelin that appeared normal and little histopathological change were observed in the control B6 mice (Figure 3A e-f). Bielschowsky silver staining of the adjacent sections also showed irregular vacuolation and mild axon loss in the demyelinated regions of the spinal cord from IL-1R KO mice (Figure 3A k-l) but not in the sections from the WT control mice (Figure 3A i-j). To further compare the cellular infiltration levels in the CNS of these mice, we examined the levels of CD45+ cells in the CNS which largely represents infiltrating cells (Figure 3B). Our results clearly displayed that the level of CD45+ cells (Figure 3B d), many of which overlap with H & E staining Figure 3B c), was higher in the CNS of IL-1R KO mice compared to that of the control B6 mice (Figure 3B a-b).\nHistopathology of the spinal cord in IL-1R KO and wild-type mice. (A) H & E staining of the spinal cord showed infiltration of inflammatory cells in knockout (KO) mice (c, d) and little infiltration in wild-type (WT) mice (a, b). Luxol Fast Blue (LFB) staining of adjacent sections showed irregular vacuolation and minor demyelination in the white matter of KO mice (g, h) but no loss of myelin in WT mice (e, f). Bielschowsky silver staining of the same area shows the presence of irregular vacuolation and minor axonal loss in KO mice (k, l) but not in WT mice (i, j). Magnification, ×10 and ×40. Black arrows indicate regions of lymphocyte infiltrates, demyelination, or axon loss; thin black squares indicate the areas from the lumbar spinal cord region, which are shown in high magnification (b, f, and j for B6 mice and d, h, and l for IL-1R KO mice). (B) H & E staining of spinal cords of control (a) and IL-1R KO mice (c) are shown. The adjacent sections (b and d, respectively) were stained with anti-CD45 antibody (red) for infiltrating cells and counterstained with 4',6-diamidino-2-phenylindole (DAPI) (blue) for nuclei.\nAt 70 days post-infection, the histopathology of TMEV-infected IL-1R KO and B6 mice was compared to correlate the disease development with the histopathology of the CNS (Figure 3). Series of histopathological examinations of the spinal cords from both KO and WT mice were conducted after H & E, LFB, and Bielschowsky silver staining. The H & E staining was used for evaluating the evidence of active inflammation and lymphocyte infiltration. LFB specifically stains axonal myelin sheath, and this was used to evaluate the axonal demyelination. Bielschowsky silver staining stains axons dark brown and was used to evaluate axonal integrity. Lymphocyte infiltration, minor demyelination and axon loss were detected in the CNS, including the brain and spinal cord, in IL-1R KO mice but not in WT B6 mice. Compared to control B6 mice (Figure 3A a-b), IL-1R KO mice (Figure 3A c-d) showed more lymphocyte infiltration in the white matter of the lumbar spinal cord when examined by H & E staining. LFB staining of the adjacent sections showed irregular vacuoles and demyelination in the white matter of the spinal cord in IL-1R KO mice (Figure 3A g-h) and in brain regions including the cerebellum and medulla (not shown). In contrast, myelin that appeared normal and little histopathological change were observed in the control B6 mice (Figure 3A e-f). Bielschowsky silver staining of the adjacent sections also showed irregular vacuolation and mild axon loss in the demyelinated regions of the spinal cord from IL-1R KO mice (Figure 3A k-l) but not in the sections from the WT control mice (Figure 3A i-j). To further compare the cellular infiltration levels in the CNS of these mice, we examined the levels of CD45+ cells in the CNS which largely represents infiltrating cells (Figure 3B). Our results clearly displayed that the level of CD45+ cells (Figure 3B d), many of which overlap with H & E staining Figure 3B c), was higher in the CNS of IL-1R KO mice compared to that of the control B6 mice (Figure 3B a-b).\nHistopathology of the spinal cord in IL-1R KO and wild-type mice. (A) H & E staining of the spinal cord showed infiltration of inflammatory cells in knockout (KO) mice (c, d) and little infiltration in wild-type (WT) mice (a, b). Luxol Fast Blue (LFB) staining of adjacent sections showed irregular vacuolation and minor demyelination in the white matter of KO mice (g, h) but no loss of myelin in WT mice (e, f). Bielschowsky silver staining of the same area shows the presence of irregular vacuolation and minor axonal loss in KO mice (k, l) but not in WT mice (i, j). Magnification, ×10 and ×40. Black arrows indicate regions of lymphocyte infiltrates, demyelination, or axon loss; thin black squares indicate the areas from the lumbar spinal cord region, which are shown in high magnification (b, f, and j for B6 mice and d, h, and l for IL-1R KO mice). (B) H & E staining of spinal cords of control (a) and IL-1R KO mice (c) are shown. The adjacent sections (b and d, respectively) were stained with anti-CD45 antibody (red) for infiltrating cells and counterstained with 4',6-diamidino-2-phenylindole (DAPI) (blue) for nuclei.\n Cytokine gene expression is transentily higher in the CNS of IL-1R KO mice during early viral infection To understand the susceptibility to TMEV-induced demyelinating disease in IL-1R KO mice, we analyzed various cytokine message levels expressed in the CNS of virus-infected control and IL-1R KO mice during the early stages (3, 5, and 8 dpi) of viral infection using real-time PCR (Figure 4). The levels of IFN-α and IFN-β gene expression in IL-1R KO mice were significantly higher than those in B6 mice at 3 dpi, although the levels became similar at 5 and 8 dpi. The expression levels of CXCL-10 that were associated with T cell infiltration and IL-10 that was associated with viral persistence were higher at 5 dpi, and this trend was maintained at 8 dpi. However, the expression level of IL-6 in IL-1R KO mice was transiently lower at 5 dpi, while no differences in TNF-α expression were noted. Similarly, the production of a pathogenic T cell cytokine, IL-17 was largely unchanged. However, viral RNA and the production of IFN-γ were transiently higher at 3 and 8 dpi. These results suggest that the lack of IL-1 signaling differentially affects viral replication and the expression of various innate and immune cytokines depending on the stage of TMEV infection.\nExpression level of cytokine genes in the CNS of TMEV infected B6 and IL-1R knockout (KO) mice at 3, 5 and 8 days post-infection (dpi). The relative expression levels of the indicated mRNAs in the central nervous system (CNS) of Theiler’s murine encephalitis virus (TMEV)-infected C57BL/6 and IL-1R KO mice at 3, 5 and 8 dpi were assessed by real-time PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001).\nTo understand the susceptibility to TMEV-induced demyelinating disease in IL-1R KO mice, we analyzed various cytokine message levels expressed in the CNS of virus-infected control and IL-1R KO mice during the early stages (3, 5, and 8 dpi) of viral infection using real-time PCR (Figure 4). The levels of IFN-α and IFN-β gene expression in IL-1R KO mice were significantly higher than those in B6 mice at 3 dpi, although the levels became similar at 5 and 8 dpi. The expression levels of CXCL-10 that were associated with T cell infiltration and IL-10 that was associated with viral persistence were higher at 5 dpi, and this trend was maintained at 8 dpi. However, the expression level of IL-6 in IL-1R KO mice was transiently lower at 5 dpi, while no differences in TNF-α expression were noted. Similarly, the production of a pathogenic T cell cytokine, IL-17 was largely unchanged. However, viral RNA and the production of IFN-γ were transiently higher at 3 and 8 dpi. These results suggest that the lack of IL-1 signaling differentially affects viral replication and the expression of various innate and immune cytokines depending on the stage of TMEV infection.\nExpression level of cytokine genes in the CNS of TMEV infected B6 and IL-1R knockout (KO) mice at 3, 5 and 8 days post-infection (dpi). The relative expression levels of the indicated mRNAs in the central nervous system (CNS) of Theiler’s murine encephalitis virus (TMEV)-infected C57BL/6 and IL-1R KO mice at 3, 5 and 8 dpi were assessed by real-time PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001).\n Anti-viral CD4+ T cell responses in the CNS, of virus-infected IL-1R KO mice are lower during the early stage of infection To compare CD4+ T cell responses specific to viral determinants in the CNS of IL-1R KO and WT mice, infiltration levels of CD4+ T cells specific to the predominant CD4+ T cell epitopes were assessed (Figure 5A and B). The levels of IFN-γ-producing CD4+ T cells in response to pan-T cell stimulation (either PMA plus ionomycin or anti-CD3 and anti-CD28 antibodies) were similar between IL-1R KO and control WT B6 mice. However, such CD4+ T cell responses to viral epitopes were proportionally lower in the CNS of virus-infected IL-1R KO mice compared to B6 mice, although the overall levels in the CNS were similar. This discrepancy may be due to the high levels of CXCL-10 expression (Figure 4), which promotes infiltration of T cells, in the CNS of IL-1R KO mice. The levels of IL-17-producing CD4+ T cells in either TMEV-infected IL-1R KO or B6 mice were undetectable. To further determine whether the pattern of CD4+ T cell responses is unique in the CNS of virus-infected mice, we also assessed the T cell responses in the periphery of TMEV-infected IL-1R KO and control B6 mice at 8 and 21 dpi (Figure 5C). Again, the levels of T cell proliferation and the production of key T cell cytokines (IFN-γ and IL-17) against viral epitopes (for both CD4+ and CD8+ T cells) were not drasticaly different between the splenic T cells from IL-1R KO and control B6 mice. Despite the similar low levels of IL-17 production in response to viral epitopes, the IL-17 level was significantly lower in IL-1R KO mice compared to WT B6 mice after robust stimulation with anti-CD3/CD28 antibodies. These results are consistent with the role of IL-1 signaling in promoting IL-17 production [26,27].\nVirus-specific CD4+T cell responses in the CNS and the periphery of TMEV-infected B6 and IL-1R knockout (KO) mice. (A) Levels of Th1 and Th17 cells in the central nervous system (CNS) of virus-infected B6 and IL-1R KO mice were assessed using flow cytometry at 8 days post-infection (dpi) after stimulation with PBS, PMA/ionomycin, anti-CD3/CD28 antibodies, or viral epitope peptides (Pep: mixture of 2 μM VP2203-220 and 2 μM VP425-38). The flow cytometric plots show gated CD4+ T cells. (B) The numbers of CNS-infiltrating IFN-γ-producing CD4+ T cells reactive to either viral epitope peptides (CD4: equal mixture of VP2203-220 and VP425-38) or anti-CD3/CD28 antibodies in virus-infected B6 and IL-1R KO mice (three mice each) at 8 and 21 dpi. A representative result from two to three similar experiments is shown here. (C) Levels of proliferation and cytokine production by splenic T cells in response to viral epitopes by CD4+ T cells (CD4 Mix: equal mixture of VP2203-220 and VP425-38), CD8+ T cells (VP2-121–130), or both CD4+ and CD8+ T cells (anti-CD3/CD28 antibodies) were assessed at 8 and 21 dpi. Values are expressed as the mean of triplicate samples (mean ± SD) from a representative of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001.\nTo compare CD4+ T cell responses specific to viral determinants in the CNS of IL-1R KO and WT mice, infiltration levels of CD4+ T cells specific to the predominant CD4+ T cell epitopes were assessed (Figure 5A and B). The levels of IFN-γ-producing CD4+ T cells in response to pan-T cell stimulation (either PMA plus ionomycin or anti-CD3 and anti-CD28 antibodies) were similar between IL-1R KO and control WT B6 mice. However, such CD4+ T cell responses to viral epitopes were proportionally lower in the CNS of virus-infected IL-1R KO mice compared to B6 mice, although the overall levels in the CNS were similar. This discrepancy may be due to the high levels of CXCL-10 expression (Figure 4), which promotes infiltration of T cells, in the CNS of IL-1R KO mice. The levels of IL-17-producing CD4+ T cells in either TMEV-infected IL-1R KO or B6 mice were undetectable. To further determine whether the pattern of CD4+ T cell responses is unique in the CNS of virus-infected mice, we also assessed the T cell responses in the periphery of TMEV-infected IL-1R KO and control B6 mice at 8 and 21 dpi (Figure 5C). Again, the levels of T cell proliferation and the production of key T cell cytokines (IFN-γ and IL-17) against viral epitopes (for both CD4+ and CD8+ T cells) were not drasticaly different between the splenic T cells from IL-1R KO and control B6 mice. Despite the similar low levels of IL-17 production in response to viral epitopes, the IL-17 level was significantly lower in IL-1R KO mice compared to WT B6 mice after robust stimulation with anti-CD3/CD28 antibodies. These results are consistent with the role of IL-1 signaling in promoting IL-17 production [26,27].\nVirus-specific CD4+T cell responses in the CNS and the periphery of TMEV-infected B6 and IL-1R knockout (KO) mice. (A) Levels of Th1 and Th17 cells in the central nervous system (CNS) of virus-infected B6 and IL-1R KO mice were assessed using flow cytometry at 8 days post-infection (dpi) after stimulation with PBS, PMA/ionomycin, anti-CD3/CD28 antibodies, or viral epitope peptides (Pep: mixture of 2 μM VP2203-220 and 2 μM VP425-38). The flow cytometric plots show gated CD4+ T cells. (B) The numbers of CNS-infiltrating IFN-γ-producing CD4+ T cells reactive to either viral epitope peptides (CD4: equal mixture of VP2203-220 and VP425-38) or anti-CD3/CD28 antibodies in virus-infected B6 and IL-1R KO mice (three mice each) at 8 and 21 dpi. A representative result from two to three similar experiments is shown here. (C) Levels of proliferation and cytokine production by splenic T cells in response to viral epitopes by CD4+ T cells (CD4 Mix: equal mixture of VP2203-220 and VP425-38), CD8+ T cells (VP2-121–130), or both CD4+ and CD8+ T cells (anti-CD3/CD28 antibodies) were assessed at 8 and 21 dpi. Values are expressed as the mean of triplicate samples (mean ± SD) from a representative of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001.\n Levels of TMEV-specific CD8+ T cell responses in the CNS are comparable between IL-1R KO and WT B6 mice To further determine whether the susceptibility of IL-1R KO mice to TMEV-induced demyelinating disease is associated with a compromised anti-viral CD8+ T cell response, we also analyzed the T cell responses in the CNS of TMEV-infected IL-1R KO and control B6 mice (Figure 6). Virus-specific CD8+ T cells reactive to the predominant epitope (VP2121-130), determined using the VP2121-H-2Db tetramer, indicated that the proportions of virus-specific CD8+ T cells in the CNS of virus-infected WT B6 and IL-1R KO mice are similar (Figure 6A). To further determine whether the functions of the virus-reactive CD8+ T cells are different, we assessed the abilities of the cells to produce IFN-γ in response to specific and non-specific stimulations (Figure 6B). The results clearly indicated that their ability to produce IFN-γ is also similar in both proportion (Figure 6B) and number in the CNS of TMEV-infected B6 and IL-1R KO mice (Figure 6C). These results strongly suggest that there are no significant differences in the CD8+ T cell responses to the viral determinants, unlike those of CD4+ T cell responses, in the CNS of virus-infected WT B6 and IL-1R KO mice.\nLevels of virus-specific CD8+T cell responses in the CNS of virus-infected B6 and IL-1R KO mice. (A) Levels of H-2Db-VP2-121–130-tetramer reactive CD8+ T cells in the central nervous system (CNS) of B6 and IL-1R knockout (KO) mice at 8 days post-infection (dpi). (B) Proportions of CNS-infiltrating CD8+ T cells reactive to viral epitopes, anti-CD3/CD28 antibodies and PMA/ionomycin were assessed using flow cytometry following intracellular cytokine staining at 8 dpi. (C) The overall numbers of virus-specific and anti-CD3/CD28 reactive CD8+ T cells in the CNS of virus-infected B6 and IL-1R KO mice are shown at 8 and 21 dpi. A representative result from two to three similar experiments is shown here.\nTo further determine whether the susceptibility of IL-1R KO mice to TMEV-induced demyelinating disease is associated with a compromised anti-viral CD8+ T cell response, we also analyzed the T cell responses in the CNS of TMEV-infected IL-1R KO and control B6 mice (Figure 6). Virus-specific CD8+ T cells reactive to the predominant epitope (VP2121-130), determined using the VP2121-H-2Db tetramer, indicated that the proportions of virus-specific CD8+ T cells in the CNS of virus-infected WT B6 and IL-1R KO mice are similar (Figure 6A). To further determine whether the functions of the virus-reactive CD8+ T cells are different, we assessed the abilities of the cells to produce IFN-γ in response to specific and non-specific stimulations (Figure 6B). The results clearly indicated that their ability to produce IFN-γ is also similar in both proportion (Figure 6B) and number in the CNS of TMEV-infected B6 and IL-1R KO mice (Figure 6C). These results strongly suggest that there are no significant differences in the CD8+ T cell responses to the viral determinants, unlike those of CD4+ T cell responses, in the CNS of virus-infected WT B6 and IL-1R KO mice.\nLevels of virus-specific CD8+T cell responses in the CNS of virus-infected B6 and IL-1R KO mice. (A) Levels of H-2Db-VP2-121–130-tetramer reactive CD8+ T cells in the central nervous system (CNS) of B6 and IL-1R knockout (KO) mice at 8 days post-infection (dpi). (B) Proportions of CNS-infiltrating CD8+ T cells reactive to viral epitopes, anti-CD3/CD28 antibodies and PMA/ionomycin were assessed using flow cytometry following intracellular cytokine staining at 8 dpi. (C) The overall numbers of virus-specific and anti-CD3/CD28 reactive CD8+ T cells in the CNS of virus-infected B6 and IL-1R KO mice are shown at 8 and 21 dpi. A representative result from two to three similar experiments is shown here.\n Cytokine production by Th cells stimulated with macrophages from IL-1R KO mice is reduced To compare the function of CD4+ T cells stimulated by macrophages from B6 and IL-1R KO mice, T cells from naïve OT-II mice, which carry T cell receptor (TCR) transgenes specific for OVA323-339, were stimulated with peritoneal macrophages infected in vitro for 24 h with TMEV (10 MOI) in the presence of OVA323-339 peptide (Figure 7A) or OVA protein (not shown). Viral infection did not significantly alter the levels of T cell stimulation by these macrophages. However, proliferation of CD4+ T cells in response to the cognate peptide or protein was higher when stimulated with IL-1R KO macrophages compared to the proliferation stimulated with B6 macrophages. In contrast, IFN-γ and IL-17 production by the T cells stimulated with IL-1R KO macrophages were significantly lower than the production stimulated with control B6 macrophages. These results indicated that antigen-presenting cells display altered T cell stimulating function in the absence of IL-1R-mediated signaling.\nCytokine reduction of CD4+T cells with stimulation of IL-1R KO macrophages. (A) Isolated CD4+ T cells (1 × 105) from the spleen of OT-II mice were cultured with in vitro 10 MOI Theiler’s murine encephalitis virus (TMEV)-infected peritoneal macrophages (1 × 104) from either C57BL/6 or IL-1R knockout (KO) mice for 3 days in the presence of 2 μM OVA epitope peptides. T cell proliferative responses were analyzed using [3H]TdR uptake, and cytokine production (IFN-γ and IL-17) of the cultures were analyzed using specific ELISAs. (B) Isolated CD4+ T cells (1 × 105) from the spleen of B6 mice infected with TMEV at 8 days post-infection (dpi) were cultured with in vitro TMEV-infected (10 MOI for 24 h) peritoneal macrophages (1 × 104) from either naïve C57BL/6 or IL-1R KO mice for 3 days in the presence of viral epitope peptides. Message levels of the indicated genes were then analyzed by real-time PCR. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level was used as an internal control. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001. Data shown are the representation of three independent experiments. (C) Peritoneal CD11b+ cells from naïve B6 and IL-1R KO mice infected with TMEV in vitro for 24 h were analyzed for the expression of PDL-1 and TIM-3 T cell inhibitory molecules. A representative flow cytometry plot of three similar results is shown here.\nTo further understand the potential mechanisms underlying the altered T cell stimulation by IL-1R KO macrophages, we examined the potential contribution of IL-1 signaling to the induction of cytokines in TMEV-infected macrophages (Figure 7B). After TMEV infection in vitro for 24 h, levels of viral RNA as well as IFN-α and IFN-β messages were similar between macrophages from WT B6 and IL-1R KO mice. However, the expression of the IL-6 message was extremely compromised in IL-1R KO macrophages compared to B6 macrophages. In contrast, the expression level of TNF-α message was more highly upregulated in IL-1R KO macrophages after TMEV infection. Interestingly however, the expression of TGF-β in uninfected IL-1R KO macrophages was higher than the expression in B6 macrophages but reduced to a similar level after viral infection. These results suggest that the cytokine production profile of macrophages and perhaps other antigen-presenting cells is altered in the absence of IL-1 signaling, which may affect the initial development and/or function of T cells following viral infection.\nTo further understand the underlying mechanisms associated with altered CD4+ T cell development in the absence of IL-1 signaling, the levels of co-stimulatory molecules and key inhibitory molecules were studied in a representative macrophage antigen-presenting cell (APC) population (Figure 7C). The levels of CD80, CD86 and CD40 in B6 and IL-1R1 KO mice were not significantly different (not shown). However, PDL-1 and Tim-3 were significantly elevated in the absence of IL-1 signaling. These molecules are known to negatively affect the function of T cells [28] and/or promote inflammatory responses through its expression by innate immune cells, such as microglia [29]. It was interesting to note that the expression of PDL-1 was upregulated upon viral infection in B6 macrophages, whereas the expression in IL-1R-deficient macrophages was constitutively upregulated even in the absence of viral infection. In contrast, the expression of Tim-3 was constitutively upregulated in IL-1R-deficient macrophages to the level (approximately 5%) of upregulation seen after viral infection in B6 macrophages, but it was further upregulated in IL-1R KO macrophages after TMEV infection. These results strongly suggest that these increases in the inhibitory molecules may participate in the altered T cell development and/or function.\nTo compare the function of CD4+ T cells stimulated by macrophages from B6 and IL-1R KO mice, T cells from naïve OT-II mice, which carry T cell receptor (TCR) transgenes specific for OVA323-339, were stimulated with peritoneal macrophages infected in vitro for 24 h with TMEV (10 MOI) in the presence of OVA323-339 peptide (Figure 7A) or OVA protein (not shown). Viral infection did not significantly alter the levels of T cell stimulation by these macrophages. However, proliferation of CD4+ T cells in response to the cognate peptide or protein was higher when stimulated with IL-1R KO macrophages compared to the proliferation stimulated with B6 macrophages. In contrast, IFN-γ and IL-17 production by the T cells stimulated with IL-1R KO macrophages were significantly lower than the production stimulated with control B6 macrophages. These results indicated that antigen-presenting cells display altered T cell stimulating function in the absence of IL-1R-mediated signaling.\nCytokine reduction of CD4+T cells with stimulation of IL-1R KO macrophages. (A) Isolated CD4+ T cells (1 × 105) from the spleen of OT-II mice were cultured with in vitro 10 MOI Theiler’s murine encephalitis virus (TMEV)-infected peritoneal macrophages (1 × 104) from either C57BL/6 or IL-1R knockout (KO) mice for 3 days in the presence of 2 μM OVA epitope peptides. T cell proliferative responses were analyzed using [3H]TdR uptake, and cytokine production (IFN-γ and IL-17) of the cultures were analyzed using specific ELISAs. (B) Isolated CD4+ T cells (1 × 105) from the spleen of B6 mice infected with TMEV at 8 days post-infection (dpi) were cultured with in vitro TMEV-infected (10 MOI for 24 h) peritoneal macrophages (1 × 104) from either naïve C57BL/6 or IL-1R KO mice for 3 days in the presence of viral epitope peptides. Message levels of the indicated genes were then analyzed by real-time PCR. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level was used as an internal control. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001. Data shown are the representation of three independent experiments. (C) Peritoneal CD11b+ cells from naïve B6 and IL-1R KO mice infected with TMEV in vitro for 24 h were analyzed for the expression of PDL-1 and TIM-3 T cell inhibitory molecules. A representative flow cytometry plot of three similar results is shown here.\nTo further understand the potential mechanisms underlying the altered T cell stimulation by IL-1R KO macrophages, we examined the potential contribution of IL-1 signaling to the induction of cytokines in TMEV-infected macrophages (Figure 7B). After TMEV infection in vitro for 24 h, levels of viral RNA as well as IFN-α and IFN-β messages were similar between macrophages from WT B6 and IL-1R KO mice. However, the expression of the IL-6 message was extremely compromised in IL-1R KO macrophages compared to B6 macrophages. In contrast, the expression level of TNF-α message was more highly upregulated in IL-1R KO macrophages after TMEV infection. Interestingly however, the expression of TGF-β in uninfected IL-1R KO macrophages was higher than the expression in B6 macrophages but reduced to a similar level after viral infection. These results suggest that the cytokine production profile of macrophages and perhaps other antigen-presenting cells is altered in the absence of IL-1 signaling, which may affect the initial development and/or function of T cells following viral infection.\nTo further understand the underlying mechanisms associated with altered CD4+ T cell development in the absence of IL-1 signaling, the levels of co-stimulatory molecules and key inhibitory molecules were studied in a representative macrophage antigen-presenting cell (APC) population (Figure 7C). The levels of CD80, CD86 and CD40 in B6 and IL-1R1 KO mice were not significantly different (not shown). However, PDL-1 and Tim-3 were significantly elevated in the absence of IL-1 signaling. These molecules are known to negatively affect the function of T cells [28] and/or promote inflammatory responses through its expression by innate immune cells, such as microglia [29]. It was interesting to note that the expression of PDL-1 was upregulated upon viral infection in B6 macrophages, whereas the expression in IL-1R-deficient macrophages was constitutively upregulated even in the absence of viral infection. In contrast, the expression of Tim-3 was constitutively upregulated in IL-1R-deficient macrophages to the level (approximately 5%) of upregulation seen after viral infection in B6 macrophages, but it was further upregulated in IL-1R KO macrophages after TMEV infection. These results strongly suggest that these increases in the inhibitory molecules may participate in the altered T cell development and/or function.", "We have previously demonstrated that administration of LPS or IL-1β causes resistant C57BL/6 mice to develop demyelinating disease [18]. It has recently been shown that LPS treatment promotes this pathogenesis by elevating the induction of the pathogenic Th17 response [17]. However, it is unknown how IL-1β promotes this pathogenesis. To understand the mechanism, we compared the levels of Th1 and Th17 in the CNS of B6 mice treated with either LPS or IL-1β, along with control mice treated with PBS, following infection with TMEV at 8 days post-infection (Figure 1). The results clearly indicated that the levels of IL-17A-producing Th17 cells in mice treated with either LPS or IL-1β were significantly elevated compared to PBS-treated control mice (Figure 1A and B). In contrast, the levels of IFN-γ-producing Th1 cells were not different. It is interesting to note that IL-1β-treated mice exceeded the Th17 level of LPS-treated mice. However, the levels of IL-17-producing CD8+ T cells were minimal (not shown), and the levels of IFN-γ-producing CD8+ T cells were also similar among the groups (Figure 1C). These results strongly suggest that IL-1β can promote the pathogenesis of TMEV-induced demyelinating disease by enhancing the induction of pathogenic Th17 cells rather than altering the Th1 response.\nEffects of IL-1β administration on Th17 and Th1 responses in TMEV-infected B6 mice. (A) Levels of IFN-γ- and IL-17-producing CD4+ T cells in B6 mice intraperitoneally treated with PBS, lipopolysaccharide (LPS), or IL-1β during the early stage (−1 and 3 days post-infection (dpi)) of Theiler’s murine encephalitis virus (TMEV) infection (three mice per group) were analyzed using flow cytometry of the pooled central nervous system (CNS) cells at 8 dpi after stimulation with either PBS or anti-CD3/CD28 antibodies. (B) The overall numbers of IL-17-producing cells in the CNS of the above treated B6 mice (three mice per group) were shown. (C) Levels of IFN-γ-producing CD8+ T cells in the CNS of these groups of mice were also similarly analyzed. ***P < 0.001.", "Although administration of IL-1β promotes the pathogenesis of TMEV-induced demyelinating disease, the IL-1β produced via NLRP3 proteosome activation upon viral infection is considered to be a protective mechanism against microbial infections by promoting the apoptosis of infected cells [24]. To further investigate the potential role of IL-1β-mediated signaling in the development of TMEV-induced demyelinating disease, we compared the development of TMEV-induced demyelinating disease in IL-1R KO mice with a B6 background and control B6 mice (Figure 2A). Every IL-1R KO mouse developed demyelinating disease while none of the control B6 mice showed clinical signs at 35 days post-infection (dpi). The results clearly indicated that B6 mice with the deficiency in IL-1 signaling became susceptible to the TMEV-induced disease. This is somewhat unexpected because our previous study indicated that administration of IL-1β to B6 mice renders the mice susceptible to the disease, suggesting a pathogenic role for IL-1β in disease development.\nThe course of TMEV-induced demyelinating disease development, viral persistence levels and CNS-infiltrating mononuclear cells in TMEV-infected in B6 and IL-1R KO mice. (A) Frequency and severity of demyelinating disease in B6 (n = 10) and IL-1R knockout (KO) (n = 10) mice were monitored for 70 days after Theiler’s murine encephalitis virus (TMEV) infection. (B) Viral persistence levels in the pooled brains (BR) and spinal cords (SC) of infected mice (three mice per group) at 8, 21 and 70 days post-infection (dpi) were determined by quantitative PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicate experiments. Statistically significant differences are indicated with asterisks;*P < 0.05, **P < 0.01, ***P < 0.001. (C) Levels of T cells (CD4+ and CD8+), macrophages (CD11b+CD45high), microglia (CD11b+CD45int), NK cells (NK1.1+CD45+) and granulocytes (Ly6G/6C+CD45+) were assessed using flow cytometry in central nervous system (CNS)-infiltrating mononuclear cells from TMEV-infected C57BL/6 and IL-1R KO mice at 3 and 8 dpi. Numbers in FACS plots represent percentages in the CNS. Data are representative of three experiments using three mice per group.\nTo correlate the disease susceptibility of IL-1R KO mice with viral persistence in the CNS, the relative viral message levels in the CNS of wild type (WT) B6 and IL-1R KO mice were compared at days 8, 21 and 70 post-infection with TMEV (Figure 2B). The results showed that the level of viral load in the spinal cord, but not in the brain, is consistently higher in IL-1R KO mice compared to control B6 mice. These results strongly suggest that IL-1 signaling plays an important role in controlling viral persistence in the spinal cord during the course of TMEV infection. However, it was previously shown that the viral load level alone is not sufficient for the pathogenesis of TMEV-induced demyelinating disease [25]. Thus, we further assessed the levels of cellular infiltration to the CNS of these mice during the early stages (3 and 8 dpi) of viral infection (Figure 2C). The results indicated that infiltration into the CNS of granulocytes, NK cells, macrophages and CD8+ T cells but not CD4+ T cells was elevated, particularly at the early stage of viral infection. These results collectively suggest that high viral loads and cellular infiltration into the CNS in resistant B6 mice in the absence of IL-1 signaling leads to the elevated development of TMEV-induced demyelinating disease.", "At 70 days post-infection, the histopathology of TMEV-infected IL-1R KO and B6 mice was compared to correlate the disease development with the histopathology of the CNS (Figure 3). Series of histopathological examinations of the spinal cords from both KO and WT mice were conducted after H & E, LFB, and Bielschowsky silver staining. The H & E staining was used for evaluating the evidence of active inflammation and lymphocyte infiltration. LFB specifically stains axonal myelin sheath, and this was used to evaluate the axonal demyelination. Bielschowsky silver staining stains axons dark brown and was used to evaluate axonal integrity. Lymphocyte infiltration, minor demyelination and axon loss were detected in the CNS, including the brain and spinal cord, in IL-1R KO mice but not in WT B6 mice. Compared to control B6 mice (Figure 3A a-b), IL-1R KO mice (Figure 3A c-d) showed more lymphocyte infiltration in the white matter of the lumbar spinal cord when examined by H & E staining. LFB staining of the adjacent sections showed irregular vacuoles and demyelination in the white matter of the spinal cord in IL-1R KO mice (Figure 3A g-h) and in brain regions including the cerebellum and medulla (not shown). In contrast, myelin that appeared normal and little histopathological change were observed in the control B6 mice (Figure 3A e-f). Bielschowsky silver staining of the adjacent sections also showed irregular vacuolation and mild axon loss in the demyelinated regions of the spinal cord from IL-1R KO mice (Figure 3A k-l) but not in the sections from the WT control mice (Figure 3A i-j). To further compare the cellular infiltration levels in the CNS of these mice, we examined the levels of CD45+ cells in the CNS which largely represents infiltrating cells (Figure 3B). Our results clearly displayed that the level of CD45+ cells (Figure 3B d), many of which overlap with H & E staining Figure 3B c), was higher in the CNS of IL-1R KO mice compared to that of the control B6 mice (Figure 3B a-b).\nHistopathology of the spinal cord in IL-1R KO and wild-type mice. (A) H & E staining of the spinal cord showed infiltration of inflammatory cells in knockout (KO) mice (c, d) and little infiltration in wild-type (WT) mice (a, b). Luxol Fast Blue (LFB) staining of adjacent sections showed irregular vacuolation and minor demyelination in the white matter of KO mice (g, h) but no loss of myelin in WT mice (e, f). Bielschowsky silver staining of the same area shows the presence of irregular vacuolation and minor axonal loss in KO mice (k, l) but not in WT mice (i, j). Magnification, ×10 and ×40. Black arrows indicate regions of lymphocyte infiltrates, demyelination, or axon loss; thin black squares indicate the areas from the lumbar spinal cord region, which are shown in high magnification (b, f, and j for B6 mice and d, h, and l for IL-1R KO mice). (B) H & E staining of spinal cords of control (a) and IL-1R KO mice (c) are shown. The adjacent sections (b and d, respectively) were stained with anti-CD45 antibody (red) for infiltrating cells and counterstained with 4',6-diamidino-2-phenylindole (DAPI) (blue) for nuclei.", "To understand the susceptibility to TMEV-induced demyelinating disease in IL-1R KO mice, we analyzed various cytokine message levels expressed in the CNS of virus-infected control and IL-1R KO mice during the early stages (3, 5, and 8 dpi) of viral infection using real-time PCR (Figure 4). The levels of IFN-α and IFN-β gene expression in IL-1R KO mice were significantly higher than those in B6 mice at 3 dpi, although the levels became similar at 5 and 8 dpi. The expression levels of CXCL-10 that were associated with T cell infiltration and IL-10 that was associated with viral persistence were higher at 5 dpi, and this trend was maintained at 8 dpi. However, the expression level of IL-6 in IL-1R KO mice was transiently lower at 5 dpi, while no differences in TNF-α expression were noted. Similarly, the production of a pathogenic T cell cytokine, IL-17 was largely unchanged. However, viral RNA and the production of IFN-γ were transiently higher at 3 and 8 dpi. These results suggest that the lack of IL-1 signaling differentially affects viral replication and the expression of various innate and immune cytokines depending on the stage of TMEV infection.\nExpression level of cytokine genes in the CNS of TMEV infected B6 and IL-1R knockout (KO) mice at 3, 5 and 8 days post-infection (dpi). The relative expression levels of the indicated mRNAs in the central nervous system (CNS) of Theiler’s murine encephalitis virus (TMEV)-infected C57BL/6 and IL-1R KO mice at 3, 5 and 8 dpi were assessed by real-time PCR. Data are expressed by fold induction after normalization to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001).", "To compare CD4+ T cell responses specific to viral determinants in the CNS of IL-1R KO and WT mice, infiltration levels of CD4+ T cells specific to the predominant CD4+ T cell epitopes were assessed (Figure 5A and B). The levels of IFN-γ-producing CD4+ T cells in response to pan-T cell stimulation (either PMA plus ionomycin or anti-CD3 and anti-CD28 antibodies) were similar between IL-1R KO and control WT B6 mice. However, such CD4+ T cell responses to viral epitopes were proportionally lower in the CNS of virus-infected IL-1R KO mice compared to B6 mice, although the overall levels in the CNS were similar. This discrepancy may be due to the high levels of CXCL-10 expression (Figure 4), which promotes infiltration of T cells, in the CNS of IL-1R KO mice. The levels of IL-17-producing CD4+ T cells in either TMEV-infected IL-1R KO or B6 mice were undetectable. To further determine whether the pattern of CD4+ T cell responses is unique in the CNS of virus-infected mice, we also assessed the T cell responses in the periphery of TMEV-infected IL-1R KO and control B6 mice at 8 and 21 dpi (Figure 5C). Again, the levels of T cell proliferation and the production of key T cell cytokines (IFN-γ and IL-17) against viral epitopes (for both CD4+ and CD8+ T cells) were not drasticaly different between the splenic T cells from IL-1R KO and control B6 mice. Despite the similar low levels of IL-17 production in response to viral epitopes, the IL-17 level was significantly lower in IL-1R KO mice compared to WT B6 mice after robust stimulation with anti-CD3/CD28 antibodies. These results are consistent with the role of IL-1 signaling in promoting IL-17 production [26,27].\nVirus-specific CD4+T cell responses in the CNS and the periphery of TMEV-infected B6 and IL-1R knockout (KO) mice. (A) Levels of Th1 and Th17 cells in the central nervous system (CNS) of virus-infected B6 and IL-1R KO mice were assessed using flow cytometry at 8 days post-infection (dpi) after stimulation with PBS, PMA/ionomycin, anti-CD3/CD28 antibodies, or viral epitope peptides (Pep: mixture of 2 μM VP2203-220 and 2 μM VP425-38). The flow cytometric plots show gated CD4+ T cells. (B) The numbers of CNS-infiltrating IFN-γ-producing CD4+ T cells reactive to either viral epitope peptides (CD4: equal mixture of VP2203-220 and VP425-38) or anti-CD3/CD28 antibodies in virus-infected B6 and IL-1R KO mice (three mice each) at 8 and 21 dpi. A representative result from two to three similar experiments is shown here. (C) Levels of proliferation and cytokine production by splenic T cells in response to viral epitopes by CD4+ T cells (CD4 Mix: equal mixture of VP2203-220 and VP425-38), CD8+ T cells (VP2-121–130), or both CD4+ and CD8+ T cells (anti-CD3/CD28 antibodies) were assessed at 8 and 21 dpi. Values are expressed as the mean of triplicate samples (mean ± SD) from a representative of three experiments. *P < 0.05, **P < 0.01, ***P < 0.001.", "To further determine whether the susceptibility of IL-1R KO mice to TMEV-induced demyelinating disease is associated with a compromised anti-viral CD8+ T cell response, we also analyzed the T cell responses in the CNS of TMEV-infected IL-1R KO and control B6 mice (Figure 6). Virus-specific CD8+ T cells reactive to the predominant epitope (VP2121-130), determined using the VP2121-H-2Db tetramer, indicated that the proportions of virus-specific CD8+ T cells in the CNS of virus-infected WT B6 and IL-1R KO mice are similar (Figure 6A). To further determine whether the functions of the virus-reactive CD8+ T cells are different, we assessed the abilities of the cells to produce IFN-γ in response to specific and non-specific stimulations (Figure 6B). The results clearly indicated that their ability to produce IFN-γ is also similar in both proportion (Figure 6B) and number in the CNS of TMEV-infected B6 and IL-1R KO mice (Figure 6C). These results strongly suggest that there are no significant differences in the CD8+ T cell responses to the viral determinants, unlike those of CD4+ T cell responses, in the CNS of virus-infected WT B6 and IL-1R KO mice.\nLevels of virus-specific CD8+T cell responses in the CNS of virus-infected B6 and IL-1R KO mice. (A) Levels of H-2Db-VP2-121–130-tetramer reactive CD8+ T cells in the central nervous system (CNS) of B6 and IL-1R knockout (KO) mice at 8 days post-infection (dpi). (B) Proportions of CNS-infiltrating CD8+ T cells reactive to viral epitopes, anti-CD3/CD28 antibodies and PMA/ionomycin were assessed using flow cytometry following intracellular cytokine staining at 8 dpi. (C) The overall numbers of virus-specific and anti-CD3/CD28 reactive CD8+ T cells in the CNS of virus-infected B6 and IL-1R KO mice are shown at 8 and 21 dpi. A representative result from two to three similar experiments is shown here.", "To compare the function of CD4+ T cells stimulated by macrophages from B6 and IL-1R KO mice, T cells from naïve OT-II mice, which carry T cell receptor (TCR) transgenes specific for OVA323-339, were stimulated with peritoneal macrophages infected in vitro for 24 h with TMEV (10 MOI) in the presence of OVA323-339 peptide (Figure 7A) or OVA protein (not shown). Viral infection did not significantly alter the levels of T cell stimulation by these macrophages. However, proliferation of CD4+ T cells in response to the cognate peptide or protein was higher when stimulated with IL-1R KO macrophages compared to the proliferation stimulated with B6 macrophages. In contrast, IFN-γ and IL-17 production by the T cells stimulated with IL-1R KO macrophages were significantly lower than the production stimulated with control B6 macrophages. These results indicated that antigen-presenting cells display altered T cell stimulating function in the absence of IL-1R-mediated signaling.\nCytokine reduction of CD4+T cells with stimulation of IL-1R KO macrophages. (A) Isolated CD4+ T cells (1 × 105) from the spleen of OT-II mice were cultured with in vitro 10 MOI Theiler’s murine encephalitis virus (TMEV)-infected peritoneal macrophages (1 × 104) from either C57BL/6 or IL-1R knockout (KO) mice for 3 days in the presence of 2 μM OVA epitope peptides. T cell proliferative responses were analyzed using [3H]TdR uptake, and cytokine production (IFN-γ and IL-17) of the cultures were analyzed using specific ELISAs. (B) Isolated CD4+ T cells (1 × 105) from the spleen of B6 mice infected with TMEV at 8 days post-infection (dpi) were cultured with in vitro TMEV-infected (10 MOI for 24 h) peritoneal macrophages (1 × 104) from either naïve C57BL/6 or IL-1R KO mice for 3 days in the presence of viral epitope peptides. Message levels of the indicated genes were then analyzed by real-time PCR. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) level was used as an internal control. The values are expressed as the means ± SD of triplicates. Statistically significant differences are indicated with asterisks; *P < 0.05, **P < 0.01, ***P < 0.001. Data shown are the representation of three independent experiments. (C) Peritoneal CD11b+ cells from naïve B6 and IL-1R KO mice infected with TMEV in vitro for 24 h were analyzed for the expression of PDL-1 and TIM-3 T cell inhibitory molecules. A representative flow cytometry plot of three similar results is shown here.\nTo further understand the potential mechanisms underlying the altered T cell stimulation by IL-1R KO macrophages, we examined the potential contribution of IL-1 signaling to the induction of cytokines in TMEV-infected macrophages (Figure 7B). After TMEV infection in vitro for 24 h, levels of viral RNA as well as IFN-α and IFN-β messages were similar between macrophages from WT B6 and IL-1R KO mice. However, the expression of the IL-6 message was extremely compromised in IL-1R KO macrophages compared to B6 macrophages. In contrast, the expression level of TNF-α message was more highly upregulated in IL-1R KO macrophages after TMEV infection. Interestingly however, the expression of TGF-β in uninfected IL-1R KO macrophages was higher than the expression in B6 macrophages but reduced to a similar level after viral infection. These results suggest that the cytokine production profile of macrophages and perhaps other antigen-presenting cells is altered in the absence of IL-1 signaling, which may affect the initial development and/or function of T cells following viral infection.\nTo further understand the underlying mechanisms associated with altered CD4+ T cell development in the absence of IL-1 signaling, the levels of co-stimulatory molecules and key inhibitory molecules were studied in a representative macrophage antigen-presenting cell (APC) population (Figure 7C). The levels of CD80, CD86 and CD40 in B6 and IL-1R1 KO mice were not significantly different (not shown). However, PDL-1 and Tim-3 were significantly elevated in the absence of IL-1 signaling. These molecules are known to negatively affect the function of T cells [28] and/or promote inflammatory responses through its expression by innate immune cells, such as microglia [29]. It was interesting to note that the expression of PDL-1 was upregulated upon viral infection in B6 macrophages, whereas the expression in IL-1R-deficient macrophages was constitutively upregulated even in the absence of viral infection. In contrast, the expression of Tim-3 was constitutively upregulated in IL-1R-deficient macrophages to the level (approximately 5%) of upregulation seen after viral infection in B6 macrophages, but it was further upregulated in IL-1R KO macrophages after TMEV infection. These results strongly suggest that these increases in the inhibitory molecules may participate in the altered T cell development and/or function.", "TMEV-infection in susceptible strains of mice induces chronic demyelinating disease that is primarily mediated by CD4+ T cells [17,30,31]. However, epitope-specific CD4+ T cells can be protective or pathogenic depending on when activated T cells are available in conjunction with viral infection [23,32,33]. Interestingly, the level of IL-1β, induced following infection with TMEV, plays an important role in the pathogenesis of TMEV-induced demyelinating disease [18,34]. Previously, it has been shown that administration of IL-1 to mice exacerbates the development of experimental autoimmune encephalomyelitis (EAE), the pathogenic immune mechanisms of which are similar to those of TMEV-induced demyelinating disease [35-37]. In addition, IL-1 appears to directly activate astrocytes and microglia to exacerbate neurodegeneration in non-immune-mediated diseases [38]. Because IL-1β is induced via the innate immunity mediated by various TLRs and because the downstream IL-1 signals mediated via IL-1R also play an important role in the host defense [1,4], we have investigated the role of IL-1β signals in the development of TMEV-induced demyelinating disease by assessing the effects of IL-1β administration and using IL-1R-deficient mice.\nWe have previously demonstrated that administration of IL-1β into resistant B6 mice renders the resistant mice susceptible to TMEV-induced demyelinating disease [18]. The administration of IL-1β dramatically increased the level of IL-17 production in the CNS of the resistant mice, which do not produce a high level of Th17 cells following TMEV infection (Figure 1). This result is consistent with recent reports that IL-1β strongly promotes the development of IL-17-producing Th17 cells either directly or via the production of IL-6 [19,39]. The presence of high levels of IL-17A in mice infected with TMEV exerts a strong pathogenic role by inhibiting the apoptosis of virus-infected cells, blocking cytolytic CD8+ T cell function, and elevating cellular infiltration to the CNS [17]. Recently, it was also shown that the presence of FoxP3+ Treg cells that preferentially expand due to stimulation by IL-1β [40] is not beneficial for the development of TMEV-induced demyelinating disease; hence, these regulatory cells inhibit the protective anti-viral immune responses [41]. Therefore, administration of IL-1β, resulting in a higher level of IL-1β, appears to promote the pathogenesis of TMEV-induced demyelinating disease in resistant B6 mice by elevating pathogenic Th17 and Treg responses to TMEV antigens. In addition, it is known that IL-1 directly activates astrocytes and microglia in the CNS [42], which are associated with the pathogenesis of TMEV-induced demyelinating disease [13,43]. Furthermore, IL-1 mediates the loss of astroglial glutamate transport and drives motor neuron injury in the spinal cord during viral encephalomyelitis [44]. The expression of IL-1R1 is upregulated in glial cells following TMEV infection [45], and thus the elevated receptor expression is likely to exert the detrimental effects seen as a result of IL-1 signaling on neurodegeneration and/or pathogenic immune responses.\nIn the absence of IL-1R1-mediated signals, resulting from engagements with the predominant cytokine IL-1β and weak cytokine IL-1α, strongly resistant B6 mice become susceptible to the development of TMEV-induced disease (Figure 2). Viral loads in the spinal cord are higher in the absence of IL-1R signals, suggesting that the presence of IL-1 signaling plays an important role in controlling viral persistence during the course of TMEV infection. The high viral loads also accompanied higher cellular infiltration into the CNS. Histopathological examinations of the virus-infected IL-1R-deficient B6 mice confirmed the elevated lymphocyte infiltration, demyelination and axonal losses in the CNS compared to control B6 mice (Figure 3). These results are consistent with previous reports indicating that either IL-1β- or IL-1RI-deficient mice are susceptible to various infections [1,7,8,46]. These results collectively suggest that either an abnormally high level of IL-1β or the absence of IL-1-mediated signals lead to high viral loads and cellular infiltration to the CNS, resulting in the elevated development of TMEV-induced demyelinating disease. Therefore, a fine balance of IL-1β-mediated signaling appears to be important for protection from viral infections. It is also interesting to note that this viral model for MS is markedly different from the EAE model, which is not associated with microbial infections, in that a deficiency of IL-1R1 significantly reduces the development of demyelinating disease [37].\nDespite many previous studies on the role of IL-1β signaling in viral infections, the underlying mechanisms of the signals involved in the protection from infection remain unclear. Previously, it has shown that IL-1-mediated signals augment T cell responses by increasing cellular infiltration, as well as upregulating cytokine production and co-stimulatory molecule expression in APCs [5,47,48]. However, our results showed that the cellular infiltration is elevated in IL-1R1 KO mice during the early stages of viral infection (Figure 2), although the anti-viral CD4+ T cell responses in the CNS of virus-infected IL-1R KO mice are lower without compromising either peripheral CD4+ T cell responses (Figure 5) or CNS CD8+ T cell responses (Figure 6). These results suggest that the APCs associated with CD4+ T cell responses in the CNS are primarily affected by the absence of IL-1-mediated signaling. Our previous studies strongly suggested that primarily the microglia and, to a certain extent, astrocytes, harbor viral loads and play important roles in the stimulation of the level and type of the CD4+ T cell response [43]. In addition, it is known that IL-1 signaling affects the function of these cell types [42]. Therefore, it is most likely that these cells play an important role in the development of anti-viral CD4+ T cell responses in the CNS during the early stage of viral infection. Because the cytokine production profile of APCs is altered in the absence of IL-1 signaling, perhaps due to the elevated expression of inhibitory molecules (Figure 7), similar mechanisms by CNS APCs may negatively affect the initial development and/or function of anti-viral T cells following viral infection. Regarding the underlying mechanisms, it is currently unclear how the deficiency in IL-1 signals enhances the expression of inhibitory molecules in APCs. However, we have observed that APCs from susceptible SJL mice expressed significantly higher levels of these molecules upon viral infection either in vitro or in vivo compared to cells from resistant B6 mice (data not shown), suggesting that the viral load may lead to the elevated expression. Therefore, it is most likely that the absence of IL-1 signals permits the initial elevation of viral load (Figure 4), and the higher viral load, in turn, leads to an eventual compromise in the efficiency of anti-viral T cell responses and functions. In contrast, the presence of excessive IL-1 signals preferentially triggers T cell responses that are unfavorable for the protection of the hosts from chronic viral persistence and the pathogenesis of demyelinating disease, as previously seen [17,19].", "IL-1 signaling plays a protective role against viral infections. However, we have previously demonstrated that administration of IL-1 promotes the pathogenesis of TMEV-induced demyelinating disease, similar to the autoimmune disease model (EAE) for MS. The IL-1-mediated pathogenesis of TMEV-induced demyelinating disease appears to reflect an elevated Th17 response in the presence of IL-1. However, IL-1R-deficient B6 mice also induced TMEV-induced demyelinating disease accompanied by high viral persistence and upregulated expression of T cell inhibitory molecules such as PDL-1 and Tim-3. These results suggest that the presence of high IL-1 level promotes the pathogenesis by elevating Th17 responses, whereas the absence of IL-1 signals permits viral persistence in the CNS due to insufficient T cell activation. Therefore, the balance of IL-1 signaling appears to be critical for the determination of protection vs. pathogenesis in the development of a virus-induced demyelinating disease.", "APC: antigen-presenting cell; CNS: central nervous system; Dpi: days post-infection; EAE: experimental autoimmune encephalomyelitis; ELISA: enzyme-linked immunosorbent assay; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; H & E: hematoxylin and eosin; IL-1R: interleukin-1 receptor; LFB: Luxol Fast Blue; LPS: lipopolysaccharide; MNC: mononuclear cell; MS: multiple sclerosis; OVA: ovalbumin; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; PFU: plaque-forming unit; SEM: standard error of the mean; TLR: toll-like receptor; TMEV: Theiler’s murine encephalomyelitis virus; TMEV-IDD: TMEV-induced demyelinating disease.", "The authors declare that they have no competing interests.", "BSK directed experiments, interpreted the results and wrote the manuscript. YHJ conducted immunological experiments and helped writing. LM conducted histological experiments and wrote the corresponding portions. HSK performed some molecular analyses. WH and HSP conducted the initial immunological experiments. CSK contributed for the interpretation of results and direction of the study. All authors read and approved the final manuscript." ]

[ null, "materials|methods", null, null, null, null, null, null, null, null, null, null, null, null, "results", null, null, null, null, null, null, null, "discussion", "conclusions", null, null, null ]

[ "IL-1R", "TMEV", "Demyelination", "CNS", "T cell responses", "IL-1", "IL-1R KO mice", "Th17" ]

[ 786, 101, 42, 48, 110, 189, 70, 118, 102, 124, 272, 112, 63, 431, 703, 667, 374, 663, 403, 920, 131, 10, 67 ]

[ "il", "mice", "cells", "il 1r", "1r", "ko", "1r ko", "il 1r ko", "b6", "tmev" ]

[ "pathogenic immune responses", "innate immune cytokines", "il 1β inflammatory", "tlrs interleukin receptors", "toll like receptors" ]

[ "Clinical Competence", "Education, Medical", "Humans", "Learning", "Pandemics", "Schools, Medical", "Students, Medical" ]

[ "Ethics statement" ]

[ "This study is about the results of tests conducted during regular class hours, and the subject of analysis is not students but anonymized test scores. The post-mortem survey was also conducted anonymously. Therefore, this study is a study in which there is no reason to presume the subject’s refusal to consent, and the risk to the subject is extremely low even if consent is waived. The study was approved by the Kangwon National University Hospital Institutional Review Board (KNUH-2022-02-031-002)." ]

[ null ]

[ "INTRODUCTION", "METHODS", "Ethics statement", "RESULTS", "DISCUSSION" ]

