id
stringlengths 38
42
| messages
listlengths 3
3
| source
stringclasses 1
value |
---|---|---|
Salesforce/xlam-function-calling-60k_1724
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_3_summary\", \"description\": \"Fetches a summary of stock performance and related metrics from the Stocky API.\", \"parameters\": {\"keyword\": {\"description\": \"The stock keyword to search for. Default is 'GOOG'.\", \"type\": \"str\", \"default\": \"GOOG\"}}}, {\"name\": \"get_liquidity_value\", \"description\": \"Retrieves the liquidity value of a specified cryptocurrency in US Dollars.\", \"parameters\": {\"symbol\": {\"description\": \"The ticker symbol of the cryptocurrency.\", \"type\": \"str\", \"default\": \"BTC\"}}}, {\"name\": \"market_trends\", \"description\": \"Fetches market trends data from the Joj Finance API.\", \"parameters\": {\"t\": {\"description\": \"Tab name, specifying the category of market trends. One of the following:\", \"type\": \"str\", \"default\": \"indexes\"}, \"gl\": {\"description\": \"Geolocation for the data, default is 'US'.\", \"type\": \"str, optional\", \"default\": \"US\"}, \"s\": {\"description\": \"Subtab name for 'indexes' tab to specify the region. One of the following:\", \"type\": \"str, optional\", \"default\": \"\"}, \"hl\": {\"description\": \"Language code, default is 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}}}]",
"role": "system"
},
{
"content": "Please provide the liquidity value of Cardano (ADA) and the market trends for gainers in the US. Also, what is the summary of the stock performance for Alphabet Inc. (GOOG)?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_liquidity_value\", \"arguments\": {\"symbol\": \"ADA\"}}, {\"name\": \"market_trends\", \"arguments\": {\"t\": \"gainers\", \"gl\": \"US\"}}, {\"name\": \"get_3_summary\", \"arguments\": {\"keyword\": \"GOOG\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1725
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"tweet_detail_conversation\", \"description\": \"Retrieves the detail and conversation about a specified tweet using the RapidAPI Twitter API.\", \"parameters\": {\"tweet_id\": {\"description\": \"The ID of the tweet to retrieve details and conversation for.\", \"type\": \"str\", \"default\": \"1299530165463199747\"}, \"cursor\": {\"description\": \"A parameter for pagination to fetch additional results in the conversation thread. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"tiktok_url_shortener\", \"description\": \"This function shortens a TikTok URL using the ScrapTik API and allows for optional specification of device and proxy.\", \"parameters\": {\"url\": {\"description\": \"The TikTok URL to shorten.\", \"type\": \"str\", \"default\": \"https://m.tiktok.com/v/6977803984228584709.html\"}, \"device\": {\"description\": \"The type of device for the request. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"tok_proxy\": {\"description\": \"The proxy to use for the request. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Retrieve the conversation thread for tweet '1382558777777777777' starting from the next page, and also shorten the same TikTok URL specifying 'mobile' as the device.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"tweet_detail_conversation\", \"arguments\": {\"tweet_id\": \"1382558777777777777\", \"cursor\": \"next_page\"}}, {\"name\": \"tiktok_url_shortener\", \"arguments\": {\"url\": \"https://www.tiktok.com/@user/video/7071748139533582853\", \"device\": \"mobile\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1726
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"v1_dogs\", \"description\": \"Fetch a list of dog breeds matching specified parameters from the API. Returns at most 20 results by default.\", \"parameters\": {\"offset\": {\"description\": \"Number of results to offset for pagination. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"energy\": {\"description\": \"Energy level of the breed (0-5, where 0 indicates low energy and 5 indicates high energy). Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"protectiveness\": {\"description\": \"Protectiveness level of the breed (0-5, where 0 indicates minimal alerting and 5 indicates maximum alerting). Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"max_weight\": {\"description\": \"Maximum weight of the breed in pounds. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"min_weight\": {\"description\": \"Minimum weight of the breed in pounds. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"trainability\": {\"description\": \"Ease of training the breed (0-5, where 0 indicates very difficult and 5 indicates very easy). Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"shedding\": {\"description\": \"Shedding level of the breed (0-5, where 0 indicates no shedding and 5 indicates maximum shedding). Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"name\": {\"description\": \"Name of the dog breed. Defaults to 'golden retriever'.\", \"type\": \"str, optional\", \"default\": \"golden retriever\"}, \"min_height\": {\"description\": \"Minimum height of the breed in inches. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"barking\": {\"description\": \"Barking tendency of the breed (0-5, where 0 indicates minimal barking and 5 indicates maximum barking). Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"max_height\": {\"description\": \"Maximum height of the breed in inches. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"max_life_expectancy\": {\"description\": \"Maximum life expectancy of the breed in years. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"min_life_expectancy\": {\"description\": \"Minimum life expectancy of the breed in years. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Identify breeds that are easy to train, have a minimum height of 18 inches, and a maximum weight of 70 pounds.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"v1_dogs\", \"arguments\": {\"trainability\": 5, \"min_height\": 18, \"max_weight\": 70}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1727
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"getmoviestatus\", \"description\": \"Fetches the status of a movie using the HelioViewer API.\", \"parameters\": {\"is_id\": {\"description\": \"Unique movie identifier (provided by the response to a `queueMovie` request).\", \"type\": \"str\", \"default\": \"VXvX5\"}, \"format\": {\"description\": \"Desired movie format (`mp4`, `webm`, or `flv`).\", \"type\": \"str\", \"default\": \"mp4\"}, \"verbose\": {\"description\": \"Whether to include extra metadata in the response. Defaults to None.\", \"type\": \"bool, optional\", \"default\": \"checked\"}, \"callback\": {\"description\": \"Wrap the response object in a function call of your choosing. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"token\": {\"description\": \"Authentication token. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"get_post_by_id\", \"description\": \"Retrieves a post by its `post_id` using the FluentMe API.\", \"parameters\": {\"post_id\": {\"description\": \"The unique identifier of the post to retrieve.\", \"type\": \"str\", \"default\": \"P36288\"}}}]",
"role": "system"
},
{
"content": "Fetch the status of movie 'mv11223' in mp4 format and the content of post 'pst09876'.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"getmoviestatus\", \"arguments\": {\"is_id\": \"mv11223\", \"format\": \"mp4\"}}, {\"name\": \"get_post_by_id\", \"arguments\": {\"post_id\": \"pst09876\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1728
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"stays_properties_detail_photos\", \"description\": \"Fetch detailed photos of a specific property from the stays/properties/detail/photos endpoint using the Booking.com RapidAPI.\", \"parameters\": {\"language_code\": {\"description\": \"The language code to use for the response. Default is 'en-us'.\", \"type\": \"str\", \"default\": \"en-us\"}, \"id_detail\": {\"description\": \"The ID of the property to fetch detail photos for. Default is 'cr/la-buena-vida-cabinas'.\", \"type\": \"str\", \"default\": \"cr/la-buena-vida-cabinas\"}}}, {\"name\": \"list_of_hotel_chains\", \"description\": \"Fetches a list of hotel chains from the Booking.com API.\", \"parameters\": {\"name\": {\"description\": \"Hotel chain name to filter results by.\", \"type\": \"str, optional\", \"default\": \"\"}, \"chain_id\": {\"description\": \"Chain ID to filter results by.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"get_stations\", \"description\": \"Retrieve the nearest electric vehicle charging stations within a specified distance.\", \"parameters\": {\"distance\": {\"description\": \"The radius in miles to search for charging stations. Defaults to '100'.\", \"type\": \"str, optional\", \"default\": \"100\"}, \"longitude\": {\"description\": \"The longitude coordinate for the search location. Defaults to '2.4379392'.\", \"type\": \"str, optional\", \"default\": \"2.4379392\"}, \"latitude\": {\"description\": \"The latitude coordinate for the search location. Defaults to '44.351488'.\", \"type\": \"str, optional\", \"default\": \"44.351488\"}}}, {\"name\": \"hotel_photos\", \"description\": \"Fetches a list of photos for given hotels based on their IDs from the RapidAPI Priceline provider.\", \"parameters\": {\"hotel_ids\": {\"description\": \"Comma-separated string of PPN hotel IDs (Semi Opaque Only).\", \"type\": \"str\", \"default\": \"700000000,700000001,700000002,700000003\"}, \"image_size\": {\"description\": \"The size of the images to be returned. Valid options are 'small' (60px), 'medium' (300 to 312px), or 'large' (500 to 800px). Defaults to 'medium'.\", \"type\": \"str, optional\", \"default\": \"medium\"}}}]",
"role": "system"
},
{
"content": "Fetch photos for hotels with IDs 12345, 67890 in large size.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"hotel_photos\", \"arguments\": {\"hotel_ids\": \"12345,67890\", \"image_size\": \"large\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1729
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"neuronal_activity_rate\", \"description\": \"Calculates the neuronal activity rate based on the synaptic input rate, synaptic weight, and decay constant.\", \"parameters\": {\"synaptic_input_rate\": {\"description\": \"The rate of synaptic inputs per second.\", \"type\": \"int\", \"default\": 1.0}, \"synaptic_weight\": {\"description\": \"The weight of the synaptic input, denoting its influence. Defaults to 1.0.\", \"type\": \"float, optional\", \"default\": 0.1}, \"decay_constant\": {\"description\": \"The rate at which the neuron's potential decays. Defaults to 0.1.\", \"type\": \"float, optional\", \"default\": 1.0}}}, {\"name\": \"find_equilibrium_index\", \"description\": \"Finds the equilibrium index of a list, where the sum of elements on the left is equal to the sum of elements on the right.\", \"parameters\": {\"arr\": {\"description\": \"The input list of integers.\", \"type\": \"List[int]\"}}}, {\"name\": \"euclidean_distance\", \"description\": \"Computes the Euclidean distance between two points in a 2D plane.\", \"parameters\": {\"point_a\": {\"description\": \"The coordinates of the first point (x, y).\", \"type\": \"Tuple[float, float]\"}, \"point_b\": {\"description\": \"The coordinates of the second point (x, y).\", \"type\": \"Tuple[float, float]\"}}}]",
"role": "system"
},
{
"content": "Is there an equilibrium index for the list [2, 4, 6, 8, 10]?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"find_equilibrium_index\", \"arguments\": {\"arr\": [2, 4, 6, 8, 10]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1730
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"trending_videos\", \"description\": \"Fetches a list of trending YouTube videos based on the given parameters.\", \"parameters\": {\"country\": {\"description\": \"The country code for which to retrieve trending videos. Defaults to 'us'.\", \"type\": \"str, optional\", \"default\": \"us\"}, \"lang\": {\"description\": \"The language code for the video titles and descriptions. Defaults to 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}, \"section\": {\"description\": \"The section of trending videos to retrieve. Possible values are \\\"Now\\\", \\\"Music\\\", \\\"Movies\\\", \\\"Gaming\\\". Defaults to 'Now'.\", \"type\": \"str, optional\", \"default\": \"Now\"}}}]",
"role": "system"
},
{
"content": "Retrieve the trending videos in the 'Movies' section for Germany in German.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"trending_videos\", \"arguments\": {\"country\": \"de\", \"lang\": \"de\", \"section\": \"Movies\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1731
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_geocoding\", \"description\": \"Fetch complete, readable place information in the preferred language based on provided latitude and longitude.\", \"parameters\": {\"version\": {\"description\": \"Version of the geocoding API to use.\", \"type\": \"str\", \"default\": \"v1\"}, \"lat\": {\"description\": \"Latitude in decimal degrees (WGS84).\", \"type\": \"int\", \"default\": \"37.422213\"}, \"lng\": {\"description\": \"Longitude in decimal degrees (WGS84).\", \"type\": \"int\", \"default\": \"-122.084058\"}, \"lang\": {\"description\": \"Preferred language of the content. Defaults to 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}}}, {\"name\": \"latest_vessel_position\", \"description\": \"Fetches the latest position of a vessel based on its MMSI using the RapidAPI service.\", \"parameters\": {\"mmsi\": {\"description\": \"The Maritime Mobile Service Identity (MMSI) of the vessel.\", \"type\": \"str\", \"default\": \"244110352\"}}}, {\"name\": \"municipio_por_c_digo_postal\", \"description\": \"Fetches the municipality corresponding to a given postal code using the provided RapidAPI key.\", \"parameters\": {\"codigo_postal\": {\"description\": \"The postal code for which the municipality is to be retrieved.\", \"type\": \"str\", \"default\": \"32500\"}}}, {\"name\": \"measure_distance\", \"description\": \"Calculates the distance between two geographic locations defined by their latitude and longitude coordinates.\", \"parameters\": {\"lon1\": {\"description\": \"Longitude of the first location.\", \"type\": \"int\", \"default\": \"36.6880794\"}, \"lon2\": {\"description\": \"Longitude of the second location.\", \"type\": \"int\", \"default\": \"39.2694784\"}, \"lat2\": {\"description\": \"Latitude of the second location.\", \"type\": \"int\", \"default\": \"-6.7785166\"}, \"lat1\": {\"description\": \"Latitude of the first location.\", \"type\": \"int\", \"default\": \"-3.3696827\"}, \"unit\": {\"description\": \"Unit of distance measurement. Valid options are 'km' (default), 'mi', 'ft', and 'yd'.\", \"type\": \"str, optional\", \"default\": \"km\"}}}, {\"name\": \"facilities_lookup\", \"description\": \"Fetches a list of facilities in Tunisia based on specified criteria such as city, province, and facility type.\", \"parameters\": {\"city\": {\"description\": \"The city where the facility is located.\", \"type\": \"str\", \"default\": \"Tunis\"}, \"province\": {\"description\": \"The region where the facility is located.\", \"type\": \"str\", \"default\": \"Manouba\"}, \"type\": {\"description\": \"The type of facility to search for.\", \"type\": \"str\", \"default\": \"hospital\"}, \"limit\": {\"description\": \"The maximum number of facilities to return. Defaults to '1'.\", \"type\": \"str, optional\", \"default\": \"1\"}}}, {\"name\": \"continents\", \"description\": \"Retrieves a list of continents from the Geography API, optionally filtered by a specified name. Pagination can be controlled using `pagesize` and `page` parameters.\", \"parameters\": {\"name\": {\"description\": \"Optional; Name of the continent to filter by. Defaults to 'North America'.\", \"type\": \"str\", \"default\": \"North America\"}, \"pagesize\": {\"description\": \"Optional; Number of results per page. Defaults to 10.\", \"type\": \"int\", \"default\": \"10\"}, \"page\": {\"description\": \"Optional; Page number to retrieve. Defaults to 1.\", \"type\": \"int\", \"default\": \"1\"}}}]",
"role": "system"
},
{
"content": "What is the distance in kilometers between two points, one at latitude 40.7128 and longitude -74.0060, and another at latitude 34.0522 and longitude -118.2437?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"measure_distance\", \"arguments\": {\"lat1\": 40.7128, \"lon1\": -74.006, \"lat2\": 34.0522, \"lon2\": -118.2437, \"unit\": \"km\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1732
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"geocodingsearch\", \"description\": \"Performs a forward geocoding search using a free-form query string and optional parameters to specify query filters and output format.\", \"parameters\": {\"q\": {\"description\": \"Free-form query string for the geocoding search.\", \"type\": \"str\", \"default\": \"New York City NY USA\"}, \"countrycodes\": {\"description\": \"Two-letter country code as defined in ISO 3166-1 alpha2 to restrict search to a specific country.\", \"type\": \"str, optional\", \"default\": \"\"}, \"json_callback\": {\"description\": \"Name of JSON callback function for JSONP calls; use this when the format is set to JSON.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_text\": {\"description\": \"Include a textual representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"namedetails\": {\"description\": \"Include detailed naming information in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"limit\": {\"description\": \"Limit the number of search results.\", \"type\": \"str, optional\", \"default\": \"\"}, \"viewbox\": {\"description\": \"Specify a bounding box for the search area in the format 'x1,y1,x2,y2', where x is longitude and y is latitude.\", \"type\": \"str, optional\", \"default\": \"\"}, \"format\": {\"description\": \"Output format of the response (e.g., JSON).\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_geojson\": {\"description\": \"Include GeoJSON representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"bounded\": {\"description\": \"Use '1' to restrict the search area to the specified viewbox.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_svg\": {\"description\": \"Include SVG representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_kml\": {\"description\": \"Include KML representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_threshold\": {\"description\": \"Simplification threshold for the polygon geometry.\", \"type\": \"int, optional\", \"default\": \"0.0\"}, \"accept_language\": {\"description\": \"Set the query and response language using two-letter language codes (e.g., 'en' or 'es') or a combination of language and region code (e.g., 'en-GB' or 'es-AR'). Default is 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}, \"addressdetails\": {\"description\": \"Include detailed address information in the output.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"geocode\", \"description\": \"Fetch geocoordinates for a given address using the TrueWay Geocoding API.\", \"parameters\": {\"address\": {\"description\": \"The address that you want to geocode.\", \"type\": \"str\", \"default\": \"505 Howard St, San Francisco\"}, \"language\": {\"description\": \"The language in which to return results. Default is 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}, \"country\": {\"description\": \"The country code to narrow the search results.\", \"type\": \"str, optional\", \"default\": \"\"}, \"bounds\": {\"description\": \"The bounding box to narrow the search results.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"v1_reversegeocoding\", \"description\": \"This function performs reverse geocoding using the API Ninjas service to obtain location information based on provided latitude and longitude coordinates.\", \"parameters\": {\"lat\": {\"description\": \"The latitude coordinate to be used for reverse geocoding.\", \"type\": \"int\", \"default\": \"47.6062\"}, \"lon\": {\"description\": \"The longitude coordinate to be used for reverse geocoding.\", \"type\": \"int\", \"default\": \"-122.3321\"}}}]",
"role": "system"
},
{
"content": "Can you provide the detailed address information for the Eiffel Tower in Paris, France, including any namedetails and polygon_text?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"geocodingsearch\", \"arguments\": {\"q\": \"Eiffel Tower, Paris, France\", \"namedetails\": \"1\", \"polygon_text\": \"1\", \"addressdetails\": \"1\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1733
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"postcodes_postcode\", \"description\": \"Fetches addresses for a given UK postcode using the RapidAPI UK Postcode API.\", \"parameters\": {\"postcode\": {\"description\": \"The UK postcode to look up addresses for.\", \"type\": \"str\", \"default\": \"PL11DN\"}}}]",
"role": "system"
},
{
"content": "I need the addresses for postcodes WC2N 5DU and SE1 9SG.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"postcodes_postcode\", \"arguments\": {\"postcode\": \"WC2N 5DU\"}}, {\"name\": \"postcodes_postcode\", \"arguments\": {\"postcode\": \"SE1 9SG\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1734
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_5_year_historical_monthly_prices\", \"description\": \"Fetch 5-year historical monthly stock prices for a given ticker symbol.\", \"parameters\": {\"ticker\": {\"description\": \"The stock ticker symbol for which historical data is to be fetched.\", \"type\": \"str\", \"default\": \"AAPL\"}}}]",
"role": "system"
},
{
"content": "Can you provide the 5-year historical monthly data for Tesla Inc. (TSLA) including Open, High, Low, and Close prices?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_5_year_historical_monthly_prices\", \"arguments\": {\"ticker\": \"TSLA\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1735