[ "Blended learning, defined as a teaching method conjoining traditional lectures and various technologies, is rapidly being introduced in the field of education along the coronavirus disease 2019 (COVID-19) crisis. Online education first appeared in the 1990’s under the name of E-learning as an ancillary instrument to traditional lectures. However in 2010’s, it started to integrate itself with offline education in order to overcome the shortcomings of one-sided, lecture based education, and started being called blended learning. The COVID-19 crisis accelerated adoption of online learning into the field of education, and along with it a contemplation regarding relative weight, target, and integration of offline and online education has become greater than ever.12\nRepresentative models of Blended Learning include a supplemental model that utilizes online learning activities to supplement online classes, a flipped learning model that performs offline cooperative learning after watching a lecture video, a rotation model that circulates various learning activities by mixing online and offline, And there is a flex model that conducts self-directed learning activities online and gives individual feedback offline.3 In medical education, clinical skills education was traditionally carried out in an offline setting. Conventionally, the whole curriculum would be carried out offline, but when online lecture is necessary, flipped learning model of blended learning proposed by Garrison et al. would normally be used. This refers to in-advance online learning such as watching video clips offered by e-learning consortium (http://www.mededu.or.kr/), followed by offline practice. Prior studies conducted in college of nursing that utilized such model have reported improved student satisfaction.456789\nMeanwhile video clips used in the clinical skills education can be divided into tutorial video by the instructor, and self-video by the student themselves. Both the tutorial video and self-video are assumed to have similar educational effect, and researches that advocate the use of self-video taken by smart phones are gaining attention.4567810 And it is very difficult to recruit clinician experts in charge of scoring OSCE (Objective Structured Clinical Examination) in medical school, so rather than meeting the schedule of busy clinician experts, we think the evaluation using these medical students’ self-video clips seems to be very useful in a medical school.\nIn the light of such prior research, we designed a study where students would self-videotape their own OSCE and receive feedback, in order to validate the applicability of FLEX model in learning clinical skills of medical education. This is because self-video recording has a common context with self-directed learning of the FLEX model. Additionally, due to the elongation of COVID-19 crisis, there is a growing interest in FLEX model which puts more emphasis on online education but little research has been conducted using this model.", "Sixteen 3rd grade students who failed on OSCE in the year 2015 were asked to take a make-up examination using self-taken video clip. Students were required to upload video clips for the failed items at the school homepage within 7 days. The time limit of 5 minute was identically applied as the original examination. These students were not randomly selected by the researcher, but were students who did not reach the standard score in the tests conducted in class.\nSelf-taken video clips were reviewed by three independent examiners, all of whom had over 10 years of experience in medical education. The checklist was identical to the original examination, which was divided into skills domain and proficiency domain. The only difference was the ‘not identified’ column that was added in addition to ‘yes’ and ‘no’ for skills domain. There was no difference in the checklist item between the original and the make-up examination.\nEvaluation of proficiency domain was carried out using 5-point Likert scale. The score for skills domain was converted into total of 80, and the score for proficiency domain was converted into total of 20, adding up to 100. Students were considered to have ‘passed’ the item when the converted score was equal to or greater than 70. This cutoff was identical to the cutoff applied for the original examination.\nThe Paired Wilcoxon Signed Rank Test was used to investigate whether there is a statistically significant difference between the results of original examination and make-up examination. Also, post-hoc questionnaire was conducted to investigate the following; number participants required for videotaping, number of videotaping trials, preference between conventional examination and self-videotaped examination, and the reasons behind the preference.\nEthics statement This study is about the results of tests conducted during regular class hours, and the subject of analysis is not students but anonymized test scores. The post-mortem survey was also conducted anonymously. Therefore, this study is a study in which there is no reason to presume the subject’s refusal to consent, and the risk to the subject is extremely low even if consent is waived. The study was approved by the Kangwon National University Hospital Institutional Review Board (KNUH-2022-02-031-002).\nThis study is about the results of tests conducted during regular class hours, and the subject of analysis is not students but anonymized test scores. The post-mortem survey was also conducted anonymously. Therefore, this study is a study in which there is no reason to presume the subject’s refusal to consent, and the risk to the subject is extremely low even if consent is waived. The study was approved by the Kangwon National University Hospital Institutional Review Board (KNUH-2022-02-031-002).", "This study is about the results of tests conducted during regular class hours, and the subject of analysis is not students but anonymized test scores. The post-mortem survey was also conducted anonymously. Therefore, this study is a study in which there is no reason to presume the subject’s refusal to consent, and the risk to the subject is extremely low even if consent is waived. The study was approved by the Kangwon National University Hospital Institutional Review Board (KNUH-2022-02-031-002).", "A total of 16 students submitted 33 video clips. There were 11 video clips for cardiopulmonary resuscitation (CPR) item, 10 for endotracheal intubation (ET) item, and 12 for male Foley insertion (FI) item (Supplementary Table 1).\nThe results of the make-up examination can be seen in Table 1. Students were given credit for each checklist item when 2 or more examiners marked ‘yes.’ In all three items, an increase in the score was noted in the make-up examination compared to the original examination, and the Paired Wilcoxon Signed Rank Test showed a significant difference between the two. For each of CPR, ET, and FI item, the average original examination score was 57.8, 50.8, 51.1, but the average make-up examination score was 73.7 for CPR and 78 for FI, surpassing the cutoff. When comparing the result by domains, the score for both the skills domain and the proficiency domain showed a significant increase in make-up examination compared to the original examination.\naCut-off value of pass is 70 points; **P < 0.01 by paired Wilcoxon signed rank test.\nThe results of post-hoc questionnaire can be seen in Tables 2 and 3. Among the 16 students, 15 responded. The average number of videotaping trials exceeded 2 for all three items, and the maximum number of videotaping trials for each item was 10, 5, and 5. Eleven of 15 responders reported subjective improvement in OSCE skills, and another 11 out of 15 students reported preference towards self-videotaped examination over conventional examination. The main reason behind the preference towards self-videotaped examination was availability of self-practice without time limit, and students who chose conventional examination pointed out lack of tension in self-videotaped examination.", "The findings of the present study indicate that online education followed by small group offline feedback is capable of improving students’ clinical skills and proficiency in OSCE. In addition, a majority of students reported subjective improvement in their OSCE skills and preference towards self-videotaped examination. Therefore, the researchers have reached a conclusion that FLEX model may be applied in skill learning of medical education and is effective.\nThe FLEX model has an advantage both in cognitive and affective area. In the cognitive area, the FLEX model may promote academic achievement, problem-solving skills, critical thinking, and comprehension. In the affective area, the FLEX model may promote satisfaction, academic interest, learning attitude, and motivation. In this study’s setting, students can videotape and review their own skills and knowledge and interact with other students by assisting them and giving feedbacks, thereby achieving the above mentioned effects. Video clips have an additional advantage of enabling a comparison between student’s skills along the time course due to the fact that it may be saved and accessed afterwards. Also, utilizing smart phones for video clips can reduce the psychological and technical barrier to making video clips.\nIn the perspective of education provider, self-videotaped examination requires less educational resources. Normally, even a single round of OSCE examination requires scheduling of examiners, in-test student management, maintenance of consumables and dummy models. In such background, the results by Casey et al.,11 which showed no significant difference between self-assessed remediation and faculty-guided remediation is worth noting. If self-assessed remediation suffices, medical schools may put aside manpower and material resources.\nThis study has certain limitations. First of all, not having been designed as a comparative study, the score difference between original examination and make-up examination may have been impacted by multiple factors. Specifically, the reason behind the improvement of performance is confounding, potentially attributable to repeated pre-practice or change in learning method, and cannot be assessed individually.\nVivekananda-Schmidt asserted the usefulness of using videotaped OSCE for Joint Examination of medical students, but the study utilized fixed camera and thus the quality, angle, and the voice recording of the video was identical among one another.12 A study by Christoph Kiehl which also argued the usefulness of videotaped OSCE utilized tripod-mounted digital video camera as well, and the quality difference between the videos were negligible.13 However in this study, video clips were taken by student themselves, and thus three independent examiners were required to evaluate video clips in order to minimize the effect of quality difference between one another.\nThis resulted in another limitation of compromised equivalence in evaluation between the two examinations. In original examination, students were evaluated by one examiner, whereas in the make-up examination, they were evaluated by three examiners. Despite the differences among the two examinations, the present study adopted a form of self-videotaped examination and condoned resulting difference in the number of examiners so that the meaning of offline feedback may be maximized without renouncing the quality of evaluation.\nFinally, some checklist items were marked ‘not identified’ due to the physical limitation of a video clip. Major reasons behind ‘not identified’ were small object size, unobservable fine movement of students, unobservable fine movement of dummy models, and unevaluable visual inspection of students. Examples for the suggested reasons are as follows; evaluating a stylet tip of the endotracheal tube, pulling the penis in right angle when inserting a Foley catheter, chest compression in CPR, and visual inspection of sclera to confirm jaundice.\nTo overcome such limitations, further study comparing the results of self-videotaped examination and conventional examination in the same examination round is required. In addition, we suggest following guidelines in order to minimize the physical limitations that have been confirmed in the present study. First, smart phone cameras need to film the target in close proximity when filming small objects or body surface. Second, if possible, it is recommended to infer the movement of a small object by the movement of large objects when evaluating video clips. Third, a concrete checklist for each item should be prepared in advance. If a certain checklist item is ambiguous, then removal of such checklist item is encouraged. Finally, a monitor and a sensor should be clearly shown on the video clip as ancillary devices.\nIn spite of above mentioned limitations, the present study validated the applicability of FLEX model of blended learning in OSCE, which is yet to be widely used. Blended learning is a teaching method that will not fade away with the remission of COVID-19 crisis, but a method that will be applied extensively in the coming future. Medical schools therefore need contemplation on how to apply blended learning in their curriculum, and the present study may serve as one indicator in doing so. In particular, since the OSCE curriculum, which has been conducted as a “face-to-face education,” has verified effectiveness of blended learning, the present study demonstrates a very helpful basic material for the medical school curriculum in the future." ]

[ "intro", "methods", null, "results", "discussion" ]

[ "Checklist", "Smart Phone", "Clinical Skill", "Competence", "Video Recording", "COVID-19 Pandemic" ]

[ 97 ]

[ "examination", "study", "video", "students", "learning", "self", "education", "model", "clips", "skills" ]

[ "called blended learning", "online education appeared", "online learning activities", "blended learning covid", "offline online education" ]

[ "Cross-Sectional Studies", "Follow-Up Studies", "Humans", "Nurses", "Surveys and Questionnaires", "Workplace", "Workplace Violence" ]

[ "Background", "Methods", "Study design", "Participants", "Inclusion criteria", "Exclusion criteria", "Ethics approval", "Measurement instruments", "General information questionnaire", "Revised version of the hospital WPV questionnaire", "Data collection", "Statistical analysis", "Questionnaire response rate", "Nurses’ general information", "Incidence of WPV among nurses in 2010, 2015, and 2019", "Incidence of different forms of WPV among nurses in 2010, 2015, and 2019", "Cognition and attitudes of nurses toward WPV in 2010, 2015 and 2019", "Attitudes and responses of hospitals to WPV towards nurses in 2010, 2015 and 2019", "Discussion" ]

[ "According to the World Health Organization (WHO), workplace violence (WPV) can be defined as “incidents where staff are abused, threatened or assaulted in circumstances related to their work, involving an explicit or implicit challenge to their safety, well-being or health”. WPV can manifest as physical violence or psychological violence in different forms [1]. In recent years, as the reform of China’s medical system has entered the “deep water zone”, the doctor-patient relationship is becoming increasingly tense, and doctor-patient conflict is gradually emerging. As the main manifestation of doctor-patient conflict, the incidence of hospital WPV is increasing yearly. As the main workforce in medical and health care institutions, nurses have become the main victims of WPV due to the nature of their work, which requires direct contact and frequent communication with patients [2–5]. Studies from outside of China have shown that approximately 70 %-90 % of nurses have experienced one or more types of WPV [6–8]. In China, cross-sectional investigations of WPV among nurses have shown that the incidence of WPV is 71.9 %-84.6 %, which is similar to the incidence reported in other countries [9–11]. These findings show that WPV among nurses has become a common phenomenon in both developing and developed countries.\nWPV is a very serious public health problem that not only causes different degrees of physical and psychological injury to nurses but also has negative effects on hospitals [12, 13]. At the individual level, nurses may suffer from varying degrees of physiological harm, such as chronic pain, elevated blood pressure, gastrointestinal disorders, nightmares and even death [14, 15]. Regarding the psychological effects of WPV, in addition to feelings of grievance, anger, anxiety and other emotions, nurses may experience symptoms of insomnia, suicidal ideation and post-traumatic stress disorder [16–18]. At the hospital level, WPV reduces the enthusiasm of nurses toward their work and the quality of their work and increases their turnover rate, which affects the stability of the nursing team [19, 20]. In summary, WPV among nurses is characterized by a high incidence rate and great harmfulness.\nSince the 1980 s, scholars at home and abroad have sought to reduce hospital WPV incidence and improve nurses’ ability to respond through a series of measures, including improving medical-related laws and regulations [21], improving the hospital environment and treatment procedures [22], improving nurses’ communication ability [23], and focusing on WPV training [24]. However, a review of the current domestic and foreign literature found that the incidence of WPV among nurses remains high [25, 26]. Some scholars [27] have pointed out that due to the lack of long-term tracking data on the occurrence of WPV among nurses, the existing prevention and intervention measures lack pertinence. A study by Spelten et al. [28] pointed out that reducing the incidence of WPV first requires a comprehensive understanding of the dynamic development process of violence toward nurses, including by determining the frequency and intensity of WPV events and assessing the long-term results of violence on staff. However, most of the existing WPV studies are short-term status surveys, and few studies continuously compare the WPV status and characteristics of nurses in a certain region. This study aimed to analyze the current situation and characteristics of WPV among nurses in Suzhou general hospitals from 2010 to 2019 to provide information that can help hospital managers understand the status quo of WPV among nurses and trends in WPV over time.", "Study design In this cross-sectional study, structured questionnaires were used to investigate the occurrence of WPV among nurses in 6 general hospitals in Suzhou in 2010, 2015 and 2019.\nIn this cross-sectional study, structured questionnaires were used to investigate the occurrence of WPV among nurses in 6 general hospitals in Suzhou in 2010, 2015 and 2019.\nParticipants A total of 942, 2,110 and 2,566 clinical nurses were selected from Suzhou general hospitals in November of each year in 2010, 2015 and 2019, respectively, by the convenience sampling method.\nA total of 942, 2,110 and 2,566 clinical nurses were selected from Suzhou general hospitals in November of each year in 2010, 2015 and 2019, respectively, by the convenience sampling method.\nInclusion criteria (1) Employment as in-service nurses in clinical departments who had direct contact with patients in their daily work.\n(2) Professional certification.\n(3) Completion of at least 1 year of clinical nursing work.\n (4) Provision of a signed informed consent form and voluntary participation in the study.\n(1) Employment as in-service nurses in clinical departments who had direct contact with patients in their daily work.\n(2) Professional certification.\n(3) Completion of at least 1 year of clinical nursing work.\n (4) Provision of a signed informed consent form and voluntary participation in the study.\nExclusion criteria (1) Nurses off-duty during the investigation, e.g., on maternity leave, sick leave, or vacation.\n(2) Non-regular nurses and personnel undergoing refresher training in our hospital.\n(1) Nurses off-duty during the investigation, e.g., on maternity leave, sick leave, or vacation.\n(2) Non-regular nurses and personnel undergoing refresher training in our hospital.\nEthics approval The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University in China (No. 2,018,062). The participants were made aware of the aim and procedures of the study, and they all signed an informed consent form. The researchers guaranteed the confidentiality of the subjects’ information and that it would be used only for research purposes. The voluntary principle was always followed during the study, and the participants could leave the study at any time.\n The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University in China (No. 2,018,062). The participants were made aware of the aim and procedures of the study, and they all signed an informed consent form. The researchers guaranteed the confidentiality of the subjects’ information and that it would be used only for research purposes. The voluntary principle was always followed during the study, and the participants could leave the study at any time.", "In this cross-sectional study, structured questionnaires were used to investigate the occurrence of WPV among nurses in 6 general hospitals in Suzhou in 2010, 2015 and 2019.", "A total of 942, 2,110 and 2,566 clinical nurses were selected from Suzhou general hospitals in November of each year in 2010, 2015 and 2019, respectively, by the convenience sampling method.", "(1) Employment as in-service nurses in clinical departments who had direct contact with patients in their daily work.\n(2) Professional certification.\n(3) Completion of at least 1 year of clinical nursing work.\n (4) Provision of a signed informed consent form and voluntary participation in the study.", "(1) Nurses off-duty during the investigation, e.g., on maternity leave, sick leave, or vacation.\n(2) Non-regular nurses and personnel undergoing refresher training in our hospital.", " The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University in China (No. 2,018,062). The participants were made aware of the aim and procedures of the study, and they all signed an informed consent form. The researchers guaranteed the confidentiality of the subjects’ information and that it would be used only for research purposes. The voluntary principle was always followed during the study, and the participants could leave the study at any time.", "General information questionnaire The questionnaire was designed by the research group to suit the research purpose and collected information on gender, age, education, whether an only child, marital status, hospital grade, department, years worked, employment type and professional title.\nThe questionnaire was designed by the research group to suit the research purpose and collected information on gender, age, education, whether an only child, marital status, hospital grade, department, years worked, employment type and professional title.\nRevised version of the hospital WPV questionnaire The questionnaire designed by Shengyong Wang [29] of Jinan University includes 33 entries in 4 dimensions: the frequency of WPV occurrence in the past year, the most impressive WPV experience in the past year, cognition and attitudes toward WPV, and the attitudes and responses of hospitals to WPV. The questionnaire has been widely used in clinical practice. The questionnaire has good reliability and validity; the test-retest reliability of the questionnaire was 0.803, and the average content validity of each item was 0.916.\nThe questionnaire designed by Shengyong Wang [29] of Jinan University includes 33 entries in 4 dimensions: the frequency of WPV occurrence in the past year, the most impressive WPV experience in the past year, cognition and attitudes toward WPV, and the attitudes and responses of hospitals to WPV. The questionnaire has been widely used in clinical practice. The questionnaire has good reliability and validity; the test-retest reliability of the questionnaire was 0.803, and the average content validity of each item was 0.916.\nData collection Two weeks before the beginning of the study, the head of the research team (which included 2 postgraduate tutors, 6 postgraduates, and 4 undergraduates) contacted the managers of each hospital by telephone or e-mail to request the support of the corresponding person in charge for the study and published a notice on each hospital website to recruit participants to participate in the survey. The contents of the notice included the location, time, purpose, significance, confidentiality principle and precautions of the questionnaire. If nurses were willing to participate in the survey, they could go to a designated conference room to receive the questionnaire and complete it anonymously. Each hospital was equipped with 2 research team members. If a nurse had any questions during completion of the questionnaire, the project team members could give guidance at any time. After completing the questionnaire, the nurse placed it into the questionnaire recovery box in the conference room. At 6:00 p.m., after the nurses had completed the questionnaires, the questionnaire recovery box was sealed by the members of the research group and sent to the questionnaire archives of the research group for safekeeping.\nTwo weeks before the beginning of the study, the head of the research team (which included 2 postgraduate tutors, 6 postgraduates, and 4 undergraduates) contacted the managers of each hospital by telephone or e-mail to request the support of the corresponding person in charge for the study and published a notice on each hospital website to recruit participants to participate in the survey. The contents of the notice included the location, time, purpose, significance, confidentiality principle and precautions of the questionnaire. If nurses were willing to participate in the survey, they could go to a designated conference room to receive the questionnaire and complete it anonymously. Each hospital was equipped with 2 research team members. If a nurse had any questions during completion of the questionnaire, the project team members could give guidance at any time. After completing the questionnaire, the nurse placed it into the questionnaire recovery box in the conference room. At 6:00 p.m., after the nurses had completed the questionnaires, the questionnaire recovery box was sealed by the members of the research group and sent to the questionnaire archives of the research group for safekeeping.\nStatistical analysis Data management and analysis were performed using SPSS 18.0. The count data are described as frequencies and percentages, and the quantitative data are reported as means and standard deviations. The chi-square test was used to analyze the general data of the nurses from the different time periods, the incidence of WPV, nurses’ cognition and attitudes regarding WPV and the hospitals’ attitudes toward WPV and corresponding measures. The Mann-Whitney U test was used to analyze the demographic data. Statistical significance was set at P<0.05.\nData management and analysis were performed using SPSS 18.0. The count data are described as frequencies and percentages, and the quantitative data are reported as means and standard deviations. The chi-square test was used to analyze the general data of the nurses from the different time periods, the incidence of WPV, nurses’ cognition and attitudes regarding WPV and the hospitals’ attitudes toward WPV and corresponding measures. The Mann-Whitney U test was used to analyze the demographic data. Statistical significance was set at P<0.05.", "The questionnaire was designed by the research group to suit the research purpose and collected information on gender, age, education, whether an only child, marital status, hospital grade, department, years worked, employment type and professional title.", "The questionnaire designed by Shengyong Wang [29] of Jinan University includes 33 entries in 4 dimensions: the frequency of WPV occurrence in the past year, the most impressive WPV experience in the past year, cognition and attitudes toward WPV, and the attitudes and responses of hospitals to WPV. The questionnaire has been widely used in clinical practice. The questionnaire has good reliability and validity; the test-retest reliability of the questionnaire was 0.803, and the average content validity of each item was 0.916.", "Two weeks before the beginning of the study, the head of the research team (which included 2 postgraduate tutors, 6 postgraduates, and 4 undergraduates) contacted the managers of each hospital by telephone or e-mail to request the support of the corresponding person in charge for the study and published a notice on each hospital website to recruit participants to participate in the survey. The contents of the notice included the location, time, purpose, significance, confidentiality principle and precautions of the questionnaire. If nurses were willing to participate in the survey, they could go to a designated conference room to receive the questionnaire and complete it anonymously. Each hospital was equipped with 2 research team members. If a nurse had any questions during completion of the questionnaire, the project team members could give guidance at any time. After completing the questionnaire, the nurse placed it into the questionnaire recovery box in the conference room. At 6:00 p.m., after the nurses had completed the questionnaires, the questionnaire recovery box was sealed by the members of the research group and sent to the questionnaire archives of the research group for safekeeping.", "Data management and analysis were performed using SPSS 18.0. The count data are described as frequencies and percentages, and the quantitative data are reported as means and standard deviations. The chi-square test was used to analyze the general data of the nurses from the different time periods, the incidence of WPV, nurses’ cognition and attitudes regarding WPV and the hospitals’ attitudes toward WPV and corresponding measures. The Mann-Whitney U test was used to analyze the demographic data. Statistical significance was set at P<0.05.", "In 2010, 2015 and 2019, 1,000, 2,132 and 2,700 questionnaires were distributed, respectively, and 942, 2,110 and 2,566 effective questionnaires were actually recovered, for effective response rates of 94.20 %, 98.97 % and 95.04 %.", "A total of 5,618 nurses completed the three surveys, including 388 emergency nurses, 618 outpatient nurses and 4,612 ward nurses. The age of the respondents ranged from 20 to 63 years, with an average age of 31.41 ± 5.82 years, and the proportion of respondents < 30 years old was 51.6 %. The number of years worked ranged from 1 to 37, with the average being 8.85 ± 7.45 years. Of the respondents, 23.2 % had worked ≤ 5 years; 52.8 % had a bachelor’s degree; and 42.7 % had junior professional titles. The demographic characteristics are presented in Table 1.\n\nTable 1Comparison of the demographic characteristics of the nurses, n (%)ItemsCategories201020152019χ2/ZPAge (Years)<30506 (53.7)1080 (51.2)1311 (51.1)16.915*0.01030~39348 (36.9)737 (34.9)933 (36.4)40~4975 (8.0)236 (11.2)278 (10.8)≥5013 (1.4)57 (2.7)44 (1.7)GenderFemale894 (94.9)2049 (97.1)2396(93.4)34.249<0.001Male48 (5.1)61 (2.9)170(6.6)Marital statusMarried605 (64.2)1430 (67.8)1628 (63.4)17.2570.002Single337 (35.8)665 (31.5)922 (35.9)Other0 (0.0)15 (0.7)16 (0.6)Only childYes392 (41.6)1098 (52.0)1291 (50.3)29.551<0.001No550 (58.4)1012 (48.0)1275 (49.7)Education levelTechnical secondary degree or below62 (6.6)63 (3.0)33 (1.3)385.760*<0.001Junior college568 (60.3)1008 (47.8)811 (31.6)Bachelor’s degree305 (32.4)1019 (48.3)1656 (64.5)Master’s degree or above7 (0.7)20 (0.9)66 (2.6)Years worked≤5194 (20.6)381 (18.1)726 (28.3)85.897*<0.0016~10294 (31.2)775 (36.7)847 (33.0)11~15204 (21.7)384 (18.2)428 (16.7)≥16250 (26.5)570 (27.0)565 (22.0)Professional titleSenior324 (34.4)687 (32.6)592 (23.1)120.281*<0.001Medium288 (30.6)640 (30.3)688 (26.8)Junior330 (30.5)783 (37.1)1286 (50.1)PostNurse901 (95.6)1977 (93.7)2432 (94.8)5.4010.067Head nurse41 (4.4)133 (6.3)134 (5.2)Employment typeOfficial staff495 (52.5)1068 (50.6)1213 (47.3)9.8780.043Contract staff437 (46.4)1016 (48.2)1317 (51.3)Temporary staff10 (1.1)26 (1.2)36 (1.4)DepartmentEmergency59 (6.3)168 (8.0)161 (6.3)77.396<0.001Outpatient159 (16.9)265 (12.6)194 (7.6)Ward724 (76.9)1677 (79.5)2211 (86.2)*: The Mann-Whitney U test was used\nComparison of the demographic characteristics of the nurses, n (%)\n*: The Mann-Whitney U test was used", "The incidence of WPV among nurses was 62.4 % in 2010, 69.0 % in 2015 and 68.4 % in 2019 (P=0.001). Compared with that in 2010, the incidence increased significantly in 2015 and 2019 (P<0.001, P=0.001). The details are shown in Table 2.\n\nTable 2Comparison of the incidence of WPV among nurses in different years, n (%)YearQuantityNot exposed to WPVExposed to WPVχ2PT1 (2010)942354 (37.6)588 (62.4)13.9790.001T2 (2015)2110655 (31.0)1455 (69.0)T3 (2019)2566812 (31.6)1754 (68.4)Multiple comparisonPT1−T212.575<0.001PT1−T310.9380.001PT2−T30.1950.681\nComparison of the incidence of WPV among nurses in different years, n (%)", "According to the current situation of WPV toward nurses in different years, the proportion of nurses who experienced sexual harassment (4.1 %) was the highest in 2010. The proportion of people who suffered verbal abuse (66.2 %) and threats (46.3 %) was the highest in 2015. Physical assault (13.1 %) was the highest in 2019. The overall comparison of WPV in different years and of different types showed significant differences (P<0.05). Further multiple comparisons of the data showed that there were highly statistically significant differences between the total number of WPV incidents in 2010 and 2015 and between the number of physical assault incidents in 2015 and 2019 (P<0.001). The details are shown in Table 3\n\nTable 3Comparison of different forms of WPV among nurses in different years, n (%)YearQuantityExposed to WPVVerbal abuseVerbal threatPhysical assaultSexual harassmentT1 (2010)942588 (62.4)570 (60.5)387 (41.1)93 (9.9)39 (4.1)T2 (2015)21101455 (69.0)1396 (66.2)977 (46.3)211 (10.0)55 (2.6)T3 (2019)25661754 (68.4)1651 (64.3)1116 (43.5)335 (13.1)102 (4.0)χ213.97928.58819.42326.86516.185P0.001<0.0010.004<0.0010.013Multiple comparisonPT1-T2<0.0010.0120.4400.2320.025T1-T30.0010.0050.2500.0480.303T2-T30.6810.0010.020<0.0010.010\nComparison of different forms of WPV among nurses in different years, n (%)", "Compared with the number in 2010, more nurses surveyed in 2015 and 2019 said that they had heard of WPV before, and the result was considered statistically significant (PT1−T2=0.020, PT1−T3=0.032). In 2010 and 2015, less about WPV was included in the nurses’ preservice training (PT1−T3=0.002, PT2−T3=0.001), but more nurses thought they would benefit from WPV training (PT1−T3=0.016, PT2−T3=0.010). The study also found that clinical nurses in 2015 and 2019 were more likely than nurses in 2010 to approve of hospitals setting up WPV processing facilities and to support a zero-tolerance policy toward WPV (P<0.001). In addition, more than 85 % of nurses involved in the three surveys expressed their willingness to attend WPV training and thought they would benefit from it. The details are shown in Table 4Table 4Comparison of cognition and attitudes toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Having heard of WPV beforeYes763 (81.0)1782 (84.5)2157 (84.7)6.1660.0460.0200.0320.717No179 (19.0)328 (15.5)916 (16.3)WPV is inevitable at workYes712 (75.6)1594 (75.5)1962 (76.5)0.6250.7321.0000.5910.470No230 (24.4)516 (24.5)604 (24.0)Thinking WPV is not worth the fussYes132 (14.0)264 (12.5)374 (14.6)4.2580.1190.2680.7040.044No810 (86.0)1846 (87.5)2192 (85.4)Thinking preservice training should include training programs on WPVYes922 (97.9)2058 (97.5)2457 (95.8)16.192<0.0010.6080.0020.001No20 (2.1)352 (2.5)109 (4.2)Willing to attend the WPV trainingYes874 (92.8)1968 (93.3)2405 (93.7)1.0830.5820.6420.3170.551No68 (7.2)142 (6.7)151 (6.3)Thinking training on WPV would be beneficialYes822 (87.3)1851 (87.7)2313 (90.1)9.2790.0100.7220.0160.010No120 (12.7)259 (12.3)253 (9.9)Thinking WPV coping management organizations are neededYes903 (95.9)2071 (98.2)2519 (98.2)19.082<0.001<0.001<0.0011.000No39 (4.1)39 (1.8)47 (1.8)Supporting a “zero-tolerance” policyYes618 (65.6)1882 (89.2)2310 (90.0)368.750<0.001<0.001<0.0010.360No324 (34.4)228 (10.8)256 (10.0)\nComparison of cognition and attitudes toward WPV among nurses in different years, n (%)", "This study found that in the past 9 years, the hospitals’ attitudes and responses to WPV towards nurses have greatly improved, as indicated by improvements in five aspects, namely, “offering training”, “encouraging reporting of WPV to supervisors”, “equipped with a WPV management department”, “handling WPV efficiently”, and “hospital’s attitudes” (P<0.001). However, most hospitals still have not developed training. Regarding hospitals’ emphasis on WPV, hospitals paid more attention to WPV toward physicians (P=0.013). The details are shown in Table 5\n\nTable 5Comparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Offering trainingYes91 (9.7)487 (23.1)840 (32.7)202.794<0.001<0.001<0.001<0.001No851 (90.3)1623 (76.9)1726 (67.3)Encouraging reporting of WPV to supervisorsYes585 (62.1)1575 (74.6)1849 (72.1)51.255<0.001<0.001<0.0010.050No357 (37.9)535 (25.4)717 (27.9)Equipped with WPV management departmentYes432 (45.9)1215 (57.6)1451 (56.5)39.942<0.001<0.001<0.0010.495No510 (54.1)895 (42.4)1115 (43.5)Handling WPV efficientlyYes264 (28.0)791 (37.5)1193 (46.5)106.884<0.001<0.001<0.001<0.001No678 (72.0)1319 (62.5)1373 (53.5)Hospital’s attitudesProtecting the interests of staff91 (9.7)574 (27.2)775 (30.2)283.785<0.001<0.001<0.001<0.001Handling WPV fairly based on the facts425 (45.1)855 (40.5)1194 (46.5)Turning a blind eye283 (30.0)549 (26.0)470 (18.3)Punishing staff regardless of the cause143 (15.2)132 (6.3)127 (4.9)Degree of emphasisPhysician>Nurse403 (42.8)959 (45.5)1117 (43.5)12.6490.0130.002<0.0010.346Nurse>Physician0 (0.0)22 (1.0)23 (0.9)Physician=Nurse539 (57.2)1129 (53.5)1426 (55.6)\nComparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)", "This study found that the overall incidence of WPV towards nurses in Suzhou general hospitals gradually increased from 62.4 to 68.4 % from 2010 to 2019 and significantly increased from 2010 to 2015. There were significant differences at first (P<0.05), but then a plateau was reached (P>0.05). The incidence reported here is lower than the overall WPV incidence of 76 % among 762 registered nurses identified in a study from the U.S. [30], higher than the incidence reported in a study conducted in Botswana (44.1 %) [31], and similar to the incidence reported in a study by Ren et al. (68.1 %) [32]. The incidence of WPV towards nurses varies by country, region, social background and sample size. However, the phenomenon of WPV against nurses has become increasingly common at home and abroad, in developing countries and developed countries. A comparison of the types of WPV nurses experience across the three study years showed that “verbal abuse” is the most common form of WPV, which is consistent with most surveys [33–36]. Verbal abuse and threats showed an upward trend and then a downward trend from 2010 to 2019, with the highest incidence in 2015. This was possibly related to the greater emphasis of hospitals on the training of nurses’ service attitudes and communication skills in recent years. To reduce the incidence of verbal abuse or threats, hospital management developed training on coping and communication strategies for nurses, including using amiable words, putting themselves in patients’ shoes and listening to the needs of patients from the patients’ point of view so that patients could feel understood and respected. However, the lack of corresponding legal constraints on verbal violence led to nurses being unable to obtain timely evidence and a fair hearing after experiencing this type of WPV, which made verbal violence hard to intervene in and prevent. The results of this survey showed that the incidence of physical assault against nurses has gradually increased over the past nine years. Though the incidence of physical violence was relatively low between 2010 and 2015 (P>0.05), the incidence of physical assault increased significantly from 2015 to 2019 (P<0.001). With the development of the economy and the improvement of living standards, people’s demand for medical treatment has changed; people are not satisfied with only cure of the disease itself but are increasingly attentive to the overall effect of treatment and attach increasing importance to the experience of the treatment process. When patients and their relatives have unpleasant experiences or their requirements are not met during medical treatment, it is easy for conflicts to arise between nurses and patients. If the hospital treatment system or process is not perfect, such conflict is likely to escalate and induce physical aggression. It is recommended that hospital management give attention to the various forms of WPV while focusing on the service attitude, the patient’s medical experience and the transformation of the service process. Hospital management should focus on not only implementing policies but also establishing hospital security forces and an effective cooperation mechanism between hospitals and public security systems, implementing measures such as increasing patrol times, improving security inspections, prohibiting the carrying of sharp or dangerous goods into hospitals and developing security training for staff [37]. Such practices would allow a hospital to intervene immediately in the event of violence, ensure the safety of medical personnel and reduce the occurrence of violence through multi-sector coordination. It was shown that the incidence of sexual harassment among nurses had a decreasing trend and then an increasing trend over time, with the incidence being basically flat in 2010 and 2019, which was due to the improvement of laws and the health care system in recent years. Since 2014, China has issued a series of laws and regulations, such as the Regulations on the Prevention and Treatment of Medical Disputes, the Memorandum of Cooperation on Joint Punishment of Persons who seriously endanger the Normal Medical Order, and the Basic Medical and Health Promotion Law, which have played a positive role in protecting legitimate rights by law, deterring illegal acts targeting medical staff and institutions and maintaining the order of hospitals. However, with the passage of time, some law enforcement officers have not truly implemented the laws and regulations, resulting in a rebound trend of hospital WPV since 2015. Therefore, it is suggested that law enforcement officers should sternly punish people who attack medical staff and promote the implementation of policies and laws so that they can effectively protect the legitimate rights and interests of nurses.\nIn the past 9 years, nurses’ cognition and attitudes toward WPV have improved. The rates of “having heard of WPV before”, “thinking WPV coping management organizations are needed” and “supporting a zero-tolerance policy” increased significantly from 2010 to 2015 (P<0.05) but showed no great changes from 2015 to 2019 (P>0.05), which was likely related to the formulation of corresponding preventive measures and provision of reasonable and effective education and training. The National Institute of Occupational Safety and Health [38] developed and delivered WPV prevention training course for nurses, and more than 90 % of participants thought the course filled gaps in their knowledge. It was also found that the reasons why some nurses were unable to effectively judge whether they had experienced WPV were that they lacked an understanding of the concept of WPV or had never heard the term WPV before. Ming et al. [39] found that after a randomized intervention for clinical nurses, the cognition and attitudes of the nurses who participated in violence training were higher than those who did not. Brann et al. [40] found that the level of cognition and knowledge of WPV among nurses was higher than before training; nurses could identify violence that they had experienced personally or as bystanders and no longer considered violence part of their work. Therefore, it is necessary to develop training on WPV for clinical nurses. In addition, the results of the three surveys showed that although the majority of nurses were willing to participate in WPV prevention training, there was less WPV content in their preservice training in 2019 than in 2010 and 2015 (PT1−T3=0.002, PT2−T3=0.001), which indicates to hospital management that in order to maximize the effect of education and training and improve nurses’ ability to identify and deal with WPV in clinical practice, it is necessary to strengthen the training on WPV and make it more systematic and routine, integrate WPV content into new nurses’ education and in-hospital education, regularly disseminate knowledge on violence to nurses, strengthen continuous management after the training, and promote the continuous improvement of the post-training results while meeting the learning needs of nurses [41]. Furthermore, it is necessary to carry out public education, publicize the key role of the hospital in solving problems in the medical system through various networks, and increase public understanding of the efforts of medical centers to improve the medical experience and providing services to patients to decrease WPV.\nIn this survey, hospitals’ attitudes and responses to nurses’ WPV improved significantly from 2010 to 2019, which was embodied in five aspects: “offering training”, “encouraging reporting of WPV to supervisors”, “equipped with a WPV management department”, “handling WPV efficiently” and “hospital’s attitudes” (P<0.05). The differences in the response rates for “offering training”, “handling WPV efficiently”, “hospital’s attitudes” at different times were statistically significant (P<0.001), which may be related to changes in the management philosophy of the hospital managers. At present, hospital management pays more attention to the safety of nurses, constantly explores and develops scientific and effective nurse-related WPV management measures, actively and effectively controls violence, addresses nurses’ suffering from violence and minimizes hospital violence caused by improper or unclear management policies [37]. However, less than half of respondents reported receiving WPV prevention-related training. Although the training incidence increased in 2019 compared with that in 2010 and 2015, it was only 32.7 %, which is consistent with the results of other studies [42, 43]. The results of the survey also showed that more than 95 % of nurses believed that preservice training should include training on WPV, and more than 90 % of nurses expressed a willingness to attend, which showed that the current hospital-related education and training is far from meeting the needs of clinical nurses. To reduce the incidence of WPV or minimize the harm of WPV, nurses’ WPV management intervention skills should be strengthened, with special attention given to developing training, exploring the content and form of training, increasing the initiative and enthusiasm of nurses, and improving nurses’ cognition, attitudes and coping abilities with regard to WPV. In addition, compared with the results from 2010, those from 2015 to 2019 showed that hospitals paid more attention to doctors who had experienced WPV, with a gradual upward trend (P<0.001). Some studies [19, 44, 45] suggest that organizational support and hospital management can reduce the negative effects of WPV on nurses. Without strong hospital attention, nurses may lack trust in the management department and experience reduced job satisfaction, which will aggravate adverse reactions to WPV. In conclusion, hospitals should treat WPV among doctors and nurses equally so that nurse-directed WPV can be resolved equally and fairly and the psychological gap of employees can be reduced." ]

[ null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null, null ]

[ "Background", "Methods", "Study design", "Participants", "Inclusion criteria", "Exclusion criteria", "Ethics approval", "Measurement instruments", "General information questionnaire", "Revised version of the hospital WPV questionnaire", "Data collection", "Statistical analysis", "Results", "Questionnaire response rate", "Nurses’ general information", "Incidence of WPV among nurses in 2010, 2015, and 2019", "Incidence of different forms of WPV among nurses in 2010, 2015, and 2019", "Cognition and attitudes of nurses toward WPV in 2010, 2015 and 2019", "Attitudes and responses of hospitals to WPV towards nurses in 2010, 2015 and 2019", "Discussion", "Conclusions" ]

[ "According to the World Health Organization (WHO), workplace violence (WPV) can be defined as “incidents where staff are abused, threatened or assaulted in circumstances related to their work, involving an explicit or implicit challenge to their safety, well-being or health”. WPV can manifest as physical violence or psychological violence in different forms [1]. In recent years, as the reform of China’s medical system has entered the “deep water zone”, the doctor-patient relationship is becoming increasingly tense, and doctor-patient conflict is gradually emerging. As the main manifestation of doctor-patient conflict, the incidence of hospital WPV is increasing yearly. As the main workforce in medical and health care institutions, nurses have become the main victims of WPV due to the nature of their work, which requires direct contact and frequent communication with patients [2–5]. Studies from outside of China have shown that approximately 70 %-90 % of nurses have experienced one or more types of WPV [6–8]. In China, cross-sectional investigations of WPV among nurses have shown that the incidence of WPV is 71.9 %-84.6 %, which is similar to the incidence reported in other countries [9–11]. These findings show that WPV among nurses has become a common phenomenon in both developing and developed countries.\nWPV is a very serious public health problem that not only causes different degrees of physical and psychological injury to nurses but also has negative effects on hospitals [12, 13]. At the individual level, nurses may suffer from varying degrees of physiological harm, such as chronic pain, elevated blood pressure, gastrointestinal disorders, nightmares and even death [14, 15]. Regarding the psychological effects of WPV, in addition to feelings of grievance, anger, anxiety and other emotions, nurses may experience symptoms of insomnia, suicidal ideation and post-traumatic stress disorder [16–18]. At the hospital level, WPV reduces the enthusiasm of nurses toward their work and the quality of their work and increases their turnover rate, which affects the stability of the nursing team [19, 20]. In summary, WPV among nurses is characterized by a high incidence rate and great harmfulness.\nSince the 1980 s, scholars at home and abroad have sought to reduce hospital WPV incidence and improve nurses’ ability to respond through a series of measures, including improving medical-related laws and regulations [21], improving the hospital environment and treatment procedures [22], improving nurses’ communication ability [23], and focusing on WPV training [24]. However, a review of the current domestic and foreign literature found that the incidence of WPV among nurses remains high [25, 26]. Some scholars [27] have pointed out that due to the lack of long-term tracking data on the occurrence of WPV among nurses, the existing prevention and intervention measures lack pertinence. A study by Spelten et al. [28] pointed out that reducing the incidence of WPV first requires a comprehensive understanding of the dynamic development process of violence toward nurses, including by determining the frequency and intensity of WPV events and assessing the long-term results of violence on staff. However, most of the existing WPV studies are short-term status surveys, and few studies continuously compare the WPV status and characteristics of nurses in a certain region. This study aimed to analyze the current situation and characteristics of WPV among nurses in Suzhou general hospitals from 2010 to 2019 to provide information that can help hospital managers understand the status quo of WPV among nurses and trends in WPV over time.", "Study design In this cross-sectional study, structured questionnaires were used to investigate the occurrence of WPV among nurses in 6 general hospitals in Suzhou in 2010, 2015 and 2019.\nIn this cross-sectional study, structured questionnaires were used to investigate the occurrence of WPV among nurses in 6 general hospitals in Suzhou in 2010, 2015 and 2019.\nParticipants A total of 942, 2,110 and 2,566 clinical nurses were selected from Suzhou general hospitals in November of each year in 2010, 2015 and 2019, respectively, by the convenience sampling method.\nA total of 942, 2,110 and 2,566 clinical nurses were selected from Suzhou general hospitals in November of each year in 2010, 2015 and 2019, respectively, by the convenience sampling method.\nInclusion criteria (1) Employment as in-service nurses in clinical departments who had direct contact with patients in their daily work.\n(2) Professional certification.\n(3) Completion of at least 1 year of clinical nursing work.\n (4) Provision of a signed informed consent form and voluntary participation in the study.\n(1) Employment as in-service nurses in clinical departments who had direct contact with patients in their daily work.\n(2) Professional certification.\n(3) Completion of at least 1 year of clinical nursing work.\n (4) Provision of a signed informed consent form and voluntary participation in the study.\nExclusion criteria (1) Nurses off-duty during the investigation, e.g., on maternity leave, sick leave, or vacation.\n(2) Non-regular nurses and personnel undergoing refresher training in our hospital.\n(1) Nurses off-duty during the investigation, e.g., on maternity leave, sick leave, or vacation.\n(2) Non-regular nurses and personnel undergoing refresher training in our hospital.\nEthics approval The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University in China (No. 2,018,062). The participants were made aware of the aim and procedures of the study, and they all signed an informed consent form. The researchers guaranteed the confidentiality of the subjects’ information and that it would be used only for research purposes. The voluntary principle was always followed during the study, and the participants could leave the study at any time.\n The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University in China (No. 2,018,062). The participants were made aware of the aim and procedures of the study, and they all signed an informed consent form. The researchers guaranteed the confidentiality of the subjects’ information and that it would be used only for research purposes. The voluntary principle was always followed during the study, and the participants could leave the study at any time.", "In this cross-sectional study, structured questionnaires were used to investigate the occurrence of WPV among nurses in 6 general hospitals in Suzhou in 2010, 2015 and 2019.", "A total of 942, 2,110 and 2,566 clinical nurses were selected from Suzhou general hospitals in November of each year in 2010, 2015 and 2019, respectively, by the convenience sampling method.", "(1) Employment as in-service nurses in clinical departments who had direct contact with patients in their daily work.\n(2) Professional certification.\n(3) Completion of at least 1 year of clinical nursing work.\n (4) Provision of a signed informed consent form and voluntary participation in the study.", "(1) Nurses off-duty during the investigation, e.g., on maternity leave, sick leave, or vacation.\n(2) Non-regular nurses and personnel undergoing refresher training in our hospital.", " The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University in China (No. 2,018,062). The participants were made aware of the aim and procedures of the study, and they all signed an informed consent form. The researchers guaranteed the confidentiality of the subjects’ information and that it would be used only for research purposes. The voluntary principle was always followed during the study, and the participants could leave the study at any time.", "General information questionnaire The questionnaire was designed by the research group to suit the research purpose and collected information on gender, age, education, whether an only child, marital status, hospital grade, department, years worked, employment type and professional title.\nThe questionnaire was designed by the research group to suit the research purpose and collected information on gender, age, education, whether an only child, marital status, hospital grade, department, years worked, employment type and professional title.\nRevised version of the hospital WPV questionnaire The questionnaire designed by Shengyong Wang [29] of Jinan University includes 33 entries in 4 dimensions: the frequency of WPV occurrence in the past year, the most impressive WPV experience in the past year, cognition and attitudes toward WPV, and the attitudes and responses of hospitals to WPV. The questionnaire has been widely used in clinical practice. The questionnaire has good reliability and validity; the test-retest reliability of the questionnaire was 0.803, and the average content validity of each item was 0.916.\nThe questionnaire designed by Shengyong Wang [29] of Jinan University includes 33 entries in 4 dimensions: the frequency of WPV occurrence in the past year, the most impressive WPV experience in the past year, cognition and attitudes toward WPV, and the attitudes and responses of hospitals to WPV. The questionnaire has been widely used in clinical practice. The questionnaire has good reliability and validity; the test-retest reliability of the questionnaire was 0.803, and the average content validity of each item was 0.916.\nData collection Two weeks before the beginning of the study, the head of the research team (which included 2 postgraduate tutors, 6 postgraduates, and 4 undergraduates) contacted the managers of each hospital by telephone or e-mail to request the support of the corresponding person in charge for the study and published a notice on each hospital website to recruit participants to participate in the survey. The contents of the notice included the location, time, purpose, significance, confidentiality principle and precautions of the questionnaire. If nurses were willing to participate in the survey, they could go to a designated conference room to receive the questionnaire and complete it anonymously. Each hospital was equipped with 2 research team members. If a nurse had any questions during completion of the questionnaire, the project team members could give guidance at any time. After completing the questionnaire, the nurse placed it into the questionnaire recovery box in the conference room. At 6:00 p.m., after the nurses had completed the questionnaires, the questionnaire recovery box was sealed by the members of the research group and sent to the questionnaire archives of the research group for safekeeping.\nTwo weeks before the beginning of the study, the head of the research team (which included 2 postgraduate tutors, 6 postgraduates, and 4 undergraduates) contacted the managers of each hospital by telephone or e-mail to request the support of the corresponding person in charge for the study and published a notice on each hospital website to recruit participants to participate in the survey. The contents of the notice included the location, time, purpose, significance, confidentiality principle and precautions of the questionnaire. If nurses were willing to participate in the survey, they could go to a designated conference room to receive the questionnaire and complete it anonymously. Each hospital was equipped with 2 research team members. If a nurse had any questions during completion of the questionnaire, the project team members could give guidance at any time. After completing the questionnaire, the nurse placed it into the questionnaire recovery box in the conference room. At 6:00 p.m., after the nurses had completed the questionnaires, the questionnaire recovery box was sealed by the members of the research group and sent to the questionnaire archives of the research group for safekeeping.\nStatistical analysis Data management and analysis were performed using SPSS 18.0. The count data are described as frequencies and percentages, and the quantitative data are reported as means and standard deviations. The chi-square test was used to analyze the general data of the nurses from the different time periods, the incidence of WPV, nurses’ cognition and attitudes regarding WPV and the hospitals’ attitudes toward WPV and corresponding measures. The Mann-Whitney U test was used to analyze the demographic data. Statistical significance was set at P<0.05.\nData management and analysis were performed using SPSS 18.0. The count data are described as frequencies and percentages, and the quantitative data are reported as means and standard deviations. The chi-square test was used to analyze the general data of the nurses from the different time periods, the incidence of WPV, nurses’ cognition and attitudes regarding WPV and the hospitals’ attitudes toward WPV and corresponding measures. The Mann-Whitney U test was used to analyze the demographic data. Statistical significance was set at P<0.05.", "The questionnaire was designed by the research group to suit the research purpose and collected information on gender, age, education, whether an only child, marital status, hospital grade, department, years worked, employment type and professional title.", "The questionnaire designed by Shengyong Wang [29] of Jinan University includes 33 entries in 4 dimensions: the frequency of WPV occurrence in the past year, the most impressive WPV experience in the past year, cognition and attitudes toward WPV, and the attitudes and responses of hospitals to WPV. The questionnaire has been widely used in clinical practice. The questionnaire has good reliability and validity; the test-retest reliability of the questionnaire was 0.803, and the average content validity of each item was 0.916.", "Two weeks before the beginning of the study, the head of the research team (which included 2 postgraduate tutors, 6 postgraduates, and 4 undergraduates) contacted the managers of each hospital by telephone or e-mail to request the support of the corresponding person in charge for the study and published a notice on each hospital website to recruit participants to participate in the survey. The contents of the notice included the location, time, purpose, significance, confidentiality principle and precautions of the questionnaire. If nurses were willing to participate in the survey, they could go to a designated conference room to receive the questionnaire and complete it anonymously. Each hospital was equipped with 2 research team members. If a nurse had any questions during completion of the questionnaire, the project team members could give guidance at any time. After completing the questionnaire, the nurse placed it into the questionnaire recovery box in the conference room. At 6:00 p.m., after the nurses had completed the questionnaires, the questionnaire recovery box was sealed by the members of the research group and sent to the questionnaire archives of the research group for safekeeping.", "Data management and analysis were performed using SPSS 18.0. The count data are described as frequencies and percentages, and the quantitative data are reported as means and standard deviations. The chi-square test was used to analyze the general data of the nurses from the different time periods, the incidence of WPV, nurses’ cognition and attitudes regarding WPV and the hospitals’ attitudes toward WPV and corresponding measures. The Mann-Whitney U test was used to analyze the demographic data. Statistical significance was set at P<0.05.", "Questionnaire response rate In 2010, 2015 and 2019, 1,000, 2,132 and 2,700 questionnaires were distributed, respectively, and 942, 2,110 and 2,566 effective questionnaires were actually recovered, for effective response rates of 94.20 %, 98.97 % and 95.04 %.\nIn 2010, 2015 and 2019, 1,000, 2,132 and 2,700 questionnaires were distributed, respectively, and 942, 2,110 and 2,566 effective questionnaires were actually recovered, for effective response rates of 94.20 %, 98.97 % and 95.04 %.\nNurses’ general information A total of 5,618 nurses completed the three surveys, including 388 emergency nurses, 618 outpatient nurses and 4,612 ward nurses. The age of the respondents ranged from 20 to 63 years, with an average age of 31.41 ± 5.82 years, and the proportion of respondents < 30 years old was 51.6 %. The number of years worked ranged from 1 to 37, with the average being 8.85 ± 7.45 years. Of the respondents, 23.2 % had worked ≤ 5 years; 52.8 % had a bachelor’s degree; and 42.7 % had junior professional titles. The demographic characteristics are presented in Table 1.\n\nTable 1Comparison of the demographic characteristics of the nurses, n (%)ItemsCategories201020152019χ2/ZPAge (Years)<30506 (53.7)1080 (51.2)1311 (51.1)16.915*0.01030~39348 (36.9)737 (34.9)933 (36.4)40~4975 (8.0)236 (11.2)278 (10.8)≥5013 (1.4)57 (2.7)44 (1.7)GenderFemale894 (94.9)2049 (97.1)2396(93.4)34.249<0.001Male48 (5.1)61 (2.9)170(6.6)Marital statusMarried605 (64.2)1430 (67.8)1628 (63.4)17.2570.002Single337 (35.8)665 (31.5)922 (35.9)Other0 (0.0)15 (0.7)16 (0.6)Only childYes392 (41.6)1098 (52.0)1291 (50.3)29.551<0.001No550 (58.4)1012 (48.0)1275 (49.7)Education levelTechnical secondary degree or below62 (6.6)63 (3.0)33 (1.3)385.760*<0.001Junior college568 (60.3)1008 (47.8)811 (31.6)Bachelor’s degree305 (32.4)1019 (48.3)1656 (64.5)Master’s degree or above7 (0.7)20 (0.9)66 (2.6)Years worked≤5194 (20.6)381 (18.1)726 (28.3)85.897*<0.0016~10294 (31.2)775 (36.7)847 (33.0)11~15204 (21.7)384 (18.2)428 (16.7)≥16250 (26.5)570 (27.0)565 (22.0)Professional titleSenior324 (34.4)687 (32.6)592 (23.1)120.281*<0.001Medium288 (30.6)640 (30.3)688 (26.8)Junior330 (30.5)783 (37.1)1286 (50.1)PostNurse901 (95.6)1977 (93.7)2432 (94.8)5.4010.067Head nurse41 (4.4)133 (6.3)134 (5.2)Employment typeOfficial staff495 (52.5)1068 (50.6)1213 (47.3)9.8780.043Contract staff437 (46.4)1016 (48.2)1317 (51.3)Temporary staff10 (1.1)26 (1.2)36 (1.4)DepartmentEmergency59 (6.3)168 (8.0)161 (6.3)77.396<0.001Outpatient159 (16.9)265 (12.6)194 (7.6)Ward724 (76.9)1677 (79.5)2211 (86.2)*: The Mann-Whitney U test was used\nComparison of the demographic characteristics of the nurses, n (%)\n*: The Mann-Whitney U test was used\nA total of 5,618 nurses completed the three surveys, including 388 emergency nurses, 618 outpatient nurses and 4,612 ward nurses. The age of the respondents ranged from 20 to 63 years, with an average age of 31.41 ± 5.82 years, and the proportion of respondents < 30 years old was 51.6 %. The number of years worked ranged from 1 to 37, with the average being 8.85 ± 7.45 years. Of the respondents, 23.2 % had worked ≤ 5 years; 52.8 % had a bachelor’s degree; and 42.7 % had junior professional titles. The demographic characteristics are presented in Table 1.\n\nTable 1Comparison of the demographic characteristics of the nurses, n (%)ItemsCategories201020152019χ2/ZPAge (Years)<30506 (53.7)1080 (51.2)1311 (51.1)16.915*0.01030~39348 (36.9)737 (34.9)933 (36.4)40~4975 (8.0)236 (11.2)278 (10.8)≥5013 (1.4)57 (2.7)44 (1.7)GenderFemale894 (94.9)2049 (97.1)2396(93.4)34.249<0.001Male48 (5.1)61 (2.9)170(6.6)Marital statusMarried605 (64.2)1430 (67.8)1628 (63.4)17.2570.002Single337 (35.8)665 (31.5)922 (35.9)Other0 (0.0)15 (0.7)16 (0.6)Only childYes392 (41.6)1098 (52.0)1291 (50.3)29.551<0.001No550 (58.4)1012 (48.0)1275 (49.7)Education levelTechnical secondary degree or below62 (6.6)63 (3.0)33 (1.3)385.760*<0.001Junior college568 (60.3)1008 (47.8)811 (31.6)Bachelor’s degree305 (32.4)1019 (48.3)1656 (64.5)Master’s degree or above7 (0.7)20 (0.9)66 (2.6)Years worked≤5194 (20.6)381 (18.1)726 (28.3)85.897*<0.0016~10294 (31.2)775 (36.7)847 (33.0)11~15204 (21.7)384 (18.2)428 (16.7)≥16250 (26.5)570 (27.0)565 (22.0)Professional titleSenior324 (34.4)687 (32.6)592 (23.1)120.281*<0.001Medium288 (30.6)640 (30.3)688 (26.8)Junior330 (30.5)783 (37.1)1286 (50.1)PostNurse901 (95.6)1977 (93.7)2432 (94.8)5.4010.067Head nurse41 (4.4)133 (6.3)134 (5.2)Employment typeOfficial staff495 (52.5)1068 (50.6)1213 (47.3)9.8780.043Contract staff437 (46.4)1016 (48.2)1317 (51.3)Temporary staff10 (1.1)26 (1.2)36 (1.4)DepartmentEmergency59 (6.3)168 (8.0)161 (6.3)77.396<0.001Outpatient159 (16.9)265 (12.6)194 (7.6)Ward724 (76.9)1677 (79.5)2211 (86.2)*: The Mann-Whitney U test was used\nComparison of the demographic characteristics of the nurses, n (%)\n*: The Mann-Whitney U test was used\nIncidence of WPV among nurses in 2010, 2015, and 2019 The incidence of WPV among nurses was 62.4 % in 2010, 69.0 % in 2015 and 68.4 % in 2019 (P=0.001). Compared with that in 2010, the incidence increased significantly in 2015 and 2019 (P<0.001, P=0.001). The details are shown in Table 2.\n\nTable 2Comparison of the incidence of WPV among nurses in different years, n (%)YearQuantityNot exposed to WPVExposed to WPVχ2PT1 (2010)942354 (37.6)588 (62.4)13.9790.001T2 (2015)2110655 (31.0)1455 (69.0)T3 (2019)2566812 (31.6)1754 (68.4)Multiple comparisonPT1−T212.575<0.001PT1−T310.9380.001PT2−T30.1950.681\nComparison of the incidence of WPV among nurses in different years, n (%)\nThe incidence of WPV among nurses was 62.4 % in 2010, 69.0 % in 2015 and 68.4 % in 2019 (P=0.001). Compared with that in 2010, the incidence increased significantly in 2015 and 2019 (P<0.001, P=0.001). The details are shown in Table 2.\n\nTable 2Comparison of the incidence of WPV among nurses in different years, n (%)YearQuantityNot exposed to WPVExposed to WPVχ2PT1 (2010)942354 (37.6)588 (62.4)13.9790.001T2 (2015)2110655 (31.0)1455 (69.0)T3 (2019)2566812 (31.6)1754 (68.4)Multiple comparisonPT1−T212.575<0.001PT1−T310.9380.001PT2−T30.1950.681\nComparison of the incidence of WPV among nurses in different years, n (%)\nIncidence of different forms of WPV among nurses in 2010, 2015, and 2019 According to the current situation of WPV toward nurses in different years, the proportion of nurses who experienced sexual harassment (4.1 %) was the highest in 2010. The proportion of people who suffered verbal abuse (66.2 %) and threats (46.3 %) was the highest in 2015. Physical assault (13.1 %) was the highest in 2019. The overall comparison of WPV in different years and of different types showed significant differences (P<0.05). Further multiple comparisons of the data showed that there were highly statistically significant differences between the total number of WPV incidents in 2010 and 2015 and between the number of physical assault incidents in 2015 and 2019 (P<0.001). The details are shown in Table 3\n\nTable 3Comparison of different forms of WPV among nurses in different years, n (%)YearQuantityExposed to WPVVerbal abuseVerbal threatPhysical assaultSexual harassmentT1 (2010)942588 (62.4)570 (60.5)387 (41.1)93 (9.9)39 (4.1)T2 (2015)21101455 (69.0)1396 (66.2)977 (46.3)211 (10.0)55 (2.6)T3 (2019)25661754 (68.4)1651 (64.3)1116 (43.5)335 (13.1)102 (4.0)χ213.97928.58819.42326.86516.185P0.001<0.0010.004<0.0010.013Multiple comparisonPT1-T2<0.0010.0120.4400.2320.025T1-T30.0010.0050.2500.0480.303T2-T30.6810.0010.020<0.0010.010\nComparison of different forms of WPV among nurses in different years, n (%)\nAccording to the current situation of WPV toward nurses in different years, the proportion of nurses who experienced sexual harassment (4.1 %) was the highest in 2010. The proportion of people who suffered verbal abuse (66.2 %) and threats (46.3 %) was the highest in 2015. Physical assault (13.1 %) was the highest in 2019. The overall comparison of WPV in different years and of different types showed significant differences (P<0.05). Further multiple comparisons of the data showed that there were highly statistically significant differences between the total number of WPV incidents in 2010 and 2015 and between the number of physical assault incidents in 2015 and 2019 (P<0.001). The details are shown in Table 3\n\nTable 3Comparison of different forms of WPV among nurses in different years, n (%)YearQuantityExposed to WPVVerbal abuseVerbal threatPhysical assaultSexual harassmentT1 (2010)942588 (62.4)570 (60.5)387 (41.1)93 (9.9)39 (4.1)T2 (2015)21101455 (69.0)1396 (66.2)977 (46.3)211 (10.0)55 (2.6)T3 (2019)25661754 (68.4)1651 (64.3)1116 (43.5)335 (13.1)102 (4.0)χ213.97928.58819.42326.86516.185P0.001<0.0010.004<0.0010.013Multiple comparisonPT1-T2<0.0010.0120.4400.2320.025T1-T30.0010.0050.2500.0480.303T2-T30.6810.0010.020<0.0010.010\nComparison of different forms of WPV among nurses in different years, n (%)\nCognition and attitudes of nurses toward WPV in 2010, 2015 and 2019 Compared with the number in 2010, more nurses surveyed in 2015 and 2019 said that they had heard of WPV before, and the result was considered statistically significant (PT1−T2=0.020, PT1−T3=0.032). In 2010 and 2015, less about WPV was included in the nurses’ preservice training (PT1−T3=0.002, PT2−T3=0.001), but more nurses thought they would benefit from WPV training (PT1−T3=0.016, PT2−T3=0.010). The study also found that clinical nurses in 2015 and 2019 were more likely than nurses in 2010 to approve of hospitals setting up WPV processing facilities and to support a zero-tolerance policy toward WPV (P<0.001). In addition, more than 85 % of nurses involved in the three surveys expressed their willingness to attend WPV training and thought they would benefit from it. The details are shown in Table 4Table 4Comparison of cognition and attitudes toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Having heard of WPV beforeYes763 (81.0)1782 (84.5)2157 (84.7)6.1660.0460.0200.0320.717No179 (19.0)328 (15.5)916 (16.3)WPV is inevitable at workYes712 (75.6)1594 (75.5)1962 (76.5)0.6250.7321.0000.5910.470No230 (24.4)516 (24.5)604 (24.0)Thinking WPV is not worth the fussYes132 (14.0)264 (12.5)374 (14.6)4.2580.1190.2680.7040.044No810 (86.0)1846 (87.5)2192 (85.4)Thinking preservice training should include training programs on WPVYes922 (97.9)2058 (97.5)2457 (95.8)16.192<0.0010.6080.0020.001No20 (2.1)352 (2.5)109 (4.2)Willing to attend the WPV trainingYes874 (92.8)1968 (93.3)2405 (93.7)1.0830.5820.6420.3170.551No68 (7.2)142 (6.7)151 (6.3)Thinking training on WPV would be beneficialYes822 (87.3)1851 (87.7)2313 (90.1)9.2790.0100.7220.0160.010No120 (12.7)259 (12.3)253 (9.9)Thinking WPV coping management organizations are neededYes903 (95.9)2071 (98.2)2519 (98.2)19.082<0.001<0.001<0.0011.000No39 (4.1)39 (1.8)47 (1.8)Supporting a “zero-tolerance” policyYes618 (65.6)1882 (89.2)2310 (90.0)368.750<0.001<0.001<0.0010.360No324 (34.4)228 (10.8)256 (10.0)\nComparison of cognition and attitudes toward WPV among nurses in different years, n (%)\nCompared with the number in 2010, more nurses surveyed in 2015 and 2019 said that they had heard of WPV before, and the result was considered statistically significant (PT1−T2=0.020, PT1−T3=0.032). In 2010 and 2015, less about WPV was included in the nurses’ preservice training (PT1−T3=0.002, PT2−T3=0.001), but more nurses thought they would benefit from WPV training (PT1−T3=0.016, PT2−T3=0.010). The study also found that clinical nurses in 2015 and 2019 were more likely than nurses in 2010 to approve of hospitals setting up WPV processing facilities and to support a zero-tolerance policy toward WPV (P<0.001). In addition, more than 85 % of nurses involved in the three surveys expressed their willingness to attend WPV training and thought they would benefit from it. The details are shown in Table 4Table 4Comparison of cognition and attitudes toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Having heard of WPV beforeYes763 (81.0)1782 (84.5)2157 (84.7)6.1660.0460.0200.0320.717No179 (19.0)328 (15.5)916 (16.3)WPV is inevitable at workYes712 (75.6)1594 (75.5)1962 (76.5)0.6250.7321.0000.5910.470No230 (24.4)516 (24.5)604 (24.0)Thinking WPV is not worth the fussYes132 (14.0)264 (12.5)374 (14.6)4.2580.1190.2680.7040.044No810 (86.0)1846 (87.5)2192 (85.4)Thinking preservice training should include training programs on WPVYes922 (97.9)2058 (97.5)2457 (95.8)16.192<0.0010.6080.0020.001No20 (2.1)352 (2.5)109 (4.2)Willing to attend the WPV trainingYes874 (92.8)1968 (93.3)2405 (93.7)1.0830.5820.6420.3170.551No68 (7.2)142 (6.7)151 (6.3)Thinking training on WPV would be beneficialYes822 (87.3)1851 (87.7)2313 (90.1)9.2790.0100.7220.0160.010No120 (12.7)259 (12.3)253 (9.9)Thinking WPV coping management organizations are neededYes903 (95.9)2071 (98.2)2519 (98.2)19.082<0.001<0.001<0.0011.000No39 (4.1)39 (1.8)47 (1.8)Supporting a “zero-tolerance” policyYes618 (65.6)1882 (89.2)2310 (90.0)368.750<0.001<0.001<0.0010.360No324 (34.4)228 (10.8)256 (10.0)\nComparison of cognition and attitudes toward WPV among nurses in different years, n (%)\nAttitudes and responses of hospitals to WPV towards nurses in 2010, 2015 and 2019 This study found that in the past 9 years, the hospitals’ attitudes and responses to WPV towards nurses have greatly improved, as indicated by improvements in five aspects, namely, “offering training”, “encouraging reporting of WPV to supervisors”, “equipped with a WPV management department”, “handling WPV efficiently”, and “hospital’s attitudes” (P<0.001). However, most hospitals still have not developed training. Regarding hospitals’ emphasis on WPV, hospitals paid more attention to WPV toward physicians (P=0.013). The details are shown in Table 5\n\nTable 5Comparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Offering trainingYes91 (9.7)487 (23.1)840 (32.7)202.794<0.001<0.001<0.001<0.001No851 (90.3)1623 (76.9)1726 (67.3)Encouraging reporting of WPV to supervisorsYes585 (62.1)1575 (74.6)1849 (72.1)51.255<0.001<0.001<0.0010.050No357 (37.9)535 (25.4)717 (27.9)Equipped with WPV management departmentYes432 (45.9)1215 (57.6)1451 (56.5)39.942<0.001<0.001<0.0010.495No510 (54.1)895 (42.4)1115 (43.5)Handling WPV efficientlyYes264 (28.0)791 (37.5)1193 (46.5)106.884<0.001<0.001<0.001<0.001No678 (72.0)1319 (62.5)1373 (53.5)Hospital’s attitudesProtecting the interests of staff91 (9.7)574 (27.2)775 (30.2)283.785<0.001<0.001<0.001<0.001Handling WPV fairly based on the facts425 (45.1)855 (40.5)1194 (46.5)Turning a blind eye283 (30.0)549 (26.0)470 (18.3)Punishing staff regardless of the cause143 (15.2)132 (6.3)127 (4.9)Degree of emphasisPhysician>Nurse403 (42.8)959 (45.5)1117 (43.5)12.6490.0130.002<0.0010.346Nurse>Physician0 (0.0)22 (1.0)23 (0.9)Physician=Nurse539 (57.2)1129 (53.5)1426 (55.6)\nComparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)\nThis study found that in the past 9 years, the hospitals’ attitudes and responses to WPV towards nurses have greatly improved, as indicated by improvements in five aspects, namely, “offering training”, “encouraging reporting of WPV to supervisors”, “equipped with a WPV management department”, “handling WPV efficiently”, and “hospital’s attitudes” (P<0.001). However, most hospitals still have not developed training. Regarding hospitals’ emphasis on WPV, hospitals paid more attention to WPV toward physicians (P=0.013). The details are shown in Table 5\n\nTable 5Comparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Offering trainingYes91 (9.7)487 (23.1)840 (32.7)202.794<0.001<0.001<0.001<0.001No851 (90.3)1623 (76.9)1726 (67.3)Encouraging reporting of WPV to supervisorsYes585 (62.1)1575 (74.6)1849 (72.1)51.255<0.001<0.001<0.0010.050No357 (37.9)535 (25.4)717 (27.9)Equipped with WPV management departmentYes432 (45.9)1215 (57.6)1451 (56.5)39.942<0.001<0.001<0.0010.495No510 (54.1)895 (42.4)1115 (43.5)Handling WPV efficientlyYes264 (28.0)791 (37.5)1193 (46.5)106.884<0.001<0.001<0.001<0.001No678 (72.0)1319 (62.5)1373 (53.5)Hospital’s attitudesProtecting the interests of staff91 (9.7)574 (27.2)775 (30.2)283.785<0.001<0.001<0.001<0.001Handling WPV fairly based on the facts425 (45.1)855 (40.5)1194 (46.5)Turning a blind eye283 (30.0)549 (26.0)470 (18.3)Punishing staff regardless of the cause143 (15.2)132 (6.3)127 (4.9)Degree of emphasisPhysician>Nurse403 (42.8)959 (45.5)1117 (43.5)12.6490.0130.002<0.0010.346Nurse>Physician0 (0.0)22 (1.0)23 (0.9)Physician=Nurse539 (57.2)1129 (53.5)1426 (55.6)\nComparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)", "In 2010, 2015 and 2019, 1,000, 2,132 and 2,700 questionnaires were distributed, respectively, and 942, 2,110 and 2,566 effective questionnaires were actually recovered, for effective response rates of 94.20 %, 98.97 % and 95.04 %.", "A total of 5,618 nurses completed the three surveys, including 388 emergency nurses, 618 outpatient nurses and 4,612 ward nurses. The age of the respondents ranged from 20 to 63 years, with an average age of 31.41 ± 5.82 years, and the proportion of respondents < 30 years old was 51.6 %. The number of years worked ranged from 1 to 37, with the average being 8.85 ± 7.45 years. Of the respondents, 23.2 % had worked ≤ 5 years; 52.8 % had a bachelor’s degree; and 42.7 % had junior professional titles. The demographic characteristics are presented in Table 1.\n\nTable 1Comparison of the demographic characteristics of the nurses, n (%)ItemsCategories201020152019χ2/ZPAge (Years)<30506 (53.7)1080 (51.2)1311 (51.1)16.915*0.01030~39348 (36.9)737 (34.9)933 (36.4)40~4975 (8.0)236 (11.2)278 (10.8)≥5013 (1.4)57 (2.7)44 (1.7)GenderFemale894 (94.9)2049 (97.1)2396(93.4)34.249<0.001Male48 (5.1)61 (2.9)170(6.6)Marital statusMarried605 (64.2)1430 (67.8)1628 (63.4)17.2570.002Single337 (35.8)665 (31.5)922 (35.9)Other0 (0.0)15 (0.7)16 (0.6)Only childYes392 (41.6)1098 (52.0)1291 (50.3)29.551<0.001No550 (58.4)1012 (48.0)1275 (49.7)Education levelTechnical secondary degree or below62 (6.6)63 (3.0)33 (1.3)385.760*<0.001Junior college568 (60.3)1008 (47.8)811 (31.6)Bachelor’s degree305 (32.4)1019 (48.3)1656 (64.5)Master’s degree or above7 (0.7)20 (0.9)66 (2.6)Years worked≤5194 (20.6)381 (18.1)726 (28.3)85.897*<0.0016~10294 (31.2)775 (36.7)847 (33.0)11~15204 (21.7)384 (18.2)428 (16.7)≥16250 (26.5)570 (27.0)565 (22.0)Professional titleSenior324 (34.4)687 (32.6)592 (23.1)120.281*<0.001Medium288 (30.6)640 (30.3)688 (26.8)Junior330 (30.5)783 (37.1)1286 (50.1)PostNurse901 (95.6)1977 (93.7)2432 (94.8)5.4010.067Head nurse41 (4.4)133 (6.3)134 (5.2)Employment typeOfficial staff495 (52.5)1068 (50.6)1213 (47.3)9.8780.043Contract staff437 (46.4)1016 (48.2)1317 (51.3)Temporary staff10 (1.1)26 (1.2)36 (1.4)DepartmentEmergency59 (6.3)168 (8.0)161 (6.3)77.396<0.001Outpatient159 (16.9)265 (12.6)194 (7.6)Ward724 (76.9)1677 (79.5)2211 (86.2)*: The Mann-Whitney U test was used\nComparison of the demographic characteristics of the nurses, n (%)\n*: The Mann-Whitney U test was used", "The incidence of WPV among nurses was 62.4 % in 2010, 69.0 % in 2015 and 68.4 % in 2019 (P=0.001). Compared with that in 2010, the incidence increased significantly in 2015 and 2019 (P<0.001, P=0.001). The details are shown in Table 2.\n\nTable 2Comparison of the incidence of WPV among nurses in different years, n (%)YearQuantityNot exposed to WPVExposed to WPVχ2PT1 (2010)942354 (37.6)588 (62.4)13.9790.001T2 (2015)2110655 (31.0)1455 (69.0)T3 (2019)2566812 (31.6)1754 (68.4)Multiple comparisonPT1−T212.575<0.001PT1−T310.9380.001PT2−T30.1950.681\nComparison of the incidence of WPV among nurses in different years, n (%)", "According to the current situation of WPV toward nurses in different years, the proportion of nurses who experienced sexual harassment (4.1 %) was the highest in 2010. The proportion of people who suffered verbal abuse (66.2 %) and threats (46.3 %) was the highest in 2015. Physical assault (13.1 %) was the highest in 2019. The overall comparison of WPV in different years and of different types showed significant differences (P<0.05). Further multiple comparisons of the data showed that there were highly statistically significant differences between the total number of WPV incidents in 2010 and 2015 and between the number of physical assault incidents in 2015 and 2019 (P<0.001). The details are shown in Table 3\n\nTable 3Comparison of different forms of WPV among nurses in different years, n (%)YearQuantityExposed to WPVVerbal abuseVerbal threatPhysical assaultSexual harassmentT1 (2010)942588 (62.4)570 (60.5)387 (41.1)93 (9.9)39 (4.1)T2 (2015)21101455 (69.0)1396 (66.2)977 (46.3)211 (10.0)55 (2.6)T3 (2019)25661754 (68.4)1651 (64.3)1116 (43.5)335 (13.1)102 (4.0)χ213.97928.58819.42326.86516.185P0.001<0.0010.004<0.0010.013Multiple comparisonPT1-T2<0.0010.0120.4400.2320.025T1-T30.0010.0050.2500.0480.303T2-T30.6810.0010.020<0.0010.010\nComparison of different forms of WPV among nurses in different years, n (%)", "Compared with the number in 2010, more nurses surveyed in 2015 and 2019 said that they had heard of WPV before, and the result was considered statistically significant (PT1−T2=0.020, PT1−T3=0.032). In 2010 and 2015, less about WPV was included in the nurses’ preservice training (PT1−T3=0.002, PT2−T3=0.001), but more nurses thought they would benefit from WPV training (PT1−T3=0.016, PT2−T3=0.010). The study also found that clinical nurses in 2015 and 2019 were more likely than nurses in 2010 to approve of hospitals setting up WPV processing facilities and to support a zero-tolerance policy toward WPV (P<0.001). In addition, more than 85 % of nurses involved in the three surveys expressed their willingness to attend WPV training and thought they would benefit from it. The details are shown in Table 4Table 4Comparison of cognition and attitudes toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Having heard of WPV beforeYes763 (81.0)1782 (84.5)2157 (84.7)6.1660.0460.0200.0320.717No179 (19.0)328 (15.5)916 (16.3)WPV is inevitable at workYes712 (75.6)1594 (75.5)1962 (76.5)0.6250.7321.0000.5910.470No230 (24.4)516 (24.5)604 (24.0)Thinking WPV is not worth the fussYes132 (14.0)264 (12.5)374 (14.6)4.2580.1190.2680.7040.044No810 (86.0)1846 (87.5)2192 (85.4)Thinking preservice training should include training programs on WPVYes922 (97.9)2058 (97.5)2457 (95.8)16.192<0.0010.6080.0020.001No20 (2.1)352 (2.5)109 (4.2)Willing to attend the WPV trainingYes874 (92.8)1968 (93.3)2405 (93.7)1.0830.5820.6420.3170.551No68 (7.2)142 (6.7)151 (6.3)Thinking training on WPV would be beneficialYes822 (87.3)1851 (87.7)2313 (90.1)9.2790.0100.7220.0160.010No120 (12.7)259 (12.3)253 (9.9)Thinking WPV coping management organizations are neededYes903 (95.9)2071 (98.2)2519 (98.2)19.082<0.001<0.001<0.0011.000No39 (4.1)39 (1.8)47 (1.8)Supporting a “zero-tolerance” policyYes618 (65.6)1882 (89.2)2310 (90.0)368.750<0.001<0.001<0.0010.360No324 (34.4)228 (10.8)256 (10.0)\nComparison of cognition and attitudes toward WPV among nurses in different years, n (%)", "This study found that in the past 9 years, the hospitals’ attitudes and responses to WPV towards nurses have greatly improved, as indicated by improvements in five aspects, namely, “offering training”, “encouraging reporting of WPV to supervisors”, “equipped with a WPV management department”, “handling WPV efficiently”, and “hospital’s attitudes” (P<0.001). However, most hospitals still have not developed training. Regarding hospitals’ emphasis on WPV, hospitals paid more attention to WPV toward physicians (P=0.013). The details are shown in Table 5\n\nTable 5Comparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)ItemsCategories201020152019χ2PP(T1)(T2)(T3)T1-T2T1-T3T2-T3Offering trainingYes91 (9.7)487 (23.1)840 (32.7)202.794<0.001<0.001<0.001<0.001No851 (90.3)1623 (76.9)1726 (67.3)Encouraging reporting of WPV to supervisorsYes585 (62.1)1575 (74.6)1849 (72.1)51.255<0.001<0.001<0.0010.050No357 (37.9)535 (25.4)717 (27.9)Equipped with WPV management departmentYes432 (45.9)1215 (57.6)1451 (56.5)39.942<0.001<0.001<0.0010.495No510 (54.1)895 (42.4)1115 (43.5)Handling WPV efficientlyYes264 (28.0)791 (37.5)1193 (46.5)106.884<0.001<0.001<0.001<0.001No678 (72.0)1319 (62.5)1373 (53.5)Hospital’s attitudesProtecting the interests of staff91 (9.7)574 (27.2)775 (30.2)283.785<0.001<0.001<0.001<0.001Handling WPV fairly based on the facts425 (45.1)855 (40.5)1194 (46.5)Turning a blind eye283 (30.0)549 (26.0)470 (18.3)Punishing staff regardless of the cause143 (15.2)132 (6.3)127 (4.9)Degree of emphasisPhysician>Nurse403 (42.8)959 (45.5)1117 (43.5)12.6490.0130.002<0.0010.346Nurse>Physician0 (0.0)22 (1.0)23 (0.9)Physician=Nurse539 (57.2)1129 (53.5)1426 (55.6)\nComparison of attitudes and responses of hospitals toward WPV among nurses in different years, n (%)", "This study found that the overall incidence of WPV towards nurses in Suzhou general hospitals gradually increased from 62.4 to 68.4 % from 2010 to 2019 and significantly increased from 2010 to 2015. There were significant differences at first (P<0.05), but then a plateau was reached (P>0.05). The incidence reported here is lower than the overall WPV incidence of 76 % among 762 registered nurses identified in a study from the U.S. [30], higher than the incidence reported in a study conducted in Botswana (44.1 %) [31], and similar to the incidence reported in a study by Ren et al. (68.1 %) [32]. The incidence of WPV towards nurses varies by country, region, social background and sample size. However, the phenomenon of WPV against nurses has become increasingly common at home and abroad, in developing countries and developed countries. A comparison of the types of WPV nurses experience across the three study years showed that “verbal abuse” is the most common form of WPV, which is consistent with most surveys [33–36]. Verbal abuse and threats showed an upward trend and then a downward trend from 2010 to 2019, with the highest incidence in 2015. This was possibly related to the greater emphasis of hospitals on the training of nurses’ service attitudes and communication skills in recent years. To reduce the incidence of verbal abuse or threats, hospital management developed training on coping and communication strategies for nurses, including using amiable words, putting themselves in patients’ shoes and listening to the needs of patients from the patients’ point of view so that patients could feel understood and respected. However, the lack of corresponding legal constraints on verbal violence led to nurses being unable to obtain timely evidence and a fair hearing after experiencing this type of WPV, which made verbal violence hard to intervene in and prevent. The results of this survey showed that the incidence of physical assault against nurses has gradually increased over the past nine years. Though the incidence of physical violence was relatively low between 2010 and 2015 (P>0.05), the incidence of physical assault increased significantly from 2015 to 2019 (P<0.001). With the development of the economy and the improvement of living standards, people’s demand for medical treatment has changed; people are not satisfied with only cure of the disease itself but are increasingly attentive to the overall effect of treatment and attach increasing importance to the experience of the treatment process. When patients and their relatives have unpleasant experiences or their requirements are not met during medical treatment, it is easy for conflicts to arise between nurses and patients. If the hospital treatment system or process is not perfect, such conflict is likely to escalate and induce physical aggression. It is recommended that hospital management give attention to the various forms of WPV while focusing on the service attitude, the patient’s medical experience and the transformation of the service process. Hospital management should focus on not only implementing policies but also establishing hospital security forces and an effective cooperation mechanism between hospitals and public security systems, implementing measures such as increasing patrol times, improving security inspections, prohibiting the carrying of sharp or dangerous goods into hospitals and developing security training for staff [37]. Such practices would allow a hospital to intervene immediately in the event of violence, ensure the safety of medical personnel and reduce the occurrence of violence through multi-sector coordination. It was shown that the incidence of sexual harassment among nurses had a decreasing trend and then an increasing trend over time, with the incidence being basically flat in 2010 and 2019, which was due to the improvement of laws and the health care system in recent years. Since 2014, China has issued a series of laws and regulations, such as the Regulations on the Prevention and Treatment of Medical Disputes, the Memorandum of Cooperation on Joint Punishment of Persons who seriously endanger the Normal Medical Order, and the Basic Medical and Health Promotion Law, which have played a positive role in protecting legitimate rights by law, deterring illegal acts targeting medical staff and institutions and maintaining the order of hospitals. However, with the passage of time, some law enforcement officers have not truly implemented the laws and regulations, resulting in a rebound trend of hospital WPV since 2015. Therefore, it is suggested that law enforcement officers should sternly punish people who attack medical staff and promote the implementation of policies and laws so that they can effectively protect the legitimate rights and interests of nurses.\nIn the past 9 years, nurses’ cognition and attitudes toward WPV have improved. The rates of “having heard of WPV before”, “thinking WPV coping management organizations are needed” and “supporting a zero-tolerance policy” increased significantly from 2010 to 2015 (P<0.05) but showed no great changes from 2015 to 2019 (P>0.05), which was likely related to the formulation of corresponding preventive measures and provision of reasonable and effective education and training. The National Institute of Occupational Safety and Health [38] developed and delivered WPV prevention training course for nurses, and more than 90 % of participants thought the course filled gaps in their knowledge. It was also found that the reasons why some nurses were unable to effectively judge whether they had experienced WPV were that they lacked an understanding of the concept of WPV or had never heard the term WPV before. Ming et al. [39] found that after a randomized intervention for clinical nurses, the cognition and attitudes of the nurses who participated in violence training were higher than those who did not. Brann et al. [40] found that the level of cognition and knowledge of WPV among nurses was higher than before training; nurses could identify violence that they had experienced personally or as bystanders and no longer considered violence part of their work. Therefore, it is necessary to develop training on WPV for clinical nurses. In addition, the results of the three surveys showed that although the majority of nurses were willing to participate in WPV prevention training, there was less WPV content in their preservice training in 2019 than in 2010 and 2015 (PT1−T3=0.002, PT2−T3=0.001), which indicates to hospital management that in order to maximize the effect of education and training and improve nurses’ ability to identify and deal with WPV in clinical practice, it is necessary to strengthen the training on WPV and make it more systematic and routine, integrate WPV content into new nurses’ education and in-hospital education, regularly disseminate knowledge on violence to nurses, strengthen continuous management after the training, and promote the continuous improvement of the post-training results while meeting the learning needs of nurses [41]. Furthermore, it is necessary to carry out public education, publicize the key role of the hospital in solving problems in the medical system through various networks, and increase public understanding of the efforts of medical centers to improve the medical experience and providing services to patients to decrease WPV.\nIn this survey, hospitals’ attitudes and responses to nurses’ WPV improved significantly from 2010 to 2019, which was embodied in five aspects: “offering training”, “encouraging reporting of WPV to supervisors”, “equipped with a WPV management department”, “handling WPV efficiently” and “hospital’s attitudes” (P<0.05). The differences in the response rates for “offering training”, “handling WPV efficiently”, “hospital’s attitudes” at different times were statistically significant (P<0.001), which may be related to changes in the management philosophy of the hospital managers. At present, hospital management pays more attention to the safety of nurses, constantly explores and develops scientific and effective nurse-related WPV management measures, actively and effectively controls violence, addresses nurses’ suffering from violence and minimizes hospital violence caused by improper or unclear management policies [37]. However, less than half of respondents reported receiving WPV prevention-related training. Although the training incidence increased in 2019 compared with that in 2010 and 2015, it was only 32.7 %, which is consistent with the results of other studies [42, 43]. The results of the survey also showed that more than 95 % of nurses believed that preservice training should include training on WPV, and more than 90 % of nurses expressed a willingness to attend, which showed that the current hospital-related education and training is far from meeting the needs of clinical nurses. To reduce the incidence of WPV or minimize the harm of WPV, nurses’ WPV management intervention skills should be strengthened, with special attention given to developing training, exploring the content and form of training, increasing the initiative and enthusiasm of nurses, and improving nurses’ cognition, attitudes and coping abilities with regard to WPV. In addition, compared with the results from 2010, those from 2015 to 2019 showed that hospitals paid more attention to doctors who had experienced WPV, with a gradual upward trend (P<0.001). Some studies [19, 44, 45] suggest that organizational support and hospital management can reduce the negative effects of WPV on nurses. Without strong hospital attention, nurses may lack trust in the management department and experience reduced job satisfaction, which will aggravate adverse reactions to WPV. In conclusion, hospitals should treat WPV among doctors and nurses equally so that nurse-directed WPV can be resolved equally and fairly and the psychological gap of employees can be reduced.", "The incidence of WPV among nurses in Suzhou general hospitals increased in 2015 and 2019 compared to that in 2010. The main form of WPV is verbal abuse. Despite the continuous improvement of nurses′ awareness of WPV, there is still room for improvement in hospitals′ attitudes and responses to WPV, especially in terms of actively carrying out WPV training. In conclusion, hospital managers should aim to comprehensively understand the dynamics of WPV, especially the trends of violence over long time periods, to reduce the incidence of WPV among nurses." ]

[ null, null, null, null, null, null, null, null, null, null, null, null, "results", null, null, null, null, null, null, null, "conclusion" ]

[ "Nurse", "Workplace violence", "General hospital", "Comparison" ]

[ 693, 541, 32, 36, 63, 40, 91, 917, 45, 95, 211, 97, 47, 375, 117, 224, 338, 289, 1777 ]

[ "wpv", "nurses", "001", "years", "wpv nurses", "2015", "2010", "training", "2019", "hospital" ]

[ "violence addresses nurses", "phenomenon wpv nurses", "hospital violence caused", "workplace violence wpv", "incidence wpv nurses" ]

[ "Adolescent", "Air Pollutants", "Air Pollution", "Asthma", "Child", "Child, Preschool", "Environmental Exposure", "Environmental Policy", "Government Regulation", "Humans", "Los Angeles", "Models, Theoretical", "Morbidity", "Nitrogen Dioxide", "Ozone", "Residence Characteristics", "Urban Renewal", "Vehicle Emissions" ]

[ "Supplemental Material" ]

[ "Click here for additional data file." ]

[ null ]

[ "Methods", "Results", "Discussion", "Supplemental Material" ]

[ "We used population-attributable fractions to quantify the impact of air pollution on asthma-related outcomes in LAC for year 2007 for children < 18 years of age. We followed an existing methodological framework (Künzli et al. 2008; Perez et al. 2009) that we adapted for this new study as summarized below.\nTo estimate the prevalence of asthma attributable to near-roadway pollution exposure, we used a concentration–response function (CRF) from the Children’s Health Study (CHS), a large population-based cohort in Southern California, in which living near major roadways, a proxy for traffic-related pollution exposure, was associated with increased prevalence of asthma (McConnell et al. 2006). Details on CHS study design and recruitment methods have been published previously (McConnell et al. 2006; Peters et al. 1999). To be consistent with the exposure assignment of the CRF study, we used the TeleAtlas MultiNet roads network (http://www.tomtom.com/en_gb/licensing/products/maps/multinet/) to map major LAC roads, defined as freeways, highways, or major arterial roads. These were then linked to census population data to derive the percentage of persons living within 75 m of these roads. For the present study we linked exposure to census population data given at the parcel level, which increased accuracy relative to linkage at the census block level used in a previous analysis (Perez et al. 2009). To be consistent with the prior CRF outcome definition, we used as background risk the asthma prevalence reported in the CHS (defined by use of controller medications in the previous year or lifetime asthma with any wheeze in the previous year or severe wheeze in the previous 12 months).\nRegional pollutants including particulate matter, nitrogen dioxide (NO2) and ozone (O3) are among the many causes of acute exacerbation among children with asthma, regardless of the cause of asthma onset (Jackson et al. 2011). However, an important consideration is that among those children with asthma attributable to living near a major road, all subsequent exacerbation should be attributed to air pollution, regardless of the trigger, assuming that these children would not otherwise have had the disease (Künzli et al. 2008). Conceptually, the total burden of asthma due to near-source and regional pollution includes the number of yearly asthma exacerbations triggered by causes other than regional air pollution among children whose asthma was caused (at least in part) by near-roadway pollution (Figure 1). These exacerbations are in addition to those directly triggered by regional air pollution exposure among all children with asthma, including children whose asthma was caused by near-roadway exposure and children whose asthma was caused by something other than traffic proximity. Air pollution risk assessments typically calculate only the asthma exacerbation burden triggered directly by regional pollution exposures, regardless of the underlying cause of asthma, whereas we included the additional burden of disease among children with asthma caused by near-roadway exposure but with exacerbations triggered by factors other than regional pollution.\nConceptual model used to calculate asthma-related exacerbation attributable to air pollution for Los Angeles County based on Künzli et al. (2008). The thick dashed line indicates children with asthma attributable to near-roadway exposure. The thick solid line indicates total exacerbations due to regional and near-roadway air pollution.\nTo avoid double counting the burden associated with correlated regional pollutants, we estimated exacerbation attributable to NO2 or O3 only. NO2 was selected to represent urban-scale combustion-related pollution because it is correlated with particulate mass and other regional pollutants associated with respiratory health effects in southern California (Gauderman et al. 2004). O3 is produced as a result of photo-oxidation that is uncorrelated with other regional pollutants in the Los Angeles air basin (Gauderman et al. 2004).\nThe CRFs for bronchitis episodes among those with asthma, and for prevalent asthma attributable to near-roadway exposure, were derived from the CHS (McConnell et al. 2003, 2006) (Table 1). CRFs from appropriate studies of Southern California populations were not available for doctor visits, emergency department visits, or hospital admissions. Therefore, we applied CRFs used in a previous Southern California health impact assessment (Perez et al. 2009) or averaged the coefficient used in the previous analysis with the coefficient from a more recent study conducted in a similar population, as indicated in Table 1.\nConcentration–response functions (CRF) with 95% confidence intervals (CI) considered in the evaluation of air pollution burden.\nThe number of children < 18 years of age (> 2.5 million) was obtained from the American Community Survey (U.S. Census Bureau 2011). Background rates of the outcomes were obtained from the CHS or from local surveys (Table 2). Annual average daily concentrations of NO2 and O3 obtained from the 2007 U.S. Environmental Protection Agency Air Quality System (AQS) (U.S. Environmental Protection Agency 2009) and CHS monitoring stations were interpolated based on inverse distance-squared weighting to each census block group in the county to estimate population exposures. Because of the seasonality of school attendance and both the seasonal and day-of-week variability of O3, the O3 population exposure for school absences was based on 2007 daily maps, rather than annual maps, obtained from interpolated hourly ambient school-week concentrations projected to 2000 census block group centroids.\nPopulation size and baseline health outcome and exposure estimates used to evaluate the burden of asthma due to air pollution in LAC in 2007.\nWe estimated that 17.8% of LAC children lived within 75 m of major roads, and that the annual population-weighted exposure to NO2 was 23.3 ppb (24-hr average) and to O3 was 39.3 ppb (8-hr maximum) in LAC (Table 2). We assumed background concentrations of 4 ppb for NO2 annually and 38 ppb for 8-hr maximum O3 on all days, based on long-term measurements (1994–2003) from CHS monitoring stations in clean coastal locations (i.e., Lompoc, CA) (McConnell et al. 2003). [The average population-weighted annual O3 for LAC was near background because population exposures in the areas with high O3 are offset by population exposures in areas with high oxides of nitrogen (NOx) emissions and very low O3 concentrations, due to nitric oxide (NO) in fresh vehicular exhaust scavenging O3 in those areas.] We considered three near-roadway proximity exposure reduction scenarios (Table 3):\nExposure reduction scenarios for near-roadway exposure, regional NO2 and O3, and corresponding reduction in childhood asthma cases attributable to near-roadway pollution exposure (based on total of 320,500 children with asthma in LAC).\nA reduction in annual concentrations of regional pollutants for each census block group to levels found in clean CHS communities (from 23.3 ppb to 4 ppb for NO2 and 39.3 ppb to 36.3 ppb for O3) in combination with a reduction in the proportion of children in the county living within 75 m of a major road from 17.8% to 0%\nA 20% reduction in the annual concentrations of regional pollutants for each census block group (from 23.3 ppb to 19.4 ppb for NO2 and 39.3 ppb to 38.7 ppb for O3) in combination with a 3.6% reduction in the proportion of all children in the county living within 75 m of a major road (from 17.8% to 14.2%, corresponding to a 20% decrease in the proportion of children currently living within 75 m)\nA 20% reduction in regional pollutant concentrations in combination with a 3.6% increase in the proportion of children living within 75 m of a major road (from 17.8% to 21.2%).\nScenario 1 reflects the total burden of preventable illness from both exposures. At this time there is considerable uncertainty regarding the potential impact of compact urban growth strategies on near-roadway exposures, so scenarios 2 and 3 were selected assuming moderate reductions in regional pollutants from continued regulatory efforts and a moderate 20% increase or decrease in near-roadway exposure—a value that was chosen for illustration and could be refined using data from regional planners as they become available. Regional pollutant concentrations aggregated to the census block group level that exceeded background levels were reduced linearly, whereas we assumed that concentrations at or below the background level would be unaffected by changes in emissions.\nThere are intrinsic limitations and uncertainties in risk analysis. We estimated a 95% confidence interval (CI) derived from the propagation of the CIs for the CRFs to address uncertainty in these estimates. In addition, proximity to major roadways has uncertainty as a proxy for near-roadway pollution exposure that depends on traffic volume, the emissions of the vehicular fleet, and local meteorological factors. Therefore, we also estimated the total burden of asthma-related exacerbations associated with a 100% and a 20% reduction in population-weighted exposure to the near-roadway dispersion-modeled pollution mixture (instead of a change in roadway proximity in exposure scenarios 1 and 2 in Table 3) using the CHS CRF from an estimate of the association of asthma prevalence with dispersion-modeled near-roadway pollution exposure accounting for traffic volume and emission factors (McConnell et al. 2006). Specifically, we used modeled NOx to represent the incremental contribution of local traffic to a more homogeneous community background concentration of NOx that included both primary and secondary pollution resulting from long-range transport and regional atmospheric photochemistry. It is a marker for correlated pollutants in the near-roadway mixture (rather than the etiologic agent for near-roadway health effects). We developed new estimates of population-weighted yearly average of local traffic-related NOx concentrations for 2007 in LAC using the CALINE4 dispersion model with the 2007 TeleAtlas MultiNet Roadway network, and 2007 vehicle emission factors for Los Angeles from the EMFAC model (California Air Resources Board 2007). Vehicle emission factors were developed for winter (55oF/50% relative humidity) and summer (75oF/50% relative humidity) conditions using average speeds of 65 mph on freeways and highways [FCC (functional class code) 1 and FCC2 class roads], 50 mph on major arterials (FCC3 class roads), and 30 mph on minor arterials and collectors (FCC4 roads). The model used year 2000 traffic volumes adjusted to 2007 VMT provided by the California Department of Transportation (17.5% increase in VMT for LAC). Modeled NOx concentrations were estimated for the block group centroids. The CHS CRF was developed for the contribution of local traffic on non-freeways using an older road functional roadway classification (FRC) scheme (McConnell et al. 2006) that is no longer available in a form that matches the most current FCC classification that we used. To minimize overestimation of population exposure to near-roadway exposure in LAC, we used estimates of exposure from FCC3 (major arterials) as representative of non-freeway roads used in developing the CHS CRF. We considered the impact of all near-FCC3 roadway NOx (corresponding to a scenario of 100% reduction in modeled near-roadway pollution at the block group centroid) and of a 20% decrease in population exposure. This corresponds to the 3.6% reduction in the total population of children within 75 m of a major roadway (a 20% reduction the proportion of the total population living within 75 m) (Table 3).", "Of the estimated 320,500 cases of childhood asthma in the county (based on Southern California prevalence of 0.1257) (Table 2), we estimated that approximately 27,100 (8%; 95% CI: 2%, 16%) were caused at least in part by residential proximity to a major road (Table 3). A 3.6% reduction in the proportion of children living within 75 m of a major road (scenario 2) would result in 5,900 fewer asthma cases (95% CI: 1,000, 11,800) caused by near-roadway exposure (2% of the total cases in the county; 95% CI: 0.3%, 4%), whereas a 3.6% increase (scenario 3) would result in an additional 5,900 asthma cases caused by near-roadway exposure (Table 3).\nEstimates of yearly asthma-related exacerbations attributable to air pollution are presented in Table 4 for NO2 and O3, with results partitioned by cause of asthma (traffic proximity or other factors) using the conceptual scheme in Figure 1. Using this approach and assuming no near-roadway exposure and a reduction of NO2 or O3 to background levels (scenario 1), we estimated that 70,200 episodes (95% CI: 31,000, 95,700) of bronchitis (56.6% of all episodes) could be attributed to the combined effects of traffic proximity and regional NO2, our marker for the regional mixture of combustion-related pollutant exposure. The estimated burdens of other exacerbations attributable to exposure were smaller, ranging from 10.6% for emergency department visits to 19.5% for hospital admissions. The overall impact of air pollution was highly sensitive to the inclusion of exacerbations attributable to asthma triggers other than regional NO2 among children whose asthma was caused by traffic proximity. For example, we estimated that 65,100 bronchitis episodes were triggered by regional air pollution, including 5,600 episodes among children whose asthma was caused by near-roadway air pollution and 59,500 episodes among children whose asthma was caused by something other than air pollution (Table 4). In addition, we estimated that 5,100 bronchitis episodes (4.1% of the total) triggered by something other than regional air pollution would not have occurred if children had not lived within 75 m of a major road, because these children would not have developed asthma to begin with. These episodes would not have been accounted for if estimated effects of traffic proximity on asthma prevalence had not been considered. The estimated impact of such cases was especially large for outcomes that were weakly associated with regional NO2 (e.g., emergency department visits for asthma with an estimated CRF of 1.0011 per 1 ppb NO2) (Table 1), because exacerbations triggered by causes other than air pollution among children with asthma caused by traffic proximity account for a larger proportion of all episodes.\nYearly number (%) of childhood asthma-related exacerbations attributable to near-roadway pollution in combination with regional NO2 and regional O3 above background levels in clean communities (scenario 1, traffic proximity model) (95% confidence intervals).a\nThe estimate of the burden of bronchitis episodes directly attributable to O3 and traffic proximity pollution (18,790 preventable episodes triggered by regional air pollution under the usual risk assessment approach) was considerably less than for NO2 (65,100 episodes triggered by air pollution) (Table 4). O3 CRFs for outcomes other than bronchitis and missed school days were modest (e.g., for emergency department visits, 1.024 for each 10-ppb increase in O3) (Table 1); therefore, accounting for all exacerbations among children whose asthma was caused by traffic proximity led to substantial increases in estimates of disease burden attributable to O3—from 133 to 1,730 emergency department visits (Table 4).\nA partial reduction in the burden of asthma exacerbation could be achieved with a more modest reduction in population exposure to traffic proximity and regional pollutants. Figure 2 shows the estimated numbers of exacerbations (and percent of total) attributable to a 20% decrease in regional air pollution (either NO2 or O3) in combination with a 3.6% reduction in the proportion of all children living near major roadways (scenario 2) or a 3.6% increase in traffic proximity that might result from compact urban development (scenario 3). We report the estimated impacts for the regional pollutant with the strongest association with each outcome—based on a reduction in NO2 for all outcomes except school absences, which were estimated for a reduction in O3. The net impact of each air pollution reduction scenario depended on the total number of outcomes per year and the strength of the CRF for the regional pollutant. Thus, a 3.6% reduction in the proportion of all children in the county who lived near major roadways (scenario 2) would result in a 1.9% decrease in each outcome in Figure 2 (corresponding to the reduction in cases of asthma caused by near-roadway exposure, regardless of whether the exacerbation was triggered by air pollution or by other factors). For bronchitis episodes, which are relatively common and have a large CRF for NO2 (1.070 per 1-ppb increase) (Table 1), we estimate that a total of 19,900 exacerbations (16.1% of all episodes annually) could be prevented by a 20% NO2 reduction, most of which (17,600 episodes, 14.2%) were attributable to the reduction of episodes triggered by regional pollution among children whose asthma was not caused by air pollution, rather than to bronchitis episodes among children whose asthma was caused by near-traffic pollution (scenario 2 in Figure 2). If NO2 were reduced by 20% but traffic proximity increased by 3.6% (scenario 3), we estimated a smaller reduction in total bronchitis episodes (15,580 episodes, 12.6% of the total). In contrast, for emergency department visits (with the weakest CRF for NO2, 1.0011 per 1-ppb increase), most of the benefit under scenario 2 resulted from the estimated reduction in the number of children with asthma caused by traffic proximity pollution, whereas an increase in the population living near major roadways under scenario 3 resulted in an increase in emergency department visits that exceeded the modest benefit from NO2 reduction, resulting in a net increase in total number of visits. Other outcomes demonstrated intermediate patterns for the relative impact of a reduction in regional pollution and a change in traffic proximity, with the net absolute impact depending also on the baseline frequency of the outcome in the population (Figure 2).\nNumber and percentage of exacerbations attributable to changes in pollutant levels under different exposure scenarios. Scenario 2 assumes a 3.6% decrease in children living near major roads and a 20% decrease in regional pollution. Scenario 3 assumes a 3.6% increase in children living near major roads and a 20% decrease in regional pollution. Regional pollution is represented by NO2 for all outcomes except O3 for school absences. Bars to the left and right of zero represent reductions and increases in the burden of asthma exacerbation, respectively, compared with baseline. (A) Bronchitis episodes, (B) hospital admissions, (C) emergency department visits, (D) clinic visits, and (E) school absences.\nIn additional analyses we used the CRF from a dispersion-modeled estimate of the effect of near-roadway pollutant mixture exposure on asthma (2.07; 95% CI: 1.12, 3.83 per 16 ppb) (McConnell et al. 2006) and an estimated annual average contribution of near-roadway pollution derived from major arterials expressed as 2.6 ppb of NOx, or 8% of all near-roadway pollution generated from freeways, highways, state highways, minor arterials, and collectors. We estimated that 39,800 cases of prevalent asthma (12% of the total; 95% CI: 2%, 20%) were caused by near-roadway pollution based on this analysis, compared with 27,100 cases based on roadway proximity (scenario 1) and that a 20% decrease in near-roadway exposure (scenario 2) would result in 8,400 fewer cases (3% of all cases in the county; 95% CI 0.4%, 4%) compared with 5,900 fewer cases based on roadway proximity (Table 3). The total burden of asthma-related exacerbation attributable to the combination of near-roadway and regional pollution under these scenarios is shown in Supplemental Material, Tables S1 and S2 (http://dx.doi.org/10.1289/ehp.1104785). Although the numbers of exacerbations attributed to near-roadway exposure were increased, estimates were of the same order of magnitude as those obtained using traffic proximity as an indicator of near-roadway exposure.", "The implications of near-roadway exposures for the burden of disease due to air pollution have not been fully appreciated. Our results indicate that risk assessment focusing exclusively on regional pollutant effects substantially underestimates the impact of air pollution on childhood asthma because it does not account for exacerbations caused by exposures other than air pollution among the approximately 8% of children with asthma in Los Angeles County whose asthma can be attributed to pollution from near-roadway pollution exposure based on proximity. Moreover, the burden of asthma exacerbation among children whose asthma was caused by living near roadways, and the potential benefits of reducing near-roadway exposures, are disproportionately larger for more severe and more expensive outcomes, such as hospital admissions and emergency department visits.\nThe use of traffic proximity is both a strength and limitation. A traffic proximity buffer is appealing as a regulatory metric because it is precise and easily measured. However, reductions in traffic density and vehicular emissions are not reflected in this metric, so estimates of the burden of disease based on the proximity CRF (for the Los Angeles Basin) may not easily be generalized to other urban settings. Proximity is a proxy indicator of local traffic-related pollutants that vary by type of roadway, over time, and by region, and that also depend on the pollution reduction technologies and age of local vehicular fleets [Health Effects Institute (HEI) 2009]. Therefore, we conducted a sensitivity analysis based on exposure estimates derived from a dispersion model of near-roadway traffic-related pollution that integrated traffic density, emission factors, and meteorology. Results of this alternative approach demonstrated a pattern of preventable asthma burden for a 100% decrease in near-roadway pollution exposure that was generally consistent with that estimated for a 100% decrease in residential proximity to major roads, and estimates for a 20% decrease in near-roadway pollution that were consistent with estimates based on a 20% decrease in proportion of children currently living near major roads (corresponding to the 3.6% decrease from 17.8% to 14.2% of all children in the county). It is also possible that living near a major traffic corridor is associated with socioeconomic characteristics and mold or other substandard housing characteristics that could explain the association of traffic proximity with asthma in studies from which the CRFs were derived. However, markers for these characteristics did not confound this association (McConnell et al. 2006). The CHS has also shown that the association between traffic proximity and asthma is modified by genetic variants in plausible biological pathways, which would be difficult to explain based on confounding by socioeconomic status or related characteristics (Salam et al. 2007).\nCompact urban development (scenario 3) that increases the number of children living near major roadways could limit the overall benefit of reduced exposure to regional pollution, especially for emergency department and clinic visits and for school absences, if not accompanied by substantial reductions in emissions and traffic volume along major traffic corridors. In practice, the CRF associated with near-roadway proximity may be reduced if overall reductions in vehicle miles traveled and emissions result in reduced air pollution exposures near roadways. We did not attempt to estimate a more informative association between dispersion-modeled exposure and illness under scenario 3 because data are not readily available to make such estimates. Realistic estimates under different SB375 compact urban development scenarios of the likely impact on traffic volume and emissions factors, in addition to changes in population distributions along major traffic corridors, are urgently needed to identify strategies that will optimize the benefits of compact urban development on both GHG emissions and on respiratory health. Strong “win–win” policies could result from compact growth and other strategies that increase the number of people living along busy roads, thereby reducing vehicle-miles traveled and regional air pollution, if coupled with reduction of traffic-related primary emissions such as ultrafine particles and black carbon. Promoting the rapid adoption of low- or zero-emission vehicles powered by carbon-neutral energy sources, and limiting residential development in buffer zones very near the largest roadways, are obvious examples of such strategies. Conversely, our findings suggest that a compact urban development plan that increases the proportion of children near major roadways, while simultaneously expanding or adding new traffic corridors to accommodate greater traffic volume, will increase rather than decrease the burden of air pollution–related asthma. Although such a scenario may be unlikely in California, in other regions in the world—particularly in developing countries—it is plausible.\nThere are uncertainties in our estimates related to the conceptual approach. Until recently, the causal association of asthma onset and near-roadway pollution—an important assumption underlying our analysis—was uncertain (Eder et al. 2006). However, a scientific consensus is emerging that the observed epidemiological associations of higher asthma rates along major roads are causal (Anderson et al. 2011a, 2011b; HEI 2009; Ryan and Holguin 2010; Salam et al. 2008). In addition, our approach assumes that removal or reduction of near-roadway pollutant exposure would reduce the number of children developing asthma (Künzli et al. 2008). Asthma is likely to develop as a consequence of multiple, potentially synergistic, risk factors, and we may have overestimated the benefit of exposure reduction if some of the cases of childhood asthma attributed to near-roadway pollution would have developed due to competing risk factors even if the children had not been exposed to traffic. However, an 8-year follow-up of a Dutch birth cohort showed that the association between incident asthma and soot exposure did not diminish during follow-up, as might have been expected if some of the soot-associated cases would have developed due to competing causes in the absence of soot exposure (Gehring et al. 2010). Further research is needed to determine the potential role of competing risks, but the current understanding of asthma etiology warrants a precautionary preventive approach to near-roadway pollution effects. Our conceptual model of effects of exposure reduction also does not address the time lag that might be required for health benefits to be achieved.\nWe have previously acknowledged uncertainties related to the extrapolation of CRFs across populations, which we have attempted to minimize by applying CRFs, asthma prevalence, and outcome frequency estimates for Southern California, when available (Künzli et al. 2008). Statistical uncertainty was estimated by calculating 95% CIs, which were relatively wide. We accounted for the propagation of random variation based on the observed distribution of chronic and acute CRF estimates, but mean estimates are not influenced by this uncertainty.\nWe may have underestimated the burden of disease by using NO2 as a surrogate for regional combustion pollutants including also particulate matter and other pollutants, without accounting for additive effects of different pollutants. We used spatial mapping of ambient daily air quality data to assign exposure to NO2 and O3 at the census block level. Although the accuracy of assignment from the monitoring grid may not be uniform within the area of study, the interpolation method, which is similar to that used by the U.S. Environmental Protection Agency, has been shown to capture sufficient spatial variability for the scale of our assessment (Hall et al. 2008).\nOur estimates of near-roadway effects also did not account for exposure at school and other locations beside the home, which recent studies suggest may also cause asthma (McConnell et al. 2010). The asthma exacerbation outcomes that we examined vary with regard to their impact on quality of life and resource utilization, ranging from school absences (with relatively modest morbidity for each episode) to hospitalization. It would be useful to evaluate the impact that the alternative risk assessment approach we propose would have on economic costs of air pollution, which preliminary results suggest may be substantial (Brandt et al. 2012).\nAlthough this study focused on the impact of near-roadway exposure on asthma, there is emerging evidence that these exposures also contribute to atherosclerotic heart disease, chronic obstructive pulmonary disease, lung cancer, and childhood neurodevelopmental outcomes (Guxens et al. 2012; HEI 2009; Künzli et al. 2010). Therefore, the implications of near-roadway exposure for the total burden of disease associated with air pollution are potentially quite large. However, the potential increase in physical activity associated with more compact urban design and walkable neighborhoods should also be considered (Saelens et al. 2003). Although there is little evidence that exercise improves asthma, physical activity has known cardiovascular health benefits that could outweigh potential detrimental effects of near-roadway exposure (Giles et al. 2011; Hankey et al. 2012). A more comprehensive assessment of all health-relevant benefits of planned GHG policies would be useful for policy makers. Nonetheless, it is clear that by using available health information to develop “win–win” policies to prevent childhood respiratory disease as cities are redeveloped to reduce GHG emissions, a much larger burden of disease could be prevented.", "Click here for additional data file." ]