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_user_favorite_list\", \"description\": \"Retrieve the favorite video list for a TikTok user using their unique identifier.\", \"parameters\": {\"sec_uid\": {\"description\": \"The unique identifier of the TikTok user whose favorite list is to be retrieved.\", \"type\": \"str\", \"default\": \"MS4wLjABAAAAv7iSuuXDJGDvJkmH_vz1qkDZYo1apxgzaxdBSeIuPiM\"}}}]",
"role": "system"
},
{
"content": "Please provide the favorite video list for TikTok user 'user012' based on their sec_uid.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_user_favorite_list\", \"arguments\": {\"sec_uid\": \"user012\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1736
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"jokes\", \"description\": \"Fetches jokes from the Jokester API, optionally filtered by category.\", \"parameters\": {\"category\": {\"description\": \"Category to filter jokes by. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"get_cities\", \"description\": \"Fetches a list of cities based on the provided criteria using the RapidAPI service.\", \"parameters\": {\"country_id\": {\"description\": \"The ID of the country to filter cities by. Default is None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"keyword\": {\"description\": \"Keyword to filter cities, default is 'Jakarta'.\", \"type\": \"str, optional\", \"default\": \"Jakarta\"}}}, {\"name\": \"statistics\", \"description\": \"Fetch statistical data from the Immersive Roulette API.\", \"parameters\": {\"duration\": {\"description\": \"The number of hours for which to retrieve statistics. Defaults to 3 hours.\", \"type\": \"int\", \"default\": \"3\"}}}]",
"role": "system"
},
{
"content": "Retrieve a list of cities in the United States that contain the word 'New' in their name, and fetch a joke from the 'Programming' category.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_cities\", \"arguments\": {\"country_id\": 234, \"keyword\": \"New\"}}, {\"name\": \"jokes\", \"arguments\": {\"category\": \"Programming\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1737
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"cell_density\", \"description\": \"Calculates the cell density based on the optical density (OD) and dilution factor.\", \"parameters\": {\"od\": {\"description\": \"The optical density of the sample.\", \"type\": \"float\", \"default\": 1000000000.0}, \"dilution\": {\"description\": \"The dilution factor applied to the sample.\", \"type\": \"int\", \"default\": 1000000000.0}, \"factor\": {\"description\": \"The calibration factor for converting OD to cell density. Defaults to 1e9.\", \"type\": \"float, optional\"}}}, {\"name\": \"independent_samples_t_test\", \"description\": \"Conducts a two-sample independent t-test and returns the t-statistic, p-value, and conclusion.\", \"parameters\": {\"sample1\": {\"description\": \"The first sample of observations.\", \"type\": \"List[float]\", \"default\": 0.05}, \"sample2\": {\"description\": \"The second sample of observations.\", \"type\": \"List[float]\", \"default\": 0.05}, \"alpha\": {\"description\": \"The significance level of the test. Defaults to 0.05.\", \"type\": \"float, optional\"}}}, {\"name\": \"is_valid_sudoku\", \"description\": \"Checks if a 9x9 Sudoku board is valid.\", \"parameters\": {\"board\": {\"description\": \"The Sudoku board represented as a 2D list of strings.\", \"type\": \"List[List[str]]\"}}}, {\"name\": \"numerical_derivative\", \"description\": \"Estimates the derivative of a function at a given point using the central difference formula.\", \"parameters\": {\"function\": {\"description\": \"The function to calculate the derivative of.\", \"type\": \"Callable[[float], float]\"}, \"x\": {\"description\": \"The point at which to estimate the derivative.\", \"type\": \"float\"}}}, {\"name\": \"euclidean_distance\", \"description\": \"Computes the Euclidean distance between two points in a 2D plane.\", \"parameters\": {\"point_a\": {\"description\": \"The coordinates of the first point (x, y).\", \"type\": \"Tuple[float, float]\"}, \"point_b\": {\"description\": \"The coordinates of the second point (x, y).\", \"type\": \"Tuple[float, float]\"}}}, {\"name\": \"trapezoidal_integration\", \"description\": \"Calculates the definite integral of a function using the trapezoidal rule.\", \"parameters\": {\"func\": {\"description\": \"The function to integrate, expressed as a string (e.g., \\\"x**2 + 2*x\\\").\", \"type\": \"str\", \"default\": 10000}, \"a\": {\"description\": \"The lower limit of integration.\", \"type\": \"float\", \"default\": 10000}, \"b\": {\"description\": \"The upper limit of integration.\", \"type\": \"float\"}, \"n\": {\"description\": \"The number of subdivisions for the trapezoidal approximation. Defaults to 10000.\", \"type\": \"int, optional\"}}}]",
"role": "system"
},
{
"content": "Perform an independent samples t-test on two groups of test scores: [85, 90, 92, 88, 91] and [80, 82, 84, 86, 88] at a significance level of 0.01.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"independent_samples_t_test\", \"arguments\": {\"sample1\": [85, 90, 92, 88, 91], \"sample2\": [80, 82, 84, 86, 88], \"alpha\": 0.01}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1738
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"skill_rating_mw_2_ranked\", \"description\": \"Fetches the Skill Ratings of the top players ranked in Modern Warfare 2 (MW 2) leaderboard.\", \"parameters\": {\"limit\": {\"description\": \"Maximum number of top-ranked players to retrieve, defaults to '250'. Must be a number between 1 and 250.\", \"type\": \"str\", \"default\": \"250\"}}}, {\"name\": \"playerdetails\", \"description\": \"Fetches the details of a specific E-Sports player by their player ID using the provided API key.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the player for which to retrieve the details.\", \"type\": \"int\", \"default\": 1078255}}}, {\"name\": \"players_185_225_233_110_30015\", \"description\": \"Retrieves the list of players currently online from the specified V Rising game server.\", \"parameters\": {\"ip\": {\"description\": \"The IP address of the game server.\", \"type\": \"str\", \"default\": \"185.225.233.110\"}, \"port\": {\"description\": \"The port number of the game server.\", \"type\": \"str\", \"default\": \"30015\"}}}, {\"name\": \"get_item_by_id\", \"description\": \"Fetches an RPG item by its ID using the Toolbench RapidAPI service.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the RPG item to retrieve.\", \"type\": \"str\", \"default\": \"6383989636a233ea35d1e566\"}}}]",
"role": "system"
},
{
"content": "I need the details of an E-Sports player with ID 45678 and the skill ratings for the top 125 players in Modern Warfare 2.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"playerdetails\", \"arguments\": {\"is_id\": 45678}}, {\"name\": \"skill_rating_mw_2_ranked\", \"arguments\": {\"limit\": \"125\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1739
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"neuronal_activity_rate\", \"description\": \"Calculates the neuronal activity rate based on the synaptic input rate, synaptic weight, and decay constant.\", \"parameters\": {\"synaptic_input_rate\": {\"description\": \"The rate of synaptic inputs per second.\", \"type\": \"int\", \"default\": 1.0}, \"synaptic_weight\": {\"description\": \"The weight of the synaptic input, denoting its influence. Defaults to 1.0.\", \"type\": \"float, optional\", \"default\": 0.1}, \"decay_constant\": {\"description\": \"The rate at which the neuron's potential decays. Defaults to 0.1.\", \"type\": \"float, optional\", \"default\": 1.0}}}, {\"name\": \"find_equilibrium_index\", \"description\": \"Finds the equilibrium index of a list, where the sum of elements on the left is equal to the sum of elements on the right.\", \"parameters\": {\"arr\": {\"description\": \"The input list of integers.\", \"type\": \"List[int]\"}}}, {\"name\": \"euclidean_distance\", \"description\": \"Computes the Euclidean distance between two points in a 2D plane.\", \"parameters\": {\"point_a\": {\"description\": \"The coordinates of the first point (x, y).\", \"type\": \"Tuple[float, float]\"}, \"point_b\": {\"description\": \"The coordinates of the second point (x, y).\", \"type\": \"Tuple[float, float]\"}}}]",
"role": "system"
},
{
"content": "Calculate the neuronal activity rate with a synaptic input rate of 100 inputs per second, a synaptic weight of 0.5, and a decay constant of 0.05. Also, find the equilibrium index of the list [1, 3, 5, 7, 9].",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"neuronal_activity_rate\", \"arguments\": {\"synaptic_input_rate\": 100, \"synaptic_weight\": 0.5, \"decay_constant\": 0.05}}, {\"name\": \"find_equilibrium_index\", \"arguments\": {\"arr\": [1, 3, 5, 7, 9]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1740
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"find_first_non_repeating_char\", \"description\": \"Finds the first non-repeating character in a string.\", \"parameters\": {\"s\": {\"description\": \"The input string.\", \"type\": \"str\"}}}, {\"name\": \"is_armstrong_number\", \"description\": \"Checks if a number is an Armstrong number.\", \"parameters\": {\"num\": {\"description\": \"The number to check.\", \"type\": \"int\"}}}, {\"name\": \"is_rotation\", \"description\": \"Checks if one string is a rotation of another string.\", \"parameters\": {\"str1\": {\"description\": \"The first string.\", \"type\": \"str\"}, \"str2\": {\"description\": \"The second string.\", \"type\": \"str\"}}}, {\"name\": \"is_subset\", \"description\": \"Checks if one set is a subset of another set.\", \"parameters\": {\"set1\": {\"description\": \"The first set.\", \"type\": \"set\"}, \"set2\": {\"description\": \"The second set.\", \"type\": \"set\"}}}]",
"role": "system"
},
{
"content": "Check if the number 371 is an Armstrong number.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"is_armstrong_number\", \"arguments\": {\"num\": 371}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1741
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"is_leap_year\", \"description\": \"Checks if a year is a leap year.\", \"parameters\": {\"year\": {\"description\": \"The year to check.\", \"type\": \"int\"}}}, {\"name\": \"is_hotel_available\", \"description\": \"Checks the availability of a hotel for a given date range.\", \"parameters\": {\"hotel\": {\"description\": \"The name of the hotel.\", \"type\": \"str\"}, \"city\": {\"description\": \"The city where the hotel is located.\", \"type\": \"str\"}, \"checkin\": {\"description\": \"The check-in date in the format \\\"YYYY-MM-DD\\\".\", \"type\": \"str\"}, \"checkout\": {\"description\": \"The check-out date in the format \\\"YYYY-MM-DD\\\".\", \"type\": \"str\"}}}, {\"name\": \"simulate_query_database\", \"description\": \"Simulates querying a database based on certain conditions.\", \"parameters\": {\"table\": {\"description\": \"Name of the table to query.\", \"type\": \"str\"}, \"conditions\": {\"description\": \"Conditions for the query, each condition is a dictionary.\", \"type\": \"list\"}}}]",
"role": "system"
},
{
"content": "Is the year 2000 a leap year?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"is_leap_year\", \"arguments\": {\"year\": 2000}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1742
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"v1_whois\", \"description\": \"Fetches the WHOIS information for a given domain using the API Ninjas Whois API.\", \"parameters\": {\"domain\": {\"description\": \"The domain to retrieve WHOIS information for.\", \"type\": \"str\", \"default\": \"example.com\"}}}, {\"name\": \"getpagespeed\", \"description\": \"Fetch the page or website loading speed for a given URL using the RapidAPI service.\", \"parameters\": {\"url\": {\"description\": \"The URL of the page or website to check the loading speed.\", \"type\": \"str\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Could you fetch the WHOIS details for amazon.com and the loading speed of apple.com?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"v1_whois\", \"arguments\": {\"domain\": \"amazon.com\"}}, {\"name\": \"getpagespeed\", \"arguments\": {\"url\": \"apple.com\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1744
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"multiple_guids\", \"description\": \"Generate multiple GUIDs by querying an external API.\", \"parameters\": {\"number\": {\"description\": \"The number of GUIDs to generate (must be between 0 and 1000).\", \"type\": \"str\", \"default\": \"10\"}}}]",
"role": "system"
},
{
"content": "Generate 15 GUIDs for the user IDs and 25 for the session tokens.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"multiple_guids\", \"arguments\": {\"number\": \"15\"}}, {\"name\": \"multiple_guids\", \"arguments\": {\"number\": \"25\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1745
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_regions\", \"description\": \"Fetches the regions of a specified country using the provided API key.\", \"parameters\": {\"country_code\": {\"description\": \"The ISO code of the country for which regions are to be fetched. The country code can be obtained from the \\\"Get Countries\\\" endpoint.\", \"type\": \"str\", \"default\": \"ph\"}}}, {\"name\": \"search_by_coordinates_point\", \"description\": \"Search for EV charging stations near specific geographic coordinates.\", \"parameters\": {\"lng\": {\"description\": \"Longitude of the geographic coordinates point to search nearby.\", \"type\": \"str\", \"default\": \"-121.925337\"}, \"lat\": {\"description\": \"Latitude of the geographic coordinates point to search nearby.\", \"type\": \"str\", \"default\": \"37.359428\"}, \"query\": {\"description\": \"Keyword to filter the search results by a specific query, such as 'evgo', 'tesla', or 'chargepoint'.\", \"type\": \"str, optional\", \"default\": \"\"}, \"min_kw\": {\"description\": \"Minimum power in kilowatts to filter the availability of connectors.\", \"type\": \"str, optional\", \"default\": \"\"}, \"max_kw\": {\"description\": \"Maximum power in kilowatts to filter the availability of connectors.\", \"type\": \"str, optional\", \"default\": \"\"}, \"limit\": {\"description\": \"Maximum number of results to return. Allowed values range from 1 to 500.\", \"type\": \"str, optional, default='20'\", \"default\": \"20\"}, \"available\": {\"description\": \"Filter to find EV charging stations with an available connector.\", \"type\": \"str, optional\", \"default\": \"\"}, \"type\": {\"description\": \"Filter to return EV charging stations with connectors of specified types, provided as a comma-delimited list, e.g., 'CHAdeMO', 'J1772,CCS'.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "What are the regions in Brazil and are there any available charging stations near Copacabana Beach?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_regions\", \"arguments\": {\"country_code\": \"BR\"}}, {\"name\": \"search_by_coordinates_point\", \"arguments\": {\"lng\": \"-43.1882714\", \"lat\": \"-22.986539\", \"available\": \"true\", \"query\": \"Copacabana Beach\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1746
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"chat\", \"description\": \"Communicates with the AI chatbot via RapidAPI and returns the chatbot's response.\", \"parameters\": {\"uid\": {\"description\": \"User Identification for personalized response and response continuity.\", \"type\": \"str\", \"default\": \"user1\"}, \"message\": {\"description\": \"Message that the chatbot has to respond to.\", \"type\": \"str\", \"default\": \"What's your name?\"}}}, {\"name\": \"get\", \"description\": \"Retrieves the synonyms of a given word in a specified language using the RapidAPI Synonyms Words service.\", \"parameters\": {\"language\": {\"description\": \"The language code for the word. Supported codes are 'EN' (English), 'ES' (Spanish), 'FR' (French), and 'PT' (Portuguese).\", \"type\": \"str\", \"default\": \"EN\"}, \"word\": {\"description\": \"The word for which to find synonyms.\", \"type\": \"str\", \"default\": \"car\"}}}, {\"name\": \"translate\", \"description\": \"Translates the given text to a specified target language using the Google Translate API and RapidAPI.\", \"parameters\": {\"text\": {\"description\": \"The text to be translated.\", \"type\": \"str\", \"default\": \"How are You\"}, \"target_lang\": {\"description\": \"The language code of the target language.\", \"type\": \"str\", \"default\": \"es\"}}}, {\"name\": \"display_entities\", \"description\": \"Displays the extracted named entities from the given text using a specified model and RapidAPI service.\", \"parameters\": {\"text\": {\"description\": \"The text to extract entities from.\", \"type\": \"str\", \"default\": \"An October post from Dylan that may be saving you a Google search.\"}, \"model\": {\"description\": \"The name of the model to use for entity extraction. If None, the default model will be used.\", \"type\": \"str, optional\", \"default\": \"\"}, \"spans\": {\"description\": \"Specific spans to use for entity extraction. If None, entity extraction will be performed on the entire text.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Translate 'The quick brown fox jumps over the lazy dog' to Italian and 'La volpe marrone veloce salta sopra il cane pigro' to English.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"translate\", \"arguments\": {\"text\": \"The quick brown fox jumps over the lazy dog\", \"target_lang\": \"IT\"}}, {\"name\": \"translate\", \"arguments\": {\"text\": \"La volpe marrone veloce salta sopra il cane pigro\", \"target_lang\": \"EN\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1747
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"is_a_coordinate_water\", \"description\": \"Determines if a given coordinate on Earth is water based on the provided longitude and latitude.\", \"parameters\": {\"longitude\": {\"description\": \"The longitude of the coordinate to check.\", \"type\": \"int\", \"default\": \"-70.2652276\"}, \"latitude\": {\"description\": \"The latitude of the coordinate to check.\", \"type\": \"int\", \"default\": \"41.9029192\"}}}, {\"name\": \"zipcode_by_city\", \"description\": \"Retrieves the zip code(s) of a given city using the GeoSource API.\", \"parameters\": {\"city\": {\"description\": \"The name of the city for which to retrieve zip code(s). The city must be in the supported countries list (44 countries).\", \"type\": \"str\", \"default\": \"Brussels\"}}}, {\"name\": \"ip_locator\", \"description\": \"Fetches geolocation information for a given IP address using RapidAPI.\", \"parameters\": {\"ip_address\": {\"description\": \"The IP address for which geolocation information is to be retrieved.\", \"type\": \"str\", \"default\": \"92.223.89.73\"}, \"format\": {\"description\": \"The desired output format of the response. Supported formats are .csv, .xml, and .json.\", \"type\": \"str\", \"default\": \"json\"}}}, {\"name\": \"language_by_id\", \"description\": \"Fetches language information from the API based on the provided language identifier and optional filters.\", \"parameters\": {\"lang\": {\"description\": \"A 2-letter ISO language code used to fetch the language data.\", \"type\": \"str\", \"default\": \"sv\"}, \"lang_3\": {\"description\": \"An optional 3-letter ISO language code filter.\", \"type\": \"str, optional\", \"default\": \"\"}, \"iso_a2\": {\"description\": \"An optional 2-letter country code filter.\", \"type\": \"str, optional\", \"default\": \"\"}, \"fields\": {\"description\": \"A comma-separated string specifying the fields to be included in the response. Default is 'iso_a2,lang_3,flag'.\", \"type\": \"str, optional\", \"default\": \"iso_a2,lang_3,flag\"}}}, {\"name\": \"district_detail_and_coordinates_of_specific_division\", \"description\": \"Fetches detailed information about the districts, coordinates, and upazilas of a specific division from the BDAPI.\", \"parameters\": {\"division_name\": {\"description\": \"The name of the division for which to fetch details.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"findbypincode\", \"description\": \"Fetches information for a given Indian pincode using the Toolbench RapidAPI.\", \"parameters\": {\"pincode\": {\"description\": \"The pincode for which information needs to be fetched.\", \"type\": \"int\", \"default\": 518345}}}, {\"name\": \"get_states\", \"description\": \"Fetches a list of states based on various search parameters.\", \"parameters\": {\"keyword\": {\"description\": \"A keyword to search for states. Defaults to 'asia'.\", \"type\": \"str, optional\", \"default\": \"asia\"}, \"perpage\": {\"description\": \"The number of results to return per page. Defaults to 50.\", \"type\": \"int, optional\", \"default\": \"50\"}, \"city_id\": {\"description\": \"A city ID to find associated states. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"is_id\": {\"description\": \"A specific state ID to search for. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"page\": {\"description\": \"The number of results to return per page. Defaults to 50.\", \"type\": \"int, optional\", \"default\": \"1\"}}}, {\"name\": \"ip_geolocation\", \"description\": \"This function retrieves geolocation information for a given IP address using the Toolbench API.\", \"parameters\": {\"ip_address\": {\"description\": \"The IP address for which to retrieve geolocation data.\", \"type\": \"str\", \"default\": \"187.66.247.186\"}}}]",
"role": "system"
},
{
"content": "Retrieve geolocation data for IP address 192.168.1.1.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"ip_geolocation\", \"arguments\": {\"ip_address\": \"192.168.1.1\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1748