[ "methods", "results", "discussion", null ]

[ "air pollution", "asthma", "burden of disease", "children", "compact urban growth", "risk assessment", "vehicle emissions" ]

[ 7 ]

[ "asthma", "near", "pollution", "roadway", "exposure", "near roadway", "children", "regional", "traffic", "air" ]

[ "pollution asthma related", "asthma traffic proximity", "pollution exposure children", "roadway exposure asthma", "exposure children asthma" ]

[ "Aged", "Caregivers", "Humans", "Multimedia", "Prospective Studies", "Research Design" ]

[ "2. Methods", "2.1. Study population", "2.2. Study design", "2.3. Survey tools and evaluation indicators", "2.5. Sample size", "Acknowledgements", "Author contributions" ]

[ " 2.1. Study population Using convenience sampling, 100 professional caregivers were selected as the research subjects in a 3A grade hospital, and 50 caregivers in each group were randomly assigned to the control group and the observation group. Inclusion criteria: physical and mental health; >65 years old; attendants of the professional caregiver company connected to the hospital; informed consent and voluntary participation in this study. Exclusion criteria: cognitive dysfunction, inability to complete the training and investigations; those who refuse to participate or withdraw voluntarily after reasonable explanation. This study was approved by the medical ethics committee of the right hospital and all participants provided informed consent. The authors have declared that no competing interests exist.\nUsing convenience sampling, 100 professional caregivers were selected as the research subjects in a 3A grade hospital, and 50 caregivers in each group were randomly assigned to the control group and the observation group. Inclusion criteria: physical and mental health; >65 years old; attendants of the professional caregiver company connected to the hospital; informed consent and voluntary participation in this study. Exclusion criteria: cognitive dysfunction, inability to complete the training and investigations; those who refuse to participate or withdraw voluntarily after reasonable explanation. This study was approved by the medical ethics committee of the right hospital and all participants provided informed consent. The authors have declared that no competing interests exist.\n 2.2. Study design The study lasted for 6 months from March to August, 2021. The control group were educated by conventional educational methods, while the observation group by teach-back method. The interventions were implemented at the beginning of the study and 3 months later. Before, in the middle, and at the late stage of the study, questionnaires were completed on the knowledge, confidence, and behaviors (KCB) of fall prevention in elderly inpatients, and the occurrence of falls in all elderly patients cared by the caregivers within 6 months were collected. All relevant data are within the paper and its supporting information files. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific methods are as follows:\nThe nursing department organized and established a fall prevention and management group for the elderly inpatients. The head nurse of the rehabilitation is the team leader, with six charge nurses as members and the director of the rehabilitation as consultants.\nIn the control group, caregivers were randomly assigned to clinical departments, and charge nurses taught them about fall prevention using conventional methods, that is, informing them of the high-risk factors of falling in elderly inpatients and distributing fall prevention guidance manual.\nIn the observation group, the teach-back method combined with multimedia was adopted for centralized training. Training content: PPT courseware, scene simulation video, and use of WeChat group. PPT courseware content takes about 10 minutes, including the incidence of falls, varieties of factors related to fall, the harm of fall in elderly patients, treatment measures after the fall, meanings of fall prevention and specific methods, such as for long-term bedridden patients, lifting the head of a bed for 3 to 5 minutes, and then informing to sit by the bed for a few minutes, finally asking to walk slowly without abnormal response standing in situ. The scene simulation video lasted six minutes, showing a variety of causes by which elderly patients fall in the hospital (such as dizziness, sliding, etc.), showing the seriousness of patients fall (such as fractures needing for surgical treatment), as well as advocating some effective measures to prevent falls. A nurse is responsible for the establishment of a wechat group to share the knowledge and experience on fall prevention from time to time and analyze the causes of falling events within the group so that everyone can learn lessons. Implementation of teach-back method: After the training, charge nurses ask the caregivers questions one by one using a gentle and open way such as “Do you think what kind of inpatients are prone to fall? “What should we do when a patient complains of dizziness while moving”. The caregivers are encouraged to provide positive answers based on their own understanding. If the answers are incorrect, the nurses will correct them immediately, such as “Let’s strengthen the memory again, it should be...” “When the patient complains of dizziness in the activity, we should immediately ask the patient to stop the activity, sit down or lie down to rest, and inform the medical staff,” etc., and ask for retelling until the retelling is correct.\nThe study lasted for 6 months from March to August, 2021. The control group were educated by conventional educational methods, while the observation group by teach-back method. The interventions were implemented at the beginning of the study and 3 months later. Before, in the middle, and at the late stage of the study, questionnaires were completed on the knowledge, confidence, and behaviors (KCB) of fall prevention in elderly inpatients, and the occurrence of falls in all elderly patients cared by the caregivers within 6 months were collected. All relevant data are within the paper and its supporting information files. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific methods are as follows:\nThe nursing department organized and established a fall prevention and management group for the elderly inpatients. The head nurse of the rehabilitation is the team leader, with six charge nurses as members and the director of the rehabilitation as consultants.\nIn the control group, caregivers were randomly assigned to clinical departments, and charge nurses taught them about fall prevention using conventional methods, that is, informing them of the high-risk factors of falling in elderly inpatients and distributing fall prevention guidance manual.\nIn the observation group, the teach-back method combined with multimedia was adopted for centralized training. Training content: PPT courseware, scene simulation video, and use of WeChat group. PPT courseware content takes about 10 minutes, including the incidence of falls, varieties of factors related to fall, the harm of fall in elderly patients, treatment measures after the fall, meanings of fall prevention and specific methods, such as for long-term bedridden patients, lifting the head of a bed for 3 to 5 minutes, and then informing to sit by the bed for a few minutes, finally asking to walk slowly without abnormal response standing in situ. The scene simulation video lasted six minutes, showing a variety of causes by which elderly patients fall in the hospital (such as dizziness, sliding, etc.), showing the seriousness of patients fall (such as fractures needing for surgical treatment), as well as advocating some effective measures to prevent falls. A nurse is responsible for the establishment of a wechat group to share the knowledge and experience on fall prevention from time to time and analyze the causes of falling events within the group so that everyone can learn lessons. Implementation of teach-back method: After the training, charge nurses ask the caregivers questions one by one using a gentle and open way such as “Do you think what kind of inpatients are prone to fall? “What should we do when a patient complains of dizziness while moving”. The caregivers are encouraged to provide positive answers based on their own understanding. If the answers are incorrect, the nurses will correct them immediately, such as “Let’s strengthen the memory again, it should be...” “When the patient complains of dizziness in the activity, we should immediately ask the patient to stop the activity, sit down or lie down to rest, and inform the medical staff,” etc., and ask for retelling until the retelling is correct.\n 2.3. Survey tools and evaluation indicators A self-designed questionnaire (including name, gender, age, education level, fall-related training experience, and length of service) was used to collect demographic information of the caregivers and evaluate whether there was a statistical difference in two groups.\nWith experiences based on the characteristics of clinical nursing work, and after widely searching relevant literatures and referring to “Morse fall assessment scale” and so on, we designed “the questionnaire about the KCB of professional caregivers on fall prevention in elderly inpatients.” The questionnaire was reviewed and modified by five nursing specialists, the content validity is more than 80%. The questionnaire is composed of 33 items, including three dimensions KCB. The knowledge dimension, with a total of 15 items, covering disease factors, environmental factors, prevention measures and emergency response, etc., used the Likert 5 scoring method. Each entry got 1 point for “I don’t know”, 2 points for “heard”, 3 points for “understanding”, 4 points for “clear”, and 5 points for “very clear”. There were 9 items in the confidence dimension, which reflected the positivity and stance of fall prevention. Alike Likert rating method was adopted and each entry got 1 point for “very reluctant”, 2 points for “unwilling”, 3 points for “uncertain”, 4 points for “willing”, and 5 points for “very willing”, with a total score of 45 points. There were 9 items in the behavioral dimension, and Likert 5 scoring method was also adopted when each entry got 1 point for “Never”, 2 points for “occasionally”, 3 points for “some time”, 4 points for “often”, and 5 points for “always”, with a total score of 45 points. Higher the score is, better the cognition and confidence of the caregivers regarding fall prevention is, and higher the credibility of the normative behavior is. The questionnaire has good reliability and validity. The content validity indices of KCB were 0.812, 0.875, and 0.838, respectively. The total Cronbach’s α coefficient was 0.868, and the Cronbach’s α coefficient for each dimension ranged from 0.808 to 0.865.\nWe used two ways to describe the incidence of falls. One is the proportion of all fallers and the other is the person-daily rate which means the ratio of the number of all falls occurred to the total days of stay for all inpatients taken care of during the study period. The control and observation groups were calculated separately.\nA self-designed questionnaire (including name, gender, age, education level, fall-related training experience, and length of service) was used to collect demographic information of the caregivers and evaluate whether there was a statistical difference in two groups.\nWith experiences based on the characteristics of clinical nursing work, and after widely searching relevant literatures and referring to “Morse fall assessment scale” and so on, we designed “the questionnaire about the KCB of professional caregivers on fall prevention in elderly inpatients.” The questionnaire was reviewed and modified by five nursing specialists, the content validity is more than 80%. The questionnaire is composed of 33 items, including three dimensions KCB. The knowledge dimension, with a total of 15 items, covering disease factors, environmental factors, prevention measures and emergency response, etc., used the Likert 5 scoring method. Each entry got 1 point for “I don’t know”, 2 points for “heard”, 3 points for “understanding”, 4 points for “clear”, and 5 points for “very clear”. There were 9 items in the confidence dimension, which reflected the positivity and stance of fall prevention. Alike Likert rating method was adopted and each entry got 1 point for “very reluctant”, 2 points for “unwilling”, 3 points for “uncertain”, 4 points for “willing”, and 5 points for “very willing”, with a total score of 45 points. There were 9 items in the behavioral dimension, and Likert 5 scoring method was also adopted when each entry got 1 point for “Never”, 2 points for “occasionally”, 3 points for “some time”, 4 points for “often”, and 5 points for “always”, with a total score of 45 points. Higher the score is, better the cognition and confidence of the caregivers regarding fall prevention is, and higher the credibility of the normative behavior is. The questionnaire has good reliability and validity. The content validity indices of KCB were 0.812, 0.875, and 0.838, respectively. The total Cronbach’s α coefficient was 0.868, and the Cronbach’s α coefficient for each dimension ranged from 0.808 to 0.865.\nWe used two ways to describe the incidence of falls. One is the proportion of all fallers and the other is the person-daily rate which means the ratio of the number of all falls occurred to the total days of stay for all inpatients taken care of during the study period. The control and observation groups were calculated separately.\n 2.4. Statistical methods Microsoft Office 2010 Excel was used for data entry and double verification was performed. SPSS23.0 statistical software was used for data analysis. Counting data are expressed as frequencies or percentages, and the chi-square test was used for comparison between groups. The measured data were first tested for normality. If a normal distribution was satisfied, the mean ± standard deviation was used to represent the data and t test was performed between groups, while if not, the rank sum test was used. P < .05 indicates a statistically significant difference.\nMicrosoft Office 2010 Excel was used for data entry and double verification was performed. SPSS23.0 statistical software was used for data analysis. Counting data are expressed as frequencies or percentages, and the chi-square test was used for comparison between groups. The measured data were first tested for normality. If a normal distribution was satisfied, the mean ± standard deviation was used to represent the data and t test was performed between groups, while if not, the rank sum test was used. P < .05 indicates a statistically significant difference.\n 2.5. Sample size The sample size was calculated using G*Power© software version 3.1.9.7 (Heinrich Heine University, Dusseldorf, Germany). Depending on the results of a pilot trial with 2-sided (two tails) Type-I error 0.05 and power of 80% (1-β = 0.8), effect size (d) factor 0.60, and considering a dropout rate of approximately 10%, the minimum sample size was 100.\nThe sample size was calculated using G*Power© software version 3.1.9.7 (Heinrich Heine University, Dusseldorf, Germany). Depending on the results of a pilot trial with 2-sided (two tails) Type-I error 0.05 and power of 80% (1-β = 0.8), effect size (d) factor 0.60, and considering a dropout rate of approximately 10%, the minimum sample size was 100.", "Using convenience sampling, 100 professional caregivers were selected as the research subjects in a 3A grade hospital, and 50 caregivers in each group were randomly assigned to the control group and the observation group. Inclusion criteria: physical and mental health; >65 years old; attendants of the professional caregiver company connected to the hospital; informed consent and voluntary participation in this study. Exclusion criteria: cognitive dysfunction, inability to complete the training and investigations; those who refuse to participate or withdraw voluntarily after reasonable explanation. This study was approved by the medical ethics committee of the right hospital and all participants provided informed consent. The authors have declared that no competing interests exist.", "The study lasted for 6 months from March to August, 2021. The control group were educated by conventional educational methods, while the observation group by teach-back method. The interventions were implemented at the beginning of the study and 3 months later. Before, in the middle, and at the late stage of the study, questionnaires were completed on the knowledge, confidence, and behaviors (KCB) of fall prevention in elderly inpatients, and the occurrence of falls in all elderly patients cared by the caregivers within 6 months were collected. All relevant data are within the paper and its supporting information files. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific methods are as follows:\nThe nursing department organized and established a fall prevention and management group for the elderly inpatients. The head nurse of the rehabilitation is the team leader, with six charge nurses as members and the director of the rehabilitation as consultants.\nIn the control group, caregivers were randomly assigned to clinical departments, and charge nurses taught them about fall prevention using conventional methods, that is, informing them of the high-risk factors of falling in elderly inpatients and distributing fall prevention guidance manual.\nIn the observation group, the teach-back method combined with multimedia was adopted for centralized training. Training content: PPT courseware, scene simulation video, and use of WeChat group. PPT courseware content takes about 10 minutes, including the incidence of falls, varieties of factors related to fall, the harm of fall in elderly patients, treatment measures after the fall, meanings of fall prevention and specific methods, such as for long-term bedridden patients, lifting the head of a bed for 3 to 5 minutes, and then informing to sit by the bed for a few minutes, finally asking to walk slowly without abnormal response standing in situ. The scene simulation video lasted six minutes, showing a variety of causes by which elderly patients fall in the hospital (such as dizziness, sliding, etc.), showing the seriousness of patients fall (such as fractures needing for surgical treatment), as well as advocating some effective measures to prevent falls. A nurse is responsible for the establishment of a wechat group to share the knowledge and experience on fall prevention from time to time and analyze the causes of falling events within the group so that everyone can learn lessons. Implementation of teach-back method: After the training, charge nurses ask the caregivers questions one by one using a gentle and open way such as “Do you think what kind of inpatients are prone to fall? “What should we do when a patient complains of dizziness while moving”. The caregivers are encouraged to provide positive answers based on their own understanding. If the answers are incorrect, the nurses will correct them immediately, such as “Let’s strengthen the memory again, it should be...” “When the patient complains of dizziness in the activity, we should immediately ask the patient to stop the activity, sit down or lie down to rest, and inform the medical staff,” etc., and ask for retelling until the retelling is correct.", "A self-designed questionnaire (including name, gender, age, education level, fall-related training experience, and length of service) was used to collect demographic information of the caregivers and evaluate whether there was a statistical difference in two groups.\nWith experiences based on the characteristics of clinical nursing work, and after widely searching relevant literatures and referring to “Morse fall assessment scale” and so on, we designed “the questionnaire about the KCB of professional caregivers on fall prevention in elderly inpatients.” The questionnaire was reviewed and modified by five nursing specialists, the content validity is more than 80%. The questionnaire is composed of 33 items, including three dimensions KCB. The knowledge dimension, with a total of 15 items, covering disease factors, environmental factors, prevention measures and emergency response, etc., used the Likert 5 scoring method. Each entry got 1 point for “I don’t know”, 2 points for “heard”, 3 points for “understanding”, 4 points for “clear”, and 5 points for “very clear”. There were 9 items in the confidence dimension, which reflected the positivity and stance of fall prevention. Alike Likert rating method was adopted and each entry got 1 point for “very reluctant”, 2 points for “unwilling”, 3 points for “uncertain”, 4 points for “willing”, and 5 points for “very willing”, with a total score of 45 points. There were 9 items in the behavioral dimension, and Likert 5 scoring method was also adopted when each entry got 1 point for “Never”, 2 points for “occasionally”, 3 points for “some time”, 4 points for “often”, and 5 points for “always”, with a total score of 45 points. Higher the score is, better the cognition and confidence of the caregivers regarding fall prevention is, and higher the credibility of the normative behavior is. The questionnaire has good reliability and validity. The content validity indices of KCB were 0.812, 0.875, and 0.838, respectively. The total Cronbach’s α coefficient was 0.868, and the Cronbach’s α coefficient for each dimension ranged from 0.808 to 0.865.\nWe used two ways to describe the incidence of falls. One is the proportion of all fallers and the other is the person-daily rate which means the ratio of the number of all falls occurred to the total days of stay for all inpatients taken care of during the study period. The control and observation groups were calculated separately.", "The sample size was calculated using G*Power© software version 3.1.9.7 (Heinrich Heine University, Dusseldorf, Germany). Depending on the results of a pilot trial with 2-sided (two tails) Type-I error 0.05 and power of 80% (1-β = 0.8), effect size (d) factor 0.60, and considering a dropout rate of approximately 10%, the minimum sample size was 100.", "Thanks to Yili Ou for helping with data collecting; Thanks to Jie Tan, Zhu Liu, Yamei Wang, and Jiyao Xiang for designing the questionnaires; and thanks to Luxi Yang for quality assurance of the research. Although the above members did not participate in the writing of the article, they did a lot help.", "Conceptualization: Qin Wang.\nData curation: Qin Wang.\nInvestigation: Huixiang Zou.\nResources: Huixiang Zou.\nSoftware: Qin Wang.\nWriting – original draft: Qinqin Wang.\nWriting – review & editing: Qinqin Wang." ]

[ "methods", null, null, null, null, null, null ]

[ "1. Introduction", "2. Methods", "2.1. Study population", "2.2. Study design", "2.3. Survey tools and evaluation indicators", "2.4. Statistical methods", "2.5. Sample size", "3. Results", "4. Discussion", "Acknowledgements", "Author contributions" ]

[ "Falls are the most common adverse events in hospitals, accounting for 20% to 30% of all adverse events.[1] Approximately 3% of inpatients will fall and 25% of them will cause injury.[2] Elderly inpatients have a particularly high risk of fall owing to many comorbidities as well as decreased physical function and activity ability.[3] Falls of inpatients not only bring pains to patients and economic burden to families and society, but also prolong the hospital stay. Moreover, inpatients’ fall may become the fuse of medical contradictions.[4] Clinically, varieties of nurse-led interventions have been used to reduce the incidence of falls in hospitalized patients.[5] There are also plenty of patient-involved studies in regard to fall prevention.[6] But most researches ignored that the elderly are less active, and expected too much of senile inpatients, therefore, the effectiveness of interventions on falls prevention is not ideal. For older patients, the active involvement of caregivers in fall prevention is still needed to reduce the incidence of falls. It has been reported that patients cared for by trained caregivers are less prone to fall.[7] Though playing an important role in the prevention of falls, many professional caregivers are not familiar with knowledge regarding falls in elderly patients.[8] To ensure the safety of patients, it is necessary to conduct fall-related interventions for professional caregivers. The traditional way of preaching is boring, so it’s difficult for caregivers to understand, memorize and apply the content they learn. The teach-back method is a two-way mode of information transmission. This means that after receiving health education, professional caregivers are allowed to express their understandings of relevant information in their own language and they will be given guidance on the information they misunderstand or do not understand again until completely mastering relevant knowledge.[9] This approach has been endorsed by several institutions, including the Joint Commission in The United States, and is widely used in the healthcare communities.[10,11] In present study, teach-back method combined with multimedia was used to train professional caregivers about the knowledge of preventing falls in elderly inpatients, and certain effects were achieved, which are reported as follows.", " 2.1. Study population Using convenience sampling, 100 professional caregivers were selected as the research subjects in a 3A grade hospital, and 50 caregivers in each group were randomly assigned to the control group and the observation group. Inclusion criteria: physical and mental health; >65 years old; attendants of the professional caregiver company connected to the hospital; informed consent and voluntary participation in this study. Exclusion criteria: cognitive dysfunction, inability to complete the training and investigations; those who refuse to participate or withdraw voluntarily after reasonable explanation. This study was approved by the medical ethics committee of the right hospital and all participants provided informed consent. The authors have declared that no competing interests exist.\nUsing convenience sampling, 100 professional caregivers were selected as the research subjects in a 3A grade hospital, and 50 caregivers in each group were randomly assigned to the control group and the observation group. Inclusion criteria: physical and mental health; >65 years old; attendants of the professional caregiver company connected to the hospital; informed consent and voluntary participation in this study. Exclusion criteria: cognitive dysfunction, inability to complete the training and investigations; those who refuse to participate or withdraw voluntarily after reasonable explanation. This study was approved by the medical ethics committee of the right hospital and all participants provided informed consent. The authors have declared that no competing interests exist.\n 2.2. Study design The study lasted for 6 months from March to August, 2021. The control group were educated by conventional educational methods, while the observation group by teach-back method. The interventions were implemented at the beginning of the study and 3 months later. Before, in the middle, and at the late stage of the study, questionnaires were completed on the knowledge, confidence, and behaviors (KCB) of fall prevention in elderly inpatients, and the occurrence of falls in all elderly patients cared by the caregivers within 6 months were collected. All relevant data are within the paper and its supporting information files. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific methods are as follows:\nThe nursing department organized and established a fall prevention and management group for the elderly inpatients. The head nurse of the rehabilitation is the team leader, with six charge nurses as members and the director of the rehabilitation as consultants.\nIn the control group, caregivers were randomly assigned to clinical departments, and charge nurses taught them about fall prevention using conventional methods, that is, informing them of the high-risk factors of falling in elderly inpatients and distributing fall prevention guidance manual.\nIn the observation group, the teach-back method combined with multimedia was adopted for centralized training. Training content: PPT courseware, scene simulation video, and use of WeChat group. PPT courseware content takes about 10 minutes, including the incidence of falls, varieties of factors related to fall, the harm of fall in elderly patients, treatment measures after the fall, meanings of fall prevention and specific methods, such as for long-term bedridden patients, lifting the head of a bed for 3 to 5 minutes, and then informing to sit by the bed for a few minutes, finally asking to walk slowly without abnormal response standing in situ. The scene simulation video lasted six minutes, showing a variety of causes by which elderly patients fall in the hospital (such as dizziness, sliding, etc.), showing the seriousness of patients fall (such as fractures needing for surgical treatment), as well as advocating some effective measures to prevent falls. A nurse is responsible for the establishment of a wechat group to share the knowledge and experience on fall prevention from time to time and analyze the causes of falling events within the group so that everyone can learn lessons. Implementation of teach-back method: After the training, charge nurses ask the caregivers questions one by one using a gentle and open way such as “Do you think what kind of inpatients are prone to fall? “What should we do when a patient complains of dizziness while moving”. The caregivers are encouraged to provide positive answers based on their own understanding. If the answers are incorrect, the nurses will correct them immediately, such as “Let’s strengthen the memory again, it should be...” “When the patient complains of dizziness in the activity, we should immediately ask the patient to stop the activity, sit down or lie down to rest, and inform the medical staff,” etc., and ask for retelling until the retelling is correct.\nThe study lasted for 6 months from March to August, 2021. The control group were educated by conventional educational methods, while the observation group by teach-back method. The interventions were implemented at the beginning of the study and 3 months later. Before, in the middle, and at the late stage of the study, questionnaires were completed on the knowledge, confidence, and behaviors (KCB) of fall prevention in elderly inpatients, and the occurrence of falls in all elderly patients cared by the caregivers within 6 months were collected. All relevant data are within the paper and its supporting information files. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific methods are as follows:\nThe nursing department organized and established a fall prevention and management group for the elderly inpatients. The head nurse of the rehabilitation is the team leader, with six charge nurses as members and the director of the rehabilitation as consultants.\nIn the control group, caregivers were randomly assigned to clinical departments, and charge nurses taught them about fall prevention using conventional methods, that is, informing them of the high-risk factors of falling in elderly inpatients and distributing fall prevention guidance manual.\nIn the observation group, the teach-back method combined with multimedia was adopted for centralized training. Training content: PPT courseware, scene simulation video, and use of WeChat group. PPT courseware content takes about 10 minutes, including the incidence of falls, varieties of factors related to fall, the harm of fall in elderly patients, treatment measures after the fall, meanings of fall prevention and specific methods, such as for long-term bedridden patients, lifting the head of a bed for 3 to 5 minutes, and then informing to sit by the bed for a few minutes, finally asking to walk slowly without abnormal response standing in situ. The scene simulation video lasted six minutes, showing a variety of causes by which elderly patients fall in the hospital (such as dizziness, sliding, etc.), showing the seriousness of patients fall (such as fractures needing for surgical treatment), as well as advocating some effective measures to prevent falls. A nurse is responsible for the establishment of a wechat group to share the knowledge and experience on fall prevention from time to time and analyze the causes of falling events within the group so that everyone can learn lessons. Implementation of teach-back method: After the training, charge nurses ask the caregivers questions one by one using a gentle and open way such as “Do you think what kind of inpatients are prone to fall? “What should we do when a patient complains of dizziness while moving”. The caregivers are encouraged to provide positive answers based on their own understanding. If the answers are incorrect, the nurses will correct them immediately, such as “Let’s strengthen the memory again, it should be...” “When the patient complains of dizziness in the activity, we should immediately ask the patient to stop the activity, sit down or lie down to rest, and inform the medical staff,” etc., and ask for retelling until the retelling is correct.\n 2.3. Survey tools and evaluation indicators A self-designed questionnaire (including name, gender, age, education level, fall-related training experience, and length of service) was used to collect demographic information of the caregivers and evaluate whether there was a statistical difference in two groups.\nWith experiences based on the characteristics of clinical nursing work, and after widely searching relevant literatures and referring to “Morse fall assessment scale” and so on, we designed “the questionnaire about the KCB of professional caregivers on fall prevention in elderly inpatients.” The questionnaire was reviewed and modified by five nursing specialists, the content validity is more than 80%. The questionnaire is composed of 33 items, including three dimensions KCB. The knowledge dimension, with a total of 15 items, covering disease factors, environmental factors, prevention measures and emergency response, etc., used the Likert 5 scoring method. Each entry got 1 point for “I don’t know”, 2 points for “heard”, 3 points for “understanding”, 4 points for “clear”, and 5 points for “very clear”. There were 9 items in the confidence dimension, which reflected the positivity and stance of fall prevention. Alike Likert rating method was adopted and each entry got 1 point for “very reluctant”, 2 points for “unwilling”, 3 points for “uncertain”, 4 points for “willing”, and 5 points for “very willing”, with a total score of 45 points. There were 9 items in the behavioral dimension, and Likert 5 scoring method was also adopted when each entry got 1 point for “Never”, 2 points for “occasionally”, 3 points for “some time”, 4 points for “often”, and 5 points for “always”, with a total score of 45 points. Higher the score is, better the cognition and confidence of the caregivers regarding fall prevention is, and higher the credibility of the normative behavior is. The questionnaire has good reliability and validity. The content validity indices of KCB were 0.812, 0.875, and 0.838, respectively. The total Cronbach’s α coefficient was 0.868, and the Cronbach’s α coefficient for each dimension ranged from 0.808 to 0.865.\nWe used two ways to describe the incidence of falls. One is the proportion of all fallers and the other is the person-daily rate which means the ratio of the number of all falls occurred to the total days of stay for all inpatients taken care of during the study period. The control and observation groups were calculated separately.\nA self-designed questionnaire (including name, gender, age, education level, fall-related training experience, and length of service) was used to collect demographic information of the caregivers and evaluate whether there was a statistical difference in two groups.\nWith experiences based on the characteristics of clinical nursing work, and after widely searching relevant literatures and referring to “Morse fall assessment scale” and so on, we designed “the questionnaire about the KCB of professional caregivers on fall prevention in elderly inpatients.” The questionnaire was reviewed and modified by five nursing specialists, the content validity is more than 80%. The questionnaire is composed of 33 items, including three dimensions KCB. The knowledge dimension, with a total of 15 items, covering disease factors, environmental factors, prevention measures and emergency response, etc., used the Likert 5 scoring method. Each entry got 1 point for “I don’t know”, 2 points for “heard”, 3 points for “understanding”, 4 points for “clear”, and 5 points for “very clear”. There were 9 items in the confidence dimension, which reflected the positivity and stance of fall prevention. Alike Likert rating method was adopted and each entry got 1 point for “very reluctant”, 2 points for “unwilling”, 3 points for “uncertain”, 4 points for “willing”, and 5 points for “very willing”, with a total score of 45 points. There were 9 items in the behavioral dimension, and Likert 5 scoring method was also adopted when each entry got 1 point for “Never”, 2 points for “occasionally”, 3 points for “some time”, 4 points for “often”, and 5 points for “always”, with a total score of 45 points. Higher the score is, better the cognition and confidence of the caregivers regarding fall prevention is, and higher the credibility of the normative behavior is. The questionnaire has good reliability and validity. The content validity indices of KCB were 0.812, 0.875, and 0.838, respectively. The total Cronbach’s α coefficient was 0.868, and the Cronbach’s α coefficient for each dimension ranged from 0.808 to 0.865.\nWe used two ways to describe the incidence of falls. One is the proportion of all fallers and the other is the person-daily rate which means the ratio of the number of all falls occurred to the total days of stay for all inpatients taken care of during the study period. The control and observation groups were calculated separately.\n 2.4. Statistical methods Microsoft Office 2010 Excel was used for data entry and double verification was performed. SPSS23.0 statistical software was used for data analysis. Counting data are expressed as frequencies or percentages, and the chi-square test was used for comparison between groups. The measured data were first tested for normality. If a normal distribution was satisfied, the mean ± standard deviation was used to represent the data and t test was performed between groups, while if not, the rank sum test was used. P < .05 indicates a statistically significant difference.\nMicrosoft Office 2010 Excel was used for data entry and double verification was performed. SPSS23.0 statistical software was used for data analysis. Counting data are expressed as frequencies or percentages, and the chi-square test was used for comparison between groups. The measured data were first tested for normality. If a normal distribution was satisfied, the mean ± standard deviation was used to represent the data and t test was performed between groups, while if not, the rank sum test was used. P < .05 indicates a statistically significant difference.\n 2.5. Sample size The sample size was calculated using G*Power© software version 3.1.9.7 (Heinrich Heine University, Dusseldorf, Germany). Depending on the results of a pilot trial with 2-sided (two tails) Type-I error 0.05 and power of 80% (1-β = 0.8), effect size (d) factor 0.60, and considering a dropout rate of approximately 10%, the minimum sample size was 100.\nThe sample size was calculated using G*Power© software version 3.1.9.7 (Heinrich Heine University, Dusseldorf, Germany). Depending on the results of a pilot trial with 2-sided (two tails) Type-I error 0.05 and power of 80% (1-β = 0.8), effect size (d) factor 0.60, and considering a dropout rate of approximately 10%, the minimum sample size was 100.", "Using convenience sampling, 100 professional caregivers were selected as the research subjects in a 3A grade hospital, and 50 caregivers in each group were randomly assigned to the control group and the observation group. Inclusion criteria: physical and mental health; >65 years old; attendants of the professional caregiver company connected to the hospital; informed consent and voluntary participation in this study. Exclusion criteria: cognitive dysfunction, inability to complete the training and investigations; those who refuse to participate or withdraw voluntarily after reasonable explanation. This study was approved by the medical ethics committee of the right hospital and all participants provided informed consent. The authors have declared that no competing interests exist.", "The study lasted for 6 months from March to August, 2021. The control group were educated by conventional educational methods, while the observation group by teach-back method. The interventions were implemented at the beginning of the study and 3 months later. Before, in the middle, and at the late stage of the study, questionnaires were completed on the knowledge, confidence, and behaviors (KCB) of fall prevention in elderly inpatients, and the occurrence of falls in all elderly patients cared by the caregivers within 6 months were collected. All relevant data are within the paper and its supporting information files. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific methods are as follows:\nThe nursing department organized and established a fall prevention and management group for the elderly inpatients. The head nurse of the rehabilitation is the team leader, with six charge nurses as members and the director of the rehabilitation as consultants.\nIn the control group, caregivers were randomly assigned to clinical departments, and charge nurses taught them about fall prevention using conventional methods, that is, informing them of the high-risk factors of falling in elderly inpatients and distributing fall prevention guidance manual.\nIn the observation group, the teach-back method combined with multimedia was adopted for centralized training. Training content: PPT courseware, scene simulation video, and use of WeChat group. PPT courseware content takes about 10 minutes, including the incidence of falls, varieties of factors related to fall, the harm of fall in elderly patients, treatment measures after the fall, meanings of fall prevention and specific methods, such as for long-term bedridden patients, lifting the head of a bed for 3 to 5 minutes, and then informing to sit by the bed for a few minutes, finally asking to walk slowly without abnormal response standing in situ. The scene simulation video lasted six minutes, showing a variety of causes by which elderly patients fall in the hospital (such as dizziness, sliding, etc.), showing the seriousness of patients fall (such as fractures needing for surgical treatment), as well as advocating some effective measures to prevent falls. A nurse is responsible for the establishment of a wechat group to share the knowledge and experience on fall prevention from time to time and analyze the causes of falling events within the group so that everyone can learn lessons. Implementation of teach-back method: After the training, charge nurses ask the caregivers questions one by one using a gentle and open way such as “Do you think what kind of inpatients are prone to fall? “What should we do when a patient complains of dizziness while moving”. The caregivers are encouraged to provide positive answers based on their own understanding. If the answers are incorrect, the nurses will correct them immediately, such as “Let’s strengthen the memory again, it should be...” “When the patient complains of dizziness in the activity, we should immediately ask the patient to stop the activity, sit down or lie down to rest, and inform the medical staff,” etc., and ask for retelling until the retelling is correct.", "A self-designed questionnaire (including name, gender, age, education level, fall-related training experience, and length of service) was used to collect demographic information of the caregivers and evaluate whether there was a statistical difference in two groups.\nWith experiences based on the characteristics of clinical nursing work, and after widely searching relevant literatures and referring to “Morse fall assessment scale” and so on, we designed “the questionnaire about the KCB of professional caregivers on fall prevention in elderly inpatients.” The questionnaire was reviewed and modified by five nursing specialists, the content validity is more than 80%. The questionnaire is composed of 33 items, including three dimensions KCB. The knowledge dimension, with a total of 15 items, covering disease factors, environmental factors, prevention measures and emergency response, etc., used the Likert 5 scoring method. Each entry got 1 point for “I don’t know”, 2 points for “heard”, 3 points for “understanding”, 4 points for “clear”, and 5 points for “very clear”. There were 9 items in the confidence dimension, which reflected the positivity and stance of fall prevention. Alike Likert rating method was adopted and each entry got 1 point for “very reluctant”, 2 points for “unwilling”, 3 points for “uncertain”, 4 points for “willing”, and 5 points for “very willing”, with a total score of 45 points. There were 9 items in the behavioral dimension, and Likert 5 scoring method was also adopted when each entry got 1 point for “Never”, 2 points for “occasionally”, 3 points for “some time”, 4 points for “often”, and 5 points for “always”, with a total score of 45 points. Higher the score is, better the cognition and confidence of the caregivers regarding fall prevention is, and higher the credibility of the normative behavior is. The questionnaire has good reliability and validity. The content validity indices of KCB were 0.812, 0.875, and 0.838, respectively. The total Cronbach’s α coefficient was 0.868, and the Cronbach’s α coefficient for each dimension ranged from 0.808 to 0.865.\nWe used two ways to describe the incidence of falls. One is the proportion of all fallers and the other is the person-daily rate which means the ratio of the number of all falls occurred to the total days of stay for all inpatients taken care of during the study period. The control and observation groups were calculated separately.", "Microsoft Office 2010 Excel was used for data entry and double verification was performed. SPSS23.0 statistical software was used for data analysis. Counting data are expressed as frequencies or percentages, and the chi-square test was used for comparison between groups. The measured data were first tested for normality. If a normal distribution was satisfied, the mean ± standard deviation was used to represent the data and t test was performed between groups, while if not, the rank sum test was used. P < .05 indicates a statistically significant difference.", "The sample size was calculated using G*Power© software version 3.1.9.7 (Heinrich Heine University, Dusseldorf, Germany). Depending on the results of a pilot trial with 2-sided (two tails) Type-I error 0.05 and power of 80% (1-β = 0.8), effect size (d) factor 0.60, and considering a dropout rate of approximately 10%, the minimum sample size was 100.", "All 100 caregivers participated in the study and completed the questionnaire survey, with recovery rate 100%. There was no significant difference in the general data between two groups (P > .05). The demographic details are presented in Table 1.\nComparison of general data of two groups.\nAt the beginning of the study, the KCB scores on falls in elderly inpatients in both groups were low, and there was no statistical difference. After different interventions, the scores of KCB of the two groups on fall prevention in elderly inpatients were improved. After once or twice training, the average scores of the three dimensions in the observation group were higher than those in the control group, and the difference was statistically significant (P < .05). The details are presented in Tables 2, 3, and 4.\nComparisons of scores of knowledge dimension.\nComparisons of scores of confidence dimension.\nComparisons of scores of behavior dimension.\nDuring the study period, all the caregivers in the control group took care of 684 elderly inpatients, 9 of whom fell down so that the incidence of falls was 1.32%, and the person-daily rate was 1.34%. In the observation group, all caregivers took care of 658 elderly inpatients, 2 of whom fell down, so the incidence of falls was 0.30%, and then the person-daily rate was 0.33%. There was a statistically difference in the incidence of falls between two groups (P < .05; Table 5).\nComparisons of the incidence of falls.", "Inpatients fall is a permanent topic we need to pay attention to, particularly for elderly inpatients. There are many ways to prevent falls, which have been proven to work.[12,13] Through the review of relevant studies, this study is the first to use the teach-back method to intervene professional caregivers so as to reduce inpatients fall incidence. With the aging of the population in my country and the establishment of the “one patient, one accompany” system after the epidemic of COVID-19, there are more and more professional caregivers, who has become an irreplaceable part. At the same time, compared with medical staff, professional caregivers, spending the most time with their patients, play a vital role in the prevention of fall. In the present study, we adopt teach-back method to improve the KCB of professional caregivers, and the incidence of falls was 1.32% in the control group and 0.30% in the observation group. Study results showed that using teach-back method to intervene professional caregivers is an effective measure to prevent falls.\nThe teach-back method can significantly improve the level of KCB of professional caregivers on the fall prevention in elderly inpatients. The results showed that before the interventions, the average knowledge scores in the two groups was <40 at a failing level. On one hand, it was because of the low education level of caregivers. In this study, 56% of the control group just had a primary school education or below, and it was 62% in the observation group, which was similar to the results of Cho MY.[14] On the other hand, it may be that the caregivers had not received professional trainings about how to prevent fall. Gu YY[15] pointed out that the main way for caregivers to acquire fall-related knowledge is through personal life experience and hospital training. Without professional training, caregivers tend to view falls according to their own experience, which not only is easy to lead negligence, but also not positive enough in fall prevention, and even at a loss when facing high-risk situations such as dizziness. For the nation, the contradiction of the low degree of the caregiver groups will continue for a long time, so it is of great importance to strengthen professional training to reduce the incidence of falls. According to the theoretical model of “KCB”, cognition determines confidence and finally changes behavior. Through training, caregivers can calculate their knowledge about falls in elderly inpatients and fundamentally realize the harm and severity of falls, and voluntarily participate in the management of fall prevention. According to the characteristics of the professional caregiver group, the present study took advantage of multimedia which is full of diversified forms, rich content, specific images, and repeatability to conduct professional training for the observation group and obtained obvious effects.\nThe teach-back method has several advantages over traditional propaganda. From the research results we find that the average scores of KCB of two groups increased after different nursing interventions. The average scores of the observation group was higher than that of the control group, and the difference was statistically significant, indicating that the teach-back method combined with multimedia was more effective than the routine heath education. This is consistent with Wu Qiuxiang’s[7] view that the incidence of falls in elderly patients who have been professionally trained is lower than those who have not been trained. Traditional propaganda is characterized by passive acceptance of the inculcated knowledge, which is inefficient and the contents are easy to forget for professional caregivers. Multimedia can fully display the related contents, also be three-dimensional and imaginable, so it is more easily accepted by the caregivers. Videos in Wechat plays a role of continuable health education, so that the caregivers can review the previous knowledge and learn the new, which can strengthen their memories. Finally, through the method of teach-back, the caregivers will feel in the role of active participators, profoundly understand the significance of fall prevention, and understand when the occurrence is likely to appear, and finally achieve the purpose of falling prevention. The results showed that the overall level after the second training was relatively higher than that after the first training, suggesting the need for persistent interventions. In this regard, the nursing department can set up a special group to conduct fall prevention training regularly.\nMultimedia combined with teach-back method can reduce the incidence of falls in elderly inpatients. In this study, the incidence of falls was 1.32% in the control group and 0.30% in the observation group, which was statistically significant. Previous studies have used different intervention methods, therefore, the reported incidence of falls was very different. The incidence of falls in this study was roughly the same as that in Hill AM’s research.[16] In view of the growing number of elderly patients in hospital, professional care is becoming increasingly important. It is of great significance to train professional caregivers through a teach-back method to reduce the incidence of falls among elderly inpatients. And multimedia combined with teach-back method can quickly make caregivers master the basic knowledge and skills about fall prevention and nursing.\nOverall, with global aging and restrictive visit after COVID-19 pandemic, professional caregivers are in great demand. How to quickly and efficiently improve caregivers’ KCB on fall prevention is particularly important. In our study, the training mode of teach-back method had achieved a certain effect, and it is worth more clinical research and applications.\nThis study had some limitations. For example, elderly patients cared for by the control group and the observation group came from different departments, and the incidence of falls among inpatients in different departments is differential, so there might be some bias.", "Thanks to Yili Ou for helping with data collecting; Thanks to Jie Tan, Zhu Liu, Yamei Wang, and Jiyao Xiang for designing the questionnaires; and thanks to Luxi Yang for quality assurance of the research. Although the above members did not participate in the writing of the article, they did a lot help.", "Conceptualization: Qin Wang.\nData curation: Qin Wang.\nInvestigation: Huixiang Zou.\nResources: Huixiang Zou.\nSoftware: Qin Wang.\nWriting – original draft: Qinqin Wang.\nWriting – review & editing: Qinqin Wang." ]

[ "intro", "methods", null, null, null, "methods", null, "results", "discussion", null, null ]

[ "caregiver", "elderly inpatient", "fall", "KCB", "teach-back" ]

[ 2870, 126, 613, 490, 82, 61, 49 ]

[ "fall", "caregivers", "group", "prevention", "points", "falls", "study", "fall prevention", "elderly", "inpatients" ]

[ "falls inpatients", "fall prevention nursing", "prevent falls nurse", "falling elderly inpatients", "caregivers fall prevention" ]

[ "Adenoma", "Adult", "Aged", "Body Mass Index", "Colorectal Neoplasms", "Cross-Sectional Studies", "Humans", "Leisure Activities", "Logistic Models", "Male", "Middle Aged", "Obesity", "Risk Factors", "Sedentary Behavior", "Television" ]

[ "Study population", "Ascertainment of colorectal adenoma cases and controls", "Assessment of TV watching and other sedentary behaviours", "Assessment of leisure-time physical activity", "Statistical analysis" ]

[ "The HPFS is a cohort study of 51 529 US male health professionals aged 40–75 years at enrolment in 1986. Participants have been mailed questionnaires every 2 years since baseline to collect data on demographics, lifestyle factors, medical history, and disease outcomes, and every 4 years to report update in dietary intake. The overall follow-up rate was >94% (Rimm et al, 1990). In this analysis, we included participants without diagnosis of cancer (except nonmelanoma skin cancer), ulcerative colitis, or colorectal polyp before 1988. To reduce the potential for detection bias, we further restricted to 31 716 men who reported having undergone at least one sigmoidoscopy or colonoscopy between 1988 and 2008. This study was approved by the institutional review board at the Harvard School of Public Health.", "On each biennial questionnaire, we asked whether participants had undergone sigmoidoscopy or colonoscopy; what the indications for these procedures were; whether colon or rectal polyps had been diagnosed in the past 2 years; and if they had the date of diagnosis. When a diagnosis was reported, we obtained informed consent to acquire medical records and pathology reports. Investigators blinded to any exposure information reviewed all records and extracted data on histological type, anatomic location, size, and number of the polyps.\nCases and controls were defined in each 2-year period: all newly diagnosed adenomas (including prevalent adenomas that may have been present for a long time and detected by current endoscopy as well as incident adenomas identified after a previous negative endoscopy, but not recurrent adenomas identified after positive endoscopies) were considered as cases, and all the participants who reported endoscopy but without diagnosis of adenoma were defined as controls. If more than one adenoma was diagnosed, the subject was classified according to the adenoma of the largest size and most advanced histological characteristics. Adenomas in the cecum, ascending colon, hepatic flexure, transverse colon, or splenic flexure were classified as being in the proximal colon. Adenomas in the descending or sigmoid colon were classified as distal and adenomas in the rectum or at the rectosigmoid junction were classified as rectal. We also grouped adenoma cases according to likelihood of developing advanced neoplasia during surveillance (high-risk: at least one adenoma ⩾1 cm in diameter, or with advanced histology (tubulovillous or villous histologic features or high grade or severe dysplasia), or ⩾3 adenomas vs low-risk: other adenoma) (Lieberman et al, 2012), size (large: ⩾1 cm vs small: <1 cm), histology (villous vs tubular), and multiplicity (⩾3 vs <3).", "Starting from 1988, participants reported their average weekly time spent watching TV (including videotapes) biennially. The 1988 questionnaire included six response categories (ranging from 0–1 to 40+ h per week). Subsequent questionnaires included 13 response categories (ranging from 0 to 40+ h per week). We also assessed weekly hours of sitting at work, driving, and other sitting at home (including reading, eating, or at desk), respectively, using the same response categories as TV watching since 1990. To capture long-term sedentary behaviour, we calculated cumulative average hours of sitting (TV watching, at work/driving, and other sitting at home) up to the 2-year interval before the time of the current endoscopy. The main analysis of TV watching included 31 065 men with information on TV watching.", "Participants reported average weekly time spent on the following activities biennially: walking, jogging, running, bicycling, calisthenics or use of a rowing machine, lap swimming, squash or racquetball, and tennis, and their usual walking pace. From these information, weekly energy expenditure in MET-h was calculated (Ainsworth et al, 1993). Our physical activity questions have been previously validated against physical activity diaries (Chasans-Taber et al, 1996).", "We analysed sitting while watching TV (0–6, 7–13,14–20, and 21+ h per week) in relation to the risk of colorectal adenoma as the main analysis. We also evaluated whether sitting at work/driving, and other sitting at home was associated with adenoma risk. We then investigated the association between TV watching and risk of adenoma in the proximal, distal, and rectal colon. For proximal adenomas, we conducted sensitivity analysis excluding participants who only had sigmoidoscopy but no colonoscopy. In addition, we stratified by subtypes of adenoma.\nTo take into account that one person may have undergone multiple endoscopies between 1988 and 2008 and to handle time-varying exposure and covariates efficiently, Andersen-Gill data structure with a new record for each 2-year follow-up period during which a participant underwent an endoscopy was used. Exposure and covariates were set to their values at the time that the questionnaire was returned. Once a participant was diagnosed with adenoma, he was censored for all later follow-up cycles. Age and multivariate-adjusted logistic regressions for clustered data (PROC GENMOD) were used to account for repeated observations (i.e. multiple endoscopies) and calculate odds ratios (ORs) approximating relative risks. Test for trend was conducted using sitting time as a continuous variable. We controlled for the following potential confounders (cumulative updated when applicable): age in 5-year intervals; history of colorectal cancer in a first-degree relative (yes/no); personal history of diabetes (yes/no); height (meter in continuous); alcohol intake (g per day in categories: <5, 5–9.9, 10–14.9, 15–29.9, and 30+); smoking (pack-years in categories: never smoker, 1–4.9, 5–19.9, 20–39.9, and 40+); regular aspirin use (yes/no); total calorie (kcal per day in quintiles); dietary variables including energy-adjusted total folate (μg per day in quintiles); calcium intake (mg per day in quintiles); red and processed meat intake (servings per day in quintiles); time period of endoscopy (in 2-year interval to capture possible changes in adenoma detection rates); number of endoscopies (continuous); time in years since the most recent endoscopy (continuous); and reason for the current endoscopy (screening/symptoms/other). To fully assess whether observed associations may be explained by unhealthy diet, we adjusted for DASH (Dietary Approaches to Stop Hypertension Diet) score, instead of individual food/nutrient intake (total folate, calcium, and red and processed meat intake). DASH score is a composite score that features high intakes of fruit, vegetables, legumes, and nuts; moderate amounts of low-fat dairy products; and low amounts of animal protein and sweets (Fung et al, 2008). Adherence to the DASH diet is associated with reduced risk of colorectal cancer (Fung et al, 2010).\nWe additionally adjusted for leisure-time physical activity (MET-h per week in quintiles) to assess whether the influence of sedentary behaviours were independent of physical activity. We adjusted for body mass index (BMI, kg m−2 in quintiles) to assess whether it mediates the association of interest. As BMI is not an accurate indicator of overweight and obesity in the elderly (Wannamethee et al, 2007), we conducted sensitivity analysis adjusting for waist circumference, a measure of abdominal obesity and a potential independent risk factor for colorectal cancer (Wang et al, 2008), among a subsample of men who reported their waist information in 1987 and 1996.\nWe examined if the association between TV watching and risk of adenoma differed by age, family history of colorectal cancer (yes/no), BMI (<25, 25–29.9, and 30+ kg m−2) and employment status (yes/no). Because employment likely influences the potential amount of time that can be spent sitting while watching TV, it could modify any association with adenoma. We also assessed the joint association of TV watching and physical activity by cross-classifying the two variables. We evaluated interaction by entering a product term of continuous TV watching and the above variables, and the P-value for interaction was determined by a Wald test.\nTo compare the influence of recent and long-term sedentary behaviour (the primary analysis) on risk of adenoma, we conducted sensitivity analysis using only the most recent TV viewing information before each endoscopy. Because adenoma cases in our primary analysis included both prevalent adenoma diagnosed at the first endoscopy and incident adenoma diagnosed after previous negative endoscopies, as exploratory analysis, we restricted to the first endoscopies to assess whether prolonged sitting was more associated with progression of adenoma. All the analyses were performed using SAS v. 9.3 (SAS Institute, Cary, NC, USA), and the statistical tests were two-sided and P-values <0.05 was considered statistically significant." ]

[ null, null, null, null, null ]

[ "Materials and Methods", "Study population", "Ascertainment of colorectal adenoma cases and controls", "Assessment of TV watching and other sedentary behaviours", "Assessment of leisure-time physical activity", "Statistical analysis", "Results", "Discussion", "Conclusion" ]

[ " Study population The HPFS is a cohort study of 51 529 US male health professionals aged 40–75 years at enrolment in 1986. Participants have been mailed questionnaires every 2 years since baseline to collect data on demographics, lifestyle factors, medical history, and disease outcomes, and every 4 years to report update in dietary intake. The overall follow-up rate was >94% (Rimm et al, 1990). In this analysis, we included participants without diagnosis of cancer (except nonmelanoma skin cancer), ulcerative colitis, or colorectal polyp before 1988. To reduce the potential for detection bias, we further restricted to 31 716 men who reported having undergone at least one sigmoidoscopy or colonoscopy between 1988 and 2008. This study was approved by the institutional review board at the Harvard School of Public Health.\nThe HPFS is a cohort study of 51 529 US male health professionals aged 40–75 years at enrolment in 1986. Participants have been mailed questionnaires every 2 years since baseline to collect data on demographics, lifestyle factors, medical history, and disease outcomes, and every 4 years to report update in dietary intake. The overall follow-up rate was >94% (Rimm et al, 1990). In this analysis, we included participants without diagnosis of cancer (except nonmelanoma skin cancer), ulcerative colitis, or colorectal polyp before 1988. To reduce the potential for detection bias, we further restricted to 31 716 men who reported having undergone at least one sigmoidoscopy or colonoscopy between 1988 and 2008. This study was approved by the institutional review board at the Harvard School of Public Health.\n Ascertainment of colorectal adenoma cases and controls On each biennial questionnaire, we asked whether participants had undergone sigmoidoscopy or colonoscopy; what the indications for these procedures were; whether colon or rectal polyps had been diagnosed in the past 2 years; and if they had the date of diagnosis. When a diagnosis was reported, we obtained informed consent to acquire medical records and pathology reports. Investigators blinded to any exposure information reviewed all records and extracted data on histological type, anatomic location, size, and number of the polyps.\nCases and controls were defined in each 2-year period: all newly diagnosed adenomas (including prevalent adenomas that may have been present for a long time and detected by current endoscopy as well as incident adenomas identified after a previous negative endoscopy, but not recurrent adenomas identified after positive endoscopies) were considered as cases, and all the participants who reported endoscopy but without diagnosis of adenoma were defined as controls. If more than one adenoma was diagnosed, the subject was classified according to the adenoma of the largest size and most advanced histological characteristics. Adenomas in the cecum, ascending colon, hepatic flexure, transverse colon, or splenic flexure were classified as being in the proximal colon. Adenomas in the descending or sigmoid colon were classified as distal and adenomas in the rectum or at the rectosigmoid junction were classified as rectal. We also grouped adenoma cases according to likelihood of developing advanced neoplasia during surveillance (high-risk: at least one adenoma ⩾1 cm in diameter, or with advanced histology (tubulovillous or villous histologic features or high grade or severe dysplasia), or ⩾3 adenomas vs low-risk: other adenoma) (Lieberman et al, 2012), size (large: ⩾1 cm vs small: <1 cm), histology (villous vs tubular), and multiplicity (⩾3 vs <3).\nOn each biennial questionnaire, we asked whether participants had undergone sigmoidoscopy or colonoscopy; what the indications for these procedures were; whether colon or rectal polyps had been diagnosed in the past 2 years; and if they had the date of diagnosis. When a diagnosis was reported, we obtained informed consent to acquire medical records and pathology reports. Investigators blinded to any exposure information reviewed all records and extracted data on histological type, anatomic location, size, and number of the polyps.\nCases and controls were defined in each 2-year period: all newly diagnosed adenomas (including prevalent adenomas that may have been present for a long time and detected by current endoscopy as well as incident adenomas identified after a previous negative endoscopy, but not recurrent adenomas identified after positive endoscopies) were considered as cases, and all the participants who reported endoscopy but without diagnosis of adenoma were defined as controls. If more than one adenoma was diagnosed, the subject was classified according to the adenoma of the largest size and most advanced histological characteristics. Adenomas in the cecum, ascending colon, hepatic flexure, transverse colon, or splenic flexure were classified as being in the proximal colon. Adenomas in the descending or sigmoid colon were classified as distal and adenomas in the rectum or at the rectosigmoid junction were classified as rectal. We also grouped adenoma cases according to likelihood of developing advanced neoplasia during surveillance (high-risk: at least one adenoma ⩾1 cm in diameter, or with advanced histology (tubulovillous or villous histologic features or high grade or severe dysplasia), or ⩾3 adenomas vs low-risk: other adenoma) (Lieberman et al, 2012), size (large: ⩾1 cm vs small: <1 cm), histology (villous vs tubular), and multiplicity (⩾3 vs <3).\n Assessment of TV watching and other sedentary behaviours Starting from 1988, participants reported their average weekly time spent watching TV (including videotapes) biennially. The 1988 questionnaire included six response categories (ranging from 0–1 to 40+ h per week). Subsequent questionnaires included 13 response categories (ranging from 0 to 40+ h per week). We also assessed weekly hours of sitting at work, driving, and other sitting at home (including reading, eating, or at desk), respectively, using the same response categories as TV watching since 1990. To capture long-term sedentary behaviour, we calculated cumulative average hours of sitting (TV watching, at work/driving, and other sitting at home) up to the 2-year interval before the time of the current endoscopy. The main analysis of TV watching included 31 065 men with information on TV watching.\nStarting from 1988, participants reported their average weekly time spent watching TV (including videotapes) biennially. The 1988 questionnaire included six response categories (ranging from 0–1 to 40+ h per week). Subsequent questionnaires included 13 response categories (ranging from 0 to 40+ h per week). We also assessed weekly hours of sitting at work, driving, and other sitting at home (including reading, eating, or at desk), respectively, using the same response categories as TV watching since 1990. To capture long-term sedentary behaviour, we calculated cumulative average hours of sitting (TV watching, at work/driving, and other sitting at home) up to the 2-year interval before the time of the current endoscopy. The main analysis of TV watching included 31 065 men with information on TV watching.\n Assessment of leisure-time physical activity Participants reported average weekly time spent on the following activities biennially: walking, jogging, running, bicycling, calisthenics or use of a rowing machine, lap swimming, squash or racquetball, and tennis, and their usual walking pace. From these information, weekly energy expenditure in MET-h was calculated (Ainsworth et al, 1993). Our physical activity questions have been previously validated against physical activity diaries (Chasans-Taber et al, 1996).\nParticipants reported average weekly time spent on the following activities biennially: walking, jogging, running, bicycling, calisthenics or use of a rowing machine, lap swimming, squash or racquetball, and tennis, and their usual walking pace. From these information, weekly energy expenditure in MET-h was calculated (Ainsworth et al, 1993). Our physical activity questions have been previously validated against physical activity diaries (Chasans-Taber et al, 1996).\n Statistical analysis We analysed sitting while watching TV (0–6, 7–13,14–20, and 21+ h per week) in relation to the risk of colorectal adenoma as the main analysis. We also evaluated whether sitting at work/driving, and other sitting at home was associated with adenoma risk. We then investigated the association between TV watching and risk of adenoma in the proximal, distal, and rectal colon. For proximal adenomas, we conducted sensitivity analysis excluding participants who only had sigmoidoscopy but no colonoscopy. In addition, we stratified by subtypes of adenoma.\nTo take into account that one person may have undergone multiple endoscopies between 1988 and 2008 and to handle time-varying exposure and covariates efficiently, Andersen-Gill data structure with a new record for each 2-year follow-up period during which a participant underwent an endoscopy was used. Exposure and covariates were set to their values at the time that the questionnaire was returned. Once a participant was diagnosed with adenoma, he was censored for all later follow-up cycles. Age and multivariate-adjusted logistic regressions for clustered data (PROC GENMOD) were used to account for repeated observations (i.e. multiple endoscopies) and calculate odds ratios (ORs) approximating relative risks. Test for trend was conducted using sitting time as a continuous variable. We controlled for the following potential confounders (cumulative updated when applicable): age in 5-year intervals; history of colorectal cancer in a first-degree relative (yes/no); personal history of diabetes (yes/no); height (meter in continuous); alcohol intake (g per day in categories: <5, 5–9.9, 10–14.9, 15–29.9, and 30+); smoking (pack-years in categories: never smoker, 1–4.9, 5–19.9, 20–39.9, and 40+); regular aspirin use (yes/no); total calorie (kcal per day in quintiles); dietary variables including energy-adjusted total folate (μg per day in quintiles); calcium intake (mg per day in quintiles); red and processed meat intake (servings per day in quintiles); time period of endoscopy (in 2-year interval to capture possible changes in adenoma detection rates); number of endoscopies (continuous); time in years since the most recent endoscopy (continuous); and reason for the current endoscopy (screening/symptoms/other). To fully assess whether observed associations may be explained by unhealthy diet, we adjusted for DASH (Dietary Approaches to Stop Hypertension Diet) score, instead of individual food/nutrient intake (total folate, calcium, and red and processed meat intake). DASH score is a composite score that features high intakes of fruit, vegetables, legumes, and nuts; moderate amounts of low-fat dairy products; and low amounts of animal protein and sweets (Fung et al, 2008). Adherence to the DASH diet is associated with reduced risk of colorectal cancer (Fung et al, 2010).\nWe additionally adjusted for leisure-time physical activity (MET-h per week in quintiles) to assess whether the influence of sedentary behaviours were independent of physical activity. We adjusted for body mass index (BMI, kg m−2 in quintiles) to assess whether it mediates the association of interest. As BMI is not an accurate indicator of overweight and obesity in the elderly (Wannamethee et al, 2007), we conducted sensitivity analysis adjusting for waist circumference, a measure of abdominal obesity and a potential independent risk factor for colorectal cancer (Wang et al, 2008), among a subsample of men who reported their waist information in 1987 and 1996.\nWe examined if the association between TV watching and risk of adenoma differed by age, family history of colorectal cancer (yes/no), BMI (<25, 25–29.9, and 30+ kg m−2) and employment status (yes/no). Because employment likely influences the potential amount of time that can be spent sitting while watching TV, it could modify any association with adenoma. We also assessed the joint association of TV watching and physical activity by cross-classifying the two variables. We evaluated interaction by entering a product term of continuous TV watching and the above variables, and the P-value for interaction was determined by a Wald test.\nTo compare the influence of recent and long-term sedentary behaviour (the primary analysis) on risk of adenoma, we conducted sensitivity analysis using only the most recent TV viewing information before each endoscopy. Because adenoma cases in our primary analysis included both prevalent adenoma diagnosed at the first endoscopy and incident adenoma diagnosed after previous negative endoscopies, as exploratory analysis, we restricted to the first endoscopies to assess whether prolonged sitting was more associated with progression of adenoma. All the analyses were performed using SAS v. 9.3 (SAS Institute, Cary, NC, USA), and the statistical tests were two-sided and P-values <0.05 was considered statistically significant.\nWe analysed sitting while watching TV (0–6, 7–13,14–20, and 21+ h per week) in relation to the risk of colorectal adenoma as the main analysis. We also evaluated whether sitting at work/driving, and other sitting at home was associated with adenoma risk. We then investigated the association between TV watching and risk of adenoma in the proximal, distal, and rectal colon. For proximal adenomas, we conducted sensitivity analysis excluding participants who only had sigmoidoscopy but no colonoscopy. In addition, we stratified by subtypes of adenoma.\nTo take into account that one person may have undergone multiple endoscopies between 1988 and 2008 and to handle time-varying exposure and covariates efficiently, Andersen-Gill data structure with a new record for each 2-year follow-up period during which a participant underwent an endoscopy was used. Exposure and covariates were set to their values at the time that the questionnaire was returned. Once a participant was diagnosed with adenoma, he was censored for all later follow-up cycles. Age and multivariate-adjusted logistic regressions for clustered data (PROC GENMOD) were used to account for repeated observations (i.e. multiple endoscopies) and calculate odds ratios (ORs) approximating relative risks. Test for trend was conducted using sitting time as a continuous variable. We controlled for the following potential confounders (cumulative updated when applicable): age in 5-year intervals; history of colorectal cancer in a first-degree relative (yes/no); personal history of diabetes (yes/no); height (meter in continuous); alcohol intake (g per day in categories: <5, 5–9.9, 10–14.9, 15–29.9, and 30+); smoking (pack-years in categories: never smoker, 1–4.9, 5–19.9, 20–39.9, and 40+); regular aspirin use (yes/no); total calorie (kcal per day in quintiles); dietary variables including energy-adjusted total folate (μg per day in quintiles); calcium intake (mg per day in quintiles); red and processed meat intake (servings per day in quintiles); time period of endoscopy (in 2-year interval to capture possible changes in adenoma detection rates); number of endoscopies (continuous); time in years since the most recent endoscopy (continuous); and reason for the current endoscopy (screening/symptoms/other). To fully assess whether observed associations may be explained by unhealthy diet, we adjusted for DASH (Dietary Approaches to Stop Hypertension Diet) score, instead of individual food/nutrient intake (total folate, calcium, and red and processed meat intake). DASH score is a composite score that features high intakes of fruit, vegetables, legumes, and nuts; moderate amounts of low-fat dairy products; and low amounts of animal protein and sweets (Fung et al, 2008). Adherence to the DASH diet is associated with reduced risk of colorectal cancer (Fung et al, 2010).\nWe additionally adjusted for leisure-time physical activity (MET-h per week in quintiles) to assess whether the influence of sedentary behaviours were independent of physical activity. We adjusted for body mass index (BMI, kg m−2 in quintiles) to assess whether it mediates the association of interest. As BMI is not an accurate indicator of overweight and obesity in the elderly (Wannamethee et al, 2007), we conducted sensitivity analysis adjusting for waist circumference, a measure of abdominal obesity and a potential independent risk factor for colorectal cancer (Wang et al, 2008), among a subsample of men who reported their waist information in 1987 and 1996.\nWe examined if the association between TV watching and risk of adenoma differed by age, family history of colorectal cancer (yes/no), BMI (<25, 25–29.9, and 30+ kg m−2) and employment status (yes/no). Because employment likely influences the potential amount of time that can be spent sitting while watching TV, it could modify any association with adenoma. We also assessed the joint association of TV watching and physical activity by cross-classifying the two variables. We evaluated interaction by entering a product term of continuous TV watching and the above variables, and the P-value for interaction was determined by a Wald test.\nTo compare the influence of recent and long-term sedentary behaviour (the primary analysis) on risk of adenoma, we conducted sensitivity analysis using only the most recent TV viewing information before each endoscopy. Because adenoma cases in our primary analysis included both prevalent adenoma diagnosed at the first endoscopy and incident adenoma diagnosed after previous negative endoscopies, as exploratory analysis, we restricted to the first endoscopies to assess whether prolonged sitting was more associated with progression of adenoma. All the analyses were performed using SAS v. 9.3 (SAS Institute, Cary, NC, USA), and the statistical tests were two-sided and P-values <0.05 was considered statistically significant.", "The HPFS is a cohort study of 51 529 US male health professionals aged 40–75 years at enrolment in 1986. Participants have been mailed questionnaires every 2 years since baseline to collect data on demographics, lifestyle factors, medical history, and disease outcomes, and every 4 years to report update in dietary intake. The overall follow-up rate was >94% (Rimm et al, 1990). In this analysis, we included participants without diagnosis of cancer (except nonmelanoma skin cancer), ulcerative colitis, or colorectal polyp before 1988. To reduce the potential for detection bias, we further restricted to 31 716 men who reported having undergone at least one sigmoidoscopy or colonoscopy between 1988 and 2008. This study was approved by the institutional review board at the Harvard School of Public Health.", "On each biennial questionnaire, we asked whether participants had undergone sigmoidoscopy or colonoscopy; what the indications for these procedures were; whether colon or rectal polyps had been diagnosed in the past 2 years; and if they had the date of diagnosis. When a diagnosis was reported, we obtained informed consent to acquire medical records and pathology reports. Investigators blinded to any exposure information reviewed all records and extracted data on histological type, anatomic location, size, and number of the polyps.\nCases and controls were defined in each 2-year period: all newly diagnosed adenomas (including prevalent adenomas that may have been present for a long time and detected by current endoscopy as well as incident adenomas identified after a previous negative endoscopy, but not recurrent adenomas identified after positive endoscopies) were considered as cases, and all the participants who reported endoscopy but without diagnosis of adenoma were defined as controls. If more than one adenoma was diagnosed, the subject was classified according to the adenoma of the largest size and most advanced histological characteristics. Adenomas in the cecum, ascending colon, hepatic flexure, transverse colon, or splenic flexure were classified as being in the proximal colon. Adenomas in the descending or sigmoid colon were classified as distal and adenomas in the rectum or at the rectosigmoid junction were classified as rectal. We also grouped adenoma cases according to likelihood of developing advanced neoplasia during surveillance (high-risk: at least one adenoma ⩾1 cm in diameter, or with advanced histology (tubulovillous or villous histologic features or high grade or severe dysplasia), or ⩾3 adenomas vs low-risk: other adenoma) (Lieberman et al, 2012), size (large: ⩾1 cm vs small: <1 cm), histology (villous vs tubular), and multiplicity (⩾3 vs <3).", "Starting from 1988, participants reported their average weekly time spent watching TV (including videotapes) biennially. The 1988 questionnaire included six response categories (ranging from 0–1 to 40+ h per week). Subsequent questionnaires included 13 response categories (ranging from 0 to 40+ h per week). We also assessed weekly hours of sitting at work, driving, and other sitting at home (including reading, eating, or at desk), respectively, using the same response categories as TV watching since 1990. To capture long-term sedentary behaviour, we calculated cumulative average hours of sitting (TV watching, at work/driving, and other sitting at home) up to the 2-year interval before the time of the current endoscopy. The main analysis of TV watching included 31 065 men with information on TV watching.", "Participants reported average weekly time spent on the following activities biennially: walking, jogging, running, bicycling, calisthenics or use of a rowing machine, lap swimming, squash or racquetball, and tennis, and their usual walking pace. From these information, weekly energy expenditure in MET-h was calculated (Ainsworth et al, 1993). Our physical activity questions have been previously validated against physical activity diaries (Chasans-Taber et al, 1996).", "We analysed sitting while watching TV (0–6, 7–13,14–20, and 21+ h per week) in relation to the risk of colorectal adenoma as the main analysis. We also evaluated whether sitting at work/driving, and other sitting at home was associated with adenoma risk. We then investigated the association between TV watching and risk of adenoma in the proximal, distal, and rectal colon. For proximal adenomas, we conducted sensitivity analysis excluding participants who only had sigmoidoscopy but no colonoscopy. In addition, we stratified by subtypes of adenoma.\nTo take into account that one person may have undergone multiple endoscopies between 1988 and 2008 and to handle time-varying exposure and covariates efficiently, Andersen-Gill data structure with a new record for each 2-year follow-up period during which a participant underwent an endoscopy was used. Exposure and covariates were set to their values at the time that the questionnaire was returned. Once a participant was diagnosed with adenoma, he was censored for all later follow-up cycles. Age and multivariate-adjusted logistic regressions for clustered data (PROC GENMOD) were used to account for repeated observations (i.e. multiple endoscopies) and calculate odds ratios (ORs) approximating relative risks. Test for trend was conducted using sitting time as a continuous variable. We controlled for the following potential confounders (cumulative updated when applicable): age in 5-year intervals; history of colorectal cancer in a first-degree relative (yes/no); personal history of diabetes (yes/no); height (meter in continuous); alcohol intake (g per day in categories: <5, 5–9.9, 10–14.9, 15–29.9, and 30+); smoking (pack-years in categories: never smoker, 1–4.9, 5–19.9, 20–39.9, and 40+); regular aspirin use (yes/no); total calorie (kcal per day in quintiles); dietary variables including energy-adjusted total folate (μg per day in quintiles); calcium intake (mg per day in quintiles); red and processed meat intake (servings per day in quintiles); time period of endoscopy (in 2-year interval to capture possible changes in adenoma detection rates); number of endoscopies (continuous); time in years since the most recent endoscopy (continuous); and reason for the current endoscopy (screening/symptoms/other). To fully assess whether observed associations may be explained by unhealthy diet, we adjusted for DASH (Dietary Approaches to Stop Hypertension Diet) score, instead of individual food/nutrient intake (total folate, calcium, and red and processed meat intake). DASH score is a composite score that features high intakes of fruit, vegetables, legumes, and nuts; moderate amounts of low-fat dairy products; and low amounts of animal protein and sweets (Fung et al, 2008). Adherence to the DASH diet is associated with reduced risk of colorectal cancer (Fung et al, 2010).\nWe additionally adjusted for leisure-time physical activity (MET-h per week in quintiles) to assess whether the influence of sedentary behaviours were independent of physical activity. We adjusted for body mass index (BMI, kg m−2 in quintiles) to assess whether it mediates the association of interest. As BMI is not an accurate indicator of overweight and obesity in the elderly (Wannamethee et al, 2007), we conducted sensitivity analysis adjusting for waist circumference, a measure of abdominal obesity and a potential independent risk factor for colorectal cancer (Wang et al, 2008), among a subsample of men who reported their waist information in 1987 and 1996.\nWe examined if the association between TV watching and risk of adenoma differed by age, family history of colorectal cancer (yes/no), BMI (<25, 25–29.9, and 30+ kg m−2) and employment status (yes/no). Because employment likely influences the potential amount of time that can be spent sitting while watching TV, it could modify any association with adenoma. We also assessed the joint association of TV watching and physical activity by cross-classifying the two variables. We evaluated interaction by entering a product term of continuous TV watching and the above variables, and the P-value for interaction was determined by a Wald test.\nTo compare the influence of recent and long-term sedentary behaviour (the primary analysis) on risk of adenoma, we conducted sensitivity analysis using only the most recent TV viewing information before each endoscopy. Because adenoma cases in our primary analysis included both prevalent adenoma diagnosed at the first endoscopy and incident adenoma diagnosed after previous negative endoscopies, as exploratory analysis, we restricted to the first endoscopies to assess whether prolonged sitting was more associated with progression of adenoma. All the analyses were performed using SAS v. 9.3 (SAS Institute, Cary, NC, USA), and the statistical tests were two-sided and P-values <0.05 was considered statistically significant.", "During 20 years of follow-up, we documented 4280 newly diagnosed adenomas among 31 065 men who had at least one endoscopy between 1988 and 2008 and reported information on TV watching (Supplementary Table 1). We calculated the distribution of potential risk factors for adenomas according to categories of sitting while watching TV in 1998 (Table 1). Men who spent more time sitting while watching TV were older, had slightly higher BMI, and were more likely to have history of diabetes. These men also spent more time sitting at home reading, eating, or at desk, had higher intake of total energy, and red and processed meat. They were less likely to be employed and had lower intake of folate and calcium. Although men who spent more than 21 h sitting while watching TV per week engaged in less leisure-time physical activity compared with men who watched 0–6 h of TV per week, physical activity levels were similar across the other categories of TV watching.\nMore time spent sitting while watching TV was significantly associated with increased risk of colorectal adenoma in multivariate analysis (Table 2). When we adjusted for DASH score instead of folate, calcium, and red and processed meat, the ORs were essentially the same (data not shown). The results were similar after adjusting for physical activity as well as after further adjustment for BMI, suggesting that leisure-time physical activity did not confound and obesity minimally mediated the observed association. The ORs (95% CIs) of adenoma across categories of TV watching (0–6, 7–13,14–20, and 21+ h per week) were 1.00 (referent), 1.09 (1.01–1.17), 1.16 (1.06–1.27), 1.10 (0.97–1.25), respectively (Ptrend=0.001). Each 14-h increment of TV watching per week was associated with 11% increased risk of adenoma (OR=1.11; 95% CI: 1.04–1.18). Sensitivity analysis controlling for waist circumference instead of BMI showed similar results (data not shown). Other sitting at home (reading, eating, or at desk) (OR per 14-h per week increment=1.08; 95% CI: 1.02–1.16) but not sitting at work/driving was also associated with increased risk of adenoma. For the remaining analyses, we focused on sitting while watching TV and presented results for multivariate analysis adjusting for both physical activity and BMI.\nProlonged sitting while watching TV was associated more strongly with proximal and rectal adenoma compared with distal adenoma (Table 3). Excluding men who did not have colonoscopies minimally affected the risk estimates for proximal adenoma (Supplementary Table 2). Men who spent more time watching TV were slightly more likely to have high-risk compared with low-risk adenoma, which was primarily driven by ⩾3 adenomas (Table 4).\nThe positive association between TV watching and risk of adenoma was slightly stronger for men aged 65 years and above compared with men younger than 65 years, men without compared with men with family history of colorectal cancer, among those who were employed (full/part time) compared with retired/unemployed/disabled, and among normal and overweight men than for obese men, although interactions were not significant (Supplementary Table 3).\nLeisure-physical activity was associated with lower risk of adenoma (ORhighest vs lowest quintile: 0.87; 95% CI: 0.78–0.97) independent of TV watching. In joint analysis, we observed minimal interaction of TV watching and physical activity levels with risk of adenoma (Pinteraction=0.98) (Table 5). Compared with men who were least sedentary (0–6 h per week) and physically most active (highest quintile), those who were most sedentary (14+ h per week of TV watching) and least active (lowest quintile) had a significant increased risk for adenoma (OR=1.25; 95% CI: 1.05–1.49). The joint association was more pronounced for high-risk (OR=1.29; 95% CI: 1.00–1.66) than for low-risk adenoma (OR=1.06; 95% CI: 0.80–1.40).\nThe significant positive association between TV watching and risk of adenoma persisted when only the most recent information before each endoscopy was used instead of cumulative average (Supplementary Table 4). When we restricted to the first reported endoscopy for each man, the association remained similar, suggesting that sedentary lifestyle may be involved in both progression and initiation of colorectal adenoma (Supplementary Table 4).", "In this prospective analysis nested in a large cohort of men, a sedentary lifestyle, primarily more time spent sitting while watching TV, was significantly associated with an increased risk for colorectal adenoma. This association appeared independent of levels of leisure-time physical activity and minimally mediated by BMI. The association was more pronounced for rectal and proximal compared with distal adenoma, and slightly stronger for high-risk than for low-risk adenoma, driven by multiple adenomas. To the best of knowledge, our study is the first to link sedentary behaviour and a precursor of cancer.\nOur findings indicate the potential importance of reducing time spent sedentary, in particular TV viewing time, in addition to promoting physical activity in the prevention of colorectal neoplasia. In particular, being less sedentary and more active reduce primarily risk of high-risk adenoma, which is more likely to progress to colorectal cancer and serves as the major target in screening endoscopies (Winawer and Zauber, 2002; Regula et al, 2006). Our observed weaker and null association between other sitting at home (reading, eating, or at desk), sitting at work/driving, and risk of colorectal adenoma, respectively, were consistent with a recent meta-analysis that, for colon cancer, the RR was higher for TV watching (RR=1.54) than for time spent sitting at work (RR=1.24), comparing the highest vs lowest levels of sedentary time (Schmid and Leitzmann, 2014). The reasons for these differences across sedentary pursuits were unclear but may be related to measurement errors as well as additional link between TV and unhealthy diet (Hu et al, 2003; Owen et al, 2010).\nThere are several plausible mechanisms through which sedentary behaviour may increase the risk of colorectal neoplasia. Obesity may represent an intermediate step in the causal pathway (Lynch, 2010). However, in our multivariate analysis, the odds ratio estimates were hardly changed after adjustment for BMI or waist circumference. Another hypothesis is that prolonged TV watching was associated with increased consumption of unhealthy food (Hu et al, 2001, 2003); however, in our study, the positive significant association persisted after adjusting for individual food/nutrient intake (red and processed meat, folate, and calcium) or composite DASH score. Other mechanisms have been postulated. Hyperinsulinaemia and possibly hyperglycaemia may promote colon carcinogenesis (Giovannucci, 1995, 2007). A meta-analysis of 10 cross-sectional studies showed that, comparing the highest level of sedentary behaviour to the lowest, greater time spent sedentary increased the risk of metabolic syndrome by 73% (Edwardson et al, 2012). A prospective analysis among 376 middle-aged adults suggested that baseline sedentary behaviour (defined by heart rate observations below an individually predetermined threshold) was independently associated with higher log fasting plasma insulin at follow-up (Helmerhorst et al, 2009). In cross-sectional studies, sedentary behaviour was also positively associated with insulin (Gustat et al, 2002), insulin resistance (Balkau et al, 2008; Schmidt et al, 2008), and 2-h glucose (Healy et al, 2007). Inflammation (Fung et al, 2000) and loss of muscle contractile activity that leads to suppressed lipoprotein lipase activity and glucose uptake (Hamilton et al, 2007) may also be involved in the link between sitting time and adenoma/cancer.\nOur observation that prolonged sitting while watching TV was associated more strongly with proximal and rectal adenoma compared with distal adenoma requires confirmation by other studies. Indeed, literature concerning physical activity and colorectal cancer by anatomical subsites were inconsistent (Robsahm et al, 2013) and limited evidence suggested that sedentary behaviour may also differentially affect colon carcinogenesis by subsite (Boyle et al, 2011). Of note, identification of potential differential associations between an exposure and risk of colorectal adenoma/cancer by anatomic subsite could provide more insight into the colorectal carcinogenic mechanisms. For example, cigarette smoking is associated with higher risk of CIMP (CpG island methylator phenotype) high (Samowitz et al, 2006; Curtin et al, 2009; Limsui et al, 2010; Nishihara et al, 2013), MSI (microsatellite instability) high (Slattery et al, 2000; Curtin et al, 2009; Poynter et al, 2009; Limsui et al, 2010; Nishihara et al, 2013), and BRAF- (v-raf murine sarcoma viral oncogene homolog B1) mutated (Samowitz et al, 2006; Curtin et al, 2009; Limsui et al, 2010; Rozek et al, 2010; Nishihara et al, 2013) colorectal cancers, which occur more frequently in the proximal colon. In particular, if our observed stronger association between sitting while watching TV and proximal adenoma were true, decreasing sedentary behaviour may be particularly beneficial for the prevention of proximal adenomas/cancers, which are less detectable and more likely to be missed even in colonoscopies (Lieberman et al, 2012).\nStrengths of our study include the ability to capture long-term sedentary behaviour, minimise measurement errors through asking time spent sitting watching TV explicitly while excluding TV viewing coupled with other non-sedentary activities (e.g. cooking, on treadmills), and control for a variety of potential confounders and mediators. In addition, although the average hours of sitting watching TV (10 h per week) was lower than the national estimates (34 h per week in adults aged 50–64 years) (Nielsen, 2011), a widespread distribution of TV viewing time in our study (an average of 4 h per week among the least and 26 h per week in the most sedentary men) allowed us to assess the potential health benefit of a less sedentary lifestyle. Our study also had several limitations. First, we did not assess time of standing at home/work, which similarly requires low energy expenditure, but physically different from sitting by involving isometric contraction of the antigravity (postural) muscles (Hamilton et al, 2008; Owen et al, 2010). Whether standing could ameliorate the increased risk of colorectal adenoma and other chronic outcomes associated with too much sitting requires more investigation. In addition, time spent sitting at computer, an increasingly prevalent sedentary behaviour in modern society, was not assessed in our cohort. Second, we only included participants who reported having undergone an endoscopy. However, as adenomas are largely asymptomatic, misclassification of outcome is likely non-differential, that is, not related to sedentary behaviours, and thus influence of such bias if any is likely to be small. Moreover, self-report of endoscopies were reliable in our cohort. A previous review of the medical records obtained from a random sample of 200 patients who reported a negative endoscopic result confirmed the absence of adenomas in all cases. In addition, measurement errors associated with recall of sedentary behaviours as well as potential confounders from the biennial questionnaires were likely; however, they would be non-differential to adenoma diagnosis. Possibility of residual confounding, especially from physical activity, could not be ruled out even though our leisure-time physical activity questions have been previously validated and occupational physical activities engaged by these health professionals were limited. Finally, the generalisability of our data to other populations, particularly women and other racial or ethnic groups, may be limited.", "In conclusion, prolonged TV watching is associated with modest increased risk of colorectal adenoma, particularly proximal, rectal, and high-risk adenoma, independent of leisure-time physical activity and not mediated by obesity. Sedentary lifestyle may be relevant in colorectal carcinogenesis. More research is warranted to confirm our findings and studies of time spent sitting while watching TV as well as other sedentary behaviours in relation to the risk of colorectal cancer and survival among colorectal cancer patients are needed." ]

[ "materials|methods", null, null, null, null, null, "results", "discussion", "conclusions" ]

[ "colorectal adenoma", "sedentary behaviour", "television watching" ]

[ 152, 344, 161, 87, 949 ]

[ "adenoma", "tv", "watching", "time", "risk", "sitting", "analysis", "tv watching", "colorectal", "sedentary" ]

[ "colonoscopy", "men colonoscopies minimally", "sigmoidoscopy colonoscopy addition", "excluding men colonoscopies", "sigmoidoscopy colonoscopy 1988" ]

[ "Activities of Daily Living", "Aged, 80 and over", "Cross-Sectional Studies", "Depression", "Family", "Female", "Friends", "Geriatric Assessment", "Humans", "Interpersonal Relations", "Logistic Models", "Male", "Quality of Life", "Social Support", "Thailand" ]

[ "Design and methods", "Ethical approval", "Data collection procedures", "Research instrument and measurement", "Independent and dependent variables", "Controlled variables", "Conclusion" ]

[ " Ethical approval This study was approved by Chiang Mai Provincial Health Office, Ethics Review Committee (EC-CMPHO 2/56). The participants were interviewed and written informed consent was obtained.\nThis study was approved by Chiang Mai Provincial Health Office, Ethics Review Committee (EC-CMPHO 2/56). The participants were interviewed and written informed consent was obtained.\n Data collection procedures A community-based, cross-sectional study was conducted in Chiang Mai Province, Northern Thailand. The study sample comprised of 435 people aged ≥80 years at the time of the survey. All were community residents. The sample size was calculated to ensure the power of the finding with a 95% confidence interval and to represent the population of 10,461 people aged ≥80 years living in the Chiang Mai Province. A multistage sampling approach was applied, taking into account the geographical area, population size, and whether the districts were rural or urban.\nMultistage sampling was designed to obtain a representative sample in a stratified proportionate approach. There are totally 25 districts in Chiang Mai Province. A large district, a medium district, and a small district were selected in the first stage of sampling through stratified random sampling approach applying population size to form stratum (Table 1).\nFrom each selected district, one subdistrict was selected by applying simple random sampling. From each subdistrict, participants were sampled in consecutive villages starting from village number one, until a defined number of participants were recruited.\nThe district Muang Chiang Mai is the main city of Chiang Mai province. Comprising of 16 subdistricts, its population size is comparable to the population of a southern part, northern part, and middle part of the province (Table 1). Therefore, three subdistricts were selected randomly from the 16 subdistricts of Muang Chiang Mai (Table 1). Finally, the sample represented Chiang Mai Province by selecting a total of ten districts. Researchers traveled to villages in twelve subdistricts to reach 435 participants and collected data through interviews (Table 1).\nThe interviewer administered the questionnaires, and measurement was carried out during home visits in ten districts of Chiang Mai Province. Public health officers who were well trained to interview elderly people conducted data collection from May to July 2014. The response rate was 97.7% among those who were interviewed.\nA community-based, cross-sectional study was conducted in Chiang Mai Province, Northern Thailand. The study sample comprised of 435 people aged ≥80 years at the time of the survey. All were community residents. The sample size was calculated to ensure the power of the finding with a 95% confidence interval and to represent the population of 10,461 people aged ≥80 years living in the Chiang Mai Province. A multistage sampling approach was applied, taking into account the geographical area, population size, and whether the districts were rural or urban.\nMultistage sampling was designed to obtain a representative sample in a stratified proportionate approach. There are totally 25 districts in Chiang Mai Province. A large district, a medium district, and a small district were selected in the first stage of sampling through stratified random sampling approach applying population size to form stratum (Table 1).\nFrom each selected district, one subdistrict was selected by applying simple random sampling. From each subdistrict, participants were sampled in consecutive villages starting from village number one, until a defined number of participants were recruited.\nThe district Muang Chiang Mai is the main city of Chiang Mai province. Comprising of 16 subdistricts, its population size is comparable to the population of a southern part, northern part, and middle part of the province (Table 1). Therefore, three subdistricts were selected randomly from the 16 subdistricts of Muang Chiang Mai (Table 1). Finally, the sample represented Chiang Mai Province by selecting a total of ten districts. Researchers traveled to villages in twelve subdistricts to reach 435 participants and collected data through interviews (Table 1).\nThe interviewer administered the questionnaires, and measurement was carried out during home visits in ten districts of Chiang Mai Province. Public health officers who were well trained to interview elderly people conducted data collection from May to July 2014. The response rate was 97.7% among those who were interviewed.\n Research instrument and measurement Independent and dependent variables The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\nThe SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\n Controlled variables Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\nBarthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\n Independent and dependent variables The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\nThe SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\n Controlled variables Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\nBarthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\n Statistical analysis The distribution and types of social ties were analyzed through descriptive analysis. The difference between geriatric parameters such as ADL, GDS, disability, and memory loss among the three groups of social network diversity was analyzed applying the Kruskal–Wallis and chi-squared tests. Categorization of data such as ADL and GDS followed existing standard references.16,29\nTo examine the hypothesis whether increase in SNI would significantly decrease the rank of GDS, the ordinal logistic regression analysis was applied. The dependent variable GDS was regarded as the ordinal variable. Three models of ordinal logistic regression analyses were applied to test the association between the dependent and independent variables. Various covariates were controlled in three regression models. P-value <0.05 was considered as statistically significant with a 95% confidence interval. Stata version 11 (Stata Corporation, College Station, TX) was used for data analysis.\nThe distribution and types of social ties were analyzed through descriptive analysis. The difference between geriatric parameters such as ADL, GDS, disability, and memory loss among the three groups of social network diversity was analyzed applying the Kruskal–Wallis and chi-squared tests. Categorization of data such as ADL and GDS followed existing standard references.16,29\nTo examine the hypothesis whether increase in SNI would significantly decrease the rank of GDS, the ordinal logistic regression analysis was applied. The dependent variable GDS was regarded as the ordinal variable. Three models of ordinal logistic regression analyses were applied to test the association between the dependent and independent variables. Various covariates were controlled in three regression models. P-value <0.05 was considered as statistically significant with a 95% confidence interval. Stata version 11 (Stata Corporation, College Station, TX) was used for data analysis.", "This study was approved by Chiang Mai Provincial Health Office, Ethics Review Committee (EC-CMPHO 2/56). The participants were interviewed and written informed consent was obtained.", "A community-based, cross-sectional study was conducted in Chiang Mai Province, Northern Thailand. The study sample comprised of 435 people aged ≥80 years at the time of the survey. All were community residents. The sample size was calculated to ensure the power of the finding with a 95% confidence interval and to represent the population of 10,461 people aged ≥80 years living in the Chiang Mai Province. A multistage sampling approach was applied, taking into account the geographical area, population size, and whether the districts were rural or urban.\nMultistage sampling was designed to obtain a representative sample in a stratified proportionate approach. There are totally 25 districts in Chiang Mai Province. A large district, a medium district, and a small district were selected in the first stage of sampling through stratified random sampling approach applying population size to form stratum (Table 1).\nFrom each selected district, one subdistrict was selected by applying simple random sampling. From each subdistrict, participants were sampled in consecutive villages starting from village number one, until a defined number of participants were recruited.\nThe district Muang Chiang Mai is the main city of Chiang Mai province. Comprising of 16 subdistricts, its population size is comparable to the population of a southern part, northern part, and middle part of the province (Table 1). Therefore, three subdistricts were selected randomly from the 16 subdistricts of Muang Chiang Mai (Table 1). Finally, the sample represented Chiang Mai Province by selecting a total of ten districts. Researchers traveled to villages in twelve subdistricts to reach 435 participants and collected data through interviews (Table 1).\nThe interviewer administered the questionnaires, and measurement was carried out during home visits in ten districts of Chiang Mai Province. Public health officers who were well trained to interview elderly people conducted data collection from May to July 2014. The response rate was 97.7% among those who were interviewed.", " Independent and dependent variables The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\nThe SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\n Controlled variables Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\nBarthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”", "The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.", "Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”", "In the setting of the current study, children, neighbors, and the Buddhist temple members have been reported as the most likely resources of social network for those in the oldest bracket of the elderly. There is still ample opportunity, however, for this group to strengthen their social ties by engaging in volunteer activity and clubs for the elderly. Moreover, the diversity of their social networks may serve to prevent the problem of depression. Therefore, future research should devise community-based intervention to promote the social networks of those in the oldest age bracket, which may lead the elderly to enjoy active aging and living, in turn positively impacting upon their mental health." ]

[ null, null, "methods", null, null, null, null ]

[ "Introduction", "Design and methods", "Ethical approval", "Data collection procedures", "Research instrument and measurement", "Independent and dependent variables", "Controlled variables", "Statistical analysis", "Results", "Discussion", "Conclusion" ]

[ "Social ties are important for a persons’ physical and mental well-being.1 Since the late 1900s research has been carried out to investigate the impact of social ties on health and lifespan.2,3 Cohen et al2 reported the preventive effect of social network diversity on illnesses such as the common cold. Recent epidemiological studies have shown that socially active people are less likely to develop noncommunicable diseases such as diabetes and metabolic syndrome and are likely to live longer than their nonactive counterparts.4–6 Therefore, being connected in social networks may allow us to lead a healthy life by its salutary and supportive social impacts.\nThe gift of a socially active life is not experienced by all elderly people whose contact list fades away with years of survival. Nowadays, due to the trend of population aging, global societies are seeing more and more people living into their 80s and 90s.7 For a significant minority of these people, however, a common negative aspect of old age is that of social isolation.8,9 A recent national survey in Malaysia, a neighboring country to the study site, reported that 48.6% of old persons were at risk of social isolation and that the oldest old persons were at higher risk.10,11 Research in Korea, Singapore, and the People’s Republic of China also investigated social connectedness of elderly people in each society. Although different instruments were applied in those studies, they reported similarly that people in the bracket of oldest age are liable to social isolation.11–15\nResearch exploring the nature and diversity of elderly people’s social contacts is therefore a necessity, particularly given the unique social and cultural contexts within different countries. In 2010, Thailand was home to 8.5 million elderly people aged ≥60 years and now stands as the fastest population-aging country in Southeast Asia.16,17 In 2006, people aged ≥60 years comprised 11.3% of the Thai population, a figure which is estimated to reach 29.8% by 2050.18,19 People aged ≥80 years, meanwhile, constituted 11.5% of the elderly population,17 a figure which is similarly estimated to increase to 23.6% by 2050.18 Although the impact of social networks has been investigated in a wide range of contexts globally, the types and diversity of social contacts in the oldest age group of Thai society is still scant.\nAn increasingly common problem affecting the elderly is depression. This problem may affect as many as 20% of those in the oldest age bracket.20 However, psychogeriatric research, investigating, for example, the prevalence of depression among the elderly in a country like Thailand, where psychogeriatric services are not yet in place, is still limited. An inverse relation between social network and geriatric depression was reported in a recent study in the US.21 Similar studies, however, are still necessary for Thailand and the Southeast Asian context to find out how social networks influence geriatric depression, in particular among people aged ≥80 years.\nThe current study, therefore, measuring the social network index (SNI) using a quantitative approach aimed to reveal the types of social ties experienced by Thais in the oldest age bracket and assess how their SNI relates to geriatric depression. The findings of the current study seek to highlight the importance of social networks in active aging and may provide insights into ways to preserve the social network diversity of the elderly, resulting in their improved physical and mental well-being.", " Ethical approval This study was approved by Chiang Mai Provincial Health Office, Ethics Review Committee (EC-CMPHO 2/56). The participants were interviewed and written informed consent was obtained.\nThis study was approved by Chiang Mai Provincial Health Office, Ethics Review Committee (EC-CMPHO 2/56). The participants were interviewed and written informed consent was obtained.\n Data collection procedures A community-based, cross-sectional study was conducted in Chiang Mai Province, Northern Thailand. The study sample comprised of 435 people aged ≥80 years at the time of the survey. All were community residents. The sample size was calculated to ensure the power of the finding with a 95% confidence interval and to represent the population of 10,461 people aged ≥80 years living in the Chiang Mai Province. A multistage sampling approach was applied, taking into account the geographical area, population size, and whether the districts were rural or urban.\nMultistage sampling was designed to obtain a representative sample in a stratified proportionate approach. There are totally 25 districts in Chiang Mai Province. A large district, a medium district, and a small district were selected in the first stage of sampling through stratified random sampling approach applying population size to form stratum (Table 1).\nFrom each selected district, one subdistrict was selected by applying simple random sampling. From each subdistrict, participants were sampled in consecutive villages starting from village number one, until a defined number of participants were recruited.\nThe district Muang Chiang Mai is the main city of Chiang Mai province. Comprising of 16 subdistricts, its population size is comparable to the population of a southern part, northern part, and middle part of the province (Table 1). Therefore, three subdistricts were selected randomly from the 16 subdistricts of Muang Chiang Mai (Table 1). Finally, the sample represented Chiang Mai Province by selecting a total of ten districts. Researchers traveled to villages in twelve subdistricts to reach 435 participants and collected data through interviews (Table 1).\nThe interviewer administered the questionnaires, and measurement was carried out during home visits in ten districts of Chiang Mai Province. Public health officers who were well trained to interview elderly people conducted data collection from May to July 2014. The response rate was 97.7% among those who were interviewed.\nA community-based, cross-sectional study was conducted in Chiang Mai Province, Northern Thailand. The study sample comprised of 435 people aged ≥80 years at the time of the survey. All were community residents. The sample size was calculated to ensure the power of the finding with a 95% confidence interval and to represent the population of 10,461 people aged ≥80 years living in the Chiang Mai Province. A multistage sampling approach was applied, taking into account the geographical area, population size, and whether the districts were rural or urban.\nMultistage sampling was designed to obtain a representative sample in a stratified proportionate approach. There are totally 25 districts in Chiang Mai Province. A large district, a medium district, and a small district were selected in the first stage of sampling through stratified random sampling approach applying population size to form stratum (Table 1).\nFrom each selected district, one subdistrict was selected by applying simple random sampling. From each subdistrict, participants were sampled in consecutive villages starting from village number one, until a defined number of participants were recruited.\nThe district Muang Chiang Mai is the main city of Chiang Mai province. Comprising of 16 subdistricts, its population size is comparable to the population of a southern part, northern part, and middle part of the province (Table 1). Therefore, three subdistricts were selected randomly from the 16 subdistricts of Muang Chiang Mai (Table 1). Finally, the sample represented Chiang Mai Province by selecting a total of ten districts. Researchers traveled to villages in twelve subdistricts to reach 435 participants and collected data through interviews (Table 1).\nThe interviewer administered the questionnaires, and measurement was carried out during home visits in ten districts of Chiang Mai Province. Public health officers who were well trained to interview elderly people conducted data collection from May to July 2014. The response rate was 97.7% among those who were interviewed.\n Research instrument and measurement Independent and dependent variables The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\nThe SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\n Controlled variables Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\nBarthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\n Independent and dependent variables The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\nThe SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\n Controlled variables Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\nBarthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\n Statistical analysis The distribution and types of social ties were analyzed through descriptive analysis. The difference between geriatric parameters such as ADL, GDS, disability, and memory loss among the three groups of social network diversity was analyzed applying the Kruskal–Wallis and chi-squared tests. Categorization of data such as ADL and GDS followed existing standard references.16,29\nTo examine the hypothesis whether increase in SNI would significantly decrease the rank of GDS, the ordinal logistic regression analysis was applied. The dependent variable GDS was regarded as the ordinal variable. Three models of ordinal logistic regression analyses were applied to test the association between the dependent and independent variables. Various covariates were controlled in three regression models. P-value <0.05 was considered as statistically significant with a 95% confidence interval. Stata version 11 (Stata Corporation, College Station, TX) was used for data analysis.\nThe distribution and types of social ties were analyzed through descriptive analysis. The difference between geriatric parameters such as ADL, GDS, disability, and memory loss among the three groups of social network diversity was analyzed applying the Kruskal–Wallis and chi-squared tests. Categorization of data such as ADL and GDS followed existing standard references.16,29\nTo examine the hypothesis whether increase in SNI would significantly decrease the rank of GDS, the ordinal logistic regression analysis was applied. The dependent variable GDS was regarded as the ordinal variable. Three models of ordinal logistic regression analyses were applied to test the association between the dependent and independent variables. Various covariates were controlled in three regression models. P-value <0.05 was considered as statistically significant with a 95% confidence interval. Stata version 11 (Stata Corporation, College Station, TX) was used for data analysis.", "This study was approved by Chiang Mai Provincial Health Office, Ethics Review Committee (EC-CMPHO 2/56). The participants were interviewed and written informed consent was obtained.", "A community-based, cross-sectional study was conducted in Chiang Mai Province, Northern Thailand. The study sample comprised of 435 people aged ≥80 years at the time of the survey. All were community residents. The sample size was calculated to ensure the power of the finding with a 95% confidence interval and to represent the population of 10,461 people aged ≥80 years living in the Chiang Mai Province. A multistage sampling approach was applied, taking into account the geographical area, population size, and whether the districts were rural or urban.\nMultistage sampling was designed to obtain a representative sample in a stratified proportionate approach. There are totally 25 districts in Chiang Mai Province. A large district, a medium district, and a small district were selected in the first stage of sampling through stratified random sampling approach applying population size to form stratum (Table 1).\nFrom each selected district, one subdistrict was selected by applying simple random sampling. From each subdistrict, participants were sampled in consecutive villages starting from village number one, until a defined number of participants were recruited.\nThe district Muang Chiang Mai is the main city of Chiang Mai province. Comprising of 16 subdistricts, its population size is comparable to the population of a southern part, northern part, and middle part of the province (Table 1). Therefore, three subdistricts were selected randomly from the 16 subdistricts of Muang Chiang Mai (Table 1). Finally, the sample represented Chiang Mai Province by selecting a total of ten districts. Researchers traveled to villages in twelve subdistricts to reach 435 participants and collected data through interviews (Table 1).\nThe interviewer administered the questionnaires, and measurement was carried out during home visits in ten districts of Chiang Mai Province. Public health officers who were well trained to interview elderly people conducted data collection from May to July 2014. The response rate was 97.7% among those who were interviewed.", " Independent and dependent variables The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\nThe SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.\n Controlled variables Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”\nBarthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”", "The SNI was calculated from the responses to twelve questions.2 This index counts the number of social roles in which the respondent has regular contact, at least once every 2 weeks, with at least one person: spouse, parents, their children and children-in-law, close relatives, close friends, religious members (such as church or temple), classmates, teachers and students in adult education; coworkers or colleagues: employee or employer, neighbors, volunteer networks; and others organizations: social clubs, recreational groups, trade unions, commercial groups, professional organizations, and clubs for the elderly. Hereafter, such regular contact will be referred as “active social contact” in the “Results” and “Discussion” sections.\nThe maximum SNI score is 12. Three categories of social network diversity were formed based on the SNI score: SNI 1–3 represents a “limited” social network, 4–5 as a “medium” social network, and SNI ≥6 as a “diverse” social network. SNI is freely accessible in Measurement Instrument Database for the Social Sciences.2,22 The instrument was transculturally translated from its original English version into Thai so as to maximize the participants’ comprehension and ease of use and tested in a pilot study prior to actual data collection.\nTo measure depression a 30-item long form geriatric depression scale (GDS) was applied, which had been validated and adopted for the Thai population.23,24 Reliability of GDS scale was tested in a pilot sample of 30 people. The data collectors were well trained prior to carrying out the study. The Cronbach’s alpha rating GDS in the current study population was 0.8.", "Barthel’s activities of daily living (ADL) index was applied to measure the participants’ daily activity.25,26 The ADL scores were categorized into dependent group (ADL <14) and independent group (ADL 14–20).27 The participants’ self-rated health status was investigated using a 5-point scale, with responses including “very bad,” “bad,” “reasonable,” “good,” and “very good.” The responses “bad” and “very bad” were categorized as “poor health status,” while the others were categorized as “good health status.” Memory assessment applied a single-item assessment tool. Long-term memory was assessed by asking “Can you remember the events that happened years ago?” and short-term memory was assessed by asking participants “Do you remember what you ate for breakfast this morning?”26\nDisability assessment applied long-term disability and short-term disability assessment.27,28 Participants were asked two questions to detect long-term disability: “Have you had any condition or health problem for 6 months or longer?” and “Does it prevent or limit you in the kind or amount of activity you can do?”28 A positive response to both of these questions was defined as long-term disability. Participants were asked two questions to detect short-term disability: “Have you had any condition or health problem within the last two weeks?” and “Did it prevent or limit you in the kind or amount of activity you can do?”", "The distribution and types of social ties were analyzed through descriptive analysis. The difference between geriatric parameters such as ADL, GDS, disability, and memory loss among the three groups of social network diversity was analyzed applying the Kruskal–Wallis and chi-squared tests. Categorization of data such as ADL and GDS followed existing standard references.16,29\nTo examine the hypothesis whether increase in SNI would significantly decrease the rank of GDS, the ordinal logistic regression analysis was applied. The dependent variable GDS was regarded as the ordinal variable. Three models of ordinal logistic regression analyses were applied to test the association between the dependent and independent variables. Various covariates were controlled in three regression models. P-value <0.05 was considered as statistically significant with a 95% confidence interval. Stata version 11 (Stata Corporation, College Station, TX) was used for data analysis.", "The median age of the sample was 83 years. More than half (54.94%) of the sample (435 persons) were female. The average SNI, in terms of social network diversity, was 4.9±1.9 (mean ± standard deviation [SD]). The median number of people in the contact networks was 15, with a range of 5–21. Categorizing the participants’ SNI, 25% fell into the “limited” social network group (SNI 0–3), 37% into the “medium” network group (SNI 4–5), and 38% into the “diverse” social network group (SNI ≥6). Table 2 shows the characteristics of the participants according to the different categories of SNI. The SNI did not differ between males and females.\nThe participants’ most frequent regular contacts were with their children or their neighbors, with religious society members as their third most active social tie (Figure 1). Contact with close friends and close relatives, meanwhile, represented active social ties for less than half of the participants. Only a third of the participants reported their spouse as an active social contact: 52% of the males reported this as an active social contact, compared with only 29% of the females (P<0.001, chi-squared).\nThe ADL scores differed significantly among the three different SNI groups (Table 2). There was a significant difference in age across the three groups of SNI. The proportion of females was uniform and more than the males in all groups. The elderly in the “diverse” social network group whose SNI ≥6 had the highest ADL score. The GDS score of this group was the lowest. Approximately 10.34% of the participants were suffering from depression: 80% from “mild” depression; 16% from “moderate” depression; and 4% from “severe” depression (Table 2). The proportion of people with a long-term disability and those with a long-term memory loss were significantly higher among elderly seniors with limited social network group than in medium and diverse social network groups.\nThe level of GDS declined with increasing SNI (Table 2). SNI was significantly associated with GDS in all three models of ordinal logistic regression analyses (Table 3). Covariates in the model 1 were SNI, age, sex, and educational attainment; in model 2 were SNI, age, sex, educational attainment, self-impression of health, and dependency; in model 3 were SNI, age, sex, educational attainment, self-impression of health, dependency, and short-term and long-term memory loss (Table 3). The higher the score in the SNI (reflecting a more diverse social network), the lower the GDS score (reflecting lower geriatric depression).\nMoreover, participants’ good self-rated health status indicated a likely lower level of geriatric depression (β–1.03, P<0.001), whereas those with long-term memory loss and short-term memory loss were more likely to suffer from geriatric depression (Table 3).", "This study is of particular value because few studies have conducted empirical research into the social network diversity of people aged ≥80 years.30 It has revealed common patterns of the social networks among the oldest age group in the Northern Thailand context (Figure 1). Many of the participants have lost their closest ties, such as their spouse and their friends. Hence, those who survive longer than their national life expectancy and enter their 80s and 90s may experience drastic changes in their social network. More than a quarter of the participants in the current study belonged to a very limited social network, SNI <3. They were at high risk of social isolation, a health problem overlooked in many communities despite its negative impact on life expectancy, morbidity, and quality of life.31 The findings of the current study, therefore, suggest integrating screening for social isolation as part of primary health care-based geriatric assessment.\nThe majority of participants ranked their children as their most frequently contacted social tie (Figure 1). This highlights the importance of families within the social network of the elderly. In Thai culture, parents, children, and grandchildren traditionally live together, and many elderly people retain a role of caregiver to their grandchildren within these intergenerational families.32 Moreover, a recent study reported that such intergenerational families are common to countries such as Thailand, Myanmar, and Vietnam.32 Many children may migrate to work outside their native province, for example, for career development, yet they can keep in touch with their parents due to the increasing use of mobile phones, as well as improved road access and transportation in Thailand.33\nNeighbors were ranked second by the participants among their most frequent contacts. As reported by Basto et al,34 neighbors represent an ecological asset for elderly community residents, although this may not be the case for nursing home residents.35 Neighborhood hospitality also depends on how urban the location of a community is. Communities in metropolitan Bangkok and traditional communities in Chiang Mai may be rather different. All participants in the current study were community residents living in the Chiang Mai Province, Northern Thailand. This then, may reflect the traditional culture and society unique to Northern Thailand.\nVery few participants retained occupational or educational networks (Figure 1). After retirement, there is less of a role for elderly people within the labor market and occupational networks.8 However, aging people still have other possible active social roles within their communities. The lack of formal working hours coupled with a likely more relaxed daily life may permit the elderly to engage more in social volunteering and religious activity. Notably, >60% of the participants reported their active contact as a member of the temple. Given that all of the participants were Buddhist, this finding is concurrent with that of another recent study in Thailand which reported that involvement in the Buddhist social network positively contributes to the functional health of the elderly.36\nFurthermore, more than half of the participants reported being in contact with a group or club. This could be the result of clubs especially for the elderly which have recently been established in a number of districts in Thailand. These clubs have become popular opportunities for the elderly to get together and socialize. In contrast, less than a quarter of participants reported being involved in volunteer work or regularly talked with people in volunteering activities. This finding is very similar to that of a UK study in which around 20% of the elderly, aged 75 years and older, reported participation in UK volunteering activities.36\nThis study also assessed, in a characteristic sample, the relationship of the participants’ SNI to their level of geriatric depression. The self-impression of health and long-term memory loss had a significant association with depression. After adjusting several important covariates, such as demographics (age, sex, and educational attainment), health status (dependency and self-impression of health), and cognitive decline (short-term and long-term memory loss), there was a significant negative association between social network diversity and geriatric depression. Therefore, being in regular and frequent contact with various social contacts may prevent common geriatric depression among those aged ≥80 years (Table 3).\nThe relation between geriatric depression and social network isolation has been reported in different studies with variable results.21,31,37 These inconsistent findings are probably due to various social networks and their impacts in different cultural contexts. However, the findings of earlier reports in other parts of Thailand are consistent with the findings of the current study despite the different methodological approaches applied. Thanakwang et al38 reported the positive social impact of friends and families on the psychological well-being of elderly Thais. Sasiwongsaroj et al,36 meanwhile, reported that elderly Thais involved in the Buddhist social network gained better functional, mental, and social health status as a result of this social network.36 The samples in these studies, however, comprised of elderly people aged >60 years, whereas the median age within the current study was 83 years. A twenty-year difference in later life may cause drastic changes in social networks, notably with profound loss of friends and colleagues. The current study, therefore, has been able to uncover different typologies of social networking among the oldest bracket of the elderly.\nThis study may have some limitations. The way social network diversity was measured was based on the number and frequency of contact. The quality of the relationship in each social tie could not be known using this approach, however. Moreover, the relation between variables, tested in a cross-sectional study, may require future longitudinal study and analysis. Despite these shortcomings, it is hoped that public health and long-term care programs will benefit from the findings of the present study. It is considered that the study’s descriptive and analytical findings can provide a practical impetus to design evidence-based intervention programs in the Thai setting and more broadly in that of Southeast Asia, which will preserve and promote the social networks of the elderly, in doing so serving to reduce the problem of geriatric depression.", "In the setting of the current study, children, neighbors, and the Buddhist temple members have been reported as the most likely resources of social network for those in the oldest bracket of the elderly. There is still ample opportunity, however, for this group to strengthen their social ties by engaging in volunteer activity and clubs for the elderly. Moreover, the diversity of their social networks may serve to prevent the problem of depression. Therefore, future research should devise community-based intervention to promote the social networks of those in the oldest age bracket, which may lead the elderly to enjoy active aging and living, in turn positively impacting upon their mental health." ]

[ "intro", null, null, "methods", null, null, null, "methods", "results", "discussion", null ]

[ "aging", "gerontology", "psychogeriatrics", "sociology of aging", "community", "Southeast Asia", "Chiang Mai" ]