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"mama\", \"description\": \"Fetches the MESA Adaptive Moving Average (MAMA) for a given instrument symbol and time interval from the Twelve Data API.\", \"parameters\": {\"interval\": {\"description\": \"Interval between two consecutive points in the time series. Supports: `1min`, `5min`, `15min`, `30min`, `45min`, `1h`, `2h`, `4h`, `1day`, `1week`, `1month`.\", \"type\": \"str\", \"default\": \"1min\"}, \"symbol\": {\"description\": \"Instrument symbol, can be any equity, index, ETF, forex, or cryptocurrency (e.g., `AAPL`, `EUR/USD`, `ETH/BTC`).\", \"type\": \"str\", \"default\": \"AAPL\"}, \"format\": {\"description\": \"Response format. Supports `csv` or `json`. Default is `json`.\", \"type\": \"str, optional\", \"default\": \"json\"}, \"slow_limit\": {\"description\": \"Slow limit parameter for MAMA calculation.\", \"type\": \"int, optional\", \"default\": 0.05}, \"series_type\": {\"description\": \"Type of series data. Supports: `open`, `high`, `low`, `close`. Default is `close`.\", \"type\": \"str, optional\", \"default\": \"close\"}, \"fast_limit\": {\"description\": \"Fast limit parameter for MAMA calculation.\", \"type\": \"int, optional\", \"default\": 0.5}, \"outputsize\": {\"description\": \"Number of data points to return. Default is `30` if no date parameters are set, otherwise set to maximum.\", \"type\": \"int, optional\", \"default\": 30}}}]",
"role": "system"
},
{
"content": "Can you provide the MAMA data for the S&P 500 index (SPX) for the last 6 months with a 1-day interval?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"mama\", \"arguments\": {\"interval\": \"1day\", \"symbol\": \"SPX\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1749
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"fetch_by_type_and_region\", \"description\": \"Fetch records from the API based on the given type, limit, and region.\", \"parameters\": {\"type\": {\"description\": \"The type of records to fetch. Refer to the README for accepted types.\", \"type\": \"str\", \"default\": \"Hill\"}, \"limit\": {\"description\": \"The maximum number of records to fetch.\", \"type\": \"int\", \"default\": \"5\"}, \"region\": {\"description\": \"The region from which to fetch records.\", \"type\": \"str\", \"default\": \"Eastern\"}}}, {\"name\": \"geocodingsearch\", \"description\": \"Performs a forward geocoding search using a free-form query string and optional parameters to specify query filters and output format.\", \"parameters\": {\"q\": {\"description\": \"Free-form query string for the geocoding search.\", \"type\": \"str\", \"default\": \"New York City NY USA\"}, \"countrycodes\": {\"description\": \"Two-letter country code as defined in ISO 3166-1 alpha2 to restrict search to a specific country.\", \"type\": \"str, optional\", \"default\": \"\"}, \"json_callback\": {\"description\": \"Name of JSON callback function for JSONP calls; use this when the format is set to JSON.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_text\": {\"description\": \"Include a textual representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"namedetails\": {\"description\": \"Include detailed naming information in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"limit\": {\"description\": \"Limit the number of search results.\", \"type\": \"str, optional\", \"default\": \"\"}, \"viewbox\": {\"description\": \"Specify a bounding box for the search area in the format 'x1,y1,x2,y2', where x is longitude and y is latitude.\", \"type\": \"str, optional\", \"default\": \"\"}, \"format\": {\"description\": \"Output format of the response (e.g., JSON).\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_geojson\": {\"description\": \"Include GeoJSON representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"bounded\": {\"description\": \"Use '1' to restrict the search area to the specified viewbox.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_svg\": {\"description\": \"Include SVG representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_kml\": {\"description\": \"Include KML representation of the polygon geometry in the output.\", \"type\": \"str, optional\", \"default\": \"\"}, \"polygon_threshold\": {\"description\": \"Simplification threshold for the polygon geometry.\", \"type\": \"int, optional\", \"default\": \"0.0\"}, \"accept_language\": {\"description\": \"Set the query and response language using two-letter language codes (e.g., 'en' or 'es') or a combination of language and region code (e.g., 'en-GB' or 'es-AR'). Default is 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}, \"addressdetails\": {\"description\": \"Include detailed address information in the output.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Retrieve the top 10 restaurants in Paris.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"fetch_by_type_and_region\", \"arguments\": {\"type\": \"restaurants\", \"limit\": 10, \"region\": \"Paris\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1751
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"t2g_kurs_check\", \"description\": \"Checks the exchange rate of IDR to another currency on a given date.\", \"parameters\": {\"date\": {\"description\": \"The date for which to check the exchange rate, in the format 'YYYY-MM-DD'.\", \"type\": \"str\", \"default\": \"\"}, \"valuta\": {\"description\": \"The currency to which IDR exchange rate is checked.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"get_products_in_category\", \"description\": \"Fetches products in a specified category from a remote catalog using the RapidAPI service.\", \"parameters\": {\"category\": {\"description\": \"The category from which to fetch products.\", \"type\": \"str\", \"default\": \"\"}, \"limit\": {\"description\": \"The number of products to retrieve.\", \"type\": \"int\", \"default\": \"\"}, \"skip\": {\"description\": \"The number of products to skip before starting to retrieve.\", \"type\": \"int\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "I need to know the rate of IDR to EUR on March 1st, 2023, and also, could you get me details of 10 fashion products skipping the first 20?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"t2g_kurs_check\", \"arguments\": {\"date\": \"2023-03-01\", \"valuta\": \"EUR\"}}, {\"name\": \"get_products_in_category\", \"arguments\": {\"category\": \"Fashion\", \"limit\": 10, \"skip\": 20}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1752
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"getpetbyid\", \"description\": \"Fetches the details of a pet by its ID from the Team Petstore API.\", \"parameters\": {\"petid\": {\"description\": \"The ID of the pet to retrieve.\", \"type\": \"int\", \"default\": 0}}}]",
"role": "system"
},
{
"content": "Could you find out more about the pet with ID 98765?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"getpetbyid\", \"arguments\": {\"petid\": 98765}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1753
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_random_joke_by_category\", \"description\": \"Fetches a random joke from a specified category using the World of Jokes API.\", \"parameters\": {\"category\": {\"description\": \"The category of joke to fetch, based on the categories available in the jokes API.\", \"type\": \"str\", \"default\": \"Political\"}}}]",
"role": "system"
},
{
"content": "Fetch a joke from the 'Math' category and another from the 'Travel' category.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_random_joke_by_category\", \"arguments\": {\"category\": \"Math\"}}, {\"name\": \"get_random_joke_by_category\", \"arguments\": {\"category\": \"Travel\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1754
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_pokemon_move_info\", \"description\": \"Retrieves information about a Pok\\u00e9mon's move using the Pok\\u00e9API.\", \"parameters\": {\"pokemon_name\": {\"description\": \"The name of the Pok\\u00e9mon.\", \"type\": \"str\", \"default\": \"run\"}, \"move_name\": {\"description\": \"The name of the move to check. Defaults to \\\"run\\\".\", \"type\": \"str, optional\", \"default\": \"run\"}}}, {\"name\": \"calculate_calorie_intake\", \"description\": \"Calculates the recommended daily calorie intake and macronutrient distribution based on personal characteristics and goals.\", \"parameters\": {\"weight_kg\": {\"description\": \"Body weight in kilograms.\", \"type\": \"float\"}, \"height_cm\": {\"description\": \"Height in centimeters.\", \"type\": \"float\"}, \"age\": {\"description\": \"Age in years.\", \"type\": \"int\"}, \"sex\": {\"description\": \"Biological sex, either 'male' or 'female'.\", \"type\": \"str\"}, \"activity_level\": {\"description\": \"Activity level on a scale of 1 to 5 (1 = sedentary, 5 = extremely active).\", \"type\": \"int\"}, \"goal\": {\"description\": \"Fitness goal, either 'lose', 'maintain', or 'gain'.\", \"type\": \"str\"}}}, {\"name\": \"project_population\", \"description\": \"Projects the population size after a specified number of years.\", \"parameters\": {\"current_pop\": {\"description\": \"The current population size.\", \"type\": \"int\", \"default\": 1.2}, \"num_years\": {\"description\": \"The number of years into the future to make the projection.\", \"type\": \"int\", \"default\": 1.2}, \"annual_growth\": {\"description\": \"The annual population growth rate as a percentage. Defaults to 1.2.\", \"type\": \"float, optional\"}}}, {\"name\": \"analyze_social_group_dynamics\", \"description\": \"Analyzes the social dynamics within a group based on the personality traits and group size.\", \"parameters\": {\"total\": {\"description\": \"The total group size.\", \"type\": \"int\"}, \"extroverts\": {\"description\": \"The number of extroverted members in the group.\", \"type\": \"int\"}, \"introverts\": {\"description\": \"The number of introverted members in the group.\", \"type\": \"int\"}}}, {\"name\": \"geocode_city\", \"description\": \"Retrieves the latitude and longitude coordinates of a given city using the Maps.co Geocoding API.\", \"parameters\": {\"city\": {\"description\": \"The name of the city.\", \"type\": \"str\"}}}, {\"name\": \"structural_analysis\", \"description\": \"Performs structural analysis on a building based on its ID, floor numbers, and analysis mode.\", \"parameters\": {\"building_id\": {\"description\": \"The unique identifier of the building.\", \"type\": \"str\", \"default\": \"static\"}, \"floor_numbers\": {\"description\": \"The list of floor numbers to be analyzed.\", \"type\": \"List[int]\", \"default\": \"static\"}, \"analysis_mode\": {\"description\": \"The mode of analysis, either \\\"static\\\" or \\\"dynamic\\\". Defaults to \\\"static\\\".\", \"type\": \"str, optional\"}}}, {\"name\": \"get_ip_location\", \"description\": \"Retrieves the latitude and longitude coordinates of a given IP address using the ip-api.com API.\", \"parameters\": {\"ip\": {\"description\": \"The IP address to locate.\", \"type\": \"str\"}}}, {\"name\": \"simulate_query_database\", \"description\": \"Simulates querying a database based on certain conditions.\", \"parameters\": {\"table\": {\"description\": \"Name of the table to query.\", \"type\": \"str\"}, \"conditions\": {\"description\": \"Conditions for the query, each condition is a dictionary.\", \"type\": \"list\"}}}]",
"role": "system"
},
{
"content": "Perform a dynamic structural analysis on a building with ID 'B12345' for floors 5, 10, and 15.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"structural_analysis\", \"arguments\": {\"building_id\": \"B12345\", \"floor_numbers\": [5, 10, 15], \"analysis_mode\": \"dynamic\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1755
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"playerdetails\", \"description\": \"Fetches the details of a specific E-Sports player by their player ID using the provided API key.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the player for which to retrieve the details.\", \"type\": \"int\", \"default\": 1078255}}}, {\"name\": \"get_username_point_blank\", \"description\": \"Fetch the username associated with a given Point Blank ID using the RapidAPI service.\", \"parameters\": {\"is_id\": {\"description\": \"The Point Blank ID to look up.\", \"type\": \"str\", \"default\": \"blackforster\"}}}, {\"name\": \"season_wins_leaderboard_mw_2\", \"description\": \"Fetches season wins information for a specified number of players on the MW 2 leaderboard.\", \"parameters\": {\"limit\": {\"description\": \"Number of players to fetch the leaderboard information for, ranging from 1 to 2000.\", \"type\": \"int\", \"default\": \"2000\"}, \"season\": {\"description\": \"The season for which to fetch the wins information. Defaults to 's1'.\", \"type\": \"str, optional\", \"default\": \"s1\"}}}]",
"role": "system"
},
{
"content": "Can you provide the details of e-sports players with IDs 12345 and 67890?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"playerdetails\", \"arguments\": {\"is_id\": 12345}}, {\"name\": \"playerdetails\", \"arguments\": {\"is_id\": 67890}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1756
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"domain_seo_analysis\", \"description\": \"Fetch popular SEO metrics for a specified domain name, optionally considering the search from a specific country's perspective.\", \"parameters\": {\"domain\": {\"description\": \"The domain name to analyze for SEO metrics.\", \"type\": \"str\", \"default\": \"apify.com\"}, \"country\": {\"description\": \"Specify the proxy location for the search. Supported countries include 'US', 'CA', 'IE', 'GB', 'FR', 'DE', 'SE', 'IN', 'JP', 'KR', 'SG', 'AU', 'BR'. Defaults to 'us'.\", \"type\": \"str, optional\", \"default\": \"us\"}}}]",
"role": "system"
},
{
"content": "Could you provide the SEO metrics for the following domains: 'netflix.com' from Australia, 'airbnb.com' from Brazil, and 'spotify.com' from Sweden?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"domain_seo_analysis\", \"arguments\": {\"domain\": \"netflix.com\", \"country\": \"au\"}}, {\"name\": \"domain_seo_analysis\", \"arguments\": {\"domain\": \"airbnb.com\", \"country\": \"br\"}}, {\"name\": \"domain_seo_analysis\", \"arguments\": {\"domain\": \"spotify.com\", \"country\": \"se\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1757
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"expand_around_center\", \"description\": \"Helper function to expand around a center for finding palindromic substrings.\", \"parameters\": {\"s\": {\"description\": \"The input string.\", \"type\": \"str\"}, \"left\": {\"description\": \"The left index of the center.\", \"type\": \"int\"}, \"right\": {\"description\": \"The right index of the center.\", \"type\": \"int\"}}}, {\"name\": \"merge_sorted_lists\", \"description\": \"Merges two sorted lists into a single sorted list.\", \"parameters\": {\"list1\": {\"description\": \"The first sorted list.\", \"type\": \"List[int]\"}, \"list2\": {\"description\": \"The second sorted list.\", \"type\": \"List[int]\"}}}]",
"role": "system"
},
{
"content": "What is the palindromic substring in 'madam' starting from index 2 and merge sorted lists [10, 20, 30] and [15, 25, 35]?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"expand_around_center\", \"arguments\": {\"s\": \"madam\", \"left\": 2, \"right\": 2}}, {\"name\": \"merge_sorted_lists\", \"arguments\": {\"list1\": [10, 20, 30], \"list2\": [15, 25, 35]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1758
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"google_maps_reviews\", \"description\": \"Fetches and returns JSON data of Google Maps reviews based on the specified parameters.\", \"parameters\": {\"data_id\": {\"description\": \"Unique identifier representing the location or place on Google Maps for which reviews are fetched.\", \"type\": \"str\", \"default\": \"0x89c25090129c363d:0x40c6a5770d25022b\"}, \"next_page_token\": {\"description\": \"Token to fetch the next page of results, if applicable. Default is None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"sort_by\": {\"description\": \"Criteria to sort the reviews by. Could be relevance, newest, etc. Default is None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"topic_id\": {\"description\": \"Identifier for a specific topic to filter reviews by. Default is None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"hl\": {\"description\": \"Language code to return the reviews in, formatted as language_country (e.g., 'en_us'). Default is 'en_us'.\", \"type\": \"str, optional\", \"default\": \"en_us\"}}}, {\"name\": \"whois\", \"description\": \"Queries a WhoIS lookup service to retrieve data about a specified domain.\", \"parameters\": {\"domain\": {\"description\": \"The domain name for the WhoIS lookup.\", \"type\": \"str\", \"default\": \"peekdomain.com\"}}}, {\"name\": \"suggest_region\", \"description\": \"Fetches suggested regions based on a given location using the Airdna API.\", \"parameters\": {\"location\": {\"description\": \"The location keyword to search for suggested regions.\", \"type\": \"str\", \"default\": \"santa monica\"}}}]",
"role": "system"
},
{
"content": "Retrieve WhoIS information for the domain 'example.com'.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"whois\", \"arguments\": {\"domain\": \"example.com\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1759
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"aliexpress_item_description\", \"description\": \"Fetches the detailed description of an AliExpress item using its item ID.\", \"parameters\": {\"itemid\": {\"description\": \"The ID of the AliExpress item.\", \"type\": \"int\", \"default\": \"3256804591426248\"}, \"locale\": {\"description\": \"The locale for displaying titles and content in the selected language. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"products_search_by_barcode\", \"description\": \"Search for a product in the Kohl's database using its UPC barcode.\", \"parameters\": {\"upc\": {\"description\": \"The Universal Product Code of the product to be searched.\", \"type\": \"str\", \"default\": \"194574942221\"}}}]",
"role": "system"
},
{
"content": "Can you find the product details for a UPC code 9876543210987 in the Kohl's database?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"products_search_by_barcode\", \"arguments\": {\"upc\": \"9876543210987\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1760
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"nearest_airport_from_postal_code\", \"description\": \"Retrieves the nearest airport to a given postal code within a specified country.\", \"parameters\": {\"postal_code\": {\"description\": \"The postal code for which to find the nearest airport.\", \"type\": \"str\", \"default\": \"\"}, \"country_code\": {\"description\": \"The two-digit country code corresponding to the postal code.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"get_all_bodies_positions\", \"description\": \"Fetches the positions of celestial bodies for a given location and date range using the Astronomy API.\", \"parameters\": {\"latitude\": {\"description\": \"The latitude of the location for which to get the positions.\", \"type\": \"int\", \"default\": \"33.775867\"}, \"longitude\": {\"description\": \"The longitude of the location for which to get the positions.\", \"type\": \"int\", \"default\": \"-84.39733\"}, \"from_date\": {\"description\": \"The start date for the observation period in the format 'YYYY-MM-DD'.\", \"type\": \"str\", \"default\": \"2017-12-20\"}, \"to_date\": {\"description\": \"The end date for the observation period in the format 'YYYY-MM-DD'.\", \"type\": \"str\", \"default\": \"2017-12-21\"}, \"elevation\": {\"description\": \"The elevation of the location in meters. Defaults to 166.\", \"type\": \"int, optional\", \"default\": \"166\"}, \"time\": {\"description\": \"The specific time of day for the observation in the format 'HH:MM:SS'. Defaults to '12:00:00'.\", \"type\": \"str, optional\", \"default\": \"12:00:00\"}}}, {\"name\": \"get_by_id\", \"description\": \"Fetches a specific joke by its ID from the Manatee Jokes API.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the joke to retrieve.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"dna2mrna\", \"description\": \"Converts a DNA sequence into an mRNA sequence using the specified API.\", \"parameters\": {\"dna\": {\"description\": \"The DNA sequence to be transformed into an mRNA sequence.\", \"type\": \"str\", \"default\": \"TACAAAGGCTAACGTCCTAGAGCTATT\"}}}]",
"role": "system"
},
{
"content": "What is the nearest airport to a postal code 90210 in the USA?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"nearest_airport_from_postal_code\", \"arguments\": {\"postal_code\": \"90210\", \"country_code\": \"US\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1761
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"mlem_id\", \"description\": \"Fetches a mlem image by its ID in JSON format using the Mlem API.\", \"parameters\": {\"mlemid\": {\"description\": \"The ID of the mlem image to fetch.\", \"type\": \"int\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Provide details for mlem IDs 13579 and 24680.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"mlem_id\", \"arguments\": {\"mlemid\": 13579}}, {\"name\": \"mlem_id\", \"arguments\": {\"mlemid\": 24680}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1762