[ 3551, 32, 365, 1206, 310, 287, 126 ]

[ "social", "participants", "sni", "term", "health", "network", "social network", "study", "disability", "long" ]

[ "networks aging people", "elderly diverse social", "elderly engage social", "age social isolation", "connectedness elderly people" ]

[ "Animals", "Circoviridae Infections", "Circovirus", "Feathers", "Geese", "Parvoviridae Infections", "Parvovirinae", "Poultry Diseases", "Prevalence", "Taiwan" ]

[ "Experimental design", "Birds", "Histopathology", "Molecular biological detection", "Real-time Q-PCR in quarantined and disinfected birds", "Sequence sequencing and comparison", "PCR diagnosis", "Gross lesions and histopathological examination", "Building a phylogenetic tree from the alignment", "Real-time Q-PCR in quarantined and disinfected birds", "Negative control" ]

[ "This study is divided into 2 parts. Part one explores the pathogens of GFL and GBF using microbiology, histopathology and molecular biology. In the second part, the infected geese are separated, treated and observed for feather recovery. Real-time quantitative polymerase chain reaction (Q-PCR) was used to detect the presence of GPV and GoCV viruses in the blood (Supplementary Fig. 2). All experiments within this study conform to the ethical standards issued by the National Research Council. All animal experiments have been approved by the ethics committee of the National Pingtung University of Science and Technology, and care was taken to comply with the 3R concept. In this study, the laboratory animal application form protocol number was NPUST-99-065 and approved number was NPUST-IACUC-99-065.", "A total of 92 geese from 40 farms, comprising 56 showing signs of GFL and 36 with signs of GBF, were examined. Sixty healthy geese (30 goslings and 30 geese) were procured from the same farms with rigorous disinfection and management protocols; they were not affected by goose feather loss or broken feather diseases. These healthy geese were used as negative controls. The grading evaluation of feather shedding uses the feather shedding evaluation proposed in the past literature. According to the feather loss evaluation table, it is divided into back and wings (Supplementary Figs. 3 and 4), there are 5 levels, the lower the score the more complete the feather and the higher the score, obvious severity [16].", "The tissues were embedded in paraffin and processed into 2- to 3-μm-thick sections that were stained with haematoxylin and eosin for histopathological examination. Tissue samples from other gross lesions observed were similarly collected and processed for histopathological assessment.", "PCR protocols and the specificity of primer pairs used are summarised (Supplementary Table 1). RNA and DNA were extracted from tissue using Corning Axygen AP-MN-BF-VNA-250 AxyPrep™ Body Fluid Viral DNA & RNA Purification Miniprep Kits (BIOKIT, Taiwan). Each PCR was performed in a total volume of 20 μL containing 9 µL template DNA, 10 µL Taq DNA, polymerase 2× Master Mix red (1.5 mM MgCl2) and 1 µL primer.\nGoCV PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 45 sec; annealing 55°C for 45 sec; extension 72°C for 45 sec, performed for 35 cycles; final extension 72°C for 5 min. GPV PCR protocol was as follows [1718]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 60°C for 30 sec; extension 72°C for 30 sec, performed for 35 cycles; and final extension 72°C for 5 min. GHPV PCR protocol was as follows [19]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 55°C for 30 sec; extension 72°C for 60 sec; performed for 30 cycles; and final extension 72°C for 5 min. Goose adenovirus PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 40 sec; annealing 54°C for 45 sec; extension 72°C for 40 sec, performed for 30 cycles; and final extension 72°C for 10 min. PCR products were analysed by electrophoresis in a 1.5% (w/v) agarose gel.", "Twenty geese from a farm in Wandan Township of Pingtung were separated into 4 groups, 2 GFL and 2 GBF. The geese were treated daily with a spray of 400-times-diluted iodine solution 50–60 mL. The solution was sprayed onto the head, back, wings and abdomen of each goose, and blood samples were collected every 3 days. Q-PCR Bio-Rad CFX Manager software was used to analyse the data of real-time Q-PCR products to continuously observe the quantification of GPV and GoCV in infected geese. Viral variables in geese from 39 to 66 days of age and from 49 to 76 days of age after GPV and GoCV infection were observed. DNA extractions were performed using whole blood. Real-time PCR detection of GPV and GoCV viruses, using the National Center for Biotechnology Information (NCBI) website design provided by Primer, was as follows: GoCV F, 5′-CCAGTCCATTGTCCGAA-3′; GoCV R, 5′-GGAGGAAGACAACTATGGC-3′; GPV 3F, 5′-ACAACTTTGAGTTTACGTTTGAC-3′; and GPV 3R, 5′-ATTCCAGAGGTATTGATCC ACTA-3′. Bio-Rad Manager 3.1 Software was used to interpret PCR results. The measured OD values were entered into Excel Software for conversion into a standard curve. After that, the plastid concentration was used to convert the virus amount (plasmid copy number). When Q-PCR was completed, the Cq value was obtained.", "This experiment refers to the GPV-specific primer pair GPV (VP2)-F: CCGGGTTGCAGGAGGTAC, R: AGCTACAACAACCACATC that was used by Limn et al. in 1996. It was amplified fragment 800 bp, and the GoCV-specific primer pair GoCV (466-1014)-F: CGGAAGTACCCGACGACTTA, R: ACAATGGACTGGGCTTT CAC that was used by Lin in 2005. It was amplified fragments of 568 bp. The virus-specific fragments were sequenced and analyzed for virus sequence. The sequence analysis used DNASTAR software MegAlign Version 7.1 (DNASTAR, Inc., USA), and provided it in NCBI database. Gene sequence comparison, GoCV part is based on TW11/2001 (AF536941.1), TW10/2001 (AF536940.1), TW9/2001 (AF536939.1), TW8/2001 (AF536938.1), TW7/2001 (AF536937.1), TW6/2001 (AF536936.1), TW5/2001 (AF536935.1), TW4/2001 (AF536934.1), TW3/2001 (AF536933.1), TW2/2001 (AF536932.1), TW1 /2001 (AF536931.1) as the reference sequence; the GPV part uses GPV strain Y (China) (KC178571.1), GPV strain E (China) (KC184133.1), GPV strain GDa (China) (HQ891825.1), GPV strain SH (China) (JF333590.1), GPV strain SHFX1201 (China) (KC478066.1), GPV strain VG32-1 (Europe) (EU583392.1), GPV strain Virulent B (Hungary) (U25749.1), GPV strain 06-0329 (Taiwan) (EU583391.1), GPV strain 82-0321 (Taiwan) (AY382884.1), Muscovy duck parvovirus (AY510603.1) as reference sequence, and use ClustalW in the system to compare and draw a phylogenetic tree. The phylogenetic tree was obtained using 1000 bootstrap replications to evaluate the supporting values ​​for lineage grouping.", "PCR results are shown negative results for GHPV and NGVEV. The incidence of various pathogens in geese with GFL were found to be GoCV 94.6% (53/56), CPV 60.7% (34/56) (Supplementary Fig. 5), whereas geese with GBF showed the following incidence of pathogens: GoCV 83.3% (30/36), GPV 72% (26/36) (Table 1). The result shows that GoCV and GPV are significantly correlated with GFL and GBF (p < 0.05).\nGFL, gosling feather loss disease; GBF, goose broken feather disease; PCR, polymerase chain reaction; GPV, goose parvovirus; GoCV, goose circovirus.", "Figures showing pathological sections (Fig. 1) reveal the gross and histopathologic findings in cases of goose infectious disease with GFL and GBF: Fig. 1A shows the clinical findings for feather loss (GFL), and Fig. 1B shows the clinical findings for broken feather (GBF). Fig. 1C-F shows histopathologic findings in cases of GoCV infection by PCR assay: feather follicle necrosis with inclusion body (Fig. 1C); folliculitis with necropsy follicular inflammatory cell infiltration (Fig. 1D); degeneration and necrosis of epithelial cells on the mucous membrane and the crypts of Lieberkühn (Fig. 1E) and intranuclear inclusion bodies in the degenerated epithelial cells of the crypts of Lieberkühn (Fig. 1F).", "New sequences of GoCV and GPV (569 bp and 806 bp, respectively) were generated and submitted to a public repository GenBank. The GoCV amplified sequence (VP1) was examined by PCR genetic sequence analysis software. A phylogenetic tree was built on the basis of GoCV alignment (VP1) in samples of Pingtung, Kaohsiung, Yunlin and Taiwan. This was compared with 11 GoCV sequences isolated in Taiwan. They were generally divided into two groups. For the first group, both Kaohsiung (W103-1337) and Pingtung areas (W103-1342), the GoCV similarity rate was 100%, whereas in the Taiwanese strains (TW1), (TW10) and (TW11), the similarity was 98%–99%. The other groups were amplified sequences from the Yunlin samples (W103-1368) and (W103-1346). The similarity of (W103-1368) compared with (TW9) and (TW8) was 100%. The similarity of (W103-1346) compared with (TW8) and (TW6) was 98%. The South Taiwan samples were similar to the Yunlin area samples (95%). This implies that GoCV strains differ between the south and north of Taiwan (Fig. 2).\nIn the GPV (VP2) group of amplified sequence fragments found by PCR in this study, the Taiwanese strains, 06-0329 and 82-0321, were compared with strains from China and Europe, and found to strongly resemble them with a similarity of over 99.6%, compared with Muscovy duck parvovirus in which the similarity is only 80.9% (Fig. 3).", "The viral variable was observed in the GLF birds from 39 to 66 days old. By the age of 66 days, although the feathers had all returned to normal growth, the virus had not been eliminated from the system. To reduce the effects of environmental pathogens and secondary infection by bacteria, geese were separated into the treatment group (T) and control group (C). Virus levels were compared between the 2 groups using a t-test. No significant difference in GoCV levels was found for T and C (p = 0.082; p > 0.05). GPV levels in C and T did not differ significantly (p = 0.3; p > 0.05).\nVirus levels were monitored in birds from the age of 39 to 66 days and the decrease in GoCV and GPV levels over time noted. Using the self-designed primer to quantify the change curve of virus quantity (Fig. 4A) and the change of the feathers of the goose (Fig. 4B) when we conduct field monitoring two viral loads. Compared with the change trend of feather score, it can be seen that there seems to be a similar trend, so we divide the data into two sections, and we will perform the Pearson's correlation coefficient test after 35 weeks and 6 weeks of age mentioned earlier. The results of GoCV and GPV of GLB by t-test calculation indicated no significant difference in the GoCV levels in C and T (p = 0.43; p > 0.05) and no significant difference in the GPV levels in C and T (p = 0.348; p > 0.05).\nGPV, goose parvovirus; GoCV, goose circovirus.\nHowever, during the treatment period, the birds between 42 and 63 days old with GFL did not have folliculitis, mobility also gradually improved, the grooming behaviour of the geese gradually became normal and the feather colour turned from yellow to white (Fig. 5A). Similarly, birds 49–75 days old with GBF gradually recovered. The recovery of broken feathers was maintained for about 3–4 weeks. Results indicated that if the breeding environment is properly controlled, there might be cases of early recovery (Fig. 5B).\nGPV, goose parvovirus; GoCV, goose circovirus; GFL, gosling feather loss disease; GBF, goose broken feather disease.", "The 60 healthy geese did not show the presence of GoCV infection, GPV infection or inclusion bodies (Table 1)." ]

[ null, null, null, null, null, null, null, null, null, null, null ]

[ "INTRODUCTION", "MATERIALS AND METHODS", "Experimental design", "Birds", "Histopathology", "Molecular biological detection", "Real-time Q-PCR in quarantined and disinfected birds", "Sequence sequencing and comparison", "RESULTS", "PCR diagnosis", "Gross lesions and histopathological examination", "Building a phylogenetic tree from the alignment", "Real-time Q-PCR in quarantined and disinfected birds", "Negative control", "DISCUSSION" ]

[ "Goslings in several Taiwanese farms experienced gosling feather loss disease (GFL) at 21–35 days old and goose broken feather disease (GBF) at 42–60 days. There are about 40 farms of infections. The incidence ranges from a few birds to 500 cases per field, which accounts for about 1%. It is estimated that about 12,000 geese have been infected, the morbidity is 70–80%, and the mortality is 20–30%. The economic loss may be as high as 10 million. This study aims to investigate the pathogens causing GFL and GBF. A total of 92 geese with these feather diseases were sent to animal hospitals by goose farmers. They came from 40 different farms in 5 counties (Supplementary Fig. 1A and B).\nThere are many factors affecting feather follicle atrophy or underdevelopment, including viral infections, bacterial, parasites infections, and endocrine disorders. Common viral infections can cause GFL and GBF such as goose circovirus (GoCV), goose parvovirus (GPV). Malabsorption of nutrients after enteritis that cause feathers disease, such as new gosling viral enteritis (NGVE) and goose haemorrhagic polyomavirus (GHPV).\nGoCV was first identified in a Germany's large commercial flock of geese with a history of increased mortality and runting by Soike [12]. This case occurred in a one-week-old goose. The clinical symptoms included growth retardation and feather shedding lesions. Histopathology showed varying degrees of lymphocyte loss and histiocytosis lesions in the Fahrenheit bursa, spleen, and thymus. The same geese were also found to have infectious serositis and aspergillosis infection. Soike et al. [1] believed that GoCV infection would inhibit the immune system of the geese, making the geese prone to secondary infections, causing the invasion of mold and bacteria that result geese growth retardation. Spherical or coarse-grained cytoplasmic inclusions were found in Fahrenheit bursa and Lieberkühn crypt epithelial cells. When the ultramicroscopic structure of virus inclusion bodies was examined, it was confirmed that the virus particles arranged in crystals were multilayered or irregular in size 14 nm. The author speculates that the circovirus can induce immunosuppression and make geese prone to secondary infection. In 2004, the survey results in Hungary's goose farm showed that the Fahrenheit bursa of 52 flocks of geese were examined by histology, and 75% of the GoCV-positive populations and 50% of the GoCV-negative populations were observed to have lost lymphocytes in the Fahrenheit bursa. Inclusion bodies were only found in three positive geese flocks, and the three geese flocks were positive for GoCV by dot blot hybridization test (DBH) and polymerase chain reaction (PCR) [3].\nGPV infection was first reported in Hungary in 1967 as a goose farm often called gosling plague, goose viral hepatitis, goose influenza, and ascites hepatitis, with high mortality, mainly caused by violations of goose fiber necrotizing enterocolitis [4]. This is an acute, highly contagious and fatal disease, mainly caused in goslings, fibrous necrotizing enteritis, also known as Derzsy's disease [5]. However, it first invaded Taiwan goose farms in Taiwan in 1982. Experts and scholars unified the disease as goose viral enteritis. This disease is currently infected in Europe, United States, Canada, Russia, Israel, China, Japan and Vietnam. The virus is different from the small virus that infects humans and other poultry [6]. The severity of the disease is greatly related to age. If birds are infected with this virus before one week of age, the mortality is as high as 100%. Infections over four weeks of age rarely have clinical features. If the yolk antibody is administered before three weeks of age, it will effectively combat the occurrence of GPV [7].\nA new epidemic occurred in western France in 1989, causing 40–50% mortality of 2–4 weeks old Muscovy ducks. Although the clinical symptoms are similar to GPV infection, it is not pathogenic to geese and other strains of ducks. After virus isolation and resistance analysis, it was found that this virus and goose-origin waterfowl virus (GPV) are parvoviruses, but there are significant differences in viral nucleic acid and amino acid sequences, so this virus was named Muscovy duck parvovirus (MDPV). Woolcock et al. [8] pointed out that MDPV has been isolated in many countries such as the United States, Germany, Malaysia, Japan, Taiwan, and Thailand. The disease causes the most serious death at the age of about five weeks ago, there will be 30–80% morbidity and 10–50% mortality, and older birds are also susceptible to infection when their immunity is weak [8].\nNGVE is an infectious disease that affects goslings < 30 days old with haemorrhagic, fibrinonecrotic, hyperaemic, necrotic and exudative enteritis in the small intestine [9]. It is caused by an adenovirus called the NGVE virus (NGVEV), which was first reported by Cheng [10]. Haemorrhagic nephritis enteritis of geese is an epizootic viral disease caused by infection with GHPV [11]. Since 1969, GHPV has caused serious economic losses in European countries, including Hungary [12], Germany [13] and southern France [1415]. Geese may also be infected with lice and red mites, which can induce feather loss and occasionally cause naked feathers known colloquially as ‘ghost pull hairs.’ Insufficient essential amino acids in the feed and malnutrition could become an important secondary factor after the outbreak of GFL and GBF.", " Experimental design This study is divided into 2 parts. Part one explores the pathogens of GFL and GBF using microbiology, histopathology and molecular biology. In the second part, the infected geese are separated, treated and observed for feather recovery. Real-time quantitative polymerase chain reaction (Q-PCR) was used to detect the presence of GPV and GoCV viruses in the blood (Supplementary Fig. 2). All experiments within this study conform to the ethical standards issued by the National Research Council. All animal experiments have been approved by the ethics committee of the National Pingtung University of Science and Technology, and care was taken to comply with the 3R concept. In this study, the laboratory animal application form protocol number was NPUST-99-065 and approved number was NPUST-IACUC-99-065.\nThis study is divided into 2 parts. Part one explores the pathogens of GFL and GBF using microbiology, histopathology and molecular biology. In the second part, the infected geese are separated, treated and observed for feather recovery. Real-time quantitative polymerase chain reaction (Q-PCR) was used to detect the presence of GPV and GoCV viruses in the blood (Supplementary Fig. 2). All experiments within this study conform to the ethical standards issued by the National Research Council. All animal experiments have been approved by the ethics committee of the National Pingtung University of Science and Technology, and care was taken to comply with the 3R concept. In this study, the laboratory animal application form protocol number was NPUST-99-065 and approved number was NPUST-IACUC-99-065.\n Birds A total of 92 geese from 40 farms, comprising 56 showing signs of GFL and 36 with signs of GBF, were examined. Sixty healthy geese (30 goslings and 30 geese) were procured from the same farms with rigorous disinfection and management protocols; they were not affected by goose feather loss or broken feather diseases. These healthy geese were used as negative controls. The grading evaluation of feather shedding uses the feather shedding evaluation proposed in the past literature. According to the feather loss evaluation table, it is divided into back and wings (Supplementary Figs. 3 and 4), there are 5 levels, the lower the score the more complete the feather and the higher the score, obvious severity [16].\nA total of 92 geese from 40 farms, comprising 56 showing signs of GFL and 36 with signs of GBF, were examined. Sixty healthy geese (30 goslings and 30 geese) were procured from the same farms with rigorous disinfection and management protocols; they were not affected by goose feather loss or broken feather diseases. These healthy geese were used as negative controls. The grading evaluation of feather shedding uses the feather shedding evaluation proposed in the past literature. According to the feather loss evaluation table, it is divided into back and wings (Supplementary Figs. 3 and 4), there are 5 levels, the lower the score the more complete the feather and the higher the score, obvious severity [16].\n Histopathology The tissues were embedded in paraffin and processed into 2- to 3-μm-thick sections that were stained with haematoxylin and eosin for histopathological examination. Tissue samples from other gross lesions observed were similarly collected and processed for histopathological assessment.\nThe tissues were embedded in paraffin and processed into 2- to 3-μm-thick sections that were stained with haematoxylin and eosin for histopathological examination. Tissue samples from other gross lesions observed were similarly collected and processed for histopathological assessment.\n Molecular biological detection PCR protocols and the specificity of primer pairs used are summarised (Supplementary Table 1). RNA and DNA were extracted from tissue using Corning Axygen AP-MN-BF-VNA-250 AxyPrep™ Body Fluid Viral DNA & RNA Purification Miniprep Kits (BIOKIT, Taiwan). Each PCR was performed in a total volume of 20 μL containing 9 µL template DNA, 10 µL Taq DNA, polymerase 2× Master Mix red (1.5 mM MgCl2) and 1 µL primer.\nGoCV PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 45 sec; annealing 55°C for 45 sec; extension 72°C for 45 sec, performed for 35 cycles; final extension 72°C for 5 min. GPV PCR protocol was as follows [1718]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 60°C for 30 sec; extension 72°C for 30 sec, performed for 35 cycles; and final extension 72°C for 5 min. GHPV PCR protocol was as follows [19]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 55°C for 30 sec; extension 72°C for 60 sec; performed for 30 cycles; and final extension 72°C for 5 min. Goose adenovirus PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 40 sec; annealing 54°C for 45 sec; extension 72°C for 40 sec, performed for 30 cycles; and final extension 72°C for 10 min. PCR products were analysed by electrophoresis in a 1.5% (w/v) agarose gel.\nPCR protocols and the specificity of primer pairs used are summarised (Supplementary Table 1). RNA and DNA were extracted from tissue using Corning Axygen AP-MN-BF-VNA-250 AxyPrep™ Body Fluid Viral DNA & RNA Purification Miniprep Kits (BIOKIT, Taiwan). Each PCR was performed in a total volume of 20 μL containing 9 µL template DNA, 10 µL Taq DNA, polymerase 2× Master Mix red (1.5 mM MgCl2) and 1 µL primer.\nGoCV PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 45 sec; annealing 55°C for 45 sec; extension 72°C for 45 sec, performed for 35 cycles; final extension 72°C for 5 min. GPV PCR protocol was as follows [1718]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 60°C for 30 sec; extension 72°C for 30 sec, performed for 35 cycles; and final extension 72°C for 5 min. GHPV PCR protocol was as follows [19]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 55°C for 30 sec; extension 72°C for 60 sec; performed for 30 cycles; and final extension 72°C for 5 min. Goose adenovirus PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 40 sec; annealing 54°C for 45 sec; extension 72°C for 40 sec, performed for 30 cycles; and final extension 72°C for 10 min. PCR products were analysed by electrophoresis in a 1.5% (w/v) agarose gel.\n Real-time Q-PCR in quarantined and disinfected birds Twenty geese from a farm in Wandan Township of Pingtung were separated into 4 groups, 2 GFL and 2 GBF. The geese were treated daily with a spray of 400-times-diluted iodine solution 50–60 mL. The solution was sprayed onto the head, back, wings and abdomen of each goose, and blood samples were collected every 3 days. Q-PCR Bio-Rad CFX Manager software was used to analyse the data of real-time Q-PCR products to continuously observe the quantification of GPV and GoCV in infected geese. Viral variables in geese from 39 to 66 days of age and from 49 to 76 days of age after GPV and GoCV infection were observed. DNA extractions were performed using whole blood. Real-time PCR detection of GPV and GoCV viruses, using the National Center for Biotechnology Information (NCBI) website design provided by Primer, was as follows: GoCV F, 5′-CCAGTCCATTGTCCGAA-3′; GoCV R, 5′-GGAGGAAGACAACTATGGC-3′; GPV 3F, 5′-ACAACTTTGAGTTTACGTTTGAC-3′; and GPV 3R, 5′-ATTCCAGAGGTATTGATCC ACTA-3′. Bio-Rad Manager 3.1 Software was used to interpret PCR results. The measured OD values were entered into Excel Software for conversion into a standard curve. After that, the plastid concentration was used to convert the virus amount (plasmid copy number). When Q-PCR was completed, the Cq value was obtained.\nTwenty geese from a farm in Wandan Township of Pingtung were separated into 4 groups, 2 GFL and 2 GBF. The geese were treated daily with a spray of 400-times-diluted iodine solution 50–60 mL. The solution was sprayed onto the head, back, wings and abdomen of each goose, and blood samples were collected every 3 days. Q-PCR Bio-Rad CFX Manager software was used to analyse the data of real-time Q-PCR products to continuously observe the quantification of GPV and GoCV in infected geese. Viral variables in geese from 39 to 66 days of age and from 49 to 76 days of age after GPV and GoCV infection were observed. DNA extractions were performed using whole blood. Real-time PCR detection of GPV and GoCV viruses, using the National Center for Biotechnology Information (NCBI) website design provided by Primer, was as follows: GoCV F, 5′-CCAGTCCATTGTCCGAA-3′; GoCV R, 5′-GGAGGAAGACAACTATGGC-3′; GPV 3F, 5′-ACAACTTTGAGTTTACGTTTGAC-3′; and GPV 3R, 5′-ATTCCAGAGGTATTGATCC ACTA-3′. Bio-Rad Manager 3.1 Software was used to interpret PCR results. The measured OD values were entered into Excel Software for conversion into a standard curve. After that, the plastid concentration was used to convert the virus amount (plasmid copy number). When Q-PCR was completed, the Cq value was obtained.\n Sequence sequencing and comparison This experiment refers to the GPV-specific primer pair GPV (VP2)-F: CCGGGTTGCAGGAGGTAC, R: AGCTACAACAACCACATC that was used by Limn et al. in 1996. It was amplified fragment 800 bp, and the GoCV-specific primer pair GoCV (466-1014)-F: CGGAAGTACCCGACGACTTA, R: ACAATGGACTGGGCTTT CAC that was used by Lin in 2005. It was amplified fragments of 568 bp. The virus-specific fragments were sequenced and analyzed for virus sequence. The sequence analysis used DNASTAR software MegAlign Version 7.1 (DNASTAR, Inc., USA), and provided it in NCBI database. Gene sequence comparison, GoCV part is based on TW11/2001 (AF536941.1), TW10/2001 (AF536940.1), TW9/2001 (AF536939.1), TW8/2001 (AF536938.1), TW7/2001 (AF536937.1), TW6/2001 (AF536936.1), TW5/2001 (AF536935.1), TW4/2001 (AF536934.1), TW3/2001 (AF536933.1), TW2/2001 (AF536932.1), TW1 /2001 (AF536931.1) as the reference sequence; the GPV part uses GPV strain Y (China) (KC178571.1), GPV strain E (China) (KC184133.1), GPV strain GDa (China) (HQ891825.1), GPV strain SH (China) (JF333590.1), GPV strain SHFX1201 (China) (KC478066.1), GPV strain VG32-1 (Europe) (EU583392.1), GPV strain Virulent B (Hungary) (U25749.1), GPV strain 06-0329 (Taiwan) (EU583391.1), GPV strain 82-0321 (Taiwan) (AY382884.1), Muscovy duck parvovirus (AY510603.1) as reference sequence, and use ClustalW in the system to compare and draw a phylogenetic tree. The phylogenetic tree was obtained using 1000 bootstrap replications to evaluate the supporting values ​​for lineage grouping.\nThis experiment refers to the GPV-specific primer pair GPV (VP2)-F: CCGGGTTGCAGGAGGTAC, R: AGCTACAACAACCACATC that was used by Limn et al. in 1996. It was amplified fragment 800 bp, and the GoCV-specific primer pair GoCV (466-1014)-F: CGGAAGTACCCGACGACTTA, R: ACAATGGACTGGGCTTT CAC that was used by Lin in 2005. It was amplified fragments of 568 bp. The virus-specific fragments were sequenced and analyzed for virus sequence. The sequence analysis used DNASTAR software MegAlign Version 7.1 (DNASTAR, Inc., USA), and provided it in NCBI database. Gene sequence comparison, GoCV part is based on TW11/2001 (AF536941.1), TW10/2001 (AF536940.1), TW9/2001 (AF536939.1), TW8/2001 (AF536938.1), TW7/2001 (AF536937.1), TW6/2001 (AF536936.1), TW5/2001 (AF536935.1), TW4/2001 (AF536934.1), TW3/2001 (AF536933.1), TW2/2001 (AF536932.1), TW1 /2001 (AF536931.1) as the reference sequence; the GPV part uses GPV strain Y (China) (KC178571.1), GPV strain E (China) (KC184133.1), GPV strain GDa (China) (HQ891825.1), GPV strain SH (China) (JF333590.1), GPV strain SHFX1201 (China) (KC478066.1), GPV strain VG32-1 (Europe) (EU583392.1), GPV strain Virulent B (Hungary) (U25749.1), GPV strain 06-0329 (Taiwan) (EU583391.1), GPV strain 82-0321 (Taiwan) (AY382884.1), Muscovy duck parvovirus (AY510603.1) as reference sequence, and use ClustalW in the system to compare and draw a phylogenetic tree. The phylogenetic tree was obtained using 1000 bootstrap replications to evaluate the supporting values ​​for lineage grouping.", "This study is divided into 2 parts. Part one explores the pathogens of GFL and GBF using microbiology, histopathology and molecular biology. In the second part, the infected geese are separated, treated and observed for feather recovery. Real-time quantitative polymerase chain reaction (Q-PCR) was used to detect the presence of GPV and GoCV viruses in the blood (Supplementary Fig. 2). All experiments within this study conform to the ethical standards issued by the National Research Council. All animal experiments have been approved by the ethics committee of the National Pingtung University of Science and Technology, and care was taken to comply with the 3R concept. In this study, the laboratory animal application form protocol number was NPUST-99-065 and approved number was NPUST-IACUC-99-065.", "A total of 92 geese from 40 farms, comprising 56 showing signs of GFL and 36 with signs of GBF, were examined. Sixty healthy geese (30 goslings and 30 geese) were procured from the same farms with rigorous disinfection and management protocols; they were not affected by goose feather loss or broken feather diseases. These healthy geese were used as negative controls. The grading evaluation of feather shedding uses the feather shedding evaluation proposed in the past literature. According to the feather loss evaluation table, it is divided into back and wings (Supplementary Figs. 3 and 4), there are 5 levels, the lower the score the more complete the feather and the higher the score, obvious severity [16].", "The tissues were embedded in paraffin and processed into 2- to 3-μm-thick sections that were stained with haematoxylin and eosin for histopathological examination. Tissue samples from other gross lesions observed were similarly collected and processed for histopathological assessment.", "PCR protocols and the specificity of primer pairs used are summarised (Supplementary Table 1). RNA and DNA were extracted from tissue using Corning Axygen AP-MN-BF-VNA-250 AxyPrep™ Body Fluid Viral DNA & RNA Purification Miniprep Kits (BIOKIT, Taiwan). Each PCR was performed in a total volume of 20 μL containing 9 µL template DNA, 10 µL Taq DNA, polymerase 2× Master Mix red (1.5 mM MgCl2) and 1 µL primer.\nGoCV PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 45 sec; annealing 55°C for 45 sec; extension 72°C for 45 sec, performed for 35 cycles; final extension 72°C for 5 min. GPV PCR protocol was as follows [1718]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 60°C for 30 sec; extension 72°C for 30 sec, performed for 35 cycles; and final extension 72°C for 5 min. GHPV PCR protocol was as follows [19]: pre-denaturation 94°C for 3 min; denaturation 94°C for 30 sec; annealing 55°C for 30 sec; extension 72°C for 60 sec; performed for 30 cycles; and final extension 72°C for 5 min. Goose adenovirus PCR protocol was as follows: pre-denaturation 94°C for 5 min; denaturation 94°C for 40 sec; annealing 54°C for 45 sec; extension 72°C for 40 sec, performed for 30 cycles; and final extension 72°C for 10 min. PCR products were analysed by electrophoresis in a 1.5% (w/v) agarose gel.", "Twenty geese from a farm in Wandan Township of Pingtung were separated into 4 groups, 2 GFL and 2 GBF. The geese were treated daily with a spray of 400-times-diluted iodine solution 50–60 mL. The solution was sprayed onto the head, back, wings and abdomen of each goose, and blood samples were collected every 3 days. Q-PCR Bio-Rad CFX Manager software was used to analyse the data of real-time Q-PCR products to continuously observe the quantification of GPV and GoCV in infected geese. Viral variables in geese from 39 to 66 days of age and from 49 to 76 days of age after GPV and GoCV infection were observed. DNA extractions were performed using whole blood. Real-time PCR detection of GPV and GoCV viruses, using the National Center for Biotechnology Information (NCBI) website design provided by Primer, was as follows: GoCV F, 5′-CCAGTCCATTGTCCGAA-3′; GoCV R, 5′-GGAGGAAGACAACTATGGC-3′; GPV 3F, 5′-ACAACTTTGAGTTTACGTTTGAC-3′; and GPV 3R, 5′-ATTCCAGAGGTATTGATCC ACTA-3′. Bio-Rad Manager 3.1 Software was used to interpret PCR results. The measured OD values were entered into Excel Software for conversion into a standard curve. After that, the plastid concentration was used to convert the virus amount (plasmid copy number). When Q-PCR was completed, the Cq value was obtained.", "This experiment refers to the GPV-specific primer pair GPV (VP2)-F: CCGGGTTGCAGGAGGTAC, R: AGCTACAACAACCACATC that was used by Limn et al. in 1996. It was amplified fragment 800 bp, and the GoCV-specific primer pair GoCV (466-1014)-F: CGGAAGTACCCGACGACTTA, R: ACAATGGACTGGGCTTT CAC that was used by Lin in 2005. It was amplified fragments of 568 bp. The virus-specific fragments were sequenced and analyzed for virus sequence. The sequence analysis used DNASTAR software MegAlign Version 7.1 (DNASTAR, Inc., USA), and provided it in NCBI database. Gene sequence comparison, GoCV part is based on TW11/2001 (AF536941.1), TW10/2001 (AF536940.1), TW9/2001 (AF536939.1), TW8/2001 (AF536938.1), TW7/2001 (AF536937.1), TW6/2001 (AF536936.1), TW5/2001 (AF536935.1), TW4/2001 (AF536934.1), TW3/2001 (AF536933.1), TW2/2001 (AF536932.1), TW1 /2001 (AF536931.1) as the reference sequence; the GPV part uses GPV strain Y (China) (KC178571.1), GPV strain E (China) (KC184133.1), GPV strain GDa (China) (HQ891825.1), GPV strain SH (China) (JF333590.1), GPV strain SHFX1201 (China) (KC478066.1), GPV strain VG32-1 (Europe) (EU583392.1), GPV strain Virulent B (Hungary) (U25749.1), GPV strain 06-0329 (Taiwan) (EU583391.1), GPV strain 82-0321 (Taiwan) (AY382884.1), Muscovy duck parvovirus (AY510603.1) as reference sequence, and use ClustalW in the system to compare and draw a phylogenetic tree. The phylogenetic tree was obtained using 1000 bootstrap replications to evaluate the supporting values ​​for lineage grouping.", " PCR diagnosis PCR results are shown negative results for GHPV and NGVEV. The incidence of various pathogens in geese with GFL were found to be GoCV 94.6% (53/56), CPV 60.7% (34/56) (Supplementary Fig. 5), whereas geese with GBF showed the following incidence of pathogens: GoCV 83.3% (30/36), GPV 72% (26/36) (Table 1). The result shows that GoCV and GPV are significantly correlated with GFL and GBF (p < 0.05).\nGFL, gosling feather loss disease; GBF, goose broken feather disease; PCR, polymerase chain reaction; GPV, goose parvovirus; GoCV, goose circovirus.\nPCR results are shown negative results for GHPV and NGVEV. The incidence of various pathogens in geese with GFL were found to be GoCV 94.6% (53/56), CPV 60.7% (34/56) (Supplementary Fig. 5), whereas geese with GBF showed the following incidence of pathogens: GoCV 83.3% (30/36), GPV 72% (26/36) (Table 1). The result shows that GoCV and GPV are significantly correlated with GFL and GBF (p < 0.05).\nGFL, gosling feather loss disease; GBF, goose broken feather disease; PCR, polymerase chain reaction; GPV, goose parvovirus; GoCV, goose circovirus.\n Gross lesions and histopathological examination Figures showing pathological sections (Fig. 1) reveal the gross and histopathologic findings in cases of goose infectious disease with GFL and GBF: Fig. 1A shows the clinical findings for feather loss (GFL), and Fig. 1B shows the clinical findings for broken feather (GBF). Fig. 1C-F shows histopathologic findings in cases of GoCV infection by PCR assay: feather follicle necrosis with inclusion body (Fig. 1C); folliculitis with necropsy follicular inflammatory cell infiltration (Fig. 1D); degeneration and necrosis of epithelial cells on the mucous membrane and the crypts of Lieberkühn (Fig. 1E) and intranuclear inclusion bodies in the degenerated epithelial cells of the crypts of Lieberkühn (Fig. 1F).\nFigures showing pathological sections (Fig. 1) reveal the gross and histopathologic findings in cases of goose infectious disease with GFL and GBF: Fig. 1A shows the clinical findings for feather loss (GFL), and Fig. 1B shows the clinical findings for broken feather (GBF). Fig. 1C-F shows histopathologic findings in cases of GoCV infection by PCR assay: feather follicle necrosis with inclusion body (Fig. 1C); folliculitis with necropsy follicular inflammatory cell infiltration (Fig. 1D); degeneration and necrosis of epithelial cells on the mucous membrane and the crypts of Lieberkühn (Fig. 1E) and intranuclear inclusion bodies in the degenerated epithelial cells of the crypts of Lieberkühn (Fig. 1F).\n Building a phylogenetic tree from the alignment New sequences of GoCV and GPV (569 bp and 806 bp, respectively) were generated and submitted to a public repository GenBank. The GoCV amplified sequence (VP1) was examined by PCR genetic sequence analysis software. A phylogenetic tree was built on the basis of GoCV alignment (VP1) in samples of Pingtung, Kaohsiung, Yunlin and Taiwan. This was compared with 11 GoCV sequences isolated in Taiwan. They were generally divided into two groups. For the first group, both Kaohsiung (W103-1337) and Pingtung areas (W103-1342), the GoCV similarity rate was 100%, whereas in the Taiwanese strains (TW1), (TW10) and (TW11), the similarity was 98%–99%. The other groups were amplified sequences from the Yunlin samples (W103-1368) and (W103-1346). The similarity of (W103-1368) compared with (TW9) and (TW8) was 100%. The similarity of (W103-1346) compared with (TW8) and (TW6) was 98%. The South Taiwan samples were similar to the Yunlin area samples (95%). This implies that GoCV strains differ between the south and north of Taiwan (Fig. 2).\nIn the GPV (VP2) group of amplified sequence fragments found by PCR in this study, the Taiwanese strains, 06-0329 and 82-0321, were compared with strains from China and Europe, and found to strongly resemble them with a similarity of over 99.6%, compared with Muscovy duck parvovirus in which the similarity is only 80.9% (Fig. 3).\nNew sequences of GoCV and GPV (569 bp and 806 bp, respectively) were generated and submitted to a public repository GenBank. The GoCV amplified sequence (VP1) was examined by PCR genetic sequence analysis software. A phylogenetic tree was built on the basis of GoCV alignment (VP1) in samples of Pingtung, Kaohsiung, Yunlin and Taiwan. This was compared with 11 GoCV sequences isolated in Taiwan. They were generally divided into two groups. For the first group, both Kaohsiung (W103-1337) and Pingtung areas (W103-1342), the GoCV similarity rate was 100%, whereas in the Taiwanese strains (TW1), (TW10) and (TW11), the similarity was 98%–99%. The other groups were amplified sequences from the Yunlin samples (W103-1368) and (W103-1346). The similarity of (W103-1368) compared with (TW9) and (TW8) was 100%. The similarity of (W103-1346) compared with (TW8) and (TW6) was 98%. The South Taiwan samples were similar to the Yunlin area samples (95%). This implies that GoCV strains differ between the south and north of Taiwan (Fig. 2).\nIn the GPV (VP2) group of amplified sequence fragments found by PCR in this study, the Taiwanese strains, 06-0329 and 82-0321, were compared with strains from China and Europe, and found to strongly resemble them with a similarity of over 99.6%, compared with Muscovy duck parvovirus in which the similarity is only 80.9% (Fig. 3).\n Real-time Q-PCR in quarantined and disinfected birds The viral variable was observed in the GLF birds from 39 to 66 days old. By the age of 66 days, although the feathers had all returned to normal growth, the virus had not been eliminated from the system. To reduce the effects of environmental pathogens and secondary infection by bacteria, geese were separated into the treatment group (T) and control group (C). Virus levels were compared between the 2 groups using a t-test. No significant difference in GoCV levels was found for T and C (p = 0.082; p > 0.05). GPV levels in C and T did not differ significantly (p = 0.3; p > 0.05).\nVirus levels were monitored in birds from the age of 39 to 66 days and the decrease in GoCV and GPV levels over time noted. Using the self-designed primer to quantify the change curve of virus quantity (Fig. 4A) and the change of the feathers of the goose (Fig. 4B) when we conduct field monitoring two viral loads. Compared with the change trend of feather score, it can be seen that there seems to be a similar trend, so we divide the data into two sections, and we will perform the Pearson's correlation coefficient test after 35 weeks and 6 weeks of age mentioned earlier. The results of GoCV and GPV of GLB by t-test calculation indicated no significant difference in the GoCV levels in C and T (p = 0.43; p > 0.05) and no significant difference in the GPV levels in C and T (p = 0.348; p > 0.05).\nGPV, goose parvovirus; GoCV, goose circovirus.\nHowever, during the treatment period, the birds between 42 and 63 days old with GFL did not have folliculitis, mobility also gradually improved, the grooming behaviour of the geese gradually became normal and the feather colour turned from yellow to white (Fig. 5A). Similarly, birds 49–75 days old with GBF gradually recovered. The recovery of broken feathers was maintained for about 3–4 weeks. Results indicated that if the breeding environment is properly controlled, there might be cases of early recovery (Fig. 5B).\nGPV, goose parvovirus; GoCV, goose circovirus; GFL, gosling feather loss disease; GBF, goose broken feather disease.\nThe viral variable was observed in the GLF birds from 39 to 66 days old. By the age of 66 days, although the feathers had all returned to normal growth, the virus had not been eliminated from the system. To reduce the effects of environmental pathogens and secondary infection by bacteria, geese were separated into the treatment group (T) and control group (C). Virus levels were compared between the 2 groups using a t-test. No significant difference in GoCV levels was found for T and C (p = 0.082; p > 0.05). GPV levels in C and T did not differ significantly (p = 0.3; p > 0.05).\nVirus levels were monitored in birds from the age of 39 to 66 days and the decrease in GoCV and GPV levels over time noted. Using the self-designed primer to quantify the change curve of virus quantity (Fig. 4A) and the change of the feathers of the goose (Fig. 4B) when we conduct field monitoring two viral loads. Compared with the change trend of feather score, it can be seen that there seems to be a similar trend, so we divide the data into two sections, and we will perform the Pearson's correlation coefficient test after 35 weeks and 6 weeks of age mentioned earlier. The results of GoCV and GPV of GLB by t-test calculation indicated no significant difference in the GoCV levels in C and T (p = 0.43; p > 0.05) and no significant difference in the GPV levels in C and T (p = 0.348; p > 0.05).\nGPV, goose parvovirus; GoCV, goose circovirus.\nHowever, during the treatment period, the birds between 42 and 63 days old with GFL did not have folliculitis, mobility also gradually improved, the grooming behaviour of the geese gradually became normal and the feather colour turned from yellow to white (Fig. 5A). Similarly, birds 49–75 days old with GBF gradually recovered. The recovery of broken feathers was maintained for about 3–4 weeks. Results indicated that if the breeding environment is properly controlled, there might be cases of early recovery (Fig. 5B).\nGPV, goose parvovirus; GoCV, goose circovirus; GFL, gosling feather loss disease; GBF, goose broken feather disease.\n Negative control The 60 healthy geese did not show the presence of GoCV infection, GPV infection or inclusion bodies (Table 1).\nThe 60 healthy geese did not show the presence of GoCV infection, GPV infection or inclusion bodies (Table 1).", "PCR results are shown negative results for GHPV and NGVEV. The incidence of various pathogens in geese with GFL were found to be GoCV 94.6% (53/56), CPV 60.7% (34/56) (Supplementary Fig. 5), whereas geese with GBF showed the following incidence of pathogens: GoCV 83.3% (30/36), GPV 72% (26/36) (Table 1). The result shows that GoCV and GPV are significantly correlated with GFL and GBF (p < 0.05).\nGFL, gosling feather loss disease; GBF, goose broken feather disease; PCR, polymerase chain reaction; GPV, goose parvovirus; GoCV, goose circovirus.", "Figures showing pathological sections (Fig. 1) reveal the gross and histopathologic findings in cases of goose infectious disease with GFL and GBF: Fig. 1A shows the clinical findings for feather loss (GFL), and Fig. 1B shows the clinical findings for broken feather (GBF). Fig. 1C-F shows histopathologic findings in cases of GoCV infection by PCR assay: feather follicle necrosis with inclusion body (Fig. 1C); folliculitis with necropsy follicular inflammatory cell infiltration (Fig. 1D); degeneration and necrosis of epithelial cells on the mucous membrane and the crypts of Lieberkühn (Fig. 1E) and intranuclear inclusion bodies in the degenerated epithelial cells of the crypts of Lieberkühn (Fig. 1F).", "New sequences of GoCV and GPV (569 bp and 806 bp, respectively) were generated and submitted to a public repository GenBank. The GoCV amplified sequence (VP1) was examined by PCR genetic sequence analysis software. A phylogenetic tree was built on the basis of GoCV alignment (VP1) in samples of Pingtung, Kaohsiung, Yunlin and Taiwan. This was compared with 11 GoCV sequences isolated in Taiwan. They were generally divided into two groups. For the first group, both Kaohsiung (W103-1337) and Pingtung areas (W103-1342), the GoCV similarity rate was 100%, whereas in the Taiwanese strains (TW1), (TW10) and (TW11), the similarity was 98%–99%. The other groups were amplified sequences from the Yunlin samples (W103-1368) and (W103-1346). The similarity of (W103-1368) compared with (TW9) and (TW8) was 100%. The similarity of (W103-1346) compared with (TW8) and (TW6) was 98%. The South Taiwan samples were similar to the Yunlin area samples (95%). This implies that GoCV strains differ between the south and north of Taiwan (Fig. 2).\nIn the GPV (VP2) group of amplified sequence fragments found by PCR in this study, the Taiwanese strains, 06-0329 and 82-0321, were compared with strains from China and Europe, and found to strongly resemble them with a similarity of over 99.6%, compared with Muscovy duck parvovirus in which the similarity is only 80.9% (Fig. 3).", "The viral variable was observed in the GLF birds from 39 to 66 days old. By the age of 66 days, although the feathers had all returned to normal growth, the virus had not been eliminated from the system. To reduce the effects of environmental pathogens and secondary infection by bacteria, geese were separated into the treatment group (T) and control group (C). Virus levels were compared between the 2 groups using a t-test. No significant difference in GoCV levels was found for T and C (p = 0.082; p > 0.05). GPV levels in C and T did not differ significantly (p = 0.3; p > 0.05).\nVirus levels were monitored in birds from the age of 39 to 66 days and the decrease in GoCV and GPV levels over time noted. Using the self-designed primer to quantify the change curve of virus quantity (Fig. 4A) and the change of the feathers of the goose (Fig. 4B) when we conduct field monitoring two viral loads. Compared with the change trend of feather score, it can be seen that there seems to be a similar trend, so we divide the data into two sections, and we will perform the Pearson's correlation coefficient test after 35 weeks and 6 weeks of age mentioned earlier. The results of GoCV and GPV of GLB by t-test calculation indicated no significant difference in the GoCV levels in C and T (p = 0.43; p > 0.05) and no significant difference in the GPV levels in C and T (p = 0.348; p > 0.05).\nGPV, goose parvovirus; GoCV, goose circovirus.\nHowever, during the treatment period, the birds between 42 and 63 days old with GFL did not have folliculitis, mobility also gradually improved, the grooming behaviour of the geese gradually became normal and the feather colour turned from yellow to white (Fig. 5A). Similarly, birds 49–75 days old with GBF gradually recovered. The recovery of broken feathers was maintained for about 3–4 weeks. Results indicated that if the breeding environment is properly controlled, there might be cases of early recovery (Fig. 5B).\nGPV, goose parvovirus; GoCV, goose circovirus; GFL, gosling feather loss disease; GBF, goose broken feather disease.", "The 60 healthy geese did not show the presence of GoCV infection, GPV infection or inclusion bodies (Table 1).", "GFL and GBF appear to be a common phenomenon in Taiwan. In this study, 2 cases of inclusion bodies were observed in the feather follicles, and viral nucleic acids were detected in cases of GoCV infection. Neither GHPV nor NGVEV was detected.\nThis study was similar to previous outbreak investigations in terms of the challenge and disease investigation. No inclusion bodies were observed, but the nucleic acids detected were universal [20212223]. Chen conducted an epidemiological survey of GoCV and found that the positive rate of GoCV in Taiwan is as high as 94.7% (197/208). GoCV in Taiwan has become a common virus. It is inferred that although circovirus can cause lymphocyte loss and lead to immunosuppression that could be induced many disease outbreaks [24]. Ball focused on the epidemiological investigation of GoCV, simultaneously, the parvovirus, polyomavirus, reticuloendotheliosis virus, salmonella, streptococcus and mycoplasma were detected [3]. Jing et al. [25] purified the circovirus and inoculated with 21-day-old goslings, and observed pathological changes that caused goose diarrhea, growth retardation and feather growth disorder. It can be found circovirus positive in the Fahrenheit bursa, thymus, spleen, duodenum, and liver when PCR test. The virus can be detected in the blood 14 days after vaccination. Pathological examinations have lymphopenia in the Fahrenheit bursa, spleen and liver. Inflammatory cells proliferate in the lungs and kidneys [25]. Australia has also found fractured feathers in crow with circovirus infection, which is quite similar to the situation of the goose found in this study. In the case, inclusion bodies were found in the basal layer of the feather follicle under the section, and a large number of inflammatory cells infiltrated in the feather follicle. It is the same as the nuclear inclusion bodies in the feather follicle seen in this study. Although some reports have pointed out that no inclusion bodies were seen under the slices in the investigation of the challenge and disease, but the nucleic acids detected were universal [2021].\nResearch on the etiology of GFL and GBF is becoming more and more urgent. At present, many scholars have carried out quantitative detection of viruses for GPV and GoCV, and their sensitivity can be detected up to 28 copy number variants [2627]. Woźniakowski et al. [28] also explored the relationship between the clinical investigation of the aquatic parvovirus and the amount of virus found in the system, using quantitative GPV, combined with clinical pathology, which can be used as the main method of elucidation of epidemiology. The previous study showed that there was no comparison of virus levels between GPV and GoCV and broken feathers disease. Therefore, this study designed primers for Q-PCR testing and found that the virus levels of goose infected in the wild are usually quite unstable. The virus levels ranges from 105 to 108, and it is impossible to determine the amount of virus from the appearance. Therefore, when statistics are made, there will be thought the difference in the amount of each virus exceeds 100 or more, but the data trends shown are almost the same.\nAfter the full-length sequencing and comparison of the GoCV strains, isolated from different regions in 2002–2003, the sequence similarity is above 97%, showing the genome sequence of the GoCV strain is very stable in Taiwan [24]. The sequence analysed in this study is VP1 (rep) nucleic acid between nt466 and nt1014. Although it is not a full-length sequence, there are still differences when compared with W103-1368 and W103-1346 from Yunlin County and W103-1339, W103-1337 and 1342 from the south of Kaohsiung. We found that the sequence from the south of Kaohsiung is significantly different from that of Yunlin. It is speculated that there may be differences in different types of viruses due to regional relationships; further research into this topic is required.\nGPV infection has so far produced commercially available vaccines, and farmers usually vaccinate within 1 week of age. If the maternal antibody is administered at this time, it will last for 35 days. Immunity value continues to 20 weeks of age. Most of the infected birds will have the results in reduced growth and feather development. If the gosling is older than one month, the survivor will become the carrier for life. When the goose recovers from the parvovirus infection, a large number of antibodies will continue to remain in the body for 80 months. At this time, the maternal antibody of breeding geese will be able to transfer to the hatched goslings and will achieve a good immune effect [29]. Goose infection with parvovirus often causes hemorrhagic enteritis, which results in poor absorption efficiency, relatively slow growth and uneven feathering. The feather loss is mainly related to GPV. Although it can be seen a large number of inflammatory cell infiltration in the feather follicle, PCR diagnosis of parvovirus is positive. After that, in situ hybridization (ISH) or immunohistochemical staining (immunohistochemistry, IHC) is still needed to observe whether GPV causes the feathers disease.\nThe bacterial infection is usually a secondary infection in feather diseases. However, the prevalence of bacteria was found in this study: Riemerella anatipestifer and Salmonella spp., Escherichia coli, Staphylococcus aureus and Pasteurella multocida, however, no ectoparasitic infestation was found. Sporadic cases also have amyloidosis, renal tubular degeneration and deposition of calcium salt. The feeds have been found that all essential amino acids are insufficient compared with the standard value, so it will be malnutrition after the outbreak of the disease, which will lead to more serious GFL and GBF.\nThe GoCV and GPV in Taiwan are still quite prevalent in most goose farms. Because the circovirus is an unenveloped virus, according to a previous study, it was quite difficult to eliminate GoCV and GPV. The pathogenic microorganism was still present in the system after being treated with common surfactants and halogen disinfectants [3031]. ​​It needs to be cleaned for a long time when it is empty, and it must be disinfected with formalin fumigation and phenol, which can at least remove the pathogen to reduce and improve the biological safety control of geese. The disinfectant used in this study is halogen-based iodine, and the disinfectant used in cleaning the environment is Anteweak. Although the disinfection effect tends to reduce the virus, the virus cannot be completely eradicated." ]

[ "intro", "materials|methods", null, null, null, null, null, null, "results", null, null, null, null, null, "discussion" ]

[ "Circovirus", "goose disease", "parvovirus", "polymerase chain reaction", "Taiwan" ]

[ 149, 137, 44, 337, 250, 321, 124, 137, 309, 441, 23 ]

[ "gpv", "gocv", "pcr", "feather", "goose", "geese", "fig", "virus", "gfl", "gbf" ]

[ "infected geese viral", "goose infectious disease", "diseases healthy geese", "pathogens geese gfl", "geese feather diseases" ]

[ "Aged", "Aldehyde Dehydrogenase", "Aldehyde Dehydrogenase, Mitochondrial", "Asian People", "Female", "Hemodynamics", "Humans", "Male", "Middle Aged", "Nitroglycerin", "Polymorphism, Genetic" ]

[ "Subjects", "Genetic analysis", "Clinical and hemodynamic", "Statistical analysis", "GG and GA/AA clinical data comparison", "Aldehyde dehydrogenase 2 genotype and nitroglycerin efficacy", "Changes in cardiac output, SVR, heart rate, systolic and diastolic blood pressure between groups", "Relationship between aldehyde dehydrogenase 2 gene polymorphisms and ΔCO and ΔSVR", "Noninvasive hemodynamic parameter (i.e., cardiac output and SVR) changes between the GG and GG/AA groups", "Limitations of the study" ]

[ "All patients comprising the noncoronary heart disease (NCHD) and the CHD groups from Jiaodong Peninsula of Northern China were investigated. All procedures conformed to the tenets of the Affiliated Hospital of Qingdao University. Informed consent was obtained from each subject. Furthermore, the study was approved by the Local Institutional Review Board. The exclusion criteria included serious cardiovascular and cerebrovascular diseases, endocrine and digestive disorders, kidney disease in the last 3 years, and NTG contraindications. The clinical diagnosis of obesity was determined from abnormal laboratory experiments before the start of the procedures. Accordingly, 356 patients with non-CHD (i.e., 234 men and 122 women; mean age: 57.01 ± 10.29 years) participated in the study. The inclusion criteria included: (1) Explicit exclusion of coronary artery disease, (2) without NTG contraindications (e.g., hypotension), and (3) without a history of serious alcohol abuse. The CHD group comprises 203 patients (i.e., 147 men and 56 women; mean age: 63.43 ± 9.61 years) diagnosed following the European Society of Cardiology Pocket Guide criteria of 2013. The inclusion criteria included the (1) presence of angina pectoris, (2) other possible causes of similar disease and angina pectoris (e.g., coronary spasm), (3) without NTG contraindications (e.g., hypotension), (4) sublingual NTG was used to cure angina attack, and (5) did not use angina or other antiangina drugs at the same time. The blood pressure of the patients with hypertension was controlled in the 140–120/90–70 mmHg range by taking nonoral nitrates (e.g., angiotensin II type 1 receptor blocker, calcium channel blocker, and diuretics) before the test. All risk factors were determined from routine tests, including blood, urine, and conventional and biochemical blood clotting prior to the study.", "Genomic DNA was extracted from each subject via blood sample. The genetic variants in the extra ALDH2 (G504A) region were identified using polymerase chain reaction and DNA sequencing in all cases. Genotype determination was measured by the Shanghai Biological Science and Technology Company (China).\nThe ALDH2 genotypes were divided into wild (GG) and mutant (GA/AA) types. Among 356 patients with NCHD, 196 were GG cases, and 160 were GA/AA. Among 203 patients with CHD, 103 were GG cases and 100 were GA/AA cases.", "The history of NTG treatment by objective pain relief was obtained from each participant through interview. This history was then divided into two subgroups of efficacy and nonefficacy. The hemodynamic parameter test included the checking of all patients administered with 0.5 mg sublingual NTG at 0, 5, and 15 minutes. CO and SVR were measured using the noninvasive hemodynamic parameter of BioZ.com (CardioDynamics Company). The patients were placed in a supine position with an empty stomach during the test. Medical professionals then attached the sensor to the patients’ necks and to the xiphoid level in the mid-axillary line at the junction on the bilinear sides of the chest according to user instructions. The contact skin was cleaned using alcohol wipes to ensure full conductivity. All personal data related to the test were entered. These data included gender, age, name, height, weight, and body surface area. The systolic and diastolic blood pressure (SBP and DBP), SVR, and CO were then tested and recorded. The SVR showed the state of the body's peripheral vasomotor reactions, whereas the CO depended on the cardiac preload and afterload and myocardial contractility.", "SPSS software for Windows version 17.0 (SPSS 17.0 Statistical Product and Service Solutions, the software was developed by the company of SPSS in December 2008) was used for statistical analysis. Pearson χ2 test was employed to assess deviations from the Hardy–Weinberg equilibrium for genotypes. Clinical information was subsequently compared across the genotypes using Pearson χ2 or Fisher's exact test. Fisher's exact test was used when the expected number in any cell was <5. The observed number and differences of NTG efficacy among various ALDH2 genotypes were statistically analyzed using χ2 test. Patient gender and smoking and drinking history were analyzed by t-test regression. P < 0.05 was considered statistically significant. The changes in CO and SVR at 3 time points were analyzed using repeated measurement data analysis of variance. The relation among the number of multiple impacts of ΔSVR, ΔCO factors, and ALDH2 gene polymorphisms was analyzed using a multivariate linear regression.", "The GG and GA/AA types demonstrated that the GC and GA/AA sample size, gender, age, smoking, and alcohol consumption ratio difference were not statistically significant (P > 0.05) [Table 2].\nGeneral characteristics of clinical data\n*Means χ2 value, other test statistics value for t value. GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease; BSA: Body surface area.", "Accordingly, 103 cases of GG and 100 cases GA/AA were recorded in the CHD group. The NTG efficacies of the GG and the GA/AA subgroups were 79.4% and 50.6%, respectively. The difference in rapid NTG efficiency was statistically significant (P < 0.01) [Table 3].\nALDH2 gene volunteers cases of CHD distribution and efficacy of NTG\nCHD: Coronary heart disease; ALDH2: Aldehyde dehydrogenase-2; GG: Wild-type; GA/AA: Mutant; NTG: Nitroglycerin.", "The repeated measurement data analysis of variance showed that the CO difference of the GG genotype at all three time points was statistically significant (P < 0.05) and differed with the significant increase in CO at 0 and 5 minutes (P = 0.000). The CO difference in the GA/AA group at 0, 5, and 15 minutes was statistically significant (P < 0.05), which indicated an obvious decrease from the CO difference at 0 and 15 minutes in both groups (P < 0.001). The SVR differences in both groups were statistically significant (P < 0.001) at all three-time points. A significant decrease was observed at 5 minutes, which suggested a statistically significant difference (P < 0.01) [Table 4].\nComparison of CO and SVR in different time points\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.\nThe heart rate (HR), SBP, and DBP differences between the two groups at three-time points were not statistically significant (P > 0.05).", "ΔCO and ΔSVR included ΔCO1 = CO 0 − CO 5 minutes, ΔSVR1 = SVR 0 − SVR 5 minutes, ΔCO2 = CO 0 – CO 15 minutes, and ΔSVR2 = SVR 0 –SVR 15 minutes. ΔCO1 was used as the dependent variable, whereas ALDH2 polymorphism was employed as the independent variable. The ALDH2 polymorphism significantly influenced the dependent variable (P = 0.046, 0.000). Similarly, ΔCO2 was used as the dependent variable. ΔSVR1 and ΔSVR2 were utilized as independent variables. The ALDH2 polymorphism had a significant influence on the dependent variable in both groups (P < 0.05).", "The comparisons of ΔCO1 and ΔCO2 and ΔSVR1 and ΔSVR2 in the GG and GG/AA types were statistically significant (P < 0.001) [Table 5].\nComparison of ΔCO, ΔSVR\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.", "Only considered ALDH2 polymorphism to the effect of metabolism, and in vitro and in vivo studies suggest that in vivo biotransformation of NTG is also affected by the following process a variety of enzymes, such as: Glutathione-S-transferase, cytochrome P450 reductase, xanthine oxidoreductase enzyme, including a number of species, this study does not exclude the other enzymes in the metabolism of NTG affected.\nThis research is a clinical experimental study, and the sample size is inadequate. The sample size should be expanded for further investigation. A selection bias in this study as regards the NCHD group and the subject might have affected NTG efficacy.\nThe researchers of this study plan to expand the sample size and apply invasive monitoring techniques to monitor all indicators. Accordingly, a more in-depth study of the metabolic ALDH2 pathways and processes will be conducted." ]

[ null, null, null, null, null, null, null, null, null, null ]

[ "INTRODUCTION", "METHODS", "Subjects", "Genetic analysis", "Clinical and hemodynamic", "Statistical analysis", "RESULTS", "GG and GA/AA clinical data comparison", "Aldehyde dehydrogenase 2 genotype and nitroglycerin efficacy", "Changes in cardiac output, SVR, heart rate, systolic and diastolic blood pressure between groups", "Relationship between aldehyde dehydrogenase 2 gene polymorphisms and ΔCO and ΔSVR", "Noninvasive hemodynamic parameter (i.e., cardiac output and SVR) changes between the GG and GG/AA groups", "DISCUSSION", "Limitations of the study", "CONCLUSION" ]

[ "Increasing evidence suggests that the aldehyde dehydrogenase 2 (ALDH2) (G-504-A) gene polymorphism is associated with nitroglycerin (NTG) inhibition. ALDH2 is a key enzyme in the human body that facilitates the biological metabolism of NTG, which serves an important function in NTG efficacy.[1] NTG is one of the few immediate treatments for acute angina. ALDH2 is an important mitochondrial aldehyde oxidase, the gene of which is located on chromosome 12q24. The gene has a high degree of genetic polymorphism.[2] The ALDH2 gene is found outside the 12th exon and exists in 504 point mutations with base substitutions of G to A. The ALDH2 of the GG genotype (i.e., wild-type) has normal activity on the NTG. The GA genotype (i.e., mutant) only has 6% activity, whereas the AA genotype (i.e., mutant) loses all its activities.[3] The clinical research analysis of Jo et al.[4] revealed that mutant ALDH2 is an independent risk factor for myocardial infarction in elderly men in Korea. Chen et al.[5] used animal experiments to demonstrate that the ALDH2 has a protective effect on myocardial ischemia. However, some reports still contradict the results that the correlation between the ALDH2 gene polymorphisms and NTG or its clinical efficacy is different. However, data on NTG measurement by pain relief are highly subjective.[67]\nA thoracic impedance method based on the noninvasive hemodynamic detector (i.e., BioZ.com), which monitors real-time hemodynamic and index parameters of patients, was used in this study. This method was employed to assess hemodynamic status and ventricular function. Cardiac output (CO) is representative of the CO, whereas peripheral vascular resistance (SVR) is representative of the cardiac load. Both parameters have application values in cardiac care.[8910] Therefore, this study verified NTG efficacy using noninvasive hemodynamic monitoring results of CO and SVR with objective judgment. Furthermore, this study hinders the effect of subjective factors.", " Subjects All patients comprising the noncoronary heart disease (NCHD) and the CHD groups from Jiaodong Peninsula of Northern China were investigated. All procedures conformed to the tenets of the Affiliated Hospital of Qingdao University. Informed consent was obtained from each subject. Furthermore, the study was approved by the Local Institutional Review Board. The exclusion criteria included serious cardiovascular and cerebrovascular diseases, endocrine and digestive disorders, kidney disease in the last 3 years, and NTG contraindications. The clinical diagnosis of obesity was determined from abnormal laboratory experiments before the start of the procedures. Accordingly, 356 patients with non-CHD (i.e., 234 men and 122 women; mean age: 57.01 ± 10.29 years) participated in the study. The inclusion criteria included: (1) Explicit exclusion of coronary artery disease, (2) without NTG contraindications (e.g., hypotension), and (3) without a history of serious alcohol abuse. The CHD group comprises 203 patients (i.e., 147 men and 56 women; mean age: 63.43 ± 9.61 years) diagnosed following the European Society of Cardiology Pocket Guide criteria of 2013. The inclusion criteria included the (1) presence of angina pectoris, (2) other possible causes of similar disease and angina pectoris (e.g., coronary spasm), (3) without NTG contraindications (e.g., hypotension), (4) sublingual NTG was used to cure angina attack, and (5) did not use angina or other antiangina drugs at the same time. The blood pressure of the patients with hypertension was controlled in the 140–120/90–70 mmHg range by taking nonoral nitrates (e.g., angiotensin II type 1 receptor blocker, calcium channel blocker, and diuretics) before the test. All risk factors were determined from routine tests, including blood, urine, and conventional and biochemical blood clotting prior to the study.\nAll patients comprising the noncoronary heart disease (NCHD) and the CHD groups from Jiaodong Peninsula of Northern China were investigated. All procedures conformed to the tenets of the Affiliated Hospital of Qingdao University. Informed consent was obtained from each subject. Furthermore, the study was approved by the Local Institutional Review Board. The exclusion criteria included serious cardiovascular and cerebrovascular diseases, endocrine and digestive disorders, kidney disease in the last 3 years, and NTG contraindications. The clinical diagnosis of obesity was determined from abnormal laboratory experiments before the start of the procedures. Accordingly, 356 patients with non-CHD (i.e., 234 men and 122 women; mean age: 57.01 ± 10.29 years) participated in the study. The inclusion criteria included: (1) Explicit exclusion of coronary artery disease, (2) without NTG contraindications (e.g., hypotension), and (3) without a history of serious alcohol abuse. The CHD group comprises 203 patients (i.e., 147 men and 56 women; mean age: 63.43 ± 9.61 years) diagnosed following the European Society of Cardiology Pocket Guide criteria of 2013. The inclusion criteria included the (1) presence of angina pectoris, (2) other possible causes of similar disease and angina pectoris (e.g., coronary spasm), (3) without NTG contraindications (e.g., hypotension), (4) sublingual NTG was used to cure angina attack, and (5) did not use angina or other antiangina drugs at the same time. The blood pressure of the patients with hypertension was controlled in the 140–120/90–70 mmHg range by taking nonoral nitrates (e.g., angiotensin II type 1 receptor blocker, calcium channel blocker, and diuretics) before the test. All risk factors were determined from routine tests, including blood, urine, and conventional and biochemical blood clotting prior to the study.\n Genetic analysis Genomic DNA was extracted from each subject via blood sample. The genetic variants in the extra ALDH2 (G504A) region were identified using polymerase chain reaction and DNA sequencing in all cases. Genotype determination was measured by the Shanghai Biological Science and Technology Company (China).\nThe ALDH2 genotypes were divided into wild (GG) and mutant (GA/AA) types. Among 356 patients with NCHD, 196 were GG cases, and 160 were GA/AA. Among 203 patients with CHD, 103 were GG cases and 100 were GA/AA cases.\nGenomic DNA was extracted from each subject via blood sample. The genetic variants in the extra ALDH2 (G504A) region were identified using polymerase chain reaction and DNA sequencing in all cases. Genotype determination was measured by the Shanghai Biological Science and Technology Company (China).\nThe ALDH2 genotypes were divided into wild (GG) and mutant (GA/AA) types. Among 356 patients with NCHD, 196 were GG cases, and 160 were GA/AA. Among 203 patients with CHD, 103 were GG cases and 100 were GA/AA cases.\n Clinical and hemodynamic The history of NTG treatment by objective pain relief was obtained from each participant through interview. This history was then divided into two subgroups of efficacy and nonefficacy. The hemodynamic parameter test included the checking of all patients administered with 0.5 mg sublingual NTG at 0, 5, and 15 minutes. CO and SVR were measured using the noninvasive hemodynamic parameter of BioZ.com (CardioDynamics Company). The patients were placed in a supine position with an empty stomach during the test. Medical professionals then attached the sensor to the patients’ necks and to the xiphoid level in the mid-axillary line at the junction on the bilinear sides of the chest according to user instructions. The contact skin was cleaned using alcohol wipes to ensure full conductivity. All personal data related to the test were entered. These data included gender, age, name, height, weight, and body surface area. The systolic and diastolic blood pressure (SBP and DBP), SVR, and CO were then tested and recorded. The SVR showed the state of the body's peripheral vasomotor reactions, whereas the CO depended on the cardiac preload and afterload and myocardial contractility.\nThe history of NTG treatment by objective pain relief was obtained from each participant through interview. This history was then divided into two subgroups of efficacy and nonefficacy. The hemodynamic parameter test included the checking of all patients administered with 0.5 mg sublingual NTG at 0, 5, and 15 minutes. CO and SVR were measured using the noninvasive hemodynamic parameter of BioZ.com (CardioDynamics Company). The patients were placed in a supine position with an empty stomach during the test. Medical professionals then attached the sensor to the patients’ necks and to the xiphoid level in the mid-axillary line at the junction on the bilinear sides of the chest according to user instructions. The contact skin was cleaned using alcohol wipes to ensure full conductivity. All personal data related to the test were entered. These data included gender, age, name, height, weight, and body surface area. The systolic and diastolic blood pressure (SBP and DBP), SVR, and CO were then tested and recorded. The SVR showed the state of the body's peripheral vasomotor reactions, whereas the CO depended on the cardiac preload and afterload and myocardial contractility.\n Statistical analysis SPSS software for Windows version 17.0 (SPSS 17.0 Statistical Product and Service Solutions, the software was developed by the company of SPSS in December 2008) was used for statistical analysis. Pearson χ2 test was employed to assess deviations from the Hardy–Weinberg equilibrium for genotypes. Clinical information was subsequently compared across the genotypes using Pearson χ2 or Fisher's exact test. Fisher's exact test was used when the expected number in any cell was <5. The observed number and differences of NTG efficacy among various ALDH2 genotypes were statistically analyzed using χ2 test. Patient gender and smoking and drinking history were analyzed by t-test regression. P < 0.05 was considered statistically significant. The changes in CO and SVR at 3 time points were analyzed using repeated measurement data analysis of variance. The relation among the number of multiple impacts of ΔSVR, ΔCO factors, and ALDH2 gene polymorphisms was analyzed using a multivariate linear regression.\nSPSS software for Windows version 17.0 (SPSS 17.0 Statistical Product and Service Solutions, the software was developed by the company of SPSS in December 2008) was used for statistical analysis. Pearson χ2 test was employed to assess deviations from the Hardy–Weinberg equilibrium for genotypes. Clinical information was subsequently compared across the genotypes using Pearson χ2 or Fisher's exact test. Fisher's exact test was used when the expected number in any cell was <5. The observed number and differences of NTG efficacy among various ALDH2 genotypes were statistically analyzed using χ2 test. Patient gender and smoking and drinking history were analyzed by t-test regression. P < 0.05 was considered statistically significant. The changes in CO and SVR at 3 time points were analyzed using repeated measurement data analysis of variance. The relation among the number of multiple impacts of ΔSVR, ΔCO factors, and ALDH2 gene polymorphisms was analyzed using a multivariate linear regression.", "All patients comprising the noncoronary heart disease (NCHD) and the CHD groups from Jiaodong Peninsula of Northern China were investigated. All procedures conformed to the tenets of the Affiliated Hospital of Qingdao University. Informed consent was obtained from each subject. Furthermore, the study was approved by the Local Institutional Review Board. The exclusion criteria included serious cardiovascular and cerebrovascular diseases, endocrine and digestive disorders, kidney disease in the last 3 years, and NTG contraindications. The clinical diagnosis of obesity was determined from abnormal laboratory experiments before the start of the procedures. Accordingly, 356 patients with non-CHD (i.e., 234 men and 122 women; mean age: 57.01 ± 10.29 years) participated in the study. The inclusion criteria included: (1) Explicit exclusion of coronary artery disease, (2) without NTG contraindications (e.g., hypotension), and (3) without a history of serious alcohol abuse. The CHD group comprises 203 patients (i.e., 147 men and 56 women; mean age: 63.43 ± 9.61 years) diagnosed following the European Society of Cardiology Pocket Guide criteria of 2013. The inclusion criteria included the (1) presence of angina pectoris, (2) other possible causes of similar disease and angina pectoris (e.g., coronary spasm), (3) without NTG contraindications (e.g., hypotension), (4) sublingual NTG was used to cure angina attack, and (5) did not use angina or other antiangina drugs at the same time. The blood pressure of the patients with hypertension was controlled in the 140–120/90–70 mmHg range by taking nonoral nitrates (e.g., angiotensin II type 1 receptor blocker, calcium channel blocker, and diuretics) before the test. All risk factors were determined from routine tests, including blood, urine, and conventional and biochemical blood clotting prior to the study.", "Genomic DNA was extracted from each subject via blood sample. The genetic variants in the extra ALDH2 (G504A) region were identified using polymerase chain reaction and DNA sequencing in all cases. Genotype determination was measured by the Shanghai Biological Science and Technology Company (China).\nThe ALDH2 genotypes were divided into wild (GG) and mutant (GA/AA) types. Among 356 patients with NCHD, 196 were GG cases, and 160 were GA/AA. Among 203 patients with CHD, 103 were GG cases and 100 were GA/AA cases.", "The history of NTG treatment by objective pain relief was obtained from each participant through interview. This history was then divided into two subgroups of efficacy and nonefficacy. The hemodynamic parameter test included the checking of all patients administered with 0.5 mg sublingual NTG at 0, 5, and 15 minutes. CO and SVR were measured using the noninvasive hemodynamic parameter of BioZ.com (CardioDynamics Company). The patients were placed in a supine position with an empty stomach during the test. Medical professionals then attached the sensor to the patients’ necks and to the xiphoid level in the mid-axillary line at the junction on the bilinear sides of the chest according to user instructions. The contact skin was cleaned using alcohol wipes to ensure full conductivity. All personal data related to the test were entered. These data included gender, age, name, height, weight, and body surface area. The systolic and diastolic blood pressure (SBP and DBP), SVR, and CO were then tested and recorded. The SVR showed the state of the body's peripheral vasomotor reactions, whereas the CO depended on the cardiac preload and afterload and myocardial contractility.", "SPSS software for Windows version 17.0 (SPSS 17.0 Statistical Product and Service Solutions, the software was developed by the company of SPSS in December 2008) was used for statistical analysis. Pearson χ2 test was employed to assess deviations from the Hardy–Weinberg equilibrium for genotypes. Clinical information was subsequently compared across the genotypes using Pearson χ2 or Fisher's exact test. Fisher's exact test was used when the expected number in any cell was <5. The observed number and differences of NTG efficacy among various ALDH2 genotypes were statistically analyzed using χ2 test. Patient gender and smoking and drinking history were analyzed by t-test regression. P < 0.05 was considered statistically significant. The changes in CO and SVR at 3 time points were analyzed using repeated measurement data analysis of variance. The relation among the number of multiple impacts of ΔSVR, ΔCO factors, and ALDH2 gene polymorphisms was analyzed using a multivariate linear regression.", "The genetic polymorphism balancing test was conducted on the genetic polymorphisms to balance the test allele and the genotype distribution of 510 subjects. The genotype distribution of both groups inherited the Hardy–Weinberg equilibrium (χ2 = 1.59, 0.49, P > 0.05), which indicated that the sample had a population representative.\nOf the 356 cases in the NCHD group, 196 (55.1%) were of the GG genotype and 130 (36.5%) were of the GA genotype. Of the 130 cases, 30 (8.4%) accounted for the AA genotype with the G and A allele frequencies at 82.8%–17.2%, respectively. Of the 203 cases in the CHD group, 103 (50.7%) were of the GG genotype and 86 (42.4%) were of the GA genotypes. Of the 86, 14 cases (6.9%) accounted for the AA genotype with the G and A allele frequencies of 81.4%–18.6%, respectively. The comparison between the two groups showed that the differences in the genotype distribution were not statistically significant (P = 0.33). Moreover, the allele distribution between the two groups was not statistically significant (P = 0.64) [Table 1].\nALDH2 of the two groups rs671 gene mutation genotype and allele\nCHD: Coronary heart disease; ALDH2: Aldehyde dehydrogenase-2; GG: Wild-type; GA/AA: Mutant.\n GG and GA/AA clinical data comparison The GG and GA/AA types demonstrated that the GC and GA/AA sample size, gender, age, smoking, and alcohol consumption ratio difference were not statistically significant (P > 0.05) [Table 2].\nGeneral characteristics of clinical data\n*Means χ2 value, other test statistics value for t value. GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease; BSA: Body surface area.\nThe GG and GA/AA types demonstrated that the GC and GA/AA sample size, gender, age, smoking, and alcohol consumption ratio difference were not statistically significant (P > 0.05) [Table 2].\nGeneral characteristics of clinical data\n*Means χ2 value, other test statistics value for t value. GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease; BSA: Body surface area.\n Aldehyde dehydrogenase 2 genotype and nitroglycerin efficacy Accordingly, 103 cases of GG and 100 cases GA/AA were recorded in the CHD group. The NTG efficacies of the GG and the GA/AA subgroups were 79.4% and 50.6%, respectively. The difference in rapid NTG efficiency was statistically significant (P < 0.01) [Table 3].\nALDH2 gene volunteers cases of CHD distribution and efficacy of NTG\nCHD: Coronary heart disease; ALDH2: Aldehyde dehydrogenase-2; GG: Wild-type; GA/AA: Mutant; NTG: Nitroglycerin.\nAccordingly, 103 cases of GG and 100 cases GA/AA were recorded in the CHD group. The NTG efficacies of the GG and the GA/AA subgroups were 79.4% and 50.6%, respectively. The difference in rapid NTG efficiency was statistically significant (P < 0.01) [Table 3].\nALDH2 gene volunteers cases of CHD distribution and efficacy of NTG\nCHD: Coronary heart disease; ALDH2: Aldehyde dehydrogenase-2; GG: Wild-type; GA/AA: Mutant; NTG: Nitroglycerin.\n Changes in cardiac output, SVR, heart rate, systolic and diastolic blood pressure between groups The repeated measurement data analysis of variance showed that the CO difference of the GG genotype at all three time points was statistically significant (P < 0.05) and differed with the significant increase in CO at 0 and 5 minutes (P = 0.000). The CO difference in the GA/AA group at 0, 5, and 15 minutes was statistically significant (P < 0.05), which indicated an obvious decrease from the CO difference at 0 and 15 minutes in both groups (P < 0.001). The SVR differences in both groups were statistically significant (P < 0.001) at all three-time points. A significant decrease was observed at 5 minutes, which suggested a statistically significant difference (P < 0.01) [Table 4].\nComparison of CO and SVR in different time points\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.\nThe heart rate (HR), SBP, and DBP differences between the two groups at three-time points were not statistically significant (P > 0.05).\nThe repeated measurement data analysis of variance showed that the CO difference of the GG genotype at all three time points was statistically significant (P < 0.05) and differed with the significant increase in CO at 0 and 5 minutes (P = 0.000). The CO difference in the GA/AA group at 0, 5, and 15 minutes was statistically significant (P < 0.05), which indicated an obvious decrease from the CO difference at 0 and 15 minutes in both groups (P < 0.001). The SVR differences in both groups were statistically significant (P < 0.001) at all three-time points. A significant decrease was observed at 5 minutes, which suggested a statistically significant difference (P < 0.01) [Table 4].\nComparison of CO and SVR in different time points\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.\nThe heart rate (HR), SBP, and DBP differences between the two groups at three-time points were not statistically significant (P > 0.05).\n Relationship between aldehyde dehydrogenase 2 gene polymorphisms and ΔCO and ΔSVR ΔCO and ΔSVR included ΔCO1 = CO 0 − CO 5 minutes, ΔSVR1 = SVR 0 − SVR 5 minutes, ΔCO2 = CO 0 – CO 15 minutes, and ΔSVR2 = SVR 0 –SVR 15 minutes. ΔCO1 was used as the dependent variable, whereas ALDH2 polymorphism was employed as the independent variable. The ALDH2 polymorphism significantly influenced the dependent variable (P = 0.046, 0.000). Similarly, ΔCO2 was used as the dependent variable. ΔSVR1 and ΔSVR2 were utilized as independent variables. The ALDH2 polymorphism had a significant influence on the dependent variable in both groups (P < 0.05).\nΔCO and ΔSVR included ΔCO1 = CO 0 − CO 5 minutes, ΔSVR1 = SVR 0 − SVR 5 minutes, ΔCO2 = CO 0 – CO 15 minutes, and ΔSVR2 = SVR 0 –SVR 15 minutes. ΔCO1 was used as the dependent variable, whereas ALDH2 polymorphism was employed as the independent variable. The ALDH2 polymorphism significantly influenced the dependent variable (P = 0.046, 0.000). Similarly, ΔCO2 was used as the dependent variable. ΔSVR1 and ΔSVR2 were utilized as independent variables. The ALDH2 polymorphism had a significant influence on the dependent variable in both groups (P < 0.05).\n Noninvasive hemodynamic parameter (i.e., cardiac output and SVR) changes between the GG and GG/AA groups The comparisons of ΔCO1 and ΔCO2 and ΔSVR1 and ΔSVR2 in the GG and GG/AA types were statistically significant (P < 0.001) [Table 5].\nComparison of ΔCO, ΔSVR\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.\nThe comparisons of ΔCO1 and ΔCO2 and ΔSVR1 and ΔSVR2 in the GG and GG/AA types were statistically significant (P < 0.001) [Table 5].\nComparison of ΔCO, ΔSVR\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.", "The GG and GA/AA types demonstrated that the GC and GA/AA sample size, gender, age, smoking, and alcohol consumption ratio difference were not statistically significant (P > 0.05) [Table 2].\nGeneral characteristics of clinical data\n*Means χ2 value, other test statistics value for t value. GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease; BSA: Body surface area.", "Accordingly, 103 cases of GG and 100 cases GA/AA were recorded in the CHD group. The NTG efficacies of the GG and the GA/AA subgroups were 79.4% and 50.6%, respectively. The difference in rapid NTG efficiency was statistically significant (P < 0.01) [Table 3].\nALDH2 gene volunteers cases of CHD distribution and efficacy of NTG\nCHD: Coronary heart disease; ALDH2: Aldehyde dehydrogenase-2; GG: Wild-type; GA/AA: Mutant; NTG: Nitroglycerin.", "The repeated measurement data analysis of variance showed that the CO difference of the GG genotype at all three time points was statistically significant (P < 0.05) and differed with the significant increase in CO at 0 and 5 minutes (P = 0.000). The CO difference in the GA/AA group at 0, 5, and 15 minutes was statistically significant (P < 0.05), which indicated an obvious decrease from the CO difference at 0 and 15 minutes in both groups (P < 0.001). The SVR differences in both groups were statistically significant (P < 0.001) at all three-time points. A significant decrease was observed at 5 minutes, which suggested a statistically significant difference (P < 0.01) [Table 4].\nComparison of CO and SVR in different time points\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.\nThe heart rate (HR), SBP, and DBP differences between the two groups at three-time points were not statistically significant (P > 0.05).", "ΔCO and ΔSVR included ΔCO1 = CO 0 − CO 5 minutes, ΔSVR1 = SVR 0 − SVR 5 minutes, ΔCO2 = CO 0 – CO 15 minutes, and ΔSVR2 = SVR 0 –SVR 15 minutes. ΔCO1 was used as the dependent variable, whereas ALDH2 polymorphism was employed as the independent variable. The ALDH2 polymorphism significantly influenced the dependent variable (P = 0.046, 0.000). Similarly, ΔCO2 was used as the dependent variable. ΔSVR1 and ΔSVR2 were utilized as independent variables. The ALDH2 polymorphism had a significant influence on the dependent variable in both groups (P < 0.05).", "The comparisons of ΔCO1 and ΔCO2 and ΔSVR1 and ΔSVR2 in the GG and GG/AA types were statistically significant (P < 0.001) [Table 5].\nComparison of ΔCO, ΔSVR\nCO: Cardiac output; SVR: Peripheral vascular resistance; GG: Wild-type; GA/AA: Mutant; NCHD: Noncoronary heart disease; CHD: Coronary heart disease.", "Nitroglycerin is a classic drug that cures acute angina attack. This drug generates NO or NO-related media in the body. Moreover, NTG directly acts upon guanylate cyclase and increases the amount of second messenger cyclic guanosine monophosphate in the vascular smooth muscle, thereby activating downstream target proteins (i.e., protein kinase G and AMP-dependent protein kinase). NTG also reduces the Ca concentration in the smooth muscle cells while reducing myosin sensitivity toward Ca, as well as vascular smooth muscle dilation.[11]\nAldehyde dehydrogenase 2 is a key enzyme mediating the biotransformation of NTG,[12] which consequently mediates the biological activation of NTG. Thus, the biological activation of NTG reduces the occurrence of NTG tolerance. ALDH2 prevents NTG conversion into nitrite and 1,2-bis nitroglycerin (1,2-GDN), which reduce NTG-induced vasodilation. Mackenzie et al.[13] used disulfiram-ALDH2 and demonstrated that ALDH2 partially inhibited the effects of NTG on the human body. ALDH2 gene knockout studies in mice have shown the significance and necessity of ALDH2 in vascular activity at therapeutic doses of NTG.[314] The human ALDH2 gene is located in chromosome 12 and contains 13 exons. Exon 12 of its outer 1510 guanine (G) mutated to adenine (A) facilitates the replacement of the protein encoded by this gene (504), glutamate (Glu), with lysine (Lys) (i.e., Glu504 Lys [rs671]). The single nucleotide polymorphism mutation rate in East Asia reaches up to 30%–50%.[15] The mutations cause a significant decrease in ALDH2 enzyme activity, which diminishes the biological function of ALDH2.[16] The results of this study provide clinical evidence that ALDH2 polymorphisms influence the NTG effect.\nRecent animal studies abroad have reported that the ALDH2 gene serves an important function in NTG on the pulmonary vascular bed and circulatory system biotransformation.[17] The ALDH2 gene mutation reduces the vasodilator NTG.[1819] Li et al.[19] selected 80 cases of patients diagnosed with coronary artery disease with a history of stable angina in 2006. The ALDH2 gene polymorphism and enzyme activity were detected in patients from each group. The NTG effect on all subjects in the ALDH2 wild-type group was significantly higher than that in the invalid proportion of the wild-type group. Ji et al.[7] enrolled 113 people diagnosed with coronary artery disease in 2010. They found that the ALDH2 gene polymorphisms had no association with NTG effectiveness. Mackenzie et al.[13] also observed that the clinical use of NTG was not found in the ALDH2 gene and had a high mutation rate in the Japanese population. The preceding experiment illustrates that the relationship between the ALDH2 gene polymorphisms and NTG efficacy remains controversial. This experiment also selects subjects with noncoronary and CHD to study sublingual NTG aging and further proves that the ALDH2 gene polymorphisms are related to the NTG clinical effect. The wild-type effect is better than that of the mutant type.\nThe subjects are divided into the NCHD and CHD groups. The determined ALDH2 genotype is divided into the wild and mutant groups. The ALDH2 genotypes have no significant distribution difference, similar to the findings of previous studies.[20] The NTG effect rate in the GG-type patients of the CHD group was significantly higher than that of the GA/AA type. This result is similar to that of the previous studies.[21] The noninvasive hemodynamic detector (i.e., impedance cardiography [ICG]) is employed to evaluate the NTG effect. The CO and SVR changes and other objective indicators are monitored. Furthermore, determining the degree of pain relief as a subjective factor is avoided. This study selects three representative time points (i.e., CO 0, CO 5, and CO 15 minutes) according to the pharmacokinetic characteristics of NTG. The changes in noninvasive dynamic indicators (i.e., CO and SVR) are then combined. Such combination indicates that the CO per minute reveals differences in sublingual NTG efficacy among subjects with different genotypes. Experimental results show that the ALDH2 polymorphisms are relevant to CO and SVR, which confirms the CO NTG effect.\nThe ICG is an important device for body impedance measurement in the cardiovascular dynamics of blood flow.[22] The cardiac hemodynamic status is measured on the basis of changes in systolic and diastolic thoracic impedance.[9] The ICG enables the diagnosis of heart failure and assesses the severity of coronary artery disease[23] to evaluate the efficacy of drug treatment and prognosis.[24] This study avoids the influence of subjective factors as much as possible by observing the CO per minute and the noninvasive hemodynamic index changes in SVR. The results of the observation are further employed to determine the differences among volunteers with different gene types after sublingual NTG administration. The obtained results are highly reliable.\nThe wild-type CO increases, whereas the mutant CO decreases after sublingual NTG administration. The results suggest the following: (1) Wild-type: The sublingual NTG hemorheology (HR) reflex significantly increased, whereas the stroke volume (SV) relatively and insignificantly decreased. (2) The formula CO = SV × HR demonstrates product increases. Mutant type: SV significantly was reduced, whereas HR was relatively and insignificantly increased after sublingual NTG administration.\n Limitations of the study Only considered ALDH2 polymorphism to the effect of metabolism, and in vitro and in vivo studies suggest that in vivo biotransformation of NTG is also affected by the following process a variety of enzymes, such as: Glutathione-S-transferase, cytochrome P450 reductase, xanthine oxidoreductase enzyme, including a number of species, this study does not exclude the other enzymes in the metabolism of NTG affected.\nThis research is a clinical experimental study, and the sample size is inadequate. The sample size should be expanded for further investigation. A selection bias in this study as regards the NCHD group and the subject might have affected NTG efficacy.\nThe researchers of this study plan to expand the sample size and apply invasive monitoring techniques to monitor all indicators. Accordingly, a more in-depth study of the metabolic ALDH2 pathways and processes will be conducted.\nOnly considered ALDH2 polymorphism to the effect of metabolism, and in vitro and in vivo studies suggest that in vivo biotransformation of NTG is also affected by the following process a variety of enzymes, such as: Glutathione-S-transferase, cytochrome P450 reductase, xanthine oxidoreductase enzyme, including a number of species, this study does not exclude the other enzymes in the metabolism of NTG affected.\nThis research is a clinical experimental study, and the sample size is inadequate. The sample size should be expanded for further investigation. A selection bias in this study as regards the NCHD group and the subject might have affected NTG efficacy.\nThe researchers of this study plan to expand the sample size and apply invasive monitoring techniques to monitor all indicators. Accordingly, a more in-depth study of the metabolic ALDH2 pathways and processes will be conducted.", "Only considered ALDH2 polymorphism to the effect of metabolism, and in vitro and in vivo studies suggest that in vivo biotransformation of NTG is also affected by the following process a variety of enzymes, such as: Glutathione-S-transferase, cytochrome P450 reductase, xanthine oxidoreductase enzyme, including a number of species, this study does not exclude the other enzymes in the metabolism of NTG affected.\nThis research is a clinical experimental study, and the sample size is inadequate. The sample size should be expanded for further investigation. A selection bias in this study as regards the NCHD group and the subject might have affected NTG efficacy.\nThe researchers of this study plan to expand the sample size and apply invasive monitoring techniques to monitor all indicators. Accordingly, a more in-depth study of the metabolic ALDH2 pathways and processes will be conducted.", "Aldehyde dehydrogenase 2 (G504A) gene polymorphism is associated with changes in noninvasive hemodynamic parameters (i.e., CO and SVR) after intervention with sublingual NTG. This gene polymorphism may influence the effect of NTG intervention on Northern Chinese Han population." ]

[ "intro", "methods", null, null, null, null, "results", null, null, null, null, null, "discussion", null, "conclusion" ]

[ "Aldehyde Dehydrogenase 2", "Coronary Disease", "Genetic Polymorphism", "Hemodynamic", "Nitroglycerin" ]

[ 346, 107, 215, 173, 93, 99, 221, 114, 73, 161 ]

[ "ntg", "aldh2", "co", "gg", "aa", "svr", "ga", "significant", "ga aa", "disease" ]

[ "aldh2 gene", "efficacy aldh2 genotypes", "aldh2 gg genotype", "determined aldh2 genotype", "polymorphism aldh2 gene" ]

[ "Female", "Follow-Up Studies", "Hemorrhoids", "Humans", "Male", "Personal Satisfaction", "Recurrence", "Surgical Stapling", "Treatment Outcome" ]

[ "Long-term results", "Long-term complications", "Long-term satisfaction rates" ]

[ "After a very long postoperative follow-up, 16 patients (16.3%) had a recurrence\nof HD and all were diagnosed between 2 and 9 years following surgery. Recurrence\nwas higher for grade IV HD (26.1%, n=12/46) than for grade III (7.7%, n=4/52)\n(p=0.014), but reoperation rates were similar for both groups (n=2/4 for grade\nIII and n=9/12 for grade IV HD) (p=0.547). Of these 16 patients, 9 underwent\nexcisional hemorrhoidectomy, 2 transanal dearterialization and mucopexy (THD-M),\nand the other 5 were treated with rubber band ligation in the office. All\npatients at the final follow-up had complete resolution of their symptoms and no\nfurther recurrences were detected.", "Anal canal sub-stenosis occurred in two male patients (2.1%). Their main\ncomplaint was difficulty in eliminating stools and the need for enemas to assist\non evacuation. Both patients were treated with periodic digital dilations and\nhad complete resolution of their symptoms.\nNew fecal incontinence to flatus was detected in two patients (2.1%). One patient\nwas a 47 years old female with two previous vaginal deliveries who developed new\nincontinence to flatus 4 years after surgery. She had excellent results with\nbiofeedback, improving her Jorge-Wexner\n15\n score from 11 to 3. The other patient was also a female with type-2\ndiabetes mellitus who developed new incontinence for flatus and liquid stools 10\nyears postoperatively and had little improvement with conservative treatment,\nwhich included dietary modification, biofeedback, and probiotics.\nAdditional procedures for removal of symptomatic fibrotic anal skin tags that\nimpacted anal hygiene were required in three (3.1%) patients, all females.\nChronic anal pain, rectovaginal fistula, or pelvic sepsis was not reported in\nthis series. There was no mortality.", "Out of 98 patients who were evaluated, 34 patients (34.6%) stated that they were\nvery satisfied, 47 (47.9%) satisfied, 7 (7.2%) indifferent, and 10 (10.3%)\ndissatisfied with the surgical procedure. Long-term results, late complications,\nand degree of satisfaction are described in Table 2.\n\nTable 2 -Long-term postoperative results, late complications, and degree\nof satisfaction with stapled hemorrhoidopexy.CharacteristicsN (%)Total of patients98 (100)Prolapse recurrence16 (16.3)Skin tags3 (3.1)Anal sub-stenosis2 (2.1)Anal incontinence2 (2.1)Degree of satisfactionVery satisfied34 (34.6)Satisfied47 (47.9)Indifferent7 (7.2)Dissatisfied10 (10.3)\n" ]

[ null, null, null ]

[ "INTRODUCTION", "METHODS", "RESULTS", "Long-term results", "Long-term complications", "Long-term satisfaction rates", "DISCUSSION", "CONCLUSIONS" ]

[ "For many years, surgical treatment of hemorrhoidal disease (HD) consisted solely of\nexcisional hemorrhoidectomy. Despite being an effective procedure with good\nlong-term results, it is associated with severe pain due to the excision of the\ninnervated anoderm below the dentate line\n35\n.\nIn 1998, a transanal circular stapling instrument, initially used for mucosal\nprolapses, was used to treat hemorrhoids through a procedure named stapled\nhemorrhoidopexy (SH)\n18\n\n,\n\n25\n. This technique introduced a different concept for the treatment of HD, not\nbased on resecting the diseased hemorrhoidal cushions but on reconstituting the\nanatomy and physiology of the anal canal through a mucosal lift of the distal\nrectum\n12\n. Since then, several studies with follow-up of less than 5 years have\nreported that it is safe and efficient, with less postoperative pain, shorter\nhospital stay, and an earlier return to regular activities\n1\n\n,\n\n22\n.\nThis procedure has gained wide acceptance and has been performed extensively by\ncolorectal surgeons worldwide\n12\n\n,\n\n35\n\n,\n\n38\n. However, results after a follow-up of more than 10 years remain unclear.\nSome studies have associated SH with higher rates of recurrence and the need for\nadditional surgical procedures\n33\n\n,\n\n38\n. Concerns with regard to severe short-term complications including\nrectovaginal fistula, sepsis but also long-term complications such as anal stenosis,\nand fecal incontinence, have also been discussed in the literature\n8\n.\nIn the early 2000s, our group published a prospective analysis of the initial\nexperience with SH that included 155 consecutive patients with grades III and IV\nsymptomatic hemorrhoids operated from June 2000 to December 2003 by a single\nexperienced colorectal surgeon, after a mean follow-up of 20 months\n1\n. Now, 16 years later, we reevaluated these patients and investigated the\nlong-term complications, recurrences, and degree of satisfaction with the\nprocedure.", "This research was approved by the Ethics Committee of University Hospital,\nUniversidade de São Paulo (IRB number: 44948621.5.0000.0068), and written informed\nconsent was obtained from all patients.\nIn all, 98 of 155 patients who underwent SH between June 2000 and December 2003 were\nretrospectively reassessed, with the aim of analyzing late complications, recurrence\nrate, and degree of satisfaction after a long period of follow-up. In this study, we\ndescribe the results observed in the period between 2 and 16 years of follow-up,\nsince the surgical indications, operative technical aspects, complications, and\nshort-term results (up to 2 years) were extensively described in our previous study,\npublished in 2006\n35\n. The following data were collected: sex, age, HD degree, treatments\nperformed, clinical symptoms, complications, and degree of satisfaction with the\nprocedure. Data collection was based on outpatient assessments or telephone\ninterviews. The degree of satisfaction was evaluated and classified into four\nlevels: very satisfied, satisfied, indifferent, or dissatisfied.\nStatistical analysis was performed using the chi-square test for comparison of\nrecurrence between grades III and IV hemorrhoids; p-value <0.05 was considered\nsignificant. Analysis was carried out using the SPSS version 21.0 software for\nWindows (SPSS, Chicago, IL, USA).", "From a total of 155 patients operated during the study period, 57 (36.7%) were lost\nto follow-up and 98 were evaluated. Demographic data and HD classification are shown\nin Table 1. With regard to the follow-up, 59\npatients (60.2%) were interviewed by telephone and 39 (39.8%) were evaluated as\noutpatients.\n\nTable 1 -Patients’ demographics, degree of hemorrhoidal disease, and follow-up\nperiod.Patient characteristicsNumberTotal of patients98 (100%)Male/female46 (46.9%)/52 (53.1%)Mean age, years (range)41 (39-79)HD grade III52 (53.1%)HD grade IV46 (46.9%)Mean follow-up, months (range)193 (184-231)\n\nLong-term results After a very long postoperative follow-up, 16 patients (16.3%) had a recurrence\nof HD and all were diagnosed between 2 and 9 years following surgery. Recurrence\nwas higher for grade IV HD (26.1%, n=12/46) than for grade III (7.7%, n=4/52)\n(p=0.014), but reoperation rates were similar for both groups (n=2/4 for grade\nIII and n=9/12 for grade IV HD) (p=0.547). Of these 16 patients, 9 underwent\nexcisional hemorrhoidectomy, 2 transanal dearterialization and mucopexy (THD-M),\nand the other 5 were treated with rubber band ligation in the office. All\npatients at the final follow-up had complete resolution of their symptoms and no\nfurther recurrences were detected.\nAfter a very long postoperative follow-up, 16 patients (16.3%) had a recurrence\nof HD and all were diagnosed between 2 and 9 years following surgery. Recurrence\nwas higher for grade IV HD (26.1%, n=12/46) than for grade III (7.7%, n=4/52)\n(p=0.014), but reoperation rates were similar for both groups (n=2/4 for grade\nIII and n=9/12 for grade IV HD) (p=0.547). Of these 16 patients, 9 underwent\nexcisional hemorrhoidectomy, 2 transanal dearterialization and mucopexy (THD-M),\nand the other 5 were treated with rubber band ligation in the office. All\npatients at the final follow-up had complete resolution of their symptoms and no\nfurther recurrences were detected.\nLong-term complications Anal canal sub-stenosis occurred in two male patients (2.1%). Their main\ncomplaint was difficulty in eliminating stools and the need for enemas to assist\non evacuation. Both patients were treated with periodic digital dilations and\nhad complete resolution of their symptoms.\nNew fecal incontinence to flatus was detected in two patients (2.1%). One patient\nwas a 47 years old female with two previous vaginal deliveries who developed new\nincontinence to flatus 4 years after surgery. She had excellent results with\nbiofeedback, improving her Jorge-Wexner\n15\n score from 11 to 3. The other patient was also a female with type-2\ndiabetes mellitus who developed new incontinence for flatus and liquid stools 10\nyears postoperatively and had little improvement with conservative treatment,\nwhich included dietary modification, biofeedback, and probiotics.\nAdditional procedures for removal of symptomatic fibrotic anal skin tags that\nimpacted anal hygiene were required in three (3.1%) patients, all females.\nChronic anal pain, rectovaginal fistula, or pelvic sepsis was not reported in\nthis series. There was no mortality.\nAnal canal sub-stenosis occurred in two male patients (2.1%). Their main\ncomplaint was difficulty in eliminating stools and the need for enemas to assist\non evacuation. Both patients were treated with periodic digital dilations and\nhad complete resolution of their symptoms.\nNew fecal incontinence to flatus was detected in two patients (2.1%). One patient\nwas a 47 years old female with two previous vaginal deliveries who developed new\nincontinence to flatus 4 years after surgery. She had excellent results with\nbiofeedback, improving her Jorge-Wexner\n15\n score from 11 to 3. The other patient was also a female with type-2\ndiabetes mellitus who developed new incontinence for flatus and liquid stools 10\nyears postoperatively and had little improvement with conservative treatment,\nwhich included dietary modification, biofeedback, and probiotics.\nAdditional procedures for removal of symptomatic fibrotic anal skin tags that\nimpacted anal hygiene were required in three (3.1%) patients, all females.\nChronic anal pain, rectovaginal fistula, or pelvic sepsis was not reported in\nthis series. There was no mortality.\nLong-term satisfaction rates Out of 98 patients who were evaluated, 34 patients (34.6%) stated that they were\nvery satisfied, 47 (47.9%) satisfied, 7 (7.2%) indifferent, and 10 (10.3%)\ndissatisfied with the surgical procedure. Long-term results, late complications,\nand degree of satisfaction are described in Table 2.\n\nTable 2 -Long-term postoperative results, late complications, and degree\nof satisfaction with stapled hemorrhoidopexy.CharacteristicsN (%)Total of patients98 (100)Prolapse recurrence16 (16.3)Skin tags3 (3.1)Anal sub-stenosis2 (2.1)Anal incontinence2 (2.1)Degree of satisfactionVery satisfied34 (34.6)Satisfied47 (47.9)Indifferent7 (7.2)Dissatisfied10 (10.3)\n\nOut of 98 patients who were evaluated, 34 patients (34.6%) stated that they were\nvery satisfied, 47 (47.9%) satisfied, 7 (7.2%) indifferent, and 10 (10.3%)\ndissatisfied with the surgical procedure. Long-term results, late complications,\nand degree of satisfaction are described in Table 2.\n\nTable 2 -Long-term postoperative results, late complications, and degree\nof satisfaction with stapled hemorrhoidopexy.CharacteristicsN (%)Total of patients98 (100)Prolapse recurrence16 (16.3)Skin tags3 (3.1)Anal sub-stenosis2 (2.1)Anal incontinence2 (2.1)Degree of satisfactionVery satisfied34 (34.6)Satisfied47 (47.9)Indifferent7 (7.2)Dissatisfied10 (10.3)\n", "After a very long postoperative follow-up, 16 patients (16.3%) had a recurrence\nof HD and all were diagnosed between 2 and 9 years following surgery. Recurrence\nwas higher for grade IV HD (26.1%, n=12/46) than for grade III (7.7%, n=4/52)\n(p=0.014), but reoperation rates were similar for both groups (n=2/4 for grade\nIII and n=9/12 for grade IV HD) (p=0.547). Of these 16 patients, 9 underwent\nexcisional hemorrhoidectomy, 2 transanal dearterialization and mucopexy (THD-M),\nand the other 5 were treated with rubber band ligation in the office. All\npatients at the final follow-up had complete resolution of their symptoms and no\nfurther recurrences were detected.", "Anal canal sub-stenosis occurred in two male patients (2.1%). Their main\ncomplaint was difficulty in eliminating stools and the need for enemas to assist\non evacuation. Both patients were treated with periodic digital dilations and\nhad complete resolution of their symptoms.\nNew fecal incontinence to flatus was detected in two patients (2.1%). One patient\nwas a 47 years old female with two previous vaginal deliveries who developed new\nincontinence to flatus 4 years after surgery. She had excellent results with\nbiofeedback, improving her Jorge-Wexner\n15\n score from 11 to 3. The other patient was also a female with type-2\ndiabetes mellitus who developed new incontinence for flatus and liquid stools 10\nyears postoperatively and had little improvement with conservative treatment,\nwhich included dietary modification, biofeedback, and probiotics.\nAdditional procedures for removal of symptomatic fibrotic anal skin tags that\nimpacted anal hygiene were required in three (3.1%) patients, all females.\nChronic anal pain, rectovaginal fistula, or pelvic sepsis was not reported in\nthis series. There was no mortality.", "Out of 98 patients who were evaluated, 34 patients (34.6%) stated that they were\nvery satisfied, 47 (47.9%) satisfied, 7 (7.2%) indifferent, and 10 (10.3%)\ndissatisfied with the surgical procedure. Long-term results, late complications,\nand degree of satisfaction are described in Table 2.\n\nTable 2 -Long-term postoperative results, late complications, and degree\nof satisfaction with stapled hemorrhoidopexy.CharacteristicsN (%)Total of patients98 (100)Prolapse recurrence16 (16.3)Skin tags3 (3.1)Anal sub-stenosis2 (2.1)Anal incontinence2 (2.1)Degree of satisfactionVery satisfied34 (34.6)Satisfied47 (47.9)Indifferent7 (7.2)Dissatisfied10 (10.3)\n", "New surgical procedures for the surgical treatment of HD, with less invasive\ntechniques, have been developed, such as PPH, THD-M, and LigaSure, with the aim of\nreducing postoperative pain and shortening the return to regular activities\n36\n\n,\n\n37\n.\nSH has been used for more than 20 years as a therapeutic option for the third- and\nfourth-degree HD, mainly due to shorter operative time, less postoperative pain, and\nearlier return to activities when compared with conventional hemorrhoidectomy\n12\n\n,\n\n35\n. It is considered a safe technique especially for the treatment of\ncircumferential hemorrhoidal prolapse, but concerns for long-term recurrences and\nsevere complications still exists\n12\n\n,\n\n20\n\n,\n\n22\n\n,\n\n29\n\n,\n\n31\n\n,\n\n35\n.\nEarly complications, such as rectovaginal fistulas, perianal abscess, and rectal\nlumen obliteration, have been described extensively in the literature and are well\nknown to colorectal surgeons\n29\n. However, few studies have evaluated the long-term results after more than\n10 years of follow-up\n4\n\n,\n\n33\n\n,\n\n38\n. In our study, all 98 patients had a minimum follow-up of 184 months. There\nare doubts about the ideal follow-up period to assess the postoperative recurrences\nof non-excisional procedures (PPH and THD-M)\n5\n. Some authors use the following classification for the follow-up period:\nshort, up to 2 years; medium, from 2 to 5 years; long, from 5 to 10 years; and very\nlong, more than 10 years\n38\n. To the best of our knowledge, this study has the longest follow-up in the\nliterature.\nAnal sub-stenosis occurred in two patients, and both were treated successfully with\nperiodic digital dilations. In the literature, this complication has been reported\nin 0.8-5% of patients after SH\n9\n. It is defined as circumferential narrowing of the distal rectum that cannot\nbe transposed by a digital rectal examination. Main symptoms are difficulty in\neliminating feces, the need for digital maneuvers, and the use of evacuation enemas.\nThe diagnosis is usually straightforward with a careful digital rectal examination.\nThe mechanism behind this phenomenon is submucosal inflammation due to ring\ndehiscence with local infection and full thickness excision of the rectal wall if\nthe stapled ring is placed too deep into the anal canal with the subsequent\nhypertrophic scarring of the rectal wall\n28\n. Conservative treatment with periodic outpatient dilations and infiltration\nwith corticosteroids is the first-line treatment. Ng et al.\n23\n, in a large series of 3711 cases submitted to SH, reported anal stenosis in\n1.4%, most of them were successfully treated with digital dilation.\nFecal incontinence following SH is usually transient and occurs in the early\npostoperative period\n32\n. This complication is usually mild with loss of flatus or occasional soiling\nduring exertion. It should be emphasized that fecal soiling can also occur even\nafter conventional hemorrhoidectomy and can be triggered by diarrhea, diabetes\nmellitus, and medications\n14\n.\nIn our previous study\n35\n, three patients developed transient fecal incontinence shortly after the\nsurgical procedure, but all of them resolved spontaneously. After prolonged\nfollow-up, two female patients developed new fecal incontinence. This is one of the\nmost feared complications after the treatment of HD, and it has been reported from 0\nto 8% of patients following SH\n24\n\n,\n\n26\n\n,\n\n32\n. This complication has been attributed to internal sphincter fragmentation;\na low-purse string suture that results in the staple line being too close to the\npectinate line and due to mechanical anal stretching from the 33 mm stapler. Risk\nfactors include female sex with previous vaginal delivery, pudendal neuropathy, and\nfecal straining\n22\n. The treatment is based on biofeedback rehabilitation with a success rate of\nup to 80%\n38\n. In refractory cases, the use of injectable bulking agents has been\nindicated\n19\n.\nChronic anal pain following SH is a feared complication and some authors have\nreported it in 1.6-17.5% patients\n16\n\n,\n\n38\n. In this study, no patient presented persistent pain after the long\nfollow-up. The precise etiology is unclear, but muscle incorporation in the doughnut\nmay play a role in its pathophysiology. Other possible causes are sphincter spasm,\nvery low purse string including the pectinate line, rectal pocket syndrome, and\nchronic proctitis secondary to ischemia\n7\n\n,\n\n27\n.\nRecurrence of prolapse with SH is highly variable and depends on the surgeon’s\nexperience, degree of HD, and the follow-up period. Low recurrence rates have been\nreported in series with shorter follow-up\n2\n\n,\n\n3\n\n,\n\n11\n\n,\n\n18\n\n,\n\n22\n\n,\n\n35\n. A systematic review published by Shao et al.\n34\n in 2008, with a follow-up ranging from 6 weeks to a median of 62 months,\nshowed recurrence in 9% of patients, and only 7% required a new surgical procedure.\nWhite et al.\n39\n, in a series of 169 patients, reported that recurrences occurred in 11.2%\nafter a mean follow-up of 15 months.\nIn this study, all recurrences were detected up to 9 years of follow-up, which is\nconsistent with other series with long-term\n2\n\n,\n\n3\n\n,\n\n11\n\n,\n\n13\n\n,\n\n31\n\n,\n\n34\n\n,\n\n38\n\n,\n\n39\n. Our recurrence rate was 16.3%, which is lower than previously published by\nother authors\n20\n\n,\n\n33\n\n,\n\n38\n. Sturiale et al.\n38\n evaluated patients after 12 years of follow-up and reported 40.9% recurrence\nrate. It should be noticed that evaluation was performed over the telephone and\npatients may have been unable to differentiate true recurrence from residual skin\ntags or other anorectal pathologies, which may have overestimated the recurrence\nrate. Schneider et al.\n33\n also evaluated patients over the telephone and reported recurrence of\nsymptoms in 47.4%. Belio et al.\n4\n published the only study that performed a clinical evaluation of patients\nafter a 10-year follow-up and reported 39% of recurrence rate.\nWe observed greater recurrence in HD grade IV than in grade III, similar to what was\nreported by other authors\n13\n\n,\n\n21\n. Technical aspects that may play a role in recurrence included incomplete\npurse string, too high a suture in the rectum, and incomplete mucosal resection in\ngrade IV HD, which may occur when the volume of mucosal tissue exceeds the capacity\nof the stapler casing\n6\n\n,\n\n10\n\n,\n\n14\n. In the literature, recurrence after SH seems to be more frequent than after\nconventional hemorrhoidectomy\n12\n\n,\n\n13\n\n,\n\n26\n.\nIt is important to emphasize that although most series with long-term have recorded\nhigh recurrence rates with SH, some authors reported high recurrence with excisional\nmethods. In a British trial with 17 years of follow-up, there was a symptomatic\nrecurrence of HD in 26% of the patients\n17\n. In another large randomized study with 688 patients, the recurrence rate\nfollowing Ferguson hemorrhoidectomy for grade IV HD was 40.3% (n=126/208) after a\nmean follow-up of 7.4 years\n30\n.\nBesides recurrence, bothersome fibrotic skin tags are also a cause of\nre-intervention. In our series, three patients required removal of symptomatic skin\ntags after more than 24 months of follow-up. We currently recommend the excision of\nskin tags during the initial procedure, after the patient’s agreement. Ommer et\nal.\n24\n in a prospective study of 224 consecutive patients concluded that the\nresection of large skin tags during SH provided better symptom control, lower rates\nof recurrence and reoperation, and higher degree of satisfaction.\nDegree of satisfaction after a surgical procedure is multifactorial and subjective.\nIts quantification is complex and depends on the patient’s previous experiences,\nexpectation with the surgical procedure, and the final results. A successful surgery\ndoes not always correlate with a high degree of satisfaction in terms of patient’s\nperspective, which has motivated the use of patients’ reported outcome in clinical\ntrials. In our series, 82.5% were either very satisfied or satisfied with the\nprocedure, which is consistent with other series\n4\n\n,\n\n33\n\n,\n\n38\n.\nThe main limitations of this manuscript are the retrospective nature of the study and\nthe loss of follow-up of 36.8% of patients. However, few studies have assessed the\nvery long-term (>10 years) results with this surgical technique. Its strengths\nare a large series of patients undergoing SH performed by a surgical team with\nexperience in anorectal operations and a very long follow-up that included physical\nand proctologic examination in 40% of patients.", "This study provides evidence that SH is a safe and effective surgical procedure for\nthe treatment of symptomatic hemorrhoids of grades III and IV, even after a long\nfollow-up. Recurrence is higher for grade IV hemorrhoids and may occur up to 9 years\nof follow-up. Complications after prolonged follow-up are uncommon and most often\ncan be managed with conservative treatment and low-complexity procedures.\nReoperations for resection of new hemorrhoidal nodules are infrequent, and the\npatient’s degree of satisfaction with this procedure is high." ]