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_game_statistics\", \"description\": \"Fetches statistics for a given game using the ViperScore RapidAPI.\", \"parameters\": {\"gameid\": {\"description\": \"The unique identifier of the game for which the statistics are to be fetched.\", \"type\": \"str\", \"default\": \"9576185\"}}}, {\"name\": \"matchh2hduel\", \"description\": \"Retrieves head-to-head duel information for a specific basketball match.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the basketball match for which to retrieve head-to-head duel information.\", \"type\": \"int\", \"default\": 10066290}}}, {\"name\": \"session\", \"description\": \"Fetches the session details for a given `session_id` from the Races endpoint on the F1 Live Motorsport Data API. This includes information such as drivers' times, session weather, speed traps, and session status and is updated throughout each session.\", \"parameters\": {\"session_id\": {\"description\": \"The ID of the session for which details are being retrieved.\", \"type\": \"int\", \"default\": \"2757\"}}}, {\"name\": \"ufc_287_pereira_vs_adesanya_2_april_08_2023\", \"description\": \"Fetches the details of UFC 287: Pereira vs. Adesanya 2 held on April 08, 2023, including a range of information about each fighter.\", \"parameters\": {\"limit\": {\"description\": \"The number of results to retrieve. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}, \"offset\": {\"description\": \"The number of results to skip. Defaults to None.\", \"type\": \"int, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Can you provide the head-to-head duel stats for the basketball match with ID 12345?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"matchh2hduel\", \"arguments\": {\"is_id\": 12345}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1763
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"is_valid_sudoku\", \"description\": \"Checks if a 9x9 Sudoku board is valid.\", \"parameters\": {\"board\": {\"description\": \"The Sudoku board represented as a 2D list of strings.\", \"type\": \"List[List[str]]\"}}}, {\"name\": \"polygon_area_shoelace\", \"description\": \"Calculates the area of a polygon using the shoelace formula.\", \"parameters\": {\"vertices\": {\"description\": \"A list of polygon vertices represented as tuples (x, y).\", \"type\": \"List[Tuple[float, float]]\"}}}]",
"role": "system"
},
{
"content": "What is the area of a quadrilateral with vertices at (2, 2), (5, 3), (6, 6), and (3, 5)?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"polygon_area_shoelace\", \"arguments\": {\"vertices\": [[2, 2], [5, 3], [6, 6], [3, 5]]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1764
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"daily_match_list_live\", \"description\": \"Fetches the list of daily live matches for a specific date within a \\u00b17 days period.\", \"parameters\": {\"date\": {\"description\": \"The date for which to retrieve the match list. Format should be {dd/MM/yyyy}.\", \"type\": \"str\", \"default\": \"28/01/2021\"}}}, {\"name\": \"list\", \"description\": \"Fetches all available Surebets from the specified API, optionally filtering by bookmakers.\", \"parameters\": {\"bookmakers\": {\"description\": \"A comma-separated list of bookmaker slugs to filter the results. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"daily_predictions\", \"description\": \"Fetches daily football predictions using various filters and pagination support.\", \"parameters\": {\"league\": {\"description\": \"The league identifier for filtering predictions. Example: '1'.\", \"type\": \"str, optional\", \"default\": \"\"}, \"page\": {\"description\": \"The page number for pagination. Example: '1'.\", \"type\": \"str, optional\", \"default\": \"1\"}, \"market\": {\"description\": \"The market type for filtering predictions. Example: '1X2', 'OU25', 'bts'.\", \"type\": \"str, optional\", \"default\": \"\"}, \"date\": {\"description\": \"The date for filtering predictions in the format 'YYYY-MM-DD'. Example: '2022-08-13'.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Provide the daily football predictions for the 'Serie A' on 2023-08-15 and list all surebets.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"daily_predictions\", \"arguments\": {\"league\": \"Serie A\", \"date\": \"2023-08-15\"}}, {\"name\": \"list\", \"arguments\": {}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1766
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"full_info_with_url\", \"description\": \"Fetches detailed information about a TikTok video, including author info, video statistics, and metadata, using the provided URL.\", \"parameters\": {\"url\": {\"description\": \"The URL of the TikTok video to fetch information for.\", \"type\": \"str\", \"default\": \"https://www.tiktok.com/@mehdi_amri_10/video/7060576901613587718\"}}}]",
"role": "system"
},
{
"content": "Could you get the full info for TikTok videos at these links: 'https://www.tiktok.com/@user8/video234', 'https://www.tiktok.com/@user9/video567', and 'https://www.tiktok.com/@user10/video890'?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"full_info_with_url\", \"arguments\": {\"url\": \"https://www.tiktok.com/@user8/video234\"}}, {\"name\": \"full_info_with_url\", \"arguments\": {\"url\": \"https://www.tiktok.com/@user9/video567\"}}, {\"name\": \"full_info_with_url\", \"arguments\": {\"url\": \"https://www.tiktok.com/@user10/video890\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1767
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_markets_of_coin\", \"description\": \"Fetches the top 50 markets for a given cryptocurrency coin.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the cryptocurrency coin.\", \"type\": \"int\", \"default\": \"90\"}}}, {\"name\": \"equity_earnings\", \"description\": \"Returns earnings (EPS, quarterly) history data for a given security within a specified date range.\", \"parameters\": {\"to\": {\"description\": \"The query end date (supported format is **YYYY-mm-dd**), e.g., '2020-04-17'.\", \"type\": \"str\", \"default\": \"2020-04-17\"}, \"is_from\": {\"description\": \"The query start date (supported format is **YYYY-mm-dd**), e.g., '2019-01-01'.\", \"type\": \"str\", \"default\": \"2019-01-01\"}, \"symbol\": {\"description\": \"The symbol of the asset to look for, e.g., 'AAPL' (Apple Inc), 'T' (AT&T Inc).\", \"type\": \"str\", \"default\": \"AAPL\"}}}, {\"name\": \"get_realtime_volume\", \"description\": \"Fetches the real-time trading volume of a cryptocurrency in US Dollars.\", \"parameters\": {\"symbol\": {\"description\": \"The ticker symbol of the cryptocurrency (e.g., 'BTC' for Bitcoin).\", \"type\": \"str\", \"default\": \"BTC\"}}}, {\"name\": \"stochrsi\", \"description\": \"Fetches the Stochastic Relative Strength Index (STOCHRSI) for a given financial instrument using the Twelve Data API.\", \"parameters\": {\"symbol\": {\"description\": \"The instrument symbol, which can be an equity, index, ETF, forex, or cryptocurrency (e.g., `AAPL`, `EUR/USD`, `ETH/BTC`).\", \"type\": \"str\", \"default\": \"AAPL\"}, \"interval\": {\"description\": \"The interval between two consecutive points in the time series. Supported values include `1min`, `5min`, `15min`, `30min`, `45min`, `1h`, `2h`, `4h`, `1day`, `1week`, `1month`.\", \"type\": \"str\", \"default\": \"1min\"}, \"fast_dma_type\": {\"description\": \"The type of moving average used for smoothing. Supported values are `SMA`, `EMA`, `WMA`, `DEMA`, `TEMA`, `TRIMA`, `KAMA`, `MAMA`, `T3MA`. Defaults to `SMA`.\", \"type\": \"str\", \"default\": \"SMA\"}, \"series_type\": {\"description\": \"The type of series data. Supported values are `open`, `high`, `low`, `close`. Defaults to `close`.\", \"type\": \"str\", \"default\": \"close\"}, \"fast_d_period\": {\"description\": \"The period for the fast D moving average. Defaults to 3.\", \"type\": \"int\", \"default\": 3}, \"outputsize\": {\"description\": \"The number of data points to return. Defaults to 30.\", \"type\": \"int\", \"default\": 30}, \"fast_k_period\": {\"description\": \"The period for the fast K moving average. Defaults to 3.\", \"type\": \"int\", \"default\": 3}, \"format\": {\"description\": \"The output format of the API response. Supported values are `json` and `csv`. Defaults to `json`.\", \"type\": \"str\", \"default\": \"json\"}, \"time_period\": {\"description\": \"The period for the RSI calculation. Defaults to 14.\", \"type\": \"int\", \"default\": 14}}}, {\"name\": \"stock_institution_ownership\", \"description\": \"Retrieves the institutional ownership information for a given stock symbol using the Yahoo Finance API.\", \"parameters\": {\"symbol\": {\"description\": \"The stock symbol for which to fetch institutional ownership data.\", \"type\": \"str\", \"default\": \"AAPL\"}}}, {\"name\": \"getlistbyedinetcode\", \"description\": \"Fetches all securities report data of the company specified by the given EDINET code.\", \"parameters\": {\"edinet_code\": {\"description\": \"The EDINET code of the company for which to fetch securities report data.\", \"type\": \"str\", \"default\": \"E02142\"}}}]",
"role": "system"
},
{
"content": "Could you provide the institutional ownership of Microsoft and the earnings history from March 2021 to June 2021?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"stock_institution_ownership\", \"arguments\": {\"symbol\": \"MSFT\"}}, {\"name\": \"equity_earnings\", \"arguments\": {\"to\": \"2021-06-30\", \"is_from\": \"2021-03-01\", \"symbol\": \"MSFT\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1768
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_random_challange\", \"description\": \"Fetch a random challenge from the specified API, with an option to specify the type of challenge.\", \"parameters\": {\"type\": {\"description\": \"The type of challenge to fetch. Options are 'funny', 'dirty', 'sport'. Defaults to 'funny'.\", \"type\": \"str, optional\", \"default\": \"funny\"}}}]",
"role": "system"
},
{
"content": "I need some sport challenges for our team building event tomorrow, and also a funny one for the end.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_random_challange\", \"arguments\": {\"type\": \"sport\"}}, {\"name\": \"get_random_challange\", \"arguments\": {\"type\": \"funny\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1769
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"is_valid_palindrome\", \"description\": \"Checks if a string is a valid palindrome, considering only alphanumeric characters and ignoring case.\", \"parameters\": {\"s\": {\"description\": \"The input string.\", \"type\": \"str\"}}}, {\"name\": \"euclidean_distance\", \"description\": \"Computes the Euclidean distance between two points in a 2D plane.\", \"parameters\": {\"point_a\": {\"description\": \"The coordinates of the first point (x, y).\", \"type\": \"Tuple[float, float]\"}, \"point_b\": {\"description\": \"The coordinates of the second point (x, y).\", \"type\": \"Tuple[float, float]\"}}}]",
"role": "system"
},
{
"content": "Check if '12321' is a palindrome.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"is_valid_palindrome\", \"arguments\": {\"s\": \"12321\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1770
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"latest_contracts_for_symbol\", \"description\": \"Retrieves the latest futures contracts for a given symbol for the next twelve months, with an optional parameter to specify a particular month.\", \"parameters\": {\"symbol\": {\"description\": \"The symbol for which to retrieve futures contracts.\", \"type\": \"str\", \"default\": \"CL\"}, \"month\": {\"description\": \"The month for which to return the latest contract (default is 7).\", \"type\": \"int, optional\", \"default\": \"7\"}}}, {\"name\": \"cash_flow_statement\", \"description\": \"Retrieves the cash flow statement for a given stock in JSON format.\", \"parameters\": {\"stock\": {\"description\": \"The stock symbol to retrieve the cash flow statement for.\", \"type\": \"str\", \"default\": \"AAPL\"}, \"apikey\": {\"description\": \"Your API key from https://fmpcloud.io/register.\", \"type\": \"str\", \"default\": \"demo\"}, \"period\": {\"description\": \"The period of the statement, either 'quarter' or 'annual'. Defaults to 'quarter'.\", \"type\": \"str, optional\", \"default\": \"quarter\"}}}, {\"name\": \"inverted_hammer\", \"description\": \"Fetches a list of stocks that have an Inverted Hammer signal from the specified page using the provided RapidAPI key.\", \"parameters\": {\"page\": {\"description\": \"The page number to retrieve. Default is 1.\", \"type\": \"int, optional\", \"default\": \"1\"}}}]",
"role": "system"
},
{
"content": "I need to see the list of stocks with an Inverted Hammer signal on page 2. Additionally, could you get the latest futures contracts for 'CL' for the month of October?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"inverted_hammer\", \"arguments\": {\"page\": 2}}, {\"name\": \"latest_contracts_for_symbol\", \"arguments\": {\"symbol\": \"CL\", \"month\": 10}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1771
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_analytics\", \"description\": \"Retrieve detailed statistics for your account using the specified parameters through the API.\", \"parameters\": {\"p\": {\"description\": \"The API Key to authenticate the API request.\", \"type\": \"str\", \"default\": \"\"}, \"start\": {\"description\": \"The start date for the statistics in the format YYYY-MM-DD. Defaults to 30 days ago if not specified.\", \"type\": \"str, optional\", \"default\": \"\"}, \"label\": {\"description\": \"Filter data by a specific label. Allowed values: 'all' (default) or a specific label.\", \"type\": \"str, optional\", \"default\": \"all\"}, \"end\": {\"description\": \"The end date for the statistics in the format YYYY-MM-DD. Defaults to the current date if not specified.\", \"type\": \"str, optional\", \"default\": \"\"}, \"subaccounts\": {\"description\": \"Specifies which account data to retrieve. Allowed values: 'only_main' (default), 'all', or a specific subaccount ID.\", \"type\": \"str, optional\", \"default\": \"only_main\"}, \"group_by\": {\"description\": \"Specifies the grouping of the data.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Get analytics for a specific subaccount with ID '12345'.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_analytics\", \"arguments\": {\"p\": \"your_api_key\", \"subaccounts\": \"12345\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1772
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"products_get_reviews\", \"description\": \"Fetches brief reviews of a product from the Shein API.\", \"parameters\": {\"goods_spu\": {\"description\": \"The value of 'productRelationID' returned in the /products/list or /products/search endpoints. Defaults to 'm22022854841'.\", \"type\": \"str, optional\", \"default\": \"m22022854841\"}, \"cat_id\": {\"description\": \"The value of 'cat_id' returned in the /products/list or /products/search endpoints. Defaults to '1727'.\", \"type\": \"str, optional\", \"default\": \"1727\"}, \"sku\": {\"description\": \"The value of 'goods_sn' returned in the /products/list or /products/search endpoints. Defaults to 'rm2202285484176751'.\", \"type\": \"str, optional\", \"default\": \"rm2202285484176751\"}, \"currency\": {\"description\": \"The 3-letter currency code. Defaults to 'USD'.\", \"type\": \"str, optional\", \"default\": \"USD\"}, \"goods_id\": {\"description\": \"The value of 'goods_id' field returned in the /products/list or /products/search endpoints. Defaults to '10196865'.\", \"type\": \"str, optional\", \"default\": \"10196865\"}, \"language\": {\"description\": \"The 2-letter language code. Defaults to 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}, \"country\": {\"description\": \"The 2-letter country code. Defaults to 'US'.\", \"type\": \"str, optional\", \"default\": \"US\"}}}, {\"name\": \"products_list\", \"description\": \"Fetches a list of products from the Kohl's API with various filtering and sorting options.\", \"parameters\": {\"dimensionvalueid\": {\"description\": \"The dimension value ID for filtering products. Multiple dimension values can be provided. Default is 'AgeAppropriate:Teens'.\", \"type\": \"str, optional\", \"default\": \"AgeAppropriate:Teens\"}, \"limit\": {\"description\": \"The maximum number of products to return. Default is 24.\", \"type\": \"int, optional\", \"default\": \"24\"}, \"keyword\": {\"description\": \"A search keyword to filter products by specific terms or phrases. Default is None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"offset\": {\"description\": \"The paging offset, starting from 1. Default is 1.\", \"type\": \"int, optional\", \"default\": \"1\"}, \"sortid\": {\"description\": \"The sort ID for sorting the products. Default is None.\", \"type\": \"int, optional\", \"default\": \"\"}}}, {\"name\": \"products_detail\", \"description\": \"Fetches detailed information of a product based on the given product ID and optional query parameters.\", \"parameters\": {\"goods_id\": {\"description\": \"The value of 'goods_id' field returned from the .../products/list or .../products/search endpoint.\", \"type\": \"str\", \"default\": \"2506647\"}, \"currency\": {\"description\": \"The 3-letter currency code. Defaults to 'USD'.\", \"type\": \"str, optional\", \"default\": \"USD\"}, \"country\": {\"description\": \"The 2-letter country code. Defaults to 'US'.\", \"type\": \"str, optional\", \"default\": \"US\"}, \"language\": {\"description\": \"The 2-letter language code. Defaults to 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}}}, {\"name\": \"product_search\", \"description\": \"Search for products in a store based on a keyword.\", \"parameters\": {\"store_id\": {\"description\": \"The ID of the store to search in.\", \"type\": \"str\", \"default\": \"1122\"}, \"keyword\": {\"description\": \"The keyword to search for products.\", \"type\": \"str\", \"default\": \"womens shoes\"}, \"offset\": {\"description\": \"The starting point for the search results. Defaults to '0'.\", \"type\": \"str, optional\", \"default\": \"0\"}, \"count\": {\"description\": \"The maximum number of products to return. Defaults to '25'.\", \"type\": \"str, optional\", \"default\": \"25\"}}}]",
"role": "system"
},
{
"content": "Retrieve reviews for the product with goods_spu 'm22022854841' in Spanish from Spain.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"products_get_reviews\", \"arguments\": {\"goods_spu\": \"m22022854841\", \"language\": \"es\", \"country\": \"ES\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1773
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"find_favicon\", \"description\": \"Find the favicon for a given URL using the RapidAPI favicon finder service.\", \"parameters\": {\"url\": {\"description\": \"The URL for which to find the favicon.\", \"type\": \"str\", \"default\": \"https://www.google.com/\"}}}, {\"name\": \"entreprise_par_rid\", \"description\": \"Fetches and returns company information from New Caledonia using the provided RID.\", \"parameters\": {\"rid\": {\"description\": \"The RID of the company to look up.\", \"type\": \"str\", \"default\": \"0132720\"}}}]",
"role": "system"
},
{
"content": "Retrieve the favicon for the website 'https://www.example.com' and company information for RID '12345' in New Caledonia.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"find_favicon\", \"arguments\": {\"url\": \"https://www.example.com\"}}, {\"name\": \"entreprise_par_rid\", \"arguments\": {\"rid\": \"12345\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1774
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"listpornstars\", \"description\": \"Fetch a list of pornstars based on various filtering criteria.\", \"parameters\": {\"max_rank\": {\"description\": \"Maximum rank of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"min_rank\": {\"description\": \"Minimum rank of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"max_waist\": {\"description\": \"Maximum waist measurement of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"max_cup_size\": {\"description\": \"Maximum cup size of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"min_cup_size\": {\"description\": \"Minimum cup size of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"min_weight\": {\"description\": \"Minimum weight of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"max_weight\": {\"description\": \"Maximum weight of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"max_age\": {\"description\": \"Maximum age of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"ethnicity\": {\"description\": \"Ethnicity of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"min_age\": {\"description\": \"Minimum age of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"nationality\": {\"description\": \"Nationality of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"tattoos\": {\"description\": \"Tattoo status of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"eyes\": {\"description\": \"Eye color of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"hair\": {\"description\": \"Hair color of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"page\": {\"description\": \"Page number for paginated results.\", \"type\": \"int, optional\", \"default\": \"\"}, \"min_waist\": {\"description\": \"Minimum waist measurement of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"name\": {\"description\": \"Name of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}, \"date_of_birth\": {\"description\": \"Date of birth of the pornstar.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Find pornstars who are of Asian ethnicity and have brown eyes.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"listpornstars\", \"arguments\": {\"ethnicity\": \"Asian\", \"eyes\": \"Brown\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1775
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"analyze_social_group_dynamics\", \"description\": \"Analyzes the social dynamics within a group based on the personality traits and group size.\", \"parameters\": {\"total\": {\"description\": \"The total group size.\", \"type\": \"int\"}, \"extroverts\": {\"description\": \"The number of extroverted members in the group.\", \"type\": \"int\"}, \"introverts\": {\"description\": \"The number of introverted members in the group.\", \"type\": \"int\"}}}, {\"name\": \"structural_analysis\", \"description\": \"Performs structural analysis on a building based on its ID, floor numbers, and analysis mode.\", \"parameters\": {\"building_id\": {\"description\": \"The unique identifier of the building.\", \"type\": \"str\", \"default\": \"static\"}, \"floor_numbers\": {\"description\": \"The list of floor numbers to be analyzed.\", \"type\": \"List[int]\", \"default\": \"static\"}, \"analysis_mode\": {\"description\": \"The mode of analysis, either \\\"static\\\" or \\\"dynamic\\\". Defaults to \\\"static\\\".\", \"type\": \"str, optional\"}}}]",
"role": "system"
},
{
"content": "Analyze a group of 35 with 18 extroverts and 17 introverts. Also, check 'B901' for floors 6, 12, 18 in static mode.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"analyze_social_group_dynamics\", \"arguments\": {\"total\": 35, \"extroverts\": 18, \"introverts\": 17}}, {\"name\": \"structural_analysis\", \"arguments\": {\"building_id\": \"B901\", \"floor_numbers\": [6, 12, 18]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1776
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_team_transfers\", \"description\": \"Retrieves all incoming and outgoing transfers for a specified team.\", \"parameters\": {\"teamid\": {\"description\": \"The identifier of the team for which to retrieve transfer data.\", \"type\": \"str\", \"default\": \"17\"}}}, {\"name\": \"games_esports\", \"description\": \"Fetches information about esports games for a given event ID using the SofaSport API.\", \"parameters\": {\"event_id\": {\"description\": \"The ID of the event to retrieve esports games for.\", \"type\": \"int\", \"default\": \"10289011\"}}}, {\"name\": \"prematch_event\", \"description\": \"Fetches pre-match event data from a sports betting API.\", \"parameters\": {\"lang\": {\"description\": \"The language code for the API response.\", \"type\": \"str\", \"default\": \"en\"}, \"evt\": {\"description\": \"The event ID to fetch information for.\", \"type\": \"int\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Get pre-match event data for a soccer match with event ID 54321 in English.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"prematch_event\", \"arguments\": {\"lang\": \"en\", \"evt\": 54321}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1777
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"girl_groups\", \"description\": \"Fetch information about K-pop girl groups based on various query parameters.\", \"parameters\": {\"q\": {\"description\": \"The search query to find specific girl groups.\", \"type\": \"str\", \"default\": \"Twice\"}, \"by\": {\"description\": \"The field by which to search for girl groups. Default is 'Group Name'. Possible values include:\", \"type\": \"str, optional\", \"default\": \"Group Name\"}, \"limit\": {\"description\": \"The maximum number of results to return. Default is to return all available results.\", \"type\": \"int, optional\", \"default\": \"\"}, \"offset\": {\"description\": \"The number of results to skip before starting to return results. Default is 0.\", \"type\": \"int, optional\", \"default\": \"\"}}}, {\"name\": \"year_end_hot_100_songs\", \"description\": \"Fetches the Year-End Hot 100 Songs chart for a given year from the Billboard API.\", \"parameters\": {\"year\": {\"description\": \"The year for which to retrieve the Year-End Hot 100 Songs chart.\", \"type\": \"int\", \"default\": \"2021\"}, \"range\": {\"description\": \"The range of chart positions to retrieve, default is '1-10'. If not specified, returns all results.\", \"type\": \"str, optional\", \"default\": \"1-10\"}}}, {\"name\": \"artist_related\", \"description\": \"Fetches related artists information from the Spotify API using a given artist ID.\", \"parameters\": {\"is_id\": {\"description\": \"The Spotify artist ID for which to find related artists.\", \"type\": \"str\", \"default\": \"2w9zwq3AktTeYYMuhMjju8\"}}}]",
"role": "system"
},
{
"content": "Get the top 10 songs from the Year-End Hot 100 Songs chart for the year 2010.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"year_end_hot_100_songs\", \"arguments\": {\"year\": 2010, \"range\": \"1-10\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1778
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"calculate_investment_return\", \"description\": \"Calculates the return on investment based on the initial deposit amount, annual interest rate, and investment period.\", \"parameters\": {\"initial_amount\": {\"description\": \"The initial deposit amount.\", \"type\": \"int\"}, \"interest_rate\": {\"description\": \"The annual interest rate provided by the bank.\", \"type\": \"float\"}, \"num_years\": {\"description\": \"The number of years the money is invested.\", \"type\": \"int\"}}}, {\"name\": \"is_perfect_square\", \"description\": \"Checks if a number is a perfect square.\", \"parameters\": {\"num\": {\"description\": \"The number to check.\", \"type\": \"int\"}}}, {\"name\": \"triangle_area\", \"description\": \"Computes the area of a triangle given its base and height.\", \"parameters\": {\"base\": {\"description\": \"The length of the base of the triangle.\", \"type\": \"float\"}, \"height\": {\"description\": \"The height of the triangle.\", \"type\": \"float\"}}}]",
"role": "system"
},
{
"content": "Determine if the number 144 is a perfect square.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"is_perfect_square\", \"arguments\": {\"num\": 144}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1781
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"game_odds_by_category_schedule\", \"description\": \"Fetches the schedule of game odds for a given sport and category from the sportsbook-odds API.\", \"parameters\": {\"category\": {\"description\": \"The category of the odds. For example, 0 for moneylines, 1 for spreads, 2 for over/under, etc.\", \"type\": \"str\", \"default\": \"0\"}, \"sport\": {\"description\": \"The sport for which to fetch the game odds schedule.\", \"type\": \"str\", \"default\": \"Baseball\"}}}, {\"name\": \"teamnearmatches\", \"description\": \"Fetches the list of near matches for a specific American Football team using its team ID.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the American Football team for which to fetch the list of near matches.\", \"type\": \"int\", \"default\": 4413}}}]",
"role": "system"
},
{
"content": "I'm planning a sports betting strategy for the upcoming basketball season. Can you provide the schedule of game odds for moneylines (category 0) in basketball?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"game_odds_by_category_schedule\", \"arguments\": {\"category\": \"0\", \"sport\": \"basketball\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1782
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"aliexpress_item_shipping_detail\", \"description\": \"Retrieve detailed shipping information for a specific Aliexpress item.\", \"parameters\": {\"itemid\": {\"description\": \"The Aliexpress product ID.\", \"type\": \"int\", \"default\": \"3256804591426248\"}, \"quantity\": {\"description\": \"The quantity of the item to consider for shipping. Defaults to 1.\", \"type\": \"int, optional\", \"default\": \"1\"}, \"sellerid\": {\"description\": \"The ID of the seller. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"ext\": {\"description\": \"Additional parameter obtained from one of the Item Detail Endpoints for more accurate shipping options. Defaults to a predefined value.\", \"type\": \"str, optional\", \"default\": \"bVkg9vW8ihgAMt4XYtZhMB3rnoY6MGI8Sk1gfrl4IGWuBdZZb0gRv5vgI1r5DIn8Rj7mxVzOKbKpyHkmBItRm_k2dtJ1j_gHLTu5zNN9jXHeQploYHEajpnygmD_xKGbi9I_HzxO8TtoIpwdvl5ZfH6o_x5qCBy5D1cUo6t7LoDhx7UTHmFDiCHY0PpHokfJ\"}, \"locale\": {\"description\": \"Locale parameter for displaying titles and other content in the selected language. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"region\": {\"description\": \"Region parameter to accurately get shipping costs and other promotions for a specific geographic location. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"currency\": {\"description\": \"Currency parameter for displaying the product price in the selected currency. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"product_offers\", \"description\": \"Fetches a list of offers for a specific product on Amazon based on the given ASIN.\", \"parameters\": {\"asin\": {\"description\": \"Product ASIN to get offers for. Supports batching up to 10 ASINs in a single request, separated by a comma (e.g., 'B08PPDJWC8,B07ZPKBL9V,B08BHXG144').\", \"type\": \"str\", \"default\": \"B07ZPKBL9V\"}, \"delivery\": {\"description\": \"[EXPERIMENTAL] Find products with specific delivery options, specified as a comma-delimited list. Valid values: 'PRIME_ELIGIBLE', 'FREE_DELIVERY'. Default is None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"limit\": {\"description\": \"Maximum number of offers to return. Default is 100.\", \"type\": \"int, optional\", \"default\": \"100\"}, \"product_condition\": {\"description\": \"Filter products by condition, specified as a comma-delimited list. Valid values: 'NEW', 'USED_LIKE_NEW', 'USED_VERY_GOOD', 'USED_GOOD', 'USED_ACCEPTABLE'. Default is None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"country\": {\"description\": \"Sets the marketplace country, language, and currency. Allowed values: 'US', 'AU', 'BR', 'CA', 'CN', 'FR', 'DE', 'IN', 'IT', 'MX', 'NL', 'SG', 'ES', 'TR', 'AE', 'GB', 'JP'. Default is 'US'.\", \"type\": \"str, optional\", \"default\": \"US\"}}}, {\"name\": \"categories_list\", \"description\": \"Fetches a list of categories and their recursive child categories from the Wayfair API.\", \"parameters\": {\"caid\": {\"description\": \"The category ID for which to list categories. The default root category is 214970.\", \"type\": \"int\", \"default\": \"214970\"}}}]",
"role": "system"
},
{
"content": "List the offers for Amazon product ASIN 'B07ZPKBL9V' that are new and eligible for Prime delivery, and also list those that are used like new but not eligible for Prime.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"product_offers\", \"arguments\": {\"asin\": \"B07ZPKBL9V\", \"product_condition\": \"NEW\", \"delivery\": \"PRIME_ELIGIBLE\"}}, {\"name\": \"product_offers\", \"arguments\": {\"asin\": \"B07ZPKBL9V\", \"product_condition\": \"USED_LIKE_NEW\", \"delivery\": \"FREE_DELIVERY\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1783
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"crimes_with_no_location\", \"description\": \"Fetches a list of crimes from a specified police force on a given date and category, where the crimes have no specified location.\", \"parameters\": {\"date\": {\"description\": \"The date of the crimes to retrieve in 'YYYY-MM' format.\", \"type\": \"str\", \"default\": \"2011-09\"}, \"force\": {\"description\": \"The identifier for the police force responsible for handling the crimes.\", \"type\": \"str\", \"default\": \"warwickshire\"}, \"category\": {\"description\": \"The category of the crimes to retrieve.\", \"type\": \"str\", \"default\": \"all-crime\"}}}]",
"role": "system"
},
{
"content": "Retrieve information on crimes with no location from the West Yorkshire Police for May 2023 in the categories 'Shoplifting' and 'Violence and Sexual Offences'",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"crimes_with_no_location\", \"arguments\": {\"date\": \"2023-05\", \"force\": \"West Yorkshire Police\", \"category\": \"Shoplifting\"}}, {\"name\": \"crimes_with_no_location\", \"arguments\": {\"date\": \"2023-05\", \"force\": \"West Yorkshire Police\", \"category\": \"Violence and Sexual Offences\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1784
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"hex_to_hsv\", \"description\": \"Converts a hex color code to an HSV color code using the Convexity API.\", \"parameters\": {\"hex\": {\"description\": \"The hex color code to be converted.\", \"type\": \"str\", \"default\": \"ffffff\"}}}, {\"name\": \"check_a_url\", \"description\": \"Check if the provided URL is a known phishing or scam attempt using the FraudFreeze API.\", \"parameters\": {\"url\": {\"description\": \"The URL to be checked for phishing or scam activities.\", \"type\": \"str\", \"default\": \"google.com\"}}}]",
"role": "system"
},
{
"content": "What are the HSV values for hex colors #6A5ACD and #708090?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"hex_to_hsv\", \"arguments\": {\"hex\": \"#6A5ACD\"}}, {\"name\": \"hex_to_hsv\", \"arguments\": {\"hex\": \"#708090\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1785
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"ip_lookup\", \"description\": \"This function performs an IP lookup using the provided IP address and returns the geolocation details. It utilizes the IP Whois Geolocation API from RapidAPI.\", \"parameters\": {\"ip\": {\"description\": \"The IP address (IPv4 or IPv6) to look up.\", \"type\": \"str\", \"default\": \"1.1.1.1\"}}}, {\"name\": \"get_company_ads_count\", \"description\": \"Fetch the number of ads a specific company has posted on LinkedIn using the Toolbench RapidAPI.\", \"parameters\": {\"company_id\": {\"description\": \"The unique identifier of the company whose ad count is to be fetched.\", \"type\": \"str\", \"default\": \"162479\"}}}, {\"name\": \"random_post_by_id\", \"description\": \"Retrieves a fake post by its ID from the specified API.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the fake post to retrieve.\", \"type\": \"int\", \"default\": \"1\"}}}, {\"name\": \"filter_and_query_naics_description\", \"description\": \"This function queries an endpoint to search by freeform text or NAICS code and retrieves a list of NAICS codes, hashes, and descriptions.\", \"parameters\": {\"naics\": {\"description\": \"A 6-digit NAICS code to filter the search. If this parameter is provided, the `q` parameter is optional.\", \"type\": \"int, optional\", \"default\": \"721110\"}, \"q\": {\"description\": \"A freeform text to search for industries. This must be at least 3 characters long. If this parameter is provided, the `naics` parameter is optional.\", \"type\": \"str, optional\", \"default\": \"Hotel\"}}}]",
"role": "system"
},
{
"content": "Fetch a random post with ID 54321 and also the number of ads posted by Company ABC with ID 67890 on LinkedIn.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"random_post_by_id\", \"arguments\": {\"is_id\": 54321}}, {\"name\": \"get_company_ads_count\", \"arguments\": {\"company_id\": \"67890\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1786
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_coin_price_difference\", \"description\": \"Fetches the price difference of a specified cryptocurrency from the Crypto Arbitrage Trading API using the provided RapidAPI key.\", \"parameters\": {\"name\": {\"description\": \"The name of the cryptocurrency for which to fetch the price difference.\", \"type\": \"str\", \"default\": \"MOVR\"}}}, {\"name\": \"ideas_get_view_count\", \"description\": \"Fetches the view count for a specific idea post from the Trading View API.\", \"parameters\": {\"uuid\": {\"description\": \"The unique identifier for an idea, as returned by the /ideas/list endpoint.\", \"type\": \"str\", \"default\": \"CRK6Iv51\"}, \"lang\": {\"description\": \"The language code for the response. Default is 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}}}, {\"name\": \"assetbyid\", \"description\": \"Retrieves the details of an individual asset using its unique identifier (UUID) from the Brave New Coin API.\", \"parameters\": {\"is_id\": {\"description\": \"The unique resource identifier (UUID) of the asset to be retrieved.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"get_coin_markets\", \"description\": \"Retrieve markets on different exchanges that trade a specific coin.\", \"parameters\": {\"uuid\": {\"description\": \"UUID of the coin you want to request markets for.\", \"type\": \"str\", \"default\": \"Qwsogvtv82FCd\"}, \"offset\": {\"description\": \"Offset for pagination. Default is 0.\", \"type\": \"int, optional\", \"default\": \"0\"}, \"orderby\": {\"description\": \"Index to sort results by. Default is '24hVolume'.\", \"type\": \"str, optional\", \"default\": \"24hVolume\"}, \"limit\": {\"description\": \"Limit on the number of results returned. Default is 50.\", \"type\": \"int, optional\", \"default\": \"50\"}, \"search\": {\"description\": \"Value to filter search results, e.g., exchange names, currency names, or currency symbols.\", \"type\": \"str, optional\", \"default\": \"\"}, \"referencecurrencyuuid\": {\"description\": \"UUID of the reference currency used to calculate the volume. Defaults to the US Dollar.\", \"type\": \"str, optional\", \"default\": \"yhjMzLPhuIDl\"}, \"orderdirection\": {\"description\": \"Order results in ascending ('asc') or descending ('desc') order. Default is 'desc'.\", \"type\": \"str, optional\", \"default\": \"desc\"}}}, {\"name\": \"v1getfundlatestprice\", \"description\": \"Fetches the latest price of a fund using its ISIN.\", \"parameters\": {\"isin\": {\"description\": \"The International Securities Identification Number of the fund.\", \"type\": \"str\", \"default\": \"LU0690375182\"}}}]",
"role": "system"
},
{
"content": "I'm looking for the latest price of the fund with ISIN 'GB00B3X7QG66'. Can you help?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"v1getfundlatestprice\", \"arguments\": {\"isin\": \"GB00B3X7QG66\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1787
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"players_photo\", \"description\": \"Retrieves the photo of a soccer player given the player's ID using the Soccerway API.\", \"parameters\": {\"player_id\": {\"description\": \"The unique identifier of the soccer player.\", \"type\": \"int\", \"default\": \"177208\"}}}, {\"name\": \"daily_match_list_all\", \"description\": \"Retrieve the daily match list including scheduled, live, and finished matches for a specific date.\", \"parameters\": {\"date\": {\"description\": \"The date for which to retrieve match data, in the format {dd/MM/yyyy}. Match list data can be retrieved for a period of \\u00b1 7 days from the specified date.\", \"type\": \"str\", \"default\": \"29/01/2021\"}}}, {\"name\": \"wnba_standings\", \"description\": \"Fetches the WNBA team standings for a given year, with optional grouping.\", \"parameters\": {\"year\": {\"description\": \"The year for which the standings are to be fetched.\", \"type\": \"str\", \"default\": \"2022\"}, \"group\": {\"description\": \"The group name for standings, either 'league' or 'conference'. Defaults to 'league'.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Provide the WNBA standings for the year 2020 and the daily match list for ice hockey on March 10, 2023.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"wnba_standings\", \"arguments\": {\"year\": \"2020\"}}, {\"name\": \"daily_match_list_all\", \"arguments\": {\"date\": \"10/03/2023\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1788
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"triangle_area\", \"description\": \"Computes the area of a triangle given its base and height.\", \"parameters\": {\"base\": {\"description\": \"The length of the base of the triangle.\", \"type\": \"float\"}, \"height\": {\"description\": \"The height of the triangle.\", \"type\": \"float\"}}}, {\"name\": \"calculate_quarterly_dividend\", \"description\": \"Calculates the quarterly dividend per share based on the total dividend payout and the number of outstanding shares.\", \"parameters\": {\"total_dividend\": {\"description\": \"The total dividend payout in USD.\", \"type\": \"int\"}, \"num_shares\": {\"description\": \"The number of outstanding shares.\", \"type\": \"int\"}}}]",
"role": "system"
},
{
"content": "Determine the quarterly dividend per share for a company with a total annual dividend of $100,000 and 5000 outstanding shares.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"calculate_quarterly_dividend\", \"arguments\": {\"total_dividend\": 100000, \"num_shares\": 5000}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1789
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_geo_location_of_ip_address\", \"description\": \"Retrieve the geographical location and other details of a given IP address using the Toolbench RapidAPI.\", \"parameters\": {\"ip\": {\"description\": \"The IPV4 address for which geographical information is to be retrieved.\", \"type\": \"str\", \"default\": \"34.89.89.28\"}}}]",
"role": "system"
},
{
"content": "Can you find the location details for IP addresses 192.168.1.1 and 172.217.5.206?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_geo_location_of_ip_address\", \"arguments\": {\"ip\": \"192.168.1.1\"}}, {\"name\": \"get_geo_location_of_ip_address\", \"arguments\": {\"ip\": \"172.217.5.206\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1790
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"airports_direct_routes_for_an_airport\", \"description\": \"Returns a list of direct routes for a given airport using the RapidAPI service.\", \"parameters\": {\"airportiatacode\": {\"description\": \"The IATA code of the airport for which the direct routes are being queried.\", \"type\": \"str\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "What are the direct routes from Sydney Airport? And from Tokyo's Haneda Airport?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"airports_direct_routes_for_an_airport\", \"arguments\": {\"airportiatacode\": \"SYD\"}}, {\"name\": \"airports_direct_routes_for_an_airport\", \"arguments\": {\"airportiatacode\": \"HND\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1791
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"find_missing_number\", \"description\": \"Finds the missing number in a list of integers from 0 to n.\", \"parameters\": {\"nums\": {\"description\": \"The list of integers.\", \"type\": \"List[int]\"}}}, {\"name\": \"binary_search\", \"description\": \"Performs binary search on a sorted list to find the index of a target value.\", \"parameters\": {\"arr\": {\"description\": \"The sorted list of integers.\", \"type\": \"List[int]\"}, \"target\": {\"description\": \"The target value to search for.\", \"type\": \"int\"}}}, {\"name\": \"find_max_subarray_sum\", \"description\": \"Finds the maximum sum of a contiguous subarray within a list of integers.\", \"parameters\": {\"nums\": {\"description\": \"The input list of integers.\", \"type\": \"List[int]\"}}}]",