[ "intro", "methods", "results", null, null, null, "discussion", "conclusions" ]

[ "Hemorrhoids", "Hemorrhoidectomy", "Surgical Staplers", "Postoperative Complications", "Long-Term Care", "Patient Satisfaction", "Hemorroidas", "Hemorroidectomia", "Grampeadores Cirúrgicos", "Complicações Pós-Operatórias", "Assistência de Longa Duração", "Satisfação do Paciente" ]

[ 147, 213, 125 ]

[ "patients", "follow", "years", "long", "recurrence", "anal", "hd", "term", "degree", "results" ]

[ "excisional hemorrhoidectomy", "hemorrhoidectomy transanal dearterialization", "treat hemorrhoids procedure", "hemorrhoidectomy transanal", "compared conventional hemorrhoidectomy" ]

[ "Animals", "CD8-Positive T-Lymphocytes", "Cell Differentiation", "Female", "Interferon-gamma", "Invasive Pulmonary Aspergillosis", "Lymphocyte Activation", "Mice", "Mice, Inbred BALB C", "Myeloid Cells", "Ribosomal Protein S6 Kinases", "TOR Serine-Threonine Kinases", "Tissue Culture Techniques" ]

[ "Pathogen preparation", "Animal model preparation", "CD8+ effector memory T-cells counts and interferon-γ, mammalian target of rapamycin, and S6 kinase expression", "Cytokine and soluble triggering receptors expressed on myeloid cell-1 quantification", "Statistical analysis", "Tissue culture and histology", "Regulation of the mammalian target of rapamycin pathway", "Mammalian target of rapamycin modulates CD8+ T-cell differentiation and expression of triggering receptor expressed on myeloid cell-1", "Alteration of inflammatory responses and severity of fungal infection", "Financial support and sponsorship" ]

[ "The strain of Aspergillus fumigatus, provided by the Department of Clinical Laboratory, Peking Union Medical College Hospital (PUMCH), was obtained from a case of pulmonary aspergillosis. Viable conidia (>95%) were obtained by growth on Sabouraud dextrose agar for 5 days at 35°C. Conidia were harvested in 10 ml 0.1% Tween-80/PBS and filtered through five layers of gauze. The concentration of conidia was adjusted to 1 × 108 CFU/ml by turbidity adjustment method.", "Healthy 4-week-old female BALB/c mice, weighing 20 ± 5 g, were obtained from the Animal Facility Center, PUMCH. All animals were housed in a pathogen-free facility and treated according to protocols approved by the Institutional Animal Care and Use Committee of PUMCH. Thirty mice were randomly divided into the following groups (six mice per group): (1) control group: nontreated mice. (2) IPA group: animals were inoculated with 0.1 ml A. fumigatus conidia solution intranasally. (3) Immunosuppression plus aspergillosis group (cyclophosphamide [CTX] + IPA): CTX (Jiangsu Hengrui Medicine Co., Ltd., Jiangsu, China) was injected intraperitoneally at a dose of 200 mg·kg−1·d−1 for 5 consecutive days. Animals were then infected with A. fumigatus as mentioned above. (4) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA): mice were given 2 mg·kg−1·d−1 rapamycin for the 7 consecutive days after intraperitoneal injection of CTX and A. fumigatus infection. (5) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12): mice were given 5 μg/kg IL-12 every other day for the 7 days following intraperitoneal injection of CTX and A. fumigatus infection. Blood samples were obtained by retro-orbital bleeding. Part of the lung tissue was minced and used for A. fumigatus culture, the rest was fixed with 4% formaldehyde, and paraffin-embedded tissue sections were stained with hematoxylin and eosin (H and E), Masson trichrome, and periodic acid-silver methenamine.", "Peripheral blood mononuclear cells were isolated from blood samples and counted by flow cytometry. Cells were then labeled with the following fluorescence-conjugated monoclonal antibodies: anti-rat CD45 PE (12-0451-81, eBioscience, San Diego, CA, USA), anti-rat CD8a APC (17-0081-81, eBioscience), anti-rat CD44 PE (25-0441-81, eBioscience), and anti-rat CD62L (104432, Biolegend). CD8+ Tem were sorted by flow cytometry (EPICS-XL, Beckman-Coulter, Indianapolis, IN, USA) and then stained for interferon (IFN)-γ (11-7311-81, eBioscience), mTOR (ab87540, Abcam, Cambridge, MA, USA), and S6K (ab32529, Abcam) expression.", "Cytokines and sTREM-1 were quantified using the following ELISA kits as per the manufacturer's instructions; IL-6 (cat#: ab168538, Abcam), IL-10 (cat#: ab176665, Abcam), GM (cat#: 85-86051, Affymetrix Bioscience, San Diego, CA, USA), and sTREM-1 (cat#: SEA213Mu, USCN, Wuhan, China).", "Data were analyzed using SPSS version 18.0 software (SPSS Inc., Armonk, NY, USA). All the data for the continuous variables in this study were proven to have normal distributions and are given as mean ± standard deviations (SD). Results for continuous variables that were not normally distributed are given as medians (interquartile ranges) and were compared using nonparametric tests. Student's t-test or analysis of variance followed by Bonferroni's test were used to determine the statistical significance (P) of differences. Pearson's correlation coefficient was used to analyze the correlation of two parameters. A value of P < 0.05 was considered statistically significant.", "Viable A. fumigatus was cultured from lung tissue of both IPA and CTX + IPA mice treated with rapamycin or IL-12 or without treatment [Figure 1a–1c], while control mice were negative. Histological examination indicated that the lung tissue structure was intact in the normal control [Figure 1d]. In contrast, infiltration of inflammatory cells, hemorrhage, and interstitial lung tissue injury were found in the lungs of the IPA, CTX + IPA, CTX + IPA + IL-12, and CTX + IPA + RAPA groups [Figure 1e–1h]. Compared with the IPA group, Figure 1 suggests that CTX + IPA mice treated with rapamycin or IL-12 or without treatment had greater inflammation and hemorrhage in the interstitial lung tissue.\nHistology of lung tissue stained with H and E, Masson trichrome, and PASM. (a–c) The fungal spores of Aspergillus fumigatus. (d) Control animal. (e) Animal infected with IPA. (f) Immunosuppression plus aspergillosis group (CTX + IPA). (g) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12). (h) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA). Original magnification: (a) Masson trichrome staining, original magnification ×200; (b) Masson trichrome staining, original magnification ×400; (c) PASM staining, original magnification ×600; (d–h) H and E, original magnification ×100. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; PASM: Periodic acid silver methenamine; IL: Interleukin.", "As shown in Figure 2, compared with the control group (0.25 ± 0.04, P = 0.004), IPA group (0.27 ± 0.04, P = 0.01), and CTX + IPA group (0.29 ± 0.04, P = 0.034), mTOR activity was significantly increased in the CTX + IPA + IL-12 group (0.39 ± 0.12). To verify that the induction of mTOR phosphorylation also led to its kinase activity, we monitored the kinetics of S6K, a direct target of mTOR kinase activity. As anticipated, IL-12 stimulation significantly enhanced the expression of S6K in CD8+ Tem (0.13 ± 0.03) compared with the control (0.06 ± 0.04, P < 0.001), IPA (0.07 ± 0.02, P = 0.001), and CTX + IPA (0.09 ± 0.01, P = 0.032) groups.\nIL-12 increases the expression of mammalian target of rapamycin and S6 kinase, which was blocked by rapamycin. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after intranasal inoculation of Aspergillus fumigatus. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/− cells represent CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nSimilarly, when we blocked mTOR activity by adding rapamycin during IPA infection, we found that the expression of mTOR was significantly lower in the CTX + IPA + RAPA group (0.19 ± 0.05) compared with the CTX + IPA (0.29 ± 0.04, P = 0.034) and CTX + IPA + IL-12 (0.39 ± 0.12, P < 0.001) groups. The expression of S6K was also significantly lower in the CTX + IPA + RAPA (0.04 ± 0.04) group than in the CTX + IPA (0.09 ± 0.01, P = 0.01) and CTX + IPA + IL-12 (0.13 ± 0.03, P < 0.001) groups.", "As shown in Figure 3, the proportion of CD8+ Tem, IFN-γ production, and serum sTREM-1 expression were significantly increased in the CTX + IPA + IL-12 group (0.47 ± 0.06, 0.09 ± 0.03, and 1876.91 ± 247.80, respectively) compared with the CTX + IPA group (0.35 ± 0.10, P = 0.024; 0.05 ± 0.04, P = 0.032; and 1537.64 ± 359.52, P = 0.017, respectively). The result indicates that the addition of IL-12 could improve CD8+ Tem differentiation, IFN-γ production, and resulted in robust serum sTREM-1 expression during IPA infection by activating the mTOR pathway.\nThe proportion of CD8+ effector memory T-cells, expression of interferon-γ, and sTREM-1 levels were significantly increased by IL-12 stimulation but significantly decreased by rapamycin treatment. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after Aspergillus fumigatus intranasal inoculation. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/- cells represented CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin; sTREM-1: Soluble triggering receptors expressed on myeloid cell-1.\nMore importantly, we also found that adding rapamycin could significantly decrease the proportion of CD8+ Tem (0.22 ± 0.05), IFN-γ production (0.02 ± 0.01), and serum TREM-1 expression (1214.45 ± 293.24) compared with the CTX + IPA (0.35 ± 0.10, P = 0.017; 0.05 ± 0.04, P = 0.039; and 1537.64 ± 359.52, P = 0.022, respectively) and CTX + IPA + IL-12 (0.47 ± 0.06, P < 0.001; 0.09 ± 0.03, P < 0.001; and 1876.91 ± 247.80, P < 0.001, respectively) groups. These results indicate that sustained mTOR activity is essential for CD8+ Tem differentiation, Type I effector functions, and serum sTREM-1 expression.", "IL-6 levels reflect the inflammatory response, and IL-10 levels reflect anti-inflammatory responses. Figure 4 shows that the IL-12-treated group had the highest IL-6 levels (2053.91 ± 402.37 pg/ml), followed by the CTX + IPA (1426.57 ± 488.03 pg/ml, P = 0.036), CTX + IPA + RAPA (822.74 ± 211.30 pg/ml, P < 0.001), IPA (811.58 ± 247.03 pg/ml, P < 0.001), and control (245.65 ± 85.78 pg/ml, P < 0.001) groups. In contrast, the concentration of IL-10 showed the reverse trend. The IL-10 level of the IL-12-treated group (314.94 ± 36.97 pg/ml), as well as the control (267.60 ± 46.10 pg/ml) and IPA (350.93 ± 43.11 pg/ml) groups, were significantly lower than the CTX + IPA group (437.95 ± 53.41 pg/ml, P < 0.001) and especially the CTX + IPA + RAPA group (542.44 ± 37.32 pg/ml, P < 0.001).\nIL-12 significantly increased the IL-6 level, which was significantly decreased by rapamycin treatment. In contrast, the concentration of IL-10 and galactomannan showed the reverse trend. Plasma samples obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected by ELISA 7 days after Aspergillus fumigatus intranasal inoculation. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nGalactomannan (GM) is used to demonstrate the severity of fungal infection in clinical practice. In this study, we found that, after A. fumigates inoculation, the level of GM was significantly increased in the IPA (1985.98 ± 152.79 pg/ml, P < 0.001), CTX + IPA (2251.06 ± 230.50 pg/ml, P < 0.001), CTX + IPA + IL-12 (1920.15 ± 86.16 pg/ml, P < 0.001), and CTX + IPA + RAPA (2496.87 ± 278.05 pg/ml, P < 0.001) groups compared with the control group (126.82 ± 10.31 pg/ml). However, as shown in Figure 4, treatment with IL-12 significantly decreased the level of GM compared with the CTX + IPA (P = 0.002) and CTX + IPA + RAPA (P < 0.001) groups.", "The work was supported by the Beijing Municipal Natural Science Foundation (No. 7152119) and Chinese National Natural Science Foundation for Young Scholars (No. 81601657)." ]

[ null, null, null, null, null, null, null, null, null, null ]

[ "Introduction", "Methods", "Pathogen preparation", "Animal model preparation", "CD8+ effector memory T-cells counts and interferon-γ, mammalian target of rapamycin, and S6 kinase expression", "Cytokine and soluble triggering receptors expressed on myeloid cell-1 quantification", "Statistical analysis", "Results", "Tissue culture and histology", "Regulation of the mammalian target of rapamycin pathway", "Mammalian target of rapamycin modulates CD8+ T-cell differentiation and expression of triggering receptor expressed on myeloid cell-1", "Alteration of inflammatory responses and severity of fungal infection", "Discussion", "Financial support and sponsorship", "Conflicts of interest" ]

[ "Invasive pulmonary aspergillosis (IPA) has become a leading cause of severe fungal infections in critically ill patients and has a high mortality rate, especially in patients with immune dysfunction such as those undergoing immunosuppressive or high-dose glucocorticoid therapy, and solid organ or hematopoietic stem cell transplantation patients.[1] The acquired immune response is mediated by T-lymphocytes, which determine whether the host can effectively clear the pathogen. CD8+ T-cells are a vital component of the acquired immune system.[23] Effector-phenotype CD8+ memory T-cells (Tem) can trigger a rapid, potent, and effective immune response to specific antigens in the early stages of infection. Investigating the mechanism of differentiation of CD8+ T cells in the early stages of infection could provide new insights into effectively controlling infection in IPA patients with immune dysfunction.[45]\nThe mammalian target of rapamycin (mTOR) signaling pathway regulates cell metabolism, survival, growth, and proliferation. The mTOR downstream signaling pathway contains two key substrates, the ribosomal S6 kinase (S6K) and the eukaryotic translational initiation factor 4E binding protein 1 (4E-BP1). When activated, mTOR phosphorylates S6K and 4E-BP1 to promote protein translation and is sensitive to rapamycin inhibition.[6] Recent studies have shown that mTOR may regulate T-cell differentiation and adaptive immunity following the binding of the T-cell receptor to antigen.[7] In preliminary experiments, we found that mTOR modulates lymphocyte differentiation in immunosuppressed animals with fungal infections by regulating the transcription factors T-box expressed in T-cells (T-bet) and eomesodermin.[8] T-bet is a key transcription factor regulating T-cell differentiation and belongs to the T-box transcription factor family.[9] Eomesodermin plays a synergistic role in T-bet function and regulates the differentiation of CD8+ T-cells into effector and memory T-cells. A recent study suggests that interleukin (IL)-12 can affect memory/effector CD8+ T-cell phenotype differentiation by regulating T-bet and eomesodermin.[10] IL-12 can also enhance the activity of mTOR kinase in naïve CD8+ T-cells.[11] In contrast, rapamycin inhibits the activity of mTOR kinase in CD8+ T-cells, thereby blocking the expression of T-bet and promoting the expression of eomesodermin. Increased expression of eomesodermin in CD8+ T-cells may promote the generation of memory T-cells, while high expression of T-bet could promote effector CD8+ T-cell proliferation.[12]\nTriggering receptors expressed on myeloid cells (TREMs) were identified as a new family of receptors that regulate both innate and adaptive immune responses to infection.[1314] TREM-1 is mainly expressed on neutrophils, monocytes, and macrophages. High TREM-1 levels are indicative of acute or chronic conditions caused by fungi or bacteria.[1415] The TREM-1 extracellular domain can also be found as soluble TREM-1 (sTREM-1). It is proposed that sTREM-1 may arise directly from a splice variant or following the shedding of membrane-bound TREM-1 by metalloproteinase-mediated proteolytic cleavage.[16] sTREM-1 has proven to be a valuable diagnostic and prognostic marker since it is easily detected with immunochemical assays in biological fluid samples. Previous studies have found that sTREM-1 levels are elevated in plasma and bronchoalveolar lavage fluid from patients with bacterial or fungal pneumonia.[1718] In preliminary studies, we found that plasma sTREM-1 is closely correlated with T-bet and eomesodermin levels in immunocompromised Aspergillus-infected rats, suggesting that TREM-1 may be involved in lymphocyte regulation and differentiation during fungal infection.[19]\nBased on the theories and experimental results described above, we hypothesized that TREM-1 may play a vital role in mTOR modulation of CD8+ T-cell differentiation through the transcription factors T-bet and eomesodermin during the immune response to IPA.", " Pathogen preparation The strain of Aspergillus fumigatus, provided by the Department of Clinical Laboratory, Peking Union Medical College Hospital (PUMCH), was obtained from a case of pulmonary aspergillosis. Viable conidia (>95%) were obtained by growth on Sabouraud dextrose agar for 5 days at 35°C. Conidia were harvested in 10 ml 0.1% Tween-80/PBS and filtered through five layers of gauze. The concentration of conidia was adjusted to 1 × 108 CFU/ml by turbidity adjustment method.\nThe strain of Aspergillus fumigatus, provided by the Department of Clinical Laboratory, Peking Union Medical College Hospital (PUMCH), was obtained from a case of pulmonary aspergillosis. Viable conidia (>95%) were obtained by growth on Sabouraud dextrose agar for 5 days at 35°C. Conidia were harvested in 10 ml 0.1% Tween-80/PBS and filtered through five layers of gauze. The concentration of conidia was adjusted to 1 × 108 CFU/ml by turbidity adjustment method.\n Animal model preparation Healthy 4-week-old female BALB/c mice, weighing 20 ± 5 g, were obtained from the Animal Facility Center, PUMCH. All animals were housed in a pathogen-free facility and treated according to protocols approved by the Institutional Animal Care and Use Committee of PUMCH. Thirty mice were randomly divided into the following groups (six mice per group): (1) control group: nontreated mice. (2) IPA group: animals were inoculated with 0.1 ml A. fumigatus conidia solution intranasally. (3) Immunosuppression plus aspergillosis group (cyclophosphamide [CTX] + IPA): CTX (Jiangsu Hengrui Medicine Co., Ltd., Jiangsu, China) was injected intraperitoneally at a dose of 200 mg·kg−1·d−1 for 5 consecutive days. Animals were then infected with A. fumigatus as mentioned above. (4) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA): mice were given 2 mg·kg−1·d−1 rapamycin for the 7 consecutive days after intraperitoneal injection of CTX and A. fumigatus infection. (5) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12): mice were given 5 μg/kg IL-12 every other day for the 7 days following intraperitoneal injection of CTX and A. fumigatus infection. Blood samples were obtained by retro-orbital bleeding. Part of the lung tissue was minced and used for A. fumigatus culture, the rest was fixed with 4% formaldehyde, and paraffin-embedded tissue sections were stained with hematoxylin and eosin (H and E), Masson trichrome, and periodic acid-silver methenamine.\nHealthy 4-week-old female BALB/c mice, weighing 20 ± 5 g, were obtained from the Animal Facility Center, PUMCH. All animals were housed in a pathogen-free facility and treated according to protocols approved by the Institutional Animal Care and Use Committee of PUMCH. Thirty mice were randomly divided into the following groups (six mice per group): (1) control group: nontreated mice. (2) IPA group: animals were inoculated with 0.1 ml A. fumigatus conidia solution intranasally. (3) Immunosuppression plus aspergillosis group (cyclophosphamide [CTX] + IPA): CTX (Jiangsu Hengrui Medicine Co., Ltd., Jiangsu, China) was injected intraperitoneally at a dose of 200 mg·kg−1·d−1 for 5 consecutive days. Animals were then infected with A. fumigatus as mentioned above. (4) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA): mice were given 2 mg·kg−1·d−1 rapamycin for the 7 consecutive days after intraperitoneal injection of CTX and A. fumigatus infection. (5) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12): mice were given 5 μg/kg IL-12 every other day for the 7 days following intraperitoneal injection of CTX and A. fumigatus infection. Blood samples were obtained by retro-orbital bleeding. Part of the lung tissue was minced and used for A. fumigatus culture, the rest was fixed with 4% formaldehyde, and paraffin-embedded tissue sections were stained with hematoxylin and eosin (H and E), Masson trichrome, and periodic acid-silver methenamine.\n CD8+ effector memory T-cells counts and interferon-γ, mammalian target of rapamycin, and S6 kinase expression Peripheral blood mononuclear cells were isolated from blood samples and counted by flow cytometry. Cells were then labeled with the following fluorescence-conjugated monoclonal antibodies: anti-rat CD45 PE (12-0451-81, eBioscience, San Diego, CA, USA), anti-rat CD8a APC (17-0081-81, eBioscience), anti-rat CD44 PE (25-0441-81, eBioscience), and anti-rat CD62L (104432, Biolegend). CD8+ Tem were sorted by flow cytometry (EPICS-XL, Beckman-Coulter, Indianapolis, IN, USA) and then stained for interferon (IFN)-γ (11-7311-81, eBioscience), mTOR (ab87540, Abcam, Cambridge, MA, USA), and S6K (ab32529, Abcam) expression.\nPeripheral blood mononuclear cells were isolated from blood samples and counted by flow cytometry. Cells were then labeled with the following fluorescence-conjugated monoclonal antibodies: anti-rat CD45 PE (12-0451-81, eBioscience, San Diego, CA, USA), anti-rat CD8a APC (17-0081-81, eBioscience), anti-rat CD44 PE (25-0441-81, eBioscience), and anti-rat CD62L (104432, Biolegend). CD8+ Tem were sorted by flow cytometry (EPICS-XL, Beckman-Coulter, Indianapolis, IN, USA) and then stained for interferon (IFN)-γ (11-7311-81, eBioscience), mTOR (ab87540, Abcam, Cambridge, MA, USA), and S6K (ab32529, Abcam) expression.\n Cytokine and soluble triggering receptors expressed on myeloid cell-1 quantification Cytokines and sTREM-1 were quantified using the following ELISA kits as per the manufacturer's instructions; IL-6 (cat#: ab168538, Abcam), IL-10 (cat#: ab176665, Abcam), GM (cat#: 85-86051, Affymetrix Bioscience, San Diego, CA, USA), and sTREM-1 (cat#: SEA213Mu, USCN, Wuhan, China).\nCytokines and sTREM-1 were quantified using the following ELISA kits as per the manufacturer's instructions; IL-6 (cat#: ab168538, Abcam), IL-10 (cat#: ab176665, Abcam), GM (cat#: 85-86051, Affymetrix Bioscience, San Diego, CA, USA), and sTREM-1 (cat#: SEA213Mu, USCN, Wuhan, China).\n Statistical analysis Data were analyzed using SPSS version 18.0 software (SPSS Inc., Armonk, NY, USA). All the data for the continuous variables in this study were proven to have normal distributions and are given as mean ± standard deviations (SD). Results for continuous variables that were not normally distributed are given as medians (interquartile ranges) and were compared using nonparametric tests. Student's t-test or analysis of variance followed by Bonferroni's test were used to determine the statistical significance (P) of differences. Pearson's correlation coefficient was used to analyze the correlation of two parameters. A value of P < 0.05 was considered statistically significant.\nData were analyzed using SPSS version 18.0 software (SPSS Inc., Armonk, NY, USA). All the data for the continuous variables in this study were proven to have normal distributions and are given as mean ± standard deviations (SD). Results for continuous variables that were not normally distributed are given as medians (interquartile ranges) and were compared using nonparametric tests. Student's t-test or analysis of variance followed by Bonferroni's test were used to determine the statistical significance (P) of differences. Pearson's correlation coefficient was used to analyze the correlation of two parameters. A value of P < 0.05 was considered statistically significant.", "The strain of Aspergillus fumigatus, provided by the Department of Clinical Laboratory, Peking Union Medical College Hospital (PUMCH), was obtained from a case of pulmonary aspergillosis. Viable conidia (>95%) were obtained by growth on Sabouraud dextrose agar for 5 days at 35°C. Conidia were harvested in 10 ml 0.1% Tween-80/PBS and filtered through five layers of gauze. The concentration of conidia was adjusted to 1 × 108 CFU/ml by turbidity adjustment method.", "Healthy 4-week-old female BALB/c mice, weighing 20 ± 5 g, were obtained from the Animal Facility Center, PUMCH. All animals were housed in a pathogen-free facility and treated according to protocols approved by the Institutional Animal Care and Use Committee of PUMCH. Thirty mice were randomly divided into the following groups (six mice per group): (1) control group: nontreated mice. (2) IPA group: animals were inoculated with 0.1 ml A. fumigatus conidia solution intranasally. (3) Immunosuppression plus aspergillosis group (cyclophosphamide [CTX] + IPA): CTX (Jiangsu Hengrui Medicine Co., Ltd., Jiangsu, China) was injected intraperitoneally at a dose of 200 mg·kg−1·d−1 for 5 consecutive days. Animals were then infected with A. fumigatus as mentioned above. (4) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA): mice were given 2 mg·kg−1·d−1 rapamycin for the 7 consecutive days after intraperitoneal injection of CTX and A. fumigatus infection. (5) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12): mice were given 5 μg/kg IL-12 every other day for the 7 days following intraperitoneal injection of CTX and A. fumigatus infection. Blood samples were obtained by retro-orbital bleeding. Part of the lung tissue was minced and used for A. fumigatus culture, the rest was fixed with 4% formaldehyde, and paraffin-embedded tissue sections were stained with hematoxylin and eosin (H and E), Masson trichrome, and periodic acid-silver methenamine.", "Peripheral blood mononuclear cells were isolated from blood samples and counted by flow cytometry. Cells were then labeled with the following fluorescence-conjugated monoclonal antibodies: anti-rat CD45 PE (12-0451-81, eBioscience, San Diego, CA, USA), anti-rat CD8a APC (17-0081-81, eBioscience), anti-rat CD44 PE (25-0441-81, eBioscience), and anti-rat CD62L (104432, Biolegend). CD8+ Tem were sorted by flow cytometry (EPICS-XL, Beckman-Coulter, Indianapolis, IN, USA) and then stained for interferon (IFN)-γ (11-7311-81, eBioscience), mTOR (ab87540, Abcam, Cambridge, MA, USA), and S6K (ab32529, Abcam) expression.", "Cytokines and sTREM-1 were quantified using the following ELISA kits as per the manufacturer's instructions; IL-6 (cat#: ab168538, Abcam), IL-10 (cat#: ab176665, Abcam), GM (cat#: 85-86051, Affymetrix Bioscience, San Diego, CA, USA), and sTREM-1 (cat#: SEA213Mu, USCN, Wuhan, China).", "Data were analyzed using SPSS version 18.0 software (SPSS Inc., Armonk, NY, USA). All the data for the continuous variables in this study were proven to have normal distributions and are given as mean ± standard deviations (SD). Results for continuous variables that were not normally distributed are given as medians (interquartile ranges) and were compared using nonparametric tests. Student's t-test or analysis of variance followed by Bonferroni's test were used to determine the statistical significance (P) of differences. Pearson's correlation coefficient was used to analyze the correlation of two parameters. A value of P < 0.05 was considered statistically significant.", " Tissue culture and histology Viable A. fumigatus was cultured from lung tissue of both IPA and CTX + IPA mice treated with rapamycin or IL-12 or without treatment [Figure 1a–1c], while control mice were negative. Histological examination indicated that the lung tissue structure was intact in the normal control [Figure 1d]. In contrast, infiltration of inflammatory cells, hemorrhage, and interstitial lung tissue injury were found in the lungs of the IPA, CTX + IPA, CTX + IPA + IL-12, and CTX + IPA + RAPA groups [Figure 1e–1h]. Compared with the IPA group, Figure 1 suggests that CTX + IPA mice treated with rapamycin or IL-12 or without treatment had greater inflammation and hemorrhage in the interstitial lung tissue.\nHistology of lung tissue stained with H and E, Masson trichrome, and PASM. (a–c) The fungal spores of Aspergillus fumigatus. (d) Control animal. (e) Animal infected with IPA. (f) Immunosuppression plus aspergillosis group (CTX + IPA). (g) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12). (h) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA). Original magnification: (a) Masson trichrome staining, original magnification ×200; (b) Masson trichrome staining, original magnification ×400; (c) PASM staining, original magnification ×600; (d–h) H and E, original magnification ×100. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; PASM: Periodic acid silver methenamine; IL: Interleukin.\nViable A. fumigatus was cultured from lung tissue of both IPA and CTX + IPA mice treated with rapamycin or IL-12 or without treatment [Figure 1a–1c], while control mice were negative. Histological examination indicated that the lung tissue structure was intact in the normal control [Figure 1d]. In contrast, infiltration of inflammatory cells, hemorrhage, and interstitial lung tissue injury were found in the lungs of the IPA, CTX + IPA, CTX + IPA + IL-12, and CTX + IPA + RAPA groups [Figure 1e–1h]. Compared with the IPA group, Figure 1 suggests that CTX + IPA mice treated with rapamycin or IL-12 or without treatment had greater inflammation and hemorrhage in the interstitial lung tissue.\nHistology of lung tissue stained with H and E, Masson trichrome, and PASM. (a–c) The fungal spores of Aspergillus fumigatus. (d) Control animal. (e) Animal infected with IPA. (f) Immunosuppression plus aspergillosis group (CTX + IPA). (g) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12). (h) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA). Original magnification: (a) Masson trichrome staining, original magnification ×200; (b) Masson trichrome staining, original magnification ×400; (c) PASM staining, original magnification ×600; (d–h) H and E, original magnification ×100. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; PASM: Periodic acid silver methenamine; IL: Interleukin.\n Regulation of the mammalian target of rapamycin pathway As shown in Figure 2, compared with the control group (0.25 ± 0.04, P = 0.004), IPA group (0.27 ± 0.04, P = 0.01), and CTX + IPA group (0.29 ± 0.04, P = 0.034), mTOR activity was significantly increased in the CTX + IPA + IL-12 group (0.39 ± 0.12). To verify that the induction of mTOR phosphorylation also led to its kinase activity, we monitored the kinetics of S6K, a direct target of mTOR kinase activity. As anticipated, IL-12 stimulation significantly enhanced the expression of S6K in CD8+ Tem (0.13 ± 0.03) compared with the control (0.06 ± 0.04, P < 0.001), IPA (0.07 ± 0.02, P = 0.001), and CTX + IPA (0.09 ± 0.01, P = 0.032) groups.\nIL-12 increases the expression of mammalian target of rapamycin and S6 kinase, which was blocked by rapamycin. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after intranasal inoculation of Aspergillus fumigatus. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/− cells represent CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nSimilarly, when we blocked mTOR activity by adding rapamycin during IPA infection, we found that the expression of mTOR was significantly lower in the CTX + IPA + RAPA group (0.19 ± 0.05) compared with the CTX + IPA (0.29 ± 0.04, P = 0.034) and CTX + IPA + IL-12 (0.39 ± 0.12, P < 0.001) groups. The expression of S6K was also significantly lower in the CTX + IPA + RAPA (0.04 ± 0.04) group than in the CTX + IPA (0.09 ± 0.01, P = 0.01) and CTX + IPA + IL-12 (0.13 ± 0.03, P < 0.001) groups.\nAs shown in Figure 2, compared with the control group (0.25 ± 0.04, P = 0.004), IPA group (0.27 ± 0.04, P = 0.01), and CTX + IPA group (0.29 ± 0.04, P = 0.034), mTOR activity was significantly increased in the CTX + IPA + IL-12 group (0.39 ± 0.12). To verify that the induction of mTOR phosphorylation also led to its kinase activity, we monitored the kinetics of S6K, a direct target of mTOR kinase activity. As anticipated, IL-12 stimulation significantly enhanced the expression of S6K in CD8+ Tem (0.13 ± 0.03) compared with the control (0.06 ± 0.04, P < 0.001), IPA (0.07 ± 0.02, P = 0.001), and CTX + IPA (0.09 ± 0.01, P = 0.032) groups.\nIL-12 increases the expression of mammalian target of rapamycin and S6 kinase, which was blocked by rapamycin. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after intranasal inoculation of Aspergillus fumigatus. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/− cells represent CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nSimilarly, when we blocked mTOR activity by adding rapamycin during IPA infection, we found that the expression of mTOR was significantly lower in the CTX + IPA + RAPA group (0.19 ± 0.05) compared with the CTX + IPA (0.29 ± 0.04, P = 0.034) and CTX + IPA + IL-12 (0.39 ± 0.12, P < 0.001) groups. The expression of S6K was also significantly lower in the CTX + IPA + RAPA (0.04 ± 0.04) group than in the CTX + IPA (0.09 ± 0.01, P = 0.01) and CTX + IPA + IL-12 (0.13 ± 0.03, P < 0.001) groups.\n Mammalian target of rapamycin modulates CD8+ T-cell differentiation and expression of triggering receptor expressed on myeloid cell-1 As shown in Figure 3, the proportion of CD8+ Tem, IFN-γ production, and serum sTREM-1 expression were significantly increased in the CTX + IPA + IL-12 group (0.47 ± 0.06, 0.09 ± 0.03, and 1876.91 ± 247.80, respectively) compared with the CTX + IPA group (0.35 ± 0.10, P = 0.024; 0.05 ± 0.04, P = 0.032; and 1537.64 ± 359.52, P = 0.017, respectively). The result indicates that the addition of IL-12 could improve CD8+ Tem differentiation, IFN-γ production, and resulted in robust serum sTREM-1 expression during IPA infection by activating the mTOR pathway.\nThe proportion of CD8+ effector memory T-cells, expression of interferon-γ, and sTREM-1 levels were significantly increased by IL-12 stimulation but significantly decreased by rapamycin treatment. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after Aspergillus fumigatus intranasal inoculation. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/- cells represented CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin; sTREM-1: Soluble triggering receptors expressed on myeloid cell-1.\nMore importantly, we also found that adding rapamycin could significantly decrease the proportion of CD8+ Tem (0.22 ± 0.05), IFN-γ production (0.02 ± 0.01), and serum TREM-1 expression (1214.45 ± 293.24) compared with the CTX + IPA (0.35 ± 0.10, P = 0.017; 0.05 ± 0.04, P = 0.039; and 1537.64 ± 359.52, P = 0.022, respectively) and CTX + IPA + IL-12 (0.47 ± 0.06, P < 0.001; 0.09 ± 0.03, P < 0.001; and 1876.91 ± 247.80, P < 0.001, respectively) groups. These results indicate that sustained mTOR activity is essential for CD8+ Tem differentiation, Type I effector functions, and serum sTREM-1 expression.\nAs shown in Figure 3, the proportion of CD8+ Tem, IFN-γ production, and serum sTREM-1 expression were significantly increased in the CTX + IPA + IL-12 group (0.47 ± 0.06, 0.09 ± 0.03, and 1876.91 ± 247.80, respectively) compared with the CTX + IPA group (0.35 ± 0.10, P = 0.024; 0.05 ± 0.04, P = 0.032; and 1537.64 ± 359.52, P = 0.017, respectively). The result indicates that the addition of IL-12 could improve CD8+ Tem differentiation, IFN-γ production, and resulted in robust serum sTREM-1 expression during IPA infection by activating the mTOR pathway.\nThe proportion of CD8+ effector memory T-cells, expression of interferon-γ, and sTREM-1 levels were significantly increased by IL-12 stimulation but significantly decreased by rapamycin treatment. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after Aspergillus fumigatus intranasal inoculation. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/- cells represented CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin; sTREM-1: Soluble triggering receptors expressed on myeloid cell-1.\nMore importantly, we also found that adding rapamycin could significantly decrease the proportion of CD8+ Tem (0.22 ± 0.05), IFN-γ production (0.02 ± 0.01), and serum TREM-1 expression (1214.45 ± 293.24) compared with the CTX + IPA (0.35 ± 0.10, P = 0.017; 0.05 ± 0.04, P = 0.039; and 1537.64 ± 359.52, P = 0.022, respectively) and CTX + IPA + IL-12 (0.47 ± 0.06, P < 0.001; 0.09 ± 0.03, P < 0.001; and 1876.91 ± 247.80, P < 0.001, respectively) groups. These results indicate that sustained mTOR activity is essential for CD8+ Tem differentiation, Type I effector functions, and serum sTREM-1 expression.\n Alteration of inflammatory responses and severity of fungal infection IL-6 levels reflect the inflammatory response, and IL-10 levels reflect anti-inflammatory responses. Figure 4 shows that the IL-12-treated group had the highest IL-6 levels (2053.91 ± 402.37 pg/ml), followed by the CTX + IPA (1426.57 ± 488.03 pg/ml, P = 0.036), CTX + IPA + RAPA (822.74 ± 211.30 pg/ml, P < 0.001), IPA (811.58 ± 247.03 pg/ml, P < 0.001), and control (245.65 ± 85.78 pg/ml, P < 0.001) groups. In contrast, the concentration of IL-10 showed the reverse trend. The IL-10 level of the IL-12-treated group (314.94 ± 36.97 pg/ml), as well as the control (267.60 ± 46.10 pg/ml) and IPA (350.93 ± 43.11 pg/ml) groups, were significantly lower than the CTX + IPA group (437.95 ± 53.41 pg/ml, P < 0.001) and especially the CTX + IPA + RAPA group (542.44 ± 37.32 pg/ml, P < 0.001).\nIL-12 significantly increased the IL-6 level, which was significantly decreased by rapamycin treatment. In contrast, the concentration of IL-10 and galactomannan showed the reverse trend. Plasma samples obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected by ELISA 7 days after Aspergillus fumigatus intranasal inoculation. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nGalactomannan (GM) is used to demonstrate the severity of fungal infection in clinical practice. In this study, we found that, after A. fumigates inoculation, the level of GM was significantly increased in the IPA (1985.98 ± 152.79 pg/ml, P < 0.001), CTX + IPA (2251.06 ± 230.50 pg/ml, P < 0.001), CTX + IPA + IL-12 (1920.15 ± 86.16 pg/ml, P < 0.001), and CTX + IPA + RAPA (2496.87 ± 278.05 pg/ml, P < 0.001) groups compared with the control group (126.82 ± 10.31 pg/ml). However, as shown in Figure 4, treatment with IL-12 significantly decreased the level of GM compared with the CTX + IPA (P = 0.002) and CTX + IPA + RAPA (P < 0.001) groups.\nIL-6 levels reflect the inflammatory response, and IL-10 levels reflect anti-inflammatory responses. Figure 4 shows that the IL-12-treated group had the highest IL-6 levels (2053.91 ± 402.37 pg/ml), followed by the CTX + IPA (1426.57 ± 488.03 pg/ml, P = 0.036), CTX + IPA + RAPA (822.74 ± 211.30 pg/ml, P < 0.001), IPA (811.58 ± 247.03 pg/ml, P < 0.001), and control (245.65 ± 85.78 pg/ml, P < 0.001) groups. In contrast, the concentration of IL-10 showed the reverse trend. The IL-10 level of the IL-12-treated group (314.94 ± 36.97 pg/ml), as well as the control (267.60 ± 46.10 pg/ml) and IPA (350.93 ± 43.11 pg/ml) groups, were significantly lower than the CTX + IPA group (437.95 ± 53.41 pg/ml, P < 0.001) and especially the CTX + IPA + RAPA group (542.44 ± 37.32 pg/ml, P < 0.001).\nIL-12 significantly increased the IL-6 level, which was significantly decreased by rapamycin treatment. In contrast, the concentration of IL-10 and galactomannan showed the reverse trend. Plasma samples obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected by ELISA 7 days after Aspergillus fumigatus intranasal inoculation. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nGalactomannan (GM) is used to demonstrate the severity of fungal infection in clinical practice. In this study, we found that, after A. fumigates inoculation, the level of GM was significantly increased in the IPA (1985.98 ± 152.79 pg/ml, P < 0.001), CTX + IPA (2251.06 ± 230.50 pg/ml, P < 0.001), CTX + IPA + IL-12 (1920.15 ± 86.16 pg/ml, P < 0.001), and CTX + IPA + RAPA (2496.87 ± 278.05 pg/ml, P < 0.001) groups compared with the control group (126.82 ± 10.31 pg/ml). However, as shown in Figure 4, treatment with IL-12 significantly decreased the level of GM compared with the CTX + IPA (P = 0.002) and CTX + IPA + RAPA (P < 0.001) groups.", "Viable A. fumigatus was cultured from lung tissue of both IPA and CTX + IPA mice treated with rapamycin or IL-12 or without treatment [Figure 1a–1c], while control mice were negative. Histological examination indicated that the lung tissue structure was intact in the normal control [Figure 1d]. In contrast, infiltration of inflammatory cells, hemorrhage, and interstitial lung tissue injury were found in the lungs of the IPA, CTX + IPA, CTX + IPA + IL-12, and CTX + IPA + RAPA groups [Figure 1e–1h]. Compared with the IPA group, Figure 1 suggests that CTX + IPA mice treated with rapamycin or IL-12 or without treatment had greater inflammation and hemorrhage in the interstitial lung tissue.\nHistology of lung tissue stained with H and E, Masson trichrome, and PASM. (a–c) The fungal spores of Aspergillus fumigatus. (d) Control animal. (e) Animal infected with IPA. (f) Immunosuppression plus aspergillosis group (CTX + IPA). (g) Immunosuppression plus IPA plus IL-12 treatment group (CTX + IPA + IL-12). (h) Immunosuppression plus aspergillosis plus rapamycin treatment group (CTX + IPA + RAPA). Original magnification: (a) Masson trichrome staining, original magnification ×200; (b) Masson trichrome staining, original magnification ×400; (c) PASM staining, original magnification ×600; (d–h) H and E, original magnification ×100. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; PASM: Periodic acid silver methenamine; IL: Interleukin.", "As shown in Figure 2, compared with the control group (0.25 ± 0.04, P = 0.004), IPA group (0.27 ± 0.04, P = 0.01), and CTX + IPA group (0.29 ± 0.04, P = 0.034), mTOR activity was significantly increased in the CTX + IPA + IL-12 group (0.39 ± 0.12). To verify that the induction of mTOR phosphorylation also led to its kinase activity, we monitored the kinetics of S6K, a direct target of mTOR kinase activity. As anticipated, IL-12 stimulation significantly enhanced the expression of S6K in CD8+ Tem (0.13 ± 0.03) compared with the control (0.06 ± 0.04, P < 0.001), IPA (0.07 ± 0.02, P = 0.001), and CTX + IPA (0.09 ± 0.01, P = 0.032) groups.\nIL-12 increases the expression of mammalian target of rapamycin and S6 kinase, which was blocked by rapamycin. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after intranasal inoculation of Aspergillus fumigatus. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/− cells represent CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nSimilarly, when we blocked mTOR activity by adding rapamycin during IPA infection, we found that the expression of mTOR was significantly lower in the CTX + IPA + RAPA group (0.19 ± 0.05) compared with the CTX + IPA (0.29 ± 0.04, P = 0.034) and CTX + IPA + IL-12 (0.39 ± 0.12, P < 0.001) groups. The expression of S6K was also significantly lower in the CTX + IPA + RAPA (0.04 ± 0.04) group than in the CTX + IPA (0.09 ± 0.01, P = 0.01) and CTX + IPA + IL-12 (0.13 ± 0.03, P < 0.001) groups.", "As shown in Figure 3, the proportion of CD8+ Tem, IFN-γ production, and serum sTREM-1 expression were significantly increased in the CTX + IPA + IL-12 group (0.47 ± 0.06, 0.09 ± 0.03, and 1876.91 ± 247.80, respectively) compared with the CTX + IPA group (0.35 ± 0.10, P = 0.024; 0.05 ± 0.04, P = 0.032; and 1537.64 ± 359.52, P = 0.017, respectively). The result indicates that the addition of IL-12 could improve CD8+ Tem differentiation, IFN-γ production, and resulted in robust serum sTREM-1 expression during IPA infection by activating the mTOR pathway.\nThe proportion of CD8+ effector memory T-cells, expression of interferon-γ, and sTREM-1 levels were significantly increased by IL-12 stimulation but significantly decreased by rapamycin treatment. The peripheral blood mononuclear cells obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected using flow cytometry 7 days after Aspergillus fumigatus intranasal inoculation. Side scatter and CD8a were used to gate on CD8+ T-lymphocytes, and CD44+ CD45+ CD62+/- cells represented CD8+ effector memory T-cells. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin; sTREM-1: Soluble triggering receptors expressed on myeloid cell-1.\nMore importantly, we also found that adding rapamycin could significantly decrease the proportion of CD8+ Tem (0.22 ± 0.05), IFN-γ production (0.02 ± 0.01), and serum TREM-1 expression (1214.45 ± 293.24) compared with the CTX + IPA (0.35 ± 0.10, P = 0.017; 0.05 ± 0.04, P = 0.039; and 1537.64 ± 359.52, P = 0.022, respectively) and CTX + IPA + IL-12 (0.47 ± 0.06, P < 0.001; 0.09 ± 0.03, P < 0.001; and 1876.91 ± 247.80, P < 0.001, respectively) groups. These results indicate that sustained mTOR activity is essential for CD8+ Tem differentiation, Type I effector functions, and serum sTREM-1 expression.", "IL-6 levels reflect the inflammatory response, and IL-10 levels reflect anti-inflammatory responses. Figure 4 shows that the IL-12-treated group had the highest IL-6 levels (2053.91 ± 402.37 pg/ml), followed by the CTX + IPA (1426.57 ± 488.03 pg/ml, P = 0.036), CTX + IPA + RAPA (822.74 ± 211.30 pg/ml, P < 0.001), IPA (811.58 ± 247.03 pg/ml, P < 0.001), and control (245.65 ± 85.78 pg/ml, P < 0.001) groups. In contrast, the concentration of IL-10 showed the reverse trend. The IL-10 level of the IL-12-treated group (314.94 ± 36.97 pg/ml), as well as the control (267.60 ± 46.10 pg/ml) and IPA (350.93 ± 43.11 pg/ml) groups, were significantly lower than the CTX + IPA group (437.95 ± 53.41 pg/ml, P < 0.001) and especially the CTX + IPA + RAPA group (542.44 ± 37.32 pg/ml, P < 0.001).\nIL-12 significantly increased the IL-6 level, which was significantly decreased by rapamycin treatment. In contrast, the concentration of IL-10 and galactomannan showed the reverse trend. Plasma samples obtained from IPA mice, CTX + IPA mice, CTX + IPA mice treated with IL-12 or rapamycin, and control animals were detected by ELISA 7 days after Aspergillus fumigatus intranasal inoculation. The data are presented as the mean ± standard deviation. *P < 0.05. CTX: Cyclophosphamide; IPA: Invasive pulmonary aspergillosis; IL: Interleukin.\nGalactomannan (GM) is used to demonstrate the severity of fungal infection in clinical practice. In this study, we found that, after A. fumigates inoculation, the level of GM was significantly increased in the IPA (1985.98 ± 152.79 pg/ml, P < 0.001), CTX + IPA (2251.06 ± 230.50 pg/ml, P < 0.001), CTX + IPA + IL-12 (1920.15 ± 86.16 pg/ml, P < 0.001), and CTX + IPA + RAPA (2496.87 ± 278.05 pg/ml, P < 0.001) groups compared with the control group (126.82 ± 10.31 pg/ml). However, as shown in Figure 4, treatment with IL-12 significantly decreased the level of GM compared with the CTX + IPA (P = 0.002) and CTX + IPA + RAPA (P < 0.001) groups.", "In the current study, we demonstrated that IL-12 increased the number and effector response (IFN-γ release) of CD8+ Tem and the level of sTREM-1 during IPA infection in CTX-induced immunocompromised animals, through increased expression and activity of the mTOR signal transduction pathway. Furthermore, inflammatory cytokines (IL-6) were increased and anti-inflammatory cytokines (IL-10) were decreased significantly, which markedly affect the fungal burden of the host. These effects could be blocked by the mTOR inhibitor rapamycin.\nCD8+ T-cells play a vital role in the adaptive immune system. After infection, some of the CD8+ T-cells will display a memory phenotype and can survive long term. CD8+ effector memory T-cells (CD8+ Tem), memory T-cells with effector cell phenotype, will establish a rapid immune response when the host comes into contact with the same pathogen, which is crucial for patients who are at a high risk of repeated infections such as immunosuppressed patients.[520] The mTOR signaling pathway has the ability to sense cellular metabolic state, extracellular nutrient availability, presence of growth factors/cytokines, and control key cellular processes, including apoptosis/autophagy, proliferation, and cell growth that govern cell fate. Studies indicate that mTOR contributes to the proliferation and differentiation of T-cells in response to antigen stimulation.[721] mTOR inhibition by rapamycin induces CD4+ T-cell anergy and/or differentiation into FoxP3+ regulatory T-cells and attenuates mTOR kinase signaling in regulating CD8+ T-cell trafficking.[2223] Consistent with these results, the current study demonstrated that the presence of IL-12 augments mTOR activity and influences CD8+ Tem proliferation and Type I effector maturation following immunosuppression by CTX and A. fumigatus infection. Effector functions induced by IL-12 treatment were significantly attenuated by adding the mTOR inhibitor rapamycin, confirming that sustained mTOR kinase activity is required for IL-12-programed proliferation and Type I effector function in CD8+ Tem in response to a fungal infection.\nTREM-1 is largely known as an activating receptor on neutrophils and monocytes, playing an important role in amplification of the inflammatory response. Studies demonstrated that activation of TREM-1 on monocytes drove robust production of pro-inflammatory chemokines such as monocyte chemoattractant protein 1 and IL-8. Engagement of TREM-1 in combination with microbial ligands that activate toll-like receptors also synergistically increased the production of the pro-inflammatory cytokines, TNF-α and IL-1β.[2425] Moreover, in primary human monocytes, TREM-1 activation was found to be upregulated in the context of host defense directed against bacterial and fungal infections. These cells had an improved ability to elicit T-cell proliferation and production of IFN-γ. The balance between the transcription factors T-bet and eomesodermin has been shown to determine effector and memory cell differentiation in CD8+ T-cells. Although in our previous studies, we found that both sTREM-1 and mTOR activity was significantly correlated with T-bet and eomesodermin levels in immunocompromised animals with IPA, little is known regarding its specific involvement in mTOR modulation of CD8+ T-cell differentiation and Type I effector function.[819] Consistent with previous studies, the findings of the current study demonstrated that, similar to the number and effector cell response of CD8+ Tem, the level of serum sTREM-1 expression was also significantly increased after IL-12 treatment and significantly decreased after adding rapamycin. These findings suggest that the mTOR signaling pathway is the central regulator of transcriptional programs which determine effector and/or memory cell differentiation in CD8+ T-cells through the transcription factors, T-bet and eomesodermin. Thus, sTREM-1 might be the molecular link between mTOR modulation and immune cell differentiation in the immunocompromised mice with a fungal infection. However, elucidation of a clear mechanism requires further study.\nThe current study also elucidated the final immune effects of the mTOR signal pathway. We found that IL-12 could increase plasma pro-inflammatory cytokine (IL-6) level, decrease the anti-inflammatory cytokine (IL-10), and reduce the fungal load (GM) significantly. The mTOR inhibitor rapamycin completely caused the opposite effects. These results indicated that the mTOR signaling pathway plays a vital role in CD8+ T-cell differentiation and function, resulting in changes of the immune response and fungal load in infected hosts with immunosuppression.\nTo summarize, mTOR could modulate CD8+ T-cell differentiation during immune responses to IPA. sTREM-1 may play a vital role in signal transduction between mTOR and the immune response. Whether this mechanism could be used as a target of antifungal immunotherapy in the future requires further study.\n Financial support and sponsorship The work was supported by the Beijing Municipal Natural Science Foundation (No. 7152119) and Chinese National Natural Science Foundation for Young Scholars (No. 81601657).\nThe work was supported by the Beijing Municipal Natural Science Foundation (No. 7152119) and Chinese National Natural Science Foundation for Young Scholars (No. 81601657).\n Conflicts of interest There are no conflicts of interest.\nThere are no conflicts of interest.", "The work was supported by the Beijing Municipal Natural Science Foundation (No. 7152119) and Chinese National Natural Science Foundation for Young Scholars (No. 81601657).", "There are no conflicts of interest." ]

[ "intro", "methods", null, null, null, null, null, "results", null, null, null, null, "discussion", null, "COI-statement" ]

[ "CD8+ T Effector Memory Cells", "Immunosuppression", "Invasive Pulmonary Aspergillosis", "Mammalian Target of Rapamycin", "Triggering Receptor Expressed on Myeloid Cell-1" ]

[ 92, 291, 154, 72, 123, 294, 406, 406, 463, 31 ]

[ "ipa", "ctx", "il", "ctx ipa", "12", "il 12", "group", "cd8", "rapamycin", "mice" ]

[ "response fungal infection", "pulmonary aspergillosis il", "rapamycin modulates cd8", "rapamycin cd8 cells", "immunosuppression plus aspergillosis" ]