"role": "system"
},
{
"content": "Calculate the maximum sum of any subarray in the list [1, -2, 3, 10, -6, 7, -3]",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"find_max_subarray_sum\", \"arguments\": {\"nums\": [1, -2, 3, 10, -6, 7, -3]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1792
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"list_of_hotel_types\", \"description\": \"Returns hotel type names and their translations from the Booking.com API.\", \"parameters\": {\"hotel_type_id\": {\"description\": \"The ID of the specific hotel type to query. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"get_trip_plan\", \"description\": \"Generates a trip plan based on the number of days and destination provided.\", \"parameters\": {\"days\": {\"description\": \"The number of days for the trip.\", \"type\": \"int\", \"default\": \"3\"}, \"destination\": {\"description\": \"The destination for the trip.\", \"type\": \"str\", \"default\": \"London,UK\"}}}]",
"role": "system"
},
{
"content": "I'm planning a 7-day cultural tour in Rome. Can you provide a trip plan?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_trip_plan\", \"arguments\": {\"days\": 7, \"destination\": \"Rome\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1793
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"binary_addition\", \"description\": \"Adds two binary numbers and returns the result as a binary string.\", \"parameters\": {\"a\": {\"description\": \"The first binary number.\", \"type\": \"str\"}, \"b\": {\"description\": \"The second binary number.\", \"type\": \"str\"}}}, {\"name\": \"is_prime\", \"description\": \"Checks if a number is prime.\", \"parameters\": {\"num\": {\"description\": \"The number to be checked.\", \"type\": \"int\"}}}, {\"name\": \"expand_around_center\", \"description\": \"Helper function to expand around a center for finding palindromic substrings.\", \"parameters\": {\"s\": {\"description\": \"The input string.\", \"type\": \"str\"}, \"left\": {\"description\": \"The left index of the center.\", \"type\": \"int\"}, \"right\": {\"description\": \"The right index of the center.\", \"type\": \"int\"}}}, {\"name\": \"monthly_mortgage_payment\", \"description\": \"Calculates the monthly mortgage payment based on the loan amount, annual interest rate, and loan term.\", \"parameters\": {\"loan_amount\": {\"description\": \"The total amount of the loan.\", \"type\": \"float\"}, \"annual_interest_rate\": {\"description\": \"The annual interest rate as a decimal (e.g., 0.05 for 5%).\", \"type\": \"float\"}, \"loan_term_years\": {\"description\": \"The loan term in years.\", \"type\": \"int\"}}}, {\"name\": \"potential_energy\", \"description\": \"Calculates the electrostatic potential energy given the charge and voltage.\", \"parameters\": {\"charge\": {\"description\": \"The electric charge.\", \"type\": \"float\"}, \"voltage\": {\"description\": \"The electric potential difference (voltage).\", \"type\": \"float\"}}}, {\"name\": \"light_travel_time\", \"description\": \"Calculate the time taken for light to travel from one celestial body to another.\", \"parameters\": {\"distance_in_light_years\": {\"description\": \"The distance between the two celestial bodies in light years.\", \"type\": \"int\", \"default\": 299792458}, \"speed_of_light\": {\"description\": \"The speed of light in vacuum, in m/s. Default value is 299792458 m/s.\", \"type\": \"int\", \"default\": 299792458}}}]",
"role": "system"
},
{
"content": "Check if 1024 is a prime number. Then, add two binary numbers: '111011' and '101010'. Next, find the monthly mortgage payment for a loan of $150,000 at an annual interest rate of 3.5% over 25 years. Finally, calculate the time it takes for light to travel 10 light years.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"is_prime\", \"arguments\": {\"num\": 1024}}, {\"name\": \"binary_addition\", \"arguments\": {\"a\": \"111011\", \"b\": \"101010\"}}, {\"name\": \"monthly_mortgage_payment\", \"arguments\": {\"loan_amount\": 150000, \"annual_interest_rate\": 0.035, \"loan_term_years\": 25}}, {\"name\": \"light_travel_time\", \"arguments\": {\"distance_in_light_years\": 10}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1794
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"v1_loremipsum\", \"description\": \"Fetches lorem ipsum placeholder text from the API Ninjas Lorem Ipsum API.\", \"parameters\": {\"max_length\": {\"description\": \"Maximum character length for the returned text.\", \"type\": \"int, optional\", \"default\": \"\"}, \"start_with_lorem_ipsum\": {\"description\": \"Whether to begin the text with \\\"Lorem ipsum\\\". Accepts 'true' or 'false'. Defaults to 'true' if unset.\", \"type\": \"str, optional\", \"default\": \"\"}, \"random\": {\"description\": \"Whether to randomly generate paragraphs. Accepts 'true' or 'false'. Defaults to 'true' if unset.\", \"type\": \"str, optional\", \"default\": \"\"}, \"paragraphs\": {\"description\": \"Number of paragraphs to generate. Defaults to 1 if unset.\", \"type\": \"int, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "I need a longer lorem ipsum text, about 500 characters long, starting with 'Lorem ipsum', and generated randomly.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"v1_loremipsum\", \"arguments\": {\"max_length\": 500, \"start_with_lorem_ipsum\": \"true\", \"random\": \"true\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1795
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_user_playlists\", \"description\": \"Fetch all public playlists of a specific user from the Spotify API.\", \"parameters\": {\"user_id\": {\"description\": \"The ID of the user whose playlists are to be fetched.\", \"type\": \"str\", \"default\": \"cruilla\"}}}, {\"name\": \"get_radio_playlist\", \"description\": \"Fetches a radio playlist for a given artist or song using the Spotify API.\", \"parameters\": {\"uri\": {\"description\": \"The URI of the artist or song for which to generate the radio playlist.\", \"type\": \"str\", \"default\": \"spotify:artist:2w9zwq3AktTeYYMuhMjju8\"}}}, {\"name\": \"albums_get_related_artist\", \"description\": \"Fetches related artist information for a given album using the Shazam API.\", \"parameters\": {\"is_id\": {\"description\": \"The value of the 'albums->id', 'id', or 'albumadamid' field returned from various Shazam API endpoints.\", \"type\": \"str\", \"default\": \"850569437\"}, \"l\": {\"description\": \"The language code to return results in. Defaults to 'en-US'.\", \"type\": \"str, optional\", \"default\": \"en-US\"}}}]",
"role": "system"
},
{
"content": "Retrieve all public playlists for user 'spotify_user_123' and generate a radio playlist for the artist 'spotify:artist:3dBVyJ2lfd2QaF2wp72iYz'.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_user_playlists\", \"arguments\": {\"user_id\": \"spotify_user_123\"}}, {\"name\": \"get_radio_playlist\", \"arguments\": {\"uri\": \"spotify:artist:3dBVyJ2lfd2QaF2wp72iYz\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1796
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"is_palindrome\", \"description\": \"Checks if a string is a palindrome.\", \"parameters\": {\"text\": {\"description\": \"The input string.\", \"type\": \"str\"}}}, {\"name\": \"binary_search\", \"description\": \"Performs binary search on a sorted list to find the index of a target value.\", \"parameters\": {\"arr\": {\"description\": \"The sorted list of integers.\", \"type\": \"List[int]\"}, \"target\": {\"description\": \"The target value to search for.\", \"type\": \"int\"}}}, {\"name\": \"find_max_subarray_sum\", \"description\": \"Finds the maximum sum of a contiguous subarray within a list of integers.\", \"parameters\": {\"nums\": {\"description\": \"The input list of integers.\", \"type\": \"List[int]\"}}}, {\"name\": \"is_sum_of_cubes\", \"description\": \"Checks if a number is the sum of the cubes of its digits.\", \"parameters\": {\"num\": {\"description\": \"The number to check.\", \"type\": \"int\"}}}, {\"name\": \"word_frequency\", \"description\": \"Calculates the frequency of each word in a text.\", \"parameters\": {\"text\": {\"description\": \"The input text.\", \"type\": \"str\"}}}, {\"name\": \"flatten_list\", \"description\": \"Flattens a nested list into a single-level list.\", \"parameters\": {\"nested_list\": {\"description\": \"The nested list to be flattened.\", \"type\": \"List\"}}}, {\"name\": \"longest_common_prefix\", \"description\": \"Finds the longest common prefix among a list of strings.\", \"parameters\": {\"strs\": {\"description\": \"The list of strings.\", \"type\": \"List[str]\"}}}, {\"name\": \"find_duplicate_number\", \"description\": \"Finds the duplicate number in a list of integers.\", \"parameters\": {\"nums\": {\"description\": \"The list of integers.\", \"type\": \"List[int]\"}}}]",
"role": "system"
},
{
"content": "Flatten the nested list [1, [2, [3, 4], 5]]",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"flatten_list\", \"arguments\": {\"nested_list\": [1, [2, [3, 4], 5]]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1798
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"find_first_non_repeating_char\", \"description\": \"Finds the first non-repeating character in a string.\", \"parameters\": {\"s\": {\"description\": \"The input string.\", \"type\": \"str\"}}}, {\"name\": \"reverse_string\", \"description\": \"Reverses the characters in a string.\", \"parameters\": {\"text\": {\"description\": \"The input string.\", \"type\": \"str\"}}}]",
"role": "system"
},
{
"content": "What is the first non-repeating character in the sentence 'Hello, how are you today?' and how would you reverse this sentence?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"find_first_non_repeating_char\", \"arguments\": {\"s\": \"Hello, how are you today?\"}}, {\"name\": \"reverse_string\", \"arguments\": {\"text\": \"Hello, how are you today?\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1799
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"fixtures_and_results_by_team\", \"description\": \"Returns all fixtures and results for a given team by querying the \\\"rugby-live-data\\\" API.\", \"parameters\": {\"team_id\": {\"description\": \"The ID of the team for which to retrieve fixtures and results.\", \"type\": \"int\", \"default\": \"6167\"}}}, {\"name\": \"leaguegroups\", \"description\": \"Retrieve the groups for a specific handball tournament season.\", \"parameters\": {\"tournamentid\": {\"description\": \"The unique ID of the handball tournament for which groups are to be retrieved.\", \"type\": \"int\", \"default\": 30}, \"seasonid\": {\"description\": \"The ID of the season within the tournament for which groups are to be retrieved.\", \"type\": \"int\", \"default\": 42851}}}]",
"role": "system"
},
{
"content": "Fetch all results and fixtures for rugby team 567.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"fixtures_and_results_by_team\", \"arguments\": {\"team_id\": 567}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1800
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"clubs\", \"description\": \"Retrieves information about clubs participating in the First Premier League Competition.\", \"parameters\": {\"abbr\": {\"description\": \"The abbreviation of the club. Default is 'ARS'.\", \"type\": \"str\", \"default\": \"ARS\"}, \"name\": {\"description\": \"The name of the club. Default is 'Arsenal'.\", \"type\": \"str\", \"default\": \"Arsenal\"}}}]",
"role": "system"
},
{
"content": "Get details about Liverpool FC using its abbreviation.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"clubs\", \"arguments\": {\"abbr\": \"LIV\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1801
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_equity_latest_data\", \"description\": \"Fetches the latest equity data for a given equity slug.\", \"parameters\": {\"slug\": {\"description\": \"The unique identifier for the equity, retrieved from screener results.\", \"type\": \"str\", \"default\": \"saudi-aramco\"}, \"lang\": {\"description\": \"Language code for the data. Defaults to 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}}}, {\"name\": \"tvl_protocol\", \"description\": \"Fetch the Total Value Locked (TVL) for a specified DeFi protocol from the RapidAPI Toolbench.\", \"parameters\": {\"protocol\": {\"description\": \"The slug identifier for the DeFi protocol.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"recent_exchange_rates\", \"description\": \"Retrieve the latest exchange rate data between currencies.\", \"parameters\": {\"is_from\": {\"description\": \"Three-letter currency code of the currency to convert from. Defaults to 'USD'.\", \"type\": \"str\", \"default\": \"USD\"}, \"to\": {\"description\": \"Comma-separated list of currency codes to convert 'is_from' currency into. Defaults to 'EUR,GBP'.\", \"type\": \"str\", \"default\": \"EUR,GBP\"}}}, {\"name\": \"stock_v2_get_risk_rating_breakdown\", \"description\": \"Fetch the risk rating breakdown for a given stock performance ID.\", \"parameters\": {\"performanceid\": {\"description\": \"The performance ID of the stock to fetch the risk rating breakdown for.\", \"type\": \"str\", \"default\": \"0P0000OQN8\"}}}]",
"role": "system"
},
{
"content": "Could you provide the latest equity data for Tesla Inc. in English and also the TVL for the Aave protocol?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_equity_latest_data\", \"arguments\": {\"slug\": \"tesla-inc\", \"lang\": \"en\"}}, {\"name\": \"tvl_protocol\", \"arguments\": {\"protocol\": \"aave\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1803
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"light_travel_time\", \"description\": \"Calculate the time taken for light to travel from one celestial body to another.\", \"parameters\": {\"distance_in_light_years\": {\"description\": \"The distance between the two celestial bodies in light years.\", \"type\": \"int\", \"default\": 299792458}, \"speed_of_light\": {\"description\": \"The speed of light in vacuum, in m/s. Default value is 299792458 m/s.\", \"type\": \"int\", \"default\": 299792458}}}, {\"name\": \"bacterial_growth\", \"description\": \"Calculates the bacterial population after a given time based on the initial population and growth rate.\", \"parameters\": {\"initial_population\": {\"description\": \"The initial bacterial population.\", \"type\": \"int\", \"default\": 20}, \"growth_rate\": {\"description\": \"The growth rate per unit time.\", \"type\": \"float\", \"default\": 20}, \"time\": {\"description\": \"The time elapsed.\", \"type\": \"float\"}, \"doubling_time\": {\"description\": \"The doubling time of the bacteria in minutes. Defaults to 20.\", \"type\": \"float, optional\"}}}]",
"role": "system"
},
{
"content": "Determine the bacterial population after 30 minutes if the initial population is 1000 and the growth rate is 0.05 per minute.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"bacterial_growth\", \"arguments\": {\"initial_population\": 1000, \"growth_rate\": 0.05, \"time\": 30}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1804
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"min_meeting_rooms\", \"description\": \"Finds the minimum number of meeting rooms required to accommodate all meetings.\", \"parameters\": {\"intervals\": {\"description\": \"A list of meeting time intervals, where each interval is represented as [start_time, end_time].\", \"type\": \"List[List[int]]\"}}}]",
"role": "system"
},
{
"content": "Can you determine the minimum number of meeting rooms needed for three meetings? The first starts at 9 and ends at 10, the second at 10 and ends at 11, and the third at 11 and ends at 12.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"min_meeting_rooms\", \"arguments\": {\"intervals\": [[9, 10], [10, 11], [11, 12]]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1805
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"circle_area\", \"description\": \"Computes the area of a circle given its radius.\", \"parameters\": {\"radius\": {\"description\": \"The radius of the circle.\", \"type\": \"float\"}}}, {\"name\": \"note_duration\", \"description\": \"Calculates the duration between two musical notes based on their frequencies and the tempo.\", \"parameters\": {\"freq1\": {\"description\": \"The frequency of the first note in Hz.\", \"type\": \"int\", \"default\": 120}, \"freq2\": {\"description\": \"The frequency of the second note in Hz.\", \"type\": \"int\", \"default\": 120}, \"bpm\": {\"description\": \"The tempo of the music in beats per minute. Defaults to 120.\", \"type\": \"int, optional\"}}}]",
"role": "system"
},
{
"content": "What is the area of a circle with a radius of 'five' meters? Additionally, calculate the duration between a note with a frequency of 600 Hz and another with a frequency of 900 Hz at a tempo of 140 BPM.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"circle_area\", \"arguments\": {\"radius\": 5}}, {\"name\": \"note_duration\", \"arguments\": {\"freq1\": 600, \"freq2\": 900, \"bpm\": 140}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1806
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"count_bits\", \"description\": \"Counts the number of set bits (1's) in the binary representation of a number.\", \"parameters\": {\"num\": {\"description\": \"The input number.\", \"type\": \"int\"}}}, {\"name\": \"wire_resistance\", \"description\": \"Calculates the resistance of a wire based on its length, cross-sectional area, and material resistivity.\", \"parameters\": {\"length_m\": {\"description\": \"The length of the wire in meters.\", \"type\": \"int\", \"default\": \"copper\"}, \"area_sq_m\": {\"description\": \"The cross-sectional area of the wire in square meters.\", \"type\": \"float\", \"default\": \"copper\"}, \"material\": {\"description\": \"The material of the wire. Allowed values: \\\"copper\\\" (default) or \\\"aluminum\\\".\", \"type\": \"str, optional\"}}}, {\"name\": \"find_kth_smallest_number\", \"description\": \"Finds the kth smallest number in a list.\", \"parameters\": {\"nums\": {\"description\": \"The list of numbers.\", \"type\": \"List[int]\"}, \"k\": {\"description\": \"The position (1-based index) of the smallest number to find.\", \"type\": \"int\"}}}, {\"name\": \"std_deviation\", \"description\": \"Calculates the standard deviation of a list of numbers.\", \"parameters\": {\"numbers\": {\"description\": \"The list of numbers.\", \"type\": \"List[float]\"}}}]",
"role": "system"
},
{
"content": "Count the bits in 8 and 16, and calculate the resistance of a 150m copper wire with 0.4 sq.m area.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"count_bits\", \"arguments\": {\"num\": 8}}, {\"name\": \"count_bits\", \"arguments\": {\"num\": 16}}, {\"name\": \"wire_resistance\", \"arguments\": {\"length_m\": 150, \"area_sq_m\": 0.4, \"material\": \"copper\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1807
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"search_suggestions\", \"description\": \"Fetches search suggestions from the Twitter API using specified query parameters.\", \"parameters\": {\"query\": {\"description\": \"The search query string.\", \"type\": \"str\", \"default\": \"elonmusk\"}, \"twttr_session\": {\"description\": \"The Twitter session ID for authenticated requests. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"twttr_proxy\": {\"description\": \"The Twitter proxy server address. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"cursor\": {\"description\": \"The cursor for paginated results. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"feeds\", \"description\": \"Fetch recent TikTok feeds for a given user.\", \"parameters\": {\"schematype\": {\"description\": \"The type of schema to use for the query.\", \"type\": \"str\", \"default\": \"1\"}, \"username\": {\"description\": \"The TikTok username for which to fetch recent feeds.\", \"type\": \"str\", \"default\": \"tiktok\"}}}, {\"name\": \"popular_posts\", \"description\": \"Fetches popular posts from Reddit based on the given sort type.\", \"parameters\": {\"sort\": {\"description\": \"The sorting method for the posts. Accepted values are 'new' and 'hot'.\", \"type\": \"str\", \"default\": \"new\"}, \"cursor\": {\"description\": \"An optional cursor for pagination to fetch the next set of results. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Could you get the trending posts from Reddit sorted by 'hot' and also provide Twitter search suggestions for 'digital marketing'? Thanks!",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"popular_posts\", \"arguments\": {\"sort\": \"hot\"}}, {\"name\": \"search_suggestions\", \"arguments\": {\"query\": \"digital marketing\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1808
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"v1_category\", \"description\": \"Fetches a list of trending categories from the Tokapi Mobile API using specified query parameters.\", \"parameters\": {\"count\": {\"description\": \"Number of categories to fetch. Defaults to 10.\", \"type\": \"int\", \"default\": 10}, \"offset\": {\"description\": \"Offset for pagination. Defaults to 0.\", \"type\": \"int\", \"default\": 0}, \"region\": {\"description\": \"Region code for filtering categories. Defaults to 'US'.\", \"type\": \"str\", \"default\": \"US\"}}}, {\"name\": \"get_user_tweets\", \"description\": \"Fetches tweets for a specified user using the provided RapidAPI key.\", \"parameters\": {\"count\": {\"description\": \"The number of tweets to retrieve.\", \"type\": \"str\", \"default\": \"20\"}, \"user\": {\"description\": \"The ID of the user whose tweets are to be fetched.\", \"type\": \"str\", \"default\": \"2455740283\"}, \"cursor\": {\"description\": \"The cursor for pagination. Default is None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"get_user_info\", \"description\": \"Fetches information about an Instagram user using their user ID.\", \"parameters\": {\"is_id\": {\"description\": \"The user ID of the Instagram account.\", \"type\": \"int\", \"default\": \"25025320\"}}}, {\"name\": \"get_user_highlights_tray_by_user_id\", \"description\": \"Fetches the highlight tray of a specific Instagram user identified by their user ID using the RapidAPI service.\", \"parameters\": {\"user_id\": {\"description\": \"The unique identifier of the Instagram user.\", \"type\": \"int\", \"default\": \"25025320\"}}}, {\"name\": \"full_info_with_url\", \"description\": \"Fetches detailed information about a TikTok video, including author info, video statistics, and metadata, using the provided URL.\", \"parameters\": {\"url\": {\"description\": \"The URL of the TikTok video to fetch information for.\", \"type\": \"str\", \"default\": \"https://www.tiktok.com/@mehdi_amri_10/video/7060576901613587718\"}}}, {\"name\": \"comment_list\", \"description\": \"Fetches a list of comments for a specified TikTok video using the given API.\", \"parameters\": {\"aweme_id\": {\"description\": \"The ID of the TikTok video.\", \"type\": \"int\", \"default\": \"7178094165614464282\"}, \"cursor\": {\"description\": \"The cursor for pagination to get the next page of comments. Defaults to 0.\", \"type\": \"int, optional\", \"default\": \"0\"}, \"count\": {\"description\": \"The number of comments to fetch. Maximum is 30. Defaults to 20.\", \"type\": \"int, optional\", \"default\": \"20\"}}}, {\"name\": \"hashtag_info\", \"description\": \"Fetches information about a specific TikTok hashtag using the Toolbench RapidAPI.\", \"parameters\": {\"hashtag\": {\"description\": \"The TikTok hashtag for which to retrieve information.\", \"type\": \"str\", \"default\": \"bts\"}}}, {\"name\": \"get_info_user\", \"description\": \"Fetch information about a TikTok user using the provided username.\", \"parameters\": {\"username\": {\"description\": \"The TikTok username for which to retrieve information.\", \"type\": \"str\", \"default\": \"tiktok\"}}}]",
"role": "system"
},
{
"content": "Can you fetch the trending categories in the US with an offset of 5 and 15 categories, and also get the user info for Instagram user with ID 123456789?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"v1_category\", \"arguments\": {\"count\": 15, \"offset\": 5, \"region\": \"US\"}}, {\"name\": \"get_user_info\", \"arguments\": {\"is_id\": 123456789}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1809
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"matrix_multiply\", \"description\": \"Multiplies two matrices.\", \"parameters\": {\"matrix_a\": {\"description\": \"The first matrix.\", \"type\": \"List[List[float]]\"}, \"matrix_b\": {\"description\": \"The second matrix.\", \"type\": \"List[List[float]]\"}}}, {\"name\": \"independent_samples_t_test\", \"description\": \"Conducts a two-sample independent t-test and returns the t-statistic, p-value, and conclusion.\", \"parameters\": {\"sample1\": {\"description\": \"The first sample of observations.\", \"type\": \"List[float]\", \"default\": 0.05}, \"sample2\": {\"description\": \"The second sample of observations.\", \"type\": \"List[float]\", \"default\": 0.05}, \"alpha\": {\"description\": \"The significance level of the test. Defaults to 0.05.\", \"type\": \"float, optional\"}}}, {\"name\": \"expand_around_center\", \"description\": \"Helper function to expand around a center for finding palindromic substrings.\", \"parameters\": {\"s\": {\"description\": \"The input string.\", \"type\": \"str\"}, \"left\": {\"description\": \"The left index of the center.\", \"type\": \"int\"}, \"right\": {\"description\": \"The right index of the center.\", \"type\": \"int\"}}}, {\"name\": \"count_bits\", \"description\": \"Counts the number of set bits (1's) in the binary representation of a number.\", \"parameters\": {\"num\": {\"description\": \"The input number.\", \"type\": \"int\"}}}, {\"name\": \"calculate_investment_return\", \"description\": \"Calculates the return on investment based on the initial deposit amount, annual interest rate, and investment period.\", \"parameters\": {\"initial_amount\": {\"description\": \"The initial deposit amount.\", \"type\": \"int\"}, \"interest_rate\": {\"description\": \"The annual interest rate provided by the bank.\", \"type\": \"float\"}, \"num_years\": {\"description\": \"The number of years the money is invested.\", \"type\": \"int\"}}}, {\"name\": \"find_pairs_with_sum\", \"description\": \"Finds all pairs of integers in a list that sum up to a target value.\", \"parameters\": {\"nums\": {\"description\": \"The list of integers.\", \"type\": \"List[int]\"}, \"target\": {\"description\": \"The target sum value.\", \"type\": \"int\"}}}, {\"name\": \"probability_of_consecutive_rolls\", \"description\": \"Calculates the probability of rolling a specific value on a die consecutively for a given number of rolls.\", \"parameters\": {\"target_value\": {\"description\": \"The desired value to be rolled.\", \"type\": \"int\", \"default\": 6}, \"num_rolls\": {\"description\": \"The number of consecutive rolls.\", \"type\": \"int\", \"default\": 6}, \"num_sides\": {\"description\": \"The number of sides on the die. Defaults to 6.\", \"type\": \"int, optional\"}}}]",
"role": "system"
},
{
"content": "What is the probability of rolling a 6 on a 6-sided die three times consecutively?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"probability_of_consecutive_rolls\", \"arguments\": {\"target_value\": 6, \"num_rolls\": 3, \"num_sides\": 6}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1810
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"categorize_job_title\", \"description\": \"Categorizes a given job title using the Toolbench RapidAPI job title categorization service.\", \"parameters\": {\"title\": {\"description\": \"The job title to be categorized.\", \"type\": \"str\", \"default\": \"Head of Finance\"}}}, {\"name\": \"house_prices_estimate\", \"description\": \"Estimates house prices based on given criteria and returns a list of estimated prices.\", \"parameters\": {\"area\": {\"description\": \"The area for which to estimate house prices, as defined by the auto-complete API.\", \"type\": \"str\", \"default\": \"Greenwich Close, Crawley RH11\"}, \"property_type\": {\"description\": \"The type of property. Options are 'detached', 'flat', 'terraced', 'semi_detached'.\", \"type\": \"str, optional\", \"default\": \"\"}, \"page_number\": {\"description\": \"The page index for pagination. Default is 1.\", \"type\": \"int, optional\", \"default\": \"1\"}, \"order_by\": {\"description\": \"The attribute by which to order the results. Options are 'price_paid', 'last_sold', 'address', 'estimated_value'. Default is 'address'.\", \"type\": \"str, optional\", \"default\": \"address\"}, \"page_size\": {\"description\": \"The number of items per response. Maximum is 40. Default is 40.\", \"type\": \"int, optional\", \"default\": \"40\"}, \"ordering\": {\"description\": \"The order direction of the results. Options are 'ascending', 'descending'. Default is 'descending'.\", \"type\": \"str, optional\", \"default\": \"descending\"}, \"identifier\": {\"description\": \"A specific identifier from the auto-complete API to refine the search.\", \"type\": \"str, optional\", \"default\": \"west-sussex/crawley/greenwich-close\"}}}, {\"name\": \"get_field_and_field_invite_id\", \"description\": \"Fetches the field and field invite IDs for a given document from the SignNow API.\", \"parameters\": {\"document_id\": {\"description\": \"The ID of the document for which to retrieve field and field invite IDs.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"properties_get_broadband\", \"description\": \"Fetch broadband information for a given property listing.\", \"parameters\": {\"listing_id\": {\"description\": \"The ID of the property listing for which broadband information is to be retrieved. This value is typically obtained from the `/properties/list` endpoint.\", \"type\": \"int\", \"default\": \"56354192\"}}}]",
"role": "system"
},
{
"content": "Get broadband information for property listing with ID 987654321.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"properties_get_broadband\", \"arguments\": {\"listing_id\": 987654321}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1811
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"numerical_derivative\", \"description\": \"Estimates the derivative of a function at a given point using the central difference formula.\", \"parameters\": {\"function\": {\"description\": \"The function to calculate the derivative of.\", \"type\": \"Callable[[float], float]\"}, \"x\": {\"description\": \"The point at which to estimate the derivative.\", \"type\": \"float\"}}}, {\"name\": \"solve_quadratic\", \"description\": \"Computes the roots of a quadratic equation given its coefficients.\", \"parameters\": {\"a\": {\"description\": \"The coefficient of the quadratic term (x^2).\", \"type\": \"float\"}, \"b\": {\"description\": \"The coefficient of the linear term (x).\", \"type\": \"float\"}, \"c\": {\"description\": \"The constant term.\", \"type\": \"float\"}}}]",
"role": "system"
},
{
"content": "Determine the derivative of the function f(x) = sin(x) + x at x = π.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"numerical_derivative\", \"arguments\": {\"function\": \"lambda x: math.sin(x) + x\", \"x\": \"math.pi\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1812
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"min_meeting_rooms\", \"description\": \"Finds the minimum number of meeting rooms required to accommodate all meetings.\", \"parameters\": {\"intervals\": {\"description\": \"A list of meeting time intervals, where each interval is represented as [start_time, end_time].\", \"type\": \"List[List[int]]\"}}}, {\"name\": \"is_valid_palindrome\", \"description\": \"Checks if a string is a valid palindrome, considering only alphanumeric characters and ignoring case.\", \"parameters\": {\"s\": {\"description\": \"The input string.\", \"type\": \"str\"}}}, {\"name\": \"investment_profit\", \"description\": \"Calculates the profit from an investment based on the initial amount, annual return rate, and time.\", \"parameters\": {\"amount\": {\"description\": \"The initial investment amount.\", \"type\": \"float\"}, \"rate\": {\"description\": \"The annual return rate expressed as a decimal.\", \"type\": \"float\"}, \"years\": {\"description\": \"The number of years the investment is held.\", \"type\": \"int\"}}}]",
"role": "system"
},
{
"content": "What is the profit from investing $2000 at a 4% annual rate for 7 years?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"investment_profit\", \"arguments\": {\"amount\": 2000, \"rate\": 0.04, \"years\": 7}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1813
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"potential_energy\", \"description\": \"Calculates the electrostatic potential energy given the charge and voltage.\", \"parameters\": {\"charge\": {\"description\": \"The electric charge.\", \"type\": \"float\"}, \"voltage\": {\"description\": \"The electric potential difference (voltage).\", \"type\": \"float\"}}}]",
"role": "system"
},
{
"content": "A researcher is studying the effects of voltage on a charge of 3 Coulombs. If the voltage varies from 1000 to 2000 volts in increments of 500 volts, what are the corresponding potential energies?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"potential_energy\", \"arguments\": {\"charge\": 3, \"voltage\": 1000}}, {\"name\": \"potential_energy\", \"arguments\": {\"charge\": 3, \"voltage\": 1500}}, {\"name\": \"potential_energy\", \"arguments\": {\"charge\": 3, \"voltage\": 2000}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1814
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"fetch_latest\", \"description\": \"Fetch the latest updated manga from the server based on specified genres and page number.\", \"parameters\": {\"genres\": {\"description\": \"A comma-separated list of genres to filter the manga by (e.g., 'Harem,Fantasy'). Defaults to 'Harem,Fantasy'.\", \"type\": \"str, optional\", \"default\": \"Harem,Fantasy\"}, \"page\": {\"description\": \"The page number to fetch, starting from '1'. Defaults to '1'.\", \"type\": \"str, optional\", \"default\": \"1\"}}}, {\"name\": \"v1_jokes\", \"description\": \"Fetches a set number of jokes from the API Ninjas Jokes API endpoint.\", \"parameters\": {\"limit\": {\"description\": \"The number of jokes to return, with a valid range of 1 to 30. Defaults to None, which returns a single joke.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"channel_playlists\", \"description\": \"Fetches playlists from a specified YouTube channel using the YouTube Data API and various filters.\", \"parameters\": {\"hl\": {\"description\": \"Language parameter, specified as a BCP-47 language code. Defaults to 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}, \"filter\": {\"description\": \"Filter key or token to specify the type of playlists to return. Defaults to None. Available options:\", \"type\": \"str, optional\", \"default\": \"\"}, \"cursor\": {\"description\": \"Continuation token for pagination. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"is_id\": {\"description\": \"The YouTube channel ID to fetch playlists for. Defaults to 'UC-lHJZR3Gqxm24_Vd_AJ5Yw'.\", \"type\": \"str, optional\", \"default\": \"UC-lHJZR3Gqxm24_Vd_AJ5Yw\"}, \"gl\": {\"description\": \"Geolocation parameter to filter results by region. Defaults to 'US'.\", \"type\": \"str, optional\", \"default\": \"US\"}}}, {\"name\": \"choice_endpoint\", \"description\": \"Sends a GET request to the Rock-Paper-Scissors API with the user's choice and returns the API's response.\", \"parameters\": {\"choice\": {\"description\": \"The user's selection, either \\\"rock\\\", \\\"paper\\\", or \\\"scissors\\\".\", \"type\": \"str\", \"default\": \"rock\"}}}]",
"role": "system"
},
{
"content": "Get the latest manga from 'Mystery' genre on page 2 and the response for 'scissors' in the Rock-Paper-Scissors API.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"fetch_latest\", \"arguments\": {\"genres\": \"Mystery\", \"page\": \"2\"}}, {\"name\": \"choice_endpoint\", \"arguments\": {\"choice\": \"scissors\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1815
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"calculate_distance\", \"description\": \"Calculates the Euclidean distance between two points in n-dimensional space.\", \"parameters\": {\"point1\": {\"description\": \"The coordinates of the first point.\", \"type\": \"List[float]\"}, \"point2\": {\"description\": \"The coordinates of the second point.\", \"type\": \"List[float]\"}}}, {\"name\": \"polygon_area_shoelace\", \"description\": \"Calculates the area of a polygon using the shoelace formula.\", \"parameters\": {\"vertices\": {\"description\": \"A list of polygon vertices represented as tuples (x, y).\", \"type\": \"List[Tuple[float, float]]\"}}}]",
"role": "system"
},
{
"content": "Compute the distance between two points in 2D space with coordinates (2, 2) and (5, 6). Additionally, find the area of a complex polygon with vertices at (2,2), (4,2), (4,4), (2,4).",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"calculate_distance\", \"arguments\": {\"point1\": [2, 2], \"point2\": [5, 6]}}, {\"name\": \"polygon_area_shoelace\", \"arguments\": {\"vertices\": [[2, 2], [4, 2], [4, 4], [2, 4]]}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1816
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"greatest_common_divisor\", \"description\": \"Computes the greatest common divisor (GCD) of two non-negative integers.\", \"parameters\": {\"a\": {\"description\": \"The first non-negative integer.\", \"type\": \"int\"}, \"b\": {\"description\": \"The second non-negative integer.\", \"type\": \"int\"}}}]",
"role": "system"
},
{
"content": "I need to know the GCD of 12345 and 67890, and also of 9876 and 54321.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"greatest_common_divisor\", \"arguments\": {\"a\": 12345, \"b\": 67890}}, {\"name\": \"greatest_common_divisor\", \"arguments\": {\"a\": 9876, \"b\": 54321}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1817
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"bus_trolley_schedules\", \"description\": \"Fetches bus or trolley schedules based on the provided parameters from the SEPTA API.\", \"parameters\": {\"req1\": {\"description\": \"The stop ID for which the schedule is being requested.\", \"type\": \"int\", \"default\": \"17842\"}, \"req2\": {\"description\": \"The route number. Defaults to 17.\", \"type\": \"int, optional\", \"default\": \"17\"}, \"req3\": {\"description\": \"'i' for inbound or 'o' for outbound. Defaults to 'i'.\", \"type\": \"str, optional\", \"default\": \"i\"}, \"req6\": {\"description\": \"The number of results to return. Defaults to 7.\", \"type\": \"int, optional\", \"default\": \"7\"}}}, {\"name\": \"stays_properties_detail_photos\", \"description\": \"Fetch detailed photos of a specific property from the stays/properties/detail/photos endpoint using the Booking.com RapidAPI.\", \"parameters\": {\"language_code\": {\"description\": \"The language code to use for the response. Default is 'en-us'.\", \"type\": \"str\", \"default\": \"en-us\"}, \"id_detail\": {\"description\": \"The ID of the property to fetch detail photos for. Default is 'cr/la-buena-vida-cabinas'.\", \"type\": \"str\", \"default\": \"cr/la-buena-vida-cabinas\"}}}]",
"role": "system"
},
{
"content": "I need the detailed photos of the property with ID 'fr/le-chateau-de-loire' in French language.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"stays_properties_detail_photos\", \"arguments\": {\"language_code\": \"fr-fr\", \"id_detail\": \"fr/le-chateau-de-loire\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1818
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"calculate_investment_return\", \"description\": \"Calculates the return on investment based on the initial deposit amount, annual interest rate, and investment period.\", \"parameters\": {\"initial_amount\": {\"description\": \"The initial deposit amount.\", \"type\": \"int\"}, \"interest_rate\": {\"description\": \"The annual interest rate provided by the bank.\", \"type\": \"float\"}, \"num_years\": {\"description\": \"The number of years the money is invested.\", \"type\": \"int\"}}}, {\"name\": \"draw_cards\", \"description\": \"Shuffles a standard deck of 52 cards and draws a specified number of cards from the top.\", \"parameters\": {\"num_draw\": {\"description\": \"The number of cards to be drawn. Defaults to 1.\", \"type\": \"int, optional\", \"default\": 1}}}, {\"name\": \"displacement\", \"description\": \"Calculates the displacement of an object given its initial velocity, acceleration, and time.\", \"parameters\": {\"initial_velocity\": {\"description\": \"The initial velocity of the object.\", \"type\": \"float\"}, \"acceleration\": {\"description\": \"The acceleration of the object.\", \"type\": \"float\"}, \"time\": {\"description\": \"The time elapsed.\", \"type\": \"float\"}}}, {\"name\": \"is_valid_sudoku\", \"description\": \"Checks if a 9x9 Sudoku board is valid.\", \"parameters\": {\"board\": {\"description\": \"The Sudoku board represented as a 2D list of strings.\", \"type\": \"List[List[str]]\"}}}, {\"name\": \"average\", \"description\": \"Calculates the arithmetic mean of a list of numbers.\", \"parameters\": {\"numbers\": {\"description\": \"The list of numbers.\", \"type\": \"List[float]\"}}}, {\"name\": \"calculate_angle\", \"description\": \"Calculates the angle between the hour and minute hands of a clock.\", \"parameters\": {\"hour\": {\"description\": \"The hour value (1-12).\", \"type\": \"int\"}, \"minute\": {\"description\": \"The minute value (0-59).\", \"type\": \"int\"}}}]",
"role": "system"
},
{
"content": "Draw 5 random cards from a shuffled deck.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"draw_cards\", \"arguments\": {\"num_draw\": 5}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1819
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_from_1337_x\", \"description\": \"Fetches torrent data for a given search topic from the 1337x website using the RapidAPI service.\", \"parameters\": {\"searchtopic\": {\"description\": \"The topic or keywords to search for torrents on 1337x.\", \"type\": \"str\", \"default\": \"cars\"}}}, {\"name\": \"get_product\", \"description\": \"Fetches product details from the RapidAPI endpoint using the provided product ID and API key.\", \"parameters\": {\"is_id\": {\"description\": \"The product ID to fetch details for.\", \"type\": \"int\", \"default\": \"\"}}}, {\"name\": \"nal_query\", \"description\": \"Converts a given number to its corresponding word representation in Spanish using the Numeros-a-Letras API.\", \"parameters\": {\"num\": {\"description\": \"The number to be converted to words.\", \"type\": \"str\", \"default\": \"0\"}}}, {\"name\": \"qr_code\", \"description\": \"Generates a QR code for a given URL using the RapidAPI service.\", \"parameters\": {\"url\": {\"description\": \"The URL for which to generate the QR code.\", \"type\": \"str\", \"default\": \"https://www.google.com\"}}}]",
"role": "system"
},
{
"content": "How do you say the number 123456 in Spanish?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"nal_query\", \"arguments\": {\"num\": \"123456\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1820
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"stock_get_statistics\", \"description\": \"Retrieve statistical information for a given stock.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the stock. Use the market/auto-complete API to get the correct values.\", \"type\": \"str\", \"default\": \"aapl:us\"}, \"template\": {\"description\": \"Specifies the type of statistical template to use. Options include 'COMMODITY', 'CURRENCY', 'INDEX', 'INDEXFUTURE', 'RATE', and 'STOCK'. Defaults to 'STOCK'.\", \"type\": \"str, optional\", \"default\": \"STOCK\"}}}, {\"name\": \"balansheet_financials\", \"description\": \"Fetches and returns the financial data for a given company symbol using the specified RapidAPI key.\", \"parameters\": {\"symbol\": {\"description\": \"The stock ticker symbol of the company for which financial data is requested.\", \"type\": \"str\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Please retrieve the stock statistics for Facebook Inc. (FB) and the balance sheet financials for Netflix Inc. (NFLX). Additionally, could you get the stock statistics for the S&P 500 (SPX) using the 'INDEX' template?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"stock_get_statistics\", \"arguments\": {\"is_id\": \"FB\"}}, {\"name\": \"balansheet_financials\", \"arguments\": {\"symbol\": \"NFLX\"}}, {\"name\": \"stock_get_statistics\", \"arguments\": {\"is_id\": \"SPX\", \"template\": \"INDEX\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1821
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"matchstreakodds\", \"description\": \"Fetch odds data related to streaks for a specific football match using its ID.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the match for which the streaks odds data is to be retrieved.\", \"type\": \"int\", \"default\": 10114139}}}, {\"name\": \"tournament_matches_by_date\", \"description\": \"Retrieves all matches for a specified tournament on a given date using the Tennis Live Data API.\", \"parameters\": {\"date\": {\"description\": \"The date for which to retrieve the matches, formatted as 'YYYY-MM-DD'.\", \"type\": \"str\", \"default\": \"2020-01-06\"}, \"tournament_id\": {\"description\": \"The ID of the tournament.\", \"type\": \"int\", \"default\": \"1143\"}}}, {\"name\": \"baseball_league_rankings\", \"description\": \"Fetches and returns the baseball league standings for a given league ID.\", \"parameters\": {\"league_id\": {\"description\": \"The ID of the baseball league for which rankings are to be fetched. League IDs can be retrieved from the Baseball Live Matches endpoint.\", \"type\": \"str\", \"default\": \"41276\"}}}, {\"name\": \"team_stats\", \"description\": \"Fetches team statistics for the NBA. By default, it provides stats for the current league year. Optionally, you can supply a specific `leagueyear` or `team` to get results for those parameters.\", \"parameters\": {\"leagueyear\": {\"description\": \"The league year for which to fetch team stats. Defaults to None, which retrieves stats for the current league year.\", \"type\": \"str, optional\", \"default\": \"\"}, \"team\": {\"description\": \"The team for which to fetch stats. Defaults to None, which retrieves stats for all teams.\", \"type\": \"str, optional\", \"default\": \"\"}}}]",
"role": "system"
},
{
"content": "Fetch the team statistics for all NBA teams in the current league year.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"team_stats\", \"arguments\": {}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1822
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"amenities\", \"description\": \"Retrieves amenities IDs and descriptions from the Airbnb Listings API, returning up to 50 results starting from the specified offset.\", \"parameters\": {\"offset\": {\"description\": \"The index to start retrieving the amenities from.\", \"type\": \"int\", \"default\": \"0\"}}}, {\"name\": \"webcams_list_category_category_category\", \"description\": \"Fetch a list of webcams based on specified categories.\", \"parameters\": {\"category\": {\"description\": \"Comma-separated list of category names for which webcams are to be fetched. At least one category is required.\", \"type\": \"str\", \"default\": \"\"}, \"lang\": {\"description\": \"Language code to localize the results, if available. Defaults to 'en'.\", \"type\": \"str, optional\", \"default\": \"en\"}, \"show\": {\"description\": \"Specifies the content to be listed in the response. Possible values include 'webcams', 'categories', 'continents', 'countries', 'regions', 'properties'. Defaults to 'webcams:image,location'.\", \"type\": \"str, optional\", \"default\": \"webcams:image,location\"}}}, {\"name\": \"get_property_type_filters\", \"description\": \"Retrieves property type filters from the Airbnb API.\", \"parameters\": {\"languageid\": {\"description\": \"The language ID for the requested response. To get the language ID, call the `getLanguages` API.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"rental_availability\", \"description\": \"Fetches the availability information for a specific rental property using the given rental ID.\", \"parameters\": {\"rentalid\": {\"description\": \"The unique identifier of the rental property obtained from the Rental Search API in the Vacation Rentals collection.\", \"type\": \"str\", \"default\": \"VacationRentalReview-g60763-d24816619-Deluxe_Double_Queen_with_Balcony-New_York_City_New_York\"}}}, {\"name\": \"locations_v2_search_deprecated\", \"description\": \"Searches for related locations and suggestions based on the provided query, locale, and currency.\", \"parameters\": {\"query\": {\"description\": \"Name of the country, city, district, place, etc., to search for.\", \"type\": \"str\", \"default\": \"new york\"}, \"locale\": {\"description\": \"The language code for the search results. Defaults to 'en_US'.\", \"type\": \"str, optional\", \"default\": \"en_US\"}, \"currency\": {\"description\": \"The currency code for the search results. Defaults to 'USD'.\", \"type\": \"str, optional\", \"default\": \"USD\"}}}]",
"role": "system"
},
{
"content": "Can you fetch amenities for Airbnb listings starting from offset 100 and then from offset 200?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"amenities\", \"arguments\": {\"offset\": 100}}, {\"name\": \"amenities\", \"arguments\": {\"offset\": 200}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1823
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"project_population\", \"description\": \"Projects the population size after a specified number of years.\", \"parameters\": {\"current_pop\": {\"description\": \"The current population size.\", \"type\": \"int\", \"default\": 1.2}, \"num_years\": {\"description\": \"The number of years into the future to make the projection.\", \"type\": \"int\", \"default\": 1.2}, \"annual_growth\": {\"description\": \"The annual population growth rate as a percentage. Defaults to 1.2.\", \"type\": \"float, optional\"}}}, {\"name\": \"is_leap_year\", \"description\": \"Checks if a year is a leap year.\", \"parameters\": {\"year\": {\"description\": \"The year to check.\", \"type\": \"int\"}}}, {\"name\": \"geocode_city\", \"description\": \"Retrieves the latitude and longitude coordinates of a given city using the Maps.co Geocoding API.\", \"parameters\": {\"city\": {\"description\": \"The name of the city.\", \"type\": \"str\"}}}, {\"name\": \"get_holidays_by_year\", \"description\": \"Retrieves the list of public holidays for a given year and country using the Nager.Date API.\", \"parameters\": {\"year\": {\"description\": \"The year for which to retrieve the holidays.\", \"type\": \"int\"}, \"country_code\": {\"description\": \"The two-letter ISO 3166-1 alpha-2 country code.\", \"type\": \"str\"}}}]",
"role": "system"
},
{
"content": "A student is studying the concept of leap years and wants to confirm if the year 2000 was a leap year.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"is_leap_year\", \"arguments\": {\"year\": 2000}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1825
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"title_get_parental_guide\", \"description\": \"Fetches parental guide information for a specific movie from the online movie database.\", \"parameters\": {\"tconst\": {\"description\": \"The unique identifier for the movie. It should start with 'tt' and can be obtained from the `/title/auto-complete` or `/title/find` endpoints. For example, 'tt0944947'.\", \"type\": \"str\", \"default\": \"tt0944947\"}}}, {\"name\": \"vivanews_search\", \"description\": \"Performs a search query on Vivanews through the RapidAPI endpoint.\", \"parameters\": {\"page\": {\"description\": \"The page number to retrieve results from.\", \"type\": \"int\", \"default\": \"1\"}, \"keyword\": {\"description\": \"The search keyword to query.\", \"type\": \"str\", \"default\": \"banjir\"}}}, {\"name\": \"vivanews_detail\", \"description\": \"Fetches and returns the detailed news information from Vivanews by the given ID using the provided RapidAPI key.\", \"parameters\": {\"is_id\": {\"description\": \"The ID of the Vivanews article to fetch details for.\", \"type\": \"int\", \"default\": \"1612364\"}}}, {\"name\": \"title_v2_get_business\", \"description\": \"Retrieves box office information for a given movie title from the online movie database using the provided API key.\", \"parameters\": {\"tconst\": {\"description\": \"The identifier for the movie title, starting with 'tt'. This value can be obtained from the `/title/auto-complete` or `/title/find` endpoints.\", \"type\": \"str\", \"default\": \"tt0796366\"}}}, {\"name\": \"get_latest_article_list\", \"description\": \"Fetches a list of the latest news articles for a specified language from the Malaysia Kini API.\", \"parameters\": {\"language\": {\"description\": \"The language code for which to fetch the latest news articles. Supported languages include English ('en'), Malay ('my'), and Chinese ('zh').\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"get_individual_news_from_source\", \"description\": \"Fetch LGBTQ+ related news from a specific newspaper using the newspaper's ID.\", \"parameters\": {\"newspaperid\": {\"description\": \"The unique identifier of the newspaper from which to retrieve news.\", \"type\": \"str\", \"default\": \"gaytimes\"}}}, {\"name\": \"get_biden_articles_from_specific_newspaper\", \"description\": \"Fetches all articles related to Biden from a specified newspaper using a given API key.\", \"parameters\": {\"newspaper\": {\"description\": \"The name of the newspaper from which to fetch the articles.\", \"type\": \"str\", \"default\": \"boston_globe,new_york_times,cnn,washington_post,los_angeles_times,chicago_tribute\"}}}, {\"name\": \"tags_trending\", \"description\": \"Retrieve a list of trending tags for a given `page_id`, sorted by popularity.\", \"parameters\": {\"page_id\": {\"description\": \"The ID of the page for which to retrieve trending tags.\", \"type\": \"str\", \"default\": \"main\"}}}]",
"role": "system"
},
{
"content": "What's the box office information for 'tt0468569'? Also, provide the latest articles in Chinese.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"title_v2_get_business\", \"arguments\": {\"tconst\": \"tt0468569\"}}, {\"name\": \"get_latest_article_list\", \"arguments\": {\"language\": \"zh\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1827
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"monthly_mortgage_payment\", \"description\": \"Calculates the monthly mortgage payment based on the loan amount, annual interest rate, and loan term.\", \"parameters\": {\"loan_amount\": {\"description\": \"The total amount of the loan.\", \"type\": \"float\"}, \"annual_interest_rate\": {\"description\": \"The annual interest rate as a decimal (e.g., 0.05 for 5%).\", \"type\": \"float\"}, \"loan_term_years\": {\"description\": \"The loan term in years.\", \"type\": \"int\"}}}]",
"role": "system"
},
{
"content": "Calculate the monthly payment for a $400,000 loan at 4.5% annual interest for a term of 30 years.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"monthly_mortgage_payment\", \"arguments\": {\"loan_amount\": 400000, \"annual_interest_rate\": 0.045, \"loan_term_years\": 30}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1828
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"sort_numbers\", \"description\": \"Sorts a list of numbers in ascending or descending order.\", \"parameters\": {\"numbers\": {\"description\": \"The list of numbers to be sorted.\", \"type\": \"List[float]\"}, \"descending\": {\"description\": \"If True, sorts the numbers in descending order. Defaults to False.\", \"type\": \"bool, optional\"}}}, {\"name\": \"binomial_probability\", \"description\": \"Calculates the probability of getting exactly k successes in n independent trials,\", \"parameters\": {\"n\": {\"description\": \"The total number of trials.\", \"type\": \"int\"}, \"k\": {\"description\": \"The number of successes.\", \"type\": \"int\"}, \"p\": {\"description\": \"The probability of success in each trial.\", \"type\": \"float\"}}}, {\"name\": \"wire_resistance\", \"description\": \"Calculates the resistance of a wire based on its length, cross-sectional area, and material resistivity.\", \"parameters\": {\"length_m\": {\"description\": \"The length of the wire in meters.\", \"type\": \"int\", \"default\": \"copper\"}, \"area_sq_m\": {\"description\": \"The cross-sectional area of the wire in square meters.\", \"type\": \"float\", \"default\": \"copper\"}, \"material\": {\"description\": \"The material of the wire. Allowed values: \\\"copper\\\" (default) or \\\"aluminum\\\".\", \"type\": \"str, optional\"}}}]",
"role": "system"
},
{
"content": "Sort the numbers [3.2, 1.5, 2.7, 4.1] in ascending order and calculate the binomial probability of getting 3 successes in 5 trials with a success probability of 0.6.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"sort_numbers\", \"arguments\": {\"numbers\": [3.2, 1.5, 2.7, 4.1], \"descending\": false}}, {\"name\": \"binomial_probability\", \"arguments\": {\"n\": 5, \"k\": 3, \"p\": 0.6}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1829
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"get_user_playlists\", \"description\": \"Retrieve a list of playlists for a given user from the YouTube Music API.\", \"parameters\": {\"params\": {\"description\": \"Pagination or filter parameters to customize the playlists retrieval.\", \"type\": \"str\", \"default\": \"6gPgAUdxVUJXcFlCQ3BNQkNpUjVkRjl3WVdkbFgzTnVZWEJ6YUc5MFgyMTFjMmxqWDNCaFoyVmZjbVZuYVc5dVlXd1NIMDEzUzBGTWVWcENhM2h2WVhkRFJFbFBZM2h6Vms1M0xWY3paM05wVW1jYVNnQUFaVzRBQVVaU0FBRkdVZ0FCQUVaRmJYVnphV05mWkdWMFlXbHNYMkZ5ZEdsemRBQUJBVU1BQUFFQUFBRUJBRlZETkRSb1ltVlNiME5hVmxaTlZtYzFlakJHWmtsM2R3QUI4dHF6cWdvR1FBRklBRkFx\"}, \"user_id\": {\"description\": \"The unique identifier of the user whose playlists are to be retrieved.\", \"type\": \"str\", \"default\": \"UC44hbeRoCZVVMVg5z0FfIww\"}}}, {\"name\": \"year_end_billboard_200_albums\", \"description\": \"Fetch the Year-End Billboard 200 Albums chart for a given year and range.\", \"parameters\": {\"year\": {\"description\": \"The year to fetch the Year-End Billboard 200 Albums for.\", \"type\": \"int\", \"default\": \"2021\"}, \"range\": {\"description\": \"The range of results to return (default is '1-10'). If not specified, all results are returned.\", \"type\": \"str\", \"default\": \"1-10\"}}}]",
"role": "system"
},
{
"content": "What are the most recent playlists of 'djmixmaster45' and who were the top 5 albums of 2019 according to Billboard?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"get_user_playlists\", \"arguments\": {\"user_id\": \"djmixmaster45\", \"params\": \"recent\"}}, {\"name\": \"year_end_billboard_200_albums\", \"arguments\": {\"year\": 2019, \"range\": \"1-5\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1830
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"stock_balance_sheet\", \"description\": \"Retrieves the balance sheet data for a specified stock symbol using the Yahoo Finance API.\", \"parameters\": {\"symbol\": {\"description\": \"The stock symbol for which to retrieve the balance sheet data.\", \"type\": \"str\", \"default\": \"AAPL\"}}}, {\"name\": \"spac_sec_filings\", \"description\": \"Fetches the latest SPAC SEC filings, optionally filtered by a given SPAC symbol.\", \"parameters\": {\"symbol\": {\"description\": \"The SPAC symbol to filter the SEC filings by. Defaults to 'ITAC'.\", \"type\": \"str\", \"default\": \"ITAC\"}}}, {\"name\": \"symbols_get_option_expirations\", \"description\": \"Fetches the option expiration dates for a given symbol from the Seeking Alpha API.\", \"parameters\": {\"symbol\": {\"description\": \"The stock symbol to query for option expiration data.\", \"type\": \"str\", \"default\": \"aapl\"}}}]",
"role": "system"
},
{
"content": "Could you fetch the balance sheet for Apple Inc. (AAPL) and the latest SEC filings for SPAC symbol 'PSFE'? Also, what are the option expiration dates for Tesla (TSLA)?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"stock_balance_sheet\", \"arguments\": {\"symbol\": \"AAPL\"}}, {\"name\": \"spac_sec_filings\", \"arguments\": {\"symbol\": \"PSFE\"}}, {\"name\": \"symbols_get_option_expirations\", \"arguments\": {\"symbol\": \"TSLA\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1831
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"user_tweets_replies_by_screen_name\", \"description\": \"Fetches the tweets and replies of a specified user by their screen name using the Twitter API.\", \"parameters\": {\"username\": {\"description\": \"The screen name of the user whose tweets and replies are to be fetched.\", \"type\": \"str\", \"default\": \"elonmusk\"}, \"cursor\": {\"description\": \"The cursor for pagination, if any. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}, \"limit\": {\"description\": \"The maximum number of tweets and replies to fetch. Defaults to '40'.\", \"type\": \"str, optional\", \"default\": \"40\"}}}, {\"name\": \"hashtagmedias\", \"description\": \"Fetches media related to a specific hashtag from the Instagram API using RapidAPI.\", \"parameters\": {\"hash_tag\": {\"description\": \"The hashtag to query for media.\", \"type\": \"str\", \"default\": \"cat\"}, \"next_cursor\": {\"description\": \"A cursor for pagination to fetch the next set of results. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"venue_search\", \"description\": \"Searches for venues based on latitude, longitude, and optional radius using the Wiman API.\", \"parameters\": {\"latitude\": {\"description\": \"The latitude of the location to search.\", \"type\": \"str\", \"default\": \"44.484994\"}, \"longitude\": {\"description\": \"The longitude of the location to search.\", \"type\": \"str\", \"default\": \"11.327333\"}, \"radius\": {\"description\": \"The search radius in kilometers. Defaults to 1.\", \"type\": \"int, optional\", \"default\": \"1\"}}}, {\"name\": \"igtv\", \"description\": \"Fetch IGTV channel details for a given Instagram username.\", \"parameters\": {\"username\": {\"description\": \"The Instagram username to fetch IGTV details for. Defaults to 'kimkardashian'.\", \"type\": \"str\", \"default\": \"kimkardashian\"}, \"nextmaxid\": {\"description\": \"Pagination identifier for fetching next set of results.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"getmusiclenses\", \"description\": \"Fetches music lenses from the Snapchat API.\", \"parameters\": {\"cursor\": {\"description\": \"A string to navigate through paginated results. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"search_pins\", \"description\": \"Search for Pinterest pins based on a given keyword using the specified RapidAPI key.\", \"parameters\": {\"keyword\": {\"description\": \"The search term used to find relevant Pinterest pins.\", \"type\": \"str\", \"default\": \"nasa\"}}}]",
"role": "system"
},
{
"content": "Can you find all the recent tweets and replies from Elon Musk? Also, what are the trending media posts related to the hashtag #climatechange?",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"user_tweets_replies_by_screen_name\", \"arguments\": {\"username\": \"ElonMusk\"}}, {\"name\": \"hashtagmedias\", \"arguments\": {\"hash_tag\": \"#climatechange\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Salesforce/xlam-function-calling-60k_1832
|
[
{
"content": "You are a function calling AI model. You are provided with function signatures within <functions></functions> XML tags. You may call one or more functions to assist with the user query. Don't make assumptions about what values to plug into functions.",
"function_calls": null,
"functions": "[{\"name\": \"today\", \"description\": \"Fetches the treasure of the day from the Uncovered Treasure API.\", \"parameters\": {\"callback\": {\"description\": \"Optional JSONP callback for the request. Defaults to None.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"memre_api_v1_readiness\", \"description\": \"Get the readiness status of a user for a specified item from the memre API.\", \"parameters\": {\"user_id\": {\"description\": \"The ID of the user whose readiness status is being queried.\", \"type\": \"str\", \"default\": \"\"}, \"item_id\": {\"description\": \"The ID of the item for which the readiness status is being queried.\", \"type\": \"str\", \"default\": \"\"}}}, {\"name\": \"topic_topic\", \"description\": \"Fetches entries from a specific topic using the Uncovered Treasure API.\", \"parameters\": {\"topic\": {\"description\": \"The topic for which to fetch entries.\", \"type\": \"str\", \"default\": \"\"}, \"callback\": {\"description\": \"The optional JSONP callback function name.\", \"type\": \"str, optional\", \"default\": \"\"}}}, {\"name\": \"onyomi_reading\", \"description\": \"Fetches Kanji information based on the provided Onyomi (O-N) reading using the KanjiaLive API.\", \"parameters\": {\"on\": {\"description\": \"The Onyomi reading of the Kanji, provided in Katakana or romaji.\", \"type\": \"str\", \"default\": \"\\u30b7\\u30f3\"}}}]",
"role": "system"
},
{
"content": "Fetch entries from the topic 'Ancient Civilizations' and check the Onyomi reading for the Kanji 'ローマ字'.",
"function_calls": null,
"functions": null,
"role": "user"
},
{
"content": null,
"function_calls": "[{\"name\": \"topic_topic\", \"arguments\": {\"topic\": \"Ancient Civilizations\"}}, {\"name\": \"onyomi_reading\", \"arguments\": {\"on\": \"\\u30ed\\u30fc\\u30de\\u5b57\"}}]",
"functions": null,
"role": "assistant"
}
] |
Salesforce/xlam-function-calling-60k
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.